Datasets:

ccdv

/

patent-classification

like 21

a first object of the present invention is the use of dimiracetam , or a pharmaceutically acceptable solvate thereof , in the manufacture of a medicament useful for treating and / or preventing chronic pain . the invention is also directed to dimiracetam , or a pharmaceutically acceptable solvate thereof , for use in the treatment and / or prevention of chronic pain . a further object of the present invention is a method for treating and / or preventing chronic pain , consisting in the administration of a pharmaceutically effective dose of dimiracetam to a patient in need thereof . dimiracetam is a chiral compound . for the scope of the present invention , the term “ dimiracetam ” identifies the isolated ( r ) or ( s ) enantiomers of dimiracetam , or mixtures thereof in which the two enantiomers are present in equal or different amounts . it is therefore intended that the use , method and pharmaceutical compositions which are the object of the present invention are extended to those mixtures or the single enantiomers of dimiracetam . according to the present invention , dimiracetam may be administered as such or in association with any other active principle useful for the treatment or prevention of chronic pain or diseases causing it . it is also part of the invention the administration of dimiracetam in association with active principles which present as side effect the insurgence of chronic pain , in particular antitumor and antiviral drugs ; non - limiting examples of such drugs are taxol , vincristine , cisplatin , oxaliplatin , nucleoside reverse transcriptase inhibitor antivirals ( ddc , d4t , azt ), many of which are gold standard antiviral drugs in hiv infection therapy . by means of the claimed use and method it is possible to treat effectively and with high safety all kinds of chronic pain , either neuropathic or inflammatory in origin . preferred examples of chronic pain treated according to the present invention are the following : 1 . pain induced by chemotherapeutic agents or other antiblastic therapy ( e . g . radiotherapy ); among the chemotherapeutic agents responsible for neuropathies , taxol , vincristine , cisplatin , oxaliplatin are mentioned ; 2 . pain induced by antiviral agents such as nucleoside reverse transcriptase inhibitors ( ddc , d4t , azt ); 3 . complex regional pain syndrome , phantom limb , thalamic syndromes , spinal syndromes ; 4 . pain induced by osteoarthritis , rheumatoid arthritis , autoimmune osteoarthrosis forms ; 5 . pain induced by cephalea ( cephalea in general and hemicranic forms ; cephalea due to vascular , infective , autoimmune , dysmetabolic and tumoral causes , cephalea from endocranial hypertension , cephalea from pseudotumor cerebri , classic hemicrania with and without aura , hemiplegic hemicrania and with other motor complications , childhood and juvenile hemicrania , bickerstaff &# 39 ; s syndrome , etc .). 6 . pain induced by fibromyalgia of outstanding efficacy , and therefore preferred in the scope of the invention , is the treatment of pain induced by antiviral agents , osteoarthritis , rheumatoid arthritis and autoimmune osteoarthritis . in the scope of the invention , in the present treatment the antihyperalgesic effect of dimiracetam is exerted in a range of oral dosages between 10 and 300 mg / kg , preferably between 100 and 300 mg / kg . the antihyperalgesic effect may be achieved also by routes of administration different from the oral route , i . e . intramuscular or intravenous : in these cases dimiracetam is administered in amounts which allow to obtain haematic levels comparable to those obtained after oral administration of 10 - 300 mg / kg . reference values useful for intramuscular administrations range from about 5 to about 150 mg / kg ; reference values useful for intravenous administrations range from about 2 to about 60 mg / kg . the invention encompasses therefore pharmaceutical compositions of dimiracetam useful for the above mentioned treatments . these compositions contain an amount of this active principle which is greater than that previously proposed for the nootropic activity . the amounts of the active principle , expressed in mg / kg , are those cited above . these compositions have a dosage unit useful to administer the above mentioned dosages . typically they contain from 500 to 15000 mg in case of oral compositions ; from 250 to 7500 mg in case of intramuscular compositions ; from 100 to 3000 mg in case of intravenous compositions . dimiracetam may be pharmaceutically formulated according to known methodologies . the various pharmaceutical compositions may be selected according to the needs of the treatment . such compositions can be prepared by mixing and can be suitably adapted for oral or parenteral administration , and as such , can be administered in the form of tablets , capsules , oral preparations , powders , granules , pellets , liquid solutions for injection or infusion , suspensions or suppositories . tablets and capsules for oral administration are usually supplied in dosage units and may contain conventional excipients such as binders , fillers , diluents , tabletting agents , lubricants , detergents , disintegrants , colorants , flavors and wetting agents . tablets may be coated in accordance to methods well known in the art . suitable fillers include for example cellulose , mannitol , lactose and similar agents . suitable disintegrants include starch , polyvinylpyrrolidone and starch derivatives such as sodium starch glycolate . suitable lubricants include , for example , magnesium stearate . suitable wetting agents include for example sodium lauryl sulfate . these solid oral compositions can be prepared with conventional mixing , filling or tabletting methods . the mixing operations can be repeated to disperse the active agent in compositions containing large quantities of fillers . these operations are conventional . the oral liquid compositions can be provided in the form of , for example , aqueous or oily suspensions , solutions , emulsions , syrups or elixirs or in the form of a dry product to be reconstituted with water or with a suitable liquid carrier at the time of use . the liquid compositions can contain conventional additives such as suspending agents , for example sorbitol , syrup , methylcellulose , gelatin , hydroxyethylcellulose , carboxymethylcellulose , aluminium stearate gel or hydrogenated edible fats , emulsifying agents , for example lecithin , sorbitan monooleate , or acacia ; non aqueous carriers ( which can include edible oil ) for example almond oil , fractionated coconut oil , oily esters such as glycerin esters , propylene glycol or ethyl alcohol ; preservatives , for example methyl or propyl p - hydroxybenzoate or sorbic acid and if desired , conventional flavours or colorants . oral formulations also include conventional sustained release formulations , such as tablets or granules with enteric coating . for parenteral administration , fluid dosage units can be prepared containing the active compounds and a sterile carrier . the active compounds , depending on the carrier and concentration , can be suspended or dissolved . the parenteral solutions are normally prepared by dissolving the compound in a carrier and sterilizing by filtration , before filling suitable vials or ampoules and sealing . adjuvants such as local anaesthetics , preservatives and buffering agents can be advantageously dissolved in the carrier . in order to increase stability , the composition can be frozen after filling the vial and the water removed under vacuum . the parenteral suspensions are prepared essentially in the same way , with the difference that the active compounds can be suspended rather than dissolved in the carrier , and can be sterilized by exposure to ethylene oxide prior to being suspended in the sterile carrier . a surfactant or humectant can be advantageously included to facilitate uniform distribution of the compound of the invention . a further method of administration for the compound of the invention refers to a topic treatment . topic formulations may contain for example ointments , creams , lotions , gels , solutions , pastes and / or may contain liposomes , micelles and / or microspheres . a further method of administration for the compounds of the invention is transdermal delivery . typical transdermal formulations include conventional aqueous and non - aqueous vectors , such as creams , oil , lotions or pastes or may be in the form of membranes or medicated patches . as is the common practice , the compositions are normally accompanied by written or printed instructions , for use in the treatment concerned . examples of the present invention are provided in what follows , purely for illustrative and non - limiting purposes . peripheral neuropathy is induced by repeated administration of vincristine , taxol or oxaliplatin to adult male sprague - dawley rats ( 150 - 200 g , supplier harlan ). vincristine : the drug was injected by intravenous route at the dose of 150 μg / kg . the treatment was performed every 2 days , for 5 times , until a cumulative dose of 750 μg / kg was reached . paw pressure test was performed 4 days after the last injection ( marchand f . et al . 2003 , brain res . 980 : 117 - 120 ). taxol : taxol neuropathy was induced by intraperitoneal administration of 0 . 5 mg / kg once a day , on days 1 , 3 , 5 and 8 . cumulative taxol dose was 2 mg / kg . the pharmacological test was performed 14 - 18 days after the last taxol injection ( polomano r . c . et al . 2001 , pain 94 : 293 - 304 ). oxaliplatin : 2 . 4 mg / kg were injected by intraperitoneal route for 5 consecutive days followed by 2 days suspension ( one cycle ). a total of 3 cycles was performed , reaching a cumulative dose of 36 mg / kg ( cavaletti g . 2001 , eur . j . cancer 37 : 2457 - 2463 ). the test was performed 48 h after the last oxaliplatin injection . adult male sprague dawley rats ( 150 - 200 g , supplier harlan ) were treated by intravenous route with a single administration of 25 mg / kg of nucleoside reverse transcriptase inhibitors ddc ( 2 ′, 3 ′- dideoxycytidine ) or d4t ( 2 ′, 3 ′- didehydro - 3 ′- deoxythymidine ). administration of these anti - hiv drugs induced a marked allodynic response to a mechanical stimulus ( joseph e . k . 2004 , pain 107 : 147 - 158 ). the maximum reduction of the paw pressure threshold is developed between day 5 and day 10 after injection . the test was performed on day 10 . experimental models in rats demonstrated that meninges and cerebral blood vessels are pain - sensitive structures and are heavily innervated by the trigeminal nerve . activation of trigeminal fibers causes a neurogenic inflammatory response of meningeal tissues , that has been proposed as an essential mechanism for migraine pain and other headaches . ( bolay h . 2002 , nature medicine 8 : 136 - 142 ). on these basis , animal models of blood vessel neuro - inflammation following electrical trigeminal stimulation were commonly utilized to discover potential effective drugs . adult male sprague - dawley rats ( 150 - 200 g weight , harlan ) were anaesthetized with pentobarbital sodium ® ( 60 mg / kg i . p . ), and placed in a stereotaxic frame . an ipsilateral electrode was then inserted and trigeminal nucleus was stimulated to induce a meningeal neuroinflammation , which can be detected by the amount of extravasated blue evans dye or radiolabelled bovine serum albumine . joint inflammation was induced by intra - articular injection of 0 . 1 ml of freund &# 39 ; s complete adjuvant ( cfa ) in anaesthetized rats ( male adult sprague dawley rats , 150 - 200 g , supplier harlan ). mechanical hyperalgesia was evaluated using the paw pressure test 14 days after cfa administration ( shan s 2006 , pain 129 : 64 - 75 ). osteoarthritis was induced by a single administration of 2 mg ( in a volume of 25 μl ) of sodium 2 - iodoacetate into the left knee joint of anaesthetized rats ( male adult sprague dawley rats , 150 - 200 g , supplier harlan ) ( fernihough j . 2004 , pain 112 : 83 - 93 ). this treatment induces the progressive degeneration of the joint and the development of hyperalgesia , mimicking at the histological and behavioral levels what observed in humans . pharmacological test was performed 7 days after treatment . mechanical hyperalgesia in rats ( male adult sprague dawley rats , 150 - 200 g , supplier harlan ) was determined using the paw pressure test . the nociceptive threshold was determined with an analgesimeter ( ugo basile , italy ), exerting a force that increases at constant rate ( 32 g / s ) according to the method described by leighton g . e . 1988 , br . j . pharmacol . 93 : 553 - 560 . the stimulus causing paw withdrawal was evaluated before and at different times after treatment . results represent the mean of mechanical thresholds expressed as grams . to avoid any possible damage to the animal paw the maximum applied force was fixed at 240 g . rats ( male adult sprague dawley rats , 150 - 200 g , supplier harlan ) were placed in a chamber with a mesh metal floor covered by a plastic dome that enabled the animals to walk freely , but not to jump . the mechanical stimulus was delivered in the mid - plantar skin of left hind paw using an electronic von frey apparatus . the cut - off was fixed at 50 g , while the increasing force rate ( ramp duration ) was settled at 20 sec . to verify if the administration of the compound may induce centrally mediated side effects , adult male sprague dawley rats ( 150 - 200 g , supplier harlan ) were treated with dimiracetam by subcutaneous and oral routes and monitored according to the “ irwin test ” protocol ( irwin 1968 , psychopharmacologia 13 : 222 - 257 ), a systematic and quantitative procedure for assessing the behavioral and physiological modifications induced in animals by the drug treatment . rats were constantly monitored for 30 min after administration . monitoring was iterated every morning at 9 a . m . for 4 days after administration . the rotarod test allows the evaluation of the effects of a compound on motor coordination . adult male sprague dawley rats ( 200 - 220 g , supplier harlan , milan ) were placed on a plastic rod 6 cm in diameter and 35 cm in length , rotating at constant speed ( 16 rpm ) at a height of 25 cm . the rod is divided in 4 equal sections , thus up to 4 animals may be tested simultaneously . the animals were required to walk against the motion of the rotating drum over 30 seconds . the time taken to fall off the rotarod was recorded as number of falls in 30 seconds , following the method of vaught et al . 1985 , neuropharmacology 24 : 211 - 216 . in each experiment motor coordination is measured before ( pre - test ) and after administration of the tested compound . rats scoring less than 3 and more than 6 falls in the pretest are rejected . the test was performed according to the method described by veneroni et al 2003 , pain 102 : 17 - 25 . neurological deficits were evaluated by the inability of the rats to remain on the rotating rod ( 10 rpm ) for the test period . the toxic dose was calculated as the dose causing 25 % ( td 25 ) or 50 % ( td 50 ) of the fallen rats ( only for gabapentin , the toxic dose was td 16 = 16 % of fallen rats ). the hole board test allows to study the behavior of rodents when confronted with a new environment ( boissier j r 1964 , therapie 19 : 571 - 583 ). the test enables to evaluate the initial exploratory activity of the animal and its possible variations induced by drug administration . the hole board test uses a 40 cm square plane with 16 flush - mounted cylindrical holes ( diameter 3 cm ) distributed 4 by 4 in an equidistant , grid - like manner . mice ( male swiss webster mice weighing 25 - 30 g , supplier morini ) are placed one by one in the center of the board and allowed to move freely , each for a period of 5 min . two photoelectric beams , crossing the plane from mid - point to mid - point of opposite sides , and thus dividing the plane into four equal quadrants , automatically record the movements of the animals on the plane surface . miniature photoelectric cells in each of the 16 holes record the exploration of the holes ( head plunging activity ) by the mice . the effect of dimiracetam was evaluated in the oxaliplatin - induced neuropathy model after repeated administration with the paw pressure test . results are reported in fig1 . dimiracetam was administered at doses of 100 and 300 mg / kg p . o . once a day , starting three days before oxaliplatin treatment and during the treatment itself . at the dose of 300 mg / kg , dimiracetam significantly reduced mechanical hyperalgesia . the effect was statistically significant between 30 min and 4 h after administration . test results ( von frey test ) are reported in fig2 . at the dose of 100 mg / kg , 15 - 30 min after administration , dimiracetam fully reverted ddc - induced allodynia , the mechanical threshold being at the same level in treated and control animals . the effect was still statistically significant 45 min after treatment . dimiracetam is a racemic compound ; the two corresponding enantiomers were synthesized and separately tested in the ddc - induced neuropathy model . the two compounds were administered orally at doses of 150 and 300 mg / kg and their antihyperalgesic activity was evaluated with the paw pressure test . results are reported in fig3 . ( r )- dimiracetam induced a significant reduction of the pain mechanical threshold at 300 mg / kg , 15 - 45 min after administration . the ( s ) enantiomer induced a significant effect at 300 mg / kg , 15 min after administration . these data demonstrate the efficacy also of the single enantiomers of dimiracetam . the antihyperalgesic potential of dimiracetam was evaluated ( paw pressure test ) in the osteoarthritic pain model induced by the intra joint injection of sodium monoiodoacetate ( mia ). test results are reported in fig4 . both dimiracetam and its ( r ) enantiomer at the dose of 150 mg / kg , 15 - 30 min after administration , showed a statistically significant effect in reverting mia - induced hyperalgesia . at the dose of 300 mg / kg dimiracetam fully reverted mia - induced hyperalgesia , the mechanical threshold being at the same level in treated and control animals between 15 and 45 min after administration ; the effect was still statistically significant 60 min after administration . the effect of the ( r ) enantiomer was still statistically significant 45 min after treatment . in order to verify if dimiracetam may induce unwanted side effects , the compound was tested in the rotarod model ( motor coordination and ataxia ) in rats and in the hole board model ( spontaneous and exploratory activity ) in mice . in acute toxicity experiments , dimiracetam , administered at 3000 mg / kg p . o . ( 20 - fold the dose used in the previous pharmacological activity tests ) does not alter rats motor coordination in the rotarod test , as shown in fig5 . differently , as shown in fig6 , reference compound i -( 3 - cyanophenyl )- tetrahydropyrrolo [ 1 , 2 - a ] imidazole - 2 , 5 - dione ( representative of compounds of formula ( i ) of wo2004 / 085438 , see example 13 ) significantly altered animals motor coordination , increasing the number of falls starting from the dose of 300 mg / kg ; these data show a lower tolerability level for the said reference compounds . the td 25 of dimiracetam was 6000 mg / kg p . o ., thus demonstrating a very high safety and tolerability of the compound . among the reference standards , tramadol exhibited the highest toxicity , with a td 50 of 253 mg / kg p . o ., while pregabalin and levetiracetam showed td 50 s of 536 and 2000 mg / kg p . o . respectively . gabapentin showed a td 16 of 1000 mg / kg p . o . dimiracetam administered at the dose of 1000 mg / kg by subcutaneous route and at the dose of 3000 mg / kg p . o . did not show any effects on all the behavioral parameters observed . in the hole board test , dimiracetam , administered at 3000 mg / kg p . o . does not significantly reduce either spontaneous activity ( number of movements of each animal on the plane ) or curiosity ( number of head plungings ), as shown in fig7 . on the contrary , gabapentin administered at 1000 mg / kg causes a statistically significant reduction of both the evaluated parameters . 3 . 5 preliminary toxicity in rats : single dose by oral and intravenous route oral or intravenous administration of a single dose of 3000 mg / kg of dimiracetam to sprague dawley rats is substantially well tolerated . no signs of toxicity were observed during the experiment . behavioral observation , blood and urine analyses did not show any dose - related variation of the measured clinical parameters . oral repeated administration of dimiracetam to sprague dawley rats , for 4 weeks and up to a maximal dose of 2500 mg / kg / day did not produce any changes in terms of mortality , symptomatology or changes of the normal behavior . oral repeated administration of dimiracetam to sprague dawley rats for 13 weeks and up to a maximal dose of 2500 mg / kg / day was well tolerated . no mortality or relevant clinical signs , as well as changes in terms of body weight , water and food consumption or in body temperature were seen at all dose levels . hematology , clinical chemistry , coagulation parameters and urinalysis did not reveal drug related variation of the different parameters evaluated at all tested doses . no macro - or microscopic lesions or abnormalities correlated with the administration of dimiracetam were noticed . 3 . 7 repeated toxicity in cynomolgus monkeys : 4 and 13 weeks p . o . oral repeated administration of dimiracetam in cynomolgus monkeys for 4 weeks and up to a maximal dose of 2000 mg / kg / day , was well tolerated by the animals . a slight reduction in food consumption and body weight was observed in some animals treated with the maximal dose of 2000 mg / kg . oral repeated administration of dimiracetam in cynomolgus monkeys for 13 weeks and up to a maximal dose of 2000 mg / kg / day was well tolerated by the animals . no mortality or relevant clinical signs , as well as changes in terms of body weight , water and food consumption or in body temperature were seen at all dose levels . hematology , clinical chemistry , coagulation parameters and urinalysis did not reveal drug related variation of the different parameters evaluated at all tested doses . no macro - or microscopic lesions or abnormalities correlated with the administration of dimiracetam were noticed . taken together , these data show the insurgence of a strong antihyperalgesic activity for dimiracetam within the dosage ranges typical of the present invention . the high potency of action is confirmed by the fact that this compound showed remarkably higher efficacy than gabapentin , considered up to now the gold standard in chronic pain treatment therapy . activity was found versus chronic pain of different origins ( i . e . chemotherapy - induced pain , antiviral - induced pain , osteoarthritic pain , cephalea etc .) demonstrating the broad spectrum of applicability of the treatment proposed herein . in addition , data shown in said animal models highlight a special efficacy of dimiracetam versus chronic pain associated with antiviral treatment and osteoarthritic pain and related pathologies . in addition , at doses typical for the present invention , dimiracetam proved to be much more tolerable than gabapentin or pyrroloimidazole derivatives of prior art .

0Human Necessities

reference is now made to fig1 , which is a schematic illustration of a bed 20 and a subject 22 lying supine in the bed . typically , the subject is sleeping . a typical external device 24 is shown in detail comprising a control unit 26 and a breathing sensor 28 . the breathing sensor senses respiration , and control unit sends signals 32 responsive thereto to a sublingual implant 34 typically implanted in a sublingual muscle of the subject ( e . g ., the genioglossus muscle ). the signals are sent to the implant at a particular temporal point in the subject &# 39 ; s breathing pattern , as determined by the breathing sensor . the external device , in accordance with some applications of the present invention , is placed in proximity to the subject under the chest of the subject , or under the subject &# 39 ; s pillow or mattress . alternatively , the external device can be placed anywhere near the subject , such that the sublingual implant receives signals from the external device . one or more antennas 30 of external device 24 are typically configured to send the signals to the implant , as described hereinbelow . external device 24 typically sends signals 32 to sublingual implant 34 , which drive the sublingual implant to stimulate a sublingual muscle ( e . g ., the genioglossus muscle , not shown ). this stimulation is typically in a plurality of successive periods of respiratory inspiration of subject 22 , and typically even in the absence of a detection of apnea by the external device . for some applications , signals are provided to the implant to cause the implant to stimulate the muscle at a non - inspiration point , or at multiple points during a respiratory cycle . in some applications , external device 24 sends signals 32 to sublingual implant 34 to stimulate the muscle for a pre - determined length of time or in a particular pattern , or both , over the course of subject &# 39 ; s 22 sleep cycle . for some applications , periods of no stimulation by sublingual implant 34 are provided , during the course of the sleep cycle , to prevent over - stimulating a muscle ( e . g ., the genioglossus muscle , not shown ). typically , signals 32 are provided to stimulate sublingual implant 34 during at least 30 % or at least 50 % of the respiratory periods over the course of a ten - minute period , even in the absence of a detection of apnea by external device 24 . in addition , the external device 24 is typically configured to only provide signals 32 to the sublingual implant 34 to stimulate a muscle when the subject 22 is sleeping . external device 24 typically wirelessly powers sublingual implant 34 , via signals 32 , e . g ., radio waves or inductive coupling , as described hereinbelow . breathing sensor 28 typically comprises a piezoelectric crystal , a strain gauge a pressure sensor , an accelerometer , an optical sensor , an audio sensor , a video imager , and / or a cardiac sensor , or combinations thereof , to detect , for example , breathing - related motions , snoring , electrical activity , and / or other indications of the subject &# 39 ; s breathing . the one or plurality of sensors provide information regarding , but not limited to , the subject &# 39 ; s airway pressure , snoring sounds and motions , mechanical motion associated with respiration , and / or electrical activity associated with respiration . in addition , other sensors known in the art ( e . g ., a blood oxygen saturation sensor ) assess the operation of external device 24 and implant 34 , and to support closed - loop control of external device 24 and implant 34 . reference is now made to fig2 , which is a schematic illustration of sublingual implant 34 in subject 22 , in accordance with some applications of the present invention . sublingual implant 34 shown in fig2 is typically the sublingual implant described hereinabove with reference to fig1 . implant 34 , as shown enlarged , contains a wireless receiver 40 , two or more electrodes 42 and 44 , and circuitry 46 , coupled to the electrodes . the implant and its components are encapsulated using techniques known in the art . material for the electrodes can be chosen based on numerous criteria , as are known in the art , including , tissue response , allergic response , electrode - tissue impedance , and radiographic visibility . circuitry 46 is typically configured to drive electrodes 42 and 44 to apply current , typically as a train of pulses , to a sublingual muscle site of subject 22 , in response to signals 32 from external device 24 , in a plurality of successive periods of inspiration of the subject . typically , signals 32 are generated substantially for the duration of any given sleep cycle , even in the absence of a detection of apnea by the external device . alternatively , signals 32 are generated for only a portion of the sleep cycle , e . g ., for at least 30 % or at least 50 % of the cycle . it is to be noted that the sublingual implant &# 39 ; s particular location in the muscle is shown by way of illustration and not limitation . in some applications , sublingual implant 34 can include an implant sensor ( not shown ), such as a vibration sensor sensitive to snoring vibrations , or a motion sensor . the implant sensor allows the implant to operate independently of , or in conjunction with , external device 24 , optionally providing feedback to the external device . in other applications , one or more other implant sensors are included in the implant to be used independently by the implant , or in conjunction with the external device . in some applications , the operation parameters of sublingual implant 34 — e . g ., duty cycle , frequency , pulse duration or amplitude , of the sublingual implant &# 39 ; s current , can be altered in response to how effective or painless the current generated by the implant is , and / or whether the implant disrupts the subject &# 39 ; s sleep . this may be done with a wand ( not shown ), or with an input unit such as a keypad ( not shown ) on external device 24 . feedback parameters for determining the efficacy and / or efficiency of the implant are obtained via receiving information from subject 22 himself , by way of sensors in external device 24 , or in some applications , by feedback sensors ( such as vibration or acceleration sensors , not shown ) in sublingual implant 34 . it is noted that the number of sublingual implants in the schematic is by way of illustration and not limitation . one or more of the implants are typically injected into the subject in a minimally - invasive manner in an outpatient procedure . typically , this is done through the lumen of a needle ( not shown ) using aseptic technique and with local anesthesia , as is known in the art . other surgical procedures known in the art may also be used to place the implant in a muscle . these one or more implants 34 can be configured to work in conjunction with other implants or independent of each other and / or external device 24 . in some applications , sublingual implant 34 is also configured to wirelessly receive power from external device 24 , e . g ., via a coil 48 coupled to circuitry 46 . other applications may use any one of , or a combination of , forms of wireless energy transfer , such as inductive coupling , rf , ultrasound , or other forms of wireless energy transfer . in some applications , sublingual implant 34 is continuously provided with the necessary power to stimulate muscle via external device 34 , or some other external device ( not shown ), in close enough proximity to wirelessly transfer power to the implant . in some applications , sublingual implant 34 can temporarily store electrical power , e . g ., by use of a battery or high - capacity capacitor ( not shown ), coupled by a wire ( not shown ) to the implant , or disposed within the implant . in some applications , sublingual implant 34 has an internal battery that is periodically charged by external device 24 or some other external device ( not shown ), in close enough proximity to wirelessly transfer power to the implant . for some applications , external device 24 operates substantially throughout the night , e . g ., causing implant to drive current into sublingual muscle during most respiration cycles . alternatively , external device 24 determines if the subject is sleeping , and only drives implant 34 during these periods ( e . g ., only during inspiration during sleep ). further alternatively , external device 24 determines if the subject is snoring , or exhibiting another respiration problem , and only drives the implant during such periods . it will be appreciated by persons skilled in the art that the present invention is not limited to what has been particularly shown and described hereinabove . rather , the scope of the present invention includes both combinations and subcombinations of the various features described hereinabove , as well as variations and modifications thereof that are not in the prior art , which would occur to persons skilled in the art upon reading the foregoing description .

0Human Necessities

prior linear lamps utilize a reflector ( s ) having a common reflectivity along its longitudinal length . the reflector ( s ) may be configured to be easily removed for replacement upon fouling . for example , the reflector surfaces may be slid into place along a retaining / aligning guide channel . fig2 a is a chart showing characteristics of the typical prior art linear lamp arrangement . along a longitudinal target area relative the length of the linear bulb , these characteristics generate a curved irradiance profile with a peak proximate the middle of the bulb . an example of the prior art using an arc bulb is the arc lamp model uvxl manufactured by aetek uv systems of romeoville , ill . as shown in fig1 a linear lamp 1 has a linear bulb 10 supported at either end mounted in a lamp housing 20 . a reflector 30 is positioned proximate the linear bulb 10 to redirect the linear bulb 10 energy output into a desired target area . the reflector 30 may also be configured as two or more reflectors 30 , the reflectors 30 may also be movable to isolate the linear bulb 10 energy output from the target area during process initiation , interruption and or completion . the reflector 30 of a first embodiment of the invention is configured as a plurality of reflector segments 40 . each reflector segment 40 may be selected from a range of materials having different reflectivity coefficients and or a common material having a range of different surface treatments resulting in different reflectivity coefficients . the reflector segments 40 may be installed into the linear lamp 1 via the guide channel , end to end . for example , by selecting the reflector segments 40 to have a lower reflectivity at the center of the housing 20 and a higher reflectivity towards either end , the bell curve light output characteristic of a linear lamp may be tuned to reduce the center peak . fig2 b 1 is a variation of fig2 a , showing the characteristics of the first embodiment , arranged to reduce the center peak . the reflector segments 40 utilized in the example above may comprise 4 inch wide segments of , for example , either the high specular reflectivety “ a ” or low specular reflectivety “ u ” side of alzac ( specular 2000 available from “ alanod ” aluminium - veredlung gmbh & amp ; co . kg , germany ) and astm b370 copper “ c ” material in the following order : a - a - a - u - c - u - u - c - u - a - a - a . segments at either end may be adapted to the exact length of the reflector housing . other materials having different reflectivity characteristics , surface finishes and or segment dimensions may be readily substituted by one skilled in the art to obtain a desired irradiance characteristic across a desired target area . in alternative embodiments as shown in fig3 - 8 , a low reflectivity pattern of , for example , dots or lines may be applied to the reflector segments 40 surface area to achieve a similar result . the surface pattern may be created by perforating , mechanically roughing the reflective surface and or by applying low reflectivity coating ( s ) of , for example , carbon black . any pattern that lowers the reflectivity to a desired level may be used . a collection of reflector segments 40 having a range of low to high reflectivity patterns and or materials with a similar range of reflectivity &# 39 ; s allows tuning of a linear lamp &# 39 ; s 1 light output to a specific desired irradiance profile . to increase the tuning irradiance profile specificity , shorter width reflector segments 40 may be used . if reflector segments 40 having a very small width are used , reflector segments 40 of only two types , a high reflectivity type and a low reflectivity type , may be used to configure a desired reflectivity by alternating the high and low reflectivity reflector segments 40 in combinations resulting in a desired reflectivity average that changes across the longitudinal dimension of the linear bulb 10 they are mated with . also , if a specific configuration of reflectivity levels across a reflector surface is selected , a pattern of the , for example , dots and or lines may be applied to a single reflector 30 , as shown in fig9 and 10 . fig2 b 2 is a variation of fig2 a , showing the characteristics of alternative embodiments where the reflectivity profile is evenly graduated , arranged to reduce the center peak . in a further embodiment , as shown in fig1 and 12 , a surface treatment , coating and or sleeve may be applied to the outer and or inner surfaces of the linear bulb 10 . in this embodiment , the surface treatment , coating and or sleeve should be capable of withstanding the extreme temperatures present on the linear bulb &# 39 ; s 10 surface without compromising the linear bulb &# 39 ; s 10 integrity . alternatively , as shown in fig1 and 14 , the linear bulb &# 39 ; s diameter may be varied along its length . for example , a smaller diameter towards either end and a larger diameter in a middle section may be used to lower the linear bulb &# 39 ; s radiance in the middle section and increase it towards either end . fig2 c is a variation of fig2 a , showing the characteristics of alternative embodiments where the radiance profile of the linear bulb is reduced towards the center of the linear bulb . further , the variations to the reflector reflectivity profile and the radiance profile of the linear bulb described herein may be combined to arrive at , for example , the irradiance profile shown in fig2 d . [ 0046 ] fig1 and 16 show examples of shade members 50 usable with a linear lamp according to the present invention . u . s . utility patent application ser . no . 10 / 164 , 620 , “ uv curing system for heat sensitive substances ” filed jun . 10 , 2002 by allen p . blacker et al , hereby incorporated by reference in its entirety , describes shade members and or dichroic reflector coatings usable with uv linear lamps which have the effect of lowering the level of thermal exposure the substance ( s ) being cured receive . a pattern of low reflectivity / transmission created on the shade member 50 may also be used according to the present invention to adjust the irradiance profile at a target area along corresponding to the length of the linear lamp . as described herein above , a low reflectivity / transmission pattern may be formed by , for example , selectively modifying the shade member 50 surface characteristics and or adding a low reflectivity pattern to desired areas of the shade member 50 , resulting in a linear lamp having characteristics , for example , as shown in fig2 e . a shade member 50 as described herein may be combined with reflectors 30 and or multiple reflector segments 40 also according to the present invention . alternatively as shown by fig1 , a lens 60 may also be used in place of the shade member 50 to defocus and or redirect linear bulb output in areas corresponding to target area locations where varied irradiance is desired . the lens 60 may be fabricated from , for example , quartz material as a single piece or from a plurality of segments which co - operate to produce a desired convergence and or defocusing effect . for example , as shown in fig2 f , a stronger convergence at the ends compared to a convergence at the center will increase peak irradiance at either end of the target area that would otherwise be decreased due to lateral radiant loss towards either end of the linear bulb 10 . in an embodiment optimized for even irradiance distribution towards either end of a longitudinal target area generally corresponding to the longitudinal dimension of a linear lamp 1 , the overall length of the lens 60 may be longer than the linear bulb 10 that is being imaged . the irradiance profile tuning techniques disclosed herein may also be applied to multiple linear lamp configurations or point sources , for example light emitting diodes . when linear lamps are configured , for example , end to end the uncorrected irradiance profile across a target area will rise in middle sections and fall towards each linear bulb end . the present invention may be applied to even out the resulting irradiance profile along the length of a desired target area of any size created by any number of energy sources . in use , the desired irradiance profile is selected and corresponding reflector segments 40 , reflectors 30 , shade members 50 , lens 60 and or linear bulbs 10 having appropriate surface treatments and or coatings are mounted in the linear lamp housing 20 . reflector segments 40 permit rapid and cost effective irradiance profile tuning to match a specific process demand . for example , the desired irradiance profile may be uniform across the target area , low irradiance in the middle and high irradiance at the edges of the target area or vice versa . the reflector segments 40 and or reflectors 30 may be quickly and inexpensively exchanged if they become fouled . the present invention may also be applied to existing linear lamps 1 by replacing existing reflectors 30 and or linear bulbs 10 with reflectors 30 , reflector segments 40 , shade members 50 , lens 60 and or linear bulbs 10 according to the invention . table of parts 1 linear lamp 10 linear bulb 20 housing 30 reflector 40 reflector segment 50 shade member 60 lens where in the foregoing description reference has been made to ratios , integers , materials , components or modules having known equivalents then such equivalents are herein incorporated as if individually set forth . while the present invention has been illustrated by the description of the embodiments thereof , and while the embodiments have been described in considerable detail , it is not the intention of the applicant to restrict or in any way limit the scope of the appended claims to such detail . additional advantages and modifications will readily appear to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details , representative apparatus , methods , and illustrative examples shown and described . accordingly , departures may be made from such details without departure from the spirit or scope of applicant &# 39 ; s general inventive concept . further , it is to be appreciated that improvements and / or modifications may be made thereto without departing from the scope or spirit of the present invention as defined by the following claims .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

the following description is of the best mode presently contemplated for the carrying out of the invention . this description is made for the purpose of illustrating the general principles of the invention , and is not to be taken in a limiting sense . the scope of the invention is best determined by reference to the appended claims . although specific embodiments of the invention will now be described with reference to the drawings , it should be understood that such embodiments are by way of example only and are merely illustrative of but a small number of the many possible specific embodiments to which the principles of the invention may be applied . various changes and modifications obvious to one skilled in the art to which the invention pertains are deemed to be within the spirit , scope and contemplation of the invention as further defined in the appended claims . 1 . the preferred ballast water treatment method of the present invention the purpose of the experiments described here was to obtain data on the effects of “ inert gas ” on marine organisms . “ inert gas ” of a mixture hereinafter called trimix — a commercially available gas mixture of 2 % oxygen , 12 % co 2 and 84 % nitrogen resembling the gas generated by commercially used marine “ inert gas generators ”— was used . both adult and young adult marine organisms were chosen for two reasons : a ) to make the size of specimens amenable for the experimental setup and b ) to raise the significance of possible effects since adults of a species are typically more tolerant of environmental changes than juveniles or larvae . all marine organisms were collected fresh from the coastal waters off la jolla , calif . and used immediately . they are , in that particular environment , not necessarily nuisance organisms . some of the organisms might be so considered , however , should they be introduced into other waters . the plankton sample was collected with a plankton net from a small boat . the schematic of an experimental setup in validation of the principles and methods of the present invention ( and also , a miniature scale , the gaseous exchange system ) is shown in fig1 . three parallel incubations were done for each experiment . several organisms were incubated in 1 . 5 l of seawater at 22 ° c . in large erlenmeyer flasks . each incubation was equilibrated with the respective gas using aquarium stones before any organisms were introduced . the aerobic control was bubbled from an aquarium pump for approximately 15 min and left open to the atmosphere after addition of specimens . an anaerobic incubation was bubbled with 99 . 998 % nitrogen for 15 min . after introduction of the organisms , the bubbling was continued for another 10 min and then the container was closed with a rubber stopper or the bubbling was continued . the incubation in trimix was treated similarly except that the gas mix was used instead of nitrogen . the oxygen concentrations were measured after the initial bubbling period using a strathkelvin oxygen electrode with a cameron instruments om - 200 oxygen analyzer . values of ph were determined using a combination electrode and a radiometer ph meter . survival of the marine specimens was determined visually by checking for motile responses to tactile stimulus ( e . g . mussels do not close their shells , barnacles to not withdraw their feet , shrimp do not move their mouthparts , worms appear limp and motionless ). after each testing of the animals , the incubation flasks were bubbled for 10 min to reestablish original conditions . to verify mortality of the specimens , they were relocated to aerobic conditions and checked again after 30 min . if they still did not respond , they were considered dead . this setup permitted comparison of responses to both nitrogen and “ trimix ” while making sure that test specimens were not gravely affected by other experimental parameters . incubation in pure nitrogen permitted comparison with published results by others . the oxygen concentrations were measured at “ non - detectable ” for the nitrogen incubations and 10 % air saturation (= 16 torr partial pressure ) for the “ trimix ”. the ph value of the water bubbled with trimix reached ph 5 . 5 after the initial 10 min . of vigorous bubbling . the aerobic and nitrogen bubbled seawater maintained their ph at 8 . the incubations showed clearly that “ trimix ” kills organisms considerably faster than incubations in pure nitrogen . see table 1 of fig2 . the shrimp and crabs incubated in “ trimix ” were dead after 15 min and 75 min , respectively . even a transfer into aerated water did not result in any movement . the brittle stars incubated under nitrogen started to move again after transferred into aerated water . all the mussels incubated in nitrogen and “ trimix ” were open after 95 min but only the ones in nitrogen still responded to tactile stimuli by closing their shells . the barnacles were judged dead after incubation in “ trimix ” when they did not withdraw their feet when disturbed , the ones incubated in nitrogen still behaved normally . the plankton sample mainly contained copepods . they stopped moving after 15 min and could not be revived in nitrogen and “ trimix ” incubations . the results are summarized in table 1 of fig2 , showing the effects of trimix on marine species where the trimix is 2 % oxygen , 12 % co 2 and 86 % nitrogen . low oxygen concentrations in water are a common natural phenomenon and their effects on live organisms have been widely discussed in the past . oxygen may not be available to an organism because no water for respiratory purposes is present , e . g ., during low tide in the intertidal zone . oxygen may also be removed in stagnant waters due to bacterial or other “ life based ” actions , e . g ., in ocean basins , fjords , tide pools , or in waters with high organic content and consequently high bacterial counts , e . g ., in sewage , mangrove swamps , paper mill effluent . in addition , oxygen can also be removed by chemical reactions , e . g ., in hot springs , industrial effluents . the manuscript by tamburri et al . ( 2000 ) summarizes survival of a variety of larvae and adults of organisms including some which may be significant as “ nuisance species ” under hypoxic conditions . see tamburri , m . n ., peltzer , e . t ., friederich , g . e ., aya . i ., yamane , k . and brewer , p . g . ( 2000 ). a field study of the effects of co2 ocean disposal on mobile deep - sea animals . mar . chem . 72 , 95 - 101 . the publication supports extensively that most organisms only survive strongly hypoxic conditions for a few hours and only a few adults for several days . the authors suggest that 72 h . of hypoxia will be sufficient to kill most eucaryotic organisms , adults or larvae in ballast water . the effects of high co 2 on organisms in natural waters have become a research focus because of proposals to dispose atmospheric co 2 in the deep ocean ( haugan 1997 , omori et al . 1998 , seibel and walsh 2001 ). see haugan , p . m . ( 1997 ). impacts on the marine environment from direct and indirect ocean storage of co2 . waste management 17 , 323 - 327 . see also omori , m ., norman , c . p . and ikeda , t . ( 1998 ). oceanic disposal of co2 : potential effects on deep - sea plankton and micronekton — a review . plankton biol . ecol . 45 , 87 - 99 . see also seibel , b . a . and walsh , p . j . ( 2001 ). potential impacts of co2 injection on deep - sea biota . science 294 , 319 - 320 . two effects have to be distinguished when looking at “ trimix ” incubations in seawater : a ) the lowering of the ph from ph 8 to about ph 5 . 5 and b ) the raised co 2 concentrations in the water . while the ph change caused by the incubations in “ trimix ” are in the range of published experiments , the co 2 concentration in “ trimix ” ( about 14 %) is much higher than those investigated in the published literature ( generally about 0 . 1 % to 1 %). therefore , the hypercapnic effects of “ trimix ” incubations should be much stronger than those published previously . several publications have shown the detrimental effect of lower ph values and high co 2 levels on aquatic life . in a recent publication , yamada and ikeda ( 1999 ) tested ten oceanic zooplankton species for their ph tolerance . see yamada , y . and ikeda , t . ( 1999 ). acute toxicity of lowered ph to some oceanic zooplankton . plankton biol . ecol . 46 , 62 - 67 . they found that the lc 50 (= ph causing 50 % mortality ) after incubations of 96 hours was between ph 5 . 8 and 6 . 6 and after 48 h . it was between ph 5 . 0 and 6 . 4 . therefore , the ph value caused by incubations with “ trimix ” is well within the lethal range for this zooplankton . huesemann , et al ., ( 2002 ) demonstrate that marine nitrification is completely inhibited at a ph of 6 . see huesemann , m . h ., skilmann , a . d . and crecelius , e . a . ( 2002 ). the inhibition of marine nitrification by ocean disposal of carbon dioxide . mar . poll . bull . 44 , 142 - 148 . larger organisms were also investigated . a drop in seawater ph by only 0 . 5 diminishes the effectiveness of oxygen uptake in the midwater shrimp gnathophausia ingens ( mickel and childress 1978 ). deep sea fish hemoglobin may even be more sensitive to ph changes ( noble et al . 1986 ). see mickel , t . j . and childress , j . j . ( 1978 ), the effect of ph on oxygen consumption and activity in the bathypelagic mysid gnathophausia ingrens . bio . bull . 154 , 138 - 147 . see also noble , r . w ., kwiatkowski , l . d ., de young , a ., davis , b . j ., haedrieh , r . l ., tam , l . t . and riggs , a . f . ( 1986 ). functional properties of hemoglobins from deep - sea fish correlations with depth distribution and presence of a swim bladder . biochem . biophys . acta 870 , 552 - 563 . it appears that a common metabolic response to raised co 2 levels and concomitant lowered ph is a metabolic suppression ( barnhart and mcmahon 1988 , rees and hand 1990 ). see barnhart , m . c . and mcmahon , b . r . ( 1988 ). depression of aerobic metabolism and intracellular ph by hypercapnia in land snails , otala lactea . j . exp . biol . 138 , 289 - 299 . see also rees , b . b . and hand , s . c . ( 1990 ). heat dissipation , gas exchange and acid - base status in the land snail oreohelix during short - term estivation . j . exp . biol . 152 , 77 - 92 . most recently , papers have been published investigating the effects of environmental hypercapnia in detail ( poertner et al . 1998 , langenbuch and poertner 2002 ). see poertner , h . o ., bock , c . and reipschlaeger , a . ( 2000 ). modulation of the cost of ph regulation during metabolic depression : a 31p - nmr study in invertebrate ( sipunculus nudus ) isolated muscle . j . exp . biol . 203 , 2417 - 2428 . see also langenbuch , m . and poertner , h . o . ( 2002 ). changes in metabolic rate and n excretion in the marine invertebrate sipunculus nudus under conditions of environmental hypercapnia : identifying effective acid - base variables . j . exp . biol . 205 , 1153 - 1160 . the infusion of trimix in accordance with the present invention combines both hypoxic and hypercapnic effects on marine organisms , including aquatic nuisance species . preliminary results demonstrate the effectiveness of this combination in quickly killing a variety of sample organisms . contrary to methods using additions of biocides or any chemicals in general , nothing is added to the ballast water and , therefore , nothing will be released into the environment when it is released again . methods using radiation , heating , or filtering ballast water before or during a ship &# 39 ; s trip , are much more expensive . the equipment needed to establish a rapid gassing of ballast water is available off the shelf and has been used in the marine environment . the plumbing and gas release equipment has been optimized and has been used in application such as aquaculture , sewage treatment and industrial uses . extensive supporting literature and research about the design and optimization of equipment for the aeration of water is publicly available . inert gas generators are available for fire prevention purposes on ships and other structures and are already installed on many ships , mainly tankers . they can use a variety of fuels including marine diesel to generate the inert gas . several considerations are relevant to a particular shipboard implementation for the treatment of ballast water with “ inert gas ”. these include a ) how are larvae , eggs , and plankton effected and b ) what is the effect of trimix type inert gas in fresh water . if ballast water is taken up through a screen , larger animals will not be included . the initial tests were made with adults because of easy access to them . however , if adults of a species are effected by “ inert gas ” it is most likely that their larvae will also be effected probably even more so . empirical testing can be conducted with specimens from plankton and larval cultures and with incubations of mixed plankton collected from the ocean . determinations of viability may be made by microscopic observations ( e . g . movement of mouthparts , swimming behavior ), atp measurements ( the atp levels rapidly decreases after death of an organism ), and the ability to bioluminesce ( many planktonic organisms emit light , an ability which ceases after death ). fresh water organisms are also of interest because the ph change is not as much as in seawater . freshwater in its natural environment can have ph values around 5 . 5 . it has to be proven that raised co 2 concentrations in combination with hypoxia will also affect fresh water species . only then can the method be used for both , fresh and salt water ballast . in this section 4 . is presented mathematical descriptions of the deoxygenation process and of the transfer of carbon dioxide into the ballast water , which , in turn , leads to lowering of the ph to the levels lethal to most ans . closed - form mathematical models , usable in design of a shipboard system from any set of given specifications , are presented . a list of symbols used in the equations is as follows : c concentration of carbon dioxide in the water , including ions produced by electrolytic dissociation . k h henry &# 39 ; s law constant for oxygen (= 39 . 79 × 10 − 6 ). n co2 number of moles of carbon dioxide in the bubble . p co2 partial pressure of carbon dioxide in the bubble . superscript 0 refers to quantities in the gas bubble when it is first introduced into the tank . subscript 0 refers to quantities in the water at the time t = 0 . the system analyzed places a mixture of nitrogen and carbon dioxide with a relatively small fraction of oxygen in contact with ballast water . the oxygen level in the ballast water is assumed to have reached equilibrium with air as a result of prolonged contact , and therefore would contain a concentration of oxygen sufficient to support a wide spectrum of life forms . the objective is to reduce the oxygen content to a low level by interchange with the gas mixture . the gas is bubbled through the ballast water , which assures uniform distribution of dissolved gas throughout the ballast tank . thus , diffusion within the tank can be neglected . bubbles are assumed to be small and variation of hydrostatic pressure over the vertical dimension of a bubble is neglected . the size of bubbles and the frequency of their generation are not discussed here . these two issues are addressed in existing reference literature ( see , for example , perry et al . 1984 ). the deoxygenation process is assumed to follow henry &# 39 ; s law with equilibrium achieved within the residence time of each bubble . the composition of the mixture in the bubble changes primarily due to transfer of carbon dioxide , a dynamic chemical process assumed to obey the mass action kinetics . as trimix gas is flushed through the system , the total weight of oxygen in the ballast water will be reduced . for the purpose of analyzing the deoxygenation process the presence of carbon dioxide in the trimix is neglected . when a small quantity of gas , dq , is admitted , it contains an oxygen molar fraction y 0 . by the time this quantity of gas leaves the system it contains , according to henry &# 39 ; s law , the molar fraction y / k h . ⅆ y ⅆ q = y 0 - 1 k h ⁢ y ( 1 ) q = k h ⁢ ln ⁢ y 0 - y / k h y 0 - y 0 / k h ( 2 ) from this equation it follows that pumping 5 , 200 m 3 of gas into a 32 , 200 m 3 tank reduces oxygen concentration to 0 . 83 ppm . this level of hypoxia is lethal to many ans . with the flow rate of 38 . 2 m 3 / min this can be achieved in 135 min . the relationship between the size of the tank and the time required to deoxygenate it is linear . therefore , these results can be scaled to any tank size . deoxygenation is enhanced by the under - pressure , as can be seen from the following simple argument . let p be pressure of water at a given depth in the absence of under - pressure . let p u be the absolute value of the negative pressure at the top . let y be the weight fraction of oxygen in the water without underpressure and y u — the same weight fraction with underpressure . then by henry &# 39 ; s law : y - y h y = k h ⁢ yp - k h ⁢ y ( p - p u ) k h ⁢ yp = p u p ( 3 ) from this equation it may be concluded that solubility of oxygen is reduced by underpressure . this factor becomes even more significant as a bubble rises to the surface , and the pressure inside decreases . for example , if p = 14 . 7 psi ( the usual value at the surface of the tank ) and the absolute value of the underpressure is 2 psi , then the solubility of oxygen is reduced by approximately 14 %. since it is assumed that the pressure inside the bubble depends only on the pressure of the liquid surrounding it , it follows that : ⅆ p ⅆ t = - ρ ⁢ ⁢ gu , p = p 0 - ρ ⁢ ⁢ gu ⁢ t ( 4 ) by definition n co2 + xn . differentiating this equation realizes the following : ⅆ n c ⁢ o ⁢ 2 ⅆ t = x ⁢ ⅆ n ⅆ t + n ⁢ ⅆ x ⅆ t ( 5 ) however , since the reaction of carbon dioxide with water is the dominant cause of change in the chemical composition , it can be written that : ⅆ n ⅆ t = ⅆ n c ⁢ o ⁢ 2 ⅆ t ( 6 ) n ⁢ ⅆ x ⅆ t - ( 1 - x ) ⁢ ⅆ n c ⁢ o ⁢ 2 ⅆ t ( 7 ) ⅆ n c ⁢ o ⁢ 2 ⅆ t = - kp c ⁢ o ⁢ 2 ( 9 ) for the partial pressure of carbon dioxide , according to dalton &# 39 ; s law p co2 = xp . ⅆ x ⅆ t = - k n 0 ⁢ x ⁡ ( 1 - x ) 2 ⁢ ( p 0 - ρ ⁢ ⁢ gut ) ( 10 ) i ⁡ ( x ) - i ⁡ ( x 0 ) = - kt 2 ⁢ n 0 ⁢ ( 2 ⁢ p 0 - ρ ⁢ ⁢ gut ) ( 11 ) i ⁡ ( x ) = 1 1 - x + ln ⁢ x 1 - x ( 12 ) this equation can be used to calculate the parameters of the systems , including residence time of a bubble , required to achieve the desired molar fraction of carbon dioxide in the bubble . the latter quantity is related to the ph and the concentration of carbon dioxide in the water , as shall be seen in the next subsection . concentration of carbon dioxide in water can be determined as the ratio of the number of moles transferred from the bubble to the volume of the tank . the number of moles transferred from each bubble can be determined from the value of x as follows . by definition : x = n c ⁢ o ⁢ ⁢ 2 n c ⁢ o2 + n 0 ( 13 ) n c ⁢ 02 = xn 0 1 - x ( 14 ) which gives the following answer for the concentration of carbon dioxide in water : c = n v t ⁢ ( n c ⁢ o2 0 - xn 0 1 - x ) ( 15 ) the concentration of the hydrogen ions in the water can be calculated from c by solving the following equation for h : the ph can be then found by taking the − log h . from this equation it can also be found that ph 5 . 5 corresponds to 2 × 10 − 5 mol / lit of carbon dioxide . equation ( 16 ) can be solved for c , with the result substituted into the equation ( 7 ). this yields after some tedious , but straightforward algebra the following relationship between the desired molar fraction of carbon dioxide in the bubble and the desired concentration of hydrogen ions in the water : x = 1 - ( kn ⁢ n ) c ⁢ o2 0 kn ( n c ⁢ o2 0 + n 0 ) + ( k - h ) ⁢ ( h ⁢ v ) t ( 17 ) the equations ( 11 ) and ( 17 ) constitute a closed - form mathematical model of carbon dioxide transfer , usable for design of the treatment system . 5 . the most preferred ballast water treatment system in accordance with the present invention a most preferred ballast water treatment system in accordance with the present invention is next described for a large tanker of the size as 300 , 000 dwt . a tanker of this size may not be the most cost effective candidate for realization of the ballast water treatment features of the present invention . however , the design next set forth can be easily modified for smaller tankers . the most preferred ballast water treatment system in accordance with the present invention is a combination of two effective treatment systems : deoxygenation and carbonation . the system is analogous of the american underpressure system (“ aups ”) of mh systems , san diego , calif . ( husain et al . 2001 ) in that a pressure less that atmosphere , called an “ underpressure ” is pulled in the ullage spaces of the ballast water tanks . the inert gas that is preferably supplied by a standard marine gas generator is approximately 84 %- 87 % nitrogen , 12 - 14 % carbon dioxide and about 2 %- 4 % oxygen . this inert gas has all the ingredients necessary to combine the two very effective treatments of hypoxia and carbonation at a very reasonable cost . the laboratory tests at scripps institute of oceanography , described previously , show that this gas needs very little contact time to be effective . the analyses described earlier established the flow rates and control time for hypoxia carbonated conditions . each ballast tank has rows of pipe at the tank floor with downward pointing nozzles . the pressurized inert gas is jetted downward out of the piping . the jets stir up the sediment for contact with the inert gas bubbles . the bubbles then rise through the ballast water to the space above the water surface , which has previously been underpressurized to − 2 psi . for the purposes of this paper , a 300 , 000 dwt single hull tanker was used for design studies of this system to test practicality and affordability . applicability to a 300 , 000 dwt double hull tanker was also examined . an inboard profile , deck plan view , piping layout , nozzle detail and section through a ballast tank part of the ballast water treatment system of the present invention is shown in fig4 a . a schematic diagram of the preferred embodiment of a ship &# 39 ; s ballast water treatment system in accordance with the present invention — the tank of which was just previously seen in fig4 a — is shown in fig4 b . various views of the installation of the ship &# 39 ; s ballast water treatment system in accordance with the present invention , previously seen in fig4 b , on an exemplary ship are shown in fig5 a - 5d . the exemplary ship is a 300 , 000 dwt double hull tanker . this particular ship incurs somewhat less installation cost since the tank bottom is smooth as is best shown in fig5 a . for this 300 , 000 dwt tanker , there are 8 ballast tanks as follows in table 2 of fig3 . table 2 lists the ballast water tank capacities . from analyses and experience ( tamburri et al . 2002 ), it is estimated the hypoxia and ph conditions can be set in at least 8 hours , even in the largest tanks , b3 port and starboard . the flow rate is 1350 cfm for each of these tanks . with one 1500 cfm marine gas generator , and treating each tank sequentially , it is estimated that all 8 tanks can be in a hypoxia , low - ph ( 5 . 5 - 6 ) condition in less than 48 hours . contact time for essentially total lethality may not require more than another 24 hours although the remainder of the 2 to 3 week voyage is available . the space above the liquid in each tank is underpressurized to about − 2 psi and maintained throughout the voyage . as the gas bubbles rise up to the surface , they are evacuated by a blower to maintain the underpressure of the inert gas blanket at the surface . the underpressure further facilitates the solubility of the oxygen ( see analysis ) and tends to compensate for the oxygen captured in the bubbles as they rise . since the ballast tanks are treated sequentially , only two 700 cfm compressors are required to compress the gas . the gas is compressed enough to offset the hydrostatic head plus an additional 25 % psi to provide a jet force for stirring the sediment . two compressors are provided for redundancy . if there are some concerns with the dumping of hypoxia and carbonated treated water , it is easily countered with the system discussed in this paper . the compressors will shift over from the gas generator to atmospheric and the ballast water will be oxygenated within just a few hours . in this same period of time the co 2 is readily washed out since the air contains no co 2 component . sensors are needed to monitor the ph to ensure that it never goes below about 5 . 5 . sensors will measure dissolved oxygen content to ensure an adequate deoxygenation is established . sensors will also monitor the underpressure . the control system will remotely start and stop the gas generator , the compressor and the blower . the control system also remotely controls the valves off of the inert gas manifold to each ballast tank and the valving for the underpressure manifold . the system of the present invention may be controlled by computers , or , more preferably , by a suitably designed arrangement of programmable logic controllers ( plcs ). these devices are widely commercially available . they are also easy to program and maintain . a control console with displays integrates the functions of the inert gas generator and the entire ballast water treatment system of the present invention , as well as providing for monitoring , status displays and manual override , if required . underpressurization tests have been conducted with that oil tank ullage space gas depressurization system which is , insofar as tank “ underpressures ” go , an analog of the ballast water system of the present invention . namely , the american underpressure system ( aups ) of mh systems , san diego , calif . has already been installed and tested on a naval reserve fleet tanker . this testing verified ( i ) the structural capability of ships ( oil ) tanks ( but with applicability to all ship &# 39 ; s tanks , which are equivalently constructed ) to withstand the negative pressure of − 3 psi , and also ( ii ) the controls needed to maintain the required underpressure . these findings are applicable to the equipment and controls that will be used for the ballast water treatment system of the present invention . 6 . economic evaluation of the most preferred ballast water treatment system of the present invention as used for a 300 , 000 dwt tanker ( as set forth in section 5 above ) as stated in section 5 . above , the inventors are cognizant that a large tanker of the size as 300 , 000 dwt may not be the most cost effective candidate for realization of the ballast water treatment features of the present invention . however , the following economic analysis may readily be modified for smaller tankers . in making an economic evaluation , the analysis methodology described in mackey , et al . ( 2000 ) was used . see mackey , t . p ., tagg , r . d ., parsons , m . g ., ( may , 2000 ). technologies for ballast water management , proc . 8 th icmes / sname new york metropolitan section symp . this method states , “ a logical basis for economic comparisons would be a change in required freight rate ( rfr ).” since there would be no change in cargo capacity , then : δrfr = [ crf ⁡ ( i , n ) * δp + δy ] c ( 18 ) where crf ( i , n ) is a capital recovery factor for an interest rate i for n for economic payback years ; δp is change in capital cost ; and δy is net change in annual operating cost and revenue . mackey et al . ( 2000 ) stated that the economic payback period for conversions is typically 5 years . see mackey , et al ., op . cit . a 300 , 000 dwt tanker is selected for analysis . as stated earlier , a ballast water treatment system applicable for ships must have the capacity for treating huge quantities of ballast water . if a system is practical and economical for treating a ship with 8 ballast tanks of 110 , 823 cubic meters , then it is practical for all ship types . the economics would have to be assessed for ships of other , smaller ballast capacity , as the economics might not scale . but obviously , the effectiveness as well as the practicality of the system would be established . table 3 of fig6 a and 6b lists the principal parts and materials in the ballast water treatment system together with estimated prices and labor costs . the total cost is approximately $ 3 , 057 , 100 . all tankers already have some type of inert gas generating capability . the newer tankers have generators with a gas mixture discharge similar to the mix used in the above - described experiments at scripps institute of oceanography . nevertheless , for conservatism , the generator has been included in the cost . similarly tankers probably have sufficient excess electrical capacity to supply the load of this equipment — the compressors and blower . this is especially true since this is on the return trip in ballast and the machinery will only run about 48 hours each trip . nevertheless , again for extreme conservation , a 300 kw generator has been included . to make a usefully indicative estimate of operating costs , the following assumptions were made : the tanker will operate to 360 days per year . six ( 6 ) voyages per year between persian gulf and usa . half of the voyages are return trips in ballast , or 6 trips a year . the 2 compressors and blower are assumed to operate 48 hours to obtain hypoxia and carbonation in ail 8 tanks ( note that actually the cfm of both compressors is only required for tanks b3 port and starboard and b6 port and starboard . operating costs are primarily the fuel costs for the inert gas generator and the 300 kw generator . the factor n is 5 years ( economic payback period ) and i ( interest rate ) is 8 %. if the gas and electric generators operate 48 hours for each of 6 voyages , then the total operating time is 288 hours per year for each generator . about 6 , 000 gallons of diesel fuel would be consumed by the electric generator and for the gas generator about 16 , 500 gallons . this is a total of 22 , 500 gallons . at a cost $ 1 . 25 per gallon , the yearly operating cost will be about $ 28 , 125 . considering the few hours per year that the machinery operates and the fact that the ship has no cargo and therefore less requirements of the crew , minimal cost has been allocated for maintenance . rfr = 0 . 25 × 3 ⁢ , ⁢ 057 ⁢ , ⁢ 100 + 28 ⁢ , ⁢ 125 300 ⁢ , ⁢ 000 × 6 = $ ⁢ ⁢ . 44 ⁢ / ⁢ ton ( 19 ) in estimating the cost of treatment per ton of ballast water , the estimated annual operating costs of $ 28 , 125 is used . the approximate 4 million cubic feet of ballast is 128 , 000 tons . six trips are made in ballast which is a total of 768 , 000 tons treated . therefore , cost of ballast water treatment is 3 . 7 cents per ton . 7 . practicality and affordability of a ballast water treatment system in accordance with the present invention this ballast water treatment system is focused on treating the huge amounts of ballast water discharged into us harbors . it has the capacity to readily treat these huge quantities using standard marine components . for tankers that already have the major components on board , it would be very affordable . and for tankers with the aups spill containment , the added cost would be even less expensive . also , it appears ( although not tested ) that this system may be adequately effective in treating sediments . ballast water exchange leaves sediment and other residue untreated . in fact , only the filtration concept treats sediment , by eliminating it . in accordance with the preceding explanation , variations and adaptations of the ballast water treatment methods and system in accordance with the present invention will suggest themselves to a practitioner of the gas handling , gas flow , and gas diffusion arts . for example , rather than exposing a large surface of gas in the form of small bubbles to the ballast water in tanks , the surface area of the ballast water available for gaseous interchange could be augmented by spraying the ballast water in an enclosed atmosphere of the desired gases . in other words , the ( substantially ) inert gases can be brought to the ballast water , or the ballast water to the ( substantially ) inert gases . in accordance with these and other possible variations and adaptations of the present invention , the scope of the invention should be determined in accordance with the following claims , only , and not solely in accordance with that embodiment within which the invention has been taught .

8General tagging of new or cross-sectional technology

referring to fig1 and 2 , there is shown a headrig slabbing head 10 according to a preferred embodiment of the present invention . the device comprises movable base platform 12 that is slidable along a pair of spaced parallel rails 14 anchored firmly to the floor . movable base 12 is supported on rails 14 by feet 16 at each corner of the essentially rectangular base . means to move movable base platform 12 comprise a hydraulic cylinder 15 rigidly supported in framework 17 that is in turn rigidly attached to rails 14 . piston shaft 19 of cylinder 15 extends from the cylinder and is connected at joint 21 to support structure 20 that extends upwardly from movable base platform 12 . by moving piston shaft 19 within cylinder 15 by hydraulic pressure , movable base 12 can be pushed and pulled along guide rails 14 to accurately positioned the base as desired . while base platform 12 is shown movable in a horizontal plane in the present embodiment , it is understood that movable base 12 is not limited to movement in a horizontal plane . by inclining guide rails 14 , base platform 12 can also operate on an inclined plane . in the illustrated embodiment support structure 20 has an essentially triangular cross - section as viewed in fig2 . on inclined face 22 of support structure 20 , guide means comprising a pair of spaced parallel shafts 24 are mounted . each shaft 24 is held in place by three mounting brackets 26 , one at each end of the shaft and the third midway along the shaft &# 39 ; s length . while the present embodiment shows a support structure having an inclined face with inclined shafts 24 , it is understood that the shafts 24 can also be mounted in a vertical manner on a suitably shaped support structure . shafts 24 slidably support carriage member 28 . as best shown in fig2 carriage member 28 is attached to shafts 24 by mounting blocks 29 extending from bed plate 30 of carriage member 28 . mounting blocks 29 have an aperture therethrough through which shaft 24 passes . shaft 24 and the aperture in mounting block 29 are suitably dimensioned and lubricated so as to allow smooth motion of the mounting blocks 29 over the shafts 24 . bed plate 30 is positioned on shafts 24 so that mounting blocks 29 straddle the middle mounting bracket 26 . carriage member 28 is moved along shafts 24 by means of hydraulic cylinder 50 located between shafts 24 and aligned parallel with the shaft &# 39 ; longitudinal axes , as best shown in fig1 . one end of the cylinder 50 is connected to support structure 20 and the opposite end is connected to carriage member 28 . by extending or retracting the piston shaft of cylinder 50 , carriage member 28 and its attached equipment is movable between a lowered position and an upper position as shown by dashed lines in fig2 . in the event of hydraulic cylinder 50 failing , mounting blocks 29 engaging against middle and lower mounting brackets 26 will arrest the motion of carriage member 28 as it slides down shafts 24 under its own weight . extending from bed plate 30 of carriage member 28 is a cutting means comprising chipping or slabbing head 32 rotatably mounted in bearing assembly 34 . chipping head 32 is mounted at one end of rotatable shaft 35 for rotation therewith and extends outwardly from that end of carriage member 28 that is opposite the end adjacent joint 21 connecting hydraulic cylinder piston shaft 19 and support structure 20 . the axis of rotatable shaft 35 is parallel to the longitudinal axes of guide rails 14 . chipping head 32 is surrounded by cowling 36 which is shaped to collect and direct chips produced by the chipping head downwardly to the floor and into a chip chute ( not shown ). mounted above bearing assembly 34 is the drive means for rotating chipping head 32 comprising an electric motor 38 with belt wheel 39 attached to the motor &# 39 ; s output shaft . as best shown in fig1 motor 38 is positioned such that belt wheel 39 lies directly above belt wheel 40 attached to the end of rotatable shaft 35 opposite chipping head 32 . belt wheels 39 and 40 are connected by belt 42 which transmits the rotary motion of motor 38 to shaft 35 and hence chipping head 32 . belt wheels 39 and 40 are sized so that electric motor 38 rotates chipping head 32 at its optimal speed for producing good quality chips . as a safety precaution , cowling 44 is fitted over pulleys 39 and 40 . examples of various chipping heads 32 for use with the headrig slabbing head of the present invention are shown in fig4 a , 4b 4c . as the side view of fig1 best indicates , chipping head 32 comprises an essentially frusto - conical casting 70 to which the various cutting implements of the chipping head are mounted . fig4 a , 4b and 4c provide a front view of casting 70 . about the sloping sides of casting 70 , a plurality of regularly spaced conventional chipping knives 72 are positioned so as to define a cutting plane parallel to face 77 at the narrowed end of casting 70 . in this cutting plane , chips are cut from the face of a log moved past the chipping head 32 when the head is rotating in the counterclockwise direction indicated by arrow 74 . in addition , if desired , a plurality of conventional planing knives 75 can be positioned in cavities 76 in the sloping sides of casting 70 . such planing knives 75 extend into the same cutting plane as the chipping knives . end face 77 of casting 70 is used to mount the chipping head 32 to rotatable shaft 35 , and also serves to mount various auxiliary cutting implements depending on the condition of the log to be cut . fig4 a shows a chipping head 32 equipped with a saw blade 78 mounted to the end face 77 . planing knives are not used with this particular chipping head . saw blade 78 lies in the same cutting plane as chipping knives 7 and where the teeth of the blade would overlap the leading cutting edge 79 of a chipping knife , the teeth are removed as at 80 . it has been found that such a chipping head arrangement provides the best surface finish on the cut face of the log and works best with non - frozen wood . fig4 b shows a chipping head 32 equipped with a cutter disc 82 lying in the same cutting plane as the chipping 72 and planing 75 knives . such an arrangement has been found to be best suited for opening a face on frozen wood or hardwoods . fig4 c shows a chipping head 32 equipped with planing knives 72 and end face 77 left uncovered . this arrangement has been found to provide maximum chip recovery . referring to fig1 the manner in which the present invention is positioned with respect to a conventional log carriage 60 is shown . the log carriage 60 holds and supports a log 62 and moves the log past the rotating chipping head 32 of the headrig slabbing head of the present invention so that a face 64 is machined on the log and in so doing chipping head 32 produces good quality chips suitable for paper making . just past the headrig slabbing head , the band saw of a bandmill ( not shown ) makes a second cut in the log parallel and offset from the machined face 64 so that a board section is created in one pass of the log carriage . the log carriage and log are then returned to their initial position . the log is turned and another pass is made past the headrig slabbing head of the present invention in order to open another face on the log . the process is repeated to open two , three or four faces on the log depending on the size of the log . arrow 86 in fig2 indicates the direction which a log is moved past the apparatus of the present invention when a face is cut on the log while arrow 85 indicates the direction of rotation of chipping head 32 . alternatively , chipping head 32 could be set up to operate in the opposite direction of rotation if such an arrangement better suited the particular installation site . once the required faces have been cut on the log , the headrig slabbing head of the present invention is no longer used and subsequent cutting of the log is done by the bandmill alone . fig3 shows how the apparatus of the present invention can be used to machine a face on a wide range of log diameters using the same size chipping head 32 , thereby eliminating the need for larger chipping heads that are costlier and generally require more maintenance . on smaller logs , carriage member 28 is lowered on shafts 24 to lower chipping head 32 for contact with the log surface . as well , movable base platform 12 is advanced toward the log using hydraulic cylinder 15 . for larger diameter logs , chipping head 32 is raised on carriage 28 and base platform 28 is retreated along rails 14 to ensure that chipping head 32 always contacts the log surface in a manner that produces good quality chips . preferably , the vertical position of the carriage member 28 and the horizontal position of the base platform 12 are set by information received from the log carriage setworks prior to chipping . in fig3 five set positions for chipping head 32 are shown . at each set position , the chipping head remains at a constant height above a reference line measured from the base of the log . by moving the chipping head 32 in a horizontal direction at each set position , the headrig slabbing apparatus of the present invention is able to machine a face on a range of log sizes with good quality chip production throughout the range . by moving the chipping head to new set position , a different range of log sizes can be processed while still maintaining good chip quality .

1Performing Operations; Transporting

a mold incorporating a removable insert according to the invention is shown generally at 10 in fig1 . the mold 10 includes a mold core or male part 12 , a mold cavity or female part 14 , and a mold inlet 16 having a gate 18 through which plastic material to be formed within the mold 10 is injected . a molded part is shown generally at 20 in fig1 . an insert 22 according to the invention is located within an aperture formed in the mold core 12 . the insert 22 is pressure fitted within the aperture in the mold core so that the insert 22 is held securely in place . a bore 24 leads from the insert 22 within the mold core 12 so that the insert 22 can be removed , if required , by passing a long tool through the bore 24 to tap the insert 22 from the mold core 12 . fig2 illustrates a mold 10 &# 39 ; similar to that of fig1 . however , in this embodiment of the invention , the insert 22 is located in the mold cavity 14 . otherwise , the mold 10 &# 39 ; is identical to the mold 10 of fig1 . fig3 illustrates a series of inserts 26 , 28 , 30 and 32 installed within a mold body 34 . each of the inserts 26 through 32 includes a series of indicia 36 . the inserts 26 through 32 and indicia 36 are reversed so that impressions on a molded article are easily readable . other than the indicia 36 , each of the inserts 26 through 32 is identical and therefore only the insert 28 , illustrated in enlarged cross - section in fig4 will be discussed in detail , it being understood that the description of the insert 28 is equally applicable to the inserts 26 , 30 and 32 . the insert 28 includes two primary portions , a plug body 38 and a plug 40 . the plug body 38 includes a central bore 42 in which the plug 40 is installed . one end of the plug 40 , designated 44 , includes a mold engaging surface 46 . the plug end 40 fills the bore 42 to the extent of the plug end 44 , as shown . the mold engaging surface 46 is contiguous with the face 48 of the plug body 38 . the surface 46 is contoured to conform to the adjacent contours of the face 48 and , in the form of the invention shown in fig4 the face 48 and surface 46 are flat . depending on the mold 10 in which the insert 28 is installed , however , the face 48 and surface 46 might be curved or otherwise shaped to conform to the molded part being formed . a shank 50 extends from the plug end 44 . a retention ring 52 is installed in a groove 54 formed about the shank 50 at its distal end . the bore 42 includes an annular shoulder 56 extending into the bore as shown , and a spring 58 , under compression , is located between the shoulder 56 and retention ring 52 . in cooperation with the plug end 44 , the spring 58 , bearing between the shoulder 56 and retention ring 52 , maintains the plug 40 securely in place within the bore 42 of the insert 28 . as shown in fig3 and 4 , each of the inserts 26 through 32 includes an indicator 60 for selecting certain of the indicia 36 . as shown in fig3 each indicator 60 may be pointed toward a certain one of the indicia 36 of each of the inserts 26 through 32 . as shown in fig4 the indicator 60 of the plug 40 is engraved into the mold engaging surface 46 . in order to facilitate rotation of the plug 40 to aim the indicator 60 at a different one of the indicia 36 , the plug end 44 includes a transverse slot 62 extending across the mold engaging surface 46 . the slot 62 is shaped to accommodate the blade of a screwdriver to permit the user to rotate the plug 40 as desired . the embodiment of the invention shown in fig5 is substantially identical to that shown in fig4 with the exception that the indicia 36 &# 39 ; and indicator 60 &# 39 ; are embossed rather than engraved . with this exception , the insert 28 &# 39 ; of fig5 is identical to that of fig4 and the description thereof is therefore not repeated . fig6 and 7 illustrate , respectively , an insert 64 for showing the days of a single month and an insert 66 for indicating one of six successive years . the structures of the inserts 64 and 66 are identical to those of either fig4 or 5 . corresponding reference numerals are therefore repeated in fig6 and 7 . fig8 illustrates another embodiment of the invention in which a single insert 68 includes four individual plugs 70 , 72 , 74 and 76 . the insert 68 is shown installed in a portion of a mold 78 . the insert 68 includes a series of indicia 80 about each of the plugs 70 through 76 , and each plug 70 through 76 carries an indicator 72 and a slot 84 to facilitate rotation of the plug . fig9 is a cross - sectional view of the insert 68 taken through the plug 76 . as shown , the plug 76 is installed in the bore 86 in the insert 68 , the bore comprising a first bore portion 88 and a larger diameter , second bore portion 90 . the plug 76 correspondingly includes a first segment 92 occupying the first bore portion 88 and a larger diameter , second segment 94 occupying the second bore portion 90 . since the segment 94 is of a greater dimension than the bore portion 88 , the plug 76 is maintained securely within the insert 68 , bearing against the mold 78 . a sealing ring 96 is employed at the juncture of the bore portions 88 and 90 to effect a good seal about the plug 76 and avoid a seepage of plastic material into a bore 98 . the bore 98 is similar to the bore 24 ( fig1 and 2 ) and is used when necessary for removal of the insert 68 from the mold 78 . fig1 illustrates another embodiment of the invention in which four plugs 100 , 102 , 104 and 106 are installed in a mold insert 108 . the insert 108 carries a series of indicia 110 about each of the plugs 100 through 106 and the structure of the plugs ( and corresponding bores within which the plugs 100 through 106 are located ) may correspond to any of the embodiments discussed above . the plugs 100 through 106 are spaced from one another and are arranged in a circular configuration in the insert 108 , the insert 108 therefore being amendable to insulation within a circular bore formed in a mold ( not illustrated ). although the four plugs 100 through 106 and corresponding indicia 110 are shown to represent shift , day , year and month , it should be apparent that a fewer or greater number of plugs can be employed , and the representative indicia changed depending on the use invisioned for the insert 108 . various changes may be made to the invention without departing from the spirit thereof or scope of the following claims .

1Performing Operations; Transporting

an embodiment according to this invention is explained in detail below with reference to the drawings . fig1 is a block diagram illustrating the control system of a magnetic disk drive . the magnetic disk drive has a mechanism wherein , for example , three magnetic disks rotate around a spindle . these magnetic disks have thereon one servo face 1 and five data faces 2 . servo data are written in advance into the servo face 1 using the servo track writer ( stw ). the servo - face servo data 12 are read by a servo head 3 and input to a servo - face positional error signal generator 5 , which generates servo - face positional error signals 14 ( see fig2 ). a recording - reproduction - separated head 4 records or reproduces data on or from the data face 2 . as described below , however , servo data are also written into the data faces 2 and this data - face servo data 13 are read by the head 4 . the data - face servo data 13 are inputted to a data - face positional error generator 6 , which generates data - face positional error signal 15 ( see fig4 ). a passed track counter 7 uses the servo - face positional error signal 14 to output its count 16 indicating the number of tracks passed to a digital signal processor ( dsp ) 8 while the head is moving . the servo - face positional error signal 14 and data - face positional error signal 15 are input to the dsp 8 , which then generates a hybrid positional error signal . this will be explained later referring to fig6 . a current detector 11 detects a drive current 19 when a power amplifier 9 drives the actuator 10 , and the dsp 8 uses the detected current value 17 and the positional error signals described above to perform speed and position follow - up controls , and parameter estimation and correction . these operations will be described in detail later referring to fig7 . this constitution allows the - heads 3 and 4 moved by the actuator 10 to be controlled stably . as described above , the resonance component of the mechanism including the actuator 10 is superposed on the servo - face positional error signal 14 and data - face positional error signal 15 generated from the servo data 12 and 13 read by the heads 3 and 4 . in addition , the servo - face positional error signal 14 , the data - face positional error signal 15 , and a detection signal 17 from the current detector 11 are outputted as digital signals after conversion . fig2 shows a wave form chart for the servo - face positional error signal 14 . the servo - face positional error signal 14 is a triangular wave with a cycle corresponding to four tracks as well as two phases that are at 90 degrees to each other , and consists of an n - position signal 2 and a q - position signal 21 . when the head is moved in the inner direction , the q - position signal 21 follows the n - position signal 20 with a delay of 90 degrees . fig3 is a schematic sectional view illustrating the configuration of the recording - reproduction - separated head 4 . it has thin film inductive heads 25 and 26 as data recording heads and an mr ( magnetoresistive effect ) head 28 as a data reproduction head which is provided between magnetic interference prevention shields 27 and 29 . the thin film inductive heads 25 , 26 and the mr head 28 are integrated and bonded to one side of a slider 24 , and are protected by a protect film 30 for preventing the degradation and crash of the heads . in addition to the servo - face servo data 12 , the data - face servo data 13 are used to reduce the effect of off - tracking in each disk and head . the data - face servo data 13 are written as shown in fig4 . specifically , half - track offset mode causes the data recording head to follow the servo track with shifting by 1 / 2 track and to write as data - face servo data 13 , a and b burst signals into the data face in every other track . during reproduction , the data - face servo data 13 are read by the head 4 and the data - face positional error signal generator 6 uses the difference between the gains of the a and b burst signals to generate a triangular wave with a cycle corresponding to two tracks , as the data - face positional error signal 15 . both the servo head 3 and the recording - reproduction - separated head 4 are moved by the same actuator 10 comprising the rotary voice coil motor ( vcm ). it is desirable that for data recording and reproduction , only the data - face positional error signal 15 be used to determine the position of the head . however , if much data - face servo data 13 is written , the amount of data on the data faces 2 is reduced . therefore , methods combining the data - face positional error signal 13 with the servo - face positional error signal 14 to generate a hybrid positional error signal have been adopted . among them is a frequency division method . this method is described below with reference to fig6 . in fig6 the actuator 10 , the servo head 3 , the recording - reproduction - separated head 4 , the servo - face positional signal generator 5 , and the data - face positional error signal generator 6 are identical to those shown in fig1 but are simplified . in addition , a control positional error signal generator 63 is provided in the digital signal processor ( dsp ) 8 of fig1 as described below . it should be noted that fig6 is a functional diagram showing a method for generating frequency division hybrid positional error signals , and that , in this embodiment , a circuit consisting of an anti - alias filter and a switch is provided in the front stage of the control positional error signal generator 63 as explained in fig7 . in the control positional error signal generator 63 in fig6 the servo - face positional error signal 14 and the data - face positional error signal 15 are sampled and held by sample and hold circuits 36 and 37 , and the outputs 57 and 58 are input to a highpass filter 38 and a lowpass filter 39 , respectively . signals 59 and 60 output from the highpass filter 38 and the lowpass filter 39 are added together by an adder 61 to generate a hybrid positional error signal 40 . either the hybrid positional error signal 40 or servo - face positional error signal 14 is selected by the switch 62 and outputted as a control positional error signal 41 . the switch timing for the switch 62 depends upon the moving speed of the head 4 . that is , if the head is moving fast , the reliability of the data - face positional error signal 15 becomes very low and the servo - face positional error signal 14 must be selected as a control positional error signal 41 instead of the hybrid positional error signal 40 . using the control positional error signal 41 obtained in this manner , a controller 34 and an observer 35 perform the control according to the present invention as described below . fig7 illustrates an embodiment of a servo device according to this invention . this embodiment is a magnetic disk drive to which this invention is applied and the control positional error signal 41 is generated using a frequency division method as shown in fig6 . the positional error signal generators 5 and 6 in fig7 refer to the servo - face positional error signal generator 5 and the data - face positional error signal generator 6 , and are represented as one block . therefore , there are two circuits composed of an anti - alias filter 49 and a switch 70 and the circuits are connected to the servo - face positional error signal generator 5 and the data - face positional error signal generator 6 , respectively . the control positional error signal generator 63 is as explained in fig6 . first , input and output signals for the dsp 8 are described . the servo - face positional error signal 14 , the data - face positional error signal 15 , and the detection signal 17 detected by the current detector 11 are converted to digital signals , which are then inputted to the dsp 8 . the anti - alias filter 49 is a lowpass filter that has a cutoff frequency of twice the sampling frequency , and reduces alias noises in the servo - face positional error signal 14 and the data - face positional error signal 15 after they are converted to digital signals . however , if the head is moving at a high speed , the anti - alias filter 49 compresses the positional error signals 14 , 15 . thus , in speed control mode , the positional error signals 14 , 15 are used before passing the anti - alias filter 49 . while in the position settling and following modes , the positional error signals 14 , 15 are used after passing the filter 49 . in addition , the detection signal 17 is virtually saturated when the head is accelerated but has a much smaller value in position follow - up mode . therefore , the current detector 11 that detects the actuator drive current 19 requires a very wide range . the current detector 11 thus switches the bit range between the speed control mode and the position following mode . after loading a / d converted values , the dsp 8 internally expands their lower bits in consideration of the effect of operational errors . in addition to the above signals , signals taken in the dsp 8 include external instruction commands , the count 16 of the number of passed track generated by a passed track counter 7 from the servo - face positional error signal 14 , and a comparison signal for two - phase positional error signals shown in fig2 . the comparison signal is used in the speed control mode to select between the positional error signals . the controller 34 and the observer 35 perform control in three modes : speed control , position settling , and position follow - up . the controller 34 requires a head speed in each mode but the magnetic disk drive does not allow the direct detection of the head speed . thus , the drive current detection signal 17 , the count 16 of the number of passed tracks , and the control positional error signal 41 are inputted to the observer 35 , which determines the position of the head to estimate the head speed . methods for determining the position of the head vary according to control modes and are therefore described in conjunction to individual control modes . the observer 35 has a two - stage configuration to reduce the effect of the resonance component superposed on the control positional error signal 41 . the first - stage observer inputs the drive current value 17 , the count 16 of the number of passed tracks , and the control positional error signal 41 to estimate the head speed , and the second - stage observer then uses the first estimated value and the drive current value 17 to estimate the final head speed . the observer 35 recognizes as a disturbance and estimates the effect of the spring element of a flexible print cable ( fpc ) connected to the actuator 10 as well as a magnet or spring that serves to move the head to the innermost circumferential side . the observer 35 uses an actuator model to calculate a disturbance estimated value assuming that the disturbance joins the drive current for the actuator 10 as a step input . the disturbance estimated value is subtracted from a control signal 18 that is the output of the dsp 8 to cancel the effect of the disturbance . it should be noted that the output 42 of the observer 35 in fig7 includes the head speed and the disturbance estimated values . in the speed control mode , the actuator 10 is driven based on the difference between a target speed profile 55 and the speed estimated value 42 and moves the heads 3 and 4 to the target tracks . the target speed profile 55 is generated by a speed profile generator 43 in response to a speed profile generation instruction 54 from the control unit 34 . in the speed control mode , the observer 35 uses as positional information the head position determined based on the count 16 of the number of passed tracks and the servo - face positional error signal 14 selected depending upon a combination of comparison signals for the positional error signals . as an example of the speed profile generation circuit 43 , the target speed profile 55 is expanded on memory in advance . if an inexpensive memory with a smaller number of bits is used for the speed profile , the bit range is changed depending upon the target speed profile value before the speed profile is expanded , and when the speed profile is loaded , the bits are shifted to reduce the effect of lost bits in the speed profile value . as an example of the target speed profile 55 , the head speed is specified such that the head achieves the maximum speed when accelerated , then maintains a constant speed , and reduces its speed in proportion to the square root of the remaining distance when decelerated . this speed profile generation method allows the speed profile to be loaded with a small number of steps because the remaining distance and the addresses of the speed profile can be correlated . bang - bang control by feed - forward is used to reduce the access time for the one - cylinder access operation in the speed control mode . the position settling mode is a control mode that replaces the speed control mode when the head approaches within a specified distance from the center of the target track or when the value of the head speed becomes smaller than the specified value . in the position settling mode , settling operation is performed by pd or pid control . in the pd control , a proportional item in proportion to the positional difference between the head and the center of the target track as well as a differential item in proportion to the speed estimated value 42 determined by the observer 35 are used , while in pid control , an integral item that is an integral of the positional errors is used in addition to the preceding two items . the initial value of the integral item must be the final value of the last following operation , that is , the value when the speed control mode is entered . in the position settling mode , the observer 35 uses the positional information generated from only the positional error signal 40 determined by the number of the target tracks . the internal conflict of the observer 35 caused by the switching of positional information is corrected by removing the number of passed tracks for the estimated position . the position follow - up mode is a control mode that replaces the position settling mode after a certain time and is controlled by the same system as the position settling mode . however , the position settling mode uses a gain focusing on a quick response to execute proper settling operation while the position follow - up mode uses a gain focusing on the compression rate to execute proper following operation . in each of the above control modes , the second - stage observer is used to reduce the effect of the resonance of the actuator 10 . however , to directly reduce the effect of resonance , control outputs to the actuator 10 may be made to pass a digital notch filter to reduce the signal outputs of the resonance frequency before outputting from the dsp 8 . the actuator parameters , however , may vary in accordance with temperature changes , the position of the head and so on , resulting in an excess response in the position settling mode or the like . therefore , parameters estimation and correction are required . estimation of parameters of the actuator 10 is performed by a parameter estimation unit 45 in the following procedure . 1 ) since the parameters for the actuator 10 vary according to the positions of the heads 3 and 4 , the controller 34 drives the actuator 10 to move the heads 3 and 4 to positions where measurements are desired and to make them perform following operation . 2 ) the parameter estimation unit 45 then outputs a parameter estimation start instruction 51 and closes a switch 68 . this causes a reference sine wave signal 52 with a specified frequency generated by a sine wave generator 44 to join control outputs 64 from the controller 34 via the switch 68 , resulting in generation of a dsp control signal 18 . according to the control signal 18 that contains a sine wave component , the power amplifier 9 drives the actuator 10 to vibrate the heads 3 and 4 at the specified frequency . 3 ) the drive current detection signal 17 for several cycles at the specified frequency , the control positional error signal 41 generated by the vibrating heads 3 and 4 , and the reference sine wave signal 52 are inputted to the parameter estimation unit 45 , which performs the discrete fourier transformation to calculate the input / output gains of the actuator 10 . taking the ratio of the input / output gains provides a parameter estimated value 53 for the specified frequency , which is then stored in memory 46 . to reduce the effect of eccentricity , it is desirable to select the frequency of the reference sine wave signal 52 while avoiding the rotational frequency of the disk . the period of the reference since wave signal 52 is determined to be integer times of the sampling period of the dsp 8 . to remove the effect of noise around a specific frequency , it is also desirable to carry out similar measurements at different frequencies so as to take an average of these values . to generate reference sine waves for this purpose , an integral multiple of frequencies is generated by selectively reading the values from a sine wave table in a reference sine wave signal generator 44 . the parameter correction is performed by a multiplier 47 and a divider 48 using the estimated parameter value kf for the actuator 10 stored in a memory 46 . that is , the drive current value 17 detected by the current detector 11 is multiplied by the parameter estimated value kf and the result 65 is inputted to the observer 35 . thus , in the head speed estimation , the disturbance estimation , and the operation in each mode described above , the observer 35 uses as a drive current detection value a signal 65 that is a multiple of a drive current value and a parameter estimated value kf . in addition , the control output of the control unit 34 is divided by the parameter estimated value kf and the result is outputted to the power amplifier 9 as a dsp control signal 18 to control the operation of the actuator 10 . thus , actuator parameter variations due to the characteristics of the actuator 10 or secular changes are corrected based on parameter estimated values in the memory 46 updated each time the parameter estimation is performed . when the power to the disk drive is turned on and the drive receives an instruction to cause the spindle to rotate the disks , it causes the maximum current to flow through the spindle motor , which then starts rotating . once the speed reaches 90 % of the reference rotational speed , a signal from the external microcomputer which observes the rotational speed of the spindle through a hall encoder causes the dsp 8 to start controlling the rotational speed of the spindle . when the rotational speed of the spindle follows the reference rotational speed and the servo - plo ( phase - locked oscillator ) is locked , the sampling frequency of the dsp 8 is switched from the clock frequency of a oscillator to the clock frequency obtained from the disk face to match the frequency of the servo signal obtained from the disk face with the frequency of servo signal input timing for the dsp 8 . in other words , the dsp 8 enters into zero mode . the zero mode is an operation mode which initializes variables and flows currents to the actuator 10 to move the heads 3 and 4 to the innermost circumference side . while the actuator 10 does not receive currents , the spring element of the fpc and the magnet cause the heads 3 and 4 to be located on the innermost circumference as described above . in the zero mode , the actuator 10 further applies pressure to the heads 3 and 4 to secure them . then , the control of the actuator starts in parallel to the control of the rotational speed of the spindle . the return - to - zero operation is performed by moving the head to the cylinder 0 . in this case , the cylinder 0 shall be where the following operation is performed in response to the - n position signal for the outermost circumference of the data region . the return - to - zero operation is described below with reference to fig5 . when the dsp 8 receives a return - to - zero instruction , it switches to the speed control mode with the target speed profile set at a constant speed of 100 mm / sec or below , moves the head at the constant speed , and monitors the input of an outer guard band ( ogb ) signal obtained in an outer guard band region 31 outside a data region 32 . it starts reducing the speed after obtaining the ogb signal . once it completes deceleration and confirms that the head has performed following operation in a certain cylinder , it starts moving the head to the cylinder 0 . in moving the head back in the speed control mode , it uses a slow speed value of 10 mm / sec or below so that a deceleration profile will not be required as a target speed profile . after it determines based on the absence of the ogb signal that the head reaches the cylinder 0 , it performs following operation in response to the - n position signal and completes the return - to - zero operation to enter the command acceptance state . as an initial operation , the parameters for the actuator 10 are estimated as described above and the estimated values 53 are stored in the memory 46 for updating . in this case , the number of points where parameter estimation is executed depends upon the characteristics of the actuator 10 . for example , a three zone method vibrating the heads 3 and 4 on the innermost circumference , center , and outermost circumference for parameter estimation is available . other methods performing estimation at several points and supplementing these estimated values to obtain sequential values are also available . before parameter estimation , the head is moved in the speed control and the position settling modes using the nominal values of parameters . once a parameter estimated value is thus updated , the updated value is used to perform access operation in the speed control and the position settling modes . however , the bang - bang control mentioned above is used in the speed control mode with one track access operation . when a composite head with separate reproduction and recording heads is used , offset occurs in the center of the composite head because there is a gap between the two heads . since the amount of offset varies according to the position of the heads , offset correction is required for the position of each head . therefore , the amount of offset for the head is determined based on the position of the target track and the type of the head before initiating access operation , and access operation is executed according to the target position with the amount of offset considered . the amount of offset must also be considered in switching between the recording and the reproduction heads during the following operation . however , the head information for the observer 35 must always be free from the offset regardless of the difference of the heads . a series of operation controls by the dsp 8 has been described . the switching operation for hybrid positional error signals in each mode is described below . as described above , the switch 62 causes the control positional error signal generator 63 shown in fig6 to select either the servo - face positional error signal 14 or hybrid positional error signal 40 and outputs it as a control positional error signal 41 . for example , in the speed control mode , the servo - face positional error signal 14 is used as the head position information to calculate distances and the mode switch points to generate a target speed profile 55 . while in the position settling and the follow - up modes , the hybrid positional error signal 40 is used as the head position information to calculate the proportional and integral items . however , the observer 35 always uses the servo - face positional error signal 14 . it has been noted that the frequency division method can be used as a method for generating the hybrid positional error signals in this invention but a reference servo method is also available . as shown in fig5 this method writes the servo data 12 , 13 into the guard band regions 31 , 33 outside the data region 32 on the data face and uses the servo data to measure the amount of off - tracking on the data face 2 and the servo face 1 . it then determines the amount of off - tracking in the data region 32 using the amount of off - tracking in the guard band regions 31 , 33 on the inner circumferential side 31 and the outer circumferential side 33 . finally , it adds the determined amount to the servo - face positional error signal 14 to generate a hybrid positional error signal 40 . since this method allows the amount of off - tracking on each data face to be measured in advance to execute the operation using only the servo - face positional error signal 14 , it does not require the switching of the hybrid positional error signal 40 and the servo - face positional error signal 14 as in the frequency division method . in addition , since the amount of off - tracking is known , the switching of the amount of off - tracking for access operation is executed similarly to the compensation for the recording - reproduction - separated head . in this method , the observer 35 always uses only the servo - face positional error signal 14 with no offset because the amount of off - tracking varies according to the position of the head . also , in this embodiment , the switch 70 works in such a way that the positional error signal is used before passing the anti - alias filter 49 in the speed control mode , while a similar signal is used after passing the anti - alias filter 49 in position settling and following modes . it is also possible to execute switching based on the head speed that generates the positional error signals 14 , 15 at the frequency determined by the bands of the lowpass filter that is an anti - alias filter 49 . however , the head speed is determined by estimated values from the observer 35 . fig8 is a block diagram of the head control system illustrating the parameter correction part of the actuator 10 in this embodiment . fig9 is a block diagram of the control system of the disk drive with respect to fig8 . the block configuration in fig8 corresponds to the parameter update and correction part in the configuration of this embodiment shown in fig7 and fig9 is a simplified version of the configuration in fig1 . in fig9 a head 101 reads servo information 102 from the disk 1 and a positional error signal generator 103 generates positional error signals 104 . a positional error signal generator 105 in fig8 includes a positional error signal generator 103 and a passed track counter 7 and generates positional error signals 104 , the number of passed tracks 16 , and head position information 67 . parameter estimation and correction operations have already been described . as described above , the head control system according to this invention can estimate parameters for the actuator that drives the head and use them accordingly to correct the preset parameters for the control system . therefore , even if the actuator parameters vary due to the characteristics of the actuator or temperature changes , servo characteristics can be kept stable . in addition , the position or speed of the head can determine whether or not the head positional error signal should be made to pass the anti - alias filter ( lowpass filter ) before inputting to the controller , thereby allowing the position of the head to be detected precisely regardless of head control mode .

6Physics

referring initially to fig1 , a system in accordance with the present invention is shown schematically and is generally designated 10 . as shown , the system 10 includes a hollow , generally cylindrical - shaped reactor vessel 12 that encloses a reactor chamber 14 with side walls 16 . it is also shown that the reactor vessel 12 has ends 18 and 20 . preferably , the reactor vessel 12 is substantially vertically oriented with the top end 18 directly above the bottom end 20 so that gravitational forces will act to draw the combustible material through the reactor chamber 14 . it is to be appreciated , however , that the vessel 12 can be oriented other than vertically , as long as an exit section 22 is below the reaction zone to avoid density instabilities . further , it should be ensured that excessive solids do not fall onto and accumulate on the side walls 16 . regardless of the particular orientation , the important factor , which is more fully set forth below , is that there be a substantially unidirectional flow of material through the vessel 12 . the feed material to reactor vessel 12 of the system 10 can , in certain embodiments , include four separate identifiable constituents . these are : ( 1 ) the reactant to be processed ; ( 2 ) an auxiliary fuel , if necessary to sustain reaction in the reactor chamber 14 ; ( 3 ) water ; and ( 4 ) a pressurized oxidant . more specifically , fig1 shows that the reactant 24 which is to be processed is initially held in a holding tank 26 . as contemplated for the present invention , the reactant 24 can consist of organic material , inorganics , particulates , sludge , soil , neutralizing agents , salt - forming agents , minerals , and / or combustible material . as indicated in fig1 , it may be necessary to combine this reactant 24 with an auxiliary fuel 28 , such as ethanol , which can be initially held in a holding tank 30 . fig1 also shows that both the reactant 24 and the auxiliary fuel 28 , if used , are pressurized before being introduced into the reactor chamber 14 . specifically , a transfer pump 32 and high pressure pump 34 are used to pressurize the reactant 24 . similarly , a transfer pump 36 and a high pressure pump 38 are used to pressurize the auxiliary fuel 28 . as shown for the schematic of system 10 in fig1 , the pressurized reactant 24 and auxiliary fuel 28 are combined in line 40 and transferred to the top end 18 of the reactor chamber 14 . it is to be noted that while the reactant 24 and auxiliary fuel 28 are respectively pressurized by high pressure pumps 34 and 38 to pressures above about 220 bar , they are not necessarily raised in temperature prior to being introduced into the reactor chamber 14 . thus , as intended for the system 10 , the reactant 24 can be introduced into the reactor chamber 14 at ambient temperatures . in addition to the reactant 24 and auxiliary fuel 28 , the feed material to reactor chamber 14 can also include pressurized water 42 and a pressurized oxidant . as shown in fig1 , water 42 is drawn from holding tank 44 by transfer pump 46 and is thereafter pressurized by high pressure pump 48 before it is passed into line 50 . at the same time , air , or some other oxidant , is pressurized by a compressor 52 and is passed into the line 50 . for purposes of the present invention , the oxidant to be used , as an alternative to air , can be pure liquid or gaseous oxygen , enriched air , hydrogen peroxide , nitric acid , nitrous acid , nitrate , and nitrite . alternatively , a substoichiometric oxidant can be used for applications in which partial oxidization of the reactant 24 is desired . in any event , at this point the pressurized water 42 and compressed air ( oxidant ) are mixed and introduced into a preheater 54 . as contemplated by the present invention , the heating of the pressurized water / air mixture in preheater 54 can be accomplished in several ways . for example , a regenerative heat exchange with hot effluent from reactor chamber 14 can be used . alternatively , an external source , such as electricity , or a fired heater , or a combination of these , can be used . for a cold startup of the system 10 , external heat sources must be used . when using a reactant 24 that has sufficient inherent heating value by itself , the preheater 54 may be shut down once a steady state operation of the system 10 has been achieved . as the air / water mixture leaves the preheater 54 , it is mixed with the reactant 24 and auxiliary fuel 28 from the line 40 . this mixing occurs at the junction 56 , and the feed material , including the combination of reactant 24 , auxiliary fuel 28 , water 42 , and compressed air ( oxidant ) is then introduced into the reactor chamber 14 via a port 58 . as will be appreciated by the skilled artisan , an alternative for the system 10 is to use separate feed lines for introducing one or more of the streams which make up the feed material into the reactor chamber 14 through the port 58 . if so , one feed line could be used for the introduction of the reactant 24 and auxiliary fuel 28 , and another feed line would be used for the introduction of water 42 and oxidant . similarly , a separate feed line could be used for the reactant 24 , the auxiliary fuel 28 , the water 42 , and the oxidant . further , depending upon the particular reactant 24 , it may be important to use a high shear mixer at the junction 56 to mix the feed / fuel stream from line 40 with the water / oxidant stream from the preheater 54 . for example , if the reactant 24 is largely water insoluble , high shear mixing is desirable to ensure sufficient mixing of combustible materials and high pressure oxidant . referring now to fig2 , it will be seen that the vessel 12 and chamber 14 generally define a longitudinal axis 60 . for purposes of the present invention , it is preferable that this longitudinal axis 60 of the vessel 12 be vertically oriented with the top end 18 directly above the bottom end 20 so that gravitational forces act generally downwardly along the axis 60 on the feed material . with this orientation , all of the feed material that is to be introduced into the reactor chamber 14 through the port 58 is passed through a jet assembly including a nozzle 62 . importantly , the nozzle 62 introduces a stream of material 64 into the reactor chamber 14 of the vessel 12 in a direction which is substantially along the axis 60 . in one embodiment , the nozzle 62 can introduce a straight single jet of the stream 64 at a velocity of about fifty feet per second ( 50 fps ). in another embodiment , the nozzle 62 can consist of a plurality of nozzles 62 with their respective streams 64 introduced as jets which are inclined toward the axis 60 . with this inclination , the streams 64 are directed slightly toward each other for collision with each other . importantly , the feed material from nozzle 62 should be directed so as not to directly impinge on the walls 16 of the reactor chamber 14 . in this way , build up of solid materials on the walls 16 of the reactor chamber 14 can be minimized . as shown in fig2 , the reaction stream 64 is introduced into the upper portion of the reactor chamber 14 where it is subjected to vigorous back - mixing . specifically , fluid flow in this back - mixing section 66 is characterized by a turbulence in the reaction stream 64 that results from entraining shear forces and eddies 68 which are set up as the feed material enters into the reactor chamber 14 . the feed material is thus rapidly brought above the supercritical temperature of three hundred seventy - four degrees celsius ( 374 ° c .) and rapid reaction commences . further , while the present system 10 avoids direct impingement of the reaction stream 64 onto the walls 16 , heat transfer from the walls 16 in the back - mixing section 66 can assist in the propagation of the reaction within the vessel 12 . below the back - mixing section 66 in reactor chamber 14 is a plug flow section 70 . this plug flow section 70 is characterized by the fact that there is no large scale back - mixing of the reaction stream 64 in this lower portion of the reactor chamber 14 . the flow of the reaction stream 64 in the plug flow section 70 , however , does exhibit local turbulent mixing . the present system 10 also includes a pool of brine 72 having a surface level 74 below the plug flow section 70 . the brine 72 captures the salts and particulates 76 that tend to flow down the side walls 16 of the chamber 14 . as is known , the salts and particulates 76 may flow down the side walls 16 as a result of scraping of the walls . as the salts and particulates 76 are received by the brine 72 , the composition of the brine 72 changes . in order to maintain the temperature and water content of the brine 72 , the vessel 12 is provided with a quench inlet 78 . specifically , the quench inlet 78 is positioned below the surface level 74 of the brine 72 to allow the introduction of quench fluid 80 ( shown in fig1 ) to the pool of brine 72 . as seen in fig1 , the quench fluid 80 is stored in a holding tank 82 that is in fluid communication with the quench inlet 78 via line 84 . also connected to line 84 is a neutralizing agent 86 stored in a holding tank 88 . the neutralizing agent 86 may be added to the quench fluid 80 in order to control and manipulate the content of the pool of brine 72 . it may be desirable to quench the brine 72 for a number of reasons , including to dissolve the salts and particulates 76 , to adjust the ph of the brine 72 , and / or to allow the use of the brine 72 outside the reactor vessel 12 . if desired , the quench fluid 80 may be water 42 from holding tank 44 . in such cases , line 84 may be connected to holding tank 44 . preferably a high pressure pump ( not shown ) is utilized to draw the water 42 from the holding tank 44 to the quench inlet 78 . it will be appreciated that water from an external source , or relatively dirty water ( e . g ., sea water ), or cool , recycled brine can be used as a quenching medium . these options would help to reduce the system &# 39 ; s need for clean quench water . additionally , it should be appreciated that the cooling fluid should be relatively cool when compared to the brine to provide the quenching medium . stated another way , the cooling fluid need only be cooler than the brine to cool the brine . referring back to fig2 , the vessel 12 is shown having a brine outlet 90 . brine outlet 90 allows the brine 72 , and the salts and particulates 76 therein , to be selectively removed from the vessel 12 . also shown in fig2 is a fluid effluent discharge pipe 92 which is formed with a lumen 94 . although in fig2 , the discharge pipe 92 is shown affixed to the end 20 of the vessel 12 and oriented to extend through the brine 72 , the discharge pipe 92 need not be so designed . specifically , the discharge pipe 92 may pass through the side wall 16 of the vessel 12 , either above or below the surface level 74 of the brine 72 . regardless of the specific design of the discharge pipe 92 , the internal end 96 of the discharge pipe 92 is positioned inside the chamber 14 , below the port 58 , and above the surface level 74 of the brine 72 , preferably in the plug flow section 70 . the external end 98 is positioned outside the chamber 14 . with this cooperation of structure , the discharge pipe 92 provides for removal of relatively clean , high temperature , high pressure fluid effluent 100 from the chamber 14 through the lumen 94 . as further shown in fig2 , the internal end 96 of the discharge pipe 92 may include a structure 102 that forces the fluid effluent to change direction prior to entering the discharge pipe 92 as indicated by arrows 104 . also shown are baffles 106 for reducing entrainment of salts and particulates at the internal end 96 of the discharge pipe 92 . referring now to fig1 , it is seen that line 108 is in fluid communication with the external end 98 of the discharge pipe 92 ( shown in fig2 ). as shown , line 108 leads to an energy recovery unit 110 , such as an engine or a turbine . the energy recovery unit 110 is able to recover energy from the 3400 psia , 1200 ° f . fluid effluent 100 without encountering the salts and precipitates 76 created during oxidization . the recovered energy can be used to power the air compressor 52 or other components in the system 10 . in some embodiments , the heat of the fluid effluent 100 may be recovered by a heat recovery unit 112 which is also connected to line 108 . as further shown in fig1 , brine outlet 90 is connected to a line 114 which leads to a heat recovery unit 116 . with this arrangement , heat may be recovered from the brine 72 after it is discharged through the brine outlet 90 . while the particular system and method as herein shown and described in detail is fully capable of obtaining the objects and providing the advantages herein before stated , it is to be understood that it is merely illustrative of the presently preferred embodiments of the invention and that no limitations are intended to the details of construction or design herein shown other than as described in the appended claims .

