Datasets:

hatakeyama-llm-team

/

PMC

like 0

Follow

Team Hatakeyama 25

Preventing Chronic Disease (PCD) offers fresh perspectives on the relationships among life stages, health behavior, and chronic disease. We include several reports from a survey of childbearing women in Cameron County, Texas, and Matamoros, Tamaulipas, Mexico, designed to support action by the United States-Mexico Border Health Association examined the feasibility of meeting this need in reproductive health (In the United States, 14.2 million women are aged 18 to 24 years . AccordiMexico's National Survey of Health and Nutrition estimated that 19.7 million women aged 10 to 29 years were living in Mexico in 2006 . Ten perWe know the numbers, but how do we reach these women? The primary reason US women aged 15 to 44 years enter the hospital is to give birth . Women iBut the health care system cannot be our only partner. In the United States, the lack of health insurance among 31% of women and 36% of men aged 18 to 24 years restricts their opportunities to obtain clinical care (PCD, I am retiring from the United States Public Health Service to pursue new adventures. It has been a privilege and a delight to work with the PCD production team, our editorial board, and our guest editors, authors, and reviewers. From all of you I have learned the power of the pen. I encountered new ideas with every issue and leave with an enhanced understanding of the vast scope of our work.I close this editorial with acknowledgement of my own opportunity for fresh perspectives. After serving for 6 years as the founding editor of PCD and its staff as we establish a new channel for scientific communication in preventing chronic disease. I cherish my relationships with the committed public health workers I have met through this journal. From my perspective, you are the quiet heroes.I am grateful for all the support you have given

Urinary incontinence (UI) is a disease affecting quality of life of 200 million patients worldwide. It is characterized by involuntary loss of urine. The factors involved are cystitis, detrusor hyperreflexia, spinal injury, benign prostatic hyperplasia, etc. The surge in the number of reviews on this subject indicates the amount of research devoted to this field. The prevalence is increasing at an alarming rate but unfortunately, only a few medications are currently available for this condition. There are peripheral as well as central targets including cholinergic, vanilloid, prostaglandin, kinin, calcium channel, cannabinoid, serotonin, and GABA-receptors, which act by different mechanisms to treat different types of incontinence. Drugs acting on the central nervous system (CNS) increase urinary bladder capacity, volume, or pressure threshold for micturition reflex activation while peripherally acting drugs decrease the amplitude of micturition contraction and residual volume. Anticholinergic drugs specifically M3 receptor antagonists are the first choice but have frequent side effects such as dry mouth, CNS disturbances, etc. Therefore, there is a need to understand the biochemical pathways that control urinary dysfunction to determine the potential to which they can be exploited in the treatment of this condition. This article reviews the central and peripheral molecular targets and the potential therapeutic approaches to the treatment of UI. Urinary incontinence (UI) is an involuntary bladder contraction due to overactive bladder, which leads to loss of urine. This is a worldwide common health problem having great social impact which affects quality of life.[ of life. It is de of life. As per t of life. There ar of life. Studies of life. In appro of life. This artA sequence of afferent and efferent signalling in parasympathetic, sympathetic, and somatic nerves leads to sequential storage and voiding of urine. For urinIn general, drugs that selectively affect the sensory arm (afferent arm) of the micturition reflex can be differentiated from those interfering with the efferent arm of the reflex through an urodynamic examination. An increase in urinary bladder capacity, volume, or pressure threshold for micturition reflex activation, without major interferences with amplitude of micturition contractions implies an inhibitory effect on urinary bladder sensory nerves. In contrast, drugs affecting the efferent arm of the micturition reflex invariably decrease the amplitude of micturition contractions and if this effect is prominent then residual volume will also be increased.UI is characterized by involuntary loss of urine due to several factors. These factors are cystitis, detrusor hyperreflexia, spinal injury, benign prostatic hyperplasia (BPH), diabetes mellitus, obesity, parkinsonism, etc. However, despite the plethora of research and validated biological targets, effective yet safe drugs for this condition are few.Types: Urinary incontinence (UI) is of various types such as urge incontinence, stress incontinence (SI), mixed incontinence, overflow incontinence, continuous incontinence, and reflex continence .Bladder overactivity may be the result of several mechanisms. Both myogenic and neurSI may be associated with disturbance among factors involved in urethral sphincter competence. These factors involve urethral smooth muscle, external urethral sphincter, inner urethral factor, pressure transmission to bladder and urethra, pelvic floor musculature, hormones, connective tissue, and nerves. The uretWhen the factors contributing to urge and SI occur at the same time, these lead to mixed incontinence.Less common forms of UI in females include overflow, continuous, and reflex incontinence. OverflowContinuous incontinence results from a fistula among the ureter, bladder or urethra, and the vagina, or an ectopic ureter opening into the vagina or urethra. Reflex IPeripheral targets: Peripheral targets must be the first choice for treatment of UI because of lesser side effects. These targets are as follows:2+, Na+, Mg2+, etc.[The transient potential receptor vanilloid 1 (TRPV1) receptor is a nonselective cation channelg2+, etc. Capsaicig2+, etc. Two mechg2+, etc. The secog2+, etc.22 Thus, Distension of bladder stimulates the production of PGE2 by urothelium. PGE2 can sensitize suburothelial nerves and contribute to overactive bladder, as indicated in animal models in which PGE2 antagonists reduce bladder hyperactivity. A variet26Nociceptin, a OP4 receptor agonist, modulates the micturition reflex by inhibiting the activity of TRPV1-expressing neurons at the periphery. A study The ovarian cycles affect the micturition habits. Electrophysiological evidence indicates that during proestrus mechanoreceptor excitability increases and detrusor compliance decreases. A recentAll tachykinin receptors are expressed in the urinary bladder. These receptors are potential targets for tachykinins released from a subset of TRPV1-expressing neurons. Apart from detrusor muscle (mainly NK2) and blood vessels (NK1), tachykinin receptors are also located on structures which can modulate the sensory function. There is experimental evidence indicating that peripheral stimulation of NK1, NK2, or NK3 receptors induce bladder overactivity so drugs targeted to block these receptors can be beneficial in overactive bladder. Substanc35Both bradykinin receptors (B1 and B2) are expressed on inflamed urinary bladder while B2 is present constitutively on the same. B2 receptor agonist, bradykinin, stimulates the micturition reflex in normal rats, prevented by capsaicin pretreatment and partly reduced by COX inhibitors. It has been recently demonstrated that bradykinin induces release of ATP from urothelial cells through the stimulation of B1 and B2 receptors, suggestiCOX inhibitors are known to improve bladder overactivity. COX inhi2+ through a mechanism termed Ca2+ sensitization. Myosin phosphatase regulates smooth muscle tone by shifting contractile protein kinetics.[2+ channels. Thus, blockade of Ca2+ channels might relax the detrusor and improve urge continence.[in vitro bladder contraction in tissues from healthy and diseased animals.[The detrusor can relax independently by the reduction in cytosolic Cakinetics. A rise intinence. A study animals.+ channel favors the extracellular efflux of potassium and regulates the resting potential, duration of action potentials and duration of hyperpolarisation that follows action potential.[+-channel) increases urinary bladder capacity without affecting the amplitude of micturition contraction.[+ channels.[+ channels relaxes the detrusor in vitro. However, the usefulness of K+-channel openers targeting smooth muscle is limited by hypotension and other cardiovascular side effects.[The opening of Kotential. NS-8 are the mainstay for treatment of bladder overactivity. Antimuscarinic agents increase urinary bladder capacity. Their clinical efficacy is limited by impairment of urinary bladder contractility leading to incomplete voiding. However, unlike the increase of residual volume, the increase of urinary bladder capacity is not explained by reduction of parasympathetic efferent drive. Recently, it has been shown that intravesical oxybutynin decreases the firing of urinary bladder afferent C-fibers which coP2X receptors present on detrusor muscle are activated by ATP. P2X receGABA-B receptor agonists are beneficial in the treatment of overactive bladder. Baclofen58Serotonin and dopamine receptor are the central targets for UI. Other available targets are described in the following sections.Neurologic diseases lead to overactive bladder and urge incontinence by altering neurotransmission in the CNS. In Parkinson’s disease dopamine (D2) receptors in the basal ganglia and substantia nigra facilitate detrusor activity, whereas the D1 receptor facilitates micturition. When druA recent study indicated that cannabis extract, containing δ-9-tetrahydrocannibinol, reduced bladder overactivity in patients of multiple sclerosis. ObviouslAberrations in central neurotransmission have been postulated for some forms of depression and anxiety. This might influence voiding and explain the association of disparate conditions with overactive bladder and urge incontinence. For example, reduced serotonin function is respoThe detrusor muscle responds to adrenergic stimulation by relaxation. Bladder relaxation caused by increased hypogastric nerve activity and mediated via β-adrenergic receptor activation is important during the collecting phase of bladder filling. Bladder During the last two decades, significant clinical and scientific data on the UI has been generated. Unfortunately, the accumulated knowledge has not been translated into successful treatment of patients with functional lower UI. As evident in this review, role of the detrusor smooth muscle and the changes in diseased or abnormal states are well understood. Theoretically, this should provide targets for treatment. Anticholinergic drugs are commonly available and widely used in the treatment of UI in spite of having frequent adverse effects such as blurred vision, dry mouth, etc. Newer targets for treatment will reduce the number and frequency of adverse effects. The most important target may be specific cholinergic receptors. The drug specific to M3 receptors with antispasmodic activity may be a better treatment for UI. PG receptor may be another useful target as specific PGE2 antagonists reduce bladder hyperactivity. Regarding central targets, selective D2 antagonists may be useful in treating urge UI, especially in patients having diseases like parkinsonism.Apart from the molecular targets mentioned earlier, some of the clinical aspects for assessment of UI may be complicated by patient’s hesitation to talk about this embarrassing condition. Gender differences between patients and physician may worsen this problem because patients may underreport symptoms of incontinence. Therefor

Plasmodium falciparum, the parasite responsible for severe malaria, occurs within red blood cells. A merozoite invades a red cell in the circulation, develops and multiplies, and after about 48 hours ruptures the host cell, releasing 15–32 merozoites ready to invade new red blood cells. During this cycle, the parasite increases the host cell permeability so much that when similar permeabilization was simulated on uninfected red cells, lysis occurred before ∼48 h. So how could infected cells, with a growing parasite inside, prevent lysis before the parasite has completed its developmental cycle? A mathematical model of the homeostasis of infected red cells suggested that it is the wasteful consumption of host cell hemoglobin that prevents early lysis by the progressive reduction in the colloid-osmotic pressure within the host (the colloid-osmotic hypothesis). However, two critical model predictions, that infected cells would swell to near prelytic sphericity and that the hemoglobin concentration would become progressively reduced, remained controversial. In this paper, we are able for the first time to correlate model predictions with recent experimental data in the literature and explore the fine details of the homeostasis of infected red blood cells during five model-defined periods of parasite development. The conclusions suggest that infected red cells do reach proximity to lytic rupture regardless of their actual volume, thus requiring a progressive reduction in their hemoglobin concentration to prevent premature lysis.The asexual reproduction cycle of Plasmodium falciparum is responsible for severe malaria in humans. The 48 hour asexual reproduction cycle of the parasite within red blood cells is responsible for the symptoms in this disease. Within this period, the parasite causes massive changes in the host red cell, increasing some metabolic activities hundredfold, making it leaky to many nutrients and waste products, and consuming most of the cell's hemoglobin, far more than it needs for its own metabolism. The challenge that we faced was to explain how the infected cell maintained its integrity throughout such a violent cycle. Seeking clues, we developed a mathematical model of an infected cell in which we encoded our current knowledge and understanding of the complex processes that control cell homeostasis. We present here for the first time a detailed description of the model and a critical analysis of its predictions in relation to the available experimental evidence. The results support the view that host-cell integrity is maintained by the progressive reduction in the hemoglobin concentration within the host cell, resulting in a reduced rate and extent of swelling.The parasite Plasmodium falciparum, Pf, is responsible for the most severe form of malaria in humans, representing a major cause of morbidity and mortality, especially among children. The pathology of malaria is caused by the intraerythrocytic stage of the parasite cycle. Invasion of a red blood cell (RBC) by a Pf merozoite converts a metabolically languid, hemoglobin-filled cell lacking intracellular organelles and structures, into a complex double cell, with a eukaryotic organism growing and multiplying inside, protected from immune attack. After a relatively quiescent period of about 15–20 h post-invasion, infected RBCs exhibit large increases in metabolic activity and solute traffic This puzzle prompted an investigation on how premature lysis is prevented in falciparum-infected RBCs. A mathematical model of the homeostasis of parasitized RBCs was formulated to attempt an understanding of the processes involved It had been well established that during the process of growth and maturation within RBCs malaria parasites ingest and digest hemoglobin (Hb) to levels far above those required by parasite protein synthesis concentration, and (ii) that parasite volume growth together with host cell swelling late in the cell cycle would bring IRBC volumes very near their CHV. Allen and Kirk + extrusion from the parasite compartment) thus freeing up space for the parasite to expand into the host cell and limit the extent of swelling undergone by the infected cell as the parasite volume increases and cations enter the cell through colloid-osmosis. If IRBC volumes do not approach the presumed CHVs, then both the role attributed by the model to excess Hb consumption and the need for freeing space appear irrelevant. It became clear from these considerations that a thorough re-evaluation of the model assumptions and predictions in the light of past and recent experimental evidence became necessary.The simulations led to two critical predictions: (i) that excess Hb ingestion and digestion would cause not only a dramatic fall in the Hb content of the host cell, as had been established already from experimental evidence, but also a progressive and large decline in its Hb P. falciparum-infected RBCs. A full description of the model equations is given , from invasion to about 20 h post-invasion, all IRBC variables remain essentially unchanged from their initial levels. Phase 2, +-driven net fluid lossK, is triggered by NPP activation. The immediate effect of the increase in Na+, K+ and anion (A−) permeabilities and anion concentration (−]), and cell acidification result from the transfer of RBC cytosol to the parasite as part of the Hb ingestion process. Additional reduction in host cell volume results from the removal of the space occupied by Hb molecules. Hb has a specific volume of about 0.74 ml/g In Phase 4, function . When th reduced . Phase 4 reduced , Hb and contents , Na+,A− sustained swelling, is characterized by continuous NaCl and water gains by the host cell (+ and A−), and 2F) driven by the inward Na+ gradient. The rate of fluid gain is reduced relative to that in phase 3 . Therefore, since the ratio of maximal volumes of two cells with different surface areas is V1/V2 = (A1/ A2)1.5, a fractional decrease in area will propagate to a fractional decrease in volume to the power of 1.5, stressing the magnified effect of effective membrane area reductions on CHV. Early results in the literature report opposing claims in relation to membrane area changes in infected IRBCs: population estimates report substantial reductions How can this occur? The CHV of each RBC depends critically on membrane area Pf-infected RBCs to volume expansion by fluid gains. This shows that IRBCs become progressively closer to their effective CHV as the parasite matures, regardless of their actual volume levels. Although the contributions of membrane area loss and other factors to this hemolytic vulnerability remain to be elucidated, excess Hb consumption retains its credential as a general protection mechanism for IRBCs of all volumes, by preventing excessive rates of fluid gain. This mechanism depends critically on the prediction illustrated in The increase in the osmotic fragility of IRBCs reflects a progressive hemolytic vulnerability of In conclusion: the original formulation of the colloid-osmotic hypothesis, using a coupling coefficient of one, predicted that IRBCs would swell close to a CHV level taken as the mean value for uninfected RBCs, premature rupture being prevented by the reduced Hb concentration. Simulations with coupling coefficient values below 0.7 deliver more realistic IRBC volume estimates and 7B, Plasmodium falciparum-infected red blood cells (IRCM) was derived as an extension of the original Lew-Bookchin red cell model (RCM) http://www.pdn.cam.ac.uk/staff/lew/index.html. The IRCM first computes a “Reference” steady-state (RS) meant to represent the initial condition of a human red blood cell just invaded by a falciparum merozoite generating a ring-stage internalized parasite occupying 4% of the red cell volume. In the formulation of the RS the programme offers a large variety of options for the user to change constitutive properties of the IRBC such as the value of all the parameters tested in the simulations reported in this paper. For the simulations reported here the medium was assumed to be an infinite reservoir (vanishingly low hematocrit condition). With the RS defined, the programme is set to follow the dynamic evolution of the IRBC system for 48 hours with a data output frequency chosen by the user. To enable realistic comparisons with experimental results, experimental conditions can be simulated to explore the modified dynamic behaviour of the system.The mathematical-computational model of the homeostasis of The constitutive properties of IRBCs defined in the RS comprise (see supporting information for equations):The detailed initial composition of intra and extracellular fluids complying with electroneutrality and osmotic equilibrium (eqs S1 and S2)+ buffers (HEPES-like in the current simulations (eq S3)The identity, concentration, and protonized state of medium HThe identity, concentration and mean charge of the impermeant cell solutes (eqs S4 and S5)+ buffering behaviour of Hb (eq S5 ) The cytoplasmic HThe power function describing the non-ideal osmotic behaviour of Hb (eq S6) The initial fraction of IRBC volume occupied by Hb molecules (25%) + and K+ transport through the sodium pump (eqs S7–S10) The magnitude and kinetics of active Narectional and net passive fluxes of Na+, K+, A− and H+ through each of the endogenous passive transporters expressed in the cell (eqs S11–S18) The magnitude and kinetics of all unidiThe electrical potential potential difference across the RBC membrane The stage-dependent changes in NPP-mediated permeabilities , eq S21 +, K+ and A− fluxes through NPPs (eq S13) The maximal magnitude and kinetics of NaThe Hb consumption function , eq S22 Cell volume normalized to 1 at t = 0 Area-volume ratio of RBC encoded in critical hemolytic volume set at 1.7 times the initial cell volume All functions were defined with a default set of parameter values, open to change by the modeller. The default values are displayed at the prompts in the running of the model. The initial values of most system parameters and variables were listed following a hierarchical order of reliability for the information available so as to enable derivation of lesser known from better known values in the equations of the Reference State Three main processes determine the overall dynamic behaviour of IRBCs: NPP-mediated traffic, Hb consumption and parasite volume growth. The potential osmotic stress generated by the amino acids produced during Hb digestion was neglected in the model because the amino acid composition of the effluent from infected RBCs was indistinguishable from that of globin, indicating that NPP permeability was high enough not to limit the rate of exit of the lesser permeable amino acids t in the numerical computations, the parasite ingests a volume of red cell cytoplasm, DwV containing the amount of Hb prescribed by the Hb consumption function for that time interval (eq S22). This reduces the host cell volume by DwV and increases parasite volume by cf·DwV in each Dt. cf represents a coupling coefficient which converts DwV to a quantum of parasite volume-growth within Dt, proportional to DwV, to enable the modeller to explore the effect of broad parasite volume-growth variations, and also the volume-effects of single and multiple invasions. Global volume changes within the host compartment are determined by parasite ingestion of host cytosol and by fluid transfers across the host cell plasma membrane resulting from changes in membrane permeability (NPP development), ionic gradients and colloid osmosis. Ingestion, parasite volume growth and homeostasis are therefore closely interdependent processes because ingestion affects host Hb content on which colloid osmosis largely depends and homeostasis affects the size of each DwV on which parasite volume growth depends. At each time, t, parasite volume, PV, and host cell volume, HV, result from the cumulative changes generated by host cytosol transfers to parasite and by all the ion and water fluxes through endogenous and parasite-generated pathways up to t. Thus, PV = PoV+cfΣ DwV and HV = HoV+ΣDV'−Σ DwV, respectively, where PoV represents the initial ring-stage parasite volume, HoV represents the initial host cell volume, normalized to 1, and DV' represents the homeostasis-induced infinitesimal change in host cell volume within each Dt. In the running of the model, HV at each t is computed from equation S30, as detailed in t, IRBCV, is thus defined by IRBCV = HV+PV. Solute exchanges between parasite and host, as well as possible homeostatic effects resulting from host cell membrane alterations were not considered in the model because their relevance remains uncertain and precise information, with the detail required for useful modelling is lacking.Parasite volume growth was linked to Hb ingestion as follows. For any infinitesimal time interval, represented by the integration interval Dt interval.The following sequence was applied in the computation of the transient behaviour of the IRCM for each DRS definedIf simulating experiments, enter changes in medium composition and system parameter valuesmECompute membrane potential from equation S20, implicit in mE defined, compute net fluxes through all transporters, iΦ (eqs S7–S17)With iΦ defined, compute the change in cell amount of each solute, DiQ (eqs S23 and S24) and the new amount of solute i, itQ (eq S25)With WV (eq S26), to be ingested during Dt to provide the amount of Hb to the parasite specified by equations S22 and S27 for each tCompute the volume of RBC cytosol, DPV (eq S28)Compute parasite volume, i (eq S29)Compute the new concentrations of each cell solute CWΦ (eq S18)Compute the water flux, wV (eq S27)Compute the new volume of host cell water, HV Compute the new host cell volume, t (eq S32)Compute the new value of the iteration interval, DHC to cpH (eq S33), compute the new charge on Hb, Hbn (eq S4), and the new anion and proton concentration ratios Convert the new Hbf from the new HbC (eq S6)Compute the new t assigned to output results Test for Test for IRBC volume exceeding set value of critical hemolytic volume t = 48 h Test for Test for further input of experimental conditions Go to step 3Text S1Model equations and glossary of symbols(0.14 MB PDF)Click here for additional data file.

Here we investigated how the GBM cells themselves survive in a glutamate-rich environment.Glioblastoma multiforme (GBM) cells secrete large amounts of glutamate that can trigger AMPA-type glutamate receptors (AMPARs). This commonly results in NaIn silico analysis of published reports shows down-regulation of all ionotropic glutamate receptors in GBM as compared to normal brain. In vitro, in all GBM samples tested, mRNA expression of AMPAR subunit GluR1, 2 and 4 was relatively low compared to adult and fetal total brain mRNA and adult cerebellum mRNA. These findings were in line with primary GBM samples, in which protein expression patterns were down-regulated as compared to the normal tissue. Furthermore, mislocalized expression of these receptors was found. Sequence analysis of GluR2 RNA in primary and established GBM cell lines showed that the GluR2 subunit was found to be partly unedited.Together with the lack of functional effect of AMPAR inhibition by NBQX our results suggest that down-regulation and afunctionality of AMPARs, enable GBM cells to survive in a high glutamate environment without going into excitotoxic cell death themselves. It can be speculated that specific AMPA receptor inhibitors may protect normal neurons against the high glutamate microenvironment of GBM tumors. High-grade gliomas (glioblastoma multiforme (GBM)) are the most common aggressive malignant brain tumors. Despite new diagnostic techniques and combined modality therapy c−) in GBM cells results in high concentrations of glutamate in the microenvironment. Glutamate abundance is consequently thought to lead to excitotoxic cell-death of neurons, mainly via the neuronal NMDA receptor, but also via AMPA and kainate receptor overstimulation Down-regulation of astrocytic glutamate transporters and upregulation of the cystine-glutamate antiporter system . AMPAR GluR2 subunit transcripts are subjected to RNA Q/R editing, causing receptor impermeabilityin silico analysis of primary GBM samples, compared to normal non-neoplastic brain and low-grade gliomas. Our results show down-regulated protein and mRNA expression in GBM cells, from patient material and established cell lines as compared to normal brain cells. We furthermore show partial GluR2 posttranscriptional RNA under-editing in primary brain tumor cells. AMPA receptor blockage with NBQX , a potent competitive AMPA receptor antagonist, conveyed no effect on cell proliferation. These results suggest that down-regulation of functional AMPAR expression is a mechanism allowing GBM cells to escape excitotoxic cell death.Here, we analyzed AMPA receptor expression and subunit configuration in GBM cells. A decreased ionotropic glutamate receptor, including AMPAR, expression was shown in an in silico analysis using Oncomine In order to determine whether AMPAR subunits are expressed in GBM, we performed To validate AMPAR protein expression in GBM, immunohistochemistry on GluR1 and 2 was performed on 37 paraffin embedded tumor sections of GBM. The multiform phenotype of GBM, with a large variety of different cell types , complicates discerning immunostaining of actual tumor cells. A GBM tissue microarray was created with paraffin cores enriched for tumor cells as assessed by two independent neuropathologists. Cell lines of GBM were stained to further substantiate AMPA receptor immunoreactivity in tumor cells.No overexpression of AMPARs was observed in these tumor sections, as compared to normal brain tissues cerebellum and hippocampus, in which more abundant and intensive staining was observed , a–d. LaOn cytospin slides of primary VU-122 GBM cells and the U87-MG cell line, membranous staining of GluR2 was observed , f, wherIn order to ascertain mRNA expression, RT-PCR for GluR1, 2 and 4 mRNA expression was performed using 2 primary GBM lines and the established U87-MG GBM cell line .None of the cell lines showed mRNA overexpression for these GluR subunits compared to adult and fetal total brain mRNA and adult cerebellum mRNA. The cell lines had a variable expression for GluR1 and 2. In addition, GluR4 expression was measured in all cell lines, except for VU-028 and U87-MG, which showed weak expression . In ordein vitro cell growth was monitored.To further elucidate the role of ion channel functionality, GBM cells were exposed to increasing concentrations of the competitive AMPAR antagonist NBQX and the effect on in vitro.No significant growth inhibition was observed upon AMPAR inhibition, using NBQX concentrations that completely block AMPA and kainate receptors . These fMany contradictory results have been published on the relevance of glutamate triggering of AMPAR in GBM progression. Therefore, we investigated how GBM cells survive in a high glutamate environment while the normal surrounding neural cells undergo excitotoxic cell death in silico analyses that show down-regulated mRNA expression of all ionotropic (NMDA- and non-NMDA) glutamate receptors in primary GBM samples. NMDA receptors showed the highest degree of down-regulation in this dataset, which could provide an additional mechanism of excitotoxicity escape Our findings regarding the down-regulated expression of AMPAR are supported by In summary, in this study we show that on protein level, AMPA-type glutamate receptor subunits are variably expressed in GBM and are overall down-regulated as compared to the normal brain tissue. Besides low and mislocalized expression of AMPA receptors we could not find evidence for ion channel functionality of GBM cells by lack of any depolarization using patch-clamp recordings and lack of growth inhibition after exposure to the AMPAR inhibitor NBQX. These results suggest that stimulation of AMPA receptors - and probably other ionotropic receptors - is not required for GBM cell growth.in silico analysis of TARPs showed strong down-regulation of TARP γ-2 and γ-3 in GBM compared to normal brain Mislocalization of glutamate receptors could be a result of defective trafficking of these receptors. Several proteins are involved in this process. Recently, transmembrane AMPAR regulatory proteins (TARPs) were described to function in specific control of AMPAR and kainate kinetics, ligand affinity and trafficking AMPA receptor antagonists were thought to be of potential use as anti-cancer drugs in GBMOur data provide evidence of down-regulation of AMPAR expression and function in GBM cells and show that these receptors are not essential for the proliferation of these cells. Down-regulation of ionotropic NMDA and non-NMDA glutamate receptors in GBM might allow for the escape of glutamate-mediated toxicity and might facilitate survival in a self-created glutamate rich microenvironment. By imposing excitotoxic cell death on normal neurons and not themselves, GBM cells may manipulate their environment. Based on these findings we speculate that normal neurons might be protected against the high glutamate microenvironment by specific inhibitors of ionotropic receptors et al.Oncomine For immunohistochemistry, 37 cases of adult glioblastoma multiforme were included. General written informed consent is obtained from all patients for the use of tumor material. The Cancer Center Amsterdam/VUmc Institute for Cancer and Immunology scientific research committee approved this study. All cases were reviewed independently by two neuropathologists and the diagnosis of GBM was confirmed according to the revised 2007 WHO classification of tumors of the nervous system Primary cell lines VU-028, VU-078, VU-119, VU-121, VU-122, VU-147 and VU-154 were processed from fresh tumor tissue obtained at surgery from patients with a primary GBM and cultured in Dulbecco's modification of Eagle's medium with 10% FCS (Invitrogen), and 1% Glutamine (Invitrogen). Rabbit anti-human GluR1 monoclonal antibody (clone E308) was obtained from Epitomics , anti-Glutamate Receptor 2 monoclonal antibody and anti-glutamate receptor 2 & 4 monoclonal antibody (MAB396) were obtained from Chemicon International .Tissue sections (5 µm) mounted on superfrost slides had undergone dewaxing and rehydration, after which endogenous peroxidase activity was blocked for 30 min in methanol containing 0.3% hydrogen peroxide. Slides were then washed with distilled water and phosphate-buffered saline . For antigen retrieval, the slides were placed in sodium citrate buffer and heated in a microwave oven at 99°C for 10 min, and cooled to room temperature. The sections were washed in PBS and pre-incubated with 10% normal goat serum (NGS) diluted in PBS 30 min prior to incubation with GluR1 antibody (diluted 1∶20) for 2 hr, or GluR2 antibody (diluted 1∶2000) for 1 hr, or GluR2/4 antibody (diluted 1∶200) for 1 hr. The sections were washed with PBS and incubated at room temperature for 1 hr with the appropriate biotinylated secondary antibody diluted in PBS. For the detection of mouse antibodies Power Vision was used according to the instructions of the manufacturer. Peroxidase activity was detected using 3,3-diaminobenzidine-tetrachloride in 0.1% hydrogen peroxide. All sections were counterstained with haematoxylin and mounted with an aqueous mounting medium . Immunocytochemistry was performed on cytospins and chamber slides. Cytospins were fixed in icecold buffered formaldehyde-acetone. Chamberslides were fixed using 2% paraformaldehyde. Endogenous peroxidase activity was blocked for 10 min in phosphate-buffered solution (PBS) containing 0.25% hydrogen peroxide. The slides were incubated with the antibodies and peroxidase activity was detected using 3,3-diaminobenzidine-tetrachloride in 0.1% hydrogen peroxide and enhanced with 0.4% cupric sulfate. All sections were counterstained with haematoxylin.Tissue sections were examined by two independent observers with respect to the presence of neoplastic and/or non-malignant tissue and specific immunoreactivity for the different AMPA receptors of interest. Immunoreactivity was quantified on whole cores of the tissue micro-array (0.6 µm in diameter) and 4 independent fields in whole tissue slides using a light microscope with 25× magnification. Staining indices were assigned semi-quantitatively to five categories: <20%, 20–39%, 40–59%, 60–79%, >80%.5′-TTTGAGGAAGGACGGGACCA-3′; GluR1 (reverse), 3′-ATCGTTGGTGGCGTCTGGTG-5′; GluR2 (forward), 5′-TCCTGGTCAGCAGATTTAG-3′; GluR2 (reverse), 3′-ATCGAAAGTGCTGAGGATC-5′; GluR4 (forward), 5′-ACACAGAAGAGCCAGAGGACGGA-3′; GluR4 (reverse), 3′-TGCCCTTGGATTTGCGGACAC-5′; ß-actin primers were used as described To semi-quantitatively assess GluR1, GluR2 and GluR4 mRNA expression in glioblastoma cell line (U87-MG) and glioblastoma primary cell lines (VU-028 and VU-122), total RNA was extracted using RNA Bee according to the manufacturer's instructions. First-strand cDNAs were synthesized with reverse transcriptase by using 1 mg of total RNA as a template and oligo-dT as primers. GluR1, GluR2, GluR4 primer sequences were determined using Oligo 6 software . GluR1 (forward), Sequence analysis was performed using ABI 3130 system (Applied Biosystems). For sequencing of the GluR2 PCR product, samples were denaturated at 95°C for 3 min, amplified in 45 cycles .et al.4, 2 mM CaCl2, 10 mM D(+)-glucose, 1.2 mM NaH2PO4, 26 mM NaHCO3 (carboxygenated with 5% CO2/95% O2). Whole-cell recordings were made at room temperature (20–22°C), using 3–4 MΩ borosilicate glass electrodes, containing 77 mM K-gluconate, 77 mM KCl, 0.5 EGTA, 10 mM HEPES, 4 mM Mg-ATP, 4 mM K2Phosphocreatine, 0.4 mM GTP (pH 7.3 with KOH). Cells were voltage clamped at −70 mV, lifted from the glass coverslip, and placed in front of a piezo-controlled fast application system with a double-barreled application pipette. Reliability of application was checked before experiments by measuring the open-tip response to application of diluted (10%) extracellular solution. Current responses were recorded upon 100 ms application of glutamate (1000 µM) using an EPC-8 amplifier with PULSE software . Both primary GBM cells and established GBM cell line U87-MG were measured several times in this whole cell patch-clamp setup after glutamate application. VU-78 cells were also recorded after AMPA (100 µM) and kainate (100 µM) application. As a control, we tested glutamate application on a nucleated patch pulled from a neocortical pyramidal cell in an acute mouse brain slice.Whole cell voltage clamp recordings were performed as described by Colquhoun 2O. Cells were seeded in triplicate at 1×104/ml (VU-122), 4×104/ml (U87-MG) in DMEM with 10% (U87-MG) and 20% FCS (VU-122) in 96-well tissue culture plates (200 µl/well) and incubated with 6 concentrations of NBQX 21–82 µM. After 4 days of incubation the cells were fixed with 30% trichloroacetic acid (TCA) (5 µl/well) at 4°C for 1 hour. After four washes, TCA fixed cells were stained with 0.4% SRB (100 µl/well) for 30 minutes, room temperature. After three washes with 1% ethanoic acid, protein-bound dye was dissolved in 10 mM Tris base and plates were analyzed at 540 nM using a Anthos 2001 plate reader . Cell doubling time was calculated based on proliferation curves resulting from the change in SRB absorbance over time.Proliferation of glioblastoma cell lines VU-122 and U87-MG, growing in a monolayer, were determined using the sulphorhodamine B (SRB) assay. NBQX ) was dissolved in HFigure S1In silico analysis of ionotropic glutamate receptor expression levels in low grade astrocytomas and oligodendrogliomas. Boxplots of expression of ionotropic glutamate receptor mRNA in a dataset of low grade gliomas - 50 oligodendrogliomas (white), compared to 26 astrocytomas (grey dashed). None of the GluR gene expression profiles showed major significance in differential expression.(0.62 MB TIF)Click here for additional data file.Figure S2Example traces after application of glutamate to lifted GBM cells. 1000 µM of glutamate was ‘puffed’ during 100 ms to GBM cell lines VU-028, VU-122 and U87-MG. In all cell lines glutamate failed to evoke an inward current, whereas in a pyramidal neuron, glutamate application evoked a large, inward, quickly desensitizing current, mediated by AMPA receptor activation. The trace is the average of 10–20 subsequent applications.(0.16 MB TIF)Click here for additional data file.Figure S3In silico analysis of transmembrane AMPAR regulatory proteins (TARPs) expression levels in GBM tumors. Expression of transmembrane AMPAR regulatory protein gamma 2 and 3 (TARP-γ2 and TARP-γ3) in a dataset of 77 glioblastomas (grey dashed), compared to non-neoplastic, normal brain from epilepsy surgery (white) .(0.25 MB TIF)Click here for additional data file.Table S1In silico analysis using Oncomine (0.09 MB RTF)Click here for additional data file.

If you cannot make your peers understand your message, then you are bound to have manuscripts rejected or to have difficulties getting your valuable research published, read, and perused. The challenge for the scientist clinician is to present readable papers of general interest for judgment by editors, editorial board members, and peer reviewers while soundly describing the methods in a way that is recognizable to any knowledgeable scientist. Furthermore, the editors and governors of any Journal have the responsibility to ensure that the contributors' work receives the highest possible visibility by ensuring proper indexing and tracking."Getting your message through" is the The Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine (SJTREM) is a peer-reviewed international journal indexed in PubMed, PubMed Central, Scopus, and Google Scholar. In addition, SJTREM has recently been accepted for indexing by MEDLINE. Decisions on tracking in EMBASE and by Thomson Reuters will occur shortly. The Journal is directed towards all health professionals involved in pre- and in-hospital emergency medicine and surgery, critical care, and trauma management. While SJTREM was primarily intended for a Scandinavian and Northern-European audience , it has High quality scientific papers begin with a sound research design -7. In adlevel of evidence is attributed to the type of study design used , what was done, what was found, and what the results mean. Hence, we suggest structuring the text of original research articles into headings summarised by the mnemonic acronym IMRAD [Readers and editors of a paper need to know what was cussion) ,13,24. TThe introduction or background section should be brief, but to the point, and should tell readers why the study was undertaken . A strai"who, what, why, when, and where?" This section should include information regarding how the study was planned and designed, the included patient population, and how the sample was selected/recruited. Additionally, the means used to gather information must be presented along with the statistical methods and the statistical package used for analysis.The methods section answers the questions In the results section, authors should report the actual study sample . If necessary, this information can be presented in a flow chart. Additionally, authors should describe the outcomes and results, addressing one topic per paragraph, and working from the most important topic to the least important topic. Remember that the results should be presented objectively, without any qualitative words, evaluations, or interpretations; these statements belong in the discussion section. Tables and illustrations are meant as a supplement to the text, and the fewest possible number of tables and illustrations should be used. Data in tables and figures should be presented in the manner that results in the most clarity. One point worth stressing is that authors should avoid including tables with large amounts of data, as readers may find these too busy and difficult to read. All tables and figures should be comprehensible without referring to the text, and should have titles that are succinct and sufficiently self-explanatory .The discussion section should begin with a clear and unambiguous summary of the key findings in no more than two or three sentences. Next, it must include a discussion of the strengths and weaknesses of the study. This should be followed by a comparison of the results with those from other published work. Only the major relevant works that confirm and contradict the findings should be cited. Next, this section should discuss what the study might indicate, explain the findings, and describe whether and how the study has increased the understanding of the field. Finally, authors should discuss what questions remain unanswered and suggest future work in the area ,25,26.The SJTREM strives to publish articles that are timely, credible, and enjoyable to read. We aim to publish original, important, and well-documented peer-reviewed research articles. The Editors expect authors to follow good standards and ethics for publication, and will take action regarding any report or detection of fraudulent research or scientific misconduct. We encourage authors to use SJTREM as a publication venue for reviews and original research papers in pre- and in-hospital emergency medicine and surgery, critical care, and trauma management, and we encourage authors to follow these guidelines for study design and presentation to ensure high quality scientific communication.

Studies have identified associations between household secondhand tobacco smoke (SHS) exposure and induction of childhood asthma. However, the true nature and strength of this association remains confounded in many studies, producing inconsistent evidence. To look for sources of potential bias and try to uncover consistent patterns of relative risk estimates (RRs), we conducted a meta-analysis of studies published between 1970 and 2005.Through an extensive literature search, we identified 38 epidemiologic studies of SHS exposure and the development of childhood asthma from 300 potentially relevant articles.We observed substantial heterogeneity within initial summary RRs of 1.48 , 1.25 (1.21–1.30), and 1.21 (1.08–1.36), for ever, current, and incident asthma, respectively. Lack of control for type of atopy history and child’s own smoking status within studies and age category altered summary RRs in separate meta-regressions. After adjusting for these confounding characteristics, consistent patterns of association emerged between SHS exposure and childhood asthma induction. Our summary RR of 1.33 from studies of incident asthma among older children (6–18 years of age) is 1.27 times the estimate from studies of younger children and higher than estimates reported in earlier meta-analyses.This new finding indicates that exposure duration may be a more important factor in the induction of asthma than previously understood, and suggests that SHS could be a more fundamental and widespread cause of childhood asthma than some previous meta-analyses have indicated. Asthma in childhood becomes a lifelong condition for many people, and there is evidence that its prevalence has increased over the past 50 years . Direct Health Effects from Involuntary Exposure to Tobacco Smoke . BecauseOne of our goals was to use meta-regression on atopy-controlled studies to quantitatively explore the effects of these other potentially important sources of heterogeneity on the summary RR. Some of the heterogeneity among RRs reported in previous meta-analyses may be rOur systematic review considered studies addressed in the meta-analyses of We requested a literature search for SHS as a risk factor in the development of childhood asthma examined in epidemiologic studies published between 1970 and 2005. Outcome key words included asthma, wheezy bronchitis, asthmatic bronchitis, and reactive airway disease. Exposure key words included ETS, environmental tobacco smoke, passive smoking, secondhand smoke, involuntary smoke, tobacco smoke pollution, and cigarette smoke. We limited the search to asthma in childhood and adolescence (through 18 years of age).http://www.pubmed.gov), Web of Science , Biosis Previews, Toxline (http://toxnet.nlm.nih.gov), Scifinder Scholar (http://www.cas.org/products/sfacad/index.html), Environmental Sciences and Pollution Management (http://www.csa.com), Melvyl (http://melvyl.cdlib.org), WorldCat (OCLC) Firstsearch (http://firstsearch.oclc.org), University of California and San Francisco Tobacco Control Archives (http://www.library.ucsf.edu/tobacco/). Manual searches were conducted from review articles and previous meta-analyses. When necessary, we contacted authors for additional information or for translations from languages other than English.A professional experienced librarian searched PubMed (a) outcomes of the development (not exacerbation) of new cases of asthma or, because of ambiguities related to the diagnosis of asthma in young children, wheezy bronchitis ; we used broad criteria to define new incident cases of asthma that included both allergic and nonallergic descriptions of asthma. However, we sought to include all studies that identified cases of asthma in their analyses by other criteria than symptoms of wheeze alone. Our definition included asthma, wheezy bronchitis, or asthma/wheeze that was ever or currently recognized by doctor diagnosis or by a set of symptoms that are recognized criteria for diagnosing asthma in addition to wheezing.We developed eight criteria to select studies from among peer-reviewed articles. First, studies should present b) comparable groups of subjects ; c) at least one source of postnatal household SHS exposure; d) adequate data for extracting or calculating RRs and their standard errors; this information may be presented as odds or rate ratios or estimates of relative risk; e) results for children (0–18 years of age) where the child was the unit of analysis; f ) completed and original work (not abstracts of work in progress or reviews); g) reports written in languages other than English that are commonly spoken in Europe ; and h) studies that controlled for the confounding effect of atopy history because atopy has such a strong association with asthma and parental smoking behavior. Our control for atopy history category included: family history of allergy or asthma; childhood diagnosis of allergic conditions other than asthma, such as eczema, hay fever, or allergic rhinitis; the respondent in the study reported symptoms of allergic conditions; or the study investigator stratified on an indicator of atopy such as skin-prick test results. We considered the study controlled for atopy history if the study restricted the selection of subjects to children with, subgroups were stratified by, or the estimate of RR was statistically adjusted for atopy history as defined above. We rejected studies that did not meet these criteria. When more than one analysis was conducted on the same set of children, we included information from multiple articles if they provided unique information about the children.We also included asthma identified through parental response to pilot-tested or standardized questionnaires on respiratory health. Studies should also present We extracted RRs and standard error estimates from publications using methods described by The variables we considered as potential covariates in each meta-regression are described in The first two meta-analyses in this review are an analysis of average SHS exposure on RRs from studies of newly diagnosed or persistent asthma (current asthma), and the RR from studies of asthma that may have occurred early in life and subsequently resolved (ever asthma). In the third meta-analysis of SHS effect on asthma incidence in this review, we included studies that examined SHS exposure effects and classified subjects by continued exposure before the onset of asthma.http://www.ehponline.org/docs/2007/10155/suppl.pdf)].Where possible, we collapsed exposure levels within studies that used a common reference group and adjusted for correlations among estimates using methods described by Although most of the RRs in the studies included in this review indicated a positive association for both current and ever asthma, there was substantial heterogeneity in the magnitude of the SHS effect across studies. We performed separate subanalyses for studies of current and ever asthma because we suspected that differences in study design and case detection specific to the type of asthma studied might explain RR heterogeneity. Within cohort studies that classified subjects by exposure status at the start of follow-up, we sought to examine the effect of exposure years on incident asthma. Each analysis is comprised of independent sets of study subjects. Several studies provided separate estimates of RR for both current and ever asthma. To avoid overlapping populations among analyses, we included only the current asthma RR.We estimated summary RRs using inverse variance-weighted least-squares methods . If the p-value was < 0.1.To explore the sources of RR heterogeneity, we modeled the log RR as a function of predictors in a linear meta-regression model. Each covariate was considered as a potential modifier of the RR. We included all covariates for which the We regarded the model as accounting for RR heterogeneity if the homogeneity chi-square was less than or equal to its degrees of freedom. If our model did not account for the heterogeneity in this sense, after considering all eligible covariates, we examined the influence of individual studies. We detected outliers by removing one study at a time and estimating a weighted average estimate of all other studies. We conducted this study influence analysis using “Metainf,” a statistical function of Stata version 8.0 that sequentially removes one study at time, and then recalculated RR to determine the effect that the removed study’s RR has on the average RR for all studies.We managed data using SAS version 8.2 and Microsoft Office Excel 2000 and analyzed the data using Stata (version 8.0).http://www.abacci.com/atlas/demography.asp?countryID=352) provided information on additional characteristics about the study design or population associated with 10 of these studies. We rejected 248 articles; in cases where there were multiple reasons for exclusion, we have reported only one combined estimate of RR emerged. The observations we included in our corrected analyses are included in online tables . Substantial heterogeneity among cross-sectional studies was observed in the ever asthma group when the reference group was no household exposure, and among the incident asthma group when the reference group was no maternal smoking exposure. Results are presented from random-effects models. RRs tended to be similar in eight cohort studies for which the SHS exposure was assessed before the onset of asthma to 11 case–control studies or cross-sectional studies of average household SHS exposure and current asthma where exposure to SHS was assessed at the time of diagnosis or case identification . The summary RRs among prevalence studies was higher among 23 studies of ever asthma, at 1.48 .http://www.ehponline.org/docs/2007/10155/suppl.pdf). Substantial heterogeneity remained (homogeneity p < 0.001) after fitting a meta-regression model that included four covariates and for which no additional covariates entered the model. Most of this heterogeneity appeared to be attributed to the summary estimate from one large study (a) controlled for family history of atopy, b) restricted to nonsmoking children, c) restricted to children of school age family history of atopy, b) age category of the study subjects, and c) smoking habits among study subjects were weaker modifiers for ever asthma studies [summary RRs were 0.84 and 1.20 times the joint reference estimate of RR of 1.21 ; see The strongest modifier of the ever asthma summary RR was lack of control for a child’s own smoking habits. The study summary RRs from studies that did not control for this covariate were 1.35 times higher than controlled studies. Lack of control for http://www.ehponline.org/docs/2007/10155/suppl.pdf).The observations we included in our subgroup analyses of household SHS exposure and incident asthma are summarized in online Table S2 (Supplemental Material, available online at The results of the meta-regression for eight cohort studies appear at the end of The predicted RR for SHS exposure effect on incident asthma among children in the joint reference category of all covariates was 1.33 (95% CI, 1.14–1.56; see This meta-analysis extends previous work by focusing on atopy-controlled studies, which has been well established as a source of confounding in individual studies, and examining the relationship between SHS exposure and onset of childhood asthma. We have evaluated and adjusted for additional sources of heterogeneity among summary RR by meta-regression methods and observed consistent patterns of elevated RRs among studies. We observed a consistent, positive association between household SHS exposure and current, ever, and incident asthma. We also observed an elevated summary RR for incident asthma that was statistically significant among studies of schoolchildren with postnatal exposure to SHS. We did not find that restricting exposure to postnatal SHS was an important modifier of summary RRs for any of the asthma outcomes. Recent reports by In our meta-regression of average household SHS exposure and ever asthma, covariate control accounted for much of the heterogeneity. The effect of not controlling for family history of atopy reduced the RR among ever asthma studies, and lack of control for both child and family history of atopy reduced the estimate of RR among incident asthma studies. These findings suggest that this confounding variable biases the estimate of RR toward the null.Recent studies have identified elevated levels of endotoxin in cigarette smoke and SHS indoor spaces . It is pWe observed that summary RRs from studies that examined ever asthma among younger children were slightly higher than RRs from studies of exclusively older children. These findings are contrary to the findings from cohort studies but consistent with previous reviews .Most of the cross-sectional studies assessed SHS exposure status by asking if household or parental sources currently smoked. One explanation of these findings is that RRs from cross-sectional studies of older children could be biased downward because assessment of current SHS exposure status may not reflect early-life exposure. For example, parental smoking habits may change once symptoms of allergy or asthma appear in their children. If this occurred among older asthmatics, then these children may be classified as nonexposed, which would result in a differential misclassification of exposure among cases. This source of bias is avoided in prospective cohort study designs.When studies did not restrict subjects to nonsmoking children, summary RRs were higher, possibly due to bias upward from exposure among studies that overlooked this source of SHS exposure. It is also possible that study subjects who themselves are smokers are more likely to have been exposed to higher levels of household SHS . TherefoThe RR for the average household SHS exposure effect on ever asthma appeared similar to the effect on current and incident asthma, according to our meta-regression analysis. The RR for prevalent asthma could be slightly lower because of bias downward if household exposure to SHS occurred up to the time of asthma diagnosis and then stopped. This would mean that asthmatics with past but not current household SHS might be misclassified as nonexposed.In our cohort study meta-regression, we also found that much of the observed heterogeneity was accounted for by the age category of children in the study. Most important, older children exposed to SHS were more likely than younger children to develop asthma. We found no evidence that RRs from studies using physician diagnosis to identify cases were systematically different than RRs from studies that did not identify cases in this way. The differences in our meta-analysis findings versus earlier studies are likely attributed to differences in approach and the inclusion of studies in our meta-analysis published after the previous meta-analyses. We looked more precisely at the relationship between SHS exposure and asthma as distinct from wheeze alone, and we restricted our analysis to studies that controlled for atopy history. Thus our meta-analysis examines a subtly different question than earlier meta-analyses , and takBecause cohort studies classify subjects by exposure at the start of follow-up, it is less likely that exposure misclassification would occur and more likely that the child’s age is a reasonable surrogate measure of the length of time study subjects are exposed to household SHS. This positive relationship between a surrogate of duration of household SHS exposure and RR was also observed within individual studies . Hence, The positive relationship with age category identified in these studies suggests that the risk of developing asthma from a longer time of exposure to SHS increases in later childhood. The RRs among studies that examined incident asthma were more positively associated with SHS exposure than were studies of prevalent asthma. The elevated RRs for the association between household SHS and prevalent as well as incident asthma suggest that the association between SHS exposure and asthma is not caused by selection or misclassification biases.A mechanistic theory consistent with our findings holds that the development of asthma can be causally associated with the chronic effects from exposure to SHS on bronchial hyperreactivity rather than the acute effects of SHS exposure on airway caliber . Others Clearer understanding of the role of SHS in childhood asthma induction can help inform public health interventions to prevent childhood SHS exposure and the benefits from such interventions. Our analysis attempted to address some of the remaining concerns posed by previous reviewers who stated that the evidence for an association between household SHS exposure and new-onset asthma is equivocal especially among older children. We observed a positive and consistent pattern of association between household SHS exposure and the RR of developing asthma during childhood in our meta-analyses. In contrast to earlier findings, this association was not limited to younger children, certain high-risk populations, or prevalent cases. Similar to previous analyses, we did not find that prenatal exposure to SHS was necessary to observe elevated summary RRs for any of the asthma outcomes.

Radiologically dense breast tissue (mammographic density) is strongly associated with risk of breast cancer, but the biological basis for this association is unknown. In this study we have examined the association of circulating levels of hormones and growth factors with mammographic density. A total of 382 subjects, 193 premenopausal and 189 postmenopausal, without previous breast cancer or current hormone use, were selected in each of five categories of breast density from mammography units. Risk factor information, anthropometric measures, and blood samples were obtained, and oestradiol, progesterone, sex hormone binding globulin, growth hormone, insulin-like growth factor-I and its principal binding protein, and prolactin measured. Mammograms were digitised and measured using a computer-assisted method. After adjustment for other risk factors, we found in premenopausal women that serum insulin-like growth factor-I levels, and in postmenopausal women, serum levels of prolactin, were both significantly and positively associated with per cent density. Total oestradiol and progesterone levels were unrelated to per cent density in both groups. In postmenopausal women, free oestradiol (negatively), and sex hormone binding globulin (positively), were significantly related to per cent density. These data show an association between blood levels of breast mitogens and mammographic density, and suggest a biological basis for the associated risk of breast cancer.British Journal of Cancer (2002) 87, 876–882. doi:10.1038/sj.bjc.6600537www.bjcancer.comCancer Research UK© 2002 Differences between individuals of the same age in the radiological appearance of the breast reflect differences in tissue composition. Epithelial and stromal tissues attenuate X-rays more than does fat, and appear light on a mammogram, while fat appears dark . ExtensiThe biological basis for inter-individual variations in breast tissue composition, and for the association of these variations with risk of breast cancer is, however, unknown, although several factors are known to influence the radiographic appearance of the breast. Mammographic density decreases with greater parity, greater body weight, greater age , growth hormone, insulin like growth factor-I (IGF-I), its principal binding protein - insulin-like growth factor binding protein-3 (IGFBP-3), and prolactin.The general method employed was to select pre- and postmenopausal women without breast cancer but with different degrees of mammographic density, to collect information from them about risk factors, and to measure hormones and growth factors in blood samples obtained under standardised conditions. We determined the total area of the breast, and the area of dense tissue on mammography, using a previously described computer assisted method , that was recorded by radiologists during film reporting. We wished to ensure that we recruited women with as wide a range of mammographic density as possible. The number of subjects in each of the five radiological categories of density that were actually recruited were as follows: <10% Breast density was subsequently definitively classified as a continuous variable by quantitative methods that are described below. On hundred and fifty-five subjects (41%) fell in the same category according to the two methods of classification, and 317 (83%) were within one category on both methods. , agreed to take part in the study, and the rate of participation did not vary according to the extent of mammographic density.Subjects who agreed to enter the study were then visited in their homes by the study research assistant. These visits took place in the morning after subjects had fasted for at least 12 h. All measurements in premenopausal women were made when subjects were in the luteal phase of the menstrual cycle (between days 20–24). Blood was refrigerated immediately after collection, spun and serum separated within 1–2 h of collection, and stored at −70°C until analysis. The mammogram closest to the time of the blood draw was used, and the average time interval between the mammogram and the blood draw was 32 weeks. The phase of the menstrual cycle at which mammograms were obtained is, however, not known because subjects were recruited into the present study after the mammograms had been taken.Information about epidemiologic risk factors for breast cancer, and other factors, was collected using a questionnaire, developed for this purpose, that included questions about menstrual and reproductive history, and family history of breast and other cancer.Each subject was weighed on a balance scale and measured for height. Skinfold thickness in the triceps, sub-scapular, and iliac crest areas was measured using Lange calipers, and waist and hip circumferences were measured with a tape measure. The research assistant who made these measurements was trained and certified by the Department of Athletics and Recreation, University of Toronto.Serum oestradiol and progesterone levels were measured using radioimmunassays kits purchased from Orion Diagnostica , and the inter-assay performance was monitored using controls provided by the kit manufacturer. Oestradiol in serum from postmenopausal women was measured by Esoterix Laboratories, California, USA by radioimmunoassay after extraction.Serum SHBG levels were determined using an established steroid-binding capacity assay using reference serum samples to control for inter-assay performance . The perIGF-I, IGFBP-3 and growth hormone were all measured by Esoterix, California, USA, IGF-I and IGFBP-3 using a competitive binding radioimmunoassay, and growth hormone with a two site immunometric assay. Prolactin was measured by radioimmunoassay in the Wellesley Hospital in Toronto. The per cent coefficient of variation within assays was less than 7% for all (except progesterone which was 8.7%), and between assays was less than 10% for all (except progesterone which was 11.9%).The measurements that are the subject of the analyses that follow were made using a randomly selected, craniocaudal mammographic view of one breast from each subject.2 per pixel). Images were analysed using a computer assisted method which were representative of radiographically dense tissue. We then calculated the histogram of pixel values within these boundaries, and calculated the size of the projected area of the breast in the image, and of the area of density. The percentage of radiographic density is the area of dense tissue divided by the entire projected area of the breast and multiplied by 100.A subset of duplicate images were included as a check on reliability. Reliability of the measurements made in the present study was high with a test-retest correlation of at least 0.9.Data analysis was carried out using the SAS statistical software package . Data we−1, the lower limit of sensitivity for the assay. An additional 22 observations had missing growth hormone information . There was, however, no relationship between mammographic density and whether growth hormone could be detected.Values for growth hormone were undetectable in 128 of the 382 subjects (34%) and for purposes of analysis were assigned the value of 0.2 ng lTo examine the relationships between hormones, growth factors and mammographic measures we carried out a series of multiple regression analyses that adjusted sequentially for other factors that could be confounding or modifying variables. For two variables, IGF-I and total oestrogen, their respective binding proteins, IGFBP-3 and SHBG, are known to determine the amount of free and biologically active growth factor or hormone, and were introduced into the regression analyses before the other variables. Among the other factors examined, that included other risk factors for breast cancer , measures of body size, and blood levels of other hormones or growth factors, only age and measures of body size had a substantial influence on the results. Among the measures of body size examined, that included height, weight, body mass index, waist and hip circumference and their ratio, and skinfold thickness measurements, the waist measurement was the most strongly correlated with mammographic density, and was the measure of body size used in these analyses. In all of these analyses both mammographic measures, and blood levels of hormones and growth factors, were treated as continuous variables.Table 1n=13, and 28.5, n=180) and postmenopausal subjects .Sixty subjects had previously taken hormone replacement therapy (HRT), stopping an average of 5 years before the date of the mammogram. After adjustment for age, the mean per cent density was similar in those who had previously used HRT and in those who had not, in both premenopausal . Free oestradiol, calculated from SHBG levels, showed negative associations with per cent density that remained statistically significant after adjustment only in the postmenopausal.Progesterone was significantly and positively associated with per cent density in both pre and postmenopausal women, but became non-significant in both groups after adjustment for age and the waist measure. , suggesting that, after allowance has been made for the difference in mean level, the menstrual cycle was not a major source of variation in per cent density in premenopausal subjects.These results in part confirm the findings of a cross-sectional study in the Nurses Health Study (NHS) by The associations of IGF-I and prolactin with risk of breast cancer in the NHS, respectively in pre and postmenopausal women, are thus similar to the associations with mammographic densities according to menopausal status seen in the present study. The average age of the premenopausal women studied here was 45 years, and some may have been perimenopausal. The association of growth factors and hormones at earlier ages is at present unknown but it is known that blood levels of IGF-I peak in adolescence . Some of the observed features may be explained by the actions of growth hormone. IGF-I is produced in the liver and other tissues, including the breast, in response to growth hormone , and bloAn alternative potential explanation for these findings may lie in the known actions of oestrogen. Oestrogen is involved in the control of the secretion of both growth hormone (These findings suggest novel potential approaches to breast cancer prevention, directed at modulation of the growth hormone-IGF-I axis and prolactin. Furthermore, unexpected relationships between the determinants of serum free oestradiol levels and mammographic densities suggest that manipulation of SHBG levels or function could also be beneficial. There is clearly a need for an improved understanding of the genetic and environmental factors that influence levels of these hormones and growth factors, and in particular the relationship between these factors and other known influences on risk of breast cancer, including familial, menstrual and reproductive risk factors, and ovarian hormones.

During tumorigenesis, cells acquire immortality in association with thedevelopment of genomic instability. However, it is still elusive how genomicinstability spontaneously generates during the process of tumorigenesis. Here,we show that precancerous DNA lesions induced by oncogene acceleration, whichinduce situations identical to the initial stages of cancer development, triggertetraploidy/aneuploidy generation in association with mitotic aberration.Although oncogene acceleration primarily induces DNA replication stress and theresulting lesions in the S phase, these lesions are carried over into the Mphase and cause cytokinesis failure and genomic instability. Unlike directlyinduced DNA double-strand breaks, DNA replication stress-associated lesions arecryptogenic and pass through cell-cycle checkpoints due to limited andineffective activation of checkpoint factors. Furthermore, since damaged M-phasecells still progress in mitotic steps, these cells result in chromosomalmis-segregation, cytokinesis failure and the resulting tetraploidy generation.Thus, our results reveal a process of genomic instability generation triggeredby precancerous DNA replication stress. Genomic instability is observed in most cancer cells in vivoThe most common types of genomic instability in cancer cells are alterations in thenumber of chromosomes, i.e., aneuploidy Although it is elusive how tetraploidy is developed during cellular transformation,tetraploidy is often observed in cells lacking in the M-phase function For the above hypothesis, we investigated effects of DNA replicationstress-associated lesions by oncogene acceleration or by hydroxyurea treatment aswell as impacts of DNA lesions in the M phase, and also studied the immortalizationprocess of primary mouse embryonic fibroblasts (MEFs). Here, we found that DNAreplication stress-associated lesions can be transmitted into the M phase, unlikedirectly induced DNA double-strand breaks, resulting in successive chromosomalmis-segregation, cytokinesis failure and tetraploidy generation. Importantly, weobserved that these happen during cellular immortalization, and found that senescingcells are temporarily accumulated with bi-nuclear tetraploidy, which is a form rightafter the tetraploidy generation, prior to the acquirement of the immortality.E2F1, because the initial stages of cancer development aremimicked by oncogene-acceleration, in which genomic instability is subsequentlydeveloped E2F1acceleration caused DNA lesions in U2OS cells to cause replication fork stalling and theresulting DNA double-strand breaks. After the transient replication stress,γH2AX foci were evidently increased in the subsequent M phase , showingE2F1 acceleration with those of the radiomimetic agentneocarzinostatin (NCS) that causes G2-arrest. While NCS causes γH2AX andthe resulting p-ATM foci in the entire nucleus, E2F1acceleration was found to cause only very limited γH2AX because MEFs are immortalized with the mutation in theArf/p53 module similar to cancer development To determine the possible association between M-phase DNA lesions and tetraploidygeneration during MEF-imortalization, we examined the status of DNA lesions inthe M-phase cells in each stage during the lifecycle of MEFs . ImportaAfter immortalization, MEFs were mostly γH2AX-positive and continuouslyshowed DNA lesions during mitosis , suggestThrough above study, we showed that DNA replication stress-associated lesions aretransmitted into the M phase, that DNA lesions during mitosis cause tetraploidygeneration, and that the identical processes are observed during theimmortalization of MEFs. To directly confirm our original hypothesis andmicrosatellite instability (MIN) Consistent with ageing-associated cancer-risk elevation, our results suggest thatspontaneous DNA lesions accumulated in senescent cells during MEF immortalizationact as precancerous DNA lesions, similar to the lesions induced by oncogeneacceleration. Our results also show that DNA lesions generated by DNA replicationsstress are cryptogenic due to the limited impact on DNA lesions and the checkpointactivation, and that these lesions therefore induce genomic instability after thetransmission into the M phase. Such a conclusion, i.e., genomic instabilityinduction by DNA replication stress, is supported by the evidence of cancerpredisposition with defective homologous recombination in BRCA1, BRCA2 and BLMhelicase mutants Here we observed that the escape of G2/M checkpoint with DNA lesions triggerstetraploidy development. Contrary, previous reports showed that the identical escapeof G2/M checkpoint results in the mitotic catastrophe cell death Prior to acquiring immortality, senescing MEFs are accumulated with a bi-nuclearphenotype that is a primary and transient form of tetraploidy, indicating that suchtetraploidy generation in senescing cells is the major event in these stages inassociation with M-phase DNA lesions, aberrancy in chromosomal segregation andcytokinesis failure. Since immortalized MEFs are totally tetraploidy, these stepsmust be critical for immortalization. It has been shown that immortalized MEFs aremutated in the Arf/p53 module 5 MEFswere passed in 6-cm dishes every 3 days using 10% fetal bovine serumcontaining DMEM (during P1-P6 and after IP1), otherwise maintained withmedium-change under the same medium conditions every 3 days (during M1-M7).ER-E2F1 expressing U2OS cells were treated with 4-hydroxytamoxifen (300 nM) aspreviously described Cdc25A, Cdc25A cDNA was inserted intopIREShyg2 vector . The Cdc25A expressionvector, empty vector, or none was then transfected into HEK293 cells withFuGENE6. Prometaphase cells were prepared as previously reported Cancer cell lines and normal human fibroblast SuSa were cultured as previouslydescribed Antibodies against γH2AX andphospho-histone H3 (Ser 10) (Upstate Biotechnology) were used for immnostainingand Western blot analysis. Antibodies against phospho-ATM (Ser 1981) , phospho-Chk2 (Thr 68) ,β-actin , histone H3 , cyclin B1 , p53 andcyclin E were used for Western blot analysis. Antibodiesagainst AIM-1 (Aurora-B) (BD Transduction Laboratories), phospho-vimentin (Ser72) Fifteen hours after the release from M phase-DNA damage, cells were fixed with10% neutral buffered formalin for 10 min, permeabilized with0.3% Triton X-100/PBS for 10 min, and stained with DAPI for 5 min.Phase contrast images merged with immunofluorescence images were captured withECLIPSE TE300 inverted microscope. Time-lapse images were acquired withMulticell-imaging incubator (Sanyo).A comet assay was performed as previously described Mitotic cells were prepared in a 6-h treatment with 20 ng/ml nocodazole andshaking-off. The collected cells were hypotonically swollen with 75 mM KCl for15 min, and then fixed with −20°C Carnoy's solution(75% methanol/25% acetic acid) for 20 min. The fixativewas changed once and the cells in Carnoy's solution were dropped ontoglass slides and air-dried. The slides were stained with 4% Giemsa(Merck) solution for 10 min, washed briefly in tap water, and air-dried.Movie S1Movies S1-(0.27 MB MOV)Click here for additional data file.Movie S2(0.27 MB MOV)Click here for additional data file.Movie S3(1.41 MB MOV)Click here for additional data file.Movie S4(1.09 MB MOV)Click here for additional data file.Figure S1Hypothesis. Cells damaged with precancerous DNA lesions develop tetraploidyhypothetically via chromosomal bridges during chromosomal segregation(bottom), unlike cell division in cells without DNA lesions (top). If thisis the case, generated cells with tetraploidy are primarily and transientlybi-nuclear until the following M phase, in which daughter chromosomesassemble in a common metaphase plate to lead into tetraploidy with a singlenucleus in the subsequent G1 phase.(3.03 MB TIF)Click here for additional data file.Figure S2Transient over-expression of Cdc25A promotes DNA lesions including the cellsduring mitosis. Empty (control) or Cdc25A expression (Cdc25A) vectors weretransfected into HEK293 cells. After cultivation for two days, cells weredetermined with the indicated antibodies.(3.02 MB TIF)Click here for additional data file.Figure S3Tetraploidy generation with DNA damage during mitosis in U2OS, WI-38 andprimary MEFs. A. Cells prepared as in the experimental scheme on (2.99 MB TIF)Click here for additional data file.Figure S4Cells damaged during mitosis lead to tetraploidy generation but not duringinterphase. HeLa cells in the M phase or without synchronization weretreated as in the scheme. Unlike asynchronous cells, M phase-cellsspecifically develop tetraploidy after damage. Quantification of thetetraploid cells was performed with at least 100 cells for each.(2.21 MB TIF)Click here for additional data file.Figure S5The cells damaged in the M phase further replicate DNAs in the following Sphase. A,B. After cells were damaged with NCS (A) or adriamycin (B) as in(1.10 MB TIF)Click here for additional data file.Figure S6DNA damage checkpoint activation is durable in the M phase, but dysfunctionalto induce arrest during mitosis. The activation of DNA damage checkpointprotein Chk2 in the HeLa asynchronous and M-phase cells characterized byphosphorylated histone H3 (P-H3) was analyzed for the phosphorylatedform.(0.37 MB TIF)Click here for additional data file.Figure S7Prometaphase-DNA damage does not affect the behavior of BubR1 and theprogression into the anaphase and the telophase. At 75 min after the releasefrom NCS treatment as in the experimental scheme on (4.78 MB TIF)Click here for additional data file.Figure S8Arf/p53 module mutation in the immortalized MEFs. To determine the loss ofArf/p53 module, p53 accumulation was monitored 12 h after 100 ng/ml NCStreatment at each stage of MEFs: primary growth (P4); senescence (M2);immortalized (IP2).(0.63 MB TIF)Click here for additional data file.Figure S9DNA lesions indicated by γH2AX were also confirmed with comet assay.DNA lesions, indicated by γH2AX in this study, were also confirmedby comet assay with the tails after NCS treatment for 15 min. Arrow headsindicate the spots with comet tails, indicating DNA damages.(2.88 MB TIF)Click here for additional data file.

Results of these assays showed the highest values when tannins (fraction 2) were tested. For instance, the TAA of the tannin fraction was 5.85 μmol Trolox® eq./mg, whereas the crude extract and fraction 1 showed 0.68 and 0.33 μmol Trolox® eq./mg, respectively. The content of total phenolics in fraction 2 was the highest (290 mg/g); the tannin content, determined using the vanillin method and expressed as absorbance units at 500 nm per 1 g, was 129. There were 24 compounds identified in the crude extract using an HPLC-ESI-MS method: quercetin diglycoside, catechin, digallate procyanidin, and p-hydroxybenzoic were the dominant phenolics in the extract.Phenolic compounds were extracted from red lentil seeds using 80% (v/v) aqueous acetone. The crude extract was applied to a Sephadex LH-20 column. Fraction 1, consisting of sugars and low-molecular-weight phenolics, was eluted from the column by ethanol. Fraction 2, consisting of tannins, was obtained using acetone-water as the mobile phase. Phenolic compounds present in the crude extract and its fractions demonstrated antioxidant and antiradical activities as revealed from studies using a They display the capability to inhibit or delay the oxidation of lipids, proteins, and DNA by affecting the initiation or propagation of oxidizing chain reactions. Natural phenolic antioxidants can scavenge reactive oxygen and nitrogen species (RONS) thereby preventing the onset of oxidative diseases in the body ,2. A posin vitro chemical assays − at an m/z of 451.1 corresponding to a flavanol monomer (either catechin or epicatechin) linked to glucose, and a fragment ion [F-H]− at an m/z of 289 corresponding to either catechin or epicatechin. These compounds were identified as catechin glucoside and epicatechin glucoside, respectively, and the HPLC chromatogram agrees with the sequence of the elution time for the corresponding monomers. From the analysis by HPLC-ESI-MS, compounds 2, 11, and 19 showed a negative molecular ion [M-H]− at an m/z of 577.1 corresponding to a procyanidin dimer, and a negative fragment ion [F-H]− at an m/z of 289.1, which corresponds to either catechin or epicatechin. These peaks were identified as procyanidin dimers. Compounds 5 and 15 from the HPLC-ESI-MS analysis gave a negative molecular ion [M-H]− at an m/z of 865.2 corresponding to a procyanidin trimer and a two fragments [F-H]− at an m/z of 577 and 289.1 from a dimer and a monomer, respectively; these compounds have been identified as procyanidin trimers.Compounds with the same spectral shape and wavelength maximum . Compound 4 was identified as a digallate procyanidin dimer.By HPLC-ESI-MS analysis, compound 4 showed a negative molecular ion [M-H]− at an m/z of 745.1 and two fragments [F-H]− at an m/z of 577 from a procyanidin dimer and 169.1 from gallic acid. Compound 10 was identified as procyanidin gallate.Compound 10 had a negative molecular ion [M-H]− at an m/z of 625.3 corresponding to quercetin linked to a disaccharide (hexose + hexose), and a fragment ion [F-H]− at an m/z of 301.2 from quercetin. Compounds 22 and 23 showed a UV spectrum similar to that of the quercetin glycoside, but possessed a second maximum with a hypsochromic shift to a lower wavelength and a shoulder at 267 nm, both corresponding to an acylated glycoside. Compounds 22 and 23 also had a molecular ion [M-H]− at an m/z of 505.2 and a fragment ion [F-H]− at an m/z of 301.4 from quercetin. Both peaks correspond to two different acylated quercetin hexoses.Three quercetin glycosides were tentatively identified by their UV spectra. The quercetin diglycoside (compound 17) was identified because it presented a molecular ion [M-H]− at an m/z of 447.1 and a fragment [F-H]− at an m/z of 285, corresponding to kaempferol.A kaempferol derivative was also identified (compound 20) by UV spectra. This compound gave an [M-H]− at an m/z of 430.1 and a fragment [F-H]− at an m/z of 269.1, corresponding to apigenin.Compound 24 was identified by its UV spectrum as an apigenin derivative and confirmed by HPLC-ESI-MS analysis; it yielded an [M-H]Compounds possessing a flavanol structure were the most abundant (~50%) class of compounds detected in the red lentil acetonic extract. It is important to point out that prodelphinidins were in similar abundance (161.6 μg/g) as were the procyanidins (dimers and trimers comprising 161.5 μg/g). The monomers in free and glycosidic forms were plentiful (192.8 μg/g) in the red lentil acetonic extract. Flavonols and flavones were also detected in the samples with quercetin diglycoside being the most abundant for these flavonoid classes. Non-flavonoid compounds were scarce in this type of lentil, and represented a smaller percentage in the totality of the phenolic compounds (20%).1 and B3 were the main phenolic compounds found in a crude extract of adzuki bean [Pisum sativum L.) [O-glucoside and myricetin-3-O-glucoside was also determined in raw cowpeas (Vigna sinensis L.) [o-coumaric, ferulic, and sinapic acids were determined in the crude extract of red bean [p-coumaric, sinapic, and ferulic acids, as well as quercetin and kaempferol were found in a pea crude extract [The obtained profile of individual phenolic compounds in the red lentil acetonic extract is in line with those previously reported for leguminous seeds. Catechin and epicatechin glucosides, quercetin glucoside, myricetin, and procyanidin Buki bean ,36,37. Givum L.) . A high nsis L.) . Caffeicred bean , whereas extract .3.3.1.tert-butylhydroquinone (TBHQ), β-carotene, linoleic acid, vanillin, Folin & Ciocalteu’s phenol reagent, polyoxyethylenesorbitan monopalmitate (Tween 40), Sephadex LH-20, and 2,2′-diphenyl-1-picrylhydrazyl radical (DPPH•) were obtained from Sigma . Protocatechuic acid, protocatechuic aldehyde, trans-p-coumaric acid, (+)-catechin, (−)-epicatechin, dihydroquercetin, quercetin, quercetin-3-O-glucoside, quercetin-3-O-galactoside, quercetin-3-O-rutinoside, kaempferol-3-O-rutinoside, tryptophan, and 2′,4,4′,6′-tetrahydroxydihydrochalcone-2′-O-β-glucoside (phloridzin) were purchased from Extrasynthese .All solvents used were of analytical grade unless otherwise specified. Methanol, acetone, hexanes, ethanol, acetonitrile, potassium ferricyanide, and trichloroacetic acetic were acquired from the P.O.Ch. Company . Butylated hydroxyanisole (BHA), 3.2.Authenticated red lentil seeds from the 2008 harvest were obtained from the Plant Breeding Station in Olsztyn (Poland).3.3.Red lentils were ground in a coffee mill and defatted with hexanes in a Soxhlet apparatus for 6–8 h. Phenolic compounds were then extracted from the raw material using 80% (v/v) acetone at a solids-to-solvent ratio of 1:10 (w/v) at 50 °C for 30 min . Extract3.4.Separation of the crude acetone extract into its low-molecular-weight phenolics and tannin fractions was achieved according to the method described by Strumeyer and Malin . A 2 g p3.5.The content of total phenolic compounds in the crude extract and each fraction was estimated using Folin & Ciocalteu’s phenol reagent . (+)-Cat3.6.500/g).The content of condensed tannins in the crude extract and its fractions was determined using the modified vanillin assay . Results3.7.UV spectra of the extract and its fractions were recorded with a Beckman DU 7500 diode array spectrophotometer .3.8.® equivalents (eq.)/mg extract or fraction.The determination of the TAA was carried out using a Randox kit according to the procedure outlined by the supplier. A concentration of 2 mg extract or fraction/mL methanol was used in the assay. Results were expressed as μmol Trolox3.9.β-carotene stabilized with Tween 40. Immediately after addition of the emulsion to each tube, the zero-time absorbance reading at 470 nm was recorded. Samples were kept in a water bath at 50 °C and their absorbance values were recorded over a 120 min period at 15 min intervals.The antioxidant activity of the red lentil acetonic extract and its fractions was determined in an emulsion system using the method described by Miller . Briefly3.10.3. The absorbance of the mixture was read at 700 nm with the spectrophotometer.Reducing power of phenolics was determined as described by Oyaizu . A suspe3.11.et al. [The scavenging effect of phenolics from the red lentil acetonic extract and its two fractions was monitored as described by Amarowicz et al. . A 0.1 m3.12.18 column , and Millenium software. The analytical conditions for separation are described by Dueñas et al. [Lyophilized acetonic extract (150 mg) was dissolved in 2 mL of 80% (v/v) methanol and filtered through a 0.45 μm cellulose acetate filter (Millipore) before HPLC analysis. The chromatographic system was equipped with an autoinjector, a quaternary pump, a photodiode-array detector 2001 , a Nova-Pak Cs et al. . Two mob3.13.et al. [m/z 200–1,000) and 250 V . Mass spectra were recorded from an m/z of 100 to 2,500.After HPLC separation, mass spectra were obtained using a Hewlett Packard 1100 MSD equipped with an API source using an electrospray ionization (ESI) interface. The conditions of analysis have been reported by Dueñas et al. . The sol3.14.Chromatographic peaks were identified by comparing retention times, UV spectra, and HPLC-ESI-MS spectra with those of commercial standards . Other compounds with UV spectra similar to those of hydroxycinnamates, flavanols (monomers and oligomers), gallates, flavonols, and dihydrochalcone were identified as derivatives of these compounds. Their chemical structures were confirmed by HPLC-ESI-MS.vs concentration of the standard. The trans-p-coumaric acid derivative was quantified using the calibration curve of the corresponding free phenolic acid, (+)-catechin glucoside and (−)-epicatechin glucoside were expressed as (+)-catechin and (−)-epicatechin, respectively, while procyanidins and prodelphinidin were expressed using the calibration curve for (+)-catechin. Dihydrochalcone was expressed as phloridzin. The gallates were quantified as gallic acid and the quercetin glycosides were expressed as quercetin glucoside.Quantification was made by an external standard method according to the maximum of absorption for each compound. Calibration curves were prepared by injecting different volumes of standards from a stock solution over the concentration range observed for each compound. Calibration curves were then calculated as linear regressions of peak area 4.p-hydroxybenzoic being the dominant phenolics present. Red lentil is a leguminous species that can provide an important daily source of phenolic compounds in human diets.This paper describes the antioxidant and antiradical capacities of a red lentil acetone extract as well as its low-molecular-weight phenolics and tannin fractions. The tannin fraction showed the highest content of total phenolics; similar findings were found based on the tannin content, total antioxidant activity, antiradical activity, and reducing power. HPLC-PAD and HPLC-ESI-MS data revealed various classes of phenolic compounds present in the red lentil crude extract. Twenty four compounds were identified with quercetin diglycoside, catechin, digallate procyanidin, and

The diagnostic criteria for growth hormone (GH) deficiency (GHD) in adolescents and young adults are not yet clearly established.We evaluated the factors influencing the GH peak and plasma insulin-like growth factor (IGF) I in order to determine the cut-off limits for the diagnosis of GHD during the transition period.21 patients treated for GHD due to pituitary stalk interruption syndrome at 5.7 ± 4.1 years were reevaluated at 16.0 ± 1.8 years, 0.6 ± 0.6 years after the end of GH treatment. Group 1 had isolated GHD (n = 9) and group 2 had multiple pituitary deficiencies (n = 12), including deficiencies of thyroid stimulating (n = 12), adrenocorticotropin (n = 8) and gonadotropin (n = 9) hormones.At diagnosis, group 1 had a greater pituitary height and GH peak than did group 2.At last evaluation, group 1 had greater GH peak and plasma IGF I than did group 2. No group 1 and 9 group 2 patients had an undetectable GH peak, while the 3 others had GH peak below 1 ng/ml.The GH peak decreased between diagnosis and last evaluation only in group 2 (P < 0.008).The GH peak response to pharmacological stimulation and the plasma IGF I concentration in young adults with GHD of childhood onset depend on the presence of additional pituitary deficiencies, reflecting a more severe defect of the hypothalamic-pituitary axis. The sex steroids cannot increase the IGF I if the GH secretion is zero. The diagnostic criteria for growth hormone (GH) deficiency (GHD) in adolescents and young adults, defined as the transition period, are not yet clearly established. Severe GHD in adults is defined by a peak GH response to hypoglycemia of less than 3 ng/ml , while aThe factors reported to influence the GH peak and plasma insulin-like growth factor (IGF) I concentration in GHD are the age at onset (childhood or adulthood) and the We analysed longitudinally 21 patients with pituitary stalk interruption syndrome (PSIS). We classified them as isolated GHD and multiple pituitary deficiencies. We compared the GH stimulated peak and plasma IGF I concentrations of the two groups and at diagnosis before puberty and after their growth had ended. Our objective was to evaluate the factors influencing the GH peak and plasma IGF I in order to determine the cut-off limits for the diagnosis of GHD during the transition period.This retrospective longitudinal study included 21 consecutive patients (13 boys and 8 girls) monitored by one of us (R Brauner) in a tertiary university pediatric hospital. All had GHD of prepubertal onset due to PSIS, had reached their adult height and were reevaluated for their GH secretion after the end of GH treatment. The criterion for diagnosing GHD during childhood was a GH peak response of less than 7 ng/ml after 2 stimulation tests, excluding the GH-releasing hormone (GHRH) test. Other features suggesting GHD were microphallus (6 boys), hypoglycemia (n = 8) and other hypothalamic-pituitary deficiencies (n = 12).PSIS was diagnosed on the basis of no visible pituitary stalk, no normal posterior lobe hypersignal in the sella turcica, and the presence of a hyperintense nodule in the region of the infundibular recess of the third ventricle .The patients were divided into two groups: group 1 with isolated GHD (n = 9) and group 2 with multiple pituitary deficiencies (n = 12), including deficiencies of thyroid stimulating (n = 12), adrenocorticotropin (n = 8) and gonadotropin (n = 9) hormones.The ages were 5.7 ± 4.1 years at diagnosis and 16.0 ± 1.8 years at the last GH evaluation, 0.6 ± 0.6 years after the end of GH treatment.2/d, hydrocortisone 10 mg/m2/d, ethinyl estradiol or testosterone, see below). The stimulations used at the third test were arginine insulin (n = 9), glucagon (n = 7), or ornithine (n = 5). Blood samples were obtained at 08.00 h for measuring free thyroxin, cortisol, testosterone or estradiol. The cortisol concentrations were not measured in the patients on hydrocortisone replacement therapy. Plasma IGF I was measured in all but 3 at diagnosis and in all at the third evaluation.The patients and their parents were informed that the evaluation would be performed to measure GH secretion, to adjust the replacement therapy (other than GH), and to prepare for the transfer of the follow-up to adult departments. They gave their consent for this evaluation. All patients underwent 3 stimulation tests, 2 at diagnosis before GH treatment and the third after treatment had ended. Each evaluation was performed in a single morning with patients in a fasting state, and included a physical examination plus measurements of height and weight. Before treatment, at least 1/2 stimulations used arginine insulin (n = 15) or glucagon (n = 5), except for 1 patient who was stimulated with ornithine. The larger peak was used for statistical analysis. GH therapy had been completed for at least one month before the third evaluation, but the other hormone replacement therapies were continuing from the age of around 12–13 years, and the boys testosterone heptylate (25 mg i.m. every 14 days) from the age of around 13–14 years.Height was measured twice with a Harpenden stadiometer. The height and body mass index are expressed as SDS for chronological age ,7. CommeData are expressed as means ± SD. Groups were compared with the Kruskall Wallis test followed by a Mann-Whitney U tests and repeated measures were compared with the Wilcoxon rank test.At diagnosis, all patients were prepubertal than did those in group 2. No group 1 and 9 group 2 patients had an undetectable GH peak, while the 3 others had GH peak below 1 ng/ml. The two group 2 patients with IGF I concentrations similar to those of the group 1 patients were girls (cases 18 and 19) with GH peaks of 0.9 ng/ml and spontaneous puberty. The plasma testosterone in boys and estradiol in girls at the third evaluation were pubertal in group 1 and low, but varying, in the group 2 patients evaluated on low dose replacement therapy.The GH peaks and plasma IGF I concentrations (SDS) were correlated at diagnosis (P < 0.04) and at the last evaluation (P < 0.001).The GH peak decreased between diagnosis and the last evaluation only in group 2 all the patients had GHD due to PSIS of prepubertal onset; 2) each of them was evaluated longitudinally before puberty and as a young adult and the data from these evaluations were compared.The group 1 patients with isolated GHD had significantly greater pituitary height and GH peaks at diagnosis before puberty than did the group 2 patients with multiple deficiencies, despite their similar ages, heights and BMI. This may be due to differences in the way PSIS occurred in the 2 groups. We reported a positive correlation between the GH peak after GHRH and the anterior pituitary height, GH peak after no GHRH stimulation and the spontaneous GH peak in patients with GHD (and PSIS in 22/28) . While tThis study confirms that the GH peak response to pharmacological stimulation in GHD during childhood and in young adults depends on the presence of additional deficiencies. Maghnie et al reportedThe group 1 patients with spontaneous puberty showed no increase in the GH peak in response to sex steroid secretion, but the plasma IGF I concentrations (ng/ml) did increase. The variations in the plasma estradiol or testosterone concentrations in the group 2 patients at the last evaluation probably partly reflect differences in the interval between the last administration of ethinyl estradiol or testosterone and the GH evaluation in those with gonadotropin deficiency. Among the three group 2 patients with spontaneous puberty, two had plasma IGF I concentrations similar to those of group 1 patients, while the third case 12) had a very low plasma IGF I despite a plasma testosterone concentration of 5.6 ng/ml. They differed in that their GH peak was greater than zero in the first two (cases 18 and 19) and undetectable in the third patient (case 12). This suggests that some residual GH secretion is necessary for the sex steroids to increase IGF I. This probably explains the data reported by Aguiar-Oliveira et al [ had a veThe administration of high doses of sex steroids before the last evaluation to the patients with gonadotropin deficiency, to obtain levels similar to those of group 1, would help to confirm the absence of a direct affect of sex steroids on IGF I. However, one patient from group 1 (case 3) and two from group 2 (cases 10 and 15) with similar plasma testosterone concentrations (spontaneously or after administration) but different GH peaks (3 and 0 ng/ml) had different plasma IGF I concentrations (296 vs 59 and 78 ng/ml). Martinez et al evaluateThe key feature of this study is that all the patients had GHD due to PSIS of prepubertal onset. The majority of the patients with adult-onset GHD had had a hypothalamic-pituitary lesion and had been treated by surgery and/or irradiation. Their results are consistent with previous finding that patients with craniopharyngioma ,14 or giOur results partly explain the difficulty of defining a limiting plasma IGF I concentration for diagnosing GHD in adults. Hartman et al concludeThe number of subjects studied is limited, but there are no reported data on the longitudinal evolution in GH and IGF I in patients with PSIS and only limited data on patients with PSIS in the transition period . These aThe GH peak response to pharmacological stimulation and the plasma IGF I concentration in young adults with GHD of childhood onset and PSIS depend on the presence of additional pituitary deficiencies, reflecting a more severe defect of the hypothalamic-pituitary axis. This severity can also be assessed by the height of the anterior pituitary gland on magnetic resonance imaging and by the GH response to a GHRH test.Thus diagnosis of GHD in the transition period must take into account the presence or absence of other pituitary deficiencies. The GH peak may be greater than 3 ng/ml and the plasma IGF I greater than 84 ng/ml if the GH deficit is isolated.BMI: body mass index; GH: growth hormone; GHD: growth hormone deficiency; GHRH: growth hormone releasing hormone; IGF: insulin-like growth factor; PSIS: pituitary stalk interruption syndrome.The authors declare that they have no competing interests.MM participated in the conception and design, the acquisition of data and analysis. CT and J–CS carried out the immunoassays and the statistical analyses. RB directed the work and prepared the manuscript. All the authors have given final approval of the version to be published.The pre-publication history for this paper can be accessed here:Table. Comparison of the 2 groups.Click here for file

P53were at increased risk for human papillomavirus (HPV)-related cervical cancer, but other groups have not confirmed this finding. Since approximately 18–36% of head and neck cancers are HPV-related, we examined the genotypic frequencies at that locus in 163 cases with squamous cell carcinoma of the head and neck (SCCHN) and 163 ethnically matched controls. We found no significant excess of arginine homozygotes in cases compared to controls (P= 0.50). No significant differences in allele frequencies were observed when the data were stratified by tobacco exposure or by cancer site. These findings suggest a limited role, if any, for thisP53polymorphism in SCCHN.© 2000 Cancer Research CampaignAn initial report suggested that patients homozygous for the arginine allele at codon 72 of

The ZnII complex cation, with approximate twofold symmetry, displays a slightly distorted octa­hedral geometry around the ZnII atom, which is coordinated by two N atoms from a 5,5′-dimethyl-2,2′-bipyridine ligand and by the O atoms of four water mol­ecules. In the crystal, O—H⋯O hydrogen bonds help to establish the packing.The asymmetric unit of the title compound, [Zn(C DOI: 10.1107/S160053680902488X/pv2173Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

C2/c space group; see Hassan et al. Å b = 6.5169 (1) Å c = 20.2992 (5) Å β = 91.983 (1)°V = 1050.36 (4) Å3 Z = 4 Kα radiationMo −1 μ = 0.09 mmT = 100 (2) K 0.40 × 0.20 × 0.10 mm Bruker SMART APEX diffractometerAbsorption correction: none7016 measured reflections2398 independent reflectionsI > 2σ(I)1960 reflections with R int = 0.021 R[F 2 > 2σ(F 2)] = 0.037 wR(F 2) = 0.114 S = 1.03 2398 reflections154 parametersH-atom parameters constrainedmax = 0.33 e Å−3 Δρmin = −0.23 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008X-SEED (Barbour, 2001publCIF (Westrip, 2008Data collection: 10.1107/S1600536808031243/im2084sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808031243/im2084Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

As genome-wide association studies grow in popularity for the identification of genetic factors for common and rare diseases, analytical methods to comb through large numbers of genetic variants efficiently to identify disease association are increasingly in demand. We have developed a pattern-based data-mining approach to discover unlinked multilocus genetic effects for complex disease and to detect genotype × phenotype/genotype × environment interactions. On a densely mapped chromosome 18 data set for rheumatoid arthritis that was made available by Genetic Analysis Workshop 15, this method detected two potential two-locus associations as well as a putative two-locus gene × gender interaction. Long considered to hold promise for dissecting the genetic etiology of complex diseases , genome-2-based test statistics. For the work described in this report, we applied the pattern-based method on the chromosome 18 data set on rheumatoid arthritis (RA) ascertained by the North American Rheumatoid Arthritis Consortium (NARAC) that was made available for the Genetic Analysis Workshop 15 (GAW15). Ten patterns were found to be significantly associated with the RA phenotype after multiple testing correction. The significance of those ten patterns was confirmed using Monte Carlo simulation. Furthermore, we identified a potentially significant multi-gene/gender interaction involving two loci: SNP0177 and the LD region containing markers SNP0603–SNP0615.We have developed a pattern-based mining strategy (manuscript in preparation) to detect local and global (unlinked markers) multilocus genetic associations as well as gene × gene/gene × environment interactions. The pattern-based method exhaustively yet efficiently identifies all patterns satisfying pre-defined pattern search criteria and evaluates the association of patterns to disease state through a χData are organized in a two-dimensional data matrix with markers as columns, individuals as rows, and individuals' alleles or genotypes as cell values. Each marker is represented by five columns: one column for each of the two alleles of the marker and one column for each of the three possible genotypes for the marker. A pattern is defined as a maximal sub-matrix of the data matrix in which the value of each marker across all individuals in the sub-matrix satisfies a predefined equivalence criterion such as same genotype value. A sub-matrix is maximal if 1) no more rows can be added while keeping the columns fixed and, 2) no more columns can be added when keeping the rows fixed. Under this formulation patterns can be used to model both multilocus allelic and multilocus genotypic contributions to disease state.support threshold, which specifies the minimum number of rows a pattern must have; and the locus threshold, which specifies the extent of locus interaction. For example, with the support and locus thresholds set to 20 and 2 respectively, all reported patterns will have 20 or more case supports and mostly one or two markers. In the significance evaluation step, a 2 × 2 contingency table is constructed for each pattern to tally its support in the case and control populations . The two categorical variables tabulated are population type ("cases" vs. "controls") and pattern match status ("matches" vs. "does not match"). Partially missing data are excluded. The p-value is obtained from a χ2 test of independence and then adjusted for multiple testing. A modified Bonferroni correction for multiple testing is applied to each pattern, using as the correction factor the total number of patterns that contain equal or greater case support than the target pattern under significance evaluation, rather than the total number of patterns identified. As a result, the adjusted significance is robust against the arbitrary selection of values for parameters in the pattern discovery step. The odds ratio with confidence interval is also calculated for each pattern.Pattern Examiner is a nonparametric data mining-based method for the detection of multilocus associations and gene × gene/gene × environment interactions on data collected in population-based case/control studies. This method has two steps: 1) pattern discovery and 2) significance evaluation. In the pattern discovery step, patterns are identified using as input data from the case population only. The extensiveness (and execution time) of the pattern discovery step is controlled by two parameters: the N contingency tables were constructed with the observed N genotypes of a significant pattern as rows and genders as columns. Three chi-square values, χ2case, χ2control, and χ2pooled, were then obtained for cases only, controls only, and cases and controls pooled, respectively. The p-value was obtained using χ2 = χ2case + χ2control - χ2pooled with N - 1 degree of freedom.To test for the null hypothesis that there is no difference on genotype × gender interaction between cases and controls, three 2 × p-values ≤ 0.01 before multiple testing correction. After Bonferroni correction, ten patterns remained significant, as shown in Table p-value"). Interestingly, all significant patterns share the following characteristics: 1) they all contain marker SNP0177 with allele 1, suggesting a dominant effect for marker SNP0177; 2) they all have odds ratio around two, suggesting a modest relative risk; 3) they all have large number of case support , suggesting a rather common inheritance; and 4) they are all mapped to intergenic regions on chromosome 18. Furthermore, except for markers SNP672 and SNP0177, all other markers in those ten patterns are mapped to two LD blocks as identified by the HapBlock program [We identified 2.6 million patterns, mostly containing two markers, from the NARAC chromosome 18 data set, for a support threshold of 20 and a locus threshold of 2. From this set, 65,689 patterns were found to have program . In 20 out of 400 (5%) simulated data sets we observed five or more false-positive patterns. These results suggest that the ten significant patterns discovered in the real data set are unlikely to be an artifact of chance alone. Furthermore, if we consider the fact that these ten patterns share the same marker, SNP0177, then the significance gets even stronger: out of the 400 simulated data sets there was only 1 case (0.25%) where sharing of a common marker was observed in ten or more patterns.To further evaluate the significance of those ten patterns, we performed a Monte Carlo simulation using 400 simulated data sets generated by randomizing the case-control assignment of the 920 individuals in the study while maintaining the female/male ratio in both cases and controls. The pattern-based method was applied to each simulated data set. On average, 2.7 million patterns were identified from each data set, which were then subject to test statistics and multiple testing correction. In 8 out of 400 (2%) simulated data sets we observed ten or more patterns that had N contingency tables for each marker in the significant patterns and for each significant pattern with observed genotypes for marker or pattern as rows. Four variations of the contingency tables were constructed as detailed in the legend of Table p = 0.00118) as in females (p = 0.00109) despite the much smaller sample size. When both female and male populations were considered together ("With gender partition"), an even stronger association between the pair of markers and the disease was observed. For individuals with the 1/1–1/2 genotype for markers SNP0177 and SNP0615, an odds ratio of 11.7 was observed in females over males. For individuals with the 2/2–1/2 genotype for markers SNP0177 and SNP0615, an odds ratio of 7.51 was observed in males over females. Logistic regression analysis on the interaction between the pattern and gender also yielded a significant p-value of 0.0021 (data not shown). Furthermore, a test for differential interaction in cases and controls yielded a p-value of 0.0016, suggesting that there is significant interaction between the SNP0177–SNP0615 pattern and gender in the affected individuals vs. unaffected individuals. Similar results were obtained for all patterns containing markers in the SNP0603–0615 LD block (data not shown). On the other hand, no differential interaction in cases and controls was observed for the three remaining significant patterns (data not shown).It is known that the incidence rate of RA is higher in females. Indeed, there is a matching 3.82:1 female/male ratio in both the case sample and control sample of this data set. However, as shown in Table Several lines of evidence suggest that the significant multilocus associations we detected with Pattern Examiner on the NARAC chromosome 18 data set provided by GAW15 might be true associations: 1) except for marker SNP0177 and SNP0672, multiple markers from the same LD region were found to be in different significant patterns; 2) all markers in the same LD region displayed consistent dominant or recessive (a homozygote genotype in a pattern) effect; 3) a Monte Carlo simulation with randomized cases and controls produced a type I error probability of 0.02 for the observed results. The singleton SNP0177 does raise a flag because it is in a strong LD region with adjacent markers. Further investigation is necessary to confirm the role SNP0177 plays in the association. The ultimate proof for true association will have to come from replication studies. Taking advantage of our method's ability to detect multilocus association, we performed a novel multilocus gene × gender interaction analysis and detected a two-locus gene × gender interaction that was supported by three independent assays. Detailed analysis revealed large odds ratios for certain genotype combinations. However, a wide confidence interval dampens our enthusiasm. Again, further investigation with larger sample sizes is necessary to confirm this observation.2 test (p = 0.0002 for most markers in this region), the significance disappeared after Bonferroni correction with 2300 markers. After applying a less stringent Bonferroni correction using the number of LD blocks (233 LD blocks were identified by the HapBlock program) in this 10-Mb region, those markers resurfaced as significant. Because none of the significant patterns identified by the pattern-based method included markers SNP1097–1107, this locus might act alone as a risk factor for RA.Several reports in the "Association – Problem 2" group of GAW15 have identified the LD region including markers SNP1097–1107 to be significantly associated with RA [[By focusing on detecting multilocus association and interactions, the pattern-based method complements the traditional single marker association test. A preliminary power analysis (data not shown) suggested that this method has more power than the traditional single marker-based analysis under a couple of two-locus disease models. Additional power analysis is needed to further validate its utility.We have identified two potential multilocus associations (SNP0177/SNP1130–1131 and SNP0177/SNP0603–0615) with RA as well as evidence of interaction between gender and loci SNP0177/SNP0603–0615.Dr. Zhong Li is currently employed by High Throughput Biology Inc. (HTB) and serves as its President. He owns stocks of HTB and has the potential to gain commercially from this publication. No patent was filed at this time on the methods discussed in the manuscript. Dr. Andrea Califano is currently consulting and on the Advisory Board of High Throughput Biology Inc.(HTB), for whichhe receives a very small monthly compensation. He has no stock nor holds any position in any other company that stands to commercially gain from this publication. He has no further conflict of interest. No patent was filed at this time on the methods discussed in the manuscript. Dr. Aris Floratos has received consulting fees from High Throughput Biology Inc. He has no stock nor holds any position in any other company that stands to commercially gain from this publication. He has no further conflict of interest. No patent was filed at this time on the methods discussed in the manuscript. Dr. Tian Zheng has no competing interests.