1Performing Operations; Transporting

reference will now be made in detail to the presently preferred embodiments of the invention , examples of which are illustrated in the accompanying drawings . referring first to fig1 there is illustrated an exemplary steam generator for use in connection with a nuclear powered electrical generating facility . the steam generator 10 has a generally cylindrical outer shell 12 for containing fluids such as reactor coolant under high pressure . a lower portion 14 of the steam generator is preferably hemispherical in shape and is divided into generally quarter - spherical shaped inlet and outlet chambers , 16 and 18 respectively , by a generally vertical wall structure 20 . a generally flat plate 22 is disposed within the steam generator 10 to divide its internal space into two major regions . the plate 22 , hereinafter referred to as a tube sheet , has a plurality of passages extending through it . each of the passages are shaped and sized to receive an end of a generally u - shaped tube 24 which extends from the tube sheet 22 in a generally upward direction , and which , after traversing a generally u - shaped path through the secondary coolant chamber 28 , provides fluid communication between the inlet and outlet chambers 16 and 18 . as indicated by the arrows a and b , a primary fluid , typically reactor coolant can therefore pass into the inlet chamber 16 , upwardly into the tubes 24 , through the secondary chamber 28 , and exit from the outlet chamber 18 . this flow of reactor coolant is at an elevated temperature from having passed through the core of a nuclear reactor and may therefore contain radioactive particles . as will be appreciated by the artisan , any fluid in the upper portion 28 of the steam generator 10 will be in thermal communication with the outer surface of the tubes 24 . such fluid is commonly referred to as secondary coolant . the thermally hot reactor coolant passing through the tubes 24 will be in a heat exchange relationship with the secondary coolant in the secondary portion 28 of the steam generator 10 for the period of time it takes to pass through the tubes 24 . since the reactor coolant is radioactive , it is important that the secondary coolant be prevented from coming in direct contact with it . it should be apparent from the above description that a steam generator 10 as illustrated in fig1 permits secondary coolant to be heated by the reactor coolant without the two coming into contact . although not shown in fig1 and not a part of the present invention , the steam generator 10 may be provided with a means for removing steam from the secondary portion 28 and conducting that steam to a steam turbine which is associated with an electrical generator . the tubes 24 may be preferably supported agains vibration or deformation by intermediate support plates 26 and are rigidly attached to the tube sheet 22 at their end portions . the tubes 24 are welded to the tube sheet 22 in such a way that no fluid can pass through the tube sheet 22 without passing through the tubes 24 . it has been found in practice that over long periods of operation , sediments can be deposited from the secondary coolant onto the upper surface of the tube sheet 22 and around the end portions of the tubes 24 . these sediments , which may form sludge , consist mainly of iron oxides but are not so limited . the existence of the sludge contributes to corrosion of the tubes 24 . even when the chemical nature of the sludge itself is not corrosive , artificial crevices may be created between the sludge and the tubes which act as corrosion accelerators . a crevice around the tube 24 is a chemical concentrating situation which can lead to eventual corrosion of the tubes . it should be apparent that corrosion of the tubes 24 can lead to failure of their integrity and permit mixing between the primary and secondary coolant . this , of course , would result in costly downtime to effect the necessary repairs . while sludge removal techniques may be employed to minimize any failure hazard , a more corrosion resistant design for the tube ends is also necessary to ensure the long term integrity of the steam generator . although various end fittings between the heat exchange tubes and tube sheets , as discussed above , have been proposed , the present invention offers significant advantages over them in terms of corrosion resistance , ease of fabrication , and post - fabrication inspection . turning now to fig2 a - g , there is depicted the development of a first smooth weld , smooth transition , sleeved tube embodiment of the invention . it should be understood that according to the present invention , a connecting region between the tube 100 and a sleeve 102 is formed having a transition region 104 which avoids the introduction of any unacceptable corrosion acceleration sites or adverse structural conditions in the steam generator assembly . the tube 100 of fig2 a - g corresponds to the u - shaped tubes 24 of fig1 . an important aspect of the present invention is the development of a smooth , reinforced , transition region 104 where the diameter of the tube 100 is reduced from a general or stock tube size 106 to a narrower inside diameter 108 . this transition region is preferably accomplished by swaging or pilgering the tube at a tube mill . the transition should be smooth and retain adequate backup metal in the region where the sleeve - to - tube weld 120 will be effected in the manner discussed below . in this embodiment , the outside diameter of the sleeve 102 is approximately equal to the outside diameter of the tube 100 . the result of the swaging or pilgering or upsetting of the tube end is an end portion of the tube 100 having an increased wall thickness with a reduced inside diameter portion 108 . a reduced outside diameter portion 116 ( fig2 b ) may be fashioned from the end portion 110 by machining or the like , to engineer the outside diameter of the tube 100 to a size such that it can easily accept the sleeve 102 as indicated in fig2 c . an exemplary steam generator may use tubes of 0 . 75 inch outside diameter having a wall thickness of 40 to 50 mils . the corresponding tube sheet passages will be slightly larger , for example on the order of 0 . 76 to 0 . 77 inches . a tube sheet 114 ( corresponding to the tube sheet 22 of fig1 ) may be on the order of 15 inches thick so that the size of the openings 112 ( fig2 f ) relative to the tube sheet 114 has been exaggerated in the illustration for clarity . it should also be noted that the transition region 104 preferably extends over a length of about 4 to 6 inches to ensure a smooth and gradual transition . all of the dimensions noted herein are exemplary only and are not intended to limit the scope of the invention in any way . as alluded to above , after machining ( fig2 b ), the sleeve 102 is installed over the reduced diameter portion 116 of the tube 100 as indicated in fig2 c . at this point , a small gap 118 may exist between the outside of the machined portion 116 of the tube 100 and the inside of the sleeve 102 . the machined portion 116 of the tube is then expanded into intimate contact with the sleeve as depicted in fig2 d to eliminate the gap 118 . preferably , during expansion , the gap between the tube and the sleeve is closed along the full surface of the sleeve - tube interface . it should be noted that as the tube is expanded onto the sleeve , the sleeve end and the machined step are maintained in intimate abuttment . the sleeve 102 is then welded to the tube 100 at a point adjacent the transition region 104 by a weld 120 . preferably , the weld 120 is a laser butt weld . if necessary , the weld 120 is configuration finished by grinding or the like so that the outside of the tube presents a smooth , continuous surface , with no corrosion inducing sites . inspection by radiograph or the like of the tube to sleeve may be used to verify the integrity of the weld . the welded assembly is then preferably thermally heat treated to provide the tube , the sleeve material and the weld with good caustic corrosion resistance and for stress relief . in accordance with the present invention , an adequate volume of material is present in the transition region 104 and in the region of the weld 120 to better withstand thermal stress fatigue in general and to reduce stress concentrations at the weld 120 in particular . as described above , the tube - sleeve joint configuration may be described as a partial penetration butt weld with integral backing . in comparison , prior art fillet joints typically have a short transition region with only a single layer or volume of material in the region of the transition . due to the geometry of fillet type welds , the tube wall dimensions ( that is the difference between the inside and outside diameters ) will vary sharply in the transition region . this makes the joint difficult to evaluate both superficially and volumetrically from the improved joint described above . as a result , considerably more time and expense must be expended in reliability testing fillet type weld joints . while the heat affected zones with the proposed joint ( the metallurgically affected regions in the tube transition region and in the sleeve region next to the weld ) are essentially exposed for direct inspection , in contradistinction , the heat affected zones with the fillet weld are partially hidden under the fillet . thus , the joint of the present invention facilitates a cleaner inspection and easier detection of any difficulty with the joint . these benefits are of special importance in connection with in - service inspections . moreover , because of the machined surfaces and smoothly finished weld , the sleeve - weld joint of the present invention has better self aligning and self fixing capabilities than fillet joints . after the tube - sleeve joints are accomplished , the tube and sleeve assembly 122 is bent to generally form a u - shape ( if not previously u - shaped ) and the assembly is inserted into the tube sheet 114 as shown in fig2 f . at least the right - most end of the assembly 122 as viewed in fig2 f is tackrolled or otherwise expanded into contact with the passage 112 . once the assembly is properly aligned and positioned in the passage 112 , the assembly is welded to the tube sheet 114 at weld site 124 . the weld 124 prevents any movement between the tube and sleeve during final assembly and constitutes a leak barrier between the tube 100 , the sleeve 102 , and the tube sheet 114 . in accordance with the general steam generator dimensions referred to above , the tackroll region may be on the order of two inches of axial tube length . finally , as indicated in fig2 g , the assembly 122 is hydraulically expanded into intimate contact with the tube sheet 114 along the entire interface 128 therebetween . by way of illustration and example only , the interface region 128 may be on the order of 15 - 20 inches with the entire sleeve having an axial length along the order of 30 - 40 inches . as will be appreciated by reference to fig2 g , the inside diameter of the steam generator tubes 100 of the present invention will have a &# 34 ; neck &# 34 ; region 130 of slightly reduced inside diameter which may be on the order of 15 - 20 inches long . a simplification of the arrangement of fig2 g from the fabrication standpoint is depicted in the embodiment of fig3 . in fig3 the tube - to - sleeve assembly 122 is formed from three segments . the first segment is the regular tube stock 100 . a transition segment 132 is preferably laser butt welded onto the tube 100 . the transition segment 132 varies smoothly through the regions a , b and c and is butt welded to a double corrosion barrier tube extension segment 134 . the transition segment preferably comprises a first portion a , which dimensionally mates with the stock tube 100 . for a six inch transition segment 132 , the region a will preferably comprise about two inches . in the region b , the inside diameter of the segment 132 is gradually reduced until it coincides with the inside diameter of the double corrosion barrier tube extension segment 134 . for six inch transition segment 132 , the region b will preferably comprise about 2 inches . finally , the region c dimensionally mates with the double corrosion barrier segment 134 . the double corrosion barrier extension segment comprises an assembly of tube material 136 of reduced diameter and a coaxial member 138 of sleeve material which intimately contacts the tube material 136 along the full surface of their interface . the double corrosion barrier extension segment 134 is preferably full penetration laser butt welded to the transition segment 132 and the entire segment thermally treated as described above to improve the caustic stress corrosion resistance of the finished steam generator . this embodiment has several advantages over the first embodiment since conventional machining can be used to square the ends of the various segments rather than machining an outside diameter on the end portion ( such as the end portion 116 of fig2 b ) of a full - length tube which may be several feet long . in addition , the shorter segment simplifies dimensional control and repairs of defective joints . it is very important to appreciate that weld defects are easier to repair with this embodiment as members can easily be cut away , heat affected zones cut away , ends squared , and the welding repeated . this embodiment therefore represents an excellent general repair method for both the integrally backed joint of fig2 and the double corrosion barrier sleeve and tube extension segment of fig3 . it should also be appreciated that the tube of fig3 when assembled , is inserted , tackrolled welded and expanded in a similar manner to that described above with regard to fig2 f and 2g . the embodiment of fig4 is similar to fig3 except that no separate transition segment is used . in this embodiment , a transition region 140 is formed at the end of the tube 100 but unlike the embodiment of fig2 a - g , the transition region does not continue into a reduced diameter tube portion 116 for the sleeve 102 to be inserted over . rather , a sleeve and tube assembly 142 , similar to the double corrosion barrier 134 of fig3 is preferably full penetration laser butt welded at joint 144 to provide the double pressure and corrosion barrier . radiography may be employed to verify the integrity of the weld . within the context of the steam generator dimensions alluded to above , the inside diameter of the tube 100 should vary smoothly at the portion 146 of the transition region 140 over a length of approximately 2 inches for a total transition region of approximately 3 to 10 inches . the inserting and securing of the double corrosion barrier tube of the embodiment of fig4 into the tube sheet is accomplished in a manner similar to that described above in connection with fig2 f and 2g . fig5 illustrates a constant inside diameter embodiment of the invention which is similar to the sleeved tube of fig2 e except that the outside diameter of the tube 100 is varied to accommodate the sleeve 102 on a machined diameter 116 . as with the embodiment of fig2 e , the sleeve is butt welded at joint 150 to the tube 100 . with the constant inside diameter embodiment of fig5 no neck portion 130 , as depicted in fig2 g , will be formed in the final tube as assembled in the tube sheet . the steam generator thus formed will have improved hydraulic flow characteristics . as will be understood by the artisan , the constant inside diameter embodiment of fig5 can also be adapted to the 3 - section assembly of fig3 or to the 2 - section assembly of fig4 with an appropriately configured sleeve and tube double corrosion barrier assembly butt welded to an appropriately formed tube or transition segment . the foregoing description of the preferred embodiments of the invention have been presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed , and obviously many modifications and variations are possible in light of the above teachings . the embodiments were chosen and described in order to best explain the principles of the invention and their practical application to thereby enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto :

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

with reference to the drawings , there is shown in fig1 - 6 a key case with a key select mechanism 10 , in accordance with the present invention , which includes a housing 12 within which there is mounted a plurality of keys 14 . the mounting of each of the keys 14 is shown schematically in fig2 . each key 14 is mounted in a key holder 16 which is pivotally connected to the housing 12 via an axle 18 . while the operation of a single key holder 16 will be described in detail it should be understood that this description is by way of example and that the key case 10 according to the present invention may have a single key holder 16 which supports a single key 14 or , more typically , a plurality of key holders 16 thereby accommodating a plurality of keys 14 . the key case 10 includes a flexible operating link or flexible arm 20 which has a first end 22 which is pivotally connected to the key holder 16 via a pin 24 . a first portion 26 of the flexible arm 20 is generally curved . a first intermediate portion 28 of the flexible arm 20 has a finger 30 which rides in a curved groove 32 or ramp area formed in a wall 34 of the housing 12 . a second portion 36 of the flexible arm 20 has an end 38 which engages the button member 40 . the end 42 of the second portion 36 of the flexible arm 20 has an integrally formed pin 44 which engages a socket 46 formed in a first portion 48 of the button member 40 . the button member 40 includes a pressing portion 50 which has a smooth surface 52 adapted for pressing , a first portion 48 connected to the flexible arm 20 and a second portion 52 . the second portion 52 is connected to a button latch mechanism which is indicated schematically by a rectangle 54 in fig2 and 3 and which will be described presently . fig2 is a schematic view generally taken along the line 2 - 2 in fig1 showing the relative positions of the various components when the key 14 is contained in the housing 12 of the key case 10 . as shown in fig2 , when the key 14 is container in the housing 12 , the finger portion 30 of the flexible arm 20 rests in a first detent 58 which is formed in the groove portion 60 of the wall 34 . when the end 42 of the flexible arm 20 is moved in the direction shown by the arrow 62 in fig2 , the finger 30 leaves the first detent 58 , and rides in the curved portion 63 of the groove 32 and enters the second detent 64 . this action of the flexible arm 20 causes the first end 22 of the flexible arm 20 to rotate the key holder 16 causing the key holder 16 to rotate the key 14 in a direction shown by the arrow 66 in fig2 to a position projecting outwardly relative to the housing 12 as is shown in fig3 . the key 14 can now be used to operate a lock . the button member 40 remains depressed as is shown in fig3 . when the button 40 is pressed a second time , the button 40 is released from the latch mechanism 54 and moves in a direction relatively outwardly relative to the housing 12 as shown by the arrow 68 in fig3 . this action causes the finger 30 on the flexible arm 20 to return to the first detent 58 and the key holder 16 rotates the key 14 to enter the housing 12 and the position of the various components returns to the position shown in fig2 . the components of the button latch mechanism 54 which was indicated as a rectangle 54 in fig2 and 3 are shown schematically in fig4 . the button latch mechanism 54 is conventional in nature and is generally similar to the latch mechanism found on retractable pens and will therefore not be described in detail . the button latch mechanism 54 includes the button member 40 which has a first portion 48 connected to the base 70 and a second portion 52 also connected to the base 70 . the second portion 52 has a finger 74 which bears against a rotateably mounted cam member 76 which engages one of a plurality of complementary cam fingers 78 which are formed on the internal surface 80 of a stroke cylinder 82 . the finger 74 is spring loaded by spring 88 . the pressure of the finger 74 causes the cam member 76 to rotate relative to shaft 90 to lock the button member 40 in the last position . depressing the button member 40 again rotates the cam member 76 and releases the button member 40 and allows the helical compression spring 84 , which bears on member 86 to return the button member 40 to the position shown in fig2 . fig5 and 6 show an alternative embodiment of the invention 200 which incorporates an external button selector assembly 202 which the user can slide along the housing 204 to select the desired key 206 , 208 , 210 . the housing 204 may have indicia 212 as indicated by the numerals 1 , 2 , 3 and 4 to aid in selecting the desired key 206 , 208 , 210 . when the external button 214 is moved along the directions shown by the arrows 216 , 218 to the desired location which is in alignment with a button member 40 , which has been previously described , and which corresponds to the desired key 206 , 208 , 210 and the external button 202 is depressed by the user , the desired key swings 206 , 208 , 210 out of the housing 204 in the direction shown by the arrow 220 in the manner previously described and is ready for use . as shown in fig5 and 6 the external button selector assembly 202 includes a sliding block 222 which has slots 224 , 226 which ride in projections 228 , 230 which are formed in the housing 204 and a spring 232 which urges an outer operating button 214 in the direction shown by the arrow 234 in fig6 . the outer operating button 214 is retained on the sliding block 222 by the retainer portion 236 which is formed on the end 238 of the outer operating button 214 . the foregoing specific embodiment of the present invention as set forth in the specification herein is for illustrative purposes only . various deviations and modifications may be made within the spirit and scope of the invention without departing from the main theme thereof .

8General tagging of new or cross-sectional technology

an embodiment 1 of the invention will be described with reference to fig1 through 6 . although a liquid crystal display device using liquid crystal display elements will be given here and explained as an example of the display device , this invention can be applied to display devices such as organic el display and fed ( field emission display ) using electron emitting elements . fig1 is a block diagram of a liquid crystal display device 100 in the embodiment 1 of the invention . the liquid crystal display device 100 receives input signals of a yuv video signal 101 of yuv - format , an rgb osd signal 102 and control information 103 . the yuv video signal 101 , rgb osd signal 102 and control information 103 are preferably supplied from separate systems , or through different ports . the yuv video signal 101 is composed of , for example , luminance information - y and two kinds u , v of color difference information as specified in recommendation itu - r bt . 656 - 4 . this yuv video signal is thus a digital video signal that is sequentially transferred as pixel information . the osd signal 102 is display - information for osd , and is the signal sequentially transferred pixel by pixel as is the video signal , or compressed image data or positional information and image for giving a change . the control information 103 is the information to control from the system side the display - related settings such as the output settings for display synch signal and scanning direction . the control information 103 also includes the resolution information of the inputted video signal 101 and osd signal 102 and the resolution information of a liquid crystal display panel 109 . the input signals of yuv video signal 101 , osd signal 102 and control information 103 are given on an objective basis . for example , the osd signal and control information may be fed through the same bus , or the video signal may have synch signals embedded . that is , the forms in which the input signals are transmitted are not limited . the yuv video signal 101 , osd signal 102 and control information 103 are first supplied to a signal processor 104 , which then produces a digital rgb composite video signal 105 and display synch signal 106 to drive the liquid crystal display panel 109 that has an array of a plurality of liquid crystal display elements . the rgb composite video signal 105 and display synch signal 106 are supplied to a liquid crystal drive circuit 107 , which then produces an analog signal that is to be applied to the liquid crystal display elements of the liquid display panel 109 . the display synch signal 106 is also supplied to a liquid crystal scanning circuit 108 , which then produces a scanning signal for selecting any ones of the liquid crystal display elements of liquid crystal display panel 109 . the liquid crystal display elements selected by the scanning signal produced from the liquid crystal scanning circuit 108 are driven by the analog signal produced from the liquid crystal drive circuit 107 , so that a picture is displayed on the liquid crystal display panel 109 . the signal processor 104 will be described in detail with reference to fig2 and 3 . for the sake of simple explanation , it is assumed that the yuv video signal 101 is the video signal according to the recommendation itu - r bt . 656 - 4 ( resolution : 640 × 1 ( y )× 240 , 320 × 2 ( uv )× 240 ), the osd signal 102 is the vga interlaced signal ( resolution : 640 × 3 ( rgb )× 240 ) transmitted at each update , and the liquid crystal display panel 109 has a resolution of 960 × 240 . fig2 is a block diagram showing a specific construction of the signal processor 104 shown in fig1 . fig3 is a timing chart useful for explaining the operation of this signal processor 104 . the signal processor 104 has a yuv - rgb conversion circuit 201 , a synch generation circuit 205 , a panel - matched conversion circuit 203 , an osd processing circuit 206 and an osd composing circuit 208 . first , the yuv - rgb conversion circuit 201 processes the yuv 4 : 2 : 2 - format yuv video signal 101 by computation in synchronism with a synch clock as shown in fig3 on the lower - area side , thus converting it to an rgb video signal 202 of rgb 4 : 4 : 4 format for each pixel . when receiving the control information 103 , the synch generation circuit 205 responds to the synch signal and retrace line period information of liquid crystal panel 109 included in the control information 103 to produce the display synch signal 106 for an effective signal and line start signal of video data to be displayed on the liquid crystal panel 109 . then , the panel - matched conversion circuit 203 receives the rgb video signal 202 , display synch signal 106 , and control information 103 . this control information has the ratio between the resolutions of the inputted yuv video signal and liquid crystal display panel 109 ( hereinafter , referred to as “ resolution conversion rate ”), or it has a resolution conversion rate of ½ in this case . thus , the conversion circuit 203 converts the resolution of the input video signal 202 in synchronism with the display synch signal 106 from the resolution of 640 × 3 ( rgb ) to the equivalent of 960 - pixel data of rgb delta arrangement , or ½ the resolution 640 × 3 ( rgb )= 1920 , or 960 pixels as a panel - matched rgb video signal 204 . this resolution conversion may be made by using any system such as the system in which the thinning is made by removing one from every two pieces of image data or the system in which an average value is determined from every two pieces of image data by liner computation and employed . in addition , when the image data is converted to data of delta arrangement and displayed on the liquid crystal display panel 109 of delta arrangement , the outline of the image looks different from the original color because the rgb colors are unbalanced by the thinning of image data . in order to avoid this , a low - pass filtering process may be used . the coefficient of this low - pass filter is set by using control information 103 . the osd processing circuit 206 receives the osd signal 102 , the display synch signal 106 and the control information 103 of a resolution conversion rate or the like . then , it compresses the osd signal 102 transferred at every update and makes the compressed osd signal be stored in a memory as indicated by the arrow of s 1 to s 1 ′ in fig3 . when this signal is read out from the memory , the osd processing circuit 206 produces a panel - matched rgb osd signal 207 that corresponds to the data of 960 pixels in synchronism with the display synch signal 106 . here , the osd processing circuit 206 will be described in detail with reference to fig4 . fig4 is a block diagram showing a specific construction of the osd processing circuit 206 . this osd processing circuit 206 has an osd panel - matched conversion circuit 401 , an osd compression circuit 403 , an osd memory 404 , a memory control circuit 405 and an osd restoration circuit 406 . first , the osd panel - matched conversion circuit 401 receives the osd signal 102 , the display synch signal 106 and the control information 103 of a resolution conversion rate . then , it converts the resolution of osd signal 102 to produce an osd signal 402 adapted to the liquid crystal display panel 109 to be used . in other words , the resolution , 640 × 3 ( rgb )× 240 = 1920 × 240 , of the osd signal 102 is converted to ½ as much in order to conform with the resolution , 960 × 240 of delta arrangement , of liquid crystal display panel 109 . thus , since the osd panel - matched conversion circuit 401 is provided to receive osd signal 102 , even the osd signal unsuitable for the resolution of liquid crystal display panel 109 can be processed to be suitable as is the panel - matched conversion circuit 203 to the rgb video signal 202 . in addition , even the same osd signal 102 can be suitably used without using another type of osd signal by processing it to conform with a different resolution of any liquid crystal display panel . here , if the display device employs the liquid crystal display panel of another resolution , or 640 × 240 of delta arrangement , the same resolution , 640 × 3 ( rgb )× 240 , of the osd signal 102 is converted to ⅓ as much by the osd panel - matched conversion circuit 401 in order to match the equivalent of 640 pixels of delta arrangement . in this case , the osd signal 102 is not replaced by another type of osd signal , but only the resolution conversion rate of control information 103 can be changed to cope with that situation . thus , as mentioned above , the same osd signal 102 can be supplied to the display device to display on the liquid crystal display panel having a resolution different from that of the osd signal . in addition , even if address data for specifying the displaying position of osd signal 102 and compressed data of osd signal 102 are directly transferred to the conversion circuit 401 as the osd signal 102 , the conversion circuit 401 makes the resolution conversion process by computing the post - conversion address data and compressed data from the inputted address data and compressed data . if the osd signal 102 to the conversion circuit has information formed of address data for specifying a displaying position on an assumed frame of 1920 × 240 in order for a rectangular window of 300 horizontal pixels × 40 vertical pixels to be displayed located from a point of horizontal position 240 and vertical position 100 , the osd panel - matched conversion circuit 401 converts it to address data that assumes the resolution , 960 × 240 of delta arrangement , of liquid crystal display panel 109 . in other words , it computes the conversion of the input address data to ½ as much in the horizontal direction and 1 as much in the vertical direction , thus converting to a rectangular area of 150 horizontal pixels × 40 vertical pixels to be displayed located from a point of horizontal position 120 and vertical position 100 . thus , since the osd signal 102 can be converted to the resolution of liquid crystal display panel 109 even when the display device transfers the address data for specifying the displaying position of osd signal 102 and the compressed data of osd signal 102 to the display panel , the video signal and osd signal are not shifted in their positions and sizes when they are composed , that is , the osd can be suitably performed with no such problems . when the liquid crystal display panel 109 is to display only a small amount of information as compared with the osd signal 102 , or when resolution - reducing conversion is necessary , the osd panel - matched conversion circuit 401 first converts the resolution of the osd signal to a low resolution . in this case , if the osd signal is compressed after the conversion , excess information need not be stored in the osd memory 404 , and thus the memory capacity can be reduced advantageously . the osd compression circuit 403 compresses the amount of data of the resolution - reduced signal , or osd signal 402 according to the control information 103 that specifies how to compress . thus , the memory area can be reduced since the amount of data is decreased , leading to low memory cost . an example of the compression of the amount of data ( hereinafter , referred as “ compression system 1 ”) will be described with reference to fig5 . in this compression system 1 , when pixel information as the osd signal is sequentially transferred as is the video signal , the color information is indexed and allotted to the addresses ( hereinafter , referred to as “ color addresses ”) within the storage area for color information ( hereinafter , referred to as “ color information storage area ”) in the storage area of the memory ( hereinafter , referred to as “ memory storage area ”). when osd is performed , color information is often used to make the characters and windows easy to see , and thus does not need many kinds of color in most cases . therefore , if the color information that can be displayed is 6 bits for each color of rgb , about 260000 colors can be utilized . of these colors , eight colors are selected , and color information to be used is previously assigned to the color addresses of the color information storage area . for example , white ( 63 , 63 , 63 ) is allotted to color address 0 , blue ( 0 , 0 , 63 ) to color address 1 , green ( 0 , 63 , 0 ) to color address 2 , . . . , black ( 0 , 0 , 0 ) to color address 7 . the osd using any one of the eight colors is performed by referring to the assigned color addresses . in addition , the color information to be used can be arbitrarily assigned in advance by increasing or decreasing the number of color addresses , or by using , for example , five colors or sixteen colors other than eight colors . moreover , information of the degree of transparency such as 50 -% transparency can be assigned as an index to a color address . therefore , the storage capacity necessary for the color information storage area is the bit number of color information multiplied by the number of color palettes . if we take color information of 18 bits ( about 260000 colors ) and eight color palettes , color information can be indexed by preparing the color information storage area of 18 × 8 = 144 bits . the number of pixels as to the indexed color is counted until the change of color while the sequential transfer of pixel information is being observed , and the indexed color is sequentially converted to values of a color address and the number of pixels over which the corresponding color continues . those values are sequentially stored in the region for storing the layout of osd signal ( hereinafter , referred to as “ osd signal layout storage area ”), so that the osd signal can be stored with the amount of data cut down . the above operation will be described with reference to the seventh line of the osd layout storage area shown in fig5 . in the osd layout storage area are sequentially stored values of 0 ( color address ), 43 ( count ), 1 ( color address ), 4 ( count ), 2 ( color address ), 4 ( count ), 1 ( color address ), 2 ( count ), 2 ( color address ), 2 ( count ), 1 ( color address ), 6 ( count ), 0 ( color address ), 2 ( count ), . . . . here , the bit number of color address and bit number of count are previously set , and the breakpoints of sequence of numbers and the content of the value are already determined . although the amount of data changes depending on the displayed pattern , the maximum number of points of change ( hereinafter , referred to as “ maximum change number ”) is limited so that the memory capacity of osd memory 404 can be reduced . the system side ( osd designer ) is informed of the limit of this maximum change point and requested to design the osd within the limit . the memory capacity of the osd layout storage area is computed from the expression of ( bit number of color address )×( bit number of pixel counter )×( maximum change number ). if we take eight color palettes ( 3 bits ), 128 - counter ( 7 - bit counter ) and 2500 points ( an average of about 10 per line ) as maximum change point , the osd signal can be stored in the osd layout storage area of 3 × 7 × 250 = 52500 bits . therefore , the memory storage area necessary for storing one frame of 960 × 240 of delta arrangement and eight color data ( 3 bits ) is computed as ( 960 ÷ 3 )× 240 × 3 = 230400 bits . on the other hand , according to the compression system 1 of this embodiment 1 , the color information storage area and osd layout storage area are respectively 144 bits and 52500 bits , and thus the memory storage area is computed as 144 + 52500 = 52644 bits . thus , one frame can be stored in the area of about ¼ that amount . in addition , with reference to fig6 , description will be made of an example of compressing the amount of data ( hereinafter , referred to as “ compression system 2 ”) that is different from the compressing system 1 . as we previously described about the compression system 1 , the osd signal is often used to make the characters and windows easy to see , and thus does not need many kinds of color in most cases . moreover , it is often used to display fixed patterns such as characters and symbols . in the compression system 2 , when the osd signal is transferred as , for example , pixel address , color information and shape in a form of commands , the color information can be indexed and assigned to color addresses within the 144 - bit color information storage area of the memory storage area as is the compression system 1 . in addition , only the characters and patterns to be used to display are allotted as character data of a previously fixed resolution to the addresses ( hereinafter , referred to as “ character addresses ”) within the storage area for the character data ( hereinafter , referred to as “ character data storage area ”) of the memory storage area , and stored in that area . the assigning of character data to be used to the character data storage area is performed , for example , as a checkered pattern is assigned to character address 00 , a numerical character “ 2 ” to character address 12 , an alphabetical character “ s ” to character address 33 , and so on . the storage capacity necessary for this character data storage area is the resolution of one character multiplied by the number of characters to be stored . if the resolution and character number are respectively 8 ( dots )× 10 ( lines )= 80 bits , and 64 - pattern characters , then the character data storage area is computed as 80 × 64 = 5120 bits . thus , the character data can be indexed and assigned thereto . the memory storage area has a region provided for storing the location of characters ( hereinafter , referred to as “ character location storage area ”) so that the color address ( character color and background color ) associated with character address is stored in the addresses ( hereinafter , referred to as “ location address ”) of the character location storage area . thus , complicated characters can be stored in a small - capacity memory area . description will be made of , for example , the 12th to 16th columns of the second row of the character location storage area shown in fig6 . an address is fixed at each location of the character location storage area , and values are stored as follows . for example , 7 ( character color : black ), 0 ( background color : white ) and 10 ( character : 0 ) are stored in the address of the location specified by the 12th column and second row , 7 ( character color : black ), 0 ( background color : white ) and 12 ( character : 2 ) in the address of the location specified by the 13th column and second row address , 7 ( character color : black ), 0 ( background : white ) and 44 ( character : /) in the address of the location specified by the 14th column and second row address , 3 ( character color : green ), 0 ( background color : white ) and 14 ( character : 4 ) in the address of the location specified by the 15th column and second row address , 3 ( character color : green ), 0 ( background color : white ) and 18 ( character : 8 ) in the address of the location specified by the 16th column and second row address , and so on . the storage capacity necessary for this character location storage area is ( the maximum number of characters to be displayed ) multiplied by (( the bit number of character address )+( the bit number of color address )× 2 ( character color and background color )). if characters of 40 columns × 24 rows ( 960 bits ) can be located , and if 64 characters ( 6 bits ) and eight color palettes ( 3 bits ) are selected , the osd signal can be stored in the character location storage area of 960 ×( 6 + 3 × 2 )= 11520 bits . therefore , when the osd signal has 8 colors and qvga , the memory area necessary for storing one frame according to the above description was 230400 bits , but the memory area according to the compression system 2 of this embodiment is as follows . since the color information storage area , character data storage area and character location storage area are 144 bits , 5120 bits and 11520 bits , respectively , the necessary region for storing one frame can be computed as 144 + 5120 + 11520 = 16784 bits , or less than 1 / 10 the above - mentioned capacity . in addition , if the color address and character address are changed with the character location address fixed as the osd signal , data with a small partial change of osd signal can be transferred , and thus fast osd is performed . the osd memory 404 temporarily stores the compressed osd signal , and reads it out in synchronism with a read timing signal generated from the display synch signal 106 . thus , the osd signal can be synchronized with the displaying timing . the memory control circuit 405 is responsive to the display synch signal 106 and to the control information 103 for specifying a compression / restoration method to generate a timing signal by which the compressed osd signal is controlled to write in and read from the osd memory 404 . then , the osd restoration circuit 406 responds to the control information 103 that indicates the information of the compression system of the osd compression circuit 403 to produce a panel - matched rgb osd signal 207 in accordance with the restoration system associated with the compression system . this panel - matched rgb osd signal 207 is sequentially produced and transferred pixel by pixel as a rgb signal in synchronism with the display synch signal 106 . when the restoration system is associated with the compression system 1 , the color address and the number of pixels over which the corresponding color continues are read out from the memory , and processed to produce the rgb signal as the panel - matched rgb osd signal 207 that is sequentially transferred pixel by pixel . when the restoration system is associated with the compression system 2 , the panel - match rgb . osd signal 207 is sequentially produced and transferred pixel by pixel as an rgb signal by reading the two color addresses and character address of character color and background color that were sequentially stored in the character location storage area of the memory and by referring to the two pieces of color information and character data associated with the character color and background color according to the read addresses . then , the osd composing circuit 208 shown in fig2 composes the panel - matched rgb video signal 204 and panel - matched rgb osd signal 207 that correspond to 960 - pixel data and that are synchronized with the displaying timing , and generates the rgb composite video signal 105 having the resolution of delta arrangement , 960 × 240 , that is suited to display on the liquid crystal display panel 109 as indicated in fig3 at d 2 ″+ s 1 ″. the method for composing video signals includes the over - lay system for displaying the osd signal preferentially , and the α - composing system in which the transparency is fixed by giving a coefficient α , thus allowing the osd signal to be displayed in such a form that the osd image can be seen through the video image by the computation of the video signal and osd signal . the liquid crystal driving circuit 107 and liquid crystal scanning circuit 108 drive the liquid crystal display panel 109 to display images according to the generated rgb composite video signal 105 that contains the osd corresponding to 960 - pixel data , and to the display synch signal 106 . sine this embodiment provides the osd composing circuit 208 after the yuv - rgb converter circuit 201 to which the yuv video signal is applied and after the panel - matched conversion circuit 203 to which the rgb video signal is applied , the osd signal is never interlaced and converted in color according to the yuv video signal . therefore , the osd can be performed without causing the flickering due to the interlacing and the color shift due to the color conversion . in addition , since the panel - matched conversion circuit 401 is provided to process the osd signal , the osd signal can be applied to various display panels without depending on the liquid crystal display panel 109 . moreover , since the osd compression circuit 403 and osd restoration circuit 406 are provided , the display device for asynchronous osd signal can be achieved with the memory capacity reduced . the embodiment 2 of this invention utilizes another construction of the osd processing circuit 206 mentioned with reference to fig4 for embodiment 1 . this construction will be described below with reference to fig7 . the osd processing circuit 206 of this embodiment has the same elements as those of embodiment 1 ( the panel - matched conversion circuit 401 for osd , the osd compression circuit 403 , the osd memory 404 , the memory control circuit 405 and the osd restoration circuit 406 ), but it is different in the order of processing . in the embodiment 1 , the inputted osd signal 102 was processed to convert by the osd panel - matched conversion circuit 401 and then to undergo the compression / restoration using the memory ( the osd compression circuit 403 , the osd memory 404 , the memory control circuit 405 and the osd restoration circuit 406 ). in this embodiment , the osd signal 102 undergoes the compression / restoration process using the memory , and then the conversion process using the osd panel - matched conversion circuit 401 . the following description is about the case in which the osd signal 102 and the liquid crystal display panel 109 are respectively a signal of qvga ( 320 × rgb × 240 ) transmitted for each update and a resolution ( 640 × rgb × 240 ) corresponding to the interlace of vga , and in which the control information includes information for discriminating the resolutions of the osd signal 102 and liquid crystal display panel 109 and for ordering the signal to be magnified by conversion . in this case , since the amount of data of one frame of osd signal 102 is smaller than that necessary to display on the liquid crystal display panel 109 , the control information 103 containing the information for magnifying by conversion is necessary to order the osd signal to be magnified by conversion . therefore , the osd signal 102 should be compressed before the magnifying conversion , and stored in the osd memory 404 because this is advantageous in that the memory capacity can be reduced . in this embodiment 1 , too , since the amount of data of one frame of osd signal 102 is larger than that necessary to display on the liquid crystal display panel 109 , the control information 103 containing the information for reducing by conversion is used to order the osd panel - matched conversion circuit 401 to convert for reduction , thus bringing the advantage for reducing the memory capacity . in addition , similarly as to the compression process , since the process in which the inputted osd signal of resolution 320 × rgb × 240 is compressed before the resolution conversion handles a smaller amount of data than the process in which it is compressed after the magnifying conversion to a resolution corresponding to the resolution of 640 × rgb × 240 of liquid crystal display panel 109 , it is preferable to compress the osd signal 102 and then store it in the osd memory 404 before the conversion in that excess information can be avoided from being stored in the osd memory 404 . in this embodiment , too , since the osd panel - matched conversion circuit 401 is provided , the osd signal 102 can be applied even when it does not match with the specification of liquid crystal display panel 109 . that is , even a liquid crystal display panel with a different specification can be used to accept the same osd signal 102 , or various display panels can be applied to the display device of this embodiment . moreover , even if the amount of information to be displayed on the display panel is larger than that of the osd signal , the same effect as in embodiment can be achieved . the resolutions of the inputted video signal 101 and osd signal 102 and that of the liquid crystal display panel 109 mentioned in the sections of embodiments 1 and 2 are specified for the convenience of explanation , and thus those signals and the display panel are not limited to those resolutions . in addition , the pixel arrangement of liquid crystal display panel 109 is not limited to the rgb stripe type arrangement and delta type arrangement . it should be further understood by those skilled in the art that although the foregoing description has been made on embodiments of the invention , the invention is not limited thereto and various changes and modifications may be made without departing from the spirit of the invention and the scope of the appended claims .

6Physics

hereafter , the description will be oriented to a method for recording a signal and an apparatus for recording and reproducing a signal according to an embodiment of the present invention with reference to the appended drawings . fig7 shows the recording timing appearing when the recording start point is shifted from a predetermined location by each amount of 0 , 10 or 14 in the method for recording a signal according to the present invention . this method is executed to shift the recording start point when recording ( overwriting ) a data signal as well as to erase the recorded data . in fig7 the erasing operation is executed to erase an unnecessary portion of the recorded data , that is , the data recorded up to the recording start point . concretely , in the case of performing an alpc ( automatic laser power control ) for controlling a power of a laser beam , the erasing operation is executed to erase the recorded data from the termination of the alpc to the actual recording start point . without performing an alpc , the erasing operation is executed to erase the recorded data from a point before the recording start point in the case of a shift amount = 0 to the actual writing location . that is , the erasing operation is executed to erase the data recorded on the portion that will not be used for data recording in the range of the shift amount of the recording start point from 0 to 14 . fig8 is a block diagram showing a basic arrangement of a recording system of the apparatus for recording and reproducing a signal according to the present invention . this recording system operates to record data on the timing as shown in fig7 . the recording system shown in fig8 is different from the recording system shown in fig2 in that a timing generator 13 is divided into a timing generator 13 a for generating a recording gate and a timing generator 13 b for controlling recording data and a recording start point shift timing generator 12 is provided on the input side of the timing generator 13 b . concretely , the timing generator 13 b operates to supply various kinds of timing signals to a control unit ( not shown ), a selecting circuit 17 and a parallel / serial converter 18 and generate the recording gate to be discussed below . the recording gate is a signal for limiting the recording range of the data on a time axis . the selecting circuit 17 is inputted with the data from the control unit ( not shown ) through an interface unit 14 , a sync pattern from a sync pattern generator 15 , and a vfo pattern from a vfo pattern generator 16 . the selecting circuit 17 selects one of these signals on the timing signal from the timing generator 13 and supplies the selected signal to the parallel / serial converter 18 . the parallel / serial converter 18 operates to parallel - to - serial convert the output from the selecting circuit 17 according to the output from the timing generator 13 b and output the converted data as the recording data formatted as shown in fig1 . in addition , a reproduction system timing generator 11 is inputted with a reproduction clock . the recording system timing generators 13 a and 13 b are inputted with a recording clock . the reproduction system timing generator 11 operates to generate an id detection signal when a pre - pit address pre - recorded and pre - formed on a disk is correctly detected , output the id detection signal to the recording system timing generator 13 a for generating the recording gate , and then initialize the generator 13 a . the reproduction system timing generator 11 operates to output the id detection signal to the recording start point shift timing generator 12 as well . the shift timing generator 12 operates to delay the id detection signal by a time corresponding to a shift amount of the recording start point and then supply the delayed signal to the recording system timing generator 13 b . then , the timing generator 13 b operates to generate various kinds of timing signals for the recording system . that is , the recording system timing generator 13 a is independent of the shift of the recording start point . only the recording system timing generator 13 b is subject to the shift of the recording start point controlled by the shift timing generator 12 . by this operation , the overall recording data is shifted on the time axis without changing a recording gate width , so that the recording start location is shifted on the disk . the recording gate generated by the timing generator 13 a is controlled to have a gate width ( time ) that is long enough to cover the recording area of the data even if any shift amount of the recording start point is given to the data . fig9 shows the timings of the recording gate and the recording data appearing when the recording system shown in fig8 performs a recording operation . in the timings shown in fig9 the recorded data before and after the recording data is erased on a recording medium . as stated above , before recording the data , the recording start point of the data is shifted by an amount in the range of the recording gate with a constant width ( time ). concretely , when the shift amount of the recording start point is equal to zero , the recording operation is executed from the head of the recording gate and the erasing operation is executed on the portion where no recording data exists . when the shift amount of the recording start point is maximum , the erasing operation is executed between the head of the recording gate and the head of the recording data so that the end of the recording data matches to the end of the recording gate . fig1 shows the format of the data recorded on the disk by the recording system shown in fig8 . in fig1 , like fig . l , the recording data signal is composed of vfo , sync and data ranged from the head in sequence . the unnecessary portion of the disk except the portion where the recording data signal is recorded , that is , the overall data recorded up to the recording start point is erased . that is , in fig1 , unlike the state of the data according to the conventional signal recording method as shown in fig6 which contains the unnecessary portion of the recorded data , no unnecessary recorded data of vfo 1 and vfo 2 is provided . in reproduction , therefore , the operation is executed to detect a rf signal for specifying the location of the vfo . then , the pll is activated for the rf reproduction signal of the vfo so that the pll can reliably pull the vfo 3 when extracting the reproduction clock . in turn , the description will be oriented to a method for recording a signal and an apparatus for recording and reproducing a signal to which the method is applied according to a second preferred embodiment of the present invention . as described above , the conventional signal recording method with no shift of a recording start point is executed to predict a location of the vfo from a sector mark or an address of a pre - pit pre - recorded and pre - formed on the disk . further , the conventional signal recording method for activating the pll for pulling the vfo pattern on the disk is executed to erroneously detect the reproduction rf signal for the vfo pattern from the area except the vfo area contained in the recording data and enable the pll to pull the erroneously detected reproduction rf signal . this erroneous detection is caused by defects and noises on the disk , for example . however , the pull - in range of the pll is required to be so wide as to correspond to the range where the vfo may be located . this is not preferable because the adverse effect of the defects or noises results in increasing the possibility of doing the pull - in operation about the erroneously detected data rather than the original vfo area . in such a case , it is effective to record the recording start point shift information representing the shift amount of the recording start point at the head of the vfo area , for example . fig1 schematically shows the format at which the shift information ( no . of shift ) of the recording start point is added to the vfo of the recording data . in fig1 , the shift information ( no . of shift ) of the recording start point is located at the head of the vfo . fig1 shows a basic arrangement of the recording system of the apparatus for recording and reproducing a data signal containing the shift information ( no . of shift ) of the recording start point added to the vfo . the recording system shown in fig1 has the substantially same arrangement as the basic arrangement of the recording system shown in fig8 except that a recording start point shift information pattern generator 19 is provided for generating a recording start point shift information pattern based on a timing signal supplied from the recording start point shift timing generator 12 and then the generator 19 supplies the generated pattern to the selecting circuit 17 . concretely , in recording , the pattern generator 19 is inputted with a timing signal from a recording start point shift timing generator 12 , generates the recording start point shift information pattern based on the timing signal , and then supplies the pattern to the selecting circuit 17 . under the control of the recording timing generator 13 b , the recording start point shift information pattern is recorded on the disk at a format shown in fig1 . on the other hand , at the start of the reproduction , since no clock is extracted from the reproduced data , what is required is to just record a rough shift amount with a signal ( flag ) when the reproduction rf signal is detected for specifying the vfo area , it is checked if the recording start point shift information pattern is correctly reproduced . further , it is checked if the reproduced recording start point shift information ( no . of shift ) coincides with the actually detected recording start point on the disk . then , if it is checked that the shift information ( no . of shift ) of the recording start point is correctly reproduced and the reproduced shift information coincides with the actually detected recording start point on the disk , it is determined that the detected vfo area is associated with the target data . the detected vfo pattern is pulled by the pll . fig1 is a block diagram showing a basic arrangement of the reproduction system corresponding to the recording system shown in fig1 . in place of the rf detector 21 of the conventional reproduction system shown in fig3 the reproduction system provides a recording start point shift information detecting circuit 35 and a coincidence determining circuit 36 for determining if the reproduced shift information coincides with the actually detected recording start point on the disk . in the reproduction system , concretely , the pll is activated for pulling a predetermined fixed pattern supplied from a fixed pattern generator 22 provided with a crystal oscillator , for example , between the start of the reproducing operation and the detection of the rf reproduction signal of the vfo portion . as a result , an internal clock is pre - oscillated at a frequency closing to a target one . if the rf reproduction signal of the vfo is detected , the pll is activated for synchronously pulling the rf reproduction signal at fast speed . after the pll pull - in of the signal , it is effective to lower the gain of the pll circuit for reducing the possibility of unlocking the phase of the signal . the rf reproduction signal read from the disk is amplified or equalized by a rf reproducing unit 20 and then is supplied to a recording start point shift information detecting circuit 35 and a binary circuit 23 . the recording start point shift information detecting circuit 35 operates to detect the rf reproduction signal of the vfo having the shift amount ( no . of shift ) of the recording start point added thereto and supply it to the coincidence determining circuit 36 . the coincidence determining circuit 36 determines if the shift amount for representing the detected shift information ( no . of shift ) of the recording start point coincides with the reproduction timing signal supplied from the reproduction system timing generator 11 , that is , the actually detected recording start point . then , the determined result is inputted to a flip - flop 24 as its reset input . the binary circuit 23 operates to digitize the rf reproduction signal and then supply the digitized signal to the selecting circuit 25 and a data extracting unit 27 . the flip - flop 24 uses the signal supplied from the coincidence determining circuit 36 as a reset input and the reproduction system timing signal supplied from the recording system timing generator 13 as a set input . the output of the flip - flop 24 is supplied as a selecting signal to the selecting circuit 25 . the selecting circuit 25 is inputted with the output of the fixed pattern generator 22 and the output of the binary circuit 23 . the selecting circuit 25 operates to select one of the inputs according to the selecting signal supplied from the flip - flop 24 and supply it to the pll circuit 26 . the pll circuit 26 operates to pull the digitized rf reproduction signal supplied through the selecting circuit 25 . the output of the pll circuit 26 is served as the reproduction clock . the data extracting unit 27 operates to extract the sync and the data area from the digitized rf reproduction signal supplied from the binary circuit 23 and then supply them to a sync detector 28 and a demodulator 29 . the sync detector 28 detects the rf reproduction signal supplied through the data extracting unit 27 and supplies it to an and circuit 33 . the and circuit 33 takes a logical product ( and ) of the sync detected by the sync detector 28 and the sync detecting window supplied from the recording system timing generator 13 . then , the and circuit 33 supplies the and value to the reproduction system timing generator 11 . the reproduction system timing generator is reset when the sync is correctly detected , that is , when the sync is detected in the sync detecting window . the demodulator 29 operates to demodulate the rf reproduction signal supplied from the data extracting unit 27 and supply the demodulated output to the serial / parallel converter 31 . the serial / parallel converter 31 operates to serial - to - parallel convert the demodulated rf reproduction signal according to the timing signal supplied from the reproduction timing generator 11 . then , the converted signal is supplied to the control unit ( not shown ) through the interface unit 32 . the data extracting unit 27 , the sync detector 28 , the demodulator 29 , and the serial / parallel converter 31 are inputted with the reproduction clock from the pll circuit 26 . in the reproduction system shown in fig1 , as stated above , the recording start point shift information detecting circuit 35 operates to detect the rf reproduction signal of the vfo having the shift information ( no . of shift ) of the recording start point added thereto and then supply it to the coincidence determining circuit 36 . the coincidence determining circuit 36 determines if the shift amount for representing the detected shift amount ( no . of shift ) of the recording start point coincides with the reproduction timing signal supplied from the reproduction system timing generator 11 , that is , the actually detected recording start point . the determined result is supplied to the flip - flop 24 as a reset input . until the rf reproduction signal of the vfo is detected , the pll is activated for pulling a fixed pattern internally generated by the crystal oscillator so that a clock is pre - oscillated at a frequency closing to the target one . if it is determined that the shift amount for representing the detected shift amount ( no . of shift ) of the recording start point coincides with the actually detected recording start point , the selecting circuit 25 operates to select the clock on the output from the flip - flop 24 so that the pll is activated for synchronously pulling the rf reproduction signal at high speed . after the pll pull - in of the signal , it is effective to lower the gain of the pll circuit for reducing the possibility of unlocking the phase of the signal . in a later process than the above , the reproduction system processes the data with the extracted reproduction clock . in turn , the description will be oriented to the method for recording a signal and the apparatus for recording and reproducing a signal to which the method is applied according to a third preferred embodiment of the present invention . as mentioned above , the sync pattern employs a unique pattern that can be easily detected but is far from erroneous detection . in case the sync pattern pseudoly appears because of an error caused in the vfo pattern or the data , the pseudo sync pattern may be erroneously detected . it is not preferable to widen the sync detecting window from sl to s 2 in correspondence with the shift of the recording start point , because the widening resulting in increasing the probability of the erroneous detection . in such a case , it is effective to record the shift information ( no . of shift ) of the recording start point after the sync . fig1 schematically shows the format at which the shift information ( no . of shift ) of the recording start point is added after the sync . the shift amount to be recorded on the shift information ( no . of shift ) of the recording start point is just needed to be precisely recorded according to the same modulating system as the system for the data , because the detection of the sync and the extraction of the reproduction clock have been already finished . the recording system of the apparatus for recording and reproducing recording data having the shift information ( no . of shift ) of the recording start point added to the vfo may take the basic arrangement shown in fig1 . however , as stated above , the recording system takes the different method for generating the shift information of the recording start point from the system shown in fig1 . the recording system timing generator 13 b for the data operates to record the shift information according to the predetermined format . fig1 is a block diagram showing a basic arrangement of the reproduction system provided in the apparatus for recording and reproducing recording data having the shift information ( no . of shift ) of the recording start point added to the vfo . in the reproduction system , between the and circuit 33 of the reproduction system shown in fig1 and the reproduction system timing generator 11 for the data , a coincidence determining circuit 36 and an and circuit 39 are provided . the coincidence determining circuit 36 operates to determine if the reproduced sync coincides with the actually detected reproduction clock based on the timing signal supplied from the recording system timing generator 13 . the and circuit 39 is initialized by the output of the coincidence determining circuit 36 after the sync is detected . concretely , the sync detector 28 detects the sync from the rf reproduction signal supplied through the data extracting unit 27 and then supplies the sync to the and circuit 33 . the and circuit 33 generates a logical product ( and ) of the detected sync and the sync detecting window supplied from the recording system timing generator 13 and supplies the and value to one input of the and circuit 39 . the coincidence determining circuit 36 operates to determine if the timing signal supplied from the recording system timing generator 13 , that is , the clock having the original recorded timing coincides with the reproduction clock extracted from the data . the determined result is inputted to the other input of the and circuit 39 . the and circuit 39 generates a logical product ( and ) of the logical product of the detected sync and the sync detecting window supplied from the timing generator 13 and the logical product of the recording timing signal and the demodulated output of the data and then supplies the logical product to the reproduction system timing generator 11 . then , the timing generator 11 is reset by this logical product , that is , when the sync is detected at a proper location and when the precise reproduction clock is extracted from the data . by this operation , the synchronous detection can be reliably realized even by widening the width of the sync detecting window signal by the distance corresponding to the shift amount of the recording start point . the foregoing embodiments have been expanded along the phase - changing optical disk . however , the application of the present invention is not limited to the phase - changing optical disk but any kind of recording medium if it is rewritable by repetitive heating . in particular , the invention is preferable to a magneto - optical disk for erasing and rewriting data by heating with a laser beam . as set forth above , the method for recording a signal according to the present invention is arranged to control the data recording start point on the disk to be shifted from the recording start point of the recorded data , based on the shift information of the recording start point for representing the shift amount of the recording start point . this control makes it possible to improve endurance of the disk against the laser heating . the method is also controlled to erase the unnecessary portion of the recorded data or overwrite the fixed pattern so that the synchronous signal can be reliably detected for allowing the quick pll pull - in . in the drawings and specification , there have been disclosed typical preferred embodiments of the invention and , although specific terms are employed , they are used in a generic and descriptive sense only and not for purposes of limitation , the scope of the invention being set forth in the following claims .

6Physics

referring to fig1 a , a first embodiment of a sheet feeder 1 in accordance with the present invention is shown . a nudger roller 12 is fixably mounted to a shaft 14 and positioned to contact a stack of sheets 10 . the shaft 14 is connected to a conventional drive means ( not shown ) to cause the nudger roller 12 to rotate in a counter - clockwise direction in response to a sheet feed instruction supplied by a suitable control system ( not shown ). generally , a conventional biasing means , such as a spring ( not shown ), keeps the nudger roller 12 in intimate contact with a top sheet 10a of the stack 10 . as the nudger roller 12 rotates counter - clockwise , frictional forces between the nudger roller 12 and the top sheet 10a cause the top sheet 10a to move off the stack 10 . located downstream from and in general horizontal alignment with the nudger roller 12 is a feed roller 20 fixably mounted to a shaft 22 . the shaft 22 is connected to a conventional drive means ( not shown ) to cause the feed roller 20 to rotate in a counter - clockwise direction in either continuous fashion or in relation to the sheet feed instruction which actuates the nudger roller 12 . a retard roller 30 is biased toward and in operative engagement with the feed roller 20 to form a nip therebetween . the retard roller 30 is rotatively mounted on and supported by a shaft 34 using a hub or bearing 32 . with the structure now defined , the operational and functional characteristics will now be described . referring to fig1 b , the situation where the nudger roller 12 advances a single sheet 10a to the nip between the feed roller 20 and the retard roller 30 is shown . in this situation , it is desirable for the retard roller 30 to rotate cooperatively with the feed roller 20 as indicated by the arrows . for this to occur , the system must possess particular parameters dependent upon the forces and coefficients of friction of the various components . assuming no slip between the retard roller 30 and the sheet 10a and ignoring the effects of the nudger roller 12 , the force at the nip is given by : where μ pr is the coefficient of friction between the sheet 10a and the retard roller 30 , f n is the force with which the retard roller 30 is biased toward the feed roller 20 and f r is the retarding force on the sheet 10a or the tangential force acting on the surface of the retard roller 30 . the retarding force f r causes a torque which is given by : where r o is the distance from the axis of the shaft 34 to the nip or the surface of the retard roller 30 and t 1 is the resulting torque on the retard roller 30 about the shaft 34 . substituting for f r in equation # 2 using equation # 1 yields : in order for the retard roller 30 to rotate , the torque t 1 must overcome the frictional forces at the bearing 32 which are given by : where μ bs is the coefficient of friction between the bearing 32 and the shaft 34 and r i is the distance from the axis of the shaft 34 to the bearing 32 and the shaft 34 interface ( where the inside radius of the bearing 32 contacts the outside radius of the shaft 34 ). thus , the torque necessary to induce rotation of the retard roller 30 must be less than t 1 . substituting for t 1 in equation # 4 using equation # 3 yields : thus , so long as equation # 5 is satisfied , the retard roller 30 will rotate cooperatively with the feed roller 20 . referring to fig1 c , a multi - feed situation is shown . the nudger roller 12 advances two sheets , an upper sheet 10a and a lower sheet 10b , into the nip between the feed roller 20 and the retard roller 30 . as discussed above , a variety of reasons exist which may cause this to occur , such as : friction between the sheets 10a and 10b , excessive static electricity or excessive humidity . in this situation , the retard roller 30 does not rotate and prevents the lower sheet 10b which is against the retard roller 30 from feeding downstream while the feed roller 20 advances the upper sheet 10a downstream . for the upper sheet 10a and the lower sheet 10b to properly separate , the following must hold : where μ pp is the coefficient of friction between the upper sheet 10a and the lower sheet 10b and the other terms are as defined above . thus , the frictional force between the upper and lower sheets 10a and 10b ( μ pp f n r o ) must be overcome by the retarding force ( μ bs f n r i ) due to the frictional force between the bearing 32 and the shaft 34 so that separation of the sheets 10a and 10b occurs . therefore , if the conditions of equation # 5 and equation # 6 are met , the retard roller 30 will operate as desired . that is , the retard roller 32 rotates in cooperation with the feed roller 20 when a single sheet is present in the nip and the retard roller 32 does not rotate when multiple sheets are present in the nip . accordingly , equations # 5 and # 6 may be combined to yield the following expression which consists of both conditions : equation # 7 may be simplified and rearranged by dividing all terms by f n r o which yields : it should now be apparent to those skilled in the art that the performance of the retard roller 30 may be controlled by ensuring that equation # 8 is satisfied . those skilled in the art will recognize that the performance of the retard roller 30 is dependent on the design of relevant coefficients of friction and overall system geometry . the coefficient of friction μ pp between the upper sheet 10a and the lower sheet 10b depends on the characteristics of the paper being used and is even variable from sheet to sheet of the same stock . additionally , factors such as the type of paper stock and the surface finish influence the coefficient of friction μ pp between the upper sheet 10a and the lower sheet 10b . typically , for most commercial grades of paper , the coefficient of friction μ pp ranges from 0 . 15 to 0 . 35 . the coefficient of friction μ pr between the sheet 10a and the feed roller 20 depends on the paper characteristics and the material properties of the feed roller 20 . generally , the feed roller 20 is made of a suitable rubber - like material , such as urethane having a durometer of approximately in the range of 30 to 60 , so that the feed roller 20 properly grabs the sheet 10a . as a result , the coefficient of friction μ pr typically ranges from 1 . 00 to 2 . 00 . therefore , to achieve the desired system performance , the retard roller 30 , bearing 32 and the shaft 34 must be designed so that the middle term of equation # 8 , μ bs r i / r o , is greater than about 0 . 65 and less than about 1 . 00 . for purposes of discussion , this middle term is referred to as an effective coefficient of friction μ eff since it is derived from the coefficient of friction μ bs between the bearing 32 and the shaft 34 multiplied by a term r i / r o which is derived from the geometric design of the retard roller 30 , the bearing 32 and the shaft 34 . since r i / r o , will always be less than one , the coefficient of friction μ bs must be suitably high enough so that equation # 8 is satisfied . for example , if r i / r o were equal to 0 . 50 , then the coefficient of friction μ bs would need to be between 1 . 30 and 2 . 00 so that the effective coefficient of friction μ eff of equation # 8 would be satisfied for the ranges provided above for the coefficients of friction μ pp and μ pr , respectively . those skilled in the art will recognize that this first embodiment requires a large amount of friction between the bearing 32 and the shaft 34 . although it is possible to design the bearing 32 and the shaft 34 to achieve a coefficient of friction μ bs between 1 . 30 and 2 . 00 , it would not be suited to a high volume environment . friction at these levels would lead to wear and heat generation inappropriate for high volume environments and thus only practical for low volume environments where the paper stock being used permitted the selection of suitable bearing and shaft materials . in keeping with the concept of the present invention , a sheet feeder 200 according to a second embodiment is shown in fig2 . the sheet feeder 200 is more particularly suited to high volume sheet feeding environments . the prefeed and feed portions of sheet feeder 200 are substantially identical to those of the sheet feeder 100 . a nudger roller 212 is fixably mounted to a shaft 214 and positioned to contact a stack of sheets 210 . the shaft 214 is connected to a conventional drive means ( not shown ) to cause the nudger roller 212 to rotate in a counter - clockwise direction in response to a sheet feed instruction supplied by a suitable control system ( not shown ). generally , a conventional biasing means , such as a spring ( not shown ) and / or a stack elevator ( not shown ), keeps the nudger roller 212 in intimate contact with a top sheet 210a of the stack 210 . as the nudger roller 212 rotates , frictional forces between the nudger roller 212 and the top sheet 210a cause the top sheet 210a to move off the stack 210 . located downstream from the nudger roller 212 is a feed roller 220 which is fixably mounted to a shaft 220 which is connected to a conventional drive means ( not shown ) to cause the feed roller 220 to rotate in a counter - clockwise direction in either continuous fashion or in relation to the sheet feed instruction which actuates the nudger roller 212 . the second embodiment differs from the first embodiment primarily in two aspects of how the retard function is implemented . a retard system 228 includes a pair of pulleys 230 and 240 each fixably mounted to respective bearings or hubs 232 and 242 which are each in turn mounted to respective shafts 234 and 244 . an endless belt 250 extends around the pulleys 230 and 240 so as to come into contact with the feed roller 220 forming a nip therebetween . the shaft 234 is rotatively mounted in any suitable structure , such as a frame ( not shown ), at each end by conventional means . this is shown diagrammatically in fig2 . one end of a support arm 260 is pivotally mounted to the shaft 234 . the other end of arm 260 is connected to a compression spring 270 so as to bias the retard system 228 , particularly the belt 250 , into engagement with the feed roller 220 . the shaft 244 is fixably mounted along the span of arm 260 at each end . in similar fashion to the first embodiment , bearing design and system geometry are defined so that the belt 250 rotates along with the feed roller 220 when a single sheet 210a is present in the nip and the belt 250 does not rotate when a plurality of sheets are present . referring to fig2 and 3 , in contrast to the first embodiment , the reaction forces f b1 and f b2 at the bearings 232 and 242 , respectively , are not equal to the normal force f n supplied by the spring 270 . this is due to tensile forces t 1 , t 2 , and t 3 induced on respective spans of the belt 250 by the engagement of the feed roller 220 with the belt 250 due to compression of the spring 270 . the magnitude of the tensile forces t 1 , t 2 , and t 3 is governed not only by the spring 270 , but also by the wrap angle ( amount of angular engagement of the belt 250 around the surface of feed roller 220 ). generally , because feed roller 220 rotates counter - clockwise , it can be assumed that : therefore , the reaction forces at the bearings 232 and 242 must balance the normal force f n and the tensile forces t 1 , t 2 , and t 3 in the belt 250 . this has the effect of substantially increasing the forces at the bearings 232 and 242 for the same normal force f n as provided in the first embodiment . because the bearing forces are increased , the coefficient of friction μ bs can be reduced to values more appropriate for high volume applications while still achieving a desired effective coefficient of friction μ eff . that is , the second embodiment is governed by an equation analogous to equation # 8 of the first embodiment which is governed by the system geometry . the derivation of μ eff for the second embodiment is set forth below . assuming that the spans of the belt 250 are substantially parallel , the sum of the forces acting on the bearing 232 can be simplified to : where t 1 is the tensile force on a first span of belt 250 , t 2 is the tensile force on a second span of belt 250 and f b1 is the reaction force at bearing 232 . thus , any non - parallel components due to the slight difference in wrap angle in the belt 250 caused by contact with the feed roller 220 are assumed to be negligible . in similar fashion , the sum of the forces acting on the bearing 242 can be simplified to : where t 3 is the tensile force on a third span of belt 250 and f b2 is the reaction force at bearing 242 . in order for pulley 230 to rotate , the sum of the torques acting on the bearing 232 are given by : where μ bs is the coefficient of friction between the bearing 232 and the shaft 234 , r i is the distance from the axis of the shaft 234 to the bearing 232 and r o is the distance from the axis the shaft 234 to the pitch line of the belt 250 . substituting equation ( 9 ) for f b1 yields : is a constant which is only dependent on system geometry and bearing design , equation # 13 can be rewritten as : where k is a constant equal to the term expressed in equation # 14 . using the same approach , it can be found that : now , substituting for t 2 in equation # 15 using equation # 16 yields : the forces acting at the interface between the feed roller 220 and the belt 250 will now be considered . assuming that f n bisects the wrap angle θ , the following must hold : where f n is the normal force induced by the spring 270 . those skilled in the art will recognize that the retarding force t 1 is the tension is the first span as equal to the difference between the tensions in the belt 250 upstream from the nip and downstream from the nip and is given by : where t 1 is the tension is the first span and t 3 is the tension is the third span . this difference in tension represents the traction force required to rotate the belt and represents the maximum retarding force exerted by the belt . in more general terms , the retarding force f r may be expressed as : where μ eff is a term dependent upon the second embodiment &# 39 ; s specific geometry and bearing design . solving equation # 20 for μ eff and substitution for f r and f n using equations # 19 and # 18 , respectively , yields : substituting for t 1 using equation # 17 and simplifying yields : it should now be apparent that μ eff is only a function of system geometry and bearing design . therefore , by properly designing the system geometry and selecting bearing materials , any desired μ eff can be achieved . those skilled in the art will recognize that the second embodiment allows for use of more conventional bearing relationships while achieving a desired μ eff . as discussed above , an appropriate range for μ eff is about 0 . 65 to about 1 . 00 . therefore , for example , if it was desired to have a μ eff of 0 . 70 , then the system geometry , ratio r i / r o and the coefficient of friction μ bs could be established to achieve to achieve this . thus , if r i / r o equals 0 . 50 and the wrap angle θ equals 30 degrees , then using the equations above it can be shown that a μ bs of 0 . 18 would achieve the desired μ eff of 0 . 70 . as a result , a μ bs of 0 . 18 allows for the use of more conventional materials for the bearings 232 and 242 and shafts 234 and 244 so that wear and heat generation are reduced . in the preferred embodiment , the bearings should be designed with a μ bs in the range of about 0 . 10 to 0 . 30 . many suitable and conventional materials are available for the shafts 234 and 244 and the bearings 232 and 242 which would yield a coefficient of friction in this range , such as steel and plastic or brass , respectively . the result is improved life cycle characteristics and performance in high volume environments . the second embodiment has the additional benefit of singulating along a curved path . the engagement of the belt 250 around the periphery of the feed roller 220 produces a retard zone with a circular path . this requires sheets fed from stack 210 to bend as they are advance through the retard zone . if a plurality of sheets enters the retard zone , then the resulting bending of the sheets induces a shearing force at the lead edge of the sheets which assists in separating them . referring to fig4 a third embodiment of the present invention is shown . the third embodiment is substantially similar to the second embodiment except that the retard system is active instead of passive . this active system works to eject multi - fed sheets from the nip rather than merely retarding them . the belt 250 is driven in a counter - clockwise direction in opposition to the feed direction of the sheets . fixably mounted on the shaft 234 are a plurality of laterally spaced pulleys 302 and 312 . fixably mounted on the shaft 244 is a pulley 304 . a first endless belt 320 extends around pulleys 302 and 304 while a second timing endless belt 340 extends around the pulley 312 and a pulley 330 which is operatively connected to the output shaft of a motor 350 . in this manner , the motor 350 drives shafts 234 and 244 in synchronization . additionally , the third embodiment provides for a more uniform a μ bs . this is because μ bs is solely a kinetic coefficient of friction in an active system . therefore , the differences between static and kinetic coefficients of friction and stiction associated with stopping and starting are avoided . because additional advantages of the present invention and modifications to the present invention will readily occur to those skilled in the art , the invention in its broader aspects is not limited to the specific details of the preferred embodiments . for example , the feed roller as described in the various embodiment may be easily replaced with an o - ring or endless belt type of feed system . accordingly , those skilled in the art will recognize still further modifications that may be made without departing from the spirit of the general inventive concept as defined by the appended claims and their equivalents .

1Performing Operations; Transporting

referring first to fig1 a to 1 e , one embodiment of the present invention contains two opposing side panels 22 and 24 that are connected theretogether by a rectangular shaped bottom fabric 26 . in this embodiment , panel 22 contains two loops 40 a and 40 b each defining a flat surface . the two loops are placed juxtaposing each other with their respective flat surfaces defining the flat surface of the side panel and with a fabric placed across the two loops and sewn together such that they form a single side panel . side panel 24 is also similarly constructed with two loops 40 c and 40 d positioned juxtaposing each other and another panel sewn thereover to form a single panel . the two side panels 22 and 24 are sewn together on opposing sides of a rectangular shaped bottom panel . since the loops are rigid , the direction of movement for the two side panels relative to the bottom panel is typically a rotational movement about an axis defined by the bottom side of each side panel in the direction as shown by the arrow and is hereinafter referred to as a hinged connection . the rotational movement allowed by the hinged connection is simply due to the flexibility of the fabric material . in the preferred embodiment , there is no requirement to install an actual hinge in the side panel or bottom panel , although such hinges are not excluded from the scope of the instant invention . the hinged connection , however , does not preclude the 2 frames of the same panel from rotating towards each other at 90 degrees from the hinged connection as shown in fig1 f and explained later . in this embodiment two long half zippers 28 and 30 are provided with one half sewn on either side of side panel 24 across bottom panel 26 and all the way along the sides 22 d and 22 b of the side panels 22 and 24 respectively . in greater detail as shown in fig1 a and 1b , the half - zipper 30 starts from a corner fabric flap 24 a of frame 24 and extend along the side 24 b of panel 24 down to one end 26 b of bottom panel 26 along the side 22 b of panel 22 and ends with attachment to a fabric flap 22 a that extends from the corner of side panel 22 . similarly , half - zipper 28 starts from a corner fabric flap 22 c of frame 22 and extend along the side 22 d of panel 22 down to the other end 26 c of the bottom panel 26 along the side 24 d of panel 24 and ends with attachment to a fabric flap 24 c that extends from the comer of side panel 24 . end panels 32 and 34 as shown in fig1 b contains the other half - zipper 32 a and 34 a respectively that are adapted for complementary zipping with half - zippers 28 and 30 respectively . as shown in fig1 c , end panel 34 contains zipper 34 a that allows the panel to be attached to flap 24 a and side 24 b of side panel 24 . further attachment is provided with end 26 b of bottom panel 26 and across to side 22 b of side panel 22 . the zipper 34 a finally zip up from an extension flap 22 c that extends from the upper top corner of side panel 22 . once the side panels are attached , a rectangularly shaped open structure is defined as shown in fig1 d . in this embodiment , a top is also provided and is attachable to the rectangular structure using velcro ™ tape 38 a that may be attachable to the complementary velcro ™ side 38 b that is provided on side panel 22 and 24 and also along the top edge of end panels 32 and 34 . in this embodiment , side panels 22 and 24 each consists of two loop frames that are shown as 40 a to 40 d are shown in fig1 a and 1d . the same frame is not illustrated in fig1 e in order not to obscure the structure are shown . the possibility of using twin frames for the side panel shows one advantage of the instant invention . the side panel can be unfolded and the two frames 40 a and 40 b of the same panel may be folded as shown in fig1 f such that they overlay each other . each of the twin frames may also be folded along line a — a as shown in fig1 f such that all four frames may be unzipped and folded to aligned one above another . since the end panel 32 and 34 are completely detachable , they may also be put on top of these stacks of frames such that all the frames may now be twisted together to from concentric loops simultaneously for ease of storage . fig2 a to 2 c shows a similar embodiment of the same invention except that the end panels 32 and 34 are replaced by taller end panels 42 and 44 and top 36 is replaced by wagon top 46 . top 46 also contains three identical loops 46 a that may be kept apart by extendible rods 46 b . the wagon top is then tied onto the frame by lengths of fabric 48 that are provided at the appropriate places . fig3 a to 3 d show another embodiment of the present invention in which side panels 50 and 52 each formed by a single loop are attached at the bottom by a bottom panel 51 . end panel 54 and 56 are completely detachable by unzipping zippers 58 and 60 ( see fig3 c ). the end panels 54 and 56 have heights that are higher than side panel 50 and 54 such that a downward - sloping rooftop 62 may be supported above the end panels . the rooftop 62 may be attached to the side structure via attachment strings 64 that are provided at the appropriate places . in this example , a window 66 is provided on side panel 50 and a door 68 provided on end panel 56 such that these structures may appear like a house . the other end panel 54 contains a window with curtain 70 that may be used as a public stage or theatre . referring to fig4 a to 4 f , a fourth embodiment of the present invention contains a structure that assumes the shape of an indian teepee tent . the tent contains four panels 80 , 82 , 84 and 86 that have identical shapes of a substantially triangular form with two neighbouring panels 80 and 84 hingedly connected by the side and the opposing two neighbouring panels 82 and 86 also hingedly connected at the side . a zippers is provided for attachment between panels 80 and 82 . another zipper is provided for attachment between panels 84 and 86 . these zippers also run along the bottom of panels 80 and 84 for attachment to the bottom panel 87 . in this way , the two connected side panels 80 and 84 may be completely detached from the other side panels and also from the bottom panel 87 . thus , bottom panel 87 is permanently connected to side panels 82 and 86 and may be folded theretogether during the storage process . after detachment , the panels are shown in fig4 c with panels 80 and 84 ( panel 84 not shown as it is behind panel 80 ) forming one group and panels 82 and 86 forming another group ( panel 82 also not shown as it is behind panel 86 in fig4 c ). all four panels may then be stacked together as shown in fig4 d and twisted according to the steps shown in fig4 d to 4 f into a recoiled position of three concentric loops to reduce the size for ease of storage . while the above examples are used to illustrate various aspects of the present invention , it is clear that they are for illustration only and are not meant to limit the scope of the invention as claimed herein . nevertheless , these examples served to illustrate the versatility of the instant invention . for example , the top illustrated in fig1 d and 1e assumes the appearance of an opening vehicle while a wagon top and a rooftop are shown in subsequent examples . these tops require side panels with different heights in order to make their shape realistic and the technical solution according to the present invention is to inter - change the various side panels conveniently by providing attachment means thereto . furthermore , it is clear that tops of many other shapes may be produced and adapted for use according to the present invention . for example , tops that are conical , dome , pyramidal or tapered in shape may also be inter - changed according to the present invention . although zippers are used in the examples and is the preferred means for attachment of the end panels to the bottom panel and the side panels , it is clear that other means of attachment , such as simple strings and lengths of fabric may be used to tie the side panels together . in the preferred embodiment , the end panels are attached not only to the frame of the side panel , but also to the extending corner flaps such that the structures are very stable . the comer flaps provide anchoring points for improved stability of the side panels . in addition to the completely detachable end panels as described above , it is also possible for the end panel to be detachable from the bottom panel and one of the side panel , while hingedly connected to the other side panel . this specific embodiment would not conveniently allow for changeability of the end panels , but would still allow the side panel to assume various lengths and shapes , since each end panel can still be folded together with the connected side panel . this can easily be done by changing to a shorter zipper and permanently sewing one side of the end panel to one side of a side panel . if the end panels are completely detachable , the side panels may assume a long rectangular shape even with the use of a single frame for each side panel . once the end panel are detached from the side panels , the side panels may be stacked together and twisted into their recoiled position .

4Fixed Constructions

as previously mentioned , the saturation power of a amplifier unit of a polar - loop transmitter falls as a result of a mismatch . the back - off is thereby reduced , which leads to nonlinear distortions if the envelope is driven into the nonlinear area of the amplifier characteristic . since the status of the mismatch is not detected in known transmitters , and furthermore the change of the characteristic curve as a consequence of a mismatch is unknown , it is suggested that a mismatch , or the resulting compression of the amplifier characteristic , should be detected by evaluation of the peak - to - average ratio , known as the crest factor , of the demodulated hf output signal and the accompanying interference effects . the output signal y ( t ) of the amplifier unit is a nonlinear function of the input signal x ( t ) fed to the amplifier unit . the nonlinear transformation causes the statistical properties of the input signal x ( t ) to change , and hence also the crest factor cf . assuming the transmission function of the amplifier unit is described by the following simple polynomial representation , the values a and c denoting constants and s ( t ) the complex envelope : on the two baseband signals i ( t ) and q ( t ). the crest factor cf x of the input signal x ( t ) is defined as if the crest factor cf y of the output signal y ( t ) as a result of the nonlinear transformation is calculated , this gives : under the named assumptions ( approximate representation of the transmission function of the amplifier unit by a simple polynomial and not , as necessary , by a volterra series ), the crest factor depends only on the ratio c / a , which in turn is a measure for the 1 db compression point of the amplifier characteristic . in fig1 the crest factor cf y and the output power of the amplifier unit are shown as a function of the input power for the parameter values a = 3 , c = 0 . 3 und cf x = 3 . 5 db . as can be seen at once from fig1 , the deviation measured in dbm of the output power from a linear reference output power is greater as the crest factor cf y measured in db becomes smaller . if a limit value sw , e . g . sw = 1 . 8 db , is preset , the value of the crest factor cf y should then not be smaller than the value of the preset limit value sw . the value of the crest factor cf y can thus serve as a measure for the compression of the amplifier characteristic , its deviation from a comparison value representing the state “ characteristic curve not compressed ” being independent of the absolute output power . the crest factor cf y is determined rather by the “ curvature ” of the characteristic for the instantaneous mean output power of the amplifier unit . fig2 represents the structure of a polar loop transmitter according to an exemplary embodiment . in this transmitter , the input signal u mod to be amplified , which is both amplitude - and phase - modulated , is split into an amplitude - modulated component and a phase - modulated component , and these signal components are further processed in separate closed loops . the amplitude - modulated component here corresponds to the amount of the complex envelopes ( see above ), while the phase - modulated component corresponds to the phase of the complex envelopes . separate closed loops exist for the two signal components , the amplitude closed loop ( am loop ) consisting of an amplitude comparator 2 , an intermediate repeater 4 and a battery voltage modulator ( ldo 6 ), and the phase - locked loop ( pm loop ) comprising a phase comparator 1 and a voltage - controlled oscillator 3 which generates the input signal x ( t ) for the power amplifier 5 . on the input side , the phase comparator 1 and the amplitude comparator 2 are each supplied both with the input signal u mod as a reference / set value and also with the output signal u out of the power amplifier 5 as a comparison value , said output signal u out having been tapped with a coupler , possibly mixed down ( mixer 8 ) to an intermediate or baseband frequency and then amplified ( intermediate repeater — variable gain amplifier 7 ). the output signal of the phase comparator 1 readjusts the phase - modulated component of the output signal u out by means of the voltage - controlled oscillator 3 on the set value preset by the input signal u mod . in the polar loop transmitter shown , the amplitude modulation is generated by variation of the supply voltage u d of the power amplifier 5 . via the controllable battery voltage modulator 6 ( control voltage u ldo ), the amplitude comparator 2 influences the supply voltage u d = f ( u ldo , u batt ) of the power amplifier 5 and hence the envelope of the output signal u out fed to the antenna 11 , to the effect that the amplitude of the envelope of the output signal u out is an error - free image of the amplitude of the input signal u mod present at one of the two inputs of the amplitude comparator 2 . u d is generated with the help of the voltage modulator 6 from a battery voltage u batt . the linear area of the power amplifier 5 is characterized by a linear relationship between output signal u out and the control voltage u ldo . this linear relationship exists so long as the control voltage u d is sufficiently far from the battery voltage u batt . if the control voltage u d approximates the battery voltage u batt , the transfer characteristic curve ( u out dependent on u ldo ) of the power amplifier is compressed because of saturation effects in the ldo 6 . the slope of the transfer characteristic curve is thereby reduced . this leads in the am loop to a reduction of the loop bandwidth . in addition to the poorer guidance behavior of the control system , the reduction of the bandwidth also leads to further effects , which are typical for a polar loop transmitter and significantly influence the spectrum of the modulated transmission signal . the splitting of the both amplitude - modulated and phase - modulated input signal u mod into an amplitude - modulated and a phase - modulated component increases the bandwidth of the separate signal components . the bandwidth of the closed loops ( am loop and pm loop ) must therefore be selected such that the linear distortions of the two part - signals as a result of the low - pass effect of the respective closed loop are minimal . for example , if the amplitude spectrum is too strongly filtered as a result of too low a bandwidth of the am closed loop , this leads to a widened spectrum of the output signal u out . if the phase or amplitude spectrum is now linearly distorted ( i . e . suppression of the higher - frequency parts of the amplitude spectrum ), then the cancellation of the higher - frequency signal parts worsens in the overall spectrum , making the overall spectrum wider . from this can be derived the requirement to select the bandwidth of the closed loops as large as possible . however , as already explained above , this leads to an increased noise level in the receiver band ( rx band ). independently of the desired output power and the other environmental conditions , the bandwidth of the closed loop should preferably remain as constant as possible . the open - loop gain of the transmitter can be bordered with the intermediate repeater 4 ( variable gain amplifier ) in the forward branch . if the overall amplification of the am loop is sufficiently great , this intermediate repeater 4 has no influence on the output power . the second intermediate repeater 7 ( variable gain amplifier ) in the reverse branch likewise goes into the overall amplification , but directly influences the output power u out . the greater the amplification of the feedback ( mixer 8 , amplifier 7 ), the smaller is the average output power . as already explained above , the transfer characteristic curve is compressed if the output signal u ldo of the intermediate repeater 4 approximates to the battery voltage u batt . if this occurs , the slope of the transfer characteristic curve is reduced , as is therefore also the open - loop amplification , which in turn means a reduction of the bandwidth of the am closed loop . since the gsm system requirements specify the saturation power of an edge transmitter and hence also of the power amplifier 5 , the latter is operated with sufficient back - off . this back - off operation guarantees a sufficiently linear behavior of the amplifier up to the maximum possible power . in spite of the previously mentioned back - off operation , however , undesired effects can occur with a mismatch of the transmit amplifier . a mismatch can be brought about by impedance changes , for example by a change in the distance between the mobile phone &# 39 ; s antenna and the user &# 39 ; s head . such a mismatch has the effect that the slope of the transfer characteristic curve in the linear area and hence also the bandwidth of the am closed loop will change . in addition , the saturation power of the transmitter amplifier falls . the lowering of the saturation power causes reduction of the back - off and hence of the distance to the nonlinear area of the transfer characteristic curve . if the transfer characteristic curve is driven into the nonlinear area as a result of the am modulation , intermodulation products arise . these intermodulation products are compensated by the am loop , provided the bandwidth of the am control system is sufficiently large . however , since the latter cannot always be assumed , it is suggested that the crest factor cf y of the amplifier output signal u out or y ( t ) should be used as the measure for the compression of the amplifier input signal x ( t ), and the bandwidth of the polar loop transmitter should be adjusted according to the deviation of the measured crest factor cf y from a comparison value . the crest factor cf y can be measured for example by incoherent demodulation of the amplifier output signal u out or y ( t ) with the help of the device described in wo 03 / 096548 a2 which is incorporated by reference herein . as shown in fig2 , this device consists of an envelope demodulator ( hdk ) 14 supplied with the output signal of the coupler and measuring the instantaneous power or the average power ( rms power ), a level converter ( ls ) 13 , an analog - digital converter ( adc ) 12 and a digital signal processing facility 9 used for calculating the crest factor cf y . if the measured crest factor cf y falls below a threshold value specifying too high a compression , the amplification in the forward branch of the am loop is increased . the necessary comparison of the crest factor cf y with the threshold value is carried out in the means 10 arranged after the signal processing facility 9 , the first output of this means 10 being connected to the control input of the intermediate repeater 4 while its second output is connected to the control input of the intermediate repeater 7 . the increase of the forward amplification alters only the bandwidth of the am loop , not the output power of the power amplifier 5 . if the increase of the amplification ( and thus of the bandwidth ) is chosen according to the deviation of the measured crest factor cf y from the threshold value , then the am loop can compensate nonlinear distortions of the amplifier unit 5 . for too high a compression of the characteristic curve , the bandwidth of the am loop must also be very highly enlarged , in order to include the intermodulation products of a higher order . however , this can impair the stability of the system . to avoid such stability problems , the bandwidth of the am loop is first increased by activating the intermediate repeater 4 , as already suggested . if the maximum increase of am bandwidth or of the forward amplification is not sufficient to keep the then measured crest factor cf y below the threshold value , it is advisable to increase the amplification in the reverse branch of the transmitter by activating the intermediate repeater 7 , so that the back - off increases for unchanged output power and nonlinear distortions are reduced . at the same time , the amplification in the forward branch must naturally be adjusted accordingly , so that the bandwidth of the am loop does not increase further . since the increase in the bandwidth may be important on stability grounds , it is further alternatively / additionally suggested that the characteristic of the am loop should be influenced by alterations in a loop filter . such a loop filter can be integrated or incorporated in the phase comparator 1 . thus for example the characteristic can be changed by activating or deactivating individual filter elements . the selection of the loop filter depends here on the crest factor . it is thereby possible with high bandwidths ( and high forward amplification ) to raise the phase margin , for example . while the invention has been described with reference to one or more exemplary embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . therefore , it is intended that the invention not be limited to the particular embodiments disclosed as the best mode contemplated for carrying out this invention , but that the invention will include all embodiments falling within the scope of the appended claims .

7Electricity

as mentioned before , vegf - b is a pdgf / vegf family member that is completely devoid of any n - glycosylation . to analyze the effects of n - glycosylation on vegf - b , a n - glycosylation site was introduced into vegf - b . to determine the most appropriate site to introduce a mutation that would lead to n - glycosylation of vegf - b , the amino acid sequences of the first 99 amino acids of vegf - a , plgf and vegf - b , respectively , were aligned ( see fig1 ). the n - glycosylation sites of vegf - a and plgf at amino acids 65 - 67 are italicized in fig1 . nucleotides encoding a putative n - glycosylation site ( nxt ) were inserted at the position corresponding to nucleotides 286 - 294 of hvegf - b ( seq id no : 1 ). the replaced nucleotides normally found at positions 286 - 294 encode the amino acid residues qvr and these amino acid residues are bolded in fig1 . six mammalian expression vectors for both naturally occurring isoforms of vegf - b ( i . e ., vegf - b 167 and vegf - b 186 ) and for an artificial splice variant ( comprising exons 1 to 5 only ) were constructed with and without the putative n - glycosylation site . using pcr , nucleotides coding for a histidine tag were added to the c - terminal end of a nucleotide sequence coding for hvegf - b 186 . a nucleotide sequence coding for hvegf - b 186 - h 6 was then inserted into psectaga ( invitrogen , carlsbad , calif .) using standard cloning procedures to construct psectaga - hvegf - b 186 - h 6 . the full sequence of psectaga - hvegf - b 186 - h 6 is given in seq id no : 7 . to construct psectaga - hvegf - b 186 - h 6 - nxt , a pcr product of covering nucleotides 1 - 325 from genebank acc . no . u48801 was produced which introduced a n - glycosylation site at nucleotide positions 289 - 297 using the 3 ′ primer : 5 ′- tcggtaccggatcatgaggatctgcatggtgacgttgtgctgcccagtggcca - 3 ′ ( seq id no : 8 ). this pcr product was then cloned into a plasmid with full - length hvegf - b 186 where it used to replace the corresponding sequence to produce hvegf - b 186 - nxt . a histidine tag was then added by cloning together the n - terminal portion of hvegf - b 186 - nxt with the c - terminal portion of hvegf - b 186 - h 6 using standard cloning procedures to produce hvegf - b 186 - h 6 - nxt . the nucleotide sequence coding for hvegf - b 186 - h 6 - nxt was then inserted into psectaga ( invitrogen ) using standard cloning procedures to construct psectaga - hvegf - b 186 - h 6 - nxt . the full sequence of psectaga - hvegf - b 186 - h 6 - nxt is given in seq id no : 9 , and the plasmid is illustrated in fig2 . to construct psectaga - hvegf - b 167 - h 6 , a 349 bp pcr product was produced covering nucleotides 250 - 567 from genebank acc . no . u48801 , nucleotides coding for the histidine tag , a stop codon , the noti restriction site and terminal clamp nucleotides using the 5 ′ primer : 5 ′- cctgacgatggcctggagtgt - 3 ′ ( seq id no : 10 ) and the 3 ′ primer : 5 ′- gagcggccgctcaatgatgatgatgatgatgccttcgcagcttccggcac - 3 ′ ( seq id no : 11 ) and hvegf - b 167 as the template . the 349 bp pcr product was cut with kpni and noti and the kpni - noti fragment was inserted into psectaga - hvegf - b 186 - h 6 to replace the kpni - noti fragment removed from this vector using standard cloning procedures . the full sequence of psectaga - hvegf - b 167 - h 6 is given in seq id no : 12 . similarly , psectaga - hvegf - b 167 - h 6 - nxt was constructed as above except the kpni - noti fragment was inserted into psectaga - hvegf - b 186 - h 6 - nxt to replace the kpni - noti fragment removed from this vector . the full sequence of psectaga - hvegf - b 167 - h 6 - nxt is given in seq id no : 13 , and the plasmid is illustrated in fig3 . to construct psectaga - hvegf - b ex1 - 5 - h 6 , a 443 bp pcr product was obtained covering nucleotides 1 - 411 from genebank acc . no . u48801 , nucleotides coding for the histidine tag , a stop codon , the noti restriction site and terminal clamp nucleotides using the 5 ′ primer : 5 ′- caccatgagccctctgctcc - 3 ′ ( seq id no : 14 ) and 3 ′ primer : 5 - gagcggccgctcagtggtgatgatgatggtctggcttcacagcactg - 3 ′ ( seq id no : 15 ) and hvegf - b 167 as the template . the pcr product was cut with kpni and noti and the resulting 320 bp fragment was inserted into psectaga - hvegf - b 186 - h 6 - nxt to replace the kpni - noti removed from this vector using standard cloning procedures . the full sequence of psectaga - hvegf - b ex1 - 5 - h 6 is given in seq id no : 16 . to construct psectaga - hvegf - b ex1 - 5 - h 6 - nxt , the same procedures as above were used except the kpni - noti fragment was inserted into psectaga - hvegf - b 186 - h 6 - nxt to replace the kpni - noti fragment removed from this vector . the full sequence of psectaga - hvegf - b ex1 - 5 - h 6 - nxt is given in seq id no : 17 , and the plasmid is illustrated in fig4 . the following table d lists the expression vectors for the naturally occurring 186 and 167 amino acid isoforms of vegf - b and for the artificial splice variant ( comprising exon 1 to 5 only ), constructed with and without the potential glycosylation site ( nxt ). table d construct name protein psectaga - hvegf - b 186 - h 6 histidine - tagged vegf - b 186 psectaga - hvegf - b 186 - h 6 - nxt histidine - tagged and n - glycosylated vegf - b 186 psectaga - hvegf - b 167 - h 6 histidine - tagged vegf - b 167 psectaga - hvegf - b 167 - h 6 - nxt histidine - tagged and n - glycosylated vegf - b 167 psectaga - hvegf - b - exon1 - 5 - h 6 histidine - tagged vegf - b exons 1 to 5 only psectaga - hvegf - b - exon1 - 5 - h 6 - nxt histidine - tagged and n - glycosylated vegf - b exons 1 to 5 only the six mammalian expression vectors of human vegf - b described above along with expression vectors containing histidine - tagged vegf ( positive control ), a histidine - tagged vhd of vegf - c ( negative control ) and histidine - tagged hybrid 84 - 11 ( positive control ), respectively , were transfected into 293t cells using capo 4 - mediated transfection according to procedures described in sambrook , j . et al ., molecular cloning , a laboratory manual , ( cold spring harbor press , cold spring harbor , n . y . ), 16 . 33 - 16 . 36 ( 1989 ). 48 hours after transfection , the cells were metabolically labeled with s 35 methionine and s 35 cysteine ( promix , amersham ) for 12 to 24 hours . the conditioned supernatant was subjected to immunoprecipitation with an antiserum specific to human vegf - b ( 874 ) and a monoclonal antibody specific to pentahistidine ( h 5 mab , qiagen ). as seen in fig5 through 8 , the three constructs produced with the inserted putative n - glycosylation site are glycosylated . as can be seen from fig5 - 7 , comparison of supernatants and lysates and using heparin to release cell bound proteins shows that vegf - b 167 is almost completely retained at the cell surface or within the cell . about a 50 fold increase of vegf - b 167 can be detected in the supernatant upon glycosylation ( fig5 ). as shown in fig6 and 7 , vegf - b 167 is released into the supernatant by treatment with 100 μg / ml heparin two hours prior to harvest . it was also found that approximately two times more glycosylated vegf - b 167 can be detected in the supernatant of non - heparin treated 293t cells as compared to non - glycosylated vegf - b 167 treated with 200 μg / ml heparin for two hours prior to harvesting . in addition , there is about a three fold increase in the amount of the glycosylated vegf - b 167 detected in the supernatant by treatment with 200 μg / ml heparin two hours prior to harvest as compared to glycosylated vegf - b 167 without heparin treatment , and approximately a six fold increase in the amount of the glycosylated vegf - b 167 detected in the supernatant by treatment with 200 μg / ml heparin two hours prior to harvest as compared to the amount of non - glycosylated vegf - b 167 detected in the supernatant with the same heparin treatment . [ 0081 ] fig6 and 7 show that vegf - b 186 is also partially retained at the cell surface and within the cell . in contrast to vegf - b 167 , almost all of the vegf - b 186 is released into the supernatant upon glycosylation and heparin treatment ( fig6 and 7 ). there seems to be no significant difference in the amount of vegf - b 186 found in the supernatant between heparin - treated and untreated 293t cells . thus the difference of vegf - b 186 and n - glycosylated vegf - b 186 protein levels in the supernatant ( approximately three times more glycosylated vegf - b 186 ) seems to be mainly due to enhanced secretion and / or production and not due to the release of cell surface bound protein . [ 0082 ] fig8 shows that vegf - b exon1 - 5 is only efficiently released into the medium if it is n - glycosylated ( over a 50 fold increase in soluble protein ). this is unexpected since the signals retaining vegf - b at the cell surface are thought to reside in the exon 6 and 7 encoded domains ( fig8 ). treatment with heparin was not determined for this same reason . the ability of the recombinant vegf - b to bind vegf receptor 1 ( vegfr - 1 ) was analyzed using soluble fusion proteins consisting of the extracellular domain of vegfr - 1 and the fc portion of human igg1 ( vegfr - 1 - fc ). biosynthetically labeled conditioned medium derived from 293t cells transfected as above in example 3 were immunoprecipitated with protein a sepharose ( pas ) bound to the vegfr - 1 - ig . beads were washed three times with pbs , the bound protein eluted and resolved by reducing sds - page ( 15 %). the dried gels were exposed to phosphoimager plates for 12 - 24 hours . additionally , the cell lysates were immunoprecipitated with h 5 mab . when significant amounts of vegf - b were present in the supernatant , binding to vegfr - 1 could be observed . this was seen with vegf - b 186 - h 6 after treatment with 100 μg / ml heparin two hours prior to harvest , vegf - b 186 - nxt - h 6 and vegf - b exon 1 - 5 - nxt - h 6 ( fig7 and 8 ). the effects of introducing the n - glycosylation site into vegf - b can be assayed by measuring the ability of conditioned media from cells transfected with vegf - b167 and vegf - b167 - nxt and / or vegf - b186 and vegf - b186 - nxt to stimulate the survival of baf3 vegfr - 01ec / epor cells . for the assay , baf3 cells are used that are stably transfectd with a chimeric receptor consisting of the extracellular domain of vegf receptor 1 and the intracellular domain of the erythropoietin receptor . for survival , these cells need either interlukin - 3 or any growth factor capable of binding vegfr - 1 , e . g ., vegf - a , vegf - b or plgf . cells are plated to 96 - well plates at a density of 20 , 000 / well and grown in the presence of different amounts of medium conditioned by 293t cells that have been transfected with vegf - b167 and vegf - b167 - nxt , vegf - b186 and vegf - b186 - nxt , or both . conditioned medium from 293t cells transfected with a mock ( i . e ., empty ) vector may be used as a control . prior to the assay , the conditioned medium should be cleared from potentially interfering proteins by immunoprecipitation using appropriate antibodies . for example , vegf - a may be cleared from the conditioned medium prior to the assay using a mixture of monoclonal and polyclonal anti - hvegf antibodies , commercially available from r & amp ; d systems , minneapolis , minn . it is not necessary to preclear medium of plgf as the amounts expressed by cos cells ( if any ) are negligible and its effects are not visible in the baseline noise . after 48 hours , an mtt ( 3 -[ 4 , 5 - dimethylthiazol - 2 - yl ]- 2 , 5 - diphenyl - tetrazolium bromide thiazole blue ) colorimetric assay may be performed and data collected at 540 nm using a microtitreplate reader . to create the bglii site in the coding sequence of human vegfr - 1 just before the transmembrane domain , basepairs 1998 - 2268 of vegfr - 1 were pcr amplified with primers 5 ′- cctcagtgatcacacagtgg - 3 ′, containing the endogenous bcli site , and 5 ′- cagagatctattagacttgtcc - 3 ′, containing a bglii site , and the pcr fragment was cloned into the bcli - bglii sites of vegfr - 1 in pbluescript skii + ( stratagene ) vector . the transmembrane and intracellular domains of the human erythropoietin receptor were excised from epor × b + b / pcdnai and subcloned into the resulting plasmid as a bglii / noti fragment . the epor × b + b is a clone of epor which has an internal bglii site added at the putative transmembrane ( tm )/ extracellular ( ec ) domain junction for the in - frame ligation of rtk extracellular domains . the vector backbone is pcdna1 - amp (˜ 5 . 4 kb , the original 1 . 75 kb epor clone was subcloned into pcdna1 - amp using kpni , the sequence was reported by the lodish laboratory , mit ). an ˜ 1 kb fragment can be excised from this clone using bglii ( 5 ′)- noti ( 3 ′) digest which contains the tm and cytoplasmic domain of epor . the vegfr - 1 / epor construct was finally subcloned into the pef - bos vector ( mizushima et al ., nucleic acids research , 18 ( 17 ): 5322 sep . 11 , 1990 ) as a kpni / noti fragment . the resulting plasmid was electroporated into baf3 cells and stable cell pools were generated by selection with 250 micrograms / ml zoecin . the foregoing description and examples have been set forth merely to illustrate the invention and are not intended to be limiting . since modifications of the disclosed embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art , the invention should be construed broadly to include everything within the scope of the appended claims and equivalents thereof . atg agc cct ctg ctc cgc cgc ctg ctg ctc gcc gca ctc ctg cag ctg 48 gcc ccc gcc cag gcc cct gtc tcc cag cct gat gcc cct ggc cac cag 96 agg aaa gtg gtg tca tgg ata gat gtg tat act cgc gct acc tgc cag 144 arg lys val val ser trp ile asp val tyr thr arg ala thr cys gln ccc cgg gag gtg gtg gtg ccc ttg act gtg gag ctc atg ggc acc gtg 192 gcc aaa cag ctg gtg ccc agc tgc gtg act gtg cag cgc tgt ggt ggc 240 ala lys gln leu val pro ser cys val thr val gln arg cys gly gly tgc tgc cct gac gat ggc ctg gag tgt gtg ccc act ggg cag cac caa 288 gtc cgg atg cag atc ctc atg atc cgg tac ccg agc agt cag ctg ggg 336 gag atg tcc ctg gaa gaa cac agc cag tgt gaa tgc aga cct aaa aaa 384 aag gac agt gct gtg aag cca gac agc ccc agg ccc ctc tgc cca cgc 432 tgc acc cag cac cac cag cgc cct gac ccc cgg acc tgc cgc tgc cgc 480 tgc cga cgc cgc agc ttc ctc cgt tgc caa ggg cgg ggc tta gag ctc 528 aac cca gac acc tgc agg tgc cgg aag ctg cga agg tga 567 arg lys val val ser trp ile asp val tyr thr arg ala thr cys gln ala lys gln leu val pro ser cys val thr val gln arg cys gly gly atg agc cct ctg ctc cgc cgc ctg ctg ctc gcc gca ctc ctg cag ctg 48 gcc ccc gcc cag gcc cct gtc tcc cag cct gat gcc cct ggc cac cag 96 agg aaa gtg gtg tca tgg ata gat gtg tat act cgc gct acc tgc cag 144 arg lys val val ser trp ile asp val tyr thr arg ala thr cys gln ccc cgg gag gtg gtg gtg ccc ttg act gtg gag ctc atg ggc acc gtg 192 gcc aaa cag ctg gtg ccc agc tgc gtg act gtg cag cgc tgt ggt ggc 240 ala lys gln leu val pro ser cys val thr val gln arg cys gly gly tgc tgc cct gac gat ggc ctg gag tgt gtg ccc act ggg cag cac caa 288 gtc cgg atg cag atc ctc atg atc cgg tac ccg agc agt cag ctg ggg 336 gag atg tcc ctg gaa gaa cac agc cag tgt gaa tgc aga cct aaa aaa 384 aag gac agt gct gtg aag cca gac agg gct gcc act ccc cac cac cgt 432 ccc cag ccc cgt tct gtt ccg ggc tgg gac tct gcc ccc gga gca ccc 480 tcc cca gct gac atc acc cat ccc act cca gcc cca ggc ccc tct gcc 528 cac gct gca ccc agc acc acc agc gcc ctg acc ccc gga cct gcc gcc 576 gcc gct gcc gac gcc gca gct tcc tcc gtt gcc aag ggc ggg gct tag 624 arg lys val val ser trp ile asp val tyr thr arg ala thr cys gln ala lys gln leu val pro ser cys val thr val gln arg cys gly gly atg agc cct ctg ctc cgc cgc ctg ctg ctc gcc gca ctc ctg cag ctg 48 gcc ccc gcc cag gcc cct gtc tcc cag cct gat gcc cct ggc cac cag 96 agg aaa gtg gtg tca tgg ata gat gtg tat act cgc gct acc tgc cag 144 arg lys val val ser trp ile asp val tyr thr arg ala thr cys gln ccc cgg gag gtg gtg gtg ccc ttg act gtg gag ctc atg ggc acc gtg 192 gcc aaa cag ctg gtg ccc agc tgc gtg act gtg cag cgc tgt ggt ggc 240 ala lys gln leu val pro ser cys val thr val gln arg cys gly gly tgc tgc cct gac gat ggc ctg gag tgt gtg ccc act ggg cag cac caa 288 gtc cgg atg cag atc ctc atg atc cgg tac ccg agc agt cag ctg ggg 336 gag atg tcc ctg gaa gaa cac agc cag tgt gaa tgc aga cct aaa aaa 384 arg lys val val ser trp ile asp val tyr thr arg ala thr cys gln ala lys gln leu val pro ser cys val thr val gln arg cys gly gly

0Human Necessities

fig1 and 2 show an embodiment of this invention . a direct - coupled solenoid valve 1 comprises a main valve segment 2 and a solenoid control segment 3 . a valve casing 5 making up the main valve segment 2 has a supply port p to pass compressed air or other hydraulic fluid , output ports a and b disposed on both sides thereof , and discharge ports ea and eb on both sides of the output ports . these ports open into a valve duct 6 axially in the order mentioned . one end of the valve duct 6 is closed by a closing member 8 , while the other end is closed by the solenoid control segment 3 . reference numeral 7 designates a snap ring to fasten the closing member 8 , 8a a sealing member fitted around the closing member 8 , and 9 a sealing member sealing the space between the valve casing 5 and the solenoid control segment 3 . a movable valve member 10 in the valve duct 6 comprises a valve stem 11 having an axial through hole 12 in the center there , poppet type valve sealing members 13a , 13b , 14a and 14b fitted around the valve stem 11 , and guide rings 15 fitted around both ends of the valve stem 11 . when the valve stem 11 moves axially in the valve duct 6 , the valve sealing members 13a and 13b open and close the passages between the supply port p and the output ports a and b and the valve sealing members 14a and 14b open and close the passages between the output ports a and b and the discharge ports ea and eb . a valve spring 17 that urges the valve member 10 toward the solenoid control segment 3 is compressed in a spring chamber 16 between the valve member 10 and the closing member 8 . the valve sealing members 13a , 13b , 14a and 14b are made of synthetic resin or other elastic material , while the guide rings 15 are made of polyamide , polyacetal or other resin . an intermediate member 18 that indirectly and cushioning brings the valve member 10 and the armature 27 into contact the armature 27 is attached to one end of the valve member 10 that is closer to the solenoid control segment 3 . the intermediate member 18 is a cylindrical member made of synthetic resin , hard rubber or other similar material and has a push - in tip 18a having a radial elasticity provided by means of multiple axial notches . the push - in tip 18a is elastically pressed in one end of the through hole 12 in the valve stem 11 . the intermediate member 18 is used as an aid when the space between the valve member 10 and armature 27 is too large to bring them into direct contact . therefore , the valve member 10 and the armature 27 may be brought into direct contact with each other without using the intermediate member 18 , depending on the space therebetween . the spring chamber 16 at the other end of the valve member 10 communicates with a space 20 between the valve body 5 and the solenoid control segment 3 by means of the through hole 12 in the valve stem 11 and a passageway 18b provided in the intermediate member 18 and with the discharge ports ea and eb by means of the notches ( not shown ) provided in a part of the outer surface of the guide rings 15 . the solenoid control segment 3 comprises a bobbin 22 wound with an exciting coil 21 , a magnetic frame 23 and a magnetic sheet 24 surrounding the bobbin 22 , a stator 26 inserted into one end of the center hole in the bobbin 22 and fastened to the magnetic frame 23 with a bolt 25 , and an armature 27 slidably inserted in the center hole in the bobbin . the magnetic frame 23 is covered with a coating 29 of synthetic resin or other similar material and hermetically attached to one side of the valve body 5 with bolts or other fastening means not shown . seal rings 28 hermetically seal the space between the bobbin 22 and the magnetic sheet 24 and between the center hole in the bobbin 22 and the armature 26 . the armature 27 comprises a cylindrical hollow iron core 27a having a center hole 30 and a length setting member 27b attached to the tip of the iron core 27a , as shown in fig2 . an axially extending groove 31 is formed in the outer surface of the iron core 27a , with the depth of the groove decreasing toward the space 20 in the main valve segment 2 . the center hole 30 in the iron core 27a has a smaller - diameter bore 30a at the end thereof closer to the stator 26 . a pressing member 32 whose tip comes into contact with the stator 26 is slidably inserted in the end of the smaller - diameter bore 30a . the pressing member 32 has a smaller - diameter part 32a that is fitted in the smaller - diameter bore 30a . the length of the smaller - diameter part 32a is equal to the length of the protrusion from the smaller - diameter bore 30a toward the stator 26 when the pressing member 32 comes into contact with a step adjoining the smaller - diameter bore 30a at one end of the center hole 30 ( see fig2 ). the length setting member 27b determines the core length l of the armature 27 required for switching the valve member 10 in conjunction with the iron core 27a . the length setting member 27b is cylindrical and fixed in position by tightly pressing into the end of the center hole 30 closer to the valve member 10 . a proper length of the tip protrudes from the center hole to come into contact with the valve member 10 through the intermediate member 18 . the distance l between the forward end of the length setting member 27b and the rear end of the iron core 27a is set as the length of the iron core of the armature 27 . the core length l of the iron core can be freely changed by changing the protrusion of the length setting member 27b . the length setting member 27b may be made of a magnetic material similar to the iron core 27b or synthetic resin , ceramic or other nonmagnetic materials . a return spring 34 having a greater urging force than the valve spring 17 is compressed between the pressing member 32 and the length setting member 27b to urge the armature 27 toward the valve member 10 at all times . thus , the length setting member 27b has functions to determine the core length l of the armature 27 , press the valve member 10 in contact therewith , and serve as a support for the return spring 34 . with the pressing member 32 and return spring 34 integrally built in , the armature 27 is inexpensive and reasonably designed . this permits easier handling and assembling than the conventional assemblies in which individual parts are separately attached to the solenoid control segment 3 . reference numeral 37 designates a manual operation mechanism that moves the armature 27 toward the stator 26 by depressing an operation button 37a , and 38 a printed circuit board for providing an electrical connection between an external power supply and the terminal of the exciting coil 21 . when no electric current is passed through the exciting coil 21 , the tip of the smaller - diameter part 32a of the pressing member 32 comes into contact with the stator 26 and the armature 27 is returned by the urging force of the return spring 34 , as indicated by the lower half of the armature 27 and the valve member 10 in fig1 . therefore , the valve sealing members 13a and 13b cut off the passage between the supply port p and the output port a and open the passage between the supply port p and the output port b , while the valve sealing members 14a and 14b open the passage between the output port a and the discharge port ea and cut off the passage between the output port b and the discharge port eb . when an electric current is passed through the exciting coil 21 , the armature 27 is attracted to the stator 26 against the urging force of the return spring 34 , as indicated by the upper part of the armature 27 and the valve member 10 in fig1 . with the valve member 10 urged to the right in the figure by the force of the valve spring 17 , the valve sealing members 13a and 13b open the passage between the supply port p and the output port a and cut off the passage between the supply port p and the output port b . while the valve sealing members 14a and 14b cut off the passage between the output port a and the discharge port ea and open the passage between the output port b and the discharge port eb . because the core length l of the armature 27 is determined by the iron core 27a and the length setting member 27b , the iron core 27a itself does not require very high dimensional accuracy . the core length l can be accurately determined by determining the protrusion of the length setting member 27b accurately . when joining together the main valve segment 2 and the solenoid control segment 3 , the armature 27 can be brought into contact with the valve member 10 securely by adjusting the core length l according to the length and the stop position at the end of the stroke of the valve member 10 . because the core length l of one armature 27 can be varied according to the valve member 10 , one solenoid control segment 3 can be used with multiple main valve segments 2 with valve members 10 having different length and stop positions at the end of the stroke . in the armature 27 of the embodiment described above , the length setting member 27b is fastened in the center hole 30 in the iron core 27 and , therefore , the protrusion thereof is unadjustable . however , it is possible to modify the embodiment by providing a length setting member 27b movable along the axis of the iron core 27b that permits the adjustment of the protrusion thereof . this permits free adjustment of the core length l of the armature 27 . fig3 shows an armature 41 having a length setting member 41b whose protrusion is freely adjustable . internal threads are cut on the inner surface of the center hole 42 in an iron core 41a , while external threads are cut on the outer surface of the length setting member 41b . thus , the length setting member 41b freely moves back and forth in the center hole 42 . therefore , the core length l of the armature 41 can be freely adjusted by stopping the length setting member 41b , which is movable along the axis of the armature 41 , at a desired position . the length setting member 41b may be fixed at a desired position by bolts or other suitable fastening means so that the length setting member 41b does make unnecessary movements under the impact produced by the switching of the armature or other causes . because the other parts and actions of the armature 41 are substantially the same as those of the first embodiment described earlier , similar parts are designated by similar reference numerals , with detailed description omitted . when the protrusion of the length setting member is freely adjustable , the core length of the armature can be easily and accurately set and adjusted . for example , pressure balance between two sets of valve sealing members 13a , 13b , 14a and 14b in the valve member 10 can be easily adjusted when required . while the main valve segment in the embodiments described above is a five - port valve , a three - port valve or a four - port valve having common discharge ports can be used as well . as described above , a direct - coupled solenoid valve according to this invention adjusts and sets the core length by a length setting member attached to an armature . hence , the core length can be accurately determined according to the length or the stop position at the end of the stroke of the valve member in the main valve segment even if the iron core does not have very high dimensional accuracy . this permits bringing the armature into contact with the valve member with certainty . because , in addition , the core length l of one armature can be varied according to the valve member , one solenoid control segment can be used with multiple main valve segments with valve members having different lengths or stop positions at the end of the stroke .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

with reference to fig1 to 7 , the apparatus according to the invention is provided with folding and pressing plates 1 and 3 to 9 . plate 1 preferably is arranged in a stationary , horizontal position ; whereas , plates 3 and 7 are swingable about or in relation to a horizontal axis . plates 5 , 6 and 8 , 9 are arranged approximately horizontally on opposite sides of plate 1 and 4 and can be horizontally displaced in pairs towards one another . plate 7 can be swung about the outer or tail end of plate 4 . a collar expander 2 is provided , in the conventional location at the collar end of plate 1 . fastener devices 10 are arranged at the head or collar end of the apparatus to fasten together the completely folded shirt by means such as staples . plate 7 is preferably from one to several centimeters narrower than plate 4 and about 10 centimeters shorter ; so that when plate 7 has been swung down above plate 4 , it ends about 10 centimeters from the inner front edge of plate 4 . on the apparatus according to the invention , a buttoned shirt or blouse is laid with the front or bodice side facing downward on plates 1 and 4 as shown in fig2 . the collar of the garment is placed around collar expander 2 , which extends up into the collar . a sheet of cardboard 11 or the like then is laid on the backside of the shirt . usually sheet 11 is secured in place with a protrusion ( not shown ) which is inserted underneath the collar of the garment . collar expander 2 then is actuated to hold the shirt and expand the collar to its full size . alternatively , collar expander 2 may be actuated first and sheet 11 laid on afterward . from this point , the operator can proceed in various ways depending on how the shirt is to be folded . in one method , the operator folds one sleeve along sheet 11 toward the tail of the garment so that the cuff initially lies toward the tail and later is folded up toward the collar . in another method , the operator places the one sleeve upon the other sleeve which has been folded inward across sheet 11 so that the folded garment does not have any visible cuff . after the sleeves and cuffs are folded in one of these ways , about 10 centimeters of the tail end of the shirt is folded toward the collar onto the remaining part of the shirt , as indicated in fig3 . then plate 3 is swung down to clamp the previously folded portions of the garment , sheet 11 , and the rest of the shirt firmly between itself and plate 1 . now plate 7 is swung down to firmly clamp the lower or tail portion of the shirt , along with the strip that has been folded toward the collar . plates 8 and 9 are moved simultaneously inward above plates 1 , 4 , 3 and 7 . due to this movement , the left part of the shirt is folded between plates 8 and 9 and plates 1 and 4 . plates 5 and 6 then move simultaneously inward above plates 8 and 9 . this movement folds the right part of the shirt between plates 5 and 6 and plates 8 and 9 . to facilitate this movement , plates 1 and 4 are arranged at the lowermost level . with plates 8 and 9 at a somewhat higher one and plates 5 and 6 at the highest . the control circuitry of the apparatus is preferably such that the downward movement of plate 7 actuates a micro - switch 7a ( fig8 ) which closes a circuit to actuate pneumatic or hydraulic cylinders ( see fig8 and 9 ), which automatically push in first plates 8 and 9 and then plates 5 and 6 . sequential movement of the plates is regarded as the most advantageous method ; however , alternatively , all of the side plates can be moved inward simultaneously . the control circuitry is further arranged so that following the previously described movement , all of the side plates are moved outward to their outermost positions , preferably simultaneously . thereafter plates 4 and 7 are raised a few centimeters , which can occur in the form of a diagonal movement which is directed forward and upward in relation to plate 1 . the shirt lies with its lower or tail portion resting in part upon plate 4 and in part folded around plate 7 as shown in fig4 . after attaining their uppermost position , plates 4 and 7 are pushed further forward over plate 3 whereby the part of the shirt surrounding plate 7 gradually slides off of this plate and finally slides over the foremost edge of plate 4 , which is provided with a laterally extending lip or bulge on its foremost edge . the entire shirt is now folded completely as shown in fig5 . before plate 4 begins its withdrawal movement and while it still holds the completely folded shirt in place as shown in fig5 fastener devices 10 mounted on plate 3 are actuated to automatically drive a staple through each folded corner portion of the shirt outside the collar . fastener devices 10 slip into the shirt with a tongue ( not shown ) as the shirt rests on plate 3 and are actuated by a pneumatic cylinder ( not shown ). between fastener devices 10 on plate 3 there is provided a protective grid 44 which is swung down onto the folded shirt in the position shown in fig5 and 6 prior to actuating fastener devices 10 by a pneumatic cylinder ( not shown ). grid 44 attains in its swung down position a distance from plate 1 somewhat less than finger thickness before fastener devices 10 can be actuated . if there is an obstacle such as the operator &# 39 ; s hand , the relatively raised position of grid 44 is used to prevent fastener devices 10 from actuating . tension springs 45 automatically lift up fastener devices 10 and keep them in an upper position . the power of said springs can only be overcome when fastener devices 10 are actuated . after plates 4 and 7 have completed their function at the collar end of the apparatus , they are moved back to their former positions . during this movement plate 7 is swung upward about axis 52 ( fig8 ) to return to its initial position as shown in fig1 so that plate 7 preferably assumes an angle of about 120 ° with plate 4 . support 47 holds plate 7 in the desired position . in the final phase of this movement , plate 4 is guided so that it is lowered in a diagonal , downward and outward movement to the level of plate 1 . finally , plate 3 is manually or automatically swung up about axis 53 to the position shown in fig7 and 8 thereby raising the completed folded shirt to a location convenient for removal . plate 3 preferably is stopped at an angle of about 70 ° with the plate 1 . the operator can now remove the shirt , which is completely folded and fastened together , from plate 3 leaving the apparatus ready for the next operation . as shown in fig1 a friction strip 12 is attached along the leading edges of plates 8 and 9 preferably at an approximate distance of one half centimeter from each inner longitudinal edge . strips 12 preferably are about 5 cm . wide . a self - adhering strip made of fabric and / or plastic material with a roughened upper surface having relatively high frictional resistance is preferred . while plates 8 and 9 are drawn out of the folded shirt , these strips 12 function to stretch the shirt somewhat in a lateral direction . plate 7 can also be provided on its external side on the outer half with a friction strip 13 , which is about 5 cm . wide and at about 5 cm . distance from the longitudinal sides and with an approximate distance of 1 cm . from the plate &# 39 ; s free front edge . the strip can be about 15 cm . strip 13 functions to stretch the shirt somewhat in a longitudinal direction as plates 4 and 7 move toward the collar . plates 5 , 6 , and 8 , 9 are arranged so that they can be adjusted within limits in suspensions provided about their external longitudinal edges . see fig9 . the plates also are adjustable in the vertical direction and may be secured in the desired orientation . this serves chiefly for adaptation of these plates to various material thicknesses and types of materials . there are for example relatively thick types of textiles , which require a higher adjustment of the plates . plates 5 , 6 and 8 , 9 alternatively can be united in one single longitudinal plate on each respective side . the apparatus should preferably be somewhat inclined toward the operator , for example at an angle of about 10 °- 20 °, in order to allow a more comfortable working position . if it is desired for esthetic purposes to have one cuff visible at the front or back , only the opposite sleeve is folded , for example the left , over sheet 11 , so that the right sleeve extends somewhat beyond and above plate 5 . after that the folding procedure as previously described follows during which the right sleeve remains outside of plate 5 . then the manual folding of the right sleeve follows so that one part is folded inward and folded back again , so that the cuff itself comes to lie outside the folded shirt as indicated in fig7 . after that plates 4 and 7 are pushed inward over plates 1 and 3 , whereby the cuff extends out of the folded shirt and said cuff can then by way of choice be folded forward in order to lie on the folded shirt , or it can be folded back , in order to lie behind the completely folded shirt . both cuffs can also be made visible . the foregoing describes the function of the elements of the invention which actually control the garment . fig8 to 11 reveal in greater detail the interior construction of the apparatus shown in fig1 - 7 . as shown in fig8 to 10 , the apparatus comprises a frame 14 having at each a pair of spaced vertical struts 15 connected at their upper ends by a longitudinally extending pair of tubular bearing elements 16 . approximately centrally of the apparatus , a beam 17 extends in longitudinal direction between struts 15 . struts 15 are interconnected near their lower ends by horizontal traverses 18 provided with feet 19 . feet 19 can be made of elongated tubes or the like adapted to be slidable in the vertical direction and securable by means of arresting screws 20 . at one long side of said apparatus feet 19 can be longer than at the other , as shown in fig9 to enable inclination of the apparatus in working position . to provide a stable support when the device is inclined in used , the foot ends 21 can be somewhat oblique . preferably during transport feet 19 are inserted upside down as shown from fig9 to be reversed at the place of installation , so that the oblique ends 21 are facing the floor . below tubular bearing elements 16 , a hydraulic or pneumatic cylinder 22 is mounted longitudinally . the upper side of cylinder 22 is provided with a longitudinal slot ( not shown ) out of which protrudes a carrier 23 connected to the cylinder piston . carrier 23 horizontally adjustably supports a slider 24 to which plates 4 and 7 are attached . plate 4 and thus slider 24 are guided so that starting from the position shown in fig1 and 8 , a movement of plate 4 is obtained which is inclined upwards and toward collar expander 2 , in relation to plate 1 . this movement can be achieved , for example , by means of corresponding oblique , guide rails or grooves ( not shown ) extending upward toward collar expander 2 into which extend guide pins mounted on plate 4 and / or slider 24 . bearing elements 16 also support base plate 1 which includes a heating element powered via wiring 25 . bearing elements 16 further support collar expander 2 , which may comprise three different parts as shown schematically in fig1 , whereby a pressure spring 26 and additional mechanism ( not shown ) having a pneumatic cylinder are used to actuate collar expander 2 . there can also be arranged an element 27 movable toward and away from collar expander 2 by a pneumatic cylinder 28 , which serves to hold shirt collars and the inserted protrusions of stiffening sheets 11 . beam 17 supports hydraulic or pneumatic cylinders 29 which are operatively connected via joints 49 to supporting bars 30 , at the upper ends of which plates 5 , 6 and 8 , 9 are suspended . axles 31 and arresting screws 32 permit limited adjustment of the plate for the purposes previously discussed . border plates 50 and bearings 51 facilitate such adjustment . there are all together four support bars 30 each supporting one of plates 5 , 6 , 8 or 9 . the lower ends of bars 30 are swingable about lower axles 33 extending in longitudinal direction of the apparatus between the ends of transverse members 19 . beam 17 carries also a manometer 34 for controlling incoming pressurized air for diverse devices driven by such air as pneumatic cylinders and a receptacle 35 for lubricating substance , which via various passages ( not shown ) is fed to points requiring lubrication . fig8 reveals also a clamp strip 36 for electrical wiring and a control unit 37 , which can be located lower - most in the apparatus . all sides of the apparatus preferably are covered by several protection plates 38 , the vertical edges of one of which are secured to struts 30 on each longitudinal side of the apparatus , so that the plate is movable with the struts . arresting screws 48 secure the plates to the frame . on the side of the apparatus where an operator is to stand , a so - called knee control 39 can be provided on the movable plate 38 , to be actuated by the operator to initiate a folding operation . to the left of knee control 39 , the stationary part of the apparatus can provide a keyboard 40 with emergency stop 41 , control lamp 42 and thermostatic hand - wheel 43 for choice of temperature of said heatable plate 1 . fig1 and 11 show a special folding and retaining element 46 , which comprises a relatively wide elastic belt made up of a plurality of thin and narrow plates which are elastically interconnected across said belt . element 46 is secured with one end to one long side of plate 4 . as shown in fig1 a , in the initial position said element 46 rests upon e . g . plate 6 . when plate 6 is pushed in over plates 4 and 7 , element 46 is folded in and rests upon that shirt part which is superposing plate 7 , thereby retaining and securing this part of the shirt . when plate 7 during its reverse movement is lifted up to its upper position , element 46 is folded outwards and thrown backwards to its initial position on plate 6 . such a folding and retaining element guarantees to a high extent an exact folding position for shirts and retaining of them in a desired position . the element 46 can naturally have another shape such as a hinge - like one or as a throughout flexible belt or the like . the embodiments described in the foregoing and shown in the drawings are to be regarded as non - limiting examples , which can be altered and completed in any way within the scope of the invention .

3Textiles; Paper

fig1 is a cross - sectional view of gas turbine engine 10 , in a turbofan embodiment . as shown in fig1 , turbine engine 10 comprises fan 12 positioned in bypass duct 14 , with bypass duct 14 oriented about a turbine core comprising compressor ( compressor section ) 16 , combustor ( or combustors ) 18 and turbine ( turbine section ) 20 , arranged in flow series with upstream inlet 22 and downstream exhaust 24 . compressor 16 comprises stages of compressor vanes 26 and blades 28 arranged in low pressure compressor ( lpc ) section 30 and high pressure compressor ( lpc ) section 32 . turbine 20 comprises stages of turbine vanes 34 and turbine blades 36 arranged in high pressure turbine ( hpt ) section 38 and low pressure turbine ( lpt ) section 40 . hpt section 38 is coupled to hpc section 32 via hpt shaft 32 , forming the high pressure spool or high spool . lpt section 40 is coupled to lpc section 30 and fan 12 via lpt shaft 44 , forming the low pressure spool or low spool . hpt shaft 42 and lpt shaft 44 are typically coaxially mounted , with the high and low spools independently rotating about turbine axis ( centerline ) c l . fan 12 comprises a number of fan airfoils circumferentially arranged around a fan disk or other rotating member , which is coupled ( directly or indirectly ) to lpc section 30 and driven by lpt shaft 44 . in some embodiments , fan 12 is coupled to the fan spool via geared fan drive mechanism 46 , providing independent fan speed control . as shown in fig1 , fan 12 is forward - mounted and provides thrust by accelerating flow downstream through bypass duct 14 , for example in a high - bypass configuration suitable for commercial and regional jet aircraft operations . alternatively , fan 12 is an unducted fan or propeller assembly , in either a forward or aft - mounted configuration . in these various embodiments turbine engine 10 comprises any of a high - bypass turbofan , a low - bypass turbofan or a turboprop engine , and the number of spools and the shaft configurations may vary . in operation of turbine engine 10 , incoming airflow f i enters inlet 22 and divides into core flow f c and bypass flow f b , downstream of fan 12 . core flow f c propagates along the core flowpath through compressor section 16 , combustor 18 and turbine section 20 , and bypass flow f b propagates along the bypass flowpath through bypass duct 14 . lpc section 30 and hpc section 32 of compressor 16 are utilized to compress incoming air for combustor 18 , where fuel is introduced , mixed with air and ignited to produce hot combustion gas . depending on embodiment , fan 12 also provides some degree of compression ( or pre - compression ) to core flow f c , and lpc section 30 may be omitted . alternatively , an additional intermediate spool is included , for example in a three - spool turboprop or turbofan configuration . combustion gas exits combustor 18 and enters hpt section 38 of turbine 20 , encountering turbine vanes 34 and turbine blades 36 . turbine vanes 34 turn and accelerate the flow , and turbine blades 36 generate lift for conversion to rotational energy via hpt shaft 42 , driving hpc section 32 of compressor 16 via hpt shaft 42 . partially expanded combustion gas transitions from hpt section 38 to lpt section 40 , driving lpc section 30 and fan 12 via lpt shaft 44 . exhaust flow exits lpt section 40 and turbine engine 10 via exhaust nozzle 24 . the thermodynamic efficiency of turbine engine 10 is tied to the overall pressure ratio , as defined between the delivery pressure at inlet 22 and the compressed air pressure entering combustor 18 from compressor section 16 . in general , a higher pressure ratio offers increased efficiency and improved performance , including greater specific thrust . high pressure ratios also result in increased peak gas path temperatures , higher core pressure and greater flow rates , increasing thermal and mechanical stress on engine components . the present invention is intended to be used with airfoils in turbine engines . the term “ airfoil ” is intended to cover both rotor blades and stator vanes . fig2 and fig3 disclose the invention with respect to interaction of a stator vane with a rotor . fig4 and fig5 disclose the invention with respect to interaction of a rotor blade with a stator casing or shroud . the coating of this invention may be used with either or both configurations . fig2 is a cross section along line 2 - 2 of fig1 of a casing 48 which has a rotor shaft 50 inside . vanes 26 are attached to casing 48 and the gas path 52 is shown as the space between vanes 26 . coating 60 , corresponding to the coating of this invention , is on rotor shaft 50 such that the clearance c between coating 60 and vane tips 26 t of vanes 26 has the proper tolerance for operation of the engine , e . g ., to serve as a seal to prevent leakage of air ( thus reducing efficiency ), while not interfering with relative movement of the vanes and rotor shaft . in fig2 and 3 , clearance c is expanded for purposes of illustration . in practice , clearance c may be , for example , about 25 to 55 about mils ( about 635 to about 1400 microns ) when the engine is cold to 0 to about 35 mils ( about 889 microns ) during engine operation depending on specific operations and previous rub events that may have occurred . the new rotor coating is strong enough to abrade the bare super alloy vane tips by themselves thereby eliminating necessity of an abradable coating . fig2 and fig3 show coating 60 in which includes metallic bond coat 62 and abrasive layer 66 . metallic bond coat 62 is applied to rotor shaft 50 . abrasive layer 66 is deposited on top of bond coat 62 and is the layer that first encounters vane tip 26 t . as can be seen from fig4 and fig5 , the same concept is used in which coating 70 is provided on the inner diameter surface of casing or shroud 48 . coating 70 includes a first metallic bond coat 72 that has been applied to the id of stator casing 48 . in other embodiments , stator casing 48 includes a shroud that forms a blade air seal . abrasive layer 76 is formed on metallic bond coating 72 and is the layer that first encounters rotor tip 28 t . bond coats 62 and 72 are thin , up to 10 mils , more specifically ranging from about 3 mils to about 7 mils ( 76 to 178 microns ). abrasive coatings 66 and 76 are much thicker than bond coats 62 and 72 , ranging from about 10 mils to about 19 mils ( 254 to 483 microns ). bond coats 62 and 72 may be formed of mcraly , the metal ( m ) can be nickel , iron , or cobalt , or combinations thereof and the alloying elements are chromium ( cr ), aluminum ( al ) and yttrium ( y ). for example , bond coats 62 and 64 may be 15 - 40 % cr 6 - 15 % al , 0 . 61 to 1 . 0 %. y and the balance is cobalt , nickel or iron and combinations thereof . bond coat layers 62 and 72 are applied by plasma spraying . abrasive layer 66 and 76 may be a porous or filled metallic or ceramic material such as sm2042 , sm2043 , metco 105ns or durabrade 2192 available from sulzer metco . sm2042 is described in u . s . pat . no . 5 , 434 , 210 , which is incorporated by reference herein in its entirety . the selection of suitable abrasive layer material varies with application and is typically a compromise between erosion resistance , wear ratio with vane or blade tips and durability in the subject environment . one example choice may be metco 105ns aluminum oxide coating with a mechanically roughened surface in an application where low erosion rate of the coating is desired . examples of yttria stabilized zirconia layers 66 and 76 and metal bond coats 62 and 72 are described in commonly owned u . s . pat . no . 5 , 879 , 753 and included herein in its entirety by reference . coatings 66 and 76 in this patent consist essentially of zirconia containing 11 - 14 wt . % yttria . coatings 66 and 76 are applied by plasma spraying , followed by laser engraving to form pyramids 66 a and 76 a on the surface facing the airfoil , as seen in fig3 and fig5 . other ceramic coatings may be used , provided that the ceramic has a coating having a hardness of 7 or higher on the mohs scale of mineral hardness . these may be selected from quartz , zirconia such as those discussed above , corundum and diamond . fig6 and fig7 are enlarged photographs of pyramids 66 a and 76 a of fig3 and fig5 . pyramids 66 a and 76 a are formed by application of a laser engraving on the surface that will engage the airfoil . the pyramids 66 a and 76 a were formed using a ipg 20w q - switched fiber laser with a nutfield xlr8 - 10 - yag 2 - axis scan head with an f - theta 100 mm lens providing a max spot size of 16 μm . the f - theta 100 mm lens alloed for a working distance of 3 . 85 ″ in length . fig6 represents a finely spaced grit pattern with grit spacing of 0 . 005 ″, a texture height of 0 . 0015 ″, grit side slope of 45 degrees with respect to the surface before laser treatment , and the grits are misaligned in the circumferential direction . fig7 represents a coarsely spaced grit pattern with grit spacing of 0 . 010 ″, texture height of 0 . 0015 ″, grid side slope of 45 degrees and grits misaligned in the circumferential direction . the pattern in fig6 was made at a power of 10 w , a speed of 900 mm / s , and a frequency of 40 khz . line length was 70 mm , line width was 0 . 05 mm , hatch distance was 0 . 004 mm and line distance was 0 . 381 mm . the pattern in fig7 was made at a power of 10 w , at a speed of 500 m / s , and a frequency of 40 khz . line length was 63 . 5 mm , line width of 0 . 126 mm , hatch distance of 0 . 004 mm and line distance of 0 . 381 mm . the laser beam melts and removes parts of the ceramic coatings 66 and 76 at an angle with respect to the plane of the rotor or shroud so that the metallic airfoil encounters a sharp edge and is abraded . other laser systems and dimensions are within the scope of this invention . in order to produce an effective grit surface using the laser treatment of the ceramic surface , the laser engraved surface with the top of the surface has less than about 5 % of the surface area of the base of the ceramic layer . the degree of misalignment of the rows of pyramids can range from 0 ° to about 90 °. the pyramids 66 a and 76 a of fig6 and 7 are at a misalignment of 45 ° with respect to the circumferential direction of rotation about centerline c l . as seen in fig6 and 7 , pyramids 66 a and 76 a form rows that are placed there by the laser action and the rows can be selectively aligned or misaligned as desired . while the invention has been described with reference to an exemplary embodiment ( s ), it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof . therefore , it is intended that the invention not be limited to the particular embodiment ( s ) disclosed , but that the invention will include all embodiments falling within the scope of the appended claims .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

the following detailed description is directed to the technical solution of the present invention with reference to the accompanying drawings . however , the embodiments to be described are only part of , rather than all of , the embodiments of the present invention . all other embodiments , which can be derived by those skilled in the art from the embodiments given herein without any creative efforts , fall within the scope of the present invention . in order to improve the spectrum utilization in a cellular multi - hop network , a spectrum detection method according to a first embodiment of the present invention introduces a hierarchical cooperative spectrum detection technology into the cellular multi - hop network , and meanwhile employs a data integration mechanism . as shown in fig1 , the method according to the first embodiment of the present invention includes the following steps . in step 11 , a base station receives an intermediate spectrum detection result sent by a cooperative detection non - relay node and a cooperative detection relay node . in this embodiment , the intermediate spectrum detection results include the following three cases . in case 1 , if the cooperative detection non - relay node performs spectrum detection and determines that the cooperative detection non - relay node is capable of reporting a detection result , the intermediate spectrum detection results include a first spectrum detection result of the cooperative detection non - relay node and a second spectrum detection result of the cooperative detection relay node . in case 2 , if the cooperative detection non - relay node performs spectrum detection , is capable of determining the detection result , but is not capable of reporting the detection result , the intermediate spectrum detection results include : the second spectrum detection result of the cooperative detection relay node , or , the first spectrum detection result relayed by the cooperative detection non - relay node and reported by the cooperative detection relay node , or , the second spectrum detection result of the cooperative detection relay node and the first spectrum detection result relayed by the cooperative detection non - relay node . in case 3 , if the cooperative detection non - relay node performs spectrum detection , but is not capable of determining the detection result , and relays a detection signal to the cooperative detection relay node , the intermediate spectrum detection results include the second spectrum detection result of the cooperative detection relay node . in step 12 , the base station integrates the intermediate spectrum detection results to obtain a final spectrum detection result . in this step , the base station integrates the intermediate spectrum detection results by combining the intermediate spectrum detection results . if at least k ( k & gt ;= 1 , and k is an integer ) intermediate spectrum detection results from n ( n & gt ;= 1 , and n is an integer ) intermediate spectrum detection results indicate that a spectrum is occupied , the final spectrum detection result is that the spectrum is occupied . as can be seen from the method according to the first embodiment of the present invention , in the technical solution of this embodiment , the two - level spectrum detection is performed by the cooperative detection non - relay node and the cooperative detection relay node , and the base station integrates the results of the two - level spectrum detection to obtain the final spectrum detection result , so that the spectrum utilization in a cellular multi - hop network is improved , thereby effectively improving the overall spectrum detection performance . the implementation process of the spectrum detection method according to the embodiment of the present invention is described in detail below with reference to a second embodiment . in this embodiment , a cr system serves as a secondary system , and shares the spectrum with a primary system . because the interference of the secondary user to the primary user needs to be prevented , the transmission power is generally limited , resulting in a limited coverage of a one - hop link . in order to enhance the application of the cr system , the multi - hop technology may be used , and at the same time , terminals are used as relay nodes so as to increase the coverage of the cr system . considering that a plurality of cr users is spatially distributed at random , link transmission characteristics such as amplitude of fading of the cr users are not the same with the time , space and moving speed , and the occurrence of the primary user is also at random , primary user signals received by the cr users are not completely the same . in the second embodiment of the present invention , cells of a cr base station are divided into a cluster - head region and a non - cluster - head region based on spatial locations , and a relay node capable of participating in cooperative detection , that is , a cooperative detection relay node is selected from the cluster - head region ; then , the cooperative detection relay node and cooperative detection non - relay node perform hierarchical detection , and flexibly report detection results according to the detection condition and link status ; finally , the base station integrates the detection results of the two levels . as shown in fig2 , the spectrum detection method according to the second embodiment of the present invention includes the following steps . in step 21 , a base station broadcasts available cell channel information through a common control channel . the information carries a cluster - head selection message . the cluster - head selection message includes base station location , cell radius r , cluster - head threshold c , and detection parameters λ 1 , λ 2 , and d . in the embodiment of the present invention , the detection parameters may be determined as follows . because the energy of the terminal is limited , a low - complexity energy detection method is adopted here , and the signal received by a cr user is expressed by the following formula : here , x ( t ) represents the signal received by a cr user , s ( t ) is a signal transmitted by a primary user , n ( t ) is additive white gaussian noise , h is link gain , and h 0 and h 1 respectively indicate that the primary user is absent and present . if γ is used for representing the signal - to - noise ratio ( snr ), after passing through an energy detector , distribution of y with regard to the decision of h 0 or h 1 may be expressed as follows : here , sampling times m = 2tw , t and w are respectively detection time and signal bandwidth , and e s and e n respectively represent the energy of the primary user signal and the energy of the noise . in order to reduce the interference of the primary system , the secondary system needs to set a minimum detection probability p d min ; meanwhile , in order to fully utilize the spectrum , a maximum false alarm probability p f max needs to be set . thereby , the detection parameters λ 1 and λ 2 can be calculated . a decision threshold can be obtained according to the given maximum false alarm probability , that is , the detection parameter λ 1 can be obtained through the following formula : the detection parameter λ 2 can be obtained according to the minimum detection probability : in the formula , f r ( x ) is distribution of the snr , which depends on fading of the signal . if the primary signal undergoes shadow fading , the snr is subject to log normal distribution ; if the signal undergoes rayleigh multi - path fading , the snr is subject to exponential distribution . in the formula , q m ( ) is a marcum q - function : here , i m - 1 ( ) is an ( m − 1 ) th order modified bessel function . in order to improve the accuracy of detection , the base station needs to make a correct decision , which not only requires the base station to obtain spectrum detection results of a plurality of independent terminals , but also requires the base station to fully utilize the dispersion of users in the system to improve the stability of cooperative performance . if terminals participating in cooperative detection are highly correlated , the performance of cooperative spectrum sensing may be greatly reduced . a distance between nodes that realizes independence of channels can be obtained according to a channel - related parameter p , that is , the detection parameter d is : here , δd is a distance between two nodes , and d cor is a minimum distance between the nodes that prevents correlation of channels . in step 22 , a node receiving the cluster - head selection message calculates a distance l between the node and the base station , so as to determine whether the node is located in the cluster - head region . if the distance l falls within a preset region , for example , [ r / 2 , 3r / 4 ], it is determined that the node is located in the cluster - head region ; otherwise , it is determined that the node is located in the non - cluster - head region . here , the node located in the cluster - head region is referred to as a cluster - head node . in step 23 , if path loss p loss and residual energy e rest of the cluster - head node satisfies the following formula , the cluster - head node sends a cluster - head response message to the base station . the cluster - head response message carries residual energy and location information of the cluster - head node . here , p loss is the path loss , e rest is the residual energy , and c is the cluster - head threshold . in step 24 , the base station determines cooperative detection relay nodes according to the received cluster - head response message and the residual energy and location information reported by the cluster - head node , and sends a cluster - head confirmation message to the cooperative detection relay nodes . all other nodes , including nodes in the cluster - head region other than the cooperative detection relay nodes and nodes in the non - cluster - head region may be considered as cooperative detection non - relay nodes . if the cooperative detection relay nodes are determined , the nodes can be sorted according to the following formula : in the formula , α & gt ; 1 , is a system parameter , and indicates a weight of path loss . as can be seen from the above formula , among all cluster - head nodes , the sorting principle is smallest path loss and largest residual energy . afterward , cooperative detection relay nodes are determined according to the sorting result and according to the detection parameter d and the distance d ij between the cluster - head nodes . here , the number of cooperative detection relay nodes may be multiple . in specific applications , the cooperative detection relay nodes may be determined according to the sorting result through the following program segment . it is assumed that r i represents an i th cluster - head node in a sorted order , i = 1 , 2 , . . . , n , s ={ r 1 , r 2 , . . . , r n } represents a cluster - head set , s ′ represents a set of cooperative detection relay nodes , d ij represents the distance between two cluster - head nodes , and d is a detection parameter : in step 25 , the cooperative detection relay node sends available intra - cluster channel information , and carries a cluster - head advertisement message . the cluster - head advertisement message preferably contains the detection parameters λ 1 and λ 2 . in step 26 , a node receiving the cluster - head advertisement message records the information of the cooperative detection relay node , and sends a cluster - head advertisement response message to the cooperative detection relay node . the cluster - head advertisement response message carries residual energy and location information thereof . next , the cooperative detection relay node and the cooperative detection non - relay node perform hierarchical cooperative spectrum detection . the base station divides the detection time slot into two detection time slots , the cooperative detection non - relay node performs detection in a first detection time slot , and the cooperative detection relay node performs spectrum detection in a second detection time slot . in addition , in the embodiment of the present invention , in order to improve the reliability of detection without increasing the overhead required for reporting the detection result , a soft hard decision mechanism is adopted in the detection process performed by the cooperative detection relay node and the cooperative detection non - relay node . specific description is given below . signal energies obtained by the nodes through detection of the received signals are divided into three regions , namely , an energy region 1 , an energy region 2 , and an energy region 3 . in the energy region 1 , the signal energy is smaller than the detection parameter λ 1 ; in the energy region 2 , the signal energy falls within an region [ λ 1 , λ 2 ]; in the energy region 3 , the signal energy is greater than the detection parameter λ 2 . if a node detects that the signal energy falls within the energy region 2 , it indicates that the node is not capable of determining the detection result . in this case , the cooperative detection non - relay node may relay the detection signal to the cooperative detection relay node or give up the detection , whereas the cooperative detection relay node may give up the detection or perform corresponding processing according to the detection signal or the detection result relayed by the cooperative detection non - relay node . this process may be described in detail if the cooperative detection relay node performs spectrum detection . if the signal energy falls within the energy region 1 , it indicates that the spectrum is not occupied by the primary user , and each node reports a result 0 ; and if the signal energy falls within the energy region 3 , it indicates that the spectrum is occupied by the primary user , and each node reports a result 1 . the spectrum detection process performed by the cooperative detection non - relay node and the cooperative detection relay node is described in the following . in step 27 , the cooperative detection non - relay node performs spectrum detection on the received signal , and obtains a first spectrum detection result . as shown in fig3 , after performing spectrum detection on the received signal , if the cooperative detection non - relay node detects , according to the soft hard decision mechanism described above , that the signal energy y falls within the energy region 1 or the energy region 3 , the cooperative detection non - relay node is capable of determining the detection result , and thus can obtain the first spectrum detection result . after the cooperative detection non - relay node determines that the cooperative detection non - relay node is capable of determining the detection result , it is essential for the cooperative detection non - relay node to reliably report the first spectrum detection result . it is assumed that the bit error ratio of the result reported by the system is ber min , and the snr of a corresponding link 15 γ min . the terminal may obtain a link status between the terminal and the base station , that is , snr δ 0 , through channel estimation according to the available channel information broadcast by the base station or other system broadcast messages . likewise , a link status between the terminal and the cooperative detection relay node , that is , snr γ 1 , may also be obtained . if γ 0 ≧ γ min , indicates that the cooperative detection non - relay node is capable of directly reporting the detection result thereof to the base station . otherwise , it needs to judge whether a better result can be achieved by relay reporting . if γ 0 & lt ; γ r , and ( γ 1 and γ 2 respectively represent the snr between the cooperative detection non - relay node and the cooperative detection relay node , and the snr between the cooperative detection relay node and the base station ), it indicates that relay reporting can improve the reliability of result reporting . therefore , the cooperative detection non - relay node relays the first spectrum detection result thereof to the cooperative detection relay node , so that the cooperative detection relay node performs corresponding processing . otherwise , the cooperative detection non - relay node gives up the detection result . after performing spectrum detection on the received signal , if the cooperative detection non - relay node detects , according to the soft hard decision mechanism described above , that the signal energy y falls within the energy region 2 , the cooperative detection non - relay node is not capable of determining the detection result . in this case , if γ 0 ≧ γ d ( γ d represents a detection threshold ), the cooperative detection non - relay node relays the detection signal to the cooperative detection relay node , so that the cooperative detection relay node continues the detection . in step 28 , the cooperative detection relay node performs spectrum detection on the received signal , and obtains a second spectrum detection result . as shown in fig3 , the cooperative detection relay node performs spectrum detection on the received signal in the second time slot , so as to obtain the second spectrum detection result . during the detection , an equal gain combining ( egc ) method , a maximal ratio combining ( mrc ) method , a selective combining ( sc ) method or the like may be adopted . considering the limitation of energy consumption of the terminal , the egc method is described as an example in this embodiment . the signal received by the cooperative detection relay node may be expressed by the following formula : here , h p , h pi , and h i respectively represent channel gains between the cooperative detection relay node and the primary user , between the i th cooperative detection non - relay node and the primary user , and between the cooperative detection relay node and the i th terminal . the cooperative detection relay node performs detection on the signal , and the signal energy obtained is : likewise , if the cooperative detection relay node detects , according to the soft hard decision mechanism described above , that the signal energy y falls within the energy region 1 or the energy region 3 and considers that the detection result thereof is more reliable , the cooperative detection relay node reports the second spectrum detection result . if the cooperative detection relay node detects that the signal energy y falls within the energy region 1 or the energy region 3 and considers that the detection result is not reliable , the cooperative detection relay node reports both the first spectrum detection result and the second spectrum detection result to the base station through a common channel . alternatively , the cooperative detection relay node processes the first spectrum detection result and the second spectrum detection result to obtain a third spectrum detection result , and reports the third spectrum detection result to the base station through a common channel . if it is detected that the signal energy y falls within the energy region 2 , it indicates that the cooperative detection relay node is not capable of determining the detection result , and in this case , the cooperative detection relay node performs reporting by considering the first spectrum detection result of the cooperative detection non - relay node . the specific reporting method may adopt an “ or ” principle , as expressed by the following formula : in the formula , f i represents each first spectrum detection result , and as long as one value of f i is 1 , s is 1 . that is to say , as long as one cooperative detection non - relay node detects that the spectrum is occupied by the primary user , it indicates that the spectrum cannot be used in the current sector . alternatively , if the cooperative detection relay node is not capable of determining the detection result , the cooperative detection relay node directly forwards the first spectrum detection result from the cooperative detection non - relay node to the base station . in step 29 , the base station integrates the spectrum detection results from the cooperative detection non - relay node and / or the cooperative detection relay node . in this step , a “ k of n ” principle is adopted , and the base station combines the received spectrum detection results , as expressed by the following formula : in the formula , s i represents the spectrum detection results reported by the cooperative detection non - relay node and the cooperative detection relay node . the formula shows that if any k detection results in n spectrum detection results reported are “ 1 ”, it indicates that k detection nodes in n detection nodes detect that the spectrum is occupied by the primary user . therefore , the base station judges that the spectrum is occupied by the primary user in the current cell , and cannot be used ; otherwise , the spectrum is not occupied by the primary user and can be used . in step 210 , the base station broadcasts the detected available spectrum information through a common control channel , or carries the available spectrum information in other system broadcast messages , so as to notify users in the current cell of the spectrum that can be used in the cell . it can be seen through the above steps that , in the method according to the embodiment of the present invention , if the cooperative detection relay nodes are determined , cluster division and cluster - head node selection are implemented at the same time . therefore , the cluster - head nodes can receive the available channel information broadcast by the base station and the cooperative detection relay node . in order to further improve the spectrum utilization , the available spectrum may also be used at two levels . firstly , the base station categorizes the detection results into two types : one is an available spectrum in the cell , and the other is an available spectrum in a certain cluster region . furthermore , the available channel information is broadcast based on cluster division , as shown in table 1 . here , f3 and f4 are available bands in the cell , f1 and f2 represent available bands that can only be used in the cluster region 1 , f5 and f6 represent available bands that can only be used in the cluster region 2 , and f9 and f10 represent available bands that can only be used in the cluster region 3 . if the base station performs spectrum allocation , available bands in the cell are preferentially used on a second - hop link and a direct link of the cr user . according to the second spectrum detection result of the cooperative detection relay node and the available spectrum information of the base station , the cluster - head nodes preferentially use available channels in the current cluster for communication in the clusters , that is , on a first - hop link of the cr user . however , if a terminal using a certain channel detects the presence of the primary user , the terminal immediately stops occupying the spectrum , and reports to the cooperative detection relay node through a common control channel . as can be seen from the method according to the second embodiment of the present invention , in the technical solution of this embodiment , through the two - level spectrum detection of the cooperative detection non - relay node and the cooperative detection relay node , the base station integrates the results of the two - level spectrum detection to obtain the final spectrum detection result , so that the spectrum utilization in a cellular multi - hop network is improved , thereby effectively improving the overall spectrum detection performance . persons of ordinary skill in the art should understand that all of or a part of processes in the method according to the embodiments may be implemented by a computer program instructing relevant hardware . the program may be stored in a computer readable storage media . if the program is executed , the processes of the method according to the embodiments of the present invention are performed . the storage media may be a magnetic disk , an optical disk , a read - only memory ( rom ) or a random access memory ( ram ). in addition , in a third embodiment , the present invention further provides a base station , which includes a result receiving unit 41 and a result processing unit 42 , as shown in fig4 . the result receiving unit 41 is configured to receive an intermediate spectrum detection result sent by each node . the result processing unit 42 is configured to integrate the intermediate spectrum detection results to obtain a final spectrum detection result . if the cooperative detection non - relay node performs spectrum detection and determines that the cooperative detection non - relay node is capable of reporting a detection result , the intermediate spectrum detection results include a first spectrum detection result of the cooperative detection non - relay node and a second spectrum detection result of the cooperative detection relay node . if the cooperative detection non - relay node performs spectrum detection , but is not capable of determining the detection result , and relays a detection signal to the cooperative detection relay node , the intermediate spectrum detection results include the second spectrum detection result of the cooperative detection relay node . if the cooperative detection non - relay node performs spectrum detection , is capable of determining the detection result , but is not capable of reporting the detection result , the intermediate spectrum detection results include one of : the second spectrum detection result of the cooperative detection relay node ; the first spectrum detection result relayed by the cooperative detection non - relay node and reported by the cooperative detection relay node ; and the second spectrum detection result of the cooperative detection relay node and the first spectrum detection result relayed by the cooperative detection non - relay node . as shown in fig5 , the result processing unit 42 may include a result processing module 421 and a result obtaining module 422 . the result processing module 421 is configured to combine the intermediate spectrum detection results . the result obtaining module 422 is configured to obtain the final spectrum detection result that a spectrum is occupied if at least one intermediate spectrum detection result in the intermediate spectrum detection results indicates that the spectrum is occupied . in addition , in order to ensure the accuracy of spectrum detection , as shown in fig5 , the base station may further include a node determining unit 43 configured to determine the cooperative detection relay node . the node determining unit 43 determines the cooperative detection relay node in the same manner as that described in the second embodiment of the present invention . in order to further improve the reliability of spectrum detection , the base station may further include an information sending unit 44 configured to broadcast available channel information to cluster - head nodes according to the final spectrum detection result , so that the cluster - head nodes preferentially use available channels in the cluster for communication in the clusters . in the base station according to the third embodiment of the present invention , through the two - level spectrum detection of the cooperative detection non - relay node and the cooperative detection relay node , the results of the two - level spectrum detection are integrated to obtain the final spectrum detection result , so that the spectrum utilization in a cellular multi - hop network is improved , thereby effectively improving the overall spectrum detection performance . as shown in fig6 , in a fourth embodiment , the present invention further provides a spectrum detection system , which includes at least one cooperative detection non - relay node 61 , at least one cooperative detection relay node 62 , and a base station 63 . the cooperative detection non - relay node 61 is configured to perform spectrum detection in a first time slot . if the cooperative detection non - relay node is capable of obtaining a first spectrum detection result and is capable of reporting the first spectrum detection result , the cooperative detection non - relay node is configured to send the first spectrum detection result to the base station ; if the cooperative detection non - relay node is capable of obtaining the first spectrum detection result but is not capable of reporting the first spectrum detection result , the cooperative detection non - relay node is configured to relay the first spectrum detection result to the cooperative detection relay node ; and if the cooperative detection non - relay node is not capable of obtaining the first spectrum detection result , the cooperative detection non - relay node is configured to relay a detection signal to the cooperative detection relay node . the cooperative detection relay node 62 is configured to perform spectrum detection in a second time slot , obtain a second spectrum detection result , and send the second spectrum detection result to the base station . if the cooperative detection non - relay node is capable of obtaining the first spectrum detection result but is not capable of reporting the first spectrum detection result , the cooperative detection relay node is configured to receive the first spectrum detection result relayed by the cooperative detection non - relay node , and send the first spectrum detection result to the base station or send the first spectrum detection result and the second spectrum detection result to the base station . the base station 63 is configured to integrate the received spectrum detection results to obtain a final spectrum detection result . in addition , the cooperative detection relay node 62 is further configured to obtain a third spectrum detection result by processing the first spectrum detection result if the cooperative detection non - relay node performs spectrum detection , but is not capable of reporting the detection result , and relays the first spectrum detection result to the cooperative detection relay node . at this time , the base station 63 is further configured to obtain the final spectrum detection result according to the third spectrum detection result . based on the above , in the spectrum detection method , system and base station according to the embodiments of the present invention , through the two - level spectrum detection of the cooperative detection non - relay node and the cooperative detection relay node , the base station integrates the results of the two - level spectrum detection to obtain the final spectrum detection result , so that the spectrum utilization in a cellular multi - hop network is improved , thereby effectively improving the overall spectrum detection performance . the present invention has been described by some preferred embodiments , but is not limited to those embodiments . those skilled in the art may make various modifications and variations to the invention without departing from the spirit and scope of the invention . therefore , the protection scope of the present invention is subject to the appended claims .

7Electricity

the apparatus 1 shown in fig1 has parts which , as described below , are examples of the elements recited in the claims . the apparatus includes an electrical bracket 10 . the bracket 10 is used for mounting a low - voltage electrical device , such as a cable jack 12 , to a wall stud 14 with front and side surfaces 16 and 18 . the bracket 10 includes a rectangular frame 20 for enclosing the electrical device 12 . the frame 20 is centered on perpendicular longitudinal 21 and lateral axes 23 . the frame 20 has longitudinally - extending first and second opposite side walls 32 and 34 . the frame 20 further has transversely - extending first and second opposite end walls 36 and 38 . the walls 32 , 34 , 36 and 38 define a cavity 41 and surround a front opening 43 through which the electrical device 12 can be inserted into the cavity 41 . the frame 20 can be mounted to the stud 14 in three positions . in a first side - mounted position of the frame 20 , the first side wall 32 faces and abuts the side surface 18 of the stud 14 . in a second side - mounted position of the frame 20 , the second side wall 34 faces and abuts the side surface 18 of the stud 14 . in an end - mounted position of the frame 20 , the first end wall 36 faces , but is spaced from , the side surface 18 of the stud 14 . adjoining the frame 20 are various structures for securing the device 12 to the frame 20 , attaching the frame 20 to a stud 14 and stabilizing the frame 20 relative to the stud 14 . these structures are described as follows . two mounting bosses 60 extend inward from respective end walls 36 and 38 , adjacent to the front opening 43 . each boss 60 has a bore 61 for securing the electrical device 12 to the frame 20 . this is done by inserting two self - threading screws 62 through a yoke 64 of the device 12 and screwing the screws 62 into the bores 61 . each wall 32 , 34 , 36 and 38 shown in fig1 has a front end 72 , 74 , 76 and 78 located at the front opening 43 of the frame 20 . the front ends 72 , 74 , 76 and 78 are defined by edges of the walls 32 , 34 , 36 and 38 . each of the walls 32 , 34 , 36 and 38 further has a rear end 82 , 84 , 86 and 88 located at a rear opening 89 of the frame 20 . as shown in fig2 and 3 , a length l of the frame 20 is defined by the end walls 36 and 38 . a width w of the frame 20 is defined by the side walls 32 and 34 . a depth d of the frame 20 is defined by and between the front and rear ends 72 and 82 of the side walls 32 and 34 . the rear ends 82 and 84 of the side walls 32 and 34 are defined by edges of the side walls 32 and 34 . however , the rear ends 86 and 88 of the end walls 36 and 38 , denoted by a dashed lines in fig1 and 4 , do not correspond to a visible structural feature . that is due to first and second extension plates 90 and 91 extending seamlessly from the rear ends 86 and 88 - of first and second end walls 36 and 38 . the extension plates 90 and 91 extend rearward from , and parallel to , the respective end walls 36 and 38 to a location rearward from the side walls 32 and 34 . each extension plate 90 and 91 has a pass - through hole 92 . the hole 92 is for passing electrical wires from outside the frame 20 to the device 12 in the frame 20 . a semicircular first perforation 93 in the plate 90 encircles the hole 91 to define a first knock - out 94 that is larger than , and concentric with , the hole 91 . a semicircular second perforation 95 in the plate 90 encircles the first knock - out 94 to define a second knock - out 96 that is larger than , and concentric with , the first knockout 94 . a first side tab 102 is best shown in fig1 and 4 . it extends orthogonally from the first side wall 32 in a direction transversely away from the second side wall 34 . the first side tab 102 is configured to overlie the front surface 16 of the stud 14 when the frame 20 is being mounted in the first side - mounted position . a rear surface 103 of the first side tab 102 is spaced rearwardly from the front end 76 of the first side wall 32 by a distance t equal to the thickness of drywall ( not shown ) that will overlie the - stud 14 . this is so that , when the tab 102 overlies the front stud surface 16 , the front edges 72 , 74 , 76 and 78 of the fame 20 will be flush with the front surface of the drywall . the first side tab 102 has a perforation 104 along its line of adjoinment 105 with the frame 20 . this enables the tab 102 to be removed from the frame 20 for applications where the tab 102 is not needed . a second side tab 112 extends orthogonally from the second side wall 34 in a direction transversely away from the first side wall 32 . the second side tab 112 is configured to overlie the front surface 16 of the stud 14 when the frame 20 is mounted in the second side - mounted position . a rear surface 113 of the side tab 112 is spaced rearwardly from the front opening 43 by the distance t equal to the thickness of the drywall . this is so that , when the tab 1 12 overlies the front stud 14 surface , the front edges 72 , 74 , 76 and 78 of the frame 20 will be flush with the front surface of the drywall . like the first side tab 102 , the second side tab 112 has a perforation 114 along its line of djoinment 115 with the frame 20 , as shown in fig3 . this enables the second side tab 112 to be removed from the frame 20 if the second side tab 112 is not needed . the tab 112 has two nail holes 118 for fastening the tab 112 to the front surface 16 of the stud 14 with nails . the tab 112 further has a staple hole 119 for fastening the frame 10 to the stud 14 with a staple ( not shown ). the staple can be hammered into the stud 14 , with one leg of the staple passing through the stapling hole 119 , and the other leg of the staple passing through one of the nail holes 118 . an end tab 122 is best shown in fig1 and 4 . it extends orthogonally from the first end wall 36 in a direction longitudinally away from the second end wall 38 . the end tab 122 is configured to overlie the front surface 16 of the stud 14 when the frame 20 is mounted in the end - mounted position . as with the other tabs 102 and 112 , a rear surface 123 of the end tab 122 is spaced rearwardly from the front opening 43 by the thickness t of the drywall . the end tab 122 has nail holes 128 for fastening the end tab 122 to the front stud surface 16 with nails . a pair of first nail supports 142 and 144 are best shown in fig1 and 3 . the first supports 142 and 144 extend from the first end wall 36 in a direction away from the second end wall 36 . the supports 142 and 144 adjoin the first end wall 36 at transversely opposite sides of the first end wall 36 . each support 142 and 144 has a groove surface 146 and 148 configured to support and retain a first nail 149 in an orientation in which the nail 149 extends alongside the first end wall 36 and into the side surface 18 of the stud 14 when the frame 20 is in the first side - mounted position . each support 142 and 144 further has a distal end defined by a stud abutting edge 152 and 154 that is parallel to the first end surface 36 and spaced a stand - off distance s from the first end wall 36 . the stud abutting edge 152 and 154 is configured to abut the side surface 18 of the stud 14 along a transversely - extending line of abutment that is spaced from the first end wall 36 in a direction toward the stud 14 when the frame 20 is in the end - mounted position . the nail supports 142 and 144 thus space the frame 20 longitudinally away from the side surface 18 of the stud 14 . a pair of second nail supports 162 and 164 extend from the second end wall 38 in a direction away from the first end wall 36 . the second nail supports 162 and 164 adjoin the second end wall 38 at transversely opposite sides of the second end wall 38 . each support 162 and 164 has a groove surface 166 and 168 configured to support a second nail 169 in an orientation in which the nail 169 extends alongside the second end wall 38 and into the side surface 18 of the stud 14 when the frame 20 is in the first side - mounted position . two nail retainers 172 and 174 are best shown in fig2 and 3 . the retainers 172 and 174 extend longitudinally from the second end wall 38 in a direction away from the first wall 36 . the two nail retainers 172 and 174 are transversely spaced from each other and are respectively adjacent the two second nail supports 162 and 164 . the nail retainers 172 and 174 are configured to urge the second nail 169 ( fig1 ) against the groove surfaces 166 and 168 of the second nail supports 162 and 164 , to retain the second nail 169 in the groove surfaces 166 and 168 . the second nail 169 is thus captured between the nail retainers 172 and 174 and the groove surfaces 166 and 168 . two front spacers 182 and 184 are best shown in fig2 and 4 . they extend from the first end wall 36 in a direction longitudinally away from the second end wall 38 . the front spacers 182 and 184 adjoin the first end wall 36 adjacent transversely opposite sides of the end tab 112 . each front spacer 182 and 184 is in the form of a plate that is approximately parallel to the side walls 32 and 34 and orthogonal to the end walls 36 and 38 . each front spacer 182 and 184 has a stud abutting edge 192 and 194 . the stud abutting edges 192 and 194 extend rearward from transversely opposite edges 196 of the end tab 112 . the stud abutting edges 192 and 194 are spaced from the first end wall 36 by the stand - off distance s . each stud abutting edge 192 and 194 is configured to abut the side surface 18 of the stud 14 along a line of abutment when the frame 20 is in the end - mounted position . the front spacers 182 and 184 stabilize and space the frame 20 longitudinally away from the side surface 18 of the stud 14 . each front spacer 182 and 184 further has a longitudinally - extending nail abutting edge 202 and 204 . the nail abutting edges 202 and 204 are configured to urge the first nail 149 ( fig1 ) against the groove surfaces 146 and 148 of the first nail supports 142 and 144 , to retain the first nail 149 in the groove surfaces 146 and 148 . the first nail 149 is thus captured between the groove surfaces 146 and 148 and the nail abutting edges 202 and 204 . two rear spacers 212 and 214 are best shown in fig2 and 4 . they extend from transversely opposite edges of the first extension plate 90 in a direction longitudinally away from the second extension plate 91 . each rear spacer 212 and 214 is a plate that is approximately parallel to the side walls 32 and 34 and perpendicular to the end walls 36 and 38 . each rear spacer 212 and 214 has a stud - abutting edge 222 and 224 that is parallel to the end surface 36 . these stud - abutting edges 222 and 224 are spaced the stand - off distance s from the extension plate 90 , so as to be coplanar with the other stud - abutting edges 152 , 154 , 192 and 194 . each stud - abutting edge 222 , 224 , 152 , 154 , 192 and 194 is configured to engage the side surface 18 of the stud 14 along a longitudinally extending line of contact when the frame 20 is in the end - mounted position . the rear spacers 212 and 214 , like the front spacers 182 and 184 , stabilize and space the frame 20 longitudinally away from the side surface 18 of the stud 14 . the frame 20 can be mounted to the stud 14 in the first side - mounted position as follows . first , the second side tab 112 can , optionally , be tom away from the frame 20 along its perforation 114 , because the second side tab 112 is not needed for mounting the frame 20 in the first side - mounted position . next , as shown in fig5 and 6 , the first side surface 32 of the frame 20 is held flat against the side surface 18 of the stud 14 , with the first side tab 102 abuttingly overlying the front surface 16 of the stud 14 . the first nail 149 is inserted between the nail abutting surfaces 202 and 204 of the front spacers 182 and 184 and the groove surfaces 146 and 148 ( fig3 ) of the first nail supports 142 and 144 . as indicated by an arrow 231 , the first nail 149 is hammered into the side surface 18 of stud 14 . the second nail 169 is similarly inserted between the nail retainers 172 and 174 ( fig3 ) and the groove surfaces 166 and 168 of the second nail supports 162 and 164 . as indicated by an arrow 232 , the second nail 169 is hammered into the side surface 18 of stud 14 . with the frame 20 thus fastened securely to the stud 14 , the first side tab 102 can , optionally , be broken away from the frame 20 along its perforation 104 . this avoids the possibility of a bulge in the drywall that later covers the tab 102 . the frame 20 can be mounted to the stud 14 in the second side - mounted position as follows . first , the first side tab 102 ( fig1 ) can , optionally , be torn away from the frame 20 along its perforation 104 , because the first side tab 102 is not needed for mounting the frame 20 in the second side - mounted position . next , as shown in fig7 and 8 , the second side surface 34 of the frame 20 is held flat against the side surface 18 of the stud 14 , with the second side tab 112 abutting overlying the front surface 16 of the stud 14 . the second side tab 112 is fastened to the stud 14 by hammering nails 240 through the nail holes 118 of the second side tab 112 and into the stud 14 , as indicated by arrows 241 . the frame 20 can be mounted to the stud 14 in the end - mounted position as follows . first , the side tabs 102 and 112 shown in fig1 can be tom away from the frame 20 along their perforations 104 and 114 , because the side tabs 102 and 112 are not needed for mounting the frame 20 in the end - mounted position . next , as shown in fig9 and 10 , the frame 20 is positioned such that the stud abutting edges 152 , 154 , 192 , 194 , 222 and 224 abut the side surface 18 of the stud 14 , and the end tab 122 abuttingly overlies the front surface 16 of the stud 14 . next , the end tab 122 is fastened to the stud 14 by hammering nails 250 through the holes 128 of the end tab 122 and into the front surface 16 of the stud 14 . as shown in fig1 , the bracket 10 further has two fastener loops 260 extending rearward from the rear edge 82 of the first side wall 32 . the fastener loops 260 define transversely - extending holes 261 . the holes 261 are configured to receive screws ( not shown ) for fastening the first side wall 32 to a side surface of a stud . this written description uses examples to disclose the subject technology , including the best mode , and also to enable any person skilled in the art to make and use the subject technology . the patentable scope of the subject technology is defined by the claims , and may include other examples that occur to those skilled in the art . such other examples are intended to be within the scope of the claims if they have elements that do not differ from the literal language of the claims , or if they include equivalent structural elements with insubstantial differences from the literal language of the claims .

8General tagging of new or cross-sectional technology

fig1 - 8 illustrate a tamper resistant faucet handle 10 in accordance with a first embodiment of the invention . the tamper resistant faucet handle 10 shown in fig1 - 8 is installed on a single control faucet 12 in which the range of movement of the flow control lever 14 involves both tilting with respect to the faucet base 16 and rotating of the flow control lever 14 . the tamper resistant faucet handle 10 includes a handle body 11 that is especially designed to accommodate an interference plunger 18 and a locking mechanism 20 which render the faucet handle 10 tamper resistant . the handle body 11 includes a cylindrical plunger bore 22 that extends inward from a bottom surface 24 of the handle body 11 . an interference plunger 18 is located at least partially within the plunger bore 22 , and is able to slide inward and outward along the plunger bore 22 . a compression spring 26 is located between an end wall 28 of the plunger bore 22 and the interference plunger 18 . the plunger 18 preferably includes a spring containment bore 28 to maintain proper alignment of the compression spring 26 within the bore 22 . the purpose of the compression spring is to bias the interference plunger 18 in an outward position , fig6 when the position of the plunger is not locked . the handle body 11 is provided with a finger access opening 30 adjacent the bottom portion of the plunger bore 22 to allow a user to push the plunger against the spring 26 to an inward position , fig4 and 5 . the interference plunger 18 is able to be locked at an inward position , fig5 in which the plunger 18 does not interfere with the range of movement of the flow control lever 14 ; and also in an outward position , fig6 in which the interference plunger 18 interferes with movement of the handle body 11 , and consequently the movement of the flow control lever 14 to lock the faucet 10 in a closed position . the locking mechanism 20 includes an outer sleeve 32 , an elongated locking body 34 which is slidably mounted within the outer sleeve 32 , and a spring 35 located between an end wall 36 of the outer sleeve and an end 38 of the sliding locking body 34 . the outer sleeve 32 is preferably press - fit within a locking mechanism bore 40 on the handle body 11 . the handle body 11 has an opening 41 between the locking mechanism bore 40 and the plunger bore 22 which allows interaction between the locking mechanism 20 and the interference plunger 18 . the outer sleeve 32 of the locking mechanism 20 is preferably cylindrical , and includes an opening 42 . referring to fig7 the opening 42 in the outer sleeve 32 allows the elongated locking body 34 to interact with the interference plunger 18 through opening 41 in the handle body 11 . the interference plunger 18 has two locking mechanism engagement depressions 44 , 46 . the locking body 34 engages depression 44 on the interference plunger 18 to lock the interference plunger in the outward position , fig6 . the locking body 34 engages depression 46 to lock the interference plunger 18 in the inward position , fig4 and 5 . fig7 and 8 show the locking body 34 engaging depression 46 on the plunger 18 to lock the plunger 18 in the inward position . the locking body 34 includes a clearance depression 48 . to release the locking mechanism 20 , the slidable locking body 34 is pushed against the bias force of spring 35 to align the clearance depression 48 with the interference plunger 18 through openings 41 and 42 . with the locking mechanism 20 released , the interference plunger 18 is pushed to the outward position by compression spring 26 , or the user can push the interference plunger into the inward position against the biasing force of spring 26 with their fingers through access opening 30 . the locking body 34 preferably includes a removable actuation button 50 . the removable actuation button 50 is exposed outside of the outer sleeve 32 . the button 50 provides means for the user to move the locking body 34 against the biasing force of the spring 35 to align the clearance depression 48 on the locking body 34 with the plunger 18 and release the lock . by removing the actuation button 50 , an unauthorized user is not able to push the locking body 34 a sufficient distance to align the clearance depression 48 and release the lock . the removable actuation button 50 preferably includes threads 52 which are removably engaged in mating threads 54 on the locking body 34 . the removable actuation button 50 can be removed when the interference plunger 18 is locked in the inward position , fig4 and 5 , or in the outward position , fig6 . removing the actuation button 50 when the plunger 18 is locked in the inward position , fig4 and 5 , disables the tamper resistant features of the handle 10 . removing the actuation button 50 when the plunger 18 is locked in the outward position , fig6 prevents unauthorized use by children and adults . the plunger 18 includes an interference boss 56 . the interference boss 56 is preferably a threaded shaft with self - locking threads . the interference boss 56 is repositionable and mounts into a threaded opening 58 , fig6 extending inward from the bottom surface 24 of the plunger 18 . a slot 60 is provided on the interference boss 56 so that the height of the interference boss 56 can be easily adjusted with a screwdriver . although implementation of the invention does not necessarily require the use of the repositionable interference boss 56 , this feature can be important for implementing the invention as a retrofit on faucets having somewhat different configurations and / or dimensions . as mentioned , the distance from the faucet handle body 11 to the faucet base 16 can vary depending on the faucet configuration , and the use of a repositionable interference boss 56 provides a practical means of filling the tamper resistant handle 10 to the particular faucet . the handle body 11 can be made from most materials in which conventional faucet handles are fabricated , for example , injection molded plastic , brass , stainless steel , etc . on the other hand , it is important that the interference plunger 18 , spring 26 , and the components of the locking mechanism 20 be durable and corrosion resistant . therefore , it is preferable that these components be made of brass or stainless steel . as shown in fig4 - 6 , the handle body 11 contains a screw access bore 62 through its top surface . the screw access bore 62 includes a wide portion 62a and a narrow portion 62b . the wide portion 62a of the screw access bore 62 provides clearance for the head of attachment screw 64 . the handle body 11 is secured to the control lever 14 by tightening screw 64 onto the control lever 14 with the head of screw 64 pressing tightly against the step between the narrow portion 62b and the wide portion 62a of the screw access bore 62 in the handle body 11 . the operation of the tamper resistant handle 10 on a single control faucet 12 is illustrated best in fig4 and 6 . in fig4 and 5 , the plunger 18 is locked in an inward position , and therefore the faucet handle body 11 has a full range of movement . in fig4 the handle body 11 is in a fully closed or off position , and consequently , the flow control lever 14 is in a fully closed or off position . however , because the interference plunger 18 is locked in an inward position , the user is able to move the handle body 11 , and consequently the flow control lever 14 , in the direction of arrows 66 , fig4 . movement of the handle body 11 in the direction of arrow 66 turns the faucet on or partially on . fig5 shows the handle body 11 in a fully open position . note that the plunger 18 is locked in the inward position in fig5 so that the interference plunger 18 does not interfere with the faucet base 16 , thus allowing the flow control lever 14 its full range of movement . fig6 shows the handle body 11 and flow control lever 14 locked in the fully closed or off position . in fig6 the interference plunger 18 is locked in the outward position by engaging the locking body 34 of the locking mechanism 20 in depression 46 on the interference plunger 18 . when the interference plunger 18 is locked in the outward position , fig6 the plunger 18 extends outward from the plunger bore 22 beyond the surface 24 of the handle body 11 for a distance sufficient for the plunger 18 to interfere with movement of the flow control lever 14 . more specifically , the repositionable interference boss 56 on the bottom of the interference plunger 18 engages the faucet base 16 to prevent movement of the faucet handle 11 from the fully closed or off position . as mentioned , the actuation button 50 , fig7 can be removed to disable the release mechanism for the lock . fig9 - 15 relate to a second embodiment of the invention which is especially well - suited for use on dual control faucets 112 . in fig9 faucet handle 113 controls cold water flow , and tamper resistant faucet handle 110 controls hot water flow . in many respects , the embodiment of the invention shown in fig9 - 15 is similar to the embodiment shown in fig1 - 8 , however , there are differences in the configuration due largely to the differences in operating characteristics between dual control faucets and single control faucets . in dual control faucets , the handle body 111 is attached to a rotatable flow control lever 114 , fig1 . the rotatable flow control lever 114 does not tilt with respect to the faucet base 1 16 . although it is not specifically shown in fig9 - 15 , the handle body 111 for tamper resistant faucet handle 110 is connected to the rotatable flow control lever 114 preferably by a screw such as described in conjunction with fig4 - 6 above . a cap 115 is preferably mounted over the screw access hole as is conventional in the art . conventional dual control faucets have a stepped , flow control stop member 117 surrounding the base of the rotatable flow control lever 114 . the stepped , flow control stop member 117 includes a first step 119 , and a second step 121 . an operating space 123 is disposed between the first step 119 and the second step 121 , see fig1 . conventional dual control faucet handles , as well as the tamper resistant faucet handle 110 , include a flow control boss 125 that extends downward from the handle body 111 and resides within the operating space 123 of the stepped , flow control stop member 117 . the range of movement of the flow control lever 114 is defined by rotation of the handle and the consequential movement of the flow control boss 125 between the first step 119 and the second step 121 . when the flow control boss 125 is adjacent the first step 119 , the flow control lever 114 is in a fully closed or off position ; whereas , the flow control lever 114 is rotated to a fully open position when the flow control boss 125 is adjacent the second step 121 . the tamper resistant faucet handle 110 for dual control faucet 112 limits the rotational range of movement when engaged . as mentioned , the mechanical components of the embodiment of the invention 110 for a dual control faucet 112 as shown in fig9 - 15 are similar in many respects to that for single control faucets 12 as shown in fig1 - 8 . for example , the interference plunger 118 includes a pair of locking mechanism engagement depressions 144 , 146 and is slidably located within a plunger bore 122 in the handle body 111 . a compression spring 126 biases the plunger 118 in an outward position when the plunger 118 is not locked into position . the plunger 118 for the dual control faucet 112 , however , must be prevented from rotating within the plunger bore 122 . therefore , the cross - section of the plunger 118 is not completely circular , see fig1 . more specifically , a key 119 is provided at the interface between the handle body 111 and the plunger body 118 to prevent the plunger 118 from rotating within the plunger bore 122 . as in the single control faucet 12 , an opening 141 is provided between the plunger bore 122 and the locking mechanism bore 140 so that the locking mechanism 120 can interact with the plunger 118 . the preferred locking mechanism 120 for the dual control faucet embodiment shown in fig9 - 15 is virtually identical to that shown for the single control faucet in fig1 - 8 . briefly , the outer sleeve 132 is press - fit into the locking mechanism bore 140 so that the opening 142 in the outer sleeve 132 aligns with opening 141 in the handle body 111 . the spring 135 and the locking body 134 with the removable actuation button 150 are then placed within the outer sleeve 132 . the locking body 134 engages plunger depression 144 to lock the plunger in the outward position , and engages plunger depression 146 to lock the plunger in the inward position . to release the lock , the actuation button 150 on the locking body 134 is pressed by the user against the bias force of spring 135 to align the clearance depression 148 in the locking body 134 . fig1 shows the plunger 118 locked in an inward position . in fig1 , the interference boss 156 on the plunger 118 is raised above the height of step 121 , and therefore the handle 111 is allowed its full range of movement . fig1 is a cross - section taken along line 13 -- 13 in fig1 and illustrates that the flow control lever 114 has a complete range of movement when the plunger 118 is locked in the inward position . in fig1 , the plunger 118 is locked in the outward position , and the interference boss 156 prevents rotation of the handle 111 in the counter - clockwise direction because of interference with step 121 . fig1 shows a cross - section taken along line 14 - 14 in fig1 , when the plunger 118 is locked in the outward position . when the plunger 118 is locked in the outward position , the conventional flow control boss 125 is adjacent the first step 119 , whereas the interference boss 156 on the plunger 118 is adjacent the second step 121 thereby limiting rotation of the flow control lever 114 . preferably , there is a small clearance 163 between the second step 121 and the interference boss 156 when the plunger 118 is locked in the outward position and the flow control boss 125 is adjacent the first step 119 . the clearance 163 is desirable to facilitate dependable downward engagement of the plunger 118 into the outward position . it should be recognized that the invention has been described herein in accordance with two preferred embodiments of the invention , however , the invention should not be limited to the specific embodiments herein . rather , various alternatives , embodiments and modifications may be apparent to those skilled in the art , and such alternatives or modifications should be considered to fall within the scope of the following claims .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

in a preferred embodiment , the low frequency transducer or woofer is of the permanent magnet moving coil type and consists of the permanent magnet assembly 10 to which is secured a frame 12 having a generally circular conical configuration . of course , the shape of the aperture 13 formed by the frame could be other than circular , for example , oval . the woofer diaphragm 14 extends or flares generally conically outwardly and has the ends secured to the periphery of the frame 12 by means of a compliant suspension 16 . the inward portion of the diaphragm 14 is secured to the voice coil form 18 upon the lower portion of which is the voice coil 20 which surrounds the center pole 22 of the permanent magnet assembly 10 with the voice coil positioned in the magnetic air gap 24 in the customary fashion . up to this point in the description , the construction of the transducer is entirely conventional . the high frequency transducer or tweeter construction comprises the tweeter zone 30 , the central axis , which is typically aligned with the central axis of the woofer cone 14 . as shown in the drawing , the tweeter cone has a somewhat greater flare rate and is of substantially smaller dimension than the woofer cone 14 . at the outer periphery of cone 30 , a foam compliance ring 34 is positioned between the edge of cone 30 and the surface of diaphragm 14 . behind the diaphragm 30 and extending along a portion of the surface thereof , dampening or stiffening material 32 or 36 may be provided to smooth response and isolate the lead wires if desired . at the apex of cone 30 , the driver element is positioned . this driver element consists of a piezo - electric crystal 38 in the form of what is commonly known in the trade as a bi - morph . the electrical leads 40 are connected to the crystal , 38 , and extend out to the input terminals 44 mounted upon a portion of the frame 12 . the leads 40 coming from the crystal 38 join leads 42 which connect to the input terminals 44 and likewise are connected to leads 43 which connect the voice coil 20 to leads 42 . the connection of the single pair of input leads to both drivers 38 and 20 without utilization of a divider or a crossover network is made possible because the crystal driver functions in the manner of a high pass filter network , and depending upon the thickness and diameter of the crystal and the diameter of cone 30 and its shape , etc ., provides an effective crossover frequency in the range anywhere from one to ten kilohertz . the provision of the fiberglass damping rings 32 and 36 are to suppress undesired vibrational modes while the foam compliance ring 34 provides a means to control and minimize phase interference in the acoustic radiation from both cones in the crossover region of response . a desirable acoustic response can thus be achieved by appropriate selection of the mass , the dimensions , the symmetry and the position of the tweeter mechanism as well as variations in the de - coupling ring 34 or damping ring 32 and 36 . when operating in response to low frequency electrical signals , the transducer assembly appears much as if it were a single cone , the operations in response to high frequency signals above the crossover frequency adds to the translational motion of the high frequency cone 30 essentially as if it were acting alone except that it is mounted upon a moving platform in effect . this mounting arrangement between the diaphragms leads to improved frequency response and dispersion for the overall system and to improved time phase coherence throughout the desired frequency range . from a mechanical point of view , the arrangement of the present invention also eliminates the need for the supplemental mounting brackets customarily usedd in other co - axial systems to support the higher frequency drivers . it will be obvious to those persons particularly skilled in this art that further changes or modifications of the design and configuration of this invention , as well as variation of the various factors mentioned herein , may be employed without departing from the scope and spirit of this invention as defined in the accompanying claims .

7Electricity

the following detailed description is presented to enable any person skilled in the art to make and use the invention . for purposes of explanation , specific nomenclature is set forth to provide a thorough understanding of the present invention . however , it will be apparent to one skilled in the art that these specific details are not required to practice the invention . descriptions of specific applications are provided only as representative examples . various modifications to the preferred embodiments will be readily apparent to one skilled in the art , and the general principles defined herein may be applied to other embodiments and applications without departing from the scope of the invention . the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest possible scope consistent with the principles and features disclosed herein . the principles of the present invention are achieved through the evaluation of the viability of the viruses with lymphotropism properties by sampling of the biological material , detection of presence of viral rna or dna using the polymerase chain reaction ( pcr ), as briefly discussed hereinabove . as described , a lymphocytes suspension is obtained from healthy human blood and an equal amount of biological material is then added . the aforesaid admixture is stirred , and then incubated at about 37 ° c . for about 6 - 8 hours , resulting in the washing - out of the lymphocytes from the plasma , and the lymphocytes being destroyed . the lymphocytes &# 39 ; cytoplasm is then subjected to a pcr test . as discussed , the detection of viral rna or dna in the cytoplasm of lymphocytes indicates the preserved viability of viruses , whereas the absence of viral rna or dna viruses in the cytoplasm of lymphocytes indicates inactivation of viruses . it should be understood that plasma or blood serums , biopsy samples of tissue or organs , and the washouts from the medical instruments may be used as the biological samples . in this manner , the methodologies and techniques of the instant invention allow assessment of the viability of viruses , particularly the hbv , hcv and hiv viruses . as discussed , another objective of the present invention is the elimination of eia and pcr false - negative results , such as by obtaining blood from patients suspected of being infected by lymphotropic viruses . for this approach , about 6 - 8 ml of such blood is drawn into test tubes , which preferably contain about 2 . 0 ml normal saline and about 2 - 3 drops of heparin . the lymphocytes are then separated from the blood and incubated at about 37 ° c . for about 6 - 8 hours , where lymphocytes are washed - out from the plasma and destroyed , and the cytoplasms of lymphocytes are then subjected to pcr . as discussed hereinabove , the detection of viral rna or dna in the lymphocytes &# 39 ; cytoplasm indicates the presence of viruses , whereas the absence of viral rna or dna in the lymphocytes &# 39 ; cytoplasm indicates the absence of viruses in the blood . the content of a patient &# 39 ; s lymphocyte is thus subjected to pcr - testing . it is known that many viruses , particularly those of the aforementioned hepatitis b virus ( hbv ), hepatitis c virus ( hcv ) and human immunodeficiency virus ( hiv ) can replicate in mononuclear blood cells , particularly , in the lymphocytes and in macrophages . it is known that hbv - and hcv - infections simultaneously cause inflammatory processes in the liver with subsequent hepatitis , as well as secondary immunodeficiency with various degrees of t - lymphopenia and b - lymphopenia , imbalance of regulatory subpopulations of t - lymphocytes ( t - helpers and t - suppressors ), reduction of immune regulatory index ( iri ), and dysgammaglobulinemia . the degree and grade of immunodeficiency , however , has been found to have no relation to the degree of the pathologic process in the liver . indeed , patients with chronic hbv and hcv infections have different intensities of pathological processes in the liver tissue after some time , from weak to expressed , but nonetheless have stable and steady aggravation of secondary immunodeficiencies . the dissociation of the degree of liver tissue injury and the degree of secondary immunodeficiency in various nosological forms of chronic virus hepatitis supports the idea that the hepatitis and secondary immunodeficiency in hbv and hcv infections are associated , mutually aggravating , but not mutually conditional . in other words , hbv and hcv , along with hepatotropic property viruses , possess expressed lymphotropic properties — direct properties that cause secondary immunodeficiencies . the differences in clinical appearances of the liver tissue injuries and the degree of immunodeficiency in hbv and hcv infections are due to differences in the degree of hepatotropic and lymphotropic properties of these viruses . thus , the differences in the degrees of hepatotropic and lymphotropic properties of viruses determine the differences of the pathogenesis , clinical appearance and the pattern of antiviral therapy effects in chronic hbv and hcv infections in various stages of these diseases . the identity of the lymphotropic properties of the aforesaid hbv and hcv , and hiv viruses , besides secondary immunodeficiency forming , is confirmed also by commonality of their epidemiological features , mechanism of transfer , progress of associated opportunistic infections ( frequent respiratory diseases , intestinal infections ), and particularly the development of the lymphogranulomatosis in different tissues of the organism . the development of lymphoid follicles &# 39 ; clusters , which is the aforementioned lymphogranulomatosis , in various organs and tissues of the organism is considered intrinsic for viral infections of the lymphoid cell system . when considering the lymphotropic properties of hbv , it was found that regardless of the serum titer , hbv can permanently persist in high concentrations in the cytoplasm of lymphoid elements . this phenomenon is used in the context of the instant invention for reliable increasing and elimination of the aforesaid false - negative results by eia and pcr , and the detection of lymphotropic viruses in biological material with concentrations of viral particles below the threshold of test - sensitivity for the eia and pcr techniques , as generally described hereinabove . in the instant invention , applicant employed the lymphotropic properties of hbv , hcv and hiv in an evaluation method of virus viability — the ability of these viruses to penetrate and persist intracellularly in the healthy human lymphocytes during their in vitro incubation . it should be understood that the evaluation of the viability of viruses with lymphotropism properties , particularly hbv , hcv and hiv , required the long - term storage of viruses , and the control of the antiviral efficiency of various disinfecting chemicals and physical factors against these viruses , as well as the control of antiviral therapy , as described in more detail hereinbelow . below is a description of a method pursuant to the teachings of an embodiment of the present invention directed to the evaluation of the viability of viruses with lymphotropism properties . in the production of a suspension of viruses , the biological material ( plasma or blood serum , biopsy samples of tissue or organs , and / or the wash - outs from medical instruments ) is obtained . then the biological material is subjected to quantitative pcr for the verification of the presence of viruses with lymphotropism properties , and the quantification of titer of the viruses . viruses contained in the biological material are kept in a frozen state in a refrigerator at below about − 25 ° c . temperature . a ) healthy volunteers are tested for infection with lymphotropic viruses using eia , as described . lymphocytes from healthy people with a negative result for study viruses are used in the investigations ; b ) to receive a sufficient amount of lymphocyte , blood is taken from an ulnar vein in an amount of about 20 - 30 ml in the morning from a fasting , healthy human subject . then about 7 - 8 ml of the blood is transferred to respective centrifuge tubes containing about 2 ml normal saline and about 3 drops of heparin (“ heparin ” concentration of 5000 me / ml ; 3 drops contain 750 me / ml of heparin ). the resulting solution is then stirred thoroughly ; c ) the lymphocytes are separated from the whole heparin containing blood in a ficoll - verografin gradient with density d = 1 . 077 g / ml pursuant to a technique known in the art . then , about 2 ml of the aforesaid ficoll - verografin gradient is poured into a clean centrifuge tube , then the heparinized blood lays on its surface and the tube is centrifuged at about 1500 rpm for about 20 minutes . during centrifugation , all blood cells , excluding lymphocytes , penetrate through the aforesaid ficoll - verografin gradient . blood plasma , however , remains above the gradient . in the border of the ficoll - verografin gradient and the plasma , there is a peculiar turbid ring , consisting of pure lymphocytes so formed . the ring with lymphocytes is then carefully pumped with a pipette and transferred to a clean centrifugal tube ; d ) the lymphocytes are then washed - out with about 10 ml of normal saline 2 - 3 times with further centrifugation at about 1500 rpm for about 20 minutes ; and e ) after the last centrifugation in the previous step , the supernatant is removed . the sediment containing lymphocytes is diluted and re - suspended in about 600 μl of normal saline . it should be understood that a lymphocytes suspension so produced may be stored no more than about a day at a temperature of about + 4 ° c . iii . evaluation of viruses with lymphotropism properties to penetrate and persist intracellularly in the human lymphocytes in vitro . 1 ) biological material containing viruses with lymphotropism properties is taken from a refrigerator and thawed at room temperature ; 2 ) an equal amount ( about 300 μl ) of virus - containing biological material and a suspension of healthy human lymphocytes is transferred with a pipette to a clean centrifugal tube , and the contents are mixed and placed for incubation ( incubation of viruses with lymphocytes in vitro ) into a thermostat at about + 37 ° c . for about 6 - 8 hours . the testing tube is preferably mixed with shacking every 1 . 5 - 2 hours ; 3 ) the washing - out of lymphocytes is then done . the aforesaid testing tube is removed from the thermostat . about 6 - 8 ml of normal saline is added , mixed and the admixture centrifuged at about 1500 rpm for about 20 minutes . the lymphocytes are then sediment at the bottom of the tube . the supernatant ( mixture of plasma with saline ) is then entirely removed . the lymphocytes are washed out in normal saline and sediment 2 - 3 times . after the last centrifugation and supernatant removal , the suspension of the lymphocytes ( sediment ) is diluted with about 500 μl of normal saline and transferred to a plastic 1 . 5 lock tube ( eppendorf tube ) or similar tube ; 4 ) thereafter , the tube is placed into a freezer , such as a house grade refrigerator , overnight . the lymphocytes are thereby destroyed under these slow freezing conditions ; 5 ) the removal of the membrane of destroyed lymphocytes . the next day the tubes from the freezer are thawed at room temperature . then the membranes of the aforesaid destroyed lymphocytes are removed by centrifugation at about 3000 rpm for about 30 minutes . membranes are precipitated on the bottom of the tube and the lymphocytes &# 39 ; cytoplasm content remains in the supernatant ; and 6 ) the supernatant from the tube is transferred and subjected to quantitative pcr for testing for possible viral rna or dna in the cytoplasm of the lymphocytes that were previously in the infected patient &# 39 ; s plasma . 1 . positive pcr for the presence of viral rna or dna in the cytoplasm of lymphocytes indicates the remaining virus viability , i . e ., the virus &# 39 ; ability to penetrate and persist in human lymphocytes in vitro . 2 . negative pcr for the presence of viral rna or dna in the cytoplasm of lymphocytes indicates the loss ( inactivation ) of virus viability , i . e ., the loss of the virus &# 39 ; ability to penetrate and persist in human lymphocytes in vitro . the blood is obtained from an ulnar vein of a patient after receiving antiviral therapy for hepatitis c . the plasma is then separated from whole blood and subjected to quantitative pcr for the verification of the presence of hcv and quantification virus titer . in this embodiment , the pcr testing is negative . tested plasma is kept in the freezer at below − 25 ° c . temperature . simultaneously a 20 - 30 ml sample of blood from healthy human volunteers is obtained in the morning from an ulnar vein . the blood plasma portion is then subjected to pcr analysis for viruses with lymphotropism properties infection . the lymphocytes from the healthy humans , with negative testing results for infection , are used for further investigation . then 7 - 8 ml blood aliquots are transferred to centrifuge tubes containing about 2 ml of normal saline and about 3 heparin drops (“ heparin ” concentration is 5000 me / ml , 3 drops contain 750 me / ml of heparin ). the solution in the tube is then mixed thoroughly . as described hereinabove , the lymphocytes are separated from the whole heparinized blood in a ficoll - verografin gradient with d = 1 . 077 g / ml density according to a known method by garib , yu et al . then , about 2 ml of the aforesaid ficoll - verografin gradient is poured into a clean centrifuge tube , where heparinized blood lays on the surface of the gradient and then is centrifuged at about 1500 rpm for about 20 minutes . all blood cells , excluding lymphocytes , penetrate the ficoll - verografin gradient and the sediment underneath . the blood plasma is found above the aforesaid gradient . along the border between the ficoll - verografin gradient and the plasma , the afore - noted peculiar turbid ring with pure lymphocytes suspension is formed . the ring with lymphocytes is then carefully sucked up with a pipette , and transferred to a clean centrifuge tube . the lymphocytes are washed out in normal saline and sedimented about 2 - 3 times . after the last centrifugation , the supernatant is removed . the sediment containing lymphocytes is then diluted with about 600 μl saline and re - suspended . as is understood , the lymphocytes suspension so formed may be stored for about 1 day at about + 4 ° c . temperature . the testing plasma from the freezer is then thawed at room temperature . equal volumes ( about 300 μl ) of plasma and the suspension of lymphocytes are transferred to a clean centrifuge tube with a pipette , mixed and placed for incubation in a thermostat at about + 37 ° c . temperature for about 6 - 8 hours . the tube is then mixed by shaking every about 1 . 5 - 2 hours . after incubation , the tube is removed from the thermostat . then , about 6 - 8 ml of saline is added , mixed and centrifuged at about 1500 rpm for about 20 minutes . as discussed , the lymphocytes sediment at the bottom of the tube . the supernatant ( mixture of plasma and normal saline ) is then removed . with 2 - 3 times wash - out in normal saline and the lymphocytes sedimentation is performed in the same fashion . after the last centrifugation , the supernatant is removed , and a suspension of lymphocytes ( sediment ) is diluted by adding about 300 μl of normal saline , and transferred to a 1 . 5 ml lock tube , such as an eppendorf tube . thereafter , lymphocyte membranes are destroyed by placing them overnight in a house - grade freezer . on the next day , the tubes are thawed at room temperature . then , the membranes of the destroyed lymphocytes are removed from the suspension by centrifugation of the tube at about 3000 rpm for about 30 minutes . the membranes are thereby precipitated at the bottom of the tubes , and the lymphocyte cytoplasm contents remain in the supernatant , as also described hereinabove . the supernatant is then transferred from the tube and subjected to a quantitative pcr test for the presence of hcv viruses in the cytoplasm of the lymphocytes . a positive pcr test for hcv , of course , indicates the preservation of the hcm viability and the requirement of further antiviral therapy . a liver tissue , such as sampled by a liver puncture of a patient , who was given antiviral therapy for hepatitis b is obtained . a liver biopsy sample thereof is homogenized in an about 1 . 5 ml normal saline ; transferred to a centrifuge tube , and then centrifuged at about 1500 rpm for about 20 minutes ; and the supernatant transferred to a tube . one part of the supernatant is then subjected to quantitative pcr testing for the presence of hcv virus and quantification of virus titer . if the pcr test for hcv is positive , the biopsy sample is kept in the freezer in the refrigerator at below − 25 ° c . temperature . a lymphocyte suspension from a healthy human is made , as described hereinabove in connection with example # 1 . the supernatant from the aforesaid liver biopsy sample homogenate is thawed at room temperature . then equal volumes ( about 300 μl ) of the supernatant and lymphocyte suspension are added to a tube by an automatic pipette or similar such means ; the resulting solution is admixed and placed for incubation into a thermostat at about + 37 ° c . temperature for about 6 - 8 hours , where the testing tube is mixed by shaking about every 1 . 5 - 2 hours . the tube is the removed from thermostat and about 6 - 8 ml of normal saline is added , admixed and centrifuged at about 1500 rpm for about 20 minutes . the lymphocytes sediment at the bottom of the tube , as described hereinabove . the supernatant ( mixture of plasma with normal saline ) is removed entirely , and treated by a 2 - 3 times wash - out in normal saline , where the aforementioned lymphocytes sedimentation is performed in the same fashion as before . after the last centrifugation , the supernatant is removed and the suspension of lymphocytes ( in the sediment ) is diluted by adding about 300 μl of normal saline . thereafter , the destruction of the lymphocyte membranes is performed by putting the testing tube into a house - grade freezer overnight . accordingly , lymphocyte membranes are destroyed by overnight placement into house - grade freezer . on the next day , the tubes are thawed at room temperature . then , the membranes of destroyed lymphocytes are removed from suspension by centrifugation of the tube at about 3000 rpm for about 30 minutes . the membranes are precipitated along the bottom of the tubes and the lymphocyte cytoplasm contents remain in the supernatant , as discussed and described hereinabove . the supernatant is transferred from the tube and subjected to a quantitative pcr test for the presence of hbv virus in the cytoplasm of the lymphocytes , where a negative pcr test for hbv indicates the virus &# 39 ; loss of viability ( inactivation ). this example concerns the detection of viruses with lymphotropism properties in biological material with the concentration of virus below eia and pcr sensitivity thresholds . in a blood center , the blood plasma from about 6 - 8 ml of blood is tested for viruses with lymphotropism properties . one part of the plasma is subjected to quantitative pcr testing for the presence of hbv , hcv or hiv viruses , and the quantification of virus titer , where the pcr test here for the presence of viruses is negative . the tested plasma is stored in a freezer at below about − 25 ° c . the lymphocyte suspension from healthy human subjects is then prepared as described in more detail hereinabove in connection with example # 1 . the testing plasma from the freezer is thawed at room temperature . equal volumes ( about 300 μl ) of plasma and the suspension of lymphocytes is transferred to a clean centrifuge tube using an automatic pipette , admixed and placed for incubation in a thermostat at about + 37 ° c . for about 6 - 8 hours . the tube is mixed by shaking about every 1 . 5 - 2 hours . the tube is then removed from the thermostat , and about 6 - 8 ml of normal saline is added , admixed and centrifuged at about 1500 rpm for about 20 minutes . as described hereinabove , the lymphocytes sediment along the bottom of the tube . the supernatant ( mixture of plasma with normal saline ) is removed entirely , and the remainder 2 - 3 times wash - out in normal saline , where the lymphocytes sedimentation is performed in the same manner as set forth hereinabove . after the last centrifugation , the supernatant is removed and the suspension of lymphocytes ( sediment ) is diluted by adding about 300 μl of normal saline . thereafter , the lymphocyte membranes are destroyed by placing them into a house - grade freezer overnight . on the next day , the tubes are thawed at room temperature . the membranes of the destroyed lymphocytes are removed from suspension by centrifugation of the tube at about 3000 rpm for about 30 minutes . as discussed , the membranes precipitated along the bottom of the tubes , and the lymphocyte cytoplasm contents remain in the supernatant . the supernatant is then transferred from the tube and subjected to quantitative pcr testing for the detection of hbv , hcv and hiv viruses in the content of lymphocytes &# 39 ; cytoplasm , where a positive pcr for hcv indicates the presence of hcv virus in the donor plasma , indicating that donor &# 39 ; s ineligibility for transfusion . in this example , about 6 - 8 ml of blood is obtained in the morning from a fasting donor , preferably from an ulnar vein . whole blood is then transferred to a tube , subjected to sedimentation techniques , as described herein , and a serum is obtained ; one part of the serum is subjected to a pcr test for the presence of hbv , hcv or hiv viruses . and the quantification of virus titer , where the pcr tests are negative . the rest of the blood serum is stored in the tube . the lymphocyte suspension from a healthy human subject is performed , as described in more detail hereinabove in connection with example # 1 . the lymphocytes are separated and destroyed by overnight freezing in a house - grade refrigerator , as described . on the next day , the tube is thawed at room temperature . then the membranes of the destroyed lymphocytes are removed from the suspension by centrifugation at about 3000 rpm for about 30 minutes . the membranes precipitate on the bottom of the tube , and lymphocyte cytoplasm contents remain in the supernatant . the supernatant is then transferred from the tube and subjected to a quantitative pcr test for the detection of hbv , hcv and hiv viruses in the cytoplasm of the lymphocytes , where a positive pcr for hbv indicates the presence of hbv in the donor blood . in a standard pcr test , the detection rate of hbv and hcv has been observed at about 2 . 7 %. according to epidemiological data , new cases of hepatitis b ( hbv ) and hepatitis c ( hcv ) transfer occur due to the transfusion of infected blood or its components in about 2 . 2 %- 5 . 6 % of occurrences . to uncover the reasons behind this and techniques for the elimination of hbv infection in recipients , the lymphotropic properties of the virus were used . in particular , serums from 309 donor blood samples were tested by pcr for hbv markers detection rate . pcr revealed hbv in 6 out of 209 serum samples that estimated at about 1 . 94 % of all number of donors &# 39 ; sample . the same pcr study ( study of lymphocytes content from the same donors ) revealed hbv in 17 out of 309 samples , estimated at about 7 . 44 % of all donors &# 39 ; samples . thus , the standard pcr testing of blood serum was false - negative in 5 . 50 % of samples , which indicates that this is the reason for hbv infection in recipients by transfusion of infected blood or the components thereof . while the present invention has been illustrated by the description of the embodiments thereof , and while the embodiments have been described in detail , it is not the intention of the applicant to restrict or in any way limit the scope of the appended claims to such detail . additional advantages and modifications will readily appear to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details , representative apparatus and method , and illustrative examples shown and described . accordingly , departures may be made from such details without departure from the breadth or scope of the applicant &# 39 ; s concept . furthermore , although the present invention has been described in connection with a number of exemplary embodiments and implementations , the present invention is not so limited but rather covers various modifications and equivalent arrangements , which fall within the purview of the appended claims .

2Chemistry; Metallurgy

referring more specifically to the pomological details of this new and distinct variety of nectarine tree , the following has been observed under the ecological conditions prevailing at the applicants &# 39 ; orchard which is situated in fresno county , calif . all major color code designations are by reference to the dictionary of color , by maerz and paul , second edition , published in 1950 . common color names are also used occasionally . form : upright , to upright -- spreading in form . the form of the subject variety is determined by pruning practices . vigor : medium . the instant variety is hardy when grown under typical san joaquin valley ecological conditions . trunk -- lenticels : numerous moderately large corky type lenticels are evident . trunk -- scarf skin : a moderate amount of scarf skin is present on the bark surface . leaf form : lanceolate , with a sharp acuminate tip . the leaf tip may appear slightly twisted . leaf mid - vein .-- yellow - green , ( 17 - h - 2 ) when viewed from the ventral surface of the leaf . thickness .-- approximately 1 mm . when measured at the center portion of the leaf . marginal form : crenate , occasionally moderately coarse , regular in appearance . the leaf margins are moderately undulate . color .-- yellow - green , ( 17 - g - 30 ); the petiole groove is a somewhat slightly darker green , ( 19 - f - 4 ). numbers .-- variable , from two to five glands are present . as a general matter , two or three leaf glands are present on the leaf petiole just below the basal leaf margin . one or two more leaf glands , in this instance , a reniform type , are present on the basal leaf margin . color .-- young glands have a shiny yellow - green appearance , ( 17k - 3 ); the glands darken and deteriorate with advancing age . color .-- green - yellow ( 17 - i - 5 ); the stipule color darkens with advancing maturity . the variety is early deciduous . generally .-- mid - season to slightly late in relation to other common nectarine varieties growing in this geographical area of california . bud form : conic . the variety usually produces one to two flower buds per node . color .-- a light pink ( 1 - e - 2 ). the petals of the subject variety darken with advancing maturity . length .-- average . although in most instances the stamens are shorter than the pistil . color .-- a light yellow - green , ( 17 - h - 3 ). the pistil is usually positioned above the anthers when fully extended . maturity when described : ripe for commercial harvesting and shipment approximately july 25 , 1987 through aug . 5 , 1987 . form : moderately asymmetrical , with one - half of the fruit generally larger than the other half . shape : ovate to nearly oval in its lateral aspect . nearly globose in its apical aspect . in some instances , the ventral suture of the subject variety is moderately prominent . generally .-- the suture of the subject variety appears as a very shallow depression which extends from the base to the apex . the suture of the subject variety further appears more distinct over the apical shoulder area ventrally . color .-- the suture color usually is quite similar to the underlying blush or ground color . some fine , thin , and dark red stripes occasionally appear along the suture area ( 8 - l - 8 ). this coloration is usually more evident over the basal shoulder area . form .-- a moderate depression occurs along the suture line and is further evident in the immediate vicinity , and on both sides of the apex . form .-- smooth and rounded , moderately lipped on both sides of the fruit in the area of the apical shoulders . occasionally , some fruit display a low prominence at mid - suture . position .-- variable , from a right angle to slightly oblique with respect to the fruit axis . shape .-- rounded with a low tip . the apex , in most instances , is higher at the apical shoulders . position .-- apical . moderately depressed areas subtend the apex on both the ventral and dorsal suture lines . color .-- generally -- the blush color covers approximately 80 % to 95 % of the fruit surface . in most instances , the only ground color evident is that portion of the skin which is pressed next to a branch where the subject fruit was attached . blush color : variable , a deep mahogany red to a bright cherry red ( 8 - l - 8 ) to ( 5 - l - 10 ), respectively . some intermediate red color may be evident . the blush color is often overlain with dark red mottling which is variable with respect to its hue . the density of the mottling is noteworthy in the basal shoulder area but is not exclusively limited thereto . flesh color : at commercial maturity , the flesh color is a uniform yellow - amber ( 10 - j - 5 ). the pit cavity is stained a dark red ( 7 - l - 9 ). the dark stain extends approximately 4 to 5 mm . into the flesh . texture .-- a moderate amount of callous is present in the pit cavity . generally .-- firm and crisp at commercial maturity . the subject variety becomes melting and juicy with advancing maturity . attachment : completely freestone ; a few fibers may occasionally cling to the basal area of the stone . position .-- the base angle is variable with respect to the fruit axis ; both right angle and oblique forms are evident . texture .-- moderately rough , with deep grooves appearing laterally over the apical shoulder . the stone surface has formed therein deep and often irregularly shaped pits which appear over lateral and mid - stone surfaces . shallow and fine ridges are evident over the basal shoulders , these ridges converge basally . wings .-- multiple low wings occur from the base to the apex . a central wing is slightly more prominent in the basal shoulder area . texture .-- coarse with high discontinuous ridges which subtend to a medium depth groove that extends from the base to mid - stone ; the dorsal suture is slightly eroded over the apical shoulders . dry .-- variable from dark brown to a lighter brown , ( 7 - c - 10 to 13 - e - 9 ). violet staining is considerable over the basal areas . fruit use : fresh market and dessert type nectarine for both local and long distance shipping . shipping quality : unknown , although the firm , crisp flesh at commercial maturity strongly indicates that the subject variety will have noteworthy shipping characteristics . although the new variety of nectarine tree possesses the described characteristics as a result of the growing conditions prevailing in the san joaquin valley of central california , it is to be understood that variations of the usual magnitude and characteristics incident to growing conditions , fertilization , pruning and pest control are to be expected .

0Human Necessities

with reference to the drawings , the linear mechanical lock of this invention , generally designated by the numeral 10 , has a cylindrical rod 12 which extends into a tubular lock housing 14 . the lock housing 14 has a bottom , non - load bearing element 16 , and a top , load bearing element 24 . the two housing elements 16 , 24 are assembled to make a tubular housing which is open at opposite ends . the bottom part 16 is a length of channel stock which , as seen in the cross sectional view of fig3 has a bottom 18 , two sides 20 , and an open side between upper edges 22 . the top part 24 is also u - shaped in cross section with a base 26 between side portions 28 . tabs 30 along the upper edges 22 of the channel 16 mate into aligned slots in the base 26 of the top housing element , and are bent so as to mechanically interlock the channel 16 to the underside of the base plate 26 , closing the open side of the channel 16 . the resultant housing assembly 14 has a nearly rectangular interior cross section , as seen in fig3 . a pair of clutch springs 32 , 34 are wound axially about the rod 12 in opposite senses to each other and have a normal internal diameter slightly smaller than the rod diameter , so that both springs grip the rod tightly . the outer ends of the clutch springs 32 , 34 terminate in tangs 36 , 38 , respectively . the tangs are circumferentially fixed relative to the housing 14 in slots 40 , 42 defined in the bottom 18 of the channel 16 . the inner ends of the clutch springs 32 , 34 are engaged in notches 44 of a sleeve 46 which is coaxial with and rotatable about the rod 12 by means of release lever 48 . the lever 48 extends through a window 50 in the base plate 26 and is urged against one of the side portions 28 by the tension of springs 32 , 34 acting on the sleeve 46 . the clutch springs 32 , 34 are axially contained between opposite axial bearings , one axial bearing is a fixed shoulder 52 integral with the base plate 26 . the other axial bearing is an eccentric cam 54 fixed to the inner end of a plug 56 which is rotatable in an opening 58 in the base plate 26 , as shown in fig2 . the axial bearings 52 , 54 engage the outer end coil of a corresponding clutch spring 32 , 38 at a point diametrically opposite to the end tangs 36 , 38 . fig4 shows the adjustable axial bearing in plan view with the base plate 26 removed for clarity . the outer end 58 of plug 56 has a slot 74 engageable by a bladed tool , such as a screwdriver , for turning the plug 56 in hole 58 . rotation of the plug 56 turns the eccentric cam between a minimum radius engagement with the end coil of clutch spring 34 , shown in fig4 and a maximum radius engagement , seen in fig5 along the circumference of the cam 54 . in a normal condition of the linear lock 10 , the clutch springs 32 , 34 lock the rod 12 against axial movement through the housing 14 . the rod 12 is released for axial movement by turning release lever 48 and sleeve 46 counterclockwise as indicated by the arrow in fig2 and 3 . the sleeve 46 simultaneously turns the inner ends of both clutch springs in a sense which unwinds the spring coils , enlarging their inner diameter . the interior dimensions of the lock housing , between the inner surfaces of the sides 20 , and between the bottom 18 and base plate 26 , are only slightly greater than the normal outside diameter of springs 32 , 34 , so that the housing 14 closely encompasses the clutch springs . as release lever 48 begins to turn , the inner end coils of the two springs unwind and their outer diameter enlarges only slightly before their expansion is limited by contact with the interior surfaces of the channel 16 and the base plate 26 . continuing movement of release lever 48 is transmitted to successively adjacent coils from the outer ends of the springs towards the inner end coils as the expansion of each successive coil is limited by the closely adjacent - interior surfaces of the lock housing 14 , ultimately resulting in the enlargement of all the coils of both springs , releasing the rod 12 for axial movement through the housing 14 . the upright side portions 28 of the housing top 24 are shaped and perforated to provide two mounting lugs 60 which together constitute a first load attachment point for the lock 10 . a second load attachment point is provided by a perforated mounting lug 62 at the end of rod 12 . *** the lugs 60 on the housing are close to the base 26 of the housing top 24 so as to place the load vector connecting the two load attachment points into near alignment with the rod 12 . the working loads on the lock 10 , whether tension or compression loads , are transmitted from one load component to the lugs 60 on the housing , through the axial bearings 52 , 54 to the clutch springs which act axially on the rod 12 and ultimately to the other load component connected to the rod end . the approximate alignment of the load vector with the rod and spring axis minimizes load transfer from the top housing element 24 to the bottom housing element 16 . the working loads of the lock 10 are therefore primarily carried by the top housing element 24 . since the attachment lugs 60 are not quite on - axis with the rod , some lateral loading of the housing 14 relative to the rod 12 and springs 32 , 34 may occur , in which case some fraction of the total working load will be transmitted to the housing bottom 16 . the loads on the channel 16 , however , will be small as compared to the loading on the housing top 24 . for this reason , the housing top 24 may be properly considered to be the load bearing element of the housing , while the housing bottom or channel 16 is referred to as the non - load bearing element of the housing . in a preferred form of this invention the rod 12 is supported in the housing 14 only by the clutch springs 32 , 34 , obviating the rod bearing surfaces provided by bushings in prior art linear locks . in many applications , the clutch springs will suffice to support the rod in axial alignment through the lock housing , particularly if the load attachment to the housing is made close to the rod axis , so that the loading on the lock mechanism is as nearly as possible aligned with the axis of the rod , and the axial load is largely taken up by the axial bearing elements 52 , 54 . while some torsional or lateral loading on the housing 14 relative to the rod 12 may still occur , such loading is adequately carried by the clutch springs without unduly affecting the operation of the lock . where particularly heavy working loads are to be carried by the lock 10 , rod bearing surfaces may be provided integrally with one or both of the housing elements 16 , 24 , near one or both ends of the housing 14 , by for example embossing or otherwise deforming inwardly the housing elements at selected points . because of the large difference in load bearing requirements , the housing top 24 can be made of high strength material such as steel , while the channel 16 can be of lighter , lesser strength material such as aluminum . the possibility of using different housing materials in this manner permits significant reductions in the overall weight of the lock 10 . this is an important consideration in vehicular installations , such as automotive and aircraft seating , which are typical applications for these linear locks . both housing elements 16 , 24 can be fabricated of sheet stock at low cost by stamping methods . yet another important advantage of this lock housing structure is that the housing elements 16 , 24 can be fastened together by simple mechanical means without resort to welding , which in turn permits a wider choice of materials for the housing elements since compatibility with welding processes is no longer required . the load bearing capacity of the integral fixed axial bearing 52 may be enhanced by heat treatment of the housing top 24 for greater hardness . the mechanical interlock between the housing components 16 , 24 allows such hardening , since welding of the two components is unnecessary . additionally , the housing components of the lock of this invention can be coated by various processes for corrosion resistance where the lock 10 is to be used in environmentally adverse conditions , as sell as for improved esthetic appearance for greater customer acceptance . the coating may be by various plating and painting processes , which were impractical in prior art mechanical locks repairing welding , since plated or painted components cannot be easily welded and post - assembly plating or painting is impractical . the upright sides 28 also have mounting lugs 62 for optional left or right side mounting of a cable release cr , shown in phantom lining in fig1 for remote actuation of the release lever 48 . the cable release is conventional , and has a sleeve which is anchored at its end to one of the mounting lugs 62 , and a cable slidable within the sleeve which is attached to the outer end of the release lever 48 . pulling on the cable relative to the sleeve at a remote end of the cable release cr actuates the lever 48 for unwinding the clutch springs 32 , 34 and freeing the rod 12 for axial movement through the lock housing . the upright sides 28 further have alternate release mountings 64 for optional right or left hand side mounting of a handle release actuator shown in fig6 and 7 , where the release lever 48 &# 39 ; has a modified , curved shape , best shown in fig7 . a handle mounting shaft 66 is supported between the two mounting 64 . an actuator finger 68 extends generally radially from the shaft 66 . turning the shaft 66 as indicated by the arrow in fig7 causes the release finger 68 to lift a transverse intermediate portion 70 lifting and turning the release lever 48 towards the left in fig7 as indicated by the arrows . the inner end of the modified release lever 48 &# 39 ; is attached to a sleeve 46 , as shown in fig2 . a stop finger 72 is fixed radially to the shaft 66 and is generally diametrically opposite to the release finger 70 . the stop finger moves downwardly as the release finger 68 moves up against the release lever 48 &# 39 ; until the stop finger 72 comes against the base plate 26 , stopping further rotation of the shaft 66 , to prevent excessive force against the release lever 48 &# 39 ;. assembly of the mechanical lock 10 is simple and quick . the clutch springs and the sleeve 46 of the release lever 48 are fitted onto a rod blank which is then worked to make either or both the end lug 62 and an upset 76 at the opposite end of the rod of sufficient diameter to serve as a stop against withdrawal of the rod from the housing 14 . this subassembly is then placed into the channel 16 , with the end tangs 36 , 38 in their corresponding slots 40 , 42 in the bottom of the channel . the housing top 24 is then mated to the tabs 30 of the channel 16 , so that the clutch springs 32 , 34 lie axially between the axial bearings 52 , 54 . the two housing elements 16 , 24 are then fastened together by staking the tabs 30 on the upper side of the base 26 . at this point in the assembly sequence a degree of axial slack or free play between adjacent coils of the clutch springs will typically exist , as illustrated by the slight spacing between the end coils of the spring 34 in fig4 . this free play is removed by adjustment of the axial bearing 54 , accomplished by turning the plug 56 . rotation of the cam 54 with the plug 56 continuously varies the axial position of the contact point between the eccentric camming edge of the cam 54 and the end coil of the clutch spring 44 . by turning the cam 54 between the minimum engagement position of fig4 and the maximum engagement position of fig6 a cam position will be found where the coils of both clutch springs 32 , 34 are closely adjacent without free play in an axial direction , yet without excessive tightness or friction between the coils which would impede response to the release lever 48 . adjustment of the cam 54 operates to urge the coils of the clutch spring 34 towards the opposite axial bearing 52 . during this adjustment procedure , the sleeve 46 of the release lever is free to move axially on the rod 12 under the urging of the cam 54 transmitted through the clutch spring 34 . once the cam 54 is adjusted , the plug 56 is fixed against subsequent rotation by application of a suitable permanent adhesive between the plug and surrounding portions of the lock housing . where particularly heavy working loads are anticipated , greater than can be satisfactorily carried by the fixed bearing shoulder 52 , the mechanical lock 10 can be modified by replacing the fixed axial bearing 52 with a second adjustable axial bearing similar to the plug 56 with eccentric cam 54 . in some applications , it may be desirable to provide a relative large external spring 82 compressed between the lock housing 14 and the rod 12 , as shown in fig6 to continuously bias the rod 12 to an extended position relative to the lock housing . for that purpose , a spring stop 78 is formed by curling a strip cut from the bottom 18 of the channel 16 , as shown in fig2 . the spring stop 78 is axially aligned with edges 80 , which cooperate with the spring stop 78 in supporting the inner end of the external coil spring 82 . the opposite , outer end of the coil spring 82 is supported by a stop element 84 on the rod 12 . an alternate embodiment of the present invention will be described with reference to fig8 through 12 , wherein the mechanical lock 100 differs from the earlier described lock 10 of fig1 through 7 in the mechanical arrangement for making the fine positional adjustment of the spring end bearings so as to remove any free axial play ( known as &# 34 ; shucking &# 34 ;) of the spring / rod subassembly within the lock housing . common elements of the lock 100 with the previously described lock 10 are designated by common numerals . the lock 100 has a lock housing 114 which is assembled from three housing elements . a first housing element is a bottom 116 which is a length of channel stock of u - shaped cross section , as seen in fig2 and 4 . the housing bottom 116 has a bottom 18 and two sides 20 which extend between open opposite ends and an open side between upper edges 122 . a second housing element is a top plate 124 which in part is u - shaped with side portions 28 . the side portions 28 are integral with the top plate 124 and define two mounting lugs 60 which together constitute a first load attachment point for the lock housing 114 , as well as mounting lugs 64 for optional left or right side mounting of a cable release as has been explained in connection with the lock 10 above . the housing bottom 116 has ten rectangular tabs 30 , five spaced along each edge 122 , and which in an initial condition of the housing bottom 116 extend upwardly from the edges 122 in a common plane with each side 20 . the top plate 124 has slots 132 which are sized and aligned to closely receive each of the tabs 30 . the dimensions of the slots 132 are such that the top plate 124 is fixed by the tabs 30 against movement in the direction of the rod 12 along the edges 122 of the housing bottom . the top plate 132 has a first spring end bearing 152 which is formed , for example , by stamping and bending a portion 154 of the top plate , to form an edge 152 which is contoured to the curvature of the rod 12 , so as to act as a stop for the outer end coil of the spring 32 , on the left hand side in fig1 . the end bearing 152 stops the rod and spring assembly from axial displacement towards the left in fig1 while the springs 32 , 34 are in their normal rod gripping condition of reduced diameter . a third housing element is an adjustment plate 134 which has four slots 136 arranged for receiving four corresponding tabs 30 on the housing bottom 116 , specifically , the four tabs 30 at the right hand end of the housing bottom 116 in fig9 and 10 . the adjustment plate 134 has an edge 158 shaped to the contour or curvature of the rod 12 , so that a center portion of the shaped edge lies against the surface of the rod 12 and follows the rod curvature over a portion of the rod circumference to form a second spring end bearing 158 . the second end bearing 158 acts as a stop against the outer end coil of the spring 34 , to stop the spring and rob sub - assembly against axial movement towards the right in fig1 . the two springs 32 , 34 are consequently axially captive between the two end bearings 152 , 158 , and in their normal rod gripping condition , lock the rod 12 against axial movement through the lock housing 114 . the upper edges 122 of the housing bottom are offset at segments 122 &# 39 ;, on both sides 20 of the housing bottom , to accommodate the thickness of the adjustment plate 134 when the adjustment plate is mated to the tabs 30 , so that when the adjustment plate is assembled to the housing bottom , the top surface of the adjustment plate is flush with the edges 122 . the top plate 124 is assembled to the housing bottom 116 in overlying relationship to the adjustment plate 134 , as shown in fig1 . the slots 132 of the top plate 124 receive all ten of the tabs 30 of the housing bottom , including those four tabs 30 which pass through the slots 136 of the adjustment plate 134 . the slots 136 of the adjustment plate 134 are wider than the tabs 30 which mate into those slots , in order to permit a small , limited positional adjustment of the plate 134 along the edges 122 &# 39 ; in the direction of the rod 12 . in a partially assembled condition of the lock 100 , the three housing elements 116 , 134 and 125 are assembled to the rod and spring sub - assembly but the tabs 30 remain in their initial straight condition illustrated in fig9 . an axially directed force , indicated by arrow f in fig1 , is then applied to the adjustment plate 134 in order to urge the end bearing 158 against spring 134 , thereby also axially displacing the rod and coil subassembly until the outermost coil of the spring 32 makes positive engagement with the opposite end bearing 152 . this ensures that both end bearings 152 and 158 are in positive contact with the opposite ends of the spring assembly 32 , 34 so that the springs are held tightly in an axial direction to the lock housing 114 . this in turn ensures that the rod 12 is firmly held to the housing 114 without any free play of the rod which would detrimentally affect the performance of the lock 100 in a load bearing installation . assembly of the lock 100 is completed by bending all of the tabs 30 against the upper surface of the top plate 124 to a crimped condition shown in fig8 , 11 and 12 . the crimped tabs 30 form a mechanical interlock which holds together the three housing elements and fixes both plates 134 , 124 against movement relative to the housing bottom 116 . in particular , the crimped tabs 30 fix the adjustment plate 134 in frictional engagement between the bottom 116 and top plate 124 to secure tight engagement of both end bearings with the corresponding spring ends . as described above in connection with the lock 10 , the housing bottom 116 of the look 100 is substantially non - load bearing , as the axial load acting on the lock 100 is transmitted by the rod 12 , through springs 32 , 34 onto the end bearings 152 and 158 and thus onto the plates 124 , 134 and ultimately to the load mounting lugs 60 of the lock housing . the two plates 124 , 134 of lock 100 in effect take the place of the single top plate 26 of the lock 10 . a fail safe interlock is provided to prevent failure of the lock 100 in an overload condition of the lock in the unlikely event that an axial force pulling on rod 12 relative to the lock housing 114 is of sufficient magnitude to overcome the frictional engagement of the adjustment plate 134 with the top plate 124 and housing bottom 116 and also to shear the four tabs 30 mated to the adjustment plate . this interlock includes a portion 140 which is bent away from the top plate 124 and into a window 142 defined in the adjustment plate 134 , presenting a detent edge 144 against the edge of the rectangular window 142 which is adjacent to the end bearing 158 , as best understood by reference to fig9 and 10 . the detent edge 144 stops the plate 134 from moving more than a small distance in an axial direction away from the spring 34 in case of an overload condition , and thereupon transfers a substantial portion of such an overload to the top plate 124 which in turn distributes the load over all ten of the tabs 30 , thus preventing possible failure of the lock . from the foregoing it will be appreciated that the adjustment of the plate 134 provides a simple , low cost means for achieving a high degree of precision in assembly and subsequent operation of the lock 100 with easy to manufacture sheet metal components for the lock housing . while a presently preferred form of the invention has been described and illustrated for purposes of clarity and example only , it will be better understood that many changes , substitutions and modifications to the described embodiments will become readily apparent to those possessed of ordinary skill in the art without thereby departing from the scope and spirit of the present invention which is defined in the following claims .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

referring now more particularly to the drawing , wherein like reference numerals may be used to designate like parts in the several figures , a fluorescent lamp simulator insert , which simulates in shape and , to an extent , in electrical characteristics a conventional instant start fluorescent lamp , is generally indicated at 1 in fig1 . the fluorescent lamp insert 1 has a tubular body 2 , which may be formed , for example , of glass , plastic or other preferably electrically non - conductive , fragile or non - fragile material , and , although shown in a cylindrical configuration , the tubular body may be shaped as a toroid or in another configuration , as desired . at the ends of the tubular body 2 are respective end terminations , such as end caps 3 , 4 , which may be electrically conductive or nonconductive , and opposed electrically conductive pins or terminals 5 , 6 pass through the respective end caps 3 , 4 , to provide for electrically coupling of a wire 7 , such as bell wire , located inside the tubular body 2 to the typical connections found in the lamp receiving sockets of a conventional fluorescent lighting fixture . although the fluorescent lamp insert 1 has an external appearance similar to that of a conventional instant start fluorescent lamp , the hollow tubular body 2 may be air filled , and there is no need for any air - tight seals between the tubular body and the respective end terminations . the pins 5 , 6 may be electrically insulatively supported in the respective end caps , if desired , and the tubular body 2 may be either transparent , translucent , or opaque , as desired . the wire 7 provides a direct electrical connection between the pins 5 , 6 preferably without any appreciable electrical resistance to avoid unnecessary energy dissipation . preferably the insert 1 is designed to simulate the appearance of a conventional instant start fluorescent lamp , and it is , more importantly , intended to simulate the electrical properties of such a conventional fluorescent lamp with respect to the fluorescent ballast circuit used to energize the latter . the wire 7 in the insert 1 provides the electrical property of low electrical resistance between the pins 5 , 6 , thus simulating the steady state or on electrical characteristic of a conventional fluorescent lamp without any appreciable energy dissipation . a fluorescent lamp insert in accordance with the invention has been satisfactorily tested in a conventional plural lamp series - sequence fluorescent ballast circuit , such as the circuit shown in fig4 which will be discussed in more detail below . in the course of the mentioned testing , one of the two conventional fluorescent lamps coupled in the ballast circuit was replaced by the insert of the invention , and it was found that the ballast circuit was successfully operable to effect proper energization of the remaining fluorescent lamp . moreover , the electric power consumed by the ballast circuit including one fluorescent lamp and one fluorescent lamp insert was reduced by slightly less than 50 percent of the electrical energy consumed when two fluorescent lamps were connected in the ballast circuit . moreover , during such testing the above - described possible detrimental affects to the ballast circuit or the remaining fluorescent lamp were not encountered , and the temperature of the ballast did not experience any appreciable variation from the normal ballast temperatures . although in the preferred embodiment the wire connection 7 of the insert 1 is substantially electrically conductive , it may be desirable in some circumstances to increase the resistivity thereof to maintain a reasonable electrical balance in the ballast circuit , and such increase may be effected by adding resistance in the wire connection between the pins 5 , 6 or the wire itself may be formed of an electrically resistive material such as , for example , nichrome wire . the simulation of the steady state operative electrical property of a fluorescent lamp by a relatively conductive wire 7 between the pins 5 , 6 has been found satisfactory for the intended purpose of the invention ; however , it may be desired to add between the pins 5 , 6 , additional electrical circuitry that would briefly provide a high resistance when the ballast circuit is turned on so as more exactly to simulate the affect of a fluorescent lamp . such additional circuitry may automatically cut itself out and reinstate the direct connection of the wire 7 between the pins 5 , 6 at a time equivalent to that required for the arc to be struck in a conventional instant start fluorescent lamp . turning now more particularly to fig2 a fluorescent lamp simulator insert , which is substantially in the external configuration of a conventional rapid start fluorescent lamp , is generally indicated at 11 . the insert 11 includes a generally tubular body 12 and a pair of end termination caps 13 , 14 therefor , all of which may be similar to the elements described above with reference to the fluorescent lamp insert 1 of fig1 . a first pair of electrically conductive pins 15a , 15b pass through the end cap 13 , and a second pair of electrically conductive pins 16a , 16b pass through the end cap 14 ; and to each pair of pins is connected a respective resistor 17 , 18 to simulate the resistive affect of the cathode heaters in a conventional rapid start fluorescent lamp . in the preferred embodiment each of the resistors 17 , 18 is formed of electrically resistive material , such as nichrome wire , which is preferably selected to have a resistance approximately equivalent to the cathode heaters of a conventional rapid start fluorescent lamp , although conventional carbon - type or other types of resistors may be used . since in operation of insert 11 there normally would be a voltage drop across the two pins of each pair , the pins would require electrical isolation either by non - conductive end caps 13 , 14 or by respective insulators , not shown , in the end caps . a wire 19 coupled between the approximate linear centers of the two nichrome wire resistors 17 , 18 has an affect similar to the wire 7 described above to simulate the relatively low electrical resistance between the two cathode heaters of a conventional rapid start fluorescent lamp in which the arc has already been struck . as also mentioned above , some resistance may be added in the wire connection 19 . a modified rapid start fluorescent lamp insert is shown at 11 &# 39 ; in fig2 a , wherein primed referenced numerals designate parts that correspond to those shown in the fluorescent lamp insert 11 of fig2 . the modified insert 11 &# 39 ; includes a pair of elongated resistors 17 &# 39 ;, 18 &# 39 ;, which may be of nichrome wire or the like , each being of a resistance approximately equal to the resistance of the respective cathode heaters in a conventional rapid start fluorescent lamp . the two resistance wires 17 &# 39 ;, 18 &# 39 ; are joined , for example , by soldering , welding , or the like , approximately midway along the respective lengths as shown at 20 . resistance wires form a balanced bridged network by joining in the center such that the primary lamp current is allowed to seek its own path when flowing through the simulator to prevent its flow through the cathode heater windings in the ballast . also , if desired , an electrically non - conductive spacer 20a may be inserted within the tubular body 12 &# 39 ; to reduce vibrations in the wires 17 &# 39 ;, 18 &# 39 ; during shipment to avoid breakage of the wires and / or to facilitate electrical isolation between oppositely located respective halves of each of the resistive wires 17 &# 39 ;, 18 &# 39 ;. operation of the fluorescent lamp insert 11 or 11 &# 39 ; is similar to operation of the fluorescent lamp insert 1 described above . during operation of the fluorescent lamp insert 11 or 11 &# 39 ; the respective resistors 17 , 18 or 17 &# 39 ;, 18 &# 39 ; are , of course , coupled across the respective cathode heater energizing windings in the ballast circuit , as shown , for example , in fig5 so as to limit current flow through those windings to avoid their burning out . if desired , the wire 19 of the insert 11 , which may be bell wire , may be modified to include a resistive characteristic , for example , by substitution of nichrome wire in its place , as described above , and may be used with a time delay circuit briefly to break the connection of the wire 19 in the manner described above with reference to fig1 so as to simulate the relatively large starting impedance between the two cathode heaters of a conventional rapid start fluorescent lamp . another modified form of fluorescent lamp insert that was successfully tested is generally indicated at 11 &# 34 ; in fig2 b , wherein double primed referenced numerals are used to indicate elements that correspond to those shown in fig2 . in the fluorescent lamp insert 11 &# 34 ; a capacitor 19a , which is preferably a relatively large electrolytic capacitor , is coupled in the line 19 &# 34 ; between the two resistors 17 &# 34 ; and 18 &# 34 ;. to an extent the fluorescent lamp insert 11 &# 34 ; operates in a manner similar to the fluorescent lamp inserts 11 and 11 &# 39 ;, as described above ; however , during such operation the capacitor 19a has an affect on the power factor operation of the ballast circuit in which the rapid start fluorescent lamp insert 11 &# 34 ; is used , such as the ballast circuit shown in fig5 further to reduce energy consumption thereby and the light output of any remaining rapid start fluorescent lamp in the ballast circuit . although the fluorescent lamp insert 11 &# 34 ; was successfully tested , such insert has a number of disadvantages , and the more preferred forms of the invention are shown in fig1 and 2a . several of the drawbacks to using the insert 11 &# 34 ; including the capacitor 19a include the added expense of the capacitor , the undesirable heat generated in and emanating from the capacitor , a reduced light output level of any remaining fluorescent lamp coupled in the ballast circuit , possible detrimental affects on the remaining components of the ballast circuit , and a possible reduction in life of any such remaining fluorescent lamps . the tubular bodies 2 , 12 , 12 &# 39 ;, 12 &# 34 ;, of the respective fluorescent lamp inserts may be transparent or somewhat opaque and in the latter case preferably would exhibit an appearance similar to that of a de - energized fluorescent lamp , which is an advantage for the sake of appearance when the fluorescent lighting fixture for which it is used is often not energized . on the other hand , it has been found that the mentioned opaque tubular body will have a relatively dark appearance when located proximate a normally energized fluorescent lamp . therefore , for use , for example , in a normally energized plural lamp fluorescent lighting fixture it has been found more desirable to use a transparent tubular body insert for the sake of both appearance and maximum utilization of the reflective background of the lighting fixture . referring to fig3 a further fluorescent lamp insert of the instant start type is generally indicated at 21 . the fluorescent lamp insert 21 is similar to the insert 1 of fig1 and has a tubular body 22 , end terminations 23 , 24 , electrically conductive pins 25 , 26 , and an internal wire , not shown but connected in the manner of the wire 7 as shown in fig1 . on or in the tubular body 22 is a phosphorescent material , which may be applied over the entire length of the body or , as illustrated , may be selectively applied to indicate an emergency exit with a directing arrow , as is shown generally in fig3 at 27 . the fluorescent lamp insert 21 will operate in the same manner as the fluorescent lamp insert 1 described above ; however , in the event of a power failure , for example , eliminating all or substantially all of the light in a corridor , the phosphorescent indicator 27 will glow for a sufficient period of time to indicate the general direction that the corridor runs and to indicate the location of a most proximate exit . although the phosphorescent material 27 is shown in fig3 on an instant start type of fluorescent lamp insert , it , of course , may be used also with the rapid start fluorescent lamp inserts 11 , 11 &# 39 ;, 11 &# 34 ; as shown and described above with reference to fig2 a , 2b . in fig4 a series - sequence ballast circuit 30 , which receives ac line voltage at input terminals 31 , 32 , is effective to start two conventional instant start fluorescent lamps 33 , 34 in sequence a few thousandths of a second apart and then to operate the lamps in series . the conventional circuit 30 is shown and described on page 14 of an engineering bulletin 0 - 341 , issued by g t e sylvania inc ., endicott street , danvers , massachusetts . as described in the mentioned publication , the primary winding 35 , auxiliary winding 36 , and capacitor 37 cooperate to supply a high starting voltage initially to the lamp 33 , and before the lamp 33 lights , the auxiliary winding voltage subtracts from the primary voltage and the voltage of the secondary winding 38 so that there is insufficient voltage to start the lamp 34 . after the lamp 33 has lit , however , current flowing through the capacitor 37 shifts the phase relationship between the auxiliary and secondary windings 36 , 38 such that the voltages add and are sufficient to start the lamp 34 . after starting , the two lamps 33 , 34 are operated in series without any contribution by the auxiliary winding 36 . it should be clear that if one of the lamps 33 , 34 were removed from connection in the ballast circuit 30 , there could be no series energization of the remaining lamp without improper current flow through the ballast circuit 30 . however , by substituting the insert 1 of fig1 for example , for the fluorescent lamp 33 in the ballast circuit 30 of fig4 the low impedance characteristic of an energized fluorescent lamp is presented to the ballast circuit , and the remaining lamp 34 will be properly energized by the then properly operated ballast circuit . in fig5 a conventional series - sequence ballast circuit 40 , which receives ac line voltage at respective terminals 41 , 42 , is intended to energize a pair of rapid start fluorescent lamps 43 , 44 , each of which has a pair of cathode heaters 45 , 46 . the conventional ballast circuit 40 is also shown and described in the above - mentioned g t e sylvania engineering bulletin 0 - 341 . when the ballast circuit 40 is first turned on , the cathode heaters are heated at least in part by the transformer secondary heater windings 47 , 48 so as to reduce the starting voltage requirements of the lamps . approximately at the same time the capacitor 49 briefly causes nearly all of the ballast secondary voltage to be applied across the lamp 43 to start the same . after the lamp 43 is started , its resistance drops appreciably , and a large voltage is then available to start the lamp 44 ; and thereafter the lamps are operated in series in the conventional circuit 40 . moreover , for proper starting and safe operation of high output or very high output fluorescent lamps , conventional grounded strips 50 , 51 may be required proximate the respective lamps , and a grounding connection 52 may be necessary for the ballast circuit . in the event that one of the lamps 43 , 44 were removed from connection in the ballast circuit 40 , it would be clear that the ballast circuit then would not be balanced and would not operate in its designed conventional manner for energization of the remaining fluorescent lamps . however , by substituting a fluorescent lamp insert 11 , 11 &# 39 ;, or 11 &# 34 ;, for example , for the rapid start fluorescent lamp 43 in the ballast circuit 40 , a resistance always will be coupled across the respective heater windings 47 , 48 limiting current therein to preclude their otherwise burning out , and the low impedance characteristic of an energized fluorescent lamp will be reflected in the circuit to ensure proper starting of the remaining fluorescent lamp 44 , proper resistance across the heater windings 47 , 48 , and otherwise proper current flow through the various components of the ballast circuit 40 . it will , of course , be understood that the fluorescent lamp inserts of the invention may be used in a plural lamp fluorescent lighting fixture , which uses one or more plural lamp ballast circuits for energization of respective lamps , and the invention also may be used in conjunction with a plural lamp ballast circuit that is wired , for example , to effect energization of plural fluorescent lamps located , respectively , in separate fluorescent lighting fixtures , such as in a plurality of single lamp strip lights . also , while the invention has been described with reference to use in a two lamp ballast circuit , the fluorescent lamp inserts also may be used in ballast circuits that energize more than two lamps so as to increase the efficient use of such a ballast circuit when operated to energize less than the full complement of fluorescent lamps of which it is capable .