Establishing the general and promoter-specific mechanistic features of gene transcription initiation requires improved understanding of the sequence-dependent structural/dynamic features of promoter DNA. Experimental data suggest that a spontaneous dsDNA strand separation at the transcriptional start site is likely to be a requirement for transcription initiation in several promoters. Here, we use Langevin molecular dynamic simulations based on the Peyrard-Bishop-Dauxois nonlinear model of DNA (PBD LMD) to analyze the strand separation (bubble) dynamics of 80-bp-long promoter DNA sequences. We derive three dynamic criteria, bubble probability, bubble lifetime, and average strand separation, to characterize bubble formation at the transcriptional start sites of eight mammalian gene promoters. We observe that the most stable dsDNA openings do not necessarily coincide with the most probable openings and the highest average strand displacement, underscoring the advantages of proper molecular dynamic simulations. The dynamic profiles of the tested mammalian promoters differ significantly in overall profile and bubble probability, but the transcriptional start site is often distinguished by large (longer than 10 bp) and long-lived transient openings in the double helix. In support of these results are our experimental transcription data demonstrating that an artificial bubble-containing DNA template is transcribed bidirectionally by human RNA polymerase alone in the absence of any other transcription factors. Accessing the information encoded in DNA requires that RNA polymerases recognize the core promoter, a sequence that marks the start of a gene. Statistical analysis of known promoter sequences has failed to reveal a simple code for identifying promoters, leading to the suggestion that promoter DNA is distinguished by certain structural/dynamic properties encoded in nonobvious ways by the literal sequence. Because the DNA strands at the promoter need to be separated for transcription to begin, we previously proposed that promoter sequences exhibit a propensity for spontaneous strand separation. Here, we conduct simulations of the ultrafast, small-scale strand separation motions of eight mammalian promoters and show that start sites tend to form larger and more stable openings in the double helix compared to other sequences. Experimentally, we show that an artificial permanent opening in the double helix is sufficient for transcription in the absence of sequence-specific protein–DNA contacts. These findings support a view of DNA as a structurally active participant in gene expression, rather than the commonly envisioned passive digital storage device. Our analysis suggests that functionally relevant structural variation in genomic DNA occurs at the level of fast motions not readily observed by traditional molecular structure analysis. It is generally acknowledged that the structure and dynamics of DNA at the eukaryotic promoter play important roles in gene regulation, but the nature of this relationship is unclear. From a structural perspective, RNA polymerases require single stranded DNA, or the formation of a ‘transcriptional bubble’ at the transcriptional start site (TSS) to initiate transcription ny denotes the relative displacement from equilibrium of the complementary bases of the n-th base pair, divided by √2. The first term of the Hamiltonian is the Morse potential which represents the base pair hydrogen bonds together with the electrostatic repulsion of the backbone phosphates. The parameters nD and na depend on the nature of the base pair (A-T vs. G-C) at site n. The second term represents a harmonic potential approximation but with a nonlinear coupling constant, which takes into account the influence of the stacking interactions between consecutive base pairs on the transverse stretching motion. The exponential term effectively decreases the harmonic spring constant K when one of the base pairs is displaced away from its equilibrium position in the double helix: Kmax = k (1+ρ); when ny+n−1y = 0, a condition met, e.g., at equilibrium, and Kmin = k; when ny or n−1y→∞, i.e., when at least one of the base pairs is out of the double helix stack. This term is essential for simulating long-range cooperative effects important for sharp DNA melting The PBD model is a one-dimensional nonlinear model that describes the transverse opening motion of the opposite strands of dsDNA. The Hamiltonian of the model isT = 310 K, by numerically integrating systems of stochastic equations based on the Peyard-Bishop-Dauxois (PBD) model. Periodic boundary conditions were applied in order to avoid terminal base pair effects, effectively circularizing the DNA sequence . Each DNA sequence for the existence of a bubble (collective opening) of a certain length l base pairs and amplitude threshold enumerates the bubbles of duration Δt[knq] with amplitude tr [Å] and length l base pairs, beginning at the nth base pair in the kth simulation.The probability P [15] wasLifetime was calculated as the average lifetime of a bubble of a given shape, i.e., with amplitude tr [Å] and length l [bp], over all occurrences of that bubble.The average bubble duration τThe average displacement of each base pair from its equilibrium double stranded conformation was calculated for the adeno-associated virus P5 promoter in two ways: using Metropolis Monte Carlo algorithm tr [Å] and length l [bp] containing a given base pair was calculated from the Langevin dynamic trajectories, and plotted as a function of bubble length and bubble amplitude.The average lifetime of all bubbles (see Eq. 3) of a given shape, i.e., with amplitude GCAAACGCCGTCGTCCGCACCGGTCGCGACTCGGCAAGGGAGCGGGCGGAAGCTGACTCG CGGCGGAGG GGGGTCACTC.The sequence of the DNA promoter template, assembly of the run-off transcriptional reactions, purification of human RNA polymerase II, RNA product separation, and visualization have been previously described All figures are assembled using Photoshop, FreeHand, Mathematica and MATLAB.For this study we chose a set of mammalian gene promoters with experimentally verified transcriptional start sites and presumably diverse mechanisms of regulation . The grotr as a function of bubble length (l as a function of amplitude (l (panel a) and strand separation amplitude values (panel b) can be found for each promoter, above which the TSS displays the maximum probability. These thresholds vary between promoters, but in all cases except the HSV UL11 and snRNA, bubbles longer than 10 bp and with larger than 2 Å amplitudes are most likely to be present at the TSS. In comparison, the UL11 and snRNA promoters are very active across the entire simulated promoter segments, and the TSS only become predominant for very large bubbles . The human ABF-1 promoter is the least dynamically active, with bubbles of l>10 bp and tr>1 Å (panel b), an order of magnitude less likely than similar size bubbles in the other promoters, but a very well pronounced TSS bubble.e length , panel amplitude , panel b−4 and ∼10−3 for bubbles with larger than 1 Å amplitudes, and is in the order of 10−5 for tr>3 Å. Interestingly, NMR studies estimated comparable probabilities (∼10−5) for single base pair openings that lead to exchange between base paired hydrogens and water Overall, the probability for the occurrence of bubbles longer than 10 bp varies between ∼10To further characterize the DNA dynamics of the selected promoters, we used the simulated Langevin trajectories to derive the average lifetime of a given opening as a function of base pair length and amplitude (Eq. 3). only at the TSS of the size and lifetime observed for the studied core promoters.To verify that the observed DNA dynamic profiles are relevant to transcription initiation, we performed identical PBD-LMD simulations on nonpromoter DNA sequences. The simulation results for the intron sequence of the human collagen gene are shown in Our data support the conclusion that nonpromoter sequences lack the characteristic signature of strand separation dynamics of the gene promoters.in vitro transcription experiments. We previously reported such experiments for the AAV P5 and adenoviral major late (AdMLP) promoters any transcription factors, if an artificial long-lived bubble of >/ = 5 bp is introduced at the start site of the AAV P5 promoter simulations occupy a unique niche between fast bioinformatic methods and all atom simulation techniques. We have used PBD LMD to derive three different criteria describing the strand separation dynamics of promoter DNA sequences. The results suggest that the most stable dsDNA openings do not necessarily coincide with the most probable openings or with the highest average strand displacement, underscoring the advantages of proper molecular dynamic simulations. According to the simulations, each promoter exhibits distinct DNA dynamic characteristics, but the transcriptional start site is often distinguished by large, relatively stable openings in the double helix. Such local openings are likely to be recognized and engaged by the transcriptional machinery, and may then be amplified, stabilized, or suppressed by DNA-protein interactions as part of gene transcriptional regulation. Data from

Two HIV-1 infected patients developed signs and symptoms consistent with adrenal suppression after being exposed to intra-articular triamcinolone acetate while also receiving ritonavir as part of their highly active antiretroviral therapy. Laboratory evaluation confirmed secondary adrenal suppression in both cases. Both patients recovered without the need for chronic replacement steroids. Adrenal suppression has been described as an adverse outcome in patients treated with fluticasone and concomitant ritonavir. In the reported cases, the adrenal suppression likely developed as a result of increased systemic concentrations of triamcinolone due to an inhibition of cytochrome p450 3A4 metabolism. Practitioners of HIV medicine should be aware of the potential negative interaction of injected triamcinolone and ritonavir. Ritonavir reduces the metabolism of systemic steroids including inhaled fluticasone which may lead to clinical Cushing's syndrome and secondary adrenal insufficiency -3. ThereA 41 year-old HIV-1 infected man presented to our clinic with concerns about non-healing abdominal bruising that he related to a motor vehicle collision that occurred approximately 6 weeks earlier. He noted weight gain without a change in his appetite or food intake. He complained of a pruritic rash on his upper chest and arms which he had noticed for approximately one month. His HIV-1 infection was treated daily with the fixed-dose combination of 200 mg emtricitabine and 300 mg tenofovir as well as 100 mg ritonavir and 300 mg atazanavir. He had been on a ritonavir boosted protease inhibitor (PI) regimen for four years. His CD4+ T lymphocyte concentration was 842/μL and his viral load was undetectable (level of detection <50 copies/mL-Roche v 1.5). He had been vaccinated against hepatitis A and B and uninfected by hepatitis C. He denied taking any inhaled or oral steroids, but due to chronic low back pain he had received two transforaminal epidural injections of 80 mg triamcinolone acetonide at an outside facility approximately 3 and 2 months prior to presentation.His blood pressure was 144/88 mmHg and his pulse was 91 beats per minute which were elevated from his baseline of approximately 100/75 mmHg and pulse of 80 beats per minute. His weight had increased by approximately 15 kg from his prior clinic visit 4 months prior. He had notable truncal weight gain and new Cushingoid facies. He had prominent 1 cm wide purple striae on the anterior abdomen with scattered striae on the flanks bilaterally and acneiform lesions on the chest, shoulders, back and upper arms concentration was <0.22 pmol/L . His thyroid-stimulating hormone concentration, electrolytes and renal function were all within normal limits. A synthetic glucocorticoid steroid blood screen revealed a triamcinolone acetonide concentration of 98.9 mmol/L (expected cutoff 6.9 mmol/L). He was counseled on the symptoms of adrenal crisis but continued his antiretroviral regimen without steroid replacement.One month after his initial presentation to clinic, his symptoms had improved, he was normotensive, and his weight was reduced by 4 kgs. Two months later due to complaints of left hip pain an anterioposterior roenterogram of the pelvis and left hip was obtained and revealed a large area of avascular necrosis within the left femoral head with significant lateral cortical lucency. Four months later, a mid-morning cortisol was 33.10 nmol/L, his ACTH concentration was 1.32 pmol/L, CD4+T lymphocyte concentration was 693/μL and his viral load remained undetectable. At his 6 month follow up visit, his afternoon random cortisol and ACTH values had returned to normal range .A 42-year-old HIV-1 infected woman presented to our clinic with complaints of weight redistribution around the neck and upper thighs, weakness, heat intolerance, blurry vision, heart palpitations, fatigue, hyperexcitability, insomnia, and increased appetite for approximately 20 days. Her HIV-1 infection was treated daily with the fixed dose combination of 200 mg emtricitabine and 300 mg tenofovir as well as daily 100 mg ritonavir and 300 mg atazanavir. Her most recent CD4+ T lymphocyte concentration was 693/μL and her viral load was undetectable. She had been vaccinated against hepatitis A and B and was not infected with hepatitis C.Upon presentation to our clinic she was found to have a blood pressure of 152/100 mmHg which was elevated from her baseline of 100/58 mmHg. Thyroid function studies, electrolytes and renal function were all within normal limits. Further evaluation revealed a mid-morning cortisol concentration of 55.18 nmol/L which increased after 0.25 mg cosyntropin injection to 386.26 nmol/L at 60 minutes . Her morning ACTH concentration was < 0.22 pmol/L.She denied using inhaled, oral or topical steroids. She had not been prescribed medroxyprogesterone or megestrol acetate. Due to a right shoulder impingement, she did receive an injection of 40 mg triamcinolone acetonide in her right subacromial space at an outside facility two weeks prior to her symptom onset. Six months prior to that she received a transforaminal epidural injection of betamethasone acetate as treatment for cervical spondylosis without complications while receiving the fixed-dose combination of lamivudine and zidovudine plus efavirenz. Initially her adrenal suppression was treated with a short burst of hydrocortisone (30 mg daily) to prevent potential adrenal crisis but this was discontinued after three days. Two months later the patient was asymptomatic and her random afternoon cortisol was 110.36 nmol/L, ACTH 1.76 pmol/L, CD4+ T lymphocytes 444/μLand viral load remained undetectable.Cushing's syndrome is known to occur with high doses of exogenous steroids, but has rarely been associated with triamcinolone injections -6. Our pThe ability of ritonavir to inhibit cytochrome P450 3A4 (CYP 3A4) is exploited to increase the bioavailbility of other PIs and increase their dosing intervals ,8. HowevIn a pharmacokinetic study of intra-articular administration of triamcinolone acetonide endogenous hydrocortisone suppression correlated with exogenous steroid concentrations and triamcinolone was fully absorbed within two to three weeks. TherefoOnce iatrogenic adrenal suppression is suspected, a random, preferably morning, serum cortisol and ACTH should be obtained. An ACTH (cosyntropin) stimulation test can confirm adrenal axis suppression caused by exogenous glucocorticoids. In Case 1, the synthetic glucocorticoid steroid screen confirmed that the prior triamcinolone acetonide injection was the source of exogenous steroids and presumably adrenal suppression. Usually careful history taking will provide the source of exogenous steroids, but this screening test may be useful in cases where history is lacking but clinical suspicion is high.In cases of adrenal suppression due to exogenous glucocorticoid administration, physiological replacement with hydrocortisone may not be necessary and chronic use of supraphysiological doses of corticosteroids should be avoided . CorticoA high index of suspicion for adrenal suppression is required when considering protean symptoms of a ritonavir treated HIV-1 infected patient who has recently received corticosteroids. As with our patients, careful history taking and physical examination are required to make the diagnosis and reveal the source of glucocorticoid exposure. The diagnosis may be obscured by a prior history of lipodystrophy which has similar clinical findings to those of Cushing's syndrome. However, a diagnosis is crucial to avoid the myriad complications of adrenal suppression and excess exogenous glucocorticoids which may include neuropsychological changes, hypertension, diabetes, osteoporosis and necrosis, and immune deficiency, among others.As the HIV-1 infected population with access to antiretroviral therapy ages they are likely to encounter diseases with a predilection for the elderly such as degenerative joint disease and osteoarthritis. Due to the frequent use of ritonavir in antiretroviral regimens and the common practice of intra-articular injection of steroids for rheumatic diseases, more research is needed to evaluate the interaction of injected steroids and ritonavir We advocate that any use of steroid supplementation, including intra-articular injection, should be used with caution in the setting of concurrent use of ritonavir.Written informed consent was obtained from the patients for publication of their case report and the accompanying image. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The authors declare that they have no competing interests.All authors participated in the drafting of the manuscript. All authors read and approved the final manuscript.

We report here, the case of a six-and-a-half-month-old boy investigated for persistent respiratory distress and homogeneous opacity in the left upper lobe. Echocardiography revealed a giant ductal aneurysm compressing the left pulmonary artery and upper lobe division of the left bronchus. Computerized tomography angiogram delineated the exact anatomy and prompt surgical resection provided a successful cure to this lesser known entity. S.G., a six-and-a-half-month-old boy, first in birth order, and product of a full-term normal delivery, was born with a weight of 2.5 kg, with bilateral congenital talipes equinovarus. Anomaly scanning including a neonatal chest X-ray failed to detect any other organ involvement. He was apparently well till one month of age and then developed persistent respiratory distress, failure to thrive, and had three episodes of 'pneumonia'. A chest X-ray revealed homogenous opacification of the whole left upper lobe , which wOn examination, the child weighed 5.6 kg (74% of expected) and was tachypneic . Cardiovascular examination revealed a normal cardiac size, normal heart sounds, grade 2/6 short ejection systolic murmur at the pulmonic area, and no evidence of congestive cardiac failure. All peripheral pulses and blood pressure were normal. Interestingly an expansile mass was seen in the suprasternal notch during crying.EchoDoppler examination performed using the Sonos 7500 machine with broadband transducers (S8 and S 12) in the subcostal, apical, parasternal, and suprasternal views showed no structural heart defect and normal ventricular dimensions and function. In the parasternal long axis view, the ascending aorta was dilated (Z score + 4.4). The aortic valve was tricuspid. Suprasternal long axis and short axis views showed a large ductal aneurysm rising from the descending aorta, distal to the left subclavian artery. The ampulla of this aneurysm was wide open (7 mm in size), but the pulmonary end was restricted and there was a tiny patent ductus arteriosus with a left-to-right shunt Figure ‐c. TherePreoperatively a ductal aneurysm of size 3 cm × 3 cm arising from descending aorta, just distal to the origin of the left subclavian artery, was seen. Under cardiopulmonary bypass, the pulmonary end of the ductus was ligated and then the aortic end was repaired with an autologous pericardium and the wall of the aneurysm was excised partially, while protecting the phrenic and recurrent laryngeal nerves. Postoperative follow-up at the end of two years showed complete regression of the aneurysm with laminar flow into the left pulmonary artery and descending aorta, on echocardiography.A ductus arteriosus aneurysm is a rare lesion characterized by localized saccular or tubular dilatation of the ductus arteriosus. A PubMed search revealed 144 cases; 106 spontaneous and 38 postoperative. SpontaneTwo different theories of pathogenesis have been proposed. Dr. Helen Taussig postulated that the primary event is failure of the duct to close at the aortic end after the pulmonary end has closed. This, along with concomitant exposure to systemic arterial pressure, causes aneurysmal dilatation. This observation is supported by the fact that 30% of the infantile ductal aneurysms are closed at the pulmonary end; the second theory suggests that congenital or acquired structural weakness of the ductal wall, such as reduced intimal cushion formation or abnormal deposition of elastin and glycoproteins, are responsible.[Our case supports this theory, as the pulmonary end was patent and the ascending aorta was also dilated. The presence of talipes and the unexplained dilated aortic root could be markers of connective tissue disorder. Our patient did not meet the required diagnostic criteria for any specific syndrome. Karyotyping was normal and so we cannot really comment on whether the concomitant presence of ductal aneurysm with talipes and dilated ascending aorta was a chance association or a hitherto unknown genetic syndrome.Because of the rarity and atypical presentations, often this diagnosis is missed. We feel that any infant with persistent lung collapse/consolidation should undergo echocardiography to exclude congenital heart disease. In young infants like our patient, conventional transthoracic echocardiography provides excellent images. Transesophageal echo, CT, magnetic resonance imaging (MRI) and Aortography may be required in the older age group. PreoperaSpontaneous rupture, erosion, thromboembolism, and compression of the adjacent structures are the feared complications occuring in as high as 31% of symptomatic infants less than two months. Surgery is recommended if a significantly large aneurysm does not regress spontaneously within a short follow up. In our pWe report this rare manifestation of ductal aneurysm and hope to increase the awareness among general pediatricians, radiologists, and echocardiographers to this possibility. Common investigations help in the complete diagnosis. Surgical intervention at an appropriate time can result in complete cure. However, these patients should also be screened for associated genetic and connective tissue disorder and detailed evaluation is mandatory.

Doxorubicin and cyclophosphamide (AC) therapy is an effective treatment for early-stage breast cancer. Doxorubicin is a substrate for ABCB1 and SLC22A16 transporters. Cyclophosphamide is a prodrug that requires oxidation to 4-hydroxycyclophosphamide, which yields a cytotoxic alkylating agent. The initial oxidation is catalysed by cytochrome P450 enzymes including CYP2B6, CYP2C9, CYP2C19 and CYP3A5. Polymorphic variants of the genes coding for these enzymes and transporters have been identified, which may influence the systemic pharmacology of the two drugs. It is not known whether this genetic variation has an impact on the efficacy or toxicity of AC therapy.*2, *8, *9, *3, *4 and *5, CYP2C9*2 and *3, CYP3A5*3 and CYP2C19*2. Clinical data on survival, toxicity, demographics and pathology were collated.Germ line DNA samples from 230 patients with breast cancer on AC therapy were genotyped for the following SNPs: ABCB1 C1236T, G2677T/A and C3435T, SLC22A16 A146G, T312C, T755C and T1226C, CYP2B6*2 and CYP2B6*5 alleles. The ABCB1 2677A, CYP2B6*2, CYP 2B6*8, CYP 2B6*9, CYP 2B6*4 alleles were associated with a worse outcome.A lower incidence of dose delay, indicative of less toxicity, was seen in carriers of the SLC22A16 A146G, T312C, T755C variants. In contrast, a higher incidence of dose delay was seen in carriers of the SLC22A16 1226C, CYP2B6Variant alleles in the ABCB1, SLC22A16 and CYP2B6 genes are associated with response to AC therapy in the treatment of breast cancer. Anthracycline-based adjuvant regimens have become the standard of care for early-stage breast cancer in the United Kingdom. The regimen of doxorubicin and cyclophosphamide (AC) is one of a number of available choices, with widespread use in patients with an indication for chemotherapy, but a low to moderate risk of recurrence. The combination of doxorubicin and cyclophosphamide was first tested by the National Surgical Adjuvant Breast and Bowel Project as a simple alternative regimen to replace cyclophosphamide, methotrexate and 5-fluorouracil (CMF), which had been established as an effective adjuvant treatment .A number of factors are known to influence the response to AC chemotherapy, including tumour stage, grade, number of lymph nodes involved, oestrogen receptor (ER), progesterone (PR) and ERBB2 expression . The CYP2B6*2, *3 and *4 SNPs were determined using a previously described RFLP method . PCR conditions for all the reactions together with primer and probe sequences and restriction enzymes used for the custom-designed assays are given in DNA was purified from whole blood samples using a QIAmp Maxi Blood kit . DNA yields were estimated spectro photometrically using a Nanodrop ND-1000 . Genotyping for the CYP2C9χ2 analysis. Pearson's χ2 test was used to investigate the influence of SNPs on each AC chemotherapy tolerance end point (using 2 × 2 table), unless a group contained five individuals or less, when Fisher's exact test was used. To standardise these data, both TTP and OS are taken as commencing when the patient had their first AC dose, regardless of when they were recruited to the study. Kaplan–Meier charts and Cox regression were used to analyse and demonstrate the influence of SNPs on TTP and OS.A multivariate Cox proportional hazards model, applying a forward likelihood ratio, was used to assess any influence on TTP or OS. Linkage disequilibrium was explored using a A multivariate Cox proportional hazards model, applying a forward likelihood ratio, was used to rule out any influence on TTP or OS from the following factors: age, ethnicity , histological tumour type , tumour size , tumour grade , unifocal or multifocal disease, number of involved axillary lymph nodes , ER status (positive or negative), PR status (positive or negative), ERBB2 status (positive or negative). ERBB2 status was only determined for 47 of the study participants as routine testing for new breast cancer presentations was introduced only in late 2005, after the date of presentation for most of our patients.χ2 analysis.Of the 173 (75%) of study patients with ER-positive disease, 161 received tamoxifen for a median of 46 months. Some patients received more than one type of hormonal modulation, because of a switch strategy, poor drug tolerance or extended adjuvant treatment. A total of 106 patients were treated with aromatase inhibitors for a median of 19 months. There was no association between either tamoxifen or AI therapy and any of the SNPs as tested by χ2 analysis. The previously reported LD among the ABCB1 SNPs was clearly seen, and was strongest between exon the 12 and 21 SNPs. Similarly, strong LD occurred for three of the SLC22A16 SNPs, with the A146G and T132C SNPs being in 100% LD. In contrast, the T1226C SNP was actually in negative association with the A146G and T132C alleles. Strong LD was also observed for the two SNPs in CYP2B6 that contribute to the CYP2B6*6 allele, *4 (A785G) and *9 (G516T). There was a negative association between the CYP2B6*5 SNP and the CYP2B6*6 SNPs.The distributions of the genotypes and allelotypes are shown in vs 13%, P=0.031, 25% vs 13%, P=0.031 and 23% vs 8%, P=0.036 for A146G, T312C and T755C SNPs, respectively). Conversely, a significantly greater incidence of dose delay during AC treatment was seen in variant carriers of SLC22A16 T1226C , CYP2B6*2 and CYP2B6*5 . Only 11 of the patients studied required a dose reduction and only 14 failed to complete their prescribed course. A lower incidence of dose reduction was associated with the CYP2B6*9 allele . There was no apparent influence of genotype on failure to complete course. Leucopenia and neutropenia were the most common reasons for dose delay. Carriers of the SLC22A16 T1226C minor allele also exhibited a higher incidence of leucopenia after the first cycle of therapy, compared with individuals who were wild-type homozygotes, . There was no association between genotype and leucopenia for any of the other SNPs studied.One aim of this study was to correlate genotypes in ABCB1, SLC22A16, CYP2B6, CYP2C9, CYP2C19 and CYP3A5 with tolerance of AC chemotherapy, including delivered dose intensity and toxicity. Data were gathered retrospectively from the clinical and chemotherapy records of 229 of the patients for the specific end points of ‘requirement for dose delay’, ‘requirement for dose reduction’ and ‘inability to complete planned course’. In terms of dose delays, 21% of patients experienced at least one course of AC chemotherapy where the timing of the cycle was delayed. Variant carriers, compared with homozygous wild type, of the first three linked SNPs in the SLC22A16 gene showed a statistically significant lower incidence of AC dose delay for ABCB1 demonstrated significantly shorter TTP and OS in the study population, with hazard ratios (HR) of 4.3 and 4.8 , respectively, when compared to wild-type homozygotes pooled with carriers of the 2677T allele and patients heterozygous for this SNP had a significantly shorter OS compared with patients who were homozygous wild type . However, the relevance of these data is uncertain, given the low number of rare allele homozygotes for both SNPs .There was a trend towards shorter TTP and OS associated with rare allele homozygosity for the CYP2C19*2 SNP . Similar*2 SNP was associated with a shorter TTP , but with no discernable effect on OS (*9 and *4) were also associated with a poorer outcome was associated with both a shorter TTP and OS, but had no impact on dose intensity. In contrast, the SLC22A16 T1226C was associated with a greater incidence of dose delay and leucopenia, but had no impact on survival. In a previous report investigating the effect of SLC22A16 genotype on doxorubicin pharmacology, only a minor effect of increased exposure to doxorubicin associated with SLC22A16 A146G rare allele homozygosity was observed, and the decreased incidence of dose delay associated with the same allele observed in this study is not consistent with an higher systemic exposure (SLC22A16 expression in cancer cells is associated with an increased sensitivity to the cytotoxic effects of doxorubicin (The other SNP found to have a significant effect on TTP was the ABCB1 G2677T/A. This non-synonymous variant results in substitution of either serine or threonine for alanine. This SNP has been widely studied, but the functional significance has not consistently been demonstrated (Overall, a number of SNPs appeared to influence the tolerance and effectiveness of AC chemotherapy in this group of breast cancer patients, however, no formal correction for multiple testing was made and any findings should be viewed as preliminary. Further studies would be needed to validate these findings and to substantiate possible mechanisms.

During infection with human immunodeficiency virus (HIV), immune pressure from cytotoxic T-lymphocytes (CTLs) selects for viral mutants that confer escape from CTL recognition. These escape variants can be transmitted between individuals where, depending upon their cost to viral fitness and the CTL responses made by the recipient, they may revert. The rates of within-host evolution and their concordant impact upon the rate of spread of escape mutants at the population level are uncertain. Here we present a mathematical model of within-host evolution of escape mutants, transmission of these variants between hosts and subsequent reversion in new hosts. The model is an extension of the well-known SI model of disease transmission and includes three further parameters that describe host immunogenetic heterogeneity and rates of within host viral evolution. We use the model to explain why some escape mutants appear to have stable prevalence whilst others are spreading through the population. Further, we use it to compare diverse datasets on CTL escape, highlighting where different sources agree or disagree on within-host evolutionary rates. The several dozen CTL epitopes we survey from HIV-1 gag, RT and nef reveal a relatively sedate rate of evolution with average rates of escape measured in years and reversion in decades. For many epitopes in HIV, occasional rapid within-host evolution is not reflected in fast evolution at the population level. HIV evolves so quickly that it can be seen to adapt within one infected person. Evolutionary escape from immunity is particularly well-described. Escape variants transmit to new hosts, where they may revert. We present a mathematical model of three processes: within-host evolution of escape mutants, transmission of those variants between hosts and subsequent reversion in new hosts. Using this model we reconcile diverse datasets on HIV immune escape, highlighting where multiple data sources agree or disagree on the underlying rate processes. The several-dozen immune epitopes we survey reveal a relatively sedate rate of evolution with average rates of escape measured in years and reversion in decades. Although there are frequent reports in the literature of early and rapid within-host evolution of HIV, for many epitopes this is not reflected in fast evolution at the population level. During the course of a single infection HIV evolves to escape from the selection pressures imposed by its host's immune response. Such changes have been recorded under selection from all three arms of the specific immune response, but escape from CD8+ cytotoxic T lymphocytes is particularly well documented Different hosts make immune responses to different parts of HIV (known as epitopes) and for CTL responses the epitopes that can be recognised are determined by the host's class 1 human leukocyte antigen (HLA) type. CTL escape mutants can revert to the wild-type when they are no longer under selection pressure from host immune responses A large literature describes the evolution of HIV CTL escape mutants within individual hosts. Many of those papers are case reports of the timing and speed of outgrowth of escape mutations within an individual and in most cases the events described occur during the first year of infection A better understanding of the global tempo of antigenic change in HIV can be achieved by addressing a series of specific questions. On average, how fast do HIV escape mutations arise in HLA matched individuals? How fast do reversions occur in HLA mismatched people? HIV is a relatively recently emerged infection of humans; so is it still adapting to its new hosts, and if so, how fast? What is the relationship between the tempo of adaptation within individuals and the rate of genetic change across the entire pandemic? If HIV is still adapting, what patterns can we expect to unfold across the population of infected people? How will those patterns be different in people of different HLA types and in populations with different HLA frequencies?Some of these questions have been elegantly addressed in large observational studies which describe the patterns of events that have unfolded in recent decades In order to address this gap we have developed a mathematical model that simultaneously captures events while viruses evolve within individuals and tracks the spread of variants as viruses are transmitted between individuals. Between-host transmission is modelled using a standard mathematical description of the frequency-dependent transmission of an infectious disease from which there is no recovery – the so-called SI model. However, the model we present allows host-heterogeneity with respect to a single HLA type so that some hosts have the potential to make a CTL response to a given viral epitope, whereas other hosts do not. Viral evolution is captured by allowing viral heterogeneity with respect to the presence – or not – of escape mutations in a single epitope restricted by the host HLA under consideration. Thus there are four types of infected hosts: HLA matched hosts infected with wild-type or escape mutant virus, and HLA mismatched hosts infected with wild-type or escape mutant virus. Thus there are no mixed infections, or more precisely each host can only be infectious with one type of virus. Only HLA matched hosts infected with wild-type virus can mount effective CTL responses to the viral epitope under consideration. They drive the evolution of CTL escape mutants and can therefore switch to become HLA matched hosts infected with escape mutant virus. HLA mismatched hosts are unable to mount CTL responses to the given epitope whatever mutations it bears and they can therefore allow their infecting virus to revert from escape mutant to wild-type. In this model such viral reversion is represented by HLA mismatched hosts switching from being infected with the escape mutant virus to being infected with the wild-type virus. Every infected host is infectious with the viral type they carry, so that the two viral types are transmitted between individuals at rates driven by the proportion of the total population infected with each. A diagram of the model is presented in This model has similarities to mathematical models of the spread of drug resistance In each of In any mutation at a site at which an escape mutation has been described . Escape data are available at two levels of organisation: comparisons across individuals (www.hiv.lanl.gov) using a search for dated B-clade sequences and eliminating duplicate samples from the same individual. Although this database is not strictly an epidemiological survey, it is the largest source of temporal population level data. The six epitopes are a subset of 31 epitopes in gag, reverse transcriptase (RT), and nef for which at least one escape mutation has been described in the literature. Details and references for these mutations are provided in http://hivdb.stanford.edu/). As predicted in The model's behaviour can be compared with CTL escape data from the current HIV pandemic. Such data are available from diverse studies, summarised in ividuals and chanividuals . Figure R0, , the average life expectancy of infected hosts, the duration of the HIV epidemic in the sample population and the proportion of the population who are HLA matched for each epitope. Since the data in 2B are from Switzerland, we assume that HLA prevalences are equal to those found in Caucasians We do not have to wait several decades for longitudinal cohort studies to play out. Our model can be used to infer rates of escape and reversion from HLA-typed escape prevalence data such as that shown in To test our model predictions, escape and reversion rates for the same epitopes were determined from the independent longitudinal cohort data (dataset 4) presented in We can take the inferred rates of escape and reversion and use the model to calculate a predicted change over 20 years (1985–2005) in the population escape prevalence of each epitope. When we compare that predicted change with the observed change in sequences deposited in the Los Alamos database and S3 wOur interpretation of the data in Our inferred reversion rates are even slower than our inferred escape rates: there is no reversion in 56% of epitopes and at the lower quartile the average time to reversion is 6.5 years. As shown in It is surprising to find that the rate of escape from CTL selection is more than an order of magnitude slower than suggested in a substantial literature describing events in carefully followed individuals. It is reassuring that the result arises very consistently from two different analyses of two independent datasets. Estimating escape and reversion rates from longitudinal cohort data is a straightforward and well-established process see legend. in vitro to confer escape. This curbs both the epitopes we look at and the sites within those epitopes that we consider. To check for bias arising from only looking at sites with defined escape we replot Might our definition of escape have excluded many genuine escape mutations? We confined our analysis to mutations at sites that have been demonstrated It is an inbuilt assumption of our model that escape mutants do not revert in HLA matched hosts. In principal such reversion could lead to lower prevalence of escape in HLA matched hosts and consequent underestimation of escape rates. The longitudinal cohort study (dataset 4) allows an estimate of the rate at which escape mutants revert in HLA matched hosts. The estimate is that this occurs, on average, once every 25 person-years of observation. Using this estimate and a modified version of our model in which escape mutants can revert in HLA matched hosts we can re-estimate escape and reversion rates from the data in Another possibility is that some escape mutations only appear transiently, to be replaced by other mutations in the same epitope. We develop a model of such a process in We have assumed that the rates of escape and reversion are homogenous across the duration of infection. In principal, if escape is faster earlier on during infection the prevalence of escape mutants in the population would be lower than would be predicted under the assumption that escape is as fast late on as it is early on during infection. This would lead us to underestimate the rate of escape during the early stage of infection. Instead, our estimate would represent a form of average escape rate across both the early and late stages of infection. Likewise, faster reversion in early infection could affect the prevalence of escape mutants and thus our inferred rates. Using a model in which escape and reversion are both faster in the first year of infection and an estimate that both rates halve after the first year we re-analysed the cross-sectional data to see how estimates change under these different assumption. We found that both inferred escape and reversion rates are faster under these new assumption but the halving of rates after 1 year is not large enough to have a substantial effect upon the escape prevalence at the population level and thus upon our inferred rates of escape and reversion. Details of the model and of the data supporting a halving of rates after one year are presented in We have also assumed that people are equally infectious throughout their infection. A study of HIV-discordant heterosexual couples Throughout this analysis we have treated different epitopes as though they were independent entities. Of course that is not so and the most intimate way in which epitopes can interact is by lying in identical parts of the HIV genome. Many CTL epitopes do lie in overlapping sections of the genome and we therefore developed a model to investigate the dynamics of a mutation at a single site that confers resistance in two overlapping epitopes restricted by two different HLA alleles . All patients provided written informed consent before participating in this study.t = timeh = host type v = virus type (0 if wild-type (WT), 1 if escape mutant (EM))B = population birth rate (years−1)p = proportion of the population who are HLA matched−1)ψ = rate of reversion in HLA mismatched hosts (years−1)μ = death rate of susceptible hosts (years−1)α = disease-related death rate (years−1)β = transmission probability per partnershipc = rate of partner exchange (years−1)h(t)X = number of susceptible hosts of host type h at time th hosts infected with virus type v at time tN(t) = total number of hosts in the population at time tv(t)λ = force of infection from hosts infected with virus type v at time t (years−1)The model is described mathematically using ordinary differential equations (1–6), where the force of infection is defined as Susceptible, HLA mismatchedSusceptible, HLA matchedInfected, WT, HLA mismatchedInfected, EM, HLA mismatchedInfected, WT, HLA matchedInfected, EM, HLA matchedMinitab 14 was used to compare the observed and predicted escape rates . Firstlyvalences were comon rates could noTable S1A summary of mutations in HIV-1 gag, RT and nef which have been reported in the literature as conferring CTL escape and confirmed by in vitro tests.(0.02 MB PDF)Click here for additional data file.Table S2A summary of escape and reversion data from the cross-sectional study (dataset 2) and the longitudinal cohort study (dataset 4).(0.03 MB PDF)Click here for additional data file.Table S3A summary of published escape data from case reports (dataset 3).(0.03 MB PDF)Click here for additional data file.Table S4A summary of published reversion data from case reports (dataset 3).(0.01 MB PDF)Click here for additional data file.Text S1Analytic expressions representing the escape prevalence under different circumstances.(0.03 MB PDF)Click here for additional data file.Text S2Supporting references.(0.01 MB PDF)Click here for additional data file.Text S3A detailed analysis describing how additional factors could affect the evolution of escape mutants and thus affect our inferred rates of escape and reversion rates from the cross-sectional data (dataset 2).(0.41 MB PDF)Click here for additional data file.Figure S1Confidence intervals for escape and reversion rates inferred from the cross-sectional data (dataset 2).(0.04 MB PDF)Click here for additional data file.Figure S2Sensitivity analysis showing how the assumed model parameters affect our inferences from the cross-sectional data c.f. .(0.19 MB PDF)Click here for additional data file.Figure S3Observed changes in the population escape prevalence over approximately 20 years (dataset 1).(0.04 MB PDF)Click here for additional data file.

Neurospora crassa is an excellent system to study evolution and biological function of SSRs.Simple sequence repeats (SSRs) have been successfully used for various genetic and evolutionary studies in eukaryotic systems. The eukaryotic model organism N. crassa. The distribution of tri-nucleotide (nt) SSRs, the most common SSRs in N. crassa, was significantly biased in exons. We further characterized the distribution of 19 abundant SSR types (AST), which account for 71% of total SSRs in the N. crassa genome, using a Poisson log-linear model. We also characterized the size variation of SSRs among natural accessions using Polymorphic Index Content (PIC) and ANOVA analyses and found that there are genome-wide, chromosome-dependent and local-specific variations. Using polymorphic SSRs, we have built linkage maps from three line-cross populations.We identified and characterized 2749 SSRs of 963 SSR types in the genome of N. crassa, 3) there are different levels of evolutionary forces in variation of amino acid repeats, and 4) SSRs are stable molecular markers for genetic studies in N. crassa.Taking our computational, statistical and experimental data together, we conclude that 1) the distributions of the SSRs in the sequenced N. crassa genome differ systematically between chromosomes as well as between SSR types, 2) the size variation of tri-nt SSRs in exons might be an important mechanism in generating functional variation of proteins in Simple sequence repeats (SSRs) refer to the sequences that are one to six-nucleotides (nt) repeated in tandem in a genome. SSRs have many advantageous features for various biological studies: SSRs are ubiquitous and abundant in a genome, highly variable and suitable for high-throughput applications -8. In adde novo genesis) or that they are brought about in a primal form into a receptive genomic location by mobile elements (adoptive genesis). These two hypotheses are both adequate for explaining the ubiquitous distribution of SSRs. However, there remains much to be understood to elucidate which one is right and how the non-random distribution of SSRs has emerged in the eukaryotic genome , a well-known pathogen causing a shoot or tip blight of numerous pine species and some other conifers, is 0.43 [N. crassa seems to be relatively high. To estimate a mean PIC value objectively, the tested SSR loci should be randomly sampled. However, unbiased sampling, as done in our study, is not easy to achieve even in sequenced organisms. Since the PIC calculations in many studies, including those mentioned above, are based on the available SSR marker set rather than a random sample, they could produce biased estimates of the PIC for the genome.The estimated PIC value was comparable and relatively high for SSR markers compared to other organisms -60 where is 0.49 , and the is 0.43 . CompareN. crassa implies that the SSR marker system has sufficient resolution/polymorphism to be used for genetic studies. Even though our current study of polymorphism of the selected SSR types uses a rather small sample of 7 strains, our PIC estimation of the SSR type AC/CA was consistent with the estimation using a larger sample of 32 strains and allele length homoplasy [Recently, molecular marker techniques for assisting efficient mapping/gene-cloning have been developed in a system -68. All N. crassa natural accessions are correlated with various factors including chromosomes, genomic categories, SSR types, repeat numbers, and total SSR lengths. This suggests that the factors affecting the mutation rate could be random across the genome. Thus, the non-random distribution pattern of SSRs presumably reveals the functional significance of SSRs. The size variations of tri-nt SSR in exons might be an important mechanism in generating functional variation of proteins in the N. crassa. Using statistical analyses, we concluded that there are both genome-wide and local effects in size variation of SSRs. Since genetic mobile elements are inactive in the most of N. crassa genome, the detected size variation of SSRs cannot be explained by transposable elements as demonstrated in other systems. Considering their high PIC values, SSRs are good genetic markers for intra-species populations of N. crassa. However, since the polymorphism level is locus specific, more thorough empirical characterizations of size variability of SSRs across the genome are necessary to increase their efficiency as molecular markers.We conclude that the distributions and size variations of the SSRs in Neurospora genome sequence, release 7, was downloaded from the Broad Institute [n is equivalent to (CA)n, (TG)n, and (GT)n, while (AGC)n is equivalent to (GCA)n, (CAG)n, (CTG)n, and (TGC)n. Lastly, we determined the abundance of each SSR motif and unit size in the different genomic regions by normalizing the size of the corresponding genomic region. To describe the abundance of SSRs in different genomic region, we chose to use the "relative abundance", which is calculated by dividing the number of SSRs by mega base-pair (MB) of sequences in our analyses.The 39.2 Mb nstitute , and wasnstitute . We usedNeurospora genome, we strived to select SSRs randomly from the Neurospora genome. We divided the genome into 250 kb windows and selected SSRs randomly within each window. A total of 164 SSR loci consisting of di- to hexa-SSRs with various sequence motifs were chosen for further analysis. The scatter plot of the selected markers showed that they were evenly distributed in the genome (Data not shown). With the SSRs selected, we designed oligos using Primer3 software in flanking sequence to amplify the targeted SSR loci. The range of the annealing temperatures in each primer set was between 50°C and 60°C and the primer pairs yielded amplification products between 100 and 350 bp.To characterize the overall pattern of polymorphism of the SSRs in the ® (Applied Biosystems).For semi-automated genotyping analysis, the 5' M13 sequence was attached to a forward primer in order to incorporate a florescent dye into the PCR product. Fluorescent dye labelled M13 forward primer and a marker specific reverse primer were used to generate fluorescent-labelled PCR product as previously described . The comWe generated the predicted amino acid sequences with an assumption that exonic tri-nt SSR sequences had an equal chance to be translated in all the possible reading frames of the tri-nt repeats. For example, SSR sequences GCTGCTGCTGCTGCTGCT can be translated in three different frames: 1) GCT GCT GCT GCT GCT GCT, which will be translated into Ala-Ala-Ala-Ala-Ala-Ala, 2) CTG CTG CTG CTG CTG CTG, which will be translated into Leu-Leu-Leu-Leu-Leu-Leu, and 3) TGC TGC TGC TGC TGC TGC, which will be translated into Cys-Cys-Cys-Cys-Cys-Cys. Only one of the three possible reading frames would be used to generate the "observed" amino acid repeats.The measurement of the allelic diversity or polymorphism information content (PIC) value was first described by Botstein et al. and modiN. crassa strains are divergent and not related among each other .where Pij represents the frequency of the jth allele for marker i, and summation extends over n alleles. The allelic polymorphism of the 162 SSR markers in the seven natural accessions, FGSC#2223, FGSC#4825, FGSC#4720, FGSC#4715, FGSC#3223, FGSC#4724, and FGSC#2478, were calculated following the formula. The genome structure of seven P = 0.001. Subsequently, Monte Carlo simulation with 500 iterations was used to test the marker locus order generated by GMENDEL.The 564 F1 progenies abundance is given by A = Y/L. Our modelling strategy incorporates the frequency and length information by assuming that the counts are Poisson random variables with expected values proportional to their associated lengths. If E denotes the expected value of a count, then the expected rate is R = E/L. A log-linear model is used to describe how these rates vary as a function of SST type, genomic region category, and chromosome. The fit of a particular model can be assessed by comparing the empirical abundance values, A, to maximum likelihood estimates of expected rates which satisfy the model assumptions, using the model deviance statistic,where the summation is over all 266 cells in the 19 × 7 × 2 contingency table. Our most general model has the form,or equivalently,where T denotes the main effect of SSR type, C denotes the effect of chromosome, G is the main effect of genomic location category, and T × G allows for type by region interaction, that is, differential type effects by genomic category..All data presented in the current report are freely available via our webpage, SSRs, Simple sequence repeats; nt, nucleotide; AST, abundant SSR types; PIC, Polymorphic Index Content; AAR, amino acid repeats; GO, gene ontology.QS, JP and YL generated the bioinformatic data. TK analyzed bioinformatical data and experimental data. JB, HGG, and TK performed statistical analyses. KL conceived of the project and participated in its design. TK and KL wrote the manuscript. All authors read and approved the final manuscript.List of 2749 SSR loci in the Neurospora crassa genomeClick here for fileGO analysis for proteins containing amino-acid repeatsClick here for fileNeurospora crassa genomeAbundant SSR types (AST) in the Click here for fileThe distribution of the randomly selected SSRs by the unit numberClick here for fileNeurospora crassa genomeThe physical location and PIC values of 131 SSR loci in the Click here for fileComparison of PIC values of the AC/CA SSR type in two different population sizesClick here for fileThree hypotheses for the size variation of SSRsClick here for fileThe list of 33 SSR loci for statistical analysesClick here for fileThe marker quality of the mapped SSR lociClick here for file

There is increasing concern that contraceptive pill usage may increase the risk of hepatocellular carcinoma. As primary malignant liver cancer is very rare in this country, any effect due to oral contraceptives should be apparent in national mortality statistics. An analysis of mortality rates over the last 24 years shows a small but consistent increase for young women starting to occur during the end of the last decade. However no such trend is apparent in data from other countries where pill usage is comparable to that in the U.K. Overall liver cancer remains an extremely uncommon cause of death in developed countries, but it will be particularly important to monitor trends in this disease in the future.

Eradication of Helicobacter pylori usually consists of a 7-day course of triple therapy including metronidazole or amoxicillin plus clarithromycin plus a proton pump inhibitor. We report about a rare adverse event of Hp eradication in a patient with moderate chronic and moderate active pangastritis. Shortly after the end of treatment cholestatic hepatitis occurred which was most likely related to clarithromycin, perhaps enhanced by amoxicillin. Since liver dysfunction was self-limited, no further treatment was required. In summary, clinicians should be aware about the presented rare adverse event of Helicobacter pylori eradication treatment for a close monitoring of those patients and rapid management of acute liver failure. According to the current DGVS (German Association of Gastroenterologists) S3-guidelines eradication of Helicobacter pylori (Hp) is indicated in patients with gastric or duodenal ulcer and gastric marginal zone B-cell lymphoma of MALT-type (mucosa-associated lymphoid tissue). It is facultative in patients with dyspepsia (following upper GI endoscopy), chronic asymptomatic Hp-associated gastritis, Mënëtrier's disease, idiopathic thrombocytopenic purpura, and lymphocytic gastritis . A 7-dayIn August 2008, a 64-year-old Caucasian male German presented at our outpatient department with complaints of nausea, knife-like pain in the right upper quadrant of the abdomen, which occurred after the intake of food, and additional globus pharyngis feeling. He had a past medical history of arterial hypertension, hyperuricemia, benign paroxysmal positional vertigo, and was allergic to diclofenac. The list of drugs he was taken included 6 mg betahistine q.d., 150 mg allopurinol q.d., 25 mg carvedilol q.d., 80 mg valsartan b.i.d., and 25 mg hydrochlorothiazide q.d. Initial laboratory investigation showed increased levels for ASAT [67 U/L ], ALAT [67 U/L ], GGT [87 U/L ], and bilirubin [22 μmol/L ] . Laboratory investigation showed further increased levels for ASAT [73 U/L], ALAT [1351 U/L] and GGT [344 U/L], with bilirubin level remaining unchanged [21 μmol/L] for a duration of seven days. One day after end of treatment the patient presented with a burning sensation in his throat, side stitch, mouth dryness, dark urine, and anal pruritus. Laboratory investigation showed further increased levels for ALAT [86 U/L] and GGT [185 U/L], and stably elevated levels for ASAT [59 U/L] and bilirubin 24 μmol/L] (Figure 4 μmol/L or ASAT 7 U/L, ALAor ASAT 7 U/L, ALAWe report the case of a 64-year-old patient who presented with unclear elevation of liver enzymes. Alcohol-induced liver injury, viral hepatitis, auto-immune hepatitis, Wilson's disease, hemochromatosis, and α1-antitrypsin deficiency were unlikely according to the laboratory and histology results. Cholecysto-/choledocholithiasis could also be excluded due to normal MRCP results and normal alkaline phosphatase value. Liver biopsy was suspicious for drug- or toxin-induced liver injury. Regarding the patient's drug history it was remarkable that liver enzymes started to raise shortly after completion of Hp eradication. Since pantoprazole was not very likely the culprid, clarithromycin and amoxicillin were the drugs in suspicion. It has been known for many years that several antibiotics can cause severe hepatic injury . In the In summary, clinicians should be aware about the presented rare adverse event of Hp eradication treatment. In patients with pre-existing liver disease like steatohepatitis, a close look at concomitantly prescribed drugs and monitoring of ASAT, ALAT, GGT, alkaline phosphatase, and bilirubin prior and after Hp eradication is recommended. Although only moderate liver injury was detected in our case, physicians should be prepared for rapid management of acute liver failure. In addition, alternative drug combinations, such as amoxicillin + metronidazole + PPI, metronidazole + doxycycline + bismuth subcitrate + PPI, or rifabutine + levofloxacine + PPI, should be discussed for Hp eradication in these patients.The authors declare that they have no competing interests.MW wrote the manuscript and contributed to the mangement of the patient. CM contributed to the mangement of the patient and provided further laboratory data. HL and KW did pathology studies. All authors have read and approved the final manuscript.Written informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.

Although it has been demonstrated in previous studies that tubal ligation can have widespread effects on ovarian function, including a decrease in the risk of subsequent ovarian cancer, few studies have evaluated effects on breast cancer risk. In a population-based case–control study of breast cancer among women 20–54 years of age conducted in three geographic areas, previous tubal ligations were reported by 25.3% of the 2173 cases and 25.8% of the 1990 controls. Initially it appeared that tubal ligations might impart a slight reduction in risk, particularly among women undergoing the procedure at young ages (< 25 years). However, women were more likely to have had the procedure if they were black, less educated, young when they bore their first child, or multiparous. After accounting for these factors, tubal ligations were unrelated to breast cancer risk (relative risk (RR) = 1.09, 95% confidence interval (CI) 0.9–1.3), with no variation in risk by age at, interval since, or calendar year of the procedure. The relationship of tubal ligations to risk did not vary according to the presence of a number of other risk factors, including menopausal status or screening history. Furthermore, effects of tubal ligation were similar for all stages at breast cancer diagnosis. Further studies would be worthwhile given the biologic plausibility of an association. However, future investigations should include information on type of procedure performed (since this may relate to biologic effects) as well as other breast cancer risk factors. © 2000 Cancer Research Campaign

Eukaryotic transcription activators normally consist of a sequence-specific DNA-binding domain (DBD) and a transcription activation domain (AD). While many sequence patterns and motifs have been defined for DBDs, ADs do not share easily recognizable motifs or structures.per se retained much of the transcriptional activity. Mutations which substituted tryptophan residues for both of the non-tryptophan residues in the pentapeptide (resulting in W5) significantly enhanced its activity (~1.8-fold), while mutations which substituted aromatic residues with alanine residues severely impaired its activity. Accordingly, a much more active peptide, pentatryptophan (W7), was produced, which elicited ~3-fold higher activity than that of the native pentapeptide and the N domain. Further study indicated that W7 mediates transcription activation through interacting with the general transcription factor, TFIIB.We report herein that the N-terminal domain of yeast valyl-tRNA synthetase can function as an AD when fused to a DNA-binding protein, LexA, and turn on reporter genes with distinct LexA-responsive promoters. The transcriptional activity was mainly attributed to a five-residue peptide, WYDWW, near the C-terminus of the N domain. Remarkably, the pentapeptide 7 shares no sequence homology or features with any known transcription activators, it may represent a novel class of AD.Since W Eukaryotic transcriptional activators that stimulate transcription initiation of a particular set of target genes usually consist of a sequence-specific DNA-binding domain (DBD) and a transcription activation domain (AD). The DBD targets these activators to a specific location in the promoter region of a gene, and the AD mediates transcription initiation by recruiting gene-specific factors, chromatin-remodeling factors, mediator complexes, and general transcription factors ,2. DBDs GAL regulon) consists of four structural and three regulatory genes. Protein products of the structural genes are required for transport and metabolism of galactose, and protein products of the regulatory genes control expression of the structural genes. Gal4 is an acidic transcriptional activator comprised of two functionally independent domains: an N-terminal sequence-specific DBD and a C-terminal AD. Induction of the Gal4-responsive genes by galactose is mediated through the specific binding of the Gal4-DBD to an upstream activating sequence in their promoter regions and subsequent recruitment of the general transcription apparatus by the Gal4-AD. Under non-inducing conditions in the absence of galactose, Gal4 activity is repressed by the interaction of Gal80 with the Gal4-AD [One of the earliest and best-studied models for transcriptional regulation in eukaryotes is that of yeast Gal4, which is involved in regulating galactose metabolism in response to changes in the concentration of the carbohydrate ,7. The G Gal4-AD . Under iALA1 [GRS1 (which codes for glycyl-tRNA synthetase) [HTS1 (which codes for histidyl-tRNA synthetase) [VAS1 ) [in vivo.In prokaryotes, there are typically 20 aminoacyl-tRNA synthetases, one for each amino acid -14. In ethetase) , GRS1 (wthetase) , HTS1 (wthetase) , and VAS) . BecauseKd values of around 0.6 μM [Many eukaryotic cytoplasmic tRNA synthetases contain an amino- or carboxyl-terminal polypeptide extension, which is absent from their bacterial counterparts . These ed 0.6 μM ,22. Manyd 0.6 μM and the d 0.6 μM . In addid 0.6 μM and mammd 0.6 μM . Howeverd 0.6 μM which ard 0.6 μM ,29.Kd of ~2 μM) that significantly contributes to tRNA binding and aminoacylation activities of the enzyme [7), was consequently devised. Furthermore, W7 stimulated transcription initiation via interaction with TFIIB, a general transcription factor. It is our hope that information obtained in this study will advance our understanding of the biochemical properties of ADs in general, and also provide new insights into the mechanisms of transcription activation in particular.As with many known yeast tRNA synthetases, the cytoplasmic form of yeast ValRS also contains an amino-terminal polypeptide extension. While the Ad of mammalian ValRS was shown to interact with the four subunits of the elongation factor, EF-1H, to form a high-molecular-weight complex , relative enzyme ,31. We rlexA fusion into pGilda (carrying an HIS3 marker) as described in "Materials and Methods", and the resulting construct was cotransformed with the reporter plasmid, p8oplacZ (carrying a URA3 marker), into the EGY48 yeast strain. To rule out the possibility that the bait hybrid protein was itself an autoactivator, the cotransformants were first tested on selection medium in the absence of any prey hybrid protein. Unexpectedly, the LexA-N domain fusion by itself could turn on the LEU2 and lacZ reporter genes; the cotransformants grew robustly on the X-gal agar plate and turned blue . This result suggests that the bait hybrid protein per se is a transcription activator, and the N domain of yeast ValRS acts as an AD.In addition to tRNA binding, we wondered whether the N-terminal domain of yeast ValRS possesses another function. To explore this possibility, the N-terminal domain (residues 1~135) was cloned by fusion to the DNA-binding protein, LexA, and used as bait to screen a yeast library for interacting partners. Note that the N-terminal sequence used in this assay was 37 residues longer than the Ad (residues 1~98) used in previous studies ,31 to enLEU2 and lacZ were not identical, and only fusions that could turn on both reporter genes were considered positive in this assay. To determine which segment of the N domain actually accounted for this transcriptional activity, various segments of the domain were individually fused to LexA, and their transcriptional activities were tested. As shown in Figure numbers 4~8). In contrast, segments consisting of residues 113~115, 98~112, and 98~109 had no detectable activity (numbers 9~11). Thus, the segment containing residues 111~115 (WYDWW) is essential and sufficient for this activity (number 8).It was noted that the operator sequences in the reporter genes numbers 9~11). To check whether all of these LexA fusion constructs were properly expressed in the reporter yeast strain, the expression profiles of these constructs were analyzed by Western blotting using an anti-LexA antibody. As shown in Figure numbers 9~11). pLexA-Pos and pGilda respectively served as positive and negative controls in the assays.Quantitative assays of the β-gal activity (encoded by the reporter gene carried on p8oplacZ) further showed that among these active peptides, the segments containing residues 98~115, 101~115, and 104~115 had the highest activities (~1.5-fold relative to that of the positive control); the segment containing residues 107~115 had medium activity (~0.8-fold relative to that of the positive control); and the segments containing residues 1~135 and 111~115 had the lowest activities (~0.5-fold relative to that of the positive control) Figure . As expenumbers 1, 4, and 8). To enhance its activity, two or three tandem repeats of the pentapeptide sequence were cloned, and the activities of the resulting constructs were tested. As shown in Figure 2, strongly enhanced the activity (~3-fold increase relative to that of a single pentapeptide) (compare numbers 3 and 4). However, an additional replication of the sequence, resulting in (WYDWW)3, did not further enhance the activity; (WYDWW)3 exhibited activity comparable to that of (WYDWW)2 (compare numbers 4 and 5). Western blotting assays showed that these constructs expressed similar levels of LexA fusion proteins. Thus, changes in the transcriptional activity of these fusion constructs did not result from different protein expression levels .While the pentapeptide, WYDWW, can function as an AD, its activity was relatively low, only ~50% of that of the positive control and ~30% of that of the segment containing residues 98~115 of the N domain . In contrast, mutation of the middle residue (D) to W had little effect on the activity (compare numbers 3 and 7). Moreover, mutation of the second residue (Y) to W significantly enhanced the activity (~1.8-fold) (compare numbers 3 and 9). Thus, it appears that W is preferred in all positions of the pentapeptide for activity. A Western blot analysis showed that these mutations had only minor effects on the expression levels of the fusion proteins , and the activity of the resulting construct was tested. As expected, W5 had an activity ~1.8-fold higher than that of the native pentapeptide . Most amazingly, inserting two more W residues into W5, yielding W7, further enhanced the activity (~1.8-fold) (compare numbers 4 and 5). That is, the activity of W7 was ~3-fold higher than that of the native pentapeptide (compare number 3 and 5). However, the activity of W9 was almost equivalent to that of W5 (numbers 4 and 6). Thus, W7 appeared to be the strongest AD among those tested. To investigate whether the transcriptional activities of these peptides were attributable to their hydrophobic property, W7 was mutated to F7, and the activity of the resulting construct was tested. As shown in Figure 7 to F7 resulted in a functionally inactive peptide that failed to turn on the reporter genes (numbers 5 and 7). With respect to protein expression, these fusion constructs expressed considerably different levels of proteins. LexA-W5 and LexA-W9 produced the highest protein expression levels ; LexA-WYDWW and LexA-W7 had medium protein expression levels (numbers 3 and 5); and LexA-F7 had the lowest protein expression level (number 7).To gain further insights, both of the non-W residues in the pentapeptide were mutated to W residues was carried out on the representative constructs, LexA-WYDWW, LexA-W7, and LexA-F7. To exclude the interference of transcription activation, the host cell used for the assay was INVSc1, instead of the reporter yeast strain, EGY48. As shown in Figure 7, and LexA-W7 was much more stable than LexA-F7. LexA-F7 had a short half-life (of <15 min) and was degraded in vivo at a much faster speed than the other two fusion proteins tested. It remains to be seen whether this attribute actually accounted for the negative phenotype of LexA-F7 in the transcriptional assay . Thus, it appears that there were no direct correlations between transcriptional activity and protein expression levels in these instances. Figure 7, and F7 did not compromise the stability of the specific lexA mRNAs in vivo.To further investigate whether the different protein expression levels observed herein were caused by different protein stabilities y Figure . Another7 and (WYDWW)2 were promoter-specific, and whether they were affected by the DBD used. To this end, W7 and (WYDWW)2 were assayed in a Gal4-based system, where the AD was fused in-frame to the Gal4-DBD cloned in pGBKT7 (which carries a TRP1 marker), and the reporter genes used were HIS3 and MEL1 under the control of two completely heterologous Gal4-responsive upstream activating sequences and promoter elements, GAL1 and MEL1, respectively. As shown in Figure 7 or Gal4-DBD-(WYDWW)2) grew robustly and turned blue on selection medium containing X-α-gal but lacking tryptophan and histidine , suggesting that both of these peptides acted as ADs in Gal4-DBD fusion proteins. Thus, the transcriptional activities of these two peptides were non-promoter-specific and were operational in both LexA- and Gal4-DBD-responsive reporter genes.We next tested whether the transcriptional activities of Wnumbers 1, 3, and 4). This is not surprising, considering the fact that the positive control was a wild-type GAL4 gene. Western blot assays showed that these two Gal4-DBD fusion constructs had protein expression levels much lower than that of the Gal4-DBD alone . Whether the ADs destabilized the Gal4-DBD fusion proteins and whether the relatively poor transcriptional activity of these two fusion constructss was caused by a lower level of protein expression are yet to be determined. However, regardless of the diverse protein expression levels, these results clearly demonstrate the ability of these two peptides to function as ADs in the Gal4-based system.Quantitatively, these two fusion proteins had transcriptional activities ~2.5-fold lower than that of the positive control 2 can act as ADs when directly fused to a sequence-specific DBD such as LexA and Gal4-DBD . In contrast, human lamin C did not interact with the large T-antigen and therefore failed to turn on the reporter genes . Interestingly, both W7-T and (WYDWW)2-T fusions turned on the reporter genes when acting in concert with the Gal4-DBD-53 fusion (numbers 3 and 5), but failed to do so when acting in concert with the Gal4-DBD-Lam fusion (numbers 4 and 6). This observation provides strong evidence that both W7 and (WYDWW)2 can act as ADs in a traditional two-hybrid system, albeit with efficiencies poorer than that of Gal4-AD .So far, we have shown that W Figures . The que7 also stimulates transcription initiation through interaction with one of these protein factors. Pursuant to this objective, TBP, TFIIB, and TFIIH were individually cloned into pGilda (a bait fusion vector encoding the LexA fusion protein), and then their interaction with W7 (as a part of the B42-W7 fusion protein) was tested using a yeast two-hybrid system. LexA and B42 respectively served as the DBD and AD in this assay. As shown in Figure 7, none of these fusion constructs per se could simultaneously turn on the designated reporter genes, LEU2 and lacZ showed little sequence homology. Thus, Gal4-AD and W7 may interact with different sites of TFIIB or through a different mechanism. Alternatively, a certain portion of Gal4 may fold into a three-dimensional structure that displays a hydrophobic feature similar to that of W7. In any case, it is interesting to find that both of these ADs mediate transcription activation through interacting with TFIIB. Thus, the minute AD, W7, might turn out to be an interesting paradigm for further mechanistic studies of transcription activation.A preliminary study suggested that the direct target of W7) can function as an activation domain when fused to a DNA-binding protein, LexA, and turn on reporter genes with distinct LexA-responsive promoters. Like the activation domain of Gal4, W7 mediates transcription activation through interacting with the general transcription factor, TFIIB.A short peptide containing seven consecutive tryptophan residues into pGilda and pGBKT7 for the transcriptional assays, a set of primers complementary to nucleotides -15 to +15 and +390 to +420 of lexA fusion into pGilda (carrying an HIS3 marker) as mentioned above. The lexA fusion construct was then co-transformed with the reporter plasmid, p8oplacZ , into the EGY48 yeast strain , and the resulting cotransformants were selected on minimal medium lacking uracil and histidine. A single colony of the cotransformants that grew on the selection medium was picked and streaked on an agar plate containing X-gal but lacking uracil, histidine, and leucine. The streaked colony could not grow on the X-gal plate and turn blue unless the LexA fusion protein had turned on both reporter genes (LEU2 and lacZ). Note that the DNA-binding protein, LexA, alone could not activate transcription of the LexA-responsive reporter genes, but could do so when fused to an AD.This assay essentially followed the protocol of a yeast two-hybrid assay provided by the manufacturer (BD Biosciences Clontech), except that the prey cloned in pB42AD was not used. Briefly, the gene of interest was first cloned as a TRP1 marker), and the resulting construct was then transformed into the AH109 reporter yeast strain and tested for its ability to turn on the reporter genes, HIS3 and MEL1. HIS3 was under the control of the GAL1 upstream activating sequence and a minimal promoter containing the GAL1 TATA box. The expression of MEL1 was controlled by the intact MEL1 promoter, including the MEL1 upstream activating sequence and MEL1 minimal promoter. The transformants could not grow and turn blue on selection medium containing X-α-gal but lacking tryptophan and histidine unless the Gal4-DBD fusion protein had turned on both reporter genes.Alternatively, the transcriptional activity of the N domain was tested using a Gal4-based system (BD Biosciences Clontech), in which the DNA sequence encoding the N domain was fused in-frame to the sequence encoding Gal4-DBD cloned in pGBKT7 , 150 mM NaCl, 0.5% sodium dodecylsulfate (SDS), 0.5% Triton X-100, 10 mM ethylenediaminetetraacetic acid, and 1 mM phenylmethanesulfonyl fluoride. Aliquots of the protein extracts (~40 μg) were loaded onto a mini gel (8 × 10 cm) containing 10% polyacrylamide and electrophoresed at 100 V for ~2 h. Following electrophoresis, the resolved proteins were transferred to a polyvinylidene difluoride (PVDF) membrane using a semi-dry transfer device. The membrane was probed with a horseradish peroxidase (HRP)-conjugated anti-LexA antibody and then exposed to x-ray film following the addition of appropriate substrates. The protein expression patterns of the Gal4-DBD fusions were determined following a similar protocol.g for 30 s and resuspended in 100 μl of breaking buffer (100 mM Tris-HCl (pH 8.0), 1 mM dithiothreitol, 10% glycerol, and 2 mM phenylmethanesulfonyl fluoride) and 100 μl of beads. Cells were then lysed at 4°C using a bead beater, followed by centrifugation at 12,000 × g for 2 min. Aliquots of the supernatants (25~250 μg) were diluted to 0.8 ml with Z buffer . β-Gal activity assays were initiated (at 37°C) by adding 0.2 ml of o-nitrophenyl β-D-galactoside (4 mg/ml). The reaction mixtures were incubated with constant shaking at 37°C for 20 min and then terminated by the addition of 0.4 ml of 1 M Na2CO3. The reaction mixtures were centrifuged at 12,000 × g for 2 min, and the absorbance (A420) of the supernatants was determined. Relative β-gal activities were calculated from A420 readings normalized to protein concentrations. Data were obtained from three independent experiments and averaged. Error bars indicate (± 2 × standard deviation).Yeast cells were pelleted by centrifugation at 12,000 × lexA mRNAs derived from the fusion constructs, a semiquantitative RT-PCR experiment was carried out following the protocols provided by the manufacturer (Invitrogen). Total RNA was first isolated from the transformants and then treated with DNase to remove contaminating DNA. Aliquots of RNA (~1 μg) were then reverse-transcribed into single-stranded complementary (c)DNA using an oligo-dT primer. After RNase H treatment, the single-stranded cDNA products were amplified by a PCR using a pair of specific primers. The forward and reverse primers respectively contained sequences complementary to nucleotides +1 to +21 (5'-ATGAAAGCGTTAACGGCCAGG-3') and nucleotides +370 to +390 of lexA (5'-CAAGTCACCATCCATAATGCC-3'). As a control, the relative levels of actin-specific mRNAs in each preparation were also determined using a set of primers complementary to nucleotides +537 to +560 (5'-ACCAACTGGGACGATATGGAAAAG-3') and nucleotides +696 to +719 (5'-TTGGATGGAAACGTAGAAGGCTGG-3') of actin, respectively.To determine the relative levels of specific lexA fusion constructs that were expressed under the control of an inducible GAL1 promoter were transformed into INVSc1. Transformants carrying these constructs were first grown in medium lacking histidine with 2% raffinose to a cell density of ~1.0 A600 and then induced with 2% galactose for 1 h. Afterward, cells were washed twice and then grown in medium containing 2% glucose and 100 μg/ml cycloheximide but lacking histidine. Cells were harvested at 0, 0.5, 1, 2, 4, and 8 h postinduction and lysed. Forty-microgram samples of the cellular lysates were resolved on 10% polyacrylamide and electrophoresed at 100 V for ~1 h, and the proteins were transferred to a PVDF membrane and immunoblotted with an HRP-conjugated anti-LexA antibody.To determine the turnover of the fusion proteins, analogous lexA constructs and performed the RT-PCR, Western blotting, and transcriptional assays. GL and CPC performed the degradation and β-galactosidase assays. CCW coordinated the project and wrote the manuscript. All authors read and approved the final manuscript.CHL generated the various

Their in vitro antitumour activity against seven tumoural cell lines of human origin, twobreast cancers , a colon carcinoma (WiDr), an ovarian cancer (IGROV), a melanoma (M 19MEL), a renal cancer (A 498) and a non small cell lung cancer (H 226), is reported. They are characterized bysimilar inhibition doses ID50 as the analogous di- and triorganotin derivatives of 4-carboxybenzo-15-crown-5and -18-crown-6 and in some cases by much lower ID50 values than clinically used reference compounds suchas doxorubicine and methotrexate.A series of di- and triorganotin 3,6-dioxaheptanoates and 3,6,9-trioxadecanoates were synthesized andcharacterized by

Hypoxia plays a key role in ischaemic and neovascular disorders of the retina. Cellular responses to oxygen are mediated by hypoxia-inducible transcription factors (HIFs) that are stabilised in hypoxia and induce the expression of a diverse range of genes. The purpose of this study was to define the cellular specificities of HIF-1alpha and HIF-2alpha in retinal ischaemia, and to determine their correlation with the pattern of retinal hypoxia and the expression profiles of induced molecular mediators.We investigated the tissue distribution of retinal hypoxia during oxygen-induced retinopathy (OIR) in mice using the bio-reductive drug pimonidazole. We measured the levels of HIF-1alpha and HIF-2alpha proteins by Western blotting and determined their cellular distribution by immunohistochemistry during the development of OIR. We measured the temporal expression profiles of two downstream mediators, vascular endothelial growth factor (VEGF) and erythropoietin (Epo) by ELISA. Pimonidazole labelling was evident specifically in the inner retina. Labelling peaked at 2 hours after the onset of hypoxia and gradually declined thereafter. Marked binding to Müller glia was evident during the early hypoxic stages of OIR. Both HIF-1alpha and HIF-2alpha protein levels were significantly increased during retinal hypoxia but were evident in distinct cellular distributions; HIF-1alpha stabilisation was evident in neuronal cells throughout the inner retinal layers whereas HIF-2alpha was restricted to Müller glia and astrocytes. Hypoxia and HIF-alpha stabilisation in the retina were closely followed by upregulated expression of the downstream mediators VEGF and EPO.Both HIF-1alpha and HIF-2alpha are activated in close correlation with retinal hypoxia but have contrasting cell specificities, consistent with differential roles in retinal ischaemia. Our findings suggest that HIF-2alpha activation plays a key role in regulating the response of Müller glia to hypoxia. Ischaemia is common to the major causes of blindness including diabetes and retinopathy of prematurity. Ischaemia induces powerful endogenous responses to protect against tissue injury, including compensatory changes in blood flow, paracrine expression of neurotrophic factors and angiogenesis. In the eye, however, angiogenesis can be disorganised and typically results in oedema and haemorrhage that adversely affect visual function. There is an unmet need for therapies that promote endogenous protective responses and prevent harmful angiogenesis. The development of such strategies depends on a clear understanding of oxygen sensing mechanisms in the retina and the roles of downstream mediators.HIF mRNA also occurs in certain cell types The principal regulator of the transcriptional response to hypoxia is the hypoxia-inducible factor (HIF) family of transcription factors in vitro studies suggests that HIF-1alpha responds only to severe hypoxia whereas HIF-2alpha is stabilised in relatively moderate hypoxia While HIF-1alpha and HIF-2alpha subunits are highly homologous and structurally similar in their DNA binding and dimerisation domains, they have distinct roles both during development BS lectin. Previous studies in animal models have demonstrated that oxygen tensions can fall below 5 mmHg in the ischemic retina 2 of less than 10 mmHg To investigate the effect of hypoxia on the HIF pathway in the retina we used a well-characterised mouse model of oxygen-induced retinopathy (OIR) In animals at p12 still in 75% oxygen, the absence of pimonidazole labelling indicated no areas of retinal hypoxia . In animThe extent of hypoxia detection in the retina following OIR is consistent with results of other studies of murine and rat OIR To examine the distribution of hypoxia across the retinal layers we stained retinal sections from animals 2 hours following return to room air with pimonidazole. Staining was localised primarily to the inner retina, extending from the inner retinal surface to the outer border of the outer plexiform layer . These fTo compare the tissue distribution of HIF-1alpha and HIF-2alpha with that of hypoxia we performed immunohistochemistry on retinal sections in mice 2 hours following return to room air. At this timepoint, immunostaining for both HIF-1alpha and HIF-To investigate the detailed cellular specificities and timecourses of HIF-1alpha and HIF-2alpha in retinal ischaemia we examined sections of central retina from mice at intervals following return from hyperoxia to room air. In animals at p12 still in 75% oxygen, immunostaining for both HIF-1alpha and HIF-2alpha was detected at low levels in the inner retina comparabStabilisation of both HIF-1alpha and HIF-2alpha was restricted to the inner retina. Evidence of HIF-1alpha and HIF-2alpha in the outer retina was weak throughout OIR, consistent with the provision of oxygen to photoreceptor cells by the uncompromised choroidal circulation. This pattern of HIF regulation is in contrast to the effect of systemic hypoxia in which upregulation of HIF-1alpha extends across the outer retina Strikingly, HIF-1alpha and HIF-2alpha were evident in contrasting cellular distributions within the inner retina. HIF-1alpha staining was prominent in cells across the inner nuclear layer and in retinal ganglion cells. In contrast, HIF-2alpha was highly restricted to a discrete layer of cells within the inner nuclear layer, and to occasional astrocytes in the nerve fibre layer. Immunostaining of an adjacent section for the Müller cell marker glutamine synthetase at p17 demonstrated a very similar distribution of cells , stronglHIF-1alpha and HIF-2alpha in OIR we performed real-time RT-PCR on retinal cDNA from animals at p13. Total retinal HIF-1alpha was significantly greater than HIF-2alpha in both normoxia and OIR . This most likely reflects the rapid response of the HIF system to the brief period of relative hypoxia in room air prior to tissue processing. HIF-alpha is stabilised within 1–2 hours of hypoxia The lack of a detectable effect of OIR on RNA levels of either HIF-alpha isoform demonstrates that the upregulation and differential distribution of HIF-1alpha and HIF-2alpha transcription factors in retinal ischaemia result primarily from cell type and protein specific post-translational stabilisation, and not from differentially upregulated expression. This is consistent with the mechanisms described in acute hypoxia in the retina To investigate the consequences of HIF-1alpha and HIF-2alpha activation in the retina we investigated the expression time-courses of their downstream mediators VEGF and Epo. The levels of both VEGF and Epo proteins in the whole eye were rapidly and significantly upregulated from p12 to p17. The profiles of protein upregulation were closely correlated to the timing of both HIF-1alpha and HIF-2alpha stabilisation in the retina and suggHIF-2alpha is expressed at a higher level than HIF-1alpha in the retina, and during retinal ischaemia is specifically activated in restricted populations of cells within the area of inner retinal hypoxia, consistent with Müller glia in the inner nuclear layer and astrocytes in the nerve fibre layer. Interestingly, the expression of both VEGF mRNA and Epo during ischaemia in OIR have a strikingly similar non-uniform distribution, with expression highly localized to cells in the centre of the inner nuclear layer and in the nerve fibre layer HIF-1alpha is ubiquitously expressed. We found that HIF-1alpha is stabilised throughout the hypoxic inner retina, in ganglion cells and those of the inner nuclear layer, consistent with the distribution of HIF-1alpha described in previous reports HIF-2alpha mediates powerful angiogenic and neuroprotective responses to hypoxia. Haploinsufficiency of HIF-2alpha results in blunted induction of both VEGF and Epo, and reduced retinal neovascularisation in OIR This study demonstrates that both HIF-1alpha and HIF-2alpha are activated in close correlation with retinal hypoxia but have contrasting cell specificities within the inner retina. The findings suggest that HIF-1alpha and HIF-2alpha have differential roles in retinal ischaemia, and specifically that HIF-2alpha activation plays a key role in regulating the response of Müller glia to hypoxia.All animals were used with University College London ethics committee approval and under a UK Home Office project licence and personal licence. All procedures were performed in accordance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research.2. Mice were checked twice daily, the mothers were removed from the chamber to breathe room air (21% oxygen) for a minimum of 2 hours a day to minimise lung toxicity associated with hyperoxia in adults. Food, water and bedding were changed every 2 days. The mice were exposed to a standard 12 hour light-dark cycle, and all euthanasia was performed in the light.Nursing mothers and their pups were placed in a 75% oxygen supply chamber from postnatal day 7 to postnatal day 12 as previously described Bandeiraea simplicifolia (BS) lectin was performed at a concentration of 0.1 mg/ml in PBS overnight at 4°C. Retinas were washed extensively in PBS and dissected from the eyecup, radial cuts were made to flatten the retina, and the retinas were mounted with fluorescent aqueous mounting medium ganglion cell layer uppermost using a coverslip.60 mg/kg bodyweight pimonidazole hydrochloride , Livingston UK) diluted in sterile phosphate buffered saline was administered by intraperitoneal injection 3 hours prior to euthanasia as previously described Following terminal anaesthesia eyes were fixed by intracardiac perfusion with ice-cold neutral buffered 10% (v/v) formalin. Post fixation was performed for 24 hours using formalin at 4°C, followed by 100% ethanol for 24 hours at 4°C. Eyes (n = 3 eyes for each time-point), were processed in an automated machine (Leica TP1020) then embedded in paraffin blocks for sectioning. Sections were cut on a microtome at 6 microns, and mounted on polylysine coated slides . Antigen retrieval was performed using a commercial target retrieval solution at 120°C. Immunohistochemistry was performed using a commercial signal amplification kit according to the manufacturer's instructions, with diamino benzidine (DAB) as the final substrate. Primary antibodies and dilutions used are shown in Antibody staining for the Müller glial cell marker Glutamine Synthetase (GS) was performed at a concentration of 1∶100 after antigen retrieval as detailed above . Blocking and primary antibody incubation was performed in 4% (v/v) NGS 1% (w/v) BSA PBS tween 0.05% for 1 hour at room temperature. The primary antibody was biotinylated and DAB was used as the final substrate after streptavadin-horseradish peroxidase incubation according to the manufacturer's recommendations.mHIF-1alpha, mHIF-2alpha and mβ-actin are shown in RNA was extracted from mouse tissue (n = 3 eyes for each group) using a commercial kit . Tissue for RNA extraction was placed directly in lysis solution for immediate RNA purification, or placed in RNA stabilisation solution and stored at 4°C for up to 2 weeks until RNA purification. Purified RNA was stored in DEPC treated water (Invitrogen Ltd. Paisley UK) at −80°C until use. The amount of template RNA was measured using a commercial small-volume spectrophotometer . Up to 1 µg of RNA was used as a template. For each experiment, equal amounts of RNA were used for all samples as a template for cDNA manufacture. cDNA was made from template RNA using a commercial kit . cDNA was stored at −20°C until use. Real-time quantitative RT-PCR was performed using a commercial thermal-cycler (Applied Biosciences 7900HT) with its associated software (Applied Biosciences SDS version 2.2.2). Real-time PCR reagents were all obtained commercially . The 5′ nuclease technique based on Taq-polymerase and FAM labelled hydrolysis probes was used for all real-time reactions using commercially designed primer/probe combinations . Sequences and accession numbers used for primers and probes detecting Retinal tissue (pooled from 4 eyes for each time-point) was lysed using a commercial buffer with added protease inhibitor cocktail . Cell membranes were disrupted using a sonicator with a micro-tip . Lysates were archived at −80°C. Equal amounts of protein were run on a 7.5% (w/v) reducing SDS polyacrylamide electrophoresis gel. After transfer to PVDF membrane (Millipore Watford UK) and blocking in 5% (w/v) non fat milk, 1% (w/v) bovine serum albumin in PBST, membranes were incubated with primary antibodies as detailed in Whole eyes were collected from mice and snap frozen in liquid nitrogen. Eyes were homogenised in sterile PBS with protease inhibitors using a glass homogeniser. The homogenate was spun at 7000rpm for 10 minutes. Protein concentration of the supernatant was measured using a Lowry-based colorimetric protein assay performed in triplicate compared to a bovine serum albumin standard curve. Sample endpoint ELISA was measured in triplicate using a microplate reader comparing the optical density at 450 nm with a reference at 650 nm. The combined quantity of murine VEGF-A 164 and 120 splice variants or murine erythropoietin was calculated per milligram of whole eye protein comparing each sample to a standard curve of known concentration.

Objective. Obesity is a significant contributor to oxygen demand and dynamic airway obstruction. The objective of the current study is to determine the long-term success of conservative measures directed toward weight reduction on airway management without respect to specific airway disease etiology. Methods. Patients with chronic airway obstruction secondary anatomic lesions or obstructive sleep apnea were recruited and followed prospectively. Demographics, initial and final weights, diagnosis, and followup information were recorded. Patients were referred to a registered dietician, provided counseling, and started on a weight-loss regimen. Outcome measures were change in body mass index (BMI) and rate of decannulation from weight loss alone. Results. Of fourteen patients, ten remained tracheostomy-dependent and four had high-grade lesions with the potential for improvement in oxygen demand and dynamic airway collapse with weight loss. The mean follow up period was 25 months. The mean change in BMI was an increase of 1.4 kg/m2per patient. Conclusions. Conservative measures alone were not effective in achieving weight reduction in the population studied. This may be due to comorbid disease and poor compliance. The promise of decannulation was an insufficient independent motivator for weight loss in this study. Although the theoretical benefits of weight loss support its continued recommendation, the long-term success rate of conservative measures is low. More aggressive facilitated interventions including pharmacotherapy or bariatric surgery should be considered early in the course of treating airway disease complicated by obesity. The benefits for weight loss in the obese patient are numerous. In today's society, laymen are aware of the health benefits to weight reduction that essentially affect every system of the body. Many of the benefits such as lower blood pressure, better lipid profiles, and glucose control have a profound impact on long-term health, but the patients may not feel the benefit in the short-term and thus revert to their previous lifestyle after having no apparent immediate benefit from weight loss. Studies have shown that weight loss has beneficial effects on clinical status in obese patients with airway disorders that is obvious to the patient such as decreased dyspnea and increased exercise tolerance , 2. The An association between obesity and chronic respiratory disease is becoming more apparent as the incidence of obesity is increasing. Most respiratory and airway disorders have been shown to be affected in some way by obesity , 4. For O2) at rest [O2 [It has been established that obesity increases oxygen demand during exercise. Recent studies have further shown that obesity also increases oxygen consumption , and underwent capping trials for 14 days before tracheostomy tube removal.Institutional review board approval was obtained. Patients with a body mass index (BMI) greater than 30 with anatomic airway obstruction who were currently tracheostomy-dependent or requiring tracheostomy pending weight loss were selected for study. Obese patients with airway disease received regular followup for weight measurement as well as dietary and diabetic education referrals for weight management counseling. Dietary recommendations reflected the American Diabetic Association guidelines which consisted of 1500 kcal for women and 1800 kcal for men including low-fat principles and portion control. Patients were given an exercise regimen that included a minimum of 10 minutes of moderate activity daily. Patients with etiologies of airway obstruction attributable to vocal cord paralysis and subglottic stenosis received surgical intervention for their airway obstruction consisting of unilateral cordotomy or lysis of stenosis. Patients were followed at regular intervals and weights documented. Data recorded for each patient included age, sex, BMI at the time of tracheostomy, reason for tracheostomy, and changes in BMI. Initial and final study BMI means were compared for statistical analysis using a paired 2 and the final 44.4 kg/m2 for an overall gain of 1.4 kg/m2. This was not statistically significant at P = .32. The data for men and women was similar at 43.6/43.3 and 42.7/44.7 initial/final BMI, respectively. We defined significant weight loss as a decrease in weight of 5% over thirty days. During the study, only two patients experienced significant weight loss secondary to gastrointestinal illnesses unrelated to the weight loss measures and were subsequently successfully decannulated. Two patients in the study are near decannulation due to improving clinical status after weight loss.A total of 15 patients, 5 male and 10 female, were recruited for study, of which 13 had sufficient data available for study. Demographic data, airway disease, and outcomes are summarized in Obesity contributes to respiratory pathology in several ways in the overweight patient. Anatomically, increased soft tissue mass contributes to upper airway obstruction as in the patient suffering from sleep apnea or by complicating the course of a patient with a pre-existing airway stenosis , 8. DecrOnce thought to be a relatively inert tissue, adipose tissue is now the subject of much study into its role as a metabolically active tissue. It is now known that adipose tissue has multiple systemic deleterious effects and complicates chronic diseases such as diabetes mellitus, hypertension, and dyslipidemia, and it most recently has been suggested to exacerbate respiratory diseases through the production of inflammatory mediators , 4. ObesFor many patients who are both obese and suffer from airway obstruction, excess adipose tissue may be creating a metabolic profile that aggravates their respiratory disease. Obese patients have a higher peripheral oxygen uptake than their lean counterparts that cannot all be attributed to the increase in work of breathing . This inExtra adipose tissue can also cause difficulties for patients in that the extratissue creates increased work that the musculoskeletal system must then overcome. The added demand on muscles that are already relatively oxygen-deprived likely contributes to the dyspnea felt by obese patients during exertion. Maniscalco et al. quantified increased performance and decreased dyspnea in overweight patients who lost weight following bariatric surgery . The comThe management of anatomic airway obstruction and obesity is complex. The surgical treatment of bilateral vocal cord paralysis, for example, is an ongoing compromise of respiration, voice, and deglutition. Once the optimum glottic airway with respect to these functions has been achieved, other than permanent tracheostomy, significant weight loss is the only remaining option for many patients. Despite the availability of definitive airway interventions, it is likely that many obese patients would exhibit symptomatic dyspnea even with an anatomically normal airway. Unfortunately for many patients with upper airway obstruction, long-term weight loss is not achieved despite the promise of improved respiratory function which has a significant impact on quality of life and other comorbid diseases.The current study is not intended as a clinical trial of different treatments for airway disorders but simply to provide “real-world” outcome information on conservative measures for weight loss in a small, airway-diseased population. A common situation that occurs is weighing between difficult surgical options that carry significant risk of failure; risk that could be offset by significant weight reduction. However, despite the obvious motivating factor of ending dependence on an indwelling tracheostomy, significant weight loss was not achieved by the group as a whole using conservative measures without pharmacotherapy. In the majority of cases, this was due to noncompliance with the dietary and exercise recommendations. In a large population-based study, significant long-term weight loss was achieved in only 28% of patients receiving intense multidisciplinary intervention for their obesity . DespitePatients with etiologies of airway obstruction attributable to vocal cord paralysis and subglottic stenosis received appropriate surgical intervention for their airway obstruction, but still did not achieve decannulation. This failure was attributed to continued obesity.The challenges for clinicians and patients who struggle with obesity are many: the disease touches nearly every aspect of the patient's life and is certainly one of the most difficult conditions to treat. Social and economic limitations likely conspire to complicate weight loss, and even when patients have all available resources and support at hand, long-term results are still difficult to achieve. At the end, it may prove difficult for medicine to address a disease whose etiology is more cultural than physiological. Therefore, sustained interventions at multiple levels are likely required if weight loss is to be an important part of airway management.

Pretreatment of rats with isoprenaline sulphate (IPR) stimulated DNA synthesis in both salivary and mammary gland tissues. Salivary gland tumours induced by N-methyl-N-nitrosourea (MNU) were observed for the first time in rats, but occurred only in IPR-pretreated animals given MNU during the period of IPR-stimulated DNA synthesis. The cumulative index of MNU-induced mammary tumours and the number of tumours per tumour-bearing rat were increased by IPR-pretreament only if the animals received MNU during the period of IPR-stimulated DNA synthesis.