7Electricity

in one aspect , the present invention relates to self cleaning elbows for directing the flow of gases that may contain particulate matter . such self cleaning elbows can be used in ductwork associated with gasification reactors . plasma gasification reactors ( sometimes referred to as pgrs ) are a type of pyrolytic reactor known and used for treatment of any of a wide range of materials including , for example , scrap metal , hazardous waste , other municipal or industrial waste and landfill material , and vegetative waste or biomass to derive useful material , e . g ., metals , or a synthesis gas ( syngas ); or to vitrify undesirable waste for easier disposition . fig1 is an isometric view of an example of a gasification apparatus 10 including a plasma gasification reactor vessel 12 . the reactor vessel can be used to process various feed material to produce a gas that exits the roof of the reactor vessel . various gasification reactor designs are known in the art . one example of a plasma gasification reactor is described in us patent application publication us2012 / 0199795 , which is incorporated by reference herein . as shown in the example of fig1 , two ducts 14 , 16 , termed “ uptakes ”, are employed to exhaust syngas from a gasifier reactor vessel . elbows 18 , 20 receive gas from the uptakes and direct the gas in a generally downward direction to ducts 22 , 24 . the ducts direct the gas to processing equipment ( not shown ) that remove particulate material and other contaminants . fig2 is an isometric view of another example of a plasma gasification reactor vessel 30 having an uptake duct 32 connected to a self cleaning elbow 34 , which directs the gas in a duct 36 . fig1 and 2 are examples of plasma gasification reactors ( pgr ) that may be used for gasification and / or vitrification of various process materials . one manner of operating such a pgr is for gasifying feed material to produce a syngas from a feed material . the feed material may include , as examples , one or more of materials such as biomass , municipal solid waste ( msw ), coal , industrial waste , medical waste , hazardous waste , tires , or incinerator ash . a gasification process performed in gasification reactors can produce a syngas with a relatively high particulate loading ( e . g ., solids content potentially exceeding 1 , 000 kg / h ), which must be conveyed to downstream gas cleaning equipment for particulate matter ( pm ) and contaminant removal . elbows in the exhaust gas ductwork should be designed to operate at the pressures and temperatures of gases exiting gasification reactors , and to handle the particulate loading in gas supplied from the reactor , while minimizing particulate material build - up within the elbows . a schematic representation of a common elbow geometry employed to handle gas flows with high pm content is illustrated in fig3 . fig4 is a cross - sectional view of the elbow of fig3 taken along line 4 - 4 . the elbow of fig3 and 4 is termed a “ self - cleaning elbow ” and has been widely utilized in a number of applications , including the cement and smelting industries . fig3 shows an inlet duct 40 and an outlet duct 42 connected to a “ self - cleaning ” elbow 44 . the inlet and outlet ducts typically have a circular cross - section . the elbow includes a curved portion 46 having a generally rectangular cross - section , an input transition portion 48 and an outlet transition portion 50 . the transition portions couple the inlet and outlet ducts , which have a circular cross - sectional shape , to the curved portion , which has a rectangular cross - sectional shape . there are two key features to this geometry which reduce particulate material build - up within the elbow . first , the upper surface 52 of the elbow provides a sweeping curve which re - directs gas flow . the high velocity gas and pm flowing along the upper surface 52 effectively scours any particulate material build - up which may accumulate on this surface due to impaction , while the rectangular cross - section ensures uniform scouring of the entire surface ( a round cross - section may lead to channeling of pm and incomplete scouring of build - up ). second , a lower surface with a relatively sharp bend 54 presents very little horizontal surface on which particles can accumulate ( particles falling onto this surface will tend to fall by gravity into either the inlet duct 40 or the outlet duct 42 ). arrows 56 illustrate the flow of gas through the elbow . elbows having geometries as illustrated in fig3 and 4 have been widely employed in a number of applications . however , the elbow geometry of fig3 and 4 includes a curved portion having a rectangular cross - sectional shape , which is not effective at withstanding any significant pressure differential between the internal environment of a gasification reactor and the external ( ambient ) environment . it can be understood by those skilled in the art that the rectangular cross - section of the elbow of fig3 and 4 is not optimal for handling any significant pressure differential between the internal gas flow environment and the external environment . embodiments of the invention can have an overall geometry that is generally similar to the elbow of fig3 and 4 , but include features making the elbow suitable for use in the high pressure ductwork of gasifier systems . fig5 is a side view of a self cleaning elbow assembly 60 in accordance with an embodiment of the invention . fig5 shows an inlet duct 62 and an outlet duct 64 connected to a “ self - cleaning ” elbow 66 . the inlet and outlet ducts can have a circular cross - sectional shape . the elbow includes a curved portion 68 having a generally rectangular cross - sectional shape , an input transition portion 70 and an outlet transition portion 72 . the transition portions couple the circular cross - section inlet and outlet ducts to the rectangular cross - section curved portion . the elbow of fig5 includes elements that structurally reinforce the elbow to allow the elbow to withstand a range of pressure loads , caused by a differential pressure between the internal and external environments . a plurality of stiffeners 74 are positioned adjacent to an external surface 76 of the curved portion 68 to provide structural reinforcement for pressure loadings . the stiffeners extend across the outer surface 78 of the curved portion of the elbow , and also extend along the generally flat sides of the curved portion of the elbow . only one of the generally flat sides 80 is shown in fig5 , but it will be understood that a second generally flat side exists on the elbow opposite generally flat side 80 . additional stiffeners 82 are positioned adjacent to generally flat sides 84 of the transition portions 70 , 74 . sight glasses 86 are provided to allow visual inspection of the interior of the elbow . as more fully described below , the stiffeners can be constructed to provide the desired mechanical strength , and also to reduce the possibility of hot or cold spots occurring along the walls of the elbow . in some embodiments , the structural reinforcement of the self - cleaning elbow can allow the elbow to withstand internal design pressures ranging from about − 34 . 5 kpag to about 50 kpag . in other embodiments , the structural reinforcement of the self - cleaning elbow can allow the elbow to operate in combination with a pressurized reactor that would operate at 300 kpag or more . the bottom wall of the curved portion of the elbow has a radius in a crotch area 88 to reduce stress in this region . this differs from the sharp bend 54 in the elbow of fig3 . the refractory layer ( 96 in fig6 ) is shaped internally at the crotch to achieve the desired internal dimensions for self cleaning . stiffeners are used to minimize the required thickness of the duct . the stiffener arrangement in the crotch region is configured to support the elbow , but not over - stiffen it . if the walls of the elbow are too rigid high thermal stresses will result . the stiffener design can be more robust than what is required for shell strength due to pressure . this is because of the internal refractory which may fail if the shell deflects too much . thickness of insulation around the duct stiffeners can be selected to minimize deflections and achieve the desired shell and stiffener temperatures . fig6 is a cross - sectional view of a portion of the elbow of fig5 . in the embodiment of fig6 , the wall 90 of the curved portion of the self - cleaning elbow of fig5 is shown to include a metal shell 92 , an insulation layer 94 , and a refractory layer 96 . also shown are the internal gas flow environment 98 and the external ( ambient ) environment 100 . the metal shell can be , for example , steel ; the insulating layer can be , for example , ceramic fiber blanket or semi - rigid board ; and the refractory layer can be , for example , a low iron insulating castable refractory or a high alumina castable refractory . the refractory layer provides abrasion resistance and structural strength in the lining while the insulating layer ensures that the shell temperature is kept below its design limit . the thickness and material of the insulation layer 94 and the refractory layer 96 can be selected to maintain the steel shell 92 temperature within design limits ( e . g ., between 120 ° c . and 350 ° c .) under all expected process conditions when the elbow is used in ductwork connected to gasification reactor ( based on the thermal and corrosion protection requirements ). fig6 illustrates a typical stiffener arrangement , which includes a steel stiffener 102 fixed to the steel shell 92 , as well as stiffener insulation 104 . the stiffener 102 provides structural strength to the elbow in order to withstand the loading caused by the pressure differential between the internal environment 98 and the external environment 100 . in the example of fig6 , the stiffener 102 includes a metallic component with an elongated first portion 106 having a generally rectangular cross - sectional shape , and a second portion 108 having a generally rectangular cross - sectional shape . the second portion is positioned adjacent to a first end 110 of the first portion and is substantially perpendicular to the first portion . the first and second portions of the stiffener together form a stiffener having a substantially t - shaped cross - section . a second end 112 of the first portion of the stiffener is positioned adjacent to the outer surface 78 of the curved portion of the elbow . the stiffener can be attached to the outer surface 78 of the elbow , for example , by a weld . caulking material 114 can be included to prevent moisture from contacting the steel component . there are two features of the stiffener arrangement which are employed to limit temperature differentials in the elbow assembly , in order to mitigate any issues associated with thermal expansion and contraction . first , the insulation 104 on the steel stiffener 102 is employed to prevent excessive heat dissipation to the external environment through the stiffener , which could result in a localized cool spot where the steel stiffener 102 is fixed to the steel shell 92 . second , the thickness of the insulation 104 is tapered in the area 116 near the connection point between the steel stiffener 102 and the steel shell 92 . this prevents over - insulation of the steel shell 92 near the area 118 , which could result in a localized hot spot . both of these measures reduce temperature gradients that could lead to unacceptable thermal expansion and / or contraction of the assembly . in the example of fig6 , the insulation is secured to the steel components using a plurality of pins 120 . in one embodiment , the insulation material is pushed through the pins and then clips are attached to the end of the pins to hold the insulation in place . a cladding material 122 can be positioned on the external surfaces of the thermal insulation . the cladding material protects the insulation from degradation . the insulation on the stiffener is intended to keep the temperature of the stiffener uniform and as similar to the shell as possible . if the shell is hot and the stiffener &# 39 ; s outer extremity is cold , the shell will tend to bow inwards which could damage the refractory layer . in the embodiment of fig6 , the insulation completely surrounds the metal bar in the stiffener . the stiffener is preferably welded to the shell to add the appropriate stiffness to the shell . in other embodiments , it may be possible to bolt the stiffener to the shell . a bolted connection may require some form of rigid insulation between the stiffener and the shell and sliding joints for the thermal expansion differences , but this might potentially avoid having to insulate the stiffener . the angle of taper of the insulation can be , for example , about 45 °. tapering the insulation to a point adjacent to the shell of the elbow avoids extra insulation adjacent to the shell and consequently avoids overheating of the shell in the region of the stiffeners . a balance needs to be struck between preventing the stiffener from acting like a fin and over insulating the region . as shown in fig5 , stiffeners similar to that shown in fig6 can also be positioned adjacent to generally flat surfaces of the transition portions of the elbow . these stiffeners can have the same construction as the stiffener illustrated in fig6 . in one embodiment , these stiffeners are oriented perpendicular to the flat surfaces that are exposed to pressure . various design objectives have been established in order to accommodate the significant process variations ( e . g . gas flow rate , gas temperature , and gas contaminant levels ) that may occur during operation of elbows coupled to msw gasifiers . for example , the self - cleaning elbows employed in the ductwork for gasifier systems can be designed to meet several design elements including gas flow geometry ; thermal and corrosion protection ; and structural reinforcement for pressure loadings . for thermal and corrosion protection , in some embodiments such as where the elbow is used in an outlet duct of a gasification reactor , it is desirable to limit the maximum design temperature of steel elbow shell and steel stiffeners to 350 ° c ., since temperatures above this limit may result in an unacceptable reduction in steel strength , as dictated by pressure vessel design codes . in addition , it may be desirable to limit the minimum design temperature of steel elbow shell to 120 ° c ., since temperatures below this limit may result in condensation of chemical species such as h 2 s on the steel shell , with a resultant risk of corrosion . corrosion by contaminants within the gas stream ( e . g ., primarily hydrogen sulfide ( h 2 s )), may occur when the temperature of metallic surfaces ( e . g . the steel shell of the elbow ) drops below a specified temperature . it may also be desirable to limit temperature differentials across the steel elbow shell and steel stiffeners in order to minimize differential thermal expansion and contraction , which may compromise the structural integrity of the assembly . various embodiments can also be designed to withstand a maximum internal gas temperature of 1 , 300 ° c ., in conjunction with a minimum exterior ( ambient ) temperature of 32 ° c . embodiments of the elbow may be suitable for use in gas handling applications involving a significant pressure differential between the internal gas flow environment and the ambient environment , and gas handling applications with significant variability in gas temperature and gas contaminant levels ( which present technical challenges related to corrosion protection and management of thermal expansion and contraction ). while particular aspects of the invention have been described above for purposes of illustration , it will be evident to those skilled in the art that numerous variations of the details of the disclosed embodiment may be made without departing from the invention as defined in the appended claims .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

the present invention now will be described more fully hereinafter with reference to the accompanying drawings , in which some , but not all embodiments of the inventions are shown . indeed , these inventions may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will satisfy applicable legal requirements . like numbers refer to like elements throughout . the present invention is a process and system which uses the forward shared channel of the prior art , such as , but not limited to , fig1 to provide high speed packet data services for multiple mss with a controlled qos . the invention controls ( 1 ) the selection of which ms is to receive a next transmission on the forward shared channel and ( 2 ) which mcs method is to be used to maintain or improve qos in the transmissions to the ms . the fulfillment of a qos requirement for each ms and optimal radio resource management are important functions provided by the bts by the present invention . the invention uses ms measurement feedback and selection of a mcs from a group of selectable msc to achieve the above performance benefits . fig2 illustrates a flow chart of the process steps for scheduling of the next ms to receive a transmission of data packets on the shared forward channel and mcs selection from a selectable group of mcss by the bts which are performed by at least one processor in each of the bts and in each ms ( not illustrated ). at point 100 , the bts receives the quality indication described below from the ms that has just received the transmission of data packets on the forward shared channel . the quality indication includes the ratio of pilot channel to the interference from other cells , ( e . g . ec / nt ) and the throughput trigger or fer trigger as described below with reference to fig3 which is used to select the mcs to be used to make a packet data transmission on the forward channel from a group of selectable mcss . at point 102 , the bts schedules the next transmission slot of each forward shared channel for which multiple mss contend . scheduling is based on the qos requirement of each ms user . once a particular ms has been scheduled for the next transmission slot at point 104 , the bs selects the optimal mcs to fulfill the required qos . at point 106 , the bts updates the dynamic statistics of average throughput , fer and delay for the ms for the next process cycle as described below with reference to fig5 . the invention provides for forward shared channel allocation and qos management by : all three points 100 , 102 and 104 are part of the processes of the invention and the first point 100 is also related to 1xev - dv standardization . hereinafter , the processes represented by the points 100 , 102 and 104 are discussed respectively with reference to fig2 , 3 and 4 . in order for the bts to dynamically resolve the trade - off between the calculated throughput metric and fer metric used to generate a throughput or fer trigger described below with reference to fig3 , at least one processor of the bts relies on ms feedback on a reverse channel which may without limitation be the r - qiech or r - cqich for the decision process . throughput measured above the tcp layer is the preferred source of the throughput measurement but the invention is not limited thereto . the ms , sitting at the end point of the communication link , has a clear understanding of the current throughput and fer trade - off based on the application requirement and the buffer limitations of the ms which are used to generate a throughput or fer trigger depending upon the determined performance seen by the ms in the last transmissions ( s ) thereto . alternatively , the mobile station also can use the physical layer or application layer frame error rate to generate the quality indication including the fer trigger when fer triggering is used to select mcs based upon fer . this quality indication can be bundled inside the reverse quality indication echo channel ( r - qiech ) sdu or passed by the l3 layer signalling standard and preferably includes either a throughput or fer trigger and ec / nt as described below . but the approach using l3 signalling is less attractive due to the timing consideration . at least one processor in the ms performs the “ metric contention process ” as shown in fig3 . the requested (“ req ”) qos parameters are negotiated through is - 707a standard for 1x - ev - dv systems . the corresponding qos average values (“ m_avg ”) are the statistical averages updated inside the ms as indicated at point 200 and defined as follows : the throughput metrics , namely metric ( r ) and metric ( fer ) are computed based on the negotiated qos parameters and ms internal statistics . these metrics represent the present deficiency of throughput and fer and are compared with deficiency thresholds (“ th ”) as indicated at decision points 202 - 208 . the deficiency thresholds are configurable parameters based on the application . if the deficiency exceeds the deficiency threshold th , the deficiency indicates that at the bts an effort is required to compensate for that deficiency . as shown in fig3 , the four decision points 202 , 204 , 206 and 208 each use two metrics ( metric ( r ) and metric ( fer )) and two thresholds ( th ( r ) and ( th ( fer )) in the decision process to generate the throughput trigger 212 or fer trigger 214 depending on whether mcs selection is to be based upon throughput or fer considerations . an extra decision point 210 “ error sensitivity ” of the application / user in question is used to resolve any deadlock contention between throughput and fer trigger determination which drives the decision to be based upon a fer trigger if such is important to the user . this factor is explicitly indicated from the application layer or implicitly derived / mapped by the lower layer at the ms . finally , the trigger ( either throughput trigger 212 or fer trigger 214 ) is derived from the metric contention process . the trigger ( either 212 or 214 ) then is transmitted in the r - qiech sdu together with the pilot strength ec / nt . the bts decodes these fields at point 100 and uses these fields as inputs for the optimal mcs decision process ( inputs 510 and 512 shown in fig5 ) to complete the mcs selection as described below . “ best - effort ” high - speed packet data services over cdma wireless radio channels have been developed using 1x - ev - do technology . a forward link “ best effort ” scheduler was also proposed in the publication cited above . in that publication , only throughput ( data rate ) was taken into account when the bts schedules multiple mss to transmit on the forward shared channel . in other words , the requested and average throughputs are translated into the priority of transmission . the “ assured mode ”, as defined in is - 707a / is - 2000 , for packet data services that require restrictive qos is not addressed in the publication cited above . the invention improves scheduling when compared to the publication cited above . as shown in fig4 , a scheduler is implemented in at least one processor of the bts . the scheduler takes into account user priority and qos requirement parameters , including throughput , frame error rate ( fer ), and delay as indicated at block 400 . the requested values ( req ) and the present average values ( avg ) of qos parameters are considered in the “ scheduling metric ”, schdl ( i ). k ( i ) ( e . g . k1 , k2 and k3 )= normalization factors configurable at the base station and pri = requested priority subscription priority which is saved as part of the user profile . subscription priority is saved as part of the user profile . for “ assured mode ” services , all requested (“ req ”) qos parameters are negotiated through the is - 707a standard for 1x - ev - dv systems . all the corresponding qos average values (“ avg ”) are the statistical averages over a long period of time and are updated after each transmission period . the average process of point 106 is described below with reference to fig6 . “ pri ” is the requested priority multiplied with the subscription priority that are defined in is - 707a . the scheduling is done based on the “ scheduling metric ”, schdl ( i ) of fig4 . at least one processor of the bts schedules the next transmission slot of the forward shared channel for the ms that has the highest schdl ( i ) value as indicated at block 402 . once the bts has completed scheduling for the next transmission period , the msc for the scheduled ms is performed in the processing at point 104 . the process that the bts performs without limitation to select a mcs method is the “ optimal mcs decision process ” shown in fig5 . the bts receives the forward channel quality indication from the reverse quality indication echo channel ( r - qiech or r - cqich ) for each transmission duration at point 500 . based on the quality indication ( ec / nt ), the bts looks up information used to select the msc as a function of fer and throughput which may be without limitation stored in two internal tables indicated at points 502 and 504 : table 1 -“ fer vs . ec / nt table ” and table 2 -“ throughput vs . ec / nt table ”. each table look - up generates a set of possible mcs selections to be used to control transmission of data packets from the bts to multiple mss . next , based on the trigger ( either throughput trigger 212 or fer trigger 214 ) obtained from the reverse channel , such as r - qeich or r - cqich , the bts determines which mcs set from table 1 or table 2 , or from any storage containing the msc selection information as a function of fer , throughput and ec / nt , should be dominating as indicated as selection points 506 and 508 which are responsive respectively to the input throughput trigger 212 at point 510 and the input fer trigger 214 at point 512 . only one selection occurs at a time based upon either the throughput trigger 212 or the fer trigger 214 . when the throughput trigger is indicated , the optimal mcs is selected from the throughput mcs set ( i . e . mcs ( r )), as indicated at block 516 . if the fer trigger is indicated , the optimal mcs is selected from the fer msc set ( i . e . mcs ( fer )) as indicated at block 514 . note that the selection is “ optimal ” because the mcs with lowest fer or with the highest throughput is selected . also note that tables 1 and 2 or other equivalent storage are configurable at the bts . an example explaining the optimal mcs decision process is as follows : after obtaining ec / nt , the bts looks up table 1 and identifies n possible mcs selections and n corresponding fer values , mcs ( fer ) n and fer ( current ) n , where n = 1 . . . n and looks up table 2 and identifies m possible mcs selections with m corresponding throughput values , mcs ( r ) m and r ( current ) m , where m = 1 . . . m . if trigger fer is indicated , the mcs ( fer ) with the lowest fer is selected . if throughput trigger is indicated , the mcs ( r ) m with highest throughput is selected . the corresponding fer value from table 1 becomes fer ( current ), and the corresponding throughput value from table 2 becomes r ( current ). fer ( current ) and r ( current ) are the instantaneous fer and throughput for the next transmission . if throughput trigger is indicated , the msc ( r ) m with highest throughput is selected . these values are also used to update the averages at point 106 discussed below with reference to fig6 . point 106 : updating average of throughput , fer , and delay after each transmission , the bts updates the average of throughput , fer , and delay as indicated at block 600 of fig6 . these average values are used for the next cycle of scheduling of a mcs process as indicated at block 602 . the averaging process is a low - pass process of instantaneous values over a time period , tconst , longer than the transmission duration , e . g . ( n * 5 ) ms , where n is configurable in the bts . this process is similar to the process of the publication cited above . the averaging process shown in fig6 is also expressed as : the actual scheduling of a particular ms is based upon the calculation by at least one processor in the bts of the quantity schdl ( i ) of fig4 with the forward channel transmission slot being assigned to the ms meeting a scheduling criteria which is preferably the ms having the highest calculated value of schdl ( i ) as indicated at block 402 . the scheduling may be based on and may be a function of at least two of the parameters of the throughput of the data packets , frame error rate of the data packets , delay of the data packets and subscriber priority of block 400 with the scheduling being a function of all four parameters being preferred . while the invention has been described in terms of its preferred embodiments , it should be understood that numerous modifications thereto may be made without departing from the spirit and scope of the appended claims . it is intended that all such modifications fall within the scope of the appended claims .

7Electricity

in fig1 and 2 a drawout switchgear is generally at 11 and it comprises a circuit interrupter or circuit breaker 13 , a cell 15 , and a levering - in mechanism generally indicated at 17 . the circuit breaker 13 is similar in construction and operation to that disclosed in u . s . pat . no . 4 , 139 , 748 . the circuit breaker 13 is contained in a molded housing compound of high - strength phenolic resin reinforced with glass fiber . as shown in fig2 terminals 19 , 21 extend from the rear wall of the housing . similar terminal connectors 23 , 25 are mounted on the terminals 19 , 21 , respectively . in the disconnected position ( fig2 ) of the circuit breaker the terminal connectors 23 , 25 are shown in alignment with stationary terminals 27 , 29 which extend through a rear wall 30 . when the circuit breaker 13 is in the connected or closed condition ( fig3 ), the terminal connectors 23 , 25 are in electrical engagement with the stationary line and load terminals 27 , 29 . as shown in fig1 a pair of similar brackets is mounted on the circuit breaker 13 , one on each side , by similar flanges 33 . similar wheels or rollers 35 ( fig1 and 2 ) are mounted on similar axles or pins 37 extending from the brackets 31 . the cell 15 comprises opposite side walls 39 ( fig1 ), a back wall 43 , and a front opening 45 ( fig2 ). a door or cover 47 ( fig3 ) closes the front opening 45 when the switchgear is in operation . frame members 49 , 51 are mounted on opposite sides of the cell 15 for supporting the circuit breaker 13 . a pair of tracks 53 , 55 are provided , one on each side of the circuit breaker 13 , for supporting the wheels 35 . a hold - down flange 57 , 59 is provided above each track 53 , 55 for holding the wheels 35 in place on the tracks . the levering - in mechanism 17 comprises an operating shaft 61 and camming means including a pair of cams 63 , 65 mounted on opposite ends of a cam shaft 67 . the operating shaft 61 is journally - mounted in spaced bearings 69 , 71 . the right end of the shaft 61 includes a threaded portion 73 with a stop block 75 on the end thereof . a nut 77 ( fig2 ) has a guide pin 79 and is mounted on the threaded portion 73 . the cam 63 is mounted on the shaft 67 in bearing blocks 81 ( one of which is shown in fig1 ) at opposite ends thereof which blocks extend from the frames 49 , 51 . the second cam 65 ( fig1 ) is mounted on the end of the cam shaft 67 opposite the cam 63 . the cams 63 , 65 are registered to function simultaneously for moving the circuit breaker 13 between disconnected and connected positions of the terminal connectors 23 , 25 and the stationary terminals 27 , 29 . for that purpose the lower end of the cam 63 has a slot 83 in which the pin 79 is disposed . as the nut 77 moves along the threaded portion 73 of the operating shaft 61 , the pin moves between the positions shown in fig2 and 3 corresponding to the disconnected and connected ( or closed ) positions of the terminals . the upper end of the cam 63 also comprises a slot 85 which engages a bushing 87 on the pin 37 for moving the circuit breaker 13 between the connected and disconnected positions . the cam 65 on the opposite end of the cam shaft 67 has a slot similar to slot 85 on the cam 63 for engaging a bearing 91 . it has been found in accordance with this invention that drawout switchgear structures of prior constructions , such as shown in u . s . pat . no . 4 , 139 , 748 , involve a time - consuming problem of inserting cam shafts in place and that a solution was required . for that reason the cam shaft 67 ( fig4 and 5 ) include at least one and preferably two telescopic portions by which the length of the shaft is shortened for preliminary insertion into position during assembly . thereafter , the telescopic portions are extended and secured in place in a final assembly . axles 93 , 95 are telescopically seated in similar bores 97 at opposite ends of the cam shaft 67 . as shown more particularly for the axle 93 ( fig5 ), each axle includes a flange 99 and in the retracted position is completely seated up to the flange within the bore 97 with the end wall aligned with an access hole 101 . when the outer end of the axle 93 is aligned with a hole 103 in the bearing block 81 , an instrument , such as a screwdriver 105 , is inserted into the hole 101 to move the axle 93 to the left ( fig5 ), as indicated by the broken line 93a , thereby moving the left end of the axle into the hole 103 , until the flange 99 engages the wall of the bearing block 81 . in a similar manner the axle 95 ( fig4 ) is moved into the bearing block corresponding to the block 81 on the right side of the cell . the axles are secured in place by tightening set screws 107 , 109 . the movement of the axles in the ends does not have any influence on the cams being registered since they are both welded to the shaft . in another embodiment of the invention a single telescopic structure may be used whereby , for example , only one end position or a central segment of the cam shaft 67 may be telescopically seated within central bore to enable relative movement of separate portions of the cam shaft . such an embodiment is indicated at 111 in fig4 . subsequently , the cams 63 , 65 are indexed . in conclusion , the device of this invention provides for a simplified means for installing the assembly of the cams and cam shaft in place in a minimum of time during assembly of drawout switchgear .

7Electricity

referring therefore to fig1 , a pair of correspondents 10 , 12 communicate over a transmission link 16 . each of the correspondents 10 , 12 includes a cryptographic engine 18 , 20 respectively that may receive information from the correspondent and perform cryptographic operations on it before transmission over the transmission line 16 . similarly , messages received over the transmission line 16 may be processed by the cryptographic unit 18 , 20 to provide information to the recipient . although it will be appreciated that the cryptographic units 18 , 20 are similar and that each can function with its respective correspondent as a recipient or a sender , it will be assumed for the purpose of the following description that the correspondent 10 is the sender of a message and that its cryptographic unit 18 acts to encode the information for transmission and that the correspondent 12 is the recipient of the information and the cryptographic unit 20 acts to process information that is received . referring therefore to fig2 , cryptographic unit 18 includes an input 22 of a message to be forwarded to the recipient 12 . the format of the message may be seen in fig4 and includes a packet header 24 and a payload 26 consisting of the message m . the packet header 24 has packet control information 28 and a plurality of addressing fields including the destination address 30 , in this case , the destination of the correspondent 12 , and the source address 32 , in this case the address of the correspondent 10 . the header 24 is to be transmitted over the link 16 as plain text whereas the payload 26 is to be transmitted in a secure manner . the enciphering of the message m is performed by an encryption module 34 that may implement a suitable encryption algorithm . in the present example , a block cipher mode of operation is performed preferably implementing a block cipher mode compatible with ccm . the encryption module 34 requires as inputs a nonce 36 and a key 38 . as a further input , selected information , a , contained in the header may be forwarded to the encryption module 34 to provide a degree of authentication . the output from the encryption module 34 is encrypted data ‘ c .’ in order to derive a key at input 38 , key information is supplied over line 44 permitting to a key to be derived from for example the addressing information of the sending party and the recipient or by other previously agreed upon means . in order to provide a unique value to the nonce 36 , a frame counter 46 is provided and is not permitted to be reused within the context of utilising the same key input . an input signal indicating the desired protection level is also provided at 48 and is used to indicate whether confidentiality is required and whether authenticity is required and at what level . the encoding of the input signal 48 is shown in fig7 and provides an unambiguous indication of the nature of the security level required . as seen in fig7 , the protection level sec provides eight possible options , as represented by the hexadecimal codes . this enables lower most bits of the code to represent uniquely and unambiguously the different combination . moreover , the combinations are ordered so that those with a 1xx indicate the encryption is turned on and those 0xx have the encryption turned off to further facilitate recognition of the coding . the key information 44 , frame counter 46 and protection level 48 are provided to a buffer 50 where they are concatenated to provide a security information output . the protection level of signal 48 is also fed to a encoding module 52 that determines the authentication tag length and provides an input signal m indicating the length of the authentication tag to be appended to the message and included in the ciphertext ‘ c ’. again , as may be seen from fig7 , each of the possible tag lengths , in this case 0 , 4 , 8 or 16 bytes , is provided with a corresponding m value that may be represented as a combination of three bits . the values are provided to the encryption module 34 for inclusion in the data string to be enciphered . a greater range of values may be used with additional bits provided in the field as appropriate . the outputs of the header , encrypted data 42 and security information from the buffer 50 are assembled at a database and transmitted over the communication line 16 . the format of the resultant transmission may be seen from fig5 and comprises the packet header 24 and addressing fields 30 , 32 corresponding to the plain text header and the security information formed from the concatenation of the frame counter , key identifier information and the protection level indication , that is output of the buffer 50 . the output of the encryption module 34 appears as the payload 42 and includes the cipher text of the message m and the encrypted authentication tag u obtained from the authentication data , a . upon receipt of the cipher text at the cryptographic unit 20 of correspondent 12 , the process is reversed as shown in fig3 . the header is processed to remove the associated data and provide an input to the encryption module 34 a . the nonce is reconstructed by the construction module 36 a from the information in the plaintext header and the information derived from the security information . the security information is processed through buffer 50 a which extracts the frame counter and derives the protection level included in the security information header . from the protection level , the tag length m is derived at module 52 a and provided as an input to the encryption module 34 a . the encryption module 34 a may then perform the decryption and extract the plaintext of the message m . as noted above , the input to the encryption module 34 includes the key , the nonce 36 , and the message m to be encrypted and additional authentication data a . the binary string representing the tag length m is also provided as an input . the first step of the encryption module is to compute an authentication field t . in the case of a block cipher implementing the ccm protocol , this is done using the cbc - mac mechanism and truncating the output to the appropriate size . to perform this operation , a series of blocks b o , b 1 , . . . b n are defined and the cbc - mac operation applied to these blocks . the first block b 0 is formatted as shown in fig8 and has a first octet to contain a set of flags followed by nonce 36 , a security field indication of the form indicated in fig7 and an indication of the length of the message m . the flag field is itself formatted as shown in fig9 and includes a first field set of bits l that indicate the number of octets in the length field of the message and the authentication length m , i . e , number of octets in the authentication field , corresponding to the tag length derived from the module 52 . a further bit indicated as the a data is used to indicate whether or not authentication is included in the operation . where authentication data is included , the blocks encoding the authentication a data are formed by right concatenating the octet string that encodes 1 ( a ) with a itself and splitting the result into 16 octet blocks . the last block may be right padded with zeros if necessary . these blocks are appended to the first block b 0 . after the additional authentication blocks , if any , have been added to the first block b 0 , the message blocks are right concatenated . the message blocks are formed by splitting the message into 16 octet blocks , right padding the last block with zeros if necessary . if the message m is an empty string , then no blocks are added in this step . as a result , a sequence of 16 octet blocks b 0 , b 1 . . . b n is prepared . x i + 1 := e ( k , x i ⊕ b i ) for i = 1 , . . . , n , where e ( ) is the block cipher function to provide a 16 octet string . an authentication tag t is obtained by truncating the 16 octet string to the left most m octets as indicated in the tag length output from the function 52 . to encrypt the message data , the ctr mode is used and the key stream blocks are defined by s i = e ( k , a i ) for i = 0 , 1 , 2 . . . . the encryption blocks a i are formatted as shown in fig1 with the sec field being formatted as indicated in fig8 . the flag field as shown in fig1 includes a 3 bit representation of the length l of the message . the bits 3 , 4 , and 5 are each set to 0 . the encrypted message is then prepared by xoring the octets of the message m in order , with the left most octets of the right concatenation of s 1 , s 2 , s 3 . the key block s 0 is not used to encrypt the message but is used to encrypt the authentication field t previously obtained . the encrypted authentication value u results from xoring the octets of the authentication field t with the left most m octets of the key stream block s 0 and is appended to the encrypted message as part of the enciphered payload c . upon receipt of the encrypted message , the encryption key k , the nonce 36 , the additional authenticated data , a , and the encrypted message c is obtained and decryption starts by recomputing the key stream to recover the message m and the authentication field t . the message and additional authentication data a is then used to recompute the cbc - mac value and check t . if the t value is not correct , the message is rejected without revealing further information . the above format of data permits the encryption module to be used without authenticating data . this is simply achieved by setting the flag bit adata in the authentication block shown in fig9 at 0 to indicate the absence of any authentication data . a bit value of 1 is indicative of the presence of authentication data . a corresponding value of m indicative of no authentication data is also generated and included in the data to be enciphered . the provision of the protection level encoding and the inclusion of the tag length m within the message generation also permits variable length authentication tags to be utilised within the ccm block cipher mode . as indicated in fig7 , the encoding of the protection level not only indicates the nature of the protection , i . e . authentication with or without encryption but also may be used to uniquely identify the tag length associated with the authentication data . accordingly , as part of the authentication process , the desired tag length can be verified and messages rejected if they are not compliant . although the invention has been described with reference to certain specific embodiments , various modifications thereof will be apparent to those skilled in the art without departing from the spirit and scope of the invention as outlined in the claims appended hereto . the entire disclosures of all references recited above are incorporated herein by reference .

7Electricity

hereinafter , preferred embodiments of the present invention will be explained in detail by referring to the drawings . the same reference characters are assigned to the same component elements and the description thereof will be omitted . fig1 is a diagram for explanation of the first embodiment of the present invention . referring to fig1 , a basic configuration and an operation of an euv light source apparatus according to the embodiment will be explained . the euv light source apparatus shown in fig1 employs a laser produced plasma ( lpp ) system for generating euv light by applying a laser beam to a target material for excitation . as shown in fig1 , the euv light source apparatus includes a chamber 8 in which euv light is generated , a target supply unit 7 for supplying a target 1 to a predetermined position within the chamber 8 , a driver laser 5 for generating an excitation laser beam 2 to be applied to the target 1 , a laser beam focusing optics 6 for collecting the excitation laser beam 2 generated by the driver laser 5 , and a collector mirror 10 for collecting euv light 4 emitted from plasma 3 generated when the excitation laser beam 2 is applied to the target 1 and outputting the euv light 4 . in the euv light source apparatus , for example , a metal (( liquid - state or solid - state tin ( sn )) is used as the target 1 , and a carbon dioxide ( co 2 ) laser that can generate light having a relatively long wavelength is used as the driver laser 5 . tin is used as the target 1 because it has a high conversion efficiency from laser beam energy to euv light energy . when a carbon dioxide laser is applied to the tin target , the conversion efficiency is about 2 % to 4 %. on the other hand , when another material , for example , xenon ( xe ) is used as the target 1 , the conversion efficiency is about 1 %. as a form of the target , jet or droplets of melted tin or tin - coated wire or rotary disk is used . as below , the case where the carbon dioxide laser is applied to the tin target will be explained as an example . however , in the present invention , the kinds of target materials and laser light sources are not limited to these and various kinds of target materials and laser light sources may be used . the laser beam focusing optics 6 includes at least one lens and / or at least one mirror . the laser beam focusing optics 6 may be located inside the vacuum chamber 8 as shown in fig1 , or outside the vacuum chamber 8 . the collector mirror 10 is a collection optics for collecting light by selectively reflecting a predetermined wavelength component ( e . g ., euv light near 13 . 5 nm ) of the various wavelength components emitted from the plasma 3 . the collector mirror 10 has a concave reflecting surface , and a multilayer film of molybdenum ( mo ) and silicon ( si ) for selectively reflecting euv light having a wavelength component near 13 . 5 nm is formed on the reflecting surface . furthermore , details of the euv light source apparatus according to the first embodiment of the present invention will be explained . regarding the target 1 , the melted tin is processed into droplets to be a droplet target 1 a , and outputted from a nozzle of the target supply unit 7 . in droplet generation by the continuous jet method typically used , for example , when droplets of about 20 μm in diameter are outputted , the droplets are generated at several tens of megahertz . by culling the droplets in the target supply unit , a droplet line at 100 khz is outputted from the nozzle . the initial speed when the droplets are outputted is about 100 m / sec , for example . when the carbon dioxide laser beam having a repetition frequency of 100 khz , energy of several tens of millijoule , a pulse width of several tens of nanoseconds is collected and applied to the droplet line , plasma is generated . in this regard , the laser beam and the target output are synchronously controlled by a synchronous control device ( not shown ) so that one - pulse laser beam is applied for one droplet . the light having a wavelength of 13 . 5 nm of the emitted light emitted from the plasma is collected by the collector mirror and projected onto an exposure unit . the space in which the plasma is generated is isolated from the air and the degree of vacuum of several pascal or less is maintained by a turbo molecular pump ( tmp ). such a degree of vacuum is maintained for preventing the absorption of euv light by the residual gas and effectively using the influence and effect of a magnetic field , which will be explained later . that is , if the gas pressure within the chamber is high , the mean free path is short and the time period , in which charged particles move without collision while receiving the influence of the magnetic field , is short , and thereby , the deflection effect or focusing effect on the charged particles due to the influence of magnetic field becomes weak . a static magnetic field is applied into the chamber by a magnetic generating unit including an electromagnet or the like . in the embodiment , for example , coils 15 and 16 are provided above and under the plasma generation space of the chamber 8 , respectively , and a mirror magnetic field is formed by these coils . further , a charging unit 17 for charging neutral particles in the magnetic field is provided in the chamber 8 . as the charging unit 17 , an electron beam unit may be used , or a high - frequency wave unit or microwave unit may be used . as the microwave unit , an electron cyclotron resonance ( ecr ) unit may be used . when plasma is generated , debris containing fast ions , neutral particles , and residual droplets are generated following the plasma generation . the fast ions are deflected by the mirror magnetic field generated within the chamber 8 and move toward the upper part and lower part of the chamber 8 . among the ions , the fast ions moving toward the upper part of the chamber 8 are focused near the nozzle of the target supply unit 7 , collide with the tin vapor injected from the nozzle of the target supply unit 7 , the fast ions , and / or neutral particles generated by the collision of the fast ions , and lose energy and charge and become neutral particles . on the other hand , the fast ions moving toward the lower part of the chamber 8 are focused toward the central axis of the mirror magnetic field , collide with the fast ions and neutral particles generated by the collision of the fast ions , and lose energy and charge and become neutral particles . the neutral particles existing in the lower part of the chamber are charged by the charging unit 17 again , and further guided to the lower part of the chamber 8 by the influence of the magnetic field . here , experiments by the inventors have confirmed that many of the particles generated from plasma generated by the combination of the carbon dioxide laser and the tin target are neutral nanoparticles having diameters of several to several tens of nanometers . the target material has an initial speed of about 100 m / sec and has initial momentum . accordingly , the generated nanoparticles similarly hold the initial momentum . the generated nanoparticles are focused toward the central axis in the downward direction of the chamber because of the initial output momentum and the deflection and focusing effect of the magnetic field while diffusing due to pressure at plasma generation . the residual droplets are relatively large particles having diameters of several micrometers or more and relatively large masses , and therefore , when charged , are relatively hard to deflect with the magnetic field . however , the residual droplets also hold the initial momentum . further , since the residual droplets have relatively large masses , the diffusion speed following the plasma generation is lower than that of neutral particles . therefore , the residual droplets also move toward the lower part of the chamber . as explained above , most of the debris of fast ions , neutral particles , residual droplets , and so on following the plasma generation are focused toward the lower part of the chamber and are caught . accordingly , the amount of these debris colliding with and attached to the structures within the chamber is small and the deterioration in the function as the euv light source is prevented . the debris moving toward the lower part of the chamber move to an exhaust path 20 . in the exhaust path 20 , the debris are guided to an exhaust chamber 22 connected to the chamber 8 by a debris exhaust tmp ( turbo molecular pump ) 21 . the debris guided to the exhaust chamber 22 hold momentum necessary to move toward the lower part of the chamber . further , the debris pass through a debris passage hole 24 of a catching chamber 23 formed in the lower part of the exhaust chamber 22 and reach the catching chamber 23 because of the momentum and gravity . as shown in fig1 , the debris passage hole 24 is formed in a funnel shape for collecting the debris at the center of the catching chamber 23 and preventing attachment of the debris to the wall surfaces of the catching chamber 23 . a collecting unit 25 is provided under the catching chamber 23 . the collecting unit 25 has a gate valve 26 , an evacuating unit 27 , a collecting container connecting part 28 , and a collecting container 29 . the catching chamber 23 is connected to the collecting container 29 provided under the collecting unit 25 via the gate valve 26 . when the amount of debris caught in the catching chamber 23 reaches a certain amount , the gate valve 26 is opened after the interior of the collecting container 29 communicating with the gate valve 26 is evacuated to vacuum by the evacuating unit 27 . thereby , the debris caught in the catching chamber 23 drop into the collecting container 29 . then , the gate valve 26 is closed and the air is introduced into the collecting container 29 by using a leak valve ( not shown ). the debris can be taken out by detaching the collecting container 29 from the collecting container connecting part 28 . the collecting container 29 can be connected to the collecting container connecting part 28 and used again by cleaning the collecting container 29 after the debris are taken out of the collecting container 29 . the amount of deposited debris may be detected by measuring the time of emitting the target material and / or the times of plasma generation by a timer , counter , or the like ( not shown ). as explained above , according to the embodiment , almost all of the fast ions , neutral particles , and residual droplets generated following the euv light generation can be collected during operation of the euv light source . therefore , the contamination of the chamber is reduced and the intervals of chamber cleaning operation can be greatly increased . thereby , the operation time of the euv light source required at a practical level can be achieved . next , referring to fig2 , the second embodiment of the present invention will be explained . in the second embodiment , the operation from plasma generation to immediately before introduction of debris to an exhaust path 30 is the same as the operation in the first embodiment . the debris of neutral particles , residual droplets , and so on collected in the lower part of the chamber 8 are guided to an exhaust chamber 32 under the chamber in the exhaust path 30 by a debris exhaust tmp ( turbo molecular pump ) 31 through a hole of a skimmer 18 . the pressure in the exhaust chamber 32 is kept lower than the pressure within the chamber 8 by the debris exhaust tmp 31 . the diameter of the hole of the skimmer 18 is several tens of micrometers to several millimeters . the diameter of the hole of the skimmer 18 is determined so that the residual droplets having the largest size among the products from the plasma can pass through . the sizes of the residual droplets change according to the target droplets and laser intensity . in the embodiment , for example , the diameter of the target droplets is 20 μm , the laser intensity is 10 9 w / cm 2 or less , and the diameter of the hole of the skimmer 18 is 100 μm . further , as shown in fig2 , the shape of the skimmer 18 is preferably formed in a conical shape downwardly projecting . this is for focusing the caught debris toward the central axis as far as from the walls of the exhaust chamber 32 . the debris guided to the exhaust chamber 32 hold momentum necessary for moving toward the lower part of the chamber . the debris reach a catching and reaction chamber 33 through a debris passage hole 35 of a partition wall 34 formed in the upper part of the catching and reaction chamber 33 provided under the exhaust chamber 32 due to the momentum , gravity and the pressure difference when passing through the skimmer 18 and are caught . further , the exhaust chamber 32 is constantly kept at the lower pressure than that of the chamber 8 by the skimmer 18 , a reactive gas is prevented from diffusing in the chamber 8 , which will be explained later . the catching and reaction chamber 33 is filled with a reactive gas that reacts with the target material and generates a gas product at a certain pressure . the reactive gas is supplied by a reactive gas supply unit 38 . when tin ( sn ) is used as the target material , the catching and reaction chamber 33 is filled with hydrogen gas ( h 2 ) at the atmospheric pressure at the normal temperature , for example , and the tin reacts with the hydrogen gas and snh 4 gas is generated . the snh 4 gas is generated because the boiling point of snh 4 is − 52 ° c . at the atmospheric pressure . within the catching and reaction chamber 33 , when the debris of tin are exposed to the reactive gas in sufficient time , all of the tin debris react with hydrogen to be snh 4 , and gasified . the pressure within the catching and reaction chamber 33 is higher than the pressure within the exhaust chamber , and a gas flow from the catching and reaction chamber 33 to the exhaust chamber 32 is generated . fig3 shows the partition wall 34 seen from above . as shown in fig2 , the debris passage hole 35 is formed at the center of the partition wall 34 , and exhaust gas vent holes 36 are formed on the outer circumference part of the partition wall 34 . as shown in fig2 , the partition wall 34 is formed in a conical shape . the debris in the exhaust chamber 32 move through the debris passage hole 35 to the catching and reaction chamber 33 , react with the reactive gas to be gasified into a reaction product gas in the catching and reaction chamber 33 , pass through the exhaust gas vent holes 36 into the exhaust chamber 32 , and are exhausted by the debris exhaust tmp 31 . in the partition wall 34 shown in fig3 , the opening sectional area of the exhaust gas vent holes 36 formed on the outer circumference part is set sufficiently larger than the opening sectional area of the debris passage hole 35 . the ratio of the opening sectional area of the exhaust gas vent holes 36 to the opening sectional area of the debris passage hole 35 and the whole pressure loss are determined such that the catching and reaction chamber 33 is kept at certain pressure by the reactive gas and the sufficient pressure difference is kept between the catching and reaction chamber 33 and the exhaust chamber 32 . on the other hand , the amount of flow of the reactive gas from the debris passage hole 35 is a very small value , and the debris can move through the debris passage hole 35 to the catching and reaction chamber 33 . the magnitude relation in pressure among the respective chambers is such that ( pressure of the catching and reaction chamber 33 )& gt ;( pressure within the chamber )& gt ;( pressure of the exhaust chamber ). in this manner , the debris can be caught while the reactive gas prevents the debris from diffusing in the chamber . the reactive gas and the reaction product gas containing snh 4 guided to the exhaust chamber 32 are guided to a collecting unit 45 by the debris exhaust tmp 31 . the collecting unit 45 has a diluting unit 46 , an exhausting unit 47 , and a removing unit 48 . the reactive gas and the reaction product gas guided to the exhaust chamber 32 are first guided to the diluting unit 46 of the collecting unit 45 by the debris exhaust tmp 31 . it is difficult to treat the reactive gas and the reaction product gas guided to the exhaust chamber 32 as they are by the removing unit 48 and so on at the downstream , and the reactive gas and the reaction product gas are diluted with an inert gas in the diluting unit 46 for easy removing treatment in the removing unit 48 and so on at the downstream . as a dilution gas , nitrogen ( n 2 ), helium ( he ), argon ( ar ), or the like is used . the diluted reactive gas and reaction product gas are guided through the exhausting unit 47 to the removing unit 48 . the exhausting unit 47 includes a pump for sending the diluted gas to the removing unit 48 . further , in the removing unit 48 , the reaction product gas is removed from the light source apparatus by absorption or further reaction , and thereby , the debris can be collected . in the removing unit 48 , the reactive gas and the reaction product gas containing snh 4 are absorbed by activated carbon filtration or the like . accordingly , the reactive gas and the reaction product gas containing the target material hardly flow out of the removing unit 48 . instead of activated carbon filtration , the reactive gas and the reaction product gas may be absorbed by another material such as a foam metal or functional ceramics beads , for example . further , the reactive gas and the reaction product gas containing snh 4 may be allowed to chemically react with another material by oxidization or reduction for easy collecting . in the second embodiment of the present invention , since the debris are allowed to react with the reactive gas and collected as the reaction product gas , the degree of freedom of choice regarding the transportation and treatment of the gasified debris is great . for example , the collecting operation can be performed even when the units 47 , 48 at the downstream of the diluting unit 46 are provided outside of a clean room where the euv light source apparatus is installed . thereby , the clean room can be prevented from contaminating by the collected debris . next , referring to fig4 , the third embodiment of the present invention will be explained . the third embodiment of the present invention is the same as the second embodiment of the present invention shown in fig2 in the configuration to the exhaust chamber 32 , and fig4 only shows the skimmer 18 and the downstream side of the third embodiment of the present invention , which differ from those of the second embodiment of the present invention . in the third embodiment of the present invention , a collecting unit 55 has a diluting unit 56 , an exhausting unit 57 , a removing unit 58 , and an exhausting unit 59 , and is connected to a catching and reaction chamber 53 and a debris exhaust tmp 51 . that is , the diluting unit 56 and the exhausting unit 57 are connected to the catching and reaction chamber 53 , and the reactive gas and the reaction product gas containing snh 4 are diluted by the diluting unit 56 and sent to the removing unit 58 by the exhausting unit 57 . the exhaust gas from the debris exhaust tmp 51 is also sent to the removing unit 58 via the exhausting unit 59 . this is because the flow of the reactive gas and the reaction product gas from the catching and reaction chamber 53 into the exhaust chamber 32 is unavoidable for maintaining the pressure balance , and the reactive gas and the reaction product gas from the reaction chamber 53 via the exhaust chamber 32 to the debris exhaust tmp 51 can not completely be eliminated . as explained above , in the third embodiment of the present invention , the amount of the reactive gas and the reaction product gas exhausted by the debris exhaust tmp 51 can be reduced . since the amount of exhausted gas by the debris exhaust tmp 51 is reduced , the lower capacity of the debris exhaust tmp 51 can be available and the cost can be reduced . although the total number of exhausting units is increased , the price of a typical pump is a fraction of the price of the tmp , and the effect of the reduced cost due to the lower capacity of the debris exhaust tmp 51 is great . next , referring to fig5 , the fourth embodiment of the present invention will be explained . the fourth embodiment of the present invention has a similar configuration to that of the second embodiment of the present invention , however , a heating unit 65 is provided in a catching and reaction chamber 63 . that is , by heating the catching and reaction chamber 63 , the reaction time taken for reaction of the debris and the reactive gas can be reduced and the reaction product gas can be efficiently generated from the debris . the heating unit 65 may be configured by providing a heater on the outer wall of the catching and reaction chamber 63 , or providing an infrared lamp or plasma source . further , in the fourth embodiment of the present invention , the temperatures of the debris , the reactive gas , and the reaction product gas can be raised by heating the catching and reaction chamber 63 , and the kinds of the usable reactive gas can be increased . fig6 is a table of boiling points of reaction products of , for example , halogen gases ( not the hydrogen gas ) and tin at one atmosphere . the reactive gas is heated in advance and the temperature of the reaction product as a result of the reaction with tin is equal to or more than the boiling point , and thereby , the debris can be extracted as the reaction product gas . regarding the turbo - molecular pump , one that can be used at a high temperature of several hundreds of degrees c . has been developed , however , in practice , a reaction product having a boiling point of 250 ° c . or less is used . for example , chlorine or bromine is used as a reactive gas and allowed to react with tin debris , and thereby , the tin debris can be extracted as reaction product gas sncl 4 or snbr 4 . the hydrogen gas is highly explosive , reaching the explosion limit at concentration of 4 %, and carries risks . accordingly , the control of hydrogen concentration is essential in the whole exhaust system , and there are many restrictions in configuration of the exhaust system . for example , using chlorine or bromine , the restrictions in use of hydrogen can be eliminated . next , referring to fig7 , the fifth embodiment of the present invention will be explained . in the fifth embodiment of the present invention , a switching valve 70 is provided between the exhaust path in which the reactive gas exists and the chamber 8 , and the exhaust path and the chamber 8 are constantly partitioned by the switching valve 70 . the operation from laser generation to debris collection is the same as that in the first to fourth embodiments of the present invention . note that , in the fifth embodiment of the present invention , since the exhaust path and the chamber are constantly partitioned by the switching valve 70 , the skimmer is not the essential configuration requirement of the embodiment and the skimmer may be omitted . in the fifth embodiment of the present invention , plural exhaust paths may be provided . as shown in fig7 , the embodiment will be explained by taking the case where two exhaust path “ a ” 71 a and exhaust path “ b ” 71 b are provided as an example . the debris focused toward the axis in the lower part of the chamber pass the switching valve 70 and the exhaust path “ b ” 71 b and reach a tmp “ b ” 72 b . here , the debris are deposited on the blades and wall surfaces within the tmp “ b ” 72 b . when debris in an amount equal to or more than a certain amount are deposited on the blades and wall surfaces of the tmp , the amount of exhaust flow of the tmp becomes lower . accordingly , by detecting the emission time of the target material and the times of plasma generation using a timer or counter , the switching valve 70 is switched and connected to a new exhaust path before the amount of exhaust flow of the tmp becomes lower . while the debris in the lower part of the chamber are caught through the exhaust path “ b ” 71 b to the tmp “ b ” 72 b , in the exhaust path “ a ” 71 a , the debris deposited in the tmp “ a ” 72 a react with a reactive gas supplied from a reactive gas supply unit 73 a and is gasified and a reaction product gas is generated . the reaction product gas is guided to a collecting unit 75 a , and collected via a diluting unit 76 a , an exhausting unit 77 a by a removing unit 78 a in the collecting unit 75 a . thereby , the tmp “ a ” 72 a can be recycled and reused . in this regard , the reaction of the debris and the reactive gas may be accelerated by heating the exhaust path “ a ” 71 a and / or the tmp “ a ” 72 a with a heating unit . further , in place of hydrogen , chlorine , bromine , or the like may be used as the reactive gas . when the reaction treatment of debris is ended and the tmp “ a ” 72 a becomes reusable , the reactive gas supply is stopped and the diluting unit 76 a is stopped . if the heating unit has been used , the heating unit is also stopped . note that the exhausting unit 77 a is not stopped but continuously operated as a back - pressure pump . when the valve 70 is switched , the debris in the lower part of the chamber is guided to the exhaust path “ a ” 71 a in which the debris treatment has been ended and the tmp “ a ” 72 a becomes recyclable and reusable , and deposited in the tmp “ a ” 72 a . concurrently , the reactive gas is guided to the exhaust path “ b ” 71 b and the tmp “ b ” 72 b in which the debris have been deposited and reaction treatment of the debris and accompanying recycle of the tmp “ b ” 72 b are performed , and the tmp “ b ” 72 b becomes reusable . in this regard , the reaction treatment of debris may be promoted using a heating unit . by repeatedly performing the operation , the euv light source apparatus can be continuously operated while collecting the debris . in the fifth embodiment of the present invention , an advantage that the operation of depositing and accumulating the debris and the operation of gasifying and exhausting and collecting the debris can be concurrently and independently performed is obtained . further , in the embodiment , unlike the second to fourth embodiments , there is no need to achieve the pressure balance among the chamber , the exhaust chamber , and the reaction chamber , and there is no restriction of pressure and temperature necessary for maintaining the pressure balance with respect to the reactive gas . accordingly , the pressure and temperature of the reactive gas can be set to the most suitable condition for causing the debris deposited in the tmp for gasification . referring to fig8 , the sixth embodiment of the present invention will be explained . the basic configuration of the sixth embodiment of the present invention is the same as the configuration of the second embodiment , but different in magnetic field arrangement . that is , the diameter of a lower coil 86 of an electromagnet is made larger than the diameter of an upper coil 85 . thereby , the magnetic field in the lower part of the chamber is smaller than the magnetic field in the upper part of the chamber , and the charged particles move toward the lower part of the chamber by the effect of the magnetic fields and removing of the charged particles is promoted . the basic operation of the embodiment is the same as the operation of the second embodiment , however , the collection efficiency of the debris in the lower part of the chamber can be improved because the magnetic field arrangement is changed . next , referring to fig9 , the seventh embodiment of the present invention will be explained . in the embodiment , as the target , a wire target is used in place of the droplet target . as shown in fig9 , the embodiment will be explained by taking the case of using a wire target 1 b in place of the droplet target in the first embodiment as an example . when the wire target is used , a wire formed from a tin material may be introduced by a wire target moving unit ( not shown ) into the chamber and a laser may be always applied to a new surface of the wire by continuously sliding the wire . further , a coated wire may be formed by coating the laser application surface with tin and used as a target . using the coated wire , the strength of the target base material becomes easily held and the mechanical strength of the target can be held . furthermore , fig1 shows a modified example of the coated wire target . in a coated wire target 91 shown in fig1 , a groove 93 is formed in the laser application part of a target base material 92 , the groove 93 part is coated with tin , and thereby , the coated wire target 91 is formed . the operation and effect of the seventh embodiment of the present invention are the same as the operation and effect of the first embodiment , however , greatly different in the following point from the operation and effect of the first embodiment . that is , using the wire target 1 b , specifically , the tin - coated wire 91 , the residual droplets on which the influence of the magnetic field hardly act can be reduced . this is because the volume of tin flying due to application can be minimized by making the thickness of the tin coating nearly equal to the thickness that is removed by abrasion with a carbon dioxide laser . in the case of using the droplet target usually having a spherical shape , the whole volume of the tin in the deeper part than the thickness flying due to laser application becomes residual droplets . on the other hand , in the case of using the tin - coated wire 91 , generation of the residual droplets can be reduced by setting the thickness of the tin coating to a suitable value . if the residual droplets are reduced , most of the rest of the debris become minute particles , and the collection efficiency of the debris by the magnetic field is dramatically increased by charging the minute particles .

6Physics

reference will now be made to the following detailed description of embodiments of the present invention . those skilled in the art will recognize that embodiments of the present invention provide many inventive concepts and novel features that are merely illustrative , and are not to be construed as restrictive . accordingly , the specific embodiments described herein are given by way of example and do not limit the scope of the embodiments of the present invention . in addition , those skilled in the art will understand that for purposes of explanation , numerous specific details are set forth , though embodiments of the invention can be practiced without these specific details , and that certain features have been omitted so as to more clearly illustrate embodiments of the present invention . fig3 illustrates a block diagram of an electrostatic discharge ( esd ) protection circuit 300 according to an embodiment of the present invention . esd protection circuit 300 comprises terminals 310 and 320 , a triggering element 330 , a shut - off element 340 , a series element 350 , and a transistor shunt element 360 . triggering element 330 , shut - off element 340 , series element 350 and transistor shunt element 360 provide a minimal resistance discharge path , so that an esd event does not damage devices or integrated circuits that may be coupled with terminals 310 and 320 . as described in more detail below , when an esd event occurs across terminals 310 and 320 , triggering element 330 activates transistor shunt element 360 to dissipate the esd event . triggering element 330 provides the ability to set the value of a turn - on voltage of transistor shunt element 360 , i . e ., the voltage at which transistor shunt element 360 turns - on and is activated to dissipate an esd event . the number of diodes in triggering element 330 can be used to establish the turn - on voltage level . shut - off element 340 keeps the esd discharge path turned - off during normal operation , so that it is not used until such time as the turn - on voltage of transistor shunt element 360 is reached . series element 350 provides the ability to limit the gate current into transistor shunt element 360 . transistor shunt element 360 provides a bi - directional discharge path , through , for example , the drain and source of transistor shunt element 360 , to dissipate an esd event . embodiments of the present invention operate in connection with either a positive esd event , where the potential of terminal 310 is higher than the potential of terminal 320 , or a negative esd event , where the potential of terminal 320 is higher than the potential of terminal 310 . the polarity of the esd event determines the discharge direction between terminals 310 and 320 . for example , if a positive esd event occurs , triggering element 330 is the element that turns - on transistor shunt element 360 , but if a negative esd event occurs , shut - off element 340 becomes the element that turns - on transistor shunt element 360 . thus , in accordance with the principles of embodiments of the present invention , esd protection circuit 300 provides for a bi - directional discharge path for an esd event across terminals 310 and 320 . as is the case with a positive esd event , series element 350 provides the ability to limit the gate current into transistor shunt element 360 during a negative esd event . in one embodiment of the present invention , esd protection circuit 300 is fabricated using pseudomorphic high electron mobility transistor ( phemt ) technology , which is a compound semiconductor field effect transistor ( fet ) technology . however , esd protection circuit 300 may be fabricated using other compound semiconductor fet technologies , including , for example , but not limited to , metal semiconductor field effect transistor ( mesfet ), junction field effect transistor ( jfet ), high electron mobility transistor ( hemt ), metamorphic high electron mobility transistor ( mhemt ), heterostructure field effect transistor ( hfet ), modulation - doped field effect transistor ( modfet ), or any other suitable compound semiconductor fet technologies . compound semiconductor materials used to fabricate esd protection circuit 300 may include materials , such as , for example , gallium arsenide ( gaas ), indium phosphide ( inp ), gallium nitride ( gan ), and derivatives of the foregoing , such as aluminum gallium arsenide ( algaas ), indium gallium arsenide ( ingaas ), indium gallium phosphide ( ingap ), indium aluminum arsenide ( inalas ), aluminum gallium nitride ( algan ), indium gallium nitride ( ingan ), gallium arsenide antimonide ( gaassb ), indium gallium arsenide nitride ( ingaasn ), and aluminum arsenide ( alas ), for example . in one embodiment of the present invention , esd protection circuit 300 is formed on a gallium arsenide ( gaas ) substrate . however , esd protection circuit 300 may be formed on other types of substrates , such as , for example , indium phosphide ( inp ) and gallium nitride ( gan ). in one embodiment of the present invention , terminal 310 may be coupled with a device or an integrated circuit to be protected from an esd event , and terminal 320 may be coupled with a ground . in another embodiment of the present invention , terminal 320 may be coupled with a reference potential other than ground . for example , the reference potential may provide an additional voltage potential to increase or decrease the level of the turn - on voltage , as will be explained below in greater detail . in addition or as an alternative , terminal 310 may be coupled with a bond pad , input / output pin or any other connection associated with esd protection circuit 300 , and terminal 320 may be coupled with another bond pad , input / output pin or any other connection within esd protection circuit 300 . in one embodiment of the present invention , transistor shunt element 360 is an enhancement - mode phemt . although transistor shunt element 360 is described as an enhancement - mode phemt , embodiments of the present invention contemplate any suitable enhancement - mode fet such as , for example , mesfet jfet , hemt , mhemt , hfet , modfet or any other suitable compound semiconductor fet . embodiments of the present invention activate transistor shunt element 360 on a voltage - controlled basis , in connection with a gate - to - source voltage . that is , voltage is applied to the gate of transistor shunt element 360 , and if the magnitude of the gate - to - source voltage is less than the threshold voltage of transistor shunt element 360 , then transistor shunt element 360 is turned - off . shut - off element 340 holds the gate - to - source voltage of transistor shunt element 360 below the threshold voltage of transistor shunt element 360 until the turn - on voltage established based on triggering element 330 is reached . as described above , the turn - on voltage of esd protection circuit 300 can be set using diodes in triggering element 330 . however , unlike in the prior art , no diodes or resistors are used in the discharge path . embodiments of the present invention use transistor shunt element 360 to discharge the esd event . among other things , this reduces the series resistance in the discharge path of embodiments of the present invention , which enables embodiments of the present invention to dissipate an esd event as rapidly as possible . in addition , because diodes are not used in the discharge path since they do not dissipate an esd event , smaller diodes may be used relative to those used in prior art esd protection circuits that use diodes in the discharge path . among other things , this reduces the size of esd protection circuit 300 relative to such prior art esd protection circuits . in addition , embodiments of the present invention have one discharge path for both positive and negative esd events , rather than two discharge paths like some prior art esd protection circuits . among other things , this reduces the complexity of embodiments of the present invention , reduces the amount of space consumed , and reduces the cost of the component that includes the esd protection circuit of embodiments of the present invention . moreover , unlike with some prior art esd protection circuits , the use of a power supply is not required with embodiments of the present invention . among other things , this reduces the complexity , and therefore the cost , of esd protection circuits in accordance with embodiments of the present invention . fig4 illustrates a plot 400 of the transmission line pulse characteristic 410 of the current versus voltage according to embodiments of the present invention . as described above , during an esd event , esd protection circuit 300 provides a discharge path so that the esd event does not damage devices and / or integrated circuits . the discharge path in esd protection circuit is a low resistance path to ground that allows for a rapid dissipation of an esd event through transistor shunt element 360 . accordingly , it can be seen in fig4 that esd protection circuit 300 dissipates increasing current with only a minimal effect on voltage . for the transmission line pulse characteristic 410 in fig4 , triggering element 330 provides a turn - on voltage of approximately 10 volts . once the turn - on voltage has been exceeded , the transmission - line pulse characteristic 410 is shown to “ snap back ,” in this case to a voltage of 10 volts . the “ snap - back ” voltage is determined by the construction of the transistor shunt element 360 . fig5 a through 5i illustrate the esd protection circuit 300 of fig3 according to embodiments of the present invention . as described above , esd protection circuit 300 comprises terminals 310 and 320 , triggering element 330 , shut - off element 340 , series element 350 , and transistor shunt element 360 . in addition , the drain of transistor shunt element 360 is coupled with terminal 310 , the source of transistor shunt element 360 is coupled with terminal 320 , and the gate of transistor shunt element 360 is coupled with series element 350 . in fig5 a , triggering element 330 comprises a plurality of diodes d 1 , d 2 , through dn coupled in series from terminal 310 to shut - off element 340 and series element 350 . fig5 a through 5i , diodes d 1 , d 2 , through dn may be any diode , for example , but not limited to , a schottky diode . in addition or as an alternative , diodes d 1 , d 2 to dn in fig5 a through 5i may be implemented using a transistor connected in a diode configuration , i . e ., the gate of the transistor connected to the drain of the transistor . in addition or as an alternative , in fig5 a through 5h , a component , such as , for example , but not limited to , a resistor as shown in fig5 i , may be coupled in series with diodes d 1 , d 2 to dn . in fig5 a , shut - off element 340 comprises a resistor r 1 coupled with a gate - source - coupled transistor 370 ( wherein gate - source - coupled transistor 370 has its gate coupled with its source ) coupled in series between triggering element 330 and series element 350 to terminal 320 . in one embodiment , gate - source - coupled transistor 370 is a depletion - mode fet . however , embodiments of the invention are not limited to gate - source - coupled transistor 370 being a depletion - mode fet . series element 350 comprises a series resistor r 2 coupled with the gate of transistor shunt element 360 and triggering element 330 and shut - off element 340 . in fig5 b , triggering element 330 comprises a plurality of diodes d 1 , d 2 , through dn coupled in series from terminal 310 to shut - off element 340 and series element 350 . shut - off element 340 comprises a resistor r 1 coupled with a gate - source - coupled transistor 370 coupled in series between triggering element 330 and series element 350 to terminal 320 . series element 350 comprises a short circuit that provides a direct connection between the gate of transistor shunt element 360 to triggering element 330 and shut - off element 340 in fig5 c , triggering element 330 comprises a plurality of diodes d 1 , d 2 , through dn coupled in series from terminal 310 to shut - off element 340 and series element 350 . shut - off element 340 comprises a resistor r 1 coupled in series between triggering element 330 and series element 350 to terminal 320 . shut - off element 340 may also comprise a gate - source - coupled transistor 370 coupled in series between triggering element 330 and series element 350 to terminal 320 , as shown in fig5 h . series element 350 comprises a series resistor r 2 coupled with the gate of transistor shunt element 360 and triggering element 330 and shut - off element 340 . in fig5 d , triggering element 330 comprises a plurality of diodes d 1 , d 2 , through dn coupled in series from terminal 310 to shut - off element 340 and series element 350 . shut - off element 340 comprises a resistor r 1 coupled in series between triggering element 330 and series element 350 to terminal 320 . series element 350 comprises a short circuit that provides a direct connection between the gate of transistor shunt element 360 to triggering element 330 and shut - off element 340 . in fig5 e , triggering element 330 comprises a plurality of diodes d 1 , d 2 , through dn coupled in series from terminal 310 to shut - off element 340 and series element 350 . shut - off element 340 comprises a source - resistor - coupled transistor 380 , wherein the source of source - resistor - coupled transistor 380 is coupled with a resistor r 1 in series between triggering element 330 and series element 350 to terminal 320 , and wherein the gate of source - resistor - coupled transistor 380 is coupled with terminal 320 . in one embodiment , source - resistor - coupled transistor 380 is a depletion - mode fet . however , embodiments of the invention are not limited to source - resistor - coupled transistor 380 being a depletion - mode fet . series element 350 comprises a short circuit that provides a direct connection between the gate of transistor shunt element 360 to triggering element 330 and shut - off element 340 . in fig5 f , triggering element 330 comprises a plurality of diodes d 1 , d 2 , through dn coupled in series from terminal 310 to shut - off element 340 and series element 350 . shut - off element 340 comprises a resistor r 1 coupled with a gate - source - coupled transistor 370 coupled in series between triggering element 330 and series element 350 to terminal 320 . series element 350 comprises a plurality of diodes e 1 through en coupled in series from the gate of transistor shunt element 360 to triggering element 330 and shut - off element 340 . in fig5 g , triggering element 330 comprises a gate - source - coupled transistor 370 coupled with a plurality of diodes d 1 , d 2 , through dn coupled in series from terminal 310 to shut - off element 340 and series element 350 . shut - off element 340 comprises a resistor r 1 coupled with a gate - source - coupled transistor 370 coupled in series between triggering element 330 and series element 350 to terminal 320 . series element 350 comprises a series resistor r 2 coupled with the gate of transistor shunt element 360 and triggering element 330 and shut - off element 340 . in one embodiment of the present invention , the plurality of diodes d 1 , d 2 , through dn , of triggering element 330 provide for controlling or setting the turn - on voltage of transistor shunt element 360 . for example , by increasing or decreasing the number of diodes ( e . g . d 1 , d 2 , through dn ) of triggering element 330 , the turn - on voltage may be adjusted and controlled . as an example and not by way of limitation , the turn - on voltage may be increased by increasing the number of diodes coupled in series , or in the alternative , the turn - on voltage may be decreased by reducing the number of diodes coupled in series . embodiments of the present invention contemplate the use of any type of diode , including , for example , but not limited to , a schottky diode . as described above , shut - off element 340 keeps the esd discharge path , and in particular transistor shunt element 360 , turned - off during normal operation ( i . e ., when the operating voltage is less than the turn - on voltage ). however , during a negative esd event , shut - off element 340 becomes the element that turns - on transistor shunt element 360 , thereby providing bi - directional esd discharge protection . in addition , as described above , series element 350 can be used to limit the gate current into transistor shunt element 360 . although esd protection circuit 300 is shown and described as having a particular arrangement of components , embodiments of the present invention contemplate any arrangement of components herein and / or any combination of components herein to perform esd protection . fig6 illustrates esd protection circuit 600 according to an embodiment of the present invention . in one embodiment , esd protection circuit 600 comprises terminals 310 and 320 , shut - off element 340 , series element 350 , and transistor shunt element 360 . shut - off element 340 comprises a resistor r 1 in series between series element 350 and terminal 320 . series element 350 comprises a short circuit that provides a direct connection between the gate of transistor shunt element 360 and shut - off element 340 . in esd protection circuit 600 , the voltage at which transistor shunt element 360 dissipates an esd event is determined by characteristics of transistor shunt element 360 and resistor r 1 of shut - off element 340 . although shut - off element 340 and series element 350 are shown and described as comprising particular components , embodiments of the present invention contemplate any arrangement of components herein and / or any combination of components herein to perform esd protection . for example , any shut - off element 340 and / or series element 350 described above in connection with fig5 a - 5i can be used with esd protection circuit 600 . fig7 illustrates a flow chart 700 of a process for esd protection for compound semiconductor devices and circuits according to embodiments of the present invention . as described above , terminal 310 may be coupled with a device or an integrated circuit to be protected from an esd event , and terminal 320 may be coupled with a ground or other reference potential other than ground . accordingly , after esd protection circuit 300 is operably coupled with a device or an integrated circuit to be protected , flow chart 700 starts at 702 , with esd protection circuit operating in normal operation ( i . e ., when the operating voltage is less than a turn - on voltage ). at 704 , esd protection circuit 300 experiences an esd event and detects a voltage at , for example , terminal 310 above a turn - on voltage . as described above , by increasing or decreasing the number of diodes ( e . g . d 1 , d 2 , through dn ) of triggering element 330 , the turn - on voltage may be adjusted and controlled . at 706 , triggering element 330 turns - on and at 708 , transistor shunt element 360 turns - on . the process continues at 710 , where transistor shunt element 360 provides a minimal resistance discharge path to dissipate the esd event , so that the esd event does not damage the device or integrated circuit coupled with terminals 310 and 320 . the process ends at 712 , once the voltage at terminal 310 is once again below the turn - on voltage . as described above , embodiments of the present invention operate in connection with either a positive or a negative esd event . therefore , although an esd event has been described as occurring with respect to terminal 310 , esd protection circuit 300 provides for a bi - directional discharge path for either a positive or negative esd event occurring at either terminal 310 or terminal 320 . reference in the foregoing specification to “ one embodiment ” or “ an embodiment ” means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the invention . the appearances of the phrase “ in one embodiment ” in various places in the specification are not necessarily all referring to the same embodiment . while the exemplary embodiments of the present invention have been shown and described , it will be understood that various changes and modifications to the foregoing embodiments may become apparent to those skilled in the art without departing from the spirit and scope of embodiments of the present invention . accordingly , the invention is not limited to the embodiments disclosed , but rather by the appended claims and their equivalents .

7Electricity

cable adapters and connectors are described herein , with reference to examples and exemplary embodiments . specific terminology is employed in describing examples and exemplary embodiments . however , the disclosure of this patent specification is not intended to be limited to the specific terminology so selected and it is to be understood that each specific element includes all technical equivalents that operate in a similar manner . similarly , while some examples discussed herein concern coaxial cables , adapters and connectors , the present disclosure also relates to cables , adapters and connectors which are not coaxial , such as , for example , multi - conductor cables , adapters and connectors . in an exemplary embodiment , shown in fig1 , an angled adapter 10 is shown adjacent a cable adapter 12 . the angled adapter 10 is provided with a cable attachment end 14 and a connector attachment end 16 . the cable adapter 12 may be fixed to a cable , as will be described in more detail below . the angled adapter 10 connects to the cable adapter 12 or another connector at the cable end 14 and provides a connection to an external connector at connector end 16 . the connection to the external connector at the connector end 16 is generally oriented along a connector axis 18 which is angled relative to an axis 20 of the cable to which the cable adapter 12 is fixed . in the example shown in fig1 , for example , the connector axis 18 and the cable axis 20 are substantially perpendicular . of course , many other relationships may be provided between the connector axis 18 and the cable axis 20 . for example , the connector axis 18 and the cable axis 20 may be oriented at an angle of 15 °, 30 °, 45 °, 60 ° or 75 ° ( or any other angle ) with respect to one another . in another example , the connector axis 18 and cable axis 20 may be substantially parallel or coaxial with one another . in the example shown in fig1 , the axes 18 and 20 exist in a single plane and intersect at a point . however , in another example , axes 18 and 20 may not intersect or be aligned in a single plane . fig2 is a partial cross section view of the angled adapter 10 and cable adapter 12 shown in fig1 , taken along a plane defined by connector axis 18 and cable axis 20 . as shown in fig2 , both the angled adapter 10 and the cable adapter 12 may each include a plurality of components . for example , the cable adapter 12 may include a cable adapter body 22 and a threaded cable attachment 24 press - fit into or otherwise attached to a bore of the cable adapter body 22 . the cable adapter body 22 may include a threaded portion 26 onto which the angled adapter 10 or other adapter , connector or cable may attach . as shown in fig2 , a cable 28 may be attached to the cable adapter 12 . in the example shown , a cable 28 includes an inner conductor 30 , a dielectric 32 , a spiral shielding 34 , a braided shielding 36 , and a cable jacket 38 . as shown , a crimp ring 40 may be crimped over the braided shielding 36 and a knurled surface of the cable adapter body 22 . the cable jacket 38 may cover all or part of the braided shielding 36 and crimped crimp ring 40 . the spiral shielding 34 may be attached to the cable adapter body 22 first by threading the spiral shielding 34 into complementary threads of the threaded cable attachment 24 and later fixing the components together via a solder joint 42 . in another example , shown in fig4 , one or more strain relief components 39 may be provided over the jacket 38 and optionally over all or part of the cable adapter body 22 and press sleeve body 44 . as shown in fig2 , 3 , 4 and 6 , the angled adapter 10 may include a press sleeve body 44 , an angled body 46 , a press sleeve dielectric 48 , a plug dielectric 50 , a bent contact 52 , a plug contact 54 , an intermediate outer contact 56 , a c - clip 58 , a gasket 60 and coupling nut 116 . as shown in fig2 , the features of the press sleeve body ( such as the threads 62 , inner bore 64 , and angled body - press sleeve attachment 66 ) are generally aligned to the cable axis 20 and the features of the angled body 46 ( such as the angled body - press sleeve attachment 66 , intermediate outer contact receiving groove 68 and inner bores 70 and 72 ) are generally aligned to either the cable axis 20 or the connector axis 18 . in another example , the features of the press sleeve body 44 may be aligned to two or more axes . similarly , the features of the angled body 46 may be aligned to one axis or more than two axes . in the example shown in fig2 , the main axes 18 and 20 of the angled adapter 10 exist in a single plane and intersect at a point . however , in another example , the axes to which features of the press sleeve body 44 and angled body 46 are aligned may not intersect or be aligned in a single plane . the angled adapter is assembled by inserting the bent contact 52 into the angled body 46 through the inner bore 70 . an example of a bent contact 52 is shown in greater detail in fig7 a - 7d . as shown , the bent contact 52 includes one or more bends 74 which provide an angle 80 between male 76 and female 78 ends of the bent contact 52 , the angle generally corresponding to the angle between the connector axis 18 and the cable axis 20 . press sleeve dielectric 48 is inserted over the female end 78 of the bent contact 52 and inside inner bore of the angled body 46 . an example of press sleeve dielectric 48 is shown in more detail in fig8 a - 8c . as shown in fig8 a , which is a cross section of press sleeve dielectric 48 taken along its major axis , press sleeve dielectric 48 includes an inner bore 82 into which the female end 78 of the bent contact 52 is inserted . the press sleeve dielectric 48 also may include a beveled end surface 84 and a bend relief 86 . the beveled end surface 84 forms an angle 88 with the main axis of the press sleeve dielectric 48 . in one example , angle 88 is configured to be substantially half of the angle between axes 18 and 20 or half of angle 80 , although other angles are possible . as shown in fig6 , bend relief 86 provides a space for the bend 74 of the bent contact 52 to exist without detrimental impingement . press sleeve body 44 is affixed to the angled body 46 via the angled body - press sleeve attachment 66 . in the examples shown , the attachment 66 is a press - fit between the components , although other attachments are possible , for example a threaded , soldered , welded or glued attachment . once the press sleeve body 44 and the angled body 46 are attached , the press sleeve dielectric 48 is held captive between the angled body 46 and the press sleeve body 44 by a surface 90 of inner bore 64 of the press sleeve body 44 . an example of the press sleeve body 44 is shown in more detail in fig9 a - 9c . an example of the plug dielectric 50 is shown in more detail in fig1 a - 10c . plug dielectric may include a beveled end surface 92 and a bend relief 94 . the beveled end surface 92 forms an angle 96 with the main axis of the plug dielectric 50 . in one example , angle 96 is configured to be substantially half of the angle between axes 18 and 20 or half of angle 80 , although other angles are possible . in one example , angles 88 and 96 may be similar or substantially the same . as shown in fig6 , bend relief 94 provides a space for the bend 74 of the angled contact 52 to exist without detrimental impingement . once the plug dielectric 50 is inserted into the angled body 46 , the beveled end surface 92 of the plug dielectric 50 and the beveled end surface 84 of the press sleeve dielectric 48 may desirably be flush and aligned . the beveled end surface 92 of the plug dielectric 50 and the beveled end surface 84 of the press sleeve dielectric 48 may be left to simply abut one another or may be glued , welded or otherwise attached to one another . in one example , the intermediate outer contact 56 is attached to the angled body 46 via a press - fit within the intermediate outer contact receiving groove 68 . such an attachment ensures good electrical contact between the intermediate outer contact 56 and the angled body 46 so that an electric field reentrant path may be prevented . in another example , shown in fig6 , an angled body 46 may be provided with a forward projecting member 120 configured to engage an inner bore of an intermediate outer contact 56 at a location separate from the intermediate outer contact receiving groove 68 ( and without another electrical connection between the outer contact receiving groove 68 and the contact point of the forward projecting member 120 ) to ensure a good electrical contact therebetween . in one example , such engagement may be in the form of a press - fit or friction - fit . such engagement may also be welded , brazed , soldered or otherwise fixedly adhered . the location of the engagement between the forward projecting member 120 and the intermediate outer contact 56 towards the connector end 16 of the angled adapter 10 may provide additional prevention of electric field reentrant paths . in the example shown in fig6 , for example , the engagement between the forward contacting member 120 and the intermediate outer contact 56 is located adjacent captivation features 108 and 110 of the plug contact 54 . an example of the intermediate outer contact 56 is shown in more detail in fig1 a - 11c . in one example of an intermediate outer contact 56 for an angled adapter 10 for use with signals up to , for example , 18 ghz , the intermediate outer contact 56 may not include any slots in an end thereof towards the connection end 16 of the angled adapter 10 . in another example of an intermediate outer contact 56 for use with signals up to , for example , 11 ghz , the intermediate outer contact 56 may be provided with one or more slots in an end thereof towards the connector end 16 of the angled adapter 10 . such slots may be configured to provide a complete electrical path even if a less than ideal mating torque is applied between an external connector and the adapter 10 at connection end 16 . an example of an angled body 46 is shown in more detail in fig1 a - 13d . c - clip 58 is fitted around intermediate outer contact 56 and is trapped between a forward member of angled body 46 and the intermediate outer contact 56 when the intermediate outer contact 56 is assembled into the intermediate outer contact receiving groove 68 . an external shoulder 100 of the intermediate outer contact 56 captures the c - clip 58 against a forward surface 122 of angled body 46 while an internal surface 102 of the intermediate outer contact 56 captures the plug dielectric 50 within the angled body 46 and intermediate outer contact 56 . plug contact 54 is inserted into the internal bore 98 of plug dielectric 50 . an example of the plug contact 54 is shown in more detail in fig1 a - 12d . plug contact 54 may be provided with a female end 104 , a male end 106 and a groove including an undercut 108 and a chamfer 110 . as shown in fig1 a , the plug dielectric may include a captivation feature such as a ridge including a flat 112 with a reduced inner diameter and a chamfer 114 . for example , the plug dielectric may be molded or may be machined to produce the flat 112 and chamfer 114 . as shown in fig6 , once assembled , undercut 108 is adjacent to flat 112 and chamfer 110 is adjacent to chamfer 114 . undercut 108 and chamfer 110 provide signal transmission characteristics to the angled adapter allowing transmission of signals at high frequencies , such as up to 18 ghz . the diameter and shape of the undercut 108 and chamfer 110 may be configured according to the signal transmission characteristics required by a particular application . in the example shown , chamfer 110 is provided towards the male end 106 of the plug contact 54 while the undercut 108 is provided towards the female end 104 of the plug contact 54 . in this orientation , the corresponding chamfer 114 helps to guide the plug contact 54 during assembly into the internal bore 98 of the plug dielectric 50 even if the plug dielectric 50 is slightly deformed during a forcible insertion of the plug contact 54 . once inserted , the mate of the undercut 108 and chamfer 110 with the flat 112 and chamfer 114 , respectively , mechanically captures the plug contact 54 within the plug dielectric 50 . also , when inserted , the female end 104 of the plug contact 54 mates with the male end 76 of bent contact 52 to provide an uninterrupted electrical connection between the bent contact 52 and the plug contact 54 . gasket 60 is inserted over intermediate outer contact 56 . c - clip 58 may then be compressed radially , for example using tooling designed for that purpose , and coupling nut 116 may be fitted over the compressed c - clip 58 . alternatively , coupling nut 116 may be forcibly fitted over the c - clip 58 , radially compressing it in the process . once the coupling nut 116 is fitted over the c - clip 58 , the c - clip 58 is allowed to snap into a groove 118 in the coupling nut 116 . thus , the coupling nut 116 is captured onto the intermediate outer contact 56 by c - clip 58 . in turn , c - clip 58 is held captive by the engagement of intermediate outer contact 56 within intermediate outer contact receiving groove 68 and the engagement between the forward contacting member 120 and the inner bore of the intermediate outer contact 56 . thus , when coupling nut 116 is threaded onto an external connector and tightened , the coupling nut 116 exerts a longitudinal force along the connector axis 18 acting to disengage the intermediate outer contact 56 from the adapter body 46 . however , the attachments of the intermediate outer contact 56 to the angled body 46 at intermediate outer contact receiving groove 68 and at forward contacting member 120 ( which may both be press - fit attachments , as discussed above ) are configured to resist such longitudinal force . the angled adapter 10 may be attached to the cable adapter 12 . in one example , shown in fig3 , 4 and 5 , the female threads 62 of press sleeve body 44 are threaded onto the male threads 26 of the cable adapter body 22 . of course , other attachment arrangements are also possible . materials for the various components may be chosen from among a wide range of suitable materials . in one example , angled body 46 , press sleeve body 44 , intermediate outer contact 56 and coupling nut 116 may be formed of passivated stainless steel ( such as by machining or casting ), bent contact 52 and plug contact 54 may be manufactured of beryllium - copper or phosphor - bronze and then gold plated , press sleeve dielectric 48 and plug dielectric 50 may be formed of ( such as by machining or molding ) ptfe ( polytetrafluoroethylene , a brand of which is teflon ), c - clip 58 may be manufactured from beryllium - copper or phosphor - bronze and gasket 60 may be manufactured from silicon rubber . in an aspect of the present disclosure , the dielectric components 48 and 50 are each captured in the angled adapter by a mechanical feature . for example , the press sleeve dielectric 48 may be mechanically captured within the press sleeve body 44 and the angled body 46 by surface 90 of the press sleeve body 44 . in another example , plug dielectric 50 may be mechanically captured within angled body 46 and intermediate outer contact 56 by surface 102 of the intermediate outer contact 56 . in environments with large temperature or pressure swings , such mechanical capturing ensures that the dielectrics ( which may be formed of a plastic such as ptfe ) stay in place no matter the environment into which the adapter is placed , a particular concern of adapters configured for high frequency signal transmission . in another aspect of the present disclosure , the intermediate outer contact 56 prevents the existence of a reentrant path within the angled adapter 10 . for further discussion of reentrant path creation and the resultant signal transmission problems associated therewith , see u . s . pat . no . 7 , 381 , 089 which is incorporated by reference herein in its entirety . in other words , the presence of intermediate outer contact 56 adjacent the plug dielectric at the connector end 16 of the adapter prevents any substantial gap through which errant electrical field radiation may propagate which could cause resonances or other disturbances at high signal frequencies . in yet another aspect of the present disclosure , the provision of an intermediate outer contact 56 as a separate component from the angled body 46 allows for several advantages over a unitary angled body including an outer contact at the connector end 16 . for example , surface 102 of the intermediate outer contact 56 ( which would be difficult , costly , time intensive and subject to a higher manufacturing failure rate if provided in a unitary angled body 46 ) allows for a mechanical capture of the plug dielectric 50 within the angled body 46 and the intermediate outer contact 56 . moreover , by assembling the intermediate outer contact into the angled body 46 after the plug dielectric 50 is inserted into the angled body 46 , detrimental deformation of the plug dielectric 50 , which could lead to problematic gaps and reentrant paths , as discussed above , may be avoided . such detrimental deformation of the plug dielectric 50 may be caused , for example , if a plug dielectric 50 is forcibly inserted into a unitary angled body 46 past an internal surface 102 . in still another aspect of the present disclosure , the connector end 16 of the angled adapter 10 ( including the plug contact 54 , the plug dielectric 50 , the intermediate outer contact 56 and the coupling nut 116 ) may be configured to adhere to a recognized or universal specification for high frequency connectors . one such specification maintained by the united states military is mil - prf - 39012 and more specifically mil - std - 348 , both of which are incorporated by reference herein in their entirety . in addition , the embodiments and examples above are illustrative , and many variations can be introduced on them without departing from the spirit of the disclosure or from the scope of the appended claims . for example , elements and / or features of different illustrative and exemplary embodiments herein may be combined with each other and / or substituted for each other within the scope of this disclosure . as another example , two or more of the various components described herein may be combined into one or more consolidated components or one of the various single components described herein may be provided as two or more sub - components .

7Electricity

the herein disclosed system and method for controlling computing system resources is based on an overall computing system architecture that includes multiple processors and other resources . the processor and resources may be divided into two or more partitions . each partition may have one or more processors assigned . each partition runs an instance of an operating system . resources in one partition may be shared with another partition . fig1 is a block diagram of an exemplary version of such a computer system . in fig1 , computer system 100 includes partitions 110 i . each partition 110 i includes fully - licensed processors 120 for which the computer system user has full usage rights . by dividing the computer system 100 into partitions , and by allowing sharing of resources ( i . e ., the processors 120 ) across partition boundaries , the computer system 100 may be implemented with a smaller number of processors than if sharing were not allowed , or if workloads were assigned to separate computing systems . thus , partitioning allows the computer system user to realize higher effective processor capacity with a reduced number of processors . each partition 110 i may additionally include one or more metered processors 130 , for which the computer system user pays an incremental cost when using the metered resources . an example of a metered processor is an “ instant capacity ” processor . when using an instant capacity processor , the computer system user acquires usage rights on an “ as needed ” basis , and is charged accordingly . thus , some of the instant capacity processors 130 in each partition 110 i may be temporarily assigned to operate when workload demands exceed the computing capacity of the processors 120 . the computer system user pays for operation of the processors 120 regardless of their actual operating status . that is , the user pays for each processor 120 whether or not that processor is actually executing any operations . indeed , the user pays for the processors 120 even if those processors 120 are not powered on . however , the user pays for the instant capacity processors 130 only when the instant capacity processors 130 are powered on and actually executing an operation . by paying for processing capacity “ as needed ” the computer system user can pay for a “ small ” computer system yet have a “ large ” computer system “ in standby .” thus , the computer system 100 shown in fig1 includes some processors ( the processors 120 ) that are licensed and paid for by the user , and some processors ( the instant capacity processors 130 ) that are unlicensed and are used only “ on demand .” of course , if the computer system 100 can satisfy its resource demands by reallocating unused processor capacity of the processors 120 , then there is no need to access the instant capacity processors 130 . the computer system 100 thus implements a borrowing scheme to temporarily transfer computing system resources ( the processors 120 ) as needed to meet current demands , and only supplements this borrowing scheme with the instant capacity processors 130 when the available processor capacity from the processors 120 is not sufficient . the relationship between borrowing capacity from the processors 120 and using the instant capacity processors 130 will be described later in more detail . to implement this borrowing scheme , the computer system user can assign each workload a minimum number of processors , an “ owned ” number of processors , and a maximum number of processors , and can specify these parameters as a policy to be implemented by the workload management system . as an example , workload 1 “ owns ” the processors 120 assigned to partition 1001 and workload 2 “ owns ” the processors assigned to partition 1002 . should workload 1 require four processors , that need can be satisfied by “ borrowing ” one of the processors 120 from the partition 1002 , should any of those processors 120 be “ available .” however , if none of the “ owned ” processors in the computer system 100 are available , and if the workload 1 is designated to use instant capacity processors 130 , then the required processor capacity may be met by using one or more of the instant capacity processors 130 . to implement the enhanced capacity of the “ large ” computing system with its instant capacity processors 130 , a ticap ( temporary instant capacity ) system 150 maybe made available to the computer system user . using the ticap system 150 , the user acquires rights to use the instant capacity processors 130 by , for example , paying in advance for a certain quantity of processing time . thus , the ticap system 150 allows one or more unlicensed instant capacity processors 130 to be activated for a period of pre - paid processing minutes without requiring permanent usage rights . when the instant capacity processor 130 is activated , the computer system user , under ticap , obtains temporary usage rights . note that the instant capacity processors 130 also may be placed into operation under regimes other than ticap . for example , an instant capacity processor 130 may be placed into operation to replace a failed processor 120 , if the computer system user has implemented such a service plan . although the above description , and that which follows , refers to instant capacity processors as ticap resources , the ticap system 150 may be applied to other shared computing system resources , including , for example , memory , network bandwidth , and storage facilities used by the computer system 100 . furthermore , the computer system may be configured exclusively with metered resources for which usage the computer system user pays an incremental cost ; and may be configured with fully - licensed resources , exclusively . whether configured with metered resources or fully - licensed resources , exclusively , or with a mix of the two , the computer system user may pay an incremental cost when additional resources are being consumed . for example , in a computer system with fully - licensed and metered resources , when more fully - licensed resources are being consumed , the computer system user will at least experience an incremental cost in terms of increased power consumption and consequent increased cooling demand . when more metered resources are being consumed , the computer system user experiences the increased costs of power consumption and cooling , but also may have an increased cost directly tied to using the metered resources ( i . e ., a pay - per - use cost ). the computer system user , naturally , would like some means for monitoring and controlling these incremental costs . one such means includes a visual display that indicates when incremental costs are occurring . note also , that although costs can increment up , due to added resource consumption , costs also can increment down due to reduced resource consumption . the visual display can provide an indication of current consumption and future , or predicted , consumption , so that the computer system user can anticipate these chances in cost , and can take actions as needed and as allowable , to change or control the cost of operating the computer system . as an example of a ticap implementation , the computer system user may purchase 30 days of prepaid temporary activation for instant capacity processors 130 . this allows the temporary processors 130 installed in the computer system 100 to be turned on and off , typically for short periods , to provide added capacity . a temporary instant capacity processor day is 24 hours , or 1 , 440 minutes of activation for one of the temporary processor cores 130 . a ticap day may be used by one instant capacity processor 130 operating for 24 hours , or by four instant capacity processors 130 operating for six hours each . if and when the instant capacity processors 130 are placed into operation may be determined by one or more policies implemented by the computer system user . for example , the computer system user could specify that an instant capacity processor 130 be activated whenever the capacity of the corresponding processors 120 exceeds 90 percent , and that the instant capacity processor remain in operation until processor demand is reduced to 75 percent of the processors 120 . many other policies are possible to control activation of the instant capacity processors 130 . in an embodiment , the ticap system 150 resides as software on the user &# 39 ; s computer system 100 , and operates in a standalone manner ( i . e ., no connection to the ticap provider ). as instant capacity processors 130 are activated , the user &# 39 ; s prepaid account , as implemented and monitored by the ticap system 150 , is debited . the ticap system 150 may predict , at the current rate of instant capacity processor usage , when the user &# 39 ; s prepaid account will be depleted , and may send a message to the user with that information . once the user &# 39 ; s prepaid account balance reaches zero , the ticap system 150 will deactivate any operating instant capacity processors 130 . computer system users may benefit from having a system more robust than just the ticap system 150 for managing workload on the computer system 100 . such a system would provide the computer system users with information needed to monitor the consumption of computing resources in a fashion that allows the users to understand the amount and source of that consumption and to make , if needed and / or desired , changes to policies that implement that consumption . included in this more robust system is a provision to provide the computer system user with real time or near real time information relating expenditures ( costs ) for computing system resources based on the reallocation of those resources among workloads . for example , when instant capacity or ticap processors are accessed , the computer system user &# 39 ; s expenditures for computing resources likely will increase . the computer system user would like to know why those costs increased , and to know specifically what workload demands led to the increases . in an embodiment , this information is provided to the computer system user by way of a visual or graphical interface . the interface may include varying iconic symbols and values to convey the resource expenditure information ( see fig3 ). fig2 is a block diagram of an exemplary workload management system ( wlms ) 200 that can be used to control resource utilization in the computer system 100 of fig1 , and which includes provision for visual display of information to the computer system user . the wlms 200 is an automated system that allows users to more precisely manage consumption of computing resources by workloads . a workload is a series of functions executed by an instance of an operating system , or by a subset of the operating system . policy controls define if , and under what conditions , specific workloads may automatically consume ticap resources . not all workloads are allowed access to ticap resources . furthermore , each workload may be assigned a specific quantity of computing system resources that it “ owns .” for example , a workload may normally use one processor 120 , but own two processors 120 . in addition , the workload may be allowed , by a policy established by the computer system user , to “ borrow ” up to two additional processors . should a workload require resources in excess of what the workload owns , the workload borrows up to the maximum allowable ( for a total of four processors in the given example ). when ticap resources are being consumed by the workloads , those workloads which are allowed to use ticap resources , and which are borrowing resources , are consuming ticap resources . shared resource domains are comprised of workloads , each of which is assigned a policy , and each of which is associated with a resource compartment . a resource compartment may be an operating system instance or a subdivision of an operating system instance . in managing the computer system 100 , the user identifies configurations of shared resource domains that the user wants to control . as noted above , the user also defines the policies to be implemented in controlling the shared resource domains . such policies allow for automatic implementation of the ticap system 150 , and automatic assignment of instant capacity processors 130 , by specifying parameters under which the ticap resources may be activated . thus , each shared resource domain includes workloads , each of which is assigned one or more policies and each of which is associated with a resource compartment . in fig2 , wlms 200 is coupled to the computer system 100 and ticap system 150 . the wlms 200 includes a resource monitor 210 that tracks which workloads are using which resources , and receives requests from the workloads to add additional resources . coupled to the resource monitor 210 is policy processor 220 , which applies policies set by the user with user input device 230 and stored in database 240 , to determine if and when to apply additional resources to a requesting workload . finally , user interface module 250 produces the user interfaces that the computer system user requires in order to efficiently manage the consumption of computer system resources . the policies may be simple policies ( allocate additional processing resources when percent utilization exceeds 75 percent ) or complex ( different rules for different times of the day , for example ). more specifically , a conditional policy ( rule set ) may employ conditional statements based on the occurrence of specific event . for example , a complex ( conditional ) rule set may specify one rule for the hours 6 am to 6 pm ( condition : the workload is important during daytime and is allowed to consume ticap resources ), and a second rule for the hours 6 pm to 6 am ( condition : the workload is not important during nighttime and is not allowed to consume ticap resources ). thus , a conditional policy is one way to create complex rule sets from simple policies . an active policy is one that is currently applied to a workload based on which conditions are true for that workload . in the above example , if the time of day is noon , and a policy is being implemented , the true condition is daytime and the policy that will be applied is to assign additional ticap resources to the workload . if a condition associated with a workload is not true , the policy for the workload is not implemented . with the workload policies established , the wlms 200 can compare policy requirements to operating parameters for each active workload and each consumed or available resource to determine if resources assigned to the active workloads should be changed ( increased or decreased ). if a change is indicated , the wlms 200 ( the policy processor 220 ) will initiate a resource request . the resource request may then be sent to the ticap system 150 . consider , for example , processor utilization . the resource monitor 210 monitors two parameters : number of processors in use and processor utilization for each such processor , and processor demand from each workload . the resource monitor 210 then makes a prediction as to processor demand / utilization for the next operating interval of the computer system 100 . for example , if two processors 120 are operating , each at 75 percent utilization , in order to support one workload , then 1 . 5 out of 2 processors are being used by the workload . the simplest prediction is that processor demand / utilization in the next interval will be the same as in the current interval of computer system operation . the computer system user will have specified that percentage of processor utilization at which the user believes the workload will be best operated ( e . g ., at 100 percent processor utilization , there is no margin for demand changes , and any further demand beyond 100 percent will impair workload operation ). thus if the resource monitor 210 “ predicts ” that the workloads will consume 1 . 5 processors , and the user wants processor utilization to be no more than 50 percent , then the user would prefer that an additional processor be placed in operation so that 1 . 5 out of 3 processors are operating , each at 50 percent utilization . to initiate a change in processors assigned to the workload , the wlms 200 sends a resource request to the computer system 100 , and that request may result in the assignment of one or more additional processors 120 to the workload . however , if the resource request cannot be met by assignment of processors 120 ( e . g ., none are available ), the resource request may be passed to the ticap system 150 , and one or more instant capacity processors 130 may be assigned to the workload . the distribution of processors to workload , including the assignment of instant capacity processors 130 may be shown on a visual display that is presented to the user in real time or near real time . fig3 illustrates an exemplary user interface 260 for monitoring and controlling computing system resources of the computer system 100 . the interface 260 includes identities 261 of workloads executing on the computer system 100 , percent of processor utilization 262 , active policies 263 for the workloads , and an indication 264 of whether ticap resources are authorized and being used by the workloads . the indication of ticap authorization and use may include display of various icons , as shown . the interface 260 includes other informational displays that allow the computer system user to monitor operations and to make decisions regarding control of the computing resources . for example , the interface 260 may use various icons to represent ticap authorization , ticap use , and the amount of ticap resources being consumed by a particular work load , a group of workload ( arranged , for example , by partition ) and the total ticap utilization . the icons may be caused to vary as to indicate changes in underlying data . for example , a workload may be authorized by policy to use ticap resources during weekdays but not weekends . thus , a visual display generated for a weekend period would show that specific workload without a ticap authorization icon . similarly , when a specific workload is actually using a ticap resource , the visual display would include an icon indicating ticap resources in use . many other variations of the icons , and other data presented on the visual display , are possible . upon viewing the status indications 264 and the active policies 263 , the computer system user may decide to change the policies that pertain to a specific workload . note that the user interface 260 may display conditions for a current computing interval or a future computing interval , or both . in addition , the computer system user may access similar displays for any prior computing interval . fig4 is a flowchart illustrating an exemplary operation 300 executed by the wlms 200 to allow monitoring and control of computing resources in the computer system 100 . more particularly , the operation 300 is directed to controlling processor utilization within the computer system 100 . the wlms 200 may execute other operations for controlling processor resources or for controlling resources in the computer system 100 other than processors . the operation 300 may execute on a continuous or periodic basis . as shown in block 310 , the operation 300 begins a monitoring / control “ cycle ” by sampling information from each workload executing on the computer system 100 and each resource being consumed by the active workloads . such sampling can use either a “ push ” or a “ pull ” methodology , whereby information periodically and automatically is sent from the workloads and the resources to the wlms 200 , or whereby information is sent to the wlms 200 in response to a query or polling command initiated by the wlms 200 . once the requisite information is at the wlms 200 , for each workload , the wlms 200 determines current processor utilization ( block 315 ). in block 320 , for each workload , the wlms 200 predicts processor utilization for the next computer interval . in block 325 , the wlms 200 identifies assigned policies for each workload , and in block 330 , determines from the identified and assigned policies , which policy ( s ) are active for each workload . in block 335 , the wlms 200 determines for each workload if that workload &# 39 ; s predicted processor utilization will meet the requirements of the workload &# 39 ; s active policy ( s ). that is , a workload &# 39 ; s predicted processor utilization could exceed that which can be supplied by the processors the workload currently is using , or the predicted workload could be sufficiently reduced such that one or more processors can be reassigned away from the workload . if the predicted processor utilization for all active workloads will conform to the active policies , the operation 300 moves to block 340 . in block 340 , the wlms 200 generates an update to the user interface 260 to provide the computer system used with a real time or near real time indication of the predicted requirements for resource allocation among the workloads . the visual display will also be updated to reflect iconic values to indicate which of the workloads is authorized to use ticap resources , for example , and an indication of current and future ( predicted ) ticap resource expenditures . using the information provided with the visual display , the computer system user can : 1 ) obtain a dynamic record of computer system operations and expenditures , and 2 ) make policy adjustments to change the predicted resource allocations . if the predicted processor utilization for one or more workloads will not conform to the workload &# 39 ; s active policy ( s ), the operation 300 moves to block 345 and the wlms 200 determines if the affected active workload can borrow processor resources from the non - instant capacity processors ( i . e ., the processors 120 ) that are not in use , or are not operating at their specified maximum capacity . the determination of borrowing is made , for example , on a specific policy that identifies a minimum , owned , and maximum processor assignment for the workload . in this example , if the workload owns two processors and has a maximum assignable number of four processors , then the workload may borrow up to two more processors to meet its predicted processor utilization requirements . if in block 345 , the workload cannot borrow any additional processors , the operation 300 moves to block 340 , and resource expenditure and workload operation is presented to the user in real time or near real time by way of the user interface 260 , or a similar interface . however , if in block 345 the workload can borrow additional processors , the operation 300 moves to block 350 . in block 350 , the wlms 200 determines if there are any processors available to the workload to borrow to meet its predicted processor utilization requirements . if there are non - instant capacity processors available , the operation 300 moves to block 355 and the non - utilized processors are assigned to the workload . the operation 300 then moves to block 340 . if , however , there are no non - instant capacity processors available , the operation moves to block 360 . in block 360 , the wlms 200 determines if the workload can be assigned an instant capacity processor , and if such an instant capacity processor is available for assignment . if the workload cannot be assigned an instant capacity processor , or if none are available , the operation 300 moves to block 340 . if the workload can be assigned an instant capacity processor , and if one or more are available , the operation 300 moves to block 365 and the ticap system 150 assigns the instant capacity processor to the workload . the operation 300 then moves to block 340 and the wlms 200 produces information for display to the computer system user by way of the user interface 260 , or a similar interface . the various disclosed embodiments may be implemented as a method , system , and / or apparatus . as one example , exemplary embodiments are implemented as one or more computer software programs to implement the methods described herein . the software is implemented as one or more modules ( also referred to as code subroutines , or “ objects ” in object - oriented programming ). the location of the software will differ for the various alternative embodiments . the software programming code , for example , is accessed by a processor or processors of the computer or server from long - term storage media of some type , such as a cd - rom drive or hard drive . the software programming code is embodied or stored on any of a variety of known media for use with a data processing system or in any memory device such as semiconductor , magnetic and optical devices , including a disk , hard drive , cd - rom , rom , etc . the code is distributed on such media , or is distributed to users from the memory or storage of one computer system over a network of some type to other computer systems for use by users of such other systems . alternatively , the programming code is embodied in the memory ( such as memory of a handheld portable electronic device ) and accessed by a processor using a bus . the techniques and methods for embodying software programming code in memory , on physical media , and / or distributing software code via networks are well known and will not be further discussed herein . the terms and descriptions used herein are set forth by way of illustration only and are not meant as limitations . those skilled in the art will recognize that many variations are possible within the spirit and scope of the invention as defined in the following claims , and their equivalents , in which all terms are to be understood in their broadest possible sense unless otherwise indicated .