DNA methylation patterns have been shown to significantly correlate with different tissue types and disease states. High-throughput methylation arrays enable large-scale DNA methylation analysis to identify informative DNA methylation biomarkers. The identification of disease-specific methylation signatures is of fundamental and practical interest for risk assessment, diagnosis, and prognosis of diseases.Using published high-throughput DNA methylation data, a two-stage feature selection method was developed to select a small optimal subset of DNA methylation features to precisely classify two sample groups. With this approach, a small number of CpG sites were highly sensitive and specific in distinguishing lung cancer tissue samples from normal lung tissue samples.This study shows that it is feasible to identify DNA methylation biomarkers from high-throughput DNA methylation profiles and that a small number of signature CpG sites can suffice to classify two groups of samples. The computational method we developed in the study is efficient to identify signature CpG sites from disease samples with complex methylation patterns. For R.2. Remove the feature with maximum cross-validation error and include it to the top of F, until R contains all ranked features.3. Repeat 1 and 2 for remaining features in SVM_RFE is an application of RFE using SVM as the classifier in the feature selection process . In thisWe selected SVM as the classification method to evaluate signature features selected from different feature selection approaches. Note that both SVM_RFE and FW_SVM also took SVM as classifiers in their feature selection process.xi, yi}, i = 1, 2, ..., n, where xi ∈ Rd is a sample point with d features, and yi ∈ {-1, +1} indicates the class of a sample. The class label of a new sample is obtained by a decision function:SVM is a supervised machine learning technique to solve classification problems . It mapsαi and b are optimized in the training procedure such that the number of misclassifications on the training set is minimized. K is a kernel function.where parameters was used in the implementation of LS_SVM [γ = 10 and σ2 = 0.2) was adopted.The LS_SVMlab toolbox f LS_SVM , and theEach of the three DNA methylation datasets generated by Illumina high-throughput DNA methylation arrays ,5 was spIn order to minimize bias introduced by data partitioning and to accurately assess performance of the feature selection methods, each dataset was randomly partitioned into training and testing sets multiple times. For individual feature ranking and FW_SVM, the sensitivity, specificity, accuracy, number of signature features, and running time reported for each dataset represent the average across 100 independent runs. SVM_RFE was very time-consuming with each run requiring several days to complete. Therefore, its reported performance results are from only 5 random partitions of training and testing datasets.Sensitivity, specificity and accuracy were used to assess the performance of classification:TP, FP, TN and FN represent true positives, false positives, true negatives and false negatives, respectively.where Pathway Studio™ with datAll computational methods (except Pathway Studio) in this study were implemented in MATLAB and run on a PC with a 3.8 GHz CPU and 3.0 GB RAM.Figure In contrast, the lung cancer and normal tissue data Figure show difSVM_RFE is a backward feature selection method and was designed to find an optimal combination of features by eliminating less-important features successively. However, due to its lengthy run times Table , the comIn FW_SVM, a two-stage feature selection method was developed. The irrelevant and noisy information was eliminated by a filter at the first stage, and then SVM_RFE was used to detect the final optimal feature subset from the remaining informative features at the second stage. The first applied filter is PCA. Analysis of the normal and lung cancer tissue dataset using PCA Figure found thWithout other available DNA methylation datasets, FW_SVM was tested on a benchmark microarray gene expression dataset . The proThe DNA methylation profiles in this study displayed excellent biomarker characteristics. Accurate discrimination between two sample groups was achieved on the basis of only a few CpG sites. In order to compare our results with signature CpG sites obtained by Bibikova et al. , we applTo further verify the reliability of these two signature CpG sites, we mixed the samples from these two datasets together and randomly split them 100 times into a training set (containing 2/3 of the samples) and a testing set (containing 1/3 of the samples). Raw SVMs were trained on the profiles of these two CpG sites in the training sets, and trained SVMs were used to predict the phenotype of samples in the testing sets. The average sensitivity achieved was 96%, and the average specificity was 100%.We also investigated the biological pathway in which the genes containing those two signature CpG sites are involved. Given that many factors influence gene expression, DNA methylation changes do not necessarily translate to changes of gene expression ,37. HoweIn this study, we identified the smallest subset of CpG sites required for precise classification of lung cancer and normal tissue samples, with every signature CpG site containing necessary, non-redundant and mutual information in the context of others. All the signature CpG sites identified are important biologically, but it is not necessary to include all important CpG sites for classification purposes.While these two signature CpG sites (TNF-1371 and TWIST1-524) are promising leads for potential diagnostic purposes, they were detected from a relatively small dataset of 46 samples. Accordingly, the reliability of the TNF and TWIST CpG sites as biomarkers for lung cancer requires further validation in larger datasets and through targeted biological experiments.Figure This study shows that it is feasible to identify DNA methylation biomarkers from high-throughput DNA methylation profiles and that a small number of signature CpG sites can suffice to classify two groups of samples. Signature CpG sites can easily be detected from datasets with clear methylation patterns, such as male and female datasets, using traditional feature selection methods like individual feature ranking. However, the traditional feature selection methods were not efficient to identify signature CpG sites from disease samples with complex DNA methylation patterns, such as the lung cancer tissue examined in this study. We investigated two filter methods for SVM_RFE in the study and built up FW_SVM, a predictor with an efficient feature selection method. FW_SVM was able to detect a small, optimal subset of CpG sites with non-redundant and complementary discriminative information and achieved high predictive accuracy to classify disease samples with complex DNA methylation patterns. Since each CpG site represents a feature, and the methylation level of each CpG site simply corresponds to the value of the feature, the FW_SVM algorithm, in principle, could be extended to analyze other post-genomic datasets, such as high-throughput gene expression, microRNA expression, single nucleotide polymorphisms, and proteomic data, individually or even across platforms, to identify combinatorial signature features. Therefore, FW_SVM represents a highly flexible tool that can be adopted in classification situations in which appropriate high-throughput data are available to potentially aid in diagnosis and gain fundamental insight into disease processes.Project name: FW_SVMProject home page: None. Matlab scripts for FW_SVM were submitted to BMC Bioinformatics as additional file Operating system: platform independentProgramming language: MatlabOther requirements: Work together with LS-SVMlab toolbox that can be downloaded from: License: NoneAny restrictions to use by non-academics: NoneHM developed and implemented the algorithm under the supervision of GL and ELM. The initial manuscript draft was written by HM, and refined by GL and ELM.Matlab scripts for FW_SVM. FW_SVM is a biomarker discovery algorithm and it can identify a small optimal subset of CpG sites from high-throughput DNA methylation profiles to distinguish two sample groups. FW_SVM combined Filter method and Wrapper method as a novel two-stage feature selection method and employed SVM as the classifier.Click here for file

High levels of arsenic and mercury in the spilled slurry could pose serious environmental and human health risks, according to the first peer-reviewed assessment of the chemical contamination from this spill, published 1 August 2009 in Environmental Science & Technology.When the holding pond at the Tennessee Valley Authority’s (TVA) Kingston coal-burning power plant broke on the morning of 22 December 2008, it released more than 5.4 million ydScientists have studied the chemical composition of coal ash for decades. They have a general understanding of how coal ash constituents travel through the environment but lack data on how spills translate into long-term human and ecologic health hazards. So environmental scientists Avner Vengosh and Laura Ruhl of the Nicholas School of the Environment at Duke University visited Tennessee in the months after the spill to collect samples of coal ash slurry, sediments, and water from various sites along the Emory and Clinch Rivers, which flow into the Tennessee River, the primary source of drinking water for some 410,000 Tennesseans.Data reported by the Tennessee Department of Environment and Conservation showed the ash contained elevated levels of arsenic and mercury. With time, wrote Vengosh and colleagues, as the mass of slurry begins to dry, these toxic elements might become airborne and pose a health threat to local communities. However, investigating whether this is indeed happening would require long-term air monitoring, says Vengosh.Trace elements including arsenic, selenium, lithium, and boron were measured at elevated levels in a tributary of the Emory that was dammed by the spill and turned into a standing pond. The concentration of dissolved arsenic in this pond was as high as 86 μg/L, whereas unaffected upstream waters contained 0.1–0.4 μg/L. Concentrations of these elements were significantly lower at the downstream Emory and Clinch River sites but were above background concentrations, suggesting that leaching of these toxicants was balanced by massive river dilution.Although dilution improved the water quality, it could not control the deposition of ash in the river sediments. The mercury levels in sediments a couple miles downstream of the spill were almost as high as those in the coal ash itself, around 92–130 μg/kg. Anaerobic bacteria living in these sediments could convert this mercury to its more bioaccumulative and toxic form, methylmercury.Frank Huggins, an environmental chemist at the University of Kentucky, isn’t convinced we yet know the real risk to humans and wildlife. The authors use the word “potential,” he notes. “Sure there is always a lot of potential, but . . . the actual risk is a much more difficult topic to address.” Huggins is just beginning to analyze some samples from the spill site for the TVA. He says complementary and longer-term analyses of the elements, their speciation, and how they behave over time and under different physical conditions in sediments and water will reveal the true hazards.Ecotoxicologist William Hopkins of Virginia Polytechnic Institute and State University says future studies will need to investigate which of the trace elements measured by Vengosh and colleagues are bioavailable to biota in the area as well as the severity of any effects resulting from exposure. Some such investigations have already begun. The TVA recently hired Hopkins as a consultant to begin looking at issues of bioaccumulation and toxicity. Similarly, ecophysiologist Shea Tuberty of Appalachian State University is studying how the spill has affected levels of selenium and other elements in fish tissue, and how that in turn affects fish populations. His preliminary work has established baseline selenium levels in local fish populations that are already close to levels that cause reproductive failure in most aquatic species—possibly the result of decades of selenium leaching from the holding ponds, he says.Vengosh and colleagues agree that much more research is needed to evaluate the long-term environmental and human health effects of the spill. With the support of a new project funded by the National Science Foundation, the Duke team will continue to investigate these effects.

Most people being treated for alcoholism are unable to successfully quit drinking within their treatment programs. In few cases do we know the full picture of how abstinence is achieved in Taiwan. We tracked processes of abstinence in alcohol-dependency disorders, based on study evidence and results. This research explores the process of recovery from the viewpoint of the alcohol-dependent.Semi-structured interviews were conducted in two different settings, using purpose sampling, during 2003-2004. The data were analyzed using content analysis. Participants were 32 adults, purposefully selected from an Alcoholics Anonymous group and a psychiatric hospital in North Taiwan.We found that the abstinence process is an ongoing process, in which the alcohol-dependent free themselves of addiction progressively. This process never ends or resolves in complete recovery. We have identified three stages in the struggle against alcoholism: the Indulgence, Ambivalence and Attempt (IAA) cycle, in which the sufferer is trapped in a cycle of attempting to give up and failing; the Turning Point, in which a Personal Nadir is reached, and the Ongoing Process of abstinence, in which a constant effort is made to remain sober through willpower and with the help of support groups. We also discuss Influencing Factors that can derail abstinence attempts, pushing the sufferer back into the IAA cycle.This study provides important points of reference for alcohol and drug service workers and community healthcare professionals in Taiwan, casting light on the abstinence process and providing a basis for intervention or rehabilitation services. In clarifying how alcohol individuals reach the Ongoing Process, it is based on only 9 AA interviewees. Our future research could study individuals in the community (non-AA), casting light on their pathway to successful abstinence, and whether successful individuals have different abstinence characteristics. The three Influencing Factors play the key roles in the alcohol-dependent persons' progress in processes of change; as mentioned above, they facilitate or obstruct. We believe further research is needed into the questions of what strategies to overcome the Influencing Factors in cases of lastingly successful quitting, and how these Influencing Factors result in reliance on alcohol again in the case of persons who fail. We hope coping methods for designing lapse management strategies at the local level, or harm reduction perspectives, can be included in research into inpatients undergoing treatment. Finally, as individual subjects stated, the Personal Nadir is not the same for everybody. Future research could focus on predicting the timing of the Personal Nadir, and help addicts find ways out of it, since this is the ideal opportunity to intervene with abstinence measures.In summary, this research into the complete picture of the process of abstinence from alcoholism finds that changes in addictive behaviours do not necessarily follow a precise timetable. Nevertheless, these changes are apparent with their respective characteristics. Alcohol-dependent individuals are often torn between relapse and sobriety. They have to go through a strenuous Turning Point experience to dry out permanently. It is necessary to be aware that once drinking becomes a habit, it is extremely difficult to overcome. Three Influencing Factors are high-risk situations--self-testing for abstinence effects, the struggle against physical and psychological dependence and external temptation--have to be stressed. The three Influencing Factors play a critical role as to whether sufferers can find balance in their lives without the use of alcohol and uphold the Ongoing Process in its three aspects . Support is crucial. This study is, therefore, an important reference source for psychiatric professionals trying to understand alcohol-dependent individuals' process of abstinence and providing rehabilitation services.The authors declare that they have no competing interests.MYY was responsible for the study design, obtained funding, supervised the study, and data collection. SMW performed the data analysis and was responsible for writing the drafts of this paper. MYY, HLC, and SMW were responsible for the revising it critically for important intellectual content. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-244X/9/76/prepub

We have studied the effects of hypoxia on aminolaevulinic acid (ALA)-induced protoporphyrin IX (PpIX) synthesis in EMT6 monolayer cultures characterized by different cell densities and proliferation rates. Specifically, after ALA incubation under hypoxic or normoxic conditions, we detected spectrofluorometrically the PpIX content of the following populations: (a) low-density exponentially growing cells; (b) high-density fed-plateau cells; and (c) high-density unfed-plateau cells. These populations were selected either for the purpose of comparison with other in vitro studies or as representatives of tumour regions adjacent to (high-density fed-plateau cells) and further away from (high-density unfed-plateau cells) capillaries. The amount of PpIX per cell produced by each one of these populations was higher after normoxic ALA incubation. The magnitude of the effect of hypoxia on PpIX synthesis was dependent on cell density and proliferation rate. A 42-fold decrease in PpIX fluorescence was observed for the high-density unfed-plateau cells. PpIX production by the low-density exponential cells was affected the least by ALA incubation under hypoxic conditions (1.4-fold decrease), whereas the effect on the high-density fed-plateau population was intermediate (20-fold decrease). © 1999 Cancer Research Campaign

Helicobacter pylori (H. pylori) frequently occurs after endoscopic examination of H. pylori-infected patients. In the hospital, manual pre-cleaning and soaking in glutaraldehyde is an important process to disinfect endoscopes. However, this might not be sufficient to remove H. pylori completely, and some glutaraldehyde-resistant bacteria might survive and be passed to the next patient undergoing endoscopic examination through unidentified mechanisms. We identified an Imp/OstA protein associated with glutaraldehyde resistance in a clinical strain, NTUH-C1, from our previous study. To better understand and manage the problem of glutaraldehyde resistance, we further investigated its mechanism.Contamination of endoscopy equipment by imp/ostA RNA in 11 clinical isolates from the National Taiwan University Hospital were determined. After glutaraldehyde treatment, RNA expression in the strains with the MICs of 4–10 μg/ml was higher than that in strains with the MICs of 1–3 μg/ml. We examined the full-genome expression of strain NTUH-S1 after glutaraldehyde treatment using a microarray and found that 40 genes were upregulated and 31 genes were downregulated. Among the upregulated genes, imp/ostA and msbA, two putative lipopolysaccharide biogenesis genes, were selected for further characterization. The sensitivity to glutaraldehyde or hydrophobic drugs increased in both of imp/ostA and msbA single mutants. The imp/ostA and msbA double mutant was also hypersensitive to these chemicals. The lipopolysaccharide contents decreased in individual imp/ostA and msbA mutants and dramatically reduced in the imp/ostA and msbA double mutant. Outer membrane permeability assay demonstrated that the imp/ostA and msbA double mutation resulted in the increase of outer membrane permeability. Ethidium bromide accumulation assay demonstrated that MsbA was involved in efflux of hydrophobic drugs.The minimal inhibitory concentrations (MICs) of glutaraldehyde andexpression of imp/ostA and msbA were correlated with glutaraldehyde resistance in clinical isolates after glutaraldehyde treatment. Imp/OstA and MsbA play a synergistic role in hydrophobic drugs resistance and lipopolysaccharide biogenesis in H. pylori.The expression levels of Helicobacter pylori was first isolated from the gastric mucosa of a patient with gastritis and peptic ulceration by Marshall and Warren in 1982 ) was higher than that of the wild-type . The fluorescence intensity of the msbA deletion mutant was also significantly higher than the wild-type (P = 0.00164). These results might due to the increase of outer membrane permeability when imp/ostA or msbA was mutated. Furthermore, the fluorescence intensity of the imp/ostA and msbA double mutant was also significantly higher than that of wild-type (P = 5.83 × 10-5). Therefore, the increased sensitivity to hydrophobic compounds conferred by imp/ostA and msbA mutations can be explained by the enhanced membrane permeability for the toxic substances moving in.To investigate whether the permeability of the outer membrane was altered in the mutant strains, we measured the fluorescence intensity at a 40-min time point after addition of ethidium bromide and CCCP Fig. . The flumsbA deletion mutant was more susceptible to glutaraldehyde or hydrophobic antibiotics due to the loss of an active efflux mechanism. The result showed that the msbA deletion mutant accumulated more amounts of ethidium bromide than wild-type , which participates in iron metabolism and in gastric colonization by H. pylori [fecD). Genes including aimF, bioC, ispB, NADH-flavin oxidoreductase (HP0642), and cytochrome c551 peroxidase (HP1461) were involved in biosynthesis and metabolism. Lastly, flagellar hook-associated protein 1 [fliD) [hopG, hofH, and homA. Lastly, two subunits of the 2-oxoglutarate oxidoreductase, oorB and oorD [After treating NTUH-S1 with glutaraldehyde, 40 genes were found to be upregulated at least 2.5-fold by microarray analysis. For 14 of these genes, DNA or protein sequence alignment yielded no information about their function. The other genes could be divided into three groups: transporters, biosynthesis and metabolism genes, and motility and chemotaxis genes. Two genes were related to iron transport; nonheme iron-containing ferritin and flag) [fliD) ,50 were and oorD , are alsimp/ostA and msbA, might account for the reduction of the MICs for hydrophobic antibiotics.Silver staining revealed that both imp/ostA and msbA participated in the biogenesis of LPS in H. pylori. Similarly mutation of the E. coli LPS biosynthesis gene, lpxA2, resulted in extreme susceptibility to antibiotics, especially hydrophobic antibiotics -44. Therimp/ostA and msbA can be explained by the defect in LPS production and increased outer membrane permeability. In addition, the increased sensitivity to hydrophobic compounds conferred by mutation of msbA might to the result of accumulation of chemicals that are not pumped out by the MsbA efflux pump. The combination of these effects of the imp/ostA and msbA would reduce the MICs of cells toward glutaraldehyde and hydrophobic antibiotics. These findings might help us to understand the mechanism of bacterial tolerance to chemical disinfectant and hydrophobic drugs.In the beginning, we observed that the MICs of two glutaraldehyde-resistant strains were 10 μg/ml glutaraldehyde. In fact, this is the half concentration used in our hospital for disinfection during endoscopy. We proposed that some bacteria could survive at the low concentrations in the glutaraldehyde-treated endoscopic environment. According to the MICs tests, LPS analysis, outer membrane permeability assay, and ethidium bromide accumulation assay, the increased sensitivity to hydrophobic compounds conferred by mutations of imp/ostA and msbA were correlated with glutaraldehyde resistance in clinical isolates after glutaraldehyde treatment. Imp/OstA and MsbA play an important role in hydrophobic drugs resistance and LPS biogenesis in H. pylori.The expression levels of HC, TL, and JW conceived and designed the experiments. HC carried out the experiments, analyzed the data, and drafted the manuscript. JY provided clinical isolate strains. TL and JW modified the manuscript. All the authors have read and approved the final manuscript.microarray data. Genes were upregulated and downregulated after glutaraldehyde treatment by microarray analysisClick here for file

A case of aplastic anemia diagnosed during pregnancy, which developed bilateral disc edema and acute pre-retinal hemorrhage leading to vision loss.A 20 year old primagravid female developed acute vision loss in her right eye, during hospitalization for treatment of aplastic anemia diagnosed during her pregnancy. Her best-corrected visual acuity (BCVA) was hand motions and fundus evaluation revealed a large pre-macular hemorrhage in the right eye (OD) and bilateral disc edema. Neuro-imaging studies did not reveal any signs of intracranial mass lesion or edema.There was resolution of the disc edema with improvement in the pre-macular hemorrhage resulting in 20/50 vision in the right eye, following supportive transfusions. Ophthalmic manifestations developing in a pregnant patient with aplastic anemia can be successfully managed with supportive care including red blood cell and platelet transfusions. Aplastic anemia, a serious hematological disorder characterized by pancytopenia and hypoplastic bone marrow is often exacerbated during pregnancy -3. Hormo9 cells/litre, hemoglobin of 4.9 gm/dl, and platelet count of 5 × 109 cells/litre. Further investigation showed normal liver function tests and prothrombin time and an INR of 13.3s and 0.9 respectively. Bone marrow biopsy confirmed the etiology of the pancytopenia as aplastic anemia and subsequent red blood cell and platelet transfusions stabilized the patient's hematologic status.A 20 year-old primagravid Caucasian female at 20 weeks of gestation presented to the emergency department with complaints of weakness, dizziness, headaches and palpitations. Complete blood count (CBC) analysis revealed white blood cell count (WBC) of 1.9 × 10During her initial hospitalization, she reported decreased vision in her right eye which she described as a red spot when looking at the light. On ophthalmic consultation, her visual acuity was hand motions (HM) in the right eye and 20/20 in the left eye, with normal intraocular (IOP) in both eyes. Anterior segment examination was unremarkable and pupillary reactions were normal. Dilated fundoscopic examination done at that time had revealed bilateral optic disc swelling and a layered pre-retinal hemorrhage involving the macula of her right eye Figure . HumphreThe visual acuity in the right eye and the disc edema gradually improved. During this course, the patient's hematologic status and fetus were closely monitored, with administration of supportive transfusions as needed. The patient went on to deliver a 1664 gram infant at 32 weeks gestation. On post-partum day 2, her visual acuity was 20/50 and 20/20 in the right and left eyes, respectively. Dilated fundoscopic examination revealed resolving pre-retinal hemorrhage, clearing from the visual axis, with resolution of the disc edema bilaterally Figure .The first reported case of aplastic anemia was in a pregnant individual in 1888 . Other c9/L, which is the case for many of the patients affected by aplastic anemia. 2% of patients with retinal hemorrhages exhibited pre-retinal lesions and 1 of 65 patients with ocular findings exhibited bilateral disc edema [Vision loss in our case is secondary to pre-retinal hemorrhage overlying the fovea in the right eye. Visual impairment secondary to pre-retinal hemorrhages can be a presenting symptom in previously undiagnosed cases of aplastic anemia . The presc edema .Optic disc edema has been reported to occur in 6% of cases of aplastic anemia, with the etiology most likely being related to elevated intracranial pressure ,9. A recIn summary, this report illustrates a case of visual loss associated with pregnancy related aplastic anemia which was successfully managed with supportive care including red blood cell and platelet transfusions.CBC: Complete blood count; BCVA: Best-corrected visual acuity; WBC: White blood cell count; IOP: Intraocular pressure; CT: Computed Tomography; MRI: Magnetic Resonance Imaging.Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The authors declare that they have no competing interests.KVC and SG identified the case and directly participated in management. They also revised the manuscript and verified its intellectual content. VSB and RK worked in collaboration to collect data, acquire clinical photographs, and draft, revise, and reference the manuscript.

Plasmodium falciparum variant erythrocyte surface antigens known as PfEMP1, encoded by the var gene family, are thought to play a crucial role in malaria pathogenesis because they mediate adhesion to host cells and immuno-modulation. Var genes have been divided into three major groups and two intermediate groups (B/A and B/C) on the basis of their genomic location and upstream sequence. We analysed expressed sequence tags of the var gene DBLα domain to investigate var gene transcription in relation to disease severity in Malian children. We found that P. falciparum isolates from children with cerebral malaria (unrousable coma) predominantly transcribe var genes with DBLα1-like domains that are characteristic of Group A or B/A var genes. In contrast, isolates from children with equally high parasite burdens but no symptoms or signs of severe malaria (hyperparasitaemia patients) predominantly transcribe var genes with DBLα0-like domains that are characteristic of the B and C-related var gene groups. These results suggest that var genes with DBLα1-like domains (Group A or B/A) may be implicated in the pathogenesis of cerebral malaria, while var genes with DBLα0-like domains promote less virulent malaria infections.The Our data show that P. falciparum isolates from cerebral malaria patients are significantly more likely to transcribe var genes with DBLα1-like domains characteristic of Group A and B/A var genes than isolates from patients with non-severe hyperparasitaemia, which predominantly transcribe var genes with DBLα0-like domains.We aimed to investigate the hypothesis that parasite virulence and clinical disease severity in African children are associated with the transcription of distinct subsets of 22.1var mRNA is present var transcription occurs The samples were collected as part of the Bandiagara Malaria Project case-control study of severe malaria that has been described in detail previously 2.2DNA was extracted from blood spots on filter paper using chelex-100 extraction 2.3RNA was treated for 30 min at room temperature with 1.5 units DNAase (Gibco) to remove any contaminating genomic (g) DNA. cDNA was prepared using Superscript First Strand Synthesis System (Invitrogen) with random hexamers according to manufacturers instructions.2.4var DBLα domain using unbiased degenerate primers αAF′ and αBR var gene repertoire of 3D7 apart from the strain-transcending var2CSA gene implicated in malaria in pregnancy var genes that are of unknown function. Amplification conditions were as described Reverse-transcriptase (RT)-PCR was used to amplify a region of 300–400 bp of the 2.5var gene from nine isolates was studied. The remaining upstream sequences were not studied due to lack of parasite material.Upstream PCRs were carried out on gDNA using upstream primers UpsA (5′-TAT TYH ATK TAT TAY ATT TGT TGT A) UpsB (5′-GTT AGA ACA TTT AAA ATT ATA) and UpsC (5′-AVA GAW ATA TGR TAG ATA YAG), based on sequences from 3D7, and a gene-specific DBLα primer for each isolate. Amplification conditions were 35 cycles of 94 °C, 5 s; 46 °C, 15 s; 60 °C, 2 min. The upstream sequence of the predominant 2.6PCR and RT-PCR products were run on agarose gels and extracted then cloned , and used to transform One Shot TOP10F competent cells (Invitrogen). Transformed cells were grown overnight and individual white colonies were selected for culture. Plasmids were extracted from overnight cultures using a miniprep kit (QIAGEN), and were sequenced using BigDye terminator reaction mix (Applied Biosciences).2.7http://bioweb.pasteur.fr/docs/EMBOSS/tranalign.html)Sequences were analysed using Lasergene software (DNASTAR Inc). Contigs were created with a minimum percentage match of 95% to classify sequences for each isolate. Amino acid sequences were aligned using MUSCLE 2.8var genes are subject to recombination. The network allows visualisation of ambiguous and conflicting signals in the dataset due to recombination or other factors A phylogenetic network was generated rather than a traditional phylogenetic tree because 3P. falciparum field isolates were obtained from a vaccine trial site in Mali with intense seasonal transmission of P. falciparum . Hyperparasitaemia is generally considered to be an indication of severe malaria using World Health Organisation criteria Twenty-six There were no significant differences in patient age across the three clinical categories . The cervar gene sequences from each isolate were amplified by reverse transcriptase-PCR using unbiased degenerate primers var gene inserts were sequenced per isolate. Identical sequences from the same isolate were defined as isolate sequence a, b, c etc. in decreasing order of abundance (GenBank accession numbers DQ367086–DQ367226). The number of distinct DBLα var gene sequences detected per isolate varied between 1 and 14, and almost every isolate showed a predominant gene . There was no significant difference in the number of distinct DBLα sequences per isolate detected in each clinical category . Further experiments to validate the reproducibility of these data are shown in the The transcribed DBLα ant gene . Identicvar genes amplified that were DBLα1-like. 80.1% of the var gene sequences amplified from the cerebral malaria isolates were DBLα1-like, compared to only 25.7% of the sequences from the hyperparasitaemia isolates and 40.5% of the sequences from the uncomplicated malaria patients . There was a significant positive correlation between the proportion of DBLα1-like sequences and the rosette frequency .There was a highly significant difference between clinical categories in the percentage of var genes transcribed by the isolates from cerebral malaria patients compared to hyperparasitaemia patients was also demonstrated by mapping clinical categories across a phylogenetic network of DBLα sequence tags . Sequences from the cerebral malaria patients , while sequences from the hyperparasitaemia patients (blue) are significantly concentrated in a “DBLα0-like clade” . Sequences from the uncomplicated malaria patients (green) showed no bias in distribution between the two clades had an UpsB sequence linked to a hybrid DBLα0/α1 domain and was therefore a Group B/A var gene predominantly transcribe var genes with DBLα1-like domains that are characteristic of Group A or B/A var genes, whereas isolates from patients with hyperparasitaemia (a non-virulent form of disease) predominantly transcribe var genes with DBLα0-like domains. These results provide the first firm evidence from P. falciparum clinical isolates to support the hypothesis put forward previously that Group A var genes could be implicated in the pathogenesis of severe malaria in African children The major finding of this study is that var gene transcription in clinical isolates have given conflicting results. A role for var genes with DBLα1-like domains in the multi-organ failure type of severe malaria that occurs in adults in low malaria transmission settings was suggested by a study of 10 Brazilian isolates var genes in clinical disease (severe and uncomplicated) compared to asymptomatic infections var genes in severe compared to uncomplicated and asymptomatic malaria patients var genes, but this was not statistically significant var gene group and disease manifestation, however only six isolates from assorted severe malaria patients were studied, only one of whom had cerebral malaria var gene transcription using isolates from non-severe hyperparasitaemia patients as a control group rather than uncomplicated malaria patients with low parasite burdens. Although it remains possible that there are genuine geographical differences in the relationship between var gene transcription and disease severity, we suggest that the reason why a clear pattern emerged from the current study, even though the sample numbers are not large, is because a strictly defined severe disease syndrome was investigated and a non-severe malaria control group with equivalent parasite burdens (hyperparasitaemia) was used.Previous studies on var gene transcription in parasite isolates from children with uncomplicated malaria and lower parasite burdens that are equivalent to the control groups used in previous studies var gene transcription with four out of nine isolates transcribing mostly DBLα1-like var genes, while five out of nine isolates transcribed mostly DBLα0-like var genes are sequestered in the microvasculature var gene transcription and particular disease syndromes would examine sequestered parasites, however, these are only accessible in post-mortem samples making such studies technically and ethically difficult. Two recent studies from Malawi suggest that the dominant parasite genotypes of sequestered parasites are usually the same as those in the peripheral blood var gene profile of peripheral blood parasites reflects that of sequestered ones, they are consistent with the possibility that the peripheral blood population could adequately reflect the sequestered parasite mass. Any difference in var gene transcription between peripheral and sequestered parasite populations would be likely to confound a clear picture of the relationship between var genes and disease syndromes. The fact that such a clear pattern of var gene transcription in isolates from cerebral malaria patients compared to hyperparasitaemia patients did emerge from this study suggests that such a confounding effect is not a major problem.This study and previous similar investigations var genes compared to the DBLα0-like var genes shown in this study be explained by the known functions of the different var gene groups? The only adhesion phenotype currently ascribed to the DBLα1 domain of some Group A or B/A var genes is binding to complement receptor 1 on uninfected erythrocytes to form rosettes , on the other hand, have been shown to bind to the endothelial receptor CD36 var genes with DBLα0-like domains are predominantly transcribed in non-virulent infections is consistent with this hypothesis. In addition, binding of infected erythrocytes to CD36 on dendritic cells leads to inhibition of dendritic cell maturation and impairment of host immune-responsiveness var genes could contribute to the lower virulence of malaria in the hyperparasitaemia patients if, as has been suggested previously, immuno-pathology contributes to the pathogenesis of severe malaria in vitro multiplication rates than parasites from patients in other disease categories var genes with DBLα1-like domains (characteristic of Group A and some B/A var genes) are predominantly transcribed in P. falciparum isolates from Malian cerebral malaria patients, whereas var genes with DBLα0-like domains are predominantly transcribed in isolates from patients with a non-virulent form of disease (hyperparasitaemia). These findings suggest fundamental differences in the roles played by the different var genes groups in host–parasite interaction that could be related to the contrasting cytoadhesive and immuno-modulatory functions of the var gene groups. Further research is required to examine the disease-associations, functions and diversity of var gene subsets in different geographical areas, and we emphasise the importance of strict clinical definitions and appropriate control groups in future work.In conclusion, we have shown that

The effect of adult thymectomy in DBA/2J mice on the in vitro response to syngeneic tumour cells was investigated. Spleen cells from adult mice which had been thymectomized 8 weeks previously demonstrated a severely impaired primary cytotoxic response to P815 tumour cells, whereas their cytotoxic responses to allogeneic cells (C57BL/6) and to non-H-2 antigens (BALB/c), and their ability to form a primary antibody response to sheep red blood cells was unimpaired. Suppressor T cells, specific for P815 cells, appeared early in the thymuses of animals inoculated with P815 cells (between 4 and 8 days after tumour-cell injection). No differences in tumour growth between animals thymectomized as adults and sham-operated controls were observed, and thymectomized tumour-bearing animals had levels of specific suppressor cells in their lymph nodes equivalent to the levels found in untreated controls. Severely thymocyte-deprived animals which had been thymectomized, irradiated and reconstituted with either marrow or spleen cells 8 weeks before tumour implantation succumbed more rapidly to metastatic tumour than did control animals.

This study describes the endoscopic findings about the size of the adenoid tissue and the conditionof the nasopharyngeal orifice of the eustachian tube. Results confirmed that only fiberscopic examinationallows a thorough inspection of the nasopharyngeal anatomy to make a correct diagnosis anddesign therapeutic planning. When the presence of adenoid hypertrophy resulting in nasal obstruction,snoring, and/or otitis media was confirmed endoscopically, adenoidectomy proved to be highlyefficacious in relieving these symptoms.

The selective multitest Coulter Dacos 3.0 analyser was evaluated according to the guidelines of the Comisión de Instrumentación de la Sociedad Española de Química Clínica and of the European Committee for Clinical Laboratory Standards.The evaluation was performed in four steps: examination of the analytical units; evaluation of routine working; study of interferences; and assessment of practicability.The evaluation included a photometric study. The inaccuracy is acceptable for 340 nm and 420 nm, and the imprecision at absorbances from 0.05 to 2.00 ranged from 0.06 to 0.28% at 340 nm and from 0.06 to 0.08% at 420 nm. The linearity showed some dispersion at low absorbance for PNP at 420 nm and the drift was negligible.The imprecision of the pipette delivery system, the temperature control system and the washing system were satisfactory.In routine work conditions, seven analytical methods were studied: glucose, creatinine, iron, total protein, AST, ALP and calcium. Within-run imprecision ranged, at low concentrations, from 0.9% (CV) for glucose, to 7.6% (CV) for iron; at medium concentrations, from 0.7% (CV) for total protein to 5.2% (CV) to creatinine; and at high concentrations, it ranged from 0.6% (CV) for glucose to 3.9% (CV) for ALP.Between-run imprecision at low concentrations ranged from 1.4% (CV) for glucose to 15.1% (CV) for iron; at medium concentrations it ranged from 1.2% (CV) for protein to 6.7% (CV) for iron; and at high concentrations the range is from l.2for AST to 5.7% (CV) for iron.No contamination was found in the sample carry-over study. Some contamination was found in the reagent carry-over study . Relative inaccuracy is good for all the constituents assayed. Only LDH (high and low levels) and urate (low level) showed weak and negative interference caused by turbidity, and γ-GT (high level) and amylase, bilirubin and ALP (two levels) showed a negative interference caused by haemolysis.

Streptococcus suis can cause severe systemic infection in adults exposed to infected pigs or after consumption of undercooked pig products. S. suis is often misdiagnosed, due to lack of awareness and improper testing. Here we report the first fifty cases diagnosed with S. suis infection in northern Viet Nam.S. suis were set up at a national hospital in Hanoi. That year there were 43 S. suis positive cerebrospinal fluid samples, of which S. suis could be cultured in 32 cases and 11 cases were only positive by PCR. Seven patients were blood culture positive for S. suis but CSF culture and PCR negative; making a total of 50 patients with laboratory confirmed S. suis infection in 2007. The number of S. suis cases peaked during the warmer months.In 2007, diagnostics for S. suis was commonly diagnosed as a cause of bacterial meningitis in adults in northern Viet Nam. In countries where there is intense and widespread exposure of humans to pigs, S. suis can be an important human pathogen. Streptococcus suis infection is a zoonosis which can cause severe systemic infection in humans exposed to infected pig tissue S. suis infection in humans, with around 700 cases reported worldwide, most of them in the last few years S. suis infection in abattoir workers and pig farmers in a developed country to be approximately 3/100.000 per year S. suis infection is unknown as it is not a notifiable disease and under diagnosis is common. However the two largest published case series are from this region and together account for more than 50% of all reported cases S. suis infection is a considerable, unrecognized burden in large parts of Southeast Asia S. suis was the most common cause of bacterial meningitis in adults, S. suis has never been reported in northern Viet Nam S. suis is a common cause of bacterial meningitis in northern Viet Nam we established enhanced diagnostics for S. suis at the National Institute of Infectious and Tropical Disease (NIIITD), a tertiary referral hospital in Hanoi. Here we report the data from 2007.In developing countries with intense pig farming, like those in Southeast Asia, the risk of acquiring This study was conducted at the National Institute of Infectious and Tropical Diseases (NIITD), Hanoi, from January 2007 to December 2007. The NIITD is a 160 bed tertiary care center for adult patients with infectious diseases and also serves as a referral center for central nervous system infections in northern Viet Nam. Admitted patients with suspected meningitis were managed by local physicians, according to local practice that included the taking of cerebrospinal fluid (CSF) by lumbar puncture. Patient data were collected retrospectively using a pre-printed data collection form from their medical records. For sepsis classification we used standard criteria S. suis isolates were tested for penicillin and ceftriaxone susceptibility by E-test on Mueller Hinton agars . Real time polymerase chain reaction (PCR) diagnostics for S. suis serotype 2 with cps2J as gene target were implemented according to a previously described method S. suis strains were genotyped by pulsed field gel electrophoresis (PFGE), after SmaI digestion. Four representative strains from the main clusters in southern Viet Nam were included Specimens were processed using standard microbiological methods. Optochin negative alpha-haemolytic streptococci on blood agars, isolated from blood and CSF were tested with API 20 Strep® for identification at the NIITD laboratory. S. suis cases were geo-coded using the patient's address and overlaid onto a map depicting the estimated number of pigs per square kilometer . Statistical differences in proportions were assessed by Fisher exact test. P values below 0.05 were considered significant. Institutional Review Board approval for this study was obtained.This study was approved by the Oxford Tropical Research Ethics Committee and the Scientific Committee of the National Institute of Infectious and Tropical Diseases. Written informed consent was obtained.Cryptococcus neoformans (1.9%), three for Streptococcus pneumoniae (0.5%), three for Streptococcus species (0.5%), one for Enterobacter cloace (0.2%) and 43 for S. suis (7.7%). Of the 43 S. suis positive CSF samples, S. suis was isolated in 32 and 11 were only positive by PCR. An additional seven patients were blood culture positive for S. suis but CSF culture and PCR negative; making a total of 50 (8.9%) patients with laboratory confirmed S. suis infection . The majority was farmer and a total of 16 patients reported a recent exposure to pigs or pork (32.0%): eight male patients had slaughtered pigs, five patients were exposed to pork products, and three consumed raw pig blood. Thirteen patients (26%) reported excessive alcohol consumption. None of the patients had a history of splenectomy.Between January and December 2007, 562 CSF specimens were submitted to the microbiology laboratory for analysis. Eleven specimens were positive for nfection . The num to July . The 50 Most patients presented with fever and meningism . Complic3, range 0.4–26,500). Microscopic examination of Gram- stained CSF specimens revealed Gram-positive cocci in 28 patients (56.0%). Tested S. suis isolates were susceptible to penicillin and ceftriaxone (data not shown). PFGE analysis demonstrated that the bacterial population structure in northern Viet Nam has important similarities to that seen in the south (Laboratory findings at admission showed leukocytosis in 40 patients (80%) and thrombocytopenia in 29 patients 58%, . The CSFhe south . There whe south . There wS. suis type 2 is the most commonly detected organism in acute adult bacterial meningitis in both north and south Vietnam (unpublished data). Together they represent a case series of 193 patients and illustrate that S. suis meningitis is an endemic zoonosis of adults in Vietnam, which may also be true for other Southeast Asian countries where pig farming is common. This information has important public health consequences since S. suis infection is preventable through applying protective measures during the slaughtering and processing of pigs, and through proper cooking of pig meat and other pig body parts.Data from our study complement those of an earlier report from a tertiary referral hospital in southern Viet Nam and demonstrate that There are estimated to be around 26.8 million pigs in Vietnam, of which 40% live in the Red River and Mekong River Delta (source: FAOSTAT 2006). Many rural households have a small number of pigs, thus putting a high proportion of the Vietnamese population at risk. In our study, there were considerably more patients during the summer months from May to July than during the rest of the year. Whether this pattern observed in 2007 is typical of other years and represents seasonality in risk of infection remains to be determined.S. suisS. suis to humans through exposure to pigs with PRRS virus infection and concomitant S. suis disease. This hypothesis requires further investigation.During the study period there was a Porcine Respiratory and Reproductive System (PRRS) virus outbreak in the pig population in the same region S. suis cases were male and this probably represents gender-associated behavioural or occupational risk factors. The finding of a history of excessive alcohol consumption in 26% of patients may indicate that alcoholism is a risk factor for S. suis infection or disease. Almost 70% of cases did not report recent contact with pigs or pork products and therefore further work is needed to better define the risk factors for acquiring S. suis infection, like consumption of uncooked pig meat or blood.The large majority of S. suis can be cultured easily from cerebral spinal fluid (CSF) or blood with standard microbiological techniques. S. suis grows on blood agar as small, greyish and mucoid colonies with a zone of alpha-haemolysis and is optochin resistant. Determination to the species level is performed with biochemical tests, like optochin, Voges-Proskauer, salicin, trehalose, and 6.5% NaCl. Commercial systems, like API Strep® , can also be used. These tests, including simple biochemical reactions for presumptive identification, are usually not available in developing countries and S. suis may therefore remain often undiagnosed or misdiagnosed. Furthermore, false negative culture results may occur due to antibiotic use prior to obtaining the specimens for culture. Approximately twenty percent of the cases reported here would have been missed without access to PCR, illustrating the important diagnostic potential of this technique. Fortunately, S. suis is generally susceptible to the readily available antibiotics penicillin and ceftriaxone. However, the severity of the sepsis syndrome seen in some patients requires careful clinical management and three patients in our series died despite being managed in an intensive care unit.S. suis meningitis Most of our patients presented with severe disease and typical symptoms of meningitis. The mortality rate in our case series was 6%; higher than the reported 2.6% mortality in south Viet Nam. Hearing loss was the most common sequelae at discharge, affecting one third of the patients. The higher rates of hearing loss (66%) reported elsewhere probably reflect the use of audiometry to detect milder degrees of hearing loss than we were able to detect without access to an audiometer S. suis is an important cause of adult meningitis in both north and south Viet Nam. Hearing loss as an early complaint is an important clue in the history in this setting. Laboratory capacity building to culture and identify S. suis from CSF and blood would aid greatly the ability to diagnose S. suis correctly and give reliable estimates of its burden in the community. This may also apply to other Southeast Asian countries. As far as we know the main reservoir for S. suis is pigs and it is not normally carried by humans. Countries where pig farming is common and S. suis has not yet been identified as a cause of bacterial meningitis should establish diagnostic assays to identify this bacterium. Identifying this disease is essential as it may be readily preventable through actions directed at the rearing and slaughter of pigs and food preparation practices.In conclusion,

Newborn mice have a lower spontaneous resistance to the growth of a syngeneic plasmacytoma (MOPC-460) as compared to adult mice. The transfer of different leucocyte populations from non-immunized adult donors to newborn mice influence in a dual way the resistance to MOPC-460 growth, depending on the number of cells transferred. The transfer of a low number of neutrophils, thymus or spleen cells enhances the MOPC-460 takes. Higher numbers of neutrophils, thymus or bone marrow cells induce an effective protenction. By contrast, macrophages over a dose of 1 X 10(4) constantly produce a reduction of tumour growth.

The increasing focus on functional ability assessments in relation to sickness absence necessitates the measurement of population functional levels. This study assessed the reliability of the Norwegian Function Assessment Scale (NFAS) and presents normative population data.All inhabitants in seven birth cohorts in Ullensaker municipality in 2004 were approached by means of a postal questionnaire. The NFAS was included as part of The Ullensaker Study 2004. The instrument comprises 39 items derived from the activities/participation component in the International Classification for Functioning, Disabilities and Health (ICF). Based on the results of principal component analysis, these items comprise seven domains. Non-parametric tests for independent samples were used to compare subgroups. Internal consistency was assessed by Cronbach's alpha. Two-week test-retest reliability was assessed by total proportions of agreement, weighted kappa, and intraclass correlation coefficient (ICC).The response rate was 54% (1620 persons) and 75.4% (101 persons) for the retest. Items had low levels of missing data. Test-retest reliability was acceptable with high proportions of absolute agreement; kappa and ICC values ranged from 0.38 to 0.83 and 0.79 to 0.83, respectively. No difficulty on all 39 functional activities was reported by 33.1% of respondents. Females, older persons and persons with lower levels of education reported more functional problems than their respective counterparts (p < 0.05). The age gradient was most evident for three of the physical domains. For females aged 24–56 and males aged 44–76, a clear education gradient was present for three of the physical domains and one mental domain after adjusting for age and gender.This study presents population based normative data on functional ability, as measured by the NFAS. These data will serve as basis for the development of national population norms and are necessary for score interpretation. Data quality and test-retest reliability of the NFAS were acceptable. Longitudinal trends in sickness absence and disability pensions rates in several European countries, including Norway, show that increasing proportions of the population have levels of work ability that are too low to meet work demands . To meetIt is commonly found that the level of functioning tends to be poorer with increasing age and in lower social classes . EurostaNational and international population surveys have frequently used well-established health status instruments such as the Nottingham Health Profile and the The Norwegian Function Assessment Scale (NFAS) is an instrument for self-report that was developed by an expert group in social insurance in 2000. It was developed to assess the need for rehabilitation, adjustment of work demands among sick-listed persons as well as the rights to social security benefits . ICF wasThe first version of the NFAS was tested for construct and convergent/divergent validity against SF-36 and the Dartmouth COOP Functional Health Assessment Charts/WONCA(COOP/WONCA), and for utility in a random sample of 386 persons sick-listed for six weeks in eight different geographical areas . Based oThe final version of NFAS had good construct validity , but itsUllensaker is a rural community which had 23,700 inhabitants in 2004. There are no major differences between the population of Ullensaker and the population of Norway with respect to demographic characteristics . In 2004The Regional Committee for Medical Research Ethics and The Norwegian Data Inspectorate approved the study.For purposes of assessing test-retest reliability, the first 30 returning a questionnaire within each of the five youngest birth cohorts were asked to complete the NFAS again at two weeks. The two oldest birth cohorts were not included because the persons are outside the normal working age in Norway of 16 to 67 years. Individuals reporting no difficulty on all NFAS items were not invited in the retest since possible changes could only be in one direction.The NFAS was inclBased on the results of principal component analysis from the previous study with sick-listed persons , the iteDemographic data about the education level was included in the questionnaire with the response categories of lower secondary school, upper secondary school , upper secondary school (preparatory), university 1–4 years, university >4 years. Education level was then categorized into three groups: ≤ 9 years, 10 to 12 years and ≥13 years.Internal consistency was assessed by Cronbach's alpha. Test-retest reliability was assessed by calculating total proportions of agreement, weighted kappa , and intOf the 3000 questionnaires posted, 1620 (54.0%) were returned. Compared to respondents, non-respondents were more likely to be male (p < 0.001) and young or very old , driving a car (6.1%), working in groups (9.0%), and guiding others in their activities (9.3%) had higher missing values. There was a significant increase of missing values with age (p < 0.001).Item responses were skewed towards no difficulty; range 63.5 – 96.8%. The percentage of respondents reporting no difficulty for all 39 items was 33.1%. The items going up and down stairs, engaging in your leisure activities, pushing and pulling with your arms, cleaning your house, staying alert and being able to concentrate, managing everyday stress and strains, managing to take criticism, managing to control your anger and aggression, and remembering things, represent functional activities in which more than 20% of the population reported difficulties.Cronbach's alpha ranged from 0.67 (Sitting) to 0.91 for domains and was 0.95 for the total scores. Five of seven domains exceeded the 0.70 reliability standard for use in groups , the remRetest questionnaires were returned by 101 of the 134 (75.4%) individuals sent a second questionnaire. Most persons in the youngest cohort reported no difficulty for all questions, resulting in fewer candidates in this cohort (n = 17). The respondents were significantly older (p < 0.05) than the non-respondents, but were otherwise comparable. With the exception of four items – writing, which showed a deterioration (p < 0.01) in function, and managing to take criticism, managing to control your aggression and anger, and remembering things, which showed an improvement (p = 0.01) in function – there were no score differences between test and retest. The proportion scoring exactly the same on both occasions was high, ranging from 0.68 – 0.97. Weighted kappa values ranged from 0.38 (fair agreement) to 0.83 Table 22. The weItem and domain scores ranged from 1.04 to 1.42 and from 1.05 to 1.25 respectively Table . Males rDomain and total scores for males and females within different age groups are given in Table NFAS scores decreased with more years of education, indicating better self-reported functional ability Table . With thThe Norwegian Function Assessment Scale (NFAS) was developed by an expert group to ensure that the instrument has content validity, as a measure of functional ability relevant to the working population. With just 39 items the NFAS is suitable for inclusion in population surveys with minimum respondent burden and take an estimated ten minutes to complete. The instrument seems to be acceptable to the general population in Norway, even though the response rate was relatively modest in some age cohorts. The response rate represents a potential study limitation as we do not know the possible effect imposed by the non-respondents. Compared with national population data , the stuLevels of missing data were within acceptable limits. However, a few items had a high percentage of missing values, which is probably because there was no "not applicable" option. When a participant considered a functional activity irrelevant, he or she would probably have left this item unanswered. Some items could have been irrelevant for the two oldest cohorts since many of these participants have retired from work or do not drive a car. Including a not applicable option might have lowered missing values for some items.The NFAS was originally developed for persons of working age. The small number of participants in the two oldest age cohorts, and the poorer data quality among these respondents due to more missing values and irrelevant items imply that caution should be exercised when using these normative data on groups outside the working age. Otherwise, the data quality was acceptable.The level of Cronbach's alpha was acceptable with two of the domains only just failing to meet the criterion of 0.70 for use in groups of people . The parThe total proportions of agreement in this test-retest was high compared to a study examining test-retest reliability of COOP/WONCA . CompareAs expected, the data were highly skewed indicating that a large proportion of the population did not experience difficulties with functional activities. One in three respondents reported no difficulty on all items indicating excellent functional ability, and the remaining two thirds reported a variety from minor to major difficulties with different functional activities. The population seems to have most problems with remembering and least problems with their senses. Walking/standing and Managing domain have the highest scores, whereas Senses and Sitting the lowest. The items, watching television and listening to the radio, had very low scores, indicating that very few respondents reported difficulties with this. However, problems with these senses are important aspects in relation to work.Men reported higher functional ability than women on most items. The findings of previous studies differ somewhat, which may, at least partly, be due to the use of different instruments and the aspects of health that they measure. Of the studies looking at functional health status using the SF-36, five had a similar conclusion -26, wherThe significant age gradient in physical domains and the non-gradient in mental domains found in this study follows previous research ,24,26-28In this study, the length of education was significantly related to functional ability level with better levels among the persons with the highest levels of education. This finding is supported by previous studies -25. In tComparing this population study data with data from the sample with 386 Norwegians sick-listed for six weeks , the popThis study presents population scores on the NFAS by gender, age and length of education. Data quality, internal consistency and test-retest reliability were acceptable. The main findings were that females, older persons and persons with lower levels of education reported more functional problems than males, younger persons and persons with higher levels of education. A large proportion of the respondents reported no difficulty for most items and very few answered that they could not do it. The domains, in which the respondents reported most problems with functional activities, were Walking/standing, Lifting/carrying and Managing. These data will serve as basis for the development of national population norms.The author(s) declare that they have no competing interests.NØ planned and designed the study, performed some of the statistical analysis, drafted the manuscript and coordinated the study. SB planned and designed the study, participated in the interpretation of results and in drafting and revising the manuscript. AG helped in the interpretation of the results and participated in drafting the manuscript. JSB performed most statistical analysis and reviewed the manuscript. BN participated in planning and designing the study, collected the data and participated in drafting the manuscript. PG participated in the planning and design of the study, interpretation of the results and in drafting the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

The sensitivity of a neuron to its input can be modulated in several ways. Changes in the slope of the neuronal input-output curve depend on factors such as shunting inhibition, background noise, frequency-dependent synaptic excitation, and balanced excitation and inhibition. However, in early development GABAergic interneurons are excitatory and other mechanisms such as asynchronous transmitter release might contribute to regulating neuronal sensitivity. We modeled both phasic and asynchronous synaptic transmission in early development to study the impact of activity-dependent noise and short-term plasticity on the synaptic gain. Asynchronous release decreased or increased the gain depending on the membrane conductance. In the high shunt regime, excitatory input due to asynchronous release was divisive, whereas in the low shunt regime it had a nearly multiplicative effect on the firing rate. In addition, sensitivity to correlated inputs was influenced by shunting and asynchronous release in opposite ways. Thus, asynchronous release can regulate the information flow at synapses and its impact can be flexibly modulated by the membrane conductance. Computation in a single neuron is regulated by gain control – the change in the sensitivity of a neuron to different patterns of stimulation. Hence, it is important to understand the different mechanisms underlying gain modulation. Earlier work focused on gain modulation in mature networks with functional connectivity; however, the mechanisms of gain control in the developing brain are still unclear. We show here that asynchronous release of neurotransmitter, a form of synaptic “noise” that is strongly expressed in synapses of the developing brain, and short-term synaptic plasticity can efficiently modulate the gain of the synapse without a priori assumptions about network's connectivity. Asynchronous release depends on the activity-dependent accumulation of synaptic calcium. We show that changes in asynchronous release can have either a divisive or multiplicative effect on the gain, depending on the state of the neuronal membrane conductance. Thus, activity-dependent synaptic “noise” can regulate the information flow at synapses, and its impact on the neuron is flexibly modulated by neuronal membrane conductance. Gain control of synapses regulates the flow of information through neural circuits Another mechanism of gain modulation that has been extensively studied relies on “balanced inputs” Previous studies have assumed that short-term synaptic plasticity and noise act independently of one another to affect the input-output curve of a neuron. This assumption holds for the “phasic release” of neurotransmitter from a presynaptic terminal that occurs shortly after the arrival of an action potential. Although most of the fast communication between neurons is through fast phasic release, many central synapses have an additional, asynchronous component of transmitter release in response to stimulation We used a computational modeling approach to investigate the possible effects of asynchronous release on the modulation of synaptic gain, with specific focus on the early developmental period before afferent inhibition is fully established Our goal was to understand the role of asynchronous release in modulating the gain of neurons. To accomplish this, we constructed a computational model that could capture some of the most salient features present in experimental data from hippocampal cell culture To show how synchronization can lead to this type of experimental data, we first built a computational model of a synaptic terminal which featured a small number of vesicles that could be stochastically released either as a phasic response to synaptic stimulation or in an asynchronous manner . RhythmiSince long-term simulation studies of our detailed synaptic model became computationally demanding for large (thousands) numbers of afferents, we developed a reduced and computationally much more efficient model of synaptic transmission that still incorporated both phasic and asynchronous components of release . This reAsynchronous release can modulate neuronal spiking in a time window that is dependent on the prior activity of synaptic afferents. The extent of asynchronous release at model synapses is determined by the availability of synaptic resource, which is reduced, and by the level of residual calcium, which builds up in the course of prolonged synaptic stimulation. For higher-frequency stimulation, which both depleted synaptic resource and led to a significant build up of residual calcium, the probability peaked later because it took longer for the synapse to recover and generate a sufficient level of asynchronous release. In contrast, when the stimulation rate approached the rate of residual calcium clearance, the level of asynchronous release at model synapses was low, in which case there was a low probability of generating a spike in response to a test stimulus . Stimulahe right .i-th spike that arrives at the synapse (time is measured in milliseconds). This conservative estimate ensured that the effects of conductance due to i-th phasic release are negligible. In To further investigate the effects of asynchronous release on synaptic transmission we stimulated the model synapse with Poisson inputs at different rates and compared the spike-averaged peak conductance generated by the phasic component of release with the time-averaged conductance generated by the asynchronous component . The asyThese results suggest that asynchronous release can modulate how a neuron responds to synaptic inputs, but exactly how this occurs depends on the pattern of earlier synaptic activity. In what follows, we examine how this type of modulation contributes to synaptic gain control and how it depends on the intrinsic properties of the neuron, such as the membrane conductance.How does the “activity-coupled “noise” introduced by asynchronous transmitter release affect the transfer characteristics of a neuron, and, more generally, how does short-term synaptic plasticity affect synaptic gain control? Central synapses have heterogeneous mixtures of facilitation and depression in responses to natural stimuli In on as in , a compapulation . When plinset of . Higher In in this parametric regime, the fluctuations in the synaptic signal that arise due to the phasic release are not likely to be a decisive factor for spike generation. Rather, as is explained below, the synaptic gain was determined by the average level of synaptic current, which was in turn affected by asynchronous release. In contrast, with increased membrane conductance spike generation was driven by the presence of strong events in phasic transmission and Another way to alter synaptic depression is by modulating onounced . The obspendence . Figure Membrane conductance strongly affects the excitability of the cell and shapes neuronal responses to excitatory afferents The effect of shunting on the gain change induced by asynchronous release is shown in The effects of membrane conductance and asynchronous release on the gain curve could be merely a consequence of modulation by noise To better understand the effect of shunting conductance on the change in neuronal gain caused by asynchronous release of neurotransmitter, we considered a scenario with more positive leak reversal potential synaptic model in which phasic and asynchronous release were decoupled to a rhythmic and coordinated stimulation of e drawn) . Figure e drawn) . This ise drawn) .We generated correlated inputs to the synapses see to studyIn the low shunting regime always produced higher rates for higher noise intensities number of afferent synapses? A simple scaling of synapse number and all relevant parameters would offer a simple way to extrapolate our findings for the simplified “lumped” neuron to this realistic limit . Considered together with the notion of two-layer network and the existence of asynchronous release, such local modulation of dendritic excitability could provide pyramidal neurons with significant computational capacity. In this view, the pyramidal neuron should be viewed as composed of many dendritic computational units The size of the active zone of synapses and their release characteristics are heterogeneous Asynchronous release has not been as well studied as phasic release. Asynchronous release onto a dendrite could be screened or boosted, depending on the ion channels in the dendritic tree. Future integrated experimental and modeling studies could resolve the question of how the distribution of dendritic mechanisms affects the impact of synaptic plasticity and different modes of neurotransmitter release in determining neuronal spike discharge patterns.We constructed both a vesicular model of neuronal excitation as well as a simplified approach, which makes use of the coordinated activation of 1% of the synapses impinging on a fixed neuron. The reduced model used here is based on one that was previously matched semi-quantitatively with experimental findings and used to study reverberatory networks in hippocampal cultures Δt = 0.025 msec.All equations were integrated with custom software written in C, using the second-order Runge-Kutta method with a fixed time step We used a conductance-based model with one compartment The following parameter values were used in the model: The model we used here is based on the classical quantal model of synaptic transmission We typically investigated the neuronal response to the stimulation of 2000 synapses modeled as described above of neurotransmitter from presynaptic terminal rose instantaneously and then decayed exponentiallyi. For neuronal responses to the stimulation of AMPAergic synapses, the reversal voltage was taken as In the vesicular model, the synaptic current due to the activation of afferent inputs (Equation 5) wasj-th model synapse to action potentials that occur at times Since long-term simulation studies of vesicular model become intractable in the limit of a large number (thousands) of synapses, in most of our studies we used a phenomenological model that described the synchronous activation of several active zones The firing rate of a neuron depends on the number of inputs and their rate of activation. The number of afferent synapses in real neurons varies across different types of neurons, which for cortical pyramidal neurons it approximately The maximal rates of asynchronous release in the reduced model normally ranged from 0 to 3 quanta per millisecond. Keeping in mind that each of the model synapses in the reduced model represents activation of ∼100 real synapses, the rate of asynchronous release considered here would correspond to a maximal rate of ∼0.03 quanta per millisecond for a real single synapse. This is consistent with Goda and Stevens smission , thus ini, and reversal potential In the reduced model, the synaptic current due to the activation of afferent inputs (Equation 5) wasThe following parameter values were used to model the properties of synaptic transmission: To generate correlated activity at model afferents, we followed Rudolph and Destexhe In this study, we focused on the possible effects of synaptic depression and asynchronous release at glutamatergic AMPA synapses. However, significant asynchronous release also occurs at the GABAergic synaptic terminals Figure S1A Transfer curves for high shunt regime (gshunt = 1.5 mS/cm2). Black squares: AR rate is ηmax = 0 quanta/sec. Red circles: AR rate is ηmax = 6 quanta/sec. Solid lines are linear fits y = ax+b to the low-frequency subset of data points (up to input rate of 15 Hz). Fit parameters are a = 1.14,b = 2.23 (black line) and a = 0.15,b = 6.3 (red line). B Transfer curves for low shunt regime (gshunt = 1.2 mS/cm2). Symbols are the same as in A.Effects of AR on input-output transfer properties in the vesicular model of synaptic transmission. (0.02 MB EPS)Click here for additional data file.Figure S2A Transfer curves for high and low shunt regimes, in the scenario of altered reversal potential of leak current (EL = −60 mV). Black squares: ηmax = 0. Red squares: ηmax = 0.3. Data points are averages over 20 independent realizations. B Transfer curves for high and low shunt regimes, in the scenario of Type-1 excitability. Black squares: ηmax = 0. Red squares: ηmax = 0.3. Data points are averages over 20 independent realizations.Effects of neural excitability on asynchronous release modulation of synaptic gain. (0.04 MB EPS)Click here for additional data file.Figure S3A Transfer curves for high shunt (gshunt = 1.5 mS/cm2). Closed squares: ηmax = 0. Open circles: ηmax = 0.3. B Transfer curves for low shunt (gshunt = 1.2 mS/cm2). Closed squares: ηmax = 0. Open circles: ηmax = 0.3. C Transfer curves for high shunt with selective manipulation of AR at inhibitory synapses. Closed circles: ηmaxIN = 0. Open circles: ηmaxIN = 0.2. D Transfer curves for high shunt and different GABA-to-AMPA conductance ratios. Open circles: RI/E = 1. Closed circles: RI/E = 2. E Transfer curves for low shunt. Symbols are the same as in D. F Transfer curves for high shunt, RI/E = 2, and selective manipulation of AR at inhibitory synapses. Symbols are the same as in C.Effects of inhibitory synaptic transmission and asynchronous release on synaptic gain modulation. (0.03 MB EPS)Click here for additional data file.Text S1Material in this file describes the dependence of AR-mediated gain control on different scenarios: presence of inhibitory inputs, different types of neuronal excitability, different models of synaptic transmitter release.(0.07 MB DOC)Click here for additional data file.

During the period from 1950 to 1952, three patients were studied by electrophoresis according to Tiselius on account of anticomplementary activity at WR; the presence of an M-component was demonstrated. On several later occasions it was observed that this component at first seemed to remain unchanged, later it was slightly increased; repeated examinations did not give evidence of multiple myeloma. At intervals ranging from 15 to 24 years after the primary demonstration of the M-component, all three patients presented with symptoms of multiple myeloma and died within less than one year after the disease had been diagnosed. The following conclusions are drawn:(1) The preclinical phase of multiple myeloma may cover up to 24 years.(2) A presence of multiple myeloma cannot be precluded, even after follow-up throughout 24 years, in cases of the so-called “benign monoclonal gammopathy”.

Computational biology can be considered a supradisciplinary field of knowledge that merges biology, chemistry, physics, and computer science into a broad-based science that is important to furthering our understanding of the life sciences. Although a relatively new area of research, it is recognized as a crucial field for scientific advancement in developing countries. This Perspective introduces our vision of the role of computational biology in biomedical research and teaching in Cuba. Except where individuals are directly quoted, any opinions expressed herein should be considered those of the authors. This led to investment in computing resources in the main Cuban universities and research centers, providing Beowulf-like computer clusters for massive data processing, the inauguration of the National Bioinformatics Center (BIOINFO), and a joint effort to increase scientific human resources in a transdisciplinary way.The opportunity to perform good science and to obtain important results that would directly impact Cuban society was a strong motivator. Today this implies identifying scientific problems with the greatest impact on human health, environmental concerns, sustainable production of food, and so on.In addition to the investments made by different Cuban government agencies to create the above-mentioned significant computing facilities in some centers, a policy of establishing links to important foreign centers was promoted with scientific institutions in the United Kingdom, Belgium, The Netherlands, Italy, Germany, Brazil, and Spain. There are also scientific joint programs of co-tutorial doctorate education with Spain in this field. This cooperation encourages not only the exchange of scientific results of mutual benefit, but also graduate and Ph.D. education, mostly involving short-term student exchanges.Based on this framework, Cuban researchers have organized and attended different seminars and international activities focused on computational biology in the last few years. These meetings, summarized in One of them, the Seminars of Advanced Studies on Molecular Design, organized by the laboratory of one of the authors (LAM) at the University of Havana, has been held since 1986. In the beginning, these seminars were mostly dedicated to theoretical chemistry and molecular modeling. Since 2002, they have focused on life science applications. These meetings have provided a great opportunity to join top-level specialists and Ph.D. students for stimulating presentations and discussions. Among the oldest activities are the biotechnology congresses, sponsored by the CIGB, which began to include relevant computational biology topics in the late 1990s.These international activities also led to the organization of national meetings, such as the Colloquium on Systems Biology in Cuba: Challenges and Opportunities, held at the University of Havana in 2004, and the National Seminar on Bioinformatics, held at the Center of Molecular Immunology in 2005. Binational meetings have also been held with specialists from the UK, France, Belgium, and Spain, promoting very fruitful discussions with Cuban science leaders and graduate students.Almost all of the computational biology specialists leading research groups in Cuba hold a Ph.D. degree. Most performed their Ph.D. work only partly in Cuba, with the majority of the work done in Europe and to a lesser extent in Mexico and Brazil. The backgrounds of these scientists cover: sequence and 3-D structure analysis, functional residue prediction, comparative 3-D modelling, molecular dynamics simulations, molecular docking, mathematical model of T cell–mediated suppression, and studies of transcriptional regulation networks, as well as statistical and programming skills.Interestingly, this initial group of computational biology specialists graduated in different fields , rather than in computational and biological disciplines as occurs in other places . In receThe diversity of graduating fields in computational biology explains the wide range of subjects and research topics currently under development in Cuba. These topics include: systems biology, the use of mathematical and statistical approaches to neurobiology, structure-based drug design, proteomics and genomics, mathematical biology, phylogenetic analysis of species unique to the region, protein–protein and protein–membrane interactions, computational genomics, protein design, and parallel processing of large datasets. A list of universities and research institutes developing comprehensive computational biology activities in the country is shown in To develop a new multidisciplinary field of research in a country like Cuba, as elsewhere, requires the promotion and sponsorship of Master's and Ph.D. programs, either in Cuba or in foreign countries where the science is better developed.Following this approach, four institutions—the Virtual Center of Bioinformatics, the Faculty of Biology at the University of Havana, BIOINFO, and the Central University of Las Villas—have created Master's and Ph.D. programs. The Virtual Center of Bioinformatics at the University of Havana also established conditions for national and international cooperative doctorate education. These programs have produced new scientific leaders, fast and relatively costless high-tech research results benefiting not only Cuban but also international cooperating institutions, and long-term cooperative projects.Considering the role of computational biology in biomedical discovery, food production, agricultural research, and education, Cuban scientists view these programs as very important. Additionally, through this program, computational biology teaching at the undergraduate and graduate levels is receiving special attention. The first attempt at undergraduate education was an accelerated course on bioinformatics, organized by the CIGB, the Cuban Neuroscience Center, the University of Havana, and the Institute for Nuclear Sciences and Technology (ISCTN) for outstanding students in their final years of various majors.At present, several career curricula from different Cuban universities include computational biology–related topics. For example, all undergraduate students of chemistry and biochemistry at the University of Havana take computer science, operating systems, elementary programming, and statistical courses as part of their basic training. In the case of the biochemistry major, as explained by Dr. Mayra Tejuca during the Third Symposium on Biochemistry and Molecular Biology held in Havana in October 2006, the new biochemistry study plan will allow students to choose other courses. These courses will include: Introduction to Bioinformatics, Computation, Advanced Statistics, Computational Study of Proteins, Computational Genomics, and Introduction to Systems Biology. Similarly, a computational engineering major at the University of Informatics Sciences (UCI) has an undergraduate curriculum that includes natural sciences. The purpose is to prepare engineers for interacting with basic field scientists to perform research and development on biological systems.At the postgraduate level, an M.Sc. degree course organized by ISCTN in collaboration with the UCI is under development. Furthermore, three international cosponsored programs for a Ph.D. degree have been established. The first one, developed by the Universität Hasselt, Germany, and the University of Havana, Cuba, will provide a Ph.D. degree in Statistical Medicine and Bioinformatics. The second one, sponsored by the University of Valencia, Spain, and the Institute of Technology “José A. Echeverría,” Cuba, will provide a Ph.D. degree on Parallel and Distributed Processing on Computers and Development of GRID Applications for Bioinformatics. Finally, the Autonomous University of Madrid, Spain, and the University of Havana have recently initiated a cosponsored Ph.D. program in Bioinformatics. More recently, a Ph.D. program in Molecular Biosciences with new knowledge fields in Structural Biology, Bioinformatics, and Systems Biology has been initiated at the Faculty of Biology, University of Havana, sponsored by the CIGB and the Center of Molecular Immunology.We believe that these meetings and teaching activities will provide more biologists, physicists, mathematicians, and chemists with both theoretical knowledge and practical skills in bioinformatics, while fewer and fewer jobs are available in these more traditional disciplines. With an increased number of computational biologists with M.Sc. and Ph.D. degrees, Cuba will hopefully host future meetings and contribute to scientific progress in computational biology.Computational biology represents a significant opportunity for a country like Cuba, where highly qualified human resources are available but funds to invest in equipment are scarce. In addition, the decentralized and noncompetitive cooperation between scientists and scientific institutions that has been budding recently creates a starting point for a promising national research field whose results will be useful not only scientifically, but for Cuban society as well. In the course of these developments, disciplinary barriers are being overcome, with scientists as educators implementing multidisciplinary programs in higher education. They have been reflected in the newest study plans for the Faculties of Biology, Chemistry, and Physics at the University of Havana that began in 2006. Thus, Cuba appears to be on the way to making a significant contribution to this new field of computational biology. Tirso Pons Hernández is the founder and group leader of the Laboratory of Computational Biology and Protein Design at the Center for Protein Studies, University of Havana. He obtained a B.Sc. degree in Nuclear Physics from the Institute of Nuclear Sciences, Havana, in 1991, and received a Ph.D. in Biology from the University of Havana in 2003. He is also adjunct professor at the University of Havana Biochemistry Department, where he teaches undergraduate and postgraduate courses in Bioinformatics. Dr. Pons was a visiting scientist at Dr. Alfonso Valencia's lab (CNB-CSIC) at the Autonomous University of Madrid, Spain, and at Dr. Gert Vriend's lab at the European Molecular Biology Laboratory, Heidelberg, Germany. He is a member of the Cuban Society of Biochemistry and Molecular Biology and has also received an invitation to become a member of the New York Academy of Sciences. Dr. Pons has received five Biomedical Science awards from the Cuban Academy of Sciences related to his scientific research.Luis Alberto Montero-Cabrera has been Professor of Physical Chemistry at the University of Havana since 1983. He graduated from the University of Havana in 1969 and got his Ph.D. from the Technical University of Dresden, Germany, in 1980, before returning to Cuba and founding the Laboratory of Computational and Theoretical Chemistry at the University of Havana in 1986. Professor Montero teaches computer science for chemists in theoretical and physical chemistry, and has published abundantly in peer-reviewed journals in his fields of research, including science policy. He is chairman of the Scientific Council of the University of Havana 2006–2010 and has taught postgraduate courses in seven countries within Europe and in America, as well as authoring or adapting more than 15 computer programs in theoretical chemistry. Professor Montero has been awarded the honorary degrees “Carlos J. Finlay” for scientific research and “Frank País” for education. Both recognitions are among the highest Cuban national awards.Juan P. Febles Rodríguez has worked as a Computing Professor at the Universidad de Matanzas since 1974. He obtained a B.Sc. degree in Mathematics from the Central University of Las Villas, Santa Clara, in 1974, and received a Ph.D. in Informatics from the Institute of Technology “José Antonio Echevarría,” Havana, in 1986. He took postgraduate courses at the Instituto Superior Politécnico de México (1979–1980) and at the Erevan Institute of Technology in Armenia (1984). In September 1996, he began working as Advisor at the Centro de Cibernética Aplicada a la Medicina, Instituto Superior de Ciencias Médicas, Havana, and was appointed Head of the Center in December 1997. He also teaches M.Sc. and Ph.D. courses in several universities in Cuba, Mexico, Brazil, and Guatemala. In the last five years, he has developed research projects in the areas of artificial intelligence, medical informatics, distance education, bioinformatics, and computer networks. He is currently Head of the National Scientific Program for Information Technology and a member of several national scientific groups. • Centro de Cibernética Aplicada a la Medicinahttp://www.cecam.sld.cu/• Center for Genetic Engineering and Biotechnologyhttp://bio.cigb.edu.cu/index.htmlhttp://www.biocomp.cigb.edu.cu/• Center of Molecular Immunologyhttp://www.cim.sld.cu/• Centro de Química Farmacéuticahttp://www.cqf.sld.cu/• Cuban Neuroscience Centerhttp://www.cnic.edu.cu/• National Bioinformatics Centerhttp://www.bioinfo.cu/• Centro Nacional de Genética Médicahttp://www.sld.cu/sitios/genetica/• Centro Nacional de Sanidad Agropecuariahttp://www.censa.edu.cu/• Finlay Institutehttp://www.finlay.sld.cu/• Instituto Superior de Tecnologías y Ciencias Aplicadashttp://instec.bioinfo.cu/• Institute of Technology “José Antonio Echeverría”http://www.cujae.edu.cu/• Central University of Las VillasFaculty of Mathematics, Physics, and Computer Scienceshttp://www.mfc.uclv.edu.cu/• University of HavanaFaculty of Chemistryhttp://www.fq.uh.cu/investig/lqct/Faculty of Biologyhttp://fbio.uh.cu/bioinfo/http://fbio.uh.cu/cep/index.html• Universidad de Orientehttp://www.uo.edu.cu/

Since the first description of tinnitus retraining therapy (TRT), clinicians have modified and customised the method of TRT in order to suit their practice and their patients. A simplified form of TRT is used at Ealing Primary Care Trust Audiology Department. Simplified TRT is different from TRT in the type and (shorter) duration of the counseling but is similar to TRT in the application of sound therapy except for patients exhibiting tinnitus with no hearing loss and no decreased sound tolerance . The main goal of this retrospective study was to assess the efficacy of simplified TRT.Data were collected from a series of 42 consecutive patients who underwent simplified TRT for a period of 3 to 23 months. Perceived tinnitus handicap was measured by the Tinnitus Handicap Inventory (THI) and perceived tinnitus loudness, annoyance and the effect of tinnitus on life were assessed through the Visual Analog Scale (VAS).The mean THI and VAS scores were significantly decreased after 3 to 23 months of treatment. The mean decline of the THI score was 45 (SD = 22) and the difference between pre- and post-treatment scores was statistically significant. The mean decline of the VAS scores was 1.6 (SD = 2.1) for tinnitus loudness, 3.6 (SD = 2.6) for annoyance, and 3.9 (SD = 2.3) for effect on life. The differences between pre- and post-treatment VAS scores were statistically significant for tinnitus loudness, annoyance, and effect on life. The decline of THI scores was not significantly correlated with age and duration of tinnitus.The results suggest that benefit may be obtained from a substantially simplified form of TRT. Tinnitus retraining therapy (TRT) is aimed at removing negative associations of the tinnitus signal to enable the natural habituation process to occur . The goaSince the first description of TRT in the 1990s, clinicians have modified and customised the method of TRT to suit their practice and their patients -5. A simSound therapy for simplified TRT is the same as for the TRT except for patients in Jastreboff's "category one" . PatientThe aims of this observational study were: (1) to assess the effectiveness of simplified TRT, as carried out at Ealing PCT Audiology Department during 2005 and 2006 and (2) to determine the extent to which the success of simplified TRT is affected by the duration of tinnitus, the patient's age, the use of hearing aids (HAs), and the use of SGs.Data were collected from a series of 42 consecutive patients who were referred from the ENT department to the tinnitus clinic at Ealing PCT Audiology Department during 2005–2006. The selection criteria were that each patient: (1) completed the self-assessment questionnaires, (2) attended at least two therapy sessions and continued the treatment for at least 3 months, and (3) exhibited mild to severe tinnitus handicap based on the Tinnitus Handicap Inventory (THI) [In the assessment session prior to application of the simplified form of TRT, a general medical history was obtained and otoscopy and pure-tone audiometry were performed. Audiometric thresholds were measured in a sound-attenuating room following the British Society of Audiology recommended procedure . LoudnesIn the first simplified TRT session, all patients received general information and directive counseling on tinnitus. This counseling was based on explanation of the nature of tinnitus and how to manage it. Its aims were: (1) to reassure patients that the annoyance from tinnitus would gradually reduce with the passage of time following the natural process of habituation; (2) to inform them that reduction in annoyance and distress caused by the tinnitus would promote habituation to the tinnitus and reduction of the tinnitus itself; (3) in cases of tinnitus combined with hearing loss to explain that if they could not hear properly, this was most likely because of their hearing loss and not the tinnitus; and (4) to advise them to avoid silence by using sound enrichment .Sound therapy for simplified TRT was almost the same as for TRT. The specific treatment strategy that was applied to patients in the different categories described by Jastreboff (excludi(a) Patients with bothersome tinnitus, but no hearing loss, and no DST were advised about sound enrichment, but WSGs were not offered unless requested. This is the way in which the sound therapy for simplified TRT differs from that for TRT; the latter recommends usage of bilateral WSGs for at least 8 hours per day for patients in this category. In simplified TRT, if the patient asked for WSGs, then bilateral WSGs were fitted with the same procedure as for TRT, using completely open fittings (Oticon Comfort Tips or skeleton open molds). As for TRT, the patient was instructed to set the volume so that both the tinnitus and the noise generated by the device could be heard.(b) Patients with tinnitus and hearing loss were advised about sound enrichment and were fitted with digital hearing aids (HAs). This was similar to TRT except that patients were not given the option of combination devices (a combination of a HA and a broadband noise generator), whereas this would be an option for TRT.(c) Patients exhibiting DST, with tinnitus and with or without hearing loss were advised to use bilateral WSGs and instructed to set the volume of the WSGs at a level that avoided discomfort while making the WSG noise audible in the presence of background environmental noises (instructions were to increase the volume in noisy environments). Initially, the therapy was focused on the DST, and after the patient showed improvement in DST, the tinnitus was addressed more directly. This was similar to TRT.WSGs and HAs were fitted free under the National Health Service, but patients had to buy the SGs from the supplier. It was explained to patients that WSGs and SGs might facilitate tinnitus habituation by decreasing the strength of the tinnitus signal. It was also explained that HAs may help: (1) to reduce the effort of hearing, and (2) to amplify background noises and facilitate tinnitus habituation by decreasing the strength of the tinnitus signal. However, patients needed to decide for themselves whether or not to proceed with sound therapy of any form.A single specialist (the first author) administered the treatment. He was clinically certified as an audiologist and had special expertise in tinnitus rehabilitation. Each patient was seen at 2–7 clinical appointments over a period of 3–23 months. The follow up appointments were arranged as required at 1 month, 2 month, 3 month, and 6 month intervals. The outcome measurement questionnaires were completed at the beginning of each session. The scores achieved in the last session were compared with the pre-treatment scores. Patients received about 1 to 3.5 hours of counseling. This excludes the assessment session, which usually took about 45 minutes for measurement of pure tone audiometry and LDLs, taking a case history, and obtaining the baseline questionnaires.This study was a clinical audit approved by the Clinical Governance department at Ealing PCT and it was designed to assess the Ealing PCT Audiology Department performance. This study also was performed in accordance with the Helsinki declaration on medical ethics issues.Two self-report outcome measures were used: the THI and the Visual Analog Scale (VAS) of tinniVAS scores are ratings on a scale from 0 to 10. The VAS score for loudness of tinnitus was assessed by asking the patient to rate the loudness of tinnitus during their waking hours over the last month (It was explained that 0 corresponds to no tinnitus being heard and 10 is as loud as gunfire). The VAS score for annoyance induced by the tinnitus was assessed by asking the patient to rate their subjective perception of annoyance on average during the last month (It was explained that 0 corresponds to no annoyance and 10 is the most annoying thing which can possibly happen). The VAS score for the impact of tinnitus on their life was assessed by asking the patient to rate the effect of tinnitus on their life during the last month (It was explained that 0 corresponds to no effect and 10 is as big as an earthquake).The age of the patients ranged between 28 and 81 years, with a mean of 60 years (SD = 13). None of them had any kind of previous treatment for tinnitus. The average duration of tinnitus was 6.4 years (SD = 7), with a range between 6 months and 30 years. 35 patients had a hearing loss and seven patients had normal hearing. Among the cases with hearing loss, eight were HA users and 27 had never had HAs. Three patients exhibited DST. Two patients had tinnitus in the right ear, 11 had tinnitus in the left ear and 29 had tinnitus in both ears. Table According to the THI scores prior to treatment, seven patients (16.7%) had mild handicap, 11 patients (26.2%) had moderate handicap, and 24 patients (57.1%) had severe handicap. For the VAS scores, prior to treatment, 36 patients (85%) ranked the loudness of their tinnitus as ≥ 5, 37 patients (88%) ranked the annoyance induced by their tinnitus as ≥ 5 and 31 patients (74%) ranked the impact of tinnitus on their life as ≥ 5.As shown in table The mean decline of the VAS score for tinnitus loudness was 1.6 (SD = 2.1). 23 (55%) patients exhibited a decline of two or more points, but four patients showed increased scores following treatment. The mean decline of the VAS score for annoyance of tinnitus was 3.6 (SD = 2.6). 33 (78%) patients exhibited a decline of two or more points, but one patient showed worse scores following treatment. Finally, 36 (85%) patients showed a decline of the effect of tinnitus on life of 2 or more points, but one patient showed worse scores following treatment. The mean decline of the effect of tinnitus on life was 3.9 (SD = 2.3). A two-way repeated-measures ANOVA on the VAS scores with factors before versus after treatment and VAS sub-scale showed a significant effect of treatment, F = 173.1, p < 0.001, a significant effect of VAS sub-scale, F = 11.22, p < 0.001, and a significant interaction, F = 10.49, p < 0.001. Post-hoc comparisons, based on Fisher's least-significant differences test, showed that the decline in scores following treatment was significant for all VAS subscales at p < 0.001.20 out of the 42 patients used SGs as part of their treatment. The main reasons for rejecting SGs were either having severe hearing loss or having no sleep problems. 28 out of 35 patients with hearing loss used HAs. The seven patients who didn't use HAs had only slight hearing loss (the PTA was between 21 and 30 dB in the worse ear), and they did not feel that they needed HAs. Table An ANOVA was conducted on the THI scores with before versus after treatment as a within-subjects factor and use or non-use of SGs as a between-subjects factor. The effect of before versus after treatment was significant, F = 228.3, p < 0.001, and the effect of use of SGs was also significant, F = 6.97, p = 0.012. However, a similar ANOVA on the VAS scores, with VAS sub-scale as a within-subjects factor, revealed that the use of SGs did not have a significant effect at the 0.05 level: F = 3.25, p = 0.079.An ANOVA was conducted on the THI scores with before versus after treatment as a within-subjects factor and use or non-use of HAs as a between-subjects factor. The effect of before versus after treatment was significant, F = 175.6, p < 0.001, but the effect of use of HAs was not significant, F = 0.09, p = 0.766. A similar ANOVA on the VAS scores, with VAS sub-scale as a within-subjects factor also showed that the use of HAs did not have a significant effect: F = 0.14, p = 0.708. This result does not support the idea that the use of HAs is critical for producing a decrease in tinnitus handicap. However, because all of the seven patients with tinnitus and hearing loss who did not use HAs as a part of their treatment had only slight hearing loss, this result is only applicable to patients with slight hearing loss. Due to the small number of patients in this group (only seven), this conclusion should be interpreted with caution. There is a need for further research using a controlled trial to assess the efficacy of HAs as a part of treatment for patients exhibiting tinnitus combined with slight hearing loss.Two out of seven patients with normal hearing used bilateral WSGs. These patients particularly asked for some kind of instrumentation which could help them to cope with their tinnitus in the daytime. The remaining five normally hearing patients did not ask for any assistive device and were not offered WSGs. All of the seven patients with normal hearing exhibited a 20 or more point decline in THI scores following simplified TRT treatment. Due to the small number of patients with normal hearing we are unable to draw any conclusions regarding the efficacy of WSGs for this group.r = 0.063, p = 0.69). This suggests that, regardless of the patient's age, from 28 to 81 years, they can receive benefit from simplified TRT. There was no statistically significant linear correlation between the decline in THI scores following treatment and the self-reported length of time the patient had tinnitus . This indicates that, whenever the patient decides to seek professional help for tinnitus, from 5 months to 30 years after the onset of the tinnitus, simplified TRT is capable of providing a substantial reduction in tinnitus handicap.As shown in figure Educational retraining counseling is generally regarded as an important component of TRT. The counseling in TRT is intended to explain the mechanisms underlying the tinnitus, based on the Jastreboff neurophysiological model, and to remove negative associations with the tinnitus. This is regarded as important for allowing habituation to the tinnitus to occur . The couTRT is an established method of treating tinnitus patients and typically results in a decline (improvement) in THI scores of 25 to 35 points after 12–24 months of treatment . StudiesThe current study is limited in the following ways: (1) we did not include a control group to eliminate the placebo effects from attending consultation appointments with a specialist; (2) the sample size was relatively small; (3) within the group of patients there was large variability in symptoms, in the type of instrumentation used and in the length of treatment. However, the results still indicate the potential benefit of a substantially simplified form of TRT in reducing tinnitus handicap.Using SGs as a part of sound therapy has been reported to facilitate tinnitus habituation by decreasing the strength of the tinnitus signal . The majSurr et al. ,18 recomIt is possible that decisions about fitting HAs for patients with slight hearing loss should depend on the patients' preference. If they are interested in and motivated to wear HAs, then HAs as a part of sound therapy may help them in reducing tinnitus-related problems. On the other hand, if they believe that they do not need HAs, they may benefit from simplified TRT even without amplification. This is consistent with the argument of Henry et al. that patThe effectiveness of a substantially simplified version of TRT was assessed through an uncontrolled retrospective study on 42 patients seen at Ealing PCT Audiology Department during the period 2005–2006. Simplified TRT differs from TRT in the type and (shorter) duration of the counseling but is similar to TRT in the application of sound therapy. Although we did not include a control group to assess the extent to which patients would have improved without treatment, our results revealed that simplified TRT was successful in reducing tinnitus handicap. THI and VAS scores for tinnitus loudness, annoyance and effect on life declined (improved) significantly over a period of 3 to 23 months for patients who received simplified TRT. The mean decline of THI score was 45 (SD = 22) and the difference between pre- and post-treatment scores was statistically significant. The mean decline of the VAS score was 1.6 (SD = 2.1) for tinnitus loudness, 3.6 (SD = 2.6) for annoyance, and 3.9 (SD = 2.3) for effect on life. The differences between pre- and post-treatment VAS scores were statistically significant in all cases. The amount of improvement in THI scores tended to be greater for patients who used SGs as a part of their treatment, but was not significantly associated with duration of tinnitus and age.The authors declare that they have no competing interests.HA carried out the simplified TRT, designed the study, performed some of the statistical analyses, and prepared the manuscript. BCJM helped in the interpretation of the data and in writing the manuscript. BRG performed some of the statistical analyses.The pre-publication history for this paper can be accessed here:

The NMDA receptor represents a particularly important site of ethanol action in the CNS. We recently reported that NMDA receptor 2B (NR2B) gene expression was persistently up-regulated following chronic intermittent ethanol (CIE) treatment. Increasing evidence that epigenetic mechanisms are involved in dynamic and long-lasting regulation of gene expression in multiple neuroadaptive processes prompted us to investigate the role of DNA methylation in mediating CIE-induced up-regulation of NR2B gene transcription. To dissect the changes of DNA methylation in the NR2B gene, we have screened a large number of CpG sites within its 5′-regulatory area following CIE treatment.in vitro DNA methylation assays were performed to determine the direct impact of DNA methylation on the interaction between DNA and transcription factor and promoter activity.Primary cortical cultured neurons were subjected to ethanol treatment in a CIE paradigm. Bisulfite conversion followed by pyrosequencing was used for quantitative measurement and analysis of CpG methylation status within the 5′-regulatory area of the NR2B gene; chromatin immunoprecipitation (ChIP) assay was used to examine DNA levels associated with methylation and transcription factor binding. Electrophoretic mobility shift assay (EMSA) and in vitro of methylated DNA decreased transcription factor binding activity and promoter activity. An additional ChIP assay indicated that the CIE-induced DNA demethylation is accompanied by increased occupation by transcription factors.Analysis of individual CpG methylation sites within the NR2B 5′regulatory area revealed three regions with clusters of site-specific CpG demethylation following CIE treatment and withdrawal. This was confirmed by ChIP showing similar decreases of methylated DNA in the same regions. The CIE-induced demethylation is characterized by being located near certain transcription factor binding sequences, AP-1 and CRE, and occurred during treatment as well as after ethanol withdrawal. Furthermore, the increase These results suggest an important role of DNA demethylation in mediating CIE-induced NR2B gene up-regulation, thus implicating a novel molecular site of alcohol action. N-methyl-D-aspartate receptor (NMDAR) subunit levels contributing to up-regulation of glutamate transmission by ethanol exposure were suggested by recent work showing up-regulated binding, function, and expression following chronic ethanol treatment Ethanol exposure on a chronic intermittent regimen has been found to produce behavioral excitability, seizure susceptibility, and increased anxiety 7 promoter of the glucocorticoid receptor in the hippocampus undergoes active demethylation which is independent of DNA replication as a response to maternal care after birth Epigenetic mechanisms, including DNA methylation and histone modifications, change gene expression without alteration of the DNA sequence itself. DNA methylation, as one important epigenetic modification, was once thought to be a static process after cellular differentiation. However, it has recently been shown to regulate dynamically the adult nervous system in several important phenomena Our previous work demonstrated a significant CIE-induced up-regulation of NR2B gene transcription in cultured cortical neurons To test this hypothesis, we investigated whether CIE treatment results in decreased methylation by using a bisulfite-pyrosequencing. Because it was unclear which CpG site may be sensitive to ethanol, we first established a methylation profile by scanning all 116 CpG sites across the area of 3kb NR2B promoter and 5′UTR. The cultured neurons were subjected to CIE treatment, and genomic DNA was isolated. Bisulfite conversion of genomic DNA was performed and PCR amplification was used with at least 20 primers spanning this area. The results from pyrosequencing were shown in S-adenosyl-L-methionine (SAM) is the substrate for DNA methyltransferases (Dnmts) in methylation reaction, which has been previously used to rescue the hypomethylation The methylation data are not available for CpG sites #20–23 as we were unable to get our PCR primers to work at those sites. Attempts to amplify these DNA sequences by PCR using several redesigned primers and an alternative methylation specific PCR were also not successful. However, we have used other strategies to demonstrate the important role in these CpG sites (see results in ChIP assay). Taken together, these data indicate that DNA methylation in the 5′regulatory region of the NR2B gene is dynamically modified by CIE on selected site-specific CpG dinucleotides. Thus, CIE-induced DNA demethylation may contribute to the persistent up-regulation of NR2B gene transcription.To seek further evidence that CIE causes DNA demethylation in the specific regions of the NR2B gene, a series of primers were designed to amplify DNA fragments in 7 different regions (a through g in m) within or near the transcription factor binding sites. We observed that binding activity in the CRE site is sensitive to DNA methylation at CpG 32. There, the presence of a methylated CpG inside the core sequence of CRE abolished the CREB binding. When different amounts of methylated DNA were incorporated, the binding activity was reduced proportionately in vitro or CRE site (−800∼+30) only were r vector . These vactivity .In summary, the demethylation of NR2B gene promoter might increased CREB binding to the promoter and activated transcriptional activity of the NR2B gene. This suggests a mechanism that mediates CIE-induced up-regulation of NR2B gene transcription. On the other hand, the mechanism by which the AP-1 binding site in the NR2B gene mediates ethanol effects on transcription, as previously reported by others, may involve indirect effects of CpG demethylation.DNA methylation is catalyzed by the Dnmts Recent studies have demonstrated that DNA methylation is a dynamically regulatory process in the adult nervous system The commonly accepted mechanism of 5′AZA action is based on the initial report In the present study, we also use SAM, a methyl donor, to specify demethylation involved in CIE-induced up-regulation of the NR2B gene. We found that it can prevent CIE-induced up-regulation of NR2B gene expression through blocking the induction of demethylation. The mechanism by which SAM increases DNA methylation has been suggested to be either by stimulating DNA methylation enzymes in vitro methylation of the region surrounding this binding site. Thus, increased methylation resulted in inhibition of promoter activity. Together, these data show that site-specific DNA demethylation in NR2B mediates CIE-induced up-regulation of NR2B gene transcription. However, this may not hold true for other regions. For example, we found no similar change in the AP-1 site as indicated by the lack of change in transcription factor binding and promoter activity. One possible explanation might be that AP-1 regulates NR2B transcription through a more complicated chromatin remodeling mechanism, e.g. histone modifications, rather than the direct effect of demethylation in these neighboring CpG sites. DNA methylation and histone modifications are critical epigenetic processes controlling chromatin structure and gene regulation DNA methylation results in repression of gene transcription and loss of methylation are associated with activation of transcription activity Although we initially used MeCP2 antibody in ChIP assay to identify methylated DNA fragment based on the earlier published studies Although the mechanism of how CIE induced DNA demethylation is unknown, the role of two enzymes, Dnmts and demethylases is the important focus. Emerging evidence suggests the existence of demethylse Studies of human addiction and behavioral studies in rodent models of addiction have indicated that key behavioral abnormalities associated with addiction are extremely long lived Primary cortical neurons were prepared from C57BL/6 mouse fetuses as described previously Genomic DNA (1 µg) isolated from cortical neuronal cultures using a Blood and Cell Culture DNA kit (Qiagen), was bisulfite-treated using the Zymo DNA Methylation Kit . Bisulfite-treated DNA was eluted in 10 µl volumes with 1 µl used for each PCR. PCR was performed with primers biotinylated to convert the PCR product to single-stranded DNA templates. The PCR products (10 µl) were sequenced by pyrosequencing using the PSQ96 HS System following the manufacturer's instructions. The methylation status of each locus was analyzed individually as a T/C SNP using QCpG software −ΔΔCt method was used for quantification with 18s or GAPDH as endogenous controls. Gene expression in CIE-treated cells was expressed as fold changes by comparing to that in control cells.Using 1 µg of total RNA as template, single-stranded cDNAs were synthesized using random hexamers and TaqMan reverse transcription reagent kit . For the real time PCR reaction, specific probes (Applied Biosystems) were used for NR2B expression and the SyBr green plus primers were used for other examinations. Real-time PCR was performed using the ABI Prism 7900 sequence detection system. The 2ChIP assays were performed as previously described Levels of specific methylation, histone acetylation and transcription factor binding in the 5′regulatory area of the NR2B gene were determined by measuring the amount of antibody enriched chromatin DNA by quantitative real-time PCR. Primers were designed to amplify specific regions in the 5′-regulatory area of the gene.Controls were included to confirm specificity and validity. To control the specificity of antibody binding, we used non-immune rabbit IgG (Santa Cruz Biotechnology) to immunoprecipitate chromatin samples, which resulted in negligible levels of real time PCR activity (data not shown). For internal control of qChIP PCR, we designed the primers to amplify GAPDH promoter . The levels of DNA associated with methyl-DNA binding proteins and transcription factors at the promoter of GAPDH gene were measured; no difference was found after CIE-treat treatment (data not shown).m) and non-methylated (C) oligonucleotides (Sigma-genosys) from the regions of AP-1 and CRE in the NR2B promoter were prepared and annealed. AP-1: GT CAG TGC TGT AAA ATC ATT Tm)GC(C/C TAT GGG AAA CAT Tm)GC(C/C TTT-3′5′-AGC TGG GTT A. CRE: CTG Am)G was added per well. Cells were harvested 48 h after transfection for luciferase activity assayed in a Turner Designs TD-20/20 luminometer using the dual luciferase assay system according to manufacturer's protocol (Promega).The DNA fragments from mouse NR2B promoter regions ranging from −1300 to +30 bp and from −800 to +30 bp were methylated with bacterial CpG methylase SssI or mock-methylated Two-way ANOVA followed by Newman-Keuls multiple comparison tests were used to assess the significance of the differences between CIE treatments and individual CpG methylation levels in bisulfite-pyrosequencing data. One-way ANOVA followed by Newman-Keuls multiple comparison tests were used for all other data when necessary.Table S1(0.03 MB DOC)Click here for additional data file.