6Physics

the following description is presented to enable any person skilled in the art to make and use the embodiments , and is provided in the context of a particular application and its requirements . various modifications to the disclosed embodiments will be readily apparent to those skilled in the art , and the general principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the present disclosure . thus , the present invention is not limited to the embodiments shown , but is to be accorded the widest scope consistent with the principles and features disclosed herein . the data structures and code described in this detailed description are typically stored on a computer - readable storage medium , which may be any device or medium that can store code and / or data for use by a computer system . the computer - readable storage medium includes , but is not limited to , volatile memory , non - volatile memory , magnetic and optical storage devices such as disk drives , magnetic tape , cds ( compact discs ), dvds ( digital versatile discs or digital video discs ), or other media now known or later developed that is capable of storing code and / or data for use by a computer system . the methods and processes described in the detailed description section can be embodied as code and / or data , which can be stored in a computer - readable storage medium as described above . when a computer system reads and executes the code and / or data stored on the computer - readable storage medium , the computer system performs the methods and processes embodied as data structures and code and stored within the computer - readable storage medium . furthermore , the methods and processes described below can be included in hardware modules . for example , the hardware modules can include , but are not limited to , application - specific integrated circuit ( asic ) chips , field - programmable gate arrays ( fpgas ), and other programmable - logic devices now known or later developed . when the hardware modules are activated , the hardware modules perform the methods and processes included within the hardware modules . fig1 illustrates a system that generates a training data set for a pattern - recognition model for electronic prognostication for a computer system in accordance with an embodiment . set of computer systems 100 includes n computer systems ; for simplicity , only three of the n computer systems , computer system 102 a , computer system 102 b , and computer system 102 n , are depicted . additionally , computer systems in set of computer system 100 are coupled to network 104 along with black - box recorder 106 and training - data - set generator 108 . each computer system in set of computer systems 100 can include but is not limited to a server , a server blade , a datacenter server , an enterprise computer , a field - replaceable unit that includes a processor , or any other computation system . in some embodiments , computer systems in set of computer systems 100 reside at different physical locations . note that in some embodiments , set of computer systems 100 includes at least two computer systems . network 104 can include any system that allows computers to communicate with each other , including but not limited to any combination of one or more of the following computer networks : an intranet , an extranet , and / or the internet . note that any of the networks can include one or more wireless links . black - box recorder 106 can include any mechanism that can store information related to performance parameters from computer systems in set of computer systems 100 . black - box recorder 106 can be implemented in any combination of hardware and software . in some embodiments , black - box recorder 106 operates on a computer system such as a server . in other embodiments , black - box recorder 106 operates on one or more dedicated stand - alone processors , such as a service processor , located inside one or more computer systems in set of computer system 100 . in some embodiments , black - box recorder 106 operates on a computer system in set of computer systems 100 . in some embodiments , black - box recorder 106 is co - located with one or more computer systems in set of computer systems 100 . in some embodiments , black - box recorder 106 is located separately from all computers in set of computer systems 100 . in some embodiments black - box recorder 106 is located at a computer system vendor &# 39 ; s data center . in some embodiments , each computer system in set of computer systems 100 includes a performance - parameter monitor . a performance - parameter monitor can be implemented in any combination of hardware and software . in some embodiments , a performance - parameter monitor operates on the computer system it is monitoring . in other embodiments , a performance - parameter monitor operates on one or more service processors . in still other embodiments , a performance - parameter monitor operates on a separate computer system which can include black - box recorder 106 . in some embodiments , a performance - parameter monitor operates on one computer system in set of computer systems 100 and monitors performance parameters for one or more computer systems in set of computer systems 100 . in some embodiments , a performance - parameter monitor includes a method or apparatus for monitoring and recording computer system performance parameters as set forth in u . s . pat . no . 7 , 020 , 802 , entitled “ method and apparatus for monitoring and recording computer system performance parameters ,” by kenny c . gross and larry g . votta , jr ., issued on mar . 28 , 2006 , which is hereby fully incorporated by reference . the monitored performance parameters can include but are not limited to one or more of the following : temperature information or other environmental variables ( such as relative humidity , cumulative or differential vibrations within the computer system , electromagnetic signals , acoustic signals , current noise , voltage noise , and / or time - domain reflectometry readings ), energy consumption , currents , voltages , fan speeds , performance metrics , throughput variables , transaction latencies , queue lengths , loads on one or more processors or processor cores , loads on memory , loads on a cache , i / o traffic , bus saturation metrics , fifo overflow statistics , various operational profiles gathered through ‘ virtual sensors ’ located within an operating system in the monitored computer system , telemetry signals associated with canary performance parameters for synthetic user transactions which are periodically generated for the purpose of measuring quality of service from the end user &# 39 ; s perspective , time series of any performance parameter , and any other parameter that is or may be related to the performance of the monitored computer system . performance parameters can also include but are not limited to performance parameters as set forth in u . s . pat . no . 7 , 020 , 802 . training - data - set generator 108 can include any mechanism that receives monitored performance parameters related to two or more computer systems in set of computer systems 100 and generates a training data set in accordance with embodiments of the present invention . training - data - set generator 108 can be implemented in any combination of hardware and software . in some embodiments , training - data - set generator 108 operates on a computer system such as a server . in other embodiments , training - data - set generator 108 operates on one or more service processors . in some embodiments , training - data - set generator 108 operates on a computer system in set of computer systems 100 . in some embodiments , training - data - set generator 108 is co - located with one or more computer systems in set of computer systems 100 . in some embodiments , training - data - set generator 108 is located separately from all computers in set of computer systems 100 . in some embodiments training - data - set generator 108 is located at a computer system vendor &# 39 ; s data center . some embodiments of the present invention operate as follows . during operation of computer systems in set of computer systems 100 , performance parameters are monitored from two or more computer systems in set of computer systems 100 . in some embodiments , the performance parameters are monitored by performance parameter monitors operating in the computer system being monitored , while in other embodiments the performance parameters are monitored by a performance parameter monitor operating on black - box recorder 106 . note that the performance parameters monitored from computer systems in set of computer systems 100 may be monitored simultaneously , at different times , over different time periods , or over predetermined operation modes or time periods for one or more selected computer systems in set of computer systems 100 . for example , the performance parameters monitored from computer system 102 a may be monitored and stored in black - box recorder 106 for operation of computer system 102 a over a predetermined time period while the performance parameters monitored from computer systems 102 b and 102 n are monitored over other predetermined time periods . the predetermined time periods may be selected based on any parameters desired , including but not limited to one or more of : the time of day , day of the week , load profiles on one or more computer systems in set of computer systems 100 , or any other operation mode , timing , or parameters desired . additionally , in some embodiments , performance parameter monitors operating on one or more of the computer systems in set of computer systems 100 send the monitored performance parameters to black - box recorder 106 at regular intervals or when polled by black - box recorder 106 . training - data - set generator 108 then signals black - box recorder 106 to send performance parameters from two or more computer systems in set of computer systems 100 . in some embodiments , training - data - set generator 108 determines which computer systems from set of computer systems 100 to retrieve performance parameters for , and for which time periods based on the computer system that training - data - set generator 108 is generating the training data set for . for example , training - data - set generator 108 may select monitored performance parameters from black - box recorder 106 based on one or more of the following : the type , configuration , and operation mode of the computer systems for which the performance parameters were monitored . specifically , in some embodiments , training - data - set generator selects performance parameters monitored from computer systems in set of computer systems 100 that are the same model and configuration as the computer system the training data set is being generated for . additionally , training - data - set generator 108 may select performance parameters monitored from computer systems that operated in different parts of a ten - day operation period , or in different operation modes that span a desired range of operation modes . training - data - set generator 108 then generates a training data set based on the performance parameters received from black - box recorder 106 . in some embodiments , training - data - set generator 108 generates the training data set from the monitored performance parameters by concatenating the time - series of the performance parameters received from black - box recorder 106 . this process is illustrated with reference to fig2 and 3 below . note that in some embodiments , the training data set is generated from performance parameters monitored from at least two computer systems . for example , the training data set may be generated by concatenating the time - series of monitored performance parameters from 100 or more computer systems in set of computer systems 100 . fig2 a presents a histogram of a performance parameter , ambient temperature , monitored from one computer system over a predetermined time period in accordance with an embodiment . fig2 b presents a histogram displaying the ambient temperature monitored from three computer systems in accordance with an embodiment . note that the histograms from each of the three computer systems , a , b , and c , overlap at some temperatures but are not identical . for example , during the normal operation of each of the computer systems , the distribution of the most commonly occurring temperatures was different for each of the three computer systems . fig2 c presents a histogram that combines the histograms from each of the three computer systems and represents the histogram of the training data set generated by training - data - set generator 108 using the process discussed below . fig3 a presents a time - series of the ambient temperature performance parameter monitored from one of the computer systems and recorded by black - box recorder 106 . note that the time - series of ambient temperature is shown over the course of almost 100 , 000 equally spaced observations of the ambient temperature data . training - data - set generator 108 receives the time - series of monitored ambient temperature from each of the three computer systems and concatenates them to generate the training data set . fig3 b presents a graph showing the concatenation of the time - series of the monitored ambient temperatures from the three computer systems . this concatenated data forms the training data set and can be used to train a pattern - recognition model for electronic prognostication of a computer system . note that the time - series of monitored ambient temperatures from the three computer systems may be concatenated in any order . additionally in some embodiments , portions of the time - series from each computer system may be concatenated in any order to generate the training data set . for example , the time - series of the monitored ambient temperatures from each computer system may be separated into multiple parts and the parts may be concatenated in any order to generate the training data set . fig4 illustrates a system that trains a pattern - recognition model for electronic prognostication for a computer system in accordance with an embodiment . fig4 includes set of computer systems 100 , with three computer systems ( computer system 102 a , computer system 102 b , and computer system 102 n ) depicted . additionally , computer systems in set of computer systems 100 are connected to network 104 along with black - box recorder 106 and model - training module 400 . note that model - training module 400 includes training - data - set generator 108 and pattern - recognition - model - training mechanism 402 . pattern - recognition - model - training mechanism 402 can include any mechanism that can train a pattern - recognition model using the training data set generated by training - data - set generator 108 in accordance with embodiments of the present invention . pattern - recognition - model - training mechanism 402 can be implemented in any combination of hardware and software . in some embodiments , pattern - recognition - model - training mechanism 402 operates on a computer system such as a server . in other embodiments , pattern - recognition - model - training mechanism 402 operates on one or more service processors . in some embodiments , pattern - recognition - model - training mechanism 402 operates on a computer system in set of computer systems 100 . in some embodiments , pattern - recognition - model - training mechanism 402 is co - located with one or more computer systems in set of computer systems 100 . in some embodiments , pattern - recognition - model - training mechanism 402 is located separately from all computers in set of computer systems 100 . in some embodiments , pattern - recognition - model - training mechanism 402 and training - data - set generator 108 operate on the same computer system . in some embodiments , pattern - recognition - model - training mechanism 402 is located at a computer system vendor &# 39 ; s data center . some embodiments operate as follows . training - data - set generator 108 operates as described above . the training data set generated by training - data - set generator 108 is communicated to pattern - recognition - model - training mechanism 402 . pattern - recognition - model - training mechanism 402 then uses the training data set to train a pattern - recognition model for use in electronic prognostication of a computer system . note that the computer system the pattern - recognition model is trained to be used with may be a computer system in set of computer systems 100 , and may be one of the computer systems used to generate the training data set . furthermore , note that the pattern - recognition model trained by pattern - recognition - model - training mechanism 402 can include but is not limited to a nonlinear , nonparametric regression model and can include the use of a multivariate state estimation technique ( mset ). the term “ mset ” as used in this specification refers to a class of pattern - recognition algorithms . for example , see [ gribok ] “ use of kernel based techniques for sensor validation in nuclear power plants ,” by andrei v . gribok , j . wesley hines , and robert e . uhrig , the third american nuclear society international topical meeting on nuclear plant instrumentation and control and human - machine interface technologies , washington , d . c ., nov . 13 - 17 , 2000 . this paper outlines several different pattern - recognition approaches . hence , the term “ mset ” as used in this specification can refer to ( among other things ) any technique outlined in [ gribok ], including ordinary least squares ( ols ), support vector machines ( svm ), artificial neural networks ( anns ), mset , or regularized mset ( rmset ). note that the pattern - recognition model can be built for any type of electronic prognostication for a computer system including but not limited to one or more of the purposes described in : u . s . patent application entitled “ computer system with integrated electromagnetic - interference detectors ,” by steven f . zwinger , kenny c . gross , and aleksey m . urmanov , attorney docket no . sun08 - 0117 , ser . no . 12 / 132 , 878 filed on 4 jun . 2008 , which is hereby fully incorporated by reference ; u . s . patent application entitled “ characterizing a computer system using radiating electromagnetic signals monitored by an interface ,” by andrew j . lewis , kenny c . gross , aleksey m . urmanov , and ramakrishna c . dhanekula , attorney docket no . sun08 - 0415 , ser . no . 12 / 177 , 724 filed on 22 jul . 2008 , which is hereby fully incorporated by reference ; u . s . patent application entitled “ generating a utilization charge for a computer system ,” by kalyanaraman vaidyanathan , steven f . zwinger , kenny c . gross and aleksey m . urmanov , attorney docket no . sun08 - 0774 , ser . no . 12 / 269 , 575 filed on 12 nov . 2008 , which is hereby fully incorporated by reference ; and u . s . patent application entitled “ estimating relative humidity inside a computer system ,” by leoncio d . lopez , kenny c . gross , and kalyanaraman vaidyanathan , attorney docket no . sun07 - 0844 , ser . no . 12 / 114 , 363 filed on 2 may 2008 , which is hereby fully incorporated by reference . fig5 a presents experimental results from electronic prognostication of a computer system in which temperature estimates are generated using an mset model trained based on a training data set generated from temperature data monitored from only one computer system in accordance with an embodiment . additionally , fig5 a presents sequential probability ratio test ( sprt ) alarms generated based on the mset estimates in accordance with an embodiment . note that the computer system being monitored in fig5 a is functioning normally and no alarms should be generated . the mset model used to generate the estimates of the ambient temperature of the computer system in fig5 a was trained using the performance parameter time - series data from only one computer system as depicted in fig3 a . the time - series of the performance parameter monitored from only computer system b ( as depicted in the time - series of fig3 a and the histogram of ambient temperatures in fig2 a ) does not represent the full operating ambient temperature range of the monitored computer system in fig5 a . the sprt generates false alarms as the ambient temperature monitored from the computer system goes outside the range of the training data monitored from computer system b , for example , at observation points in the range from just above observation point 1500 to approximately observation point 2000 in fig5 a . fig5 b presents experimental results from electronic prognostication of a computer system in which temperature estimates are generated using an mset model trained based on a training data set generated from temperature data monitored from three computer systems in accordance with an embodiment . additionally , fig5 b presents sprt alarms generated based on the mset estimates in accordance with an embodiment . the computer system being monitored in fig5 b is functioning normally and no alarms should be generated . the mset model used to generate the estimates of the ambient temperature of the computer system in fig5 b was trained using the performance parameter time - series data from three computer system as depicted in fig3 b . the time - series of the performance parameter monitored from the three computer systems a , b , and c ( as depicted in the time - series of fig3 b and the histogram of fig2 c ) includes the full operating range of the monitored computer system in fig5 a , and no false sprt alarms are generated , as the ambient temperature monitored from the computer system does not go outside the range of the training data . fig6 a presents another set of experimental results from electronic prognostication of a computer system in which temperature estimates are generated using an mset model trained based on a training data set generated from temperature data monitored from only one computer system in accordance with an embodiment . additionally , fig6 a presents sprt alarms generated based on the mset estimates in accordance with an embodiment . note that as in fig5 a , when the pattern - recognition model is trained with data from only one computer system and the normal operation range of the monitored computer system goes outside the data from the one system , then false alarms are generated by the electronic prognostication system . fig6 b presents experimental results from electronic prognostication of a computer system in which temperature estimates are generated using an mset model trained based on a training data set generated from temperature data monitored from three computer systems in accordance with an embodiment . additionally , fig6 b presents sprt alarms generated based on the mset estimates in accordance with an embodiment . note that no false alarms are generated when the pattern - recognition model is trained with performance parameter data from the three computer systems since the operating range of the three computer systems includes the normal operating range of the monitored computer system . fig7 presents a flowchart illustrating the process for training a pattern - recognition model for electronic prognostication for a computer system in accordance with an embodiment . first , the system monitors performance parameter data from a set of computer systems of the same type and configuration as the computer system that is going to be monitored by the pattern - recognition model to be trained ( step 702 ). the performance parameter data is pre - processed using analytical resampling , if necessary ( step 704 ). the analytical resampling may remove outlier and flat data , and resample the data so that there is a uniform sampling rate through the entire data set . note that many pattern - recognition models , including those using mset , may require uniformly sampled data . the system then generates a training data set from the performance parameter data monitored from the set of computer systems ( step 706 ). in some embodiments , the training data set is generated from the monitored performance parameter data by concatenating time - series of monitored performance parameter data as discussed above . note that the order of execution of step 704 and step 706 can be reversed in some embodiments . then , the system uses the training data set to train a pattern - recognition model for electronic prognostication of a computer system ( step 708 ). the foregoing descriptions of various embodiments have been presented only for purposes of illustration and description . they are not intended to be exhaustive or to limit the present invention to the forms disclosed . accordingly , many modifications and variations will be apparent to practitioners skilled in the art . additionally , the above disclosure is not intended to limit the present invention .

6Physics

preferred embodiments of the present invention will hereinafter be described with reference to the drawings . fig7 is a diagram showing a delay buffer circuit as a delay circuit using a delay inverter circuit that delays depending on merely the characteristic of pch tr according to an embodiment of the present invention . a delay buffer circuit using a delay inverter will hereinafter be used as an example to facilitate description of the present invention . a delay buffer circuit 40 according to the present embodiment has a first to a fourth p - channel mos transistor qp 41 to qp 44 and a first and a second n - channel mos transistor qn 41 and qn 42 . at this time , a delay inverter circuit inv 41 has the p - channel mos transistors qp 42 to qp 44 and the n - channel mos transistor qn 42 . a circuit input in is connected to the gates of the transistors qp 41 and qn 41 , and is also connected to the gates of the transistors qp 43 and qp 44 in a next stage . the output of an inverter formed by the transistors qp 41 and qn 41 will be referred to as a node nda . the node nda is connected to the gates of the transistors qp 42 and qn 42 . the sources of the transistors qp 41 and qp 42 are connected to a positive side power supply vdd ( hereinafter described as a vdd power supply ). the sources of the transistors qn 41 and qn 42 and the drain of the transistor qp 44 are connected to a negative side power supply vss ( hereinafter described as a vss power supply ). the source of the transistor qp 43 is connected to the drain of the transistor qp 42 , where a circuit output signal out is derived . the drain of the transistor qp 43 is connected to the drain of the transistor qn 42 and the source of the transistor qp 44 . a point of connection where the drain of the transistor qp 43 is connected to the drain of the transistor qn 42 and the source of the transistor qp 44 will be referred to as a node ndb . considering a typical cmos inverter ( fig1 ) as a base , in the present embodiment , the p - channel transistors qp 43 and qp 44 as switch elements are disposed between an output part and a power supply part ( vss in this case ). fig8 is a timing chart of assistance in explaining the operation of the delay buffer circuit shown in fig7 . in period t 41 , the transistor qp 41 is turned on at a point in time that vdd −| vpth | is reached when a circuit input signal in starts changing from a vdd level to a vss level . the potential of the node nda is raised from the vss level , and at the same time , the transistors qp 43 and qp 44 are similarly turned on . the node ndb and an out potential are thus short - circuited . the potential of the node ndb is raised to the potential of the output signal out while a discharge to the vss power supply is performed . this period t 41 will be referred to as a step 1 discharge period . in next period t 42 , when the input signal in is lowered to the vss level , the node ndb and the output signal out are short - circuited , and thus the node ndb is vss +| vpth | at the lowest ( the on resistance of the transistor qp 43 is set sufficiently lower than the on resistance of a cmos switch formed by the transistors qn 42 and qp 44 ). because the node nda is at the vdd level , the transistor qn 42 is turned on , and the potential of the node ndb continues being further lowered to the vss level . there are some parasitic capacitances ( for example the gate - to - drain capacitance cgd of the transistor qp 43 and the gate - to - source capacitance cgs of the transistor qp 44 ) between the input signal in and the node ndb . subjected to the coupling of these parasitic capacitances , the potential of the input signal in is lowered to a potential lower than the vss level . in addition , due to the source - to - drain capacitance csd of the transistor qp 43 , the output out is also lowered by a change in potential of the node ndb . similarly , the input signal in is lowered due to the source - to - drain capacitance csd of a transistor in an output part in a preceding stage . suppose that an amount by which the input signal in is lowered is δv . it can be said that δv depends on merely a p - channel transistor characteristic . this period t 42 will be referred to as a step 2 discharge period . according to the above description , by providing the step 1 and step 2 discharge periods in two stages , a delay in the falling timing of the output signal out with respect to the falling timing of the input signal in can be made substantially dependent on merely the characteristic of the p - channel transistor . in period t 43 , the transistor qn 41 is turned on when a level of vss +| vnth | is reached while the input signal in is changing from the vss level to the vdd level . the node nda is thereby lowered . when the potential of the node nda is lowered to a level of vdd −| vpth |, the transistor qp 42 is turned on , and the output out is thereby raised . hence , an amount of delay in the rising timing of the output signal out with respect to the rising timing of the input signal in depends on the characteristics of both pch tr and nch tr . however , this does not present a problem , because an amount of delay in the falling timing is dependent on merely the characteristic of one transistor , and is thus sufficient to detect the characteristic of the transistor formed on an insulative substrate . fig9 is a diagram showing a delay buffer circuit that delays depending on merely the characteristic of nch tr according to a second embodiment of the present invention . a delay buffer circuit 50 according to the present embodiment has a first to a fourth n - channel mos transistor qn 51 to qn 54 and a first and a second p - channel mos transistor qp 51 and qp 52 . at this time , a delay inverter circuit inv 51 has the n - channel mos transistors qn 52 to qn 54 and the p - channel mos transistor qp 52 . a circuit input in is connected to the gates of the transistors qn 51 and qp 51 , and is also connected to the gates of the transistors qn 53 and qn 54 in a next stage . the output of an inverter formed by the transistors qn 51 and qp 51 will be referred to as a node nda . the node nda is connected to the gates of the transistors qn 52 and qp 52 . the sources of the transistors qn 51 and qn 52 are connected to a negative side power supply vss . the sources of the transistors qp 51 and qp 52 and the drain of the transistor qn 54 are connected to a positive side power supply vdd . the source of the transistor qn 53 is connected to the drain of the transistor qn 52 , where a circuit output signal out is derived . the drain of the transistor qn 53 is connected to the drain of the transistor qp 52 and the source of the transistor qn 54 . a point of connection where the drain of the transistor qn 53 is connected to the drain of the transistor qp 52 and the source of the transistor qn 54 will be referred to as a node ndb . fig1 is a timing chart of assistance in explaining the operation of the delay buffer circuit shown in fig9 . in period t 51 , the transistor qn 51 is turned on at a point in time that vss +| vnth | is reached when a circuit input signal in starts changing from a vss level to a vdd level . the potential of the node nda is lowered from the vdd level , and at the same time , the transistors qn 53 and qn 54 are similarly turned on . the node ndb and an out potential are thus short - circuited . the potential of the node ndb is lowered to the potential of the output signal out while a charge from the vdd power supply is performed . this period t 51 will be referred to as a step 11 charge period . in next period t 52 , when the input signal in is raised to the vdd level , the node ndb and the output signal out are short - circuited , and thus the potential of the node . ndb is vdd −| vnth | at the highest ( the on resistance of the transistor qn 53 is set sufficiently lower than the on resistance of a cmos switch formed by the transistors qn 54 and qp 52 ). because the node nda is at the vss level , the transistor qp 52 is turned on , and the potential of the node ndb continues being further raised to the vdd level . there are some parasitic capacitances ( for example the gate - to - drain capacitance cgd of the transistor qn 53 and the gate - to - source capacitance cgs of the transistor qn 54 ) between the input signal in and the node ndb . subjected to the coupling of these parasitic capacitances , the potential of the input signal in is raised to a potential higher than the vdd level . in addition , due to the source - to - drain capacitance csd of the transistor qn 53 , the output out is also raised by a change in potential of the node ndb . similarly , the input signal in is raised due to the source - to - drain capacitance csd of a transistor in an output part in a preceding stage . suppose that an amount by which the input signal in is raised is δv . it can be said that δv depends on merely an n - channel transistor characteristic . this period t 52 will be referred to as a step 21 charge period . thus , by providing the step 11 and step 12 charge periods , a delay in the rising timing of the output signal out with respect to the rising timing of the input signal in can be said to be substantially dependent on merely the characteristic of the n - channel transistor . in period t 53 , the transistor qp 51 is turned on when a level of vdd −| vpth | is reached while the input signal in is changed from the vdd level to the vss level . the node nda is thereby raised . when the potential of the node nda is raised to a level of vss +| vnth |, the transistor qn 52 is turned on , and the output out is thereby lowered . hence , an amount of delay in the falling timing of the output signal out with respect to the falling timing of the input signal in depends on the characteristics of both pch tr and nch tr . however , this does not present a problem , because an amount of delay in the rising timing is dependent on merely the characteristic of one transistor , and is thus sufficient to detect the characteristic of the transistor formed on an insulative substrate . the first and second embodiments of the present invention have been described above . the delay buffer circuits that delay depending on merely a one - channel transistor characteristic irrespective of the configuration of the cmos transistor circuit can be fabricated . an example of modification will be shown on the basis of the embodiments . according to a use , when the characteristics of both a p - channel transistor and an n - channel transistor are desired to be detected , for example , a delay buffer dependent on merely the characteristic of the n - channel transistor and a delay buffer dependent on merely the characteristic of the p - channel transistor are necessary . by combining the first embodiment and the second embodiment described above , it is possible to detect the characteristics of transistors of both channel types with one delay buffer ( number of elements : eight transistors ). when the technique of the already introduced patent document 1 is used , sixteen transistors and four capacitances are necessary as elements of a buffer for both an n - channel transistor and a p - channel transistor . if m buffers are to be used , m ×( eight transistors + four capacitances ) can be omitted from a viewpoint of the number of elements . fig1 is a diagram showing a delay buffer circuit that delays depending on each of the characteristic of pch tr and the characteristic of nch tr independently , the delay buffer circuit being an example of modification of the delay buffer circuits according to the embodiments of the present invention . a delay buffer circuit 60 according to the present modification example has a first to a fourth p - channel mos transistor qp 61 to qp 64 and a first to a fourth n - channel mos transistor qn 61 to qn 64 . at this time , a delay inverter circuit inv 61 has the n - channel mos transistors qn 62 to qn 64 and the p - channel mos transistors qp 62 to qp 64 . a circuit input in is connected to the gates of the transistors qp 61 and qn 61 , and is also connected to the gates of the transistors qp 63 , qp 64 , qn 62 , and qn 63 in a next stage . the output of an inverter formed by the transistors qp 61 and qn 61 will be referred to as a node nda . the node nda is connected to the gates of the transistors qp 62 and qn 64 . the sources of the transistors qp 61 and qp 62 and the drain of the transistor qn 62 are connected to a positive side power supply vdd . the sources of the transistors qn 61 and qn 64 and the drain of the transistor qp 64 are connected to a negative side power supply vss . the source of the transistor qp 63 is connected to the source of the transistor qn 63 . the drain of the transistor qp 63 is connected to the drain of the transistor qn 64 and the source of the transistor qp 64 . a point of connection where the drain of the transistor qp 63 is connected to the drain of the transistor qn 64 and the source of the transistor qp 64 will be referred to as a node ndc . the source of the transistor qn 63 is connected to the source of the transistor qp 63 . the drain of the transistor qn 63 is connected to the drain of the transistor qp 62 and the source of the transistor qn 62 . a point of connection where the drain of the transistor qn 63 is connected to the drain of the transistor qp 62 and the source of the transistor qn 62 will be referred to as a node ndb . a circuit output signal terminal out is wiring connecting the source of the transistor qn 63 and the source of the transistor qp 63 to each other . fig1 is a timing chart of assistance in explaining the operation of the delay buffer circuit shown in fig1 . in period t 61 , the transistor qp 61 is turned on at a point in time that vdd | vpth | is reached when a circuit input signal in starts changing from a vdd level to a vss level . the potential of the node nda is raised from the vss level , and at the same time , the transistors qp 63 and qp 64 are similarly turned on . the node ndc and an out potential are thus short - circuited . the potential of the node ndc is raised to the potential of the output signal out while a discharge to the vss power supply is performed . this period t 61 will be referred to as a step 21 discharge period . in next period t 62 , when the input signal in is lowered to the vss level , the node ndc and the output signal out are short - circuited , and thus the node ndc is vss +| vpth | at the lowest ( the on resistance of the transistor qp 63 is set sufficiently lower than the on resistance of a cmos switch formed by the transistors qn 64 and qp 64 ). because the node nda is at the vdd level , the transistor qn 64 is turned on , and the potential of the node ndc continues being further lowered to the vss level . there are some parasitic capacitances ( for example the gate - to - drain capacitance cgd of the transistor qp 63 and the gate - to - source capacitance cgs of the transistor . qp 64 ) between the input signal in and the node ndc . subjected to the coupling of these parasitic capacitances , the potential of the input signal in is lowered to a potential lower than the vss level . in addition , due to the source - to - drain capacitance csd of the transistor qp 63 , the output out is also lowered by a change in potential of the node ndc . similarly , the input signal in is lowered due to the source - to - drain capacitance csd of a transistor in an output part in a preceding stage . suppose that an amount by which the input signal in is lowered is δv 1 . it can be said that 1 v 1 depends on merely a p - channel transistor characteristic . this period t 62 will be referred to as a step 22 discharge period . thus , by providing the step 21 and step 22 discharge periods , a delay in the falling timing of the output signal out with respect to the falling timing of the input signal in can be said to be substantially dependent on merely the characteristic of the p - channel transistor . period t 63 is a period in which the state of the potentials changed in period t 62 is maintained . the input signal in is vss − δv 1 ( δv 1 & gt ; 0 ). the node nda is at the vdd level . the node ndc is at the vss level . the output signal out is vss − δv 1 ( δv 1 & gt ; 0 ). in period t 64 , the transistor qn 61 is turned on at a point in time that vss +| vnth | is reached when the circuit input signal in starts changing from the vss level to the vdd level . the potential of the node nda is lowered from the vdd level , and at the same time , the transistors qn 63 and qn 64 are similarly turned on . the node ndb and the out potential are thus short - circuited . the potential of the node ndb is lowered to the potential of the output signal out while a charge from the vdd power supply is performed . this period t 64 will be referred to as a step 31 charge period . in next period t 65 , when the input signal in is raised to the vdd level , the node ndb and the output signal out are short - circuited , and thus the potential of the node ndb is vdd −| vnth | at the highest ( the on resistance of the transistor qn 63 is set sufficiently lower than the on resistance of a cmos switch formed by the transistors qn 62 and qp 62 ). because the node nda is at the vss level , the transistor qp 62 is turned on , and the potential of the node ndb continues being further raised to the vdd level . there are some parasitic capacitances ( for example the gate - to - drain capacitance cgd of the transistor qn 63 and the gate - to - source capacitance cgs of the transistor qn 62 ) between the input signal in and the node ndb . subjected to the coupling of these parasitic capacitances , the potential of the input signal in is raised to a potential higher than the vdd level . in addition , due to the source - to - drain capacitance csd of the transistor qn 63 , the output out is also raised by a change in potential of the node ndb . similarly , the input signal in is raised due to the source - to - drain capacitance csd of a transistor in an output part in a preceding stage . suppose that an amount by which the input signal in is raised is δv 2 . it can be said that δv 2 depends on merely an n - channel transistor characteristic . this period t 65 will be referred to as a step 32 charge period . thus , by providing the step 31 and step 32 charge periods , a delay in the rising timing of the output signal out with respect to the rising timing of the input signal in can be said to be substantially dependeht on merely the characteristic of the n - channel transistor . the example of modification described above is a delay buffer that can detect the respective characteristics of a p - channel transistor and an n - channel transistor as one delay buffer and represent the respective characteristics of the p - channel transistor and the n - channel transistor as amounts of delay . a simple configuration , a small layout area , a delay inverter circuit having a characteristic of delaying depending on merely one transistor type ( pch tr or nch tr ), and a case of using the delay inverter in a delay buffer according to the embodiment of the present invention have been described as an example . however , the embodiment of the present invention is not limited to this . the embodiment of the present invention is applicable to circuits in general that do not delay depending on merely the characteristic of one transistor in circuit operation as well as to the delay buffer according to the embodiment of the present invention . in addition , the embodiment of the present invention is not limited to a circuit using polysilicon formed on an insulating substrate . the embodiment of the present invention is applicable to circuits in general that use defective silicon . as described above , according to the present embodiment , a plurality of switch elements are inserted between an output part and a power supply , and an output potential is discharged ( charged ) in two stages by these switch elements . as a result , it is possible to achieve a simple circuit configuration , space saving , and high accuracy because capacitances known to have large variations are not used . in addition , because a delay can be produced depending on merely the characteristic of one transistor , there are many and various applications such for example as an application in which the transistor characteristic of a circuit formed on a same insulating substrate is detected and fed back to a power supply voltage and all control signals , and the control signals respond with variations in the transistor characteristic . therefore an improvement in yield ( reduction in cost ), an improvement in performance ( high reliability ) and the like can be expected . description will next be made of a semiconductor control circuit that can employ a delay buffer circuit ( delay circuit ) as described above and which is formed on an insulating substrate of a display device integral with a driving circuit . as described above , in a polysilicon process or an amorphous silicon process for tfts formed on an insulating substrate of a display device integral with a driving circuit , variations in transistor characteristics such as threshold voltage vth , mobility μ and the like are larger than in a single - crystal process . thus , in making a design , transistor size is increased or the level of driving power supply voltage is raised to secure a sufficient operating margin for the large variations . thus , for example an increase in power consumption and a large frame due to the large transistor size become a problem . a semiconductor control circuit that makes it possible to achieve a reduced power consumption and a narrow frame at the same time by accommodating the variations and reducing the margin as much as possible will be described as present embodiment . fig1 is a diagram showing a general configuration of a display device integral with a driving circuit . as shown in fig1 , this liquid crystal display device 100 is formed by integrating , on a transparent insulating substrate , for example a glass substrate 101 , an effective display section 102 in which a plurality of pixels including a liquid crystal cell are arranged in the form of a matrix , a pair of horizontal driving circuits ( h drivers ) 103 u and 103 d arranged on an upper side and a lower side of the effective display section 102 in fig1 , a vertical driving circuit ( v driver ) 104 disposed on a side of the effective display section 102 in fig1 , one reference voltage generating circuit 105 for generating a plurality of reference voltages , a data processing circuit 106 , a semiconductor control circuit 200 and the like . thus , the driving circuit - integrated display device 100 of fig1 has the two horizontal driving circuits 103 u and 103 d arranged on both sides ( the upper side and the lower side in fig1 ) of the effective display section 102 . this is to drive odd - numbered lines and even - numbered lines of data lines separately from each other . while fig1 shows the semiconductor control circuit 200 provided separately from the other circuits , the reference voltage generating circuit 105 and the data processing circuit 106 can be applied as circuits to be controlled by the semiconductor control circuit 200 to be described below . the configuration and functions of the semiconductor control circuit 200 will be described in the following . fig1 is a block diagram showing the configuration of a semiconductor control circuit according to an embodiment of the present invention . as shown in fig1 , the semiconductor control circuit 200 includes a timing generating circuit 210 , a delay circuit 220 , a sampling circuit 230 , a hysteresis characteristic generating circuit 240 , and a control object circuit 250 . in the semiconductor control circuit 200 , a detection pulse dpls generated from the timing generating circuit 210 is input as a reference pulse refp to the delay circuit 220 and the phase - frequency comparing circuit ( that is for example a sampling circuit , and which circuit will hereinafter be referred to as a “ sampling circuit ”) 230 . delayed signals s 23 and s 24 as output signals of the delay circuit 220 are each sampled , and then signals s 21 and s 22 are output . the signals s 21 and s 22 are passed through the hysteresis characteristic generating circuit 240 , and then a sampled waveform having a hysteresis characteristic is sent as a control signal to various control object circuits 250 . a general driving concept will first be described . fig1 is a timing chart of the semiconductor control circuit of fig1 . the detection pulse dpls generated by the timing generating circuit 210 is input to the delay circuit 220 . for example , in a case where a sampling trigger is a falling edge of a reference signal , when transistor characteristics ( voltage vth , drain - to - source current and the like ) are good , the delayed signals have small amounts of delay , and the sampled signals s 21 and s 22 are at a high level . suppose in this case that the number of delay buffers within the delay circuit 220 through which the delayed signal s 23 is passed is larger than the number of delay buffers for the signal s 24 . a hysteresis characteristic is provided to control by using a difference between the numbers of delay buffers . a detailed example will be described later . a power supply voltage generating circuit , a dd converter circuit , an analog buffer circuit , a data processing circuit , and a reference voltage generating circuit , for example , are applied as control object circuits 250 . in the present embodiment , unlike the existing techniques , a substrate bias is not used ( which is applicable to a polysilicon process or an amorphous silicon process ), and a hysteresis characteristic is provided , so that a stable output value is obtained . other advantages , such as lower power consumption related to a capability of the display device , a narrower frame , and an improvement in yield and correction mask reduction leading to a reduction in cost of the display device , are obtained . description will be made below of a more concrete configuration , functions , and an example of modification . fig1 is a circuit diagram showing an example of configuration in a case where the characteristic of a p - channel transistor and the characteristic of an n - channel transistor are detected separately from each other to perform control . there is a case where merely one channel is desired to be detected ( sensed ) by a control object circuit 250 . delayed signals s 31 and s 40 delayed by a delay circuit 220 - 1 depending on the characteristic of an n - channel transistor are each sampled by a sampling circuit 230 - 1 , and then signals s 33 and s 34 are output by the sampling circuit 230 - 1 . the signals s 33 and s 34 are supplied to a hysteresis characteristic generating circuit 240 - 1 , and then a signal s 37 is input to a selecting circuit 260 . similarly , delayed signals s 32 and s 41 delayed by a delay circuit 220 - 2 depending on the characteristic of a p - channel transistor are each sampled by a sampling circuit 230 - 2 , and then signals s 35 and s 36 are output by the sampling circuit 230 - 2 . the signals s 35 and s 36 are supplied to a hysteresis characteristic generating circuit 240 - 2 , and then a signal s 38 is input to the selecting circuit 260 . the selecting circuit 260 selects as to whether to consider both the characteristic of the p - channel transistor and the characteristic of the n - channel transistor or consider merely the characteristic of one transistor channel ( for example a case where merely the characteristic of the p - channel transistor is desired to be detected ). an output selected by the selecting circuit 260 is sent as a control signal s 39 to the control object circuit 250 . of course , the selecting circuit may be unnecessary according to a use . fig1 and fig1 are diagrams showing a circuit in which an amount of delay occurs depending on merely a one - channel transistor characteristic . the circuits described as the foregoing first and second embodiments or the example of modification can be applied as the circuits shown in fig1 and fig1 . fig1 is a diagram showing a delay buffer train ( suppose that the number of delay buffers is m ) that generates an amount of delay depending on n - channel transistor characteristics . the delay buffer train 221 a has m delay buffer circuits d 221 - 1 to d 221 - m connected to each other by a cascade connection . delayed signals s 41 and s 42 are output to terminals out 1 and out 2 , respectively . suppose that the number of delay buffer stages through which the signal s 41 is passed is larger than that of the signal s 42 . fig1 is a diagram showing a delay buffer train ( suppose that the number of delay buffers is n ) that generates an amount of delay depending on p - channel transistor characteristics . the delay buffer train 222 a has n delay buffer circuits d 222 - 1 to d 222 - n connected to each other by a cascade connection . delayed signals s 51 and s 52 are output to terminals out 1 and out 2 , respectively . suppose that the number of delay buffer stages through which the signal s 51 is passed is larger than that of the signal s 52 . fig1 is a diagram showing an example of configuration of the hysteresis characteristic generating circuit according to the present embodiment . fig2 is a diagram showing a truth table of the hysteresis characteristic generating circuit of fig1 . the hysteresis characteristic generating circuit 240 of fig1 includes an exclusive disjunction ( exor ) gate 241 , a switching control circuit 242 , a switch 243 , and a latch circuit 244 . the hysteresis characteristic generating circuit 240 maintains a previous output state as an output when inputs in 1 and in 2 are at different levels . when the levels of the inputs in 1 and in 2 are a same delay level ( for example a high level ), the level of the output out is the same as the input level ( for example the high level ). a switching control pulse swpls is used to prevent a malfunction of the output signal out during the switching period of the inputs in 1 and in 2 . in this circuit , the switch 243 is set in an off state during the switching period . after the signal levels of the inputs in 1 and in 2 are completely switched , the switch 243 is set in an on state ( enabled ) to reflect the input in 1 in the output out . in addition , a reset signal rst is supplied to the latch circuit 244 for the output level of an initial value . the hysteresis characteristic generating circuit 240 has been described as a circuit receiving &# 39 ; both the inputs in 1 and in 2 simply from the delay circuit 220 . however , the hysteresis characteristic generating circuit 240 is not limited to this configuration , and is applicable to various configurations . for example , one input is a delayed signal from the delay circuit , and the other input is obtained by providing a certain delay to the above - described delayed signal by counting of a counter circuit . brief description will - next be made of an example of output characteristics of a transistor power detecting ( sensing ) system as opposed to a system as a whole . fig2 is a diagram showing an example of output characteristics of a transistor detecting system . as shown in fig2 , first , the level of an output value out is set to an initial value by a reset signal . when a detection pulse is supplied , an amount of delay occurs depending on the power characteristic of a transistor . in a case of a current characteristic ( drain - to - source current ids or the like ) in a c region as case & lt ; 1 & gt ;, the current characteristic is good , and the amount of delay is small . a result of sampling the delayed signals s 23 and s 24 is an h level . a control signal s 240 supplied from the hysteresis characteristic generating circuit 240 is at a high level . in a case of a current characteristic ( drain - to - source current ids or the like ) in a b region as case & lt ; 2 & gt ;, the current characteristic is somewhat good , and the amount of delay is somewhat small . a result of sampling the delayed signal s 24 is an h level , while a result of sampling the delayed signal s 23 is an l level . the control signal s 240 supplied from the hysteresis characteristic generating circuit 240 maintains a previous state ( in this case , the initial value is reset ), and is thus at a low level . in a case of a current characteristic ( drain - to - source current ids or the like ) in an a region as case & lt ; 3 & gt ;, the current characteristic is poor , and the amount of delay is large . a result of sampling the delayed signals s 23 and s 24 is a low level . the control signal s 240 supplied from the hysteresis characteristic generating circuit 240 is at the low level . in case & lt ; 1 & gt ;, when the control signal is at an h level ( high level ), and a transition is made to the region b ( represented by the drain - to - source current ids ) as a panel characteristic is degraded due to some factor ( temperature characteristic , frequency , supplied power supply voltage or the like ), the control signal is at the h level because the hysteresis characteristic generating circuit 240 maintains a previous output state . when the characteristic is further degraded and a transition is made to the region a , a result of sampling the delayed signals s 23 and s 24 is the low level , and the control signal s 240 supplied from the hysteresis characteristic generating circuit 240 is at the low level . a return is made from the region a to the region b , and the control signal maintains the previous state and is thus at the low level . further , a return is made from the region b to the region c , and the control signal is set to the high level . by thus providing a hysteresis characteristic , an unstable control signal is not output . ( a stable control signal can be output . a stable control system can be realized for the quality of the display device and a driving system .) concrete examples of the control object circuit 250 will now be described . in general , as a method for reducing power consumption , the level of driving voltage is controlled using a voltage comparing circuit . however , when transistor characteristic variations may not be detected ( sensed ), consideration needs to be given to a wide range of transistor variation . there is thus a problem in that a regulation set value may not be lowered aggressively ( for example set to be a positive power supply voltage , and the same is of course true for negative power ). however , by providing the transistor detecting system according to the present embodiment , the power supply voltage is aggressively set low for a transistor having a characteristic better than a standard , and the power supply voltage is aggressively set high for a transistor having a worst characteristic . a few examples using the transistor detecting system will be shown . fig2 is a diagram showing a first example of configuration of a system in a case where the transistor detecting system is applied to a voltage comparing circuit for a dc / dc converter . the voltage comparing circuit 310 includes a dc / dc converter 311 , a resistance type potential divider circuit 312 , a voltage comparing circuit 313 , an and gate 314 , and a main circuit 315 . when the control signal is at an h level ( quoted from fig2 described above and indicating a good transistor characteristic ), the voltage comparing circuit 310 is enabled , and the output voltage vdd 2 of the dc / dc converter 311 is decreased . when the control signal is at an l level ( quoted from fig2 described above and indicating a poor transistor characteristic ), the voltage comparing circuit is disabled , and full power is output without the output voltage vdd 2 of the dc / dc converter 311 being decreased . fig2 is a diagram showing a second example of configuration of a system in a case where the transistor detecting system is applied to a voltage comparing circuit for a dc / dc converter . a plurality of output signals from a delay circuit train are used , whereby transistor power level can be detected in stages . by outputting a plurality of control signals ( two control signals in fig2 ) ctl 1 and ctl 2 , it is possible not merely to select the enabling or disabling of the voltage comparing circuit as in fig2 but also to set the regulation value ( regulation voltage ) of the voltage comparing circuit 310 a to a plurality of values . for example , when transistor power is at a high level ( good ), the regulation value is set low . when the transistor power is at a medium level , the regulation value is set at a medium level . when the transistor power is at a low level ( poor ), the regulation value is set high . in addition , the second configuration example allows various settings to be made using a plurality of control signals . fig2 is a diagram showing an example of configuration of a system in a case where the transistor detecting system is applied to an analog buffer circuit . the analog buffer circuit 320 of fig2 includes switches 321 to 323 , an n - channel transistor 324 , and a capacitor 325 . a polysilicon process or an amorphous silicon process has a disadvantage of large variations . in order to reduce effect of such variations , a constant - current source is designed to send a relatively large current . however , this results in a disadvantage of a correspondingly high power consumption . accordingly , the transistor power detecting system according to the present embodiment is used to receive a control signal so that the power of the constant - current source can be adjusted according to transistor power . for example , in fig2 , an output control signal from the transistor power detecting system is input to a timing generating circuit 330 , and the timing generating circuit 330 is made to output control pulses xncnt 1 and xncnt 3 for a constant - current source . when transistor conditions are good , the power of the constant - current source is decreased by enabling the switch sw 111 of the switch 321 and disabling the switch sw 112 of the switch 321 . when the transistor conditions are poor , the full power of the constant - current source is output by enabling the switch sw 111 of the switch 321 and also enabling the switch sw 112 of the switch 321 . fig2 is a diagram showing an example of configuration of a system in a case where the transistor detecting system is applied to a data processing circuit . the data processing circuit 350 of fig2 ( corresponding to the data processing circuit 106 in fig1 or the like ) includes a plurality of delay buffers db , switches 351 and 352 , a shift register 353 , and a latch circuit 354 . the latch circuit 354 includes inverters 3541 and 3542 and switches 3543 and 3544 . a polysilicon process or an amorphous silicon process has a disadvantage of large variations . it is therefore difficult to obtain a correct phase relation between a sampling pulse generated from a reference clock and data desired to be sampled . if the data desired to be sampled is advanced in phase with respect to the sampling pulse generated from the reference clock , a data series is provided with a delay buffer so that the desired data is delayed . however , an amount of delay obtained differs depending on transistor variations . it is difficult to adjust the number of delay buffers . the occurrence of an adjustment error means that a mask correction is made , which leads to an unnecessary increase in cost . in addition , there is a possibility of being unable to accommodate variations with increase in frequency . this is one of problems that needs to be solved so that the polysilicon process or the amorphous silicon process can be applied to high - frequency driving . accordingly , the transistor power detecting system according to the present embodiment is introduced . thus , when transistor power is good , because of a small amount of delay , the number of delay buffers is increased . when the transistor power is poor , because of a large amount of delay , the number of delay buffers is decreased . for example , as shown in fig2 , an output control signal from the transistor power detecting system is input to a timing generating circuit 330 , and a control pulse s 121 for controlling the number of delay buffers is output . when transistor power is good , because of a small amount of delay , the number of delay buffers is increased by turning off the switch 351 and turning on the switch 352 . when the transistor power is poor , because of a large amount of delay , the number of delay buffers is decreased by turning on the switch 351 and turning off the switch 352 . while the phase relation between data and the sampling pulse generated by the shift register 353 has been described above , the embodiment of the present invention is not limited to this . data may be sampled directly with a master clock , or a combination may be made with another logic . the concept is the same . fig2 is a diagram showing an example of configuration of a system in a case where the transistor detecting system is applied to a reference voltage generating circuit . the reference voltage generating circuit 360 of fig2 includes a black side γ adjusting circuit 361 , a white side γ adjusting circuit 362 , and a resistance ladder part 363 generating reference voltages . for example , a liquid crystal driving power supply voltage is set within a range defined by specifications . a reference voltage generating circuit designed with a power supply voltage at a standard value is common . when supplied power supply voltage becomes different , a gamma ( γ ) characteristic is also changed . this is one of problems that needs to be solved for improvement in picture quality . in such a case , a change in power supply voltage can be detected by an optical characteristic sensor to generate a control pulse . a change in power supply voltage can also be detected as variation in transistor power , which will be described in the following . two series of a supplied power supply voltage that is the same as power supply voltage ( vdd 1 _ref ) for driving a liquid crystal and a supplied power supply voltage that is not the same as the power supply voltage ( that is not varied according to specifications , and is the regulation power supply voltage vdd 1 a of an ic , for example ) are provided for delay circuits . with a same transistor characteristic ( vth ), when the power supply voltage ( vdd 1 _ref ) for driving the liquid crystal is lowered , there occurs an increase in amount of delay in the delay circuit using the power supply voltage that is the same as the power supply voltage ( vdd 1 _ref ) for driving the liquid crystal . on the other hand , an amount of delay in the delay circuit using the power supply voltage vdd 1 a that is not the same as the power supply voltage ( vdd 1 _ref ) for driving the liquid crystal is unchanged . when a difference between the amounts of delay is a designed period or more , γ control signals ctl 11 and ctl 12 are output so as to obtain a proper gamma . thus , a proper gamma can be obtained at all times . fig2 is a diagram showing a detailed example of the black side γ adjusting circuit and the white side γ adjusting circuit in fig2 . the γ control signal ctl 11 in fig2 is signals gs 1 and gs 2 in fig2 . the γ control signal ctl 12 in fig2 is signals gs 3 and gs 4 in fig2 . in the foregoing embodiments , description has been made of a case where a polysilicon process or an amorphous silicon process is used . however , the embodiment of the present invention is not limited to this , and is applicable to circuits in general using defective silicon . in addition , the embodiment of the present invention is widely applicable to various flat display devices such as various liquid crystal display devices including a tft liquid crystal display device having a driving circuit formed integrally on an insulating substrate and a cgs ( continuous grain silicon ) liquid crystal display device , an el ( electro luminescence ) display device , and the like . as described above , as effect of the embodiment of the present invention , it is possible to aggressively reduce power consumption by accommodating large variations due to a process , and accommodate the variations . thus , there is no transistor size that is larger than necessary , and when the embodiment of the present invention is applied to a narrower - frame data processing circuit , an unnecessary cost of a mask for delay buffer correction is saved . a design in a short period of time and a reduction in cost can be achieved . when the embodiment of the present invention is applied to a data processing circuit , a sampling margin is increased . thus , the embodiment of the present invention is a technique that is desired more as the frequency of high - speed driving becomes higher . an improvement in yield can be achieved . when the embodiment of the present invention is applied to a reference voltage generating circuit , it is possible to obtain a proper gamma at all times , and contribute to an improvement in picture quality . because of simple circuit configuration , there is little effect on a frame . in addition , when a detection pulse having a long cycle is used , very little power is consumed . further , an active matrix type display device typified by the active matrix type liquid crystal display device according to the foregoing embodiment is suitable especially for use as a display unit of an electronic device such as a portable telephone , a pda or the like which device proper is being reduced in size and made more compact , as well as used as a display of oa equipment such as a personal computer and a word processor , a television receiver , and the like . fig2 is an external view of an outline of a configuration of an electronic device to which the embodiment of the present invention is applied , for example a portable telephone . the portable telephone 400 according to this example has a speaker part 420 , a display part 430 , an operating part 440 , and a microphone part 450 arranged in this order from a top side on a front side of a device casing 410 . in the portable telephone of such a configuration , a liquid crystal display device , for example , is used as the display part 430 . as this liquid crystal display device , the active matrix type liquid crystal display device according to the foregoing embodiment is used . thus , by using the active matrix type liquid crystal display device according to the foregoing embodiment as the display part 430 in an electronic device ( portable terminal ) such as the portable telephone or the like , it is possible to achieve a narrower pitch , a narrower frame , and lower power consumption of a display device and hence lower power consumption of the terminal proper . it should be understood by those skilled in the art that various modifications , combinations , sub - combinations and alterations may occur depending on design requirements and other factor in so far as they are within the scope of the appended claims or the equivalents thereof .

7Electricity

referring now to the drawings , an automobile 10 broadly includes a drivetrain 12 . the drivetrain 12 includes an engine 14 , a gearbox 16 , a driveshaft 18 , an axle drive unit 20 , and wheels 22 which are driven to move the automobile 10 . while a manual gearbox utilizing a manual shift lever for selecting the desired gear during operation is illustrated in the drawings , as used herein , the term gearbox is intended to include both manually actuated gearboxes as well as automatic transmissions such as those employing fluid couplings and torque converters as are well known to those skilled in the art . the engine 14 as used herein may include not only internal combustion or external combustion engines , but also electric or other motors which function as the prime mover for the automobile 10 . a primary shaft , such as the crankshaft 24 of an internal combustion engine 14 , is typically bolted to a flywheel 26 , shown for example in fig2 and 4 , on the side of the flywheel 24 opposite the gearbox 16 . fig2 and 4 illustrate a clutch assembly 27 in accordance with the present invention and utilized to operatively couple and decouple the crankshaft 24 from the gearbox 16 . a clutch friction disc 28 , shown in fig3 and 4 , is positioned adjacent the flywheel 26 . a clutch pressure plate 30 is bolted to the flywheel 26 on the opposite side of the crankshaft 24 and includes spring portions 32 which flex and normally bias ring 34 against the friction disc 28 to hold the friction disc against the flywheel 26 . when the clutch pedal is depressed to move the clutch lever 36 , the throw - out bearing 38 moves against the spring portions 32 which in turn releases the ring 34 from biasing engagement with the friction disc 28 and thereby permits the flywheel 26 to rotate without corresponding driving of the friction disc 28 . the friction disc 28 of the present invention includes a novel clutch disc hub 40 which includes a central passage 42 having internal splines 44 at its rear end and an enlarged annular recess 46 at its forward end oriented toward the crankshaft 24 . the central passage 42 receives therein a pilot stub 48 which is complementally sized for receipt in a pocket 50 at the rear end of the crankshaft 24 and also to be received within an annular pilot bearing 52 received in the annular recess 46 of the clutch disc hub 40 . an input shaft 54 of the gearbox 16 is received in the rear end of the passage 42 of the clutch disc hub 40 , and is provided with forward external splines 56 , to be described in greater detail hereinafter , which intercalate with the internal splines 44 of the clutch disc hub 40 in driven engagement . the input shaft includes a rounded , slightly domed front surface 58 which facilitates the ability of the input shaft 54 to rock and tilt relative to the pilot stub 48 . thus , in contrast to conventional input shafts which have a pilot machined as a part thereof for locating the input shaft on the crankshaft , the provision of a separate pilot stub 48 permits the input shaft 54 of the present invention to be located by the forward external splines 56 and the clutch disc hub 40 . the clutch disc hub 40 may be held to the surrounding portions of the friction disc 28 by welding , rivets , or in any other conventional manner , or could be provided with external splines whereby the hub 40 is a separate component from the remainder of the friction disc 28 . the benefit if locating input shaft 54 on the clutch disc hub 40 rather than the crankshaft 24 is realized in the provision of forward external splines 56 in accordance with the present invention . the forward external splines 56 hereof are involute cut splines which help to self - locate the splines 56 with respect to the internal splines 44 , and also are crowned as shown in fig7 as crown involute splines 60 , so that with respect to the length l of the splines , the radially outer edge center portion 62 has both a greater height and a greater thickness than either the radially outer edge first end 64 or radially outer edge second end 66 of the splines 56 . further , the splines 56 are cut having a root 68 at the base of the splines which is also crowned , such that the center portion 70 of the root 68 is farther from the axis b than at either one end 72 or other end 74 of the root 68 . by cutting the splines 56 as crown involute splines 60 , the input shaft is able to rock or tilt with respect to the clutch disc hub 40 . that is to say , the clutch disc hub 40 is located by the crankshaft 24 . the clutch disc hub 40 may have its axis of rotation a slightly offset relative to the axis of rotation y of the crankshaft 24 without consuming significant energy because the pilot stub merely locates , and does not drive the clutch disc hub . while ideally , axes a and y will be coincident , as shown in fig4 , in fact there will likely always be some variation or offset . on the other hand , the provision of crown involute splines 60 as forward external splines 56 and the fact that the pilot stub 48 is separate from the input shaft means that the input shaft 54 need not locate from the crankshaft at its forward end but rather is located by the clutch disc hub 40 . this is inherently a shorter dimension , and further , because the splines 56 are at the forward end of the input shaft 54 and are able to rock or tilt , the axis of rotation b of the input shaft need not be coincident with the axis of rotation a to avoid bending the shaft 54 . the crown involute splines of the forward external splines 56 transmit rotational force ( roll ) without transmitting pitch or yaw on the other two orthogonal axes , and may permit deflections up to about 1 ° of deflection between the two axes without noticeable loss of power transmission . the axis if rotation b may be offset , or intersect with either or both of the axes of rotation a and y , without substantial wear or loss of transmitted power due to the necessity of bending the input shaft 54 . moreover , the input shaft 54 is free to translate to a limited degree relative to the clutch disc hub 40 and thus the crankshaft 24 to further allow for movement of the drivetrain components or initial misalignment . the internal splines 44 have a root and a spline edge including one end , another end , and a longitudinal length extending therebetween , with a middle portion intermediate the ends . the middle portion of the root and the spline edge may be cut whereby they are farther from the axis of rotation a of the clutch disc hub 40 than at either of the ends . it should be understood that in regard to the foregoing , the present invention contemplates that the internal splines 44 could be crown involute splines while the forward external splines 56 could be straight splines and still achieve the deflection compensation benefit . while this would be considered substantially equivalent in reversing which of the two components has the crown involute splines , machining of the forward external splines 56 as crown involute splines 60 is an easier machining operation than crowning the internal splines . fig5 and 6 illustrate the deflection compensation feature of the present invention in an automotive gearbox 16 . the gearbox 16 may be a conventional manual gearbox or a gearbox having reduced energy consumption as shown , for example , in my u . s . pat . no . 5 , 381 , 703 and my pending patent application ser . no . 10 / 262 , 350 , the disclosures of which are incorporated herein by reference , or with an automatic transmission , for example of the type having a fluid coupling and torque converter . the input shaft 54 leads rearwardly from the clutch assembly 27 to the gearbox 16 , a portion of which is shown in fig5 and 6 . the input shaft 54 includes a rounded , slightly convex or domed rear surface 76 for compensating for misalignment or permitting rocking or tilting of the input shaft 54 relative to the main shaft 78 of the gearbox 16 . the rear end 80 of the input shaft 54 is provided with rear external splines 82 which are also cut as crown involute splines 60 as shown in fig7 and as described above . the rear external splines 82 are located within and drive an input gear 84 . as illustrated in fig2 , 5 and 6 , the input gear 84 may be provided with a forward collar portion 86 having a smooth outer bearing surface 88 and internal input gear splines 90 , and a rear driving portion 92 including radially outwardly projecting driving teeth 94 and rearwardly extending driving dogs 96 and a smooth internal bearing surface 98 for receiving therein bearing 100 . while the internal input gear splines 90 may be cut as crown volute splines 60 , it is generally an easier machining operation to cut external splines as crown involute splines than to cut internal splines as crown involute splines . thus , if the rear external splines 82 are provided as crown involute splines 60 , internal input gear splines 90 may be cut as straight splines . the input gear 84 is located by bearings 102 and 104 shown as having ball bearings and raceways , and held by snap ring 106 so that they remain between the input gear 84 and a case bearing 108 . the case bearing 108 is , in turn , bolted ( bolts not shown in the figures for clarity ) through aligned openings in the case bearing to the housing 110 of the gearbox 16 . a slider 112 having internal splines 114 may be selectively moved forwardly along radially outwardly extending splines 116 of the main shaft 78 whereby recesses 118 in the slider may receive driving dogs 96 . thus , in a forward position , the driving dogs 96 of the input gear 84 drive the slider 112 which because of the engagement between the splines 114 and 116 in turn causes the main shaft 78 to be driven in direct drive relationship to the input shaft 54 . alternatively , when the slider 112 is moved to a rearward position , the input gear 84 drives a countershaft , which then drives the change speed gear 120 . engagement of dogs on the change speed gear 120 and corresponding recesses on the slider then cause the slider 112 to drive the main shaft 78 corresponding to the rotational speed of the change speed gear 120 because of the interengagement of the splines 114 and 116 . while preferably the input shaft 54 , the input gear 84 and the main shaft 78 are all in perfect axial alignment and remain there during operation , as a practical matter this is not the case . for a variety of reasons , including the weight of the components , unevenness of the road surface , high speed turns , and difficulties in obtaining precision alignment during installation , the input gear 84 , the main shaft 78 and the input shaft will not initially nor thereafter during operation enjoy coincident axes of rotation . rather , the axes will be parallel but offset , or intersect , or both offset and non - parallel . in the present invention , the input shaft 54 is , as described above , free to shift and may be offset with respect to the clutch assembly 27 and the crankshaft 24 without noticeable loss of efficiency normally caused when gears bind or the shaft bends . similarly , the input shaft 54 is not bound by the housing of the gearbox 16 . because of a variety of factors including the crown involute splines 60 of the rear external splines 82 , the convex rear surface 76 , and the fact that the main shaft 78 and the input shaft 54 are both located by the input gear 84 but the input shaft 54 is free to shift longitudinally and tilt or rock relative to the input gear 84 , the input shaft 54 is permitted to be mounted and positioned independently of the gearbox 16 so that initial misalignments or relative movement of the engine , clutch assembly and gearbox does not result in appreciable efficiency losses . the present invention also provides for deflection compensation of the drivetrain 12 in the axle drive unit 20 of the automobile 10 . it may be appreciated that various configurations of drive units are employed for front engine - front wheel drive automobiles , rear engine - rear wheel drive automobiles , mid - engine rear wheel drive automobiles , and four wheel drive automobiles or more . moreover the axle drive unit 20 may variously be of solid drive , differential , limited slip differential or other arrangements . the present invention may be employed with any of these arrangements , where an axle is used to drive the wheels 22 of the automobile 10 . typically , however , the present invention would not be needed where the axles and the axle drive unit are of the independent suspension type , where the axles are coupled to the axle drive unit by universal joints to permit a wide range of motion . fig1 and 8 illustrate a front engine , rear wheel drive arrangement of the axle drive unit 20 having axles 122 and 124 received in respective axle housings 126 and 128 . as illustrated , the axles 122 and 124 are in fact half - axles , each driving one of the wheels 22 . the axle drive unit 20 as illustrated is of a differential type whereby the driveshaft 18 drives a bevel pinion ( not shown ) which in turn rotatably drives a pair of opposed crown wheels , one of which is shown as crown wheel 130 . the crown wheels are fixedly coupled to a box 132 which includes pinion shaft 134 which rotates therewith , in turn rotating differential pinions 136 which drive bevel wheels 138 . in the present invention , each of the bevel wheels 138 is provided with internal splines 140 for rotatably driving the axles 122 and 124 . the axles 122 and 124 are in turn provided with complemental drive unit splines 142 for coupling with internal splines 140 of the drive bevel wheels 138 . the drive unit splines 142 are external splines . one of the drive unit splines 142 and the internal splines 140 are made as crown involute splines 60 as shown in fig7 , preferably the drive unit splines 142 . as a result , the axles 122 and 124 are not required to bend when the axles 122 and 124 are installed in offset relationship such that their respective axes of rotation r are offset relative to the axis of rotation z of the bevel wheels 138 as shown in fig8 . moreover , the splines 140 and 142 do not bind when the axles 122 and 124 are initially installed or move out of axial alignment with the bevel wheels 138 because one of the splines 140 and 142 are crown involute splines , allowing limited movement therebetween both axially and angularly . the present invention presents distinct advantages in regard to the ability to locate the driven components independently , thus permitting relative movement and angular relationships . thus , the input shaft can be located independently of the mainshaft of the gearbox , as well as the crankshaft and flywheel , and it is not necessary that the input shaft remain in alignment nor held against axial movement relative to the mainshaft . further , the present invention provides deflection compensation for relative differences in axial alignment of the clutch assembly , the main shaft , and the input shaft . further , the axles and axle drive unit may have their respective axes offset relative to one another to thereby reduce or minimize energy losses which would otherwise result when the axles were required to bend , or excessive wear in the splines . although preferred forms of the invention have been described above , it is to be recognized that such disclosure is by way of illustration only , and should not be utilized in a limiting sense in interpreting the scope of the present invention . obvious modifications to the exemplary embodiments , as hereinabove set forth , could be readily made by those skilled in the art without departing from the spirit of the present invention . the inventor hereby states his intent to rely on the doctrine of equivalents to determine and assess the reasonably fair scope of his invention as pertains to any apparatus not materially departing from but outside the literal scope of the invention as set out in the following claims .

8General tagging of new or cross-sectional technology

reference is first made to fig1 wherein an embodiment of the recording and playback system according to the present invention is illustrated . in fig1 there is shown a disc 1 comprising a base 11 of a dielectric material such as glass , and an amorphous thin film 12 formed thereon . the amorphous thin film 12 is made of gadlinium iron ( gdfe ) or gadlinium cobalt ( gdco ), for example . an output light beam of a laser source 2 is fed to an a / o ( acoustic optical ) modulator 3 where the light beam is modulated by an output signal of a driver 4 which receives a signal corresponding to the informaiton to be recorded . the modulation signal , i . e ., the output signal of the driver 4 , takes the form of a digital pulse signal produced by modulating the frequency of a carrier signal having a predetermined frequency by the signal to be recorded , and by limiting the amplitude of the signal by means of a limiter circuit . the output beam of the a / o modulator 3 takes the form of a pulse train of light corresponding to the pulse signal from the driver 4 , and passes throught a lens 5 and a dichroic mirror 6 . the beam thus is formed into a recording beam spot , and is focused on the recording surface 12 of the disc 1 by means of a focus lens 7 . the system is also provided with a readout laser source 8 , the output beam of which has a frequency different from that of the recording laser beam from source 2 . the readout laser beam is also introduced to the focus lens 7 , through a diffraction grating 9 , a lens 13 , a half prism 14 , and a mirror 15 , and forms a readout beam spot which is focused on the recording surface 12 of the disc 1 . the reflection of the readout laser beam travels the same path as does the incidental beam , until it is received by the half prism 14 at which time the reflection beam is directed to a half prism 151 . half prism 151 splits the reflection beam received form half prism 14 into a first beam directed to a first light detector 18 through a cylindrical lens 16 and a first analyzer 17 , and a second beam directed to a second light detector 20 through a second analyzer 19 . if the first and second analyzers 17 and 19 are arranged appropriately , a playback rf signal having a good s / n ratio can be produced by means of a differentiation amplifier ( not shown ) which receives the output signals of the first and second light detectors 18 and 20 , wherein noises inherent to the laser beam can be sufficiently cancelled . in addition , the output signal of the first light detector 18 is utilized to control a so called &# 34 ; focus servo &# 34 ; system in which the distance between the focus lens 7 and the recording surface 12 of the disc is controlled to maintain the beam from the focus lens 7 in focus on the recording surface 12 . a coil 21 for generating a bias magnetic field is disposed directly beneath the portion of the disc 1 at which the recording laser beam is focused , and is fed with a dc voltage from a dc voltage source 22 via a polarity switching device 23 . in fig2 there is illustrated the relationship between the recording track and a plurality of beam spots used in the system . for purposes of explanation , let it be assumed that the recording track ( or the recording portion of the disc ) moves in the direction indicated by the arrow shown in the figure . a recording beam spot 25 shown at the right hand portion of the figure has its center at the central portion of the recording track 24 . a playback beam spot 26 is also indicated with its center at the central portion of the recording track 24 . a pair of spots 27 and 28 , positioned at both sides of the playback beam spot 26 , are utilized for the tracking purpose and a first order light beam from the diffraction grating 17 is utilized for these tracking beam spots 27 and 28 . on the other hand , a zero order output light beam from the diffraction grating 17 is utilized for the playback beam spot 26 . as shown , these beam spots 26 to 28 are so arranged that beam spots 27 and 28 are positioned at the peripheral portion of the recording track when the playback beam spot 26 is located at the center of the recording track 24 . therefore , the tracking error of the playback beam spot 26 can be detected by means of the difference in intensities between the reflections of the tracking beams 27 and 28 . the thus obtained tracking error signal is used to effect operation of the tracking servo system . taking account the above described arrangement of the recording beam spot , playback beam spot , and tracking beam spots , the recording and playback method according to the present invention will now be described with reference to fig3 a to 3d . reference is first made to fig3 a , where there is illustrated the magnetization direction of the recording film at the initial state ( before any recording ) wherein the magnetization direction is unified in the upward direction . at the time of recording information on this recording film , the direction of the weak magnetic field produced by the coil 21 is controlled by means of the polarity switching device 23 so that the magnetic field is directed in the downward direction . in accordance with the signal applied to the driver 4 , the recording laser beam is controlled to turn on and off , thereby changing the localized direction of magnetization of the recording film in a manner such that only the portions of the recording film on which the recording laser beam is applied becomes downwardly magnetized as shown in fig3 b . at the time of the recording operation , the disc is translated along its radial direction at a constant speed , so that the recording tracks are spaced at constant intervals . during the recording operation , the focus servo system is controlled in accordance with the output signal of the light detector 18 , which receives the reflected beam of the playback beam spot 26 , so that the recording beam spot 25 is accurately focused on the recording film 12 . this focusing is described in detail in the aforementioned copending application . then , when it is desired to erase some of the information recorded on the recording track , the source 8 of the playback laser beam is actuated to playback ( monitor ) the recorded information and simultaneously to operate the tracking servo system and the focus servo system . when the portion of the recording track bearing the unnecessary information reaches the position of the recording beam spot in accordance with the movement of the disc 1 , the source 2 of the recording laser beam is actuated in accordance with an erasure command signal . since the direction of the magnetic field of the coil 21 is the same as the magnetization direction used during the original recording operation , the magnetization direction of the erased portion is inverse to the magnetization direction of the original unrecorded disc , shown in fig3 a and 3c . therefore , position of the recording track can be readily detected , so that with the tracking operation enabled during the recording of new information , it is ensured that there is continuity between the recording tracks of the old and new information . it is necessary to change the direction of the magnetic field at the time of recording new information on the erased portion , and since the magnetization of the erased portion has a downward direction , the magnetic field is directed upwardly at the time of recording new information . fig3 d shows an example of the recording track on which the new information is recorded on the previously erased portion of the recording track . as noted above , the continuity of recording tracks of old and new information is maintained because the tracking servo and focus servo systems are operated during the recording of new information . in order to change the direction of the magnetic field produced by the coil 21 during the rewriting of new information , it is sufficient to place a sign or a detectable pattern on the lead portion of the erased track , so that the sign or pattern is detected to operate the polarity switching device 23 at the time of rewriting . it will be appreciated from the foregoing that a precise tracking is enabled in accordance with the present invention . by timing the playback beam spots so that they precede the recording beam spots ( timed by controlling the light emission from laser sources 8 and 2 , respectively ), monitoring becomes possible during the erasure of the information , which ensures the continuity of recording track . furthermore , this arrangement enables the detection of the sign or pattern recorded at the lead portion of the erased track at the time of rewriting new information . above , a preferred embodiment of the present invention has been described . it should be understood , however , that the foregoing description has been for illustrative purpose only , and is not intended to limit the scope of the invention . rather , there are numerous equivalents to the preferred embodiments , and such are intended to be covered by the appended claims . as only one of many examples , the amorphous alloy used as the material of the thin film may be replaced by a polycrystalline material such as manganese bismuth ( mnbi ).

6Physics

in the wafer container box of the invention defined in the summary given above , the box body for containing a plurality of wafer materials is open at one side and the opening is air - tightly sealed by mounting a covering thereon in a demountable fashion . the wafer container box consisting of a body of the box opening in one lateral surface and a covering mountable on the lateral opening of the box body for air - tight sealing of the container box , comprises : ( a ) two sets of wafer alignment grooves each integrally formed on the inner surface of one of oppositely facing side walls of the box body for supporting a plurality of wafer material aligned up to down each in a horizontal disposition ; ( b ) a bottom plate fixed to the bottom surface of the box body ; ( c ) an upper mounting means provided on the top wall of the box body for supporting a robotic flange in a demountable fashion ; ( d ) a lower side mounting means provided on the outer surface of each of the side walls of the box body for supporting a side rail in a demountable fashion ; and ( e ) a side mounting means provided on the outer surface of each of the oppositely facing side walls of the box body for supporting a manual handle in a demountable fashion , it is preferable in the above described wafer container box of the invention that the upper mounting means ( c ) comprises a guide rail provided on the top wall of the box body and an inclined guide surface formed in the guide rail with inclination gradually increasing from the end surface opposite to the lateral opening toward the lateral opening , and the robotic flange comprises a holding plate and a supporting pillar provided on the lower surface of the holding plate to fit the guide rails as guided by the inclined guide surface . further preferably , the above mentioned lower mounting means is formed in the form of an engagement rib provided on the outer surface of each side wall so as to define a space for insertion and the above mentioned side rail comprises a flat plate , an insertion part provided on the inward end of the flat plate for engagement with the engagement rib and a horizontal supporting plate provided on the outward end of the flat plate . it is also preferable that the above mentioned side mounting means comprises a guide rail provided on the outer surface of each side wall of the box body and an inclined guide surface with inclination gradually increasing from the end surface of the box body opposite to the opening toward the opening and the manual handle comprises a plate fitting the guide rail as being guided by the above mentioned inclined guide surface and a handle provided on the outer surface of the plate . needless to say , the materials to be contained in the inventive wafer container box are not limited to semiconductor silicon wafers but can be photomask glass plates , liquid crystal display panels , diskformed recording media and other wafer - formed precision plate materials . the wafer container box of the invention contains usually a plurality of these wafer materials in a number of as many as several tens . the body of the box , covering , bottom plate and robotic flange constituting the container box are formed from a plastic resin composition having as sufficiently high mechanical strength and capable of exhibiting a permanent antistatic effect as composed of a base resin such as polycarbonates , acrylic resins , peek resins and the like compounded with an electroconductive resin to give a polymer alloy or electroconductive fibrous materials such as carbon fibers , metal filaments and the like to give a composite . it is of course possible that a shaped article of a conventional thermoplastic resin is imparted with surface conductivity by forming a coating layer of an electroconductive resin . although it is specified in the semi standards as a front - opening interface mechanical standard , 300 mm , that the covering of the wafer container box should have a latch mechanism for fastening to the body of the box , it is optional that the covering is fastened to and released from the box body by means of another mechanical means in place of the latch mechanism . the cross sectional profile of the guide rails is not particularly limitative including dovetails . the supporting props may have an approximately j - formed or h - formed cross section . the plate is not limited to a flat plate provided that it has a configuration engageable with the guide rails to work in a similar way . it is optional that a hook is provided at the end portion of this plate in order to come into engagement with a protrusion or recess in the body of the container box . in the wafer container box of the present invention , the accessory parts such as robotic flanges , side rails and manual handles to be mounted on the box body can be limited to those actually needed for the respective layout of the manufacturing plants , process step and transportation method with omission of unnecessary ones . in addition , the wafer - aligning and supporting grooves are formed integrally on the inner surface of each side wall so that any separate parts need not be built in the box body . this simplification relative to the accessory parts greatly contributes to the improvement in the efficiency of cleaning and drying of the box body if not to mention the advantages obtained by the weight decrease as a matter of course . in the following , a preferable embodiment of the inventive wafer container box is described in more detail by making reference to the accompanying drawing although the scope of the invention is never limited thereto in any way . as is shown in fig1 to 15 , the inventive wafer container box consists of a body 1 of the box which contains a plurality of wafer materials w in parallel alignment and a covering 12 mounted on the body 1 to air - tightly seal the front opening of the box body 1 with intervention of an elastic gasket 11 in a demountable fashion . the box body 1 is provided with a bottom plate 14 , upper mounting means 17 for supporting a robotic flange 21 , lower side mounting means 25 for supporting a pair of side rails 29 and side mounting means 34 for supporting a pair of manual handles 38 . the box body 1 is shaped in the form of a front - opening box from a basically opaque thermoplastic resin having excellent impact strength , heat resistance , water resistance and acid - resistance such as a polycarbonate resin and imparted with a permanent antistatic effect by compounding or coating with a permanent antistatic agent . the box body 1 has a sufficiently high mechanical strength to withstand mechanical shocks and the surface resistivity thereof is preferably in the range from 10 8 ohm to 10 13 ohm as determined according to the procedure specified in astm d257 . as is shown in fig2 , 13 and 15 , the inner surface of each of the oppositely facing side walls is shaped in the form of pleats to form wafer - alignment grooves 2 having a u - formed cross section at a regular pitch from up to down to support a plurality of wafer materials w each in a horizontal disposition something like shelves . thus , a plurality of wafer materials w are horizontally held by the alignment grooves 2 in parallel alignment without contacting with the adjacent wafer materials . as is shown in fig1 to 4 and 13 , a pair of protruded bottom rails 3 are integrally shaped with the bottom wall of the box body 1 along the right and left peripheries of the bottom surface to extend in the direction from front to rear . the bottom rails 3 facilitate picking up of the box body 1 . as is shown in fig3 the bottom surface of the box body 1 is provided on three positions including two side positions near to the front end and one center position near to the rear end as is specified in the semi standards with integrally shaped v - grooves 4 to serve as a positioning means forming protrusions . a bottom plate 14 is mounted on these v - grooves either directly or by means of fastening clamps in a demountable fashion . as is illustrated in the same figure , each of the v - grooves 4 consists of a pair of side ribs 5 defining an approximately oval space and a reinforcement rib bridging the side ribs 5 and serves as a positioning means of the box body 1 when the box body 1 is mounted on a wafer - processing machine by being engaged with the positioning pins 6 ( see fig5 ) of the wafer - processing machine . each of the side ribs 5 forming each of the two front v - grooves 4 has an approximately j - shaped configuration and the two j - shaped side ribs 5 jointly define an oval space surrounded thereby leaving gaps 7 between the end points of the counterposed side rib 5 . these gaps 7 between the j - shaped side ribs 5 serve as a drain notch in the cleaning work and air passage in drying . the other v - groove 4 at the center rear can also be shaped in the same fashion as described above although it is depicted in fig3 in a different fashion to have gaps 7 between the two side ribs 5 at the end positions of the oval space defined by the side ribs 5 . the front opening of the box body 1 is surrounded by rims 8 extending in the up to down directions and in the left to right directions . these rims 8 are provided at the upper and lower side positions on the inward surface with cavities 9 to serve as an engagement means . the lower rim 8 is integrally connected at the side ends with the front end of each of the bottom rails 3 . as is illustrated in fig1 , a rectangular see - through window 10 is formed in the rear wall of the box body 1 by using a highly transparent polycarbonate resin to facilitate checking , without removing the covering , of the alignment condition of all the wafer materials w contained in the container box 1 by being supported at the peripheries . if the transparent plastic resin forming the see - through window has bondability with the plastic resin forming the box body , the see - through window can be built in the box body by the techniques of insert molding or two - color molding without using any adhesives sometimes responsible for contamination of the wafer materials contained in the container box . it is of course possible that a see - through window is formed , in addition to the rear wall of the box body 1 , in each of the top wall and side walls of the box body 1 . the gasket 11 , which intervenes between the covering 12 and the periphery of the front opening of the box body 1 to ensure air - tight sealing , has a frame - like configuration and shaped by molding an elastic material having excellent weatherability , anti - chemicals resistance , aging retardancy and electric properties including a variety of thermoplastic elastomers and rubbers such as fluorocarbon rubbers , epdm rubbers , polychloroprene rubbers , butyl rubbers and silicone rubbers . it is preferable that the gasket 11 is sandwiched between a groove and a line protrusion formed on the periphery of the covering 12 and around the front opening of the box body 1 in order to further improve air - tightness of sealing with the gasket 11 . the covering 12 , which is shaped from the same plastic resin as the box body 1 , has a double - walled structure with a void space . though not shown in the figures , a latch mechanism is built in the covering 12 in order to enable automatic clamping and declamping on a wafer - processing machine . the latch mechanism is connected to the engagement hooks capable of appearing and retreating as protruded out of the outer periphery of the covering 12 . when the covering 12 is mounted on the front opening of the box body 1 , these engagement hooks are inserted into and engaged with the engagement cavities 9 around the front opening of the box body 1 . as is shown in fig2 one or more of retainers 13 are mounted on the inward surface of the covering 12 , the retainer has elastic members with a v - shaped or u - shaped cross section to receive the peripheries of the wafer materials w contained in the box body 1 with resilience when the covering 12 is mounted on the front opening of the box body 1 . the retainer 13 is shaped from a variety of thermoplastic elastomers and thermoplastic resins such as polyethylene and polypropylene . it is preferable , however , in respect of high heat resistance and rigidity , that the retainer 13 is shaped from a polycarbonate resin , polybutylene terephthalate resin , polyether ether ketone resin or polyether imide resin or , more preferably , from a polyether ether ketone resin which is safe from the phenomenon of fatigue by repeated deformation . it is important that the retainer 13 has heat resistance so high that , even when the wafer materials w coming into contact with the retainer 13 have a surface temperature as high as 80 to 150 ° c ., the retainer 13 is safe from the troubles such as thermal deformation and melt - bonding with the wafer materials w . as is illustrated in fig2 and 4 , the bottom plate 14 has a generally y - shaped configuration and has three approximately oval guide members 15 integrally shaped on the two front side positions and a center rear position each to fit and to be engaged with one of the v - grooves 4 on the bottom surface of the box body 1 . the guide member 15 has a cross section illustrated in fig5 with an upwardly narrowing inclined surface 16 which serves as a guide surface for the positioning pin 6 on the wafer - processing machine toward the v - groove 4 . it is also possible that the guide members 15 are shaped , instead of integral molding , as separate parts from the bottom plate 14 , and mounted thereon . when the guide members 15 are shaped as separate parts , the plastic resin for molding the guide members 15 should be a resin having excellent abrasion resistance such as polyether ether ketone resins , polybutylene terephthalate resins and polycarbonate resins or a plastic resin compounded with an abrasion - resistance improver such as a powder of a polytetrafluoroethylene resin . as is illustrated in fig1 , 6 and 14 , the upper mounting means 17 consists of a pair of oppositely facing guide rails 18 extending in the front - to rear direction and a threaded boss 19 protruded between the right and left guide rails 18 . each of the guide rails 18 has an inversely l - shaped cross sectional profile to stand on the top surface of the box body 1 . while the robotic flange 21 is to be inserted between the guide rails 18 from the rearward end , each of the paired guide rails 18 has a height gradually and slightly increasing from the rearward end toward the frontward end keeping a distance therebetween gradually and slightly increasing from the rearward end toward the frontward end . the outer side surface of each guide rail 18 forms an inclined guide surface 20 gradually expanding outwardly from the rearward end toward the frontward end . the robotic flange 21 is shaped by molding of a thermoplastic resin such as polycarbonate resins , polyamide resins , abs resins and pbt resins . as is shown in the same figures , the robotic flange 21 consists of a grasping plate 22 to be grasped and positioned on an oht transportation machine and a pair of props 23 downwardly protruded from the lower surface of the grasping plate 22 . the grasping plate 22 is provided at the center position with a tapered threaded hole 24 to which the threaded boss 19 on the upper mounting means 17 is inserted to fasten the robotic flange 21 by screwing with a fastening means such as a bolt and the like . each of the downwardly protruded props 23 is bent in an l - shaped form of a hook which comes to engagement with one of the guide rails 18 having an inversely l - shaped cross section on the upper mounting means 17 . thus , the robotic flange 21 having the above described structure is guided by the inclined guide surfaces 20 and becomes engaged with the guide rails 18 under fittingness increasing from the rearward end toward the frontward end to be mounted on and fixed to the mounting means at a proper mounting position in a demountable fashion . as is illustrated in fig1 and 11 to 14 , each of the lower side mounting means 25 consists of an upper and lower engagement ribs 26 integrally shaped with each of the side walls at the outer lower position with a plurality of reinforcement ribs bridging the engagement ribs 26 . these upper and lower engagement ribs 26 , which define an insertion space 27 , each extend in the front - to - rear direction and is provided with a threaded fixing boss 28 at each of the front and rear ends . as is illustrated in the same figures as above , each of the side rails 29 is provided with a flat plate 30 extending in the front - to - rear direction and an insert 31 , which is to be inserted into the insertion space 27 between the engagement ribs 26 in a demountable fashion , is integrally formed along the inside periphery of the flat plate 30 together with reinforcement ribs . the outer periphery of the flat plate 30 extends to form a horizontal supporting plate 32 with reinforcement ribs to facilitate lifting of the box body 1 . a fixing hole 33 is formed at each of the front and rear ends of the flat plate 30 , into which the fixing boss 28 is inserted and fixed thereto by screwing with a fastening means such as a bolt , which is shaped from a plastic resin such as a polycarbonate resin and polyether ether ketone resin in consideration of cleaning treatment of the box body 1 . as is illustrated in fig1 , 11 and 12 , each of the side mounting means 34 consists of a pair of guide rails 35 oppositely facing up and down on the outer surface of each of the side walls of the box body 1 as integrally shaped together with a plurality of reinforcement ribs and an engagement cavity 36 formed between the front ends of the upper and lower guide rails 35 . the upper and lower guide rails 35 are positioned in such a fashion that the vertical distance therebetween is gradually decreased from the rearward end toward the frontward end so that tightness of insertion is increased in this direction . the inward side surface of each of the guide rails 35 forms an inclined guide surface 37 gradually narrowing in the rear - to - front direction . each of the manual handles 38 consists of a plate 39 to be inserted between the guide rails 35 as being guided by the inclined guide surface 37 and a u - formed handle 40 integrally shaped on the outer surface of the plate 39 . the front end of the plate 39 is shaped in the form of an integral hook 41 having flexibility , which is engaged with the engagement cavity 36 . the handle 40 is shaped in such an inclined fashion as to be lower in the rearward end and higher at the frontward end in consideration of the center of gravity of the wafer container box positioned somewhere between the center position and the front opening . each of the manual handles having the above described structure is guided by the inclined guide surface 37 to fit to the guide rails 35 with tightness increasing in the rear - to - front direction so as to be positioned and fixed to the side mounting means at a proper mounting position in a demountable fashion . in the wafer container box having the above described structure , the container box can be equipped with a robotic flange 21 , a pair of guide rails 29 or a pair of manual handles 38 of a specific type only by selecting to meet the particular requirement of the process under various limitations of the production lines with omission of unnecessary accessory parts . accordingly , the wafer container box of the present invention is absolutely free from drawbacks in storage and handling including the cleaning works without any increase in the weight of the container box per se or without any increase in the investment for facilities . when the contained box is wrapped in a plastic film bag , absolutely no troubles are encountered by contamination due to puncture or pinhole formation in the bag . when the side rails 29 are not employed , the troubles due to interference of the side rails with the line equipment can never take place as a matter of course without necessitating an additional space for cleaning and storage of the wafer container boxes . further advantages can be expected as compared with conventional wafer container boxes that the number of bolts for assemblage of the box can be minimized so as to improve the efficiency of the assembling and disassembling works along with absorption of the positioning errors without necessitating any additional parts for exact positioning . as a consequence of integral forming of alignment grooves for supporting wafer materials on the inward surface of each of the side walls of the box body , the wafer container box as a whole can be compact - sized as compared with conventional wafer container boxes . it is of course that the troubles due to electrostatic charging of the box can be almost completely dissolved since the various parts of the box body are shaped from a thermoplastic resin exhibiting permanent anti - static effects . even if electrostatic charging has taken place , it is possible to release the charges by grounding through the robotic flange 21 or other parts prior to contacting with the transportation machine or wafer - processing machine . elimination of the electrostatic charging means that deposition of dust particles can be minimized during transportation or in the course of taking out the wafer materials from the box . accordingly , the inventive wafer container boxes brought into a clean room never cause the troubles due to contamination of the clean room and occurrence of unacceptable products . further it is possible to undertake the techniques of two - color molding to obtain a wafer container box of the invention provided with a see - through window 10 of a transparent plastic resin without joint gaps with the body of the container box 1 so that the alignment condition of the wafer materials w contained in the container box 1 can readily be watched from outside without decreasing the air - tight sealability of the wafer container box . while the wafer alignment supporting grooves 2 illustrated in the accompanying drawing each have a u - formed cross section , it is of course optional that the cross section is v - formed . examples of the transparent plastic resin for molding of the see - through window 10 include polycarbonate resins , acrylic resins and polyether imide resins though not particularly limitative thereto . when the box body 1 as a whole is formed from an antistatic opaque resin , the see - through window 10 can be shaped integrally with the box body 1 without gaps therebetween by the techniques of two - color molding or insert molding . it is also optional that another see - through window is provided in the covering 12 , which may have a double - wall structure with a void space therebetween , so as to enable automatic checking of the alignment condition of the wafer materials w contained in the wafer container box without removing the covering 12 by means of a photoelectric sensor . it is further optional that the guide rails 18 are each shaped to have such a configuration that the height and width are gradually decreased from the rear side to the front side . the inclined guide surface 20 can be formed in such a fashion that the distance from the guide rail 18 is gradually decreased fron the rear side to the front side . the engagement ribs 26 having a u - shaped or v - shaped cross section can be shaped in such a fashion that the inward surface thereof is in direct contact with the insertion part 31 of each of the side rails 29 . the flat plate 30 can be provided with one or more of fixing holes 30 in the areas excepting the end portions . the fastening bolt can be a metal bolt instead of a resin - made bolt . it is possible that each of the side walls is provided on the outer surface at the lower position with a cylindrical boss and a fixing boss arranged in the front - to - rear direction . the guide rails 35 can be shaped in such a fashion that the height thereof is gradually decreased from the rear side to the front side and the vertical width thereof is gradually increased from the rear side to the front side . the form of the handle 40 is not limited to the u - form but can be any other forms according to desire .

8General tagging of new or cross-sectional technology

an anchoring system 10 in accordance with an embodiment is illustrated in fig1 . a spline 12 , forming a core of the anchor is hollow and threaded . in an embodiment , the core may be cold forged or cold rolled . the threading may be , for example , a unified coarse ( unc ) thread pattern , though other thread types may be used in accordance with the specific application . the inner diameter of the central through - hole should be selected to be sufficiently large to allow injection of a curable material there through . in a non - limiting example , a half - inch outer diameter rod having a quarter - inch internal diameter could be used as the spline 12 . the outer threading is selected to be compatible with fasteners such as nuts to secure the assembly to the structure , or alternately , compatible with other assemblies to be mounted to the anchor . arranged outside of the spline 12 is a containment sleeve 14 . the containment sleeve 14 should generally be flexible and strong , and be sufficiently permeable to allow some degree of flow through by the curable material . the containment sleeve 14 may be made from any of a number of appropriate materials , including carbon and steel fabrics or meshes . in embodiments , woven and nonwoven fabrics , which may be reinforced with strength members such as carbon fiber , steel , and / or synthetic fibers such as kevlar and the like , could all be employed . the space between the spline 12 and the containment sleeve 14 is filled with a curable injection material 16 . the material 16 may include a variety of flowable cement and / or lime based liquid mixes , which may also be referred to as grouts . the material 16 may be selected to exhibit various properties , depending on the particular installation . for example , waterproofing , fire resistance and / or corrosion resistance may be important in certain situations . the material 16 may also be selected to have a coefficient of thermal expansion , a water permeability , a compressive strength , and / or vapor transmission that is matched to the surrounding material . in an embodiment , the installation method includes on site and / or laboratory testing of the material of the structure being reinforced to determine appropriate characteristics of the fill . as will be appreciated , the fill should substantially fill the borehole . in the embodiment of fig1 , additional optional structures are included in the anchoring system 10 . at each end of the spline 12 , a respective compression ring 18 is used to fix the containment sleeve 14 to the spline 12 , and to assist in containing the injection material 16 within the containment sleeve 14 . a threaded compression member 20 is likewise optionally connected at each end of the spline 12 . at the distal end , a cap 22 may be provided . at the proximal end , customizable connection assemblies 24 may also be provided . as will be appreciated , the connection assemblies 24 may be selected for use with various structures to be attached to the anchor . in one embodiment , a tapered dowel with internal threading at one or both ends is used in conjunction with the compression ring 18 to secure the containment to one or both ends of the anchor . the tapered dowel is threaded onto an end of the spline &# 39 ; s thread . a compression ring is then slid down the spline , with the containment sleeve 14 tucked under the ring . the ring and sleeve are then pushed onto the frame of the dowel , securing the fabric . this approach may simplify assembly by eliminating the need for plastic fittings , and may tend to increase both the tensile and shear strength of the anchor . fig1 further illustrates an embodiment in which one or more strain gages 26 are included in the anchoring structure to monitor strain in the spline 12 . they may likewise be incorporated into the material of the containment sleeve 14 . they may be arrayed along the length of the anchor to provide location specific strain information relevant to selected segments of the system , depending on the expected stress load . these strain gages may be , for example , rfid based wireless and unpowered strain gages such as those available from phase iv engineering of boulder , colo . alternately , an electrical connection could be provided as necessary or desirable . other telemetric devices may similarly be incorporated , either in conjunction with or independently of the strain gages . in an example , rfid tags can be used to uniquely or generally identify a particular anchor installed in a particular location . in an embodiment , the tag may be configured to be threadably connected to the spline 12 . accelerometers , gps , magnetic compasses and / or other devices that are useful for monitoring position and / or movement of the structure may likewise be incorporated into the anchoring system and may be wirelessly or electrically pollable using an appropriate reader . in an embodiment , the drilled hole into which the anchoring system is inserted includes a uniform diameter for an initial portion , then a wider portion at the distal end . this approach may improve the pullout capacity and may furthermore reduce the importance of a strong bond between the injected material 16 and the surrounding material . such an approach may find use , for example , in a structure that tends to experience uplift , such as , for example , a structure in a high wind area . a tapered hole of this type may be made using , for example , the gruenstark undercut coring system , available from gurenstark of cockeysville , md . in a particular example of an embodiment , a 12 ″ long , 1 ″ diameter dry cored hole is drilled into a masonry structure . the hole includes a reverse taper at the distal end to 1¼ ″ diameter . a polyester blend fabric containment that is constructed to have an outer diameter of greater than 1 ″ when expanded is used as the containment sleeve 14 . a ½ ″- 13 hollow , cold rolled , stainless type 304 unc threaded spline 12 is placed within the fabric containment sleeve 14 . the sleeve 14 is fixed to the ends of the spline 12 using compression rings and tapered dowels as described above . at the proximal end , the dowel includes a ¼ ″ through hole at the center to allow for injection of the injection material 16 . at the distal end , the dowel is closed at its end , but includes a ¼ ″ hole through its side to allow for ejection of the injection material into the containment sleeve 14 . those skilled in the art will appreciate that the disclosed embodiments described herein are by way of example only , and that numerous variations will exist . the invention is limited only by the claims , which encompass the embodiments described herein as well as variants apparent to those skilled in the art .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

a drawing of the invention as conceived and embodied in its preferred form shows the left rear body panel 10 of an automobile which is provided with a trunk lid 11 for exposing and covering the trunk storage area 12 . a laterally positioned water runoff trough 13 is adjacent to a resilient sealing strip 14 often of a rubber similar material . communications equipment such as a civilian band radio transceiver ( cb radio transceiver ) is normally positioned and concealed within a conveyance . however , optimum transmission and reception are obtained by locating the antenna 15 externally of the vehicle in a manner permitting the frequency - carrying coaxial cable 16 to run from the antenna to a location within the automobile conveyance where the transceiver is located . the present invention allows the necessary external but proximal placement of the antenna for the proper utilization of the communications equipment . subsequent to this utilization the visible part of the equipment is readily removed and concealed within the storage area 12 . installation of the various members of the adjustable separable antenna mount in assembled relationship starts with the raising of the trunk lid 11 to allow attachment of a clamping intermediate u - member 30 to the underside of the water runoff trough 13 . since the function of the runoff is to drain off water without allowing it to penetrate the storage area 12 the attachment means comprises openings 32 in the upper arm 31 of the u - shaped member 30 thru which threaded bolts 33 are positioned with plain washers 34 and rubber - like sealing washers 35 . the attachment means preferably utilize tinnerman nuts 36 through which the bolts are threaded to obtain firm attachment . in the lower horizontal arm 38 of the clamping intermediate member are two openings 39 for placement of bolts 40 which are held by lock washer - nuts 41 , preferably keps - nuts which provide a lock washer and nut as a unit . since the upper arm 31 of the clamping intermediate member 30 is firmly attached to the underside of the runoff 13 the bolts 40 provide posts on which lateral adjustment horizontally of the upper arm 21 of a hold - down lower member 20 is accomplished in slots 22 as required by variable widths of the runoff 13 . the hold - down lower member 20 is positioned on the post bolts 40 , adjusted laterally horizontally in the slots 22 and firmly anchored by a tightening of the nuts 41 . thus , an assembler has a firmly affixed partial assembly comprises the joined clamping intermediate member and the holddown lower member . to the latter the spring draw pull catch fastener 60 is loosely attached by inserting the bolts 70 of the fastener into and along the slots 26 of the vertical arm 24 of the hold - down member and finger tightening the lock washer nuts 71 . thus the plate 68 of the fastener is attached to the trunk side of the vertical arm of the hold - down member with the lever action handle 61 of the fastener in an easily accessible location for use . when so positioned the vertical arm 24 of the hold - down member 20 is ready to receive the lower vertical arm 57 of the antenna - mounting upper member 50 into and through the lateral claws 25 on the vertical arm 24 . vertical adjustment of the catch fastener 60 by proper manipulation and placement of its bolts 70 and tightening of the nuts 71 insure a fit between the trunk lid and the lower horizontal arm 56 of the mounting member 50 without deleterious compression of the sealing strip 14 . such manipulation and placement allows the strap 65 of the fastener 60 to engage the lip 58 of the lower vertical arm 57 of the mounting member 50 . the lever action handle 61 of the fastener is then actuated to provide a tension latching effect which guarantees close contact between the vertical arm 24 of the hold - down member and the lower vertical arm 57 of the antenna mounting member . all members are now in working assembly relationship . a suitable antenna 15 with coaxial cable 16 is mounted on the upper horizontal arm 51 thru an opening 52 . the cable is positioned in the slot 53 and enlarged end 54 to avoid more than minimal contact with a closed trunk lid . in the case of an antenna having a grounding component which is integral with the antenna base a separate grounding procedure is unnecessary . for an antenna requiring a separate grounding procedure an opening 59 in the mounting upper horizontal arm 50 is available for the required proximate grounding of an upper shield of the co - ax cable 16 . disassembly easily follows release of the lever action handle 61 and vertically slidable removal of the lower vertical arm 57 of the antenna mounting upper member 50 . placement of the thus separated member and the antenna in the storage area 12 removes visible evidence of the presence of the communications equipment . it will be observed that the preferred embodiment utilizes a substantially double right - angled antenna - holding upper member 50 . however , the upper vertical arm thereof 55 is also operable as a generally upstanding arm forming an obtuse angle with the lower horizontal arm 56 . both a right - angled and an obtuse - angled upper vertical arm position the antenna in a configuration sufficiently external to a conveyance for optimum operation . similarly , the horizontal lower vertical arm 56 is operable by slight adjustment of its plane to conform to a step or steps in the runoff trough 13 . it is preferred that the base , intermediate and upper members be of 14 gauge sheet metal which is coating plated . the preferred spring draw pull catch which provides the tension latching is commercially available under the name nielsen . as will be apparent to those of ordinary skill in the relevant art the various dimensions of the members , openings and slots are not critical . for most adaptations operable dimensions are : a hold - down lower member with an about 4 . 5 inch high by 2 inch wide vertical arm having about 1 . 4 inch slots and about 1 inch lateral claws ; an about 2 . 5 inch long by 2 inch wide horizontal arm with about 1 . 4 inch slots ; an intermediate clamping member of about 2 inch width with about 1 inch lower and upper arms and an about 1 . 5 inch upstanding arm , an antenna - mounting upper member with an about 2 inch width , a 5 inch lower vertical arm ; a 21 / 4 inch lower horizontal arm , a 2 inch upper vertical arm and a 3 inch upper horizontal arm . the slot component of the latter member extending from approximately the inner end of the upper vertical arm to the upper end of the lower vertical arm is about 1 / 4 inch in width and is about 43 / 4 inches in length . the two antenna mounting openings are about 0 . 6 inch and 0 . 4 inch in diameter respectively while the proximate grounding opening is about 3 / 16 inch in diameter . the preferred position for the engaging lip of the lower vertical arm of the antenna - mounting upper member is about 0 . 6 inch from the lower end of said arm . other operable dimensions and combinations of dimensions will be apparent to those of skill in the art as will be other areas of placement of the mount on a mobile conveyance with a coverable storage area .

7Electricity

reference is now made in detail to various embodiments of the disclosure , examples of which are illustrated in the accompanying drawings . whenever possible , the same or like reference numbers and symbols are used throughout the drawings to refer to the same or like parts . the drawings are not necessarily to scale , and one skilled in the art will recognize where the drawings have been simplified to illustrate the key aspects of the disclosure . the claims as set forth below are incorporated into and constitute a part of this detailed description . the entire disclosure of any publication or patent document mentioned herein is incorporated by reference . cartesian coordinates are shown in some of the figures for the sake of reference and are not intended to be limiting as to direction or orientation . the term “ relative refractive index ,” as used herein in connection with the multimode fibers and fiber cores discussed below , is defined as : δ ( r )=[ n ( r ) 2 − n ref 2 )]/ 2 n ( r ) 2 , where n ( r ) is the refractive index at radius r , unless otherwise specified . the relative refractive index is defined at the operating wavelength λ p , which is the wavelength where the multimode core of the optical fiber is designed to work optimally , e . g ., where the differential mode delay is minimized . in one aspect , the reference index n ref is silica glass . in another aspect , n ref is the maximum refractive index of the cladding matrix ( introduced and discussed below ). the refractive index n 0 is the maximum index of the index profile . in most cases , n 0 = n ( 0 ). as used herein , the relative refractive index is represented by δ and its values are given in units of “%,” unless otherwise specified . in cases where the refractive index of a region is less than the reference index n ref , the relative refractive index is negative and is referred to below as a trench . the minimum relative refractive index is calculated at the point at which the relative index is most negative , unless otherwise specified . in cases where the refractive index of a region is greater than the reference index n ref , the relative refractive index is positive and the region can be said to be raised or to have a positive index . the alpha parameter α as used herein relates to the relative refractive index a , which is in units of “%,” where r is the radius ( radial coordinate ) of the fiber , and which is defined by : δ ⁡ ( r ) = δ 0 ⁡ [ 1 - ( r - r m r 0 - r m ) α ] , where r m is the point at which δ ( r ) is the maximum δ 0 , r 0 is the point at which δ ( r )% is zero and r is in the range r i ≦ r ≦ r f , where δ ( r ) is defined above , r , is the initial point of the α - profile , r f is the final point of the α - profile and a is an exponent that is a real number . for a step index profile , α & gt ; 10 , and for a gradient - index profile , α & lt ; 5 . it is noted here that different forms for the core radius r 0 and maximum relative refractive index δ 0 can be used without affecting the fundamental definition of δ . for a practical fiber , even when the target profile is an alpha profile , some level of deviation from the ideal situation can occur . therefore , the alpha parameter α for a practical fiber is obtained from a best fit of the measured index profile . an alpha parameter in the range 2 . 05 ≦ α ≦ 2 . 15 provides a minimum for the differential mode delay ( dmd ) at 850 nm and an alpha parameter in the range 1 . 95 ≦ α ≦ 2 . 05 provides a minimum for the dmd at 1300 nm . the modal bandwidth ( or overfill bandwidth ) of an optical fiber is denoted bw and is defined herein as using overfilled launch conditions at 850 nm according to iec 60793 - 1 - 41 ( tia - fotp - 204 ), “ measurement methods and test procedures : bandwidth .” the minimum calculated effective modal bandwidths bw can be obtained from measured dmd spectra as specified by iec 60793 - 1 - 49 ( tia / eia - 455 - 220 ), “ measurement methods and test procedures : differential mode delay .” the units of bandwidth for an optical fiber can be expressed in mhz · km , ghz · km , etc ., and a bandwidth expressed in these kinds of units is also referred to in the art as the bandwidth - distance product . the modal bandwidth is defined in part by modal dispersion . at the system level , the overall bandwidth can be limited by chromatic dispersion , which limits the system performance at a high bit rate . the limits on any ranges cited herein are considered to be inclusive and thus to lie within the range , unless otherwise specified . the numerical aperture or na means the numerical aperture as measured using the method set forth in iec - 60793 - 1 - 43 ( tia sp3 - 2839 - urv2 fotp - 177 ), “ measurement methods and test procedures : numerical aperture .” fig1 is an isometric view of a section of a multicore fiber 10 , and fig2 a and 2b are front - on views of example multicore fibers according to the disclosure . the multicore fiber 10 includes a central fiber axis af , a cladding matrix 20 with an outer surface 22 and a radius rm , and a plurality of multimode cores (“ cores ”) 30 ( individually denoted 30 a , 30 b , etc .) that run the length of the multicore fiber generally parallel to the central axis . each core has a central axis ac , a radius r co and a diameter d co = 2 · r co . only one core 30 is shown as running the length of multicore fiber 10 in fig1 for ease of illustration . there is no central core 30 , i . e ., there is no core that runs down the central fiber axis af . in an example , cladding matrix 20 is uniform , i . e ., it is made of a single material , such as pure ( undoped ) silica . the multicore fiber 10 has an operating wavelength λ p . fig2 a shows an example multicore fiber 10 having an outer coating 50 that contacts and surrounds outer surface 22 of cladding matrix 20 . in an example , coating 50 has a young &# 39 ; s modulus of less than 1 . 0 mpa , preferably of less than 0 . 9 mpa and in preferred embodiments of not more than 0 . 8 mpa . in another example illustrated in fig2 b , multicore fiber 10 includes coating 50 as a primary coating and a secondary coating 52 that contacts and surrounds the primary coating . in an example , secondary coating 52 has a young &# 39 ; s modulus of greater than 1 , 200 mpa and in other embodiments of greater than 1 , 400 mpa . as used herein , the young &# 39 ; s modulus , elongation to break , and tensile strength of a cured polymeric material of a primary coating is measured using a tensile testing instrument ( e . g ., a sintech mts tensile tester or an instron universal material test system ) on a sample of a material shaped as a film between about 0 . 003 ″ ( 76 microns ) and 0 . 004 ″ ( 102 microns ) in thickness and about 1 . 3 cm in width , with a gauge length of 5 . 1 cm and a test speed of 2 . 5 cm / min . additional description of suitable primary and secondary coatings 50 and 52 can be found in pct publication wo2005 / 010589 . the cores 30 are arranged symmetrically about central fiber axis af with core axes ac located at a radius rc & lt ; rm and have a center - to - center spacing cp . the cores 30 have an alpha parameter α and a relative refractive index δ (“ core δ ”) as described in greater detail below . the cores 30 , in combination with the surrounding cladding matrix 20 , define a core numerical aperture na c . fig3 is a close - up front - end view of an example core 30 . the core 30 includes an inner core 32 , an inner cladding 33 that surrounds the inner core and a trench 34 that surrounds the inner cladding . fig4 is a plot of the core δ versus core radius r showing inner core 32 , inner cladding 33 and trench 34 surrounding the inner cladding . the trench 34 has a relative refractive index δ = δ t , while cladding matrix 20 has a relative refractive index δ = δ cm . the trench 34 has a width δr t and an outer radius r t . the inner cladding 33 has a relative refractive index δ of δ icl , which is shown by way of example as being equal to δ cm of cladding matrix 20 . the inner cladding 33 has an outer radius r cl and a width δr icl . in examples , the depth of trench 34 , which is measured by the trench δ of δ t , satisfies δ t & lt ;− 0 . 1 %, or is in the range − 0 . 7 %≦ δ t ≦− 0 . 1 % or is in the range − 0 . 5 %≦ δ t ≦− 0 . 2 %. also in examples , the width δr t of trench 34 satisfies δr t ≧ 1 μm , or is in the range 1 μm ≦ δr t ≦ 6 μm or is in the range 2 μm ≦ δr t ≦ 5 μm . as noted above , cores 30 are multimode , and trench 34 serves to equalize the delays of the higher order modes , which travel near the outer radius of the core and tend to propagate faster than the modes traveling in the center region of the multimode core due to the goos - hänchen effect . the trench also suppresses power leakage , which decreases macrobend losses compared to multimode cores that only have an inner core . in examples , the width δr icl of inner cladding 33 is in the range 0 . 5 μm ≦ δr icl ≦ 2 . 0 μm , or 0 . 6 μm ≦ δr icl ≦ 1 . 5 μm or 0 . 8 μm ≦ δr icl ≦ 1 . 2 μm . the optimum inner cladding width δr icl - opt is related to the inner core radius r ci and the relative refractive index δ t of the trench 34 by the formula δr icl - opt = 0 . 053 r ci − 0 . 586 δ t . in examples , multimode core 30 has a high overfilled modal bandwidth when | δr icl − δr icl - opt |≦ 0 . 3 μm , or | δr icl − δr icl - opt |≦ 0 . 2 μm , or | δr icl − δr icl - opt |≦ 0 . 1 μm . also in an example , the width δr icl is within 10 % of the optimum width , i . e ., is in the range defined by ( 0 . 9 )· δr icl - opt ≦ δr icl ≦( 1 . 1 )· δr icl - opt . the trench 34 also suppresses crosstalk and skew between cores 30 . in some embodiments , the crosstalk between adjacent cores 30 is less than − 30 db , or less than − 35 db or less than − 40 db . in some example embodiments , the skew between any two cores 30 of multicore fiber 10 is less than 5 ps / m , or less than 2 ps / m , or less than 1ps / m or less than 0 . 5 ps / m . in an example embodiment , the number n of cores 30 can be 2 ≦ n ≦ 10 , and in a further example embodiment is 4 ≦ n ≦ 8 , and in a further example embodiment n = 6 . also in an example embodiment , the core diameter d co is in the range 20 μm ≦ d co ≦ 40 μm and the core α is in the range 1 . 9 ≦ α ≦ 2 . 2 . further in an example embodiment , the core α is in the range 2 . 05 ≦ α ≦ 2 . 15 for λ p = 850 nm or λ p in the range from 800 nm ≦ λ p ≦ 900 nm ; or the core α is in the range 2 . 0 ≦ α ≦ 2 . 1 for λ p = 980 nm , λ p = 1 , 060 nm , or λ p in the range from 930 nm ≦ λ p ≦ 1110 nm ; or the core α is in the range 1 . 95 ≦ α ≦ 2 . 05 for λ p = 1 , 300 nm or λ p in the range from 1250 nm ≦ λ p ≦ 1350 nm ; or the core α is in the range 1 . 9 ≦ α ≦ 2 . 0 for λ p in the range from 1520 nm ≦ λ p ≦ 1620 nm . further in example embodiments , the maximum core δ , denoted δ 0 , is in the range 0 . 6 %≦ δ 0 ≦ 1 . 9 %, or between 0 . 8 %≦ δ 0 ≦ 1 . 3 % or 0 . 9 %≦ δ 0 ≦ 1 . 2 % to enable respective numerical apertures na c in the ranges 0 . 16 ≦ na c ≦ 0 . 26 , or 0 . 18 ≦ na c ≦ 0 . 24 or 0 . 185 ≦ na c ≦ 0 . 215 . further in an example embodiment , multicore fiber 10 has a ratio between the inner core radius and inner cladding radius of p = r ci / r cl = 0 . 94 , which is the same as that of corning ® clearcurve ® multimode fiber . in other embodiments , ρ is between 0 . 9 and 0 . 95 , or between 0 . 91 and 0 . 94 , or between 0 . 92 and 0 . 94 . also in an example embodiment , diameter dm = 2 · rm of cladding matrix 20 satisfies the condition dm ≦ 220 μm , and further in an example is in the range 120 μm ≦ dm ≦ 220 μm . in some embodiments , 150 μm ≦ dm ≦ 220 μm , 160 μm ≦ dm ≦ 200 μm or 170 μm ≦ dm ≦ 180 μm . in other embodiments , diameter dm is in the range 120 μm ≦ dm ≦ 150 μm , or 120 μm ≦ dm ≦ 140 μm or 120 μm ≦ dm ≦ 130 μm . further in examples , the center - to - center core pitch cp is in the range 30 μm ≦ cp ≦ 60 μm , or 30 μm ≦ cp ≦ 45 μm or 45 μm ≦ cp ≦ 60 μm . the multicore fiber 10 is formed by drawing a multicore preform using standard optical - fiber fabrication techniques known in the art . a multicore preform can be made by using different methods , for example , glass drilling , or stacking methods . in the following examples , the glass drilling method was used to form a multicore preform . in this method , a silica glass cylinder substrate is drilled with holes with the dimensions and locations according to a multicore fiber design . then core canes with a designed index profile and with a diameter slightly smaller than the hole diameter are inserted into the holes to form a multicore preform . the core canes can be made by conventional preform manufacturing methods such as ovd , mcvd or pcvd . the design parameters for nine example multicore fibers 10 are set forth below in tables 1 , 2 and 3 . in the tables , “ pf ” stands for “ preform ” and “ mcf ” stands for “ multicore fiber .” in the design examples , it is assumed that the geometry of the fiber scales with the ratio of the fiber diameter over the preform diameter . the diameter of cladding matrix 20 is denoted dm while dh stands for “ hole diameter ” and corresponds to the core diameter d co , which is equal to 2 · r t , i . e ., the outer diameter of trench 34 . thus , by way of example , a hole diameter dh = 40 μm accommodates a core 30 with a diameter d co = 30 μm ( r co = 15 μm ), an inner cladding width δr icl = 1 . 2 μm , and a trench width δr t = 3 . 8 μm . the separation distance between the centers of cores 30 that lie along a line passing through central fiber axis af is denoted dc = 2 · rc . the core radial distance measured from central fiber axis af is thus rc . the core pitch cp is the center - to - center core spacing . the core spacing cs represents the edge - to - edge separation of adjacent cores 30 as measured along a line connecting the cores &# 39 ; respective central axes ac . the parameter w represents the spacing between the outer radii of the cores 30 and the outer edge ( surface 22 ) of cladding matrix 20 . the various design parameters are included for both the initial preform and the drawn multicore fiber 10 . note that fig2 a and 2b can represent preform pf if the outer coating ( s ) is / are removed , and the reference symbol pf is included in parenthesis in fig2 a and 2b to illustrate this point . table 1 below sets forth the main design parameters for three example four - core multicore fibers 10 ( examples 1 . 1 through 1 . 3 ) and the corresponding preforms . for these four - core examples , the core pitch cp =( 2 ) 0 . 5 rc . in the tables below , “ par ” stands for “ parameter .” in example 1 . 2 , for each core 30 , inner core 32 has a diameter d ci = 30 μm , inner cladding has a width δr icl = 1 . 0 μm , and trench 34 has a width δr t = 2 . 75 μm , so that each core has an outer diameter d co = 37 . 5 μm . fig5 is similar to fig2 and shows an example embodiment of a six - core multicore fiber 10 having cores 30 a through 30 f symmetrically arranged about fiber axis af at radius rc . table 2 sets forth the main design parameters for three example six - core multicore fibers 10 ( examples 2 . 1 through 2 . 3 ) and the corresponding preforms . for these six - core examples , the core pitch cp = rc . the multicore fiber 10 of example 2 . 1 has a diameter dm = 125 μm , which is the same as that of a conventional multimode fiber . the holes have a diameter dh = 26 μm , which is designed to accommodate respective cores 30 , each having an inner core 32 of diameter d ci = 18 μm , an inner cladding 33 of width δr icl = 1 . 2 μm and a trench width δr t = 2 . 8 μm . likewise , multicore fiber 10 of example 2 . 3 has a core pitch cp = 51 . 7 μm , and the cladding diameter dm = 190 μm is designed to accommodate the larger pitch and the larger core size as compared to examples 2 . 1 and 2 . 2 . the holes have a diameter dh = d co = 34 . 5 μm , which is designed to accommodate respective cores 30 , each having an inner core 32 of diameter d ci = 26 μm , an inner cladding 33 of width δr icl = 1 . 25 μm and a trench width δr t = 3 μm . fig6 is similar to fig5 and shows an example embodiment of an eight - core multicore fiber 10 having cores 30 a through 30 h symmetrically arranged about fiber axis af at radius rc . table 3 sets forth the main design parameters for three example eight - core multicore fibers 10 ( examples 3 . 1 through 3 . 3 ) and the corresponding preforms . for these eight - core examples , the core pitch cp =( 2 ) 0 . 5 rc / 2 . the multicore fiber 10 of example 3 . 2 has a diameter dm = 180 μm and hole diameters dh = d co = 30 μm designed to accommodate respective cores 30 , each having an inner core 32 of diameter d ci = 20 μm , an inner cladding 33 of width δr icl = 1 . 0 μm and a trench width δr t = 4 μm . tables 4 through 8 below set forth example design parameters for example multimode cores 30 for use in forming example multicore fibers 10 . table 4 sets forth example design parameters suitable for an operating wavelength λ p = 850 nm , table 5 sets forth example design parameters suitable for an operating wavelength λ p = 980 nm , table 6 sets forth example design parameters suitable for an operating wavelength λ p = 1060 nm , table 7 sets forth example design parameters suitable for an operating wavelength λ p = 1300 nm and table 8 sets forth example design parameters suitable for an operating wavelength λ p = 1550 . in tables 4 through 8 below , the inner core radius r ci , the trench inner radius r cl , the inner cladding width δr icl , the trench outer radius r t and the trench width δr t are measured in microns ( μm ). the parameter mg is the number of mode groups supported by the core 30 based on a pure ( i . e ., undoped ) silica cladding matrix 20 having a relative refractive index δ cm = 0 . the parameter δτ is the differential mode group delay in ps / m between the mode groups with the maximum and minimum group velocities . the parameter bw is the calculated modal bandwidth in units of ghz · km , calculated according to the procedure outlined in t . a . lenahan , “ calculation of modes in an optical fiber using the finite element method and eispack ,” bell sys . tech . j ., vol . 62 , pp . 2663 - 2695 ( 1983 ). fig7 is a plot of the inner cladding width δr icl ( μm ) versus the inner core radius r ci ( μm ) based on measurement data for the example cores as set forth above . the plot of fig7 shows the dependence between the width δr icl of inner cladding 33 and the radius r ci of the inner core 32 for the nineteen examples set forth in tables 4 through 8 . this linear dependence was unexpected and illustrates that core preforms with approximately the same ratio ρ = r ci / r cl between the inner core and inner clad ratio ρ can be drawn into arbitrarily sized canes to make a multicore fiber 10 according to the disclosure . tables 4 through 8 illustrate that exemplary ρ values can be between 0 . 9 and 0 . 95 , or between 0 . 91 and 0 . 94 , or between 0 . 92 and 0 . 94 . the optimum value of ρ and hence the width δr icl of the inner cladding 33 also have a secondary dependence on the relative refractive index δ t of the trench . analysis of the parameters in tables 5 through 8 yields the relation δr icl - opt = 0 . 053 r ci − 0 . 586 δ t . the multimode core 30 will have a high modal overfilled bandwidth if | δr icl − δr icl - opt |≦ 0 . 3 μm , or | δr icl − δr icl - opt |≦ 0 . 2 μm , or | δr icl − δr icl - opt |≦ 0 . 1 μm . fig8 is an end - on microscope image of an example multicore fiber that has six cores as shown in fig5 and as set above as example 2 . 1 . there are six cores 30 having an inner core 32 with an average diameter of d co = 17 . 9 μm surrounded by an inner cladding 33 of width δr icl = 1 . 2 μm and a trench 34 with width δr t = 3 μm . the average core pitch cp and average core axis radius rc were measured to be 34 . 56 μm and 34 . 54 μm , respectively . the outer diameter dm of the example multicore fiber 10 of fig8 is 127 . 8 μm . the inner core has a maximum relative refractive index δ 0 of 0 . 99 %, the inner cladding has an average relative refractive index of δ cl = 0 . 0 %, and the trench has a relative refractive index of δ t =− 0 . 45 %. the attenuation of the six cores 30 of the example multicore fiber 10 of fig8 was measured at 1310 nm using optical time domain reflectometry ( otdr ), and the results are set forth in table 6 . the average attenuation at 1310 nm is 0 . 62 db / km and is less than 0 . 7 db / km for each core 30 . the overfilled bandwidths of several of the cores 30 were measured at 850 nm and 1300 nm using a multimode launch fiber with a core diameter of 30 μm . the overfilled bandwidths at 850 nm ranged from 2700 mhz - km to 4350 mhz - km , with an average value of 3340 mhz - km . the overfilled bandwidths at 1300 nm ranged from 707 mhz - km to 844 mhz - km , with an average value of 774 mhz - km . it will be apparent to those skilled in the art that various modifications to the preferred embodiments of the disclosure as described herein can be made without departing from the spirit or scope of the disclosure as defined in the appended claims . thus , the disclosure covers the modifications and variations provided they come within the scope of the appended claims and the equivalents thereto .