The negative impact of vertebral and hip low-energy fractures on health-related quality-of-life (HRQOL) has been demonstrated previously, but few prospective long-term follow-up studies have been conducted. This study aims to (i) investigate the changes and long-term impact of vertebral or hip fracture and between fracture groups on HRQOL in postmenopausal women prospectively between two and seven years after the inclusion fracture, (ii) compare HRQOL results between fracture and reference groups and (iii) study the relationship between HRQOL and physical performance, spinal deformity index and bone mineral density at seven-year follow-up.t-tests, ANCOVA, and partial correlation.Ninety-one women examined two years after a low-energy vertebral or hip fracture were invited to a new examination seven years after the diagnosis. HRQOL was examined using the SF-36 questionnaire and was compared with an age and sex-matched reference group. Physical function was assessed using tests and questionnaires. Bone mineral density was measured. Radiographs of the spine were evaluated using the visual semiquantitative technique. A longitudinal and cross-sectional design was used in this study. Statistical analyses included descriptive statistics, Student's Sixty-seven women participated. In the 42 women with vertebral fracture as inclusion fracture, bodily pain had deteriorated between two and seven years and might be explained by new fracture. Remaining pronounced reduction of HRQOL was seen in all domains except general health and mental health at seven-year follow-up in women with vertebral fractures compared to the reference group (p < 0.05). All 25 women with hip fracture as inclusion fracture had no significant changes in HRQOL between two and seven years and did not differ from the reference group regarding HRQOL after seven years. The vertebral group had significantly lower values for bodily pain, vitality, role-emotional function and mental health compared to the hip group. HRQOL showed a positive relationship between physical activity, static balance and handgrip strength.The long-term reduction of HRQOL in women with vertebral fracture emerged clearly in this study. The relationships between HRQOL and physical performance in women with vertebral and hip fracture raise questions for more research. The global burden of osteoporosis includes considerable numbers of fractures, morbidity, mortality and expenses, due mainly to vertebral, hip and forearm fractures -4. OsteoSeveral studies have shown more or less severe impairment of HRQOL in patients who have experienced vertebral or hip fractures . The extVertebral fracture can be classified into two major categories, subclinical and clinical. Studies of patients with subclinical as well as clinical vertebral fractures show association with decrements in function and HRQOL. The decrement is greater when the number of fractures is higher and the severity is greater ,17.It is noteworthy that only a few clinical trials have shown treatment benefits regarding HRQOL -21. SeveThe objectives of the present study were to (i) investigate the changes and long-term impact of vertebral or hip fracture and between fracture groups on HRQOL in postmenopausal women prospectively between two and seven years after the inclusion fracture, (ii) compare HRQOL results between fracture and reference groups and (iii) study the relationship between HRQOL and physical performance, spinal deformity index and bone mineral density at seven-year follow-up.The main inclusion criterion was participation in and completion of the previous two-year follow-up study of women with a newly diagnosed vertebral or hip low-energy fracture, in this paper called the inclusion fracture. The exclusion criteria were refusal to participate and impairment of mental or physical health hindering a subject from providing measurement, correct information and completing the questionnaire.The participants were invited by phone and post during the period of February through August 2006. The seven-year follow-up was performed a mean of 7.0 years (SD 0.5) after baseline examination. The examinations took place at the University Hospital in Linköping and the osteoporosis unit at Ryhov Hospital in Jönköping, in Sweden. Patients were originally recruited through a written invitation sent to 600 consecutive women with a new low-energy fracture of the distal forearm, proximal humerus, vertebra or hip, as described earlier ,31. In tA dropout analysis between the missing group (n = 24) and the women (n = 67) participating in the seven-year follow-up, using certain data from the two-year follow-up, showed that the missing group had significantly lower values regarding the SF-36 within the general health and social function domains. They had also lower weight, body mass index and bone mineral density in the hip. Age did not differ.At two-year follow-up, the patients were prescribed continued osteoporosis medication for the ensuing year, and were referred to their general practitioner for further treatment.An age and sex-matched reference group was chosen from a large local population study in Östergötland County, Sweden, called "Östgötens Hälsa 2006", to obtain normative values for HRQOL measured using the Short Form 36 (SF-36) questionnaire. The reference group was handled like a normal background population, recruited from the same general population area during 2006. The SF-36 was mailed to a stratified random sample of 13,440 people aged 18 to 84 years. After two reminders, 7,238 (54%) had responded. For the women aged 65 to 84, 1,144 (68%) had responded. The population study comprised 804 women aged 64 to 82 years, who formed the reference group . From the reference group, women aged 70 and 75 years were compared and showed stable values in all domains, except for vitality, which was significantly lower in the elderly women (59.0 vs. 69.7) .In this study, a longitudinal design was used to answer the purpose (i) and a cross-sectional for (ii) and (iii). The participants gave their oral informed consent before the visit and written informed consent at the visit. The study was approved by the Regional Ethical Review Board at the Faculty of Health Sciences, University of Linköping 2005, registration no. M173-05, and was performed in accordance with the Declaration of Helsinki.The Short Form 36 of the Medical Outcome Study was used as a main outcome measure of HRQOL . StudiedBefore a patient's visit to the osteoporosis unit, a self-administered questionnaire was sent to her containing questions about previous fractures, falls, concomitant diseases, treatments and lifestyle factors of importance for osteoporosis and fracture risk. A seven-grade scale was used to assess leisure-time physical activity level, modified from the original four-grade scale by Saltin and Grimby . The phyThe SF-36 questionnaire was sent to the patient before the visit, and she was asked to answer the questions on her own. If she had not completed the questionnaire before arriving at the unit, she was encouraged to do so before the examination started.The SF-36 questionnaire comprises 36 items, with two to six response options according to an ordinal scale, assessing eight health concepts or domains: physical function (PF), role limitations due to physical health problems (RP), bodily pain (BP), general health (GH), vitality (VT), social function (SF), role limitations due to emotional problems (RE) and mental health (MH). Each domain allowed a score of 0-100, with a high score indicating better HRQOL. The SF-36 has been evaluated extensively regarding both reliability and validity according to Swedish conditions .2. Body height and weight were measured in indoor clothes without shoes. Physical function was assessed by measuring handgrip strength and one-leg static balance testing. Handgrip strength (kg) was measured in the dominant hand using the standard JAMAR, an electronic dynamometer. For standardization, the adjustable handle was set at the second position for all women. Participants sat comfortably with their elbow flexed at 90 degrees and their shoulder adducted and neutrally rotated. Each test was performed three times and the mean value was used. Reference values were obtained from Mathiowetz et al. [During the visit, each patient was assessed by the first author (IH). Body height (m) was registered using a stadiometer and body weight (kg) using a calibrated scale. Body mass index (BMI) was calculated using the formula kg/mz et al. and werez et al. ,41.Bone mineral density (BMD) was measured using dual-energy X-ray absorptiometry of the lumbar spine and hip, non-dominant side. Internal variation was checked regularly with an everyday calibration using a phantom. As a reference for BMD in the hip we used the NHANES III and for ≤-2.5) at lumbar spine or hip total, and osteopenic if the lowest of these values was between <-1 and >-2.5 SD [A patient was classified as osteoporotic if T-score was 2.5 or more standard deviations (SD) below the mean value of young normal , standard deviation (SD), confidence interval (CI) and percent. Differences in basic characteristics between vertebral and hip fracture groups were tested using Student's unpaired The parametric methods as statistic analytic techniques were chosen in order to adjust for the sampling weights design in the reference group, regarding normative values for SF-36. The reference group was randomly selected from the population registry and weight-adjusted for age to fit with the age distribution for the patient group in this study. For the SF-36, items within each domain were coded, scored and summarized to derive the eight domains. The scores were then translated into a 0-100 scale where 0 indicated the worst possible HRQOL and 100 the best, according to the manual and interpretation guide for SF-36 . SF-36 st-test within each fracture group, to measure the change between two-year and seven-year follow-up. To determine the mean value differences between hip and vertebral groups regarding change, we used Student's unpaired t-test and ANCOVA while controlling for the effect of covariates, age, new co-morbidity since two-year follow-up and new low-energy fracture since two-year follow-up. We also reassembled the entire group into the groups new fracture since two-year follow-up (n = 29), no new fracture since two-year follow-up (n = 38), new co-morbidity since two-year follow-up (n = 46) and no co-morbidity since two-year follow-up (n = 21).Statistical analyses regarding aim (i) employed Student's paired t-test. To determine the differences between hip and vertebral groups we used ANCOVA while controlling for the effect of covariates, age, new co-morbidity since two-year follow-up and new low-energy fracture since two-year follow-up.Regarding aim (ii), the SF-36 of the fracture and reference groups were compared using Student's unpaired p-value was < 0.05 (2-sided) [® for Windows version 15.0 .With regard to aim (iii), a partial correlation was used in which the relationship is measured, controlling for the effect the covariates have on both variables. Variables in the partial correlation were the eight SF-36 dimensions and static balance on dominant leg with eyes open, handgrip strength on dominant hand, spinal deformity index (SDI), physical activity, bone mineral density in hip total, and fall frequency the past year. The covariates were age, new co-morbidity since two-year follow-up, new low-energy fracture since two-year follow-up and fracture group . Differences were defined as significant if the level of 2-sided) . All staOf the 67 patients in the total study group, 42 had suffered a vertebral fracture and 25 a hip fracture shortly before the baseline study (inclusion fracture). The mean age (SD) of the entire study group was 75.5 (4.6), range 64-82 years at seven-year follow-up. A total of 51% were married or cohabiting.At seven-year follow-up, 29/67 women had sustained one or more new clinical low-energy fractures, in total 49 fractures since two-year follow-up. More patients in the vertebral group (22/42), than in the hip fracture group (7/25), had sustained a new clinical fracture. In the hip fracture group at seven-year follow-up, nine women were identified as having one or more vertebral fractures. Six of these women had no previous thoracolumbar radiographs, and the true baseline prevalence and the seven-year incidence of vertebral fracture in this group are unclear. In one woman the vertebral fractures were known before the inclusion, and two women had new vertebral fractures compared with the previous radiographs.p = 0.02). In the vertebral fracture group, 48% took painkillers regularly, 24% sometimes and 28% never. In the hip fracture group, 32% took painkillers regularly, 20% sometimes and 48% never, a non-significant difference (p = 0.263). The most frequently used painkillers were paracetamol (93%), opioids (44%) and NSAID (41%) alone or in combination, regularly or as required.Back pain during the past 14 days was reported to be disturbing (GRS >30 mm) by 36/42 in the vertebral fracture group and by 15/25 in the hip fracture group, a significant difference . Overall, 69% women reported one or more new co-morbid conditions of greater importance since two-year follow-up. The incidence of new co-morbidity did not differ between the fracture groups. The total number of reported new co-morbid conditions was 71 , the most frequent being cardiac disease, 25 , rheumatic or musculoskeletal, 15 and bronchi-pulmonary disorders, 7 . Further basic characteristics of the two fracture groups are presented in Table Bisphosphonate treatment was currently being used by 34% women, 15/42 and 8/25 respectively, The vertebral fracture group had no statistically significant changes in any SF-36 domains except bodily pain, which had decreased significantly at seven-year follow-up, indicating increased pain. The hip fracture group had no significant changes in any domains Table . HoweverThe group with new fracture (n = 29), of whom 22 belonged to the vertebral group, had significantly lower values at seven-year follow up regarding role-physical, bodily pain, general health and social function . The group with no new fracture (n = 38), of whom 20 belonged to the vertebral group, had no significant changes. The group with new co-morbidity (n = 46) had no significant changes, and neither the group without new co-morbidity (n = 21).The vertebral fracture group had significantly lower scores than the reference group in all domains, except for general health and mental health.Women with hip fracture did not differ from the reference group regarding any SF-36 domain, but better values were found for their mental health , with a mean loss since baseline visit of 21 mm (SD 19) in the vertebral fracture group and 19 mm (SD 16) in the hip fracture group. Further basic characteristics of the two fracture groups are shown in Table Handgrip strength was significantly better in the hip fracture group, 19.8 (SD 5.0), compared with that of patients with vertebral fracture, 16.7 (SD 6.6). Static balance, standing on one's dominant leg with one's eyes open, did not differ between the fracture groups. Body height was significantly higher in the hip fracture group. Height loss did not differ significantly between the groups (T-score ≤-2.5), 54% had osteopenia/low BMD (T-score <-1 and >-2.5) and 5% normal value (T-score ≥-1.0) in the hip and/or spine. In the hip fracture group, 50% had osteoporosis, 42% had osteopenia/low BMD and 8% normal value. Additional BMD Z-score data are presented in Table Bone mineral density (BMD) did not differ significantly between the vertebral and hip fracture groups. According to the WHO criteria , among wAccording to the lateral radiographs of the spine in the present seven-year follow-up, 51 women had one or more vertebral fractures . Sixteen women in the hip fracture group had no vertebral fracture. In the group with vertebral fracture(s), SDI was 7.8 (6.1 SD) and range 1-25, and in the hip fracture group SDI was 2.3 (4.2 SD) and range 0-15. Seventeen patients had one vertebral fracture and eight patients had two fractures, and as many as 48% of the women had three to nine vertebral fractures. Two patients had nine vertebral fractures, SDI 23 and 25, respectively.In the total fracture group (n = 67), physical activity correlated positively with all domains except the role-emotional one, static balance showed a significantly positive correlation to most of the SF-36 domains, except social function and role-emotional function. Also, handgrip strength showed a significantly positive correlation to role-physical, vitality and mental health. Fall frequency showed negative correlation with bodily pain and vitality. BMD in the hip and SDI was not significantly correlated with SF-36. These data show the relationship between the two variables, controlling for the effect of covariates Table .The present study, which to our knowledge is the longest published prospective follow-up study regarding HRQOL after vertebral or hip low-energy fracture in routine health care, supports and provides more details to the hypothesis that vertebral fractures have a severe long-term impact on HRQOL, assessed using the SF-36.The vertebral group scored lower than did the reference group in most domains at seven-year follow-up. Also, bodily pain had deteriorated between two and seven years and might be explained by new fracture. The total group with new fracture since two-year follow up also had lower values at seven-year follow-up, which can be interpreted as the vertebral and hip fracture groups with subsequent fractures having poorer self-rated health, measured using the SF-36 at seven-year follow-up. A recent study with five years of prospective data about the long-term impact of incident fractures on HRQOL supports these findings The hip fracture group had stable values in all domains between two and seven years. Regarding the hip fracture group, it should be noted that the mean age of the patients was 68 yr at the time of the fracture, and most of them were able to return to active life. Hip fracture at this relatively early age is thus mainly a transient problem for the patient in contrast to the case of vertebral fracture. The hip fracture group, despite the incident or prevalent vertebral fracture(s) in nine women, did not differ from the reference group regarding HRQOL after seven years, and even had better values for mental health.In this study the vertebral fracture group had lower scores than the hip fracture group in bodily pain, vitality, role-emotional function and mental health at seven-year follow-up after controlling for age, new fracture and new co-morbidity.These findings support the suggestions from previous cross-sectional studies that pain and disability after vertebral fracture do not fade away ,24,25 unThe patients were prescribed, and most took, treatment for the first three years, but at seven-year follow-up only 34% were still on active anti-osteoporosis treatment, and their true compliance is not known. Is this due to a lack of continued prescription or to non-compliance by the patients?The effect of more intensive treatment strategies should be evaluated further, for both pharmacological and non-pharmacological treatments. Increased bone mineral density and reduced fracture incidence are a good start, but patients' well-being also has to be taken into account. According to current recommendations, all patients still fulfilled the criteria for active anti-osteoporosis treatment .The partial correlations show relationships between HRQOL and physical activity, static balance, and handgrip strength, and in some domains fall frequency, despite controlling for covariates such as age, fracture group, new fracture and new co-morbidity. Static balance, expressed as the ability to stand on one leg with one's eyes open, is often used as a clinical test of balance, and is considered to be sensitive to age-related changes in balance and an iDixon et al. (2005) found an association between low handgrip strength and low bone mineral density and an increased risk of incident vertebral fracture in the European Prospective Osteoporosis study (EPOS) .The results support the value of the SDI as a meaIn the present group, as many as 29 of 67 (43%) had one or more new fractures during the five-year period (since two-year follow-up). This high fracture incidence may be ascribed to the degree of osteoporosis as well as to the less ambitious treatment.A prospective three-year study showed that for each new vertebral deformity, HRQOL deteriorated further . SimilarThe question of whether the poor HRQOL and the poor survival in patients with vertebral fracture are actually due to the fractures, increased biological age or concomitant diseases is important and may be pivotal to attitudes regarding osteoporosis treatment ,11,12. RApproximate expected mortality during the five-year period (since the two-year follow-up) for the two fracture groups was assessed on age-specific death risks in Sweden 2006 . The ageThe results of this study thus support previous reports that vertebral fractures are associated with increased pain, impaired physical function ,7, decrePharmacological as well as non-pharmacological treatments and methods have to be considered. Malmros et al. (1998) found positive effects from a ten-week ambulatory exercise programme with physiotherapy on chronic pain, balance, physical function and quality of life . There iSome methodological issues need to be considered. Multiple testing increases the risk of obtaining a significant difference purely by chance; therefore, the results should be interpreted with caution. However, if a simple sequentially rejective multiple test procedure (Holm's method) had been used , most ofFor the most part, our results show clinically significant differences. A half standard deviation is a conservative estimate of clinical significance, but the minimally important difference may be below 1/2 SD in specific cases .Many patients adapt over time, and their perceptions of HRQOL may change. Learning to cope with problems is a well-recognized characteristic of the chronically ill. Also, patients may meet others whose condition is worse or better than their own, which can lead to a revaluation of their own internal standards and values.Response shift is a psychological phenomenon that results from coping caused by the affecting internal standards or values . A respoIn this study, we chose to use a generic HRQOL questionnaire instrument, to be able to make comparisons with a reference group. It is possible that the outcome would have been different if we had used an osteoporosis-specific questionnaire on HRQOL. However, at the start of the baseline study there was no disease-specific questionnaire available that had been translated into Swedish and validated.A limitation of the study is the small number of women, particularly in the hip fracture group. A baseline radiograph of the lumbar and thoracic spine was performed for only one woman with a hip fracture as inclusion fracture and, therefore, the true prevalence of vertebral fractures in this group at baseline is unclear.The reference group was handled like a normal background population, and we lacked data concerning co-morbidity and fracture status, which would have been advantageous to have in order to adjust for possible covariates. The missing group of 26% since two-year follow-up could have affected the result. A dropout analysis between the missing group and the women participating in the seven-year follow-up, using data from the two-year follow-up, showed that the missing group had significantly lower values regarding the SF-36 as well as lower weight, body mass index and bone mineral density in the hip. This can be interpreted as the missing group having poorer health, and the result at seven-year follow-up possibly leading to an overestimation of SF-36 scores for the vertebral and hip group.The low doctor compliance with treatment may be regarded as a limitation, but indeed allows the study expose the symptom development in a poor-treatment or non-treatment situation. We studied only Caucasian women, and the results may not apply to other ethnic groups or men.Strengths of the study are its prospective design and the fact that all participants were investigated using well defined methods. The advantages of using the SF-36 were the possibility to assess and compare HRQOL in individuals suffering from different co-morbidity and supplying reference data for the general population. Another strength is the large reference group for the SF-36 recruited from the same general population during 2006.This study demonstrates that women who had had vertebral fracture as inclusion fracture had remaining pronounced reduction of HRQOL at seven-year follow-up. A decreased HRQOL since the two-year follow-up might be explained by new fracture.In the age span of 64-82 years (mean age 75.5), the prevalence of vertebral fracture suggests more negative impact on HRQOL, more severe osteoporosis and a poorer prognosis than a hip fracture does. The differences in HRQOL between vertebral and hip fracture at seven-year follow-up cannot be explained by age, new disease or new fracture. Women with hip fracture did not differ from the reference group regarding HRQOL, despite vertebral fractures in nine women.The long-term reduction of HRQOL and its relationship to physical activity, static balance, and handgrip strength raise questions that warrant more investigation. Furthermore, HRQOL studies with more effective treatment including non-pharmacological intervention are needed, and the development of strategies to prevent loss of function and improve HRQOL after vertebral fracture remains an important goal for future research.The authors declare that they have no competing interests.IH participated in the design of the study, conducted patient recruitment, collected the data, performed the statistical analyses, and clinical evaluation, and drafted and revised the manuscript. M B-L participated in the design of the study, analysis and interpretation of data, statistical and clinical evaluation, and the progress and revision of the manuscript. SH participated in the design of the study regarding vertebral fracture assessment and evaluated all the radiographs. GT participated in the design of the study, analysis and interpretation of data, clinical evaluation, and the progress and revision of the manuscript. A-C E participated in the design of the study, analysis and interpretation of data, statistical and clinical evaluation, progress and revision of the manuscript, and served as project supervisor. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

A PSO is adopted for descriptor selection in the quantitative structure-property relationships (QSPR) of a dataset of 74 chiral guests due to its simplicity, speed, and consistency. The modified PSO is then combined with SVMs for its good approximating properties, to generate a QSPR model with the selected features. Linear, polynomial, and Gaussian radial basis functions are used as kernels in SVMs. All models have demonstrated an impressive performance with It has received increasing attention in the pharmaceutical field for modifying drug physicochemical properties, such as solubility, stability and bio-availability, reducing their toxicity and side effects, and suppressing unpleasant taste or smell –4-glycos.The high interest in the stability constants of CD-host complexes has initiated the search for proper models for predicting these association constants or the related free energies of complexation. The aim is not only to select convenient CDs for the complexation of a particular compound, but also to get some insight into the physico-chemical parameters influencing the affinity between host and guest molecules. The availability of a large amount of experimental data led to several interesting predictive models. The inclusion reactions of a series of benzene derivatives were used for a correlation model . DiverseIn this study, two novel approaches, Binary Particle Swarm Optimization (BPSO) and SuppSeveral factors such as number of atoms, van der Waals surface area, ionization potential, molecular weight, molar refractivity, atomic connectivity index, molecular flexibility, and angle bend energy, etc., influence thermodynamic properties. Only some of these factors strongly affect these thermodynamic properties and are controlled or set up in advance. The selection of these parameters is traditionally conducted by multiple linear regressions, partial least squares, and principle component analysis methods. Consequently, their assumptions must be verified and validated before the developed model can accurately be used. This results in a predictive model which may compromise the quality of the obtained products and/or efficiency of the modeling process.With the increasing need for more accurate and practical evaluation QSPR models, techniques in artificial intelligence, particularly Artificial Neural Networks (ANNs), are receiving more attention in industry and academia today because they can be used to learn relationships between thermodynamic properties and their parameters. However, a number of parameters such as network topology, learning rate, and training methods have to be fine-tuned before they are deployed successfully. Furthermore, drawbacks like local optima, overfitting, and long learning time tend to occur.Theoretically, the aforementioned shortcomings of ANNs have been countered by the development of Support Vector Machines. Unlike ANNs which minimize empirical risk, SVMs are designed to minimize the structural risk, by minimizing an upper bound of the generalization error, rather than the training error. Therefore, the overfitting problem in machine learning is solved successfully. Another outstanding property of SVMs is that the task of training SVMs is mapped to a uniquely solvable linearly constrained quadratic programming problem. This produces a solution that is always unique and globally optimal. They have been extended to solve regression problems as well.In this paper, Support Vector Regression (SVR), which is based on Support Vector Machines, is investigated as an alternative technique for QSPR prediction. It has shown very good results for function approximation of Quantitative Structure-Activity Relationships (QSAR) . The SVRR) is then treated as the objective function for a formulated optimization problem. Our previous paper . If the current value is better than pbest[i], then pbest[i] = current value and the pbest location, pbestx[i][d], is set to the current location in d-dimensional space.Compare the evaluation with the swarm’s previous best value, (pbest[gbest]). If the current value is better than pbest[gbest]), then gbest = current particle’s array index.Change the velocity and position of the particle according to the following equations, respectively:Loop to step 2 until a stopping criterion, a sufficiently good evaluation function value, or a maximum number of iterations, is met.PSO was introduced by Kennedy and Eberhart to imitang steps ,29:Initth particle in the dth dimension, can only take on a binary value, instead of a real valued number. This indicates whether the dth feature is selected or not. Note that the D dimensions above are equal to the total number of descriptors. After the update step still presents the same advantages as the original PSO. The near-optimal solutions are found much faster, compared with the performance of a random search or an exhaustive search. This allows BPSO to perform feature selection efficiently in datasets with large numbers of descriptors. The objective function evaluated by the BPSO is the Pearson correlation coefficient that measures the quality of QSPR model with the selected features:N is the number of training compounds for regression and iy and iŷ are the measured and the predicted activities of the ith compound, respectively.In feature selection, the input presented to the regression modeling is in the form of a table where the rows represent chemical compounds and the columns are the molecular descriptors. Each compound contains a value for each corresponding factor. How accurately a QSPR model can predict the biological activity of the compounds depends on their values in a subset of the selected features. Hence, the selection of each column or feature is treated as a binary number. A numerical value of zero is used to represent that the corresponding descriptor is not selected for QSPR modeling. Otherwise, a numerical value of one is assigned. This binary problem calls for some modification of the original PSO. Thus presentx[i][d], which represents the value stored by the iate step , presentate step , and a i2.3.K), the standard free energy (ΔG°), the enthalpy (ΔH°) and the entropy change (TΔS°) for the 1:1 inclusion complexation of enantiomer pairs of 74 selected chiral compounds with β-CD were taken from the experiments of Rekharsky and Inoue [The complex stability constant , resulting in a QSPR model developed by SVMs. The linear approximation is a fundamental concept of SVMs. Some of the most widely used kernels, such as linear, polynomial, and Gaussian radial basis functions (RBF) were tested in this study. This adds the capability to approximate both linear and nonlinear functions. Both PSO and SVMs were implemented in MATLAB 7.0.4 running on a Pentium IV (2.4 GHz) computer. The correlation coefficient for all PSO-SVM models are the average values from 10 calculations.The PSO was adopted for major descriptor selection in QSPR of the chiral guest dataset. Swarm parameters are 50 particles and 100 iterations. The iterative PSO attempts to select the key features that maximize the Pearson correlation coefficient (3.2R for training set (2TrainingR) higher than 0.8. The nonlinear kernels give better results than the linear function for the training chiral guest dataset. The polynomial kernel, with 2TrainingR between 0.9991 and 0.9994, has better calibration correlation coefficients than the Gaussian RBF kernel, whereas the Gaussian RBF gives much better predictions than those obtained with the polynomial SVM. These agree with our previous work [ous work , in whicThe numbers of descriptors in the QSPR models of these thermodynamic properties are further investigated by using the Gaussian RBF kernel, which gives the best outcome for the chiral guest dataset. The statistics for all PSO-SVM models are given in K, ΔG°, ΔH° and TΔS° by PSO-SVM integration against the experimental values are shown in H° and TΔS° predictions by four features, PSO-SVM models indicate that cmp. 32 is the maximum outlier. Considering the values in H° of cmp. 31 and cmp. 32 are −15.5 and −8.3 kJ mol−1, and TΔS° are −8.3 and 0.4 kJ mol−1, respectively. The experimental results have different values for this enantiomeric pair, whereas the PSO-SVM models have identical results: ΔH° = −13.02 kJ mol−1and TΔS° = −6.63 kJ mol−1.Even though PSO-SVM methods are not able to explain the values of descriptors in the models, the maximum outlier from the QSPR models can point out the error of the experimental data. In Δ4.K, ΔG°, ΔH° and TΔS°, by considering major selected features. The combination of the adopted methods showed satisfactory results with the large dataset.This work demonstrated that the combination of PSO and SVMs can be applied to effectively and efficiently select major features in QSPR modeling of the thermodynamic parameters of 1:1 inclusion complexation of enantiomeric pairs of chiral guests with β-CD. This responds to the needs of drug designers for prediction of the thermodynamic parameters of new compounds in complexation with β-CD. The method was based on a discrete binary modification of PSO. The fitness function was the Pearson correlation which was curve fitted by SVMs. The modified PSO appeared to be an effective and efficient algorithm, which robustly finds near-optimal and consistent results with short computer code and simple mathematical operators, while converging rather quickly. The SVMs showed excellent performance in predicting ln

Universal newborn screening for early detection of children affected by sickle cell disorders and cystic fibrosis is currently being implemented across England. Parents of infants identified as carriers of these disorders must also be informed of their baby's result. However there is a lack of evidence for most effective practice internationally when doing so. This study describes current or proposed models for imparting this information in practice and explores associated challenges for policy.Thematic analysis of semi-structured interviews with Child Health Coordinators from all English Health Regions.Diverse methods for imparting carrier results, both within and between regions, and within and between conditions, were being implemented or planned. Models ranged from result by letter to in-person communication during a home visit. Non-specialists were considered the best placed professionals to give results and a similar approach for both conditions was emphasised. While national guidance has influenced choice of models, other factors contributed such as existing service structures and lack of funding. Challenges included uncertainty about guidance specifying face to face notification; how best to balance allaying parental anxiety by using familiar non-specialist health professionals with concerns about practitioner competence; and extent of information parents should be given. Inadequate consideration of resource and service workload was seen as the main policy obstacle. Clarification of existing guidance; more specific protocols to ensure consistent countrywide practice; integration of the two programmes; and 'normalising' carrier status were suggested as improvements.Differing models for communicating carrier results raise concerns about equity and clinical governance. However, this variation provides opportunity for evaluation. Timely and more detailed guidance on protocols with clarification of existing recommendations is needed. Part of the newborn bloodspot programme , universBoth SCD and CF are recessively-inherited disorders and carriers are healthy. Newborn screening for SCD identifies all carriers of structural haemoglobin variants but not thalassaemia carriers and there is no available method of testing without detecting carriers. The national protocol for CF screening in England aims to identify a maximum number of children with CF whilst minimising the number of carriers. The protocol involves an initial immuno-reactive trypsinogen (IRT) measurement which identifies babies at high risk for CF. These samples are further tested by a two-stage DNA screen for a small panel of CF mutations. Those with two mutations will have CF. For those with only one mutation or no mutation detected but with a very high initial IRT, a second blood sample will be requested and a further IRT measurement performed at 21–28 days when it is more discriminatory. While an elevated IRT itself does not select in favour of carrier status, most of these babies will be carriers defined by limited DNA testing. However, because not all mutations are identified, a small proportion of those defined as carriers may actually have two CF variants and have the condition .With a SCD incidence of 1:2400 affected babies per year in the UK, the NHS Sickle Cell and Thalassaemia Screening Programme estimate that about 8000 newborn carriers were detected in 2006 from about 550,000 babies screened . Cystic Prior to national programmes, newborn screening was mostly offered on an ad hoc basis, with universal CF screening available to 20% of babies for over 15 years and over 10 years for SCD in some areas in London, East of England and Birmingham. Over this period, although practice for informing parents of their infants' carrier status has varied according to condition and locality , the neeThis paper reports findings from a descriptive study, part of a larger study funded by the Health Technology Assessment programme also expSemi-structured telephone interviews were conducted (by HP) with the Regional Child Health Co-ordinator from each of the nine English health regions during the second half of 2006. Consent to be interviewed was initially obtained by email and again verbally on tape at the start of the interview.Participants were invited to reflect on the extent of regional implementation of CF and SCD newborn screening, actual or proposed models for giving results, the need for condition specific models, who should give the results, and suggestions for improving current practice and policy. Respondents were also able to raise other issues of importance relevant to the subject. Where informants were unable to provide sufficient details, brief telephone calls or emails to specialist services were used to acquire supplementary information. Interviews were tape-recorded and transcribed verbatim. Data were thematically coded and analysed according to emergent themes. Interviewees were invited to give feedback on a draft version of this paper prior to submission for publication.The study was approved by the West Midlands Research Ethics Committee.Participants reported a variety of models, proposed or already operational, for imparting carrier results for imp'... because there were lines being drawn in the sand as to who should actually do this information, who should actually give this information and obviously we knew that Cystic Fibrosis was coming...so I adopted the model for the Sickle screening programme as well.' (CHC 04)Inadequate funding has affected implementation of both the delivery of screening and in particular the choice of methods for communicating carrier results. This has necessitated efforts to secure funding from local sources; often short term and dependent on an individual manager's resourcefulness or sway within the local health system. Where no additional funds could be realised, existing staff have had to take on communication of results in addition to their usual workload. Inevitably, these financial constraints have, in some regions, led to compromise and 'quick fix' models for communicating carrier results.'...I don't think there was due consideration given to the workload associated with giving carrier results and I think that was an oversight. There doesn't seem to have been any thoughts on how it would be... It needs to be properly accounted for, like we introduce services and they give 4 quid a baby for the lab but it affects every different component part of the service. It affects the midwives and their counselling, it affects the health visitors giving the results and it affects the child health record departments who have to adapt their systems of working to record the results.' (CHC 02)it's [informing carriers]all done on goodwill, the PCTs are asking where's the funding for this? And obviously it does take up some time, some practitioners' time.' (CHC 04)'... Specialist services have been operational in high prevalence HD areas long before the introduction of universal newborn screening. Bringing distinct advantages, such as expertise and referral protocols, a consequence is that regional plans for models of carrier results have to incorporate existing practice and organisational structures, resulting in less scope for innovation in some areas. Requesting changes to existing practice was a challenge, leading some interviewees to prefer starting service planning from scratch.it was easier to do the area that was a blank sheet because then you could do how best fitted what the geography and, you know, where the funds and all those sorts of things available were and you've also got some handle on what they do and can say what they should or shouldn't do. Whereas when there's already something in place it's harder isn't it?' (CHC 08)'...In contrast, there were concerns about reporting results in low prevalence HD areas due to lack of resources and practitioner knowledge. Thus, although low prevalence settings provided opportunities for trying out new models of result giving, in some areas urgency of need necessitated rapid implementation before localities were sufficiently prepared to deliver results.'Our real problem has been our low prevalence areas...it was little bit hit and miss to be quite honest. We had a case... where we found 60 children hadn't been given results. And that was a bit...because people didn't know quite what to do with it, how to do it...' (CHC 05)Regional implementation groups were a common mechanism for discussion and planning of proposed models. For some, the challenge was to find a fit between national guidance and local resources and preferences. Regions who consulted widely about this specific issue and ensured extensive health professional engagement found that the process benefited implementation of the screening programme as a whole.'I think without doubt the implementation has brought more people around the table...and trying to ensure that there is linkage and involvement across the whole of the screening profession. So making sure that every professional group, primary, tertiary and secondary level specialists have been involved in that decision making has been beneficial.' (CHC 07)With some exceptions, most interviewees expressed a strong preference that conveying carrier results should be a task undertaken by non-specialist health professionals. During interviews respondents used the term 'specialists' when referring to genetic counsellors, Haemoglobinopathy counsellors and Cystic Fibrosis nurses and regarded all other health professionals involved in communicating carrier status information as 'non-specialists'. Key to this position was the view that carriers were healthy. Utilising a specialist practitioner in this role could cause parents to believe that their baby was ill and increase their anxiety. Specialist time was more appropriate for providing further information to families who wanted to know more or wanted to discuss future reproductive decisions. While support for non-specialists giving results was consistent, informants were uncertain about how best to balance allaying parental anxiety by using a non-specialist and concerns about practitioner competence.And we would like for them [specialist HD counsellors] to spend more time doing the specialist stuff that a health visitor couldn't possibly do... for the carriers it's quite a large workload and yet it doesn't need super-specialist people, it needs somebody with some extra training and some expertise and it's sort of half-way house.' (CHC 06)'Respondents working in regions where specialists were currently involved in giving results did not see this as a problem, though they were not insistent that specialists should be involved. In one region concern had arisen about non-specialists giving CF carrier results because of the small risk that some carriers may be affected.The importance of involving the family's usual HV in giving results was highlighted as the best way to minimise parental anxiety; either as the sole professional giving the results, or visiting the family together with a specialist or purpose trained non-specialist. Ensuring appropriate training for HVs was an important consideration. Whether to train all to give results, knowing that some may never come across a carrier case, or to concentrate training to a selected group who would take on this role and accompany the family HV remained an ongoing debate for some regions.it seems to me that the best person to give the results so that it isn't worrying is in the middle of a routine health visitor visit without the phone call to say, ' hey can I see you', especially because in a sense that's making anxieties. But how do we maintain competence if even at local level you know no health visitor is going to be doing it every week say or even once a month so I think there's actually a real dilemma... ' (CHC 06)'...None of the interviewees were in favour of separate models for the two conditions. Two respondents, who had not yet implemented CF newborn screening, wanted to await further experience while others expressed strong preference for similar models and for close working between the two screening programmes. Another suggested that the difference between carrier results for the two conditions was over stated.'...I think there should be [the same model] ...I've thought about this quite a lot because with cystic fibrosis the results can be difficult to interpret and some of the mutations the significance of those isn't known. But then I thought with sickle cell screening some of the haemoglobin variants, the significance of those is unclear so the results of that can be equally as difficult to interpret and not always straightforward'. (CHC 01)A common view was that there were more similarities, such as carrier status, recessive inheritance, and skills required to inform parents, than differences between the conditions. Therefore, it appeared logical to have the same protocol and organisational structure, albeit with some variation, for giving results.'Well when we were putting the whole system [SCD newborn screening]into place in the back of our mind all the time was the fact that CF has got to roll out and it makes sense to use the same mechanism because the counselling skill is the same isn't it? You know, telling somebody that there's a problem with their baby and this is the genetics and you know, that sort of skill...a counselling skill is a counselling skill really isn't it?' (CHC 08)'I would think it should be the same method, you know, I think it should be. Ideally I mean it's the same recessive condition that you're describing, the same genetics involved so you know I'd be of the opinion you could do both.' (CHC 03)Parity in methods for the two conditions was also seen as a way of addressing longstanding inequity in NHS service provision for HD compared to CF.I think it [methods for giving carrier results]should be standard but...because I do find it...I do find it personally irritating that there's this difference between sickle cell and CF. And professionally I think, well sickle cell is a genetic condition so why don't clinical genetics see it as their remit a little bit more because it is an inherited condition... but that's always been the way. Sickle cell services seem to have existed running parallel to clinical genetics and erm...so as I say, it's [Haemoglobinopathy Disorders]probably a bit of Cinderella area...' (CHC 01)'The need to clarify what was meant in the guidance by 'communicating in person' was a priority. Personal informing was seen as a costly process and some respondents suggested that an appropriate leaflet with contact details for further information could be as effective as a personal visit. Others considered using only written information unsatisfactory as varying reading levels would increase misunderstanding and service providers would not know that parents had received the information.'...I think we need a better definition of what is 'communicated in person' because you could interpret that, couldn't you, as here's the leaflet read it, it could be here's the leaflet shall we go through it together...erm...through the whole thing about you know a specialist ringing up and saying nothing to worry about but I need to see you...erm... The other thing is in the 'in person', I mean if you've got a family that don't speak English...if the health visitor doesn't speak their language but goes in with a leaflet in the right language you know, is that a face to face contact or whatever?' (CHC 06)A nationally agreed protocol for informing carriers with clear expectations of what information needs to be communicated to parents and practitioner roles, more detailed than current guidance and similar for both conditions, was suggested.Well, it's about clear expectations. About making sure that there is clear linkage of what you do next. I think if you are going into a family to give a result, it is not just good enough to give a result and to give a leaflet. You must provide the next level of intervention. And that next level in intervention is about listening, and then signposting and very clearly where you go next. And it isn't just about saying 'go to your GP and they might refer you to clinical genetics' because some GPs may not. So I think that needs to be really erm...agreed before we sort this out. What is the kind of things if people want further support? The other thing that needs to be clear, so that the Health Visitors are very clear, is about we are not asking them to become genetics experts and we are not asking them to become Sickle Cell experts. ... we need to have some very clear role boundaries of what is expected and that is agreed boundaries and part of it is you may have a Health Visitor that is really interested and wants to do a lot more but is it appropriate?' (CHC 05)'Explicit national policy regarding cascade screening (testing of other family members), and whether and how to report results detecting non-significant haemoglobin variants would also be helpful. More practical proposals included scripts on what parents should be told, especially when handling contentious scenarios such as non-paternity; a leaflet for parents of SCD carriers (similar to the current CF leaflet); simplification of current leaflets; and review of when (timing) parents are told what the bloodspot test is for.As part of the call for continuity across both conditions, integration of the two programmes was presented as imperative to ensure consistency in practice .'The other stuff that we really, really need to do is to not to do something totally different for CF and for Sickle because we do an awful lot of going down different pathways and I don't think that makes any sense...the integration of the two programmes is just so important because it's really hopeless if they don't erm...because you get these mixed messages and you know you get it all being very special and very different. I mean it's one of the issues I think all children with chronic disease or carriers, they've got more in common through being children than they have in having a disease erm...and it seems to me we shouldn't be taking people into different pathways simply because they've got one type of disease.' (CHC 06)Respondents felt that giving results should be 'normalised' and incorporated into usual health care practice. Where possible, lessons could be learnt from other screening programmes where results may be equally worrying. Increased public awareness of the conditions and screening programmes was also mentioned as a way of allaying parental concerns about carrier status.'I think the biggest problem for the counsellors is getting across to the parents that carrier status isn't a disease and I think if we could raise the public's understanding of what Sickle Cell was, I think that would help them enormously because [otherwise]they've got to start from zero haven't they really. And bring parents up because it can come out of the blue can't it, they don't even know anything about it and then you're telling them that there's something wrong with their perfect baby.' (CHC 08)Although confident that this task was within a non-specialist remit, participants noted concerns about practitioner competence. In particular, General Practitioners' (family physicians) limited knowledge about the implications of carrier status was perceived as concerning and needed to be addressed.Creation of a new post for a designated health professional within a specific locality, described as a 'newborn bloodspot practitioner', to take responsibility for newborn screening carrier results for all conditions was proposed. This was seen as a practical way forward to facilitate continuity in liaison with laboratories and other stakeholders, and maintenance of professional competence in result giving.The pressing need for research evidence to inform current practice was emphasised. Participants wanted to know the cost-effectiveness of various models and parental preference for delivery format and information content.Recent US reports on CF newborn screening conclude that policymakers must consider the need for genetic counselling services and ensure adequate resources to support information giving prior to introducing newborn screening programmes ,16. EuroResearch with parents following newborn screening supports disclosure of carrier status and prefOur data on proposed models for imparting newborn carrier results across England suggest marked diversity, both within and between regions, and within and between conditions. Although influenced by national policy, other factors have shaped practice leading to pragmatic rather than ideal choices. Despite overwhelming support for a similar process for both conditions, only one region was implementing a similar model for both conditions and variance of methods was particularly noticeable for SCD carriers. This creates concerns about equitable service provision.Policy and accompanying funding may not address the full implications of introducing new newborn screening programmes in relation to giving carrier results and dealing with parental information needs. As funding has supported only the front end costs of the process, such as laboratory tests, health communities have had to find additional resources within existing budgets, which may result in less than ideal models for giving results.Though modest in scale, these interviews with stakeholders tasked with coordinating the implementation of newborn screening programmes are likely to have covered the full range of current models for giving carrier results in England. Our respondents' views may not have embraced perspectives beyond their own roles, for example those from antenatal screening or primary care, though, this would be unlikely to change the key messages and issues for debate raised here.Universal newborn screening for SCD and CF heralds a new era for genetic screening in England . While eFindings from this study raise important policy and practice issues for professionals with strategic and operational responsibility for implementing newborn screening. For example, the costly process of reporting in person, especially in terms of numbers of SCD carriers; challenges of maintaining non-specialist informant competence given small number of carriers per condition per year ; the need for more detailed national protocols; and equity and clinical governance concerns.Our description of current practice may encourage shared learning as newborn screening is rolled out, as well as a context to stimulate evaluation and research about methods for imparting carrier results. Immediate priorities are for practical support for implementation such as good information leaflets, national protocols for information giving, and additional resources to support carrier result communication. Evidence for best practice when imparting results will emerge over time as practice models evolve and adjust.The author(s) declare that they have no competing interests.HP devised the methodology, conducted and analysed the interviews and lead the writing, JK conceptualised the idea as principal investigator for the research of which this study forms part and assisted with drafting the paper, NQ contributed to design and assisted with writing, FU helped with analysis and writing. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

As part of our programme for developing predictive tests for normal tissue response to radiotherapy, we have investigated the efficacy of the cytokinesis-block micronucleus (MN) assay as a means of detecting interindividual differences in cellular radiosensitivity. A study was made of nine fibroblast strains established from vaginal biopsies of pretreatment cervical cancer patients and an ataxia telangiectasia (A-T) cell strain. Cells were irradiated in plateau phase, replated and treated with cytochalasin B 24 h later. MN formation was examined 72 h after irradiation as the number of MN in 100 binucleate cells. The method yielded low spontaneous MN yields (<7 per 100 cells), and mean induced MN frequencies after 3.5 Gy varied between cell strains from 18 to 144 per 100 cells. However, in repeat experiments, considerable intrastrain variability was observed (CV = 32%), with up to twofold differences in MN yields, although this was less than interstrain variability (CV = 62%). An analysis was made of the relationship between MN results and previously obtained clonogenic survival data. There was a significant correlation between MN yields and clonogenic survival. However, when the A-T strain was excluded from the analysis, the correlation lost significance, mainly because of one slow-growing strain which was the most sensitive to cell killing but had almost the lowest MN frequency. With current methodology, the MN assay on human fibroblasts does not appear to have a role in predictive testing of normal tissue radiosensitivity.

A recent paper presents an argument and mechanism for the possible stopping of clinical trials early based on opportunity costs.et al.Although we agree that the costs and opportunity costs of clinical trials need to be reduced wherever possible, we raise concerns about the motivation and mechanism for stopping clinical trials early raised by Lavery We argue that there are already enough acceptable criteria and actors in the clinical trials arena to justify early stoppage of clinical trials, and argue that factors other than efficacy need to be carefully considered, especially in developing country contexts. At present clinical trials are subject to oversight and amendment by sponsors, IRBs, regulatory authorities, host institutions, government health departments, DSMBs and various layers of community input and participation. While essential to the ethical and scientific conduct of a clinical trial, engagement and compliance with these parties has various financial, personnel and efficiency costs. Introduction of yet another player will only further increase this 'administrative drag'. The costs of this additional layer need to be factored against any proposed advantages.public health benefits, as the relative failure of condoms and VCT have shown [A completed Phase III randomised clinical trial can yield unequivocal efficacy data. Clinical trials with negative outcomes yield important scientific information. The Col 1492 study data on a failed microbicide has yielve shown ,7. The pOur second point is that clinical trials conducted in developing country settings involve significant investments in scientific and community capacity building. A narrow focus on the product itself, or its opportunity costs, overlooks the impact of stopping a clinical trial early on the morale and development of the participating scientists and related personnel, and on the host community. Furthermore, we cannot switch products without scientific data. Prior to commencement of the trial, participants and participating communities are informed of preclinical evidence of a particular product and the reasons why the product should undergo large scale human testing. If the product is then deemed less promising based on a newer product, the community will be justified in asking why the research was commenced in the first place if the scientist did not feel confident about its potential efficacy. In addition, what scientific justification will be used to argue that the newer product is going to be more efficacious? Pre-clinical data or early safety testing? Even if the community is forewarned on the possible switch, it does not negate enormous concern about the likely distrust the process may create. There is likely to be a temporal gap in switching products as it will involve new protocol, new approvals, training of staff (if we are able to retain the team) and re-educating the community.Clinical trials are rightly increasingly expected by developing country IRBs and international ethics guidance to have a community engagement and capaet al. or Buchanan. It is interesting to note that the decision tree proposed by Lavery et al. bypasses IRBs, whose primary purpose it is to protect the welfare and dignity of participating individuals and communities. IRBs are merely to be 'advised' of study terminations by the SOC.We are concerned that the abrupt withdrawal of studies by a proposed SOC will erode community engagement in clinical trials in general, even if the role and potential impact of SOC decisions are added to the enrolment and consent process. The loss of community support and confidence in clinical trials can constitute an opportunity cost not considered by Lavery While the HIV prevention field needs innovation, and effective new products are sorely needed, we argue that current mechanisms are the only ones that should be used to determine whether a clinical trial should be stopped early. Due consideration should also be given to development agendas and the obligations of the study site to the participating communities whose engagement and investment reflect more than efficacy concerns. The costs of a cold-blooded SOC decision to stop a trial will indeed be "measured in the lives of the poor" .We do, however, agree that investment in clinical trial site development needs to be sensitive to opportunity and other costs, and that trial sites should consider resource sharing to accommodate initiatives and activities that can make more efficient use of scarce resources, especially in developing country settings. This can and should be done without the oversight of an SOC. For example, many initiatives and centres in Africa are disease-specific, and increased consideration should be given to breaking these expensive and confining 'silos' and expanding the spectrum of diseases targeted by such resource-intensive research centres .Premature stoppage of a trial for other than efficacy, safety or futility reasons seems to us not to be a viable option. The introduction of a SOC and implementation of its decisions may have major opportunity costs of its own. Furthermore, the role of a SOC would be more suited at the product selection process and not after the trial has been implemented. Rather, sites with clinical trial capacity should endeavour to share resources to reduce the opportunity costs of a single trial with a long-term developmental agenda in mind. We argue that this can and should be done without the intrusion of an SOC or expanded DSMB.We argue that clinical trials, especially in the HIV prevention field, should only be stopped early on safety or futility grounds, and that developing country trial site capacity and community trust in trials could be eroded by stoppage on other grounds and mechanisms. We further argue that the HIV prevention field will probably require many products of varying efficacy until such time as an effective preventive technology is in place.IRB: Institutional Review Board; DSMB: Data Safety Monitoring Board; VCT: Voluntary Counselling and Testing.The authors declare that they have no competing interests.DW initiated and drafted the article and GR added arguments, comments and examples and assisted the first author with the final review of the paper. Both authors read and approved the final manuscript.DW is Principal Investigator of the South African Research Ethics Training Initiative (SARETI) funded by NIH/Fogarty International Center grant no. 5 R25 TW001599-10 which partially funded the work on this paper, and is Chair of the University of KwaZulu-Natal Biomedical Research Ethics Committee.GR is the director of the HIV Prevention Research Unit of the South African Medical Research Council in Durban. She was the principal investigator of most of the Microbicide trials conducted to date.The pre-publication history for this paper can be accessed here:

UL46 gene. We analyzed the amino acid sequence of UL46 using bioinformatics tools and defined the main antigenic domains to be between nucleotides 700-2,220 in the UL46 sequence. This region was designated UL46M. The DPV UL46 and UL46M genes were both expressed in Escherichia coli Rosetta (DE3) induced by isopropy1-β-D-thiogalactopyranoside (IPTG) following polymerase chain reaction (PCR) amplification and subcloning into the prokaryotic expression vector pET32a(+). The recombinant proteins were purified using a Ni-NTA spin column and used to generate the polyclonal antibody against UL46 and UL46M in New Zealand white rabbits. The titer was then tested using enzyme-linked immunosorbent assay (ELISA) and agar diffusion reaction, and the specificity was tested by western blot analysis. Subsequently, we established Dot-ELISA using the polyclonal antibody and applied it to DPV detection.The duck plague virus (DPV) UL46 protein (VP11/12) is a 739-amino acid tegument protein encoded by the E. coli Rosetta (DE3). Expression of the full UL46 gene failed, which was consistent with the results from the bioinformatic analysis. The expressed product was directly purified using Ni-NTA spin column to prepare the polyclonal antibody against UL46M. The titer of the anti-UL46M antisera was over 1:819,200 as determined by ELISA and 1:8 by agar diffusion reaction. Dot-ELISA was used to detect DPV using a 1:60 dilution of anti-UL46M IgG and a 1:5,000 dilution of horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG.In our study, the DPV UL46M fusion protein, with a relative molecular mass of 79 kDa, was expressed in The anti-UL46M polyclonal antibody reported here specifically identifies DPV, and therefore, it is a promising diagnostic tool for DPV detection in animals. UL46M and the anti-UL46M antibody can be used for further clinical examination and research of DPV. Duck plague virus (DPV) is a pantropic, generalized infection virus, which can induce an acute, septic, contagious, and lethal disease in ducks, geese, swans, and all members of the family Anatidae of the order anseriformes. The mortality rate of infected adult ducks is up to 90%; therefore, DPV is considered one of the most severe blights in the waterfowl breeding industry worldwide .UL46. DPV gene transcription can be classified into 3 types: immediate-early (IE), early (E), and late (L) [UL46, which is not essential for virus replication, is a late transcription gene of the herpesviruses. As the phosphorylated product of UL46 translation, the UL46 protein (VP11/12) plays an important role in enhancing the efficiency of αTIF (VP16)-mediated α gene expression and initiates α gene transcription through an unknown mechanism of action. Generation of an antibody against DPV UL46 will further research on the function and bionomics of DPV.The DPV genome is composed of linear, double-stranded DNA with 64.3% guanine-plus-cytosine content, which is higher than any other reported avian herpesvirus in the subfamily Alphaherpesvirinae . Althouglate (L) . UL46, wUL46 may be expressed at a low level or fail to be expressed in a prokaryotic system due to its long sequence , we selected peptide fragments with high antigenicity by predicting the hydrophilicity and antigenicity of UL46, designated UL46M, in addition to using the complete UL46 gene. UL46 and UL46M were expressed in E. coli Rosetta (DE3) by constructing the prokaryotic recombinant expression plasmids pET32a(+)/UL46 and pET32a(+)/UL46M. The DPV UL46M fusion protein had a relative molecular mass of 79 kDa, while expression of the full UL46 gene failed. The recombinant protein was used to generate the polyclonal antibody against UL46M in rabbits. ELISA and western blot identified anti-UL46M antibody with a high titer and strong specificity, and the antibody was preliminarily applied in the specific detection of DPV by Dot-ELISA. The results provide a compact foundation for research on the function of UL46 and its use in the diagnosis of DPV.Considering that UL46 gene.Generally, the expression of the main antigenic regions of the protein was prioritized in order of increasing immunogenicity and specificity of the corresponding antibody. Therefore, we analyzed the hydrophilic and antigenic indices of UL46 and selected 507 amino acids Figure as the mUL46 and UL46M, respectively, were amplified by PCR were inserted into the pMD18-T vector to construct the cloning vectors pMD18-T/UL46 and pMD18-T/UL46M. The recombinant plasmids were then confirmed by DNA sequencing and restriction digests .Two regions of DPV, approximately 2,500 bp and 1,500 bp in UL46 and UL46M gene fragments were subcloned from pMD18-T/UL46 and pMD18-T/UL46M into the prokaryotic expression vector pET32a(+) using BamHI and XhoI and were confirmed by restriction enzyme analysis /UL46 and pET32a(+)/UL46M plasmids were transformed into competent E. coli Rosetta (DE3) cells. However, only a distinct band approximately 79 kDa, corresponding to the expected UL46M protein size, was obtained after a 4-h induction with 0.7 mM isopropy1-β-D-thiogalactopyranoside (IPTG) cells carrying an empty pET32a(+) vector , Salmonella enteritidis (SE), Riemerella anatipestifer (RA), Pasteurella multocida, and normal saline, as shown in Figure The preliminary application of the polyclonal antibody against DPV UL46M was in the detection of DPV by Dot-ELISA. Thus, the samples were prepared on a nitrocellulose (NC) membrane and the anti-UL46M IgG and HRP-labeled goat anti-rabbit IgG antibodies were used for DPV detection. The square matrix test determined that the suitable dilution of anti-UL46M IgG was 1:60 and that of HRP-labeled goat anti-rabbit IgG were 1:5,000. Dot-ELISA showed a stronger positive signal for DPV in the liver sample and was negative with duck hepatitis virus-1 (DHV-1), UL46 gene is not evolutionarily conserved among the different Herpesvirus subfamilies. UL46 is only conserved in alphaherpesviruses such as Herpes simplex virus type 1 (HSV-1) and is not present in beta- and gammaherpesviruses such as human cytomegalovirus (HCMV) and Epstein-Barr virus (EBV), respectively (13-15). Although UL46 is not essential for virus replication, the formation of plaque bacteriophage can be effected in the absence of UL46 [UL46 gene, plays an important role in enhancing the efficiency of αTIF (VP16)-mediated α gene expression and in initiating α gene transcription [The of UL46 ,17. VP11cription . TherefoUL46 gene, namely, the 507 amino acid N-terminal (233-739 site), as the main UL46 antigen in addition to the complete UL46 gene to ensure greater specificity and a higher titer of the corresponding antibody. Second, it was difficult to extract UL46 from infected cells and the relative molecular weight of UL46 was only 81.8 kDa. Additionally, the weaker antigenicity of UL46 may not elicit a stronger immune response in rabbits that were already immunized. Therefore, the prokaryotic expression vector pET32a(+) was chosen to express the UL46M fusion proteins in E. coli.For the preparation of the anti-UL46 rabbit antibody, 2 factors had to be considered. First, the collecting of main antigens was the key for a gene, especially for the longer fragment, and the stronger hydrophilic and antigenic regions were important for maintaining the immunoreactivity of the antigen. Thus, we selected the more hydrophilic and antigenic regions of the DPV E. coli host cells BL21 (DE3), BL21 (DE3) plysS, and Rosetta were all used to express UL46 and UL46M. The results identified that the expression level of UL46M was similar among the 3 host cells, and the full UL46 gene failed to express. Temperature was a major influence on the expression level, compared with inducing time and IPTG density. In addition, the recombinant protein was expressed within inclusion bodies. Since the inclusion body did not possess biological activity, the protein was redissolved and renatured prior to inoculation. His-tagged UL46M was expressed using pET32a(+), which was convenient for recombinant protein purification. In addition, the His tag did not influence the structure or function of UL46M due to its small molecular weight, and even inclusion bodies were beneficial in increasing the stability of product by preventing proteolytic degradation of the protein.In our study, the The Dot-ELISA has become a new addition to the diagnostic arsenal against microbes, contagious and parasitic diseases, because it is easy to use, is economical, requires small antigen dosage, and the results are easy to interpret. Therefore, we established the Dot-ELISA for DPV detection using the anti-DPV UL46M polyclonal antibody. The result revealed polyclonal antibody specificity for DPV; thus, we concluded that this anti-UL46M antibody could be used to diagnose DPV.We employed a double wavelength (450 nm/630 nm) to detect the optical density of samples in order to decrease light interference caused by scratches or fingerprints on the 96-well microtiter plate. Considering that antigen purity was not 100% and that the polyclonal antibody was based on many epitopes, the purified IgG was used to avoid nonspecific binding during titer quantification, antibody specificity determination, and application of Dot-ELISA. The results revealed that the anti-UL46M rabbit antibody prepared in our study was of high titer and specificity.UL46. This can be extended to the qualitative and quantitative analysis of the UL46 protein using immunofluorescent and immunochemical techniques, thus providing useful tools for studying the structure and function.In conclusion, the preparation of the specific anti-UL46M rabbit antibody established a foundation for further research on the biological activity and molecular mechanism of The NCBI BLASTN and ORF Finder servers were used to find an ORF. Then, the hydrophilic and antigenic indices of DPV UL46 were analyzed using the DNAstar6.0 software , by using the predicted amino acid sequence of the complete ORF to obtain the main antigenic domain of UL46 (UL46M).DPV was propagated in Duck Embryo Fibroblasts (DEFs) that were cultured in Minimum Essential Medium (MEM) containing 10% fetal bovine serum (FNS) and 1-2% penicillin and streptomycin at 37°C. After virus infection, MEM supplements with 2-3% FBS and 1-2% penicillin and streptomycin were used. The virus particles were harvested when the cytopathic effect reached 75%. Cell lysates containing DPV were subjected to 3 freeze-thaw cycles and were then stored at -70°C until use. The extraction of DPV DNA was performed as described previously .UL46 gene. Based on the constructed DPV CHv-strain genomic library, the primer sequences for PCR amplification of the DPV UL46 and UL46M genes were synthesized by TaKaRa as follows: (A) the full UL46 gene: forward primer (P1) 5'-GGATCCACGGTGATGTCGTCCAGG-3' and reverse primer (P2) 5'-CTCGAGGCGTCTTTGGTTTGTCGTAA-3', and (B) the UL46M gene: forward primer (P1) 5'-GGATCCCCGCTGGATCTTATGGTT-3' and reverse primer (P2) 5'-CTCGAGTTATTTCCCAAATGACAGTCT-3' [BamHI and XhoI sites that were used to clone the PCR fragment are bolded in the primer sequences. The primers were dissolved in ultrapure water to a concentration of 20 pmol/μL. The PCR amplifications contained 12.5 μL of 2× Taq PCR MasterMix , 1 μL (20 pmol/μL) of each primer, 1 μL of template (10 ng/μL), and ultrapure water to a total reaction volume of 25 μL. The PCR cycle parameters were as follows: (A) the complete UL46 gene: 5 min at 95°C and 30 cycles of 1 min at 94°C, 1 min at 59°C, 2 min 40 s at 72°C, and a final extension time of 10 min at 70°C; (B) the UL46M gene: 5 min at 95°C and 30 cycles of 1 min at 94°C, 1 min at 56°C, 1 min 50 s at 72°C, and a final extension time of 10 min at 70°C. The amplified products were visualized by gel electrophoresis (10 g/L agarose gel containing 5 μL/100 mL goldview).We identified and isolated the major antigenic domains of UL46, which were designated as UL46M, in conjunction with the full-length AGTCT-3' . The BamBamHI and XhoI, purified, and ligated into the correspondingly digested cloning vector pMD18-T at 16°C overnight using DNA Ligation Mix. The subsequently generated recombinant cloning plasmids were named pMD18-T/UL46 and pMD18-T/UL46M, respectively solid medium for 16 h. The masculine clones were collected and grown in liquid LB medium at 37°C for 12 h. The recombinant plasmids were verified by PCR and designation under the above condition. Each clone was then selected and sent to TaKaRa for sequencing. Then we performed the nucleotide homology comparison with the public sequence (GenBank: EU195108) available in NCBI GeneBank using DNAMAN and blast tools.The purified PCR products were digested with restriction enzymes BamHI and XhoI and purified using a TIANprep Mini Plasmid Kit (TianGen). We then cloned the respective fragments into the 6× His-tagged prokaryotic expression vector pET32a(+) at the BamHI and XhoI sites and designated them as expression vector pET32a(+)/UL46 and pET32a(+)/UL46M cells transformed with the prokaryotic expression plasmids pET32a/UL46 and pET32a/UL46M were cultured in presence of ampicillin (100 μg/mL) in LB medium with vigorous shaking at 37°C until an A600 of 0.4-0.6. The expression of the recombinant fusion proteins was induced by addition of 0.7 mM/L IPTG and further shaken at 37°C for 4 h. After induction, the cells were harvested by centrifugation at 6,000 rpm for 10 min at 4°C and lysed in 5× sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer (0.313 M Tris-HCl (pH 6.8), 50% glycerol, 10% SDS, and 0.05% bromophenol blue with 100 mM DTT). The uninduced control and the vector control cultures were analyzed in parallel.As described above, 4 g of wet weight cells from a 1-L culture was harvested by centrifugation at 6,000 rpm for 10 min, and the pellet was suspended in 20 mL lysis buffer (20 mM Tris-HCl buffer (pH 8.0) containing 100 mM NaCl, 1.0 mM phenylmethyl sulfonylfluoride (PMSF), and 1.0 mg/mL lysozyme). The suspension was incubated for 30 min at 4°C with stirring and was then pulse-sonicated on ice until the sample was clear. Sonication was performed to lyse cells and release intracellular protein. The resulting cell lysate was centrifuged at 12,000 rpm for 30 min . The collected pellet was dissolved in deionized water and analyzed by 12% SDS-PAGE. The recombinant protein was purified using the Ni-NTA Spin Column kit, according to the manufacturer's instructions. The density of the recombinant protein was detected using the Bradford method and stored at -80°C until use .Six male New Zealand white rabbits were immunized using purified recombinant DPV UL46M protein according to Hu et al. . One milThe rabbit IgG fraction was precipitated from the harvested rabbit polyclonal antisera in saturated ammonium sulfate according to Walker et al. . Then, t2O2 for 30 min at room temperature. The reaction was stopped by the addition of 50 μL of 30% H2SO4. 20 min later, and the optical density (OD) was determined at 450 nm/630 nm double wavelength using a Bio-Rad model 860 plate reader . The normal rabbit sera and PBST were used in parallel as the negative control and blank, respectively. When the OD value of the anti-sera was ≥0.4 and the ratio with normal sera was ≥2.1, the result was positive. The largest positive dilution multiple was the antisera titer. ③ Analysis of antibody specificity by western blot. To characterize the specificity of the antibody, western bolt analysis was performed according to standard procedure [① Detection of the antisera titer by agar diffusion reaction. One gram of agar was dissolved in buffered saline prepared by the addition of 0.85 g of sodium chloride to 100 mL of distilled water. The mixture was heated, cooled down to 55°C, and poured into the plates to a thickness of 2 mm. The agar was then perforated with 3 mm-diameter holes that held approximately 100 μL of solution. Thirty microliters of 1-, 2-, 4-, 8-, 16-, and 32-fold diluted antisera was added into the peripheral apertures and DPV was added into the central aperture. The plate was diffused at 37°C for 24 h. The largest dilution multiple of the sediment band identified the antibody titer. ② Detection of the titer of anti-UL46M rabbit antibody by ELISA. A 96-well microtiter plate was coated with 100 μL (0.01 mg/L) purified DPV in sodium bicarbonate buffer (pH 9.6) and incubated at 37°C for 1 h and then at 4°C overnight. The plate was blocked with 100 μL of blocking solution (1% BSA in PBS) for 1 h at 37°C and washed 3 times with PBST (0.05% Tween 20 in PBS). Subsequently, 100 μL of a 2 multiple dilution of purified anti-UL46M IgG was added and incubated at 37°C for 1 h. The plate was washed and incubated for 1 h at 37°C with 100 μL of a 1:5,000 dilution of anti-HRP-labeled goat anti-rabbit IgG diluted, washed again and detected with 100 μL of 3,3',5,5'-tetramethylbenzidine (TMB)-HE. coli (O1), SE, RA, and P. multocida, and the livers from the dead ducks were obtained as the antigen species, while normal saline was used as the negative control in parallel. ② Sample preparation. Aseptic PBS was added in a 1/3 (w/v) ratio to the samples, which were then grinded into homogenate and centrifuged at 8,000 rpm for 10 min at 4°C after freeze-thawing 3 times at -20°C. The supernatant was collected as the antigen species for detection by Dot-ELISA, and detection using negative and blank controls was conducted in parallel. ③ Detection of Dot-ELISA. The NC membrane was cut to optimal size and the sample spot was marked using a pencil. The membrane was then saturated in ddH2O for 10 min and dried at room temperature. Five microliters of treated samples, at dilutions greater than 1:100, were loaded onto the NC membrane at the previously marked locations , followed by drying the NC membrane completely at room temperature. The NC membrane was blocked for 1 h at 37°C using blocking solution (1% BSA in PBS) and washed 3 times (5 min each) with PBST (0.05% Tween 20 in PBS). Subsequently, the membrane was incubated with a 1:60 dilution of rabbit anti-UL46M IgG with 0.1% BSA in PBS overnight at 4°C, and washed the following day. The membrane was further incubated for 1 h at 37°C with anti-HRP-labeled goat anti-rabbit IgG diluted 1:5,000 in PBS and developed using a DAB substrate buffer at room temperature until an amethyst signal was observed. Thorough washing in ddH2O terminated the reaction. The negative and blank controls were conducted in parallel. Distinct spots with consistent structures indicated a positive result, while fuzzy spots with structural anomalies or the lack of a spot indicated a negative result.① Animal test. One day old ducks were infected with one of DPV, duck Hepatitis Virus type 1 (DHV-1), The authors declare that they have no competing interests.LL carried out most of the experiments and wrote the manuscript. AC and MW critically revised the manuscript and the experiment design. JJ, DZ, RJ, QL, FL, ZC, XC and JY helped with the experiment. All of the authors read and approved the final version of the manuscript.

CTGF), cysteine rich-61 (CYR61) and early growth response 1 (EGR1), were rapidly induced by VILI in preterm lambs and whether ventilation with different tidal volumes caused different inflammatory cytokine and early response gene expression.Bronchopulmonary dysplasia (BPD) is closely associated with ventilator-induced lung injury (VILI) in very preterm infants. The greatest risk of VILI may be in the immediate period after birth, when the lungs are surfactant deficient, still partially filled with liquid and not uniformly aerated. However, there have been very few studies that have examined this immediate post-birth period and identified the initial injury-related pathways that are activated. We aimed to determine if the early response genes; connective tissue growth factor (T 20 mL/kg for 15 min) then gently ventilated (5 mL/kg) for 15, 30, 60 or 120 min (n = 4 in each). To determine if early response genes and inflammatory cytokines were differentially regulated by different ventilation strategies, separate groups of preterm lambs were ventilated from birth with a VT of 5 (VG5) or 10 mL/kg (VG10) for 135 minutes. Lung gene expression levels were compared to levels prior to ventilation in age-matched control fetuses.To identify early markers of VILI, preterm lambs were resuscitated with an injurious ventilation strategy , within 30 minutes of injurious ventilation. VG5 and VG10 caused significant increases in CTGF, CYR61, EGR1, IL1-β, IL-6 and IL-8 mRNA levels compared to control levels. CTGF, CYR61, IL-6 and IL-8 expression levels were higher in VG10 than VG5 lambs; although only the IL-6 and CYR61 mRNA levels reached significance.CTGF, CYR61 and EGR1 may be novel early markers of lung injury and mechanical ventilation from birth using relatively low tidal volumes may be less injurious than using higher tidal volumes. The lungs of very preterm infants have an immature distal airway structure, with a thick air/blood barrier and a small surface area for gas-exchange. They are surfactant deficient because undifferentiated epithelial cells predominate with few type II alveolar cells. As a result, very preterm infants often require respiratory support in the minutes following birth. Although essential for survival, mechanical ventilation of very preterm infants is closely associated with a high risk of developing bronchopulmonary dysplasia (BPD). BPD is characterised by a simplification of airways, a cessation of alveolarisation, hypercellularity, variable fibrosis and capillary dysplasia .1, nuclear factor (NF)-κB and interferon-γ . These IL-6, IL-8, CTGF and CYR61 appeared to differentiate between ventilation strategies causing different degrees of lung injury. Expression levels of all four genes were lowest in lambs mechanically ventilated with a tidal volume of 5 mL/kg and were higher in lambs mechanically ventilated with 10 mL/kg that exhibited gross and histological evidence of lung injury. In contrast, EGR1 and IL-1β appeared not to be sufficiently sensitive to detect any differences between the ventilation strategies. Although the 135 minute ventilation period did not allow time for changes in lung structure to manifest histologically, other evidence indicated that VG10 lambs incurred more lung injury than VG5 lambs. This evidence included the presence of hyaline membranes, detached epithelial cells, red blood cells in the distal lung parenchyma, the presence of blood stained tracheal aspirates, the production of pneumothoraces and subpleural air leaks, and the high PIP required to achieve the tidal volume of 10 mL/kg [Regardless of whether CTGF, CYR61 and EGR1 are critical mediators of abnormal lung development caused by VILI, they are likely to be early markers of lung injury. All three genes were very rapidly elevated in response to the injurious ventilation strategy. More importantly, when taken together, the expression levels of 10 mL/kg .The current international guidelines for neonatal resuscitation (ILCOR) provide little guidance on the most appropriate resuscitation techniques that minimise lung injury in the immediate newborn period when the lungs are partially liquid-filled and not uniformly aerated. Our data indicate that VILI during the immediate newborn period can rapidly (within 15 mins) initiate changes in gene expression which are abnormal and likely to potentiate inflammation and to promote abnormal lung development. Furthermore, our studies indicate that resuscitation and mechanical ventilation at birth with relatively high tidal volumes is potentially more injurious than with relatively low tidal volumes. We also conclude that CTGF, CYR61, EGR1, IL-1β, IL-6 and IL-8 are likely to be useful biomarkers of VILI in the newborn, particularly in studies of short duration.The authors declare that they have no competing interests.EGR1, CTGF and CYR61 as likely candidate genes, oversaw the molecular and histological component of the analyses and prepared the manuscript. MP performed the animal experiments and the TGF-β1, TNF-α and NF-κB analyses. VZ performed the real-time PCR and immunohistochemical analyses. KC supervised the animal experiments and TC provided intellectual input into the studies and provided editorial assistance with the manuscript. CM, PD and SH designed and supervised the animal experiments, obtained funding for the project and provided intellectual input and editorial assistance with the manuscript.MW identified

Leiomyosarcomas are rare tumours, predominantly localized in the stomach, small intestine and retroperitoneum. Only one case of primary leiomyosarcoma of the spleen is described in human beings in literature.We report a case of locally advanced primary leiomyosarcoma of the spleen in a 54 year-old woman, diagnosed only after splenectomy, performed with the suspicion of splenic haematoma.Due to the lack of cases, no specific chemotherapy regimen has been tested to provide a longer survival. Leiomyosarcomas are rare tumours, predominantly localized in the stomach, small intestine and retroperitoneum. Only one case of primary leiomyosarcoma of the spleen is described in human beings in literature.A 54-year-old Caucasian woman was referred to our department with a history of left-sided abdominal pain, lasting about 8 months. No other signs or symptoms were present at the moment of observation. Past medical history revealed no significant medical problems. Hysterectomy for endometriosis had been performed ten years before admission. No history of carcinogenic exposure was reported. At admission physical examination revealed a palpable spleen 4 cm below the left costal margin. No hepatomegaly was noted. Laboratory exams showed no alterations, except for mildly elevated lactic acide dehydrogenase (LDH). Chest X-ray showed a normal mediastinum and lung parenchyma. Abdominal US revealed, in the superior portion of the spleen, multiple target-shaped focal lesions, one of these with a large anechoic fluid-filled area. CT scan showed a large, inhomogeneous mass of the spleen, of 10 × 7 cm in diameter. This mass was isodense, without enhancement after contrast injection, and had low density fluid-filled areas. The liver parenchyma was normal and no evidence of retroperitoneal lymphadenopathy was found. Emergency laparotomy was performed, due to the suspicion of splenic haematoma. Neither obvious metastases nor hepatic lesions or abdominal fluid were found at laparotomy. An enormous mass of superior portion of the spleen was found, with infiltration of left suprarenal gland and of a portion of diaphragm. Due to the local dissemination a splenectomy and left surrenalectomy were performed, along with a partial diaphragm resection, with a free resection margin of about two centimetres. Splenic vessel lymphadenectomy was also performed. There were no postoperative problems and the patient was discharged on 7th postoperative day. Two different Institution was necessary to obtain the definitive diagnosis. Histological examination showed a spleen of 11 × 5 × 5 cm, with a soft dark lesion, of 10 cm diameter, in the upper pole. Gross examination showed no haemorrhage or necrosis. Microscopic examination revealed a non capsulated spindle and polyhedral cell proliferation along with multiple foci of cellular necrosis. Tumor cells, with pleomorphic and atypic vesicular nuclei, showed marked pleomorphism and rare mitotic figures Figure . ImmunohThe patient underwent specific chemotherapic regimen (5 cycles) with epirubicin 90 mg (days 1 and 2) and ifosfamide 2700 mg (days 1 – 5) every 21 days, with no significant adverse reactions.Actually, 21 months after operation, the patient is alive and totally disease-free.Leiomyosarcoma is a rare tumour, predominantly localized in stomach, small intestine and retroperitoneum . It is aLeiomyosarcoma is a rare neoplasm, with a poor prognosis. Along with this case we have described, only one case of splenic localization is reported in literature. The diagnosis can be made only at laparotomy, after pathological examination of the removed specimen; US, CT scan and MRI can be useful in suspecting diagnosis. Splenectomy performed in early stage, without rupture, seems to improve survival. No specific chemotherapy regimen has been tested for this neoplasm, but adjuvant therapy should be offered to these patients, even if only for palliation.The author(s) declare that they have no competing interests.PP, preperation of the draft manuscript, VV, GC, MC, AC, Searching of the literature and helped in preperation of draft FT, RI, GC, AS, FR, LF, MAM, Helped in preperation of manuscript GB final revision of the manuscript.All authors read and approved the final manuscript.

Ketogenic diets are an effective healthy way of losing weight since they promote a non-atherogenic lipid profile, lower blood pressure and decrease resistance to insulin with an improvement in blood levels of glucose and insulin. On the other hand, Mediterranean diet is well known to be one of the healthiest diets, being the basic ingredients of such diet the olive oil, red wine and vegetables. In Spain the fish is an important component of such diet. The objective of this study was to determine the dietary effects of a protein ketogenic diet rich in olive oil, salad, fish and red wine.t test.A prospective study was carried out in 31 obese subjects with the inclusion criteria whose body mass index and age was 36.46 ± 2.22 and 38.48 ± 2.27, respectively. This Ketogenic diet was called "Spanish Ketogenic Mediterranean Diet" (SKMD) due to the incorporation of virgin olive oil as the principal source of fat (≥30 ml/day), moderate red wine intake (200–400 ml/day), green vegetables and salads as the main source of carbohydrates and fish as the main source of proteins. It was an unlimited calorie diet. Statistical differences between the parameters studied before and after the administration of the "Spanish Ketogenic Mediterranean diet" (week 0 and 12) were analyzed by paired Student's 2→31.76 kg/m2), systolic blood pressure (125.71 mmHg→109.05 mmHg), diastolic blood pressure (84.52 mmHg→ 75.24 mmHg), total cholesterol (208.24 mg/dl→186.62 mg/dl), triacylglicerols (218.67 mg/dl→113.90 mg/dl) and glucose (109.81 mg/dl→ 93.33 mg/dl). There was a significant (p = 0.0167) reduction in LDLc (114.52 mg/dl→105.95 mg/dl) and an extremely significant increase in HDLc (50.10 mg/dl→54.57 mg/dl). The most affected parameter was the triacylglicerols (47.91% of reduction).There was an extremely significant (p < 0.0001) reduction in body weight (108.62 kg→ 94.48 kg), body mass index (36.46 kg/mThe SKMD is safe, an effective way of losing weight, promoting non-atherogenic lipid profiles, lowering blood pressure and improving fasting blood glucose levels. Future research should include a larger sample size, a longer term use and a comparison with other ketogenic diets. The international consensus is that carbohydrates are the basis of the food pyramid for a healthy diet and that the best way to lose weight is by cutting back on calories chiefly in the form of fat. It is generally believed that ketogenic diets may lead to the development of several diseases. However, many studies have found that ketogenic diets are healthier since they help to preserve muscle mass, reduce appetite, diminish metabolic efficiency, induce metabolic activation of thermogenesis, favor increased fat loss, promote a non-atherogenic lipid profile, lower blood pressure and decrease resistance to insulin with an improvement in blood levels of glucose and insulin . ContrarMediterranean diet has evident health benefits. Such diet is associated with a longer life span ,7 and loThe objective of the present study was to determine the dietary effects of the "Spanish Ketogenic Mediterranean Diet" (SKMD). Such diet was a protein ketogenic diet under free-living conditions with 4 important healthy components of the Mediterranean diet in Spain: olive oil, salad, fish and red wine. Therefore, the present study was carried out to demonstrate the changes in body weight, blood pressure, lipid profile and glucose that might occur after the administration of SKMD throughout the period of study (12 weeks), in healthy obese subjects.Olive oil, is considered the pillar of the Mediterranean diet, since it improves the major risk factors for cardiovascular disease, such as the lipoprotein profile, blood pressure, glucose metabolism and antithrombotic profile. Endothelial function, inflammation and oxidative stress are also positively modulated. Some of these effects are attributed beside the monounsaturated fatty acids (MUFA) to the minor components of virgin olive oil . HydrocaThe combination of ethanol and phenolic compounds in red wine is thought to be responsible for the apparent protective cardiovascular effect , showingTwo long-chain Omega-3 polyunsaturated fatty acids (n-3 PUFA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), are the active constituents of the fish. Low rates of death from coronary heart disease has been report among individuals with very high consumption of fish, although these people should limit intake of species highest in mercury levels. Larger, longer-living predators have higher tissue concentrations, while smaller or shorter-lived species have very low concentrations .High omega-3 consumption increases insulin sensitivity and reduces inflammatory markers and PierA prospective study was carried out at a General Medicine Consultation in 40 overweight subjects whose body mass index and age was 36.46 ± 2.22 and 38.48 ± 2.27, respectively. Subjects were selected with the cooperation of a database medical weight loss clinic. Inclusion criteria were: a diet based on carbohydrate foods (> 50% of dairy energy intake), achievement of desired weight loss, normal liver and renal function, not to have antecedents of gout or high uric acid, not to have exercise, alcoholic and smoking habits, not to be pregnant or lactating, IMC ≥ 30, age ≥ 18 years and ≤ 65 years and not to be under medication. Since obesity increases the risk for alterations in hepatocyte function that lead to accumulation of lipid in hepatocytes and hepatomegaly , we consider higher liver transaminase levels as a variant of normality in such obese patients . Chronic hepatitis B or C was ruled out in such patients by negative serologies. We determined normal renal function as measured by plasma urea nitrogen and plasma creatinine: creatinine ≤ 1.3 mg/dl and urea ≤ 40 mg/dl. Subjects with the inclusion criteria were selected for eligibility by phone and 40 eligible subjects were invited to attend an orientation session during the week prior to the study. Patients measured their body's ketosis state every morning by ketone strips. During the study, the participants were phoned by the same person weekly, in order to assure the correct realization of the protocol and the ketosis state. If the subjects failed to maintain adequate compliance with the clinical trial protocol they would be dropped out the study.Subjects received no monetary compensation for their participation and provided voluntary written consent form before initiating the diet.The Ethics and Clinical Investigation Committee of the "Spanish Medical Association of the Proteinic Diet" approved the study protocol, informed consent form and subject informational materials. Patient anonymity was preserved.This protein ketogenic diet was called "Spanish Ketogenic Mediterranean Diet" (SKMD) due to the incorporation of virgin olive oil as the principal source of fat, moderate red wine intake, green vegetables and salads as the main source of carbohydrates and fish as the main source of proteins. It was an unlimited calorie diet, nevertheless subjects were encouraged to consume per day: a maximum of 30 g of carbohydrates in the form of green vegetables and salad, a minimum of 30 ml of virgin olive oil, 200–400 ml of red wine and no limit of the protein block.Participants were permitted 3 portions (200 g/portion) of vegetables daily: 2 portions of salad vegetables , and 1 portion of low-carbohydrate vegetables . 3 portions of salad vegetables were allowed only if the portion of low-carbohydrate vegetables were not consumed. Salad dressing allowed were: garlic, olive oil, vinegar, lemon juice, salt, herbs and spices.The minimum 30 ml of olive oil were distributed unless in 10 ml per principal meal . Red wine (200–400 ml a day) was distributed in 100–200 ml per lunch and dinner. The protein block was divided in "fish block" and "no fish block". The "fish block" included all the types of fish except larger, longer-living predators (swordfish and shark). The "no fish block" included meat, fowl, eggs, shellfish and cheese. Both protein blocks were not mixed in the same day and were consumed individually during its day on the condition that at least 4 days of the week were for the "fish block".Trans fats (margarines and their derivatives) and processed meats with added sugar were not allowed.No more than two cups of coffee or tea and at least 3 litres of water were intake each day. Infusions and artificial sweeteners were allowed .1 1.4 mg, vitamin B2 1.6 mg, vitamin B6 2 mg, folic acid 200 mcg, vitamin B12 1 mcg, niacin 18 mg, biotin 150 mcg, pantothenic acid 6 mg, vitamin K 30 mcg, calcium 120 mg, potassium 40 mg, phosphorus 126.3 mcg, iron 8 mg, magnesium 45 mg, cupper 0.9 mg, zinc 8 mg, manganesum 1.8 mg, iodine 75 mcg, molibden 45 mcg, boron 70 mcg, chlorine 21 mg, chromium 25 mcg, molybdenum 45 mcg, nickel 5 mcg, selenium 55 mcg, silicon 3 mg, sin 10 mcg, vanadium 10 mcg.Micronutrients were given daily to each subject in the form of 2 tablets of a poly-vitamin-mineral supplement and one tablet of calcium carbonate 1500 mg. Each tablet of the poly-vitamin-mineral supplement contained: vitamin A 680 mcg, Beta-carotene 720 mcg, vitamin D 5 mcg, vitamin E 10 mg, vitamin C 60 mg, vitamin BSubjects were weighed and systolic/diastolic blood pressure was measurement at weeks 0, 4, 8 and 12, at the same time (that depends on the subject) and using always the same digital scale ("Seca 703") and mercurial sphygmomanometer ("Labtron Model 03-225").Fasting venous blood samples were collected at weeks 0 and 12 for total cholesterol, HDLc, LDLc, triacylglycerol and glucose. Venous blood samples for glucose, lipid and lipoprotein analysis were collected into EDTA-containing (1 g/l) tubes from all subjects after a 12 h overnight fast at the beginning of the study and at the end of each dietary period. Plasma was obtained by low-speed centrifugation for 15 min at 4°C within 1 h of venepuncture. Plasma cholesterol and TAG levels were determined by enzymatic techniques. HDL-cholesterol was determined after precipitation with fosfowolframic acid LDL-cholesterol concentration was calculated using the Friedewald formula. Plasma glucose was measured by the glucose oxidase method. To reduce interassay variation, plasma was stored at -80°C and analysed at the end of the study.t test with SPSS 12.0 and are expressed as mean ± standard error of the mean (SEM). The parameters studied were: weight, body mass index (BMI), systolic blood pressure (SBP), diastolic blood pressure (DBP), total cholesterol, HDLc, LDLc, triacylglycerol and glucose. Before the Student's t test, Kolmogorov-Smirnov and Shapiro-Wilk tests were used for testing normality and the assumption of homoscedasticity was determined with the F-Snedecor test.Statistical differences between the parameters before and after the administration of the SKMD (week 0 and 12) were analyzed by paired Student's Of the 40 persons who started the study, data collected from 31 subjects were used in the final analysis. Data were not use from 9 subjects: 3 subjects were withdrawn for failure to maintain adequate compliance with the clinical trial protocol; 4 subjects were lost to follow-up; 1 subject withdrew because he said the diet was too expensive; 1 subject was withdrawn due to suffer a polytraumatism car accident.Normal distribution and the assumption of homoscedasticity were verified. As there were no significant differences in male and female subjects in all the parameters examined (p > 0.05), the data of males and females in each group are pooled and presented together. The changes in all the parameters studied are shown in Table 2→31.76 kg/m2), SBP (125.71 mmHg→109.05 mmHg), DBP (84.52 mmHg→ 75.24 mmHg), total cholesterol (208.24 mg/dl→186.62 mg/dl) and glucose (109.81 mg/dl→ 93.33 mg/dl). There was a significant (p = 0.0167) reduction in LDLc (114.52 mg/dl→105.95 mg/dl) and an extremely significant increase in HDLc (50.10 mg/dl→54.57 mg/dl).There was an extremely significant (p < 0.0001) reduction in body weight (108.62 kg→ 94.48 kg), BMI is not associated with differences in body weight , so thisFurther trials are required to examine the potential role of the SKMD for the selective fat loss and its protective effect against muscle protein catabolism.During the SKMD the fasting glycemia improved significantly. These findings could be explained by the following points:1. A low carbohydrate diet reduces fasting glucose levels, even independently of the weight loss ,31.2. MUFA-rich diet prevents insulin resistance induced by a carbohydrate-rich diet in insulin-resistant subjects .3. DHA-EPA also improve insulin sensitivity .Our data are not enough to state with precision if the SKMD is the same or better than a conventional ketogenic diet to improve glycemic control due to its higher content in MUFA and DHA-EPA.We think that the moderate prandial red wine consumption of the SKMD did not have effect on the glycemic control, since Gin et al. reported that moderate prandial wine consumption has no adverse effect on the glycemic control of diabetic patients, thus it appears unnecessary to proscribe the consumption of red wine in moderation with meals to diabetic patients .The data presented in this study showed that the SKMD significantly decreases the total cholesterol, LDLc, triacylglycerols, SBP, DBP and increases the level of HDLc. This healthy cardiovascular profile is probably due to the favorable interaction of the weight loss and the components of the SKMD: high protein ketogenic diet-virgin olive oil-fish oil-red wine-salad. Our arguments are founded in the following findings:1. Ketogenic diets improve all aspects of atherogenic dyslipidemia, decreasing fasting and postprandial triglyceride levels and increasing HDLc and LDLc particle size . When th2. Ingestion of virgin olive oil increases HDLc levels and decr3. Omega-3 PUFA reduce plasma triacylglycerol concentrations ,41.4. Chronic moderate consumption of red wine (400 ml/day) significantly reduces fasting LDLc and increases HDLc in hypercholesterolaemic patients .5. Low carbohydrate/high-protein diets are more effective than high-carbohydrate diets for decreasing blood pressure, both diastolic and systolic .6. The salad consumption is inversely associated with diastolic blood pressure .We recognize several limitations of our study that may have influenced the study findings:1. The sample of the study is small (31 subjects).2. This is not a random population study, since subjects were selected for eligibility and their eligibility was related with their compliance to the diet.3. Weight loss may be related with improvement in all parameters that are studied.4. We didn't take into consideration calories intake before and after the 12 weeks. Although it is known that an equal number of calories are ingested, ketogenic diets are more effective for achieving fat loss than the conventional high-carbohydrate/low-fat diets , we don'5. Although the effect of vitamins is not clear, especially in short interventions, their possible contribution to better cardiovascular parameters should be possible.6. Our study has no control groups to consider the interaction between the components of the SKMD. There is no way to say if the healthy results are due to the ketogenic nature of the diet, the virgin olive oil, the red wine, the higher fish intake, the higher salad intake or a synergic effect between these components.All these limitations should be known and accordingly considered by further trials.The SKMD is safe, an effective way of losing weight, promoting non-atherogenic lipid profiles, lowering blood pressure and improving fasting blood glucose levels. Future research should include a larger sample size, a longer term use and a comparison with other ketogenic diets.EPA: eicosapentaenoic acid; DHA: docosahexaenoic acid; HDLc: high-density lipoprotein cholesterol; LDLc: low-density lipoprotein cholesterol; MUFA: monounsaturated fatty acids; PUFA: polyunsaturated fatty acids; SFA: saturated fat; SKMD: Spanish Ketogenic Mediterranean Diet; TG: triacylglycerols.The authors declare that they have no competing interests.JPG was the principal researcher and was responsible for study design, acquisition of data, analysis and interpretation of data and preparation of manuscript. AMS was responsible for analysis and interpretation of data. AAM was responsible for study design, analysis and interpretation of data.

Behavioural interventions are effective treatments for overactive bladder (OAB) and urgency urinary incontinence (UUI). They are in part aimed at improving symptoms with patient education on healthy bladder habits and lifestyle modifications, including the establishment of normal voiding intervals, elimination of bladder irritants from the diet, management of fluid intake, weight control, management of bowel regularity and smoking cessation. Behavioural interventions also include specific training techniques aimed at re-establishing normal voiding intervals and continence. Training techniques include bladder training, which includes a progressive voiding schedule together with relaxation and distraction for urgency suppression, and multicomponent behavioural training, which, in conjunction with pelvic floor muscle (PFM) exercises, includes PFM contraction to control urgency and increase the interval between voids. Guidelines for the conservative treatment of OAB and UUI have been published by several organisations and the physiological basis and evidence for the effectiveness of behavioural interventions, including lifestyle modifications, in the treatment of OAB and UUI have been described. However, many primary care clinicians may have a limited awareness of the evidence supporting the often straight-forward treatment recommendations and guidance for incorporating behavioural interventions into busy primary care practices, because most of this information has appeared in the specialty literature. The purpose of this review is to provide an overview of behavioural interventions for OAB and UUI that can be incorporated with minimal time and effort into the treatment armamentarium of all clinicians that care for patients with bladder problems. Practical supporting materials that will facilitate the use of these interventions in the clinic are included; these can be used to help patients understand lifestyle choices and voiding behaviours that may improve function in patients experiencing OAB symptoms and/or UUI as well as promote healthy bladder behaviours and perhaps even prevent future bladder problems. Interventions for stress urinary incontinence are beyond the scope of this review. The material covered in this review comprises a synthesis of literature gathered from a MEDLINE search based on the terms behavioural intervention, overactive bladder and incontinence, along with the Authors’ clinical experience. Reprints for all articles and book chapters were obtained and assessed for relevance.Behavioural interventions are effective in treating OAB and UUI. Clinicians and staff in busy office settings can readily incorporate these therapies into routine medical and nursing care. Clinicians should be familiar with the practical details of promoting healthy bladder habits, lifestyle modifications and training techniques not only to optimise treatment outcomes, but also as the foundation for patient education and counselling to promote bladder health as part of routine healthcare.Overactive bladder (OAB), with or without urinary incontinence (UI), is a serious public health problem in the United States and worldwide. OAB is defined by the International Continence Society (ICS) as urgency, with or without urgency incontinence, usually with increased daytime frequency and nocturia . Along wOveractive bladder is a prevalent condition; the National Overactive BLadder Evaluation (NOBLE) Program found that approximately 16% of men and 17% of women aged ≥ 18 years in the United States are affected by OAB . More reOveractive bladder becomes more prevalent with age ,4. This Symptoms of OAB with or without UUI are bothersome and are associated with reduced health-related quality of life ,13,14. TOptions for the treatment of OAB include behavioural interventions, which are collectively considered first-line treatments for OAB symptoms with or without UI. Behavioural interventions are aimed at changing patient lifestyle and behaviour and at teaching techniques to suppress urgency and improve continence skills. Behavioural interventions can be readily prescribed in the primary care setting, either before or concomitantly with pharmacotherapy –35. AntiRecommendations for behavioural interventions in the treatment of OAB and UI have been published by the International Consultation on Incontinence , the AmeThe evidence supporting the use of these strategies is strongest for behavioural training and bladder training with and without PFMT for the treatment of UUI ,43–45. WThe educational materials included in The foundation of behavioural intervention is patient education to enhance patients’ understanding of normal and abnormal bladder function, which then serves as a basis for their understanding the specific strategies that can be recommended for the prevention and/or management of OAB and UUI. Changing bladder habits, making lifestyle changes and adhering to the training techniques require patients to make significant behavioural changes in their daily activities. It is essential to counsel patients on how to best incorporate these strategies into their lives so that adherence to behavioural interventions, and thus an optimal treatment outcome, is more likely.A bladder diary which is obtained at the initial evaluation can be a useful tool in counselling patients about their voiding behaviour and patterns . Some inIndividuals who have urinary urgency and UUI may be unaware of what constitutes an appropriate voiding schedule and may exacerbate their symptoms by changing their voiding pattern. For adults who are cognitively intact, physically capable of self-toileting and capable of keeping bladder diaries, timed voiding is recommended, which involves voiding on a fixed schedule irrespective of the need or desire to urinate . Along wSome foods and beverages are known to promote diuresis or bladder irritability, which in some people can exacerbate OAB symptoms and UUI. Caffeine in particular has been shown to have a diuretic effect and is aAlthough the strength of the correlation of caffeine intake with OAB symptoms and UI remains to be resolved, the effects of caffeine are likely dose dependent . PatientOther dietary factors that may contribute to OAB symptoms and UUI include carbonated drinks in women ; there ipm (or approximately 3–4 h before bedtime) and shift their intake to the morning and afternoon, which anecdotally appears to have good results , moderately increasing fluid intake, engaging in exercise and establishing a routine defecation schedule. Patients should also be advised not to ignore the urge to defecate, but rather to respond promptly to the opportunity to move their bowels.2 is an independent risk factor for OAB in women , because 50% of women are unable to achieve this with simple verbal or written instruction alone . A usefuschedule . For optschedule . SimilarMulticomponent behavioural training with urgency suppression techniques have been shown to enhance the effectiveness of pharmacotherapy for OAB . Thus, an = 501) (n = 138) (n = 416) (n = 395) . Anothern = 138) . A recenn = 138) consistin = 416) . Particin = 416) . The resn = 395) . HoweverIdeally, the treatment with the lowest risk should be recommended first in the treatment for OAB and UUI ,90. AlthIn selecting the type of therapy to be used for the treatment of OAB and UUI, it is of paramount that clinicians gauge the patient’s treatment preferences, motivations, expectations and goals. The decision to begin behavioural interventions before or with medications is driven by clinician and patient preference. Some patients may want to experience quick treatment results and may not be receptive to behavioural intervention. In these cases, the optimal treatment option may be to prescribe an antimuscarinic in combination with education about lifestyle factors that can be changed to alleviate their OAB symptoms and UUI. Patients presenting with OAB symptoms should be taught skills for responding adaptively to urgency, including relaxation techniques, distraction techniques, PFM contractions and staying away from the bathroom until the urgency has subsided rather than rushing to the toilet. Bladder training or timed voiding can be especially helpful for patients whose symptoms include frequent urination. A guide to applying the techniques discussed in this review to the treatment of OAB symptoms and UUI is provided in For the patient, the success of a lifestyle modification or behavioural intervention process, with or without pharmacological therapy, may depend on receiving adequate support from their healthcare provider. Clinicians should follow-up with patients regularly to monitor their progress and determine whether the treatment regimen is effective and satisfactory to the patient, or whether adjustments need to be implemented. If the patient is not responding satisfactorily to these first-line therapies, they can be referred to a continence specialist for evaluation and treatment. Urodynamic evaluation may be indicated for those with complex symptomatology. Patients who are having difficulty isolating their PFMs and desire behavioural intervention should be referred to a physical therapist, a continence nurse specialist, or a nurse practitioner for a more intensive behavioural intervention programme using biofeedback training and/or pelvic floor electrical stimulation. Biofeedback is a teaching technique that allows patients to monitor their PFM contractions and relaxations by providing immediate physiological feedback of PFM activity in an understandable visual and/or audible format . It has Behavioural interventions can readily be incorporated into the daily lives of patients who possess the cognitive and functional capability; clinicians and staff in busy office settings can readily incorporate these therapies into routine medical and nursing care. Although OAB symptoms and UUI can be successfully managed using non-pharmacological approaches, they require considerable motivation from the patient and attrition rates may be high without adequate follow up, although attrition may also occur because of lack of efficacy. Behavioural interventions which educate and empower patients can be utilised either alone or as an adjunct therapy to enhance pharmacotherapy for OAB and UUI. However, the issue of whether it is optimal to initiate treatment using a combined therapy or to start with a single therapy and then introduce a second approach if the patient does not respond to treatment remains to be resolved and may be largely driven by patient preference until more evidence is available. Finally, clinicians should be familiar with the practical details of habit changes and training techniques not only to optimise treatment outcomes in consideration of patient preferences and goals for OAB treatment, but also as the foundation for patient education to promote bladder health as part of routine healthcare.

High blood lead (Pb) and hyperhomocysteinemia have been found to be associated with cardiovascular disease (CVD). Mean blood Pb and mean plasma homocysteine levels have been reported to be high in Pakistani population. The objective of the present study was to assess the relationship of blood Pb to the risk of hyperhomocysteinemia in a low income urban population of Karachi, Pakistan.In a cross sectional survey, 872 healthy adults were recruited from a low income urban population of Karachi. Fasting venous blood was obtained and assessed for blood Pb and plasma/serum homocysteine, folate, pyridoxal phosphate and vitamin B12. The study population had median (IQR) blood Pb of 10.82 µg/dL (8.29–13.60). Prevalence of high blood Pb (levels >10 µg/dL) was higher in males compared to females . Mean ± SD/median (IQR) value of plasma homocysteine was significantly higher in the highest quartile of blood Pb compared to the lowest quartile 16.13±11.2 µmol/L vs 13.28±9.7µmol/L/13.15 (10.33–17.81) µmol/L vs 11.09 (8.65 14.31) µmol/L . Daily consumption of fruit juice had a positive influence on both levels of plasma homocysteine and blood Pb. Compared with the lowest quartile of blood Pb, the OR for hyperhomocysteinemia was 1.69 for the fourth quartile when the model was adjusted for age, gender, folate and vitamin B12.This study showed a relationship between blood Pb and hyperhomocysteinemia in a general population of Karachi, Pakistan. The harmful effect of Pb on cardiovascular system could be due to its association with hyperhomocysteinemia. Lead (Pb) accumulates in blood and other tissues when one gets exposed to it. There are no safe levels of lead within the body and the threshold for Pb levels in the blood has been reviewed over the past several years. On the basis of different epidemiological studies, it has been recommended that levels of blood Pb should be kept below 10 µg/dL 3, while WHO/USAEPA guidelines suggest that Pb contents in ambient air should be 0.5–1.0 µg/m3Karachi is among the most densely populated industrial cities in South Asia. Because of a lack of clear cut policy by the Government of Pakistan regarding pollution control, heavy metal pollution contributed primarily by industrial waste is expected to be very high in large cities. Levels of Pb in ambient air of 3 major cities of Pakistan have been reported to be alarmingly high. The Pb contents in suspended particulate matter have been found to be in the range 1.03–4.8 µg/mKeeping in view high prevalence of hyperhomocysteinemia and Pb pollution in Pakistani population it would be imperative to examine the relationship of homocysteine and blood Pb at an urban community level.The aim of the present study was to investigate the relationship of blood Pb to the risk of hyperhomocysteinemia in a low income urban population of Karachi, Pakistan.The study was approved by the Ethics Review Committee of the Aga Khan University, and prior written informed consent was obtained from all the participants included in this study.Eight hundred and seventy two healthy individuals of age 18–60 years from low income urban locality in east of Karachi, Pakistan were included in this study. In this cross sectional survey, a systematic random sampling was adopted to select houses. A sampling frame of 4000 houses was available in this locality through the Urban Health Project of the Department of Community Health Sciences, Aga Khan University for addressing the health and developmental needs of this community. The first house was selected randomly by computer draw, while every fourth household was selected for the sample applying the right hand rule for the direction. The selection of subject from each household was voluntary provided the participants fulfilled the inclusion criteria.All the subjects were assessed for socio-demographic characteristics. Anthropometric measurements were also recorded by trained research assistants. They were community health workers from the same locality and were trained to collect demographic and clinical information from participants. Since juice consumption has been known to influence blood Pb levels Ten ml of fasting venous blood was collected and transferred equally into a heparinized tube and a non-heparinized tube. Whole blood was used for the determination of blood Pb, while plasma was analyzed for homocysteine and pyridoxal phosphate . Serum was utilized for the determination of folate and vitamin B12 using radioassay Continuous variables including blood Pb, homocysteine, folate, PLP, vitamin B12 and body mass index (BMI) were expressed as mean ± SD/median (IQR). All statistical analyses were done with the help of Statistical Package for Social Sciences® (SPSS) software version 13 for windows®. Independent sample t-test was used to compare mean values of continuous variables between two groups. Analysis of variance (ANOVA) was used to compare the above mentioned continuous variables across the blood Pb quartiles, followed by post hoc power estimation and Bonferroni test for multiple pair-wise comparisons.Multiple linear regression was used to examine the relationship of log transformed blood Pb with log homocysteine levels, controlling for covariates . After that, known determinants of homocysteine were added in the model. All those variables which were associated with homocysteine or influenced the relationship of log blood Pb with log homocysteine were kept in the final analyses. Binary logistic regression analysis was also used to examine the association between risk of hyperhomocysteinemia (dependent variable) and blood Pb (independent variable). This model was also adjusted for age, gender, folate and vitamin B12 to assess the risk of hyperhomocysteinemia.Study participants include 59.2% females and 40.7% males and had mean ± SD/median (IQR) age of, 32.51±10.71/30 (24–40) years. Analysis of the data revealed that mean ± SD blood Pb concentration 11.65±5.5 µg/dL in the study population was higher than the previously considered acceptable levels (<10 µg/dL) In order to evaluate predictors of log homocysteine adjusting for covariates, multiple linear regression was used. It turns out that an increase of 1 µg/dL log blood Pb was associated with an increase of 0.09 µmol/L log homocysteine. As homocysteine, in general, increases with age, separate models were repeated next in subjects' ≤20 years and >20 years. The association was stronger in subjects with age >20 years, such that an increase of 1 µg/dL log blood lead was associated with 0.1 µmol/L increase in log homocysteine compared to 0.07 µmol/L increase in log homocysteine in subjects ≤20 years. Moreover, this relationship remained significant for blood Pb, serum folate, serum B12, gender, daily juice consumption and occupation in subjects >20 years of age as compared to the subjects of age ≤20 years . In unadPb pollution is a serious environmental risk to human health, especially in South Asian countries where adequate regulatory measures are not in place. While studies have been carried out in developed countries to investigate the risk of CVD with mild hyperhomocysteinemia and blood Pb Our data also show significantly high percentage of men compared to women with blood Pb levels higher than the previously considered acceptable levels of blood Pb . These increased levels in men could be due to their greater exposure to environmental Pb pollution as they are generally the bread earners in this part of the world. Moreover, occupational exposure is an additive risk. Similar findings have been reported by Son et al. Increased mortality from cardiac events in individuals with blood Pb levels greater than 3 µg/dL The observed linear association of plasma homocysteine with quartiles of blood Pb indicates that blood Pb could be another determinant of hyperhomocysteinemia. However, the known determinants of hyperhomocysteinemia, such as deficiencies of folate, vitamin B6 and vitamin B12 were not found to be associated with quartiles of blood Pb in the study population. It is unclear at this stage whether hyperhomocysteinemia is the cause or effect of high blood Pb. Some of the enzymes involved in homocysteine metabolism could be affected by Pb, thereby leading to hyperhomocysteinemia. The other possibility is that high levels of plasma homocysteine, a thiol amino acid with structure similar to dimercaptosuccinic acid could be chelating Pb, thereby delaying its plasma clearance Inverse relationship between daily juice consumption and mean levels of plasma homocysteine and blood Pb points towards the notion that adequate consumption of fruit and vegetable juices could be beneficial in reducing the risk of hyperhomocysteinemia and high blood Pb. In South Asian populations where mean levels of plasma homocysteine and blood Pb are quite high, public awareness about this simple way of bringing their levels down would have a positive influence on the health of masses in this region. Similar inverse relationship between fruit and vegetable juice consumption and plasma homocysteine has been demonstrated in men by Samman et al. In a previous communication, we reported mild association (Pearson's r = 0.24) between blood Pb and homocysteine The results from this study need to be evaluated within the context of its limitations. A major limitation was the dependence on a single blood Pb measurement which, perhaps, reflects recent exposure with half life of approximately 30 days for blood Pb Regardless of these limitations, the study did show a few novel findings. The relatively large sample size allowed analysis of mean homocysteine concentration in quartiles of blood Pb. The results are representative of an urban population of Karachi, Pakistan. High levels of blood Pb in men point towards the fact that Pakistani males are at a greater risk of developing hyperhomocysteinemia compared to females probably due to greater exposure to Pb pollution hence are more prone to developing CVD and cognitive disorders. Inverse association between daily juice consumption and plasma homocysteine concentration implies that increased intake of fruit juices could play a role in reducing hyperhomocysteinemia in Pakistani population. Moreover, the inverse relationship between juice consumption and blood Pb indicates that frequent consumption of juices could be an effective way of keeping the blood Pb levels low, thereby avoiding its deleterious effects. Investigation of any relationship between blood Pb and plasma PLP was another novel aspect of this study; however we did not find any association between these two parameters. Stronger association between log homocysteine and log transformed blood Pb in adults of age >20 years compared to adults ≤20 years indicates that older adults are at a greater risk of having elevated levels of homocysteine and blood Pb.Further studies, especially on people with greater exposure to Pb would be helpful in ascertaining the relationship between blood Pb and plasma levels of homocysteine in such high risk group individuals.Since hyperhomocysteinemia is now recognized as one of the major risks for the development of CVD, various factors associated with high levels of plasma homocysteine require immediate attention in populations having high prevalence of vascular disease. In the present study the focus was on high levels of blood Pb due mainly to rampant environmental pollution in an industrial city of this country.This study showed a relationship between blood Pb and hyperhomocysteinemia in a general population of Karachi, Pakistan. Therefore, control of Pb pollution could be one of the important steps in reducing the burden of CVD.

In vitro dissolution studies exhibited remarkable increase in rate and extent of dissolution of the drug from its complexes with β -cyclodextrin. Pure rofecoxib as well as its co-ground binary mixture were formulated as aqueous gels for topical application. In vitro skin permeation of rofecoxib from formulation containing rofecoxib-cyclodextrin complex was significantly higher (p<0.05) at 1, 2, 12, 18 and 24 hr as compared to formulation containing pure rofecoxib. This could be attributed to better solubility of binary mixture in the aqueous gel vehicle leading to greater concentration gradient between the vehicle and skin and hence higher flux of the drug.Rofecoxib, a practically insoluble cox-2 selective nonsteroidal antiinflammatory agent was subjected to improvement in solubility by preparing its binary mixtures with β cyclodextrin using various methods such as physical mixing, co-grinding, kneading with aqueous methanol and co-evaporation from methanol-water mixture. Characterization of the resulting binary mixtures by differential scanning calorimetry and X-ray diffraction studies indicated partial amorphization of the drug in its binary mixtures. Rofecoxib (RXB), a cyclooxygenase -2 (cox-2) specific nonsteroidal antiinflammatory drug (NSAID) is indicated for the relief of signs and symptoms of osteoarthritis, rheumatoid arthritis and management of pain in adultsVery poor aqueous solubility of RXB, could have an undesirable effect on its permeation across the skin. Hydrophilic cyclodextrins are known to improve the solubility of insoluble drugs by forming inclusion complexesIn aqueous topical formulations, cyclodextrins keep the lipophilic insoluble drug molecules in the form of saturated solution and deliver them to the skin surface in relatively larger concentration creating a greater concentration gradient across the skin and thus facilitating the partitioning of the drug into the skinin vitro dissolution characteristics of RXB as well as on the in vitro skin permeation of the drug when formulated into an aqueous gel.The aim of the present study was to evaluate the influence of β-cyclodextrin (BCD) on the solubility and in vitro skin permeation studies.RXB was a gift sample given by Lyka Labs ltd. . Carbomer 980(Carbopol 940) was a generous gift sample from B. F. Goodrich . BCD was purchased from S.A. Chemicals . Solvents for HPLC were purchased from S. D. Fine Chem . Other reagents and chemicals used were of analytical (AR) grade. After obtaining necessary approvals from Institutional Animal Ethics Committee, guinea pigs were procured from Hindustan Lever Ltd. for the 0 (1-slope), where slope is obtained from the graph and S0 is equilibrium solubility of RXB in water. Phase solubility study was carried out to investigate the effect of BCD on the solubility of RXB, using the method reported by Higuchi and ConnorsBMs of RXB and BCD were prepared in the molar ratio of 1:1. Physical Mixture (PM) was prepared by geometric mixing of RXB and BCD without applying pressure. Co-ground BM (CG) was prepared by mixing and triturating RXB and BCD for 15 to 20 min. Co-evaporated BM (COEVAP) was prepared by dissolving RXB in methanol and BCD in water, following which both the solutions were mixed and the solvent mixture was evaporated by controlled heating at 45-50° with continuous stirring of solution until dry. Kneaded BM (KD) was prepared by geometric mixing of powders, RXB and BCD and then kneading with 1:1 mixture of methanol-water to obtain a mass with a pasty consistency, which was dried in a tray dryer at 45 to 50°. All the BMs were prepared in triplicate and were sieved through BSS 85# sieve (Sieve diameter 180 μ) and stored over anhydrous calcium chloride in dessicator.The Infra Red (IR)spectra, differential scanning calorimetry (DSC) thermograms and X-ray diffraction (XRD) patterns of RXB, BCD and the BMs were recorded. The IR spectra were recorded on a Jasco FT/IR 5300 spectrophotometer by potassium bromide (KBr) pellet method. For DSC studies, RXB, BCD and the BMs each weighing in the range of 3 to 5 mg were scanned at a rate of 10°/minute on a Shimadzu DT-40 Thermal Analyzer between 30° and 330° under inert atmosphere of nitrogen and the XRD patterns of RXB, BCD and their BMs were recorded using a Phillips X-ray Diffractometer (PW 1710) with a copper target, voltage 40 kV, current 30 mA at a scanning speed of 1° per minute.Each BM equivalent to 12.5 mg of RXB was weighed accurately and dissolved in 25 ml of methanol by sonication; 1 ml of this solution was diluted to 100 ml with 0.1 N HCl containing 0.5% polysorbate 80 (Tween 80). The drug content was calculated based on the absorbance of the solution at 262 nm. All the BMs were assayed in triplicate.In vitro dissolution studies were performed in six replicates using USP Type 2 apparatus in 900 ml of 0.1N HCl containing 0.5% Tween 80 as medium maintained at 37±0.5° using the speed of 50±2 rpm. RXB, 12.5 mg or equivalent quantity of BM was weighed accurately and dispersed in the dissolution medium. Aliquots were withdrawn at regular time intervals, filtered using Whatmann® No.1 filter papers, suitably diluted and read spectrophotometrically at 262 nm.Small quantities of formulations F1 and F2 were spread in the form of smears on the glass slides, observed under microscope and their photomicrographs were taken using Panasonic-GTKR222E camera attached to Hund Wetznar H-500 microscope.18 HiQsil, 5μ column (250×4.6 mm) stabilized by the mobile phase consisting of acetonitrile: water (60:40) at the flow rate of 1ml/min.The formulations were assayed for RXB content in triplicate by validated reverse phase HPLC technique. The accurately weighed quantity of formulation was dissolved in suitable quantity of n, n dimethylformamide, diluted suitably with mobile phase and analyzed using an isocratic system involving JASCO PU- 2080 Plus intelligent pump, Jasco UV-2075 Plus UV/Vis detector set at 262 nm, Star 800 Module interface and Borwin software (version 1.5). Chromatograms were obtained by injecting samples on to the system equipped with 20μl loop and C2. Phosphate buffer saline pH 7.4 was filled in receptor compartment and stirred continuously with the help of a magnetic stirrer. The medium was maintained at 37° with the help of a water jacket of the receptor compartment receiving water at the temperature of 37° from circulating water bath. The skin of suitable size was cut and placed properly between the donor and the receptor compartment with the dermal side in contact with the receptor medium. On the epidermal side of the skin, weighed amount of the formulation was spread evenly and both the donor and receptor compartments were clamped together. The donor compartment was covered with the aluminum foil tightly so as to avoid evaporation of water from the gel formulation during the study. The receptor medium was withdrawn completely and replaced with fresh medium at 1, 2, 4, 6, 8, 12, 18 and at the end of study duration i.e. at 24 h.Skin permeation studies were carried out using the Erweka apparatus and Keshary Chien diffusion cells. For each formulation, the skin permeation was studied in 4 replicates. Full thickness abdominal skin was excised from adult albino guinea pigs weighing in the range of 300 to 400 g. The visceral side of the freshly excised skin was cleaned free of any adhering subcutaneous tissue. The hair on the epidermal surface of the skin was cut with the help of a pair of scissors, as close to skin as possible without damaging the skin. The diffusion cells had receptor compartment volume of 8 ml and diffusion area of 5 cmSamples were diluted suitably and analyzed spectrophotometrically for the content of RXB at 255 nm. The method of analysis was validated previously for specificity and linearity. Cumulative amount of RXB permeated through skin was plotted as a function of time. Permeation profiles of both the formulations were compared applying unpaired, two tailed Student’s t test at 5% level of significance.L according to Higuchi and Connors. As the slope of the line was less than unity, it was assumed that the increase in solubility observed was due to the formation of a 1:1 complex. The apparent stability constant K1: 1 was found to be238 M-1 indicating adequate stability of the complex.Present work involved determining the influence of BCD on the solubility of RXB. The phase solubility diagram could beRXB, BCD and their BMs, were subjected to IR spectroscopy to determine any possible interaction of the drug with the carrier. There were no significant changes in the IR spectra of the BMs when compared with that of the pure RXB thus indicating minimal chemical interaction between the drug and BCD as a result of preparation of BMs. DSC scan of RXB showed a sharp melting endotherm at 212.5° . Scan ofin vitro dissolution studies were carried out for the same quantity of the drug. RXB powder, when studied for in vitro dissolution in 0.1N HCl containing 0.5% Tween 80 exhibited only 60% dissolution at the end of 3 hours with a large variation in amount dissolved at each time interval (in situ interaction between drug and the cyclodextrin during dissolution studies leading to formation of a complex with improved solubility. CG showed complete release within 20 min indicating good association of RXB and BCD attainable without involving any solvent but just by grinding of the two powders. KD exhibited fastest release with complete drug dissolution in 10 min. Thus, preparation of BMs significantly improved rate as well as the extent of in vitro dissolution of the drug owing to the factors such as complexation, partial amorphization of the drug and its improved wettability in presence of BCD.Minimum therapeutic dose of RXB for oral administration is 12.5 mg hence interval . PM althAqueous based gel formulations are well-accepted dosage forms for the topical application owing to their elegant appearance, cooling effect, good spreadability, non-tackyness and ease of removal. Hence, gel was chosen as a vehicle for the development of topical formulation of RXB. To evaluate the influence of improved solubility of the drug on its permeation characteristics, CG equivalent to 0.5% of RXB was formulated in to the same gel base. pH of the formulation was maintained between 5.3 to 5.4 which is close to the physiological pH of the skin and it would not affect the stability of the drug. Sodium benzoate, a preservative effective in acidic pH was added. The formulations were observed under microscope to determine the distribution and morphological characteristics of the drug in the gel vehicle. In case of system F1, fairly uniform distribution of small agglomerates of drug particles in the gel base indicated homogeneous mixing of the drug in the base. Formulation F2 containing BM showed almost spherical shaped fine drug particles with smooth edges indicating altered morphology of the drug in its BM with cyclodextrin . The gel-2 h-1, respectively.Abdominal skin of guinea pigs is widely used for the permeation studies of the topical formulations12in vitro dissolution profile of the drug owing to partial amorphization of drug as revealed by DSC and XRD studies. Incorporation of CG in to the gel formulation resulted in better in vitro skin permeation of drug as compared to the system containing drug alone thus confirming the beneficial effect of BCD on permeation of the drug.In conclusion, BMs of RXB and BCD prepared by various methods exhibited improvement in apparent aqueous solubility and

After transfer of Glc3Man9GlcNAc2 onto protein, dolichol-PP is recycled to dolichol-P and reused for DLO biosynthesis. Because de novo dolichol synthesis is slow, dolichol recycling is rate limiting for protein glycosylation. Immature DLO intermediates may also be recycled by pyrophosphatase-mediated cleavage to yield dolichol-P and phosphorylated oligosaccharides (fOSGN2-P). Here, we examine fOSGN2-P generation in cells from patients with type I Congenital Disorders of Glycosylation (CDG I) in which defects in the dolichol cycle cause accumulation of immature DLO intermediates and protein hypoglycosylation.Biosynthesis of the dolichol linked oligosaccharide (DLO) required for protein N-glycosylation starts on the cytoplasmic face of the ER to give Man7GlcNAc2-PP-dolichol, are permeabilised so that vesicular transport and protein synthesis are abolished, the DLO pool required for Man7GlcNAc2-P generation could be depleted by adding exogenous glycosylation acceptor peptide. Under conditions where a glycotripeptide and neutral free oligosaccharides remain predominantly in the lumen of the ER, Man7GlcNAc2-P appears in the cytosol without detectable generation of ER luminal Man7GlcNAc2-P.In EBV-transformed lymphoblastoid cells from CDG I patients and normal subjects a correlation exists between the quantities of metabolically radiolabeled fOSGN2-P and truncated DLO intermediates only when these two classes of compounds possess 7 or less hexose residues. Larger fOSGN2-P were difficult to detect despite an abundance of more fully mannosylated and glucosylated DLO. When CDG Ig cells, which accumulate ManThe DLO pools required for N-glycosylation and fOSGN2-P generation are functionally linked and this substantiates the hypothesis that pyrophosphatase-mediated cleavage of DLO intermediates yields recyclable dolichol-P. The kinetics of cytosolic fOSGN2-P generation from a luminally-generated DLO intermediate demonstrate the presence of a previously undetected ER-to-cytosol translocation process for either fOSGN2-P or DLO. An in vitro assay revealed that DLO pools that give rise to either fOSGN2-P or N-glycans are functionally linked. Furthermore, DLO intermediates synthesized in the lumen of the ER can give rise to cytosolic fOSGN2-P without detectable generation of ER-situated fOSGN2-P intermediates.In the present study we investigated fOSGN2-P generation in EBV-transformed lymphoblasts derived from several CDG I patients as well as different murine lymphoblasts. In all cell lines, the fOSGN2-P pool comprised structures containing mainly 7 or less hexose residues . After obtention of signed written parental consent forms, lymphoblasts derived from patients with unknown disease were immortalised with the Epstein Barr virus (EBV) as previously described Experiments on human cell lines were conducted in accordance with local ethics comittees and the Comités de Protection des Personnes ]mannose (24.7 Ci/mmol), D-[6-3H (N)]glucosamine (25.9 Ci/mmol) and En3hance spray were from PerkinElmer Life Sciences . TLC plates were obtained from MERCK . AG 50-X2 (H+ form) and AG 1-X2 (acetate form) came from Biorad SA, . Streptolysin O (SLO) was a generous gift from Sucharit Bhakdi . Fucose, endo-β-N-acetylglucosaminidase H from Streptomyces plicatus (endoH), protease and alkaline phophatase were purchased from SIGMA–Aldrich SARL . Castanospermine, kifunensin and swainsonine were from Toronto Research Chemicals Inc. . The tripeptide, Ac-NYT-NH2, was synthesised and purified D-mannitol was from Fluka . mannose for 30 min at 37°C under an atmosphere containing 5% CO2. Where indicated, cells were preincubated in radiolabelling media containing 2 mM castanospermine (CST), 100 µM swainsonine (SW) or 100 µM kifunensin (KIF) for 45 min prior to addition of the radioactive sugars.The parental BW5147.3 and the ThyThe transfer vector encoding wild type hALG12 and enhanced green fluorescent protein (eGFP) has already been described 2. The cells were then incubated for 1 h at 4°C in PB containing 2 µg/ml streptolysin O (SLO). Permeabilised cells containing membrane bound compartments (MBC) were then separated from the SLO perfusate containing cytoplasmic components (Cyt) by centrifugation at 130 gAv for 5 min at 4°C.After radiolabelling, cells were permeabilised using a modification of a previously described method +/glutamate, 10 mM NaCl, 2 mM EGTA, 1 mM CaCl2 and 2 mM MgCl2. Subsequently, the cells were incubated on ice for 30 min in IB, containing 2 µg/ml SLO, and then washed twice with IB to remove excess SLO. Finally, the cells were incubated for 5 min in IB prewarmed to 37°C before a final wash into ice cold IB. Aliquots of the permeabilised cells were incubated with IB containing the various additions indicated in the figure legends in a reaction volume of 50 µL for different times at 37°C. Reactions were stopped by the addition of 450 µL ice cold IB. MBC and Cyt fractions were obtained as described above.SLO-permeabilised cells were incubated in an intracellular buffer (IB) as previously described 2, 2∶1. Four mls CHCl3 were added and the mixture shaken. After centrifugation, the lower CHCl3 and upper methanolic phases were recovered. Neutral and negatively charged soluble oligosaccharide material was recovered from the latter phase whereas DLO were recovered from both the former phase and also from the CHCl3/MeOH/H2O 10∶10∶3 extracts of the interphase proteins. Oligosacharides were released from DLO after mild acid hydrolysis with 0.02N HCl for 30 min at 100°C. The dried upper methanolic phase was taken up in H2O and desalted on AG-50 (H+ form) and AG-1 (acetate form) ion-exchange columns prior to being loaded onto charcoal columns as previously described. Neutral fOS were eluted from the charcoal with 30% ethanol. Negatively charged material was eluted from the AG-1 resin with 3 M formic acid, and after removing the formic acid under vaccuum, was further treated with either 0.02 N HCl, as described for DLO, or treated with alkaline phosphatase overnight in 100 mM TrisHCl, pH 8.0, at 37°C. Neutralised material was recovered after passage over coupled AG-50/AG-1 resins. Glycoproteins from the 10∶10∶3-extracted protein pellet and the TCA-precipitated glycoproteins recovered from cell culture medium were submitted to protease digestion to yield glycopeptides. Oligosaccharides were released from glycopeptides using endo-β-N-acetylglucosaminidase H from Streptococcus plicatus (endoH).These methods have all been adapted from previously described techniques n-propanol/acetic acid/water, 3/3/2 for 16–24h 3hance and were quantitated by scintillation counting after their elution with water from the silica. After derivatisation with 2-aminopyridine (2-AP) as previously described The number of charges associated with oligosaccharide components was evaluated using quaternary aminoethyl (QAE)-Sephadex beads equilibrated in 2 mM Tris base 7GlcNAc2-PP-dolichol mannosyltransferase (CDG Ig: ALG12-deficiency) we sought evidence for DLO regulation through pyrophosphatase action and the generation of fOSGN2-P. In a first set of experiments, EBV ctrl 1 cells and EBV CDG Ig cells, in which the truncated DLO Man7GlcNAc2-PP-dolichol is known to accumulate, were pulse radiolabeled with [2-3H]mannose and after extraction with organic solvents, water soluble components were submitted to molecular sieve chromatography on Biogel P2. Radioactive material eluting before the inclusion volume of the column was pooled and loaded onto coupled cation and anion exchange chromatography columns as shown in 3H]DLO, [2-3H]glycoproteins and [2-3H]fOS, it was noted that when total cellular [2-3H]mannose incorporation is considered, [2-3H]mannose labelled material in the FA eluates corresponded to ∼4% of total cellular radioactivity in EBV ctrl 1 cells, and this value increased 3 fold in EBV CDG Ig cells are liberated from either DLO by OST 7GlcNAc2 and Man7GlcNAc species, respectively. These results indicate that the bulk of the negatively charged material derived from EBV CDG Ig cells corresponds to phosphorylated Man7GlcNAc2 and that the phosphate is attached to the GlcNAc residue at the reducing terminus of the oligosaccharide. Likewise, the negatively charged material derived from the DPM-deficient murine Thy-1 lymphoma cells was characterised. This material behaved similarly to the CDG Ig EBV cell derived material upon QAE Sephadex chromatography, was neutralised with alkaline phosphatase to yield predominantly Man5GlcNAc2 . Although the corresponding species were detected in the DLO pool (Man2-7GlcNAc2-PP-dolichol), the predominant DLO-deirved species were larger and contained 8–9 residues of mannose and varying numbers of glucose residues (Glc1-3Man8-9GlcNAc2-PP-dolichol). When the chromatographic profiles of DLO-, and fOSGN2-P-derived oligosaccharides obtained from glycosylation deficient cells are inspected there are increases in the corresponding fOSGN2-P species. In EBV CDG Ie cells, fOSGN2-P derived structures that co-elute with DLO derived Glc1-2Man5GlcNAc2-P were identified. However, the mutation in the DPM1 gene in these cells is leaky, leading to residual synthesis of fully mannosylated DLO. Accordingly, DLO and fOSGN2-P derived components that elute as Glc1-2Man5GlcNAc2-P are potentially mixtures containing also Man6-7GlcNAc2 species. By contrast to EBV CDG Ie cells, in the Thy-1 cells, DPM synthase is inactive leading to an absence of DLO structures containing more than 5 mannose residues. In these cells a fOSGN2-P derived structure comigrating with DLO-derived Glc1Man5GlcNAc2 was detected, but although substantial quantities of DLO-derived Glc2-3Man5GlcNAc2 were noted corresponding structures derived from fOSGN2-P occured at very low levels . Accordingly, despite the abundance of glucosylated DLO in all cell lines tested, glucosylated fOSGN2-P, if present, are under represented in the total fOSGN2-P pool.In order to examine the origins of fOSGN2-P in more detail, the dephosphorylated structures were compared to the glycone structures of DLO in different control and CDG I EBV cell lines on ice. The procedure employed is known to specifically permeabilise the plasma membrane of cells In order to address the mechanism underlying fOSGN2-P generation, the subcellular localisation of Manin vitro assay was established for the generation of Man7GlcNAc2-P using SLO-permeabilised EBV-CDG Ig cells. It has been demonstrated that after specific permeabilisation of the plasma membrane of various cell lines with SLO, vesicle-mediated intracellular transport of proteins 3Man9GlcNAc2-PP-dol is the major DLO with smaller amounts of Glc3Man7GlcNAc2-PP-dol and Man7GlcNAc2-PP-dol also being present. Despite the presence of fully glucosylated DLO species, Man7GlcNAc2-P was the only fOSGN2-P detected. It has been reported that the DLO pyrophosphatase activity is inhibited by pyrophosphate 7GlcNAc2-P generation but also leads to the accumulation of a DLO intermediate behaving as Man9GlcNAc2-PP-dolichol. Indeed, after jack bean α-mannosidase digestion of radioactive components eluted from this region of the chromatogram, it was ascertained that the predominant component was not glucosylated . These data suggest that in addition to inhibiting the DLO pyrophosphatase, pyrophosphate blocks DLO glucosylation. The appearance of fully mannosylated DLO intermediates in cells from this CDG Ig patient is not unexpected because the mutation in the ALG12-encoded mannosyltransferase is leaky in vitro system reported here where DLO utilisation is strikingly reduced, Man7GlcNAc2-PP-dolichol elongation by the defective ALG12-encoded mannosyltransferase may be significantly enhanced. To summarise, Man7GlcNAc2-P is generated in SLO-permeabilised CDG Ig cells and the selectivity of fOSGN2-P generation reproduces that observed in intact cells.In order to further investigate the compartmentalisation of fOSGN2-P generation an 7GlcNAc2-P generation and ER-mediated polypeptide N-glycosylation 2, NYT) containing the N-glycosylation concensus sequence to the vesicular transport-incompetent permeabilised cells could potentially deplete the DLO pool giving rise to fOSGN2-P and therefore inhibit fOSGN2-P generation. As indicated in 7GlcNAc2-P generation is an ER-associated event and that this structure is either generated in the lumen followed by highly efficient ER-to-cytosol transport the presence of a highly selective fOSGN2-P would have to be proposed. Third, the pyrophosphatase activity may be compartmentalised differently to more fully mature DLO intermediates, and the selectivity of the putative mechanism that regulates this DLO compartmentalisation would underly the selectivity of fOSGN-P generation. This hypothesis is difficult to evaluate because the subcellular localisation of the pyrophosphatase is not clear. Although the subcellular site for the generation of Man9-8GlcNAc2-P has not been investigated, the lumenal orientation Man9-8GlcNAc2-PP-dolichol has led to the assumption of an ER luminal pyrophosphatase activity 5GlcNAc2-P and Man2GlcNAc2-P were only recovered in the cytosol fraction of DPM-deficient CHO cells whose plasma membrane is permeabilised. As DLO intermediates containing 5 or less mannose residues are generated on the cytosolic face of the ER, the pyrophosphatase activity was proposed to work at the cytosolic face of this organelle Three hypotheses could explain the selectivity of fOSGN2-P generation that we observe in EBV lymphoblastoid or mouse lymphoma cells. First, the pyrophosphatase activity may show specificity towards non-glucosylated, hypomannosylated, DLO intermediates. However, it has been demonstrated that calf thyroid microsomes are capable of yielding fOSGN2-P from exogenous Glcin vitro assay we show that fOSGN2-P generation is reduced when permeabilised cells are incubated with a peptide containing the N-glycosylation consensus sequence. This result demonstrates that the DLO pool that gives rise to fOSGN2-P and the pool which is required for peptide glycosylation are functionally related. Furthermore, as peptide N-glycosylation is mediated by OST in the ER and vesicular transport is not supported in SLO permeabilised cells, these data indicate that fOSGN2-P generation is a property of the ER itself or of some contiguous membrane structure. When cells are metabolically radiolabeled and then permeabilised with SLO at 4°C we noted that although ∼80% of Man7GlcNAc2-P was recovered in the cytosol fraction, trypan blue exclusion studies indicated that greater than 95% of cells had been permeabilised. Three hypotheses may be postulated to explain these data. First, under our permeabilisation conditions, Man7GlcNAc2-P may be less permeant than trypan blue. Second, a Man7GlcNAc2-P pool could be generated within an MBC. Third, cytosolic Man7GlcNAc2-P could bind to exposed sites of the permeabilised cells. Whatever the explanation behind the localisation of MBC-associated Man7GlcNAc2-P, in vitro incubations reveal that this fOSGN2-P pool is stable and little affected by the presence of the glycosylation acceptor peptide. By contrast, the amount of cytosolic Man7GlcNAc2-P increases 6 fold during such incubations and this production is sensitive to the presence of the glycosylation acceptor peptide. Accordingly, we were unable to detect the precursor/product relationship between MBC-, and cytosol-situated Man7GlcNAc2-P that would be expected from ER-to-cytosol transport of this structure. Both glycopeptides in vitro assay for the generation of Man7GlcNAc2-P which is carried out in the absence of such molecules, a glycotripeptide and fOS remain predominantly within the MBC.Using an 7GlcNAc2-P from luminal Man7GlcNAc2-PP-dolichol without the appearance of luminal Man7GlcNAc2-P under conditions where other known transport processes, if present, operate so inefficiently that their substrates accumulate in the ER? First, a luminal pyrophosphatase activity could be tightly coupled to an ER-to-cytosol transport process allowing efficient molecular channelling of the pyrophosphatase product to the transporter resulting in an undetectable pool of luminal Man7GlcNAc2-P (7GlcNAc2-PP-dolichol from the luminal to the cytosolic face of the ER thereby exposing the DLO intermediate to a pyrophosphatase whose active site is cytosolic (7GlcNAc2-PP-dolichol across artificial sealed liposomes, although in these studies, Man5GlcNAc2-PP-dolichol appeared to be the best substrate for this activity What mechanism could account for the generation of cytosolic ManlcNAc2-P . Second,ytosolic . Indeed,To conclude, fOSGN2-P have been observed in EBV lymphoblastoid cells from control subjects and CDG I patients and murine lymphoma cells. In cells with glycosylation deficits where non-glucosylated DLO intermediates containing 7 or less mannose residues accumulate, increased fOSGN2-P generation is observed. The functional link between DLO pools required for N-glycosylation and fOSGN2-P generation in permeabilised cells indicates that they are contiguous and substantiates the hypothesis that pyrophosphatase-mediated cleavage of DLO intermediates could yield rapidly recyclable dolichol-P. The mechanisms underlying fOSGN2-P generation appear complex and reveal a novel ER-to-cytosol translocation process for either fOSGN2-P or DLO.

DOI: 10.1107/S1600536808023799/tk2286Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The second phase with G-CSF was interrupted because of evidence of cumulative cardiac toxicity. Cardiac toxicity was reported in a total of 15 patients in this study. DaunoXome shares the early cardiotoxicity of conventional anthracyclines in paediatric oncology. This study has successfully defined a haematological MTD for DaunoXome, but the significance of this is limited given the concerns of delayed cardiac toxicity. The importance of longer-term follow-up in patients enrolled into phase I studies has been underestimated previously, and may lead to an under-recognition of important adverse events.Anthracyclines are widely used in paediatric oncology, but their use is limited by the risk of cumulative cardiac toxicity. Encapsulating anthracyclines in liposomes may reduce cardiac toxicity and possibly increase drug availability to tumours. A phase I study in paediatric patients was designed to establish the dose limiting toxicity (DLT) and maximum tolerated dose (MTD) after a single course of liposomal daunorubicin, ‘DaunoXome’, as a 1 h infusion on day 1 of a 21 day cycle. Patients were stratified into two groups according to prior treatment: Group A and group B (heavily pretreated patients). Dose limiting toxicity was expected to be haematological, and a two-step escalation was planned, with and without G-CSF support. Pharmacokinetic studies were carried out in parallel. In all, 48 patients aged from 1 to 18 years were treated. Dose limiting toxicity was neutropenia for both groups. Maximum tolerated dose was defined as 155 mg m Anthracycline antibiotics have a wide spectrum of activity, and are used in many adult and paediatric protocols for the treatment of haematological and solid malignancies. The risk of cardiomyopathy is dose-limiting, and is related to cumulative dose, young age, mediastinal radiotherapy and pre-existing cardiac impairment .The effect of administration schedule of anthracyclines – as a bolus or as a prolonged infusion – has been studied in preclinical models and clinically. The pharmacokinetics of doxorubicin do appear to be affected by infusion duration is held within a vesicle comprising disteroyl phosphatidyl choline (DSPC) and cholesterol. Vesicles of this diameter (40–60 nm) are not rapidly cleared from the plasma by the reticulo-endothelial system, and release of daunorubicin continues in a sustained manner. Preclinical studies indicate increased tissue concentrations of daunorubicin in tumour, brain, liver, spleen and intestine following DaunoXome compared with free daunorubicin administration, but a reduced tissue concentration in cardiac tissue (AUC ratio 0.4) . In addi−2 . The maximum cumulative dose of anthracyclines was 720 mg m−2: only one patient, treated at the first level of 40 mg m−2, showed a decrease in fractional shortening of more than 10%. Owing to relapse or death, cardiac data are available in only 16 patients and all have normal function, although the assessment of cardiac function was made early post-treatment .A French phase I study of DaunoXome in children with acute lymphoblastic leukaemia, delivered DaunoXome every 7 days for 4 weeks at a starting dose of 40 mg m−2, once every 4 weeks. Two patients had received prior anthracycline, but neither developed cardiac toxicity. Cardiac toxicity was seen in three of 14 children. One patient developed cardiac toxicity with a fall in FS to 20%. This patient had received prior radiotherapy to the spine (35 Gy), which had included some cardiac tissue, but toxicity was not identified until after the eighth course of DaunoXome. Two other patients developed transient reductions in FS to <28% after four and seven cycles, but in both, DaunoXome administration was continued and FS said to recover to normal values. An average transient reduction in the thickness of the posterior wall and septum was reported, but this too recovered within 6 months of cessation.A phase I study with a similar schedule in children with recurrent or progressive brain tumours reported encouraging activity . Patient−2, and we decided therefore to undertake a phase I study of DaunoXome in children with relapsed or resistant malignant solid tumours.Overall, there seemed to be reasonable evidence to suggest that DaunoXome might offer good efficacy with acceptable toxicity. There seemed to be evidence of reduced cardiac toxicity to allow dosing beyond the conventional limit of 550 mg mthe dose limiting toxicity (DLT) and MTD of DaunoXome when given as a single infusion over 1 h to children with relapsed or resistant solid tumours in two cohorts, one having received conventional therapy and the other prior craniospinal radiotherapy or high-dose therapy;a second DLT and MTD in each cohort of patients with G-CSF support using the MTD from the previous study;the pharmacokinetics of liposomal daunorubicin in children.The primary aims of the study were to determine:The secondary aim was to document tumour response in these patients.The study was open from December 1998 to June 2001 as a joint UK/French study. All centres participating were required to fulfil UKCCSG/SFOP criteria for phase I studies. Patients with recurrent or resistant malignant disease, aged between 1 and 18 years, with a predicted life expectancy of more than 8 weeks, and a performance status score (Karnofsky >30 or Lansky >3) were eligible for entry.ECG, two-dimensional echocardiogram with documentation of Fractional Shortening and ejection fraction and a chest radiograph were recorded at entry. ECG and two-dimensional echocardiogram were repeated prior to each subsequent course of chemotherapy. Normal cardiac function, with a fractional shortening ⩾29% was required at entry into the study. A reduction of FS to <29% or a reduction of EF by more than 20% were used to define toxicity according to CTC criteria.Laboratory investigations were performed within 7 days of DaunoXome administration to ensure adequate haematological, renal and hepatic function, and were repeated prior to each subsequent course of chemotherapy.Written informed consent was given by all parents or guardians, and by patients themselves where appropriate. In the UK, this study was approved by the Multi-Centre Research Ethics Committee for Scotland and by Local Research Ethics Committees of each participating centre. In France, approval was received from the CCPPRB with Centre Léon Bérard in Lyon acting as promoter. Study monitoring and Source Data Verification were performed according to ICH GCP guidelines.In all, 17 centres were eligible to enter patients into the study. Coordination of the study was through the UKCCSG Data Centre. Once three patients were recruited at a dose level, recruitment was frozen to allow all those patients to complete their first cycle and be monitored. Monitoring was organised by the UKCCSG Data Centre. DaunoXome was kindly supplied by Gilead Sciences (formerly NeXstar).DaunoXome, was administered as a single, 1 h infusion on day 1. Where there was recovery from toxicity and no disease progression, treatment cycles were repeated every 21 days. In cases of DLT for the first cycle, patients were treated at the previous dose level for subsequent cycles. Patients were allowed up to a maximum of 12 courses of treatment.Arm A – patients who relapsed after conventional therapy.Arm B – patients previously treated with craniospinal radiotherapy and/or high dose therapy.Two cohorts of patients were recruited, given an anticipated reduction in bone marrow reserve for patients who had undergone intensive chemotherapyHigh-dose therapy was defined as any procedure that required bone marrow or stem cell rescue after chemo- or radiotherapy. Patients were not stratified according to prior anthracycline exposure.Dose limiting toxicity was defined from the safety profile of cycle one. No within-patient dose escalation was allowed, according to the method of Complete response (CR)=no radiological evidence of residual tumour on MRI scan,Partial response (PR)=>50% reduction of the product of two maximum perpendicular diameters of the tumour,Stable disease (s.d.)=<25% reduction of the product of two maximum perpendicular diameters of the tumour without radiological evidence of tumour progression or dissemination,Progressive disease (PD)=any radiological or clinical evidence of tumour progression, or any new tumour site.Full blood counts and biochemistry tests including liver function were performed twice weekly . Physical examination and vital signs were assessed weekly. Cardiac toxicity was assessed on day 21 of each cycle by Echo and ECG. Assessment of tumour burden was made at baseline, after two cycles, and after every other cycle. All imaging performed on any patient showing response was reviewed by two radiologists. The following definitions were used for response:Toxicity was graded according to the NCI Common Toxicity Criteria (CTC) 1998 (version 1) or, where this was not possible, according to severity .Myelosuppression: CTC grade IV neutropenia, thrombocytopenia or leucopenia lasting at least 7 days.Cardiac: >20% fall in the ejection fraction at day 21 compared with initial values,Clinically relevant nonhaematological CTC grade III or IV.A DLT was defined during the 21 days after the first dose of DaunoXome as follows:As a result of discussions regarding cardiac toxicity seen in some early patients, the definition of dose limiting cardiac toxicity was revised during the study. A single recorded fall of 20% in the ejection fraction at day 21 was defined initially as a DLT. Wide intrapatient variability was recorded in some patients, and concern was raised that an inappropriately low MTD may be identified if such changes were not representative of cardiac function. Indeed, two patients with a fall in ejection fraction at day 21 showed complete recovery of cardiac function at day 28. In consultation with cardiologists in France and the UK, a decision to require a sustained reduction in cardiac function (EF) of 20% was made, and therefore a repeat echocardiogram was performed at day 28 in any patient with a possible cardiac DLT. All cardiac toxicities were reported as Serious Adverse Events to the UKCCSG Data Centre.−1 day−1). Patients with evidence of clinical progression discontinued after one course. Full evaluation of tumour response was undertaken after the second course. Patients with response or stable disease were eligible to continue DaunoXome for further disease assessment at the same dose, provided no DLT occurred. If a DLT occurred, patients were treated at one dose level below for subsequent cycles.Dose limiting toxicity and MTD were determined using DaunoXome alone, and subsequently with G-CSF support .Patient characteristics are summarized in −2 per cycle . Arm B patients were treated at three dose levels, 80 (3), 100 (7), 125 (3) mg m−2 per cycle . Arm B patients with G-CSF were treated at 125 (3), 155 (3) and 190 (2) mg m−2 per cycle . A total of 98 courses of DaunoXome were given in the whole study, a median of two courses per patient (range 1–8).Arm A patients were treated at five dose levels (dose (number)): 80 (2 – one patient eligible from arm B), 100 (3), 125 (8), 155 (7), 190 (7) mg mDeath occurring within 30 days after the last study drug administration.Any event which was life threatening, incapacitating or permanently disabling, or required prolonged hospitaliation.Clinical or laboratory events which require withdrawal of the drug.An adverse event was defined as any CTC grade III or IV toxicity that occurred at any time while the patient was on study. Cardiac toxicity of any grade was reported. Serious adverse events were defined as:Adverse events were reported for all children. In all, 38 reported adverse events as possibly, probably or definitely related to the study drug after 1 cycle.A total of 260 nonhaematological adverse events (excluding cardiac toxicity) were reported during cycle 1. In all, 125 of these were classed as possibly, probably or definitely drug related .A total of 20 nonhaematological SAEs classed as possibly, probably or definitely related were reported in 17 patients during cycle 1. Many of these were related to coincident haematological toxicity.Two patients developed allergic reactions to DaunoXome at the time of drug administration during cycle 1. Both patients developed a high temperature, one developed a generalised rash, and one developed chest tightness and flushing. In both cases, the drug was later restarted without further adverse event. One other patient developed a high temperature and a generalised maculo-papular exanthema shortly after the start of treatment during cycle 2. These symptoms disappeared under treatment after 2 h. Administration was completed slowly thereafter.−2 in Arm B+G-CSF. The median time (range) to recovery of neutrophils (>1 × 109 l−1) for each arm over the whole range of administered doses were: Arm A 23 days (14–28), Arm B 25 days (19–26), Arm B+G-CSF 18 days (0–24).The DLT was haematological for patients treated in arm A and B without G-CSF support . The pri−2 in Arm A and 100 mg m−2 in arm B. Recruitment of patients in Arm B with G-CSF support was suspended at a time when two patients had been enrolled at the 190 mg m−2 level, one of whom had shown grade IV haematological toxicity.The MTD of DaunoXome was 155 mg mHaematological toxicity was not generally greater following second or subsequent doses of DaunoXome. Greater CTC toxicity was seen in only in only two patients.−2 anthracycline, but no correlation beyond this was seen between the grade of toxicity and total exposure to anthracycline in this study of <240 mg mis study . A summaIn 13/15 cases, grade 1–IV cardiac toxicity was thought to be at least possibly related to the study drug. In one patient, toxicity was probably due to a symptomatic pericardial effusion, attributable to underlying disease. One other patient had a pericardial effusion (grade I toxicity) unrelated to DaunoXome.−2 (median 200 mg m−2). In all, 15 of 30 patients evaluable for cardiac toxicity who did NOT develop cardiac toxicity, had received previous anthracycline . There was a trend towards increased toxicity in the group with prior anthracycline exposure .In all, 13 of 15 patients had received prior anthracyclines, with cumulative doses from 60 to 420 mg mP=0.40, χ2 test). The small numbers for patients treated with prior radiotherapy to the chest meant that no statistical difference could be identified .In all, 10 of 15 patients with cardiac toxicity had previously received radiotherapy . Four patients without cardiotoxicity had received prior radiotherapy to the chest, and one had received TBI. There was no statistically significant difference in cardiac toxicity between these two populations after a single dose of 80 mg m−2. The echocardiogram was reported to be otherwise normal, and one week later, repeat echocardiography showed FS to be 36%. This change in function was felt to be a drug-related toxicity but was transient. One further patient suffered a cardiac DLT after a single dose of 125 mg m−2, with a reduction in Ejection Fraction (EF) by more than 20% (74 to 54%). A repeat echocardiogram one week later showed normal cardiac function, , and the treating physician elected to continue with DaunoXome off-study on a compassionate basis. Cardiac function after this cycle remained normal. A further cohort of patients was recruited at the same dose level, with no further cardiac toxicity.Three patients experienced unrelated or transient cardiac abnormalities at the end of cycle 1. One patient showed a fall in Fractional Shortening (FS) from 38 to 29% after a single dose of 80 mg mThe results from these three patients prompted a review of criteria for the assessment of cardiac toxicity. There was a concern that transient falls in measured cardiac function were not representative of true changes in function, and that an inappropriately low MTD might therefore be identified. A protocol modification was made, such that cardiac toxicity would be evaluated at 21 days and, if abnormal, a second evaluation would be made at day 28. Only if cardiac function were still abnormal, measured by an absolute FS of <29% or a change in EF by ⩾20%, would cardiac DLT be reportable.−2. The ejection fraction recovered to 63% 1 week later, and the patient showed full recovery 1 month later (EF 70%). No further anthracycline was given. This patient eventually died of disease progression 3 years after entry into the study.In fact, no further patient developed a cardiac DLT after the first cycle of DaunoXome, at day 21 or day 28, and this modification to the protocol did not, therefore, affect the outcome of the study. Significant cardiac toxicity was identified, however, in three patients who received repeated courses of DaunoXome. One patient, who had received no prior anthracycline chemotherapy, developed a reduced EF after eight cycles, and a cumulative anthracycline dose of 825 mg m−2, received four cycles of DaunoXome without cardiac toxicity. After the fourth cycle, a rapid, and eventually fatal deterioration in cardiac function developed. Autopsy confirmed cardiomyopathy consistent with anthracycline toxicity. This patient received a cumulative anthracycline dose of 668 mg m−2 (340 mg m−2 of which was DaunoXome).One patient, who had received radiotherapy to the left lung and spine, and a prior anthracycline dose of 328 mg m−2), and died as a result of cardiac failure. This patient had received a cumulative anthracycline dose of 818 mg m−2 (620 mg m−2 of which was DaunoXome).One patient developed rapidly progressive cardiac impairment after four cycles of DaunoXome . The AUCs of the three compounds were evaluated by the trapezoidal rule. Pharmacokinetic parameters are given in Pharmacokinetic analysis was performed for a total of 31 patients, was delayed by 2–4 h in 10 patients. It had essentially the same pharmacokinetic behaviour as free administered daunorubicin. Free daunorubicin followed biexponential elimination kinetics in most patients; in six, a mono-exponential curve better described the observed data. The elimination half-life of free daunorubicin was independent from the dose administered. Its mean value in the overall population was 11.3±3.9 h.Free daunorubicin (DNR) was seen in plasma in most patients at the end of DaunoXome infusion, although the peak concentration . This higher AUC of free drug seen at higher doses might be expected to give a nonlinear risk of cardiac toxicity. The AUC ratio of daunorubicinol to free daunorubicin varied for most patients between 0.05 and 0.12, and once again, greater conversion of daunorubicin to daunorubicinol was seen at the highest dose.The ratio of AUCs of free daunorubicin to liposomal daunorubicin varied between 0.1 and 0.2 in most patients. A statistically greater conversion of liposomal to free daunorubicin was seen at the highest dose . He died from progressive disease, 3 years after entry into the study .In all, 39 patients were withdrawn from study due to treatment failure, three because of cardiac adverse events, one because of neurological deterioration (PD), one because they died (PD). One patient was withdrawn so that drug could be given compassionately at a different hospital, one to have surgery, one because of a protocol violation and one because of drug shortage.The development of new therapies in paediatric oncology remains slow for several reasons. There is a limited supply of new drugs suitable for development. Due to small numbers of patients, phase I and II studies are slow to run, and ethical concerns may lead to reluctance to enroll young patients. It is clear, however, that in childhood, toxicities may be different from those in adults . This was not unexpected for the group of patients under study. In all, 30 out of 43 patients experienced grade IV neutropenia during the first cycle of treatment. The most significant fall in neutrophil count occurred between 10 and 19 days following administration of DaunoXome, but recovery was usual by day 21.The dose-limiting toxicity of DaunoXome without G-CSF is neutropenia, at 155 and 100 mg mThe noncardiac, nonhaematological toxicities reported were related to myelosuppression (febrile neutropenia), but nausea, hypermagnesaemia and allergic reaction to DaunoXome were also seen. These toxicities were not considered excessive for patients undergoing this treatment regime.−2, to a maximum cumulative dose of 720 mg m−2. In the study of −2, to a maximum cumulative dose of 600 mg m−2. In the study reported by Hempel et al, patients received individual doses of 30–60 mg m−2 on days 1 and 5 of each cycle. In the present study, patients received a single dose every 21 days, up to a maximum of eight cycles. The two patients who died as a result of DaunoXome treatment both had high cumulative levels of anthracyclines (668 and 818 mg m−2), but not markedly different from those previously reported.This is the first paediatric study with liposomal Daunorubicin that has shown a significant degree of cardiac toxicity, albeit with repeated dosing. Three other paediatric studies have been performed, but none of these raised concerns over the degree of cardiac toxicity was disappointing.Although it was hoped that cardiac toxicity with DaunoXome would be significantly reduced compared to conventional Daunorubicin, this was not seen. Studies in anthracycline naïve patients may still be justified, but severe cardiotoxicity in patients receiving repeated courses of DaunoXome mean caution should be exercised in the use of this drug in children. The possibility that DaunoXome pharmacokinetics may change, such that a greater exposure to anthracycline or its active metabolite is seen at higher doses, may account for the observed cardiac toxicity in this study, but further confirmation of this is required.

Whole-cell labeling is a common application of fluorescent proteins (FPs), but many red and orange FPs exhibit cytotoxicity that limits their use as whole-cell labels. Recently, a tetrameric red FP called DsRed-Express2 was engineered for enhanced solubility and was shown to be noncytotoxic in bacterial and mammalian cells. Our goal was to create derivatives of this protein with different spectral properties.Building on previous studies of DsRed mutants, we created two DsRed-Express2 derivatives: E2-Orange, an orange FP, and E2-Red/Green, a dual-color FP with both red and green emission. We show that these new FPs retain the low cytotoxicity of DsRed-Express2. In addition, we show that these new FPs are useful as second or third colors for flow cytometry and fluorescence microscopy.E2-Orange and E2-Red/Green will facilitate the production of healthy, stably fluorescent cell lines and transgenic organisms for multi-color labeling studies. Fluorescent proteins (FPs) are useful as whole-cell labels. For this purpose, FPs can be either monomeric or oligomeric. However, oligomeric FPs are often better for whole-cell labeling because they tend to be brighter and more photostable than their monomeric counterparts .Even if an FP has desirable fluorescence properties, it may have limited utility as a cellular label due to cytotoxicity at high expression levels -4. CytotHere, we have modified the interior of DsRed-Express2 to create two additional FPs that are useful for whole-cell labeling. The first new FP, E2-Orange, exhibits orange fluorescence similar to that of previously described orange FPs -10. E2-OOrange FPs can be useful alone, in two-color studies with green FPs, or in three-color studies with green and far-red FPs. The previously available orange FPs include the oligomeric Kusabira-Orange (KO) , a monomFJ498891].DsRed-Express2 + Q66T was then subjected to random mutagenesis to identify brightening mutations. We identified two such mutations, V71A and S179T. Both mutations produced modest increases in extinction coefficient and quantum yield, and the S179T mutation also accelerated maturation. These mutations were combined to yield the final orange variant, E2-Orange [GenBank: E2-Orange has excitation and emission maxima at 540 nm and 561 nm, respectively Figure . As withE2-Orange matures quickly and is photostable Table . CompareSaccharomyces cerevisiae was transformed with vectors for high-level expression of either enhanced GFP (EGFP) or E2-Orange. By flow cytometry, these two populations of cells could be readily distinguished from each other and from cells not expressing an FP , and mOrange was modified by site-directed mutagenesis to create mOrange2. mKO2 was obtained as previously described . Humanizescribed ,6 using escribed . The nucFPs were expressed, purified, and characterized for extinction coefficient and quantum yield as previously described ,6,24. Tha values were measured as follows. Purified FP was buffer exchanged and concentrated to 2 mg/ml into buffer containing 5 mM Na+ HEPES pH 8.0 and 100 mM NaCl. Aliquots were then adjusted to a final pH of 3.5–10.0 in 0.5 pH unit increments by adding 5 μl of a 1 M adjustment buffer to 45 μl of the FP sample. The adjustment buffers were Na+ citrate (pH 3.5–5.5), Bis-Tris (pH 6–6.5), Na+ HEPES (pH 7.0–8.5), and Na+ CAPSO (pH 9.0–10.0). Fluorescence measurements were carried out on a Tecan Safire2 plate reader. Orange FPs were excited with 520 ± 10 nm light, and emission was recorded at 560 ± 10 nm. Red FPs were excited with 540 ± 10 nm light, and emission was recorded at 590 ± 10 nm. Green FPs were excited with 480 ± 10 nm light, and emission was recorded at 515 ± 10 nm. Fluorescence values for a given FP were normalized to the highest observed emission, and the pKa was determined to be the point at which the fluorescence was half of the maximal signal.pKE. coli DH10B cells harboring a given FP in the pQE-81 vector were treated with 2 mM IPTG for 15 min followed by inhibition of translation with 30 μg/ml kanamycin plus 17 μg/ml tetracyline. Fluorescence measurements were then recorded at regular time intervals using a Tecan Safire2 plate reader. For this assay, orange FPs were excited with 520 ± 10 nm light, and emission was recorded at 560 ± 10 nm. Red FPs were excited with 540 ± 10 nm light, and emission was recorded at 590 ± 10 nm. Green FPs were excited with 480 ± 10 nm light, and emission was recorded at 515 ± 10 nm.Maturation experiments were carried out as previously described . BrieflyE. coli strain DH10B, and analyzed for brightness and color using the slide projector assay.Targeted mutations were introduced into the DsRed-Express2 gene by overlap extension PCR . CombinaE. coli colony size assay, DH10B cells harboring the pREP4 repressor plasmid were transformed with pQE-60NA encoding the relevant FP. Equal volumes of cell mixture from the same transformation tube were plated either on an LB + 50 μg/ml carbenicillin + 30 μg/ml kanamycin plate, or on a similar plate containing 1 mM IPTG. Colonies were photographed after growth for 14 h at 37°C. Phototoxicity was assayed as previously described [For the S. cerevisiae strain JK9-3da expressing Sec7-3xGFP [S. cerevisiae TPI1 promoter and the CYC1 terminator [.To generate the three-color yeast strain, mCherry was subcloned into a plasmid carrying a yeast CoxIV presequence (pCoxIV) , and thic7-3xGFP . This twc7-3xGFP derivatirminator . The resrminator and imagS. cerevisiae TPI1 promoter and the CYC1 terminator. Labeled yeast or untransformed control cells were grown individually in QSD media and pooled based on equivalent OD600 units. An LSRII flow cytometer (BD Biosciences) with a 488-nm laser was used with either FITC (515/50) or PE (585/15) emission filter sets to analyze cells. All data were processed using FloJo software (Treestar).Yeast strains expressing a single FP were generated by transforming JK9-3da cells with a YIplac204 derivative containing the desired FP subcloned between the Transient transfection of HeLa cells and subsequent analysis by flow cytometry were carried out as previously described [email protected] plasmids can be obtained by request from Robert Keenan RLS engineered E2-Orange and E2-Red/Green, and carried out all experiments. DB assisted with the mammalian tissue culture experiments. RLS, BSG, and RJK participated in conception of the project, design of the study, and manuscript preparation. All authors read and approved the final manuscript.

To increase our knowledge of the occurrence of substandard care during labour.A population-based case–control study.Stockholm County.Infants born in the period 2004–2006 in Stockholm County.Cases and controls were identified from the Swedish Medical Birth Register, had a gestational age of ≥33 complete weeks, had planned for a vaginal delivery, and had a normal cardiotocographic (CTG) recording on admission. We compared 313 infants with an Apgar score of <7 at 5 minutes of age with 313 randomly selected controls with a full Apgar score, matched for year of birth.Substandard care during labour.We found that 62% of cases and 36% of controls were subject to some form of substandard care during labour. In half of the cases and in 12% of the controls, CTG was abnormal for ≥45 minutes before birth. Fetal blood sampling was not performed in 79% of both cases and controls, when indicated. Oxytocin was provided without signs of uterine inertia in 20% of both cases and controls. Uterine contractions were hyperstimulated by oxytocin in 29% of cases and in 9% of controls, and the dose of oxytocin was increased despite abnormal CTG in 19% and 6% of cases and controls, respectively. Assuming that substandard care is a risk factor for low Apgar score, we estimate that up to 42% of the cases could be prevented by avoiding substandard care.There was substandard care during labour of two-thirds of infants with a low Apgar score. The main reasons for substandard care were related to misinterpretation of CTG, not acting on an abnormal CTG in a timely fashion and incautious use of oxytocin. A small, but nonetheless too large, proportion of patients experience adverse events in the hands of healthcare workers. The frequency of substandard care during labour in Sweden is unknown, as is the number of infants injured at birth as a result of substandard care, with the exception of the 20–50 annual claims for financial compensation relating to severely asphyxiated infants.2In infants considered to have suffered from severe asphyxia as a result of substandard care during labour, we have previously found the most common causes to be: neglecting to supervise fetal wellbeing, neglecting signs of fetal asphyxia, incautious use of oxytocin and choosing a non-optimal mode of delivery.To increase our knowledge of the occurrence of substandard care during labour, we have investigated factors related to substandard care and the risk of a low Apgar score at 5 minutes. With the overall aim of improving the safety of patients during labour, we have more specifically focused on factors related to the following points.Neglecting to supervise fetal wellbeing.Improper use of oxytocin.Neglecting signs of fetal asphyxia.Substandard care during delivery.n = 74 539) of all births in Sweden (n = 309 140) during the years 2004–2006. Prematurity is one of the most important risk factors for developing cerebral palsy.n = 60), missing case records or CTG tracings (n = 31), precipitate deliveries (n = 7), or lethal malformations (n = 4). This resulted in 313 cases being used in the study. For each case, we randomly selected a healthy control with full Apgar score (10) at 5 minutes of age and matched for year of birth. Both cases (n = 313) and controls (n = 313) had planned for a vaginal delivery and had normal CTG tracing on admission to the delivery unit.We designed a population-based case-control study including the seven delivery units of Stockholm County, encompassing around 24% n = 74 39 of all n = 309 40 duringData was collected similarly for cases and controls. We retrieved data from the standardised antenatal and obstetric records used throughout Sweden, CTG recordings from during labour, and the neonatal case records. Diagnoses during pregnancy and delivery were registered at discharge from the hospital, and were classified according to the tenth Swedish version of the International Classification of Diseases (ICD-10). The following information on pregnancy complications was included: pre-eclampsia , pregestational diabetes (ICD-10 codes 024.0–024.3) and gestational diabetes (ICD-10 code 024.4). For delivery complications, we included information on dystocia (ICD-10 code 062) and breech delivery .Information about the date and time of birth, sex, birthweight, Apgar scores at 1, 5 and 10 minutes, umbilical cord pH, and acts of resuscitation were retrieved from the neonatal records. Birthweight for gestational age was based on the Swedish reference curve for intrauterine growth,According to Swedish standards, the minimum level of fetal surveillance in healthy women with uncomplicated deliveries was a CTG performed upon admission to the maternity unit for at least 20 minutes, and thereafter every other hour during the first stage of labour, assuming a normal CTG tracing.12Care during labour was considered substandard when supervision of fetal wellbeing was neglected. This included when there were no CTG recordings for more than 2.5 hours after the admission test or in between CTG recordings, and when CTG recordings were not interpretable because they were of poor quality. In cases of continuous abnormal CTG but normal FBS, a follow-up of FBS should have been carried out every 20–30 minutes, dependent on the stage of delivery.We defined imminent asphyxia as an FBS with a pH of <7.20, a lactate value of >4.8 mmol/l, a terminal CTG, or abnormal CTG tracings with prolonged bradycardia, tachycardia, a complicated variable, or late decelerations. We considered that care was substandard during delivery in the cases of imminent asphyxia if the time from the decision to deliver to birth exceeded 30 minutes, if there was a spontaneous vaginal delivery despite longstanding (at least 45 minutes) abnormal or uninterpretable CTG recordings, or if there was a complex instrumental delivery. Complex instrumental delivery was defined as an inappropriate trial of labour in a singleton delivery with a vacuum extractor or forceps in the following circumstances: incomplete cervical dilatation, non-cephalic presentation or cephalic malpresentation, non-engaged fetal head, or a clear indication of cephalopelvic disproportion. The definition of a complex instrumental delivery also included a delivery by vacuum extraction exceeding more than 20 minutes or following more than two cup detachments .13–1717ample Power 2.0. Among infants born in Stockholm County in 2004–2006, there were 415 infants with a gestational age of ≥33 completed weeks that had Apgar scores of <7 at 5 minutes of age: thus, this population seemed to be sufficient for our purpose.We designed the study as a case-control study, frequency matched for year of delivery. A power analysis was completed before implementation. A sample size estimate of 319 patients in each group would provide an 80% power to detect a two-fold increase in the odds of substandard care between infants with low (cases) and full (controls) Apgar scores, with a two-sided alpha = 0.05. This calculation is based on the assumption that 10% of the controls were subjected to substandard care, and was calculated in STo investigate possible risk factors for low Apgar scores, we used unconditional logistic regression analyses . The posP < 0.05) associated with an Apgar score of <7 at 5 minutes in the univariable models in P value > 0.05 indicates an acceptable fit.Next, we investigated the associations between factors reflecting substandard care and risk of an Apgar score of <7 at 5 minutes and 3. IWe chose to divide the year into three seasons – spring, summer and autumn – to investigate if there were differences in the risks of being born in the spring season, which is the busiest time period of the year, or in the summer, when there could be a shortage of skilled obstetricians and midwives because of holidays, compared with being born in the autumn .As all CTG tracings were scrutinised by only one of the authors (S.B.), we independently investigated the interobserver agreement between S.B. and an expert within the field . One hundred randomly selected intrapartal CTG tracings from the cases and controls were assessed by S.B. and I.I., and were classified as normal, intermediary or abnormal, and if the pattern changed, the time point was noted accordingly. The interobserver agreement in the assessment of CTG tracings between two senior consultants (S.B. and I.I.) was 86%, which was considered to be satisfactory.20Finally, we estimated the (unadjusted) attributable risk related to any substandard care . The study was approved by the Research Ethics Committee at the Karolinska Institutet, Stockholm (no. 2008/1375).Analyses were performed in Of 313 infants with Apgar scores of <7 at 5 minutes of age , 90 (47%The risk of a low (<7) Apgar score at 5 minutes was increased among infants to mothers aged 25 years or older, compared with younger mothers . PrimipaCharacteristics related to care significantly associated with increased risk of a low Apgar score were induction of labour and use of epidural . The risCompared with term (37–41 weeks of gestation) infants, both preterm (33–36 weeks of gestation) and post-term (≥42 weeks of gestation) infants had a more than doubled risk of low Apgar score. Very small for gestational age infants faced a five-fold increase in risk, and moderately large for gestational age infants had a doubled risk of a low Apgar score, compared with normal weight infants. Boys had a 50% increase in risk compared with girls, and infants in other than occiput anterior presentation had a more than doubled increase in risk compared with infants presented in occiput anterior position .n = 124) of infants with an Apgar score of <7 at 5 minutes were delivered spontaneously vaginally, versus 86% (n = 269) of the healthy controls. Vacuum extraction was performed in 35% (n = 108) of cases versus 8% (n = 25) of the controls, delivery by forceps was performed in 1.6% (n= 5) of cases versus 0.3% (n = 1) of controls, and delivery by caesarean section was performed in 24% (n = 76) of cases versus 6% (n = 18) of controls. Infants born instrumentally or abdominally had a seven-fold increase in the risk of an Apgar score of <7 at 5 minutes compared with infants born spontaneously vaginally and controls (n = 297). The interval between the last CTG tracing and birth only exceeded 2.5 hours in four cases and seven controls. There were no differences between groups concerning continuous and intermittent supervision of CTG.Twenty-one percent of the infants with an Apgar score of <7 at 5 minutes and 66% of the controls had normal CTG tracings throughout labour. Compared with labours with normal CTG tracings, labours with abnormal CTG duration of less than 45 minutes, of 45–90 minutes, and of 90 minutes or more, had a four-fold, seven-fold, and almost 15-fold increased risk for an Apgar score of <7 at 5 minutes, respectively. FBS was indicated in 156 cases and 34 controls, but was only performed in 33 cases and seven controls. Compared with labours without an indication for FBS, there was a seven-fold increased risk of low Apgar score at 5 minutes for labours with an indication of FBS, irrespective of whether it was performed or not.Oxytocin during labour was used in almost 80% of the cases and in 52% of the controls. Despite no signs of inertia, oxytocin was provided in more than 20% of the cases and controls, respectively. Compared with labours without uterine inertia and without the use of oxytocin during labour, the risk of a low Apgar score was doubled if there was uterine inertia and oxytocin was provided despite no signs of hyperstimulation. If the use of oxytocin resulted in hyperstimulation, the magnitude of the risk of a low Apgar score was dependent on whether there was uterine inertia (OR 5.6) or not (OR 3.4). Providing oxytocin during labour without simultaneous registration of contractions more than doubled the risk of asphyxia, and if the dose of oxytocin was increased despite abnormal CTG, the risk of asphyxia was increased by more than three-fold .n = 193) of cases and in 15% (n = 47) of controls. When threatening asphyxia was assessed, there was a more than seven-fold increased risk of an Apgar score of <7 at 5 minutes. In pregnancies with threatening asphyxia and a decision for delivery, the risk was greater for those being delivered within 30 minutes from decision (OR 8.5) than for those being delivered after 30 minutes or more (OR 5.4). Compared with spontaneous vaginal deliveries with normal CTG throughout labour, the risk of a low Apgar score was more than doubled in pregnancies where the CTG recording had been abnormal for less than 45 minutes, and increased more than seven-fold if the CTG recording had been abnormal for more than 45 minutes. Infants with a complex instrumental delivery faced an eighteen-fold increased risk of asphyxia compared with infants with non-complex modes of delivery (delivery .The estimated unadjusted attributable risk for any substandard care was 0.42 95% CI 0.30–0.54). Thus, assuming that substandard care among the 25 countries of the European Union.47et al.,51Draycott Some form of substandard care during labour was present in two-thirds of deliveries of infants with a low Apgar score at 5 minutes, and in one-third of the controls. The main reasons for substandard care were related to the misinterpretation of CTGs, not acting in a timely fashion on abnormal CTGs, and the incautious use of oxytocin. Assuming that substandard care is a risk factor for a low Apgar score, we estimate that the number of infants with an Apgar score of <7 at 5 minutes of age could be substantially reduced by preventing substandard care.There are no conflicts of interests. The sponsors played no part in the study design, data analyses, data interpretation, or in the writing of the report. SB and HP had full access to all the data in the study, and the final responsibility for the decision to submit for publication was shared by all authors.The study was planned by all of the authors. SB collected all the data, carried out the main part of the analyses and drafted the manuscript. CG, HP and SC assisted in the analyses, in the interpretation of the results and the revisions to the manuscript. The final version of the manuscript has been approved by all of the authors.The study was approved by the Research Ethics Committee at the Karolinska Institutet, Stockholm (no. 2008/1375).We thank the Swedish County Council Insurance Company for financing the major part of the study. We also thank the Karolinska Institutet, Södersjukhuset, Her Majesty Queen Silvia’s Jubilee Fund, The Josef and Linnea Carlsson Foundation, Schering-Plough, Majblomman Foundation, The Elsa Goije Memorial Foundation, and The Folke Bernadotte Foundation for generous financial support.

Ruk/CIN85 is a mammalian adaptor molecule with three SH3 domains. Using its SH3 domains Ruk/CIN85 can cluster multiple proteins and protein complexes, and, consequently, facilitates organisation of elaborate protein interaction networks with diverse regulatory roles. Previous research linked Ruk/CIN85 with the regulation of vesicle-mediated transport and cancer cell invasiveness. Despite the recent findings, precise molecular functions of Ruk/CIN85 in these processes remain largely elusive and further research is hampered by a lack of complete lists of its partner proteins.in vitro. Most of these identifications are novel Ruk/CIN85 interaction candidates. The identified proteins have diverse molecular architectures and can interact with other proteins, as well as with lipids and nucleic acids. Some of the identified proteins possess enzymatic activities. Functional profiling analyses and literature mining demonstrate that many of the proteins recruited by the SH3 domains of Ruk/CIN85 identified in this work were involved in the regulation of membranes and cytoskeletal structures necessary for vesicle-mediated transport and cancer cell invasiveness. Several groups of the proteins were also associated with few other cellular processes not previously related to Ruk/CIN85, most prominently with cell division.In the present study we employed a LC-MS/MS-based experimental pipeline to identify a considerable number (over 100) of proteins recruited by the SH3 domains of Ruk/CIN85 Obtained data support the notion that Ruk/CIN85 regulates vesicle-mediated transport and cancer cell invasiveness through the assembly of multimeric protein complexes governing coordinated remodelling of membranes and underlying cytoskeletal structures, and imply its important roles in formation of coated vesicles and biogenesis of invadopodia. In addition, this study points to potential involvement of Ruk/CIN85 in other cellular processes, chiefly in cell division. Ruk/CIN85 is a mammalian adaptor molecule with three SH3 domains. In addition to the SH3 domains located at the N-terminal part of the protein, Ruk/CIN85 contains other protein interaction modules, namely proline-rich sequences and a coiled-coil region . Subsequently, we subjected the obtained lists to functional profiling and association network analysis to infer potential functions of protein interaction networks organised on the SH3 domains of this adaptor molecule.In the present study we identified lists of proteins recruited in vitro. This sensitive and precise tool for detection of multiple proteins in complex mixtures has not been used to study interactions mediated by Ruk/CIN85 so far.In the present study we utilised the liquid chromatography-coupled tandem mass spectrometry (LC-MS/MS)-based approach to identify the lists of the proteins recruited by the SH3 domains of Ruk/CIN85 Using the experimental pipeline comprised of GST pull-downs, SDS-PAGE and LC-MS/MS, we identified 107 proteins recruited by the SH3 domains of Ruk/CIN85 proteins containing lipid interaction modules, (2) proteins with modules able to bind nucleic acids, (3) proteins containing only protein interaction modules and (4) proteins with enzymatic activities with lipid interaction modules were represented by the GTPase-activating proteins (GAPs) for Rho family GTPases. Most of the lipid-binding candidates contained PH domains – lipid/protein interaction modules specific towards phosphoinositides, and frequently also towards proteins. Notably, in comparison with the other modules (excluding coiled-coil and proline-rich regions), PHs were the most common domains in the identified proteins Fig. .The proteins with enzymatic activities were classified as inositol-5'-phosphatases, protein kinases and E3 ubiquitin ligases. Several other proteins of this group contained core ATPase domains, and two belonged to RNA-dependent helicases was identified simultaneously in the samples for two of three different SH3 domains of Ruk/CIN85, and almost one third 27%) was found in the samples for all the three domains Table . These d7% was foOne possible explanation for the higher similarity of SH3A and SH3C domains with respect to their interaction affinities might stem from their evolutionary origin. To verify this assumption, we performed the phylogenetic analysis of the sequences of all mouse and human SH3 domains deposited in Pfam database . The anaTo obtain the functional profile of the proteins recruited by the SH3 domains of Ruk/CIN85, we clustered them according to functional annotations using DAVID . In a coInitially, DAVID tool was used to cluster the proteins by their occurrence in different cellular locations. Two large meaningful clusters identified this way included proteins associated with the cytoskeleton and membranes Fig. . Next, tUnexpectedly, except for the protein clusters with Ruk/CIN85-related functions, both the resulting DAVID annotation list and the protein association network obtained in STRING contained clusters of proteins with the functions, which were not associated with this adaptor before. Two of these clusters combined proteins related to regulation of cell cycle and cell division (cytokinesis), and involved in RNA/mRNA processing Fig. , suggestGrowing body of evidence indicates that Ruk/CIN85 acts at the interface of membranes and the cytoskeleton. The synchronous rearrangements of membranes and associated cytoskeletal structures underlie many important cellular events such as cell motility and vesicle-mediated transport (membrane trafficking). Motile cells are constantly remodelling their membranes and the cytoskeleton to generate adhesive and protrusive structures required for migration, and cancer cells use the subversions of such structures to invade surrounding tissues. Coordinated remodelling of membranes and the cytoskeleton is also required to generate membrane vesicles and transport them between different intracellular membrane trafficking compartments.Therefore, it was not surprising that Ruk/CIN85 had been previously found to be implicated in the regulation of both these processes, and majority of proteins recruited by the SH3 domains of Ruk/CIN85 identified here localise to membranes or cytoskeletal structures.Recent studies suggest that physiologically diverse cellular processes, which require integration of membranes with the adjacent cytoskeleton, including vesicle-mediated transport, cell adhesion, migration and invasion may use compatible molecular mechanisms utilising similar sets of proteins and interactions. For this reason interactions between Ruk/CIN85 and such promiscuous proteins are of particular interest. For instance, previously Ruk/CIN85 has been implicated in the interaction with Arf GTPase-activating protein ASAP1/AMAP1, which is one of the core components of invadopodia in invasive cancer cells, and also regulates focal adhesions, circular dorsal ruffles and membrane trafficking ,21. SeveThe results obtained so far indicate that Ruk/CIN85 acts at different cellular locations. However, the exact map is only beginning to emerge and analysis of effector molecules clustered by this adaptor may help to establish a better image. Variety of GTPase-activating proteins (GAPs) recruited by the SH3 domains of Ruk/CIN85 may serve as an excellent example. The GAPs for Rho and Arf family GTPases (RhoGAPs and ArfGAPs) are the substantial portion of proteins recruited by the SH3 domains of Ruk/CIN85 involved in membrane and cytoskeleton remodelling. Previously Ruk/CIN85 has been implicated in the interactions with two RhoGAPs , one Arf GAP (ASAP1/AMAP1), and a Arf/Rho dual-specificity GAP (ARAP3) ,26,27. AEven though the majority of RhoGAPs recruited by the SH3 domains of Ruk/CIN85 are active towards Cdc42 GTPase, their sites of action are strikingly different. Scene for dual-specificity Arf/RhoGAP ARAP1 and ArfGAP ASAP1/AMAP1 is even more complex, because both act simultaneously at the cell interior and at the cell periphery. Taken together, the activities of the GTPase-activating proteins recruited by the SH3 domains of Ruk/CIN85 are distributed between a vast range of membranes and membrane compartments, ranging from the plasma membrane and protrusive/adhesive actin-rich structures such as focal adhesions, circular dorsal ruffles, lamellipodia, filopodia and invadopodia at the cell periphery to internal membrane trafficking compartments including the Golgi complex ,21,26-33Our present data indicate that via the SH3 domains Ruk/CIN85 may recruit a number of protein molecules required for the proper formation and function of coated vesicles. Majority of these proteins, including dynamins, inositol-5'-phosphatase synaptojanin 1 and N-WASP are recruited to coated pits at the late steps of coated vesicle formation to complete vesicle fission -36.In line with these observations, early studies implicated Ruk/CIN85 in the formation of clathrin-coated vesicles during the endocytosis of receptor tyrosine kinases, and particularly of the EGF receptors . ProposeIn our previous study, we observed only the weak presence of Ruk/CIN85 at compartments involved in clathrin-mediated endocytosis and sorting, while it was abundant at membrane trafficking compartments free of clathrin, primarily at the COPI-coated membranes and vesicles of the Golgi complex, and on some vesicular structures throughout the cell . Based oIt has been previously suggested that scaffolding functions of Ruk/CIN85 in membrane transport are not limited to the formation of coated vesicles, but may also extend to the regulation of subsequent vesicle trafficking events . In favoIntriguingly, Ruk/CIN85 itself displays several features characteristic for the components of vesicle coats. First, recruitment of Ruk/CIN85 to (the Golgi) membranes is modulated by Arf1 GTPase activity . Second,Current research indicates that Ruk/CIN85 may be an important regulator of cancer cell invasiveness . It has Our present data show that current view on the functional involvement of Ruk/CIN85 in invadopodia biogenesis may be oversimplified. Several proteins identified here as the novel interaction candidates for the SH3 domains of Ruk/CIN85 have well documented roles in this process. From these, N-WASP, N-WASP-interacting adaptor molecule WIP, and dynamin 2 are among the key regulators of invadopodia biogenesis . N-WASP Even though molecular mechanisms underlying invadopodia biogenesis remain mostly obscure, the short list of proteins identified so far indicates that invadopodia are closely related to podosomes and contain molecular components of focal adhesions . ConsistOf particular interest, Tks4 and Tks5 are the only specific regulators of invadopodia and podosomes identified so far ,60. ReceHence, although further experiments are obviously necessary, the existing data suggest that Ruk/CIN85 may control biogenesis of podosomes and invadopodia directly via the augmentation of actin assembly. Noteworthy, although it is not the general case for all cell models, the strong association between Ruk/CIN85 and actin-rich structures including focal adhesions had been found in astrocytes . Also, ade novo re-wired signalling pathways [If Ruk/CIN85 can indeed function both in membrane trafficking and actin remodelling in the bifacial manner, then the shifts of its attraction towards one of these processes in different cell types should be governed by certain regulatory mechanisms. Due to the fact that the appearance of malignant and invasive cell phenotypes (including ability to generate invadopodia) often relies on pathways , search Except for the proteins participating in membrane and actin remodelling, among the proteins recruited by the SH3 domains of Ruk/CIN85 we distinguished two groups of proteins with cellular functions, which had not been associated with Ruk/CIN85 before. These included proteins related to cell cycle and cell division, as well as proteins involved in RNA/mRNA processing. Additionally, the functional cluster associated with the cytoskeleton organisation and biogenesis contained many proteins with microtubule-related functions.Although the participation of Ruk/CIN85 in remodelling of actin cytoskeleton had been demonstrated in several studies, current information on its potential role in organisation of microtubules is very limited. Therefore, it is of interest that the SH3 domains of Ruk/CIN85 recruit several proteins involved in the regulation of microtubule dynamics. This primarily applies to GCP2, GCP3 and GCP4 proteins which are the main components of large and small γ-tubulin complexes (γTuSC and γTuRC) responsible for the nucleation of microtubules at centrosomes and at other cellular structures . SeveralSimilarly, in our study the SH3 domains of Ruk/CIN85 recruited the set of proteins involved in processing of RNA/mRNA molecules. Majority of these proteins including SRm160, SRm300, Sam68, poly(A)-binding proteins PABP1 and PABP4, and heterogeneous nuclear ribonucleoproteins hnRNPK and hnRNPC are involved in different aspects of pre-mRNA splicing -72. ImpoFinally, many of the proteins recruited by the SH3 domains of Ruk/CIN85 identified here are known to be involved in the regulation of cell cycle, and particularly of cell division (cytokinesis). Four of these proteins, including anillin, MgcRacGAP, MKLP-1 and PRC1, constitute the core machinery controlling formation and maintenance of the central spindle and the actomyosin contractile ring during cytokinesis -78. In aAlthough the function(s) of Ruk/CIN85 in cytokinesis is (are) hard to envisage, its participation in this process is feasible for several reasons. First, CD2AP/CMS, the close homolog of Ruk/CIN85 (and its interaction partner), is known to bind anillin and have been already implicated in the regulation of cytokinesis . Second,Results of our study show complexity of protein interaction networks organised on the SH3 domains of Ruk/CIN85 by identification of a number of proteins recruited by the SH3 domains this adaptor. Many of them are known to be involved in the regulation of membranes and cytoskeletal structures required for vesicle-mediated transport and cancer cell invasiveness. Our data support the notion that Ruk/CIN85 regulates vesicle-mediated transport and cancer cell invasiveness through the assembly of multimeric protein complexes governing coordinated remodelling of membranes and underlying cytoskeletal structures, and imply important roles of this adaptor in formation of coated vesicles and biogenesis of invadopodia. Finally, our study points to potential involvement of potential Ruk/CIN85 in other cellular processes, in particular in cell division, and may indicate directions for future research.E. coli were provided by Dr. Vladimir Buchman -fusion SH3 domains of Ruk/CIN85 in Cell culture reagents were from Invitrogen . Glutathione Sepharose 4B was from Amersham Biosciences AB . 10% Tris-HCl Ready Gel precast gels were from Bio-Rad Laboratories . Sequencing Grade Modified Trypsin was from Promega . 0.1% formic acid (FA) solutions in water and acetonitrile (ACN) were acquired from Mallinckrodt Baker . All other reagents were from Sigma-Aldrich .2 in DMEM medium supplemented with GlutaMAX-I, 10% foetal bovine serum (FBS), 50 U/ml penicillin and 50 μg/ml streptomycin antibiotics.Human cervix adenocarcinoma HeLa cells obtained from European Collection of Cell Cultures were grown in plastic plates at 37°C and 5% CO600 = 0.6 and then expression of the proteins was induced by 0.2 mM IPTG. After incubation for additional 2 hours at 25°C the bacterial cultures were harvested by centrifugation and purification of expressed proteins was performed on Glutathione Sepharose 4B according to the manufacturer's instruction .E. coli BL21(DE3)pLysS bacteria transformed with the plasmids for expression of the GST-fused SH3 domains of Ruk/CIN85 or of GST alone were grown in LB medium with 1% glucose until ODHeLa cells pre-washed twice with ice-cold PBS were harvested in the buffer of 20 mM Tris (pH 7.5), 150 mM NaCl, 5 mM EDTA, 5% glycerol, 0.5% Triton X-100 supplemented with Complete protease inhibitor cocktail and Phosphatase inhibitor cocktails 1 and 2 and lysed for 30 min on ice. The lysates were clarified by centrifugation at 18000 g for 20 min at 4°C. To remove proteins non-specifically binding to Glutathione Sepharose 4B or to glutathione S-transferase, collected supernatant was pre-cleared by incubation with GST alone bound to Glutathione Sepharose 4B beads for 2 hours at 4°C, and the beads were removed by centrifugation at 18000 g for 10 min at 4°C. Equal amounts of the GST-fusion SH3 domains of Ruk/CIN85 or GST alone bound to Glutathione Sepharose 4B (approximately 10 μg of protein to 40 μl of beads per sample) equilibrated with the same buffer were incubated for 4 hours at 4°C with equal amounts of the pre-cleared lysate of HeLa cells. The beads were washed five times in the buffer containing 20 mM Tris (pH 7.5), 150 mM NaCl, 5 mM EDTA, 5% glycerol, and 0.1% Triton X-100 and then boiled in SDS-loading buffer.The samples obtained in the pull-down experiments were separated on SDS-PAGE in 10% Tris-HCl precast gels and visualised by Coomassie R-250 staining. After the electrophoretic separation of samples, equal pieces were cut from experiment (GST-fusion SH3 domains) and control gel lanes as indicated in Additional file Prior to the analysis excised gel slices were subjected to the standard procedure of in-gel trypsin digestion, during which proteins were reduced with 100 mM DTT for 30 min at 56°C, alkylated with iodoacetamide in darkness for 45 min at room temperature, and digested overnight with 10 ng/ul trypsin. Peptides were eluted from gel with the water solution of 0.1% FA and 2% ACN. The resulting peptide mixtures were applied to RP-18 pre-column using water containing 0.1% FA as a mobile phase and then transferred to a nano-HPLC RP-18 column using ACN gradient (0 – 30% ACN in 45 min) in the presence of 0.1% FA at a flow rate of 250 nl/min. The column outlet was coupled directly to the ion source of LTQ FTICR mass spectrometer working in the regime of data-dependent MS to MS/MS switch. A blank run ensuring absence of cross-contamination from previous samples preceded each analysis.Homo sapiens (human), enzyme specificity – semi-trypsin, permitted number of missed cleavages – 1, fixed modification – carbamidomethylation (C), variable modifications – carbamidomethylation (K) and oxidation (M), protein mass – unrestricted, peptide mass tolerance – ± 40 ppm, fragment mass tolerance – ± 0.8 Da, max missed cleavages – 1. The searches were restricted to Homo sapiens sequences because HeLa cells used in our experiments originated from the human. Only proteins for which at least two peptides with Mascot cut-off scores ≥ 48, indicating identity or extensive homology of peptide (p ≤ 0.05), were considered as the positive identifications.After pre-processing the raw data with Mascot Distiller software , obtained peak lists were used to search the non-redundant protein database of the National Centre for Biotechnology Information (NCBI) version 20070428 using the Mascot search engine with the following search parameters: taxonomy restriction – The resulting protein lists for the experiment (GST-fusion SH3 domains) samples were compared with the control lists to exclude proteins non-specifically binding to GST or Glutathione Sepharose 4B. Protein hits scoring as the positive identifications in the controls were in all cases removed from the lists, even if the corresponding hits from the experiment samples matched larger number of peptides. For the protein hits matching two or more database entries accession number of the best annotated entry were listed in Table and by searches in Ensembl release 52 database . The short names of the modules found in the identified proteins were listed in Table Analysis of modular architectures of the identified proteins was performed by querying their sequences against InterPro version 19.0 database using InterProScan software and by s. Scansite matrices for the SH3 domains of Ruk/CIN85 (see Additional file Presence of potential recognition consensus sites for the SH3 domains of Ruk/CIN85 in protein sequences was analysed using Scansite version 2.0 software . Scansit according to the standard protocol [ with the following analysis parameters: species – Homo sapiens, confidence level – 0.200, active prediction methods – all, and using combined list of Ensembl gene IDs for input (see Additional file Analysis of functional enrichment within the identified proteins was performed in DAVID 2.0 software accordinprotocol . Functioprotocol with theRuk/CIN85: Regulator of ubiquitous kinase/c-Cbl-interacting protein of 85 kDa; CD2AP: CD2-associated protein/Cas ligand with multiple SH3 domains; LC-MS/MS: liquid chromatography-coupled tandem mass spectrometry; GST: glutathione S-transferase.The authors declare that they have no competing interests.SH conceived the study, participated in its design, participated in protein purification, GST pull-down experiments, as well as performed analysis of the LC-MS/MS data, functional annotation clustering and other bioinformatics analyses. YR participated in protein purification and GST pull-down experiments. AM performed LC-MS/MS. LD had been involved in drafting and critical revision of the manuscript. MJR participated in design of the study, coordinated it and helped to draft the manuscript. All of the authors read and approved the final manuscript.Modular organisation of Ruk/CIN85 and representative SDS-PAGE gel resulting from GST pull-down experiment. A. Modular organisation of Ruk/CIN85 adaptor molecule. B. Representative SDS-PAGE gel loaded with 1/5 of each sample resulting from GST pull-down experiment. For the LC-MS/MS analysis proteins were separated on a parallel SDS-PAGE gel loaded with 4/5 of each sample. Blank tracks were left between the loaded lanes to avoid cross-contamination. Locations of the excised gel pieces are outlined with colour boxes. Three corresponding gel slices with the size ranges of 75 – 175 kDa, 45 – 75 kDa and 33 – 45 kDa were excised from each lane.Click here for fileProteins recruited by the SH3 domains of Ruk/CIN85 identified by the LC-MS/MS. The table lists the proteins recruited by the SH3 domains of Ruk/CIN85 identified by the LC-MS/MS. GI – protein genbank identifier; Name – short protein name; Sample – sample where protein was identified (refer to Additional file Score – Mascot protein score; Mr – protein molecular weight; u.p. – number of unique peptides matched to protein sequence; % c. – % of protein sequence covered by matched peptides; Uniprot – protein accession number in UniProt Knowledgebase. The long and/or alternative names, as well as all additional genbank identifiers for the identified proteins are listed in the two last columns.Click here for fileLong names of module/domain abbreviations mentioned in the Table Click here for fileCircular phylogram of all the SH3 domains found in mice and men. The figure shows the circular phylogram of all the SH3 domains found in mice and men. The clade harbouring the SH3 domains of Ruk/CIN85 is indicated in green. Magnify.Click here for fileScansite matrices used for prediction of potential recognition consensus sites for the SH3 domains of Ruk/CIN85 in the identified proteins. The data provided represent the Scansite matrices used for prediction of potential recognition consensus sites for the SH3 domains of Ruk/CIN85 in the identified proteins.Click here for fileENSEMBL IDs of the genes encoding the identified proteins. The table lists ENSEMBL IDs of the genes encoding the identified proteins.Click here for file