6Physics

referring now to fig1 , a network 100 illustrating flows according to the prior art is shown . network 100 includes a first fabric 102 and a second fabric 104 . the second first fabric 102 is formed by three switches 106 a , 106 b and 106 c . a host or server node device 108 is connected to switch 106 a . fabric 104 is formed by three switches 112 a , 112 b and 112 c . a disk storage unit 114 is connected to switch 112 a while a tape storage unit 116 is connected to switch 112 b . switch 106 a is also connected to a first router 110 a . router 110 a is also connected to switch 112 a . switch 112 c is connected to a second router 110 b which is also connected to switch 106 c . by the operation of the routers 110 a and 110 b phantom devices appear in fabrics 102 and 104 . disk storage unit 114 ′ appears to be connected to phantom domain created by the router 110 a , the phantom domain appearing as part of the first fabric 102 . to simplify fig2 , the disk storage unit 1114 ′ is shown connected to switch 106 a , as any access from the first fabric 102 must go through switch 106 a to access the disk storage unit 114 ′. a phantom tape storage unit 116 ′ appears to be connected to a phantom domain created by router 110 b , the phantom domain appearing as a part of the second fabric 104 , while a phantom host 108 ′ appears to be connected to a different phantom domain created by router 110 b , the phantom domain appearing as a part of the second fabric 104 . again for simplicity the tape storage unit 116 ′ is shown connected to switch 106 c and host 108 ′ is shown connected to switch 112 c . fig1 illustrates the flow of an els req packet from host 108 to disk tape storage unit 114 . the els request packet is transmitted from host 108 and passes through switch 106 a enroute to router 110 a . router 110 a traps the els req packet as modifications are necessary . after completing the modifications to the frame , the router 110 a sends a command to router 110 b so that router 110 b can place the els req packet in a context to allow trapping of the els rsp packet if it passes through router 110 b . after the acknowledgement for the command is received from router 110 b , router 110 a transmits the modified els req packet which is received at switch 112 a and forwarded to disk storage unit 114 . disk storage unit 114 performs the desired operation and provides an els rsp packet which travels through switch 112 a and switch 112 c to router 110 b . as router 110 b has formed a trap for this els rsp packet , the els rsp packet is provided to the router 110 b processor where the payload is modified . the modified packet is then provided out of the router 110 b to switch 106 c which provides the els rsp packet to switch 106 a which provides it to host 108 , thus completing the els operation . the router 110 b sends a command to router 110 a to delete the context for the els req / rsp operation as the els rsp packet has been received and modified . as can be seen there are many operations required by the routers 110 a and 110 b which use router processor resources and delay processing of the els packets . for example , communication between the two routers 110 a and 110 b must occur at least to set up the context in router 110 b . the cpu - based processing is also done in the routers 110 a and 110 b and therefore as the number of els req and els rsp packets increases , the workload on the router 110 a , 110 b processors increases as described in the background . ultimately this workload of the processors begins to limit the size of a network that can be handled by the routers 110 a and 110 b , thus artificially limiting the size of the network 100 . it is understood that a simple network with only two fabrics , two routers and a few devices is illustrated in the figures to simplify explanation of the prior art and operations according to the present invention . it is understood that in a conventional or actual embodiment there would be numerous hosts switches and storage units involved , enough so that throughput of the routers 110 a and 110 b would be a limiting factor in the size of the network . fig2 illustrates the simpler flow where the els req and els rsp packets do not contain a device address in the payload . the els req packet is issued from host 108 travels through switch 106 a and arrives at router 110 a . as no changes are necessary the router 110 a simply forwards the packet to switch 112 a and then to disk storage unit 114 . the els rsp packet is provided from the disk storage unit 114 through the switch 112 a to the switch 112 c and then to the router 110 b . as no context is set up in router 110 b , all els rsp packets must be trapped for handling by the processor of the router 110 b . as no changes are necessary in this scenario , the els rsp packet simply transfers through router 110 b to switch 106 c and then switch 106 a and finally to host 108 . by contrasting the flow of fig2 with the flow of fig1 the additional workload on the routers 110 a and 110 b can be understood . the operations of fig1 and 2 are provided in the flowchart of fig3 . in step 300 the router 110 a receives the els req packet provided from the host 108 . in step 302 the router 110 a determines if the els req packet or els rsp packet payload will be changed due to the presence of device addresses . this is done by trapping for particular els operation codes in the payload of the packet by trap logic contained in the router 110 a . if changes are necessary , the els req packet is trapped and modified by the router 110 a processor in step 304 and the relevant information is staged to router 110 b if the els rsp packet also requires changes . after the modification or if no changes are required in step 306 , the els req packet is forwarded by the router 110 a to the disk storage unit 114 . for the els rsp packet , in step 310 the router 110 b receives the els rsp packet from switch 112 c . in step 312 the router 110 b traps the els rsp packet as it has been indicated based on the modification staging and context provided by the router 110 a in step 304 . if in step 314 the els rsp packet is a match , then in step 316 the els rsp packet payload is modified as necessary . after step 316 or if there was no match in step 314 , the els rsp packet is forwarded by router 110 b to the host 108 in step 318 . in step 320 the router 110 b provides the els delete message to router 110 a . operation of a preferred embodiment according to the present invention is illustrated in fig4 and 5 . fig4 is the same network topology and components as shown in fig1 except the initial numerals are changed from a one to a four . thus it is network 400 , fabric 402 , fabric 404 and so on . further illustrated in fig4 are relevant portions of the header and payload of the els req and els rsp packets of interest . the host 408 provides an els req packet to ingress switch 406 a . switch 406 a analyzes the els req packet to determine if changes are necessary to addresses in the payload of the els rsp packet . if so , a trap is set to handle the els rsp packet but no payload modifications are performed in switch 406 a on the els req packet . the els req packet is forwarded to the router 410 a where the router hardware automatically changes the header addresses from addresses of fabric 402 , indicated by did 1 and sid 1 , to addresses of fabric 404 , indicated by the did 2 and sid 2 . therefore the packet that is transmitted from router 410 a has a header addressed did 2 and sid 2 but the payload still contains the did 1 information as the packet is not trapped for handling by the router 410 a . upon receipt by the switch 412 a , the egress switch in the illustrated embodiment , the switch 412 a analyzes the packet and determines it is an els req packet with an address in the payload and therefore traps and modifies the address in the payload as indicated by the address changing to did 2 . the modified packet is then forwarded to the targeted disk storage unit 414 . completing operation , the disk storage unit 414 provides an els rsp packet to switch 412 a which simply passes the els rsp packet through even though an address is present in the payload that must be changed . switch 412 b passes the els rsp packet to router 410 b , which performs the header address translation as illustrated and provides the header translated packet to switch 406 c . switch 406 c provides the packet to switch 406 a , the egress switch , which concludes that this is the els rsp packet to the previous els req packet and therefore traps the els rsp packet to the switch processor for modification . the switch 406 a processor modifies the els rsp packet payload to indicate the proper destination address , in the example did 1 . this is done by having the switch processor review the header destination address and copy the header destination address into the payload address location . the packet is then forwarded to the host 408 . as seen , there are no operations in the routers 410 a or 410 b that are performed by the router processors , only the conventional header translations which are performed by the router hardware in the preferred embodiment . this removes the processing required for the els req and els rsp packets by the router processors . this reduced workload for these two packet types allows the router processor bandwidth to be provided to and used by other router operations , which effectively allows the router to scale to a larger network level . as the operations of modifying the packet are performed as necessary by the ingress and egress switches , the actual modification workload is minimized and not concentrated in any particular device but only handled by the switches that are actually connected to devices that are issuing or receiving the respective els req and els rsp packets . also shown in fig4 for illustration are the address changes which are performed on els req and els rsp packets that contain two addresses in the payload . effectively the relevant switches simply change both addresses in the payload . reviewing the packet received by switch 412 a , it is noted that the packet contains the proper addresses in the header , did 2 and sid 2 in the illustration , and the improper addresses , did 1 and sid 1 , in the payload . by referencing the proper two addresses from the header , the switch 412 a simply places those values into the payload and then provides the packet to the disk storage unit 414 . operation according of fig4 and according to the present invention is illustrated in fig5 . in step 500 the ingress switch 406 a in fabric 402 receives an els req packet from the host 408 . in step 501 the switch 406 a determines that the packet is destined to the translate domain of the router 410 a . according to fibre channel standards , a router provides two levels of virtual domains at a connected port . the first level is a front domain and the second level is a translate domain . more on this operation and architecture can be illustrated by reviewing the fc - ifr rev . 1 . 06 specification , especially section 4 . 4 . by determining that the destination address is the translate domain , this indicates that the packet is being addressed to a phantom device , such as phantom disk storage unit 414 ′, and therefore modifications may need to be performed . in step 502 the switch 406 determines if the els rsp payload will need to be changed or modified . if so , in step 504 an entry into the switch asic contained inside the switch 406 is made to trap the els rsp packet on its return . if not to the translate domain in step 501 or if no changes are needed in step 502 or after step 504 , the els req packet is forwarded to the router 410 a in step 506 . in step 508 the router 410 a forwards the els req packet to switch 412 a in fabric 404 . as switch 412 a is the egress switch for this particular packet as switch 412 a is connected to disk storage unit 414 , the els req packet is received at switch 412 a in step 510 and trapped to the switch processor . in step 512 the switch 412 a determines if the els req packet is from the translate domain provided by the router 410 a for fabric 404 . if so , in step 514 a determination is made whether the els req packet requires modification . if so , in step 516 the processor or cpu in switch 412 a modifies the payload address in the els req packet as illustrated in fig4 . if the packet is not from the translate domain in step 512 or is not required to be modified in step 514 or the edge switch has completed modification in step 516 , the request phase operations complete . in step 520 the els rsp packet is forwarded by switches 412 a and 412 b to router 410 b . it is noted that no operations are performed in ingress switch 412 a regarding the els rsp packet . in step 522 the els rsp packet is forwarded by the router 410 b to fabric 402 , specifically switch 406 c , which then provides the els rsp packet to the switch 406 a , the egress switch for the els rsp packet . in step 524 the switch asic traps the els rsp packet based on the trap set in step 504 . in step 526 the switch processor modifies the address or addresses in the packet payload to provide the right addresses . if the els rsp packet is not trapped in step 524 or after step 526 the switch 406 a forwards the els rsp packet in step 528 to host 408 to complete the els operation . fig6 is a block diagram of an exemplary router or switch 698 . a control processor 690 is connected to a router or switch asic 695 . the asic 695 is connected to media interfaces 680 which are connected to ports 682 . generally the control processor 690 configures the asic 695 and handles higher level router or switch operations , such as the name server , routing table setup , and the like . the asic 695 handles general high speed inline or in - band operations , such as switching , routing and frame header translation . the control processor 690 is connected to flash memory 665 or the like to hold the software and programs for the higher level router or switch operations and initialization such as performed in fig3 and 5 ; to random access memory ( ram ) 670 for working memory , such as the name server and router tables ; and to an ethernet phy 685 and serial interface 675 for out - of - band management . the asic 695 has four basic modules , port groups 635 , a frame data storage system 630 , a control subsystem 625 and a system interface 640 . the port groups 635 perform the lowest level of packet transmission and reception . generally , frames are received from a media interface 680 and provided to the frame data storage system 630 . further , frames are received from the frame data storage system 630 and provided to the media interface 680 for transmission out of port 682 . the frame data storage system 630 includes a set of transmit / receive fifos 632 , which interface with the port groups 635 , and a frame memory 634 , which stores the received frames and frames to be transmitted . the frame data storage system 630 provides initial portions of each frame , typically the frame header and a payload header for fcp frames , to the control subsystem 625 . the control subsystem 625 has the translate 626 , router 627 , filter 628 and queuing 629 blocks . the translate block 626 examines the frame header and performs any necessary address translations , such as those that happen in a router where packet header addresses must be changed . there can be various embodiments of the translation block 626 , with examples of translation operation provided in u . s . pat . no . 7 , 752 , 361 and u . s . pat . no . 7 , 120 , 728 , both of which are incorporated herein by reference in their entirety . the router block 627 examines the frame header and selects the desired output port for the frame . the filter block 628 examines the frame header , and the payload header in some cases , to determine if the frame should be transmitted . the queuing block 629 schedules the frames for transmission based on various factors including quality of service , priority and the like . therefore by removing els req and els rep packet payload address translation duties from the routers and moving the duties to the ingress and / or egress switches , the processing demands on the router processor are significantly reduced . as the processing demands are significantly reduced , this allows increased size for the network as a whole as the router processor can do increased numbers of other router tasks . the above description is illustrative and not restrictive . many variations of the invention will become apparent to those skilled in the art upon review of this disclosure . the scope of the invention should therefore be determined not with reference to the above description , but instead with reference to the appended claims along with their full scope of equivalents .

7Electricity

the invention is best shown in comparison to my prior u . s . pat . no . 4 , 902 , 215 , incorporated herein by reference in full . in side view in fig1 i show a dry lay up for manufacture of a fiber composite structure 1 , utilizing the inventive vacuum bag 4 . the composite 1 is formed on a rigid mold 6 , for this illustrative purpose a flat smooth table surface forming a backing for the fiber composite article 1 . a pattern of dry reinforcing fibers 2 , such as fiberglass or carbon fibers , is laid on the mold 6 . the shape of the mold 6 determines the shape of the final structure 1 , and thus the mold 6 can be curved or of any desired shape , as will be illustrated below . in the prior art , a peel sheet 3 would be placed over the fiber lay up 2 , and then a distribution layer laid on the peel sheet to enhance flow of resin to impregnate the lay up 2 . a resin entrance chamber would be centrally placed on the lay up with a communicating resin distribution chamber to communicate resin flow to the distribution layer . a vacuum outlet , either in the rigid mold or on the outer periphery of the lay up , would communicate with a source of vacuum . a vacuum bag or sheet would then be placed over the entire assembled lay up and distribution layers , and sealed around its perimeter to the mold . a vacuum , applied to the vacuum outlet , would draw the vacuum bag against the lay up . the vacuum both draws the resin throughout the fiber lay up , and presses the resin impregnated lay up against the rigid mold to smoothly form the desired fiber reinforced shape . it should be appreciated that this process requires individual labor to set up the same distribution layers , chambers and vacuum bag in separate steps , even though identical articles may be desired . there are no economies of scale in this process , and every article manufactured is made as though it were a one of a kind article . in the invention , a preformed vacuum bag with integral resin distribution piping and distribution pattern , and optional vacuum piping , is created for the composite article which is to be formed . to create this inventive vacuum bag 4 , the desired rigid mold 6 is first covered with a model of the desired finished fiber composite structure 1 . this can be a master article , manufactured as stated above , or a wax or wood model , or some combination of fiber composite base article and wax or wood additions , to create the external shape of the desired article 1 . this master article pattern is then coated with a separation layer , such as a 50 % soap and water mixture . the separation layer is allowed to completely dry . a reverse master resin distribution pattern , of one of the various forms as illustrated in my prior &# 39 ; 251 patent fig3 - 7 , is then applied over the outer surface of the model article 1 . this reverse master pattern may be the mirror image of any pattern of continuous small channels 14 , preferable running in two cross wise directions . such a reverse master pattern could include a repeated pattern of cylindrical dots , or small regular polyhedral solids 16 . it can also include the pattern of spaced apart rows , crossed by an overlying pattern of spaced rows at right angles to the first rows . over the reverse master pattern is laid a hollow piping structure of significantly greater cross sectional area . such a structure should run the long length of the desired article 1 , and for a wide or complex shape , preferably has branch conduits so that no part of the article 1 is more than forty - eight inches from a conduit . optionally a second conduit structure 24 is placed as a continuous ring around the bag , communicating for vacuum flow from the mold 6 , just outside the perimeter b of the pattern master article 1 . this distribution pattern and the conduit ( s ) are in turn coated with a separation layer which is allowed to dry . the inventive vacuum bag 4 is then formed by repeated applications of an elastomer , such as a viscous , curable silicone rubber , or other peeling , resin resistant curable elastomer , to cover the assembled master pattern 1 , building up a layer of elastomer with greater thickness over the hollow conduit structures 10 , 24 . thicker extensions 19 extending outward from these conduit structures may be provided , to extend beyond the outer limits of the article 1 , and to be completely coated with elastomer . the second conduit structure 24 may be reinforced by embedding a helical coil or spring 25 into the vacuum conduit 24 wall to prevent collapse of the conduit 24 upon application of a vacuum from a vacuum source 26 . a suitable material for forming vacuum bag 4 is dow corning tooling elastomer -- tht ™. this elastomer is translucent , helping in monitoring the progress of the construction of the vacuum bag . this material has a viscosity of 450 poise , which helps give good brushability , and cures , when catalyzed , at room temperature within 24 hours . after cure , the vacuum bag 4 is peeled from the underlying pattern article 1 . the recommended elastomer has high tear strength , reducing the chance of damage to the finished bag . the bag may be additionally reinforced by fiber reinforcement , such as nylon fibers , applied as a hand lay up during the construction of the bag . the conduit sections produce , within the finished bag 4 , a pattern of elongated flow conduits 10 communicating with the inner surface 12 of the vacuum bag 4 . these flow conduits 10 communicate for fluid flow with a resin distribution pattern 14 , formed from the imprint of the reverse master resin distribution pattern . this pattern 14 will normally be a cross hatch of small channels at right angles to each other , separated by a repeated pattern of small bumps 16 on the inner surface of the bag . these bumps 16 may be pyramidal shapes , or spherical , or small cylindrical or square pillars . any such repeated pattern of bumps 16 that will support the channels 14 against complete collapse under a vacuum is suitable , so that the bump pattern will press against the fiber lay up 2 but the channels 14 will remain open a spaced distance for resin flow . the bag build up around the piping extensions creates hollow cured elastomeric tube receptacles 20 on the bag exterior , which connect for fluid flow with the interior elongated flow conduits 10 in the inner surface 12 of the bag 4 . these tube receptacles 20 accept and seal an inserted plastic tube 22 for connection with a resin dispensing system 23 , and , where a surrounding vacuum flow conduit 24 , with reinforcing wall helical springs 25 , has been formed in the bag 4 , with tubing 22 connected to a vacuum source 26 . the resulting bag 4 is a monolithic vacuum bag structure having embedded resin conduits 10 and distribution channels 14 which have been customized to the article 1 desired to be made on a specific rigid mold 6 . this inventive bag 4 can therefore be repeatedly used to make accurate , identical fiber reinforced articles 1 . in each case it is necessary only to make the fiber lay up 2 against the mold 6 , add the peel layer 3 if desired , and then cover the lay up with the vacuum bag 4 of the invention , sealing the bag to the mold with tacky seal 30 . the described material for making the inventive bag 4 does not adhere to resins . this has the advantage that the bag 4 can be easily peeled from the composite structure 1 and any residual resin in the distribution channels 10 , 11 formed in the bag 4 may be easily removed . it has the disadvantage that it is difficult to seal the bag 4 to the mold 6 using the tapes of the prior art vacuum bag process . however , those skilled in the art know of a &# 34 ; tacky tape &# 34 ; which may be used to seal the bag to the mold , and schnee moorehead adhesives part # 5601 has been reported to be suitable . alternatively , a suitable adhering material , such as teflon , may be embedded in the perimeter of the vacuum bag during manufacture and cure , to provide a suitable surface to seal the bag . in some circumstances , such as where the mold is a planar smooth surface , such as a metal topped table , the silicone rubber vacuum bag may adhere to the table sufficiently to provide a suitable seal . it is recognized that the design of the bag 4 should be such that the resin is distributed from the center of the article a to the periphery b , and the vacuum should be drawn from the periphery b . this set up serves to purge any air leaks from the seals at the periphery of the vacuum bag , preventing air bubbles or voids in the resin impregnated fiber . this flow arrangement can easily be established by the set up of the article master patten during the construction of the bag 4 . the construction of the bag 4 is otherwise highly variable to meet the shape of the desired article and mold . for example , in my prior patent &# 39 ; 215 fig8 a section of the large structure such as a boat hull is shown . in such a structure , the flow of resin is aided by gravity to the periphery of the bag . if for any reason the mold should be inverted , than several resin inlets could be provided , and resin supplied to each in turn as the resin flows centrally outward through the reinforcing fiber lay up . the translucency of the vacuum bag is advantageous in that the progress of he resin can be visually followed by manufacturing personnel so as to sequence the supply of resin . the vacuum outlet 26 does not have to be molded into the bag . providing vacuum conduits 24 in the bag 4 may be useful on complicated molds 6 , or where the mold 6 cannot be provided with an internal vacuum outlet 26 and distribution conduit 24 . otherwise the vacuum conduits 24 may be in the mold 6 , and the bag 4 , when created , is extended to cover the vacuum conduits 24 , the distribution pattern 14 in the bag inner surface running almost to the position of the mold &# 39 ; s vacuum conduits . an alternate form of the inventive bag 4 is formed by providing a polymer film bag having sufficient rigidity to resist collapse under full vacuum , embossing within the polymer film a master resin distribution pattern to provide the pattern of continuous small channels 14 which may run in cross directions or in random directions so as to provide the desired two dimensional crosswise flow of the resin . in the case of a rigid polyethylene or plastic bag 4 of this inventive type , the master pattern would primarily comprise a repeated pattern of grooves or channels which may be regular or irregular in extent but which should extend uniformly across the entire sheet of the rigid bag . placed within the rigid bag 4 is a hollow piping structure 22 of cross sectional area running the long length of the desired vacuum bag 4 , alternately containing branch conduits 10 emanating at right angles from a long conduit . a resin supply 23 opening is provided into at least one part of the conduit through the rigidified vacuum bag 4 . the rigid conduits 10 provide for supply of resin which is rapidly distributed under the rigidified plastic sheet under the application of vacuum . the rigidified plastic sheet is chosen of a material which will conform in general shape to the article being formed but which will maintain the internal channel structure 10 , 14 for the distribution of resin between the bag 4 and the article being formed even under the application of a vacuum to the overall bag 4 . thus the bag forms the resin distribution panel 14 from a cross hatch , which can include a random cross hatch , of non - collapsing essentially v - shaped channels which the stiffness of the bag retains even under the application of a vacuum . a suitable material for forming such a bag is polyethylene sheet . this material remains sufficiently flexible that it can be rapidly applied over the fiber lay up of an article by means of tacky tape as described above and has the further advantage that it provides for a ready and even distribution of resin even under a one time use . the chosen material is not adhesive to resin and may easily be pealed from the resin . if desired , a suitable separation layer may applied to the interface of the material before being laid up against the article to be impregnated . this alternate form of the bag has the advantage , therefore , that it is suitable for one time as well as repeated use and provides the integral uniform resin channels without requiring a separate distribution layer between the outer vacuum bag and the article being laid up . an alternate form of inventive vacuum bag 4 is formed from a sheet 49 of uncured vacuum bag material . in the example described herein , this material is an uncured silicone rubber , but any thermo - setting or otherwise curable plastic material can readily be used for the process . a fixed mask 50 for generating a repeated pattern of uniform width resin flow channels 14 is provided . in the preferred embodiment , mask 50 is a sheet 52 of metal or similar material with a repeated densely packed pattern of polygons 54 ( preferably hexagons ) cut into the sheet . any regular circle , oval shape , or polygon 54 capable of being uniformly patterned within a sheet 52 would be suitable , and there is additionally no reason why any dense packed tiling of irregular patterns 54 ( such as a pen rose tiling ) could not readily be used . it is desirable that the distance between any resin channel 14 and the center of its adjoining polygon 54 in the sheet 52 be minimized and it is also desirable that the resin channels 14 be of a fairly uniform width so as to prevent uneven concentration of resin in the finished article . with regular polygons , this is accomplished by making the polygon 54 relatively small . a pattern of polygons ranging from under one inch across to less than a quarter of an inch across has been found suitable . it is also suitable that the mask 50 be a cylindrical mask , with the sheet 49 molded into the mask by an embossing roller , or other form of extruding the sheet 49 into the pattern of the mask 50 . similarly , while the preferred embodiment uses a polygonal pattern in the mask 50 for forming the bumps 16 of the vacuum bag 4 , a pattern such as densely packed ovoids ( ovals or ovals having more pointed ends ), or any other pattern which produces interwoven channels 14 which promote smooth even resin flow , may be suitable . an elastomeric sheet 49 of material from which the vacuum bag 4 is to be formed is laid across this mask 50 and a vacuum drawn on the underside of the mask 50 . an elastomeric sheet 49 may be a thermoplastic , thermoset plastic , silicone rubber , a polyurethene rubber , or other curable or plastic or elastomeric sheet . all such materials are settable : they may be deformed into a shape and then set in that shape to form the bag 4 of the invention . alternately , pressure may be applied at the top of the sheet 49 to extrude the sheet 49 into the mask 50 forming the repeated pattern of raised bumps 16 on the sheet 49 corresponding to the polygonal structure embedded in the mask 50 , and forming a series of recesses 14 in the sheet 49 corresponding to the lands 56 between each polygon 54 on the mask 50 . the sheet 49 is then cured either by the application of suitable temperature cycling , by exposure to a curing agent or the like . upon curing , the sheet 49 is then removed from the mask 50 . the result is a vacuum bag sheet 4 having a uniform pattern of resin channels 14 throughout the sheet extending across the face 12 of the sheet , spaced from the base of the sheet by raised bumps 16 corresponding to the polygonal holes 54 within the mask 50 . it can readily be seen how such sheets 49 can be mass produced repeatedly by use of the same mask 50 . in use , the vacuum bag 4 is formed by placing repeated sheets 49 over the article to be vacuum impregnated , which is laid up as a mat or repeated mats 2 of a fiber - reinforcing material such as fiberglass , carbon filament , boron filaments or the like over a shaping mold 6 . the sheets 49 are then cut to fit and sealed with any suitable sealing compound , such as silicone rubber , to form a uniform bag 4 covering the article to be formed . a flexible tube 22 is then laid periodically along the length of the formed bag 4 and sealed to - the bag 4 by a circular band 58 of sealing compound along a length of the tube 22 . a tool is then inserted into the tube and both the tube and the sheet are slit 60 along a length within the area sealed together by the sealing compound . the tube 22 is then connected to a supply 23 of resin . a vacuum is then applied around the outer edges of the molded vacuum bag 4 substantially in the manner disclosed for the other embodiments above . this vacuum then draws resin from the supply tube 22 , through the formed slit 60 and uniformly through the resin channels 14 formed in the sheet 49 , drawing the resin down uniformly , impregnating the reinforcing fiber mat 2 laid over the mold 6 . the pattern of channels 14 insures a uniform wetting action as well as a uniform distribution of resin . the advantages of this embodiment are several : the sheets 49 may be mass produced for storage before use , and then fit and uniformly cut to any number of mold shapes , sealing the sheets together to make an overall vacuum bag 4 . the bag 4 made of sheets 49 is particularly suited for multiple vacuum baggings of complex forms against a mating mold 6 . the method of applying the resin hose 22 and forming the connection from the resin hose 22 into the bag 4 is a particularly simple one and permits the resin hoses 22 to be applied as flow patterns may dictate based upon the underlying shape of the article being formed . the inventive vacuum bag 4 of this embodiment of particular utility when used on a vacuum table having perimeter channels for drawing a vacuum and replaceable molds for lay up of small parts which may be placed upon the table . it can thus be seen how this particular unitary vacuum bag 4 follows the pattern of the other embodiments in having an integrated uniform series of resin flow channels 14 molded within the bag 4 together a resin supply pipe 22 molded to the bag and how the bag 4 may be easily and uniformly fit to any number of complex mold shapes for the creation of a resin impregnated fiber reinforced article . it can thus be seen that the invention provides a vacuum bag which has considerable operational advantages for repeated manufacture of fiber reinforced articles against molds , providing a unitary vacuum cover to both seal and press the resin into the fibers , as well as providing an integrated means for uniform distribution of resin to the fiber lay up and a uniform vacuum suction . further the vacuum bag of the invention , being conformably build for the specific mold and article to be constructed , has none of wrinkling and folds of the prior art planar sheets used for vacuum bags , and therefore control of the surface smoothness of the manufactured fiber reinforced article is improved . the invention extends past the specific embodiments described to include those equivalent structures and processes as will be apparent to those skilled in the art form the claims .

1Performing Operations; Transporting

the integrated circuit is formed on a semiconductor substrate 1 of a first given conductivity type . in one example , said substrate is of p - doped silicon . the region to be protected is a zone 2 located , for example , on the right - hand side of an arbitrary boundary line 3 . as stated earlier , the zone 2 can comprise memory circuits which are integrated in the same substrate 1 . said zone can also comprise any other type of circuit . regardless of the types of electronic circuit which may be formed in the zone 2 in accordance with integrated circuit technology , the aim of the invention is to neutralize the access 4 to said zone 2 . the access 4 essentially comprises a terminal 5 of a connection 50 . in this connection , the terminal 5 is connected to a fusible portion or so - called fuse section 6 which continues in the form of a conductive layer 7 and this latter in turn penetrates into the zone 2 . the distinctive feature of the invention lies in the fact that the end portion 8 of the fuse section ( namely the end portion located nearest the zone to be protected ) is connected directly to the layer 7 which is of a second given conductivity type , namely n + doped in the example under consideration . the remarkable feature here is that the layer 7 forms with the substrate 1 a junction which is conductive only in one direction . in this invention , steps are taken to ensure that this junction is conductive in a direction which is conducive to blowout of the fuse 6 but acts in opposition to the normal utilization bias of the integrated circuit . in the example shown in the figures , the integrated circuit is fabricated in accordance with the nmos technology . under normal service conditions , the p - type substrate is connected to ground ( that is , to zero volt ) whereas other portions of the circuit are biased at + vcc . this means that the bias potential of the substrate is lower than or equal to the other bias potentials of the circuit . now the junction 9 which forms a separation between the substrate 1 and the layer 7 is conductive only in the direction of substrate 1 to layer 7 . this means that said junction is conductive only when the substrate is at a higher value of potential than the layer 7 and therefore at a value which is higher than the potential applied to the terminal 5 . in consequence , when the memory is programmed , electrical pulses varying between + vcc and 0 volts are transmitted by the layer 7 to the zone 2 . during this stage , the junction 9 is blocked . the layer 7 is isolated from the substrate 1 and the pulses pass correctly . in order to blow the fuse , if the substrate continues to be connected to ground , it is only necessary to supply the terminal 5 with a negative potential over a period of sufficiently long duration . in one example , this negative potential has a value of - 12 volts . in this case , the junction is unblocked and the current flows to the terminal 5 , thus melting the fuse 6 . it is apparent that , once this operation is completed , the layer 7 which is in conductive relation with the zone 2 to be protected can no longer be supplied with current . in point of fact , since the circuit is supplied at its normal polarity between zero volt and + vcc , the introduction of electrical pulses into the layer 7 via the substrate 1 is not possible . if this substrate is nevertheless subjected to electrical pulses , the first result thereby achieved is that the operation of the integrated circuit will be completely disorganized since the substrate is common to the entire integrated circuit . there is then no chance of obtaining any memory - programming action as originally expected . furthermore , in the event that these electrical pulses are negative such as - vcc , for example , the junction 9 is blocked and the pulses no longer pass . if the pulses applied are positive pulses in order that they ma pass through the junction 9 , it is necessary to ensure that the potential applied to the substrate 1 is higher than + vcc . this is also contrary to good performance of the circuit . in the example shown in fig1 it is observed that the access terminal 5 and the fuse section 6 are deposited above an insulating layer 10 obtained by local oxidation of the substrate 1 at this point . the insulating layer 10 can be replaced by a layer of silicon nitride ( si 3 n 34 ) obtained by the growth process . the n + diffusion of the layer 7 is performed , for example , at the same time as a source and drain diffusion of a normal transistor of a circuit which would be contained within the zone 2 of the integrated circuit . in consequence , this diffusion of the layer 7 does not require any additional step in the method of fabrication of the integrated circuit . that part of the connection 50 which connects the access terminal 5 to the layer 7 is formed from polycrystalline silicon having a thickness ( as shown in fig1 ) which is approximately 0 . 5 micron . at the point corresponding to the fuse 6 , the width 1 of said polycrystalline silicon is 2 . 5 microns in one example . so far as the remainder is concerned , the width l of the polycrystalline silicon has a value of about 20 microns , except at the point corresponding to the terminal 5 . said polycrystalline silicon is deposited in a conventional manner after formation of the layers 10 and 7 and can even be n + doped in order to improve its contact with the layer 7 . this dopant can diffuse into said layer 7 without and attendant hazard . in fig2 the contours of the polycrystalline silicon are marked in chain - dotted lines at locations in which the silicon is covered by other layers . the outstanding feature of the invention lies in the fact that , in order to achieve an improvement in melting of the fuse , the fuse is maintained in free air at the expected point of rupture . the portion which remains in the open air is designated by the reference numeral 11 . in order to guard against any attempt made by an operator to connect an electrode to a remaining stump of fuse which may continue to appear in this free portion 11 in the open air after a fuse blowout , this portion of fuse is surrounded by a metal band 12 . the metal of said band can be of aluminum . said metal band 12 is joined to a metallic plate 13 . this band - plate assembly is connected in addition to a constant potential ( not shown ). once the fuse has melted , the layer 7 is naturally brought to a so - called rest potential by the circuits in the zone 2 . the constant potential to which the band - plate assembly is connected acts in opposition to said rest potential . in particular , the plate 13 can be connected to ground . in consequence , any attempt made by an operator who is necessarily clumsy by reason of the small size of the portion 11 in free air is attended by the risk of touching the band 12 at the same time as the remaining stump of the fuse 6 . this prevents any transmission of information into the zone 2 in which access is to be prohibited . the presence of the portion 11 in free air gives rise to a potential hazard of pollution of the integrated circuit . this hazard is offset by the formation of a diffused layer 7 of substantial width . this width is also conducive to the flow of a strong current within the junction 9 . however , the size of this layer 7 then becomes appreciable . in order to prevent the layer 7 itself from serving as a connection to the zone 2 to be protected , said layer is covered by the plate 13 . under these conditions , any electrode which might perforate the integrated circuit at a point located opposite to the layer 7 could not reach this latter without also touching the plate 13 . this is apparent in fig2 in which the contours of the diffused zone 7 are represented by a chain - dotted line within the contour of the plate 13 . since the arrangements of the metallic plate 13 and of the band 12 cannot be realized directly on the polycrystalline silicon and on the layer 7 , it is accordingly necessary to separate them by means of an insulating layer . this insulating layer , which is designated by the reference 14 and appears at all points in fig2 except in the free - air portion 11 and opposite to the terminal 5 , is formed by depositing an oxide by low - pressure chemical vapor deposition ( lpcvd ). for the purpose of finishing the integrated circuit , this circuit is usually coated with a dielectric layer 15 . said layer 15 is applied over the general surface . the free - air opening of the portion 11 is then obtained by performing a plasma etching operation on said dielectric . this plasma etch is preferred to wet - process etching . in a ( chemical ) wet - process etching operation , there would be an attendant danger of chemical attack on the polycrystalline silicon material of the fuse , thus resulting in a reduction in thickness . the resistance of the fuse would increase and the current flowing through the fuse at the moment of blowout would decrease , with the result that the fuse would no longer melt . it is for this reason that the insulating layer 14 , which is also applied at all points and therefore in particular above the free - air portion 11 of the fuse and above the terminal 5 , is maintained above said portion 11 after etching of the metallizations ( in particular the metallization layer formed on the access terminal 5 ). said layer 14 is even retained above the portion 11 after the cleaning operation which directly follows etching of the metallizations . the opening which provides communication between the fuse portion 11 and free air is formed last . this is a vertical opening formed by plasma attack on the layer 15 and on the layer 14 . this is the only special operation which , in the method of fabrication of the integrated circuit in accordance with the invention , differs from a conventional method of fabrication of integrated circuits .

8General tagging of new or cross-sectional technology

referring now to fig1 and 2 a plated spring electrolyte dispensing ampule 10 according to the present invention is shown and described . a spring 12 forms a generally cylindrical interior space 14 . spring 12 is wound such that adjacent turns thereof are in contact when spring 12 is in an equilibrium position . at a first end of spring 12 a metal cap 16 having a cylindrical protrusion 18 provides a closure for cylindrical space 14 . protrusion 18 is adapted to fit within spring 12 and is affixed thereto , for instance by means of solder or otherwise , so as to provide a seal . at a second end of spring 12 , space 14 is closed by means of a plurality of turns 20 of spring 12 . turns 20 lie substantially in a plane perpendicular to the axis of spring 12 and may be formed by familiar techniques employed during the spring winding process . while two particular methods of providing closure for the ends of a space formed by a cylindrical spring are shown here , it is not intended to limit the scope of the present invention to any particular means for performing this function . in addition to providing closure for the ends of space 14 , it is necessary to bond the adjacent turns of spring 12 together in such a manner as to provide a sealed enclosure . a preferred embodiment of the present invention accomplishes this by electroplating a thin layer 22 of metal over adjacent turns 24 of spring 12 . it is preferred that layer 22 be of the minimum thickness necessary to provide hermetic sealing , this being on the order of one - quarter to one - half of a mil . greater thicknesses are certainly usable , but at some point the strength of layer 22 will become a dominant factor in the response of the ampule to set - back forces . it will be immediately apparent to one skilled in the art that the choice of metals for cap 16 , spring 12 and layer 22 is primarily determined by the choice of the electrolyte solution to be used in the battery . the materials must be capable of hermetically containing a highly reactive electrolyte solution , such as fluoboric acid , under time and temperature conditions specified by military requirements . in addition , since the solution to be contained is an electrolyte , no two metals having substantially different oxidation potentials may be in contact with the electrolyte solution . as is well known , beryllium copper will reliably contain acid electrolytes in the absence of air . other materials such as phosphorus bronze may also be appropriate . as is well known in the art , besides the ability to hermetically contain the electrolyte over long periods , the primary design criteria for set - back responsive ampules involve the response of the ampule to various forces . the ampule must be able to withstand anticipated forces other than those of set - back , for instance if the projectile is dropped , without releasing the electrolyte . the present invention achieves control over these design criteria by means of the characteristics of spring 12 . the motion of a spring with a known spring constant and known mass under the influence of known forces is a familiar problem . since the anticipated set - back forces and the maximum drop - safety forces for a particular fuze are known in advance , the choice of the proper spring can be readily made by one skilled in the art . while spring 12 as shown here is wound from wire having a cylindrical cross - section other cross - sections , such as elliptical or square , may be used . such variations may be used to alter the spring constant and / or the characteristics of layer 22 . as mentioned above , it is also possible to increase the thickness of metal layer 22 to the point that is becomes a significant factor in the response of the ampule to various forces . a primary advantage of the present invention is that the design of the container itself controls the response of the ampule to set - back forces . prior art ampules generally involve spring biased and / or viscously damped cutter mechanisms or other mechanical devices to achieve this function . referring now to fig3 a a deferred action battery 30 using a plated spring electrolyte dispensing ampule 32 according to the principles of the present invention is shown in cross - section . a battery case 34 , which is generally cylindrical , contains an annular ring of battery plates 36 . battery plates 36 generally comprise a plurality of alternating layers of metal and insulating material . in addition , battery case 34 suspends ampule 32 containing electrolyte 38 substantially coaxially with annular battery plates 36 such that the bottom of ampule 32 is suspended above the bottom of battery case 34 . a battery 30 of this type is utilized to construct a projectile fuze or the like which may be stored for long periods of time prior to use . referring now to fig3 b the response of deferred action battery 30 to a set - back force f is shown . the mass of the electrolyte solution 38 and of the spring itself accelerates the spring toward the bottom of battery case 34 thus rupturing the thin sealing layer coating the spring and separating the adjacent turns of the spring . driven by hydrostatic pressure created by set - back force f and by the growing centrifugal force caused by the spinning of the projectile , electrolyte solution 38 dispenses between the now separated turns of the spring and is directed to battery plates 36 . the multiple openings available for the dispersal of electrolyte solution 38 will more evenly distribute the solution to the battery plates , thus achieving an improved start - up performance . as set - back force f decreases in magnitude the spring will begin to return to its equilibrium position . by this time , however , the hydrostatic pressure on electrolyte 38 due to the spin forces will be so great as to force electrolyte 38 between adjacent turns of the spring . thus , it is not anticipated that any latching mechanism will be necessary to hold the spring in its open position . while fig3 b shows a plated spring ampule rupturing uniformly over the length of the spring , it will be apparent that this need not be the case . the hydrostatic pressure on the electrolyte solution is such that if only a few turns of the spring actually separate , the electrolyte will be dispensed . the present invention provides a set - back responsive electrolyte dispensing ampule which can hermetically contain caustic electrolytes over long periods of time and which has an extremely simple mechanical design , thus promising lower fabrication costs in high volume production . while the invention has been particularly shown and described with reference to a preferred embodiment thereof , it will be understood by those skilled in the art that various other modifications and changes may be made to the present invention from the principles of the invention described above without departing from the spirit and scope thereof .

7Electricity

fig1 shows a relatively small unmanned jet aircraft 1 used as an aerial target . it carries a parachute ( not shown ) remotely controlled for deployment and recovery of the craft after a mission is completed . the target aircraft 1 is provided with an active radar augmenter where increased apparent target size is required for various missile systems . the augmenter comprises a receiving antenna 2 in the nose of the fuselage , an amplifier 4 , and a transmitting antenna 5 mounted atop a vertical fin 6 at the rear of the aircraft 1 , these three units being interconnected as shown by suitable transmission cables 7 and 9 . for a particular surface - to - air missile having x - band semi - active radar guidance , for example , a ground based radar sends signals which are received by the receiving antenna 2 . these signals are amplified by amplifier 4 and re - transmitted by transmitting antenna 5 to the missile ( not shown ). the missile receives the signals from transmitting antenna 5 and tracks on this antenna to guide itself to the target 1 and explode by means of an rf proximity fuze , for example . the receiving antenna 2 may be a conventional horn type having a directional pattern pointed forward with 30 to 40 - degree solid angle coverage in the 8 to 11 ghz frequency range . antenna 2 preferably has good reception for both horizontally and vertically polarized waves , and for this reason may be axially rotated 45 ° to 55 ° from the normal horizontal position , as shown in fig1 . the antenna 2 is coupled to the connecting cable 7 by a waveguide adapter 10 . the amplifier 4 is any suitable conventional high - gain unit which faithfully reproduces its input signal in the required operating range . the transmitting antenna 5 , further shown in fig2 may comprise a printed - circuit spiral 11 mounted vertically in the front of a cylindrical cavity 12 which is attached to an extension 14 from the top of the vertical fin 6 . the extension 14 may not be necessary if the forward portion of the aircraft does not block the desired transmitting pattern of transmitting antenna 5 . transmitting antenna 5 should be able to transmit both horizontally and vertically polarized waves , so that good performance will be possible in all applications of the invention . the directional pattern is wide , preferably from about 120 degrees up to 10 degrees down , in pitch , and about ± 60 degrees in yaw . in former operations of this type , a missile was guided by a signal reflected to it from an augmenter in the target nose , such as a luneberg lens . with the present invention , the missile is guided by a signal transmitted to it from the rear area of the target . the signal is strong enough so that the missile guidance ignores other radar returns , even from the skin surface of the target 1 . it is thus seen that direct hits on the target will be fewer and that near misses will be farther behind the target . more targets can be recovered and repaired for repeated flights while still allowing missile scoring systems to be effectively used , in conjunction with proximity fuzing of the missiles . in actual practice , there has been a significant worthwhile reduction of target destruction . the present invention can also be used with missiles other than surface - to - air missiles , such as air - to - air for example . the direction and coverage angle of either antenna can obviously be changed to suit any missile system . by having an active augmenting system like the present one , the &# 34 ; reflected &# 34 ; signal can be directed where desired by choice of directional pattern of the rear - mounted transmitting antenna 5 . for missiles approaching the target from directions other than forward , the transmitting antenna can be mounted on the rear of the target fuselage , for example . the present receiving antenna 2 is not required to be installed in the aircraft nose , but it obviously should be far enough from transmitting antenna 5 so the two will not interfere . while in order to comply with the statute , the invention has been described in language more or less specific as to structural features , it is to be understood that the invention is not limited to the specific features shown , but that the means and construction herein disclosed comprise the preferred mode of putting the invention into effect , and the invention is therefore claimed in any of its forms or modifications within the legitimate and valid scope of the appended claims .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

at the outset , it should be appreciated that like drawing numbers on different drawing views identify identical , or functionally similar , structural elements of the invention . while the present invention is described with respect to what is presently considered to be the preferred embodiments , it is to be understood that the invention as claimed is not limited to the disclosed embodiments . fig1 a illustrates housing 1 for an optical device , for example a microscope . the housing comprises an insertion channel for linear carrier 2 , for example a slider . by means of a handle 12 , the linear carrier can be pushed into housing 1 as far as stop 10 . an optical component 4 , for example a filter or a lens , is located in linear carrier 2 . fig1 a depicts a “ working position ” of optical component 4 in the device . in the depiction shown , optical axis 9 of optical component 4 , like the entire device in this region , extends vertically . the underside of linear carrier 2 is in contact with housing 1 on a precision displacement surface 6 and can be displaced as indicated by double arrow 13 . fig2 shows what is depicted in fig1 a , but carrier 2 is partly pulled out of housing 1 to the “ parked position ” for optical component 4 . magnets a 2 and b 2 are located in carrier 2 on each side of optical component 4 . magnets a 2 and b 2 are permanent magnets and are oriented such that the south pole of a 2 and the north pole of b 2 are directed upward in fig1 a and 2 . magnets a 1 and b 1 are likewise present in housing 1 , a 1 being on the one hand associated with magnet a 2 , and b 1 on the other hand associated with magnet b 2 . according to the present invention , however , the magnetic orientations of a 1 and b 1 are such that on the one hand the south pole of a 1 faces the south pole of a 2 , and on the other hand the north pole of b 1 faces the north pole of b 2 . this results in two mutually corresponding magnet pairs a 1 / a 2 and b 1 / b 2 ; this “ correspondence ” results not ( as is generally known ) in an attractive action , but rather in a continuous repulsion action . the effect of these magnet pairs a 1 / a 2 and b 1 / b 2 oriented with identical polarity is thus used , according to the present invention , to press carrier 2 continuously against reference plane 7 in the working position and thus to ensure precise positioning for optical component 4 in housing 1 . the reason for using magnet pairs a 1 / a 2 and b 1 / b 2 positioned on either side of optical component 4 is to generate a “ large - area ” pressure against a reference plane 7 , as opposed to a “ single - point ” pressure . it is also within the context of the present invention to arrange the corresponding magnets , so to speak , “ diagonally ,” providing one stop or two stops offset at an angle in order to ensure precise positioning in two or three spatial directions . if precise positioning in two spatial directions is implemented , angle α is determined in the plane spanned by vertical 16 and translation direction 13 of carrier 2 . if precise positioning in three spatial directions is implemented , angle α is measured in a plane that contains vertical 16 and is at an angle of approximately 45 ° to translation direction 13 of carrier 2 . fig2 shows the “ parked position ” for optical component 4 in the pulled - out carrier 2 . optical component 4 is located outside optical axis 9 , i . e ., outside the working position . this position of carrier 2 could be used , for example , to replace optical component 4 with a different type of optical component , so as to subsequently either to bring it into the working position by sliding carrier 2 into housing 1 as far as stop 10 , or to introduce optical component 4 into the beam path ( symbolized by optical axis 9 ) only when needed . the juxtaposition of magnets b 1 / a 2 in the parked position results in another aspect of the invention . magnet pair b 1 / a 2 is now positioned with opposite polarity , since the north pole of b 1 corresponds to the south pole of a 2 . the desired result is therefore a mutual attraction , resulting in a magnetic interlock that prevents carrier 2 from unintentionally falling or being pulled out of housing 1 . as is further evident from fig1 a , it may be advantageous to position magnet pairs a 1 / a 2 and b 1 / b 2 that coact with each other , and to align them with one another , in such a way that axis 14 a of a 1 is lined up with the corresponding axis of a 2 and moreover forms an angle α with a vertical 16 that is perpendicular to reference plane 7 , i . e . to the translation direction of carrier 2 in housing 1 . angle α can advantageously lie within the range 0 & lt ; α & lt ; 45 °. tilting of axis 14 a , i . e . selection of an angle α & gt ; 0 , results in an additional directional component of the repulsive compression force toward stop 10 . in more general terms , it can be stated that the connecting line of the identically poled magnetic poles associated with one another , i . e ., for example the south poles of a 1 and a 2 or the north poles of b 1 and b 2 , is intended to have a pressing component toward stop 10 , or toward those stops that have already been explained above in connection with the implementation of precise positioning in two spatial directions . fig3 a depicts a linear carrier 2 in the form of a switching slider that contains three optical components 4 , the center one of which is in the working position . this is illustrated by the indication of optical axis 9 . located on the one side of carrier 2 are detents 11 a , i . e ., notches that correspond to an appropriate detent lug on housing 1 . located on either side of each optical component 4 are magnets a 2 and b 2 whose respective polarities ( i . e . magnetic orientations ) are all identically oriented . magnet pairs a 2 / a 1 and b 2 / b 1 are once again evident , magnets a 1 and b 1 being depicted with dashed lines and arranged below the drawing plane . in this exemplary embodiment , however , unlike in fig1 a , the axis orientations of the two magnet pairs a 2 / a 1 and b 2 / b 1 are offset in parallel fashion ( cf . fig3 b , which depicts a section along line y — y of fig3 a ). this variation of the spatial associations of the mutually corresponding identically poled magnet pairs also results in a correspondingly directed additional action of the overall repulsion force toward detent 11 a . fig3 b shows recess 5 , which is considerably larger , especially in terms of its depth , than carrier 2 that is to be inserted . magnet pair b 1 / b 2 exerts its repulsive force and presses the one side of the carrier against inner precision stop surface 6 , which constitutes reference plane 7 . fig4 depicts a rotary carrier 3 that is embodied as a circular disk . it contains six optical components 4 , optical component 4 located in the working position being identified by its optical axis 9 . the filter wheel itself has six peripherally arranged detent notches . it is evident that the particular detent notch associated with optical component 4 that is in the working position is in engagement with a corresponding detent lug . for simplicity &# 39 ; s sake , in this application the detent notch ( es ) and detent lug are referred to together as detent 11 b ( fig4 ) or detent 11 a ( fig3 a ). it is apparent from fig4 that the detent lug is arranged on the cylindrical inner wall of housing 1 . carrier 3 is mounted rotationally about an axis 15 . optical components 4 and magnets a 1 , b 2 etc . positioned therebetween lie with their respective centers on a circular line , the penetration point of axis 15 through the drawing plane of fig4 representing the center point of that notional circular line . the eccentricity , visible in fig4 , of the position of axis 15 with respect to the axis ( not depicted ) of cylindrical housing 1 is conditioned , in terms of design , by the fact that when catch 11 needs to be released , i . e . upon departure from the detent position for component 4 shown in fig4 , a deflection of the disk - shaped carrier 3 in the diametrical direction becomes unavoidable . it is apparent from this that axis 15 is not fixed in stationary fashion within housing 1 . although two embodiments of carriers ( linear switching slider ; disk - shaped carrier ), which according to the present invention hold a plurality of optical components and can be brought into a precise working position within an optical device , have been described in detail in order to explain the present invention , other carriers , for example those having a nonlinear longitudinal extension or a conical three - dimensional turret shape or a serial arrangement of cube - shaped optical components similar to chain links , are of course also encompassed by the concept of the present invention . there is also , in principle , no limitation to specific types in terms of the selection of specific magnetic materials ( e . g . neodymium ) or magnet configurations ( e . g . square or polygonal magnet sections ) or magnet types ( e . g . including electromagnets ). 9 optical axis of optical component ( 4 ) in working position a 2 , b 2 magnet ( s ) in ( 2 ) and ( 3 ) α angle between axis ( 14 a or 14 b ) of a magnet ( a 1 , a 2 , b 1 , b 2 ) and a vertical ( 16 ) encountering reference plane ( 7 ) at a right angle

6Physics

referring now to the drawings , wherein like reference numerals designate identical or corresponding parts throughout the several views , and more particularly to fig3 thereof , there is described the embodiment which meets the objects of the present invention and which provides a side illuminated waveguide hologram . the light source for the hologram of the fig3 is attained by way of an input coupler mechanism 12 which conducts light from a source into the waveguide . this input coupler can be a prism or a grating or an optical fiber . the waveguide itself 22 is a sheet of transparent material with two surfaces which are locally parallel and optically polished . the refractive index of the waveguide must be higher than the index of the environment in order to achieve waveguiding . the wave which is coupled in is confined in the waveguide by total internal reflection on the waveguide surfaces and propagates along a zigzag path as illustrated . the holograph emulsion 32 is placed parallel to and immediately in contact with the waveguide . this holographic recording material can be a silver halide emulsion , a photopolymer layer , a dicromated gelatin film or a photoresist coating . when the hologram is illuminated with the guided wave , the previously recorded holographic image is reconstructed . when compared with conventional holography , the waveguide holograms provide a compact system without requiring the kind of alignment required for conventional holography . because of the flexibility of the optical fiber , the laser or incoherent source which is used can be remotely located . the waveguide hologram system is flat and it can be hung on a wall or hand held without concern as to its illumination . furthermore , the reconstructed image in a waveguide hologram is obstruction free and because the illumination beam is confined in the waveguide it cannot be blocked . because of the high image to background contrast and multiple utilization of the illumination beam as shown in the fig4 a bright image can be obtained . furthermore because the image can only be reconstructured by the light inside the waveguide other light sources will not affect the quality of the image . the utilization of a multimode waveguide is illustrated in fig3 . using side illumination provides for improved coupling efficiency over edge illuminated waveguides and further allows for use of an easily directed light source without requiring modification of the light source . with the type of system shown in fig3 although a laser could be utilized , either white light or other sources of light having a wide beam can be used . it is to be noted that in edge lit illumination systems , there is a restriction on the width of the input light beam . that is , the input light beam can be no larger than the thickness of the wave guide . the side illuminated multimode waveguide is particular advantageous in conjunction with waveguides which have a thickness greater than the wavelength but yet the thickness can be less than the width of an incident light beam i . e . λ & lt ;& lt ; t & lt ; w . because the thickness is much greater than the wavelength , the difficulties of thin film waveguides are overcome and white light illumination can be conveniently used . furthermore , because the thickness is less than the width of the beam , uniform illumination is obtained . these advantages ar brought out by the side illumination input light coupling of fig3 and provide for a significant ease of construction and a compact package . the utilization of a waveguide with the thickness much greater than the wavelength but less than the width of the input beam allows for use of a side input coupled light source with a relatively wide beam width in order to form a spatially continuous pattern of totally internally reflected light . this multimode side input coupled waveguide hologram provides for a multiple utilization of the illumination beam as shown in fig4 and functions to provide an undiffracted beam , confined in the waveguide , to reconstruct the holographic image as shown in fig5 . the fig4 illustrates the illumination process wherein the collimated guided illumination beam , when it reaches an area where the hologram is placed , first encounters the region 1 of the hologram . a part of the light is diffracted as the reconstruction of the image and the rest of the light is reflected . after total internal reflection at the other waveguide surface , the residual light illuminates the region 2 on the hologram and undergoes the second reconstruction . this process is repeated until the illumination beam passes the hologram . because of the multiple utilization of the illumination beam , the holographic image constructed by the fig3 embodiment is more efficient than in conventional holography . the portions of the beam that are undiffracted remain confined in the waveguide and therefore the undiffracted light makes no contribution to the background brightness . thus , a bright image can be obtained even with an inefficient hologram by simply increasing the power of the illumination beam . this increased power will increase the brightness of the image with no contribution to the background brightness because , as indicated above , the undiffracted light confined within the waveguide makes no contribution to the background brightness . a significant factor in the improvement of performance and simplicity of construction is the use of the side input coupled light in contrast to edge lit structures . the edge lit waveguide structures require either a laser beam or a thick wave guide in order to function properly . with the present structure using a side light input coupling , full internal reflection is obtained with ordinary light sources , including fiber optic input which allows for remote non - critical location of the actual light source . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein .

6Physics

before one embodiment of the invention is explained in full detail , it is to be understood that the invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the following drawings . the invention is capable of other embodiments and of being practiced or of being carried out in various ways . also , it is to be understood that the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting . the use of including and comprising and variations thereof herein is meant to encompass the items listed thereafter and equivalents thereof as well as additional items . fig1 schematically illustrates a remote monitoring system 5 according to one embodiment of the invention . the remote monitoring system 5 includes a handset orientation tolerant bi - directional acoustic modem 10 for communicating data over a telephone line 12 . the acoustic modem 10 is located at a remote location 14 from a central site 16 . the central site 16 typically is a hospital or physician &# 39 ; s office . the telephone line 12 has a first end 18 and a second end 20 . the first end 18 is located at the remote location 14 and the second end 20 is located at the central site 16 . the first end 18 is coupled to a telephone 22 having a microphone 24 and a speaker 26 . the second end 20 is coupled to a receiving station 32 at the central site 16 . the acoustic modem 10 includes a first transducer 28 and a second transducer 30 . in one embodiment , the first transducer 28 and the second transducer 30 are piezo transducers . as shown in fig1 the acoustic modem 10 may be coupled to a data source 34 , a converter 36 , or a memory 38 or any combination thereof . the data source 34 , the converter 36 , the memory 38 , and the acoustic modem 10 may also be integral with each other in any combination , and thus , packaged as at least one combined unit , or alternatively , packaged as single units . the data source 34 can be any event recorder or device that is adapted to acquire biomedical or other data including electrocardiograms , pacemaker readings , respiratory rate , heart rate , impedance measurements for determining tidal volume and minute ventilation , eeg , defibrillator data , data from event recorders and loop recorders , as well as other medical equipment such as iv infusion pumps and more . furthermore , the data may include any signal , analog or digital , that is convertible to an acoustic signal for transmission from a remote location to a receiving station . in one embodiment , the acoustic modem 10 of the invention is digital . in another embodiment , the acoustic modem 10 of the invention is analog . the analog acoustic modem may utilize a standard for frequency modulated ( fm ) analog transmissions , or any other analog standard . moreover , in some embodiments , the acoustic modem 10 is suited to effect transmission of data through the traditional public - switched telephone network ( pstn ), while in other embodiments ( not shown ), the acoustic modem 10 is adapted to communicate using an internet protocol telephone such as is commonly available from cisco systems , inc . the transmission standard utilized to transfer the data from the remote location 14 to the central site 16 can include any future types of transmission . the converter 36 receives , amplifies , conditions , and encodes the biomedical or other data from the data source 34 or the memory 38 . the design and signal processing utilized by the converter 36 is conventional . any conversion methodology or techniques now known or later devised may be employed or substituted . the converter 36 does not need to be utilized if the data provided by the data source 34 or the memory 38 is already in a proper format for input to the acoustic modem 10 . the memory 38 can be any conventional type of electronic storage . in one embodiment , the biomedical data is stored after acquisition by the data source 34 and before conversion by the converter 36 . in another embodiment , the converted data is stored after conversion by the converter 36 and before input to the acoustic modem . in another embodiment , the biomedical data is not stored in the memory 38 . the acoustic modem 10 is further schematically illustrated in fig2 . the acoustic modem 10 includes a programmable controller 40 . the first transducer 28 and the second transducer 30 are selectively coupled in alternation to the controller 40 by a drive selector 42 and an input selector 44 . the drive selector 42 actuates a switch s 1 that electrically connects one of the first transducer 28 and the second transducer 30 to the digital output 46 of the controller 40 . the signals output from the digital output 46 are sent through a digital - to - analog converter 48 and a drive signal conditioning unit 50 to the one of the first transducer 28 and the second transducer 30 that is electrically connected to the digital output 46 . the input selector 44 actuates a switch s 2 that electrically connects the other of the first transducer 28 and the second transducer 30 to the digital input 52 of the controller 40 . the signals input to the other of the first transducer 28 and the second transducer 30 are sent through an input signal conditioning unit 54 and an analog - to - digital converter 56 to the digital input 52 . in operation , each transducer of the acoustic modem 10 is capable of functioning as both a transmitting unit to emit acoustic signals , and as a receiving unit to receive communication from the central site . after the patient , or someone else acting on their behalf ( e . g . the patient may have just experienced a heart condition and is therefore unable to align the phone on their own ), aligns the telephone handset 22 with the acoustic modem 10 , the controller 40 determines the orientation of the telephone 22 with respect to the first transducer 28 and second transducer 30 of the acoustic modem 10 . the software used by the controller 40 to establish the handset orientation is illustrated in the flow chart of fig3 . the software determines the orientation of the microphone 24 and the speaker 26 of the telephone 22 with respect to the first transducer 28 and the second transducer 30 of the acoustic modem 10 , and accordingly assigns functionality to the first transducer 28 and the second transducer 30 . the patient starts the software as shown at step 100 . the software can be setup to continuously sample for a detectable dial tone , or setup to only sample for a detectable dial tone when the patient triggers the controller 40 by actuating a switch 60 on the acoustic modem 10 . the software preferably continuously samples for a detectable dial tone and is therefore sampling whenever the acoustic modem 10 is turned on . as shown at step 110 , the software selects the first transducer as an input , i . e . the software assigns the first transducer 28 the functionality of the receiving unit . in order to assign functionality of the receiving unit to the first transducer 28 , the input selector 44 actuates switch s 2 to electrically couple the first transducer 28 to the digital input 52 . as shown at step 120 , the software directs the first transducer 28 to “ listen ” for a dial tone for a first duration . in one embodiment the first duration is one half second . the duration can be any amount of time , although it is preferable to have a duration that will quickly detect a telephone handset 22 that is properly orientated with the acoustic modem 10 . any sound that is detected by the first transducer 28 is conditioned by the input signal conditioning unit 54 and then converted from analog to digital by the analog - to - digital converter 56 for input into the digital input 52 of the controller 40 . if the noise falls within signal characteristics of a dial tone or other tone of the telephone 22 , the controller 40 considers a dial tone to be detected . although the signal characteristics of dial tones do vary , dial tones generally are pure tones that may include a couple of harmonics and dial tones typically are not modulated . as shown at step 130 the software records the loudness of the dial tone detected with the first transducer . the value of the loudness of the dial tone detected with the first transducer 28 is recorded in a memory unit coupled to the controller that may or may not be memory 38 . as shown at step 140 , the software selects the second transducer 30 as an input , i . e ., the software assigns the second transducer 30 the functionality of the receiving unit . in order to assign functionality of the receiving unit to the second transducer 30 , the input selector 44 actuates switch s 2 to uncouple the first transducer 28 from the digital input 52 and electrically couple the second transducer 30 to the digital input 52 . as shown at step 150 the software directs the transducer to “ listen ” for a dial tone for a second duration . in one embodiment the second duration is the same amount of time as the first duration . in other embodiments , the second duration can vary from the first duration , although it is preferable to have a duration that will allow for fast detection of a telephone handset 22 that is properly orientated with the acoustic modem 10 . any sound that is detected by the second transducer 30 is conditioned by the input signal conditioning unit 54 and then converted from analog to digital by the analog - to - digital converter 56 for input into the digital input 52 of the controller 40 . if the noise falls within signal characteristics of a dial tone or other tone of the telephone 22 , the controller 40 considers a dial tone to be detected . as shown at step 160 the software records the loudness of the dial tone detected with the second transducer . the value of the loudness of the dial tone detected with the second transducer 30 is recorded in the memory unit coupled to the controller in which the loudness of the dial tone detected with the first transducer 28 was recorded if a dial tone was detected with the first transducer 28 . as shown at step 170 the software determines whether at least one dial tone was detected . the software branches back to step 110 if no dial tone was detected , and branches to step 180 if at least one dial tone was detected . at act 180 , the software compares the value of the loudness of the dial tone detected with the first transducer 28 to the value of the loudness of the dial tone detected with the second transducer 30 , determines which of the two values is greater , and thereby determines which of the two transducers is aligned with the speaker 26 of the telephone 22 . the transducer that receives the strongest or loudest dial tone signal is assumed to be the best transducer to serve as the receiving unit for the acoustic modem 10 . a dial tone may be detected by both transducers due to the proximity of each transducer to the speaker 26 of the telephone 22 . if only one dial tone was detected , the value of loudness of the dial tone detected by the other transducer will be zero and therefore necessarily less than the value of the loudness of the dial tone detected . if the first transducer 28 properly detected a louder ( or the only ) dial tone , the software branches from step 180 to step 190 , and selects the first transducer as the receiving unit and the second transducer as transmitting unit . the input selector 44 actuates switch s 2 to electrically couple the first transducer to the digital input 52 , thereby assigning the first transducer 28 functionality of the receiving unit . the drive selector 42 actuates switch s 1 to electrically couple the second transducer to the digital output 46 , thereby assigning the second transducer 30 functionality of the transmitting unit . if the second transducer 30 properly detected a louder ( or the only ) dial tone , the software branches from step 180 to step 200 , and selects the second transducer as the receiving unit and the first transducer as transmitting unit . the input selector 44 actuates switch s 2 to electrically couple the second transducer 30 to the digital input 52 , thereby assigning the second transducer 30 functionality of the receiving unit . the drive selector 42 actuates switch s 1 to electrically couple the first transducer 28 to the digital output 46 , thereby assigning the first transducer 28 functionality of the transmitting unit . as shown at step 210 the software transmits dialing tones with the transmitting unit to auto - dial the receiving station 32 of the central site 16 . auto - dialing removes another step of patient intervention in the process . if a patient is unable to dial , or if the number of the receiving station 32 of the central site 16 is forgotten , the patient needs only to align the telephone 22 with the acoustic modem 10 and wait while the biomedical data is automatically transmitted . as shown at step 220 the software waits until an acknowledgement from the receiving station 32 is received by the receiving unit of the acoustic modem instructing the software that the receiving station is ready to proceed with the communication of data . as shown at step 230 the software proceeds with the communication of the data from the remote location 14 to the central site 16 . the remote monitoring system 5 is adapted to communicate data between the remote location 14 and the central site 16 . the communication between the remote location 14 and the central site 16 can be either half duplex or full duplex . if the communication of data is full duplex , both the remote location 14 and the central site 16 can transmit data at the same time . in order to have full duplex communication , the acoustic sounds transmitted from the remote location 14 cannot have an overlapping frequency range with the acoustic sounds transmitted from the central site 16 . if the acoustic signals that are being simultaneously transmitted do have overlapping frequency ranges , the data will be corrupted and will be unusable for purposes of monitoring the patient . if the communication of data is half duplex , only one of the remote location 14 and the central site 16 can transmit data at any one time . however , half duplex communication allows for use of the complete frequency range available to the location that is transmitting the data , and therefore , half duplex communication generally allows for higher bit rates than full duplex communication . when half duplex communication is utilized to transmit the data between the remote location 14 and the central site 16 , the data is transmitted from the remote location 14 to the receiving station 32 of the central site 16 in small packets of data with sequence numbers . the receiving station 32 acknowledges whether or not the transmission of a small packet of data was proper . this acknowledgement is received by the receiving unit of the acoustic modem 10 . if a negative acknowledgement ( or no acknowledgement ) is received by the receiving unit , the small packet of data is retransmitted to ensure complete transmission of uncorrupted data . the receiving station 32 is able to organize the small packets of data in proper sequence by sequentially organizing the sequence numbers that are attached to the small packets of data . in one embodiment , the transmit bit rate of the communication of data from the central site 16 to the remote location 14 is slower than the transmit bit rate of the communication of data from the remote location 14 to the central site 16 . once the communication of data is completed , the software proceeds to step 240 . if the acoustic modem 10 is set up to continuously monitor for a detectable dial tone , then the software automatically returns to step 100 and begins sampling each transducer as discussed above . if the acoustic modem 10 is set up to monitor when the switch 60 is actuated , the software shuts down and waits until it is powered up again to begin sampling for a detectable dial tone . the biomedical data is converted into an acoustic signal that is emitted by the transmitting unit of the acoustic modem 10 . the transmitting unit of the acoustic modem 10 is disposed within acoustic range of , or adjacent to the microphone 24 of the telephone 22 . the acoustic signal is then transmitted from the telephone 22 over the telephone line 12 to the receiving station 32 at the central site 16 . the acoustic signal is received by the computer system at the receiving station 32 and is then translated by a converter back to the biomedical data that was acquired from the patient . in the preferred embodiment , the receiving station 32 of the central site 16 communicates with the acoustic modem 10 using a computer system . this eliminates the requirement of having a receiving authority at the central site 16 to communicate with the patient and facilitate the transmission of data . thus , the patient is able to automatically transmit biomedical data at any time during the day or night . it should be apparent from the discussion above and to those of ordinary skill in the art that the exact configuration of the controller 40 could be varied . for example , many of the individual components describe above could be combined on a single integrated circuit or chip and features and components could be implemented in either hardware or software . various features and advantages of the invention are set forth in the following claims .

7Electricity

the various fig2 - 6 show schematically a three - pole apparatus 1 according to an embodiment of the present invention . in particular , fig2 - 6 show the apparatus 1 in the form of side views where it is assumed that the cubicle 2 inside which it is contained is open . for the sake of convenience of illustration , moreover , the casing made of insulating material and described below is shown cross - sectioned so that all the components housed inside it are visible . a metal cubicle 2 , which is suitable for housing the three - pole apparatus 1 according to the invention , is shown closed in fig1 and open in fig2 - 4 . the cubicle 2 is box - shaped . in an advantageous embodiment , three different zones are identified inside the cubicle 2 : an upper zone 2 a , also called “ busbar cell ”, a middle zone 2 b , also called “ apparatus cell ”, and a bottom zone 2 c , also called “ cable cell ”. conveniently , the busbar cell 2 a is closed by an upper panel 2 a . the upper panel 2 a may be bolted , or otherwise fixed , to the walls of the cubicle 2 . conveniently , the middle zone 2 b is closed by a middle panel 2 b . the middle panel 2 b may be bolted , or otherwise fixed , to the walls of the cubicle 2 . the middle panel 2 b has an inspection port 2 b ′ which is closed by a sheet of transparent material such as glass or plexiglass . conveniently , the cable cell 2 c is closed by a door 2 c hinged to one of the walls of the cubicle 2 . it is possible to provide , in the door of the cable cell 2 c , one or more inspection windows 2 c ′ for checking the position of the earthing switch . inside the cubicle 2 , the three - pole apparatus 1 is supported by a c - shaped guide 3 ( visible more clearly in the enlarged fig5 and 6 ) which is fixed to the walls of the cubicle 2 at a suitable height . the apparatus 1 is situated substantially in the middle zone of the cubicle 2 . the roof of the cubicle 2 has , projecting from it , three insulating supports 6 which support three respective main medium or high voltage busbars 7 . the three busbars 7 pass through the cubicle 2 transversely . since this consists of a front view of the cubicle , only one main busbar 7 and one insulating support 6 are shown . each main busbar 7 is fixed to its support 6 via a line contact member 8 , which is preferably a tulip contact surrounded by a spring . the three - pole apparatus comprises a disconnector and a circuit breaker . the disconnector comprises three single - pole isolating devices and the circuit breaker comprises three vacuum circuit - breaker modules 20 . in this way , for each pole , the three - pole apparatus 1 comprises a single - pole isolating device 10 which is linearly actuated and a vacuum circuit - breaker module 20 . the vacuum circuit - breaker modules 20 are contained , at least partially , inside a casing 30 made of insulating material ( for example epoxy resin or the like ). the casing 30 may conveniently consist of two parts : an upper bell and a lower bell . preferably , the casing 30 is at least partly finned externally so as to increase the flow - off lines . the casing 30 is , preferably , not sealingly closed and therefore contains air inside it . in any case , it forms a protected atmosphere . one of the three single - pole isolating devices 10 of the three - pole apparatus 1 according to the invention will now be described . the single - pole isolating device 10 comprises a guide tube 101 which acts as a field diffuser . the bottom end of the guide tube 101 is in electrical contact with the top end of a respective circuit breaker 20 ; the top end of the guide tube 101 is instead in electrical contact with a tulip contact 102 . the guide tube 101 is made of electrically conductive material , conveniently aluminium or aluminium alloy . the guide tube 101 preferably has a circular cross - section . two longitudinal grooves 103 , which are situated radially opposite each other , are formed in the guide tube 101 . for this reason , only one groove 103 is visible in the figures . a movable line isolating contact 104 slides inside the guide tube 101 . the movable contact 104 also has a preferably cylindrical cross - section . it may be conveniently hollow . conveniently , the movable contact 104 may be made of copper or aluminium . when the apparatus is in the service position ( fig2 ), the movable contact 104 is completely extracted and its top end is in contact with the line contact member 8 . the bottom part of the movable contact 104 is passed through by a pin 105 ( fig5 and 6 ). the pin 105 is guided inside the longitudinal grooves 103 . in this way it performs a vertical displacement ( and causes the movable contact 104 to perform a similar vertical displacement ). each end of the pin 105 is pivotably mounted on an isolating link rod 106 . in turn , each link rod 106 of a single - pole isolating device is pivotably mounted on a crank 107 of a single - pole isolating device . the cranks 107 are rigidly connected to a shaft 108 of a single - pole isolating device . conveniently , the link rods and cranks are made of an electrically insulating material . according to the present invention a single isolating shaft is provided for simultaneously actuating the three single - pole isolating devices of the disconnector . with reference to fig2 and 3 , by rotating the isolating shaft 108 in an anti - clockwise direction , the three movable contacts 104 of the three single - pole isolating devices 10 are displaced downwards , passing from the service position ( fig2 ) into the isolating position ( fig3 ). the casing 30 made of insulating material is conveniently shaped so as to have an upper wall inclined in the manner of the link rods 107 of the single - pole isolating device in their service position and a bottom wall inclined in the manner of the link rods 107 of the single - pole isolating device in their isolating position . the link rods of all three single - pole isolating devices are therefore rigidly fastened to the shaft 108 . in other words , its rotation actuates simultaneously the three single - pole isolating devices of the disconnector . the shaft 108 may be made to rotate by means of known control devices which will not be further described . in any case , according to the present invention , the isolating shaft 108 is supported by the casing 30 . as mentioned above , the three - pole apparatus 1 according to the invention has a circuit breaker comprising three vacuum circuit - breaker modules 20 . according to an advantageous embodiment of the invention , each vacuum circuit - breaker module 20 is vertical or in any case in axial alignment with the respective movable isolating contact 104 , as shown in the various fig2 - 6 . a single vacuum circuit - breaker module 20 will be described hereinbelow . the bottom end of the guide tube 101 , as mentioned above , is in contact with the fixed contact 201 of the vacuum circuit - breaker module . the fixed contact 201 of a vacuum circuit - breaker module and the movable contact 202 of the vacuum circuit - breaker module are shown schematically in fig5 and 6 . the movable contact 202 of the vacuum circuit - breaker module is fixed to an end - piece 203 projecting at the bottom from the casing 30 . a single circuit - breaker shaft 204 causes opening and closing of the three vacuum circuit - breaker modules 20 of the circuit breaker , separating or establishing contact between the movable contacts 202 and the fixed contacts 201 . the shaft 204 of the circuit breaker is supported directly by the casing 30 made of insulating material . alternatively , it is supported by a plate 31 which in turn forms a support for the insulating casing 30 and which is in turn supported by the c - shaped guides of the cubicle . a system of levers 205 causes compression of the contacts , i . e . moves the movable contacts 202 towards the fixed contacts 201 . in the embodiment shown , a bracket 206 , which is rigidly fastened to the casing 30 , supports rotatably a lever 207 , one end of which acts on the projecting end - piece 203 . in fig5 the circuit breaker 20 is in the closed position , while in fig6 the circuit breaker is in the open position ( the fixed and movable contacts are separated ). the bottom end - piece 203 is fixed to conductive braiding 208 which is in turn fixed to a contact plate 209 . the contact plate 209 is retained inside a clamping terminal 210 fixed to a shaped plate 211 . the shaped plate 211 is supported by an insulating body 212 fixed to a wall of the cubicle 2 and is in electrical contact with the cables 9 which convey current to the user . an earthing switch 50 is present inside the cubicle 2 . conveniently , an earthing switch 50 is envisaged for each three - pole apparatus . in one embodiment , the earthing switch 50 comprises an isolating arm 51 which is hinged with a wall of the cubicle 2 as shown in fig2 , 3 and 4 . in the service position ( fig2 ) or in the line isolating position ( fig3 ), the isolating arm 51 is arranged next to the wall of the cubicle 2 . in the earthing position ( fig4 ), the free end of the isolating arm 51 engages with the shaped plate 211 . according to an advantageous embodiment of the invention , a partition 60 is provided between the busbars 7 and the apparatus 1 . the partition 60 has three openings 61 ( only one of which is shown in the various figures ) for allowing the movable contacts 104 of the disconnector to pass through . the openings 61 have an isolating and guiding function . as an alternative to the three openings 61 , a single suitably shaped opening 61 may be provided . in a very advantageous embodiment , a separating shutter 62 for closing the openings 61 is also preferably envisaged . it is possible to envisage three separate shutters which are connected together or a single separating shutter for closing the three openings . in one embodiment of the invention , the separating shutter 62 moves into the position for closing the openings when the movable contacts 104 are completely below the partition 60 and the earthing switch 50 moves from the open position into the closed position . in another embodiment , the separating shutter 62 moves into the closed position when , after isolating the movable contacts 104 and positioning the earthing switch 50 in the earth position , the screws of the panel 2 b are unbolted in order to allow extraction of the three - pole apparatus 1 . obviously , the inspection port 2 b ′ mentioned above is used by the personnel in order to check the position of the movable isolating contacts 104 . in any case , owing to the partition 60 and the separating shutter 62 , the busbars 7 are completely separated and contact with them — even accidentally — is not possible when personnel are working on the apparatus in order to replace or repair it . according to the present invention , the three - pole apparatus 1 may be easily installed inside a cubicle 2 or removed from it . in fact , both the circuit breaker shaft 204 and the isolating shaft 108 are supported by the casing 30 made of insulating material or by a structure fixed to it ( such as , for example , the plate 31 ). moreover , the single - pole isolating / disconnector devices 10 are slidable linearly . moreover , at the bottom , the apparatus has for each pole a plate 209 retained by a clamping terminal 210 . in the position suitable for extraction ( fig4 ), the three - pole apparatus 1 may be made to slide along the c - shaped guides 3 and extracted from the cubicle 2 , without having to disassemble anything . the operation requires a minimum amount of effort , also because of the relatively compact dimensions of the apparatus 1 , and is performed in a few seconds , i . e . merely the time needed to open the bottom door , unscrew the screws of the middle panel and pull out the apparatus in the manner of a drawer . the apparatus may be extracted only in the isolated , shutter closed , circuit breaker open and earthed position . the configuration suitable for extraction is shown in fig4 . starting from the service position of fig2 , when the apparatus has to be extracted , the contacts of the circuit breaker are separated ; the contacts 104 are moved from the position of fig2 to the one of fig3 . profitably , the shutter is moved to close the respective opening . finally , the arm 51 is rotated so that it is moved to the earthing position ( fig4 ) wherein the free end of the isolating arm 51 engages with the shaped plate 211 . this measure increases the safety for the personnel in that busbars 7 become completely separated and contact with them — even accidentally — is not possible . personnel who has to extract the apparatus can immediately verify that the disconnector is in the isolated position by looking to the length of contacts outside from the casing . in any case , if the contacts are in the service position , the apparatus can not be extracted because the such contacts are within corresponding holes or apertures in the partition . mounting of the apparatus according to the invention is likewise performed in a very simple and rapid manner : the apparatus 1 is inserted into the cubicle 2 , causing it to slide inside the c - shaped guides 3 , and then the middle panel 2 b and the bottom door 2 c are closed and screwed down again . the apparatus 1 according to an embodiment of the invention is shown in an enlarged view in fig5 and 6 , already mentioned above .

7Electricity

an explanation will be given on a mode for carrying out the present invention referring to drawings . firstly , an explanation will be given on entire construction of a maneuvering device 1 referring to fig1 to 4 . the maneuvering device 1 is so - called two - shaft ( two - device ) type having two outdrive devices 2 . the maneuvering device 1 includes the outdrive devices 2 , hydraulic cylinders 3 , a control device 4 and the like . in each of the outdrive devices 2 , one of ends of an input shaft 5 is connected via an universal joint 6 to a power transmission shaft ( not shown ) of an engine 7 so as to be able to transmit power . between the engine 7 and the input shaft 5 , a main clutch 23 is interposed . power transmission from the engine 7 to the input shaft 5 is turned on and off ( engaged and disengaged ) with the main clutch 23 . the other end of the input shaft 5 is connected via a switching clutch 8 to an upper end of a drive shaft 9 so as to be able to transmit the power . a rotation direction of the drive shaft 9 is switched with the switching clutch 8 . a lower end of the drive shaft 9 is connected to one of ends of a final output shaft 10 so as to be able to transmit the power . on the other end of the final output shaft 10 , a propeller 11 is provided . each of the outdrive devices 2 is supported pivotally via a gimbal ring 12 by a hull 13 so as to be rotatable laterally . one of ends of a steering arm 14 is connected to the gimbal ring 12 . for example , a rotation angle of the outdrive device 2 is 30 ° for the leftward and 30 ° for the rightward and the sum total thereof is 60 °. in each of the hydraulic cylinders 3 , inside a cylinder sleeve 15 , a piston 16 is provided slidably . the piston 16 is connected to one of ends of a rod 17 . the other end of the rod 17 is connected to the other end of the steering arm 14 . by sending hydraulic oil in a hydraulic oil tank ( not shown ) to the cylinder sleeve 15 , the piston 16 is slid . the control device 4 has a normal sailing mode and a very low speed sailing mode as a sailing mode of a ship 22 . the normal sailing mode and the very low speed sailing mode will be explained in detail later . the control device 4 is connected to a rotation speed sensor 19 detecting a rotation speed of the outdrive device 2 ( the propeller 11 ), a position sensor 18 detecting positions ( slid positions ) of the pistons 16 of the hydraulic cylinders 3 , an electromagnetic valve 25 changing a sending direction of the pressure oil to the hydraulic cylinders 3 , a throttle actuator 27 changing a rotation speed of the engine 7 , a joystick lever 20 , an operation wheel 24 , an accelerator lever 26 , a very low speed sailing mode button 28 and a changing dial 29 . a baseline operation amount ms and a baseline increase amount δms concerning a duty ratio d and an operation amount of the joystick lever 20 are stored in the control device 4 . the duty ratio d is a ratio of time in which the main clutch 23 has been turned on at a predetermined cycle . namely , when the predetermined cycle is referred to as t and the time in which the main clutch 23 has been turned on is referred to as t 1 , the duty ratio d is a value that the time t 1 in which the main clutch 23 has been turned on is divided by the predetermined cycle t ( t 1 / t ). the joystick lever 20 is rotatable around an x axis , a y axis and a z axis . namely , the joystick lever 20 can be tilted along a direction of the x axis ( a lateral direction ) and a direction of the y axis ( a longitudinal direction ) and can be twisted around the z axis . the joystick lever 20 is biased to a neutral position so as to be along a vertical direction when being not operated . according to the construction , by transmitting power of the engine 7 to the main clutch 23 , the universal joint 6 , the input shaft 5 , the switching clutch 8 , the drive shaft 9 and the final output shaft 10 , the propeller 11 is rotated . then , by rotating the propeller 11 , propulsion power of the outdrive device 2 is generated . then , the control device 4 switches the rotation direction of the drive shaft 9 via the switching clutch 8 corresponding to an operation direction of the joystick lever 20 . by switching the rotation direction of the drive shaft 9 , forward / rearward sailing of the ship 22 is switched . the control device 4 changes an opening of a throttle ( not shown ) of the engine 7 via the throttle actuator 27 corresponding to an operation amount ( tilt amount and twist amount ) of the joystick lever 20 . by changing the throttle opening , the engine rotation speed is changed , whereby the propulsion power of the outdrive device 2 is changed . similarly , the rotation speed of the engine 7 is changed corresponding to an operation amount of the accelerator lever 26 . namely , the rotation speed of the left engine 7 is changed by operating one of the accelerator levers 26 , and the rotation speed of the right engine 7 is changed by operating the other accelerator lever 26 . furthermore , the control device 4 slides the piston 16 of the hydraulic cylinders 3 via the electromagnetic valves 25 corresponding to the operation amount ( tilt amount and twist amount ) of the joystick lever 20 . by sliding the piston 16 , the outdrive device 2 is rotated via the rod 17 and the steering arm 14 . namely , the rotation angle ( steering angle ) of the outdrive device 2 is changed . similarly , the outdrive device 2 is rotated corresponding to an operation amount of the operation wheel 24 . next , an explanation will be given on a maneuvering method of the ship 22 with the maneuvering device 1 referring to fig5 to 8 . as shown in fig5 , when the very low speed sailing mode button 28 is at an on state ( step s 1 , yes ), the sailing mode is the very low speed sailing mode ( step s 2 ). on the other hand , when the very low speed sailing mode button 28 is at an off state ( step s 1 , no ), the sailing mode is the normal sailing mode ( step s 3 ). when the sailing is continued ( step s 4 , yes ), the steps from the step s 1 are repeated . in the case of the normal sailing mode , as shown in fig6 ( a ), when gearshift of the main clutch 23 is neutral , the engine rotation speed n is a low idling rotation speed nlow regardless of the tilt amount m of the joystick lever 20 . when gearshift of the main clutch 23 is forward , the engine rotation speed n is changed within a range between the low idling rotation speed nlow and a maximum engine rotation speed nmax 1 corresponding to ( proportionally to ) the tilt amount m of the joystick lever 20 . the low idling rotation speed nlow is an engine rotation speed at the time of idling of the engine 7 . on the other hand , in the case of the very low speed sailing mode , as shown in fig6 ( b ), the baseline operation amount ms is determined within the range of the tilt amount m of the joystick lever 20 . in detail , the baseline operation amount ms can be changed with the changing dial 29 discussed later . when the tilt amount m of the joystick lever 20 is not more than the baseline operation amount ms , the engine rotation speed n is maintained at the low idling rotation speed nlow and the duty ratio d is changed within a range from 0 % to 100 % corresponding to ( proportionally to ) the tilt amount m of the joystick lever 20 . when the tilt amount m of the joystick lever 20 excesses the baseline operation amount ms , the duty ratio d is 100 % and the engine rotation speed n is changed within a range between the low idling rotation speed nlow and a maximum engine rotation speed nmax 2 corresponding to ( proportionally to ) the tilt amount m of the joystick lever 20 . however , when an increase amount of the tilt amount m of the joystick lever 20 from the baseline operation amount ms ( hereinafter , simply referred to as “ increase amount ”) δm (= m − ms ) is not more than the baseline increase amount δms , the engine rotation speed n is maintained at the low idling rotation speed nlow . concretely , as shown in fig7 , in the case of the very low speed sailing mode ( step s 2 ), at a step s 5 , whether the tilt amount m of the joystick lever 20 is less than or equal to the baseline operation amount ms or not is judged . when the tilt amount m of the joystick lever 20 is not more than the baseline operation amount ms ( step s 5 , yes ), the engine rotation speed n becomes the low idling rotation speed nlow ( step s 6 ) and the duty ratio d is changed within the range from 0 % to 100 % corresponding to ( proportionally to ) the tilt amount m of the joystick lever 20 ( step s 7 ). on the other hand , when the tilt amount m of the joystick lever 20 excesses the baseline operation amount ms ( step s 5 , no ), the duty ratio d becomes 100 % ( step s 8 ) and whether the increase amount δm excesses the baseline increase amount δms or not is judged ( step s 9 ). when the increase amount δm excesses the baseline increase amount δms ( step s 9 , yes ), the engine rotation speed n is changed within the range between the low idling rotation speed nlow and the maximum engine rotation speed nmax 2 corresponding to ( proportionally to ) the tilt amount m of the joystick lever 20 ( step s 10 ). on the other hand , when the increase amount δm does not excess the baseline increase amount δms ( step s 9 , no ), the engine rotation speed n is maintained at the low idling rotation speed nlow ( step s 11 ). next , an explanation will be given on a relation between the tilt amount m of the joystick lever 20 and the duty ratio d and the engine rotation speed n at the very low speed sailing mode referring to fig8 . as shown in fig8 , when the tilt amount m of the joystick lever 20 is m 1 ( the joystick lever 20 is not tilted ), the duty ratio d is 0 % and the engine rotation speed n is the low idling rotation speed nlow . following the tilt of the joystick lever 20 from a position of the tilt amount m 1 , the engine rotation speed n is maintained at the low idling rotation speed nlow and the duty ratio d is increased from 0 %. when the tilt amount m of the joystick lever 20 is m 2 ( the baseline operation amount ms ), the duty ratio d is 100 % and the engine rotation speed n is the low idling rotation speed nlow . namely , when the tilt amount m of the joystick lever 20 is not more than the baseline operation amount ms , the tilt amount m of the joystick lever 20 is proportional to the duty ratio d . accordingly , following reduction of the tilt amount m of the joystick lever 20 , the duty ratio d is reduced and a sailing speed is reduced , and following approach of the tilt amount m of the joystick lever 20 to the baseline operation amount ms , the duty ratio d is increased and the sailing speed is increased ( the sailing speed approaches to a sailing speed at the time at which the engine rotation speed n is the low idling rotation speed nlow and the main clutch 23 has been turned on ). the sailing speed at the time at which the tilt amount m of the joystick lever 20 is the baseline operation amount ms is the sailing speed at the time at which the engine rotation speed n is the low idling rotation speed nlow and the main clutch 23 has been turned on . following the tilt of the joystick lever 20 from a position of the tilt amount m 2 , the duty ratio d is maintained at 100 % and the engine rotation speed n is increased from the low idling rotation speed nlow . as mentioned above , when the increase amount δm does not excess the baseline increase amount δms , the engine rotation speed n is maintained at the low idling rotation speed nlow . when the tilt amount m of the joystick lever 20 is m 3 ( when the joystick lever 20 is tilted maximally ), the duty ratio d is maintained at 100 % and the engine rotation speed n is the maximum engine rotation speed nmax 2 . namely , when the tilt amount m of the joystick lever 20 is within a range from ms + δms to m 3 , the duty ratio d is maintained at 100 % and the engine rotation speed n is changed within the range between the low idling rotation speed nlow and the maximum engine rotation speed nmax 2 corresponding to ( proportionally to ) the tilt amount m of the joystick lever 20 . an increase amount ( acceleration ) of the engine rotation speed n at the time at which the tilt amount m of the joystick lever 20 is within the range from ms + δms to m 3 is substantially the same as an increase amount ( acceleration ) of the engine rotation speed n at the time at which the tilt amount m of the joystick lever 20 is within the range from m 1 to m 2 so as to make the acceleration smooth . herein , the baseline operation amount ms can be changed with the changing dial 29 . when the baseline operation amount ms is changed to a side of m 1 ( a side in which the tilt amount m of the joystick lever 20 is small ), a change amount of the duty ratio d ( a change amount of the duty ratio d per unit tilt amount of the joystick lever 20 ) is increased and the acceleration is increased , whereby a maximum sailing speed at the very low speed sailing mode is increased . on the contrary , when the baseline operation amount ms is changed to a side of m 3 ( a side in which the tilt amount m of the joystick lever 20 is large ), the change amount of the duty ratio d ( the change amount of the duty ratio d per unit tilt amount of the joystick lever 20 ) is reduced and the acceleration is reduced , whereby the maximum sailing speed at the very low speed sailing mode is reduced . as mentioned above , the ship maneuvering device 1 of the ship 22 has the engine 7 , the outdrive device 2 having the propeller 11 rotated by the power of the engine 7 , the main clutch 23 which is a clutch engaging and disengaging the power transmission from the engine 7 to the propeller 11 , the joystick lever 20 which is an operation means actuating the outdrive device 2 , and the control device 4 connected to the engine 7 , the main clutch 23 and the joystick lever 20 . the control device 4 has the very low speed sailing mode . the control device 4 is connected to the very low speed sailing mode button 28 which is a determination means determining whether the very low speed sailing mode is executed or not . in the case in which the execution of the very low speed sailing mode is determined , when the operation amount of the joystick lever 20 is not more than the baseline operation amount ms , the control device 4 makes the engine rotation speed n be the low idling rotation speed nlow and changes the duty ratio d , which is a ratio of the time t 1 in which the main clutch 23 at the predetermined cycle t has been turned on corresponding to the operation amount of the joystick lever 20 , within the range not more than 100 %. according to the construction , by executing the very low speed sailing mode , the main clutch 23 is engaged and disengaged while the engine 7 is rotated at the low idling rotation speed nlow , whereby sailing at a speed lower than the sailing speed at the low idling rotation speed nlow of the engine 7 is enabled so as to make maneuvering of the ship easy . since the sailing speed is changed by changing the duty ratio d corresponding to the operation amount of the joystick lever 20 , the sailing speed can be changed following a sailing situation so as to make the maneuvering of the ship easy . for example , at the time of berthing and unberthing of the ship 22 , too high sailing speed is prevented which makes the maneuvering of the ship at the time of berthing and unberthing difficult for an unskilled operator unfamiliar to the maneuvering of the ship . namely , the unskilled operator unfamiliar to the maneuvering of the ship can perform the berthing and unberthing easily . when the operation amount of the joystick lever 20 excesses the baseline operation amount ms , the control device 4 makes the duty ratio d be 100 % and increases the engine rotation speed n from the low idling rotation speed nlow corresponding to the operation amount of the joystick lever 20 . according to the construction , by operating the joystick lever 20 , the engine rotation speed n is increased from the low idling rotation speed nlow , whereby the sailing speed can be increased following the sailing situation so as to make the maneuvering of the ship easy further . when the increase amount δm of the operation amount of the joystick lever 20 concerning the baseline operation amount ms is not higher than the baseline increase amount δms , the control device 4 maintains the engine rotation speed n at the low idling rotation speed nlow . according to the construction , for the time being after the operation amount of the joystick lever 20 excesses the baseline operation amount ms , the engine rotation speed n is maintained at the low idling rotation speed nlow , whereby the operator is not panicked by sudden change of the engine rotation speed n and the maneuvering of the ship becomes easy further . furthermore , the control device 4 is connected to the changing dial 29 which is a changing means changing the baseline operation amount ms . according to the construction , by changing the baseline operation amount ms following the sailing situation , the maneuvering of the ship can be made easy further . namely , by changing the baseline increase amount δms , maneuvering feeling can be fitted to the operator . the determination means according to the present invention is not limited to the very low speed sailing mode button 28 according to this embodiment . for example , the determination means according to the present invention may alternatively be a lever . the changing means according to the present invention is not limited to the changing dial 29 according to this embodiment . for example , the changing means according to the present invention may alternatively be a lever . next , an explanation will be given on the ship maneuvering device of the ship in detail from another viewpoint . as shown in fig2 , 3 and 9 , the ship maneuvering device 1 of the ship has the pair of left and right engines 7 , rotation speed changing actuators 4 a and 4 b independently changing engine rotation speeds n a and n b of the pair of left and right engines 7 , the pair of left and right outdrive devices 2 respectively connected to the pair of left and right engines 7 and rotating the propellers 11 so as to propel the ship 22 , the switching clutches 8 disposed between the engines 7 and the propellers 11 , the pair of left and right hydraulic steering cylinders 3 respectively independently rotating the pair of left and right outdrive devices 2 laterally , the electromagnetic valves 25 controlling hydraulic pressure in the hydraulic cylinders 3 , the joystick 20 , the accelerator lever 26 and the operation wheel 24 as operation means setting the traveling direction of the ship , the operation amount detection sensor 39 as an operation amount detection means detecting the operation amount of the joystick 20 ( see fig1 ), operation amount detection sensors 43 a and 43 b as operation amount detection means detecting the operation amount of the accelerator lever 26 ( see fig1 ), an operation amount detection sensor 44 as an operation amount detection means detecting the operation amount of the operation wheel 24 ( see fig1 ), and the control device 4 controlling the rotation speed changing actuators 4 a and 4 b , the switching clutches 8 , the hydraulic steering cylinders 3 and the electromagnetic valves 25 so as to travel to a direction set by the joystick 20 , the accelerator lever 26 and the operation wheel 24 ( see fig1 ). the engines 7 are arranged in a rear portion of the ship 22 as a pair laterally , and are connected to the outdrive devices 2 arranged outside the ship . the engines 7 have output shafts 41 a and 41 b for outputting rotation power . the rotation speed changing actuators 4 a and 4 b are means controlling the engine rotation power , and changes a fuel injection amount of a fuel injection device and the like so as to control engine rotation speeds of the engines 7 . the outdrive devices 2 are propulsion devices rotating the propellers 11 so as to propel the ship 22 , and are provided outside the rear portion of the ship 22 as a pair laterally . the pair of left and right outdrive devices 2 are respectively connected to the pair of left and right engines 7 . the outdrive devices 2 are rudder devices which are rotated concerning the traveling direction of the ship 22 so as to make the ship 22 turn . the outdrive devices 2 mainly include input shafts 5 , the switching clutches 8 , drive shafts 9 , final output shaft 10 , and the rotating propellers 11 . the input shafts 5 transmit rotation power . in detail , the input shafts 5 transmit rotation power of the engines 7 , transmitted from the output shafts 41 a and 41 b of the engines 7 via universal joints 6 , to the switching clutches 8 . one of ends of each of the input shafts 5 is connected to corresponding one of the universal joints 6 attached to the output shafts 41 a and 41 b of the engines 7 , and the other end thereof is connected to corresponding one of the switching clutches 8 . the switching clutches 8 are arranged between the engines 7 and the rotating propellers 11 , and switch rotation direction of the rotation power . in detail , the switching clutches 8 are rotation direction switching devices which switch the rotation power of the engines 7 , transmitted via the input shafts 5 and the like , to forward or reverse direction . the switching clutches 8 have forward bevel gears and reverse bevel gears which are connected to inner drums having disc plates , and pressure plates of outer drums connected to the input shafts 5 is pressed against the disc plates of the forward bevel gears or the reverse bevel gears so as to switch the rotation direction . the drive shafts 9 transmit the rotation power . in detail , the drive shafts 9 are rotation shafts which transmit the rotation power of the engines 7 , transmitted via the switching clutches 8 and the like , to the final output shaft 10 . a bevel gear provided at one of ends of each of the drive shafts 9 is meshed with the forward bevel gear and the reverse bevel gear provided on corresponding one of the switching clutches 8 , and a bevel gear provided at the other end is meshed with a bevel gear provided on corresponding one of the final output shaft 10 . the final output shafts 10 transmit the rotation power . in detail , the final output shaft 10 are rotation shafts which transmit the rotation power of the engines 7 , transmitted via the drive shafts 9 and the like , to the propellers 11 . as mentioned above , the bevel gear provided at one of ends of each of the final output shaft 10 is meshed with the bevel gear of corresponding one of the drive shafts 9 , and the other end is attached thereto with corresponding one of the propellers 11 . the propellers 11 are rotated so as to generate propulsion power . in detail , the propellers 11 are driven by the rotation power of the engines 7 transmitted via the final output shaft 10 and the like so that a plurality of blades arranged around the rotation shafts paddle surrounding water , whereby the propulsion power is generated . the hydraulic steering cylinders 3 are hydraulic devices which drive steering arms 14 so as to rotate the outdrive devices 2 . the hydraulic steering cylinders 3 are provided therein with the electromagnetic valves 25 for controlling hydraulic pressure , and the electromagnetic valves 25 are connected to the control device 4 . the hydraulic steering cylinders 3 are so - called single rod type hydraulic actuators . however , the hydraulic steering cylinders 3 may alternatively be double rod type . the joystick 20 as the operation means is a device determining the traveling direction of the ship , and is provided near an operator &# 39 ; s seat of the ship 22 . a plane operation surface of the joystick 20 is an oblique sailing component determination part 20 a , and a torsion operation surface thereof is a turning component determination part 20 b . the joystick 20 can be moved free within the operation surface parallel to an x - y plane shown in fig4 , and a center of the operation surface is used as a neutral starting point . longitudinal and lateral directions in the operation surface correspond to the traveling direction , and an inclination amount of the joystick 20 corresponds to a target hull speed . the target hull speed is increased corresponding to increase of the inclination amount of the joystick 20 . the torsion operation surface is provided with the joystick 20 , and by twisting the joystick 20 concerning a z axis extended substantially perpendicularly to the plane operation surface as a turning axis , a turning speed can be changed . a torsion amount of the joystick 20 corresponds to a target turning speed . a maximum target lateral turning speed is set at fixed turning angle positions of the joystick 20 . the accelerator levers 26 as the operation means are devices determining the target hull speed of the ship , and are provided near the operator &# 39 ; s seat of the ship 22 . the two accelerator levers 26 are provided so as to correspond respectively to the left and right engines 7 . the rotation speed of the engine 7 is changed by operating one of the accelerator levers 26 , and the rotation speed of the engine 7 is changed by operating the other accelerator lever 26 . the operation wheel 24 as the operation means is a device determining the traveling direction of the ship , and is provided near the operator &# 39 ; s seat of the ship 22 . the traveling direction is changed widely following increase of a rotation amount of the operation wheel 24 . a correction control start switch 42 ( see fig1 ) is a switch for starting correction control of turning action of the ship 22 . the correction control start switch 42 is provided near the joystick 20 and is connected to the control device 4 . next , an explanation will be given on various kinds of detection means referring to fig1 . rotation speed detection sensors 35 a and 35 b as rotation speed detection means are means for detecting engine rotation speeds n a and n b of the engines 7 and are provided in the engines 7 . an elevation angle sensor 36 as an elevation angle detection means is a means for detecting an elevation angle a of the ship 22 . the elevation angle indicates inclination of the hull in the water concerning a flow .\ a hull speed sensor 37 as a hull speed detection means is a means for detecting a hull speed v , and is an electromagnetic log , a doppler sonar or a gps for example . lateral rotation angle detection sensors 38 a and 38 b as lateral rotation angle detection means are means for detecting lateral rotation angles θ a and θ b of the outdrive devices 2 . the lateral rotation angle detection sensors 38 a and 38 b are provided near the hydraulic steering cylinders 3 , and detect the lateral rotation angles θ a and θ b of the outdrive devices 2 based on the drive amounts of the hydraulic steering cylinders 3 . the operation amount detection sensor 39 as the operation amount detection means is a sensor for detecting the operation amount in the plane operation surface and the operation amount in the torsion operation surface of the joystick 20 . the operation amount detection sensor 39 detects an inclination angle and an inclination direction of the joystick 20 . the operation amount detection sensor 39 detects the torsion amount of the joystick 20 . the operation amount detection sensors 43 a and 43 b as the operation amount detection means are sensors for detecting the operation amounts of the accelerator levers 26 . the operation amount detection sensors 43 a and 43 b detect inclination angles of the accelerator levers 26 . the operation amount detection sensor 44 as the operation amount detection means is a sensor for detecting the operation amount of the operation wheel 24 . the operation amount detection sensor 44 detects the rotation amount of the operation wheel 24 . outdrive device rotation speed detection sensors 40 a and 40 b as rotation speed detection means of the outdrive devices 2 are sensors for detecting rotation speeds of the propellers 11 of the outdrive devices 2 , and are provided at middle portions of the final output shaft 10 . the outdrive device rotation speed detection sensors 40 a and 40 b detect outdrive device rotation speeds nd a and nd b . the control device 4 controls the rotation speed changing actuators 4 a and 4 b , the switching clutches 8 and the hydraulic steering cylinders 3 so that the ship travels to the direction set by the joystick 20 . the control device 4 is connected respectively to the rotation speed changing actuators 4 a and 4 b , the switching clutches 8 , the hydraulic steering cylinders 3 , the electromagnetic valves 25 , the joystick 20 , the accelerator levers 26 , the operation wheel 24 , the rotation speed detection sensors 35 a and 35 b , the elevation angle sensor 36 , the hull speed sensor 37 , the lateral rotation angle detection sensors 38 a and 38 b , the operation amount detection sensor 39 , the operation amount detection sensors 43 a and 43 b , the operation amount detection sensor 44 , and the outdrive device rotation speed detection sensors 40 a and 40 b . the control device 4 includes a calculation means 32 having a cpu ( central processing unit ) and a storage means 33 such as a rom , a ram or a hdd . next , an explanation will be given on a method for calculating the propulsion powers and directions of the left and right outdrive devices 2 with the control device 4 referring to fig1 . firstly , an operation amount of the joystick 20 is detected ( step s 100 ), and based on the operation amount of the joystick 20 , oblique sailing component propulsion power vectors t atrans and t btrans for the oblique sailing and turning component propulsion power vectors t arot and t brot for the turning of the left and right outdrive devices 2 are calculated respectively ( step s 200 ). the operation amount of the joystick 20 is the inclination angle , the inclination direction and a torsion amount of the joystick 20 , and detected with the operation amount detection sensor 39 . then , based on the operation amounts , the control device 4 calculates the oblique sailing component propulsion power vectors t atrans and t btrans for the oblique sailing and the turning component propulsion power vectors t arot and t brot for the turning of the left and right outdrive devices 2 . the oblique sailing component propulsion power vectors t atrans and t btrans of the left and right outdrive devices 2 are calculated as shown in fig1 ( a ) . the turning component propulsion power vectors t arot and t brot of the left and right outdrive devices 2 are calculated as shown in fig1 ( b ) . next , the oblique sailing component propulsion power vectors t atrans and t btrans and the turning component propulsion power vectors t arot and t brot of the left and right outdrive devices 2 are composed respectively so as to calculate the propulsion powers and the directions of the left and right outdrive devices 2 ( step s 300 ). as shown in fig1 ( c ) , vectors t a and t b are calculated by composing the oblique sailing component propulsion power vectors t atrans and t btrans and the turning component propulsion power vectors t arot and t brot of the left and right outdrive devices 2 calculated at the step s 200 . next , based on norms of the composited vectors t a and t b , the control device 4 calculates a rotation speed n of each of the left and right engines 7 ( step s 40 ), the switching clutches 8 are switched , and the left and right engines 7 are driven . based on the directions of the composited vectors t a and t b , the lateral rotation angles θ a and θ b of the outdrive devices 2 are calculated respectively ( step s 500 ), and the hydraulic steering cylinders 3 are driven . next , an explanation will be given on a process of restriction of the lateral rotation angles of the pair of left and right outdrive devices 2 at the calculation of the rotation angles θ a and θ b at the step s 500 . since the same process is performed concerning the pair of left and right outdrive devices 2 , the process of restriction of the lateral rotation angle of the one outdrive device 2 is described . when the angle ( direction ) β of the composition vectors t a is within a range over a predetermined angle range of the outdrive device 2 at the step s 500 in the flow chart , the outdrive device 2 is controlled so as to be at a predetermined limiting angle mode . herein , the predetermined angle range is a range shown with slashes in fig1 , and is an angle range in which the outdrive device 2 can be rotated . since the hydraulic steering actuator 17 a is constructed by a hydraulic cylinder and its rotation range is limited , the predetermined angle range is provided . when the predetermined angle range is referred to as θ 1 , a limiting angle is referred to as α , and the rear side is regarded as 0 °, the relation thereof is − α & lt ; θ 1 ≦ α . since the rotation of the engine 7 can be switched between forward and reverse rotations with the forward / reverse switching clutch 16 a , centering on the front side , in other words , 180 ° (− 180 °), the lateral angle is − 180 °& lt ; θ 1 ≦ 180 °−(− α ), 180 °− α & lt ; θ 1 ≦ 180 °. for example , when α is 30 °, the predetermined angle range is − 180 °& lt ; θ 1 ≦− 150 °, − 30 °& lt ; θ 1 ≦ 30 °, 150 °& lt ; θ 1 ≦ 180 °. next , an explanation will be given on the limiting angle mode . in the limiting angle mode , for obtaining smooth action following the operation of the joystick 20 , the driving is performed with reduced propulsion power . namely , the engine rotation speed n a is reduced to a set rotation speed n set . in the limiting angle mode , the rotation angle θ a of the outdrive device 2 is fixed at a state of a predetermined limiting angle . concretely , by the angle ( direction ) β of the composition vectors t a determined with the control device 4 , the lateral rotation angle θ a of the outdrive device 2 is determined . as shown in fig1 , in the case in which an x axis indicates the angle β of the composition vector t a and a y axis indicates the lateral rotation angle θ a of the outdrive device 2 , when the angle β of the composition vector t is within a range of − 180 °−(− α )& lt ; β ≦− 90 °, the lateral rotation angle θ a of the outdrive device 2 is − 180 °−(− α ). when the angle β of the composition vector t is within a range of − 90 °& lt ; β ≦− α , the lateral rotation angle θ a of the outdrive device 2 is (− α ). when the angle β of the composition vector t a is within a range of α & lt ; β ≦ 90 °, the lateral rotation angle θ a of the outdrive device 2 is α . when the angle β of the composition vector t a is within a range of 90 °& lt ; β ≦ 180 °− α , the lateral rotation angle θ a of the outdrive device 2 is 180 °− α . as shown in fig1 , in the limiting angle mode , a play tolerance ( hysteresis ) is set so as to prevent frequent change of the rotation angle θ a of the outdrive device 2 . in the case in which the angle β of the composition vector t a is within a range of − 180 °−(− α )& lt ; β ≦ 90 °, when the angle β of the composition vector t a is larger than − 90 °+ γ , the rotation angle θ a of the outdrive device 2 is (− α ). in the case in which the angle β of the composition vector t a is within a range of − 90 °& lt ; β ≦− α , when the angle β of the composition vector t a is not more than − 90 °− γ , the rotation angle θ a of the outdrive device 2 is − 180 °−(− α ). in the case in which the angle β of the composition vector t a is within a range of α & lt ; β ≦ 90 °, when the angle β of the composition vector t a is larger than 90 °+ γ , the rotation angle θ a of the outdrive device 2 is 180 °− α . in the case in which the angle β of the composition vector t a is within a range of 90 °& lt ; β ≦ 180 °− α , when the direction of the composition vector t a is not more than 90 °− γ , the rotation angle θ a of the outdrive device 2 is α . in the limiting angle mode , the engine rotation speed n a of the engine 7 may alternatively be reduced following reduction of a minor angle between the direction of the composition vector t a and the lateral direction of the ship 22 . following the reduction of the angle between the direction of the composition vector t a and the lateral direction of the hull ( 90 ° and − 90 °), that is , following approach of the angle β of the composition vector t a to 90 ° or − 90 °, the engine rotation speed n a of the engine 7 is reduced . as shown in fig1 and 16 , in the limiting angle mode , by increasing a rotation reduction rate of the engine 7 , the engine rotation speed n a is reduced . an area shown with slashes in fig1 is a rotation speed reduction area in which the engine rotation speed n a is reduced gradually , and a colored area is a reduction rate 100 % area in which the reduction rate of the engine rotation speed n a is 100 %. concretely , as shown in fig1 , within a range larger than − 180 °−(− α ) and not more than φ 1 , the reduction rate is increased following the increase of the angle β of the composition vector t a , and at φ 1 , the reduction rate is 100 %, that is , the engine rotation speed n a is a low idling rotation speed . when the angle β of the composition vector t a is larger than φ 1 and not more than φ 2 , the reduction rate is maintained at 100 %. when the angle β of the composition vector t a is larger than φ 2 and not more than − α , the reduction rate is reduced following the increase of the angle β . at − α , the reduction rate is 0 %, that is , the engine rotation speed n a is the engine rotation speed calculated at the step s 400 . herein , φ 1 and φ 2 are angles are linearly symmetrical with − 90 °. for example , when φ 1 is − 100 °, φ 2 is − 80 °. when the angle β of the composition vector t a is larger than α and not more than φ 3 , the reduction rate is increased following the increase of the angle β . at φ 3 , the reduction rate is 100 %, that is , the engine rotation speed n a is the low idling rotation speed . when the angle β of the composition vector t a is larger than φ 3 and not more than φ 4 , the reduction rate is maintained at 100 %. when the angle β of the composition vector t a is larger than φ 4 and not more than 180 °− α , the reduction rate is reduced following the increase of the angle β . at 180 °− α , the reduction rate is 0 %, that is , the engine rotation speed n a is the engine rotation speed calculated at the step s 400 . herein , φ 3 and φ 4 are angles are linearly symmetrical with 90 °. for example , when φ 3 is 80 °, φ 4 is 100 °. φ 1 , φ 2 , φ 3 and φ 4 can be changed within the ranges of − 180 °−(− α )≦ φ 1 & lt ;− 90 °, − 90 °≦ φ 2 & lt ;− α , α ≦ φ 3 & lt ; 90 °, and 90 °≦ φ 4 & lt ; 180 °− α . as mentioned above , the ship maneuvering device 1 has the pair of left and right engines 7 , the rotation speed changing actuators 4 a and 4 b independently changing engine rotation speeds n of the pair of left and right engines 7 , the pair of left and right outdrive devices 2 respectively connected to the pair of left and right engines 7 and rotating the propellers 11 so as to propel the ship 22 , the switching clutches 8 disposed between the engines 7 and the propellers 11 , the pair of left and right hydraulic steering cylinders 3 respectively independently rotating the pair of left and right outdrive devices 2 laterally , the joystick 20 setting the traveling direction of the ship , the operation amount detection sensor 39 detecting the operation amount of the joystick 20 , and the control device 4 controlling the rotation speed changing actuators 4 a and 4 b , the switching clutches 8 , and the hydraulic steering cylinders 3 so as to travel to a direction set by the joystick 20 . from the operation amount of the joystick 20 , the control device 4 calculates the oblique sailing component propulsion power vectors t atrans and t btrans for the oblique sailing of the left and right outdrive devices 2 and the turning component propulsion power vectors t arot and t brot for the turning , and composes the oblique sailing component propulsion power vectors t atrans and t btrans and the turning component propulsion power vectors t arot and t brot of the left and right outdrive devices 2 so as to calculates the composition vectors t a and t b , thereby calculating the propulsion powers and the directions of the left and right outdrive devices 2 . according to the construction , in comparison with the case of calculating the propulsion powers and the directions of the left and right outdrive devices 2 based on only the oblique sailing component propulsion power vectors t atrans and t btrans and subsequently calculating the propulsion powers and the directions of the left and right outdrive devices 2 based on only the turning component propulsion power vectors t arot and t brot , by calculating the composition vectors t a and t b based on the oblique sailing component propulsion power vectors t atrans and t btrans and the turning component propulsion power vectors t arot and t brot , the final propulsion powers and the final directions can be calculated , whereby smooth operation is obtained without setting priority and operability is improved . when the angle β of the composition vector t a ( t b ) is within a range over the predetermined angle range of the outdrive devices 2 , the outdrive devices 2 are controlled so as to be made the predetermined limiting angle mode and the engine rotation speed n a ( n b ) is reduced to the set rotation speed n set . according to the construction , even if the angle β of the composition vector t a ( t b ) is over the predetermined angle range of the outdrive device 2 ( 2 ), the steering of the outdrive devices 2 ( 2 ) can be corrected . when the angle β of the composition vector t a ( t b ) is within a range over the predetermined angle range of the outdrive device 2 ( 2 ), the rotation angle θ a ( θ b ) of the outdrive device 2 ( 2 ) is fixed at the state of the predetermined limiting angle . according to the construction , when the angle of the composition vector t a ( tb ) is over the predetermined angle range of the outdrive devices 2 ( 2 ), frequent change of the rotation angle and frequent switching of forward / reverse rotation of the outdrive device 2 ( 2 ) is prevented . when the angle β of the composition vector t a ( t b ) is within a range over the predetermined angle range of the outdrive device 2 ( 2 ), the engine rotation speed n a ( n b ) of the engine 7 ( 7 ) is reduced following the reduction of the minor angle between the direction β of the composition vector t a ( t b ) and the lateral direction of the hull . according to the construction , when the angle β of the composition vector t a ( t b ) is over the predetermined angle range of the outdrive devices 2 ( 2 ), the switching of forward / reverse rotation of the outdrive devices 2 ( 2 ) can be performed smoothly . the present invention can be used for a ship having an engine , an outdrive device having a propeller rotated by power of the engine , and a clutch engaging and disengaging power transmission from the engine to the propeller .

1Performing Operations; Transporting

hereinafter , the present invention will be concretely described with reference to the appended drawings . it should be noted here that if a given component of the liquid jet head in any of the following embodiments of the present invention is the same in structure as any of the previously described components , the second component will be given the same referential number , and may not be described . a liquid jet head in accordance with the present invention is mountable in a printer , a copying machine , a facsimile machine with a communication system , a word processor or the like apparatus with a printer portion , and also , an industrial recording apparatus which is in combination with various processing apparatuses . further , a liquid jet head in accordance with the present invention can be used as an ink jet recording head to record on various recording media , for example , paper , thread , fiber , cloth , leather , metal , plastic , glass , lumber , ceramic , etc . incidentally , not only does “ recording ” mean to form a meaningful image , such as a letter , a pattern having a specific meaning , but also , to form a meaningless image on recording medium . further , the present invention is compatible with a recording head of the so - called full - line type , which is wide enough to cover the entire recordable range of a sheet of recording medium , in terms of the direction perpendicular to the direction in which the sheet of recording medium is conveyed . moreover , it is compatible with a large recording head made up of an integral combination of small recording heads , a color recording head made up of a combination of multiple , individually manufactured small recording heads . hereafter , the preferred embodiment of the present invention will be described with reference to the appended drawings . fig1 is a schematic perspective view of the liquid jet head in this embodiment . this liquid jet head is made up of a substrate 2 , an ink passage plate 3 , energy generating elements 1 , contact pad 13 . the energy generating elements 1 are disposed in two columns on the substrate 2 , at a preset pitch . the contact pad 13 is for establishing electrical connection between the liquid jet head and the other devices , and is formed also on the substrate 2 . the substrate 2 has an ink distribution hole 7 , the top opening of which is between the two columns of energy generating elements . the ink passage plate 3 has two columns of ink ejection outlets 6 , and multiple ink passages 8 which extend from the ink distribution hole 7 to the ink ejection outlets 6 , one for one . the ink passage plate 3 hereafter may be referred to as a substrate covering resin layer 3 , or simply as a resin layer 3 . the ink passage plate 3 is bonded to the substrate 2 with the placement of an adhesion enhancement layer 5 between the ink passage plate 3 and substrate 2 , in such a manner that the ink ejection outlets 6 align with the energy generating elements one for one . fig2 ( a ) is a top plan view of the recording chip which is a part of the liquid jet head in this embodiment . fig2 ( b ) is a sectional view of the recording chip at a line a - a in fig2 ( a ). as described above , the stress generated in the substrate covering resin layer 3 is affected by the thickness of the resin layer 3 . that is , the greater the thickness of the resin layer 3 , the greater the amount by which stress is generated in the resin layer 3 . this stress sometimes causes the resin layer 3 to separate from the adhesion enhancement layer 5 , and the separation adversely affects the liquid jet head in terms of reliability . in this embodiment , therefore , the substrate covering resin layer 3 is separated into two sublayers , that is , a first resin layer 10 and a second resin layer 11 , with the presence of a step 12 . next , this structural setup will be described in detail . referring to fig2 ( a ) and 2 ( b ), the liquid jet head in this embodiment has the substrate 2 , first resin layer 10 formed on the substrate 2 , and second resin layer 11 formed on the first resin layer 10 . in other words , the second resin layer 11 is above the substrate 2 with the presence of the first resin layer 10 between the second resin layer 11 and substrate 2 . further , the second resin layer 11 is made smaller than the first resin layer 10 , creating therefore the step 12 between the top surface of the second resin layer 10 and the top surface of the first resin layer 11 . that is , the location of the step 12 coincides with those of the bottom edges of the second resin layer 11 . referring to fig2 ( b ), the hatched portion 12 , that is , a portion of the first resin layer 10 , which horizontally extends beyond the bottom edges of the second resin layer 11 , is solid . that is , the step portion 12 does not have grooves or the like . further , the step portion 12 and second resin layer 11 are integral parts of the ink passage plate 3 , that is , the substrate covering resin layer 3 . the amount by which stress is generated in the step portion 12 of the substrate covering resin layer 3 can be reduced by reducing the step portion 12 in thickness . further , the step portion 12 is the portion of the first resin layer 10 , which horizontally extends beyond the edge of the second resin layer 11 , as described above . that is , there is a step between the first and second resin layers 10 and 11 . in other words , the substrate covering resin layer 3 is provided with pliant portions , that is , the boundaries between the bottom edges of the second resin layer 11 and the first resin layer 10 . therefore , the stress generated in the peripheral portion of the substrate covering resin layer 3 can be dispersed into the abovementioned boundaries , and the boundary between the first resin layer 10 and adhesion enhancement layer 5 . that is , the above - described structural arrangement can reduce the stress generated in the substrate covering resin layer 3 . in other words , the present invention can afford more latitude in designing a liquid jet head in terms of the thickness of the first resin layer 10 . further , the liquid jet head in this embodiment is structured so that the height h ( thickness ) of the step portion 12 from the interface between the adhesion enhancement layer 5 and substrate covering resin layer 3 is less than the half of the thickness t of the thickest portion of the substrate covering resin layer 3 . the first resin layer 10 is in direct contact with the adhesion enhancement layer 5 , and therefore , the volume of the first resin layer 10 significantly affects whether or not the first resin layer separates from the substrate 2 ( adhesion enhancement layer 5 ). thus , in order to minimize the amount by which stress is generated in the first resin layer 10 by reducing the first resin layer 10 in volume , the liquid jet head in this embodiment is structured so that the thickness t 1 of the first resin layer 10 is no more than one half the thickness t of the substrate covering resin layer 3 . further , even though the liquid jet head is structured so that the step portion 12 is thin , the step portion 12 does not have grooves or the like ; it is solid . thus , the step portion 12 is satisfactorily strong . as for the thickness t of the substrate covering resin layer 3 having the step portion 12 , the thickness t is the sum of the thickness t 1 of the first resin layer 10 and the thickness t 2 of the second resin layer 11 . that is , the provision of the step portion 12 divides the substrate covering resin layer 3 , the thickness of which is t , into the portion which is t 1 in thickness , and the portion which is t 2 in thickness . thus , the stress generated in the substrate covering resin layer 3 is distributed into the portion with the thickness of t 1 and the portion with the thickness of t 2 , in proportion to the their thickness . therefore , the amount by which stress is generated in the step portion 12 , that is , the peripheral portion of the first resin layer 10 , which is in contact with the adhesion enhancement layer 5 , is relatively small because the step portion 12 is thin ( t 1 in thickness ). therefore , the step portion 12 is unlikely to separate from the substrate 2 . in this embodiment , the liquid jet head is structured so that the first resin layer 10 is thinner ( t 1 in thickness ) than the second resin layer 11 , as described above . thus , the second resin layer 11 is relatively thick ( t 2 in thickness ) compared to the first resin layer 10 ( t 1 in thickness ). in order for an ink jet head to be satisfactory in ink ejecting performance , the distance between each of its liquid ejection outlets 6 and the corresponding energy generating element 1 , that is , the thickness t of the substrate covering resin layer 3 , has to be set to a specific value . in this embodiment , the thickness t of the substrate covering resin layer 3 is roughly 75 μm . structuring a liquid jet head so that the thickness t 2 of the second resin layer 11 is greater than the thickness t 1 of the first resin layer 10 makes the second resin layer 11 greater than the first resin layer 10 in the amount by which stress is generated in them . if the amount of stress in the second resin layer 11 exceeds a certain value , the second resin layer 11 cracks . however , the cracks which occur in the second resin layer 11 are different from the cracks which occur at the interface between the substrate covering resin layer 3 and adhesion enhancement layer 5 as the substrate covering resin layer 3 separates from the substrate 2 . that is , unlike the cracks which occur at the interface between the substrate covering resin layer 3 and adhesion enhancement layer 5 , the cracks which occur in the substrate covering resin layer 3 are attributable to the cohesive failure of the substrate covering resin layer 3 itself . thus , in this embodiment , in order to prevent the occurrences of the cracking of the substrate covering resin layer 3 , which is attributable to cohesive failure , the corner portions 11 b of the second resin layer 11 are rounded to reduce the amount of the stress which concentrates to these portions . however , the corner portions 11 a of the first resin layer 10 are not rounded ; a vertical surface of the first resin layer 10 ( relative to substrate 2 ) perpendicularly intersects with its adjacent vertical surfaces . that is , in this embodiment , the four corners 11 a of the first resin layer 10 have an angle 90 °; the vertical surfaces of the first resin layer 10 perpendicularly intersect with the adjacent vertical surfaces . if the corner portions 11 a of the first resin layer 10 are rounded , the point to which stress concentrates is likely to shift from the first resin layer 10 to the adhesion enhancement layer 5 , and therefore , the adhesion enhancement layer 5 and substrate 2 may separate from each other , or cohesive failure may occur to the adhesion enhancement layer 5 . if the adhesion enhancement layer 5 separates from the substrate 2 or becomes damaged due to cohesive failure , the adhesion enhancement layer 5 fails to protect the surface of the substrate . this is why the corner portions 11 a of the first resin layer 10 are angled at 90 ° to prevent the point to which stress concentrates , from shifting from the first resin layer 10 to the adhesion enhancement layer 5 . in this embodiment , the overall thickness t of the resin layer 3 is roughly 75 μm , and the thickness t 1 of the first resin layer 10 , which is a part of the substrate covering resin layer 3 is roughly 20 μm , whereas the width w of the step portion 12 is roughly 80 μm . thus , even if the substrate covering resin layer 3 is changed in thickness , the same effects as those described above can be obtained by changing the second resin layer 11 in thickness ( t 2 ) and / or the step portion 12 in width w , as necessary . also in this embodiment , the substrate covering resin layer 3 is structured so that there is only one step between the main portion of the substrate covering resin layer 3 and the peripheral portion of the substrate covering resin layer 3 . however , the substrate covering resin layer 3 may be structured so that there are two or more steps between the main portion of the substrate covering resin layer 3 and the peripheral portion of the substrate covering resin layer 3 . that is , the substrate covering resin layer 3 may be structured so that there are two or more second resin layers 11 on the first resin layer 10 . in a case where the substrate covering resin layer 3 is structured so that two or more second resin layers 11 are on the first resin layer 10 , the main portion of the substrate covering resin layer 3 is surrounded by two or more step portions 12 , which are different in thickness . for example , if the substrate covering resin layer 3 is structured so that there are two second resin layers 11 stacked on the first resin layer 10 , the bottom second resin layer 11 is formed on the first resin layer 10 in such a manner that the peripheral area of the first resin layer 10 remains exposed from the bottom resin layer 11 , and the top second resin layer 11 is formed on the bottom second resin layer 11 in such a manner that the peripheral area of the bottom second resin layer 11 remains exposed from the top second resin layer 11 . by structuring the substrate covering resin layer 3 so that there are two or more steps between the main portion ( center portion in terms of plane parallel to substrate 2 ) of the substrate covering resin layer 3 and the outermost edge of the substrate covering resin layer 3 , the stress generated at the step portions 12 , that is , the peripheral portions of the resin layer 3 , can be dispersed in steps into the two or more step portions 12 ; the stress can be further dispersed . next , referring to fig3 , a typical method for manufacturing the liquid jet head in accordance with the present invention will be described . first , referring to fig3 ( a ), a layer 4 is formed of dissolvable resin on the substrate 2 which already has the energy generating elements 1 . the dissolvable resin layer 4 is formed in the pattern of the multiple ink passages 8 . more concretely , first , a dry sheet of dissolvable resin is laminated to the substrate 2 , and resist is coated on the laminated sheet of dissolvable resin by spin - coating or the like method . then , the resist layer is exposed to ultraviolet rays ( deep - uv light ), and developed . even more concretely , polymethyl isopropenyl ketone ( odur - 1010 : product of tokyo ohka kogyo co ., ltd .) is spin - coated on the substrate 2 , and dried . then , the dried polymethyl isopropenyl ketone is patterned by being exposed with the use of deep - uv light , and developed . next , referring to fig3 ( b ), the first resin layer 10 is formed on the dissolvable resin layer 4 . next , referring to fig3 ( c ), the first resin layer 10 is exposed with ultraviolet rays ( deep - uv light ), for example . then , the portion of the first resin layer 10 , which will become the step portion 12 , is heated to create the pattern of the step portion 12 . then , the material for the second resin layer 11 is coated as shown in fig3 ( d ). next , the coated material for the second resin layer 11 is exposed with ultraviolet rays ( deep - uv light ), for example , as shown in fig3 ( e ). lastly , the precursor of the liquid jet head formed through the above described steps is developed to form the first and second resin layers 10 and 11 as shown in fig3 ( f ). as described above , the liquid jet head in this embodiment is provided with the step portion 12 , that is , the portion of the first resin layer 10 , which extends outward beyond the second resin layer 11 . therefore , it is unlikely to suffer from the problem that the peripheral portion of the substrate covering resin layer 3 separates from the substrate 2 . further , the step portion 12 is solid , being therefore satisfactorily strong . next , referring to fig4 ( a ) and 4 ( b ), the second preferred embodiment of the present invention will be described . fig4 ( a ) is a top plan view of the recording chip , which is a part of the liquid jet head in this embodiment , and fig4 ( b ) is a sectional view of the recording chip , at a line a - a in fig4 ( a ). in this embodiment , the second resin layer 11 is provided with a groove 9 , which surrounds the ink passage portion having the liquid ejection outlets 6 and ink passages 8 . the groove 9 is shaped so that the surface 9 a of each of its two lateral walls is jagged ; the cross section of the surface 9 a of each of its lateral walls , at a plane perpendicular to the substrate 2 , looks like saw teeth . the structure of the liquid jet head in this embodiment is the same as that of the liquid jet head in the first embodiment , except that the second resin layer 11 of the latter has the groove 9 . thus , the features of the liquid jet head in this embodiment , which are the same as those of the liquid jet head in the first embodiment will not be described in detail . further , the structural components of the liquid jet head in this embodiment , which are the same as the counterparts in the first embodiment will be given the same referential codes to describe them . if the surface 9 a of each of the lateral walls of the groove 9 is flat , the stress generated in the second resin layer 11 works in the same direction across a large area , and therefore , the separation of the substrate covering resin layer 3 from the adhesion enhancement layer 5 occurs across a large area of the interface between the substrate covering resin layer 3 and adhesion enhancement layer 5 . in this embodiment , however , the surface 9 a of each of the lateral surfaces of the groove 9 of the substrate covering resin layer 3 is made jagged so that its cross section , at a plane parallel to the substrate 3 , looks like the teeth portion of a saw . therefore , the stresses different in direction are generated in the same area of the interface between the second resin layer 11 and adhesion enhancement layer 5 . thus , some of the stresses cancel with each other , reducing therefore the stress which acts on the substrate covering resin layer 3 . further , since the second resin layer 11 of the liquid jet head in this embodiment is provided with the groove 9 , the substrate covering resin layer 3 of the liquid jet head in this embodiment is smaller in overall volume than the liquid jet head in the first embodiment . that is , the amount by which stress is generated in the substrate covering resin layer 3 of the liquid jet head in this embodiment is smaller , by an amount equivalent to its overall volume reduction , than the amount by which stress is generated in the substrate covering resin layer 3 of the liquid jet head in the first embodiment . that is , not only can this embodiment reduce the amount by which stress is generated in the peripheral portion of the substrate covering resin layer 3 of the liquid jet head to prevent the substrate covering resin layer 3 from separating from the substrate 2 , but also , can prevent the problem that the portions of the substrate covering resin layer 3 , which surrounds its area having the ink passages 8 , separate from the substrate 2 . the groove 9 is not located in the step portion 12 . therefore , the liquid jet head in this embodiment is satisfactorily strong in spite of the presence of the groove 9 . next , the third preferred embodiment of the present invention will be described with reference to fig5 ( a ), which is a top plan view of the recording chip , that is , a part of the liquid jet head in this embodiment , and fig5 ( b ), which is a sectional view of the recording chip at a line a - a in fig5 ( a ). except that the liquid jet head in this embodiment is provided with a groove 19 and multiple connective portions 14 , the liquid jet head in this embodiment is the same as that in the first embodiment . thus , the features of the liquid jet head in this embodiment , which are the same as those of the liquid jet head in the first embodiment will not be described in detail . further , the structural components of the liquid jet head in this embodiment , which are the same as the counterparts in the first embodiment , will be given the same referential codes as those given to the counterparts in the first embodiment , one for one , instead of directly describing them . the liquid jet head in this embodiment is provided with a groove 19 , which surrounds the portion of the substrate covering resin layer 3 , which has the liquid ejection outlets 6 and ink passages 8 . the groove 19 in this embodiment is different from that in the second embodiment in that the surface 19 a of each of the lateral walls of the groove 19 in this embodiment is flat . further , the portion 3 a of the substrate covering resin layer 3 , which is on the outward side of the groove 19 , is connected to the portion 3 b of the substrate covering resin layer 3 , which is on the inward side of the groove 19 , by the multiple connective portions 14 , each of which are separated from adjacent ones by a preset distance . in this embodiment , the internal surfaces 19 a are flat . therefore , the effects provided by the first embodiment , that is , the effects obtained by the jagged surfaces 9 a , the cross section of which at a plane parallel to the substrate 2 looks like the teeth portion of a saw , cannot be obtained . however , the portion 3 a of the substrate covering resin layer 3 , which is on the outward side of the groove 9 , and the portion 3 b of the substrate covering resin layer 3 , which is on the inward side of the groove 9 , are supported by the connective portions 14 . therefore , the separation of the substrate covering resin layer 3 can be prevented . further , the present invention may be embodied in the combination of the second and third preferred embodiments . that is , not only may the surface of each of the lateral walls of the abovementioned groove be made jagged , but also , the substrate covering resin layer 3 may be provided with multiple connective portions , which connect the portion 3 a of the substrate covering resin layer 3 , which is on the outward side of the groove , and the portion 3 b of the substrate covering resin layer 3 , which is on the inward side of the groove . incidentally , the numerical values or the like quoted in the description of the preceding preferred embodiment are nothing but examples . that is , these values are not intended to limit the present invention in scope . next , a typical method for manufacturing the liquid jet head in this embodiment will be described . first , referring to fig8 , an example of a method for manufacturing the liquid jet head in this embodiment will be roughly described . fig8 ( a 1 )- 8 ( e 1 ) are schematic sectional views of the precursors of the liquid jet head in the various stages of the manufacturing of the liquid jet head in this embodiment , as seen at a plane equivalent to the sectional plane in fig7 . fig8 ( a 2 )- 8 ( e 2 ) are top plan views of the same precursors as those shown in fig8 ( a 1 )- 8 ( e 1 ), one for one . first , energy generating elements 1 are formed on a substrate 2 as shown in fig8 ( a 1 ) and 8 ( a 2 ). next , a pattern 21 for the formation of the liquid passages is formed of dissolvable resin . more concretely , a sheet of dry film of resist is laminated on the surface of the substrate 2 , or the top surface of the substrate is coated with resist by spin - coating or the like method . then , the resist layer is exposed with ultraviolet rays ( deep - uv light ), and developed . as the material for the resist , polymethyl isopropenyl ketone ( odur - 1010 : product of tokyo ohka kogyo co ., ltd .) can be listed . incidentally , if necessary , an adhesion improvement layer may be formed on the substrate before the formation of the pattern 21 , in order to better adhere the liquid passage formation plate to the substrate 2 . as the material for the adhesion improvement layer , polyether amide can be listed , for example . next , a cover layer 22 , which is for forming the liquid passage formation plate , is formed on the pattern 21 . then , liquid ejection outlets 6 are formed through the cover layer 22 , obtaining the precursor shown in fig8 ( c 1 ) and 8 ( c 2 ). it is in this step that the step portion 12 is formed in a manner to surround the primary portion of the cover layer 22 . from the standpoint of reducing the amount by which stress is generated in the substrate covering resin layer 3 , the step portion 12 is formed in such a manner to entirely surround the primary portion of the cover layer 22 . next , referring to fig8 ( d 1 ) and 8 ( d 2 ), the liquid distribution hole 7 is formed through the substrate 2 by etching or the like method . more specifically , in a case where a silicon wafer is used as the material for the substrate 2 , the ink distribution hole 7 is formed by anisotropic etching , with the use of strong alkaline solution , such as koh , naoh , and tmah . more concretely , the bottom surface of the substrate ( silicon wafer ) is thermally oxidized , and the pattern for the liquid distribution hole 7 is formed on the oxidized bottom surface of the substrate 2 . then , the substrate 2 is etched with tmh solution for ten hours plus several hours , while keeping the temperature of the tmh solution at 80 ° to form the ink distribution hole 7 . next , referring to fig8 ( e 1 ) and 8 ( e 2 ), the pattern 21 is removed to form the liquid passages 8 . more concretely , the pattern 21 is exposed in entirety with deep - uv light through the cover layer 22 , and then , is dissolved away . then , the remainder is dried . incidentally , subjecting the precursor to ultrasonic waves while dissolving the pattern 21 can definitely reduce the time necessary for dissolving away the pattern 21 . after the completion of the above described steps , the precursor is provided with electrical contacts necessary for electrical connection . this is the last step in the manufacturing of the liquid jet head in this embodiment . next , the step shown in fig8 ( b 1 ) and 8 ( b 2 ), and the step shown in fig8 ( c ) and 8 ( c 2 ), that is , the steps for forming the step portion 12 will be described in detail with reference to fig9 . fig9 is a sectional view of the precursor of the liquid jet head in this embodiment , which is equivalent to the precursor shown in fig8 ( a 1 ). referring to fig9 ( a ), in order to form a liquid passage formation plate 24 on the pattern 21 on the substrate , a first cover layer 25 , which is the bottom portion of the cover layer 22 , is formed in a manner to cover the pattern 21 and the substrate 2 . more specifically , the first cover layer 25 is formed by spin - coating the pattern 21 and the top surface of the substrate 2 with photosensitive resinous compound of the negative type . the photosensitive resinous compound used in this embodiment contains polymeric resin and polymerization initiator . as the polymeric resins usable as the material for the first cover layer 25 in this embodiment , there are resins obtainable by radical polymerization , resins obtainable by cationic polymerization , resins obtainable by anionic polymerization , and the like . there is no requirement regarding the choice of the polymeric resin . as for the initiator , in the case of a resin obtainable by cationic polymerization , a cation polymerization initiator is appropriate . as the cationic polymerization initiator , a substance which generates acid as it is exposed to light can be used . as the substance which generates acid as it is exposed to light , aromatic sulfonate or aromatic iodonium salt can be used . the abovementioned resin and initiator can be used by dissolving them in an appropriate solvent . sometimes , an additive or additives may be added to form a liquid jet head which is superior in various properties , such as , mechanical strength . in particular , a photosensitive resin of the negative type , the polymeric resin of which is an epoxy resin , and the initiator of which is a substance which generates acid as it is exposed to light , is desirable as the material usable for the photolithography used for the formation of a liquid jet head in accordance with the present invention . next , referring to fig9 ( b ), a part of the first cover layer 25 is exposed with ultraviolet rays or the like . as the part of the first cover layer 25 is exposed , the acid generating substance in the exposed part reacts to light acid , producing acid in the exposed portion . more specifically , at least the area of the first cover layer 25 , which is on the outward side of the pattern , and the area of the first cover layer 25 , which is not in the adjacencies of the pattern , are exposed , as shown in fig1 ( which is top plan view of precursor , which are equivalent to fig8 ( a 2 )- 8 ( e 2 )). the area of the first cover layer 25 , which is on the outward side of the pattern , is exposed . as a result , an exposed portion 23 is formed . referring to fig1 ( a ), the exposed portion 23 is formed in a manner to surround the pattern 21 like a frame . however , the area of the first cover layer 25 , which is on the outward side of the pattern 21 , may be exposed in such a manner that the exposed portion 23 will result on each side of the pattern 21 as shown in fig1 ( b ). next , referring to fig9 ( c ), the second cover layer 26 for forming the liquid passage plate is formed on the first cover layer 25 . the second cover layer 26 is formed also on the exposed portion 23 . the material for the second cover layer 26 , which is to be formed on the first cover layer 1 can be selected from among the aforementioned photosensitive resin of the negative type . however , the polymerization initiator for the material for the second cover layer 26 is desired to be the same as that for the material for the first cover layer 25 . further it is desired that the base resin for the material for the second cover layer 26 and the polymerization initiator for the material for the second cover layer 26 are the same as those for the material for the first cover layer 25 . in particular , it is desired that the two photosensitive resinous compounds of the negative type are the same in the chemical compound seed . although it is desired that the two materials are the same in chemical compound seed , it is not necessary that the two are the same in the ratio of the chemical compound seed . further , the two materials may be different in density , or the like , relative to the solvent for spin - coating . next , referring to fig9 ( d ), the portions of the surface of the second cover layer 25 , which will be turned into the liquid ejection outlets 6 , are masked . then , the first cover layer 25 is exposed together with the second cover layer 26 . more concretely , the portions of the first cover layer 25 , which are on the pattern 21 , are exposed from above ( through ) the portion 23 a ( portions closer to pattern 21 ) of the exposed portion 23 of the second cover layer 26 formed on the exposed portions . then , the portions of the first cover layer 25 , which are below the part of the exposed part 23 of the first cover layer 25 , is exposed through the portion of the second cover layer 26 , which is above the pattern 21 . as for the first cover layer 25 , the exposed portion 23 to the area on the pattern 21 are exposed . the other portion 23 b ( portion away from pattern 21 ) of the exposed portion 23 is left unexposed portion 23 with the use of a mask . then , the precursor is heated to harden the exposed portions of the first and second cover layers 25 and 26 . next , the precursor is developed to remove the unexposed portions of the first and second cover layers 25 and 26 , obtaining thereby the precursor , the cover layer 22 of which has the liquid ejection outlets 6 and the step portion 12 as shown in fig9 ( e ). the precursor shown in fig9 ( e ) is equivalent to the precursor of the liquid jet head in the first embodiment , which is shown in fig8 ( c 1 ). it is preferable to harden the exposed portion 23 of the first cover layer 25 by heating the precursor , as shown in fig1 , after the completion of the steps described with reference to fig9 ( b ). the hardening of the exposed portion 23 prevents the acid from dispersing . that is , it can prevent the acid from moving from the exposed portion 23 into the second cover layer 26 as the second cover layer 26 is painted on the exposed portion 23 ( fig9 ( c )). the exposed portion 23 has only to be heated to harden the exposed portion 23 enough to prevent the acid movement . as for the temperature level for the heating , it is thought that a temperature range of 80 ° c .- 90 ° c . is appropriate , although it depends on the ingredients of the photosensitive resin of the negative type . the hardening of the exposed portion 23 can provide a distinct contrast between the portion 23 b of the exposed portion 23 , that is , the portion to be hardened , and the portion 11 a of the second cover layer 26 , which is on the portion 23 b of the exposed portion 23 , which is not to be hardened , respectively . thus , the hardening ensures that the flange - like portion 12 a of the step portion 12 , which corresponds to the top surface of the exposed portion 23 , is precisely formed in shape . further , described above is the case where the cover layer 10 is not developed after a portion of the first cover layer 25 is developed to create the exposed portion 23 . the case where the cover layer 10 is developed after the hardening of the exposed portion 23 will be described later . the steps which follow the step shown in fig9 ( b ) are the same as the steps shown in fig8 ( d 1 ) and 8 ( d 2 ). in a case where the first and second cover layers 25 and 26 are created by painting , it is not necessary that each cover layer is created by a single stroke of painting means . that is , they may be exposed after they are created by applying the material for each cover layer several times . going through the above described steps when manufacturing the liquid jet head in this embodiment ensures that the resultant liquid jet head will have even more precisely formed step portion ( flange - like portion ) around its liquid passage plate , and therefore , the liquid passage plate does not separated from the substrate , because the precisely formed step portion ( flange - like portion ) can reduce the amount of stress to which the liquid passage plate is subjected . next , referring to fig1 , the method for manufacturing the liquid jet head in another preferred embodiment will be described . fig1 ( a )- 13 ( h ) are schematic sectional views of the precursors of the liquid jet head , in this embodiment , which are in various manufacturing steps for the head , one for one , as are the fig8 ( a 1 )- 8 ( e 1 ). first , referring to fig1 ( a ), energy generating elements 1 are formed on a substrate 2 . next , referring to fig1 ( b ), a first pattern 21 for liquid passages and a second pattern 30 for forming a moat - like portion are formed on the substrate 2 . the provision of the second pattern 30 causes the material for the first cover layer 25 to better fill the corner portion between the vertical edge of the first pattern 21 and the substrate 2 . the second pattern 30 is formed in a manner to surround the first pattern 21 . next , referring to fig1 ( c ), the photosensitive resin compound of the negative type is applied to the top side of the substrate 2 to form a first cover layer 25 in a manner to cover both patterns 21 and 30 . next , referring to fig1 ( d ), the first cover layer 25 is exposed in such a manner that the resultant exposed portion 23 will surround the first and second patterns 21 and 30 . next , referring to fig1 ( e ), the second cover layer 26 is formed on the first cover layer 25 to form a liquid passage plate . the material for the second cover layer 26 may be selected from among the abovementioned photosensitive resin compounds of the negative type . next , referring to fig1 ( f ), the portions of the second cover layer 26 , which will become the liquid ejection outlets 6 , and the portions of the second cover layer 26 , which corresponds in position to the moat - like portion , are masked . then , the first cover layer 25 is exposed together with the second cover layer 26 . during this exposing step , the second cover layer 26 is exposed across the portion which corresponds in position to a portion 23 a ( portion away from pattern 21 ), and the portion which corresponds in position to the exposed portion 21 , leaving exposed the portion which corresponds in position to the other portion 23 b ( portion closer to pattern 21 ), with the use of a mask . then , the precursor is heated to harden the exposed portions of the first and second cover layers 25 and 26 to obtain a cover layer 22 , which is an integration of the first and second cover layers 25 and 26 . next , referring to fig1 ( g ), the liquid passages 8 and moat - like portion 20 are formed by removing the first and second patterns 21 and 30 . next , referring to fig1 , the method for manufacturing the liquid jet head in another preferred embodiment of the present invention will be described . fig1 ( a )- 15 ( f ) are sectional views of the precursors of the liquid jet head , in this embodiment , which are similar to fig9 ( a )- 9 ( e ). referring to fig1 ( a ), lateral wall forming members 30 for forming the lateral walls of the liquid passages are formed on the substrate 2 , on which energy generating elements have been formed . the lateral wall forming members 30 are formed by hardening the patterned photosensitive resin compound of the negative type . next , referring to fig1 ( b ), the space between the lateral wall forming members 30 , which will become the liquid passages , is filled with dissolvable resin . more specifically , the dissolvable resin is poured into the space by the amount large enough to cover even the top surface of the lateral wall forming wall 30 . then , the dissolvable resin is hardened to form a solid dissolvable resin layer 17 . next , the solid layer 17 is filed until the top surface of the lateral wall forming member 30 is exposed , that is , until the top surface of the lateral wall forming member 30 becomes level with the top surface of the filed solid layer 17 , as shown in fig1 ( c ). as the method for filing ( polishing ) the solidified dissolved resin layer 17 , it is possible to use one of the cmp ( chemical - and - mechanical polishing ) methods , for example . next , referring to fig1 ( d ), the material for a cover layer 18 is coated across the combination of the top surface of the lateral wall forming member 30 and the top surface of the solidified dissolvable resin layer 17 . the material for the cover layer 18 is a photosensitive resin compound of the negative type . it is desired to be the same as the material for the lateral wall forming member 30 . the examples of the photosensitive resin compound of the negative type for the cover layer 18 are the same as those mentioned as the examples of the material for the first cover layer 25 . next , referring to fig1 ( e ), the portions of the cover layer 18 , which will become the liquid ejection outlets 6 are masked , and also , the outward edge portion of the cover layer 18 , which corresponds in position to the outward edge portion 30 b of the lateral wall forming member 30 , is masked . then , the cover layer 18 is exposed . in other words , the cover layer 18 is exposed except for the portions which correspond in position to the liquid ejection outlets 6 and the outward edge portion 30 b of the lateral wall forming member 30 . next , the exposed cover layer 18 is hardened by the application of heat , and then , is developed . then , the liquid distribution hole 7 is formed , and the solidified dissolvable layer 17 is removed . it is through this step that the liquid ejection outlets 16 are formed , and the outward edge portion of the lateral wall forming member 30 is removed in a manner to create a step between the lateral wall forming member 30 and liquid ejection outlet forming member 19 . at this time , another method for forming a structural component having a step , using the above described method , will be described referring to fig1 ( a )- 14 ( e ). first , referring to fig1 ( a ), a first layer 27 is formed of a photosensitive resin compound of the negative type , on the substrate 2 . as the photosensitive resin compound of the negative type for the first layer 27 , one of those described as the examples of the photosensitive resin compounds of the negative type , which can be used as the material for the cover layers , can be used . next , referring to fig1 ( b ), the portions of the first layer 27 are selectively exposed to form an exposed portion 23 . then , the first layer 27 is heated to harden the exposed portion 23 to prevent the polymerization initiation seeds from dispersing . next , referring to fig1 ( c ), a second layer 28 is formed of a photosensitive resin compound of the negative type , on the first layer 27 in such a manner as to cover the exposed portion 23 as well . it is desired that the second layer 28 is the same in composition as the first layer 27 . next , the second layer 28 and first layer 27 are partially exposed so that a portion 23 a of the exposed portion 23 of the first layer 27 is exposed . more specifically , the portion of the second layer 28 , which corresponds in position to the unexposed portion of the first layer is exposed from above the portion 23 a . as for the first layer 27 , the portion , which was not exposed in the preceding exposing step , is exposed . in this step , the portion of the second layer 28 , which is above the other portion 23 b of the exposed portion 23 , is left unexposed . then the exposed portions of the first and second layers 27 and 28 are hardened by the application of heat . next , the precursor was developed to remove the unexposed portions of the first and second layers 27 and 28 , obtaining thereby a structure 29 having a step portion 12 . next , an embodiment of the present invention , which is related to a method for manufacturing a liquid jet head in accordance with the present invention , will be concretely described . first , a substrate 2 , which is a piece of wafer made of silicon crystal with a crystal axis of 100 is masked ( unshown ) across the portion which corresponds in position to the ink distribution hole . then , electro - thermal transducers 2 are formed , as energy generating elements , on the substrate 2 . then , a protective layer and a cavitation prevention layer ( unshown ) are formed ( fig8 ( a )). each of the electro - thermal transducers is in connection to a control signal input electrode ( unshown ) for activating the element . next , a liquid passage pattern 21 is formed of positive resist formed of acrylic resin ( odur1010a : product of tokyo ohka kogyo co ., ltd . ), on the substrate 2 ( fig8 ( b 1 )). then , the following compound a is spin - coated on the pattern 21 , and the precursor is baked for nine minutes at 90 ° c ., to form the first cover layer 25 , which is 20 μm in thickness ( fig9 ( a )). next , the portion 23 of the first cover layer 25 is partially exposed at a 120 mj / cm 2 ( fig9 ( b )). then , the precursor was heated three minutes at 90 ° c . then , the second layer 26 , which is 60 μm in thickness , was formed on the first cover layer 25 by coating the compound a on the first cover layer 25 ( fig9 ( c )). next , the first and second cover layers 25 and 26 were exposed at 50 mj / cm 2 . more specifically , the exposed portion 23 was exposed in such a pattern that the portion 23 a was exposed while leaving the portion 23 b unexposed ( fig9 ( d )). then , the precursor was developed with xylene to form the liquid ejection outlets 6 and the step portion 12 a ( flange - like portion ) ( fig9 ( e )). next , the liquid distribution hole 7 was formed , and the pattern 21 was removed , to complete the liquid passage formation plate ( fig8 ( e 1 )). the liquid jet head in accordance with the present invention was obtained through the above described steps . this embodiment of the present invention , which is related to the manufacturing of a liquid jet head in accordance with the present invention , is the same as the fourth embodiment , except that in this embodiment , the precursor was not baked after the exposure of the portion 23 in fig9 ( b ). up to the step shown in fig9 ( b ), this embodiment is the same as the fourth embodiment . then , the first cover layer 25 was heated to harden the exposed portion 23 . then , the precursor was developed to remove the portions of the first cover layer 25 other than the exposed portion 23 , obtaining the precursor shown in fig1 ( a ). next , the second cover layer 26 was formed in a manner to cover the exposed portion 23 ( fig1 ( b )). then , the first and second cover layers 25 and 26 were exposed so that the portion 23 a of the exposed portion 23 was exposed while the portion 23 b remains unexposed . the steps which were carried out hereafter to obtain a liquid jet head in accordance with the present invention , were the same as those in the fourth embodiment , which were described with reference to fig9 ( e ). next , referring to fig1 , the method for manufacturing a comparative liquid jet head will be described . fig1 ( a )- 16 ( c ) are sectional views of a conventional liquid jet head ( comparative liquid jet head ), which are equivalent to fig8 ( a 1 )- 8 ( e 1 ). this liquid jet head manufacturing method is the same as the liquid jet head manufacturing method in the fourth embodiment up to its step which is the same as the step in fourth embodiment , shown in fig9 ( b ). then , the second cover layer 26 is formed on the first cover layer 25 without exposing the first cover layer 25 , obtaining the precursor shown in fig9 ( a ) the method used for forming the second cover layer 26 is this embodiment is the same as that used in fourth embodiment . the first and second layers of this conventional liquid jet head are the same in thickness as the counterparts of the liquid jet head in the fourth embodiment . next , the first and second cover layers 25 and 26 were exposed at 500 mj / cm 2 ( fig1 ( b )). the portion x of the first cover layer 25 of this liquid jet head , which is shown in fig1 ( b ), and is the outward end portion of the first cover layer 25 , is comparable to the exposed portion 23 a in the fourth embodiment . the steps which were carried out thereafter to obtain the conventional liquid jet head shown in fig1 ( c ) were the same as those carried in fourth embodiment . the comparative example of a liquid jet head , that is , the liquid jet head manufactured through this method for manufacturing a liquid jet head does not have the step portion 12 a ( flange - like portion ). the liquid jet head in the first to third preferred embodiments , and the liquid jet head made with the use of the comparative example 1 of a liquid jet head were subjected to pressure - temperature tests . a certain number of each of the liquid jet heads in the first to third preferred embodiments of the present invention , and the comparative example of a liquid jet head ( conventional liquid jet head ) were prepared , and were dipped in ink . then , they are left under twice the normal pressure at 121 ° for ten hours . then the liquid jet heads were examined to find if separation occurred between the substrate 2 and liquid passage formation plate of any of the liquid jet head . in the case of the liquid jet heads in accordance with the present invention , virtually no separations were found between the liquid passage formation plate 24 and substrate 2 . further , even in the case of a liquid jet head whose liquid passage formation plate 24 and substrate 2 separated from each other , the extent of separation is at a level which is not problematic in practical terms . on the other hand , in the case of the comparative liquid jet heads ( conventional liquid jet heads ), the ratio of the liquid jet heads whose liquid passage formation plate and substrate 2 had separated from each other was greater than in the case of the liquid jet heads in accordance with present invention . further , the former was greater in the extent of separation than the latter . it is reasonable to think , based on the above described result , that because the liquid jet heads in the above described preferred embodiments of the present invention were provided the step portion 12 ( flange - like portion ), the stress which occurs in the liquid passage formation plate 24 , formed of the photosensitive resin of the negative type , that is , the material for the liquid passage formation plate 24 , shrinks when it hardens , or the like stress , is reduced by the step portion 12 ( flange - like portion ). further , the flange - like portion 12 a of the step portion 12 in the fourth preferred embodiment of the present invention , which corresponds in position to the top surface of the exposed portion 23 was flatter than the counterpart in the fifth preferred embodiment . it is reasonable to think that this occurred because in the case of the fourth embodiment , the exposed portion 23 is hardened by the application of heat after the formation of the exposed portion 23 , and therefore , the exposed portion 23 remained intact in the shape of its top surface as it was formed as a part of the first cover layer . that is , it is reasonable to think that the hardening reduced the movement of the acid generated by the exposure , and therefore , in the case of the fourth embodiment , the acid did not disperse into the second cover layer 26 as much as it did in the case of the fifth embodiment . moreover , the surface of the liquid jet head in the fourth embodiment , which has the opening of each of the liquid ejection outlets 6 , was flatter than the counterpart in the sixth embodiment . it is reasonable to think that this occurred because in the case of the liquid jet head in the fourth embodiment , the second cover layer 26 was formed on the first cover layer 25 without carrying out the developing process after the exposure of the portion 23 , that is , while keeping flat the top surface of the first cover layer 25 . while the invention has been described with reference to the structures disclosed herein , it is not confined to the details set forth , and this application is intended to cover such modifications or changes as may come within the purposes of the improvements or the scope of the following claims . this application claims priority from japanese patent applications nos . 016369 / 2008 and 244196 / 2008 filed jan . 28 , 2008 and sep . 24 , 2008 , respectively , which are hereby incorporated by reference herein .

1Performing Operations; Transporting

the present invention rests on the idea that in a clinical environment a patient is continually exposed to stimuli caused by various unintentional stimulation sources . unintentional stimulation here refers to stimulation that occurs naturally without proactive actions whose only purpose is to generate stimulus - response pairs . as discussed in freedman , n ., et al ., “ abnormal sleep / wake cycles and the effect of environmental noise on sleep disruption in the intensive care unit ”, am . j . respir crit care med vol 163 : 451 - 457 , 2001 , abrupt noise in an icu environment causes sleep disruptions leading to arousals and awakenings . in an icu environment , such unintentional stimuli may also be caused by various other sources external to the patient , such as lights , sounds , caregiving procedures , or the ventilation of the patient . an unintentional stimulus may also be internal , such as pain or anxiety . in the present invention , a first measure indicative of the level of consciousness of the patient is determined . the time series of the first measure is examined to detect the raises or other changes caused by arousals resulting from unintentional stimuli . a second measure indicative of the responsiveness of the patient is then determined based on a selected sequence of the time series . the second measure may be calculated based on the frequency and / or intensity of at least one such change detected , and the number of data points in the sequence may vary depending on the implementation . the ability of the second measure to differentiate between natural sleep and unconsciousness induced by sedatives is based on the discovery that deepening sedation tends to suppress naturally occurring arousals , while test persons in natural sleep remain relative responsive . the invention therefore provides a selective mechanism for differentiating between sedation and natural sleep . in one embodiment of the invention , the first measure represents high - frequency eeg power measured from the patient and the second measure is indicative of the occurrence of raises in the first measure . this embodiment is discussed in the following with reference to fig1 , which represents the continuous state of the process , i . e . it is assumed that the process has already gathered enough signal data from the patient to be able to calculate the required values over the time windows used . the eeg signal measured from a patient ( step 11 ) is first digitized and the sampled eeg signal is filtered to exclude high - and low - frequency artifacts ( step 12 ). as is common in the art , the digitized signal samples are processed as sets of sequential signal samples representing finite time blocks or time windows , commonly termed “ epochs ”. based on the signal data , the process then calculates the current high - frequency eeg power at step 13 and stores the calculated value . the high - frequency eeg power is derived by calculating the power of the signal data in a frequency band comprising high - frequency eeg components . in this example , the said band extends from 20 hz to 35 hz and the length of the time window within which the power is determined corresponds to one epoch ( 5 seconds ). the high - frequency eeg power may be derived from a power spectrum . the fast fourier transform , for example , is a computationally effective algorithm for this purpose . alternatively , the high - frequency eeg power may be calculated straight from the time - domain signal , by utilizing appropriate filters . a time series representing the first measure , which is the high - frequency eeg power in this case , is thus obtained from step 13 . the process then determines a change variable indicative of the changes in the high - frequency eeg power . for this , the process first finds the minimum high - frequency eeg power defined within a preceding time window of a predetermined length ( step 14 ). in this example , the length of the time window from which the minimum is searched is 1 minute . the change variable is then determined by subtracting the minimum value from the current value ( step 15 ). the values of the change variable obtained during another , longer time window are then used to obtain a final index indicative of the mean / cumulative high - frequency eeg power changes with respect to time ( step 16 ). the said another time window is long with respect to the typical frequency of the unintentionally caused arousals of the patient . in this example , the final index is calculated over a time window of 30 minutes , i . e . the window extends 30 minutes backwards from the current moment . nevertheless , steps 13 to 16 may be performed for each epoch . the determination of the change variable is illustrated in fig2 , in which curve 20 represents the power values obtained during the preceding time window from which the minimum is retrieved . if the current high - frequency eeg power determined at step 13 is vc , for example , the value of the change variable corresponds to vc − vm . since the absolute value of the change variable may be great , the usability of the variable may be enhanced by calculating the logarithm of the difference . in the above embodiment , the responsiveness index r of the patient is thus determined according to equation ( 1 ) as follows : and where peeg ( ti ) refers to high - frequency eeg power in a short time window ti computed over the frequency range of 20 hz to 35 hz . in the above example , the length of this time window corresponds to one epoch ( 5 seconds ), while t 2 = 30 minutes and t 1 = 1 minute , as discussed above . however , the values may change . due to the above subtraction , the final index does not depend on the absolute level of the background high - frequency eeg . this is an important property as the absolute high - frequency eeg power level varies substantially between different patients . for the same reason , the index is robust against stationary artifacts , such as ecg or pacemaker artifacts . on the other hand , due to the long time window the index is also relatively robust against isolated transient artifacts , such as those occurring during care procedures . low - frequency artifacts such as eye movements obviously do not affect the index either . the particular embodiment disclosed above uses both the amplitude and the frequency of the arousals , but the implementation of the second measure may also be based on the frequency or the amplitude of the arousals only . requirements for artifact detection procedures depend on the choice of the frequency range used . the second measure may also indicate the frequency or the total number of substantial changes occurred within a certain preceding time window , where substantial changes refer to changes exceeding a predetermined change limit . fig3 illustrates the responsiveness calculated in the above - described manner as a function of the responsiveness level assessed by a clinician using the ramsay score . the ramsay score includes six levels , and the value of the responsiveness that corresponds to each level represents the mean value of the patients of the level concerned . as can be seen from the figure , the calculated index conforms to the assessment of the clinician . in the above embodiment , the values of the high - frequency eeg power are continuously examined to find the abrupt raises associated with the arousals of the patient . fig4 illustrates another embodiment of the present invention , in which the determination of the responsiveness is synchronized with the natural stimuli that cause the arousals . therefore , the first measure needs to be examined only when a stimulus occurs . in this embodiment , the first measure may be obtained as discussed above ( steps 41 and 42 ). concurrently , the clinical environment is monitored to detect the natural stimuli that may cause arousals of the patient ( step 43 and 44 ). as noted above , the natural stimuli may be originated from various sources , and one or more such sources may be monitored at step 43 . for example , the noise level may be recorded through a microphone and / or the airway pressure of a ventilator may be monitored to detect patient / ventilator dyssynchrony . furthermore , if a non - invasive blood pressure monitor is used , the cuff pressurization may be used as a standard disturbance that may cause an arousal of the patient . when detecting a disturbance that may cause an arousal of the patient , a trigger message is supplied to an analysis process ( step 44 / yes ). the analysis process also receives the time series representing the first measure . the trigger message acts as a trigger notifying the analysis process of the occurrence of a stimulus , and the message may further include information about the type and / or magnitude ( intensity ) of the stimulus . in response to the trigger message , the analysis process determines ( step 45 ) the corresponding change in the first measure . the changes occurring within a certain time period may then be used to calculate the final index . for example , a variable indicative of the sum or mean of the changes occurring within the said time period may be calculated . the length of the period depends on the practical implementation ; if the responses in the first measure are clear , the number of stimuli in the time window may be low . in an extreme case , the final index may be determined from a sequence of two measures obtained based on a single stimulus . the length of the period over which the final index is defined may thus be defined in time units or in the number of detected stimuli . if several stimulus sources are monitored , the changes caused by different sources may be weighted differently when calculating the final index . as noted above , the eeg entropy may also be used instead of high - frequency eeg power as the first measure indicative of the level of consciousness of the patient . instead of entropy , the evaluation of the level of consciousness may also be based on another parameter that characterizes the amount of disorder or irregularity in the eeg signal data measured from the patient . other possible quantifications that may be used include fractal spectrum analysis , lempel - ziv complexity , or bispectral or multispectral analyses . a further parameter that may be employed as the first measure is the above - mentioned bispectral index , bis ™. the bis involves the calculation of three parameters : burst suppression ratio , beta ratio , and synchfastslow , and the resulting bis value is a combination of the three parameters . the principles of the bis algorithm are described in ira j . rampil , a primer for eeg signal processing in anesthesia , anesthesiology , vol . 89 ( 4 ) october 1998 , pp . 980 - 1002 . if bis is employed as the first measure , the present invention includes monitoring the bis values and deriving a second measure , which is indicative of the magnitude and / or frequency of the bis changes within a certain period . as discussed above , the second measure may indicate the mean or sum of the changes within a period of a predetermined length or the mean or sum of the changes within a period comprising a predetermined number of stimuli . the second measure may also be indicative of the rate of changes that exceed a certain limit value . fig5 illustrates one embodiment of the system or apparatus according to the invention . the physiological signal ( s ) obtained from one or more sensors attached to a patient 10 are supplied to an amplifier stage 51 , which amplifies the signal ( s ) before they are sampled and converted into digitized format in an a / d converter 52 . the digitized signals are supplied to a computer unit 53 which may comprise one or more processors . as noted above , the signal data measured from the patient is typically eeg signal data , which is measured through electrodes applied to the forehead of the patient . the electrodes also receive high - frequency eeg signal data from the patient . the computer unit is provided with a memory or database 54 holding the digitized signal data obtained from the sensor ( s ). the memory or database may also store first and second calculation algorithms that the computer unit executes in order to obtain the first and second measures , respectively . the resulting index of responsiveness may be displayed on the screen of a monitor 56 . although one computer unit or processor may perform the above steps , the processing of the data may also be distributed among different units / processors ( servers ) within a network , such as a hospital lan ( local area network ). the apparatus of the invention may thus also be implemented as a distributed system . if the index determination is synchronized with the occurrence of the stimuli , the apparatus / system is further provided with a detection system 58 for detecting the stimuli that may cause the arousals in the clinical environment . as discussed above , the detection system may detect one or more stimulus types , in which case it is provided with one or more detection interfaces for receiving signals indicative of the stimuli . for example , if audio stimuli occurring in the clinical environment are detected , the corresponding detection interface may be provided with a microphone m for measuring the noise level . some of the detection interfaces may be connected to desired clinical equipment , such as to a ventilator for measuring the airway pressure for detecting patient / ventilator dyssynchrony or to a blood pressure cuff for detecting when the cuff is pressurized . the computer unit may further act as a controlling entity controlling the administration of the drugs from the delivery system 57 to the patient . the computer unit may also supply the values of the responsiveness index to another computer unit or microprocessor ( not shown ), which then acts as the controlling entity controlling the drug delivery system . the said controlling entity may be provided with the control data needed for the administration , such as the pharmacodynamic and pharmacokinetic properties of the drugs to be administered . the drug delivery system may comprise separate delivery units for one or more drugs to be administered , such as a delivery unit for an analgesic drug and / or a delivery unit for a hypnotic drug . the computer unit may also act as a decision - support tool for the physician , such as an anesthesiologist , who may control the operation of the drug delivery system through an appropriate user input device 55 , such as a keyboard or a bar code reader . various parameters possibly needed in the calculation of the first and second measures may also be supplied through the input device , if the computer unit has no access to such data . a conventional patient monitor intended for measuring the level of consciousness may also be upgraded to enable the monitor to determine the responsiveness index of the invention . such an upgrade may be implemented by delivering to the patient monitor a plug - in software module that enables the device to calculate the responsiveness index based on the time series of the first measure defined in the device . the software module may be delivered , for example , on a data carrier , such as a cd or a memory card . as discussed above , the patient monitor may be an entropy - based monitor or a bis monitor , for example . the plug - in software module has access to the time series of the entropic indicators or the bis values , whereby it may calculate the responsiveness index in the above - described manner . the software module may also comprise a new version of the software , which replaces the existing software of the patient monitor . a responsiveness monitor of the invention may also be implemented as a separate module connectable to a conventional patient monitor intended for measuring the level of consciousness . as is shown in fig6 , such a responsiveness monitor 60 may comprise a data processing unit 63 which receives the time series of the first measure from the conventional patient monitor and derives the second measure from the said time series . the responsiveness monitor may comprise a display of its own for displaying the calculated responsiveness index to the user , and it may optionally include the above - described detection system 58 . although the invention was described above with reference to the examples shown in the appended drawings , it is obvious that the invention is not limited to these , but may be modified by those skilled in the art without departing from the scope of the invention .

0Human Necessities

the following detailed description of implementations consistent with the present invention refers to the accompanying drawings . the same reference numbers in different drawings may identify the same or similar elements . also , the following detailed description does not limit the invention . instead , the scope of the invention is defined by the appended claims and their equivalents . implementations consistent with the principles of the invention provide single - crystal silicon fin structures that are formed on opposite sides of a dielectric fin structure . the material for the dielectric fin structure is chosen such that a significant stress is induced in the single - crystal silicon material to enhance mobility . fig1 illustrates an exemplary process for forming fin structures for a finfet device in an implementation consistent with the principles of the invention . fig2 - 9 illustrate exemplary views of a finfet device fabricated according to the processing described in fig1 . the fabrication of one finfet device will be described hereinafter . it will be appreciated , however , that the techniques described herein are equally applicable to forming more than one finfet device . with reference to fig1 and 2 , processing may begin by forming a dielectric fin structure 210 on a substrate 200 of a semiconductor device ( act 105 ). in one implementation , substrate 200 may comprise silicon . in alternative implementations consistent with the present invention , substrate 200 may comprise other semiconducting materials , such as germanium , or combinations of semiconducting materials , such as silicon - germanium . in another alternative , substrate 200 may include an insulator , such as an oxide layer , formed on a silicon or germanium substrate . dielectric fin structure 210 may comprise a dielectric material that causes significant tensile stress ( strain ) in the dual fin structures that will be formed adjacent dielectric fin structure 210 . in one implementation , dielectric fin structure 210 may comprise an oxide or a nitride . dielectric fin structure 210 may be formed in a conventional manner . for example , a dielectric material may be deposited over substrate 200 to a thickness ranging from about 200 å to about 1000 å . a mask may be formed over a portion of the dielectric material and the dielectric material may then be etched in a conventional manner , with the etching terminating on substrate 200 to form dielectric fin structure 210 . the resulting dielectric fin structure 210 may have a width ranging from about 100 å to about 1000 å . after forming dielectric fin structure 210 , an amorphous silicon layer 310 may be deposited on the semiconductor device , as illustrated in fig3 ( act 110 ). in one implementation consistent with the principles of the invention , amorphous silicon layer 310 may be deposited to a thickness ranging from about 100 å to about 1000 å . amorphous silicon layer 310 may then be etched in a conventional manner , with the etching terminating at substrate 200 to form amorphous silicon spacer ( fin ) structures 410 , as illustrated in fig4 ( act 115 ). each amorphous silicon fin structure 410 may have a height ranging from about 200 å to about 1000 å and a width ranging from about 100 å to about 1000 å . a dielectric layer 510 may be deposited on the semiconductor device , as illustrated in fig5 ( act 120 ). in one implementation consistent with the principles of the invention , dielectric layer 510 may be deposited to a thickness ranging from about 200 å to about 1000 å . dielectric layer 510 may comprise an oxide or other dielectric materials . the semiconductor device may be polished via a chemical - mechanical polishing ( cmp ) ( or other technique ) to planarize the top surface of the semiconductor device such that the top surface of each of amorphous silicon fin structures 410 is exposed , as illustrated in fig6 ( act 120 ). during the cmp , a portion of the upper surface of dielectric fin structure 210 and amorphous silicon fin structures 410 may be removed so that the upper surface of each of amorphous silicon fin structures 410 is exposed . for example , after the cmp , the height of fins 210 and 410 may range from about 150 å to about 200 å . a metal layer 710 , such as nickel , may be deposited on the semiconductor device , as illustrated in fig7 ( act 125 ). in one implementation , nickel layer 710 may be deposited to a thickness of about 20 å . a metal - induced crystallization ( mic ) operation may then be performed . the mic operation may involve annealing nickel layer 710 at about 500 ° c . to about 550 ° c . for several hours , which acts to diffuse the nickel into the amorphous silicon to convert the amorphous silicon in fin structures 410 to single - crystal silicon 810 , as illustrated in fig8 ( act 130 ). as a result of the mic operation , a thin layer of a nickel silicon ( nisi ) compound 820 may formed between substrate 200 and single - crystal silicon fin structures 810 . in one implementation , the thickness of nisi layer 820 may range from about 20 å to about 200 å . after single - crystal silicon fin structures 810 are formed , conventional finfet fabrication processing can be utilized to complete the transistor ( e . g ., forming the source and drain regions ), contacts , interconnects and inter - level dielectrics for the finfet device . for example , dielectric layer 510 may be removed , a protective dielectric layer , such as a silicon nitride or silicon oxide may be formed on the top surface of fins 210 and 810 , followed by the formation of a gate dielectric on the side surfaces of single - crystal silicon fin structures 810 . source / drain regions may then be formed at the respective ends of fins 210 and 810 , followed by formation of one or more gates . for example , a silicon layer , germanium layer , combinations of silicon and germanium or various metals may be used as the gate material . the gate material may then be patterned and etched to form the gate electrodes . for example , fig9 illustrates an exemplary top view of the semiconductor device consistent with the principles of the invention after the source / drain regions and gate electrodes are formed . as illustrated , the semiconductor device includes a double - gate structure with fins 210 and 810 , source and drain regions 910 and 920 , and gate electrodes 930 and 940 . source / drain regions 910 and 920 may then be doped with n - type or p - type impurities based on the particular end device requirements . in addition , sidewall spacers may optionally be formed prior to the source / drain ion implantation to control the location of the source / drain junctions based on the particular circuit requirements . activation annealing may then be performed to activate source / drain regions 910 and 920 . the present invention has been described above as forming a number of fin structures . it should be understood that methods consistent with the present invention may be used to form any number of fins , based on the particular circuit requirements . thus , in accordance with the principles of the invention , single - crystal silicon fin structures may be formed , having a dielectric fin structure located between the single - crystal silicon fin structures . the material for the dielectric fin structure may be chosen so as to induce a significant stress ( strain ) in the single - crystal silicon fin structures . as a result , enhanced mobility in the single - crystal silicon fin structures is achieved . fig1 - 15 illustrate exemplary views for forming multiple fin structures in an alternative implementation consistent with the principles of the invention . with reference to fig1 , processing may begin with a semiconductor device that includes an oxide layer 1010 formed on a substrate 1000 . substrate 1000 may comprise silicon or other semiconducting materials , such as germanium , or combinations of semiconducting materials , such as silicon - germanium . oxide layer 1010 may have a height ranging from about 200 å to about 1000 å . oxide layer 1010 may be etched to form a trench 1020 , as illustrated in fig1 . in one implementation , trench 1020 may have a width ranging from about 200 å to about 2000 å . next , amorphous silicon may be deposited and etched to form amorphous silicon spacers 1110 , as illustrated in fig1 . each of amorphous silicon spacers 1110 may have a width ranging from about 100 å to about 1000 å . a dielectric material 1210 may be deposited in the gap between amorphous silicon spacers 1110 , as illustrated in fig1 . the dielectric material may comprise an oxide or other dielectric materials . a layer of nickel 1310 may deposited on a top surface of amorphous silicon spacers 11 10 , as illustrated in fig1 . the thickness of nickel layer 1310 may be about 20 å . a mic operation may then be performed . the mic operation may involve annealing nickel layer 1310 at about 500 ° c . to about 550 ° c . for several hours to convert amorphous silicon spacers 1110 to single - crystal silicon fin structures 1410 , as illustrated in fig1 . as a result of the mic operation , a thin layer of a nickel silicon ( nisi ) compound 1420 may be formed between substrate 1000 and single - crystal silicon fin structures 1410 . in one implementation , the thickness of nisi layer 1420 may range from about 20 å to about 200 å . oxide layer 1010 may then be removed in a conventional manner , as illustrated in fig1 . accordingly , a spacer - induced merged fet can be produced . in another implementation , spacers may be used to create a narrow trench that can provide a coupling effect between both sides of the trench . as illustrated in fig1 , a semiconductor device may include an oxide layer 1610 formed on a substrate ( not shown ) with a silicon layer 1620 formed thereon . a material , such as a silicon nitride or a silicon oxide , may be deposited and patterned to form hard masks 1640 . next , a spacer material , such as sin , sio , or some other material , may be deposited and etched to form spacers 1630 on the side surfaces of hard masks 1640 . silicon layer 1620 may then be etched using spacers 1630 and hard masks 1640 as masks to form a narrow trench 1710 , as illustrated in fig1 . trench 1710 may have a width ranging from about 100 å to about 1000 å . trench 1710 advantageously provides a coupling effect between fins 1620 located on both sides of trench 1710 . implementations consistent with the principles of the invention provide single - crystal silicon fin structures that are formed on opposite sides of a dielectric fin structure . the material for the dielectric fin structure is chosen such that a significant stress is induced in the single - crystal silicon material . in this manner , enhanced mobility can be achieved . the foregoing description of exemplary embodiments of the present invention provides illustration and description , but is not intended to be exhaustive or to limit the invention to the precise form disclosed . modifications and variations are possible in light of the above teachings or may be acquired from practice of the invention . for example , in the above descriptions , numerous specific details are set forth , such as specific materials , structures , chemicals , processes , etc ., in order to provide a thorough understanding of the present invention . however , the present invention can be practiced without resorting to the details specifically set forth herein . in other instances , well known processing structures have not been described in detail , in order not to unnecessarily obscure the thrust of the present invention . in practicing the present invention , conventional deposition , photolithographic and etching techniques may be employed , and hence , the details of such techniques have not been set forth herein in detail . while a series of acts has been described with regard to fig1 the order of the acts may be varied in other implementations consistent with the present invention . moreover , non - dependent acts may be implemented in parallel . no element , act , or instruction used in the description of the present application should be construed as critical or essential to the invention unless explicitly described as such . also , as used herein , the article “ a ” is intended to include one or more items . where only one item is intended , the term “ one ” or similar language is used . the scope of the invention is defined by the claims and their equivalents .

7Electricity

embodiments of the invention will be shown below to describe the invention in detail , but it should not be understood that the invention is limited to these embodiments . here , the same parts are denoted by the same reference symbols . first , a method of manufacturing a multilayer ceramic substrate according to the embodiment will be described . in fig1 are shown schematic illustrations to show a process of manufacturing a composite green sheet made of different materials used in this embodiment . as shown in fig1 ( 1 ), a first green sheet 1 is formed on a support sheet 2 such as pet ( polyethylene terephthalate ) sheet . for example , ceramic powder is mixed with organic vehicle to make slurry as a dielectric paste and a film is formed of the slurry on a resin sheet such as a pet ( polyethylene terephthalate ) sheet by a doctor blade method or the like to produce a green sheet . to produce a glass ceramic substrate , slurry is used that is made by mixing ceramic powder and glass powder with organic vehicle . the organic vehicle is such that binder is dissolved in an organic solvent and is mainly constructed of : a solvent such as terpineol , butyl carbitol , acetone , toluene , and isopropyl alcohol ; a binder such as ethyl cellulose and poly ( vinyl butyral ); and a plasticizer such as di - n - butylphthalate . in addition , deflocculant and humectant may be added thereto . the contents of the organic vehicle are not limited to specific values , but may be common contents , for example , 1 to 5 wt % binder and 10 to 50 wt % solvent . in addition to the above - described organic paint containing organic vehicle , water - soluble paint made by dissolving a water - soluble binder and dispersant in water may be used . here , the water - soluble binder is not limited to a specific material but can be selected as appropriate from poly ( vinyl alcohol ), cellulose , water - soluble acrylic resin , and emulsion . materials constructing main ingredients and secondary ingredients are used as the dielectric raw materials of the dielectric paste according to the composition of a dielectric porcelain composition . in this regard , the forms of raw materials are not limited to specific ones but oxides constructing the main ingredients and the secondary ingredients and / or compounds that become oxides when they are fired may be used . the raw materials may be powders produced by either a liquid - phase synthetic method or a solid - phase method . here , compounds that become oxides when they are fired include , for example , carbonate , nitrate , oxalate , and organometallic compound . needless to say , oxide and compound that becomes oxide when it is fired may be used in combination . it is recommended that the contents of respective compounds in the dielectric raw materials be determined so as to make the composition of the above - described dielectric porcelain composition after they are fired . in the case of manufacturing a glass ceramic substrate that is an ltcc substrate , a glass component and a ceramic component can be selected as appropriate on the basis of a target dielectric constant and a firing temperature , and a substrate made of alumina ( crystal phase ), produced by firing at 1000 ° c . or less , and silicon oxide ( glass phase ) can be taken as an example . in addition , as the ceramic component can be used magnesia , spinel , silica , mullite , forsterite , steatite , cordierite , strontium feldspar , quartz , zinc silicate , zirconia , and titania or the like . as the glass component can be used borosilicate glass , borosilicate barium glass , borosilicate strontium glass , borosilicate zinc glass , borosilicate potassium glass or the like . preferably , the content of the glass component is 60 to 80 volume % and the content of ceramic component that is aggregate is 40 to 20 volume %. this is because if the content of the glass component is outside the above range , a composite composition is hard to form and is decreased in strength and sintering property . the thickness of each first green sheet is determined for usage of elements and conductive lines made in the substrate by firing and usually ranges from 20 to 245 μm . and the thickness of the sheet after firing becomes 13 to 160 μm . for example , in the case of usage in which many inductance elements need to be made , it is preferable that the thickness of the first green sheet is thin . to give an actual example , the thickness of the green sheet is 20 to 45 μm , and after firing , the thickness becomes 13 to 30 μm . further , when a conductive lines of high q value is formed or a via hole for radiating heat is formed , it is preferable that the thickness of the first green sheet is thick . to give an actual example , the thickness of the green sheet is 60 to 80 μm , and after firing , the thickness becomes 39 to 52 mi . the number of layers of the first green sheets is not limited to a specific number but ranges from 4 to 50 . next , as shown in fig1 ( 2 ), the first green sheet 1 is punched out by a puncher 4 in a state where a predetermined portion 3 to be punched of the first green sheet 1 attached to the support sheet 2 . the shape of the predetermined portion 3 to be punched is determined by the shape of a die 5 . next , as shown in fig1 ( 3 ), a second green sheet 6 is formed on the support sheet 2 such as a pet sheet by the same method as used for the first green sheet . here , the second green sheet 6 is preferably formed of a material whose dielectric constant becomes different after firing from the first green sheet 1 . the dielectric constant of the second green sheet 6 is selected as appropriate according to the characteristics of a capacitor element and an inductance element that are to be formed . however , it is preferable that the first green sheet 1 and the second green sheet 6 are equal in thickness to each other so as to form a final flat composite green sheet 7 of different materials . further , the composition of dielectric paste used for the first green sheet 1 and the second green sheet 6 are preferably prepared in such a way that the first green sheet 1 and the second green sheet 6 have press compressibility and firing shrinkage of the same level . a combination of material compositions to be described below is taken as an example of a combination of compositions to satisfy these characteristics . for example , when the composition of the dielectric raw material of the first green sheet is aluminum oxide base dielectric raw material ( al 2 o 3 - glass ( sio 2 — b 2 o 3 — al 2 o 3 — mgo — cao — sro )), the composition of the dielectric raw material of the second green sheet is preferably the following composition . that is , aluminum oxide - titan oxide base dielectric raw material ( al 2 o 3 — tio 2 - glass ( sio 2 — b 2 o 3 — al 2 o 3 — mgo — cao — sro )), and aluminum oxide - titan oxide - strontium oxide base dielectric raw material ( sio 2 — al 2 o 3 — la 2 o 3 — b 2 o 3 — tio 2 — bi 2 o 3 — nd 2 o 3 — sro )) can be preferably used . next , as shown in fig1 ( 4 ), the second green sheet 6 is separated from the support sheet 2 . next , as shown in fig1 ( 5 ), the separated second green sheet 6 is placed on the punched first green sheet 1 and is provisionally bonded to it , preferably , by pressing . the conditions of provisional bonding are not limited to specific ones but , preferably , pressing pressure is 3 to 5 mpa , heating temperature is 35 to 80 ° c ., and pressing time is 0 . 1 to 1 . 0 second . next , as shown in fig1 ( 6 ), the degree of inserting the puncher 4 into the die 5 is adjusted and the second green sheet 6 is punched out and the punched second green sheet 6 b is inserted in the punched portion 3 of the first green sheet 1 . by aligning the first green sheet 1 , the second green sheet 6 , the puncher 4 , and the die 5 with each other , the punched second green sheet 6 b can be inserted in the punched portion 3 of the first green sheet 1 with high accuracy . next , as shown in fig1 ( 7 ) and 1 ( 8 ), the second green sheet 6 a after punching is peeled off from the first green sheet 1 . further , as shown in fig1 ( 9 ), the support sheet 2 is peeled of f from the composite green sheet 7 made of different materials . accordingly , the composite green sheet 7 of different materials can be produced in which the punched second green sheet 6 b is inserted in the punched portion 3 of the first green sheet 1 . in the green sheet used in this embodiment , for the purpose of printing a conductive paste , it is preferable that after the step of peeling off the second green sheet 6 a provisionally bonded to the surface of the first green sheet 1 , a support sheet 8 having no punching hole is bonded to the green sheet . that is , as shown fig1 ( 10 ), the support sheet 8 such as a new pet sheet having no hole is prepared and is bonded , preferably by pressing , to the composite green sheet 7 of different materials . the conditions of bonding by pressing are not limited to specific ones but preferably , pressing pressure is 5 to 8 mpa , heating temperature is 50 to 100 ° c ., and pressing time is 3 . 0 to 8 . 0 seconds . as shown in fig1 ( 11 ), it is also recommended that a step of forming via holes 9 in any one or both of the first green sheet and the second green sheet of the composite green sheet 7 of different materials , bonded to the support sheet 8 , is performed before printing the conductive paste . in this regard , the forming of the via holes 9 in the first green sheet is performed not only after the composite green sheet 7 of different materials is formed but also , for example , after the first green sheet 1 is formed ( after fig1 ( 1 ) or 1 ( 2 )). the forming of the via holes 9 in the second green sheet 6 is performed not only after the composite green sheet 7 of different materials is formed but also , for example , after the second green sheet 6 is formed ( after fig1 ( 3 )). next , as shown in fig1 ( 12 ), the conductive paste is printed on the surface of the composite green sheet 7 of different materials and in the via holes 9 to form a conductive layer 11 and via holes 10 . because the conductive paste is printed after the composite green sheet 7 of different materials is formed , the conductive paste can be printed on both of the first green sheet 1 and the second green sheet 6 b inserted in the first green sheet 1 . in addition , the conductive paste can be printed across the boundary between the first green sheet 1 and the second green sheet 6 b . therefore , a pattern of circuits and electrodes can be freely printed irrespective of the positions where the second green sheet 6 b is inserted in the composite green sheet 7 of different materials . the conductive paste is prepared by kneading conductive material of various kinds of conductive metals and alloy such as ag , ag — pd alloy , cu , and ni with the above - described organic vehicle . the contents of the organic vehicle are not limited to specific values but usual contents can be used : for example , binder is 1 to 5 wt % and solvent is 10 to 50 wt %. further , additives selected from various kinds of dispersants and plasticizers may be contained in the respective pastes when necessary . thereafter , the support sheet 8 is peeled off from the composite green sheet 7 of different materials ( not shown ). by the above process , the composite green sheet of different materials can be formed . next , a plurality of composite green sheets of different materials are laminated and are pressed on a full - scale basis in the direction of lamination to form a green sheet laminate . the pressure of full - scale pressing is not limited to a specific one but preferably ranges from 40 to 100 mpa and a heating temperature ranges from 35 to 80 ° c . thereafter , the green sheet laminate is subjected to a binder burn - out processing and a firing processing to produce a multilayer ceramic substrate 1 after firing , as shown in fig2 . fig2 is a schematic sectional view showing one embodiment of a multilayer ceramic substrate according to this embodiment . a firing temperature is determined according to the material of the green sheet and is not limited to a specific temperature but usually ranges from 850 to 1000 ° c . a firing atmosphere can be determined as appropriate according to the kinds of conductive materials in the conductive paste . when base metal such as cu , ni , cu alloy , and ni alloy is used as the conductive material , the firing atmosphere is preferably made a reducing atmosphere and the partial pressure of oxygen of the firing atmosphere is preferably made 10 − 10 to 10 − 3 pa , more preferably 10 − 7 to 10 − 3 pa . if the partial pressure of oxygen at the time of firing is too low , the conductive material in an internal electrode tends to cause abnormal sintering and to break off . if the partial pressure of oxygen at the time of firing is too high , the internal electrode tends to be oxidized . thereafter , a circuit pattern 38 and terminals 33 are printed on the surface of the multilayer ceramic substrate 100 . here , the circuit pattern may be printed before the multilayer ceramic substrate 100 is fired . in the multilayer ceramic substrate 100 , dielectric layers 31 and other dielectric layers 35 different from the dielectric layers 31 can be formed at desired positions and in desired sizes , and is it possible to easily form electric connections 39 to the direction of main surface of each ceramic substrate . further , conductive through holes 34 can be also formed with ease in a conventional manner . in this regard , when a laminate type capacitor is formed in the multilayer ceramic substrate , the following process is performed . that is , when the green sheet laminate is formed , the punched portions of the first green sheets are aligned with each other in such a way that the second green sheets have portions overlapping above and below in the direction of lamination . the conductive paste is printed on the surface of the second green sheet inserted in this punched portions . with this , an internal conductive layer is interposed between the layers of the second green sheets when the multilayer ceramic substrate is formed , whereby laminate type capacitors can be formed . in this regard , a conductive layer and an electrode pattern can be freely printed irrespective of the positions where the second green sheet is inserted in the composite green sheet 7 of different materials , so that the internal electrode layers can be electrically connected to each other with ease . the invention is not limited to the embodiment described above but can be variously modified within the scope of the invention . for example , the embodiment described above has described the case where the second green sheet is equal in thickness to the first green sheet . however , as shown in fig2 , it is also recommendable to overlay two second green sheets , the thickness of which is made one half of the thickness of the first green sheet , and to form an internal conductive layer 37 between two overlaid second green sheets . a multilayer ceramic substrate having a capacitor element shown in fig3 was formed , and capacitance and ir were measured . a fired layer 21 of the first green sheet was made to have a composition ( sio 2 — b 2 o 3 — al 2 o 3 — mgo — cao — sro ) whose dielectric constant e was 7 . 3 after firing . a fired layer 22 of the second green sheet was made to have a composition ( sio 2 — al 2 o 3 — la 2 o 3 — b 2 o 3 — bao — tio 2 — bi 2 o 3 — nd 2 o 3 — sro ) whose dielectric constant e was 21 . 1 after firing . the size after firing of the second green sheet inserted in the first green sheet was made 2 . 57 mm × 2 . 57 mm × 40 μm . the size of an internal electrode was 2 . 13 mm × 2 . 13 mm . an external electrode is denoted by a reference numeral 23 . this was example 1 . similarly , the fired layer 21 of the first green sheet was made to have a composition ( bao — al 2 o 3 — sio 2 — b 2 o 3 ) whose dielectric constant e was 5 . 9 after firing . the fired layer 22 of the second green sheet was made to have a composition ( bao — nd 2 o 3 — tio 2 — b 2 o 3 — cao — zno ) whose dielectric constant e was 72 . 3 after firing . the size after firing of the second green sheet 22 inserted in the first green sheet 21 was made 2 . 57 mm × 2 . 57 mm × 40 μm . the size of the internal electrode was made 1 . 71 mm × 1 . 71 mm . this was example 2 . the relationship between capacitor capacity and insulation resistance of example 1 , which was measured under conditions that a frequency for capacity measurement was 1 khz and a voltage for ir measurement was 10 v , is shown in fig4 . the relationship between capacitor capacity and insulation resistance of example 2 , which was measured under conditions that a frequency for capacity measurement was 1 khz and a voltage for ir measurement was 10 v . is shown in fig5 . referring to fig4 and 5 , in the case of fig4 , there is provided insulation resistance equal to or larger than 10 11 ω , and in the case of fig5 , there is provided insulation resistance equal to or larger than 10 9 ω . therefore , the multilayer ceramic substrate had characteristics higher than a predetermined quality level .

8General tagging of new or cross-sectional technology

referring to fig1 there is illustrated a typical electrochemical treatment system , generally designated by the numeral 20 , adapted for electrochemical machining by the use of the present invention . more particularly , the system 20 has an electrochemical machining (&# 34 ; ecm &# 34 ;) section 30 incorporating two ecm cells 40 , each constructed in accordance with and embodying the features of the present invention , and disposed in a working region 39 . while two of the cells 40 have been illustrated , it will be appreciated that any desired number of cells 40 could be utilized in the system 20 , depending upon the amount of material to be removed . the system 20 is mounted on a floor 21 and operates to process a continuous web 22 of material , such as a continuous metal strip , which is to be processed by the system 20 for reducing the thickness thereof , such as in the formation of metal foils . the system 20 has an entry section 23 in which the web 22 is unreeled from a coil 24 by means of a suitable uncoiler motor 25 . while two of the coils 24 are illustrated in fig1 it will be appreciated that only one is used at a time . when one coil 24 is exhausted , the trailing end of the web therefrom is welded to the leading end of the web of the other coil 24 at a welder 26 , and the empty reel is then replaced . in this manner , the system 20 can be operated substantially continuously . to facilitate this continuous operation , the entry section 23 includes a looping unit 27 which accumulates a length of the web 22 , the system 20 drawing web from this accumulation during the time that a switchover is being made from one supply coil to another , all in a known manner . as the web 22 leaves the entry section 23 it may be passed through a cleaner 28 to remove surface impurities . the web 22 then enters the ecm section 30 , being processed sequentially in the ecm cells 40 . upon exiting the ecm section 30 , the web 22 passes through a rinse tank 31 for removing the electrolyte fluid and any remaining loose material , and is then passed through a dryer 32 and a main pulling bridle 33 for drawing the web 22 through the ecm section 30 . the web 22 then passes through an exit section 34 , which includes another looping unit 35 to accumulate a length of web 22 . the web 22 then passes through a shear mechanism 36 and then onto a tension or take - up reel 37 , which is driven by an associated coiler motor 38 . it will be appreciated that when a reel 37 is filled , the web is severed at the shear mechanism 36 , and the leading end is then fed onto a second take - up reel 37 , while the filled reel 37 is removed and replaced with an empty one . during this severing and rethreading operation onto the new take - up reel 37 , web from the ecm section is accumulated in the looping unit 35 . thus , continuous operation of the system 20 is facilitated , in a known manner . referring now to fig2 through 7 , the ecm cell 40 will be described in detail . the ecm cell 40 includes a large , cylindrical , electrically conductive roller 41 , mounted for rotation about the longitudinal axis thereof by stub shafts 42 . the roller 41 has an electrically conductive cylindrical outer surface 44 , having annular recesses 45 formed therein , respectively at the opposite ends thereof ( see fig7 ) to define reduced - diameter portions . disposed in each of these recesses 45 is an electrically insulating annular sleeve 46 , which may be formed of rubber or other suitable material . the axial length of the roller 41 is designed to correspond with the lateral width of the web 22 being processed . more particularly , the axial distance between the inner edges of the insulating sleeves 46 is preferably slightly less than the lateral width of the web 22 , so that the side edges of the web 42 overlap the insulating sleeves 46 a slight distance ( e . g . 1 / 2 inch ). this will ensure that the metallic surface of the roller 41 is not directly exposed to the electrolytic action , but the overlap will be small enough to ensure that the web 22 will be positively charged . preferably , the cylindrical outer surface 44 of the roller 41 is machined to a constant radius along its entire axial length . it will be appreciated that different size rollers 41 may be utilized for processing different size webs . accordingly , the roller 41 is preferably mounted in a roll stand ( not shown ) which is designed to accommodate a quick change of rollers . the roller 41 is adapted to be coupled , while it is rotating , to a source of electric power , as by slip rings 47 coupled to the stub shafts 42 . the web 22 is fed into the ecm cell 40 so as to be wrapped around the roller 41 in electrical contact therewith . more particularly , where the web 20 enters the ecm cell 40 adjacent to the top thereof , it is first fed around guide rollers 48 , 49 and 50 ( see fig1 and 2 ), so that the web 22 may extend upwardly over the top of the roller 41 and then downwardly therefrom , exiting around the guide roller 51 . if more than one ecm cell 40 is utilized , the web 22 is passed from the guide roller 51 directly to the guide roller 50 of the next ecm cell 40 . in the last ecm cell 40 , the web 22 , after passing around the guide roller 51 , will then be fed around guide rollers 53 and 54 back up to the same level at which it entered the ecm section 30 . preferably , the ecm cell 40 is designed so that the web 22 will be disposed in contact with the outer surface 44 of the roller 41 around more than 180 ° of the circumference thereof , it being appreciated that the angular extent of contact can be controlled by the spacing between the guide rollers 50 and 51 . as the web 22 exits the roller 41 , it passes through a thickness gauge 55 , which may be a gamma ray gauge , for a purpose to be explained more fully below . it will be appreciated that use of the insulating sleeves 46 on the roller 41 permits the use of a roller 41 which has an axial dimension greater than the lateral width of the web 22 , so as to keep the web 22 properly positioned on the roller 41 . for example , on a roller designed to process a 36 - inch width web , the width of the roller 41 might be 40 inches , with 2 . 5 inches of insulating sleeve 46 on each end thereof . the ecm cell 40 also includes a cathode assembly 60 ( see fig8 ), which comprises two part - cylindrical cathode members 61 and 62 , which may be substantially identical in construction . while two cathode members are shown , the cathode assembly 60 would comprise a single cathode member or more than two . preferably , the combined arcuate extent of the cathode members is not greater than 300 °. each of the cathode members 61 and 62 has parallel planar side walls 63 , radially extending planar end walls 64 , a part - cylindrical inner working surface 65 and a part - cylindrical outer surface 66 , coaxial with the working surface 65 ( see fig3 - 6 ). terminal connections 67 ( see fig2 ) are respectively provided on the cathode members 61 and 62 for connection to an associated source of electric power . the cathode members 61 and 62 are designed so that , in use , they are disposed substantially coaxially with the conductive roller 41 , with the working surfaces 65 arranged on a common cylinder , spaced a predetermined slight distance radially outwardly from the conductive outer surface 44 of the roller 41 , this distance being greater than the initial thickness of the web 22 . thus , when the web 22 is wrapped around the roller 41 , the cathode assembly 60 cooperates therewith to define therebetween an annular working gap 68 ( see fig6 and 7 ), which gap may , for example , be in the range of from about 0 . 02 inch to about 0 . 04 inch . there may be formed in the working surface 65 of each of the cathode members 61 and 62 a plurality of laterally extending channels 70 , each of which is preferably rectangular in transverse cross section and extends the entire width of the cathode member from one to the other of the side walls 63 , the channels 70 preferably being equidistantly spaced apart circumferentially of the cathode member . extending radially through each cathode member 61 and 62 is a plurality of bores 71 , spaced apart longitudinally of each of the channels 70 . each of the bores 71 branches into three ports 72 , 73 and 74 , which open into the corresponding one of the channels 70 at equidistantly spaced - apart points therealong ( see fig5 ). threadedly engaged in the outer end of each of the bores 71 is a fitting 75 , which projects radially outwardly beyond the outer surface 66 and is adapted to the threadedly engaged with a mating coupling 75a ( fig6 ) on an associated conduit . more particularly , alternate ones of the fittings 75 along each channel 70 are coupled to inlet conduits 76 , while the remaining fittings 75 along that channel 70 are coupled to outlet conduits 77 . preferably each cathode member 61 and 62 has an axial extent slightly greater than that of the conductive roller 41 and is provided at each side thereof with an electrically non - conductive retainer plate 79 . more particularly , referring to fig3 and 7 , the retainer plates 79 are fixedly secured , respectively , to the side walls 63 of the associated cathode member 61 or 62 and extend radially inwardly well beyond the working surface 65 . thus , as can be seen in fig7 when the cathode assembly 60 is mounted in place in working relationship with the conductive roller 41 , the retainer plates 79 respectively extend downwardly and overlap the adjacent ends of the conductive roller 41 , providing end walls for the working gap 68 . it can be seen that the ports 72 - 74 are arranged generally in a rectangular matrix configuration comprised of a plurality of rows 80 , aligned respectively with the channels 70 , and a plurality of intersecting columns 81 , the matrix preferably being arranged so that the ports 72 - 74 provide uniform coverage of the working gap 68 . more particularly , in use , a suitable electrolyte fluid 85 , indicated by the arrows 5 in fig6 is introduced from an associated source through the inlet conduits 76 , passes through the associated bores 71 and thence through the ports 72 - 74 into the associated channels 70 and thence to the working gap 68 . preferably , the electrolyte fluid 85 is introduced under substantial pressure , so that it fills the working gap 68 and is disposed in contact with the web 22 and the working surfaces 65 of the cathode assembly 60 over the full lateral and circumferential extent of the working gap 68 . the bulk of the electrolyte fluid 85 then flows upwardly through the ports 72 - 74 associated with the outlet conduits 77 and thence through those outlet conduits 77 to the associated source or a reservoir , as will be explained more fully below . because the working gap 68 must at all times be maintained between the cathode assembly 60 and the web 22 , some of the electrolyte fluid 85 will escape . indeed , because of the high pressure of the electrolyte fluid 85 , it will tend to escape at the open sides and ends of the cathode members 61 and 62 at a relatively high velocity . as will be explained below , fluid escaping the ends of the cathode members 61 and 62 will be directed toward collection means . it will be appreciated that the retainer plates 79 prevent ejection of the electrolyte fluid 85 from the working region 39 in directions axially of the conductive roller 41 . upon striking the retainer plates 79 , the electrolyte fluid will fall downwardly by gravity to an associated collector , as will be explained below . the ends of the channels 70 may be plugged , as at 78 , to prevent fluid from flowing therefrom . referring now to fig9 there is illustrated a hydraulic system 90 for controlling the flow of electrolyte fluid 85 through the ecm cell 40 . the electrolyte fluid 85 may be of any of a number of different types , depending upon the metal being processed . in the case of processing a titanium web 22 , the electrolyte fluid 85 is preferably an 18 % aqueous solution of sodium chloride . the electrolyte fluid 85 is formulated in a make - up chamber 91 provided with a water inlet port 92 and a salt inlet port 93 . electrolyte fluid is pumped from the make - up chamber 91 by a pump 94 to the inlet conduits 76 of the ecm cell 40 . preferably , the pressure of the electrolyte fluid 85 will be in the range of from about 10 atmospheres to about 20 atmospheres across the working surfaces 65 of the cathode assembly 60 . the outlet conduits 77 which receive electrolyte fluid from the working gap 68 carry it to a collection basin 95 disposed beneath the conductive roller 41 , and into which also falls the portion of the electrolyte fluid 85 which drops by gravity from the ecm cell 40 , as indicated by the arrows 96 in fig9 . the electrolyte fluid 85 which leaves the ecm cell 40 carries with it solid material resulting from the machining of the web 22 . this mixture is pumped from the collection basin 95 by a pump 97 to a filter 98 , which removes the solids in the electrolyte fluid 85 . typically , the solid material will be mainly in the form of hydroxides and oxides of the metal machined from the web 22 . the filtered electrolyte is returned to the make - up chamber 91 , while the solids are delivered to a sludge basin 99 for disposal . it will be appreciated that the pump 94 may deliver electrolyte fluid 85 to all of the ecm cells 40 in the ecm section 30 , where more than one such cell is utilized . similarly , it will be appreciated that the collection basin 95 may receive electrolyte fluid 85 from all of the ecm cells 40 in the ecm section 30 . referring now to fig8 there is illustrated a speed control system 100 , for controlling the speed of travel of the web 22 through the ecm cell 40 . the conductive roller 41 is positively driven by an anode motor 101 , which is preferably a variable speed dc motor . the cathode members 61 and 62 of the cathode assembly 60 may , respectively , be coupled to jack screw assemblies 102 and 103 , each of which is provided with a drive motor 104 . the system 100 operates under control of a microprocessor 105 . while two blocks 105 are shown for ease of illustration , it will be appreciated that they may represent a single microprocessor . an additional thickness gauge 106 , which may be the same type as the thickness gauge 55 , may be provided at the input to the ecm cell 40 . the thickness gauges 55 and 106 , are respectively , coupled by conductors 107 and 107a to the microprocessor 105 , which is , in turn , coupled by conductors 108 and 108 ( a ) to the drive motors 104 of the jack screw assemblies 102 and 103 , and by a conductor 109 to the anode 101 . in operation , for a given voltage differential across the working gap 68 , the rate of material removal from the web 22 is determined by the dimension of the working gap 68 , the pressure of the electrolyte fluid 85 and the length of time that any particular part of the web 22 remains in the electrolysis zone of the ecm cell 40 working region 39 . this latter parameter is , in turn , a function of the speed of transport of the web 22 through the ecm cell 40 . the initial thickness measurement of the web 22 from the gauge 106 is fed to the microprocessor 105 which , in turn , controls the setting of the jack screw assemblies 102 and 103 to determine the position of the cathode assembly 60 and , thereby , the dimension of the working gap 68 . the thickness of the web 22 is again measured by the gauge 55 as it leaves the ecm cell 40 . the microprocessor 105 compares this measured thickness with the desired thickness and sends a signal to the anode motor 101 to speed it up or slow it down , as required . when multiple ecm cells are used , it is necessary to drive the web 22 at the same linear speed through each of the ecm cells in order to avoid tension or slack in the web 22 . this can be accomplished by controlling the speed of all of the anode motors 101 by electrical interconnection of the microprocessor 105 of the last ecm cell with the anode motors 101 of the other ecm cells . it will be appreciated that , where multiple ecm cells 40 are utilized in the ecm section 30 , the measurement gauge 55 on the exit side of the ecm cell 40 can also be used to adjust the working gap setting for the next cell , as well as to control the web speed . this gap control feature is particularly useful where the system 20 is run continuously with multiple coils , since the web thickness may vary from coil to coil . referring now to fig1 , there is illustrated an electrolytic control system 110 , for controlling the electrolysis reaction . ac power , such as 3 - phase , 60 hz , 440 volt power , is applied from a suitable source , designated by terminals 111 , to a voltage regulator 112 . the output of the voltage regulator 112 is applied to a dc rectifier 113 which produces dc power at its output in the range of 7 to 25 volts . the output terminals of the dc rectifier 113 are , respectively , connected by the conductors 114 and 115 , to the conductive roller 41 and the cathode assembly 60 . if desired an ammeter 116 may be connected in the conductor 114 . the electrolytic reaction during the machining process consists of the removal of electrons from the web 22 , and supply of these electrons to the cathode members 61 and 62 by the aid of the direct power source . the electrolyte fluid 85 will preferentially electrolyze the water rather than the sodium chloride . the results of the reaction will be hydrogen gas produced at the cathode members 61 and 62 and a titanium hydroxide or titanium oxide produced at the anode ( the web 22 ). the production of hydrogen sould be in the approximate ratio of 1 / 2 mole per mole of titanium metal removed from the web 22 . in normal ecm practice this hydrogen gas is merely vented into the building and allowed to escape through a roof vent . the hydrogen may largely be in the electrolyte fluid removed from the ecm cell 40 , in which case this gas could readily be selectively vented . the spent electrolyte fluid is essentially salt water . in operation , the conductive roller 41 is positively charged . the roller 41 moves the web 22 uniformly past the cathode assembly 60 , as the roller 41 rotates . the charge on the roller 41 is conducted to the web 22 , which is held firmly in contact with the conductive surface 44 of the roller 41 by tension in the web 22 and by the hydraulic pressure of the electrolyte fluid 85 . as indicated above , the thickness gauge 106 measures the thickness of the web 22 as it enters the ecm cell 40 , and in response to this measurement , the microprocessor 105 controls the positioning of the cathode members 61 and 62 for setting the working gap 68 at the desired dimension for the amount of material removal desired . the overall speed of web 22 through the system 20 will be nominally set to provide the desired rate of material removal for the predetermined working gap 68 . the thickness gauge 55 again measures the thickness of the web 22 as it exits the ecm cell 40 , the microprocessor 105 utilizing this measurement to compare the thickness to the predetermined desired finished thickness . if the thickness is too great , the anode motor 101 is controlled to slow down the speed of rotation of the roller 41 , to increase the amount of time that the web remains in the working region 39 and , thereby , the amount of material removed . correspondingly , if the thickness is too small , the speed of rotation of the roller 41 is increased to lessen the amount of material removed . it will be appreciated that the uncoiler motors 25 and the coiler motors 38 will operate at variable speeds so as to provide a uniform flow of web to and from the ecm cell 40 as called for by the speed of rotation of the conductive roller 41 . a significant aspect of the present invention is that the flow of current between the cathode assembly 60 and the web 22 is dependent upon the conductance of the electrolyte fluid 85 , which is inversely proportional to the working gap 68 between the cathode assembly 60 and the web 22 . thus , it will be appreciated that the method and apparatus of the present invention are inherently biased to &# 34 ; flatten &# 34 ; crowned strip material . such crowning , i . e . the web being thicker at the center than at the edges , usually occurs in wide strips due to roll bending . conversely , it will be appreciated that the present invention is inherently biased so as not to attack &# 34 ; thin &# 34 ; spots in the web 22 . another feature of the invention is that the process can be easily controlled with a minimum amount of web in the ecm cell 40 at any one time . furthermore , the process can be stopped without damaging the web 22 to repair equipment or to respond to power failures , and the like , by merely cutting the power supply to the ecm cell 40 . it will be appreciated that the present invention permits accurate maintenance of a very narrow working gap 68 , which permits a high current flow . furthermore , the flow of electrolyte fluid 85 under high pressure through the working gap 68 , in addition to flushing away material removed from the web 22 , gives a scrubbing action to the web 22 which helps prevent pitting . the high current flow and the pressurized flow of electrolyte fluid both contribute to high production rates and uniformity of machining . in the event that only one coil of web material 22 is run at a time , it may be desirable to utilize a lower cost web material , such as carbon steel , and attach it to the web 22 being processed as a leader / trailer . this carbon steel web could be left threaded through the system 20 at the completion of processing of a coil of material , and could be attached to the new coil to get it threaded through the system 20 . this would significantly reduce the manpower costs attendant upon rethreading new coils of material into the system 20 . referring now to fig1 and 12 , there is disclosed an alternative form of cathode member , generally designated by the numeral 120 , which can be substituted for the cathode members 61 and 62 of the cathode assembly 60 . the cathode member 120 is a curved , part - cylindrical member , substantially the same in construction as the cathode members 61 and 62 , except that it additionally includes a plurality of substantially equidistantly , laterally spaced - apart grooves 121 formed in the working surface 65 and extending circumferentially thereof along the entire length thereof . the grooves 121 are of sufficient depth to prevent electrical conduction between the web and the groove area , and preferably have radiused edges at their interface with the working surface 65 . if desired , elongated strips of electrically non - conductive material could be laid in the grooves 121 . it will be appreciated that , in use , the grooves 121 extend parallel to the direction of movement of the web 22 through the ecm cell 40 . because the bottoms of the grooves 121 are spaced farther from the web than the working surface 65 , the current will flow preferentially in the areas covered by the working surface 65 . accordingly , material will not be removed from the web 22 in the areas of the grooves 121 . referring to fig1 , this results in a ribbed web 125 , which is machined to a reduced thickness , as at 126 , over the entire area of the web , except for those regions under the grooves 121 , resulting in longitudinal ribs 127 , which have a thickness corresponding approximately to the original unmachined thickness of the web . the presence of the ribs 122 serves to give the web 125 strength and rigidity which approaches that of the original web before machining , but at a significant reduction in weight . this can be particularly advantageous in combining lengths of the ribbed web 125 to form panels . examples of these panel constructions are illustrated in fig1 - 16 . in fig1 , if it is assumed that the original web 125 was 3 / 16 inch thick , and it is machined to a thickness of 1 / 16 inch at the areas 126 , and if it is further assumed that the ribs 127 are 1 / 8 inch wide and spaced on 2 inch centers , the resulting ribbed web 125 has a weight which is only 38 % of the original weight of the web . if two layers of the web 125 are overlaid with the ribs 127 thereof butting together and diffusion welded , as illustrated in fig1 , there results a panel 130 which has an overall thickness of 3 / 8 inch . the butted ribs 127 form butt joints 131 which act as miniature i - beams , separated by open spaces 132 . the panel 130 has a weight only 38 % of the weight of a solid 3 / 8 inch panel , but has substantially the same strength . another version of panel 135 is illustrated in fig1 , and is formed by overlapping two layers of the ribbed web 125 , with the ribs 127 of one layer disposed in staggered relationship with those of the other layer . there results a 1 / 4 inch panel 135 having open spaces 137 . this arrangement gives greater support to the skin of the panel 135 , at the same spacing of the ribs 127 . another version of panel , generally designated 140 , is illustrated in fig1 . this type of panel is formed by arranging the two layers of web 125 at angles of 90 ° to each other , so that the ribs 127 of the two layers of web 125 crisscross perpendicular to each other . the ribs 127 may be diffusion welded at their intersections , and the lengths of the top layer of web 125 may be butt welded , as at 141 . this results in a checkerboard rib structure which is useful for obtaining rigidity in both longitudinal and lateral directions . it will be appreciated that , depending on the desired application , the grooves 121 in the cathode member 120 may be of any desired width and spaced apart any desired distance , depending upon the particular configuration of ribbed web desired . from the foregoing , it can be seen that there have been provided an improved electrochemical machining method and apparatus for performing same , which permit the continuous electrochemical machining of a metal web , can be readily scaled up to large commercial production sizes , can be easily stopped without damaging the web , require relatively low investment cost and minimal floor space , and permit high production rates , all while permitting the electrochemical machining of metals , such as titanium , which are difficult or impossible to machine by other known techniques .

1Performing Operations; Transporting

a dynamoelectric machine is defined as any apparatus that converts electrical energy between the electrical and the mechanical state by means of an electromagnetic effect . windings are employed in the armature and field of a dynamoelectric machine , and may be held in place by a retaining system incorporating various components ( e . g ., wedges , ripple springs , etc .). fig1 is a perspective end view of an exemplary electric generator 100 . a rotor 102 is transparently represented by dashed lines . a plurality of stator bar windings 104 are positioned in slots 106 defined around an inner circumference of a stator core 108 . in the exemplary embodiment , stator bar windings 104 are formed from a plurality of flat bar conductors or stator bars that are coupled together to form a pre - determined winding path through winding 104 . in one embodiment , the stator bars are fabricated from copper . fig2 illustrates a partial , perspective illustration of a stator core 108 . the stator core 108 has a plurality of slots 106 , generally extending in an axial direction , which contain the windings 210 . as one example , two windings 210 may be contained within each slot 106 . the windings 210 are housed in the lower portion of the slots 106 . various filler strips 220 , slides 230 and wedges 240 may be installed above the windings 210 . fig3 is an enlarged , partial perspective illustration of a stator core , and shows the interrelation between the slots 106 , slides 230 and wedges 240 . the dovetail shaped wedge 240 engages a dovetail groove 315 and a slide 230 is normally driven under the wedge 240 . the stator core 108 may be comprised of many laminations of magnetic steel or iron material . the laminations form groups , and these groups are separated by spacers . the spacers define cooling vent slots 350 , which are generally orthogonal to the slots 106 . the cooling vents 350 between the groups of laminations allow for ventilation and cooling of the stator core . typically , the vent gaps 242 in the wedges 240 are aligned with the cooling vents 350 . fig4 illustrates a simplified , top plan view of one slot 106 filled with body wedges 440 , and end wedges 450 . the total length of the slot l s , is the distance from one end of the slot to the other in an axial direction . the length of the body wedges and the end wedges are l bw and l ew , respectively . in this example , it can be seen that there are eight body wedges 440 of length l bw , and two end wedges 450 of length l ew . the various dimensions vary by specific application , but as one example , the core length or slot length could be l s = 67 . 5 ″. the body wedge length might be l bw = 6 . 75 ″, and the end wedges could also be l ew = 6 . 75 ″. however , it is common for the end wedges 450 to have a different length than the body wedges 440 , and each opposing end wedge may have a different length as well . fig5 illustrates a simplified , top plan view of one slot 106 filled with body wedges 540 , end wedges 550 and a center wedge 560 . a second wedge 570 may also be utilized . however , in some applications the second wedge 570 may be replaced with a body wedge 540 . the total length of the slot l s , is the distance from one end of the slot to the other in the axial direction . the length of the body wedges , end wedges and the center wedge are l bw , l ew and l cw , respectively . the middle spacing distance l ms , is the distance from the end of the slot to the midpoint . in this example , it can be seen that there are eight body wedges 540 of length l bw , two end wedges 550 of length l ew and one center wedge of length l cw . the center wedge 550 can be used for alignment of the vent gaps 242 in body wedges 540 , 240 to the cooling vents 350 ( see fig3 ). the system for determining the number of wedges for a slot in a dynamoelectric machine , according to aspects of the present invention , can be implemented in software ( e . g ., firmware ), hardware , or a combination thereof . in the currently contemplated best mode , the system is implemented in software , as an executable program , and is executed by a special or general purpose digital computer , such as a personal computer ( pc ; ibm - compatible , apple - compatible , or otherwise ), workstation , minicomputer , or mainframe computer . an example of a general purpose computer that can implement the system of the present invention is shown in fig6 . in fig6 , the wedge calculating system is denoted by reference numeral 600 . generally , in terms of hardware architecture , as shown in fig6 , the computer 611 includes a processor 612 , memory 614 , and one or more input and / or output ( i / o ) devices 616 ( or peripherals ) that are communicatively coupled via a local interface 618 . the local interface 618 can be , for example but not limited to , one or more buses or other wired or wireless connections , as is known in the art . the local interface 618 may have additional elements , which are omitted for simplicity , such as controllers , buffers ( caches ), drivers , repeaters , and receivers , to enable communications . further , the local interface may include address , control , and / or data connections to enable appropriate communications among the aforementioned components . the processor 612 is a hardware device for executing software , particularly that stored in memory 614 . the processor 612 can be any custom made or commercially available processor , a central processing unit ( cpu ), an auxiliary processor among several processors associated with the computer 611 , a semiconductor based microprocessor ( in the form of a microchip or chip set ), a macroprocessor , or generally any device for executing software instructions . examples of some suitable commercially available microprocessors are as follows : a pa - risc series microprocessor from hewlett - packard company , an 80 × 86 or pentium series microprocessor from intel corporation , a powerpc microprocessor from ibm , a sparc microprocessor from sun microsystems , inc , or a 68xxx series microprocessor from motorola corporation . the memory 614 can include any one or combination of volatile memory elements ( e . g ., random access memory ( ram , such as dram , sram , sdram , etc .)) and nonvolatile memory elements ( e . g ., rom , hard drive , tape , cdrom , etc .). moreover , the memory 614 may incorporate electronic , magnetic , optical , and / or other types of storage media . note that the memory 614 can have a distributed architecture , where various components are situated remote from one another , but can be accessed by the processor 612 . the software in memory 614 may include one or more separate programs , each of which comprises an ordered listing of executable instructions for implementing logical functions . in the example of fig6 , the software in the memory 614 includes the wedge calculating system 600 in accordance with the present invention and a suitable operating system ( o / s ) 622 . a nonexhaustive list of examples of suitable commercially available operating systems 622 is as follows : ( a ) a windows operating system available from microsoft corporation ; ( b ) a netware operating system available from novell , inc . ; ( c ) a macintosh operating system available from apple computer , inc . ; ( e ) a unix operating system , which is available for purchase from many vendors , such as the hewlett - packard company , sun microsystems , inc ., and at & amp ; t corporation ; ( d ) a linux operating system , which is freeware that is readily available on the internet ; ( e ) a run time vxworks operating system from windriver systems , inc . ; or ( f ) an appliance - based operating system , such as that implemented in handheld computers or personal data assistants ( pdas ) ( e . g ., palmos available from palm computing , inc ., and windows ce available from microsoft corporation ). the operating system 622 essentially controls the execution of other computer programs , such as the wedge calculating system 600 , and provides scheduling , input - output control , file and data management , memory management , and communication control and related services . the wedge calculating system 600 is a source program , executable program ( object code ), script , or any other entity comprising a set of instructions to be performed . when a source program , then the program needs to be translated via a compiler , assembler , interpreter , or the like , which may or may not be included within the memory 614 , so as to operate properly in connection with the o / s 622 . furthermore , the wedge calculating system 600 can be written as ( a ) an object oriented programming language , which has classes of data and methods , or ( b ) a procedure programming language , which has routines , subroutines , and / or functions , for example but not limited to , c , c ++, pascal , basic , fortran , cobol , pert , java , and ada , or ( c ) configured as a spreadsheet having multiple inputs and multiple outputs ; the outputs calculated by predetermined mathematical operations . in the currently contemplated best mode of practicing the invention , the wedge calculating system 600 is configured as a spreadsheet having multiple inputs and multiple outputs ; the outputs calculated by predetermined mathematical operations . the i / o devices 616 may include input devices , for example but not limited to , a keyboard , mouse , scanner , microphone , etc . furthermore , the i / o devices 616 may also include output devices , for example but not limited to , a printer , display , etc . finally , the i / o devices 616 may further include devices that communicate both inputs and outputs , for instance but not limited to , a modulator / demodulator ( modem ; for accessing another device , system , or network ), a radio frequency ( rf ) or other transceiver , a telephonic interface , a bridge , a router , etc . if the computer 611 is a pc , workstation , or the like , the software in the memory 614 may further include a basic input output system ( bios ) ( omitted for simplicity ). the bios is a set of essential software routines that initialize and test hardware at startup , start the o / s 622 , and support the transfer of data among the hardware devices . the bios is stored in rom so that the bios can be executed when the computer 611 is activated . when the computer 611 is in operation , the processor 612 is configured to execute software stored within the memory 614 , to communicate data to and from the memory 614 , and to generally control operations of the computer 611 pursuant to the software . the wedge calculating system 600 and the o / s 622 , in whole or in part , but typically the latter , are read by the processor 612 , perhaps buffered within the processor 612 , and then executed . when the wedge calculating system 600 is implemented in software , as is shown in fig6 , it should be noted that the wedge calculating system 600 can be stored on any computer readable medium for use by or in connection with any computer related system or method . in the context of this document , a computer readable medium is an electronic , magnetic , optical , or other physical device or means that can contain or store a computer program for use by or in connection with a computer related system or method . the wedge calculating system 600 can be embodied in any computer - readable medium for use by or in connection with an instruction execution system , apparatus , or device , such as a computer - based system , processor - containing system , or other system that can fetch the instructions from the instruction execution system , apparatus , or device and execute the instructions . in the context of this document , a “ computer - readable medium ” can be any means that can store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , or device . the computer readable medium can be , for example but not limited to , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , device , or propagation medium . more specific examples ( a nonexhaustive list ) of the computer - readable medium would include the following : an electrical connection ( electronic ) having one or more wires , a portable computer diskette ( magnetic ), a random access memory ( ram ) ( electronic ), a read - only memory ( rom ) ( electronic ), an erasable programmable read - only memory ( eprom , eeprom , or flash memory ) ( electronic ), an optical fiber ( optical ), and a portable compact disc read - only memory ( cdrom ) ( optical ). note that the computer - readable medium could even be paper or another suitable medium upon which the program is printed or stored , as the program can be electronically captured , via for instance optical scanning of the paper or other medium , then compiled , interpreted or otherwise processed in a suitable manner if necessary , and then stored in a computer memory . in an alternative embodiment , where the wedge calculating system 600 is implemented in hardware , the wedge calculating system can be implemented with any or a combination of the following technologies , which are each well known in the art : a discrete logic circuit ( s ) having logic gates for implementing logic functions upon data signals , an application specific integrated circuit ( asic ) having appropriate combinational logic gates , a programmable gate array ( s ) ( pga ), a field programmable gate array ( fpga ), etc . the number of wedges , and their respective lengths , required to fill slot 106 can be determined by the method and system according to aspects of the present invention . the method described below , utilizes a series of nested statements to optimize the wedge design by selecting the longest possible wedge ( or by using the size wedge available ) that will fit evenly in slot 106 . if the only possible solution is a body wedge length of one vent spacing , a center wedge may be added to reduce the quantity of body wedges . table 1 lists the various inputs and outputs of the equations used to calculate the length and quantity of wedges required . for core inputs , n cv is the number of cooling vents 350 present in one slot 106 . the core length , l s , is the length of one slot 106 . the middle spacing , l ms , is the combined length of a punching packet and cooling vent in the center section of the core . the end packet length is l ep and the cooling vent length is l cv . for wedge inputs , e bw is the maximum available body wedge length , and the locking or end wedge length is e lw . wedges can come in multiple lengths , and there may be multiple sizes available for installation . the outputs of the method yield the maximum body wedge length l bw , end wedge lengths l ew1 and l ew2 , total number of body wedges n bw for one slot , and the second wedge lengths , l 2w1 and l 2w2 , if desired . in addition , the various inputs below can be obtained manually or by measuring using physical or electronic devices , and the results may be stored in a medium which can be accessed by the method and system herein described . the first step in the method , according to aspects of the present invention , is to calculate the end spacing , l es . the end spacing is defined as the axial length of the last packet of core laminations plus one half the length of the cooling vent . the end packet length is defined as the axial length of the outboardmost core laminations up to the first cooling vent . the end spacing can be calculated with the following equation : the next step is to calculate the middle spacing , l ms . the middle spacing is defined as the axial length of any one of the packets of core laminations in the middle section of the core plus the length of one cooling vent . the middle spacing can be calculated by the following equation : l ms =(( l s −( 2 * l es ))/( n cv − 1 )) ( equation 2 ) alternatively , the middle spacing could be manually measured using physical or electronic devices . for example , a tape measure could be used to measure the middle spacing . the length of the slot , l s , can also be manually measured using physical or electronic devices . after the middle spacing is determined , the end or locking wedge length and maximum body wedge length can be determined by using equations 3 and 4 , respectively . l ew = rounddown (( e lw − l es )/ l ms )* l ms + l es ( equation 3 ) two types of locking wedges can be accounted for in the method , according to aspects of the present invention . one type of wedge is a mechanical locking wedge , which uses some form of mechanical tab inserted into the core cooling vent to lock the wedge . another type of wedge is a non - mechanical locking wedge , which relies on an adhesive or other retention means , other than physical insertion of a projection into the cooling vent , to lock the wedge . the optimization process or method for each style wedge is illustrated in fig7 and 8 . fig7 illustrates a process 700 to calculate and optimize the number of mechanical - style locking wedges . in step 710 , the end wedge length , l ew1 and l ew2 , can be set equal to the end spacing distance , l es , plus the middle spacing distance , l ms . in step 720 , the second wedge lengths , l 2w1 and l 2w2 , are set equal to the maximum body wedge length , e bw . in step 730 , it is decided if the estimated number of body wedges is an integer value . if the answer is yes , then the process is finished . if the answer is no , then the process continues to step 740 . in step 740 , the second wedge length , l 2w1 , is set equal to the second wedge length , l 2w1 , minus the middle spacing distance , l ms . in step 750 , it is decided if the estimated number of body wedges is an integer value . if the answer is yes , then the process is finished . if the answer is no , then the process continues to step 760 . in step 760 , the second wedge length , l 2w2 . is set equal to the second wedge length , l 2w2 , minus the middle spacing distance , l ms . in step 770 , it is decided if the estimated number of body wedges is an integer value . if the answer is yes , then the process is finished . if the answer is no , then the process loops back to step 740 and repeats . fig8 illustrates a process 800 to calculate and optimize the number of non - mechanical - style locking wedges . in step 810 , the end wedge lengths , l ew1 and l ew2 , are set equal to the end spacing distance , l es . in step 820 , it is decided if the estimated number of body wedges is an integer value . if the answer is yes , then the process is finished . if the answer is no , then the process continues to step 830 . in step 830 , the end wedge length , l ew1 , is set equal to the end wedge length , l ew1 , plus the middle spacing distance , l ms . in step 840 , it is decided if the estimated number of body wedges is an integer value . if the answer is yes , then the process is finished . if the answer is no , then the process continues to step 850 . in step 850 , end wedge length , l ew2 , is set equal to the end wedge length , l ew2 , plus the middle spacing distance , l ms . in step 860 , it is decided if the estimated number of body wedges is an integer value . if the answer is yes , then the process is finished . if the answer is no , then the process loops back to step 830 and repeats . the number of body wedges can now be determined by using equation 5 . in equation 5 , n bw is the total number of body wedges required for one slot , l s is the length of the slot , l ew1 and l ew2 are the lengths of the two end wedges , l 2w1 and l 2w2 are the length of the two second wedges , if required . l bw is the maximum calculated acceptable body wedge length . for non - mechanical style wedges , the values of the two second wedges , l 2w1 and l 2w2 , can be set equal to zero . the above equations illustrate one of many variations of calculating the number and length of body and end wedges required to fill a slot in a dynamoelectric machine . any suitable equation may be substituted , or the order of the calculations may be varied as desired in the specific application . while the invention has been described in terms of various specific embodiments , those skilled in the art will recognize that the invention can be practiced with modification within the spirit and scope of the claims .