For many long standing practices, the rationale for them is often lost as time passes. This is the situation with respect to the storage and handling of equimolar 50% nitrous oxide and 50% oxygen volume/volume (v/v) mixtures.A review was undertaken of existing literature to examine the developmental history of nitrous oxide and oxygen mixtures for anesthesia and analgesia and to ascertain if sufficient bibliographic data was available to support the position that the contents of a cylinder of a 50%/50% volume/volume (v/v) mixture of nitrous oxide and oxygen is in a homogenous single gas phase in a filled cylinder under normal conditions of handling and storage and if justification could be found for the standard instructions given for handling before use.After ranking and removing duplicates, a total of fifteen articles were identified by the various search strategies and formed the basis of this literature review. Several studies were identified that confirmed that 50%/50% v/v mixture of nitrous oxide and oxygen is in a homogenous single gas phase in a filled cylinder under normal conditions of handling and storage. The effect of temperature on the change of phase of the nitrous oxide in this mixture was further examined by several authors. These studies demonstrated that although it is possible to cause condensation and phase separation by cooling the cylinder, by allowing the cylinder to rewarm to room temperature for at least 48 hours, preferably in a horizontal orientation, and inverting it three times before use, the cylinder consistently delivered the proper proportions of the component gases as a homogenous mixture.The contents of a cylinder of a 50%/50% volume/volume (v/v) mixture of nitrous oxide and oxygen is in a homogenous single gas phase in a filled cylinder under normal conditions of handling and storage. The standard instructions given for handling before are justified based on previously conducted studies. For many long standing practices, the rationale for them is often lost as time passes. This is the situation with respect to the storage and handling of oxygen and nitrous oxide gas mixtures. Equimolar 50% nitrous oxide and 50% oxygen volume/volume (v/v) mixtures are marketed in Canada as ALnox , Entonox (Linde), and Liqui-Med Analgesic Gas (Praxair). One of the concerns for such mixtures is that they may have the potential to separate and stratify under the conditions of shipping and storage which may be regularly seen in Canada. If the components separated and stratified in such a cylinder it could deliver unsafe concentrations of the constituent gases without thorough remixing of the gases before use.The manufacturers of these gas mixtures include instructions in their Material Safety Data Sheets to store cylinders in a horizontal position for at least 48 hours in an area where the temperature is maintained above 10°C and to invert the cylinders three times before use to ensure the mixture is homogenous, but offer no explanation as to why; the background knowledge of the studies done in gas physics and behaviours has long since faded from our collective consciousness.In September of 2009, a review was undertaken of existing literature to examine the developmental history of these mixtures and to ascertain if sufficient bibliographic data was available to firstly support the position that the contents of a cylinder of a 50% nitrous oxide and 50% oxygen volume/volume (v/v) mixture are in a homogenous single gas phase in a filled cylinder under normal conditions of handling and storage and secondly, if phase separation could be made to occur, there was justification for the instructions given for the 48 hour horizontal storage at temperatures above 10°C and three times inversion before use.Three search strategies were employed to identify potentially relevant articles. First, a search was made via PubMed, Science Direct, Springer Link and Oxford Journals databases using the following MeSH, full text, and keyword terms: [premix or premix* or premixed] and [gas or gases] and [nitrous oxide] and [oxygen]. The search was limited to English language articles. No other limits, e.g. dates or study settings, were placed on the searches. Second, a search was made utilizing Google ™ Scholar using the same search terms. Third, bibliographies of all articles identified from the databases and online search were checked to determine potentially relevant citations.Each article identified through one of the search strategies was reviewed and classified as a definitely, possibly, or clearly not related to the question at hand. To be considered as definitely related to the question the article had to report physical measurements and/or contain a clinician report of the behaviour of a 50% nitrous oxide and 50% oxygen volume/volume (v/v) mixture in a single cylinder under varying temperatures during conditions of handling and storage. Articles that did not contain direct measurements of the concentrations of the products in the premixed cylinder, but contained clinical information or other observations were considered as possibly related to the question. Articles that did not address the homogeneity or stability of the mixture were excluded, as were theses, letters, preliminary communications and editorials. However any articles referenced in these excluded articles were checked for possible applicability.The articles that were classified as definitely or possibly related to the question at hand were tabulated and duplicates eliminated. A total of 441 articles were identified in the various search strategies, with fifteen being identified as definitely related to the topic and four possibly related. After removing duplicates, a total of eight articles that definitely dealt with the subject and four articles that possibly dealt with the subject were located and retrieved. From the bibliographies of the articles identified from the search strategy another three articles were identified. The resulting fifteen articles formed the basis of this literature review.Experiments and Observations on Different Kinds of Air in 1772 [Nitrous oxide, a gas with analgesic properties, has been known for more than two centuries. Joseph Priestley isolated both nitrous oxide and oxygen during the course of his Nitrous oxide and oxygen gas is unquestionably the safest anaesthetic in the world; anybody studying the subject clinically and theoretically knows that. The only question is that so far they have not been able to use it".Nitrous oxide was originally mixed with air for anaesthesia but incidents of patient hypoxia and adverse sequelae were often reported. However, Andrews in 1868 The use of nitrous oxide and oxygen mixtures for anaesthesia in children was first reported by Wood in 1927.In 1945, Barach and Rovenstine recommenAs described by Tunstall , and latnot passing through. In gas physics it refers to changes in the temperature of a system due to changes in the volume or pressure of a gas with an absence of net heat transfer between the system and its environment. No net heat transfer takes place because the event occurs rapidly resulting in very little time for the gas to interact with its environment. Opening a cylinder valve and releasing the contents is considered an adiabatic event. Given that the total amount of energy in the gas remains essentially the same (none is added or lost), as the pressure of the gas is reduced and volume increases the available energy can either be used to do the work of expansion, or to maintain the temperature of the gas, but it cannot be used for both. Therefore the temperature of the gas will decrease.One of the concerns about nitrous oxide and oxygen mixtures was effect of adiabatic cooling on their stability and homogeneity. The term "adiabatic" literally means impassable, coming from the Greek roots meaning If the cylinder was suddenly turned on "full blast" would phase separation result as the mixture cooled due to the drop in pressure? Cole investigThe next question is, is it possible to cause phase separation by decreasing the temperature of the mixture in a cylinder? Cole immersedBracken, Broughton and Hill ,16 confiThe following graph taken from Bracken, Broughton and Hill demonstrThe maximum temperature at which this phase separation could occur and result in formation of nitrous oxide in the liquid phase for a 50%/50% v/v nitrous oxide and oxygen mixture is -5.5°C. This maximum temperature point occurs on a line equivalent to a cylinder filled to 116.5 bar at 20°C. For filling pressures above or below this value the onset of condensation occurs at lower temperatures, i.e. -7°C for a cylinder filled to 138 bar ; at 207 bar the value decreases further to -17°C.They observed that mechanical agitation of the cylinder would result in the almost instantaneously re-homogeneity of the cylinder contents. However, if the cylinder was not at room temperature before agitation, the resulting drop in temperature of the mixture of as much as 10 or 12°C as it remixed could lead to a recondensation of the nitrous oxide into its liquid phase and loss of homogeneity.Tunstall also exaIn the following year, Gale, Tunstall and Wilton-Davies , using aSubsequently Crawford, Ellis, Hill and Payne performeNitrous oxide, which as a single gas liquefies at the pressures commonly seen in a medical gas cylinder, remains solely in the gas phase when part of a 50%/50% v/v mixture with oxygen as long as it remains above its critical temperature . The resulting mixture is homogenous above this temperature and will not lose homogeneity during use. It is possible to cause condensation and phase separation of such a mixture by cooling the cylinder below its critical temperature. Temperatures below this point may be seen in many months of the year in Canada. However, by allowing a cylinder to rewarm to room temperature for at least a 48-hour period, preferably in a horizontal orientation to maximize surface area for heat transfer to any nitrous oxide in the liquid phase in the cylinder, and briskly inverting it three times before use, the gases in the cylinder will rehomogenize and consistently deliver the proper proportions of the constituent components.The author is employed as a respiratory therapist in the medical gas industry by VitalAire Canada, part of the Air Liquide Group and owns shares in Air Liquide through an employee stock ownership plan.The review was conceived, designed and conducted by the author without additional assistance.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2253/10/19/prepub

A genome-wide screen of inbred Drosophila lines together with transcriptional network modeling reveals insights into the genetic bases of heritable aggression. Drosophila melanogaster harbor quantitative genetic variation in aggressive behavior, providing an excellent model system for dissecting the genetic basis of naturally occurring variation in aggression.Aggressive behavior is an important component of fitness in most animals. Aggressive behavior is genetically complex, with natural variation attributable to multiple segregating loci with allelic effects that are sensitive to the physical and social environment. However, we know little about the genes and genetic networks affecting natural variation in aggressive behavior. Populations of D. melanogaster and performed a genome-wide association screen for quantitative trait transcripts and single feature polymorphisms affecting aggression. We identified 266 novel candidate genes associated with aggressive behavior, many of which have pleiotropic effects on metabolism, development, and/or other behavioral traits. We performed behavioral tests of mutations in 12 of these candidate genes, and show that nine indeed affected aggressive behavior. We used the genetic correlations among the quantitative trait transcripts to derive a transcriptional genetic network associated with natural variation in aggressive behavior. The network consists of nine modules of correlated transcripts that are enriched for genes affecting common functions, tissue-specific expression patterns, and/or DNA sequence motifs.Correlating variation in transcript abundance with variation in complex trait phenotypes is a rapid method for identifying candidate genes. We quantified aggressive behavior in 40 wild-derived inbred lines of Correlations among genetically variable transcripts that are associated with genetic variation in organismal behavior establish a foundation for understanding natural variation for complex behaviors in terms of networks of interacting genes. These behaviors are, however, energetically costly and individually risky, suggesting that excessive aggression may be deleterious. In humans, aggression often manifests as violent behavior with attendant costs to society, and is frequently a component of psychiatric disorders, including schizophrenia, conduct disorder, alcoholism, bipolar disorder, and Alzheimer's disease -4. Analyreceptor , neural molecule , interleleukin-6 and Cathhepsin E affect a-alanine ,12, corrruitless ,14, biogruitless ,15, and Drosophila transcriptome to artificial selection for aggressive behavior in a laboratory stock [Cyp6a20 [muscleblind, CG17154, CG5966, CG30015, Darkener of apricot, CG14478, CG12292, tramtrack, CG1623, CG13512, SP71, longitudinals lacking, scribbler, Male-specific RNA 87F, kismet) affect aggressive behavior. However, the genotypes created by artificial selection are different from any naturally segregating genotype, and it is possible that novel combinations of alleles perturb the transcriptome beyond the range of variation that would be found in a population of wild-type alleles. In addition, selection induces linkage disequilibrium between selected and linked loci, raising the possibility that some correlated transcriptional responses to selection are due to linkage drag.Levels of aggression vary continuously in natural populations, due to the segregation of alleles at multiple loci with effects that depend on the social and physical environment: aggressive behavior is thus a typical quantitative trait . In contry stock and a pory stock . These sry stock to 1,539ry stock involved[Cyp6a20 and 15 o[Cyp6a20 and singF40,779 = 73.0168, P < 0.0001; Figure σL2) and within line (σE2) variance components were σL2 = 0.783 and σE2 = 0.217, for a broad-sense heritability (H2) of aggressive behavior of H2 = 0.78. Surprisingly, there was a 25-fold range of aggressive behavior in these lines: from an average of 3.3 to 76.9 aggressive encounters for 8 flies in a 2-minute observation period.We quantified aggressive behavior of 40 wild-derived inbred lines, using a rapid and high-throughput behavioral assay . Variatih2) in this population would be h2 = 0.64. This is much greater than the estimate of realized h2 from response to selection (h2 ≈ 0.09) [The variation among the inbred lines far exceeds that of lines selected for 21 generations for increased and decreased aggressive behavior, which only differ less than threefold (with a mean of 14.2 and 34.2 encounters in the high and low selection lines using the same assay) . Under a ≈ 0.09) , indicatP < 0.01) associated with variation in aggressive behavior . In addition, 167 SFPs (P < 0.05) with a minor allele frequency of at least 10% were associated with variation in aggression; these represent 137 independent genes . Four of the QTTs were also implicated as candidates from the SFP analysis . No gene ontology information is available for three of these genes . methuselah-like 8 encodes a predicted G protein coupled receptor that may affect the determination of life span [Previously, we quantified variation in gene expression among these wild-derived inbred lines . A totalife span .In total, these analyses implicate 266 unique candidate genes associated with natural variation in aggressive behavior. These candidate genes are involved in a broad spectrum of biological processes, including vision, olfaction, learning and memory, and the development and function of the nervous system . However, the candidate genes are also involved in transcription, protein modification, mitosis and other basic cellular processes . More than half of the genes with annotations are involved in metabolism, nearly 60% have protein binding functions, and approximately 25% are implicated in development .Cyp4p2. Members of this gene family have also been associated with aggressive behavior in previous studies [nord, visgun, and klingon [Drosophila aggressive behavior is associated with learning and memory [Drosophila.Two categories of candidate genes are worthy of mention. We found a member of the Cytochrome P450 gene family associated with aggressive behavior, studies ,18. Cyto studies . The rep klingon - consisd memory . Perhaps12 = 0.36, P > 0.05). There are several possible - and not mutually exclusive - reasons why the degree of overlap between the two experiments is not more extensive. First, the observation that there is no more overlap between the two experiments than expected by chance could mean that there are many rare alleles affecting aggressive behavior segregating in nature, such that two independent samples captured different subsets of alleles. Second, the flies from the selection lines were not mated, and had been starved for 90 minutes prior to RNA extraction, in contrast to the mated, fully fed flies for which transcript profiles were obtained in this experiment. Third, the control line was the most extreme for many of the transcripts that were divergent among the selection lines; this type of transcript-phenotype association will not be detected in a linear regression. Fourth, selection causes linkage disequilibrium between the selected locus and linked unselected loci; changes in transcript abundance among these linked loci between the selection lines are false positive associations. In contrast, the rapid decay of linkage disequilibrium in regions of normal recombination in unselected Drosophila [A total of 26 of the 266 candidate genes identified in this study overlapped with the candidate genes implicated from the correlated response of the transcriptome to selection for divergent level of aggressive behavior , from a osophila ,28 minimP-element insertional mutations in 12 of the candidate genes, and their co-isogenic control lines. Nine of the mutant alleles were associated with significantly different aggression levels from the control and schizo are less aggressive than the control strain. No gene ontology information is available for the predicted genes tested; however, CG11448 is homologous to the amyloid beta A4 precursor protein, which is implicated in Alzheimer's disease. late bloomer has a role in nervous system development and synapse biogenesis. It is homologous to TSPAN7, a tetraspanin protein implicated in mental retardation [skuld is involved in numerous transcription-related processes, and also has roles in metabolism and development. Gap1 has roles in the cell cycle, and is also involved in signal transduction and numerous developmental processes, such as axis specification and sensory organ development. Finally, schizo is involved in several signal transduction pathways, the development of the central nervous system, and muscle development. It is homologous to the human protein ADP-ribosylation factor guanine nucleotide exchange factor 2, dysfunctions of which are associated with microcephaly [Flies with mutations in ocephaly .r| ≥ 0.7). Note that these are, at present, undirected networks. We do not know which transcripts are causally associated with variation in aggression, due to functional polymorphisms in cis-regulatory regions, and which transcripts are trans-regulated and change expression as a consequence of cis-regulatory variation at another locus [The transcriptome is highly genetically inter-correlated . This coer locus .P < 0.01). Nearly 50% of the annotated genes in module 6 are involved in establishment of localization, compared to approximately 13% of the background (P < 0.001); 25 to 30% of the genes in modules 6 (P < 0.05) and 7 (P < 0.01) are involved in cell communication, whereas only 13% of the background falls into that category tool). Approximately one-third of the transcripts in module 6 affect ion binding, relative to approximately 2% of the probe sets in the genomic background; this is a significant enrichment . However, organismal genetic correlations can only be significant if alleles affecting both traits have largely similar positive or negative effects on the traits [synaptogyrin, which is involved in synaptic vesicle exocytosis [Rab9 is associated with chill coma recovery [GRHRII, which encodes a predicted G-protein coupled receptor [The wild-derived inbred lines have been assessed for variation in other complex traits: longevity, starvation stress resistance, chill coma recovery time, locomotor reactivity (a startle response), copulation latency, competitive fitness and sleep traits ,37. At te traits . There cocytosis , is assoocytosis . Rab9 isrecovery and sleereceptor and gonareceptor , is assoreceptor and sleer ≥ 0.70) to the transcriptome , as well as other general functions with less obvious relationships to aggression per se . Analysis of natural variants affecting complex traits that have survived the sieve of natural selection thus gives insights about the genetic basis of complex behaviors that are not possible from analysis of mutations of large effect. That none of the genes previously implicated to affect aggression was detected in this screen is somewhat surprising. There are several possible explanations. The known candidate genes may not be genetically variable at the level of transcription; we could not detect genetically variable transcripts at these loci because they are expressed at low levels or at a different developmental stage; our SFP map detects only a small fraction of polymorphic variants; and the candidate genes may not tolerate functional variation due to strong purifying selection. For example, variation in fruitless was not associated with variation in aggressive behavior in this study or previous studies [fruitless was genetically variable, and variation in fruitless expression for this probe set was not associated with variation in aggressive behavior.Aggression is clearly a highly complex trait - we have identified 266 candidate genes associated with natural variation in aggressive behavior, none of which have been previously implicated to affect aggression. Follow-up functional validation shows that 75% of studies ,18. Onlycis- from trans-acting polymorphisms, and infer the direction of the flow of information through the network. The entire suite of 266 candidate genes provides a focal point for linkage analysis of segregating populations derived from the inbred lines. Further, the inbred lines can be characterized for other quantitative traits, including components of metabolism, which will enable us to interpret the balance of selective forces maintaining variation for aggressive behavior in natural populations on a genome wide scale. Extension of these analyses to a larger sample of inbred lines will increase the power of network analyses, and provide a more representative sample of allelic diversity associated with aggressive behavior. Finally, it is not inconceivable that our understanding the genetic underpinnings of variation in aggressive behavior in Drosophila could be used to develop novel pharmacological therapies for treatment of pathological aggression in humans and domestic animals.The QTTs associated with natural variation in aggressive behavior group into genetically correlated modules with shared functional annotations, sequence motifs, and tissue-specific expression. These modules are, in turn, correlated with other traits, providing insights about the molecular basis of pleiotropy between aggression and other behavioral and fitness-related traits. These results provide the foundation for a systems genetics analysis of natural variation in aggressive behavior. The future availability of whole genome DNA sequence variation for these lines will enable us to discriminate D. melanogaster inbred lines to identify 266 novel candidate genes associated with aggressive behavior, many of which have pleiotropic effects on metabolism, development, and/or other behavioral traits. Behavioral tests of mutations in 12 of these candidate genes showed that 9 indeed affected aggressive behavior. The genetically correlated transcripts formed a transcriptional genetic network of nine modules of correlated transcripts that are enriched for genes affecting common functions, tissue-specific expression patterns, and/or DNA sequence motifs. These results establish a foundation for understanding natural variation for complex behaviors in terms of networks of interacting genes.Aggressive behavior is an important component of fitness in most animals, and is genetically complex, with natural variation attributable to multiple segregating loci with allelic effects that are sensitive to the physical and social environment. However, we know little about the genes and genetic networks affecting natural variation in aggressive behavior. We combined quantitative genetic analysis of variation in aggressive behavior with whole genome transcript profiling in a population of P-element insertional mutations and their co-isogenic control lines were obtained from Bloomington Drosophila Stock Center, Bloomington, Indiana, USA.The 40 inbred lines were derived by 20 generations of full-sib mating from isofemale lines that were collected from the Raleigh, NC farmer's market in 2003 . Flies wBehavioral assays were performed as described previously on sociaDrosophila 2.0 arrays, using a strictly randomized experimental design. The raw array data were normalized using a median standardization. The measure of expression was the median log2 signal intensity of the probes in the perfect match probe sets, after removing probes containing SFPs between the wild-derived lines and the reference strain sequence used to design the array. Negative control probes were used to estimate the level of background intensity; probe sets with expression levels below this threshold were considered to be not expressed.The gene expression analysis has been described previously . BrieflyY = μ + L + ε was used to partition variation in male aggressive behavior and transcript abundance between lines and the variation within lines (ε). A FDR of < 0.01 [L term in the analyses of natural variation in gene expression, to account for multiple testing. Broad sense heritabilities (H2) were estimated as:The analysis of variance (ANOVA) model f < 0.01 was usedσL2 and σE2 are the among line and within line variance components, respectively. Estimate of cross-trait genetic correlations were:- where covij is the covariance of line means between trait i and trait j, and σi and σj are the square roots of the among line variance components for the two traits. Differences in aggressive behavior between P-element insert lines and their co-isogenic controls were assessed by t-tests, with significance levels based on Bonferroni-corrected P-values. Simple linear regressions were used to identify QTTs significantly associated (P < 0.01) with variation in aggressive behavior across the 40 lines. Similarly, ANOVA models were used to identify SFPs significantly associated (P < 0.05) with variation in aggressive behavior.- where Y = μ + E + ε(Y is the phenotype and E is the covariate median log2 expression level) and extracting the residuals to compute the genetic correlations for module construction [The genetic correlations between all transcripts significantly associated with aggressive behavior were computed after removing the correlation between these transcripts and the phenotype. This was achieved by fitting the model truction . Modulestruction by transtruction ,37 were truction .Statistical analyses were performed using JMP 7.0 software . Functional annotations of genes are based on FlyBase annotatiANOVA: analysis of variance; FDR: false discovery rate; MEME: Multiple EM for Motif Elicitation; QTT: quantitative trait transcript; SFP: single feature polymorphism.TFCM and ACE designed research; ACE performed research; EAS contributed analytic tools; ACE and JFA analyzed data; TFCM and ACEF wrote the paper.P < 0.01; Additional data file The following additional data are available with the online version of this paper: transcripts significantly associated with variation in aggressive behavior among 40 wild-derived inbred lines (regression σL2) and within (σE2) line variance components, broad sense heritabilities (H2) and the false discovery rate (FDR) for the line term are for males only.Mean expression level, among biological process and (b) molecular function Gene Ontology categories of genes for which variation in gene expression is correlated with variation in aggressive behavior. The percentage of genes falling into a given category is depicted on the x-axis. The relevant genomic background is the 7,508 probe sets that were differentially expressed in males at a FDR of < 0.01. No categories were significantly over-represented among level 3 categories; however, the level 4 'transport' biological process category was over-represented .Level 3 Click here for file(a) Level 3 biological process and (b) level 4 molecular function categories. Only categories applying to at least 5% of a list are depicted. Categories significantly over-represented in the SFP list relative to the genomic background are denoted as follows: *adjusted P < 0.05; **P < 0.01; ***P < 0.001.Click here for file(a) are level 3 biological processes; those in (b) are level 3 molecular functions. The percent of genes falling into a given category is depicted on the y-axis.Categories in Click here for fileH2 = broad sense heritability. QTT = quantitative trait transcript; SFP = single feature polymorphism.Average |r| is the mean absolute value of the correlation of the transcript to all other variable transcripts. Click here for fileDegree = the average correlation of a transcript with all other transcripts in its module. Average degree = the average correlation of all transcripts in the module.Click here for file(a) Reference [Expression of these genes has been correlated with aggressive behavior and the other traits listed. eference ; (b) refeference .Click here for file

Specialist physicians provide a large share of outpatient health care for children and adolescents in the United States, but little is known about the nature and content of these services in the ambulatory setting. Our objective was to quantify and characterize routine and co-managed pediatric healthcare as provided by specialists in community settings.Nationally representative data were obtained from the National Ambulatory Medical Care Survey for the years 2002-2006. We included office based physicians , and a representative sample of their patients aged 18 or less. Visits were classified into mutually exclusive categories based on the major reason for the visit, previous knowledge of the health problem, and whether the visit was the result of a referral. Primary diagnoses were classified using Expanded Diagnostic Clusters. Physician report of sharing care for the patient with another physician and frequency of reappointments were also collected.Overall, 41.3% out of about 174 million visits were for routine follow up and preventive care of patients already known to the specialist. Psychiatry, immunology and allergy, and dermatology accounted for 54.5% of all routine and preventive care visits. Attention deficit disorder, allergic rhinitis and disorders of the sebaceous glands accounted for about a third of these visits. Overall, 73.2% of all visits resulted in a return appointment with the same physician, in half of all cases as a result of a routine or preventive care visit.Ambulatory office-based pediatric care provided by specialists includes a large share of non referred routine and preventive care for common problems for patients already known to the physician. It is likely that many of these services could be managed in primary care settings, lessening demand for specialists and improving coordination of care. Specialist physicians provide an increasing share of health care for children and adolescents , at leasThe current debate on the future needs of health care workforce needs to be informed not only by trends in absolute and relative numbers of physicians, but also by the content and the type of the care provided by them -12. InfoIn order to improve the understanding of what US specialists do in caring for children and adolescents patients in their area of special interest we aimed to describe the nature and content of the specialist care focusing on care provided in the community. In particular, we focused our analysis on the burden of routine follow-up and preventive care as well as the degree to which care is shared with primary care physicians.Data were obtained from the National Ambulatory Medical Care Survey (NAMCS), United States, for five consecutive years (2002 to 2006).The survey included visits made to non-federally employed, office-based physicians in the United States. A multistage probability design was used with probability samples of 112 geographic sampling units, physician practices within geographic units, and patient visits within practices. Non-federally employed physicians who are classified by the American Medical Association (AMA) or the American Osteopathic Association (AOA) as primarily engaged in office-based patient care were randomly selected. Selected physicians completed questionnaires for a systematic random sample of all patient visits made during 1 week (yearly response rates ranging from: 70.4% (2002) to 58.9% (2006)). Additional details of the survey's methods are available elsewhere -19. In tThe principal specialty of a physician was self-designated at the time of the survey . BecausePrimary diagnosis for each visit was recorded as free text by the physician and was coded according to the International Classification of Diseases, 9th Revision, Clinical Modification (ICD-9CM). More thA classification of types of visits was developed based on two major visit attributes as reported by the specialist: "Previous knowledge of the health problem" ", "Known patient, known problem (routine)", and "Other")Table , and "ViSince specialized health care is expected to be coordinated with that provided by the patient's primary care physician,26, we mParticipating physicians also reported whether a subsequent follow-up appointment had been suggested to the patient at the end of the visit (reappointment).http://www.acg.jhsph.edu was used for case-mix adjustment [The Johns Hopkins Adjusted Clinical Groups (ACG) Case-Mix System justment ,28. The The unit of analysis was the visit throughout. Sampling weights that accounted for the multistage sampling design were obtained from the National Center for Health Statistics. These weights were used to obtain national estimates of the overall numbers of visits and descriptives for all the variables,18. LikeTwo multivariable logistic regression models were constructed for the comparisons between referrals and non referrals among visits to specialists adjusting for patient's age, sex, ethnicity, insurance, morbidity burden, and physician specialty were to specialists .Routine or preventive visits by known patients emerged as the most frequent type of visit, accounting for 71,896,865 estimated visits overall 41.3%), and for the great majority of all visits to medical specialists (51.2%) and psychiatrists (73.8%) , allergy and immunology (17.8%), dermatology (11.7%). Comparatively, visits to these specialists accounted only for 34.9% of all visits when all visit types were considered. Seven diagnostic groups accounted as well for slightly more than half of all routine and preventive visits (52.7%) , while non referred care was most frequently for routine or preventive care (48.8%). Routine or preventive care for non referred patients was the most common type of visit, accounting for almost as many visits as all other categories of referred visits combined .Specialists reported sharing care for the patient with another physician in only 23.5% of all visits. Shared care was more likely to be reported in visits for referred patients than for non-referred patients .A reappointment was scheduled in about 3 out of 4 visits. Overall, every 1 out of 2 reappointments resulted from a routine or preventive care visit (47.4%). The likelihood of a reappointment in referred visits was similar to that for non referred visits .Our analysis of about 174 million ambulatory visits to office based specialists by children and adolescents in 2002-2006 demonstrated clear patterns in the provision of health care. Routine and preventive care for patients already known to the physician accounted for more than 40% of visits. About three quarters of visits result in a reappointment with the same specialist regardless of whether the patient had been referred for that visit or not. Referrals by other professionals accounted for about a third of all specialty care visits. For patients without a referral, specialists were about three times less likely to share the patient's care with another physician.First, all information included in the study was based on physician report. Available evidence regarding the validity of NAMCS data suggests that only self-report of visit duration seems particularly susceptible to over-estimation, but we Second, the distinction between referred and non referred patients could in part be an artefact of follow-up -35. For Third, physicians reported sharing care with another physician in about a third of all referred care visits. This low percentage might signal a different understanding in the distribution of responsibilities between the referring physician and the specialist ,37.Fourth, the unit of analysis was the visit rather than the patient, thus limiting our ability to make any inference about the patients. However, this does not modify our conclusions focusing on physicians activity, better quantified in terms of visits than patients.We have shown that routine and preventive visits are common among specialists in office based practice, as well as the source of future such visits through follow-up appointments. This was especially true for non referred care. The low level of shared care and the high levels of routine follow up suggest that primary care physicians are not being incorporated into follow up of referred problems. If they were, it could lower the demand on specialists.There is little evidence to suggest how frequently patients with common chronic conditions need specialist follow up, and there is considerable variation in the frequencies and intervals at which specialists request their patients to make return visits. In countries with well developed systems of primary care, the routine follow up of patients with common chronic conditions is undertaken in primary care,39.The results of our study suggest that some of the activity performed by specialists working in a specialist role in the community could also be done in primary care. Primary care professionals are accountable for the large majority of personal health care needs, and mucGreater efficiency might be achieved by having the primary care practitioner do the follow-up care, allowing specialists to focus on those aspects of care which demand their unique skills,42. InteInexorable increases in costs of care, the imperative of continuity of care, and the emergence of the Medical Home model appear to be sufficient justification for re-assessing the appropriate relative roles of primary care and specialist physicians.Our data demonstrate that a handful of conditions account for about half of all ambulatory visits to specialists in children and adolescents in the US. More intensive training of generalists on the management of these particular clinical areas would result in an increased offer for these services within primary care and in increased continuity of care. The same principle would apply to other countries and health systems, should these observations be confirmed in similar studies.Ambulatory office-based pediatric care provided by specialists includes a large share of non referred routine and preventive care for common problems for patients already known to the physician. It is likely that many of these services could be managed in primary care settings, lessening demand for specialists and improving coordination of care.ACG: Johns Hopkins Adjusted Clinical Groups; ADG: Aggregated Diagnostic Groups; EDC: Expanded Diagnostic Clusters; NAMCS: National Ambulatory Medical Care Survey; US: United States.The authors declare that they have no competing interests.JMV, CBF and BS designed the study. JMV accessed the data and performed the statistical analysis. All authors helped with the interpretation of the data. JMV and BS drafted the first version of the manuscript, and all authors contributed to subsequent versions and revised it critically for important intellectual content. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6963/9/221/prepub

The FONICAP group is screening, with randomised phase II studies, the activity of new chemotherapy programmes for advanced non-small-cell lung cancer (NSCLC) looking for regimens with > 30% activity. In the present study, three regimens were tested: MIP ; MIP-IFN ; and PC (cisplatinum 60 mg m-2 and carboplatin 400 mg m-2 on day 1 every 28 days). Overall 93 chemotherapy-naive patients were enrolled: 23 received MIP, 27 received MIP-IFN and 43 received PC. Eighty per cent of the patients had stage IV and 20% stage IIIb disease . Response rates were as follows: MIP = 9% (95% CI 1-28%), MIP-IFN = 7% (95% CI 1-24%) and PC = 14% (95% CI 5-28%). The overall median survival was 183 days. Grade III-IV leucopenia was observed in 36% of patients treated with MIP-IFN vs 10% in the other two arms, and thrombocytopenia grade III-IV was reported in nearly 10% of patients overall. In conclusion, (1) all three regimens investigated have poor activity (< 30%); (2) when tested in multicentre randomised phase II trials, MIP displays lower activity than in phase II trials; (3) PC has similar activity to other platinum-containing regimens; (4) randomised phase II studies are a reliable and quick method of determining the anti-tumour activity of novel chemotherapeutic regimens in NSCLC.

This paper presents a retrospective statistical study on the newly-released data set by the Stanley Neuropathology Consortium on gene expression in bipolar disorder and schizophrenia. This data set contains gene expression data as well as limited demographic and clinical data for each subject. Previous studies using statistical classification or machine learning algorithms have focused on gene expression data only. The present paper investigates if such techniques can benefit from including demographic and clinical data.We compare six classification algorithms: support vector machines (SVMs), nearest shrunken centroids, decision trees, ensemble of voters, naïve Bayes, and nearest neighbor. SVMs outperform the other algorithms. Using expression data only, they yield an area under the ROC curve of 0.92 for bipolar disorder versus control, and 0.91 for schizophrenia versus control. By including demographic and clinical data, classification performance improves to 0.97 and 0.94 respectively.This paper demonstrates that SVMs can distinguish bipolar disorder and schizophrenia from normal control at a very high rate. Moreover, it shows that classification performance improves by including demographic and clinical data. We also found that some variables in this data set, such as alcohol and drug use, are strongly associated to the diseases. These variables may affect gene expression and make it more difficult to identify genes that are directly associated to the diseases. Stratification can correct for such variables, but we show that this reduces the power of the statistical methods. The Stanley Neuropathology Consortium recentlyQ1. Can either bipolar disorder or schizophrenia be distinguished from control purely on the basis of gene expression profile?Q2. Does addition of the demographic and clinical history data further improve the ability to distinguish bipolar disorder or schizophrenia from control?Q3. Is there a significant difference between the abilities of different widely-used data analysis algorithms to make these distinctions?We show that bipolar disorder and schizophrenia each can be distinguished from control, based on gene expression alone, significantly better than chance – in fact with areas under the Receiver Operating Characteristic (ROC) curve (AUC) of 0.91 (schizophrenia vs. control) and 0.92 (bipolar disorder vs. control). While area under the ROC curve indicates how well one can distinguish across a range of specificities (with 0.5 being no better than chance and 1.0 being perfect distinction), it is also worth noting that for each task, a sensitivity of 0.85 can be achieved when operating at a specificity of 0.9. Moreover, by taking demographic information and clinical history into account We have investigated if post-stratification can correct for such variables, but we found that it significantly reduces the predictive accuracy of the statistical methods.The expression data set was obtained from the Stanley Neuropathology Consortium . The recThe expression data was obtained using Affymetrix Human Genome U133A GeneChip oligonucleotide arrays containing 22,283 probe sets . Probe level data was summarized using the GC content adjusted robust multi-array average (RMA) method , MT1X [GenBank:NM_002450], MT1X [GenBank:NM_005952], TNFSF10 [GenBank:NM_003810], ABCG2 [GenBank:AF098951], MT1E [GenBank:BF217861], SST [GenBank:NM_001048], CRHBP [GenBank:NM_001882], EMX2 [GenBank:AI478455], NPY [GenBank:NM_000905], MT2A [GenBank:NM_005953], MT1H/P2 [GenBank:NM_005951], SOX9 [GenBank:NM_000346], S100A8 [GenBank:NM_002964].When comparing the features that appear in the different tables, we observe that for the schizophrenia versus control task (Table NM_007177]) in common. For the bipolar versus control task , and all subjects and female subjects also share 6 features . For both diseases, there is no overlap between the ranking for the female subjects and that for the male subjects. Possibly of higher interest are the features relevant to both the schizophrenia versus control and bipolar versus control tasks. Comparing the rankings . Since, these samples are not derived from controlled animals models we will have to rely on these analytical means to aid our efforts in dissecting the root causes of complex diseases.Because most classification techniques that we consider are restricted to numerical features only, we re-encode each nominal feature as a numeric feature. Table . We use the reimplementation of C4.5 that is available in the Weka data mining tool version 3.4.4 [kNN. We use the EOV software version 1.0 by Hardin et al. [q-values, we use the software QVALUE version 1.1 developed by Storey [We choose the SVM-light software version 6.01 for conson 3.4.4 . We alson et al. . To compy Storey . All areMost classifiers provide confidence scores for their predictions. The classification behavior of such classifiers can be modified by applying a threshold to this score: only predict positive if the confidence is above the given threshold. By varying the threshold, we obtain different ROC points, which can be connected into a curve. We present such a curve for each classifier and report the corresponding AUC.D into 10 subsets Ti; (b) train 10 classifiers on the training sets D-Ti; (c) test classifier i on test set Ti. We pool the predicted confidence values of the classifiers over the 10 test sets to construct the ROC curve. The CV algorithm that we employ is stratified, which means that it ensures that the Ti have identical class distributions, or as nearly identical as possible.To obtain the ROC curves, we use 10-fold cross-validation (CV). 10-fold CV is often used to evaluate the predictive performance of classifiers if the number of instances is small. In this situation, 10-fold CV results in a lower-variance estimate of error than does the use of a single held-aside test set. 10-fold CV consists of three steps: (a) partition the data set t-test. The paired sample values used in the test are the AUC values computed for the two techniques on the 10 CV test sets.To assess statistical significance when comparing two classification techniques by AUC value, we use a two-sided paired C of SVM-light, which controls the contribution of the misclassified examples, is set to 1.0 . We enable Laplace smoothing of DT's confidence values. Following Hardin et al. [N to 20. We enable Weka's discretization feature for NB. We run kNN with k = 3 neighbors.Most classification techniques come with a number of parameters. We set all parameters to their default values, except for the following. The parameter n et al. , we set We tune NSC's Δ parameter, which controls the amount of shrinkage, by means of 10-fold CV, as suggested by Tibshirani et al. . Recall t-test for each feature comparing its value in the two classes. Then we rank the features by their t-test's p-value and retain the 10% features that most significantly differ in the two classes . We repeat the feature selection for each CV fold and perform the t-test on the corresponding training set.The performance of some classification techniques can be improved by running a feature selection method prior to constructing the classifier. We implement feature selection for SVM, NB, and 3NN. The feature selection works as follows. We perform a two-sided paired To compute the feature ranking by SVM weight, we normalize each feature by subtracting its mean and dividing by its standard deviation (in the data set at hand), and run the SVM algorithm on the transformed data. The rationale behind this is to avoid favoring features with a small value range in the ranking. We also enable feature selection to construct the ranking by SVM weight as discussed before.JS performed the statistical analysis and drafted the manuscript. SD provided the data, provided critical input and drafted the biological relevance section of the manuscript. DP supervised the study and helped drafting the manuscript. All authors read and approved the final manuscript.• FeatureRankingsStratified.{doc, pdf} (Microsoft Word and PDF format): "Feature rankings on post-stratified data" in additional files Feature rankings similar to Tables • FeatureRankingsDetailed.xls (Microsoft Excel format): "Feature rankings with additional information" in additional file Feature rankings that contain the same information as Tables Feature rankings on post-stratified dataClick here for fileFeature rankings on post-stratified dataClick here for fileFeature rankings with additional informationClick here for file

We present a Bayesian approach to detecting experimentally-induced patterns of distributed responses in SPMs with anisotropic, non-stationary noise and arbitrary geometry. We extend the framework to accommodate fixed- and random-effects analyses at the within and between-subject levels respectively. We illustrate the method by characterising the anatomy of language at different scales of functional segregation.In this work, we propose statistical methods to perform inference on the spatial distribution of topological features (e.g. maxima or clusters) in statistical parametric maps (SPMs). This contrasts with local inference on the features ►Given a fixed partition of an SPM , which regions are relatively active?►This method identifies 'active' regions as containing more events (e.g. blobs) than expected by chance►The method is sensitive to different features of an SPM, relative to conventional analyses The paradigm of functional segregation in cognitive neuroscience entails differential engagement of distinct brain regions. An example is the famously problematic hypothesis that region Q is engaged and region R is not activated; i.e. functional specialisation or segregation. This segregation of specialised or functionally selective responses in the brain requires that responses are specific to certain brain regions. We will refer to this as ‘regional specificity’. Mass-univariate approaches (like SPM) cannot address regional specificity, because one can never infer R is not activated . There is a general paucity of methods for addressing hypotheses about the specificity of distributed effects in neuroimaging. Historically, the SPM school calls on the so-called ‘topological’ rather than spatial inference, which considers topological features of statistical parametric maps like maxima or regional excursion sets, as opposed to individual voxels e.g., . The preClearly, to make an inference that one part of the brain responds more than another part, we have to consider regional responses. This takes us out of the mass-univariate (voxel-based) inference framework used by SPM and obliges us to define the regions entailed by relative regional effects. This definition relaxes the dependence on spatial smoothing that is an integral part of most conventional SPM analyses: to the extent that experimentally-induced responses are conserved spatially over subjects, they can combine to give significant group effects in between-subject SPM analyses. One motivation for smoothing is to ensure responses from each subject overlap by smearing them. This requires effects in different subjects to be close, relative to the scale of the smoothing kernel. In turn, this induces the problem of optimising the scale of the kernel and leads to the notion of scale-space searches . Here, wWe focus on the special case when ‘events’ are maxima/peaks of a real-valued SPM, resulting from the estimation of a general linear model (GLM) point-wise over the brain. Assuming that randomness in the component fields (i.e. error fields) of the GLM take the form of a Gaussian-field, closed-form solutions for the rate of local maxima in the SPM exceeding some arbitrary height have been derived using random field theory than conventional analyses using RFT.A ⊆ ℜD. Now partition A into regions, A = {Aj}j∊1,…,n and let dj indicate the integer number of events in Ai. Under any (e.g. non-isotropic) null SPM, this number depends on the ‘statistical volume’ of Ai which we denote |Aj|..For an isotropic SPM, |Aj| is directly proportional to the physical volume of Aj. Otherwise, the measure of the j-th region |Aj| is its RESEL count and is estimated easily using conventional techniques . For our purposes, the crucial property of a homogenous Poisson process is that events fall uniformly and independently over space completes the partition. Knowing that there are k supra-threshold events in the whole brain, d1 of which observed in the small volume, we can easily calculate classical ‘p-values’ for the observed pattern, under the null:Classical decision schemes to reject the null-patterningp-value tends to be slightly less conservative than set-level inference reveal this nference on the sa posteriori to observing the SPM. Here, p(Mi) is the a priori belief that Mi is the correct model and the posterior is:We are initially agnostic about the null and alternative models M1 is not unfairly advantaged (e.g. This update requires the integrated likelihood or evidence:ged e.g. :(6)pd|θ=And the priors are determined by the model:δ(⋅) is a degenerate distribution, zero everywhere but for its argument. This specialises Eq. Dir(cm) denotes the Dirichlet prior on θ where m gives the prior mean and c relates to the prior precision (see below for more details on the Dirichlet). In the present context we specify an uninformative Jeffries Dirichlet prior in which each element of this n-vector is set equal to 1/2 (θ = a). These models therefore have different implications for predicted observations d and one with lower concentration c ≪ ∞. It can be shown that under our priors, the dispersion of the distribution given in Eq. To see this concretely, consider a bipartition and two mean-a. This implements Occam's razor. In this example, model selection reduces to comparing two distributions with equal means and different variances, so that the null model is preferred when the data fits the model, while the converse model is preferred otherwise. A more general result for the predictive variance–covariance of the Dirichlet-multinomial is given in The first (null) model thus has competitive advantage over the alternative  ∝ pp(θ|M1), which encode each region's relative propensity to emit an ‘event’. Inference on regional parameters can be finessed with appropriate adjustments to posterior confidence, if we infer on a large number of parameters (see below). In what follows, we consider Bayesian inference on single SPMs and multiple SPMs acquired from different subjects under the same conditions.This scheme provides a simple way to make inferences on models and test hypotheses. Model evidence however is a gross measure: strong evidence for non-uniform patterning can arise from an excess of events in just one (or more) region of the partition. The success of the alternate model, as judged by its higher evidence (i.e. a large Bayes factor) can further be explained by examining the posterior density on its parameters: So far, we have only considered inference on a single SPM (e.g. from one subject). The strategy for multi-subject analyses depends on one's belief about between-subject variation. If all between-subject variation in spatial patterning arises from noise (i.e. the form of any structured inhomogeneity is conserved over subjects), a fixed-effects strategy is appropriate. This motivates pooling of data over subjects, because the subject index is not informative of true variation. Alternatively, if we believe there is true inter-subject variation in regional patterning, one can pursue a random-effects (RFX) strategy. In this case, pooling must be more qualified: subject indices carry information about true variation and inference focuses on the population mean. We first generalise the formulation above to accommodate subject-specific indices. We then describe two schemes that are suitable in the fixed and random-effects cases.Ai = {Ai1, ..., Ain}:i = 1, …,I now represent the partition of the i-th subject. As above, under M0, the Aij govern the probability that a given event in the i-th subject will fall in region j or, equivalently, the expected fraction of events falling in region j. Under M1, the corresponding probability is θij : ∑ jθij = 1; the vector θi now describes, for the i-th subject, the probability of a given event falling in each of the j = 1,…,n regions, assuming there is experimentally-induced patterning. Notationally, the i-th subject data now yields data di. Henceforth, we redefine d =  to denote the entire data-set over subjects.Let Aj = ∪ iAij. Inference on this ‘hyper-subject’ now reduces to the scheme described above, by simply pooling regional resel and event counts over subjects. Under fixed effects (FFX), subject-specific indices are uninformative regarding putative patterning and can be ignored. Pooling over uninformative subject-specific indices, we can define θi = , which characterises the pattern of the i-th subject is therefore sampled from:If we believe that there is real between-subject variation in patterning, we can use our random sample of subjects to infer on the population from which they came. It is convenient to assume a parametric form for the population. Here, we assume they are distributed according to a Dirichlet, whose parameters we aim to infer. The parameter vector θij > 0:∀i, j. The components of m =  define the proportion of events in each region, expected over subjects in the population. Here, mj is the regional population mean we seek, around which subjects vary according to a Dirichlet whose variance is controlled by c > 0. Again, if there was no systematic, experimentally-induced spatial patterning at the group level, m = a is simply equal to the relative resel counts, by the preceding arguments. For Bayesian inference on these quantities, we represent our a priori uncertainty about the population parameters with p.Where Γ is the gamma function and mj rather than models Mi. As we shall see, this does not pose an obstacle to useful inference at the population level. Under RFX models, we can ask whether, on average, individuals deviate from null-patterning, for any region as follows. First, we consider the set of marginal distributions p(mj|d) = ∫ pdcdmj∼ , where mj∼  is the vector of population means, except for region j. We can obtain a stochastic approximation to this integral (to arbitrary precision) via well-understood methods (see CS95(mj) that can be penalised for multiple inferences, as described next. This permits us to identify regions with an unusual density of events. We note that classical RFX analysis, under the same Dirichlet assumptions about the population, may be achieved via frequentist results found in Model comparison is more problematic in the random-effects case. In particular, the integrated likelihood has no analytic solution. For convenience, we restrict inference to the population means hods see . From thmj ≠ aj (or θj ≠ aj) to declare a region ‘significant’. Note when we compare models there is no multiplicity problem. There is only one model comparison and the integrated likelihood is automatically penalised in relation to the number of free regional parameters. From one perspective, parameters play an auxiliary role in quantifying why the null pattern has been rejected by model comparison; in this view, parameter inference per se is unnecessary. However, from the perspective of inference on parameters (under a selected model), it may be desirable to seek some form of control at the parameter level if each parameter is reported in relation to its marginal posterior. This is particularly important if no omnibus test is available and there are many parameters.When making separate inferences about regional parameters, we encounter a multiple comparisons problem, if we use a high posterior confidence that x% Bayesian confidence interval’ summarises where x% of our posterior belief in the true parameter lies. Under our RFX model, the posteriors p(m|d) and p(mj|d) are unimodal ; this also applies to our FFX model. Therefore, we use central confidence intervals for both FFX and RFX models. With two regions , these confidence intervals exclude extreme tails attributed with ε = (1 − x) net credibility. Consequently, we choose to penalise (increase) confidence intervals according to the number of regions minus one by enforcing ε = (1 − x)/(n − 1). We do not want to justify a Bayesian approach in terms of frequentist error control, which would be inappropriate. However, as we will show, under the conditions of our simulation, our approach incidentally provides frequentist control of false detections.Unless otherwise stated, we use x = 99%.With this in mind, recall that an ‘m1 observed in an independently replicated experiment. Precise or informed alternative models are easily accommodated in the FFX analysis by substituting a degenerate Dirac delta for the prior: p(θ|M1) = δ(m1) (assuming high confidence about m1). With RFX models, precise priors p = δ(m1) finesse the complications in evaluating the integrated likelihood and enable straightforward RFX model comparison: having specified m under the null and alternative hypotheses, the model evidence obtains by integrating the likelihood with respect to the population means and the scalar c . Note, by definition, the parameters of an informed model (such as the null) are specified by the hypothesis. There is therefore no component-wise inference on their parameters; inference is between two hypothetical patterns. We will explore the applications of informed model comparison in future work.In the preceding sections, we described schemes for evaluating the mismatch between an observed pattern and that estimated under vague prior assumptions. In some situations, one may have a precise alternative model or hypothesis. This could be derived from the spatial profile t-fields or SPMs.Bayesian error control, imposed by integrating the data-likelihood under vague priors, does not aim to satisfy Frequentist criteria . It is nevertheless interesting to examine how strongly the results depend on the inferential scheme. In this section, we simulate experimental data and evaluate the Frequentist behaviour of our Bayesian scheme. We explore this behaviour in the absence of experimentally-induced patterning, by generating data with no signal. For each of 84 volumes in the simulated experiment, independent unit-variance Gaussian noise was introduced onto a 64 × 64 × 64 regular lattice. We induced non-stationarity with piecewise constant smoothing over twenty random regions; obtained through a Voronoi parcellation diagram with random seeds . Each reL = 150 groups of 20 simulated subjects from our corpus. For each of these simulated experiments and ensuing SPMs, we defined ‘regions of interest’ by randomly selecting a fixed number of N regions from the AAL anatomical parcellation scheme as our final ‘region’. We calculated the regional resel counts of each ‘region’ and the corresponding number of events above a height threshold of three. We then assessed the Frequentist properties of fixed- and random-effects inference.We randomly sampled N ∊ {5,10,15,20} regions. This indicates that under our decision threshold and the conditions of our simulation, our Bayesian procedure incidentally implies a low false-positive rate in terms of model selection.All rational decisions (e.g. ‘tests’) require some subjective notion of utility/loss. Conventional decision thresholds are somewhat arbitrary . A threshold of 20 is the convention for Bayesian decisions based on relative evidence (given a Bayes factor). To begin, we defined a Bayes factor of twenty as the threshold for accepting the alternative model. We found that no Bayes factor from any of the simulated groups attained this threshold for any I(N), Il(N), ..., IL(N) are identically distributed: the approximate equality L realised observations. Here the random variable V denotes the expected number of frequentist errors in an experiment, the indicator I(N) = 1:V > 0 and 0 otherwise. L is the number of simulated replications over which we take the empirical expectation. We observed no FWER greater than 0.05 for any N ∊ {5,10,15,20} regions. FWER on regional parameters were {0.013, 0.013, 0.046, 0.033} respectively. These findings indicate that our procedure incidentally limits false-positive decisions on regional parameters to a small rate.For inference on parameters, we estimated of the Frequentist Family-Wise Error Rate (FWER) using N ∊ {5,10,15,20} regions: the observed values were {0.006, 0.000, 0.043, 0.043} respectively.In the context of random-effects models, we restrict our analysis to inferring parameters (not models). We used the RFX scheme to infer regional parameters for the same set of null experiments. Again, for each experiment, we counted the number of SPMs with one or more parameters, whose penalised confidence intervals were inconsistent with the null. We observed no FWER greater than 0.05, for any N = 116; i.e., the entire set of regions in the AAL. Our empirical estimate of the FWER on regional parameters was 0.04, validating the method for open-ended exploratory use.The preceding validations consider partitions with a relatively small number of areas. In some situations, we may have no priors on the functional anatomy and prefer a more exploratory approach. It is easy to validate the FFX procedure for many regions. We performed the same simulation procedure described above, but with Strictly speaking, data smoothing should have no effect on the robustness of the scheme because we effectively work in RESEL space (where the effects of smoothness are removed). More precisely, our null model conditions on the RESEL count associated with each region. This means the model does not depend on the degree of smoothing. Nevertheless, smoothness will affect the production of maxima in each individual SPM and therefore affect regional counting statistics. To illustrate that the approach is robust to different levels of data smoothing, we simulated 1000 SPMs using data smoothed with an 8 mm Gaussian kernel. Using the above procedure and under the conditions of this simulation, we found a regional FWE of 0.003 and no false model comparisons.A reliable measure of language laterality is important for both basic and clinical research. Furthermore, lateralisation represents a canonical example of a functional pattern one might want to make inferences about. Language laterality in fMRI is usually assessed by computing a Laterality Index (LI) that compares the relative contribution of both hemispheres, during a given language task. However, several methodological issues may confound the LI in healthy and diseased populations; for a critical review see We demonstrate our method on a data-set from previous work . These dhttp://www.fil.ion.ucl.ac.uk/spm/). All functional volumes were spatially realigned, un-warped, normalised to the MNI space, and smoothed with an isotropic 6-mm FWHM Gaussian kernel, with a resulting voxel size of 2 × 2 × 2 mm. The pre-processed functional volumes for each subject were then submitted to a conventional fixed-effects SPM analysis, using a general linear model at each voxel. Each stimulus onset (except fixation) was modelled as an event encoded in condition-specific ‘stick-functions’. The resulting stimulus functions were convolved with a canonical hemodynamic response function to form regressors for the linear model. Our contrast of interest was the main effect of semantic matching on words, relative to perceptual matching on unfamiliar symbols. More details about this analysis and the main effect of interest during semantic matching can be found elsewhere . Functional imaging used an EPI GRE sequence . Data processing and statistical analyses were carried out with the Statistical Parametric Mapping SPM5 software package  = , was inconsistent with, that expected by chance 0.4962; i.e. that based on resel counts. On applying RFX analysis, we again found that the confidence interval for the estimated average fraction of events in the left hemisphere, CI(m1) = , was inconsistent with that expected by chance alone (0.4962). From either of these we conclude that there is evidence for left-lateralization of language.We began by defining two regions for the entire right and left hemispheres; excluding the cerebellum due to the crossed cerebellar representation of laterality; and the mesial cortex near to inter-hemispheric fissure to see whether we could characterise lateralisation with greater regional precision. Under FFX assumptions, we again found evidence for a non-uniform pattern, with a Bayes factor of 1.149 × 10Note that there is overlap between the regions returned by the both analyses. As expected, high activity tends to be in the left hemisphere and low activity tends to be in the right hemisphere.θ, while the right panel corresponds to RFX analysis on m. We can see from these plots that some of the confidence intervals exclude the null (green dots). For ease of visual inspection, we highlight such regions with embolded confidence bounds (thick dots).To visualise the basis for these inferences about regional specificity shown in a priori knowledge of the functional anatomy. In particular, we choose all regions, excluding the vermis and cerebellum, as our partition. For illustration, we then assumed nothing about the functional anatomy engaged by the task comparison and use a more exploratory approach, which is useful when there is little As a final check on our model assumptions we analysed SPMs based on real data that conformed to the null hypothesis: if our null Poisson Process model is not tenable for real data, the fraction of events found in each region should not be approximated by the relative RESEL count. For each of 15 subjects we calculated an SPM testing for the effects of a random covariate . The results are null SPMs by construction. We repeated this procedure ten times and were never able to reject the null model, according to the decision procedures used above.t-statistic, using the 24 subject-specific contrasts of parameter estimates above. For both FWE adjusted thresholds, we catalogued all AAL regions containing at least one supra-threshold voxel. Pattern inference identified relative regional effects in five regions not identified by either conventional SPM analysis:•‘Frontal_Sup_Orb_L’,•‘Frontal_Mid_Orb_R’,•‘Frontal_Sup_Orb_R’,•‘ParaHippocampal_R’,•‘Temporal_Pole_Sup_R’Finally, we compared the results from pattern inference with two conventional whole-brain approaches based on the height and extent of SPM excursion sets. To do this we computed an SPM of the Conversely, FWE procedures identified regions that were active in absolute — but not relative — terms. Four regions were identified using peak height . Inference based on spatial extent identified 29 regions . This emphasises that inference about relative vs absolute responses are distinct. In other words, inferring that a region has responded does not necessarily mean the response is regionally specific .relative to the rest of the search volume. Note that the interpretation is inherently relative. The rest of the brain may or may not be activated in absolute terms i.e. as determined by conventional peak or cluster-extent methods. It is in this sense that the method infers patterns — attributes of the SPM that are distributed over whole search volume. It therefore differs qualitatively from existing methods, and is complementary to them. While we have focused on patterns in SPMs of functional images, the method is clearly applicable to structural (e.g. VBM) analyses, for which there is also a clear null hypothesis (absolute peak rate (e.g. as inferred via set-level inference). In such conditions, rejecting a regionally nonspecific hypothesis is more conservative than rejecting a hypothesis that no region has responded.We have introduced a new method, which can identify experimentally-induced changes in spatial patterning over a set of pre-specified regions. Here, inference is on the spatial organisation of events (high peaks) rather than their absolute number or the attributes of individual activations. A positive decision about region Q means that region Q is relatively sparse or rich in events, pothesis . We haven − 1 penalty furnishes appropriate control, despite this dependence. Its success is not surprising, given the formal similarity of this penalty to Bonferroni-correction, which holds under arbitrary dependence.Note that the model underlying pattern inference does not, strictly speaking, assume independence of counts across regions: given the total count, components of a multinomial random vector have negative covariance. For region-wise tests, this negative dependence means that falsely inferring an event excess in one region increases the chance of inferring event dearth in the remaining regions. Our simulations indicate that the To assess the evidence for experimentally-induced spatial patterning over a set of pre-specified regions, we must account for two confounding explanations: (i) spatial inhomogeneity in the SPM and (ii) the relative volume of cells. We exploit an established measure of ‘statistical’ volume (the resels-per-voxel image) to attain a volume measure that effectively removes local variations in the geometry of statistical dependencies, under the null. We use this in conjunction with the Poisson clumping heuristic to elaborate a hierarchical pattern model, which affords inference on both model and parameter (pattern) space; at the within or between-subject level.local (within region) functional heterogeneity over subjects; it sees only the regional count. Only heterogeneity between different regions would benefit from an explicit random-effects model. Additional factors limiting functional heterogeneity should bolster the suitability of FFX analyses. This is fortunate for practical reasons; the analytic FFX solution is quick, benefits from an exact model evidence, and is more suitable for exploratory analyses.As an illustration, we applied the method to ask whether a language task influences the pattern of event in the ensuing SPMs. We identified specific regions of a language network that had a surprisingly low or high proportion of events, given their volume. In particular, left-hemisphere regions tended to be relatively rich in events, and right-hemisphere regions were relatively sparse. It is noteworthy that there was close agreement between RFX and FFX inferences. This is partly because our FFX is naturally robust to vs bilateral temporal regions are more engaged in a task. Here, one would distinguish lobes while pooling across hemispheres into a two-region partition (three if considering the complement of the brain). Note that each partition embodies a different hypothesis. This means one can address the same SPM with different hypotheses, framed in terms of different partitions. We have tried to illustrate this anecdotally by using different partitions above, when charactering language activations. One can imagine step-down applications of this approach; where a cell from a ‘significant’ partition is itself partitioned and the process repeated recursively, until no further functional segregation can be inferred. We will pursue this in elsewhere. In a hypothesis-driven approach, partitions are informed by known functional neuroanatomy. Previous research provides a priori, constraints on the inference: known functional anatomy can be used to restrict the search to a small number of regions. This empowers inference, because reducing the number of regions reduces the implicit penalty imposed by the integrated likelihood or multiplicity-controlled confidence intervals.As we have demonstrated, pattern inferences can be used for hypothesis-driven as well as exploratory analyses. In the former case, the motivation for choosing a specific parcellation derives primarily from the scientific question. The approach we have illustrated started with building blocks, defined within an existing parcellation scheme , and aggregating regions when desirable. Regions can be grouped according to prior knowledge of the functional neuroanatomy. For example, one may ask whether bilateral frontal post-hoc interpretation of the pattern will be regionally specific. Sensitivity here depends on any responses being expressed within the same cells. It is interesting to think about the limiting case in which the partition includes the set of all voxels and how this relates to standard topological inference. In a subsequent paper, we will look at optimising the partition with respect to sensitivity and the implicit dependence on the spatial scale at which activations are conserved over subjects.We emphasise that our inference about spatially structured responses is no more than that . The regional specificity of this inference is determined by the nature of the partition. The partition can have a small number of large regions ; in which, case the inference will have little regional specificity but good sensitivity to effects that are not conserved spatially over subjects. Conversely, the partition can have a large number of small cells, in which case the inference and t = 3. This is roughly the lower bound required for valid set-level inference . First, the number of events depends (inversely) on the degree of spatial smoothing. In this respect, our method is most powerful with relatively low smoothing, e.g. FWHM of 2–3 times the voxel size (cf the pattern classification approach in nference . Recall The assumption that fixed-effects models are more appropriate than models that allow for random effects over subjects is clearly questionable in many contexts. Generally, fixed-effect assumptions will tighten the confidence intervals on the model's parameters, boosting the significance of the results. This is important in the current setting, because fixed-effects analyses are only tenable when between-subject variations in the expression of responses fall within — rather than between — regions of the partition. Future work will develop tools which require much weaker assumptions; i.e., non-parametric random effects — when this assumption is not tenable. Such models may provide benchmarks for justifying simpler models and enable formal model selection.We have presented the simplest possible examples from a rich class of spatial patterning methods, which seek to understand patterns over pre-specified partitions of the brain. In future work we will describe another parametric patterning method for inferring the influence of subject-level covariates on spatial patterning. In a second line, we will elaborate on flexible non-parametric models for characterising patterned data.

The 173–195 segment corresponding to the helix 2 of the C-globular prion protein domain could be one of several “spots” of intrinsic conformational flexibility. In fact, it possesses chameleon conformational behaviour and gathers several disease-associated point mutations. We have performed spectroscopic studies on the wild-type fragment 173–195 and on its D178N mutant dissolved in trifluoroethanol to mimic the in vivo system, both in the presence and in the absence of metal cations. NMR data showed that the structure of the D178N mutant is characterized by two short helices separated by a kink, whereas the wild-type peptide is fully helical. Both peptides retained these structural organizations, as monitored by CD, in the presence of metal cations. NMR spectra were however not in favour of the formation of definite ion-peptide complexes. This agrees with previous evidence that other regions of the prion protein are likely the natural target of metal cation binding. These are derived from the wild type and the Creutzfeldt-Jakob-disease-associated mutant full len2 and AcNNFVHNCVNITIKQHTVTTTTKGNH2, respectively, weresynthesized by standard fluorenylmethoxycarbonyl chemistry protocol aspreviously described and hPrP[173–195] D178N,with sequences AcNNFVHDCVNITIKQHTVTTTTKGNHescribed .μM peptide dissolved in TFE to mimic the α-helical structure of the parent segment in thenative protein. Spectra were also collected after addition of increasingamounts of metal cations [Zn(II) and Cu(II)] up to a 10 : 1 metal/peptide molarratio. In any case, final spectra were obtained averaging three scans,subtracting the blank, and converting the signal to mean residue ellipticity inunits of deg⋅cm2⋅dmol−1⋅res−1. Other experimental settings were 20 nm/min scan speed, 2.0 nm band width, 0.2 nm resolution, 50 mdeg sensitivity and 4 seconds response.Far UV CD spectra of both peptides were recorded at room temperature on a JascoJ-810 spectropolarimeter, using 1 cm quartz cell containing 20 d2-OH(99%). NMR spectra were acquired at 300 K on a 600 MHz Bruker Avancespectrometer equipped with a cryoprobe. Natural abundance 1H-15N HSQC and 1H-13C HSQC D178N. The lower intensity of the far UV CD spectrum of hPrP[173–195] D178N, run in the same condition as that of hPrP[173–195] , suggestulations , validatα2-helical region of the prion protein and represent the wild type sequence and its D178N mutant, respectively, both in the absence and in the presence of metal cations. As can be judged from far UV CD spectra, the two negative bands at 222 and 208 nm, and a positive band at 192 nm indicate that both peptides exhibit α-helicalarrangement. However, the lower intensity that characterizes the spectrum ofthe mutant peptide suggests some rearrangement as compared to the singlehelical structure exhibited by the wild type peptide. In fact, there is NMR evidencethat the conformation of the wild type peptide is significantly affected byreplacing the negatively charged Asp178 with a neutral Asn residue. In themutant peptide, increased conformational freedom characterizes all residuesdownstream Gln188, which ultimately causes unwinding and bending of the wildtype fully helical structure. As a consequence, structural rearrangement leadsto the formation of two short helices separated by a kink centred on Lys185 and Gln186. In this bent structure, His177 and His187 approach to each other as compared to the parent helical peptide, forming two major conformational families, characterized by proximal and distal imidazole rings, respectively.Moreover, the network of stabilizing H-bonds mainly involves the interactionbetween Asn174 and Thr188 (head-to-tail type) and between Asn181 and His187 orGln186 (core type) . In concFor both peptides, addition of increasing metal cation aliquots did not perturb NMRspectra in any specific way. The chemical shifts of all resonances did notvary, as it could be expected in case of metal-peptide complex formation, andthe overall effect was a progressive generalized broadening of all relevantresonances. In fact, addition of higher and higher metal aliquots caused irreversible aggregation,which always lies in wait when the peptide concentration is very high, possiblyowing to ionic strength increase and/or to water addition on metal cationtitration. However, that the interaction of the metal with the peptide backbone is nonspecific wasconfirmed by the unaltered appearance of CD spectra after metal addition, whereaggregation did not occur thanks to the lower peptide concentration. These wereperformed in neat TFE to conform to the conditions of NMR experiments, butfurther experiments in mixed water/TFE solvent suggested that water-inducedeffects largely dominate structural rearrangements, rendering metal-inducedmodifications, if any, hard to discriminate.2+ complexes in blocked and free C- and N-termini analogues of the peptide fragment 180–193 (VNITKQHTVTTTT), which almost entirely encompasses the α2-helix. They suggested that the binding site of copper(II) inthe structured region of the protein is located on the His187 residue, and thatthe anchoring imidazole residue drives the metal coordination environmenttowards a common binding motif in different regions of the prion protein. Other studies [β(25–35) peptide and that the second putative helical region of PrP could be involved in modulation of Cu (II)-mediatedtoxicity in neurons during prion disease. However, our results suggest that theinteraction of metal cations with peptide fragments derived from the C-terminalglobular domain could be affected by experimental ambiguity caused by the factthat the structural organization of these peptides is different from thatassumed in Among studies that have been carried out on metal interaction with peptidesderived from the PrP C-terminus, it is worth mentioning that recently Brown andcoauthors have cha studies showed tα-inducing environment. This supports the view that the single Asp178 residue is of foremost importance in maintaining the structural properties of the PrP globular domain.It is known that the lack of mutual interactions has dramatic effects on the integrity of the whole helical domain of the prion protein, and the stability of one single helical region stronglysuffers from ablation of the other helical segments as well as of thedisulphide bridge. However, native-like conditions can be to some extentrestored choosing a medium that may help extract useful information using thepeptide fragment approach. Thus, we have used TFE as the most suitableenvironment to investigate structural similarities between the wild type andthe D178N mutant fragment corresponding to the helix 2. Our experiments confirmthat it is reasonable to suspect the involvement of this region in the ints out , 49 and ints out , 50, 51.ints out –54, the α-helix-inducer TFE to force peptides into a conformation close to the helical one that hasbeen found in α-helices and a two-stranded β-sheet [Furthermore, in the peptide fragment approach, it is unlikely that aqueous buffer is the most suitable environment to analyze metal interaction with peptide fragments, whose parent segments in the nativeprotein experience different environmental conditions. Concerning the roleplayed by metal cations in the β-sheet , 56. Alt β-sheet , 58 and

Correction for downscatter in I-123 SPECT can be performed by the subtraction of a secondary energy window from the main window, as in the triple-energy window method. This is potentially noise sensitive. For studies with limited amount of counts (e.g. dynamic studies), a broad subtraction window with identical width is preferred. This secondary window needs to be weighted with a factor higher than one, due to a broad backscatter peak from high-energy photons appearing at 172 keV. Spatial dependency and the numerical value of this weighting factor and the image contrast improvement of this correction were investigated in this study. Energy windows with a width of 32 keV were centered at 159 keV and 200 keV. The weighting factor was measured both with an I-123 point source and in a dopamine transporter brain SPECT study in 10 human subjects by minimizing the background outside the head. Weighting factors ranged from 1.11 to 1.13 for the point source and from 1.16 to 1.18 for human subjects. Point source measurements revealed no position dependence. After correction, the measured specific binding ratio (image contrast) increased significantly for healthy subjects, typically by more than 20%, while the background counts outside of all subjects were effectively removed. A weighting factor of 1.1–1.2 can be applied in clinical practice. This correction effectively removes downscatter and significantly improves image contrast inside the brain. Radioisotopes used for imaging with single-photon emission computer tomography (SPECT), such as Technetium-99m, typically emit photons with energy between 100 and 200 keV. This allows effective collimation by lead. These emissions have a photon energy of 159 keV for Iodine-123, which also emits a significant amount of photons with a higher energy (abundance 3.1%). The most important of these have a photon energy of 529 keV and an abundance of 1.4%, whereas the primary photons at 159 keV have an abundance of 83.4%..The observation of a fairly constant energy spectrum above the 159 keV peak suggestsThe triple-energy window (TEW) method also cor910The impact of the energy window subtraction on the final images, and the value of the appropriate weighting factor for the second energy window, have been investigated in a brain SPECT study and in experiments with an I-123 point source. The kinetics are influenced by scatter corrections,[Measurements were performed with a triple-head IRIX camera fitted with parallel hole, low-energy, general purpose (LEGP) collimators with an orbit radius of 16.5 cm. Projection data were obtained in 128 × 128 matrix size with an isotropic pixel size of 2.33 mm.The energy window for the primary imaging photons, with corresponding raw projection data I, was set at 143–175 keV. The energy window for the downscattered photons with projection data D was set at 184–216 keV. Both energy windows have a full width of 32 keV. In order to minimize the contamination of the downscatter window by primary photons (caused by limited energy resolution) a small energy gap (175–184 keV) between the two windows was chosen. Downscatter-corrected projection data J was calculated using the formula:k is the spatially invariant weighting factor for the downscatter window.[where r window.–5th-order Butterworth post-filter with a cut-off frequency of 0.3 Nyquist (= 0.64 cm–1) was used. Attenuation correction with Chang’s first-order correction[–1 for I-123 imaging without Compton scatter correction of the primary 159 keV photons.[SPECT imaging was performed by recording projection data at 120 fixed angles, with an interval of 3° and a noncircular orbit. The mean radius of rotation was 13.9 cm. Reconstruction of projection data with standard filtered back-projection (FBP), both with and without downscatter correction, was performed in MATLAB 7.5 . Matrix size was 128 × 128, with 2.33 mm pixels and identical slice thickness. A 3D low-pass 4 photons.14–16 The photons. and b.k in Equation 1 was determined experimentally with an I-123 point source with 37 MBq activity. The contribution of the primary photons was ‘removed’ either: (i) by shielding the source with 6-mm lead, thus efficiently excluding the 159 keV photons, and placing the source inside the camera field-of-view (FOV) or (ii) by placing the unshielded I-123 source outside the FOV, near the scanner axis but 20 cm in front of the gantry and placing a 6.3-liter cylindrical water-filled phantom with a diameter of 16 cm inside the scanner as a scattering medium for mimicking a subject.The weighting factor k was determined as the ratio of the total counts between the two energy windows in the raw projection data, using the formula:The camera heads in both experiments were positioned at 90° (collimator surface perpendicular to the floor), 210°, and 330°, and the weighting factor for each angle. The energy spectrum in k, pixelwise k-maps were calculated. The statistical uncertainty in k depends on the number of counts. Therefore, a z-score, which does not scale with the amount of counts, was calculated. With I and D the pixel value in the corresponding projection data I and D the z-score for each pixel was defined by the difference between the global k factor defined by Equation 2 and the pixel value kpixel= I/D, normalized by the theoretical standard deviation σpixel; this was given by the formulaIn order to investigate the spatial dependence of the weighting factor 2) of the ratio I/D was approximated, for small variances, by adding the relative variances of I and D. These were expressed, assuming Poisson statistics, as the reciprocal value of the number of counts.On the right hand side, the variance .123 I-PE2I was given, immediately followed by a constant infusion of 123 I-PE2I for 3 hours. The B/I (bolus infusion) protocol was similar in both healthy subjects and patients, with a bolus worth 2.7 hours (range 2.6–2.8 hours) of infusion (the B/I ratio).[An average intravenous bolus of 74.3 MBq (range 65.8–79.9 MBq) of I ratio).18 Six SPc ≡ C/V and measured in counts/mL with C being the amount of counts and V the volume in milliliters. In order to minimize the subjectivity of drawing VOIs (volumes of interest), a method similar to the one devoveloped by Tossici-Bolt et al.[The performance of the downscatter correction was evaluated as image contrast after reconstruction. The noise properties of the reconstructed images were not investigated in detail in this paper. Image contrast was evaluated as (1) the striatal contrast and (2) the contrast between the intensities of the background outside the subject and the reference region (both of the latter regions are expected to have a uniform intensity). Specific binding ratio (SBR) is used as a measure for striatal contrast, which has the advantage that it is a clinically known and familiar quantity. The SBR is defined as the ratio of the specific striatal count concentration and the reference count concentration in the rest of the brain. Count concentrations are defined by lt et al. was usedwhere subscript S refers to the striatum, VOI to the volume of interest around the striatum, and the subscript ‘ref’ to the reference region. Identical VOIs were used for both reconstructions, with and without downscatter correction. In order to ensure that all the striatal counts were contained in the large VOI, an extra top and bottom slice with VOIs were added. Examples of the VOIs are shown in Figures outside the subject in the corrected projection data, i.e., J = 0 in Equation 1. By using the counts in the region outside the subject only the weighting factor can be determined by applying Equation 2. The background region for determining k was drawn well outside the head limits, as defined by expanding Chang’s attenuation map radially [k was calculated with Equation 2 applied to the raw projection data. For one subject, the edge threshold was varied in order to investigate its influence on k [t-tested, and the stated P-values were calculated by standard two-tailed t-tests. For the independent t-test, equal variance was not assumed.For comparison with the I-123 source experiments, the weighting factor in each of the 10 subjects was determined by minimizing the background outside the subject. There should be no counts, neither primary photons nor scattered primary photons, radially by threence on k . DiffereP maps show almost no significant differences from the global value of k. To the left of the k map, relatively far away from the source, there may be a larger area with a somewhat lower value of k. In a 8 × 8 matrix this is also indicated by four pixels, with a significant negative difference. As for the I-123 source placed outside the scanner, the maps did not show any significant difference of k from the global value.k was calculated with Equation 2 for each of the three camera configurations. For the shielded source in the scanner, the respective values of k were 1.123, 1.132, and 1.122. The total number of counts in the primary window was 1.7, 1.1, and 1.7 million counts, respectively. The uncertainty in k due to Poisson statistics was less than 0.002.The weighting factor k were 1.107, 1.109, and 1.115 for the three angles. The total number of counts in the primary window was 0.37, 0.39, and 0.24 million counts. The uncertainty in k due to Poisson statistics was less than 0.003.Similarly, for the source placed outside the scanner, the values of k-value of 1.1 was chosen for the reconstruction of the subject data. The results for the subjects are listed in Based on these results, a k was also determined in the subjects by minimizing the background. It was found to be slightly higher than 1.1 and significantly different (P<.005) between healthy subjects and patients, with ranges of 1.155–1.170 and 1.174–1.181, respectively. The uncertainty in k, caused by the limited amount of counts, was 0.002 for all subjects.For comparison with the I-123 source experiments, the weighting factor k=1.1) and non-downscatter-corrected images are visually comparable, but show improved contrast. Because of the energy window subtraction, the mean amount of counts in the reference region, the background, and (in lesser degree) in the striatal region is decreased. This is because the reduction in mean counts in the striatal region is comparatively smaller than that in the reference region.The background in the image was effectively removed by the downscatter correction for all subjects Figures and 4c. t-test revealed a significant difference (P<.005) between the SBR, both with and without downscatter correction for each striatum in healthy subjects. The uncertainty in SBR due to the limited amount of counts is approximately 0.1 or less. The difference in SBR was not significant (P>.2) for the patient group. SBR for the healthy subjects was increased by 23% ± 3% and 22% ± 5% (mean ± SD) for the left and right striatum, respectively. The relative SBR change in the striatum for patients ranged from –13.5% to 16.9% (left striatum) and from –10.0% to 20.2% (right striatum). Linear regression without intercept revealed a slope of (1.21 ± 0.01) between corrected and uncorrected SBRs for all subjects and for both left and right striatums in The contrast between background outside the subject and the reference region decreased from 0.15 ± 0.02 to 0.00 ± 0.01 (mean ± SD). A et al.[et al.k between the three camera configurations and the two setups with the iodine source could be the uncertainty in the calibration of the camera heads, the electronic noise, or a small geometrical dependency of k.A possible explanation for the small differences in k. Smaller values of k are possibly observed in areas of no importance, far away from the source. Similar results are observed when the iodine source is placed outside the scanner (images not shown). This indicates that the assumption of spatial invariance is within reason. More counts, however, might reveal more significant differences.Inspection of the images in k on the edge offset for a healthy subject. The determined weighting factor increases with decreasing edge offset. The assumption of no primary photons is not valid close to the edge and this results in a too high a value of k. The value of k determined at a distance of 3 pixels (edge offset) to the head for a 2-pixel thick layer was calculated as 1.245 ± 0.009. This indicates that the k factor is slightly higher for projection lines going through the head. Source–detector distance dependency of the downscatter count rate has been reported before.[2k.k between healthy subjects and patients might be caused by more uniform distribution of activity in the brain in patients.The small but statistically significant difference in before reconstruction. Downscatter correction is not necessary if medium energy collimators are used, since the amount of detected downscattered high-energy photons is negligible; however, this is at the cost of a loss in sensitivity.Downscattered photons are not collimated and therefore a sinogram of these photons (not shown) has very limited visible structure and subtraction of the downscatter energy window has to be performed k=1 is increased by 0.3 for k=1.1 and 0.6 for k=1.2.The largely improved SBRs for healthy subjects make discrimination between healthy subjects and patients easier. The effect of the novel result of a higher value (compared to one) of the weighting factor on the SBR is not profound, though it is not completely negligible. In healthy subjects with an SBR of approximately 10, the SBR compared to the calculated SBR for The chosen downscatter window is on the high-energy side of the backscatter peak, while the main window is placed on the low-energy side of the backscatter peak. A downscatter window around a higher energy will result in a higher value for the weighting factor. With the energy windows used in this paper, the weighting factor is close to one because the maximum of the backscatter peak is situated between the two window positions.et al.[Contrast might be improved even more by applying a scatter correction for the primary photons. This might be included by one or more energy windows below the main window, as in the dual-energy window scatter correction for Tc-99m . An extDownscatter correction by energy window subtraction can easily be performed and is chosen because other techniques, such as the TDCS (transmission-dependent convolution subtraction) technique, demand advanced postprocessing. Add to t10Septal penetration of high-energy photons reduces the contrast of I-123 SPECT images if low-energy collimators are used, but it can be corrected in a simple and effective way by subtraction of a second (higher) energy window from the raw emission data. Two novel methods for determining the weight of the second energy window have been presented in this article, the first based on phantom work and the second on the minimization of the background in the projection images before reconstruction.k=1.1–1.2 can be used. Correcting for high-energy photons significantly improves the contrast between high- and low-count regions. In the case of SPECT brain studies of the dopamine transporter with the PE2I tracer, the contrast was improved by more than 20% in healthy subjects.The value of the weighting factor was found to be slightly higher than one, a consequence of the structure of the downscatter energy spectrum above the main window. In clinical practice, a spatially invariant weighting factor with a value of

Mycotoxins are secondary metabolites which are produced by numerous fungi and pose a continuous challenge to the safety and quality of food commodities in South Africa. These toxins have toxicologically relevant effects on humans and animals that eat contaminated foods. In this study, a diagnostic DNA microarray was developed for the identification of the most common food-borne fungi, as well as the genes leading to toxin production.A total of 40 potentially mycotoxigenic fungi isolated from different food commodities, as well as the genes that are involved in the mycotoxin synthetic pathways, were analyzed. For fungal identification, oligonucleotide probes were designed by exploiting the sequence variations of the elongation factor 1-alpha (EF-1 α) coding regions and the internal transcribed spacer (ITS) regions of the rRNA gene cassette. For the detection of fungi able to produce mycotoxins, oligonucleotide probes directed towards genes leading to toxin production from different fungal strains were identified in data available in the public domain. The probes selected for fungal identification and the probes specific for toxin producing genes were spotted onto microarray slides.The diagnostic microarray developed can be used to identify single pure strains or cultures of potentially mycotoxigenic fungi as well as genes leading to toxin production in both laboratory samples and maize-derived foods offering an interesting potential for microbiological laboratories. Mycotoxins are fungal toxins which pose a threat to human, animal and plant health. These toxins can cause acute or chronic toxicity in humans and animals that eat contaminated foods or crops, depending on the quantities produced and consumed . It is eAspergillus species differentiation using Southern blot hybridization assays ) could be identified within the PCR products generated for each fungal species. However, amplification of the Fusarium species showed no significant differences between the sequences of the PCR products generated with the ITS primers. Therefore, the elongation factor 1-alpha (EF-1 α) gene was used for the identification of polymorphisms in Fusarium species and for the design of unique species- or genus-specific probes. A total of 38 probes could be designed or identified for Alternaria, Aspergillus, Penicillium and Stenocarpella species from the ITS regions and 22 probes could be designed or identified for the Fusarium species from the EF-1 α gene regions of the rRNA complex. Amplification of fungal DNA with the universal fungal primers ITS1 and ITS4 and subsequent sequence analysis allowed the differentiation of most of the fungal species studied. Several unique polymorphisms . Although the ITS sequences are quite similar for both fungal species, high hybridization efficiencies were obtained with net signal intensities of about 2000 signal units for A. clavatus and of about 3500 signal units for A. versicolor which were specific for universal fungal sequences served as internal standards to ensure that the parameters (labelling and hybridization) were similar across experiments. A similar intensity of controls across slides indicated that the relative signal intensities of probes are also similar across slides. Further, some probes in this study were modified to contain locked nucleic acids (LNAs) in at least two selected single nucleotide polymorphisms (SNP) sites per fragment. SNP's were found to be most effective, and thus gave better signal, if they were in a centre position. A probe with multiple polymorphisms along the probe length, regardless of position or modification at the polymorphic site, showed less cross-hybridization (results not shown) which is consistent with the data obtained by You et al. .Fusarium anthophilum was used to test this approach as no species-specific probes were present on the slide. The hybridization of this fungus to the fum5F and fum5R probes and elongation factor 1-alpha (EF-1 α) regions are all effective for the detection and identification of food-borne fungi. However, all these methods can identify only a single organism at a time. Suitable detection methods, anticipating mycotoxin risks, are needed to ensure a safe food production chain and eliminate the risk factors. Oligonucleotide microarrays have a high multiplexing capacity and have proved to be an efficient approach to overcome these limitations. This technology offers an identification process based on sequence confirmation through hybridization and has Fusarium species showed that they have similar sequences which could have cross hybridized on the array, making it non-specific. Kane et al. and served as targets for the design of multiple probes for each species which are able to discriminate between the forty fungal isolates. The sequences of the conserved regions were aligned using the ClustlX software [For DNA sequencing and subsequent oligonucleotide design, the full ITS regions of all 40 fungi were amplified using universal fungal primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') as described by White et al . The PCRClustalX . The mon2, 0.2 mM of each dNTP, 0.5 U Taq polymerase and 1 × reaction buffer (Bioline) and 5 ng template DNA. The PCR amplification consisted of 30 cycles of denaturation at 94°C for 30 sec, oligonucleotide specific annealing temperatures varying from 55°C to 60°C for 45 sec depending on the primer used, and extension at 72°C for 1 min; an initial denaturation step at 94°C for 5 min, and a final extension step at 72°C for 5 min. Aliquots of amplicons were resolved on 1% agarose gels.In addition, the public databases were used to identify toxin-specific probes for genes leading to toxin production for each of the 40 fungi. To test the optimal annealing temperature for array hybridization, monoplex PCR amplifications were carried out for all the probes identified. The PCR amplifications were performed in a 25 μl volume containing 0.4 μM of each oligonucleotide, 1.5 mM MgClhttp://fabinet.up.ac.za/microarray. Following printing, the slides were allowed to dry overnight at 45-50% relative humidity. Spotted DNA was then bound to the slides by UV cross-linking at 250 mJ and baked at 80°C for 2 h. The DNA internal transcribed spacer oligonucleotides ITS1, ITS3 and ITS4 served as controls for global normalization and were spotted at concentrations of 50 ng/μl, 100 ng/μl, 150 ng/μl and 200 ng/μl onto the array.Arrays were constructed from 86 uniquely designed species- and toxin-specific oligonucleotide probes. Equal volumes (10 μl each) of 100 pmol/ml oligonucleotide and 100% DMSO were transferred into a 384-well plate (Amersham PharmaciaBiotech) and stored at -20°C. Sixteen replicates of each oligonucleotide were printed onto Vapour Phase Coated Glass Slides (Amersham Pharmacia Biotech) using a Molecular Dynamics Gen III spotter at the African Centre for Gene Technologies (ACGT) Microarray Facility, University of Pretoria, Pretoria, South Africa 2CO3 (pH9) and 2.5 μl Cy5 mono NHS ester 4000 pmol dye resuspended in 12 μl DMSO. The reactions were incubated at room temperature for 90 minutes in the dark. After labeling, the dye coupling reaction was column-purified using the QiaQuick PCR purification (QIAGEN GmbH).For target labeling, DNA was extracted from the forty fungi listed in Table Vacuum-dried Cy5-labeled target and 0.3 pmol of the Cy3-labeled control probes were resuspended in 40 μl of hybridisation mixture containing 50% formamide (SIGMA), 25% 2× hybridization buffer (Amersham Pharmacia Biotech), and 25% deionized water. This mixture was denatured at 95°C for five minutes and stored on ice for hybridization. The hybridization solution was pipetted onto a glass slide, covered with a cover slip and inserted into a custom-made hybridization chamber . The hybridization was performed overnight at 53°C. After hybridization, the slides were washed twice in 2× SSC and 0.2% SDS at 37°C for 6 minutes, once in 0.2× SSC and 0.2% SDS at room temperature for 5 minutes and twice in 0.075× SSC at room temperature for 5 min. The slides were rinsed in de-ionised water for 2 s and dried by centrifugation at 1000 × g for 5 minutes.Oligonucleotide arrays were scanned with a GenePix 4000B scanner . The mean pixel intensity of each array that resulted from the individual hybridizations was quantified with the Array Vision 6.0 software . Individual net signal intensities were obtained by subtracting the local background from the raw spot intensity value. Irregular spots were manually flagged for removal. Further data analysis was performed in the Microsoft Excel software . Anomalous spots not detected through manual inspection were flagged for removal, if the signal intensity of a spot varied more than 10% from the mean of the sixteen replicates on each slide. Signal intensities of the sixteen replicates were then averaged and intensity values were normalized across slides by global regression on the spot intensity data of the internal transcribed spacer oligonucleotides ITS1, ITS3 and ITS4, which were used as a reference for normalization of all spot intensity data (reference design). The net signal intensity of each spot was divided by the median signal intensity of the sixteen replicates and spots with an SNR × Standard deviation Background) value below the median were removed from the analysis . Each spThe data discussed above has been deposited at NCBI Gene Expression Omnibus (GEO) and is aThe reproducibility of the array was tested using fungal DNA that was independently extracted from eight blind fungal samples obtained from the Forestry and Agricultural Biotechnology Institute, Pretoria. Fungal DNA was labeled and hybridized to the diagnostic chip. For each hybridization experiment, one technical replicate (using independent labeling reactions) was performed, each replication consisting of a reverse labelling experiment. Data analysis was done as described above and binary scores were obtained. Signal intensity values of replicate hybridizations were plotted against each other in Microsoft Excel to verify that the independent fungal samples showed the same scoring pattern. The results were also compared in each case to the identity obtained for the same culture grown by standard laboratory procedures. In addition, the probes positively identified were used for PCR amplification of the eight samples and the results obtained for the array were confirmed with the PCR product amplified from the same sample. The BLAST program was used to obtain the identities of the amplicons. The same procedure was followed for the mycotoxin biosynthesis genes.DNA: deoxyribonucleic acid; EF-1 α: elongation factor 1-alpha; ITS: internal transcribed spacer; LNA: locked nucleic acids; PCR: polymerase chain reaction; SNP: single nucleotide polymorphisms; ssu rRNA: small subunit ribosomal RNA.SL: conceived the study, designed the experiment, microarray study, statistical analysis and drafted the manuscript. EB: participated in the study co-ordination and helped to draft the manuscript. Both authors read and approved the final manuscript.

In the crystal, layers lying parallel to (10via weak C—H⋯N(cyano) and C—H⋯Br bonds and short N(cyano)⋯Br contacts [3.345 (4) Å].The backbone of the title mol­ecule, C Å b = 9.4017 (4) Å c = 24.4524 (10) Å β = 96.175 (2)°V = 2339.29 (17) Å3 Z = 4 Kα radiationMo −1 μ = 1.78 mmT = 122 K 0.85 × 0.36 × 0.10 mm Bruker APEXII CCD diffractometerT min = 0.549, T max = 0.746 (expected range = 0.616–0.837)Absorption correction: multi-scan 5482 reflections with R int = 0.044 R[F 2 > 2σ(F 2)] = 0.059 wR(F 2) = 0.156 S = 1.19 6791 reflections293 parametersH-atom parameters constrainedmax = 3.08 e Å−3 Δρmin = −0.60 e Å−3 Δρ APEX2 (Bruker, 2005SAINT (Bruker, 2005SAINT and SADABS (Bruker, 2005SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 (Farrugia, 1997PLATON (Spek, 2009Mercury (Macrae et al., 2006SHELXL97 and PLATON.Data collection: 10.1107/S1600536809017747/hb2973sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809017747/hb2973Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Little is known regarding the prevalence and course of fatigue in cancer patients after treatment has ended and no recurrence found. The present study examines fatigue in disease-free cancer patients after being treated with radiotherapy (n = 154). The following questions are addressed. First, how do patients describe their fatigue 9 months after radiotherapy and is this different from fatigue in a nonselective sample from the general population (n = 139)? Secondly, to what degree is fatigue in patients associated with sociodemographic, medical, physical and psychological factors? Finally, is it possible to predict which patients will suffer from fatigue 9 months after radiotherapy? Results indicated that fatigue in disease-free cancer patients did not differ significantly from fatigue in the general population. However, for 34% of the patients, fatigue following treatment was worse than anticipated, 39% listed fatigue as one of the three symptoms causing them most distress, 26% of patients worried about their fatigue and patients' overall quality of life was negatively related to fatigue (r = -0.46). Fatigue in disease-free patients was significantly associated with: gender, physical distress, pain rating, sleep quality, functional disability, psychological distress and depression, but not with medical or treatment-related variables. The degree of fatigue, functional disability and pain before radiotherapy were the best predictors of fatigue at 9-month follow-up, explaining 30%, 3% and 4% of the variance respectively. These findings are in line with the associations found with fatigue during treatment as reported in the preceding paper in this issue. The significant associations between fatigue and both psychological and physical variables demonstrate the complex aetiology of this symptom in patients and point out the necessity of a multidisciplinary approach for its treatment.

Injury that occurs to a finger wearing a ring though rare can have grave consequences. It is a preventable injury which has a peculiar mode of trauma that is usually occupational. Injury ranges from simple contusion to degloving of soft tissues to traumatic amputation. We hereby report our experience of four cases of finger avulsion injuries due to a ring and discuss their variable clinical presentation and individualized management. Finger avulsion is a rare and grave injury. Injury caused to the finger wearing a ring by avulsion of the soft tissues, when the ring is pulled forcefully can cause a wide spectrum of damage ranging from a simple contusion injury to a traumatic amputation. Despite the high rate of failure,13A 35-year-old male, refuse collector, presented with avulsion amputation of the left third digit at the level of the distal interphalangeal joint . While rA 31-year-old female, working as a waitress in a café, suffered an accident at her workplace. The patient's left index wedged into an orifice at the base of a refrigerator which she was trying to lift and move. This led to an avulsion of the second left digit and sub-amputation through the proximal interphalangeal joint (PIP) with onlA 24-year-old right-handed male carpenter, presented with avulsion amputation of the right fourth digit at the level of P1 resulting from an occupational accident. While fabricating a wooden piece, his wedding ring was caught by the wood-turning lathe. This led to an amputation at the level of the proximal phalanx with a section of the extensor and flexor tendons. The amputated digit was crushed . The casA 45-year-old male farmer, presented with an occupational injury. While driving in a cow into a cowshed, his wedding ring accidentally got entangled into the rope tied around the cow. The resultant sudden violent forward thrust by the cow led to a circumferential lesion formation at the base of his left fourth digit, without disconnection . The casRing avulsion injuries often present a technical challenge. The goal is to salvage, maintain function and if possible, provide an esthetic appearance. They result from the mechanism of crushing, shearing and avulsion, inducing severe macroscopic and microscopic damage.6Before the advent of microsurgery, many techniques were used to cover the denuded finger, such as use of tubed pedicle flaps from abdominal wall, but the results were often unsatisfactory.Although management of Class I cases is simple, Class II ring avulsions require some type of vascular repair because the circulation is inadequate in contrast to Class I cases. However, the most difficult treatment is related to a Class III ring avulsion in which there is complete degloving or amputation.Several authors agree that replantation of completely amputated finger avulsions is often unsuccessful because of vascular damage involving a long segment of the artery.1214In Class III lesions with an intact PIP joint and flexor digitorum superficialis tendon reimplantation should be tried. However, we think that a ray amputation is a better alternative, if the PIP joint is damaged.41415In Patient 2 who presented with a third stage according to Urbaniak classification, reimplantation was done in spite of a sub-amputation through proximal phalanx because she refused amputation considering the esthetic aspect. She was explained well regarding the likely loss of function of the ray and the chances of developing postoperative gangrene with reimplantation.In Case 1 reimplantation could have been a better option if the patient had sought medical attention early (< 24 h) with proper preservation of the amputated digit. He refused ray amputation, hence we debrided the stump and covered it with skin graft. This case shows that the Moroccan population needs to be sensitized more about hand injuries and that amputated rays and digits etc can be reimplanted provided the patient and the part reaches the caregiver timely and in an appropriate condition.For digital artery repair we used vein graft. We insisted on the quality of debridement of the arterial ends for successful revascularisation.16Ring finger avulsion injuries are very rare. We insist on prevention, especially in occupations involving manual and hand work. Ring must be removed from the finger before working. Microsurgery is superior to any method of primary or secondary reconstruction from a functional and esthetic point of view.

Suicide is a statistically rare event, but devastating to those left behind and one of the worst possible outcomes associated with mental illness. Although a friend, family member or co-worker may be the first person to notice that a person is highly distressed, few have the knowledge and skills required to assist. Simple guidelines may help such a person to encourage a suicidal individual to seek professional help or decide against suicide.This research was conducted using the Delphi methodology, a method of reaching consensus in a panel of experts. Experts recruited to the panels included 22 professionals, 10 people who had been suicidal in the past and 6 carers of people who had been suicidal in the past. Statements about how to assist someone who is thinking about suicide were sourced through a systematic search of both professional and lay literature. The guidelines were written using the items most consistently endorsed by all three panels.Of 114 statements presented to the panels, 30 were accepted. These statements were used to develop the guidelines appended to this paper.There are a number of actions which are considered to be useful for members of the public when they encounter someone who is experiencing suicidal thoughts or engaging in suicidal behaviour. These guidelines will be useful in revision of curricula of mental health first aid and suicide intervention training programs. They can also be used by members of the public who want immediate information about how to assist a suicidal person. Many different approaches have been tried to prevent suicide, but few have any strong supporting evidence. A systematic review of suicide prevention strategies concluded that education of physicians and restriction of lethal means were effective, while methods such public education, screening programs and media education need further evaluation . Major rIn this paper, we aim to improve one particular approach to public education – training of members of the public in how to give first aid to someone who is suicidal. Two existing approaches of this sort are Applied Suicide Intervention Skills Program (ASIST) and Mental Health First Aid training.ASIST was initAnother program of this sort is Mental Health First Aid training which waIn order for these approaches to be effective, they need to ensure that the first aid strategies that are taught are likely to be helpful. Because controlled trials of component first aid strategies are not feasible, an alternative is to use expert consensus to develop a set of guidelines on strategies that are most likely to work. Such guidelines can be used directly as a source of advice by members of the public and they can inform the content of first aid training courses aiming to prevent suicide. The aim of this project was to develop such guidelines. These guidelines needed to focus on the immediate prevention of suicide, and not on solving the problems which lead to the crisis. The first aider's role would be to ensure the suicidal individual's safety until the crisis has passed or the person has chosen to seek appropriate professional help.We chose the Delphi method, a technique used for reaching consensus in a group of experts or across expert groups. Our aim was to get consensus within and between panels of professionals, carers and consumers, so that the guidelines would be respectful of the needs of all three groups. This method is relatively inexpensive and simple to conduct, and can be done on the Internet. By conducting the research online, it was possible to include participants from English-speaking countries across the world, inexpensively and without lengthy postal delays. The Delphi methodology has been used in health research in the past, mainly to reach consensus amongst medical practitioners, but also with consumers of health services in some settings ,5. We haThis study had two phases: a literature search and questionnaire development, and the Delphi process. Please see Figure The aim of the literature search was to find statements which instruct the reader on how to determine whether someone is having thoughts of suicide, how to offer assistance in the short term, and how to access appropriate professional help for a suicidal person. The literature search was conducted across three domains: the medical and research literature, the content of existing suicide prevention and intervention programs, and lay literature. The lay literature included books written for the general public, particularly carers' guides, websites and pamphlets.The medical and research literature was accessed through searches of PsycInfo and PubMed. The search term was 'suicide' and all records for the 20 years leading to the search date were reviewed. The search term 'suicide' generated far too many records, but all attempts to narrow the search were found to be unsatisfactory as they excluded too many relevant records. Papers which described assessment of suicide risk, brief suicide interventions, or guidelines for treating suicidal patients were reviewed, a total of 234 papers. While much of the advice given in these papers was considered too clinically orientated to be useful for first aid, a number of papers did include brief advice and simple intervention instructions. Statements were drawn from 42 of the 234 relevant records. All statements felt to be simple enough for lay people to use were included.To find appropriate websites, we used the search engines Google , AltavisThe fifty most popular books on the Amazon website Any relevant pamphlets were sought and read, and statements were taken from these as well. The majority of the pamphlets were written and distributed by organisations focussing on mental health in general, or suicide in particular, but some were more general community organisations. Most of these pamphlets were obtained from websites, but where these were not available online, a request was made for relevant materials from large mental health and community organisations. While the majority of the lay literature focussed on understanding suicide, supporting people who have lost a loved one to suicide, and being aware of the risk factors and warning signs which might indicate that someone was thinking about suicide, there was also some advice to friends and family members on what to do if they are concerned that someone they love may be at risk.Where available, the training materials from existing courses which address suicide intervention were also reviewed and statements were drawn from these. Only a small number of training courses were found to be relevant, as the majority of such training is developed for professionals with previous clinical training in specific settings. The courses for which material was reviewed were the existing Mental Health First Aid Program , the AppThe questionnaire was developed by first grouping statements into categories: identification of suicide risk, assessing seriousness of the suicide risk, initial assistance, talking with a suicidal person, no-suicide contracts, ensuring safety, confidentiality, and passing time during the crisis. Similar or near-identical statements were frequently derived from multiple sources, and they were not repeated in the questionnaire. A working group comprised of the authors of this paper and colleagues working on similar projects convened at each stage of the process to discuss each item in the questionnaire. The role of the working group was to ensure that the questionnaire did not include ambiguity, repetition, items containing more than one idea or other problems which might impede comprehension. The wording was carefully designed to be as clear, unambiguous and action-oriented as possible. For example, 'the first aider should find out if the person is thinking about harming themselves' is better stated 'the first aider should ask the person if they have been having thoughts of suicide'. All statements were written as an instruction as shown in the above example. The only items which were not included in the questionnaire were those which were so ambiguous that the working party was not able to agree on the meaning of the statement, or those which called upon 'intuition' or 'common sense', as these cannot be taught.The majority of participants answered the questionnaire via the Internet, using an online survey website, Surveymaker . Three pThe criteria for item inclusion in the questionnaire have been articulated above; items which are non-clinical in nature, interpretable by the research team, teachable and useful to a member of the public with only minimal training were included. To clarify, consider the examples below."Consider a brief hospitalisation for your suicidal patient."While a professional such as a family doctor or psychiatrist may recommend hospitalisation, a member of the public could not take this action themselves. This item is very clinical in nature, and not useful to a member of the public, so was not included."You need to walk the walk with the person you are helping."This statement cannot be interpreted literally, so was not included."It is important to follow your instincts when helping a suicidal person."This statement asks the reader to draw on instinct, which cannot be taught or effectively described. It was not included in the questionnaire."If you suspect that someone may be suicidal, you should ask them directly."This item is clear and concise, will lead to accurate identification of the problem, and can be done by anyone, so it was included in the questionnaire.Participants were recruited into one of three panels: professionals (clinicians and researchers), consumers and carers. The professional panel had 22 experts, the consumer panel 10, and the carer panel 6. All panel members were from developed English speaking countries . Participants were recruited in a number of ways. Professionals recruited were those who had publications in the areas of suicide intervention or prevention, identification of suicidal ideation, or treatment of suicidal patients. When letters were sent to professionals asking them to be involved, they were also invited to nominate any colleagues who they felt would be appropriate panel members. Those active in clinical practice were also asked to consider any former patients who might be willing to be involved. The 22 professional participants included 5 psychologists, 5 psychiatrists, 3 managers of mental health services, 2 social workers, 1 nurse, 9 researchers and 3 professors of psychology. Some participants had multiple roles in research, teaching and clinical work. Consumers were recruited from advocacy organisations, and referral by clinicians. They were also identified if they had written websites offering support and information to other consumers, or published memoirs. Carers were recruited through carers' organisations, but were difficult to recruit for this study. It may be that few carers see themselves as being adequately experienced in dealing with suicide crises, having been involved in perhaps only one. In some cases they may not be aware that the person they care for has been suicidal or even made a suicide attempt in the past. We discussed approaching support groups for people who had lost a loved one to suicide, but it was decided this would be inappropriate and may be distressing to the people in the groups.Three rounds of questionnaires were distributed as follows, with each statement being rated up to two times. In round 1 the questionnaire, derived from the process described above, was given to the panel members. The questionnaire included space after each of the sections to add any suggestions for new statements that panel members felt should be included.essential, important, don't know or depends, unimportant, or should not be included. The options don't know and depends were collapsed into one point on the scale because operationally, they are the same response; most of the statements were, very reasonably, noted to be useful in some cases and not others, meaning they could not be generalised in guidelines, which is also true of statements participants did not feel confident to rate.In each round of the study, the usefulness of each statement for inclusion in the mental health first aid guidelines was rated as The suggestions made by the panel members in the first round were reviewed by the working group and used to construct new items for the second round. Although the carers' ratings were not used in the final analysis, their suggestions in round 1 for new ideas were included in round 2. Suggestions were accepted and added to round 2 if they represented a truly new idea, could be interpreted unambiguously by the working group, and were actions. Suggestions were rejected if they were near-duplicates of items in the questionnaire, if they were too specific , too general ("just be there"), or were more appropriate to therapy than first aid .essential or important by 80% or more the professional and consumer panels were accepted for inclusion in the guidelines. If they were endorsed by 80% or more of one of the panels, or by 70–80% of both panels, they were re-rated in the subsequent round. Items which met neither condition were rejected. Before the second and third rounds of the study, each participant was sent a summary of the results of the previous round, listing which items had been accepted, which had been rejected, and which were to be re-rated. When an item was to be re-rated by the panellists, they were provided with their own response and a table outlining how many people in each group had endorsed the item. They were told that they did not have to change their responses when re-rating an item, but that if they wished to, they would have the opportunity to do so.Items rated as Table Figure It was important to the research team to avoid making the guidelines read like a list of 'dos' and 'don'ts'. The accepted items were incorporated into a plain language document. To illustrate, consider the following statements:1. If the first aider thinks someone might be having suicidal thoughts, they should ask that person directly.2. The first aider should not avoid using the word 'suicide'. It is important to discuss the issue directly, without dread or expressing negative judgement.These statements were incorporated to make the following paragraph:If you suspect someone may be at risk of suicide, it is important to ask them directly about suicidal thoughts. Do not avoid using the word 'suicide'. It is important to ask the question without dread, and without expressing a negative judgement. The question must be direct and to the point. For example, you could ask: "are you having thoughts of suicide?" or "are you thinking about killing yourself?"The guidelines were developed from these accepted statements, however, there were some difficulties. The major issue was that while professionals and carers strongly endorsed statements which directed the first aider to seek professional help while the person was suicidal, the consumers did not. Correspondence from consumers on the panel indicated that the crisis care they had received in hospitals was often punitive, and might include being placed in physical restraints, spoken to unkindly, and told they were wasting the hospital's time. Carers, on the other hand, felt ill-equipped to cope with a suicidal friend or family member and preferred to seek help whenever such a crisis arose. It is worth noting here that not all of the consumers rejected the idea of professional help; only items endorsed by 80% or more of each panel were accepted and half of the consumers did endorse professional help as important.The only professional help item accepted by the whole panel was an item stating that if a person is suicidal they should be provided with safety contacts, including professional help. An item was also accepted advising the person to consider utilising supports they had used in the past if these were still available. Such supports might include professional help, but might not. In addition, panelists accepted a number of statements which relate to risk assessment, such as the extent to which a plan for suicide has been developed and the means for suicide accessed, and whether the person has made a previous suicide attempt. While these risk factors would help a professional to shape an intervention, they are not sufficient for a first aider to prevent suicide, and are left hanging.To address this discrepancy, we included a paragraph in the guidelines explaining that professionals think that professional help should always be sought, but that some people who have been suicidal disagree. We acknowledged that carers were often torn between wanting to seek help for the suicidal person and being afraid of alienating them. We did not say that help should or should not be sought, but we gave enough information to allow the first aider to make an informed decision.When the guidelines were in draft form, they were sent to all the panel members for feedback, along with an explanation of the professional help issues we encountered. We asked panel members to respond to the addition, whether they supported it, wanted it removed, or had a suggestion of how it could be improved. Overall, the response supported the inclusion of the paragraph but, as we expected, a small number of panellists disagreed. No consumer panellists objected to the inclusion, but some of the professionals felt that the guidelines needed to state categorically that professional help must be sought. The paragraph remained as written.For the rest of the guidelines, only feedback related to readability and structure was sought and incorporated. The guidelines are appended to this article and can be freely distributed , 3 completed the second round and none completed the third round, although 10 carers had initially agreed to take part. During the study period, 2 carers informed the senior author that there had been further suicide attempts made by the people they care for during that time. These carers had a great deal of experience helping someone who is suicidal, and perhaps this experience explains why they often endorsed items which related to actively seeking the assistance of a professional helper. However, they also had a great deal of responsibility, often working outside the home, running a household and caring for one or more family members with mental illness, which may explain why they were not able to complete the study.One limitation of this study is the small number of panel members, particularly in the carers' panel. It is important as well to reiterate that all panellists were recruited from developed English-speaking countries, so that the guidelines may not be generalisable to other countries or to minority cultures within those countries. Furthermore, these guidelines cannot stand alone, as they do not address the underlying psychological distress or mental illness which causes an individual to become suicidal. They need to be used in conjunction with the other guidelines in this series, including first aid for depression, first aid for psychosis, and first aid for non-suicidal self-injury ,7. TheseThis process has proven that it is possible to develop guidelines for suicide first aid which are acceptable to professionals, people who have been suicidal, and to carers. Where the guidelines are used as the basis for first aid training, efforts need to be made to evaluate their impact on the first aiders' helping behaviours and on the recipients of the first aid, as far as this is possible. This will assist researchers to develop an evidence base for mental health first aid and suicide prevention initiatives.CMK is a Master Trainer of the Applied Suicide Intervention Skills Training course, developed by LivingWorks Canada. The remaining authors have no competing interests to declare.CMK and AFJ prepared the manuscript. All authors reviewed the manuscript. AFJ and BAK developed the methodology. CMK did the literature searches and wrote the first draft of the questionnaire. All authors contributed to the development of later versions of the questionnaire. CMK wrote the attached guidelines. All authors reviewed and suggested improvements to the guidelines.The pre-publication history for this paper can be accessed here:2 spreadsheets. Spreadsheet 1: All items, categories, rates of endorsement and final outcomes. Spreadsheet 2: List of categories, number of items in each and outcomes at each round.Click here for fileFirst aid guidelines for suicidal thoughts and behaviours. This file may be distributed freely, with the authorship and copyright details intact. Please do not alter the text or remove the authorship and copyright details.Click here for file

Traumatic brain injury makes the brain vulnerable to secondary insults. Post-traumatic alterations in intracranial dynamics, such as reduced intracranial compliance (IC), are thought to further potentiate the effects of secondary insults. Reduced IC combined with intracranial volume insults leads to metabolic disturbances in a rat model. The aim of the present study was to discern whether a post-traumatic hypotensive insult in combination with reduced IC caused more pronounced secondary metabolic disturbances in the injured rat brain.n = 8/group): 1) trauma with hypotension; 2) trauma and reduced IC with hypotension; 3) sham injury with hypotension; and 4) sham injury and reduced IC with hypotension. A weight drop model of cortical contusion trauma was used. IC was reduced by gluing rubber film layers on the inside of bilateral bone flaps before replacement. Microdialysis probes were placed in the perimeter of the trauma zone. Hypotension was induced 2 h after trauma. Extracellular (EC) levels of lactate, pyruvate, hypoxanthine, and glycerol were analyzed.Rats were randomly assigned to four groups (The trauma resulted in a significant increase in EC dialysate levels of lactate, lactate/pyruvate ratio, hypoxanthine, and glycerol. A slight secondary increase in lactate was noted for all groups but group 2 during hypotension, otherwise no late effects were seen. There were no effects of reduced IC.In conclusion, reduced IC did not increase the metabolic disturbances caused by the post-traumatic hypotensive insult. The results suggest that a mild to moderate hypotensive insult after initial post-traumatic resuscitation may be tolerated better than an early insult before resuscitation. Traumatic brain injury (TBI) is a major cause of death and disability globally ,2. OutcoSystemic hypotension is an insult that occurs in 15%–35% of patients with severe head injury and is associated with a significant increase in mortality and morbidity . Both eaExperimental studies have also shown synergistic effects of TBI and early secondary systemic hypotension resulting in increased contusion volume and reduThe status of intracranial pressure/volume dynamics is another factor that influences the effect of secondary insults upon TBI. Reduced intracranial compliance (IC), i.e. reduced ability to compensate for additional intracranial volume, is a common clinical situation following a traumatic brain injury. A reduction of IC may under certain circumstances lead to hemodynamic effects followed by metabolic disturbances and ischemia . It seemMany experimental studies focus on the direct brain tissue effects of TBI in isolation. This pathophysiology is important to study, but it is very difficult to intervene clinically at this phase because of the inevitable delays between the primary insult and initiation of emergency care. Experimental models resembling the post-resuscitation phase in treatment are important to study to increase our understanding of the optimal timing and treatment approach to the patient. The aim of the present experimental study was to determine whether a late post-traumatic hypotensive insult caused a secondary metabolic disturbance in the rat brain following focal cortical injury and whether reduced IC had an impact on such a response.® 3% and O2:N2O (1:1). Thereafter, they were intubated and mechanically ventilated . Anesthesia was maintained with isoflurane (1.2%–1.8%) and O2:N2O (1:2). Arterial and venous catheters were surgically implanted into tail vessels and the right femoral artery. Mean arterial blood pressure (MABP) was continually measured. Arterial blood gases were checked regularly throughout the experiment and were maintained within normal levels, i.e. pCO2 4.5–5.5 kPa, pO2 12–20 kPa, and pH 7.35–7.45. Body temperature was monitored with a rectal probe and kept between 37.0–37.5°C with a heating pad. After catheter preparation the animals were placed in a stereotaxic frame. The skull was exposed and a burr hole (1.5 mm diameter) was made 1 mm caudal to bregma and 1.6 mm lateral to the mid-line for access to the left lateral ventricle. Bilateral craniotomies (6 × 9 mm) were made over the parietal cortex with the center 3 mm caudal to the bregma on the right side and slightly more caudal on the left side due to the ventricular burr hole were used and had free access to food pellets and water. Anesthesia was induced by placing the rats in a gas mixture of Halothaneurr hole .A two-way single lumen system , filled with physiological saline, was used for intracranial pressure (ICP) measurements. The tubing system was in open communication between the left lateral ventricle and a pressure transducer. An amplifier was connected to a computer running LabWindows CVI software for continuous online acquisition, display, and storage of the ICP signal. A 24-gauge spinal needle was used as a ventricular catheter (outer diameter 0.55 mm). It was stereotactically inserted in the left ventricle. During insertion continuous registration of ICP was carried out. Intraventricular placement was confirmed by the sudden decrease in ICP upon ventricular puncture, a rapid increase in ICP due to jugular vein compression, and the presence of cardiopulmonary pulsation on the monitor screen. The ventricle was punctured at a depth of 3.0–3.5 mm from the dura. For ICP recording the zero point was adjusted to the level of the external auditory canals. ICP was recorded continuously.+ 140 mM, K+ 2.7 mM, Ca²+ 1.2 mM, Mg²+ 0.9 mM, and Cl¯ 147 mM) was perfused through the probe at a flow rate of 2 μL/min using a microinjection pump . After 1.5 h of equilibration the MD samples were collected in 10-min fractions.A microdialysis (MD) probe was stereotactically inserted through a small incision in the dura medially in the perimeter of the trauma zone (right side). The MD probe was perfused for 2 h before the trauma, and the last three 10-minute MD dialysate samples were averaged to obtain a base-line value. Before trauma or sham injury the MD probe and ICP needle were removed and stereotactically reinserted within 1 and 3 min, respectively. The MD probe had a membrane length of 2 mm . Mock CSF (containing NaTrauma was produced by dropping a 21 g weight from 35 cm onto a piston (diameter 4.5 mm) resting on the dura. The piston was constructed to allow a maximum compression of 1.5 mm ,31. IntrThe bone flaps were replaced under microscopic control within 5–10 min of impact. Two hours after impact hypotension was induced by withdrawal of blood through the femoral artery. Earlier experiments from our department, using the same degree of TBI, showed that the observed metabolic disturbances after TBI normalized approximately 2 h after impact . HeparinAt the end of the experiment, the thorax of the animal was opened and the heart catheterized through the left ventricle wall. The right atrium was opened as an outlet. The animal was perfusion-fixated by infusion of 250 mL of physiological saline followed by 250 mL of 4% formaldehyde solution. The animal was decapitated and the brain kept in 4% formaldehyde solution. The brains were cut in coronal sections over the sites of the ventricular needle, MD probe, and craniotomy areas, and analyzed under the operation microscope.Analyses of the MD fractions (random samples) were performed. Analyses of energy metabolites were made in order to assess the metabolic state. Glycerol was analyzed as a marker of cell membrane degradation. Lactate, pyruvate, and glycerol were analyzed with an enzymatic colorimetric method using the CMA/600 microdialysate analyzer . Hypoxanthine was measured using high-performance liquid chromatography with UV detection at 254 nm. Briefly, a reverse phase 100 × 4 mm nucleosil-100 C18 column was eluted with a mobile phase constituted of 0.01 M sodium phosphate (pH 6) and 6% methanol. The signal of the UV detector was evaluated with an electronic SP4290 integrator against freshly prepared standard solutions.n = 8/group): Sham injury with 0 or 3 layers of rubber film and hypotensive insult (groups Sh0 and Sh3), or trauma injury with 0 or 3 layers of rubber film and hypotension insult (groups Tr0 and Tr3). For statistical analyses the experiment was divided into five time periods: T1: 30 min before trauma (base-line or pre-impact period), T2: 30 min after trauma (post-impact period), T3: 30 minutes before hypotension (pre-insult period), T4: over the 30 min hypotensive insult (insult period), and T5: 30 min after the insult (reperfusion period) .For each of the variables the average per animal was calculated for each time period. One animal (Sh0) had missing data for the blood pressure and ICP at T5 due to sudden death during this period. Hypoxanthine values were missing for two animals in group Tr0 due to technical problems. Some animals had extra MD measurements due to the extra time needed from the start of phlebotomy until BP reached near to 50 mmHg, and these extra measurements were deleted from all analyses.The averages for each animal and time period were then analyzed in an ANCOVA model including the factors: treatment-group , time, and the interaction term (treatment-group*time). ICP was included as a covariate in the analyses of all variables except ICP. The statistical significance of each effect was determined from the model, and the pair-wise comparisons between groups and time periods were also derived from the model. A probability of 0.05 or less was considered as statistically significant.As the residuals for the variables L/P ratio (lactate/pyruvate ratio), glycerol, hypoxanthine, and lactate were extremely skewed, these variables were transformed to their natural logarithms before they were analyzed. The data were also summarized by means, standard deviations, medians, minimum, and maximum values per treatment group and time.The experimental protocol was approved by the ethics committee for Uppsala University.Blood gases, temperature, and BP for each group prior to impact are shown in P values for comparisons within and between groups for different time periods .The changes in BP are illustrated in The hypotensive insult resulted in a decrease in BP for all groups and III.The neurochemical changes induced by the hypotensive insult are shown in The present study shows that a late hypotensive insult, following a focal traumatic brain injury, affects brain energy metabolism with increases in lactate and L/P ratio but not to the extent that the energy depletion leads to AMP or membrane degradation. Reduced IC does not lead to a more pronounced disturbance. The results from this study are similar to the metabolic and membrane responses seen after diffuse axonal injury combined with late hypotension and hypoxia . These r+] and decrease of interstitial [Ca2+] and hypotension (MABP 40 mmHg), there was an increase of lactate and L/P ratio at both time points. The late insult at 225 minutes post trauma did not affect cerebral metabolism to the same extent, while the early insult at 25 minutes had a more pronounced effect. These studies also showed that the hypotensive insult itself led to metabolic disturbances if it occurred at 25 minutes post sham trauma and that this disturbance was of the same magnitude as that seen with a late insult after trauma. All of these responses show that the insult is sufficient to elicit a metabolic reaction in the tissue.At what level physiological changes become insults is a question that is central in discussions concerning intensive care. That the hypotensive insult in this study is too mild to cause metabolic disturbances in the tissue is not supported by findings from other studies using the same level of hypotension. Geeraerts et al. have shoThe findings from the present study, earlier studies with this model, and the studies by Geeraerts et al. in a different model, but with similar results, shed light on the problems related to development of neurocritical care in TBI. Earlier, experimental studies were a way of dealing with the complex pathology related to TBI. Most studies have focused on a single or a few phenomena during the acute phase and have used continuous or snap-shot methods to monitor changes. Because of practical and economical reasons most experimental studies only cover a few hours of observation. In contrast, clinical studies have had access to continuous monitoring, around the clock and every day of the week, for as long as the patient has been in the ICU. However, these studies have relied on paper documentation of physiological parameters which has only given summary information on care and pathophysiological disturbances. With the advent of modern computers it is now possible to achieve detailed documentation of the pathophysiology occurring with the patient over longer periods of time . To full

Invasive ductal carcinoma (IDC) of the breast usually metastasizes to the lungs, liver, bones and brain. Solitary adrenal metastasis is extremely rare. Due to the rarity of this condition, the optimal treatment is unclear. We report the first case of IDC of the breast metastasizing solely to the adrenal gland after a modified radical mastectomy but having a long-term disease-free survival while treated merely by a left adrenalectomy.A 64-year-old woman was found a left adrenal mass on a follow- up visit two years after taking a right modified radical mastectomy for the breast cancer. She was subsequently given a left adrenalectomy. Postoperative histopathology findings were compatible with invasive ductal carcinoma (IDC) of the breast. Due to the patient's refusal, no further treatments were offered after the adrenalectomy. The patient now is still alive and has no sign of relapse. Survival time after taking the right modified radical mastectomy and the left adrenalectomy is more than five years and three years, respectively.This is the first case of a patient with solitary, metachronous adrenal metastasis from IDC of the breast to be reported. For patients in this condition, complete removal of metastasized organ may translate into survival benefit. Invasive ductal carcinoma (IDC) is the most common type of the breast cancer, which has been reported to constitute approximately 70-85% of all invasive breast carcinomas. UsuallyDue to the rarity of solitary adrenal metastasis from breast cancer, the optimal treatment is still unclear. Generally, distant visceral metastasis is an upset aspect for cancer patient, palliative chemotherapy would be recommended. However, studies on some malignant diseases -8 sugges2N1M0). Due to the poor compliance, the patient only accepted two cycles of chemotherapy after the right modified radical mastectomy , and refused any other adjuvant therapies.In September 2006, a 64-year-old woman was hospitalized for a left adrenal mass which was detected by a follow up visit. Ultrasonography showed a 5.4 × 7.0 cm mass on the left adrenal gland, which was confirmed by unenhanced CT scan a size of 5.4 × 7.0 cm well-shaped, homogenous, and low-density (27 HU) tumor Figure . The patOn further examination, patient's arterial blood pressure was found normal, as were laboratory measurements including tumor mark CA15-3 . The plasma ACTH was within a normal range . Extensive imaging evaluations including cranial magnetic resonance imaging(MRI), thoracic CT scan, pelvic ultrasonography, and isotope bone scanning (ECT) revealed an isolated disease in the left adrenal gland. We suspected a relapse of the disease. Left adrenalectomy was performed in September 2006. Histopathological examinations confirmed a metastasis event from IDC of the breast as same characteristics of the tumor cells were observed Figure . ImmunohMetastasis to the adrenal glands is a frequent finding at autopsy and most commonly occurs in patients with lung, gastrointestinal carcinomas and renal -9. AdrenAdrenal metastases are often asymptomatic, patients may present adrenal insufficiency if most of the adrenal gland is replaced or destroyed . In addiCurrently, there are no guidelines for treating patients with solitary adrenal metastasis. Studies in lung cancer , colorecInvasive ductal carcinoma of the breast is considered a systemic disease, the high rate of relapse underlines the need for an effective systemic therapy. Multiple studies have demonstrated that adjuvant therapy for early-stage or advanced breast cancer produces a 23% or greater improvement in disease-free survival and a 15% or greater increase in overall survival rates. Recommendations for the use of adjuvant therapy are based on the individual patient's risk and the balance between absolute benefit and toxicity. Anthracycline-based regimens are preferred, and the addition of taxanes increases the survival rate in patients with lymph node-positive disease. EuropeaIn summary, this is the first reported case of a solitary adrenal metastasis from IDC of the breast with a detailed survival description. For patients in this condition, we suggest that early recognition and adrenalectomy will probably lead to survival benefit. Apparently, this recommendation is based on a rare case and further clinical research is needed.Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The authors declare that they have no competing interests.XJL and PS conceived concept, participated in drafting of the manuscript and critical review, they also took part in the care of the patient. XFW and FFS assembled data and participated in writing the manuscript. KS carried out the histopathological evaluation and reviewed pathology. All authors read and approved the final manuscript.

Distinguishing management effects from the inherent variability in a system is a key consideration in assessing reserve efficacy. Here, we demonstrate how seascape heterogeneity, defined as the spatial configuration and composition of coral reef habitats, can mask our ability to discern reserve effects. We then test the application of a landscape approach, utilizing advances in benthic habitat mapping and GIS techniques, to quantify this heterogeneity and alleviate the confounding influence during reserve assessment. Seascape metrics were quantified at multiple spatial scales using a combination of spatial image analysis and in situ surveys at 87 patch reef sites in Glover's Reef Lagoon, Belize, within and outside a marine reserve enforced since 1998. Patch reef sites were then clustered into classes sharing similar seascape attributes using metrics that correlated significantly to observed variations in both fish and coral communities. When the efficacy of the marine reserve was assessed without including landscape attributes, no reserve effects were detected in the diversity and abundance of fish and coral communities, despite 10 years of management protection. However, grouping sites based on landscape attributes revealed significant reserve effects between site classes. Fish had higher total biomass (1.5×) and commercially important biomass (1.75×) inside the reserve and coral cover was 1.8 times greater inside the reserve, though direction and degree of response varied by seascape class. Our findings show that the application of a landscape classification approach vastly improves our ability to evaluate the efficacy of marine reserves by controlling for confounding effects of seascape heterogeneity and suggests that landscape heterogeneity should be considered in future reserve design. No-take marine reserves have been increasingly promoted as a management tool to conserve biodiversity and prevent over-exploitation of marine communities Given the paucity of baseline data, Control-Impact (CI) comparisons are the most commonly used marine reserve assessment methodology, in which control sites outside of the reserve are compared to impact sites within In both terrestrial and aquatic systems, the response of organisms to heterogeneity in a landscape varies across spatial scales In comparison to the numerous terrestrial-based landscape studies, a landscape ecology approach in marine systems is still in its infancy 2 is located 30 km offshore of Belize, Central America, and comprises an area of 560 km2 . The atoPatch reefs served as the focal habitat for this analysis. Several features of the patch-reef array at Glover's Atoll make this reserve an ideal model system to test the applicability of landscape ecology approach to marine reserve evaluation. First, patch-reef complexes are pervasive, often containing hundreds of individual patches enabling ample replication within the reef system. Second, the discrete boundaries of patch reefs, often surrounded by sand or seagrass, enables spatial metrics of patch composition and configuration to be readily quantified through remote sensing and spatial analyses. Third, due to the geographic isolation and deep waters (>400 m) surrounding the atoll We assessed the fish and benthic communities at 87 submerged patch reefs in 2008–09 using a spatially explicit stratified random sampling design in which the entire lagoon area was divided into 23, equally sized blocks. A random point generator in ArcGIS was used to select a minimum of 3 patch reef sites within each block. A total of 56 non-reserve sites and 31 reserve sites were sampled in three field efforts: May 2008, February 2009 and April 2009. To investigate possible temporal changes over the 10-month sampling period, fish and coral surveys were repeated at 15 randomly selected patches from the total 87. No significant differences in coral cover, coral diversity, fish abundance or fish diversity were detected in this subset from 2008 sampling to 2009, and we therefore pooled the two years of data. Fish abundances were determined using the stationary point-survey method 2 were taken every 2 m from 0.5 m above the substrate along transects running the long and short reef axes. Depending on the total patch size, 25–100 images were generated per patch. Images were analyzed to species for scleractinian corals (>2 cm min. diameter), to functional group for benthic biota or to substrate class for non-biotic substrates. Using point-intercept methods, 100 random points were scored per image, on 20 randomly selected images per patch using CPCe v3.5 software The benthic composition of each patch reef was determined through the use of digital photography. Photographs of the benthos encompassing a reef area of approximately 0.25 mwww.spatialecology.com/htools) on polygons drawn around the patch boundaries using multi-band, high-resolution (4×4 m ground resolution) IKONOS imagery. An adjusted patch area was also calculated using the percentage of sand and seagrass to account for differences in hard substrate on each patch. Patch volumes were obtained from bathymetric maps generated in ENVI v4.7 based on depth and GPS data collected throughout the atoll at 183 points was used. In CCA, regression analysis is used to find the best possible relationship between multiple environmental variables and multivariate community response data, assuming key environmental variables have been measured and the community response is unimodal in relation to these variables. Multicollinearity between seascape metrics was explored through correlation matrices. When evident (r>0.2), a principle component analysis was conducted on the co-linear metrics and the first principal component was used in subsequent analyses as an independent explanatory variable Separate hierarchical clustering analyses were preformed for coral and fish to classify patches together into ‘seascape groups’ sharing similar attributes of the significant seascape metrics identified for fish and for corals in the CCA analyses. Reserve effects were then evaluated using a modified Control-Impact design, in which reserve effects were only tested among patch reefs sharing the same seascape grouping for fish and corals, respectively. Comparisons of the fish assemblage and coral assemblage between management zones were conducted using one-way analysis of variance (ANOVA). We then repeated our analyses for each response variable using a traditional Control-Impact methodology with all 87 patch reef sites. Reserve effects were then compared between the two Control-Impact assessments.th root-transformed abundance data in order to reduce the contribution of common species Following detection of reserve effects, additional analyses were conducted to determine which organisms were influenced by reserve protection. Community similarity within coral and fish communities with respect to reserve protection and patch type were calculated in multidimensional space using a two-way crossed analysis of similarity (ANOSIM). Community similarity matrices were calculated using a Bray-Curtis index on 4Three seascape-level metrics of spatial configuration were identified in CCA analyses as explaining the greatest amount of variation in the fish community: distance from channel, patch reef area within a 500 m buffer, and nearest neighbor distance . Using tCCA analysis was used to identify 3 seascape level metrics that explained the greatest amount of variation in the coral community: distance from channel, ‘patch size’, and structural complexity of the patch . ‘Patch 1,43 = 8.05, P = 0.007). A similar significant increase of 50% was seen in total fish biomass from outside the reserve to inside . There was no difference in fish species richness inside versus outside reserve for either site grouping approach . Similarly, coral:macroalgal ratio increased 80% for Type II clustered sites within the reserve versus outside .As with the fish community, no significant differences between reserve and nonreserve sites were detected in coral community parameters when all patch reef sites were pooled . However1,56 = 9.037, P = 0.004; coral:macroalgal: one-way ANOVA, F1,56 = 5.362, P = 0.024). Similarly, Fish Type II patches showed positive responses, while Type I patches showed no differences between reserve and nonreserve sites results revealed that coral communities were statistically indistinguishable between both Type I and Type II patches and across the reserve boundary (P>0.05). ANOSIM of the fish community revealed significant differences by patch type and reserve protection, but only Patch Type II reefs showed separation of community composition across the reserve boundary . Non-commercial fish species showed no significant response to reserve protection within either Type I or Type II patch reefs , suggesting that the positive reserve effect detected among Type II patch reef was driven by commercially important fish species sensitive to seascape heterogeneity and reserve management. Further investigation of the differences in commercial fish species composition on Type II patches showed no significant difference across the reserve boundary based on fish diet or trophic level . Species-specific responses within Type II patches revealed significantly greater biomass within the reserve for 3 species; two snappers (Lutjanus griseus and L. synagris) and the hogfish factors of nearest neighbor and reef area within a 500 m buffer were significant factors explaining composition of fishes. Interestingly, benthic complexity of the patch reefs (i.e. rugosity) at the fine or medium grain scale was not found to be an important predictor for fish or coral assemblage parameters. This suggests that when patterns of community composition are assessed and constrained to a single, topographically complex habitat type, landscape level parameters may be better predictors of marine assemblage structure.For the large number of marine reserves lacking baseline data, augmenting the traditional Control-Impact reserve assessment with the seascape approach can improve reserve evaluation by controlling for influential aspects of seascape variability that affect target populations. While applied here to shallow water patch reef environments, this approach is repeatable in other marine systems given the increased access to high-resolution benthic habitat maps and GIS technology We stress the need to control for spatial heterogeneity in the evaluation of marine reserves, but application of these landscape ecology principles may improve criteria for reserve placement and design The establishment of marine reserves as a conservation tool has increased rapidly over the past decade. Yet the absence of baseline data, even within relatively well-replicated studies, makes it challenging to separate management effects from natural variability in populations driven by seascape differences. A weak assessment design that fails to capture reserve effects when they are present can generate false conclusions about reserve efficacy, seriously crippling management efforts to expand the use of marine reserves as a conservation tool. The burden of proof rests on managers and scientists to clarify how marine reserves can function as viable strategies for conservation and population replenishment. Therefore, we need a better understanding of the effects of reserves, which can be positive, negative or mixed. The use of a robust assessment methodology should be implemented to ensure that, when present, positive or negative effects can be properly ascertained. We suggest that the seascape approach applied in this study is one such method, and will serve as a powerful tool to improve our ability to distinguish management effects from natural system variation in future assessments of reserve efficacy.Table S1Commercially important fish species observed during sampling for Glover's Atoll.(0.04 MB DOC)Click here for additional data file.Table S2ANOVA results of reserve effects on fish and coral response variables using varying site classification scenarios.(0.05 MB DOC)Click here for additional data file.

In a report that looks at the short- and long-term effects of the stabilization of Earth’s temperature, the NRC committee quantifies, as much as possible, the outcomes of different stabilization targets for the planet, with a focus on the United States.1A large fraction of emissions of carbon dioxide , although some are linked directly to CO2 emissions scenarios and link them to temperature, says Matthews. In 2009 Matthews and colleagues described the framework for linking the temperature response to carbon emissions, a construct known as the carbon climate response.2-induced global mean temperature change to be inferred directly from cumulative carbon emissions,” Matthews et al. wrote.1Things shifted for climate change researchers about five years ago, when climate models began to factor in the carbon cycle, making it easier to include specific COThe NRC report discusses three main types of health-related stress expected from rising average temperatures: illness and infectious diseases carried by animal hosts and mosquitoes and other vectors, heat-related illness and deaths, and health problems due to air pollution and water contamination .In one discussion, the report summarizes research on a 1995 Chicago heat wave that resulted in 692 heat-related deaths within the city7Yet quantifying the impact on human health per degree of global temperature change is difficult, and must take into account many confounding factors including behavior, says Christopher Portier, now director of the National Center for Environmental Health and the Agency for Toxic Substances and Disease Registry. In his former position as senior advisor at the National Institute of Environmental Health Sciences, Portier led a federal working group that released a report on 11 categories of disease and other health consequences that may occur due to climate change.The NRC report was released a few days before Senate majority leader Harry Reid (D–NV) announced there were not enough votes in support of climate change legislation, meaning Congress won’t pass a climate change bill in 2010. Tim Profeta, director of the Nicholas Institute for Environmental Policy Solutions at Duke University, says he read the NRC report the same day that climate legislation was failing in the Senate. “That created quite a juxtaposition,” he says, “showing us both the challenges we have before us and the amount of work that we have to get done.”1–2°C of WarmingFIRE200–400% increase in area burned per degrees in parts of western United States1–4°C of WarmingRAIN5–10% less rainfall per degree in Mediterranean, SW North America, southern Africa dry seasons5–10% more rainfall per degree in Alaska and other high-latitude Northern Hemisphere areas3–10% more heavy rain per degree in most land areasRIVERS5–10% less streamflow per degree in some river basins, including the Arkansas and Rio GrandeFOOD5–15% reduced yield of U.S. corn, African corn, and Indian wheat per degreeSEA ICE15% reduction in annual average Arctic sea ice area per degree3°C of WarmingCOASTSLoss of about 250,000 kmMillions more people at risk of coastal floodingTEMPERATURE EXTREMES9 of 10 summer seasons are expected to be warmer than all but 1 summer of 20 in the last decades of the 20th century over nearly all land areas4°C of WarmingTEMPERATURE EXTREMESAbout 9 out of 10 summers warmer than the warmest ever experienced during the last decades of the 20th century over nearly all land areas5°C of WarmingFOODYield losses in most regions and potential doubling of global grain prices

The Human papillomavirus plays an important role in the initiation and progression of cervical cancer. However, it is a necessary but not sufficient cause to develop invasive carcinoma; hence, other factors are required in the pathogenesis of this malignancy. In this review we explore the hypothesis of the deregulation of wnt/β-catenin signaling pathway as a "second hit" required to develop cervical cancer. Cervical carcinoma (CC) is one of the most common cancers and a leading cause of death among women worldwide. . The numOver 30 years ago, some authors pointed out that CC had sexually transmitted disease behavior ,5. But iAt present, more than 100 types of HPV have been identified , 40 of wOnce HPV has infected basal cells, the viral genome is replicated actively as episome and early genes E1–E7) are expressed. E1 and E2 are important proteins for viral genome replication and viral cycle completion . E1 play–E7 are eMYC, NR4A2, hTERT, APM-1, FANCC, and TNFAIP2, etc., are found . 2.. 2.39]. pathway . The canFollowing the trimerization of Wnt/Fzd/LRPs, the LRP co-receptor is phosphorylated leading to the binding and phosphorylation of Disheveled (Dvl), which transduces the Wnt signal into the cell through direct binding with FZD ,43. Dvl An important hallmark in the canonical Wnt pathway is the stabilization of β-catenin in cytoplasm and its accumulation into the nucleus. This is possible due to the detachment of β-catenin from the degradation complex, a multi-protein assembly activated in the absence of wnt signaling, whose main task is to add ubiquitins to β-catenin resulting in its inactivation by means of the ubiquitin-proteasome pathway . In an uAfter the FZ/LRP activation by its ligand, the degradation complex kinase activity is inhibited. Consequently, non-phosphorylated β-catenin is stabilized, and increasing levels tend to accumulate in the cytoplasm. β-catenin accumulation in cytoplasm leads to its nuclear accumulation, where it is associated with lymphoid enhancer-binding factor 1/Tcell-specific transcription factor (LEF/TCF) and transcriptional activator Pygopus (Pygo). Pygo contains a domain (PHD), which is shared by many nuclear proteins with a role in chromatin remodeling and transcriptional co-activation . MutatioIn the absence of wnt signaling, TCF is bound to Groucho, forming a repressor complex of Wnt target genes. Groucho can repress gene transcription by inhibition of basal transcriptional machinery and recruitment of histone deacetylases (HDACs) ,52. AlthWhen β-catenin enters the nucleus, it converts the repressor LEF/TCF/Groucho into a transcriptional activator complex. This is possible due to Groucho displacement by interaction between β-catenin and LEF/TCF, thereby activating wnt target genes . SeveralTo this point we have reviewed how the wnt/β-catenin pathway turns on complex signaling events leading to the activation of target genes. Mutations in several components of this pathway have been studied and identified in nearly all human cancers. However, in cervical cancer only few studies have shown the involvement of certain wnt/β-catenin genes in their pathogenesis. In this regard, it has been suggested that HPV-immortalized human keratinocyte transformation requires a second hit and could be achieved thanks to the activation of the canonical wnt pathway . This hyAnother mechanism involved in the upstream activation of the wnt/β-catenin pathway is over-expression of pathway activators such as wnt ligands, frizzled receptors, and disheveled. There is evidence showing over-expression of WNT10B, -14, FZD10, and DVL-1 in cervical cell lines -65; noneWe recently conducted a genome-wide expression analysis in HPV16 CC compared against normal cervix epithelia . We wereInterestingly, gene components of the planar cell polarity (PCP) pathway were actively expressed in normal cervices, showing that this branch of wnt signaling is downregulated in CC Figure . In vertEven though the extensive use of the Papanicolau smear and colposcopy examination have significantly decreased the mortality rates, CC remains as the second cause of death in women worldwide. HPV sequences have been found in more than 99% of CC and HPV infection is the most important etiologic factor in cervical carcinogenesis. Besides, HPV infection is very common among the young sexually active population, but only a small fraction of infected individuals will develop cervical carcinoma later in life. Thus, HPV can be considered as an initial hit in the multistep carcinogenesis that leads to the development of CC. The molecular pathways involved in the progression of HPV-infected cells to CC have not yet been accurately identified. Here, we reviewed the role of Wnt/β-catenin pathway activation and the inactivation of planar cell polarity pathway in CC cells as a second hit to develop CC.In CC mutations on CTNNB1 gene are uncommon; thus the activation on wnt signalling pathway it seems to be activated upstream of/β-catenin. This fact could be achieved by means of negative regulators inactivation or over-expression of pathway activators.Other branch in wnt signaling pathway that could be relevant during CC pathogenesis is planar cell polarity (PCP) pathway, which is involved in differentiation processes. PCP is a key differentiation and morphogenetic process involved in development of epithelia. In normal cervical epithelia, cells are polarized and migrate from basal to the luminal space as they differentiate. Interestingly, PCP component genes are down-expressed in CC, indicating that this mechanism could be abated prior the establishment of the neoplasia. From the diagnostic point of view this fact could be important, because if we were able to show as an early process, we could account with potential molecular markers for early detection.The authors declare that they have no competing interests.CPP conceived and wrote the manuscript, ADG and BAT participated in the discussion and analysis of the content.

P=0.086 by Fisher’s exact test). Arm B tended to favour EFFS, with a hazard ratio of 0.64 . No significant differences in the acute toxicities or complications were observed. The median survival was 79 days and 119 days in arm A and arm B, respectively. This medium-sized trial failed to show statistical significance in the primary end point. Although ipc BLM appeared safe and effective in the management of MPE, the therapeutic advantage seems modest.Safety and efficacy of intrapericardial (ipc) instillation of bleomycin (BLM) following pericardial drainage in patients with malignant pericardial effusion (MPE) remain unclear. Patients with pathologically documented lung cancer, who had undergone pericardial drainage for MPE within 72 h of enrolment, were randomised to either arm A or arm B . The drainage tube was removed when daily drainage was 20 ml or less. The primary end point was survival with MPE control at 2 months. Eighty patients were enrolled, and 79 were eligible. Effusion failure-free survival at 2 months was 29% in arm A and 46% in arm B (one-sided Malignant pericardial effusion (MPE) is a grave complication of malignant tumours. The frequency of pericardial involvement by malignancy has been estimated to be 10–21% at autopsy .Malignant pericardial effusions are often asymptomatic and detected incidentally by echocardiography or computed tomography. Symptomatic cases, however, often manifest cardiac tamponade, which can rapidly lead to cardiovascular collapse and death, unless promptly treated .Lung cancer is the most frequent cause of MPE, and other common primary sites include breast cancer, oesophageal cancer, lymphoma and leukaemia BLM instillation, as compared with pericardial drainage alone, in lung cancer patients with MPE.3, platelet count⩾75 000 per mm3, haemoglobin⩾9.0 g dl−1 and no renal or hepatic failure; however, laboratory abnormalities related to cardiac tamponade were allowed). Patients with chemotherapy-naive small cell cancer were excluded. Other exclusion criteria included apparently non-malignant effusion , recurrent MPE, myocardial infarction or unstable angina within the previous 3 months, constrictive pericarditis, active interstitial pneumonia, severe infection and disseminated intravascular coagulation. Those with an unstable clinical condition attributable to other severe complications, such as superior vena cava syndrome, central airway obstruction or uncontrollable massive pleural effusion, were also excluded.Patients with pathologically documented lung cancer, who had undergone pericardial drainage for clinical MPE (moderate to large accumulation of fluid), were eligible for study entry. Indications for the drainage were clinically determined; cases after emergent drainage and those after elective one were both included. Patient registration should be done within 72 h of drainage. The eligibility criteria were as follows: 75 years of age or less, expected life prognosis of 6 weeks or more with control of the MPE and minimum organ functions , in which a drainage catheter is inserted using the Seldinger technique, and subxiphoid pericardiostomy , in which a drainage tube is placed surgically, were allowed; each participating institution, however, basically adhered to one method, which they used in routine practice. The drainage method used was recorded on the case report form.After registration with telephone or facsimile, the patients were randomly assigned to one of the two treatment arms with block randomisation stratified by the institution. In arm A, no additional intervention was performed and the patient was observed clinically after the pericardial drainage. In arm B, 15 mg of BLM dissolved in 20 ml of normal saline was instilled through the drainage catheter into the pericardial space immediately after the patient registration. The catheter was then clamped and reopened after 2 h, allowing resumption of the drainage. Additional doses of BLM at 10 mg were instilled similarly every 48 h, unless the criteria for tube removal, as described below, were met.The drainage tube was removed, in both arm A and arm B, when the drainage volume per 24 h was 20 ml or less. If the criterion was met during the 24 h preceding randomisation in a patient allocated to arm A, the tube was immediately removed.Primary control of the MPE was considered to be achieved when the drainage tube could be successfully removed within 7 days of randomisation. When the criterion for tube removal, that is 20 ml per 24 h, could not be met by 7 days, the case was judged to show primary failure of the protocol therapy: treatment after off-protocol was not limited by the study protocol. When the drainage tube had to be removed because of obstruction, but re-drainage was clinically unnecessary, it was judged to have been successfully removed with primary control of MPE.Monitoring for recurrence of the MPE in those who showed primary control was conducted by echocardiography at 1, 2, 4, 6 and 12 months. When the estimated fluid volume in the recurrent effusion exceeded 100 ml, the case was labelled as showing MPE re-accumulation and recurrence. Re-drainage was performed as clinically indicated.The adverse effects of the therapy were evaluated according to the Japan Clinical Oncology Group Toxicity Criteria rate at 2 months; EFFS was patient survival without MPE recurrence as defined above, in patients showing primary control. It was calculated as the period from the date of pericardial drainage to the date of MPE recurrence or the patient’s death. For those patients with primary failure, MPE recurrence was considered to have occurred at the date of drainage, with an EFFS of zero. Effusion failure-free survival was judged regardless of the other disease status.The secondary end points included the primary MPE control rate, time to drainage tube removal, EFFS, treatment-related morbidity, proportion of late pericardial or cardiac complication, overall survival (OS) and symptom scores.Study-specific four-item symptom scores were completed by patients at the time of randomisation and at 1 month after the enrolment. The scores were to be interviewed by the health professionals other than the attending physicians. The items consisted of cough, pain, anorexia and shortness of breath. The scoring was conducted as follows: as not at all present (0), a little (1), moderate (2) and very much (3). The score for each item and the sum of the total score for all the four items were compared between the baseline and the follow-up assessments, and judged to be improved (lower scores in the follow-up assessments), stable (no change of scores) or worsened .α. The required sample size was calculated as 80 patients, 40 in each arm, for comparing independent proportions.From the historical data, the EFFS rate at 2 months in arm A was assumed to be 30% and that in arm B was presumed to be 60%. The study was designed to provide 80% power with 5% one-sided The OS, time to tube removal and EFFS of both arms were calculated by the Kaplan–Meier method and compared by log-rank tests. The primary MPE control rate, symptom scores, complication rates and EFFS at each of the follow-up points were compared using Fisher’s exact test. All analyses were performed with the SAS software version 9.1 .From August 1999 to January 2006, 80 patients from 14 institutions were enrolled and randomised, 42 to arm A and 38 to arm B. One patient in arm B was found to be ineligible because of late registry, 2 weeks after the pericardial drainage. All 80 patients were analysed for their characteristics and chemotherapy morbidity, and the 79 eligible patients were analysed for efficacy and survival.In arm B, all 38 patients received at least one ipc BLM instillation and a total of 74 administrations: seven patients received four administrations , five received three administrations , five received two administrations and the remaining 21 received a single administration . There was no apparent relationship between total dose and efficacy end points such as EFFS, except that those required four administrations had a worse primary control of the MPE.A total of 24 patients (14 in arm A and 10 in arm B) received systemic chemotherapy after drainage tube removal. Nine patients (five in arm A and four in arm B) received gefitinib. Cytotoxic chemotherapy was administered to 21 patients (11 in arm A and 10 in arm B).As anticipated, there were as many as nine early deaths within 30 days of randomisation; five in arm A and four in arm B. Although the death was ascribed to disease progression in the majority, two patients in arm A died of massive bleeding during surgical attempts at re-drainage for recurrent MPE, possibly due to crack formation in the ventricular wall upon dissection of the adherent pericardium. Another patient in arm B died suddenly on day 12 of the protocol without a clear cause.P=0.030 by log-rank test).Primary control of the MPE with successful tube removal within 7 days of randomisation was achieved in 28 of the 42 cases (67%) in arm A and 27 of the 37 eligible cases (73%) in arm B, the difference between the two groups not being statistically significant. The median time to tube removal was 7 days in each arm. Arm B favoured EFFS , with a vs 29%), the difference between the two groups was not statistically significant (one-sided P=0.086 by Fisher’s exact test).The EFFS at 1, 2, 4, 6 and 12 months was 50, 29, 17, 14 and 5%, respectively, for arm A, and 65, 46, 32, 24 and 10%, respectively, for arm B. Although arm B also favoured the primary end point, EFFS at 2 months and 43 had undergone non-surgical (percutaneous tube pericardiostomy) drainage before randomisation. Patients with surgical drainage tended to have a longer EFFS . The effThe baseline symptom scores were taken for all of the 79 eligible patients, at enrolment (after drainage). At the 1-month follow-up, approximately half of the patients (55% in arm A and 51% in arm B) had stable or improved overall scores. There were no significant differences between the arms for any of the symptom scores .Malignant pericardial effusion is a potentially life-threatening complication of malignancy that usually manifests itself at an advanced or terminal stage of the disease. It brings great agony to the patient once it becomes symptomatic, with dyspnoea, orthopnoea, chest pain and cough. Although the prognosis of the patients with MPE is very poor, especially in those with chemotherapy-resistant tumours such as non-small-cell lung cancer for drainage might be necessary in future trials, as they might well affect the patient outcomes. In fact, we did observe that, although not a randomised comparison and thus it should be interpreted with caution, patients who underwent surgical drainage tended to have a better MPE control.The third limitation of our study was that we did not control for the method of primary pericardial drainage, and each institution chose it in accordance with its daily practice. We do not believe that our results were much biased by the drainage methods, as each participating institution basically adhered to one method of its choice, and the ipc BLM arm tended to favour EFFS in both subgroups with surgical and non-surgical drainage. However, control for the drainage method or indication (emergent Recently, less invasive techniques for surgical treatment of MPE have been described, such as percutaneous balloon pericardiotomy (One ancillary finding of our study was that two patients died of major bleeding during surgical attempts at re-drainage for recurrent MPE. Although it has rarely been reported in the literature, partial adhesions could have led to injury to the cardiac wall during the surgical procedure.In this trial, we evaluated the safety and efficacy of pericardial sclerosis with a ‘classic’ sclerosant agent of BLM. Future trial designs would include one to compare BLM with another agent with a different mode of action, such as intrapericardial instillation of a platinum compound as ‘local chemotherapy’.In conclusion, we found that pericardial sclerosis with ipc BLM after drainage appears to be safe and effective, overall, in the management of MPE in patients with lung cancer and should be a valid therapeutic option in these patients. We could not, however, demonstrate a statistical significance in the primary end point with the modest sample size of 80. The therapeutic advantage might not be large enough, and more trials are warranted.The authors have no conflicts of interest to declare.www.clinicaltrials.gov, ClinicalTrials.gov number, NCT00132613 and in UMIN-CTR[www.umin.ac.jp/ctr/], identification number, C000000030.Registered in

A study was made evaluating the use of radiation-induced cell cycle delay in lymphocytes to predict tumour response to radiotherapy. Peripheral blood lymphocytes were isolated from whole blood from 49 patients with head and neck cancer before treatment with radiotherapy and from 25 healthy donors. The clinical response to radiotherapy was assessed at 0-2 months after treatment. The level of radiation-induced cell cycle delay was measured using flow cytometry after mitogen stimulation of lymphocytes. The analysis of ten normal donors gave no significant difference in variability between the intra-assay and the intra-donor samples. However, the cell cycle data for lymphocytes from these healthy donors showed significant inter-individual differences in G2 phase accumulation. Patients showing no response to radiotherapy had a high level of S-phase cells compared with partial (P < 0.001) and complete responders (P = 0.016). An inverse relationship was found when analysing the fraction of cells in G2 (P = 0.009 and 0.034 respectively). In general, healthy donors had similar cell cycle kinetics compared with the non-responders. In conclusion, the result indicates that radiation-induced cell cycle delay in lymphocytes is inversely correlated with tumour response to radiotherapy in head and neck cancer patients. However, the value of the present test for predicting individual tumour response is limited, because of assay variability and overlap between groups.

Since the transfer and application of modern sequencing technologies to the analysis of amplified fragment-length polymorphisms (AFLP), evolutionary biologists have included an increasing number of samples and markers in their studies. Although justified in this context, the use of automated scoring procedures may result in technical biases that weaken the power and reliability of further analyses.bin) that represents a valuable estimator during the optimization process. This statistic can be computed at any stage of the AFLP analysis without requiring the inclusion of replicated samples. Finally, we show that downstream analyses are not equally sensitive to scoring errors. Indeed, although a reasonable amount of flexibility is allowed during the optimization of the scoring procedure without causing considerable changes in the detection of genetic structure patterns, notable discrepancies are observed when estimating genetic diversities from differently scored datasets.Using a new scoring algorithm, RawGeno, we show that scoring errors – in particular "bin oversplitting" (i.e. when variant sizes of the same AFLP marker are not considered as homologous) and "technical homoplasy" (i.e. when two AFLP markers that differ slightly in size are mistakenly considered as being homologous) – induce a loss of discriminatory power, decrease the robustness of results and, in extreme cases, introduce erroneous information in genetic structure analyses. In the present study, we evaluate several descriptive statistics that can be used to optimize the scoring of the AFLP analysis, and we describe a new statistic, the information content per bin and can be found at EcoR I and Mse I according to the original protocol ) propose a graphical solution by displaying the GeneScan results on a "gel-like" interface and allowing the user to manually define the bins. Although this strategy allows direct control of the scoring, it requires experienced users and remains sensitive to human biases or fully automated scoring procedures , where the user does not directly score the dataset, but parameterizes a scoring algorithm. At least three main issues must be considered when scoring a dataset .Programs such as Genographer V2.0 . Moreovn et al. , freely I. Size homoplasy , which cII. Occurrence of bin definition errors resulting from a non-optimal scoring parameterization. This bias can lead to two contrasting errors: either a) "oversplitting", in which bins are too thin and may split variant locations of the same amplicon into smaller and erroneous sub-bins, or b) including an exaggerated range of amplicon sizes within the same bin, thus introducing an artificial similarity between unrelated samples. Although they differ in their causes, we assume that this second bias has comparable consequences for the dataset quality as those caused by size homoplasy. We will therefore term this bias "technical homoplasy" in order to distinguish it from size homoplasy.III. Difficulties in detecting amplicons due to variable quality of AFLP reactions. Low quality runs can lead to the introduction of a noisy signal within the dataset. This bias can be limited by using optimized and standardized laboratory AFLP protocols and by rIn addition, recent studies propose the evaluation of the quality of both bins and alleles in order to increase the final dataset quality. Several of these procedures are applied once the scoring is complete . HoweverCerastium uniflorum (Caryophyllaceae), produced five datasets with increasing technical homoplasy. In parallel, we produced five analogous datasets with the commercial software GeneMapper. Finally, we scored the dataset manually by using the freeware Genographer. Using these eleven datasets, we first evaluate several descriptive statistics that can be used to optimize the scoring of the AFLP data. We then investigate the effects of the AFLP scoring settings, as well as the choice of the scoring method, on downstream analyses such as data mining statistics (ordination techniques), inter-individual and inter-population distance, Maximum Likelihood clustering to produce an exhaustive list of detected amplicons generated by the AFLP reaction. This list records the size, fluorescence and sample origin of each amplicon which are used as the input data for RawGeno. It should be noted that our program can potentially be modified to handle results from other genotyping machines.The analysis begins by detecting and calculating the size of peaks within the AFLP profiles. This preliminary analysis is conducted either with GeneScan V3.1.2 (ABI) or with the freeware PeakScanner V 1.0 , a perennial, diploid (2n = 36) plant distributed throughout the European Alps in subnival habitats. A total of 209 individuals from 46 populations were analysed with three selective AFLP primer pairs. Details on the sampling scheme, the primer pairs used and the scoring methods are provided in Gugerli et al. [In order to investigate the effects of the scoring procedure on genetic analyses, a dataset from an extensive study on intra- and inter-specific plant biodiversity (IntraBiodiv Consortium ) was choi et al. and Bonii et al. . Raw dati et al. , throughi et al. , in whici et al. ). As a ca priori and was deduced from the results we obtained. Replicated samples (i.e. ~20% of the sampling) were included in all ten datasets, which allowed the calculation of error rates (see below) and subsequently, the removal of non-reproducible bins in the final dataset. Monomorphic bins and singletons were also removed. The whole set of downstream analyses (see below) were carried out on these cleaned datasets. The ten resulting matrices were coded as binary states in the same way as for the manual dataset (see above). For RawGeno, datasets were labelled as follows: RG_0.2, RG_1, RG_2, RG_5 and RG_10. GeneMapper datasets were labelled as follows: GM_0.2, GM_1, GM_2, GM_5 and GM_10.The parameters of RawGeno were determined as follows was recorded for each dataset. Second, the mean homoplasy rate was computed within the RawGeno datasets. The homoplasy rate (HR) was defined as the number of amplicons belonging to the same individual that are assigned within the same bin. This statistic was calculated for each sample/bin and averaged for the whole dataset. The frequency of the "present" allele was computed for each bin and frequencies were plotted against the bin sizes (in bp). Finally, the level of correlation was calculated between each of the ten automatically scored datasets and the manually scored one . This was achieved by: I. Calculating Jaccard similarity indices between a - Vm = Ra, where Va is the variance of the automatically scored dataset, Vm is the variance of the manually scored dataset and Ra is referenced to as the residuals that are specific to the automatically scored dataset. We further measured the ability of these residuals to discriminate populations, in order to assess whether the automatically scored datasets effectively contained more information than the manually scored one. This calculation was achieved by applying a Mantel test between the residuals matrix and a contrast matrix comprising the population origin of each sample. This test required the computation of Euclidean distance on the contrast and residual matrices, for which we used the "mantel" function of the "vegan" R CRAN package (1000 permutations).The datasets produced from the automated analysis were compared to the manually scored one by using a partial constrained correspondence analysis . We usedFor each dataset, two estimators of the error rate were computed by considering the information comprised in the replicated samples.b = Mrepl/nbin, where Mrepl is the total number of mismatches between a sample and its replicate and nbin is the total number of bin. This statistic was computed for each sample-replicate pair.I. The mismatch error rate defined II. The Bayesian error rates ε1.0 and ε0.1 that represent, respectively, the probability of mis-scoring the presence or the absence of AFLP fragments. We used MasterBayes (an R CRAN package ) and thebin). This statistic was calculated for each sample of the dataset and was defined as Ibin = Msampling/nbin where Msampling is the average number of mismatches between the considered sample and the other samples of the dataset and nbin is the total number of bins in the dataset. This criterion can be computed at any stage of the scoring process and does not require the inclusion of replicated samples. Here, we applied it after the removal of non-reproducible bins.These two estimators required the inclusion of replicated samples and did not allow addressing the quality of datasets where non reproducible bins had been removed . As a consequence, we propose a new "optimality criterion" based on the information content per bin . The values estimated with the various datasets were compared using scatterplots and linear regressions.Three indices, revealing the level of diversity in each population, were computed: I. the estimated Heterozygosity (Hj), by using AFLP-Surv (we usedEcoR I and Mse I are used as restriction enzymes) [The manual scoring required approximately 100 hours of "human work" and produced 102 reproducible bins. Automated scoring procedures, in contrast, produced the scorings in about 1 hour (depending on the kind of dataset and the computer power). Moreover, the automatic scoring procedures preserved a large number of bins as we obtained 502, 456, 316, 177 and 116 bins for the RawGeno datasets (RG_0.2 to RG_10) and 4126, 1338, 742, 340 and 183 bins for the GeneMapper datasets (GM_0.2 to GM_10). As expected, the use of larger bin widths decreased the number of bins and introduced technical homoplasy. Interestingly, technical homoplasy occurred more rapidly, with the increase of the bin width, in small fragment sizes , clearly impacted the dataset quality, as shown by a decreasing correlation to the manual dataset with increasing bin width , defined by the number of mismatches between a sample and its replicate, divided by the number of bins (Eb = Mrepl/nbin), failed to unambiguously detect the oversplitting, while technical homoplasy was slightly detected was shown to be unable to discriminate datasets scored with varying bin sizes. As a result, we advise that the mismatch error rate should not be used to optimize the bin definition and the scoring of AFLPs. This criterion provided, however, valuable information when the number of bins remained similar among datasets. This situation was encountered, for instance, during further quality checking steps, such as fluorescence or bin reproducibility filtering. Interestingly, the two Bayesian error rates in the dataset. It is therefore clear that the evaluation of dataset quality requires a much more absolute criterion, such as error rates. However, the properties of the different estimators must be evaluated taking into account technical homoplasy and bin oversplitting. For instance, the mismatch error rate can be Biogeographic structure analyses were moderately affected by the scoring system Figure . For insC. uniflorum seemed to be composed of five main phylogeographic regions . These regions were identified by the clustering analysis in the following order . Our study showed that, with high quality AFLP and GeneScan raw data, automated procedures can be particularly efficient in producing ready-to-use datasets, at least in the context of population genetic or phylogeographic studies . However, the automated scoring of AFLPs is a multiple-step process and a trade-off based on several quality criteria may be desirable since it might provide more relevant information than a single statistic. Optimizing the parameters used in the scoring algorithm therefore represents one of the most important steps of the whole analysis. Using RawGeno, we were able to evaluate the impact of technical homoplasy and bin oversplitting on optimality criteria and genetic structure patterns by intentionally biasing our starting datasets. Interestingly, our results demonstrated that a high number of redundant and informative bins might overcome technical homoplasy due to scoring errors, at least when investigating biogeographic structures. While allowing for some plasticity during the optimization of the scoring procedure, this result also reinforces the use of the AFLP methodology for its ability to produce highly informative datasets. By contrast, the estimation of genetic diversity may be considered with caution since scoring biases are likely to reinforce problems caused by size homoplasy.Finally, RawGeno provided results at least as accurate as those obtained by scoring the dataset manually or by using a commercial software such as GeneMapper. To our knowledge, RawGeno is the only freely available program proposing a fully automated scoring solution, from electropherogram files to user-defined working binary matrices. Benefiting from the open source R platform, RawGeno can be potentially enhanced and used by any user.NA1 carried out the main design of the study, organized the package, programmed and debugged the R code, and drafted the manuscript. JWT, DE and TG participated in the design of the study and programmed parts of the code. NA2 participated in the main design and coordination of the study and helped to draft the manuscript. All authors read and approved the final manuscript.Detailed technical features of RawGeno. This document provides a description of scoring and bin filtering solutions proposed by RawGeno. In addition, it includes recommendations to achieve a proper scoring.Click here for fileSpatial genetic structures for all datasets. The graphics are displayed on an array where the lines represent the different datasets and the columns display the different analyses. The three first columns contain the scatterplots of three genetic diversity indices . The values obtained by using the automatically scored datasets (displayed on the y-axis) are compared to those obtained with the manually scored dataset (displayed on the x-axis). The red line represents a linear regression between values obtained by both datasets .Click here for fileEffect of the scoring parameters on diversity estimators. Scatterplot of the number of bins , according to the mean homoplasy rate (x-axis). The mean homoplasy rate (HR) is defined as the average number of peaks belonging to the same individual that are affiliated within the same bin. The eleven datasets are displayed as dots and as maps on the scatterplot. The maps represent C. uniflorum populations with circles. The radius of circles is a function of the measured diversity. A. Percentage of polymorphic loci (PLP). B. Estimated Heterozygosity (Hj). C. Rarity index (Rarity).Click here for file

Dear Sir:Angiostrongylus cantonensis in Thailand and Taiwan are different. In Thailand, most patients are adults and fever is less common. In contrast, most patients in Taiwan are children and fever is more common. These differences might be caused by the route of infection and carrying hosts. Adult Thai patients acquire the disease by eating raw golden apple snails or other paratenic hosts; whereas exposure to the African giant snails/slugs (A. fulica) is the main cause of disease in Taiwanese children.First of all, we appreciate all comments from Dr. Tsai and others on our article. We agree that characteristics of eosinophilic meningitis caused by Regarding the exclusion criteria, we intended to exclude patients only if the computed tomography (CT) or magnetic resonance imaging (MRI) of the brain indicated other causes of cerebrospinal fluid (CSF) eosinophils, particularly gnathostomiasis. Previous reports showed some radiographic features indicating gnathostomiasis.We would like to thank Dr. Tsai and others for mentioning our proposed sample size calculation. We would like to clarify the calculation and add a missing reference.7Finally, we agree that to determine the risk factors of developing encephalitic angiostrongyliasis needs further prospective observation. And, it might be different among age groups and places.Kittisak SawanyawisuthE-mail: [email protected]

Burnout syndrome has been clinically characterised by a series of three subtypes: frenetic, underchallenged and worn-out, with reference to coping strategies for stress and frustration at work with different degrees of dedication. The aims of the study are to present an operating definition of these subtypes in order to assess their reliability and convergent validity with respect to a standard burnout criterion and to examine differences with regard to sex and the temporary nature of work contracts.r, and differences with Student's t-test and the Mann-Whitney U test.An exploratory factor analysis was performed by the main component method on a range of items devised by experts. The sample was composed of 409 employees of the University of Zaragoza, Spain. The reliability of the scales was assessed with Cronbach's α, convergent validity in relation to the Maslach Burnout Inventory with Pearson's p < 0.001), while permanent employees did so in the underchallenged (p = 0.018) and worn-out (p < 0.001) profiles.The factorial validity and reliability of the scales were good. The subtypes presented relations of differing degrees with the criterion dimensions, which were greater when dedication to work was lower. The frenetic profile presented fewer relations with the criterion dimensions while the worn-out profile presented relations of the greatest magnitude. Sex was not influential in establishing differences. However, the temporary nature of work contracts was found to have an effect: temporary employees exhibited higher scores in the frenetic profile (The classical Maslach description of burnout does not include the frenetic profile; therefore, these patients are not recognised. The developed questionnaire may be a useful tool for the design and appraisal of specific preventive and treatment approaches based on the type of burnout experienced. Burnout syndrome has been described as a prolonged response to chronic emotional and interpersonal stressors on the job, determined by the dimensions of exhaustion, cynicism, and inefficacy . ExhaustDespite the various definitions of the syndrome presented in the literature, burnout has traditionally been described as a relatively uniform entity in all individuals, with more or less consistent aetiology and symptoms . NeverthThe frenetic type compriseThe classification criterion (dimension on which differentiation is based) is the degree of dedication , specifiIn a previous exploratory study carried out by our group , associaWithin this framework, the main aim of the current study was to construct a questionnaire that would allow the clinical profiles reflected in the previously described conceptual structure to be operationalised. We also evaluated the internal consistency of the constituent scales and subscales as well as their convergent validity with regard to a standard burnout criterion. Lastly, we examined the potential differences caused by sex and the temporary nature of work contracts.We used the correlational method with a cross-sectional design. The measurements were obtained by means of the self-assessment technique using a questionnaire. All participants provided their informed consent.The study population consisted of the employees of the University of Zaragoza who were employed in January 2008 . The sample size was calculated for a 95% confidence interval with a 3.5% error, assuming the prevalence of burnout to be 18%, according to previous studies on the general population . The calThe mean age of participants was 40.51 years (SD = 9.09). Of the participants, 44.4% were males. In terms of job position, 42.9% of the subjects were teaching and research staff members, 46.9% were administration and service personnel and 10.2% were fellows. Of the sample, 21.9% were not in a stable relationship, and 49.9% had children. In terms of length of employment, 18.5% had been working at the university for less than 4 years, with 44.6% working between 4 and 16 years and 36.9% for more than 16 years. The income distribution was as follows: 31.1% had a monthly income of less than €1,200, with 42.1% earning €1,200-2,000 per month and 26.8% earning more than €2,000. Nearly 67% of the participants did not take sick leave in the previous year. Of the subjects, 63.6% were permanent employees and 93.8% worked full time.Subjects were first asked questions concerning general socio-demographic and work-related aspects for the purpose of providing a description of the participating sample and carrying out the previously mentioned contrasts. They were then presented with a self-administered questionnaire that consisted of 72 items, 8 for each of the 9 characteristics included in the previously described model. The items were developed by a group of experts who attempted to include the main characteristics of the reference domain by means of consensus . The worTo conclude, subjects were presented with the Maslach Burnout Inventory-General Survey (MBI-GS) in the vc2 communality values, the reliability of scales and subscales with Cronbach's α and relation to the criterion with Pearson's r. Contrast tests were calculated with Student's t-test for independent measurements or through z values associated with the Mann-Whitney U test . Data analysis was performed with the SPSS version 15 statistics software package.From the proposed items, we selected those with the best discrimination coefficient in their respective domain -22. The An e-mail explaining the aims of the research was sent to the selected subjects. The e-mail contained a link to an online questionnaire and two access passwords for subjects to complete the questionnaire during the month of February 2008. As a token of appreciation for their collaboration in the study, participants received a report with their score from the questionnaire and its interpretation. This project was approved by the Ethics Committee of Aragon.The following paragraphs present the results obtained from the selected items according to the method previously described based on the Classical Theory of Tests.p < 0.001). This analysis provided an unforced solution for three factors. The first of these (ambition) presented an eigenvalue of 4.37 (36.44% variance); the second (overload) had an eigenvalue of 2.41 (20.09%); and the third (involvement) exhibited an eigenvalue of 1.67 (13.94%). The three factors exceeded Kaiser's criterion and the scree test allowed the solution to be accepted as adequate. In total, 70.47% of the variance was explained.The distribution of items on the frenetic scale allowed the use of the EFA , which provided an unforced solution for three factors. The first of these (indifference) presented an eigenvalue of 6.91 (57.57%); the second (lack of development) had an eigenvalue of 1.40 (11.66%); and the third (boredom) exhibited an eigenvalue of 1.01 (8.34%). The three factors exceeded Kaiser's criterion, and the sedimentation graph slope became gentle for these three factors. The solution explained 77.57% of the total variance.The distribution of items on the unchallenged scale permitted EFA . EFA provided an unforced solution for three factors. The first of these (lack of acknowledgement) presented an eigenvalue of 4.89 (40.76% variance); the second (neglect) had an eigenvalue of 2.44 (20.34%); and the third (lack of control) exhibited an eigenvalue of 1.23 (10.21%). The three factors exceeded Kaiser's criterion, and the scree test offered a structure for the three factors. This model explained 71.31% of the total variance.The distribution of items on the worn-out scale made EFA possible . Each of the items contributed to raising the reliability of their factor as well as the total scale of their profile, except items 12 and 22, which raised the reliability of their factor but not that of their profile. Nevertheless, elimination of these items resulted in the same value for the general corresponding scales; therefore, they were not rejected.r = 0.30; p < 0.001), insignificant for cynicism and moderately low in a positive sense for efficacy . The underchallenged profile presented relations of the greatest magnitude. The relations were moderate for exhaustion , very high for cynicism and moderate for efficacy in an inverse sense . The worn-out profile obtained the greatest relations with the criterion. The relations were very high for exhaustion and cynicism , and moderately high for efficacy in a negative sense . Table Convergence values with the MBI-GS differed for each of the identified burnout types. The frenetic profile presented fewer relations with the criterion dimensions. The relations were moderate for exhaustion (p < 0.001), while permanent employees did so in the underchallenged (p = 0.018) and worn-out (p < 0.001) profiles.Table This study is the first with the aim of producing an operational concept of professional burnout that enables classification into clinical subgroups. This concept was a need felt by clinicians because not all individuals with burnout present the same characteristics and prognosis. Analysis of the selected items and resulting scales for each profile has confirmed the factor validity and high reliability of the model. All of the operational definitions were faithful to the meanings contained in the Farber's theory.The frenetic scale was composed of the involvement, ambition and overload dimensions. The high scores and low variability obtained in the items belonging to the involvement factor suggest that these responses may be influenced by social desirability, an aspect that should be considered when establishing anchoring points on a scalar level in later studies. The frenetic profile generally presented significant relations with exhaustion and with efficacy in a positive sense. These subjects are affected by burnout, given that this is what they express in therapy sessions when manifesting their psychological distress ,10. HoweThe underchallenged profile comprised the indifference, lack of development and boredom dimensions. This last factor, despite fulfilling Kaiser's criteria, presented a low percentage of explained variance, likely due to its high association with the other two factors. However, this factor should be included in the model because its content clearly differs from that of the other two factors. We observed relations between the underchallenged profile and exhaustion, lack of efficacy and, particularly, cynicism. Underchallenged employees have lost interest in the tasks involved in their work, have become cynical, and consequently seem to be affected by preliminary stages of burnout, such as dissatisfaction, limited variety and absence of feedback in tasks ,37. In oThe worn-out profile is characterised by neglect, lack of control and lack of acknowledgement. The low scores and lower variability for items belonging to the neglect factor suggest that social desirability may have influenced subjects' responses. The worn-out type presents significant relations with exhaustion, cynicism and lack of efficacy, and therefore appears to be the profile that best fits the definition of burnout provided by Maslach, Schaufeli and Leiter . Their nStructural conditions, such as the temporary nature of work contracts, accentuate the development of some types of burnout. According to our results, temporary employees exhibit significantly higher scores for the frenetic subtype, associated with excessive dedication. Permanent employees displayed significantly higher scores for the underchallenged and worn-out subtypes, characterised by lower dedication. Significant differences were also found in the involvement, ambition, indifference, boredom, lack of acknowledgement and neglect dimensions, with the first two being higher in temporary workers, and the remaining dimensions higher in permanent employees. The structural condition of the temporary nature of work contracts appears to be associated with the type of burnout experienced, perhaps owing to differential involvement in work tasks. On the contrary, there were no significant differences by gender.Although the characteristics of the subtypes may comprise determining factors for burnout syndrome, not all profiles fit the definition of Maslach, Schaufeli and Leiter in the sSubtypes are affected by different sources of stress and discontent at work, depending on the level of dedication with which they cope with obstacles and difficulties. Consequently, in order to efficiently adapt treatment strategies for burnout syndrome, we must specifically consider the burnout subtype experienced in each case. From a clinical perspective, exclusive consideration for the most recent manifestations of the syndrome, as performed in current evaluation standards, are insufficient. In order to overcome this limitation, it is necessary to have a more extensive definition for burnout syndrome that takes into account the level of involvement with which subjects cope with their work as part of the syndrome development process.This study has several limitations. First, a low response rate was obtained. However, the rate is quite similar to those found in previous studies using internet surveys ,18. ThisThe results of this study provide empirical support for the factor validity and internal consistency of the scales comprising the three clinical profiles. The Burnout Clinical Subtype Questionnaire is interesting in that it allows measurements for the three different burnout subtypes to be established. Moreover, it does so in a brief and operational manner, which makes it quite useful for the design and evaluation of specific treatment strategies for burnout syndrome.The authors declare that they have no competing interests.JM-M and JG-C are the principal researchers and developed the original idea for the study and the study design. JM-M developed the statistical methods. Both authors have read and corrected draft versions and approved the final version.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/10/302/prepubAppendix. Burnout Clinical Subtype QuestionnaireClick here for file

The time has come again to review the progress of the Indian Journal of Ophthalmology (IJO) since its previous report published a year ago. In the pFive hundred and forty-eight manuscripts were submitted in 2009, which was much higher than the previous year . Of the www.ijo.in>, which adopts the policy of Open Access, is getting even more popular, and is accessed from almost every part of the world [Figs. Our website <ld Figs. and 3.We are fortunate to have established a wide base of reviewers, the majority of whom are from abroad and experts in their respective fields. This rising trend in the number of reviewers has helpAlthough uploading of full text of old journals on our website is complete for all the available issues of IJO, it is disheartening to note that eight issues could not be uploaded due to unavailability of their hard copies . I seek the help of all members in tracing these eight issues to complete the missing links of IJO.The editorial office is doing everything in its capacity to help improve the standard of research and publications. The last research methodology workshop conducted in March 2009 was a great success. These workshops have become a regular feature of IJO in the past five years and have now culminated into a three part training series. Another initiative taken by the IJO to facilitate research was to provide the full text of any paid article to the members of the All India Ophthalmological Society (AIOS). This was made use of by a good number of AIOS members wherein 142 articles were requested for in a year.The introduction of the “AIOS –IJO award” in the year 2009 was another step taken by IJO to attract good research papers from AIOS members. After a rigorous evaluation process six papers were chosen in the various categories. The list of awardees has been published in this issue of IJO. Furthermore, we are working on a project along with a management school on ‘How to attract good research papers for IJO’, the outcome of which, I am very confident, will help us in improving the quality of published papers in IJO.Every journal is judged by its ‘Impact Factor’. This yea

D-galactoside-specific mistletoe lectin I. In this study, we investigated the cellular effect of bacterially expressed, recombinant mistletoe lectin alone or in combination with ionising radiation in a genetically defined p53-wild-type and p53-deficient E1A/ras-transformed murine tumour cells system. Downregulation of the proliferative activity and cell killing by recombinant mistletoe lectin occurred in a clear dose response (0.1–1 ng ml−1). Induction of apoptosis was p53-independent, but apoptosis-associated factor-1-dependent. Cellular treatment with lectin in combination with ionising radiation resulted in both p53-wild-type and p53-deficient tumour cells in an at least additive, antiproliferative effect and enhanced activation of caspase-3. Combined treatment with ionising radiation and lectin revealed a similar cytotoxic effect in human, p53-mutated adenocarcinoma cells. Thus, recombinant mistletoe lectin alone and in combination with ionising radiation bypasses often prevalent apoptotic deficiencies in treatment-resistant tumour cells.Mistletoe extracts are used as alternative cancer treatment in addition to standard chemotherapy and radiation treatment and have an immunostimulatory and pain-relieving effect. A direct antitumour effect of mistletoe extracts against tumour cells of lymphoid origin has been linked to the D-galactoside-specific mistletoe lectin I (ML-I). Mistletoe lectin-I is a heterodimer that consists of the toxic A-chain, a site-specific type II ribosome-inactivating N-glycosidase, and the carbohydrate-binding-subunit B responsible for cellular lectin uptake and procaspase-9 to process the protease to its active form at the plasma membrane, other stress stimuli activate caspases at intracellular sites in a genetically defined p53-wild-type and p53-deficient tumour cell system and in cells lacking an intact Apaf-1/caspase-apoptotic pathway. This murine E1A/ras-transformed cell system has previously been described for its strict p53- or Apaf-1-dependent apoptotic response to treatment with IR and different cytotoxic drugs Mr 55 kDa) was produced by cloning and separate expression of the two subunits A and B in Escherichia coli and renatured in a coassociation process was kindly provided by H Zinke . rML (ψm- and PI-exclusion-experiments (see below), the serum concentration was not readjusted. Control experiments were performed with the corresponding serum conditions. Tumour cell proliferation was assessed by the colorimetric alamar blue assay, a proliferation assay that assesses metabolic activity comparable to the MTT-tetrazolium-based quantification assay of cell metabolism . All proliferation experiments (in triplicate) were repeated as independent experiments at least twice. For trypan blue exclusion floating and adherent cells were collected, diluted 1 : 1 with 0.4% trypan blue solution and scored under a light microscope.Treatment with rML was performed in presence of 2% FCS for 4 h followed by serum addition to 20% final serum concentration. For Annexin V-, Δ−1 or in 96-well plates using a Pantak Therapax 300 kV X-ray unit at 0.7 Gy min−1 and was always applied 1 h following rML treatment.The results represent the mean+s.d. of two independent experiments, with a minimum of 100 cells scored per treatment. Irradiation of cell cultures was carried out at room temperature in tissue culture dishes (100 × 100 mm) with a 6 MV linear accelerator at a dose rate of 2 Gy minμg ml−1 for 15 min at a final concentration of 5 4 per ml) were incubated with the cationic dye JC-1 for 5 min at 37°C and analysed by flow cytometry drastically reduced the proliferative activity of both p53-wild-type and p53-deficient transformed cell populations. The proliferative activity was reduced in both cell populations in a clear dose response as tested over a 72 h time period after treatment completely abrogated the metabolic activity (not shown). In parallel, the cytotoxic effect of rML-treatment in p53+/+ and p53−/− transformed cells was determined 24 h after treatment by PI exclusion. No significant difference in cell survival between these two cell lines was observed when cells were treated with increasing concentrations of rML (The effect of rML on tumour cell proliferation was tested in E1A/ras-transformed p53-wild-type (+/+) and p53-deficient (−/−) murine embryo fibroblasts. This tumour cell system was previously described for its strict p53-dependent response to treatment with IR and different cytotoxic drugs s of rML . Thus, tvs 6% Annexin V-positive cells). Treatment with increasing concentrations of rML induced a dose- and time-dependent increase of Annexin V-positive staining cells. After treatment with 0.1 ng ml−1 rML for 4 h 10 and 3%, and after 24 h 63 and 29% of the p53+/+ and p53−/− cells, respectively, stained Annexin V positive. Treatment with an increased concentration of rML (1 ng ml−1) for 4 h resulted in 41 and 36% Annexin V-positive cells, and after 24 h 94 and 68% of the p53+/+ and p53−/− cells stained Annexin V positive (0/G1 population. A distinct hypodiploid (sub-G1) cell population was observed after treatment with increasing rML-doses. No significant differences in the amount of p53+/+ and p53−/− cells with apoptotic nuclei was observed 24 h after incubation with 0.1 ng ml−1 and 1 ng ml−1 rML in these oncogene transformed cells. A large shift of Annexin V-binding-positive cells was detected 24 h after serum withdrawal in the p53+/+ but not in the p53−/− cell population . These rΨm). To investigate a change of ΔΨm on rML-treatment, p53+/+ and p53−/− cells were incubated for 6 h with 0.5 ng ml−1 rML. As a positive control experiment, cells were treated for 15 min with the K+-ionophore valinomycin (50 nM) or for 3 h with staurosporine (1 μM), which was previously shown to act as a p53-independent inducer of apoptosis . Likewise treatment of p53+/+ and p53−/− transformed cells with staurosporine and rML reduced ΔΨm to a large extent in both cell population. Treatment with rML (0.5 ng ml−1) reduced the red/green-fluorescence ratio to 0.08 for the p53+/+ and to 0.22 for the p53−/− cell population showing p53-independent mitochondrial depolarisation by rML was determined in Apaf-1+/+ and Apaf-1−/− E1A/ras-transformed MEFs. Quantitative analysis of dead cells was performed with the trypan blue exclusion assay. A dose-dependent increase of cell killing was observed in wild-type E1A/ras-transformed MEFs, while Apaf-1-deficient cells were strongly resistant to rML-treatment (77 vs 20% cell death at 0.5 ng ml−1 rML) and 2 Gy induced an at least additive antiproliferative effect in both cell populations. Experiments to determine the antiproliferative effect of rML and IR were also performed against the human p53-mutated adenocarcinoma cell line SW480, which has previously shown to be rather radiation resistant activated caspase-3 in both cell population, supporting p53-independent apoptosis-induction by rML as observed on the cellular level (see above). When rML-treatment was combined with IR (2 Gy) formation of the active form of caspase-3 was at least additive in both p53+/+ and p53−/− cell population, suggesting that the increased antiproliferative effect by rML in combination with IR is because of enhanced apoptosis-induction.Formation of active effector-caspase-3 upon treatment with rML alone and in combination with IR was determined in cytosolic lysates derived from the genetically defined p53+/+ and p53−/− cells by Western blotting to further understand the combined effect on the molecular level. A caspase-3-specific antibody was used that recognises only the cleaved, active form of caspase-3 ribosome-inactivating proteins, induces apoptosis in p53-mutated tumour cells .in vitro and in vivo (The antiproliferative and cytotoxic effect of rML alone and in combination with IR was prominent both in the murine genetically defined, oncogene-transformed tumour cell system and in the human p53-mutated colon adenocarcinoma cell line. Even though the potential antitumour effect of mistletoe extracts has been linked to its immunomodulatory mechanism mediated by natural killer cells, lymphokine-activated killer cells and macrophages, a cytotoxic effect of purified protein components directed against tumour cells has been previously reported

Chiari disease is in general a congenital condition characterized by an anatomic defect of the base of the skull, in which the cerebellum and brain stem herniate through the foramen magnum into the cervical spinal canal. The onset of Chiari syndrome symptoms usually occurs in the second or third decade (age 25 to 45 years). Symptoms may vary between periods of exacerbation and remission. The diagnosis of Chiari type I malformation in patients with or without symptoms is established with neuroimaging techniques. The most effective therapy for patients with Chiari type I malformation/syringomyelia is surgical decompression of the foramen magnum, however there are non-surgical therapy to relieve neurophatic pain: either pharmacological and non-pharmacological. Pharmacological therapy use drugs that act on different components of pain. Non-pharmacological therapies are primarly based on spinal or peripheral electrical stimulation.It is important to determine the needs of the patients in terms of health-care, social, educational, occupational, and relationship issues, in addition to those derived from information aspects, particularly at onset of symptoms.Currently, there is no consensus among the specialists regarding the etiology of the disease or how to approach, monitor, follow-up, and treat the condition.It is necessary that the physicians involved in the care of people with this condition comprehensively approach the management and follow-up of the patients, and that they organize interdisciplinary teams including all the professionals that can help to increase the quality of life of patients. For several decades, the eponyms Arnold and Chiari have been used as synonyms to define conditions with ectopia of the cerebellar tonsils below the level of the posterior edge of the foramen magnum. The first case was described by Cleland in 1883. The most detailed original description, however, was made by Chiari in 1891. In the mid-1970s, the term Chiari was again used to name the syndrome.Chiari syndrome is a developmental malformation of the occipital mesodermal somites that can be associated to syringomyelia and hydrocephalus. The most extreme form consists of the herniation of structures of the lower cerebellum, the cerebellar tonsils, and brain stem through the foramen magnum, in such a way that parts of the brain enter the spinal canal, thickening and compressing it. Symptoms typically appear during adolescence or adulthood, and are not usually accompanied by hydrocephalus. In general, patients complain of recurrent headache, cervical pain, and progressive spasticity of the lower limbs.Among the many malformations of the craniocervical junction, Chiari type I syndrome and syringomyelia are noteworthy because of their prevalence and the seriousness of their symptom.The word syringomyelia means reed- or flute-like spinal cord. The disease affects both genders, although with slight predominance in women, and all races. Although most authors consider the average at presentation approximately 35 years -5, symptThere are two types of therapies to treat these malformations: surgical therapy, that should be considered for symptomatic patients and which main goal is the decompression of the foramen magnum; and non-surgical therapy, used to relieve the symptoms caused by neuropathic pain.Although malformations of the craniocervical junction are considered rare diseases (RDs) due to their low incidence, the increasingly frequent use of neuroimaging techniques in clinical protocols has led to such a large increase in the diagnosis of tonsil herniations that there is discussion in the medical literature about whether the prevalence figures known for these diseases should be revised. On the other hand, it is important to develop a consensus regarding the management and the therapeutic approach of these malformations, particularly, considering that in many cases they remain asymptomatic for years.A classification of the Chiari malformation and related issues about the disease, such as diagnosis and treatment is discussed below, as well as their social and health concernings.The classification of Chiari malformation recognizes five subtypes:Chiari type 0 malformation: characterized by an alteration in Cerebro Spinal Fluid (CSF) hydrodynamics at the level of the foramen magnum. Patients with this subtype have syringomyelia either without tonsil herniation or with only mild tonsil herniation-associated findings.Chiari type I malformation: caudal herniation of the cerebellar tonsils exceeding 5 mm below the foramen magnum. This malformation is typically associated with hydrosyringomyelia. It is not usually accompanied by descent of the brain stem or IV ventricle, nor associated with the presence of hydrocephalus.Chiari type II malformation: caudal herniation of the cerebellar vermis, brain stem, and IV ventricle through the foramen magnum. It is associated with myelomeningocele, hydrocephalus, and, less frequently, hydrosyringomyelia. Other types of intracranial defects may exist.Chiari type III malformation: consists of occipital encephalocoele, with some of the intracranial defects associated with Chiari II malformation.Chiari type IV malformation: cerebellar aplasia or hypoplasia, associated with aplasia of the tentorium cerebelli.Chiari type I malformation is undoubtedly the most frequent subtype. It can coexist with other defects, which are classified according the involved area:Spinal cord: The most frequent defect associated to Chiari I is syringomyelia. It is agreed that 40-75% of Chiari type I malformations have associated syringomyelia. In contrast, almost 90% of syringomyelias are associated with Chiari malformation. Syringomyelia is a chronic spinal cord defect in which a tubular cavity, or central cavitation, is present in several spinal cord segments Associated to Chiari type I malformation. B) Associated with other obstructive lesions of the foramen magnumType II: syringomyelia without obstruction of the foramen magnum, or idiopathic.Type III: syringomyelia with other diseases of the spinal cord. A) Spinal cord tumours B) Traumatic myelopathy C) Spinal arachnoiditis and pachymeningitis D) Myelomalacia due to compression of the spinal cord Type IV: Pure hydromyelia, usually associated to hydrocephalus.Bone malformations of the craniocervical junction occur in about 50% of the patients with Chiari type I malformation, although the frequency ranges from 45 to 60%, depending on the series.Posterior fossa volume anomalies are highly significant due to their pathogenic implications. It has been observed that the posterior fossa is narrower and smaller in patients with Chiari malformation than in the general population.Skull defects sometimes are underdiagnosed if appropriate diagnostic tools are not used. Empty sella turcica, platybasia (flattening of the skull base), basilar impression , third occipital condyle, and vestiges of the proatlas usually cause anterior compression of the bulbospinal junction, contributing, together with the posterior compression that Chiari malformation causes, to the reduction of the space for the neuroaxis at the level of the bulbospinal junction.Spine defects: Klippel-Feil anomaly, or fusion of the atlas to the occipital. Dens retroflexion and scoliosis may also be present. Scoliosis has been found in 50-70% of Chiari type II malformations, whereas the association seems to be less frequent in type I malformations, depending on the series. Scoliosis is almost always associated to syringomyelia and has a left curvature, unlike idiopathic scoliosis, which usually is a dextroscoliosis. In cases with syringomyelia, weakness of the spinal axial musculature is due to a progressive disorder of the motor neuron, which results in denervation of the paravertebral muscles.Ventricles and cisterns: Hydrocephalus only occurs in 3-10% of patients with Chiari type I malformation. In contrast, practically always occur in Chiari type II malformation.Meninges: Thinning of the meninges occurs at the level of the foramen magnum. Several bands of dura mater constricting the foramen magnum and posterior arch of the atlas are often present. In surgical series, arachnoiditis caused by repeated rubbing of the abnormally herniated cerebellar tonsils against the leptomeninge and dura mater in the foramen magnum has been reported. Arachnoiditis has been confirmed in postoperative histopathology studies and it is believed to increase as the herniation evolves in time.Brain: In Chiari I malformations, no associated cerebral anomalies exist. The only defect sometimes observed is thinning of the medulla oblongata and loss of folia in the herniated cerebellar tonsils. These findings do not have clinical implications.There is no universally accepted theory explaining the Chiari malformation and its associated anomalies. Even acquired forms of cerebellar tonsil herniation are recognised. Chiari I and II malformation tend to be more frequent in women and, in some subtypes of Chiari malformation, a genetic factor is beginning to be discussed. Two findings support the existence of a genetic factor: the familial association observed and the coexistence with genetic anomalies (Klippel-Feil or achondroplasia). Families with several members affected have been reported and Milhorat et al found thIn the Chiari I-syringomyelia complex, various pathogenic hypotheses are currently postulated, although the most accepted refer to a mechanical factor and an embryonic developmental anomaly -15.The onset of Chiari syndrome symptoms usually occurs in the second or third decade (age 25 to 45 years), although it is commonly earlier in patients with syringomyelia. Symptoms generally have an insidious onset and a progressive course. There is high clinical variability among patients, ranging from asymptomatic patients, patients with non-specific clinical manifestations, to patients with severe neurologic deficits.Symptoms may vary between periods of exacerbation and remission. Suboccipital headache is the most frequent symptom in these patients. The headache is located in the occipital and is of oppressive nature, increasing with Valsalva manoeuvres . The headache can also have non-specific features or a tensional profile.Neck pain is frequent and characterized by the absence of radicular distribution. It is associated to continuous, burning, deep-seated discomfort in the shoulders, nape, chest, and upper limbs. Neck pain usually increases with Valsalva manoeuvres.Vertigo can occur, particularly positional vertigo, or triggered by head movements. Other otological symptoms present in these patients are tinnitus and aural fullness. Occasionally, mild neurosensorial hearing loss, with peripheral vestibulopathy is found in otological evaluationsOther frequent symptoms are ocular, often with unremarkable neuro-ophthalmologic examination. The most frequent ocular symptoms are: retro-orbital headache, diplopia, photopsia, blurred vision, and photophobia.In very severe cases in which compression of the spinal cord or medulla oblongata occurs, symptoms of involvement of the motor or sensory pathways, or lower cranial nerves exist.Breathing-related sleep disorders were frequently reported in patients with craniocervical junction malformations. Chiari type I malformation should be considered in the differential diagnosis of central apnoeas in infants, especially when they are associated with other neurological sign or symptom. Some authors considered the presence of sleep disorders as an earlier marker of progressive brain stem dysfunction. -18Phenotypically, up to 25% of patients may have a short, or bull-like neck. In cases associated to syringomyelia, levoscoliosis may be present. In these patients, the involvement of various nervous structures result in mixed physical signs:First motor neuron: generalised hypereflexia, spasticity, and Babinski reflex, mostly in the lower limbs.Second motor neuron: atrophy, weakness, fasciculations, and areflexia, mostly in the upper limbs.Sensory system: central cord syndrome typical of syringomyelia.Cerebellum: nystagmus, ataxia, and dysmetria.Lower cranial nerves: affected in 15-25% of cases. The following findings may exist: vocal cord paralysis, soft palate weakness, lingual atrophy, cricopharyngeal achalasia, facial hypoaesthesia, and absent gag reflex .The delay from the onset of the disease to the diagnosis of any craneocervical junction malformation, before 1985 was significantly longer than after 1985 when magnetic resonance imaging became widely available in clinical practice. That period of time usually was shorther in the pediatric group. [The diagnosis of Chiari type I malformation in patients with or without symptoms is established with neuroimaging techniques; the preferred technique is magnetic resonance imaging (MRI) . MRI canAsymptomatic patients who are diagnosed of Chiari type I malformation without syringomyelia should not be considered as candidates for surgery. In asymptomatic Chiari type I malformation with syringomyelia, the opinion of neurosurgeons varies. In symptomatic patients, surgical treatment should be considered.Approximately 10% of patients with Chiari type I malformation have hydrocephalus. Various techniques are used to treat this malformation, but they all involve decompression at the foramen magnum.As in all surgical procedures, decompression of the foramen magnum in Chiari malformation is not free from complications. Most of them involve CSF disorders, which are usually present in about 10% of patients. These include CSF fistula, meningitis, hydrocephalus, or the progression of syringomyelia. Postoperative relief of preoperative pathologies was experienced in 83% of patients. Of the most common presenting symptoms, headache/neck pain and scoliosis, 12 and 17%, respectively, were not alleviated postoperatively. However, the mortality rate, which is usually due to respiratory arrest in the immediate postoperative period or a serious sequela, should be less than 2%. ,22Most patients experience an improved quality of life after surgery. The symptoms that improve most are mainly headache and neck pain, followed by symptoms attributable to direct compression of the cerebellum or brain stem . In contrast, the symptoms attributable to syringomyelia improve less.If syringomyelia persists, inadequate decompression of the craniocervical junction should be considered. Syringomyelia can reappear in up to 10-20% of patients, due to either inadequate decompression or excessive scar tissue formation, impairing CSF flow.In post-traumatic syringomyelia Figure , some auNeuropathic pain is caused by the lesion of junctional structures between the cerebral base and the cerebellum, and the cervical spinal cord. When a nervous system lesion occurs, different symptoms appear, some are due to loss of function when damage is severe and there is total disruption of nerve conduction; other symptoms are due to irritation Table Physical findings typical of neuropathic pain can be found, particularly:Allodynia: a painful response to a non-painful stimulus, such as, brushing the skin with a cotton wad or sponge.Hyperalgesia: an excessively painful response to a mildly painful stimulus, such as a slight prick.Pain therapy in Chiari/syringomyelia is problematic, as in any disease with low incidence, in which there is little scientific evidence. Given the high variability in intensity, severity, and location of symptoms, each patient must receive individualized treatment. Globally, there are two types of therapy: pharmacological and non-pharmacological.Neuropathic pain should be managed with a multifactorial approach using drugs that act on different components of pain, including disturbed neuronal activity and work activities.The role of physical therapy in the multidisciplinary process of rehabilitation is the management of the patient's physical.Taking into account the most frequent manifestations, the goals of physical therapy interventions include reduction of pain and spasticity, tone normalization, improvement of muscular activity and articular range of movement, balance and upright reactions re-education, and, facilitation of cervical spine, pectoral girdle, upper limbs, pelvic girdle, and lower limbs movements. There are different therapeutic options, physical therapy methods and techniques used to alleviate the pain: superficial and deep thermotherapy, electrotherapy, and massotherapy.Methods that merit comment because alleviate motor disorders are: general kinesitherapy, postural treatment, specific kinesitherapy and explain the broad array of symptoms associated to Chiari syndrome, which are related with the sensory organs, sensitivity, stability, balance, and motricity.The goals for craniosacral osteopathy are to eliminate the restrictions that oppose or limit normal CSF flow, in order to maintain constant hydrodynamic values, allowing an efficient supply to tissues and nerves to conserve homeostatic integrity.Interventions on the biomechanics of the craniosacral axis and actions on connective tissue restrictions and the extracellular matrix, where all the enzymatic metabolic and stimulus transmission processes take place , are theThe human being is conceived as a global being integrated by biological and psychological components in constant interaction with their environment. In this sense, chronic conditions, like Chiari syndrome and syringomyelia, involve a situation of change in which all the components of a person's health are implicated.The World Health Organisation (WHO) defines health as “a state of complete physical, mental and social well-being, and not just the absence of disease or illness.” The introduction of the social factor as an element that configures the state of well-being, together with the physical and mental factors, means that psychosocial care is needed to cope with a health problem like Chiari syndrome and syringomyelia.Therefore, a combined medical and psychological intervention is required for each patient, with the major objectives of reducing the psychosocial impact of the disease and improving the patient’s quality of life. In this context, psychotherapy is a therapeutic element that should be considered mandatory in the comprehensive management of patients with Chiari syndrome and syringomyelia. From this perspective, there are therapeutic options that reduce the psychosocial impact caused by the disease and improve the patient’s quality of life.The management of craniocervical malformations should begin with a correct and adequate diagnostic orientation and care of the patients, with a complete medical history and physical examination. Given the variability of their clinical expression, these malformations usually are not diagnosed in primary care centres, which are the natural gateway to the health-care system. They are identified primarily in specialized care or emergency rooms, where the patient is seen in episodes of disease exacerbation, since this conditon is usually oligosymptomatic or asymptomatic in early stages.The patients, in addition to an adequate diagnosis, usually require individualized health-care plans, as well as a prolonged follow-up of the disease. This care should be based on a trained effective social and health-care team, that includes health-care professionals and social services, with the active participation of the patient's social network ,49.Globally, the responsibilities of the general practitioner (GP) regarding patients with syringomyelia and/or Chiari syndrome are similar to those related to any patient with low prevalent chronic diseases. Once diagnosed, the task is to “accompany” the patient, attend to their needs and associated problems, and assess any signs of worsening of the condition .Thus, two phases can be identified regarding the relationship between the GP and the patient with syringomyelia and/or Chiari syndrome: the pre-diagnostic phase and the post-diagnostic phase.The pre-diagnostic phase depends almost exclusively on imaging studies, in this case, MRI. This fact makes the condition practically undiagnosable in the primary care clinic. Suspected patients have to be referred to a neurology / neurosurgery clinic, where they can be assessed and the presence or absence of the condition established.Once the diagnosis is made, patients should be reassured and, above all, informed that their symptoms are forms of expression of a possible craniocervical junction malformation, which in many cases can be corrected surgically. Also, control of the symptoms with the appropriate pharmacological therapy is critical. Based mostly on analgesia, in the first stages of the condition it is important to treat pain adequately.Another professional closely linked to these patients after diagnosis is the physiotherapist. The social worker also is a key figure in the multidisciplinary approach to the care of these patients in health centres. For the general practitioner, referral of these patients to the social worker should not just be a way of avoiding problems within the patient's social environment, but a way to share the load of care with these professionals.Finally, in dependent patients it is necessary to develop home care programmes, including the general practitioner, nurse, physiotherapist, and social worker. Although these patients comprise a small percentage of the total number of people with this syndrome, it is in these patients where primary care physicians must make an extra effort to address their needs .It is important to highlight the existence of advocacy groups that form a network with, among other objectives, the goal of disseminating health information to the community in order to increase the understanding, not only of this condition, but of many others, through conferences, seminars, or awareness campaigns at local and general levels. The dissemination of information related to craniocervical malformations from both health and social standpoints fulfill the need, often demanded by community members, for information on these diseases in particular, and on all Rare Diseases (RDs) in general. Information is considered as the first step in training and the keystone to any educational programme.The educational programme referred above consists of providing information and training to the professionals involved in different aspects in the care of patients with craniocervical malformations, fundamentally health-care and social personnel .Advising a person with craniocervical malformations regarding medical and legal issues can be very complex, and should be undertaken by a qualified and experienced specialist. The role of the medical professional is to provide up-to-date information, such as details of referrals and recommendations for other professionals, investigations developed, and recommended therapies .As mentioned before, this can be a disabling condition, and may cause full disability in some patients, often requiring legal support to claim economic aid, special occupational conditions, occupational disability, and disability degree certification.Work position adaptations, employment plans and promotion, insertion in the workplace or reinsertion after a prolonged sick leave, regardless of the worker's preparation and professional competence, are rights according to the legislation in force, but only if the degree of disability is 33% or more. Sometimes, this right is negotiated through collective agreements, as a result of disease or permanent total disability.It is important to determine the needs of the patients in terms of health-care, social, educational, occupational, and relationship issues, in addition to those derived from information aspects, particularly at onset of symptoms.It is critical and necessary for the patient to receive adequate and validated information from the professionals who will be caring for them, so it is necessary that health-care professionals improve their communication skills and provide information to the affected people.Since craniocervical malformations occur with diverse symptoms and an irregular course, these changing features are the factors which complicate most the timely diagnosis. Few primary care physicians are fully aware of these diseases and are capable to establish the diagnosis. It is necessary that professionals, especially primary care physicians, learn to identify the most characteristic symptoms of the most frequent craniocervical malformations (Chiari type I and syringomyelia) in order to develop a diagnostic suspicion and refer appropriately patients for diagnostic confirmation.On the other hand, it is necessary that the physicians involved in the care of people with this condition comprehensively approach the management and follow-up of the patients, and that they organize interdisciplinary teams including all the professionals that can help to increase the quality of life of patients. In these teams, physiotherapists, rehabilitation medical specialists, pain specialists, psychologists, etc. have a special role.The usefulness of different complementary support therapies should be verified, and should be included in the portfolio of services of the public health system whenever it is demonstrated that their use is beneficial for the patient.Finally, another aspect to highlight is the existing legislation and regulations that should be adapted to consider these diseases as a possible cause of disability and discapacity.The authors declare that they have no competing interests.