7Electricity

a first embodiment of a compressor 1 according to the invention will be described in detail below on the basis of a juxtaposition of fig1 and fig2 . as can be seen from fig1 , the compressor 1 , of which only an outlet connecting pipe 3 can be seen here , has an annular sound absorber 4 which is arranged , as a separate component , on the outer side of the outlet connecting pipe 3 . two chambers 14 , 15 which are divided by radial walls 22 , 23 and 24 are formed in the interior of the sound absorber 4 , which chambers 14 , 15 are connected to the interior of the outlet connecting pipe 3 via two radial connecting ducts 12 , 13 and two connecting ducts 12 ′, 13 ′ arranged opposite the connecting ducts 12 , 13 , and which chambers 14 , 15 serve to generate sound absorption of the gas flow flowing out of the compressor housing ( not illustrated ). a holding device 5 which is arranged on an end side 7 , which points away from the compressor 1 , of the sound absorber 4 has a multiplicity of clips , two of which clips are denoted , as representatives of all of the clips , by the reference numerals 8 and 9 in fig2 . to fasten the sound absorber 4 to the outlet connecting pipe 3 of the compressor 1 , after the walls 22 , 23 , 24 of the two chambers 14 , 15 of the sound absorber 4 have been pushed against three shoulders 3 ′, 3 ″, 3 ′″ which are formed on the outer circumference of the outlet connecting pipe 3 , the clips 8 , 9 are clipped into an encircling holding groove 6 which is formed in the outlet connecting pipe 3 . in each case one seal 19 , 20 and 21 is arranged between the shoulders 3 ′, 3 ″, 3 ′″ of the outlet connecting pipe 3 and the walls 22 , 23 , 24 , in order to seal off the sound absorber 4 with respect to the outside and to separate the two chambers 14 and 15 . fig3 illustrates a further embodiment of a sound absorber 4 ′ of the compressor 1 according to the invention . here , identical components are denoted by the same reference symbols as in the first embodiment of fig1 . as can be seen from fig3 , the outlet connecting pipe 3 of the compressor 1 in this embodiment has , in contrast to the first embodiment , only one shoulder 3 ′″ and no holding device 5 formed on the sound absorber 4 ′, as in the first embodiment of fig1 . in this embodiment , to fasten the sound absorber 4 ′ on the outlet connecting pipe 3 of the compressor 1 , the sound absorber 4 ′ is pushed against the shoulder 3 ′″ of the outlet connecting pipe 3 and is fastened by means of a holding element 10 which is preferably designed as a circlip and engages into a holding groove 11 of the outlet connecting pipe 3 . a seal 17 is arranged between the shoulder 3 ′″ of the outlet connecting pipe 3 and the wall 24 of the sound absorber 4 , and a seal 18 is arranged between the wall 22 and the circlip 10 , in order to seal off the sound absorber 4 ′ to the outside . the above - described embodiments of the sound absorber 4 and 4 ′ are constructed from two annular shell components or half shells 16 , 16 ′ which can be connected to one another , with the perspective , partially cut - away view of fig5 illustrating only the half shell 16 , which is preferably formed as a plastic injection - molded part , of the sound absorber 4 , 4 ′, and the chambers 14 , 15 arranged therein . the two annular half shells 16 , 16 ′ may be differently - shaped components or , for adaptation to an available installation space of the compressor housing 2 , may if necessary have a geometric shape differing from a circular cross section . to simplify assembly , the two half shells 16 , 16 ′ are connected to one another preferably by means of plastic welding , adhesive bonding or by means of clips . it is alternatively also conceivable for a complete sound absorber housing to have more than two components . to complement the disclosure , reference is explicitly made to the diagrammatic illustration of the invention in fig1 to 5 . 22 , 23 , 24 radial walls of the sound absorber

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

a linear actuator according to a first embodiment of the present invention will hereinafter be described with reference to fig1 . a linear actuator of fig1 generally comprises a stator assembly 60 , a rotor assembly 70 , an output shaft 80 , a rear end cap 90 ; a front end protrusion 100 ; and a front end cap 110 . the stator assembly 60 is composed of two stator units 63 , 66 , one 63 of which is structured such that two stator yokes 63 a , 63 b shaped into a ring oppose each other so as to sandwich therebetween a bobbin 62 having a winding 61 provided therearound , and the other 66 of which is structured such that two stator yokes 66 a , 66 b shaped into a ring oppose each other so as to sandwich therebetween a bobbin 65 having a winding 64 provided therearound , and the two stator units 63 , 66 structured as above are coaxially stacked on each other forming a hollow - cylinder looking like a doughnut . the two stator yokes 63 a , 63 b of the stator unit 63 each have an array of pole teeth and are coupled to each other with their respective pole teeth intermeshing with each other . in the same way , the two stator yokes 66 a , 66 b of the stator unit 66 each have an array of pole teeth and are coupled to each other with their respective pole teeth intermeshing with each other . and , respective pole teeth of the two stator units 63 , 66 are appropriately shifted from each other for two - phase driving . the pole teeth constitute the inner circumference of the stator assembly 60 . the windings 61 , 64 are responsible for exciting the respective pole teeth of the stator units 63 , 66 . the stator yokes 63 a , 63 b and 66 a , 66 b , and bobbins 62 , 65 with the windings 61 , 64 are integrally fixed together by means of a yoke support member 67 which is formed of resin by injection - molding . the rotor assembly 70 is housed in the stator assembly 60 . the rotor assembly 70 is composed of a rotor magnet 71 , a resin segment 72 , and a female screw 73 , and is shaped into a hollow - cylinder . the rotor magnet 71 is shaped in a ring , has a plurality of magnetic poles , and constitutes the outer circumference of the rotor assembly thus opposing the pole teeth of the stator assembly 60 with a predetermined gap therebetween . the resin segment 72 is shaped tube - like , and disposed inside the rotor magnet 71 , and the female screw 73 is attached inside the resin segment 72 by means of resin injection - molding . the rear end cap 90 is positioned at a rear end face 60 b of the stator assembly 60 and covers the hollow of the stator assembly 60 . the rear end cap 90 is formed of resin simultaneously and integrally with the yoke support member 67 by resin injection - molding . the rear end cap 90 has a cavity 91 at its inner side facing the rotor assembly 70 . the cavity 91 constitutes a sleeve bearing and supports rotatably a rear end portion 70 b of the rotor assembly 70 . the cavity 91 is not necessarily configured as shown in fig1 but may alternatively be configured so as to receive a ball bearing fitted thereinto for rotatably supporting the rotor assembly 70 . the output shaft 80 is shaped round in its cross section , has a male screw 81 formed at a portion toward a rear end 80 b thereof , has a stopper pin 82 disposed at a portion toward a front end 80 a , and has its rearward portion inserted through the rotor assembly 70 . the male screw 81 engages threadedly with the female screw 73 of the rotor assembly 70 , whereby the output shaft 80 travels in the axial direction linearly without turning or with less than one turn when the rotor assembly 70 rotates . in this connection , the stopper pin 82 prohibits or restricts rotation of the output shaft 80 within one turn . the front end protrusion 100 is shaped into a ring and positioned at a front end face 60 a of the stator assembly 60 . the front end protrusion 100 is formed of resin simultaneously and integrally with the yoke support member 67 and also with the rear end cap 90 by resin injection - molding . the front end protrusion 100 has an inner diameter larger than the inner diameter of the stator assembly 60 , and has a front ball bearing 101 fitted thereinto . a portion of the resin segment 72 of the rotor assembly 70 is fixedly fitted into the inner ring of the front ball bearing 101 , whereby the front end portion of the rotor assembly 70 is rotatably supported . the front end protrusion 100 has a stopper member 103 attached to its frontward portion . the stopper member 103 is shaped into a disk , has a center hole for inserting the output shaft 80 , and has a circular recess formed at its inner side facing the front ball bearing 101 . the recess of the stopper member 103 defines a diameter larger than an outer diameter of the inner ring of the front ball bearing 101 thereby forming a clearance from the inner ring so as not to block the rotation of the rotor assembly 70 . in the structure described above , the output shaft 80 is caused to stop its rearward movement when the stopper pin 82 of the output shaft 80 touches the stopper member 103 . the front end cap 110 is attached by means of a metal fitting 114 to the front end face 60 a of the stator assembly 60 so as to cover the hollow of the stator assembly 60 housing the rotor assembly 70 . the front end cap 110 has a round center hole 111 , and the output shaft 80 is inserted through the center hole 111 so as to have its front end portion ( toward the front end 80 a ) sticking out from the front end cap 110 . the front end cap 110 has a groove 112 extending parallel to the length of the output shaft 80 . the aforementioned stopper pin 82 is lodged in and guided by the groove 112 so as to prohibit or restrict rotation of the output shaft 80 and to restrict the travel distance of the output shaft 80 . the actuation of the linear actuator of fig1 will be discussed . current is caused to flow in the windings 61 , 64 so as to excite the respective pole teeth of the stator units 63 , 66 , whereby the rotor assembly 70 is caused to rotate due to magnetism from the rotor magnet 71 . when the rotor assembly 70 rotates , the output shaft 80 is caused to move in the axial direction by means of the female screw 73 of the rotor assembly 70 threadedly engaging with the male screw 81 of the output shaft 80 . in this connection , the stopper pin 82 moves along the groove 112 while prohibiting or restricting the rotation of the output shaft 80 . the stopper pin 82 moves rearward together with the output shaft 80 moving rearward , and the output shaft 80 stops its movement when the stopper pin 82 touches the stopper member 103 . as described above , the linear actuator according to the first embodiment of the present invention includes the stopper member 103 , and the output shaft 80 is caused to stop its rearward movement when the stopper pin 82 touches the stopper member 103 . thus , the female screw 73 does not touch the proximal end portion of the male screw 81 therefore eliminating the aforementioned screw biting problem , and the stopper pin 82 does not touch any portion of the rotor assembly 70 or the inner ring of the front ball bearing 101 therefore not requiring any extra torque for restarting the rotation of the rotor assembly 70 . also , the stopper member 103 does not have any pointed portion therefore exhibiting little wear and keeping off damage , eventually resulting in a stable and accurate positioning control of the output shaft 80 . a linear actuator according to a second embodiment of the present invention will be described with reference to fig2 . in fig2 , like reference numerals refer to like elements in fig1 . the linear actuator according to the second embodiment differs from the first embodiment principally in bearing type , and in stopper member structure . specifically , in the first embodiment , the front and rear end portions of the rotor assembly 70 are rotatably supported respectively by the ball bearing 101 and the cavity 91 constituting a sleeve bearing , and the stopper member 103 is attached to the front end protrusion 100 . on the other hand , in the second embodiment , the front and rear end portions of a rotor assembly are rotatably supported respectively by a sleeve bearing and a ball bearing ( reversed compared with the first embodiment ), and a stopper member is constituted by a portion of the sleeve bearing which rotatably supports the front end portion of the rotor assembly . the linear actuator according to the second embodiment shown in fig2 basically comprises a stator assembly 60 , a rotor assembly 70 , and an output shaft 80 , which are of the same structure as the first embodiment shown in fig1 . a rear end cap 120 is disposed at a rear end face 60 b of the stator assembly 60 so as to cover the hollow of the stator assembly 60 . the rear end cap 120 is formed of resin integrally with a yoke support member 67 by injection - molding , and has a cavity 121 at its inner side facing the rotor assembly 70 . the cavity 121 has a circular recess formed coaxially therewith , and a rear ball bearing 122 to rotatably support a rear end 70 b of the rotor assembly 70 is fitted into the recess . a front end cap 130 is attached at a front end face 60 a of the stator assembly 60 so as to cover the hollow of the stator assembly 60 housing the rotor assembly 70 . the front end cap 130 defines a cavity at its inner side facing the rotor assembly 70 , and has a round center hole 131 . a sleeve bearing 140 is fitted into the cavity of the front end cap 130 and supports rotatably a front end portion 70 a of the rotor assembly 70 , and the output shaft 80 is inserted through the center hole 131 so as to have its front end portion ( toward a front end 80 a ) sticking out from the front end cap 130 . the output shaft 80 is movably inserted through the sleeve bearing 140 . the sleeve bearing 140 has a groove 141 formed at its inner circumference so as to extend parallel to the length of the output shaft 80 . a frontward end of the groove 141 is open , and the other end is blind so as to constitute a stopper member 142 . a stopper pin 82 is lodged in and guided by the groove 141 thereby controlling the movement of the output shaft 80 . a front plate 150 may be attached as required . the linear actuator structured above actuates basically in the same way as the linear actuator of the first embodiment . the output shaft 80 moves linearly when the rotor assembly 70 rotates . the stopper pin 82 fixedly disposed at the output shaft 80 also moves linearly along the groove 141 while prohibiting or restricting the rotation of the output shaft 80 . when the output shaft 80 moves rearward , the stopper pin 82 moves also rearward , and the output shaft 80 stops its movement upon the stopper pin 82 touching the stopper member 142 . as described above , the linear actuator according to the second embodiment of the present invention includes the stopper member 142 , and the rotor assembly 70 is caused to stop its linear movement when the stopper pin 82 touches the stopper member 142 . thus , the female screw 73 does not touch the proximal end portion of the male screw 81 therefore eliminating the aforementioned screw biting problem , and the stopper pin 82 does not touch any portion of the rotor assembly 70 therefore not requiring any extra torque for duly restarting the rotation of the rotor assembly 70 . also , the stopper member 142 does not have any pointed portion therefore exhibiting little wear and keeping from damage , eventually resulting in a stable and accurate positioning control of the output shaft 80 . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes that come within the meaning and range of equivalency of the claims are to be embraced within their scope . this application is based on japanese patent application no . 2003 - 50097 filed on feb . 26 , 2003 and including specification , claims , drawings and summary . the disclosure of the above japanese patent application is incorporated herein by reference in its entirety .

7Electricity

referring now to the drawings and , more particularly , to fig1 , an optical fiber sensor in accordance with a first embodiment is generally shown at 10 . the optical fiber sensor 10 is an optical fiber having a cladding 11 , a central core 12 , and peripheral cores 13 and 14 . the cladding 11 has a generally circular section , but has a flat edge , defining a flat surface 15 on the full length of the cladding 11 . the cladding 11 is made of a material having an effective index of refraction smaller than that of the cores 12 , 13 and 14 . the central core 12 is generally centrally positioned within the cladding 11 , as is visible in fig1 . the peripheral cores 13 and 14 are respectively spaced apart from the central core 12 by distances a and b . in the first embodiment of fig1 and 2 , the central core 12 and the peripheral core 13 lie in a first neutral plane n x generally parallel to the flat surface 15 . the central core 12 and the peripheral core 14 lie in a second neutral plane n y generally perpendicular to the flat surface 15 . the central core 12 is therefore at the intersection of the first and second neutral planes . referring to fig2 , the optical fiber sensor 10 is shown having sets of bragg gratings in the cores 12 , 13 and 14 . more specifically , the central core 12 has gratings 20 , 21 , 22 , etc . the peripheral core 13 has gratings 30 , 31 , 32 , etc . the peripheral core 14 has gratings 40 , 41 , 42 , etc . for illustrative purposes , only a portion of the optical fiber sensor 10 is illustrated , as the optical fiber sensor 10 typically has a plurality of other bragg gratings . the gratings are regrouped by sets of longitudinally aligned gratings , namely a first set of gratings 20 , 30 and 40 at location l 1 along the fiber , a second set of gratings 21 , 31 , and 41 , at a location l 2 along the fiber , etc . each set of gratings represents a point of detection in a known location along the optical fiber sensor 10 . the optical fiber sensor 10 is provided with the flat surface 15 so as to be installed in a predetermined way ( i . e ., known position and orientation ) on a body whose curvature must be detected . the optical fiber sensor 10 is typically associated with a support that will be secured to the body , and the predetermined way by which the optical fiber sensor 10 will be secured to the body through the support will enable to reference the two axes of curvature ( illustrated as axis x and axis y in fig1 ) about which curvature can be measured . moreover , in the first embodiment , the optical fiber sensor 10 is secured to the support in such a way that the optical fiber sensor 10 is prevented from being elongated or stretched . bragg gratings are generally sensitive to elongation or compression that might result from bending or strain and from temperature variations . referring to fig3 , a graph 50 illustrates the reflectivity spectrum of the bragg grating as a function of the wavelength of light reflected by the bragg grating , although a similar graph would have been obtained by capturing the light transmitted by the bragg grating . from an initial position 51 , a compression ( for instance , resulting from a temperature decrease ) of the bragg grating results in a decrease of the bragg wavelength , as illustrated as position 52 . on the other hand , an elongation ( for instance , from a temperature increase ) of the bragg grating results in an increase of the bragg wavelength , as illustrated at position 53 . the central core 12 is neutrally positioned within the optical fiber sensor 10 and its support so as not to be sensitive to bending . more specifically , the central core 12 lies in the first neutral plane n x , so as to not be sensitive to bending about the x - axis . similarly , the central core 12 lies in the second neutral plane n y , so as not to be sensitive to bending about the y - axis . in the preferred embodiment , the peripheral core 13 lies in the first neutral plane n x , and is therefore not sensitive to bending about the x - axis ( sensitive only to bending about the y - axis ), whereas the peripheral core 14 lies in the second neutral plane n y , so as not to be sensitive to bending about the y - axis ( sensitive only to bending about the x - axis ). the optical fiber cross - section temperature at a specific location should be almost uniform . this implies that all gratings at a known location will have the same temperature , such that the gratings in all cores will have the same bragg wavelength shift at that known location . accordingly , the combination of the central core 12 with the peripheral cores 13 and 14 enables to separate bending - induced wavelength shifts from temperature - induced wavelength shifts in the bragg gratings . hence , the optical fiber sensor 10 enables to measure the curvature of a body independently of the effect of temperature on the optical fiber sensor 10 . referring to fig4 , an optical fiber sensor in accordance with a second embodiment is generally shown at 10 ′. the optical fiber sensor 10 ′ is generally similar to the optical fiber sensor 10 ( fig1 ), in that it has a cladding 11 , a central core 12 , and peripheral cores 13 and 14 . the optical fiber sensor 10 ′ additionally has peripheral cores 13 ′ and 14 ′, diametrically opposed to the peripheral cores 13 and 14 , respectively . the peripheral cores 13 ′ and 14 ′ are provided to increase the sensitivity of the optical fiber sensor 10 ′. more specifically , the longitudinally aligned sets of gratings of the peripheral cores 13 ′ and 14 ′ are respectively combined with that of the peripheral cores 13 and 14 , to provide two gratings per axis of curvature ( e . g ., axes x and y of fig1 ). for example , when the grating in the peripheral core 13 is compressed , the corresponding grating in the peripheral core 13 ′ is elongated , giving twice the total spectral shift , in opposite directions , of this bragg gratings set compared to the central core and the peripheral core 13 bragg gratings set . referring to fig5 a to 5c , the optical fiber sensor 10 ′ is shown as being bent in a first direction about a first axis in fig5 a , and in a second direction about the first axis in fig5 c , while the optical fiber sensor 10 ′ in fig5 b is not bent . it is therefore seen in fig5 a that the gratings 30 and 30 ′ ( respectively of the peripheral cores 13 and 13 ′) undergo compressive and tensile strains , respectively , whereas in fig5 c the gratings 40 and 40 ′ ( respectively of the peripheral cores 14 and 14 ′) undergo tensile and compressive strains , respectively , while the centrally - positioned grating 20 generally remains unstrained . in fact , due to the central position of the core 12 , the grating 20 and any other grating in the central core 12 only undergo strains ( within the operative curvature range of the sensors 10 and 10 ′) caused by temperature . as all gratings of a same set are generally subjected to the same temperature , the strain induced by bending can be isolated from the strain induced by temperature by relating the gratings of the central core 12 to the gratings of the peripheral cores 13 , 13 ′, 14 and / or 14 ′. referring to fig6 , an optical fiber sensor system in accordance with the first and second embodiments is generally shown at 100 . the optical fiber sensor system 100 has one of the optical fiber sensor 10 / 10 ′/ 10 ″ ( with optical fiber sensor 10 ″ being described hereinafter for fig7 ) secured to a support 101 in a predetermined way ( i . e ., known position and orientation ), in which the optical fiber sensor 10 / 10 ′/ 10 ″ is oriented for curvature measurement about two reference axes ( fig1 and 2 ). a light source 102 is provided with coupling optics 104 so as to multiplex light signals into the optical fiber sensor 10 / 10 ′/ 10 ″. therefore , light from the light source 102 is coupled to the central core 12 , and the peripheral cores 13 , 13 ′, 14 and / or 14 ′. as the optical fiber sensor 10 / 10 ′/ 10 ″ is mounted to a body by way of the support 101 , movements in the body will cause strain in the bragg gratings of the peripheral cores 13 , 13 ′, 14 and / or 14 ′. accordingly , bragg wavelength shifts can be determined in order to qualify ( compressive or tensile strain ) and quantify ( angular value ) the curvature . in order to couple the light source 102 to the optical fiber sensor 10 / 10 ′/ 10 ″ via the coupling optics 104 , a first approach known in the art provides a multicore - to - single - core fiber fan - out to feed each core of the multicore fiber independently . in such an arrangement for the coupling optics 104 , the diameters of four single - core single - mode fibers are reduced using hydrofluoric acid . the fibers are then arranged in a square shape to match the core spacing of the optical fiber sensor 10 / 10 ′/ 10 ″. the fiber 10 / 10 ′/ 10 ″ is then connected to the fan - out by an adhesive bonded splice . in one embodiment of the coupling optics 104 , the fan - out arrangement includes five fibers , with one in the middle surrounded by four other fibers arranged in square shape in order to match the core distribution of the configuration of fig4 of the fiber 10 / 10 ′/ 10 ″. an efficient coupling is assured by reducing the fibers &# 39 ; cladding until the fiber core distances are matched . in a second approach , as indicated in the us publication no . us 2004 / 0234218 , a refractive plano - concave lens is used to couple and extract the light from free - space beams . the light beams from different cores of the multicore fiber are separated in different directions by the plano - concave lens . of course , the same configuration can be used to couple separated light beams into the fiber 10 / 10 ′/ 10 ″. at the outlet end of the optical fiber sensor 10 / 10 ′/ 10 ″, the optical fiber sensor 10 / 10 ′/ 10 ″ is coupled to a light analyzer so as to receive the transmitted light signals in an embodiment in which transmitted light signals are analyzed . it is , of course , considered to analyze reflected light signals in an alternative embodiment . the light analyzer 106 is typically an optical spectrum analyzer measuring shifts in the bragg wavelengths . a processor 108 associated with the light analyzer 106 performs the calculation of curvatures along the two axes of reference ( e . g ., axes x and y in fig1 ), as a function of the shift magnitude in bragg wavelengths as provided by the light analyzer 106 . the bragg wavelength readings obtained from the bragg gratings of the central core 12 are used to factor out the effect of temperature on the optical fiber sensor 10 / 10 ′/ 10 ″. hence , the processor 108 provides curvature magnitude and orientation over time , for instance in the form of angular values with respect to reference axes such as axes x and y . according to a first configuration , the bragg wavelengths of each bragg grating are different . this simplifies the detection of the wavelengths for the subsequent analysis of the results by both the light analyzer 106 and the processor 108 as each transmitted ( or reflected ) wavelength is directly associated with a specific bragg grating and location in a specific core . the variation of bragg wavelength of the bragg gratings of the central core 12 will be used to determine the effect of temperature on the optical fiber sensor 10 / 10 ′/ 10 ″. according to a second configuration , the bragg wavelengths at each location ( e . g ., l 1 , l 2 , etc ., of fig2 ) of the optical fiber sensor 10 are the same for an uncurved optical fiber sensor 10 at that given location . the light analyzer 106 must receive the transmitted ( or reflected ) light signals from each core of the optical fiber sensor 10 / 10 ′/ 10 ″ separately . the bragg gratings are then identified as a function of the wavelengths detected and the selected core . the processor 108 will read the bragg wavelengths provided by the optical analyzer 106 , and will determine shifts of the bragg wavelengths , whereby curvature is calculable with respect to the reference axes ( i . e ., axes x and y of fig1 ). the reading of the bragg wavelengths and calculation of curvature by the processor 108 is optionally performed over time . the support 101 is defined as a function of the type of body / structure upon which the optical fiber sensor 10 / 10 ′/ 10 ″ will be installed for curvature measurement . for instance , in one contemplated use of the optical fiber system 100 , the optical fiber sensor 10 / 10 ′/ 10 ″ is used to calculate curvature on various parts of the human body ( e . g ., back , spine , or the like ). therefore , the support 101 is some clothing that will marry the shape of the body part , and keep the optical fiber sensor 10 / 10 ′/ 10 ″ in the predetermined orientation . as examples of suitable clothing are undershirts , tights , gloves , arm and leg sleeves , and the like . accordingly , the flat surface 15 ( or flat surfaces 15 and 15 ′ as will be described hereinafter for fig7 ) represent one configuration , among other connection configurations , by which the orientation of the optical fiber sensor 10 / 10 ′/ 10 ″ can be maintained throughout the use of the optical fiber sensor system 100 . the flat surface 15 is machined into a glass ( or polymeric ) preform which will be melted and drawn to get an optical fiber . therefore this technique represents an efficient solution for a quick and precise axes orientation determination . alternatively , connection holes , peripheral depressions or the like can be used to connect the optical fiber sensor 10 / 10 ′/ 10 ″ to a body in a connection configuration . in accordance with the contemplated use of the optical fiber sensor system 100 , a calibration is typically performed at a constant temperature to obtain an initial position and orientation of the optical fiber sensor 10 / 10 ′/ 10 ″ with the body whose curvature is to be detected . for instance , it is contemplated to perform a calibration of the initial value of bragg wavelengths of each grating with respect to the body , such that a given curvature at a specific location of the optical fiber sensor 10 / 10 ′/ 10 ″ is associated with a position on the body . in the embodiments of fig1 - 2 and 45 , the peripheral cores 13 , 13 ′, 14 and / or 14 ′ are positioned to provide curvature about the axes x and y . more specifically , strain sustained by the peripheral cores 13 / 13 ′ will represent curvature about the y - axis ( normal to the plane of the body at the location of the set of gratings ), whereas strain sustained by the peripheral cores 14 / 14 ′ will represent curvature about the x - axis ( parallel to the plane of the body at the location of the set of gratings ). it is pointed out that other positions are contemplated for the peripheral cores 13 , 13 ′, 14 and 14 ′, within the cladding 11 , and with respect to the connection configuration ( i . e ., the flat surface 15 ). moreover , the distances a and b between the central core 12 and the peripheral cores 13 and 14 ( fig1 ) can be adjusted at the design time , as a function of the required sensitivity and the flexibility of the optical fiber sensor 10 / 10 ′/ 10 ″. greater distances a and b ( and thus greater diameter of the fiber 10 / 10 ′/ 10 ″) will result in increased sensitivity of the sensor and decreases flexibility of the fiber , and vice - versa . although the optical fiber sensor 10 / 10 ′/ 10 ″ is illustrated as being generally circular , it is pointed out that the other cross - section shapes ( square , rectangular , trapezoidal , etc . . . ) are considered for the optical fiber sensors 10 / 10 ′/ 10 ″. moreover , curvature detection can be performed about a single axis , such as axis x ( fig1 ). in such a case , only one peripheral core is necessary , such as peripheral core 14 for curvature measurement about the x - axis . referring to fig7 , an optical fiber sensor in accordance with a third embodiment is generally shown at 10 ″ the optical fiber sensor 10 ″ is similar to the optical fiber sensor 10 ′ of fig4 , whereby like reference numerals will designate like elements . the cladding 11 of the optical fiber sensor 10 ″ has a generally circular section , but with a pair of flat edges , defining flat surfaces 15 and 15 ′ on the full length of the cladding 11 . advantageously , the fiber sensor 10 ″ is symmetrical along both the x - and y - axes . the planes of symmetry are therefore coplanar with the first neutral plane n x and the second neutral plane n y . the presence of a pair of flat surfaces 15 and 15 ′ facilitates the securing of the optical fiber sensor 10 ″ in a desired orientation , and ensures that the central core 12 is n the neutral planes for both axes . amongst contemplated uses for the optical fiber sensors 10 / 10 ′/ 10 ″ and the optical fiber sensor system 100 are posture detection ( e . g ., health clubs ) and posture correction , ergonomic studies , physical rehabilitation . other uses are virtual - reality movement detection , computer animation ( e . g ., reproduction of body movements ), air - bag deployment control , movement - detecting prosthesis , auto - adjusting seating devices . other uses are contemplated , whereby the list of above - described uses is non - exclusive .

6Physics

a buffer may suitably be prepared at ph ranging from 5 . 0 to 10 . 0 . at ph more acidic than this range , stability of fviia and / or fx in the solution will be impaired wherein fviia and / or fx are gradually inactivated . at ph more basic than this range , stability of fviia and / or fx in the solution is also not sufficient and hence the proteins are inactivated gradually . at ph 6 . 5 to 10 . 0 , however , the substrate fx is converted into fxa by fviia . therefore , ph ranging from 5 . 0 to 6 . 5 , preferably from 5 . 4 to 6 . 1 , may be used , by which there is no concern about impairment of the activity of each component or conversion from fx into exa . fviia and fx for use in the present invention may be prepared by any known methods , for example , by isolating from human blood or by the genetic recombination technique . fviia may be prepared from blood by the known methods including those disclosed in e . g . japanese patent publication no . 155797 / 1991 , japanese patent publication no . 059866 / 1998 and japanese patent - publication no . 059867 / 1998 . alternatively , fviia may be prepared by applying cryo - poor plasma , which is prepared by cool - thawing human fresh frozen plasma and removing cryoprecipitate by centrifugation , to anion exchange chromatography to give crude fvii , which is then purified by affinity column chromatography with immobilized anti - fvii monoclonal antibody , followed by activation of fvii with other plasma proteins such as activated blood coagulation factor xii , or exa . to ensure safety , the resulting fviia may preferably be contaminated with as little prothrombin , thrombin , fix and fixa as possible . fx may be prepared from blood by applying cryo - poor plasma , which is prepared by cool - thawing human fresh frozen plasma and removing cryoprecipitate by centrifugation , to anion exchange chromatography to give crude fx , which is then purified by affinity column chromatography with immobilized anti - fx monoclonal antibody . like in case of fviia , to ensure safety , the resulting fx may preferably be contaminated with as little prothrombin , thrombin , fix and fixa as possible . the liquid composition of the present invention may suitably comprise fviia at 1 to 20 μm and fx at 5 to 400 μm . in a preferable embodiment , the liquid composition of the present invention may additionally comprise 0 . 001 to 1 % by weight non - ionic surfactant , and not less than 0 . 01 % by weight of one or more compounds selected from the group consisting of albumin , sugars and amino acids , to thereby allow for storage stability of the composition as well as to facilitate dissolution at reconstitution in case that said liquid composition is lyophilized . the composition or the hemostatic preparation of the present invention may be administered to any patients who suffer from various hemostatic disorders and demonstrate hemorrhagic inclination . the present invention provides a novel hemostatic preparation with improved safety , efficacy and facility . the present invention is explained in more detail by means of the following examples which are not intended to restrict the scope of the present invention in any sense . in order to investigate stability of a fviia / fx mixture in a buffer solution , 0 . 4 mg / ml fviia and 1 . 0 mg / ml fx were mixed together in a buffer solution ( mes buffer in the absence of cacl 2 : 100 mm mes , 100 mm nacl ) at specified ph and the mixture was incubated at 37 ° c . the activity of each fviia , fx and fxa in a sample was measured at each specified time in a system where any of these factors does not affect to each other . fviia used herein was a blood - derived product prepared as described in japanese patent publication no . 155797 / 1991 . as a result , both fviia and fx retained more than 90 % activity after incubation for 24 hours at every ph values of the buffer tested . a content of fxa was calculated on the basis of its specific hydrolytic activity to a synthetic substrate ( s2222 ) and a molar ratio of the content to fx is shown in fig2 . no increase in a content of fxa was observed in the buffer at ph 5 . 6 and 6 . 0 while drastic increase in a content of fxa was detected in the buffer at ph 7 . 0 and 8 . 0 . in order to investigate stability of a fviia / fx mixture in a buffer solution after lyophilization , 0 . 4 mg / ml fviia and 1 . 0 mg / ml fx were mixed together in a buffer solution [ citrate buffer in the absence of cacl 2 : 10 mm sodium citrate , 120 mm nacl , 0 . 5 % glycine , 2 % albumin , and 50 ppm tween ® 80 ( polysorbate 80 )] at specified ph to prepare a bulk , which was lyophilized . as in example 1 , fviia used herein was a blood - derived product prepared as described in japanese patent publication no . 155797 / 1991 . the activity of each factor was measured before and after lyophilization as described in example 1 and the content of fxa is shown in fig3 . as a result , both fviia and fx retained more than 80 % activity before and after lyophilization at every ph value of the buffer tested . no increase in a content of fxa was observed in the buffer at ph 5 . 5 and 6 . 0 while drastic increase in a content of fxa was detected in the buffer at ph 7 . 0 .

0Human Necessities

as indicated above testing of components such as elongate members is generally a question of applying test loadings up to expected practical impact loadings during a test methodology . in such circumstances providing a stress field of varying conditions in a composite panel that is representative of a soft body impact loading on a rotating aerofoil or similar elongate member would be desirable . in such circumstances achieving loading and deflections to achieve a superimposition of threshold and pressure loading upon a composite specimen and which allows reverse bending of the specimen would be advantageous . in such circumstances impacts would effectively be upon a fixed displacement type loading irrespective of specimen mounting stiffness . in the above circumstances it will be appreciated that the resultant stress state is desirably at a representative level of bending stress in the plane of the component in the form of an elongate member or plate or other configuration such as a beam , box section or curved element as a test specimen and provides shear stress in the form of interlaminar stress . in such circumstances by appropriate choice of testing regime stress loading will be representative of practical conditions for the component . by such an approach it will be possible to model stressing of the component using finite element analysis as the boundary conditions will be more easily described . such analysis will be significantly easier than with regard to prior clamped restraint type testing methodology and apparatus . ideally , methods of presenting the component as a test specimen should avoid localised stresses which may result in unrepresentative failure of the specimen . it will also be understood that test methodology in apparatus should generally be simple and cheap and able to provide several tests in an acceptable period of time . furthermore , elongate members used as test components or specimens in the apparatus should also be relatively easy to produce and cheap to manufacture . as indicated the test components can be elongate , square panels , beams or box sections provided they give the necessary representation form . the test apparatus and method provided by the invention is particularly adapted to testing components in the form of elongate members as specimens . the components are typically formed from composite materials but may also be made of laminated metals or jointed components . fig1 provides a schematic illustration of a test apparatus 1 in accordance with a first aspect of the present invention . the apparatus 1 in use comprises a component 2 securely associated with end mountings 3 . the component 2 as indicated is typically a composite material and extends into slots or other couplings within the mountings 3 . the mountings 3 are generally heavy features in order to combine with the component 2 in order to define inertia for the apparatus 1 in a test mode . typically , each mounting end 3 will have a mass in the order of 0 . 3 to 3 kg . the component as indicated generally is an elongate member which extends between the mounting ends 3 and will have a set test size . this size may be in the order 200 mm long by 20 mm wide by 3 mm in depth but it will be appreciated that the size of the elongate member 2 may be varied within test ranges in order to appropriately test the elongate member 2 as a specimen . as with any test apparatus or test method regime , the elongate member 2 may be specifically configured to make desired specific analytical testing or a like for like standard elongate member 2 dimensions specified for comparing materials from which the respective elongate members are formed . in such circumstances the end members 3 may be matched with the elongate member 2 in order to achieve the desired inertia combination for comparison or otherwise . the mounting ends 3 are suspended such that as indicated the inertia of these ends 3 along with the component 2 is utilised with respect to an impact provided by a projectile 4 arranged to impact on the elongate member 2 . typically this impact is central along the component 2 . the projectile 4 has a relatively facile compliance relationship under impact with the elongate member 2 . such as a compliant relationship may be preferably achieved by having a soft projectile impacting upon a harder component or vice versa with a harder projectile impacting on a flexible soft component structure . in such circumstances the projectile 4 will deform and typically disintegrate , disperse or otherwise comply once a high impact load has been applied to the component 2 . the projectile 4 is typically a cylindrical shape although other shapes could be utilised . in order to be relatively facile in compliance under impact with the elongate member 2 the projectile 4 would typically be formed from gelatine or a similar material such as an uncured foam , gel , or a membrane encapsulating a fluid or gel or cellular metal or cellular polymer etc . furthermore , the projectile may be made up of pebbles or run - away gravel which applies the initial high pressure pulse before dispersion . as indicated these specific test conditions are provided for a particular component or standardised test conditions and parameters may be specified for component comparison . furthermore , impacts upon the test component are generally perpendicular although alternative angles may be useful to investigate other failure modes . as indicated above the end mountings 3 are typically suspended . such suspension is advantageously achieved through vertical cables as depicted in fig2 which extend down to present the mounting ends 3 and the component 2 . the cables 5 will generally as indicated suspend the component 2 in a frame or cradle such that the projectile 4 is appropriately presented to the component 2 . as can be seen in fig2 the projectile 4 has a typical cylindrical shape although other shapes could be used . the depiction in fig2 is just prior to impact by the projectile 4 upon the component 2 and therefore it will be seen that the component 2 is substantially straight or has the shape dictated by the test methodology . the projectile 4 as indicated is compliant but defines a mass which will be propelled towards the component 2 . typically the projectile 4 will be propelled at around a 100 meters per second in order to generate appropriate impact load upon the component 2 . as indicated above impact will normally be perpendicular and initially generate a high pressure load pulse . this load pulse then decays to a stabilised pressure as the projectile flows due to elasticity or disintegrates . the projectile 4 as indicated will be relatively facile and compliant upon impact with component 2 . as the projectile 4 has mass typically in the order of 10 to 30 grams and preferably around 20 grams deflection and distortion of the component 2 will occur against the suspended inertia defined by the end mountings 3 and component 2 . the facile impact created by the gelatine or similar nature of the material from which the projectile 4 is formed results in “ soft ” contact with the component 2 . this induces interlaminar stress within the component 2 without unrepresentative localised damage which may occur if a large hard impact projectile is used unless the test component 2 is soft and compliant and gives the deserved impact relationship . fig3 illustrates the apparatus 1 in mid impact . thus , as can be seen the projectile 4 has become compliant and spread upon impact with component 2 . this causes a three - point bend operation resulting in a load upon the component 2 . restraint is created by the inertia of the combination of the ends 3 and the elongate member 2 . this allows easy modelling of the loading upon the component 2 as it avoids localised bending stress at the point of contact by the projectile 4 . the mass of the combination of the component 2 and the ends 3 results in deflection being dominated by the inertia of the combination rather than the stiffness of the component specimen which was a problem with prior fixed or clamped arrangements where the test specimen was securely fixed and clamped . as indicated the mass of the combination of the component 2 and the ends 3 dominates in the flexure response hence the combination will generally move very little in space . it will be appreciated that the matching of the projectile 4 mass with the inertia mass of the combination of the ends 3 and component 2 should be carefully chosen such that as indicated there is very little displacement in space . it will be understood that the suspension mechanism depends upon such stabilised displacement and allows the use of a cable support method . if there was significant displacement this would introduce restraint possibly creating erroneous results . ideally the cables 5 will simply hang during an impact regime with flexing and deflection of the component 2 , accommodating the impact load provided by the projectile 4 . the cables 5 will be suspended in order to present the ends 3 and component 2 to minimise rotational inertia and ensure minimal localised bending stress where the specimen is clamped in the ends 3 . in the above circumstances it will be appreciated that the strain rates achieved are typically due to the dimensions of the component 2 and the rate of impact loading provided by the projectile 4 . in the above circumstances a method is provided in which a component 2 is effectively loaded and coupled to ends 3 which are suspended upon the cables 5 . the elongate member 2 is then subject to an impact load from a soft projectile 4 and deflection of the component 2 monitored against time to give a characteristic response . it will be understood that dependent upon the degree of damage sustained typically some impact energy will be stored within the component 2 and consequently the component 2 will respond by reverse flexural bending and loading . fig4 through to fig8 illustrate this deformation response of the component 2 . in fig4 the apparatus 1 is depicted just after the projectile disintegrates subsequent to full impact with the component 2 . in such circumstances it can be seen the component 2 has at least partially deformed and bent . in fig5 the apparatus 1 subsequent to the configuration as depicted in fig4 is shown in schematic form . as can be seen the component 2 has continued to bend as a result of impact loading and inertia effects in the apparatus 1 . the degree and maximum extent of bending of the component 2 will be a characteristic of the material and dimensions of the component 2 . fig6 illustrates the apparatus 1 showing initial reverse bending of the component 2 as a result of stored “ elastic ” strain energy within the component 2 released by the suspension of the ends 3 upon the cables 5 . fig7 illustrates further reverse bending of the component 2 as result of elastic energy within the component 2 . fig8 illustrates the furthest extent of reverse bending as a result of elastic energy within the component 2 built up as a result of impact with the projectile 4 ( not shown ). it will be noted through the deformation stages depicted from fig2 to fig8 that the component 2 is deflected over time by the impact loads presented by the projectile 4 . fig9 provides a graphic illustration of deflection in respect of an aperture . as can be seen a curve a illustrates deflection by a component and curve b deflection by the mounting ends 3 . these deflections a , b are taken over a time period in which the component 2 flexes . this time period for illustration purposes is 5 milliseconds . it will be noted that the deflection of the component is symptomatic of the particular materials and dimensions of the component 2 . in such circumstances the curve a , b can be utilised for comparison with other sample components for analytical and design purposes . the invention provides an apparatus and a method for testing specimen components . as indicated this testing may be relative to a known set of parameters achieved empirically or through finite element impact modelling for a desire operative performance . alternatively , a deflection response curve as depicted in fig9 may be determined for an acceptable performance by a component to be tested through a representative specimen . the invention is particularly useful with regard to components formed from composite materials . in such circumstances these composite materials will generally comprise a hybrid of more than one material combined within a laminate or fibre reinforcement within the material . specifically , the invention is applicable to testing carbon fibre reinforced polymer components presented in the form of elongate members between the end mountings . the invention addresses fundamental problems with regard to testing of laminate materials . in such circumstances the method and apparatus of the present invention can provide an accurate reconstruction of the stress state and damage within a real component by achieving a desired inertia mass combination between the mountings ends 3 and representative component 2 in relation to the dimensions of the component such as length , width and thickness . in such circumstances a more realistic response from the material from which the component is formed is achieved in order to adapt and formulate design objectives . such advantages may have particular applicability with regard to fan blade development within gas turbine engines . the present method and apparatus allows cheap , repeatable , easily understood , straight forward and more realistic modelling of impact load stressing upon components to be provided without the necessity of resorting to producing actual real components designed for destructive testing . modifications and alterations to the invention will be understood by those skilled in the art . thus , generally the specimen component is typically in the form of an elongate member and will be substantially flat in its original suspended state prior to impact . however , it will also be understood that components which are initially bent or curved or kinked may also be tested . furthermore , the impact site for the projectile may be substantially central or adjusted along the length of the component to match expected operational stressing upon the component . although suspension upon cables hanging vertically down has particular advantages it will also be understood that other forms of suspension may be appropriate including where possible suspension upon gas or air jets or other fluids as it will be understood that ideally the mounting ends provide inertia in association with the component such that positional site retention is achieved whilst impact energy is principally absorbed through flexing and deformation of the component itself .

6Physics

fig1 shows a covered cylinder 2 and a funnel 3 that hangs from cylinder 2 at an axial distance by means of hanging ties 15 . upon the cover 19 of the cylinder 2 , a funnel 5 is arranged concentrically above the tip of concentrical cone 1 . the top of the cone 1 is adjustable through the distance 8 in an axial direction by an elevation adjustment of a cone suspension 9 . through a control window 16 , the grain flow inside the cylinder 2 is visible . the cone 1 ends concentrically at its bottom in a larger funnel 7 that is suspended underneath the cylinder 2 . a tube 4 is led laterally into the larger funnel 7 to supply water to a spray head 11 with six nozzles 17 that are displaced horizontally at 60 ° increments around the spray head and directed towards the funnel 3 , which is positioned concentrically with the funnel 7 . the spray head 11 is furthermore provided with a central lower nozzle 18 so that a fog forming a hollow cone is sprayed upon the grains completely from the inside . as shown by the arrow 14 , air can reach a suction joint 13 through the hollow cone fog of the grains and through an annular space or a ring slot 10 between the funnel 7 and the cone 1 . the tube 4 is formed by two empty tubes extending towards a tube ring 78 resting diametrally upon the walls of the funnel 7 . the tube ring 78 serves as a support 85 for a passage balance 86 . a cylinder 87 effects upon inner walls of the cone 1 over movable backing roll arms 88 to control the penetration depth of a shaft 90 over a servo - motor 89 . three support feet 45 and 59 ( fig2 ) that are each divided longitudinally by a double flange 58 serve as a support of a vertical shaft 21 . working bodies 35 and inclined cone surfaces 33 are arranged upon the shaft 21 or a hollow shaft 40 as rotors with working surfaces . collision cylinders 38 and 28 are provided to brake and reroute the grains and to conduct them to a collection funnel 43 , opposite to oncoming suction air . the collection funnel is provided with a spout 54 . the outlet slope of the collection funnel 43 is interrupted in the area of the shaft 21 and the hollow shaft 40 by a cylinder 50 arranged there . a slider 73 conducts the grains around the cylinder 50 , through which the suction air is aspirated and discharged through an air suction joint 24 towards the outside . with an upper support 42 , the shaft 21 is supported upon a machine cover 44 . girder sections 29 are provided to absorb dynamic oscillation and bear the weight of the shaft 21 . a double cylinder support serves for rerouting the forces to a bottom plate 51 reinforced by a support 39 . under the bottom plate 51 , a geared engine 20 / 57 for the shaft 21 is arranged . the preprocessed grains in the funnel 3 ( fig1 ) are conducted to a working surface of the working body 35 through an inlet 49 ( fig2 ), an inlet funnel 48 , and a cylinder 32 . the preprocessing is a kind of shower wash in which the grain surface absorbs moisture and swells up . in a chamber between a fixed working surface 36 and a working surface of the quickly rotating working body 35 , considerable turbulence of the grain flow reaching this chamber occurs . this is not only due to the considerable differential speed of the two working surfaces but also , among other factors , to the design of the working surfaces of the working bodies 35 and 36 , the centrifugal forces , and gravity , as well as to the reciprocal effects of the collisions of single grains . the working surface of the working body 35 is formed with a plurality of axial projections and / or grooves , preferably in the form of low pyramids that virtually &# 34 ; launch &# 34 ; the colliding grains with a distinct axial component of movement , so that their grain crease is opened and a cleaning effect achieved . by &# 34 ; pyramid &# 34 ; is meant all possible geometrical forms with an extension tapering off from a bottom area to a tip , including irregular forms that may be distributed nonuniformly upon the working surfaces . this processing results in the possibility of removal or peeling of the outer wood fiber coating of the grain , the epidermis with beard , down to a predetermined separation zone , which up to now was not achievable with known grain cleaning processes . the special advantages of this processing -- the so - called shower wash with subsequent removal of the outer coating by diametral collision turbulence -- results in a relatively large surface for the milling product , lower energy consumption during milling , and additionally a higher degree of milling . the milling product from grain processed according to the present invention can absorb a larger quantity of water and result hence in a higher volume increase for whole - wheat doughs in which the product is used . furthermore , the above described pre - processing can avoid environmentally harmful substances , toxic agents and problem bacteria , that are often accumulated in large extent upon the epidermis and in the beard , from getting into the dough , and can facilitate a specific guiding of the sour dough , with the grain components that are important for digestibility and consumption from a food - physiological aspect being decomposed better . the above described process of collision turbulence also takes place in the area between the fixed working surface 34 and the working surface of the working body 33 , which is also rotated at high speed . according to the preferred embodiment of the present invention , it is possible to supply the grains leaving the funnel 3 , not directly to the inlet 49 , but to an intermediate step in which the surface water is eliminated from the grains . this surface water mostly contains a considerable part of the dissolved dirt . thus , the final product , the grain to be milled , meets even higher requirements if this surface water is eliminated before the treatment of the grain by the turbulence effect , and dissolved dirt does not move into the grain crease , transcontaminating it . for the intermediate step , screen units , especially surrounding cylindrical - shaped screens with screen slots and the like , are possible . a unit of this kind is shown in fig3 . a steel tank 65 with a collection trough bottom is positioned with a horizontal inclination and the tank sloping axially upon shorter feet 73 and higher feet 70 . cylinder stubs on a front side of the tank 65 provide an inlet tube 62 on the lower front side and , diametrally opposite , an outlet tube 63 on the higher part . a drive 68 with a motor 64 rests upon a pipe bridge 80 . loose surface water and dissolved dirt are centrifuged through radially surrounding slots of a cylindrical - shaped screen 61 into the tank 65 and can be discharged at the lowest point through a drain 67 . fig4 shows an arrangement of the already described units , the shower - wash unit according to fig1 the screen unit according to fig3 and the collision turbulence unit according to fig2 as well as an electronic data processing unit that charges the individual units according to a program and receives the necessary process data . fig5 and 6 show examples of the design of the working surfaces of the working bodies 35 and 36 , in sectional view and top view . these are the prismshaped elevations projecting outwards that exercise the above described effects upon the grains .

1Performing Operations; Transporting

fig1 schematically illustrates a lavatory 100 to be used by an individual household in e . g . a farmers village in a developing country , where there is no communal infrastructure , and wherein an apparatus 102 according to the invention ( schematically shown ) has been implemented . the lavatory would suitably be located near the house , such that the inhabitants will be able to easily access it on a frequent basis , thereby eliminating the need for digging latrine holes in the ground . a standard size of the apparatus could serve say 5 - 10 people . for ease of handling , the actual apparatus 102 will be placed on the ground , and the toilet room will be placed on top , thus requiring a staircase to gain access thereto . of course the apparatus can be implemented to serve several households too , in which case the lavatory suitably would be located in the centre of a village . depending on the size of the village there could of course be provided several lavatories . to the apparatus there will be coupled one or more toilets 104 suitably of a “ mill ” type , which is preferred because of its function to fragment the material . the apparatus according to the invention will treat the urine and faeces on a continuous basis and rapidly transform the faeces to virtually bacteria free harmless end products in the form of a nitrate - rich liquid phase and a phosphorous - rich slurry or semi - solid phase . these end products can be directly pumped or transported onto nearby fields to provide cheap fertilizer and thereby increase crops . the apparatus constitutes a self - contained system for taking care of faeces and treating it to produce cheap fertilizer thereby improving life for poor farmers in developing countries . now the working and structure of the apparatus will be described in more detail with reference to fig2 . thus , the apparatus comprises a housing or tank 200 wherein the treated faeces is stored temporarily before it is pumped or otherwise transported to the end use as fertilizer in the fields . inside the tank 200 there is provided a process vessel 202 . the process vessel suitably has a circular cylindrical cross section . there is also an inlet tube 204 at the top of the vessel 202 through which faeces from a suitable toilet 206 will be fed into the process vessel 202 . inside the process vessel 202 there is provided a member that is referred to as a guide collar 212 . this is a flange or rim running circumferentially along the inner wall 214 of the vessel 202 at a height above the bottom of the vessel 202 corresponding to about ⅔ to ¾ of the total height of the vessel 202 . this guide collar 212 extends horizontally inwards , i . e . radially , from the inner circumferential wall 214 so as to leave a central opening having a diameter that is between ⅓ and ⅘ of the diameter of the vessel 202 itself . thus , the guide collar in a sense partitions the process vessel 202 in a lower 216 and an upper 218 compartment , respectively . located in the centre of the vessel 202 there is a tube 220 . the tube 220 has an aperture 221 slightly lower that the level of the guide collar 212 . the tube 220 is drawn through the wall of the process vessel 202 , and further through the wall of the tank 200 . it is connected to the bottom 222 of the tank at 223 via a branch tube 224 . thereby it will be possible to circulate the material located at the bottom of the tank 200 back into the process vessel 202 in a manner to be described . another branch 226 of the tube 220 extends upwards and opens 227 at a level above the top level in the tank 200 . this provides overflow protection in the event that the tank should be completely filled . at a level above half of the height of tank 200 there is provided a drainage 228 for no 3 - rich supernatant . this liquid can be used directly as a fertilizer by pumping it into the fields . there is also provided at a lower level a drainage 229 for phosphorous - rich sludge collecting at the bottom of the tank 200 . this material can also be used directly as fertilizer . at the top of that tank 200 there is also provided a vent 230 for co 2 and other gases from inside the tank . there is also provided an overflow feed tube 231 which ascertains that treated material continuously will be fed into the storage tank 200 . this overflow feed tube is located at a level such that there is formed a head space h above the liquid inside the process vessel 202 . the normal level inside the process vessel 202 is indicated with a broken line in fig2 . the key component of the apparatus is a rotary impeller device 300 of a similar construction to that of the device mentioned in the background section . the impeller 300 is positioned substantially within the upper portion of the process vessel 202 , i . e . at a position above the level of the guide collar 212 . however , it preferably extends slightly below the collar . the impeller 300 is driven by a motor 232 the speed of which can be controlled to at least two different speeds . the impeller 300 is connected to the motor via a shaft 234 which is hollow for the purpose of supplying air to the process vessel 202 . the motor 232 is suitably an electric motor , but in cases where electricity is not available , diesel engines or other types of combustion engines could be used instead . it is also conceivable to use solar power or wind power to generate the required electric energy , which can be stored in batteries . the impeller 300 is similar in construction to the device disclosed and claimed in ep 1 156 870 , but with some modifications to render it suitable for the purpose of the present invention . the details of the impeller will now be described separately below with reference to fig3 . thus , the impeller , generally indicated with reference numeral 300 in fig3 , is suitably made of stainless steel ( although other resistant materials such as various types of plastics are equally possible ), and comprises two distinct portions ; an upper compartment 301 a and a lower compartment 301 b separated by a partition plate 302 . a driving shaft 304 is attached to the partition plate 302 in the centre thereof . the shaft is hollow to enable ambient air to be drawn into the lower compartment 301 b via a hole 306 in the partition plate 302 . the upper compartment 301 a is formed by a truncated cone 303 a having the narrower part thereof facing upwards such as to leave an annular opening 305 around the centrally located shaft 304 . the truncated cone 303 a is preferably welded to the partition plate 302 . there are provided openings 308 in the wall of the upper compartment 301 a . these are circumferentially spaced along the periphery of the compartment wall , preferably near the partition plate 302 , most preferred such that the lower edge of the openings is flush with the partition plate . suitably there are four such openings , although two or three or five or more openings are possible . the purpose and function of the upper compartment will be described below in connection with the description of the operation of the apparatus according to the invention . the lower compartment 301 b is also formed by a truncated cone 303 b having the narrower part thereof facing downwards . this truncated cone 303 b is attached to the bottom side of the partition plate 302 via impeller blades 307 , distributed evenly along the periphery of the cone 303 b . the impeller blades form spacers between the cone 303 b and the partition plate 302 , so as to provide a peripheral opening for liquid to pass out from the compartment 301 b during the treatment . preferably there are six impeller blades , although this number is not critical . there could be four or five or even seven up to ten or more blades . the width of the “ slit ” formed between the truncated cone 303 b and the partition plate typically could be 15 mm if the diameter of the entire impeller is 150 mm . the slit width will vary with size of the impeller , and thus a large diameter will yield a correspondingly larger slit width . at the periphery of the opening at the narrow end of the truncated cone , there is collar 310 , also in the form of a truncated cone but arranged such that it widens downwards , i . e . it has an opposite orientation compared to the cone forming the lower compartment 301 b . the height of this “ collar cone ” 310 from its wider opening up the joint with the larger compartment forming cone is preferably about 30 % of the height of the larger cone , but can vary from 25 to 35 %, but could be substantially larger without departing from the inventive idea or negatively impart the function . the lower circumference of this collar cone 310 is located slightly below the level of the guide collar 212 . furthermore , and an important feature , is that the cone angles α of the cone forming the compartment 301 b and the collar cone 310 should be the same . suitably this angle α is about 60 ° but can vary within certain limits such as 65 to 75 °, or 60 to 80 °. now the operation of the apparatus according to the invention will be described with reference to fig1 - 3 . the apparatus according to the present invention can be run in two modes . a first “ treatment mode ” in which freshly collected faeces is treated , and a second “ maintenance mode ”, in which material is treated that has been stored long enough that unwanted odours have started to develop . also , unwanted bacterial growth can be inhibited by this second mode operation . when the toilets 206 are used , faeces will be fed via the inlet tube 204 and into the process vessel 202 . initially of course the system is empty , and the treatment of the material will not begin until the process vessel is filled to the set level , defined by the position of the overflow feed tube 231 . at this point in time , i . e . when the process vessel is adequately filled , the motor 232 will be started to initiate stirring of the faeces by means of the impeller 300 . once the system is up and running the motor will run continuously . in the first mode the speed of rotation of the impeller is in the order of 750 rpm but can be up to about 1000 rpm . this will cause the material inside the vessel 202 to rotate forming a vortex . at this speed the liquid or semi - liquid material located at or near the walls in the process vessel , in the region below the guide collar 212 , will be drawn upwards and into the impeller 300 . the collar cone 310 , by virtue of its cone shape , will support the flow into the impeller to render the transport more efficient . the guide collar 212 will effectively function as a partition wall between the upper and lower part of the process vessel , thereby preventing material that has been treated inside the impeller to mix too rapidly with untreated material below the collar 212 . eventually of course the material will in some sense be “ homogeneous ”, and only when new material is fed into the system an inhomogeneous situation occurs and the process of oxygenation will become operative . due to the construction of the impeller 300 with its truncated cone configuration , there will be created a suction due to the formation of a vortex inside the lower compartment 301 b of the impeller 300 . thereby , air from the environment will be sucked in through the hollow shaft , and also liquid will be sucked in through the collar cone 310 at the lower end of the impeller . in the extreme conditions inside compartment 301 b there will a very efficient oxygenation of the faeces material , and a rapid nitrification process will take place thereby eliminating ammonia formation , and also killing of bacteria will be very rapid . the upper part of the impeller 300 , i . e . the compartment 301 a , will have dual functions . first of all it will cause a suction into the upper opening 305 , such that newly introduced faeces will very rapidly enter there into and mix with air that is also sucked in from the head space h in the vessel 202 . the material will then be thrown out through the peripheral openings 308 and back into the upper portion 218 in the vessel 202 . during running of the impeller , proteins and other biological material in the faeces will cause heavy foaming . however , due to the construction of the impeller with an upper portion 218 as described above , foam that is generated will be drawn in from the surface of the media in the vessel and disintegrate in the process of passing through the upper compartment 301 a . thus , use of anti - foaming agents , common in sewage treatment systems is eliminated . when the system has been run for a while , and if the treated material has been stored in the tank 200 for more than say 24 hours inevitably there will be e . g . h 2 s generated together with other unwanted gases , such as ammonia , and as mentioned above , bacterial growth may have reached an unwanted level . in order to stop this unwanted process , the material from the tank 200 can be recirculated into the process vessel for further treatment . this is achieved by increasing the speed of rotation of the impeller 300 to about 1500 rpm . this will cause the vortex formed by the impeller at the lower opening to be more directed and actually essentially focussed to the tube 220 and down into it through the opening 221 . as can be seen in fig2 , the tube 220 extends via the branch 224 to the bottom of tank 200 . thus the suction caused by the impeller 300 in this second mode of operation will transport material from the bottom of the tank 200 back into the process vessel 202 , where it will undergo the same treatment again as it already once have undergone . the second mode of operation can be triggered by sensors ( not shown ) capable of detecting e . g . h 2 s and ammonia , and when the level has reached a threshold level the second mode of operation will be initiated . alternatively , the second mode could be subject to time control , i . e . the system will automatically go into second mode at certain time intervals . in a preferred embodiment , the second mode of operation will be the idle mode , i . e . the first mode will be triggered to become operative when fresh faeces has been fed into the process vessel . although the invention has been described with reference to use by humans , the apparatus is suitable for use also with animal dung and excrements , provided the viscosity thereof is suitable for stirring as contemplated using the rotary device disclosed herein .

8General tagging of new or cross-sectional technology

co - pending u . s . patent application 62 / 156 , 371 entitled “ boot seal ,” is incorporated herein by reference . a typical prior - art cable - end , elastomeric , breakout boot seal is shown in fig1 . it consists of a sleeve portion 200 which is constrictively stretched over the end of cable 3 . the environmental fluid pressure p f has the effect of unseating the rear portion of sleeve 200 ; however , there is a pressure p f + p s , where p s is the “ stretch ” pressure of the constrictive elastomer upon cable 3 . the stretch pressure works in cooperation with the environmental pressure to keep the sleeve seated . since ( p f + p s )≧ p f in all cases , the rearward portion of sleeve 200 will not be unseated by environmental fluid pressure p f , and the seal will not fail in that mode no matter how great the environmental fluid pressure . the same reasoning is true for all elastomeric boot seals wherein there is adequate stretch to conformably seat the sealing sleeve to the object over which it is stretched . individual sleeves 290 , which are integrally molded onto heavy end - wall 295 of sleeve 200 , stretch over individual cable jacketed conductors 300 . the same mechanism that worked to keep the interface between sleeve 200 and cable 3 sealed , keeps the interfaces between sleeves 290 and conductor jackets 300 sealed ; that is , ( p f + p s1 )≧ p f , where p s1 is the stretch pressure that constrictive sleeves 290 exert on respective conductors 300 . it is therefore clear that no matter how great fluid pressure p f is , the various interfaces will remain sealed against it . as discussed in u . s . pat . no . 6 , 796 , 821 , prior art elastomeric breakout boot seals like that shown in fig1 can be easily displaced and unseated , particularly if there is an overpressure within cable 3 to which they are attached . looking still at fig1 , it is clear that if appreciable pressure developed within cable 3 , as might occur from out - gassing of material within cable 3 , for instance , the fig1 boot seal would simply be pushed off of the end of cable 3 . such cases are more likely when the opposing environmental fluid pressure p f is small . in the case of subsea cables , that means either when the cable is not yet submerged , or when it is in shallow water . there are process - type breakout boot seals , such as those manufactured by tyco - raychem , which sealably adhere to the cable , and are not as easily displaced . but using process - type boot seals is not always practical ; for instance , when the cable jacket cannot be adhered to , or when the seal must be installed in conditions detrimental to the sealing process . the invented termination is disclosed herein in two embodiments , both of which utilize breakout boot seals that are retained in place on the ends of the cables onto which they are installed . the first embodiment incorporates a breakout boot seal construction as disclosed in co - pending u . s . patent application 62 / 156 , 371 . in the &# 39 ; 371 construction the breakout boot seal includes a mechanism that grips directly onto the cable being terminated . the second embodiment does not grip directly onto the cable ; instead , it is retained by standoff - rods that cooperate with one retainer washer external to the breakout boot seal , and another washer internal to the breakout boot seal . fig2 is an overall oblique view of invented termination 2 used to join connector 1 to cable 3 , and fig3 is a partially sectioned view of the assembly shown in fig2 . fig4 is a partially sectioned exploded view of the assembly shown in fig2 . looking now at fig3 and 4 , underwater connector 1 is mechanically joined to the forward end of termination shell 4 by spring pins 5 a and 5 b . pins 5 a and 5 b seat in respective through holes 6 a and 6 b in termination shell 4 , and in respective slots 7 a and 7 b in connector back shell 8 , thereby both rotationally and axially locking termination shell 4 to connector 1 . cable 3 passes into the rearward portion of termination shell 4 through cable grip assembly 9 . connector 1 , shell 4 , and grip assembly 9 altogether form the termination &# 39 ; s protective housing . shell 4 may be made of any substantially rigid material such as hard plastic or metal that is suitably rugged for the intended application . cable grip assembly 9 comprises retainer nut 10 , washer 11 and cable grip 12 . cable grip 12 may be made of a hard but somewhat flexible material such as ryton ® pps ( polyphenylene sulfide ). threads 13 on retainer nut 10 cooperate with threads 14 in the rearward end of termination shell 4 to contain cable grip assembly 9 within conical bore 15 a of termination shell 4 . retainer nut 10 has an oversized through bore 10 a which is slightly larger than the outer diameter of cable 3 , and therefore does not seal to cable 3 . tightening retainer nut 10 tightly presses the elements comprising cable grip assembly 9 into conical bore 15 a of inner diameter 15 of termination shell 4 , forcing the exterior conical surface of cable grip 12 axially into conical bore 15 a . a roughened exterior surface 16 of cable grip 12 ( fig6 ) is forced against roughened surface ( not shown ) of conical bore portion 15 a of termination shell 4 to rotationally lock cable grip assembly 9 to termination shell 4 . cable grip 12 is split through axially by slot 17 , causing it to compress radially when forced axially inward against conical bore 15 a . cable grip 12 is also partially segmented into individual tines 18 separated by slots 19 which facilitate its radially inward compression , and which cause radial ridges 20 to bite into the exterior of cable 3 thereby gripping cable 3 . no element of cable grip assembly 9 seals against cable 3 ; instead , in - situ environmental fluid is free to flow through it into and out of the interior of termination shell 4 . one advantage of the invention is that all of the elastic portions enclosing fluid chamber 21 are integrated into a single unified part : chamber enclosure 22 ( fig1 ). depending on the particular application , chamber enclosure 22 may be made of an elastomer which is chemical compatible with the other elements of the termination with which it is in contact . in some cases neoprene would be acceptable , for instance , or natural rubber . fluid chamber 21 is defined by chamber enclosure 22 , connector 1 and cable 3 as follows : the forward end of fluid chamber 21 is closed by the ( hidden ) rear wall of connector 1 . inward facing shoulder 23 of chamber enclosure 22 seals into seat 24 of connector 1 . shoulder 23 is held sealable into seat 24 by inner wall 25 of termination shell 4 . generally tubular wall 26 of chamber enclosure 22 housing fluid 27 extends backward from inward facing shoulder 23 into heavy walled portion 28 a of integrally molded breakout boot seal portion 28 . breakout boot seal sleeves 29 sealably stretch over jacketed conductors 30 . other boot seals 31 sealably stretch over the terminal ends of jacketed conductors 30 and over boot seal nipples 32 of connector 1 . sleeves 33 and 34 extend back along cable 3 from end wall 35 of boot seal portion 28 thereby completely enclosing fluid chamber 21 . fluid chamber 21 is thus defined and sealed . note that cable 3 does not enter fluid chamber 21 ; only the individual jacketed conductors 30 enter fluid 27 within fluid chamber 21 . space 36 surrounding the outside of chamber enclosure 22 and inside of termination shell 4 is open to the in situ environment , for instance seawater , which is free to pass through cable grip assembly 9 and thence through the space between inner diameter 15 of shell 4 and the outer diameter of sleeve 34 . ventilation through cable grip assembly 9 takes place by way of axial slots 17 and 19 of cable grip 12 and the oversized central bore 10 a of retainer nut 10 . means other than the ventilation through cable grip assembly 9 can be provided if needed ; for example , one or more vent holes 37 could be added . tubular wall 26 of chamber enclosure 22 allows changes of the in - situ environmental pressure outside of chamber enclosure 22 to be transmitted to fluid 27 as the in - situ pressure increases and decreases . although more than one way can be envisioned for retaining breakout boot seal portion 28 of chamber enclosure 22 in place on the end of cable 3 , in the first described embodiment it is accomplished by a retainer 38 in the form of a push - nut type fastener , shown also in fig5 , which is integrally molded or inserted into thick - walled portion 28 a of boot seal portion 28 of chamber enclosure 22 . post - mold insertion of retainer 38 is possible due to the elasticity of boot seal portion 28 . retainer 38 can be made from rigid flexible material such as thin metal or hard plastic which keeps boot seal portion 28 in place on cable 3 . retainer 38 does not rely on bonding or any other chemical processes . push - nut fasteners such as retainer 38 are widely available commercially , for instance from araymond tinnerman . referring to fig5 , retainer 38 includes a circular peripheral body 39 . extending axially through body 39 is a central opening 40 . opening 40 has a generally circular configuration and has an inner marginal periphery that is defined by a plurality of individual tab - like extensions or tines 41 . the tines 41 are inclined radially inwardly from body 39 and cooperate to define a conical shape about the margin of opening 40 . tines 41 are separated from one another by recesses 42 . note that recesses 42 represent openings that keep retainer 38 from sealing to the outside surface of cable 3 . referring now to fig3 , the distal ends of tines 41 of retainer 38 forming opening 40 are disposed at a diameter which is less than the inner diameter 43 of heavy walled portion 28 a of boot seal portion 28 , and somewhat less than the outer diameter of cable 3 . inner diameter 43 , in turn , is greater than the outer diameter of cable 3 thereby allowing distal tines 41 to project inward from inner diameter 43 to effectively grip cable 3 . there &# 39 ; s another advantage to having inner diameter 43 of boot seal portion 28 slightly larger than the outer diameter of cable 3 . it is that sleeve portion 33 does not constrictively seal to cable 3 along inner diameter 43 . as an added measure to ensure that sleeve 33 does not seal to cable 3 along inner diameter 43 of boot seal portion 28 , axial ribs ( not shown ) along inner diameter 43 can be provided . ventilation between inner diameter 43 of boot seal portion 28 and the outer surface of cable 3 is important , because , as will soon be discussed , it provides that any material issuing from the end of cable 3 due to an overpressure within the cable can be made to migrate to sleeve 34 of boot seal portion 28 where it will subsequently be discharged . the main function of retainer 38 is to keep chamber enclosure 22 in place on the end of cable 3 . retainer 38 forms a one - way axial grip onto cable 3 , allowing cable 3 to be pressed through retainer 38 from the rearward end , but not to be subsequently withdrawn from it . tines 41 on retainer 38 are angled forward , and can be deflected radially outward by the rearward entering cable . during assembly , retainer 38 permits chamber enclosure 22 to be pushed onto the end of cable 3 , with conductors 30 being fed through sleeves 29 . once pushed into place on the end of cable 3 , retainer 38 keeps chamber enclosure 22 from subsequently being forced off of the end of cable 3 . if for some reason chamber enclosure 22 needs to be removed from cable 3 , a thin , split , flexible tube 50 such as shown in fig7 can be slid from the rear under both sleeve 34 and retainer 38 to displace tines 41 outwardly , freeing cable 3 . tube 50 can be cut and rolled from suitable thin sheet material . chamber enclosure 22 is formed with a relatively thin walled , tubular portion 26 which extends radially outward from thicker walled portion 28 a , and then extends forward in a generally tubular shape that terminates on its forward end in inward protruding shoulder 23 . sleeve 33 extends forward of thicker - walled portion 28 a , and terminates in a relatively thick end wall 35 . sleeves 29 extend forward from end wall 35 , with the bores of sleeves 29 continuing rearward through wall 35 . sleeve 34 of chamber 22 extends rearward constrictively over cable 3 from a point rearward of retainer 38 . retainer 38 keeps breakout boot seal portion 28 of chamber enclosure 22 in place against modest pressure internal to cable 3 . both the jacket of cable 3 and thicker walled portion 28 a of boot seal portion 28 of chamber enclosure 22 , being of resilient material , have some limitations regarding the retaining ability of retainer 38 . the retaining ability can be enhanced by having multiple retainers 38 spaced axially along cable 3 , but it still will be limited . the retention of boot seal portion 28 of chamber enclosure 22 onto the end of cable 3 can also be enhanced by relieving any cable 3 internal overpressure at a low level . to better understand internal cable pressure , consider fig8 which shows one typical sort of underwater cable construction . it consists of outer cable jacket 60 and inner jacketed conductors 30 . the space 61 between jacketed conductors 30 and outer cable jacket 60 contains a filler 62 which may or may not be porous . in any case , pressure can build up along the interfaces between jacketed conductors 30 and filler 62 , and / or within the interface between outer cable jacket 60 and the filler 62 , and in the case of a porous filler , within filler 62 itself . said more succinctly , pressure can possibly build up anywhere within space 61 between jacketed conductors 30 and outer cable jacket 60 . the internal pressure within cable 3 may increase due to a variety of mechanisms . for example , the plastic jackets of jacketed conductors 30 within cable 3 can continue to outgas as they age , thus creating an internal pressure inside cable 3 ; or mobile substances such as gel fillers or intruded water can migrate within cable 3 due to handling , also potentially increasing pressure in cable 3 within space 61 . when the internal cable pressure exceeds a desired level , it is advisable to provide a release path to relieve the pressure without damaging or unseating boot seal portion 28 from cable 3 . in general , when the overpressure internal to a boot seal sleeve reaches a certain level it causes the boot seal sleeve to expand radially , allowing gas or fluid inside of it to leak outward along the interface between it and the object over which it is stretched ; however , environmental fluid will still not leak in . boot seal sleeves make effective one - way pressure relief valves , for which they are frequently used . referring now to fig3 , in fluid - filled cable terminations any cable 3 internal overpressure should be relieved rearwardly along the external surface of cable 3 through the interface 70 between cable 3 and sleeve 34 , and not forwardly into fluid chamber 21 . that can be accomplished by designing the stretch pressure of boot seal sleeve 34 on cable 3 to be much less than that which any of boot seal sleeves 29 exert on the jacketed conductors 30 over which they are constrictively stretched . in that case , any material forced outward from the cable 3 interior will pass out under sleeve 34 via path 70 and thence into the external environment , and not into fluid chamber 21 . one simple way to control the stretch pressure on any elastomeric sleeve is by increasing or decreasing its wall thickness and / or inner diameter . thicker walls and / or smaller inner diameter sleeves exert more stretch pressure on the objects over which they are stretched , and thinner wall thicknesses and / or larger internal sleeve diameters exert less stretch pressure . in pressure - balanced fluid - filled terminations it is typically assumed that the fluid pressure within the chamber is approximately equal to the pressure outside of the chamber due to the easy transmission of the outside pressure to the fill fluid . the discussion is always couched in terms of the pressure within the fluid chamber adjusting to the external in - situ pressure . it is not discussed in terms of the outside environmental pressure adjusting to the pressure in the fluid chamber , because that cannot happen ; the outside environment is of infinite volume for all practical purposes . however , there are some non - trivial cases in which the pressure within the chamber can exceed the outside environmental pressure . for instance , there is nearly always some air left in the fluid chamber during assembly . subsequently the entrapped air can expand in the case where the in - situ pressure is relatively low , such as when a fluid - filled termination is transported at high altitude , or when it &# 39 ; s exposed to high temperatures . in a termination having no means to contain expansion of its compensation chamber , the pressurized entrapped air could displace the compensation chamber enclosure out of sealing position ; or worse , it could rupture the chamber enclosure out through the vent passages found in most prior art terminations . the invented termination is designed to prevent those potential failures . over - pressure within chamber enclosure 22 will cause chamber enclosure 22 to expand to fill the large diameter , rear , bell shaped portion 71 of termination shell 4 , which keeps chamber enclosure 22 from expanding further . there are no vent holes in shell 4 that are positioned in such a way that the walls of chamber enclosure 22 could extrude and rupture through them . pressure from the expanding air will force heavy - walled portion 28 a of chamber enclosure 22 against end wall 52 of termination shell 2 . note that the outer diameter of retainer 38 is greater than the rearward inner diameter 15 of termination shell 4 . rearward expansion of chamber enclosure 22 is thus arrested by the interference of retainer 38 and end wall 52 . the expansion of chamber 21 is therefore limited in every direction rendering it undamaged and in place in the presence of over - pressure within fluid chamber 21 . ribs 72 seen in fig1 on the rearward bell - shaped wall 73 of chamber enclosure 22 guarantee that rear exterior wall 73 of chamber enclosure 22 will not seal to rear wall 52 of termination shell 4 when pressed against it . ventilation between space 36 exterior to tubular portion 26 of chamber enclosure 22 and the external environment takes place along the ribbed portion of exterior wall 73 , thence through the space between the outside diameter of sleeve 34 and inner diameter 15 of shell 4 , and onward through slots 17 , 19 of cable grip 12 and finally through the oversized bore 10 a of retainer nut 10 . the procedure for installing the termination is easily understood from fig4 . nut 10 , washer 11 , cable grip 12 and termination shell 4 are slid backward onto cable 3 in the order shown . the end of cable 3 is prepared by cutting back the outer jacket and filler material to expose lengths of jacketed conductors 30 . if not already molded in place , retainer 38 is inserted into chamber enclosure 22 . slight lubrication of the various parts facilitates installation . next , jacketed conductors 30 are fed through sleeves 29 of chamber enclosure 22 , and cable 3 is pushed into chamber enclosure 22 until it butts against end wall 35 . thin walled portion 26 of chamber enclosure 22 is rolled back upon itself rearwardly to allow easier access to jacketed conductors 30 . boot seals 31 are slid rearwardly onto jacketed conductors 20 as far as possible . jacketed conductors 30 are cut to proper length , and the electrical conductor jackets are cut back to expose conductor ends 56 , which are then joined to the electrically conductive elements 57 of connector 1 . the joining of conductors 56 to conductive elements 57 can take place in a variety of well known ways , such as soldering or crimping in the case of electrical conductors , or passage through penetrators in the case of optical fibers . some clear examples of these ways can be found in u . s . patent application ser . no . 13 / 296 , 406 . boot seals 31 are then slid forwardly into engagement with boot seal nipples 32 . cable 3 and connector 1 are held horizontally aligned at an axial separation distance that leaves space for a service bend in jacketed conductors 30 and / or the management of optical fibers . next thin - walled , tubular portion 26 of chamber enclosure 22 is rolled forward . inward facing shoulder 23 is then seated into seat 24 of connector 1 . still in a horizontal position , chamber enclosure 22 is now filled with fluid 27 , such as oil , by pinching up the top portion of shoulder 23 from seat 24 and inserting a small tube under shoulder 23 through which a measured amount of fluid 27 is injected into chamber 21 . excess air is forced out as much as practical . shoulder 23 is allowed to snap back into sealing position in seat 24 . termination shell 4 is then slid forward onto the rear of connector 1 , and spring pins 5 a , 5 b are inserted . cable grip 12 , washer 11 , and nut 10 are slid forward into the end of shell 4 ; nut 10 is tightened , and the termination is complete . there are alternate ways that would be useful in some circumstances to retain chamber enclosure 22 including boot seal portion 28 in position relative to cable 3 within the termination assembly . as an example of such circumstances , the cable to be terminated might have an outer jacket that &# 39 ; s too soft to be adequately held in place by a push - nut type fastener such as that just described . an alternate termination construction is shown in fig9 - 12 and 14 . in this alternate embodiment plain washer 80 replaces retainer 38 of the earlier embodiment . washer 80 is sized with an inner diameter slightly larger than the outer diameter of cable 3 , and an outer diameter somewhat larger than inner diameter 15 of shell 4 . standoff 83 ( fig1 ) has a disc - shaped end 84 with through - hole 85 and standoff rods 86 . through - hole 85 is sized just slightly larger than the outer diameter of sleeve 33 of chamber enclosure 22 . standoff rods 86 are inserted into sockets ( not shown ) in the rear wall of connector 1 . the heavy - walled portion 28 a of chamber enclosure 22 , including washer 80 , is axially trapped loosely between disc - shaped end 84 of standoff 83 and end wall 52 of termination shell 4 . it cannot move forward because of standoff 83 ; it cannot move backward because of end wall 52 . sleeve 33 is heavy so as to be robust and not easily stretched forward . over - pressure within cable 3 is relieved , as before , backward under sleeve 34 via path 70 and further through grip assembly 9 and into the exterior environment . as in the earlier embodiment , ribs 72 on the rearward bell - shaped portion of chamber enclosure 22 guarantee that rear exterior wall 73 of chamber enclosure 22 will not seal to end wall 52 of termination shell 4 when pressed against it . ventilation is thereby assured between space 36 exterior to tubular wall 26 of chamber enclosure 22 and the external environment . note that in the second embodiment , chamber enclosure 22 is not fastened directly to cable 3 . that is the principal functional difference between the first and second embodiments . cable 3 is mechanically held in place by cable grip 12 , and chamber enclosure 22 is held in place axially by the entrapment of its heavy walled portion 28 a including plain washer 80 against end wall 52 of termination shell 4 and disc - shaped end 84 of standoff 83 . assembly of this alternate embodiment is the same as in the first described embodiment except that one additional part , standoff 83 , has been added to the assembly and retainer 38 has been replaced by plain washer 80 . apart from the modifications just described the second termination embodiment functions the same as the first one employing retainer 38 . in both of the embodiments just described the jacketed conductors 30 within the termination could be either optical fibers or electrical wires . in the case of optical conductors , the jackets could be protective tubes of material such as steel hypodermic tubing which , although rigid , is flexible enough to be embedded in a flexible subsea cable . looking now at fig9 , optical fiber protective tube 90 passes out of cable 3 , through the end wall 35 of boot seal portion 28 and thence through constrictive breakout boot seal sleeve 29 into fluid chamber 21 . within fluid chamber 21 , optical fiber 92 is sealably passed out of tube 90 through a device such as fiber penetrator 91 . optical fiber protective tubes such as 90 are most often either gel filled or simply empty . the pressure within them is nominally one atmosphere . fiber penetrator 91 permits optical fiber 92 contained therein to pass undamaged from the one atmosphere pressure interior of protective tube 90 into the possibly high pressure of fluid chamber 21 with no exchange of material between fluid chamber 21 and the interior of protective tube 90 . examples of fiber penetrators such as 91 can be found in u . s . pat . nos . 6 , 067 , 395 and 6 , 608 , 960 . once into fluid chamber 21 , excess amounts of optical fiber 92 can be managed in the well known way of winding flexible elongated elements into a figure - 8 pattern as described in u . s . pat . nos . 2 , 634 , 923 and 2 , 082 , 489 . the figure - 8 pattern keeps long , thin , flexible elements whose ends are fixed from being twisted when coiled . u . s . pat . nos . 7 , 769 , 265 and 8 , 731 , 363 each describe winding tracks which facilitate winding optical fibers into the figure - 8 pattern and which also serve as the mounting devices for the wound fiber coils . the &# 39 ; 265 optical fiber management invention is for a winding spool and a method of employing the spool , whereas the &# 39 ; 363 invention is for a winding apparatus upon which optical fibers are wound and stored . a close study of the aforementioned patent - winding techniques , particularly as described in the &# 39 ; 265 patent , makes it clear that the winding could equally well be done by hand without the need of any reels or spools . optical fiber can be hand - wound into a simple coil in the case where the optical fiber has at least one free end , or into a flat figure - 8 coil like that just described in the case where both fiber ends are fixed . the method of fiber management described in the invention is much simpler . optical fibers are simply hand wound into a flat coil without the use of any apparatus at all . the resulting fiber coil can then be clipped or otherwise retained in position within chamber enclosure 22 . no reel , track or spool is required . fig1 is a perspective view of isolated termination elements to clarify the fiber management technique . diagonally opposed standoff rods 86 protrude forward from disc - shaped end 84 of standoff 83 . retainer clips 94 , shown in fig1 , comprise a first through bore 95 sized to tightly fit onto standoff rod 86 , and a second through bore 96 sized to accommodate one or more coils of optical fiber . slot 98 in retainer clip 94 allows bore 95 to spring slightly outward during installation , thereby firmly gripping standoff rod 86 once installed . installation of retainer clips 94 can take place by inserting them onto the ends of standoff rods 86 and sliding them into axial position . slot 97 in clip 94 allows the fiber coil to be inserted into bore 96 . retainer clips 94 are installed so that slots 97 are oriented generally radially inward towards the longitudinal axis of termination shell 4 . optical fibers are very springy , and fibers in a circular loop will tend to spring radially outward from the loop &# 39 ; s center . in the invention , that means they will spring radially outward and away from slots 97 , and therefore will not escape from retainer clips 94 through slots 97 . clips 94 could be made in many different configurations that would work just as well as those shown . as discussed in u . s . pat . no . 8 , 731 , 363 , in applications where space within the termination is very limited , it is advantageous to manage the optical fibers into a curved figure - 8 arrangement . the &# 39 ; 363 management apparatus arranges fiber loops on two curved tracks that are either side - by - side axially or opposed radially within the termination chamber . but , there is a much simpler and more compact method of managing the fiber coils into a curved arrangement . once again , it relies on the spring characteristics of optical fiber . the hand - wound coil shown in fig1 can be pinched radially into a curved coil as illustrated in fig1 . diametrically opposed portions of the coil are inserted into retainer clips 94 and allowed to spring outwards towards their relaxed flat condition , but are constrained by the clips to remain curved . note that the result is a more compact , single fiber coil , not the two coils required in the &# 39 ; 363 patent . the invention embodiments herein disclosed are seen to be much simpler than prior art fluid - filled and pressure - balanced cable terminations , and yet they have not sacrificed utility . the simplification enhances reliability by eliminating some of the prior art failure modes . for example , prior art terminations generally have many more sealed interfaces each of which is a potential leak path , and each potential leak path presents the possibility of failure . assembly errors are diminished in the invented termination by the uncomplicated installation , which in part is due to its having many fewer components than prior art devices . the economical construction of the invention should enable the use of fluid - filled and pressure balanced terminations in a much wider range of electrical , fiber - optical , and hybrid applications than have heretofore been practical . the above description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the invention . various modifications to these embodiments will be readily apparent to those skilled in the art , and the generic principles described herein can be applied to other embodiments without departing from the spirit or scope of the invention . thus , it is to be understood that the description and drawings presented herein represent presently preferred embodiments of the invention and are therefore representative of the subject matter which is broadly contemplated by the present invention . it is further understood that the scope of the present invention fully encompasses other embodiments that may become obvious to those skilled in the art and that the scope of the present invention is accordingly limited by nothing other than the appended claims .

7Electricity

the following includes definitions of selected terms employed herein . the definitions include various examples and / or forms of components that fall within the scope of a term and that may be used for implementation . the examples are not intended to be limiting . both singular and plural forms of terms may be within the definitions . “ computer - readable medium ”, as used herein , refers to a storage medium that participates in directly or indirectly providing instructions and / or data . a computer - readable medium may take forms , including , but not limited to , non - volatile media , and volatile media . non - volatile media may include , for example , optical or magnetic disks and so on . volatile media may include , for example , optical or magnetic disks and so on . volatile media may include dynamic memory and the like . common forms of a computer - readable medium include , for example , a floppy disk , a flexible disk , a hard disk , a magnetic tape , other magnetic medium , a cd - rom , other optical medium , other physical medium with patterns of holes , a ram , a rom , an eprom , a flash - eprom , or other memory chip or card , a memory stick , and other media from which a computer , a processor or other electronic device can read . “ logic ”, as used herein , includes but is not limited to hardware , firmware , software and / or combinations of each to perform a function ( s ) or an action ( s ), and / or to cause a function or action from another component . for example , based on a desired application or needs , logic may include a software controlled microprocessor , discrete logic like an application specific integrated circuit ( asic ), a programmed logic device , a memory device containing instructions , or the like . logic may also be fully embodied as software . where multiple logical logics are described , it may be possible to incorporate the multiple logical logics into one physical logic . similarly , where a single logical logic is described , it may be possible to distribute that single logical logic between multiple physical logics . “ signal ”, as used herein , includes but is not limited to one or more electrical or optical signals , analog or digital , one or more computer or processor instructions , messages , a bit or bit stream , or other means that can be received , transmitted and / or detected . “ software ”, as used herein , includes but is not limited to , one or more computer or processor instructions that can be read , interpreted , compiled , and / or executed and that cause a computer , processor , or other electronic device to perform functions , actions and / or behave in a desired manner . the instructions may be embodied in various forms like routines , algorithms , modules , methods , threads , and / or programs including separate applications or code from dynamically linked libraries . software may also be implemented in a variety of executable and / or loadable forms including , but not limited to , a stand - alone program , a function call ( local and / or remote ), a servelet , an applet , instructions stored in a memory , part of an operating system or other types of executable instructions . it will be appreciated by one of ordinary skill in the art that the form of software may be dependent on , for example , requirements of a desired application , the environment in which it runs , and / or the desires of a designer / programmer or the like . it will also be appreciated that computer - readable and / or executable instructions can be located in one logic and / or distributed between two or more communicating , co - operating , and / or parallel processing logics and thus can be loaded and / or executed in serial , parallel , massively parallel and other manners . “ user ”, as used herein , includes but is not limited to one or more persons , software , computers , logics , or other devices , or combinations of these . “ data store ”, as used herein , refers to a physical and / or logical entity that can store data . a data store may be , for example , a database , a table , a file , a list , a queue , a heap , a memory , a register , and so on . a data store may reside in one logical and / or physical entity and / or may be distributed between two or more logical and / or physical entities . an “ operable connection ”, or a connection by which entities are “ operably connected ”, is one in which signals , physical communication flow , and / or logical communication flow may be sent and / or received . typically , an operable connection includes a physical interface , an electrical interface , and / or a data interface , but it is to be noted that an operable connection may include differing combinations of these or other types of connections sufficient to allow operable control . a “ print data transmission protocol ”, as used herein , refers to the collection of wireless data communication components that enable a cellular telephone to transmit a print job to an image forming device . one example print data transmission protocol is bluetooth . some portions of the detailed descriptions that follow are presented in terms of algorithms and symbolic representations of operations on data bits within a memory . these algorithmic descriptions and representations are the means used by those skilled in the art to convey the substance of their work to others . an algorithm is here , and generally , conceived to be a sequence of operations that produce a result . the operations may include physical manipulations of physical quantities . usually , though not necessarily , the physical quantities take the form of electrical or magnetic signals capable of being stored , transferred , combined , compared , and otherwise manipulated in a logic and the like . it has proven convenient at times , principally for reasons of common usage , to refer to these signals as bits , values , elements , symbols , characters , terms , numbers , or the like . it should be borne in mind , however , that these and similar terms are to be associated with the appropriate physical quantities and are merely convenient labels applied to these quantities . unless specifically stated otherwise , it is appreciated that throughout the description , terms like processing , computing , calculating , determining , displaying , or the like , refer to actions and processes of a computer system , logic , processor , or similar electronic device that manipulates and transforms data represented as physical ( electronic ) quantities . example methods may be better appreciated with reference to the flow diagrams of fig1 through 5 . while for purposes of simplicity of explanation , the illustrated methodologies are shown and described as a series of blocks , it is to be appreciated that the methodologies are not limited by the order of the blocks , as some blocks can occur in different orders and / or concurrently with other blocks from that shown and described . moreover , less than all the illustrated blocks may be required to implement an example methodology . furthermore , additional and / or alternative methodologies can employ additional , not illustrated blocks . in one example , methodologies are implemented as processor executable instructions and / or operations stored on a computer - readable medium including , but not limited to , an application specific integrated circuit ( asic ), a compact disc ( cd ), a digital versatile disk ( dvd ), a random access memory ( ram ), a read only memory ( rom ), a programmable read only memory ( prom ), an electronically erasable programmable read only memory ( eeprom ), a disk , a carrier wave , and a memory stick . in the flow diagrams , blocks denote “ processing blocks ” that may be implemented , for example , in software . additionally and / or alternatively , the processing blocks may represent functions and / or actions performed by functionally equivalent circuits like a digital signal processor ( dsp ), an application specific integrated circuit ( asic ), and the like . a flow diagram does not depict syntax for any particular programming language , methodology , or style ( e . g ., procedural , object - oriented ). rather , a flow diagram illustrates functional information one skilled in the art may employ to fabricate circuits , generate software , or use a combination of hardware and software to perform the illustrated processing . it will be appreciated that in some examples , program elements like temporary variables , routine loops , and so on are not shown . it will be further appreciated that electronic and software applications may involve dynamic and flexible processes so that the illustrated blocks can be performed in other sequences that are different from those shown and / or that blocks may be combined or separated into multiple components . it will be appreciated that the processes may be implemented using various programming approaches like machine language , procedural , object oriented and / or artificial intelligence techniques . fig1 illustrates an example cellular telephone protocol adaptive print method 100 . the method 100 may include , at 110 , identifying a cellular telephone print item to print , where the cellular telephone print item includes one or more printable elements . the cellular telephone may be , for example , a camera - enabled mobile phone or a wireless network enabled personal digital assistant ( pda ) with cellular phone capabilities . the cellular telephone print item may be , for example , a multimedia message service ( mms ) message , a short message service ( sms ) message , an email , an image , a file , an object , a contact , a calendar item , and the like . conventionally , if available at all , the printing performed by a cellular telephone of a print item like an mms message has been limited to the text in the message or a single image in the message , but not both . this limited conventional printing , when implemented , has been performed , for example , via a simple object push ( e . g ., obex push over bluetooth ). but a user may desire more than a simple image dump or a text object push . by way of illustration , mms concerns a store and forward method for transmitting related items like graphics , video clips , sound files , short text messages and the like via wireless networks . since an mms message may contain different combinations of these items , a user may want to print various combinations of these items . however , some items ( e . g ., sound files ) may not be printable , other items ( e . g ., graphics interchange format ( gif ) files ) may not be printable on an image forming device with which a cellular telephone communicates via a certain print data transmission protocol , while other items ( e . g ., text , jpeg ( joint photographic experts group ) format files ) may be printable . thus , the cellular telephone protocol adaptive print method 100 includes , at 120 , identifying a print data transmission protocol by which a print job can be transmitted from a cellular telephone to an image forming device via a wireless communication link . identifying the print data transmission protocol by which a print job can be transmitted to an image forming device facilitates determining which , if any , elements of a message like an mms message may be printed by an image forming device that implements , for example , a receiver end of the print data transmission protocol . mms may be implemented over a wireless application protocol ( wap ). wap defines a secure specification that facilitates users accessing , substantially instantaneously , via their cellular telephones , mms messages . the cellular telephones can include , but are not limited to , mobile phones , pagers , two way radios , smart phones , communication systems , and the like . wap implementations can support wireless network technologies like cellular digital packet data ( cdpd ) networking , code division multiple access ( cdma ) processing , global system for mobile communication ( gsm ) networking , time division multiple access ( tdma ), and so on . wap may be supported by operating systems including those engineered for handheld devices . thus , the environment in which the cellular telephone operates may be varied , with differing print capabilities depending on the protocol ( s ) implemented between various cellular telephones and various image forming devices . furthermore , the types of messages received , and the mix of print item elements encountered in those various messages may be varied . thus , identifying the print data transmission protocol at 120 facilitates broadening and / or enriching the print experience of a user by making it more responsive to the varied environment and varied messages that can be encountered by the cellular telephone user . at 120 , identifying a print data transmission protocol may involve actions including , but not limited to , examining a logic on a cellular telephone to identify a supported cellular telephone transmission protocol , examining an image forming device with which the cellular telephone can communicate to determine an available image forming device that can print the print job , identifying an available wireless communication link between the cellular telephone and the image forming device with which the cellular telephone can communicate , and determining a cellular telephone transmission protocol ( s ) that can be employed to transmit a print job over the available wireless communication link ( s ) to the image forming device ( s ) with which the cellular telephone can communicate . by way of illustration , in an mms message , the presentation of the message may be coded into a message presentation file so that images , sounds , text and so on are displayed in a pre - determined order as one singular message . for printing , the presentation may need to be altered since certain types of content may not be printable for one or more reasons . for example , a wireless request to print an mms message including a sound file or a certain graphic file may not be receivable or printable by a certain image forming device using the print data transmission protocol . thus , broadening and / or enriching the print experience is facilitated by method 100 which may include , at 130 , identifying , from printable elements in a print item , print job candidate elements that can be processed into a printer - ready format according to the print data transmission protocol . in other words , the capabilities of the print data transmission protocol can be used to determine which printable elements are printable and / or determine which printable elements are not printable so that time and resources can be optimized by not trying to print unprintable content . for example , an mms message may include a text portion , two graphics portions ( a gif portion , a jpeg portion ) and an audio file . at 130 , the method 100 may identify that the audio file is not printable . the method 100 may also identify , by referring to the print data transmission protocol identified at 120 , that the jpeg graphic portion is printable on the image forming device with which the wireless mobile communication device will communicate via the print data transmission protocol while the gif portion is not . the method 100 may also identify that the text portion is printable . thus , the various printable elements of a print item can be identified as print job candidate elements by the method 100 , and a user and / or logic can determine which , if any , of the print job candidate elements are to be processed into a print job element for transmission to an image forming device . while the print job candidate elements to process can be selected through a user interface or programmatically , the print job candidate elements that are processed into print job elements may also be filtered out of the set of printable elements . for example , a pre - determined , configurable filter that identifies desired printable elements based on attributes like type , size , time stamp , owner , originator , and so on may be employed to select the print job candidate elements that are to be processed . at 140 , after identifying the printable elements of the print item as print job candidate elements ( e . g ., the text and jpeg sections of an mms message ), the method 100 may include selectively processing a print job candidate element into a print job element formatted according to the print data transmission protocol . the method 100 also may include , at 150 , processing the one or more print job elements into a print job . in one example , method 100 may also include transmitting the print job to the image - forming device . in another example , the print data transmission protocol is based on a bluetooth wireless network , a bluetooth basic print profile ( bpp ) and a markup language like xhtml ( extensible hypertext markup language ). in yet another example , the print data transmission protocol is bluetooth . turning now to fig2 , an example implementation of block 140 from fig1 is illustrated . in one example , at 242 , print job candidate elements to process are identified . then , at 244 , printer - ready instructions are prepared . for example , in the mms message described above , the printable text portion and the printable jpeg portion may be wrapped with printer - ready instructions and / or reformatted and then mixed with printer - ready instructions . it is to be appreciated that a cellular telephone print item may be identified in different manners . thus , in one example , a cellular telephone adaptive protocol print method includes , presenting , via a user interface , one or more candidate cellular telephone print items to be processed and receiving , via the user interface , an indication that identifies one or more cellular telephone print items to process . by way of illustration , a cellular telephone user may have received a set of mms messages , a set of sms messages , and a set of emails . if the cellular telephone is camera - enabled , the user may also have acquired a set of images , still and / or video . furthermore , the cellular telephone may have come pre - configured with a set of items ( e . g ., images , text , audio ). thus , the user may have a varied set of items , some of which may be printable in whole or in part . thus , a cellular telephone protocol adaptive printing method can examine the varied set of items and display to the user , via the user interface , which items are printable and , in one example , which of the elements in a print item are printable . for example , an mms message may be presented as being printable , with the printable portions and non - printable portions of the mms message identified by , for example , visual distinctions . fig3 illustrates a portion 242 of an example cellular telephone protocol adaptive print method . at 310 , a determination is made concerning whether the decision about which print job candidate elements are to be processed will involve a user interaction via a user interface . if the determination at 310 is yes , then at 320 print job candidate elements are presented to the user and at 330 an indication is received concerning which print job candidate elements the user desires to have processed into a print job . if the determination at 310 is no , then at 340 the print job candidate elements are compared to a pre - configured set of elements that can include , but is not limited to , a file extension , a candidate element file content , a candidate element file type , a candidate element file format , a candidate element object type , a candidate element message type , a candidate element encoding , a candidate element content , and a candidate element format to a set of one or more types , extensions , contents , and formats supported by the print data transmission protocol . based on the comparison at 340 , a print job candidate element ( s ) is chosen to be processed at 350 . thus , in one example , the portion 242 includes determining which print job candidate elements are to be processed based , at least in part , on a content type supported by the print data transmission protocol . in another example , the portion 242 includes comparing one or more print job candidate elements to a preconfigured set of element types chosen to be printed and , based on the comparison , selecting one or more print job candidate elements to process . thus , print job candidate elements to process into print job elements can be filtered out of the set of available print job candidate elements . for example , a pre - determined , configurable filter that identifies desired printable elements based on attributes like type , size , time stamp , owner , originator , and so on may be employed to select the printable elements that are to be processed . fig4 illustrates a portion 400 of a wireless protocol adaptive printing method that concerns processing print job elements into a print job according to a print data transmission protocol and an information dense content arranger layout . thus , in one example , processing print job elements into a print job includes selecting a configurable information dense content arranger into which the print job elements can be arranged and arranging the print job elements in the configurable information dense content arranger . in one example , the information dense content arranger is designed to interact with the print data transmission protocol . in another example , the configurable information dense content arranger is an xhtml template . in yet another example , the configurable information dense content arranger is an xhtml - print template . it is to be appreciated that references to xhtml are intended to include versions of xhtml like xhtml - print . at 410 , a determination is made concerning whether the decision about which content arranger , if any , will be employed in processing the print job elements into a print job will involve the user via a user interface . if the determination at 410 is yes , then the portion 400 may include , at 420 , presenting to a user , via a user interface , candidate arrangers and , at 430 , receiving , via the user interface , an indication that identifies the arranger into which the print job element ( s ) is to be arranged . thus , at 440 , an arranger can be selected based on the indication received at 430 from the user via the user interface . if the determination at 410 is no , then the portion 400 may include , at 450 , comparing the print job elements to a set of stored print job element patterns , and , at 460 selecting the arranger based on the comparing of 450 . by way of illustration , the set of stored print job elements may include various content layouts designed for various amounts and / or mixes of content in a print job . for example , a first print job that has several small images each captioned with a short text message may lead to selecting an arranger that facilitates viewing multiple images and the associated text on a single page . a second print job that has one large image and a large amount of text to flow around the image may lead to selecting an arranger that facilitates centering the image on a printed page and having the text flow around the image in a pleasing way . a third print job that has several large images that are time stamped may lead to selecting an arranger that facilitates displaying each large image on a separate page with its associated text time stamp . the third print job may benefit from , for example , a first page treatment , a last page treatment , and a header / footer being attached . thus , in one example , the arranger facilitates producing these effects . additionally , other arrangers may facilitate implementing print functionalities including , but not limited to , positioning text and / or images , centering text and / or images , rotating text and / or images , scaling text and / or images , and combining multiple images and / or texts on a printed page . furthermore , other arrangers may facilitate implementing print functionality to account for multiple page prints . for example , multiple page printing may involve automatically handling white space , arranging content into rows and / or columns , numbering pages , generating intelligent page breaks that enhance readability , and the like . once again , arranger selection can enhance the print experience when the arranger is chosen in light of the print data transmission protocol . thus , in one example , an xhtml template may be selected based on its functionality when transmitted over a bluetooth wireless network using bluetooth bpp . thus , printable elements from an mms message may be processed into a print job that is arranged according to the layout in an xhtml template , and then the template is transmitted to an image forming device via a bluetooth wireless network using bluetooth bpp . fig5 illustrates a wireless protocol adaptive printing method 500 . the method 500 may include , at 510 , retrieving a cellular telephone print item from a server . the server types from which the cellular telephone print item can be retrieved include , but are not limited to , an mms server , an sms server , a contact server , a calendar server , a message server , an image server , a text server , and a game server . at 520 , a determination is made concerning whether the cellular telephone print item is a complete message . if the determination at 520 is no , that the cellular telephone print item is not a complete message , then the method 500 may include , at 530 , communicating with a server to retrieve additional data until the cellular telephone print item is a complete message . completing the retrieval at 530 may involve communicating with one or more servers . for example , a message header may have been retrieved at 510 and the message header may indicate that text associated with the message header is available at a text server while images associated with the message header are available at an image server . thus , completing the retrieval at 530 may include communicating with the text server for the text and the image server for the images . once a complete message is retrieved , the method 500 may also include , at 540 , identifying a communication link by which a cellular telephone can communicate with an image forming device and , at 550 , identifying a protocol by which print items can be transmitted . for example , the communication link may be a wireless link supported by wap and the print data transmission protocol may be based on a bluetooth wireless network and bluetooth bpp . the method 500 may also include , at 560 , identifying printable elements in the complete retrieved cellular telephone print item and , at 570 , selectively processing chosen printable elements into print job elements . the method 500 may then include , at 580 selecting an arranger to guide the layout of the print job elements and arranging the print job elements into a print job . in one example the arranger is an xhtml template and the print job elements are merged into the xhtml document along with printer - ready instructions concerning the print job elements . at 590 , the print job is transmitted , via the wireless communication link , using the print data transmission protocol to an image forming device . it is to be appreciated that processor executable instructions for portions and / or all of method 500 may be stored on a computer - readable medium . in one example , a computer - readable medium may store processor executable instructions operable to perform a method that includes , retrieving a cellular telephone print item from an mms server and selectively retrieving additional data from the mms server to make a complete cellular telephone print item that includes printable elements . the method may also include identifying a wireless communication link by which a print job can be transmitted from a camera - enabled mobile phone to a printer via a bluetooth wireless network and bluetooth bpp and filtering out of the printable elements print job elements to process into a printer - ready format , where the identifying depends , at least in part , on content types supported by a bluetooth wireless network and bluetooth bpp . the method may also include processing the print job elements into a print job , where the processing includes generating one or more printer - ready instructions and arranging the print job elements and the printer - ready instructions in an xhtml template . the method may also include transmitting the xhtml template to the printer using the wireless communication link , a bluetooth wireless network , and bluetooth bpp . fig6 illustrates an example cellular telephone 600 configured with a wireless protocol adaptive printing system . the cellular telephone 600 may communicate with an image forming device 610 over a wireless network using , for example , bluetooth protocols , and / or ieee 802 . 11 protocols . bluetooth refers to short - range radio technology concerned with data and / or computer communications . information concerning the bluetooth specification and protocols can be found , for example , at www . bluetooth . org . ieee 802 . 11 refers to a family of specifications developed by the institute of electrical and electronics engineers ( ieee ) for wireless local area network ( lan ) technology . the image forming device 610 may be , for example , a printer . the cellular telephone 600 may be , for example , a camera - enabled mobile phone . the cellular telephone 600 may have available a print item 620 to be processed by the print system . the print item 620 may be associated with a message received from a server . servers with which the message may be associated include , but are not limited to , an mms server , an sms server , an image server , a text server , an audio server , and so on . thus , the print item 620 may include various parts 622 . some of the parts 622 may be printable ( e . g ., text , jpeg file ) on the image forming device 610 when communicated via a print data transmission protocol . in one example , the print item 620 may be an mms message . the cellular telephone protocol adaptive print system may include a content transforming logic 630 configured to process the print item 620 into a print job 640 pursuant to a print data transmission protocol supported by a mobile device protocol logic 650 . the protocol logic 650 may be configured , for example , to transmit a print job 640 from a cellular telephone 600 to an image forming device 610 pursuant to a print data transmission protocol . thus , the protocol logic 650 can be said to support a print data transmission protocol . in one example , the print data transmission protocol is based on a bluetooth wireless network and bluetooth bpp . in one example , the cellular telephone protocol adaptive print system may be incorporated in a wireless communication device 600 . the cellular telephone 600 may be , for example , a camera - enabled mobile phone . the image forming device 610 may include a receiving protocol logic 660 configured to receive a print job 640 processed by the mobile device protocol logic 650 . additionally , the image forming device 610 may include a rendering logic 670 configured to process the print job received by the receiving protocol logic 660 into a printer - usable format . the rendering logic 670 may be configured , for example , to render the print job received by the receiving protocol logic 660 into a bitmap . printer - ready formats can include forms like printer - ready bits , printer - ready instructions , printer - independent data and instructions and so on . in one example , the system provides the print job 640 in the form of “ printer - ready bits ” ( e . g ., a rendered image , a bitmap ), while in another example , the system provides the print job 640 in the form of “ printer - ready instructions ” ( e . g ., postscript instructions , xhtml instructions ). printer - ready bits may include , for example , data rendered into a format acceptable to a printer where the printer can print the data without further rendering . printer - ready instructions may include , for example , data prepared and packaged into a file that is in a format acceptable to a printer where the printer can print the data by processing the instructions included with the data . thus printer - ready bits and printer - ready instructions refer to an item that has a data representation acceptable to and / or usable by a printer . in another example , the system provides the print job 640 in a printer - independent yet still printer - ready format . for example , data like vcard and / or vcal data may be provided . in yet another example , the system provides the print job 640 in a format suitable for display on a device like a computer monitor or television screen rather than on a printer . thus , it is to be appreciated that the print job 640 is not limited to printer - ready data destined for a printer and that the image forming device may take various forms ( e . g ., printer , display ). fig7 illustrates a cellular telephone 700 that can communicate with an image forming device 710 comprising a protocol logic 770 and a rendering logic 780 , where the cellular telephone 700 is configured with a user interface logic 720 . the user interface logic 720 may be configured to present information related to parameters associated with items including , but not limited to , a print item 730 , a print item element 732 , a content transforming logic 740 , a print job 750 , and a mobile device protocol logic 760 . additionally , the user interface logic 720 may be configured to receive , for example , an indication and / or a value associated with the parameters associated with the print item 730 , the content transforming logic 740 , the print job 750 , and the mobile device protocol logic 760 . the user interface logic 720 thus facilitates configuring and / or controlling the print system on the cellular telephone 700 . by way of illustration , although the cellular telephone 700 may receive a variety of print items 730 , a user may only be interested in printing certain print items . thus , the user interface logic 720 may be employed to configure the content transforming logic 740 to consider a set of print items 730 for printing while rejecting others . similarly , a print item 730 may have a variety of printable and non - printable elements 732 . thus , the user interface logic 720 can be employed to configure the content transforming logic 740 to consider some elements 732 of a print item 730 as printable while considering other elements 732 not to be printable . furthermore , a print job 750 may be able to be laid out according to a variety of arrangements . thus , the user interface logic 720 can be employed to design , modify , maintain , select , and so on different possible templates , arrangements , and so on for a print job 750 . the user interface logic 720 can also be configured to facilitate managing parameters associated with filtering . for example , print items to process can be filtered out of a set of available print items based on their relationship to one or more pre - determined , configurable filtering parameters . so too can print item elements to be processed by filtered from available print item elements based on their relationship to one or more pre - determined , configurable filtering parameters . likewise , content arrangers to suggest to a user can be filtered out of the entire set of available content arrangers based on conformity with one or more pre - determined , configurable parameters . fig8 illustrates a cellular telephone 800 that can communicate with an image forming device 810 where the cellular telephone 800 is configured with a print system that includes a server logic 820 . the server logic 820 can be configured to provide a print item 860 to a content transforming logic 870 using a protocol logic 890 for conversion into a print job 880 . the server logic 820 may interact with , for example , a data store 830 on the cellular telephone 800 to retrieve an element ( s ) of a print item 860 . similarly , the server logic 820 may interact with a server 840 to retrieve a print item 860 or portions thereof . the print item 860 , and / or a printable element associated with the print item 860 may be located in , for example , a data store 850 that the server 840 accesses at the request of the server logic 820 . while a single server 840 and a single data store 850 are illustrated , it is to be appreciated that a greater number of servers 840 and data stores 850 may be accessed by the server logic 820 . in one example , the server logic 820 is configured to provide the print item 860 to the content transforming logic 870 by providing a print item identifier and a print item sub - element ( s ). the print item sub - elements may have of one or more print item sub - element types . for example , a print item sub - element may be text , an image in a first format ( e . g ., jpeg ), an image in a second format ( e . g ., gif ), an audio element , and so on . when the server logic 820 provides a print item identifier ( e . g ., a print item header ) to the content transforming logic 860 , the content transforming logic 860 may determine to selectively acquire a sub - element . for example , the content transforming logic 860 may determine to acquire the text element and the jpeg element , but to not acquire the gif element and the