Psychological stress has been suggested to shorten cancer survival, but few studies have examined the effect of parental bereavement, and the results have been inconsistent. We identified all 21 062 parents who lost a child in Denmark from 1980 to 1996 and among them, 1630 parents with subsequent incident cancer formed the exposed cohort. We recruited 6237 incident cancer patients from a group of 293 745 randomly selected unexposed parents matched on family structure at the same time as the bereaved parents. All incident cancers in the two cohorts were followed to the end of 1997, or until they died. Cox proportional-hazards regression models were used to evaluate the hazard ratio (HR) of dying in exposed parents with cancer. The overall HR of dying from an incident cancer in exposed parents was 1.23 compared to parents with cancer who did not lose a child. The HRs were nearly identical to those in the unexposed parents for site-specific cancers like lung cancer, breast cancer, and other groups of cancers like cancers in all digestive organs, smoking-related cancers, alcohol-related cancers, hormone-related cancers, virus/immune-related cancers, and lymphatic/haematopoietic cancers. Death of a child is not a strong prognostic factor for cancer survival among parents diagnosed with cancer after the bereavement. However, a small impairment in overall cancer survival cannot be ruled out. Psychological stress may alter immune function that could influence tumour growth and metastasis , but wheThe death of a child is one of the greatest stresses , and mayWe investigated the effect of the death of a child on the overall and specific cancer survival in parents who lost a child. By using the data from nationwide registers, we had the opportunities to collect accurate information on exposure and follow-up, and detailed data on socioeconomic factors for confounder control.The cohort has been described elsewhere . IdentifFor cancer survival, follow-up started when participants were diagnosed with cancer and ended on date of death, emigration, or 31 December 1997, whichever came first. The main outcomes of interest were overall cancer survival, survival for site-specific cancers, and five subgroups of cancers in which stress could play a role in the aetiology: smoking-related cancers , alcohol-related cancers , virus and immune-related cancers , lymphatic/haematopoietic tissue cancers (ICD 7 codes 200–205) and hormone-related cancers .Cox proportional-hazards regressions were fitted to obtain the hazard ratios of dying with cancer, and to estimate 95% confidence intervals (CIs). Sociodemographic characteristics of the cohort members, such as age at entry , sex , school education , and residence were included in the models as potential confounders.We examined the relative risk in cancer survival between exposed and unexposed cohort members by length of time from the study entry (exposure) to cancer diagnosis , and also according to age, gender, and type of death of the deceased child or death by other causes).Similar analytic strategies were also applied to subgroups of cancers, and specific cancers with short or long expected survival .A total of 135 parents died of cancer among 461 incident cases in the exposed cohort, and 1630 parents died of cancer among 6237 incident cases in the unexposed group. The overall hazard ratios (HRs) for dying from cancer for both parents, fathers, and mothers in the exposed cohort were 1.23 , 1.26 (0.98–1.63), and 1.19 (0.93–1.52), respectively. We found no clear indication of a higher relative mortality rate in cancer patients diagnosed shortly after the bereavement . The HR of dying from cancer did not differ in bereaved parents according to age, school education, residence place, the number of children in the family, or the number of parents in the family (data not shown).Table 2We observed that parents who lost a child had a slightly shorter cancer survival than those who did not lose a child. This slightly shorter survival was not observed in any particular cancer group, nor was it associated with the sex or age of the parents, the type of bereavement, or the time since exposure. The effect could be causal or because of uncontrolled confounding.The possible link between psychological stress and cancer survival has generated a literature of contradictory findings. Some earlier studies suggested worse survival for breast cancer patients exposed to stress . In one We have previously shown that the death of a child was associated with a slightly increased cancer risk in mothers and suggested that stress-related health behaviours may account for this increased risk (Parents' response to the death of a child could vary with the elapsed time, type of bereavement, and personal characteristics . We founa priori, expected survival time.Psychological stress has been suggested to play a role in cancer progression through immune downregulation, poorer repair of damaged DNA, and alterations in apoptosis . Some haOur study has a number of advantages. We had access to valid classifications of exposure, and complete follow-up . All berOur study also has limitations. Firstly, we had no information on the stage of the disease when they were diagnosis or for cancer treatment, which are the most important factors for cancer progression. Secondly, we had no information on health behaviours after cancer diagnosis, or compliance to the treatment. Thirdly, the enrolled parents were young and had a low risk of cancer, which yielded limited statistical power especially for subgroups of cancer.In summary, we found a slightly reduced survival in bereaved parents and this may be due to confounding. The effect of psychological stress related to bereavement on cancer survival is likely to be small, if any effect exists at all.

The 2007/8 GP Access Survey in England measured experience with five dimensions of access: getting through on the phone to a practice, getting an early appointment, getting an advance appointment, making an appointment with a particular doctor, and surgery opening hours. Our aim was to identify predictors of patient satisfaction and experience with access to English primary care.8,307 English general practices were included in the survey . 4,922,080 patients were randomly selected and contacted by post and 1,999,523 usable questionnaires were returned, a response rate of 40.6%. We used multi-level logistic regressions to identify patient, practice and regional predictors of patient satisfaction and experience.After controlling for all other factors, younger people, and people of Asian ethnicity, working full time, or with long commuting times to work, reported the lowest levels of satisfaction and experience of access. For people in work, the ability to take time off work to visit the GP effectively eliminated the disadvantage in access. The ethnic mix of the local area had an impact on a patient's reported satisfaction and experience over and above the patient's own ethnic identity. However, area deprivation had only low associations with patient ratings. Responses from patients in small practices were more positive for all aspects of access with the exception of satisfaction with practice opening hours. Positive reports of access to care were associated with higher scores on the Quality and Outcomes Framework and with slightly lower rates of emergency admission. Respondents in London were the least satisfied and had the worst experiences on almost all dimensions of access.This study identifies a number of patient groups with lower satisfaction, and poorer experience, of gaining access to primary care. The finding that access is better in small practices is important given the increasing tendency for small practices to combine into larger units. Consideration needs to be given to ways of retaining these and other benefits of small practice size when primary care services are reconfigured. Differences between population groups may be due to differences in actual care received or different response tendencies of different groups. Further analysis is needed to determine whether case-mix adjustment is required when comparing practices serving different populations. Access to health services is a prerequisite for any high quality health care system. Conceptually, access can be classified as a dimension of care on its own, separated from dimensions of quality ,2 thoughThe possible deterioration in patient access to primary care led the Department of Health to create the Improved Access Scheme, in an effort to evaluate and further improve access by incentivising the ability to book ahead as well as the ability to get appointments rapidly . The schThe reports for the first two years of the survey indicated that positive experience and satisfaction was high in all five dimensions of access. However, the reports were limited to a descriptive exploration of the outcomes. In this paper, using data from the 2007/08 wave of the survey, we explore the factors associated with patient satisfaction and experience at the level of: (1) the patients; (2) the practices; and (3) the geographical region.The survey was administered by Ipsos MORI, on behalf of the Department of Health. Patient information was obtained using Primary Care Trust (PCT) registration records from the National Health Application and Infrastructure Services (NHAIS) database. The main outcomes of interest were the survey items that asked respondents about their experience and satisfaction with access to their general practice. Satisfaction and experience with access are two theoretically different aspects of care . The queInformation on patient characteristics was also collected in the questionnaire: age, gender, number of appointments in the last year, whether the patient was a parent or legal guardian, employment status, travel time from home to work, typical working hours, ability to take time away from work to visit GP surgery, limiting long-standing conditions, difficulty performing day-to-day activities because of limiting long-standing conditions, carer responsibilities and ethnicity. Measures of area deprivation and rurality were assigned to patients based on the Lower Super Output Area in which each resided. The full 2008 questionnaire is presented in Additional file th of January 2008, with two reminders sent out in February and March, while the closing date for completed surveys was the 2nd of April 2008. Overall 4,922,080 questionnaires were posted, with no more than 930 issued for any practice. Telephone help lines in 10 languages in addition to English were available for individuals who were unable to complete the questionnaire without additional assistance. The overall response rate was 40.6%, with 1,999,523 completed responses collected [In 2007/08, 8,307 out of 8,403 practices in England were included in the survey (reasons for exclusion included having fewer than 50 eligible patients). Patients were eligible to be selected for participation if they were aged 18 or over, with a valid NHS number and registered with the same practice continuously from the 1 July 2007 to the date of the sample extraction from the NHAIS on 18/19 November 2007. Patients were randomly sampled from each participating practice, with more patients selected in practices likely to have lower rates of response. The sample size for each practice was determined by the number of returned questionnaires likely to deliver a confidence interval of ± 7 percentage points, at the 95% level, for items Q2, Q3 and Q4 . The queollected . More deollected . The datFor this study, we obtained information about practice and PCT characteristics from other additional sources: the General Medical Services (GMS) database 2006; Super Output Area Indices of Multiple Deprivation 2004; and the Quality and Outcomes Framework (QOF) results for 2006/7. Practice level variables were: practice list size, full time equivalent GPs, ratio of full time equivalent GPs per 10,000 patients, overall reported achievement on 48 'stable' QOF indicators (i.e. introduced in 2004/05 and with minor or no changes in the first 5 years of the scheme), distance to nearest practice, emergency admissions per 1000 patients, standardised mortality ratios of people under 65, number of new registrations, total opening hours and extended opening hours. Measures of global practice population deprivation and rurality were created by aggregating scores across the patients in each practice sample. We constructed practice population measures of ethnic mix, percentage of people in full-time employment and age profile, using both the practice samples and the 2001 census. Both estimates are prone to error , however, the two measures correlated well for ethnic mix moderately well for age , but less well for rates of full-time employment (r = 0.537). In the analysis we used to estimates from the Census. Regional information was limited to three variables: Strategic Health Authority, number of practice staff in the PCT per 100,000 population, and walk-in centre attendance in the PCT per 100,000 population and had been established specifically to improve access to primary care.We used multilevel multivariate regression to investigate relationships between each dimension of satisfaction/experience and patient, practice and regional characteristics. The outcome variables were all binary (e.g. able/unable to get an urgent appointment), therefore we utilised logistic regression. We began with univariate analyses, examining each predictor separately, and followed these up with a multivariate analysis to control for relationships between predictors. We included the patient, practice and regional level predictor variables in the same multi-level analysis. The size of the dataset made it not feasible to model the full hierarchical nature of the data (respondents nested within practices nested within regions), therefore we adopted a two-level model that took account of the nesting of respondents within practices, and assigned the regional variables to the individual practices. Although this may have introduced some small error into the p-values for some predictors, p-values have not been used to gauge the importance of each predictor.The size of the sample was such that very small differences in scores were statistically significant, making significance alone a poor guide to the effect of each predictor. Therefore to assess strength of effect we used an approach based on the odds-ratio coefficient for each predictor variable. First, we rescaled each continuous predictor variable by subtracting the mean and dividing by twice the variable's standard deviation. In analysis, these rescaled variables then yield odds-ratios comparable to those obtained comparing one level of a categorical variable with another . Second,We conducted one multivariate analysis on the full sample of patients, and a second using only those patients in full- or part-time employment. Three variables that were only applicable to patients in employment were included in the second analysis only.We excluded patients with any missing data, since the sample size was large enough to allow us to avoid less robust approaches. We examined the set of independent variables for multi-collinearity prior to analyses and removed those with a variance inflation factor greater than four . One varTable Patient age, employment status, and ethnicity were associated with satisfaction and experience in all five domains Table . SatisfaPractice size was a strong practice-level predictor, with larger practices receiving poorer ratings on all domains of satisfaction and experience. Figure Two variables potentially measuring aspects of quality of care were also associated with scores on this questionnaire. Patient ratings were higher for practices with higher scores on the Quality and Outcomes Framework, and lower for those with higher rates of emergency admission. Relative to an 80% baseline, we estimate from the regression results that an increase in QOF reported achievement of 10 points was associated with an increase in satisfaction and experience rating of up to 3.4% .The only regional predictor of note was location, as defined by Strategic Health Authority. On most domains, patients in the North East reported the higher levels of satisfaction/experience, while those in London reported the lowest.The patient- and practice-level predictor variables used in the regression models explained quite sizable percentages of the variability between practices Table . In the For patients in employment, satisfaction and positive experience in all domains was substantially higher amongst patients able to take time off work to visit their GP. Patients who had a commute of more than one hour to work were more dissatisfied on all domains than those with short commutes. Compared to part-time workers, people in full-time employment rated access as poorer on most domains. Those working normal office hours found it harder to get an immediate appointment and were less satisfied with practice opening hours than people with other working patterns. The raw means in table We conducted further analyses to examine whether individual patient responses were related to the distribution of these characteristics in the general population local to each practice . To examine this question we repeated the multi-level regressions adding in three interaction terms between patient and practice-population variables: patient ethnicity (white v non-white) by the percentage of whites in the practice population; patient age by percentage in the population under 45; patient working full-time by percentage in the population working full-time. These analyses controlled for differences in all other measured factors.Table 18 it is unlikely that any over-representation of females in the present case will have introduced bias since the effect of gender was estimated to be very small. It is also probable that non-respondents tended to be younger (mean practice patient age in the sample was 53.8 and in the 2001 census it was 47.3). Since younger patients tend to be more negative in their responses, satisfaction and positive experience with access might have been overestimated. However, a recent study of a later but similar questionnaire suggested that that response bias in practice estimates of access to care was small and not consistent in direction across individual questions in the survey [99% of practices in England were included in the survey resulting in a very large sample with almost two million respondents. The overall response rate to the survey was low (40.6%), and so results could have been affected by response bias. While previous research in patient satisfaction and experience with access suggests that non response is commoner among men,e survey . The repNonrepresentativeness may lead to bias in subgroup scores Tables and 2 asThe analyses identify patient and practice characteristics that explain quite substantial percentages - up to 30% - of the variation in practice access ratings. Patient demographic factors with the greatest impact on satisfaction/experience, across all domains of access, were age (older people more satisfied), ethnicity , and employment status . Amongst those in employment, we found that being not being able to take time off work to visit the GP was a key factor in determining responses across all domains. Other factors that freed up time, such as working part-time or having a short commute, were associated with more positive responses to the questionnaire. Despite substantial variation in reported practice opening hours, we found no notable relationship between total hours of availability and responses to any of the access questions - including satisfaction with opening hours themselves. This result held even among the working population.Practice size emerged from the analysis as the dominant practice-level factor influencing experience of access. Patients in small practices were generally reported easier access than patients in larger practices. Small practices were also less variable in terms of the access they provided. Satisfaction with telephone access was particularly increased in smaller practices. It may be that smaller practices can maintain a better ratio of telephone lines/administrative staff to volume of calls. This finding is consistent with previous studies, in which smaller practices were associated with high patient ratings of access and continuity of care -20. UsinWe found that patient ethnic identity affected reported satisfaction and experience on all domains of access. Many factors are known to influence the way in which different patient groups rate their care, including differences in health needs, expectations, and response tendencies, as well as experience per se -23. SomeThese findings are broadly consistent with other literature on patient evaluations of their care. Studies in both the UK and in other countries have found that younger patients, patients from ethnic minority groups and patients living in socio-economically deprived localities tend to have less favourable evaluations of their care compared to older, white or affluent populations ,25. ThesSatisfaction and experience on some domains also appeared to be related to aspects of the quality of care provided by the practice - Quality and Outcomes Framework clinical indicator scores and rates of emergency admission. Previous research has not always found consistent relationships between access to primary care and rates of preventable hospital admission ,28. Our The authors declare that they have no competing interests.All authors were involved in conceptualizing and planning the study. EK and DR decided on the analyses and EK carried them out. EK drafted the manuscript and MR and DR critically revised it. All authors contributed to the interpretation of the results. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2296/11/61/prepub2008 GP patient survey questionnaire.Click here for file

Vaults are the largest known cytoplasmic ribonucleoprotein structures and may function in innate immunity. The vault shell self-assembles from 96 copies of major vault protein and encapsulates two other proteins and a small RNA. We crystallized rat liver vaults and several recombinant vaults, all among the largest non-icosahedral particles to have been crystallized. The best crystals thus far were formed from empty vaults built from a cysteine-tag construct of major vault protein (termed cpMVP vaults), diffracting to about 9-Å resolution. The asymmetric unit contains a half vault of molecular mass 4.65 MDa. X-ray phasing was initiated by molecular replacement, using density from cryo-electron microscopy (cryo-EM). Phases were improved by density modification, including concentric 24- and 48-fold rotational symmetry averaging. From this, the continuous cryo-EM electron density separated into domain-like blocks. A draft atomic model of cpMVP was fit to this improved density from 15 domain models. Three domains were adapted from a nuclear magnetic resonance substructure. Nine domain models originated in ab initio tertiary structure prediction. Three C-terminal domains were built by fitting poly-alanine to the electron density. Locations of loops in this model provide sites to test vault functions and to exploit vaults as nanocapsules. Vaults are large barrel-shaped particles found in the cytoplasm in all mammalian cells, which may function in innate immunity. As naturally occurring nanoscale capsules, vaults may be useful objects to engineer as delivery vehicles. In this study, we propose an atomic structure for the thin outer shell of the vault. Using x-ray diffraction and computer modeling, we have inferred a draft atomic model for the major vault protein, which forms the shell-like enclosure of the vault. The shell is made up of 96 identical protein chains, each of 873 amino acid residues, folded into 14 domains. Each chain forms an elongated stave of half the vault, as well as the cap of the barrel-like shell. Our draft atomic model is essentially an atomic-level model for the entire 9.3-MDa vault shell, which offers a guide for protein engineering to test vault functions and to exploit vault particles as nanocapsules. A draft atomic structure has been determined for the 9.3-MDa protein shell of the vault cytoplasmic particle, revealing stave-like polypeptides forming the barrel-like structure of the vault. The mass of a rat liver vault is about 13 × 106 Da [Vault ribonucleoprotein particles are found in the cytoplasm of most eukaryotic cells . Ninety-3 . The MVP× 106 Da .Pseudomonas aeruginosa in lung epithelial cells at an early stage of infection, and MVP knockout mice [Vaults were recently shown to have a protective role in innate immunity . MVP co-out mice , which dout mice and cellout mice –12; howeVault structure has previously been probed by transmission electron microscopy, cryo-electron microscopy (cryo-EM), and nuclear magnetic resonance (NMR). Multi-image averaging greatly clarified the cryo-EM image of the MVP shell . Vault aExtending the cryo-EM vault structure via crystallography to derive an atomic model is of great potential value in designing modifications of the vault structure and to elucidate function. The crystallographic difference-Fourier technique applied to future cocrystals could precisely localize internal vault components, while indicating their shapes and thus orientations relative to the MVP shell.Phasing was initiated by manual placement of cryo-EM electron density of a half vault at a crystal 2-fold axis see . The phaThe featureless cryo-EM electron density separated into globules in the more plausible 48-fold averaged electron density map , indicatThis initial 48-fold averaging was later improved by “dot model refinement,” applying concentric 24-fold were built into the electron density map resulting from “dot model refinement” . BecauseThe 15 domain models from three sources are shown as panels of The MVP structure in the “crossover zone” , and 5K 3 whole-vault model . Positive charges clustered by the fold were found on the inside surface of the vault at domain 10 . Residues 102–112 and 277–305 could not be placed in density. The site that 277–305 would occupy is slightly above the location indicated by cryo-EM analysis as the site with most binding energy for the MVP interaction domain of VPARP . Atoms oThe draft model provides a list of sequence positions likely to be loop structures where ligand-binding sequences may be inserted. Passenger proteins could then be targeted to the vault interior or exterior . The esThe draft model of the vault shell offers new conjectures about vault function. It has been suggested that vaults may interact with lipid rafts . A bulk An amphiphilic crevice that could bind lipid was found at the top of the vault shoulder. The inner surface of the crevice H is formThe draft model hints at the origin of the striking eight-petal geometry of the collapsed vault structure . How do An MVP C-terminal structure very similar to the nonequivalent C termini of this model top of L could bThese few examples of new insights into vault engineering and vault function demonstrate the potential usefulness of the draft model of the vault shell described in this paper.The vault construct most successful for crystallography thus far was cpMVP . The N-2, and 0.2% n-octyl-β-D-glucopyranoside (β-OG). If a 1-mM dithiothreitol (DTT) solution was used instead of water to keep the volumes constant, the reservoir DTT concentration was about 0.8 mM. DTT seems to delay crystallization while encouraging growth of the favored C2 crystal form. The glycerol and detergent minimally affected crystallization, but they did facilitate later cryoprotection and reduce surface tension around the crystal. The volume of water (or 1 mM DTT) in the reservoir was critical to set the destination vapor pressure; one pipet was calibrated to deliver this volume. The precipitant solutions contained 0.27%–0.33% PEG 8000, 1.5% glycerol, 0.025 M Na MOPS, pH 7, 0.02 M MgCl2, and 0.1% β-OG. The total volumes were completed with water . The precipitant mixtures were centrifuged at 10,000g for 3 min. The hanging drops were made by mixing 1.5-μl vault and 3-μl precipitant solutions. The air volume was initially saturated with cyclohexane 8000, 3% glycerol, 0.05 M Na MOPS, pH 7, 0.044 M MgClxane see . Crystalxane see . Diffracxane see .z-axis shown in the self-rotation function Click here for additional data file.Figure S2The vault crystals were cryoprotected without osmotic shock by this microdialysis protocol.(47 KB PDF)Click here for additional data file.Figure S3The self-rotation function indicated the orientation of the vault in the crystal.(88 KB PDF)Click here for additional data file.Figure S4Using cryo-EM electron density, initial phasing was attempted by automated molecular replacement, but abandoned due to inaccuracy.(63 KB PDF)Click here for additional data file.Figure S5Initial reflection phases were calculated from the manually placed and rotated cryo-EM electron density. The figure shows the main steps of this placement.(86 KB PDF)Click here for additional data file.Figure S6The half vault manually placed on a crystal 2-fold axis snugly packs the cell. The figure shows a section through the packed cell and the lack of phasing model for the N termini in the waist region of the vault.(63 KB PDF)Click here for additional data file.Model S1This partially-assembled cpMVP model is more convenient to examine than the full model B. The fihttp://www.gzip.org/. Some molecular viewer software options for the PDB file format are listed at http://www.rcsb.org/pdb/.The file is compressed with gzip. Download uncompression tools from (396 KB GZ).Click here for additional data file.Text S1Qualitative and quantitative validation is discussed.(78 KB PDF)Click here for additional data file.Text S2(19 KB PDF)Click here for additional data file.Text S3This text lists suppliers, part numbers, and derivation of the part numbers for the low-cost, vibration-damping platforms used underneath the most recent vault crystallizations.(12 KB PDF)Click here for additional data file.Text S4(71 KB PDF)Click here for additional data file.Text S5(54 KB PDF)Click here for additional data file.Text S6Cryo-EM electron density was manually placed in the crystal cell to initiate the phase set.(14 KB PDF)Click here for additional data file.Text S7Reflection phases were improved by symmetry averaging and solvent flattening, leading to the conclusion that MVP folds into domains.(19 KB PDF)Click here for additional data file.Text S8This text presents the detailed protocol used for further evolution of the x-ray reflection phases and of the envelope around the vault.(79 KB PDF)Click here for additional data file.Text S9(92 KB PDF)Click here for additional data file.Text S10(11 KB PDF)Click here for additional data file.http://www.rcsb.org/pdb) with accession code 2QZV. The 96-mer vault nanocapsule accession number for rat liver MVP sequence is Q62667.The GenBank (

Gene expression alterations have previously been associated with type 2 diabetes, however whether these changes are primary causes or secondary effects of type 2 diabetes is not known. As healthy first degree relatives of people with type 2 diabetes have an increased risk of developing type 2 diabetes, they provide a good model in the search for primary causes of the disease.KIF1B and GDF8 (myostatin). LDHB was found to have a decreased expression in both groups compared to controls.We determined gene expression profiles in skeletal muscle biopsies from Caucasian males with type 2 diabetes, healthy first degree relatives, and healthy controls. Gene expression was measured using Affymetrix Human Genome U133 Plus 2.0 Arrays covering the entire human genome. These arrays have not previously been used for this type of study. We show for the first time that genes involved in insulin signaling are significantly upregulated in first degree relatives and significantly downregulated in people with type 2 diabetes. On the individual gene level, 11 genes showed altered expression levels in first degree relatives compared to controls, among others We hypothesize that increased expression of insulin signaling molecules in first degree relatives of people with type 2 diabetes, work in concert with increased levels of insulin as a compensatory mechanism, counter-acting otherwise reduced insulin signaling activity, protecting these individuals from severe insulin resistance. This compensation is lost in people with type 2 diabetes where expression of insulin signaling molecules is reduced. Type 2 diabetes is a complex and multi-factorial disease involving both genetics and pre- and postnatal environmental etiological factors. The genetic importance in the pathogenesis of type 2 diabetes is indicated by several lines of evidence from studies of both twins and first degree relatives of people with type 2 diabetes The underlying genetics of type 2 diabetes is very complex and it is clear that several genes play a role making this a polygenic disease. Furthermore, there are several different combinations of the so-called ‘diabetogenes’ that can lead to type 2 diabetes under the influence of certain environmental conditions Skeletal muscle accounts for approximately 75% of the glucose uptake after a meal, and accordingly has a major impact on overall glucose homeostasis First degree relatives of people with type 2 diabetes are as a group very interesting since they have a greatly increased risk of developing type 2 diabetes compared to the background population Given the fact that type 2 diabetes is a polygenic disorder, the microarray technology simultaneously measuring the expression of thousands of genes is well suited for studies of this disease. We determined the expression profiles in skeletal muscle from people with type 2 diabetes, first degree relatives, and healthy control individuals by microarray experiments. All subjects were Caucasian males and biopsies were taken after a controlled metabolic period of a two hour hyperinsulinemic euglycemic clamp. Our results show for the first time that insulin signaling is significantly downregulated in people with type 2 diabetes, whereas it is significantly upregulated in first degree relatives. Furthermore, we identify several new genes in skeletal muscle from first degree relatives that have an altered gene expression compared to healthy controls.2/min hyperinsulinemic euglycemic clamp. The insulin concentration was acutely raised and maintained by a continuous infusion of insulin and the glucose concentration was held constant at basal levels (5 mmol/L), by variable glucose infusion. After 2 hours, biopsies were taken from the vastus lateralis muscle of each subject using a Bergström needle under local anesthesia. Samples were immediately frozen in liquid nitrogen and saved for later use.Male subjects comprised three experimental groups; healthy controls, people with type 2 diabetes, and first degree relatives . The firThe study protocol was in accordance with the Helsinki Declaration II, and approved by The Danish Research Agency (KA 01122 g), and by The Danish Data Protection Agency (J.nr. 2001-41-1531). All subjects signed an informed consent form before entering the study.t-test was used to identify statistically significant differences between the groups. Data are presented as mean values±SD, and values of P≤0.05 were considered to be significant.Statistical analyses were performed with SAS Statistical Analysis Package . Two-sided Student's www.affymetrix.com). These arrays contain approximately 54,000 probesets representing approximately 47,000 transcripts.After homogenization, total RNA was isolated from the skeletal muscle biopsies using Trizol reagent from Invitrogen as specified by the manufacturer. The RNA subsequently went through a clean-up step using the RNeasy Mikro kit from Qiagen. Fragmented biotinylated cRNA was made and hybridized to Affymetrix Human Genome U133 Plus 2.0 Arrays and scanned following guidelines from Affymetrix (http://biosun1.harvard.edu/complab/dchip/). The fold change (FC) was set to >1.2, the p-value<0.05 (unpaired t-test), with a lower 90% confidence bound of FC, and the difference between experiment and control intensity value was set to be more than 30. The false discovery rate (FDR) was determined using a permutation approach and should be less than 5%.Cell intensity files (CEL files) were generated in the program GCOS from Affymetrix. A quality control report was subsequently made using Bioconductor, and the data were modeled using the RMA (Robust Multichip Average) approach http://www.genmapp.org/). Here the criteria were set to: FC>1.2, p-value <0.05, and the intensity value >30. Functional analyses were also performed using the program Ingenuity Pathway Analysis (IPA), using the FC>1.2, p-value <0.05 criteria. The microarray data is described in accordance with MIAME guidelines.Functional analyses were made using the program GenMAPP/MAPPFinder −ΔΔCt). The PPIA (cyclophilin A) gene was used as an endogenous control. Calculating the FC in this way, only one value including all replicates is obtained and accordingly standard deviations are reported for Ct values and not fold changes.Quantitative RT-PCR was performed for selected genes in order to validate the results obtained in the microarray study. cDNA was produced from 0.5 µg of each RNA sample using the ‘High Capacity cDNA Reverse Transcription Kit’ from Applied Biosystems. The last step of the experiments was performed using TaqMan Low Density Arrays (customized) and the ‘TaqMan Universal PCR Master Mix’ both from Applied Biosystems following company guidelines. The arrays were run on the 7900HT system and data were analyzed using the SDS 2.1 software from Applied Biosystems. The Ct value for each sample was determined at least twice on different arrays, and the average was used to calculate relative fold changes from the same skeletal muscle samples used for the microarray study were separated on 10% BIS-TRIS gels and proteins were transferred to nitrocellulose membranes . After blocking, the membranes were incubated overnight with primary antibodies against IRbeta and PGC-1alpha followed by a second incubation with HRP-conjugated anti-rabbit antibody from Cell Signaling (#7074). The signal was detected with LumiGLO reagent and bands were visualized using the LAS-3000 Image-reader from Fujifilm. Band intensities were quantified using the Multi Gauge V2.0 software (Fujifilm).We determined the gene expression profiles in skeletal muscle biopsies from healthy individuals, people with type 2 diabetes, and first degree relatives. For simplicity reasons these groups will be termed ‘C’ (controls), ‘D’ (diabetics), and ‘R’ (relatives). Gene expression values were determined using the microarray technology from Affymetrix as described above. All subjects were Danish Caucasian males, and all biopsies were taken after a 2 hour hyperinsulinemic euglycemic clamp as previously described The expression levels of individual genes were compared between groups using the program dChip. All genes found to be regulated and their fold changes are listed in the online INSR), insulin receptor substrate 2 (IRS2), protein phosphatase 1 (PPP1CB), lipoprotein lipase (LPL), hexokinase 2 (HK2), phosphorylase kinase (PHKA1), forkhead box O3A (FOXO3A), histone deacetylase 7A (HDAC7A), and NADH dehydrogenase (NDUFS1) (Employing the cutoffs described in the (NDUFS1) .COL1A1), collagen 3 alpha 1 (COL3A1), growth differentiation factor 8 (GDF8), kinesin family member 1B (KIF1B), lactate dyhydrogenase B (LDHB), PDZ and LIM domain 5 (PDLIM5), trophoblast-derived noncoding RNA (TncRNA), golgi autoantigen, golgin subfamily A 8A (GOLGA8A), AT rich interactive domain 5B (ARID5B), LON peptidase N-terminal domain and ring finger 2 (LONRF2), and an EST with some exceptions like IRS2 and RHEB (Ras homolog enriched in brain)) did not live up to the FC>1.2 criteria.Thirteen genes found to be significantly differentially expressed in the ‘D’ group according to the chosen cutoffs in dChip, were further investigated by qRT-PCR online . All genCOL1A1 and COL3A1) did not meet the FC>1.2 criteria .Six of the 11 genes differentially expressed in the ‘R’ group were investigated by qRT-PCR online . All genPGC1α (PPARγ coactivator 1α) was slightly downregulated in the ‘D’ group (FC = −1.20), and PGC1β (PPARγ coactivator 1 β) was downregulated in the ‘R’ group (FC = −1.35). However, these differences were not statistically significant.Additionally, genes of particular interest not found on the dChip derived genelists where investigated with qRT-PCR and the results were compared to microarray results online . Using tAll Ct averages, standard deviations, and fold changes can be seen in the online The data were compared between groups by functional analyses using GenMAPP/MAPPFinder. Fold changes and p-values calculated in dChip were imported to the program, and the cutoffs were the following: FC>1.2, p-value <0.05, and the mean expression value >30. A higher number of genes applied to these criteria, than in the dChip analyses, where additional cutoffs were present.PPM1A, PPM1B, PPP1R9B, PPP2CB, and PPP2R5B).The top three functions/pathways for each comparison are shown in Functional analyses were also made using the Ingenuity Pathway Analysis (IPA) program, looking at general regulation of signaling pathways not discriminating between up- and downregulation of specific genes. The same cutoffs were used as in the GenMAPP/MAPPFinder analyses. Overall, IPA analyses confirmed the result obtained from the GenMAPP/MAPPFinder analysis; namely that insulin signaling is the main signaling pathway altered in both groups (data not shown).The alterations in expression of genes involved in insulin signaling found in the GenMAPP/MAPPFinder analyses can be seen in In order to validate our results at the gene expression level, protein levels of the IR and PGC1α were determined by western blot analysis for all samples of the 3 experimental groups. In this study, skeletal muscle biopsies from male subjects with type 2 diabetes, first degree relatives, and healthy controls were investigated at the gene expression level using the microarray technology. The first degree relatives were slightly hyperinsulinemic in the fasting state and only mildly insulin resistant compared to type 2 diabetics, making them as close to the background population as possible. The same level of insulin resistance has previously been found in first degree relatives The biopsies were taken after a 2 hour hyperinsulinemic euglycemic clamp thereby ensuring a constant and controlled metabolic environment. When analyzing the data it should be kept in mind that for genes regulated by insulin, any change in expression could simply be a direct consequence of insulin resistance, since the muscle tissue is subjected to high levels of insulin during the clamp. Nonetheless, all differences seen between groups are genuine differences since all groups were treated in the same way. Furthermore, we were unable to completely match subjects for advanced age and elevated BMI in this study, which are known characteristics of patients with overt type 2 diabetes. Accordingly, we cannot exclude the possibility that age and/or BMI per se contributed to the differences found in patients with type 2 diabetes. However, this does not change the overall finding and conclusion that genes involved in insulin signaling are upregulated in people at risk of – and prior to - type 2 diabetes development, and subsequently are downregulated in the diabetic state.Overall, differences in expression were found to be modest with FCs ranging between 1.2 and 1.4 for most genes. However, even small changes in gene expression can have a major biological impact, and using pathway analysis tools we show that even small changes on an individual gene level can lead to highly significant changes when combined for an entire pathway.TCF7L2 ), which is downregulated in the ‘D’ group and unaltered in the ‘R’ group. This observation can be explained by the fact that SLC2A4 expression is increased during a hyperinsulinemic clamp in healthy muscle but not in type 2 diabetic muscle VAMP2 . PossiblOxidative phosphorylation (OXPHOS), which has previously been shown to be downregulated in both prediabetic relatives and people with type 2 diabetes NDUFS1), NADP transhydrogenase (NNT), 5-methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR), polymerase gamma (POLG), NADH dehydrogenase 2 (NDUFS2) were among others found to be down-regulated in the ‘D’ group to be upregulated in healthy first degree relatives in this study suggests that this factor could play an initiating role in the muscle wasting observed in many diabetic patients and potentially in the development of insulin resistance in the prediabetic stage.GDF8 is also known as myostatin, which works as an inhibitor of skeletal muscle growth and is a member of the TGF-beta family. Myostatin has been suggested as a good candidate for therapeutic intervention in diseases with loss of muscle mass, including diabetes. Indeed, an increased expression of this gene has been reported in skeletal muscle from chronic muscle wasting conditions such as cachexia and aging in human and animal models LDHB. LDHB catalyzes the conversion of pyruvate to lactate in the anaerobic glycolytic process and is therefore crucial for normal energy homeostasis. Mitochondrial ATP synthesis has been reported to be down in insulin resistant but non-diabetic offspring of parents with type 2 diabetes as well as in type 2 diabetic patients The only gene with a know function found to have altered expression levels in both the first degree relatives and the type 2 diabetics was HK2 was also found to have a reduced expression in muscle from type 2 diabetes patients have been identified and shown to have different gene expression levels in healthy first degree relatives compared to controls. These new findings in first degree relatives could potentially be used as a diagnostic tool in the prediction of type 2 diabetes. Further investigations in the future will be imperative in clarifying specific possible roles of these results in type 2 diabetes pathogenesis.Furthermore, several potentially important genes regarding the underlying causes of insulin resistance and type 2 diabetes Click here for additional data file.Table S1Table showing all genes found to apply to all criteria set in a dChip analysis comparing people with type 2 diabetes with controls, and first degree relatives with controls. Fold changes (FC) and gene names are listed.(0.22 MB DOC)Click here for additional data file.Table S2Averages of biological replicate Ct values and their standard deviation (SD). Ct values for 29 genes were determined for all samples. The first degree relative and control groups consisted of 15 people and each sample was run in two independent experiments. The type 2 diabetes group consisted of 5 people, and each sample was run in three independent experiments. ΔCt values and averages were calculated. Relative fold changes were calculated as: FC = 2-ΔΔCt.(0.09 MB DOC)Click here for additional data file.

Isavirus, family Orthomyxoviridae. ISAV agglutinates erythrocytes of several fish species and it is generally accepted that the ISAV receptor destroying enzyme dissolves this haemagglutination except for Atlantic salmon erythrocytes. Recent work indicates that ISAV isolates that are able to elute from Atlantic salmon erythrocytes cause low mortality in challenge experiments using Atlantic salmon. Previous work on ISAV-induced haemagglutination using the highly pathogenic ISAV strain NBISA01 and the low pathogenic ISAV strain RPC/NB-04-0851, showed endocytosis of NBISA01 but not RPC/NB-04-0851. Real-time RT-PCR was used to assess the viral RNA levels in the ISAV-induced haemagglutination reaction samples, and we observed a slight increase in viral RNA transcripts by 36 hours in the haemagglutination reaction with NBISA01 virus when the experiment was terminated. However, a longer sampling interval was considered necessary to confirm ISAV replication in fish erythrocytes and to determine if the infected cells mounted any innate immune response. This study examined the possible ISAV replication and Type I interferon (IFN) system gene induction in Atlantic salmon erythrocytes following ISAV haemagglutination.Infectious salmon anaemia (ISA) virus (ISAV), which causes ISA in marine-farmed Atlantic salmon, is an orthomyxovirus belonging to the genus 50) by 5 days of incubation. Moreover, reverse transcription (RT) quantitative PCR used to compare mRNA levels of key Type I IFN system genes in erythrocyte lysates of haemagglutination reactions with the two ISAV strains showed a higher relative fold increase of IFN-α in NBISA01 haemagglutinations compared to RPC/NB-04-085-1 haemagglutinations (33.0 – 44.26 relative fold increase compared to 11.29). Erythrocytes exposed to heat-inactivated virus or to polyinosinic:polycytidylic acid (polyI:C) or to L-15 medium alone (negative control assays) had minimal late induction (<3.5 relative fold increase) of STAT1 and/or ISG15 and Mx genes, whereas erythrocytes exposed to UV-inactivated virus lacked any cytokine induction.Haemagglutination assays were performed using Atlantic salmon erythrocytes and one haemagglutination unit of the two ISAV strains, NBISA01 and RPC/NB-04-0851, of differing genotypes and pathogenicities. Haemagglutination induced by the highly pathogenic NBISA01 but not the low pathogenic RPC/NB-04-0851 resulted in productive infection as evidenced by increased ISAV segment 8 transcripts and increase in the median tissue culture infectious dose (TCIDISAV-induced haemagglutination by a highly pathogenic virus strain results in virus uptake and productive infection of Atlantic salmon erythrocytes accompanied by significant induction of IFN-α. This study also highlights the critical role of ISAV strain variation in the initial stages of the virus-cell interaction during haemagglutination, and possibly in the pathogenesis of ISA. Moreover, the study shows for the first time that fish erythrocytes immunologically respond to ISAV infection. Salmo salar L). This fish disease is caused by ISA virus (ISAV), a fish orthomyxovirus assigned to the genus Isavirus within the family Orthomyxoviridae the lower sensitivity of the virus titration in TO cell line compared to real-time RT-PCR, [2] the fact that real-time RT- PCR also detects non infectious or defective particles which the TCID50 does not, and [3] the fact that the virus replication associated with haemagglutination involved only a single cycle of virus replication as multiple haemagglutination events were unlikely. It is interesting to note that avian erythrocytes also demonstrate virus uptake during haemagglutination by influenza A virus and show de novo synthesis of viral proteins but not production of new infectious virus particles [In the present study we set up haemagglutination assays in L-15 growth medium to compare two phenomena (elution and uptake) of the ISAV-induced haemagglutination of Atlantic salmon erythrocytes between virus strains of differing pathogenicities. We found remarkable differences in virus replication and quality of cytokine response in the fish erythrocytes. Real-time quantitative RT-PCR was used to assess the viral RNA levels in the haemagglutination reaction samples. Only the Ct values for the NBISA01 haemagglutinations showed any decrease from the 0 hour to day 5. This decrease was evident even when oligodT primers were used for cDNA synthesis, confirming that there was In addition to virus replication in haemagglutinations induced by the highly pathogenic NBISA01 strain, we found that there was also a higher relative fold increase of IFN-α transcripts than with the less pathogenic RPC/NB 04-085-1 strain which did not replicate in erythrocytes. The induction of the IFN-α gene closely followed the increase of NBISA01 transcripts in that by day 1 the viral transcripts started to increase simultaneously with the first peak of IFN-α transcripts. The NBISA01 haemagglutinations showed a pattern of fold increase with a peak of IFN-α and Mx transcripts for a shorter period of time. This pattern of induction is not continuous like the inductions in TO cells infected with ISAV . This maBoth the UV- and heat-inactivated preparations of both NBISA01 and RPC/NB-04-085-1 viruses and the L-15 medium assay (negative control) showed no haemagglutination. The UV-inactivated viruses also showed no induction of type I IFN system genes whereas the heat-inactivated viruses and the L-15 medium assay showed induction of the type I IFN system genes by day 5 similar to those due to polyI:C stimulation by day 3. The absence of haemagglutination in the UV-inactivated viruses was unexpected since the inactivation was directed towards the viral genome and not the surface glycoproteins required for haemagglutination. One possible explanation is that the UV lamp generated sufficient heat over the 18 hours of exposure to contribute to the denaturation of the virus surface glycoproteins. In contrast, the heat inactivation alone had no effect on the viral ssRNA genome but probably even disrupted the structural viral proteins so that the virus RNA was exposed and easily detected by the erythrocyte viral pattern recognition receptors so as to induce the observed minimal induction of the Type I IFN system genes. Alternatively, these minimal responses were non-specific since they were also seen with L-15 medium alone (negative control assays).STAT-1 expression has been studied in other fish species including rainbow trout but thisThe NBISA01 haemagglutination showed a moderate relative fold increase of PKZ transcripts. PKR gene has been characterized in rainbow trout , and cruIn the present work the RT quantitative PCR data showed varying levels of induction of key Type I IFN system genes IFN-α, Mx, ISG15, STAT1, and PKZ upon haemagglutination of erythrocytes by the highly pathogenic NBISA01 virus. This virus induced significantly high relative fold increase in IFN-α transcripts compared to the RPC/NB-04-085-1 virus although both viruses had similar levels of induction of Mx, ISG15 and STAT1. The slight Type I IFN system response with RPC/NB-04-085-1 haemagglutinations which involve only virus adsorption but no endocytosis and no rPolyI:C is a synthetic dsRNA that is detected either by the RNA helicases or the Toll-like receptor 3 (TLR3) to activate the transcription of type I IFN system genes (reviewed in ). This hIn conclusion, we report here that ISAV-induced haemagglutination by a pathogenic virus strain results in virus uptake and productive infection of Atlantic salmon erythrocytes accompanied by significant induction of IFN-α. This study also highlights the critical role of ISAV strain variation in the initial stages of the virus-cell interaction during haemagglutination, and possibly in the pathogenesis of ISA. Moreover, the study shows for the first time that fish erythrocytes immunologically respond to ISAV infection.Two ISAV isolates of differing genotypes and pathogenicities were used. NBISA01 is a highly pathogenic strain belonging to the North American genotype, whereas RPC/NB 04-085-1 is a low pathogenic strain of the European genotype found in eastern Canada and its HE protein places it in a unique, highly polymorphic region (HPR) group . The two2 at 1 meter from the lamp) suspended in a biological safety cabinet following the procedure reported by Oye and Rimstad [The viruses were inactivated by using either UV light or heat treatment. UV inactivation of ISAV was carried out with a germicidal UV lamp were not viable beyond 48 hours. Therefore, common fish cell line growth media, Leibovitz's L-15 (Invitrogen) and Hanks minimum essential medium (BioWhittaker) (HMEM), were tested to identify one that better maintained erythrocyte viability. Using the Trypan blue dye exclusion test, we found that erythrocytes resuspended in L-15 growth medium had lower cell deaths, and those surviving maintained a normal shape in contrast to erythrocytes in HMEM growth medium which were shrunken. In subsequent experiments, the erythrocytes were washed and then resuspended in L-15 medium supplemented with 10% foetal bovine serum, 2 mM L-glutamine, 100 IU/ml penicillin G, 100 μg ml-1 streptomycin, and 0.25 μg ml-1 amphotericin B. For determining the haemagglutination (HA) units of the stock virus preparations, haemagglutination reactions were set up using 50 μl of two-fold dilutions of the two virus isolates and 50 μl of 1% erythrocytes [Atlantic salmon erythrocytes were collected from specific pathogen free 100 g-Atlantic salmon using EDTA-coated Vacutainerhrocytes . The haeWashed Atlantic salmon erythrocytes were resuspended in L-15 medium consisting of 10% FBS, 2 mM L-glutamine, 100 IU ml-1 penicillin G, 100 μg ml-1 streptomycin, and 0.25 μg ml-1 amphotericin B, and polyinosinic:polycytidylic acid (polyI:C) (Amersham Biosciences) at a final concentration of 30 μg ml-1. One hundred microliters of 1% erythrocyte suspension was added to each well of the haemagglutination plate and incubated at 16°C. The preparations were sampled after 12, 24, and 72 hours.Total RNA from the haemagglutination samples was extracted from 375 μl of homogeneous erythrocyte suspensions using 1.25 ml of TRIZOL Reagent (Invitrogen). RNA extraction was performed from two separate samples at each sampling point, which were then pooled before DNase treatment using the DNase treatment kit (Roche) prior to RT-PCR amplification.DQ182560). The IFN gene primer set is designed in the common region of the two IFN-α subtypes, α1 and α2 [2 , and 13.4 μl of nuclease free water. The real time PCR programme for amplifying PKZ gene had a master mix consisting of 12.8 μl of water, 2.4 μl of 25 mM MgCl2 , 0.4 μl of the 10 μM forward and reverse primer, and 2 μl of SYBR Green master mix. The real-time PCR cycling conditions consisted of an initial denaturation at 95°C for 10 minutes to activate the hot-start polymerase, followed by 40 cycles of 95°C for 5 s, 59°C for 10 s (60°C for the PKZ gene), 72°C for 10 s, and detection at 80°C for 2 s. The cycle threshold (Ct) values, the number of cycles run in real-time RT-PCR when the fluorescence in the sample crosses a threshold value (background) and amplification enters a log-linear phase, were analyzed using LightCycler software version 3.5 (Roche). Melting curve analysis with the same software was performed from 70°C to 95°C in 0.1°C/s increments to verify the specificity of the amplicons so as to interpret SYBR Green fluorescence data. For determining amplification efficiency of each primer set . The cDNA synthesis used 125 ng of total RNA in a master mix consisting of 4 μl of 5x RT reaction buffer, 2 μl of dNTP mix (200 μM), 2 μl of random hexamer (600 μM) or oligodT (0.8 μg/μl), 0.5 μl RNase inhibitor 40 U/μl), 0.5 μl of Transcriptor reverse transcriptase (20 U/μl), and nuclease free water adjusted to a final volume for 20 μl. The RT step was programmed at 25°C for 10 minutes followed by 55°C for 30 minutes and a final enzyme denaturation for 5 minutes at 85°C. Real-time PCR used first strand cDNA template with LightCycler FastStart DNA Master SYBR Green I (Roche) in the LightCycler (LC) 1.2 (Roche). The PCR primer pairs used are listed in Table 1 and α2 . The 20 U/μl, 0.et al. [2 , and nuclease free water adjusted to a final volume of 20 μl. The cycling conditions consisted of one cycle of RT at 55°C for 30 min, initial denaturation at 95°C for 30 s followed by 50 cycles of 95°C for 5 s, 59°C for 10 s, 72°C for 10 s, and detection at 80°C for 2 s. The Ct values and melting curve data were analyzed using LightCycler software version 3.5 (Roche). Melting curve analysis was performed from 70°C to 95°C in 0.1°C/s increments to verify the specificity of the amplicons so as to interpret SYBR Green fluorescence data. The amplicons were also run in 1% agarose gel electrophoresis in 1x Tris acetate EDTA buffer (40 mM Tris acetate and 1 mM EDTA) (Fisher Scientific) and stained with ethidium bromide and photographed under 304 nm UV light.For quantifying the level of viral RNA, real-time RT-PCR was done using the RNA Amplification Kit SYBR Green I (Roche) and the primer pair designed by Devold et al. to ampliet al. , with mi-1 to 10-8, inoculated on 48-well cell culture plates containing TO cell monolayers using 4 wells per dilution, from which the median tissue culture infectious dose (TCID50) was determined as previously described [Total cell lysates of the haemagglutination assays were titrated to determine growth cycles of the virus strains in Atlantic salmon erythrocytes. Virus titration utilized serial 10-fold dilutions of the samples ranging from 10escribed . Each saThe author(s) declare that they have no competing interests.STW conducted all the experiments and wrote the manuscript. MJTK helped in designing the experiments and writing the manuscript. GMW and DWW helped in the initial stages of conceiving the study and edited the manuscript. DBG helped in designing the experiments and edited the manuscript. FSBK conceived the study, coordinated the research, and helped in designing the experiments, writing and editing the manuscript.

Children aged under five years with severe acute malnutrition (SAM) in Africa and Asia have high mortality rates without effective treatment. Primary care-based treatment of SAM can have good outcomes but its cost effectiveness is largely unknown.This study estimated the cost effectiveness of community-based therapeutic care (CTC) for children with severe acute malnutrition in government primary health care centres in Lusaka, Zambia, compared to no care. A decision tree model compared the costs and outcomes of CTC to a hypothetical 'do-nothing' alternative. The primary outcomes were mortality within one year, and disability adjusted life years (DALYs) after surviving one year. Outcomes and health service costs of CTC were obtained from the CTC programme, local health services and World Health Organization (WHO) estimates of unit costs. Outcomes of doing nothing were estimated from published African cohort studies. Probabilistic and deterministic sensitivity analyses were done.The mean cost of CTC per child was $203 $139–$274), of which ready to use therapeutic food (RUTF) cost 36%, health centre visits cost 13%, hospital admissions cost 17% and technical support while establishing the programme cost 34%. Expected death rates within one year of presentation were 9.2% with CTC and 20.8% with no treatment (risk difference 11.5% (95% CI 0.4–23.0%). CTC cost $1760 (95% CI $592–$10142) per life saved and $ 53 (95% CI $18–$306) per DALY gained. CTC was at least 80% likely to be cost effective if society was willing to pay at least $88 per DALY gained. Analyses were most sensitive to assumptions about mortality rates with no treatment, weeks of CTC per child and costs of purchasing RUTF.CTC is relatively cost effective compared to other priority health care interventions in developing countries, for a wide range of assumptions. Children aged under five years with severe acute malnutrition (SAM) in Africa have high mortality rates without effective treatment -5. HospiSeveral home-based RUTF programmes in developing countries have shown good outcomes -10. HoweLusaka, Zambia, provides an innovative example of large scale provision of CTC through government primary health care centres. Since 2005 the Lusaka District Health Management Team (LDHMT), which is responsible for the city's 25 primary health care centres, has steadily expanded CTC provision by its staff working in these health centres. By January 2008, 21 of the 25 LDHMT health centres were providing CTC. CTC clinics were set up within each health centre, each staffed by a nurse, a health educator and two volunteers. Nurses were trained to diagnose SAM in children under 5 years of age, by measuring mid upper arm circumference (MUAC) and examining children for bilateral pedal pitting oedema. SAM was defined as MUAC of 11 cm or less, or bilateral pitting oedema [Twenty volunteers attached to each health centre screened children at the health centres and in the community and referred those with SAM to CTC. Government and private sector nurses and traditional health practitioners working near to each health centre were trained and encouraged to identify and refer SAM cases. Popular art theatre discussions were held to raise community awareness of SAM and CTC. Valid International, a company specialising in nutritional research in developing countries, helped initiate the programme and provided technical support to the LDHMT for implementation and staff training. RUTF was manufactured in Lusaka or imported, and delivered to LDHMT medical stores free of charge.The aims of this study were 1) to describe the outcomes of CTC in Lusaka, 2) to estimate the costs of CTC and 3) to estimate the effectiveness and cost effectiveness of this type of CTC, compared to no treatment. The reasons for comparing CTC to no treatment were, first, to enable the cost-effectiveness of CTC to be compared to any other health care intervention and, second, because comparable data on costs of alternative ways of treating SAM in this population were not available.The study was a cost effectiveness analysis based on a decision tree model . Cost anThe structure of the decision tree is shown in Figure Model parameters are shown in Table For the 'do nothing' option, expected mortality was based on evidence from a review of child mortality rates associated with malnutrition in developing countries . In partFor the CTC option, outcomes at the end of health centre care were death, recovery, referral to hospital, or default Table . These oAll costs were expressed in international dollars for the year 2008. Unit costs measured in Zambian kwacha and UK pounds were deflated to their year 2000 equivalents , then coThe relevant types of cost were for health centre visits, RUTF, hospital admissions and Valid International's contribution to establishing the programme. Costs per health centre visit were based on the 2008 LDHMT budget, minus the proportion of the LDHMT budget devoted to non-health centre services , plus LDHMT staff salaries paid by the provincial health department. This total annual cost of health centre care was then divided by the number of health centre visits during 2007 to produce an average cost per health centre visit. The cost of community mobilisation was estimated from the 2008 LDHMT budget for community based child health activities, 10% of which was assumed to be for CTC . This was multiplied by 2.4 years of the CTC programme and divided by the 3358 children treated, producing a mean cost of community mobilisation per child. The cost per kilogram of RUTF in Zambia was estimated by Valid International. Programme data showed that the mean body weight per child was 7.4 (standard error 0.065) Kg, and that each child received 200 kcal/Kg/day, which is equivalent to 1.9 (standard error 0.016) Kg RUTF per week. Costs of ambulatory CTC were health centre unit costs plus RUTF costs, multiplied by the duration of treatment. Treatment duration was stratified by CTC outcome , and included administration, training, research, local and international travel, and consultancy. For each line item of expenditure, the proportion attributable to CTC was estimated by two senior Valid International personnel. This was divided by the number of children who received CTC over the same period, to produce an average cost to Valid International per child, regardless of duration of treatment.Costs per day of hospital inpatient care at the Lusaka University Teaching Hospital were not available and so were based on WHO estimates of tertiary hospital care in Zambia, adjusted to include drug costs . For chiThe cost effectiveness analysis was carried out with Tree Age Pro Healthcare software and checked with Microsoft Excel. Point estimates were calculated for costs, outcomes, CTC effect and incremental cost effectiveness ratios (CTC costs divided by CTC effect), using the point estimates for each model parameter.Probabilistic sensitivity analyses ,25 were Finally, one- and two-way sensitivity analyses were conducted. One way sensitivity analyses were calculated using the mean values of each parameter, and varying the values of one parameter at a time. Two way sensitivity analyses were conducted to examine the effects of simultaneously varying the values of two parameters.Patient's consent and research ethics committee approval were not necessary because the study was based on aggregate programme data and published literature and did not require access to individual patient records.CTC cost an average of $203 per child, 70% of which was due to RUTF and Valid International's costs per life saved and $ 53 (95% CI $18–$306) per DALY gained.CTC was more likely than not to be cost effective if society was willing to pay at least $1700 per life year gained Figure . CTC wasThe model was most sensitive to assumptions about expected mortality without treatment, weeks of CTC per child, effect of HIV on mortality without CTC, hospital referral rate, cost per kilogram of RUTF, quantity of RUTF consumed per week and technical support costs Table . Cost efThe study shows that CTC for SAM among children aged under five years in Lusaka results in good outcomes at a reasonable cost. The estimated cost of $1760 per life saved, or $53 per DALY gained, suggests that this model of CTC has a similar cost effectiveness to other priority child health interventions in Africa such as immunisation, micronutrient supplementation, and treatment of pneumonia and diarrhoea . The cosThe main strengths of this study are that 1) it was based on an innovative large scale programme implemented through government primary care health centres throughout a Zambian city, 2) it had original and up to date programme data on costs, outcomes and severity of SAM and 3) it compared the costs and outcomes of the programme with what would be expected without any intervention. Comparison with no treatment allows the cost effectiveness of this model of CTC to be compared with any other intervention in health, and not just to be considered as an incremental change to alternative nutrition strategies ,29. ThisThe main limitation of comparing CTC to doing nothing is that it is dependent on assumptions about the outcomes and costs of no health care for SAM. We do not know what these children's mortality rates would have been without treatment. Most recent studies of mortality among children with SAM have been among children who received treatment ,9,10. WeThe deterministic sensitivity analyses Table showed tSeveral other limitations and assumptions of the study should be considered. First, it would have been desirable also to have compared CTC with alternative ways of treating SAM. As stated in the Background, although other studies have compared outcomes of community- and hospital-based treatment of SAM ,12, onlyThe Lusaka model of CTC for SAM appears highly cost effective. This study suggests that this form of CTC should be expanded to the rest of Zambia and adapted for other African countries with high rates of SAM. Cost effectiveness could be increased in future with less external technical support, as CTC is increasingly implemented through government services, and by reducing RUTF costs through local and larger scale production and sourcing of components. Priorities for future research include controlled trials and economic evaluations of alternative ways of providing CTC, such as hospital-based care or selective SAM-only programmes. This requires prospective collection of individual level data on severity of SAM, HIV status, use of health services and outcomes, and active follow up of children who default.CTC: community-based therapeutic care; LDHMT: Lusaka District Health Management Team; MUAC: mid upper arm circumference; RUTF: ready to use therapeutic food; SAM: severe acute malnutrition; UNICEF: United Nations Children's Fund; WHO: Word Health Organization,The author received funding from Valid International and Concern to carry out the study.MOB designed the model, identified relevant parameters and data sources, carried out the analyses and wrote the paper.Max Bachmann is a health services researcher and public health physician who uses health economic and clinical epidemiological methods to evaluate innovative health care interventions to improve population health, such as child health care, HIV/AIDS care and chronic disease management, in Africa and the United Kingdom. Now at the University of East Anglia, he previously worked at the medical schools of the universities of Cape Town, Bristol and the Free State.

Enteroaggregative Escherichia coli (EAEC), an increasingly recognized cause of diarrhea in children in developing countries, has been particularly associated with persistent diarrhea (more than 14 days), a major cause of illness and death. Recent outbreaks implicate EAEC as a cause of foodborne illness in industrialized countries. The pathogenesis of EAEC infection is not well understood, but a model can be proposed in which EAEC adhere to the intestinal mucosa and elaborate enterotoxins and cytotoxins, which result in secretory diarrhea and mucosal damage. EAEC's ability to stimulate the release of inflammatory mediators may also play a role in intestinal illness.

Mol­ecules A and B are aligned edge-to-face, whereas mol­ecules B and C are aligned almost parallel to each other. The crystal structure displays C—H⋯π and π–π parallel-displaced inter­actions, and C—H⋯O hydrogen bonds.The asymmetric unit of the title compound, C Å b = 16.4509 (6) Å c = 15.8214 (5) Å β = 92.105 (4)°V = 3840.0 (2) Å3 Z = 12 Kα radiationMo −1 μ = 0.30 mmT = 293 (2) K 0.18 × 0.15 × 0.10 mm Bruker APEX area-detector diffractometerSADABS; Bruker, 2001T min = 0.948, T max = 0.971Absorption correction: multi-scan (18809 measured reflections6647 independent reflectionsI > 2σ(I)3093 reflections with R int = 0.061 R[F 2 > 2σ(F 2)] = 0.037 wR(F 2) = 0.071 S = 0.79 6647 reflections514 parametersH-atom parameters constrainedmax = 0.16 e Å−3 Δρmin = −0.18 e Å−3 Δρ SMART (Bruker, 2001SAINT (Bruker, 2001SAINT (Bruker, 2001SHELXS97 (Sheldrick, 1997SHELXL97 (Sheldrick, 1997ORTEP-3 (Farrugia, 1997SHELXL97 Data collection: 10.1107/S1600536807066469/ng2408sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536807066469/ng2408Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The mechanisms for the relationship between particulate air pollution and cardiac disease are not fully understood. Air pollution-induced myocardial ischemia is one of the potentially important mechanisms.2.5) on myocardium ischemic injury as assessed by ST-segment height in a community-based sample of 106 healthy non-smokers. Twenty-four hour beat-to-beat electrocardiogram (ECG) data were obtained using a high resolution 12-lead Holter ECG system. After visually identifying and removing all the artifacts and arrhythmic beats, we calculated beat-to-beat ST-height from ten leads . Individual-level 24-hour real-time PM2.5 concentration was obtained by a continuous personal PM2.5 monitor. We then calculated, on a 30-minute basis, the corresponding time-of-the-day specific average exposure to PM2.5 for each participant. Distributed lag models under a linear mixed-effects models framework were used to assess the regression coefficients between 30-minute PM2.5 and ST-height measures from each lead; i.e., one lag indicates a 30-minute separation between the exposure and outcome.We investigate the acute effects and the time course of fine particulate pollution (PM2.5 exposure was 14 (22) μg/m3. All inferior leads and two out of three lateral leads (I and V6), showed a significant association between higher PM2.5 levels and higher ST-height. Most of the adverse effects occurred within two hours after PM2.5 exposure. The multivariable adjusted regression coefficients β (95% CI) of the cumulative effect due to a 10 μg/m3 increase in Lag 0-4 PM2.5 on ST-I, II, III, aVF and ST-V6 were 0.29 (0.01-0.56) μV, 0.79 (0.20-1.39) μV, 0.52 (0.01-1.05) μV, 0.65 (0.11-1.19) μV, and 0.58 (0.07-1.09) μV, respectively, with all p < 0.05.The mean (SD) age was 56 (7.6) years, with 41% male and 74% white. The mean (SD) PM2.5 concentration is associated with immediate increase in ST-segment height in inferior and lateral leads, generally within two hours. Such an acute effect of PM2.5 may contribute to increased potential for regional myocardial ischemic injury among healthy individuals.Increased PM On the other hand, ST-height changes, including both ST depression and elevation, generally have been accepted as indicators of myocardial ischemic injury [2.5 on the ST-height, an ECG marker of myocardial ischemia, in a community-based sample of middle-aged adults.Numerous studies have consistently found a significant association between exposures to fine particulate matter, defined as fine particles with aerodynamic diameter less or equal to 2.5 micrometers (PMse (CVD) -4. The mse (CVD) have sugc injury ,12. We t2.5 on cardiac electrophysiology, blood coagulation, and systemic inflammation. Recruitment methods and examination procedures for the APACR study have been published elsewhere [For this report, we used the data collected for the Air Pollution and Cardiac Risk and its Time Course (APACR) study, which we designed to investigate the mechanisms and the time course of the adverse effects of PMlsewhere ,14. Brie2.5 and Holter ECG recorders. Participants were given an hourly activity log to record special events that occurred over the next 24 hours, including outdoor activities, exposure to traffic on the street, traveling in an automobile, and any physical activities. The entire clinical examination session lasted about one hour. Participants were then released to proceed with their usual daily routines. The next morning, the participants returned to the GCRC to remove the PM2.5 and Holter monitors, deliver the completed activity log, have another 50 mL of blood drawn, and a urine sample collected. Then, an exercise echocardiography was performed on each participant according to a standardized protocol to measure the participant's ventricular function and structure. The entire Day-2 session lasted for about one hour and 45 minutes. Penn State University College of Medicine Institutional Review Board approved the study protocol.Study participants were examined in the GCRC in the morning between 8:00 AM and 10:00 AM on Day-1. All participants fasted for at least eight hours before the clinical examination. After completing a health history questionnaire, a trained research nurse measured seated blood pressure three times, height, and weight, and drew 50 mL of blood for biomarker assays according to the blood sample preparation protocols. A trained investigator connected the PM2.5 DataRam for real-time 24-hour personal PM2.5 exposure assessment. Details of the exposure assessment [2.5 concentrations were initially recorded at one-minute intervals. For each participant, we calculated the 30-minute segment-specific averages, based on the whole and half hours, as our PM2.5 exposure variable in the APACR study. Therefore, the PM2.5 exposure variables were treated as repeated measures, and each individual contributed 48 exposure data points.The APACR study used a personal PMsessment ,14 and osessment -18. RealA high-fidelity 12-lead HScribe Holter System was used to collect the 24-hour Holter beat-to-beat ECG data. The high-fidelity ECG significantly increases the resolution and enhances the accuracy of various wave form measurements. The details of the Holter ECG data collection and reading have been published ,14. ReleWe performed time and frequency domain HRV analysis on the ECG recording, after removing artifacts with standardized visual inspection and statistical filters. We calculated HRV indices from 30-minute segment-specific recordings using the SuperECG package according to current recommendations , and use2.5 and Holter measures. Therefore, these weather covariables are treated as repeated measures, and each individual contributed 48 data points for each variable.We obtained individual-level real-time temperature and relative humidity using the HOBO H8 logger . The real-time temperature and relative humidity were recorded at one-minute intervals initially. For each participant, we calculated 30-minute segment specific averages, corresponding to the PM2).A standardized questionnaire administered on Day-1 of the study was used to collect the following individual-level information: (a) demographic variables, including age, race, sex, and highest education level; (b) medication uses, including anti-anginal medication, anti-hypertensive medication, and anti-diabetic medication; and (c) physician diagnosed chronic disease history, including CVD , hypertension, and diabetes. The averages of the second and third measures of seated systolic and diastolic blood pressures on Day-1 were used to represent a participant's blood pressure levels. Day-1 fasting glucose was measured by Penn State GCRC central laboratory. CVD was defined by anti-anginal medication use or a history of CVD. Hypertension was defined by anti-hypertensive medication use, physician diagnosed hypertension, systolic blood pressure ≥ 140 mmHg, or diastolic blood pressure ≥ 90 mm Hg. Diabetes was defined by anti-diabetic medication use, physician diagnosed diabetes, or fasting glucose ≥ 126 mg/dl. Body mass index (BMI) was defined as the ratio of weight to height squared , throughout the analyses to account for the potential autocorrelation. A second-degree polynomial for the distributed lag model was used because the amount of variability in the outcomes of interest explained by the air pollution measures is not large, so that the degree of polynomial must be chosen parsimoniously. In our experience, second-degree polynomials perform adequately, which is supported by Schwartz [2.5 and ECG variables were assessed in parallel over 48 lags (24 hour), we decided a prior to model no more than ten lags, which allowed us to fit the distributed lag model using at least 75% of the data. We started from the largest number of lags (lag 0-10), and reduced the total number of individual lags by back-eliminating the longer lags one lag at a time until a significant cumulative effect on ST-II was identified (lag 4 in this report). We then identified this model as our final model for all ST-height measurements. All results are expressed per 10 μg/m3 increase in PM2.5. In the distributed lag models, basic demographic variables were included as the first step of covariable adjustment. We then included additional adjustment for diabetes, hypertension and CVD. To examine the impact of CAM on PM2.5 and ST-height associations, we repeated the models by adjusting for each of the HRV variables. In these models, all time-dependent covariables, such as weather and HRV variables, were entered in the model using the same distributed lag structure as the PM2.5 variable. We used SAS statistical version 9 for all analyses.Two-sample t tests or chi-square tests, as appropriate, were used to compare the distributions of basic demographic variables between participants with and without chronic diseases. We perform a repeated measures analysis using distributed lag models -23 under2.5 exposure and ST-height measures are approximately normal. The ST-height measures are significantly lower in subjects with chronic disease. Figure th and 90th percentile) of the PM2.5 and ST-height from limb lead II (ST-II), as an example of ST-height measures. Both the PM2.5 and ST-height showed sufficient variation within 24 hours, and within time frame between individuals.The demographic and cardiovascular disease risk profiles of the study population are presented in Table 2.5 on each of the ST-height measures are summarized in Table 3 increment of PM2.5 exposure. In summary, five leads , out of ten ECG leads analyzed, showed a significant positive association between PM2.5 exposure and ST-height. Examining the cumulative effect, most of the adverse effect occurred within two hours (lag0-4) after the elevation of PM2.5. Specifically, the cumulative effect due to a 10 μg/m3 increase in Lag 0-4 PM2.5 concentration on ST-I, II, III, aVF and ST-V6 were 0.29 (0.01-0.56) μV, 0.79 (0.20-1.39) μV, 0.52 (0.01-1.05) μV, 0.65 (0.11-1.19) μV, and 0.58 (0.07-1.09) μV, respectively. To visualize the acute effect of PM2.5 exposure on ST-height and its time course, both individual and cumulative effects of lag 0-4 PM on ST-II height are presented in Figure 2.5 exposure lead to regional cardiac ischemic changes. Our data also revealed a less consistent individual lag effect. Additional adjustment for chronic disease did not change the pattern of association from the models adjusted only for major demographic and weather-related variables.The cumulative effect and individual lag effects of PM2.5 from 0-4 lags after adjusting for HRV variables are presented in Table 2.5 and ST-height did not change substantially with additional adjustment for HRV variables as measures of cardiac autonomic modulation. Therefore, the ST-segment elevation we observed is independent of sympathetic and parasympathetic nervous activity.The statistically significant final multivariable-adjusted models . Therefore, the effects of PM2.5 on ST-height did not differ depending on whether a person had previous health problems. We also performed stratified analysis according to chronic disease status, using M1 in Table We tested the interaction terms between PM2.5 effect on HRV at approximate in four to six hours [2.5 effect on ventricular repolarization at three to four hours [A large number of epidemiologic studies have found an association between short-term exposure to increased particulate air pollution and CVD morbidity and mortality -4,26,27.ix hours , and an ur hours . No stud2.5 on myocardial ischemia. However, we did not limit our examination to the characteristics of clinically manifest ischemia , since air pollution could possibly induce ischemic changes to a lesser degree. Our results reveal that PM2.5 had a significant positive effect on ST-height from five out of ten leads, supporting that elevated PM2.5 levels can lead to higher ST-height in inferior and lateral leads, which can be considered as indications of potential for regional myocardial ischemic damage. These findings are consistent with previous reports [2.5 effects from special populations to a community-based sample of healthy individuals, and from ambient-based estimated PM exposures to individual-level measured exposures to PM.In this study of community-based individuals, we examined the acute effect and time course of PM reports -9,42, an2.5 and myocardial ischemia association was majorly mediated through its adverse effects on CAM, at least not from the same lagged effects that we analyzed. However several other mechanisms could explain the adverse effects of PM on myocardial ischemia. First, PM may induce a constriction in the coronary artery. Supporting this hypothesis, Brook and coworkers reported a sudden conduit vasoconstriction after a short-term PM2.5 and O3 exposure in a sample of healthy volunteers [2.5 in parallel to its well documented adverse effects on CAM. This is similar to the electrophysiological changes seen in Brugada Syndrome, which is associated with high incidence of sudden cardiac death [We examined whether the PM and ST-height relationship is chiefly mediated through its adverse effect on CAM. As evidenced by the results presented in Table lunteers . Mills alunteers . Second,lunteers -48. Thirac death by means2.5 effects on myocardial ischemia measures, our data consistently indicate that the time course of the adverse effect is within four lags of the exposure window - approximately two hours of elevated PM2.5 exposure, similar to that reported by Mills and coworkers [2.5 effects on ischemia are also consistent with that reported by Cavallari and coworkers [2.5 effects on myocardial ischemia measures are more acute than the effects on HRV [2.5 on myocardial ischemia in healthy middle aged individuals sampled from communities.On the time course of PMoworkers on the aoworkers on the es on HRV and on vs on HRV . To our 3 increase in Lag 0-4 PM2.5 exposure, the associated increases in ST-II is only 0.79 μV, corresponding to 2% increase in this variable, which has a mean of 35 and SD of 38 μV. Therefore, such small effects on ST-height may not be clinically meaningful. On the other hand, it can be argued that the entire population is exposed to PM2.5 on a continuous basis daily. Thus, elevated PM2.5 levels can have a huge public health impact. Moreover, the minor effect observed in ST-height in this study was measured in generally healthy individuals. It is possible that PM2.5 effect on myocardial ischemia might be greater in individuals with underlying structural heart disease or ischemic heart disease. Future studies should target these clinical subgroups likely to be more susceptible to the effects of PM2.5, especially those made more vulnerable by residing near sources of PM2.5, e.g. highways.It is worthwhile noting that most of the effect sizes of individual lags within the two hour time frame (lag0-lag4) are smaller than the cumulative effects. As expected, some of the associations between individual lag PM exposure and ST-height are not statistically significant. While individual lag effects may be too small to show an important contribution to the ST-height, the sum of such small effects is large enough to show a significant impact on the ST-height measures. This can be clearly illustrated by Figure 2.5. In general, our participants had limited indoor exposures, such as second-hand smoking. Thus, we were unable to assess whether exposures at much higher levels would exhibit similar associations. However, we purposely used the personal monitors and real-time Holter system to collect the true individual-level exposure and routine ECG data, respectively. We argue that the associations we observed in these individuals are more reflective of their routine exposure and outcome associations. Third, the ECG data from Holter were not collected under a controlled, supine position setting. Thus, the short-term variation of other factors that may impact the ST-height cannot be fully accounted for. However, our study captures the range of activities occurring in real life, including time spent outdoors, time spent commuting in automobile, and various other activities associated with a disease-free community-based individual. Lastly, the pDR estimated PM2.5 concentrations over 24 hours were used in this study as an estimation of personal exposures. This nephelometric device responds to the optical properties of the particles it encounters rather than the true particle gravimetric properties. It should be recognized that the optical properties calibrated using Arizona road dust might not be highly representative of the actual PM2.5 aerosol the study participants encountered. Previous studies have reported that the Arizona road dust calibrated pDR, identical to the one used in this study, provides a mass concentration estimate in good agreement with that from gravimetric mass-based measures (correlation coefficients > 0.8), but the pDR often yield estimates 10-50% higher than that from a gravimetric mass-based measures[2.5 should not have biased the pattern of the observed associations. It can be argued that the reported effect sizes per 10 μg/m3 increase in the pDR estimated PM2.5 actually represented effect sizes of only 5.00 - 9.00 μg/m3 increase in the true PM2.5 exposure, if pDR systematically overestimates the true exposure by 10-50%, i.e., the reported effect sizes in this study were systematically underestimated.There are several limitations. First, the APACR study excluded smokers and persons with acute cardiac events within the past six months. Thus, our findings may not apply to smokers or persons with a recent acute cardiac event. Second, the majority of participants reported that they stayed indoors most of the time during the 24-hour study period, except when they had to travel by automobile. This behavior pattern is reflected in the relatively low levels of exposure to PM measures,16,18. B2.5 at the individual level, is directly associated with higher ST-height measures in inferior and lateral leads, which is indicative of regional ischemic damage potential to the myocardium. Moreover, the time to effects is about two hours after elevated PM2.5. The effect of PM on ST-height is independent of major confounding factors and cannot be attributed solely to its effects on HRV as measures of CAM. Overall, these findings support that PM may affect myocardial ischemia, and partly through such a mechanism, PM increases cardiovascular risk, such as sudden cardiac death and myocardial infarction.In summary, acute exposure to PMAR(1): Autoregressive order one; BMI: Body Mass Index; CAM: Cardiac Autonomic Modulation; CVD: Cardiovascular Diseases; ECG: Electrocardiography; GCRC: General Clinical Research Center; HF: Power in the High-Frequency range (0.15-0.40 Hz); HRV: Heart Rate Variability; LF: Power in the Low-Frequency range (0.04-0.15 Hz); PM: Particulate Matter; RMSSD: Square Root of the Mean of the Sum of the Squares of Differences between adjacent RR intervals; SD: Standard Deviation; SDNN: Standard Deviation of Normal-to-Normal RR intervals.The authors declare that they have no competing interests.FH performed statistical analysis and drafted the manuscript. MLS built the statistical models and wrote the statistical methods section. RS contributed to the data collection and revision of the manuscript. EOB and ANV suggested major revisions of the manuscript. RWW contributed to the air pollution data collection and revision of the paper. RW contributed to the interpretation and methods of the statistical modeling. WEC contributed in the revision of the paper and interpretation of the ECG variables. DL, principle investigator of the APACR study, conceptualized the hypothesis and conducted the data collection, made major contributions in the interpretation of the results, and writing of the paper. All authors read and approved the final manuscript.

Angiotensin converting enzyme inhibitors (ACE inhibitors) reduce peripheral vascular resistance via blockage of angiotensin converting enzyme (ACE). ACE inhibitors are commonly used to treat congestive heart failure and high blood pressure, but other effects have been reported. In this study, we explored the association between ACE inhibitor therapy and the prevalence of comorbid conditions in adults with diabetesWe surveyed 1003 adults with diabetes randomly selected from community practices. Patients were interviewed at home and self-reported their personal and clinical characteristics including comorbidity. Current medications were obtained by direct observation of medication containers. We built logistic regression models with the history of comorbidities as the outcome variable and the current use of ACE inhibitors as the primary predictor variable. We adjusted for possible confounding by social and clinical factors , glycosolated hemoglobin (A1C), number of comorbid conditions, and number of prescription medications).vs. 15%; odd ratio = 0.59; 95% confidence interval ; P = 0.01); and a history of stomach ulcers or peptic ulcer disease less frequently than non-users . After correcting for potential confounders, ACE inhibitors remained significantly inversely associated with a personal history of cancer and peptic ulcer disease .ACE users reported a history of any cancer (except the non-life-threatening skin cancers) less frequently than non-users (10% ACE inhibitor use is associated with a lower likelihood of a history of cancer and peptic ulcers in patients with diabetes. These findings are limited by the cross sectional study design, self-report of comorbid diagnoses, and lack of information on the timing and duration of ACE inhibitor use. Further research is needed to confirm these associations and understand their mechanisms. EvidencThis study is part of a larger project, the Vermont Diabetes Information System (VDIS), a study of 8,855 adults with diabetes in primary care practices . The subSubjects completed a questionnaire at home and were visited by a trained research assistant who reviewed the questionnaire responses, assisted the subject with any missing or unacceptable responses, reviewed the subject's medications, and measured their blood pressure, height and weight using a portable sphygmomanometer, stadiometer, and scale. Race, education, income, marital status, functional status, smoking, alcohol consumption, and comorbid conditions were obtained by questionnaire. Prior to the interview, patients were instructed to gather all current medications, including over the counter preparations, for review by the research assistant. The medication list was ascertained by direct observation of the medication container with recording of the drug name, dose, frequency, and route of administration. Duration of therapy was not recorded.To determine comorbidity, we used a modification of the Self-Administered Comorbidity Questionnaire in whichThe interviews occurred between July 2003 and March 2005. Most laboratory data were obtained from the patients' local clinical laboratories, which all use the same Diabetes Control and Complications Trial/Epidemiology of Diabetes Interventions and Complications high performance, liquid chromatography (HPLC) method for the determination of glycosylated hemoglobin (A1C). Less than 1% of A1C tests were done using the Bayer DCA 2000 immunoassay point of care instrument, which has been shown to compare favorably with the HPLC method .The research protocol was carried out in compliance with the Helsinki Declaration and was approved by the Committee on Human Research of the University of Vermont. The interviewed subjects provided written informed consent. The full study protocol and variables, and the medication profiles of the subjects have been previously reported ,14.2), current alcohol use (yes/no), current cigarette use (yes/no), number of comorbidities, and number of prescription medications. The selection of these potential confounding conditions was based on clinical and epidemiologic judgment and not on statistical determinants. We used Stata/SE 9.2 for all analyses.We performed a cross sectional analysis of the interviewed subjects at the time of their enrollment in the VDIS trial. We explored the association between rheumatic disease, asthma/COPD, CAD, cancer, CHF, cirrhosis, CVA, depression, paresis, PUD, PVD, and the use of ACE inhibitors therapy using logistic regression with each condition as the outcome variable and the use of ACE inhibitors as the primary predictor variable. We then adjusted for possible confounding by social and clinical factors including gender, age (years), systolic blood pressure (mmHg), glycosylated hemoglobin level (A1C in mg%), body mass index (BMI in kg/mThe study population was representative of adults with diabetes in primary care practices in Northern New England. See Table 2), having higher number of prescription medications, and being a non-drinker.Table 2), alcohol drinking (yes/no), cigarette smoking (yes/no), number of comorbidities, and number of prescription medications. This model showed a significant association between cancer and the use of ACE inhibitors Table . Other vThese data suggest a negative association of ACE inhibitor use with both cancer and PUD in a community based population of adults with diabetes.Evidence from animal models suggests that angiotensin II stimulates neovascularization and promet al. [et al. [Very few reports have looked at the association between ACE inhibitors and peptic ulcers. One study found that captopril significantly reduced the development of gastric ulcers in pylorus-ligated rats . Anotheret al. determinet al. indicate [et al. suggesteThe mechanisms of the observed associations between ACE inhibition and the two diagnoses are unknown. It is possible that ACE inhibitors protect against the development of cancer or ulcer disease, although confirmation of these hypotheses must await additional investigation. Another interpretation of our results is the "treatment-risk paradox" in which the history of cancer or ulcer disease inhibits the use of ACE inhibitors, perhaps due to concerns of polypharmacy or intolerance of the medication due to the underlying disease. However, the prescribing information for ACE inhibitors does not discourage their use in either cancer or PUD and univariate analysis shows no significant differences between the number of comorbidities in ACE inhibitor users and non-users. These facts argue against the "treatment-risk paradox" theory, although not conclusively.This study has several strengths. First, the interviewed subjects were a randomly selected subset of a large population of patients receiving care in the Northeast, and are therefore likely to be representative of primary care patients generally. Second, all data on medications were obtained by direct observation in the patient's home and not from secondary sources. Third, multiple potential confounders were assessed and found to have no significant effect on the apparent associations between ACE inhibition and PUD and cancer.This study has several limitations including lack of clinical confirmation of the comorbid diagnoses, and lack of information on the timing and duration of ACE inhibitor treatment relative to the onset of the comorbidities. As in any cross-sectional study, unmeasured confounders may be responsible for the apparent associations found.These data suggest a potential protective association of ACE inhibitors for cancer and peptic ulcer disease in patients with diabetes. Further research is needed to confirm these associations and understand their mechanisms.The authors declare that they have no competing interests.MERN, CDM and BL contributed equally to all aspects of this work.The pre-publication history for this paper can be accessed here: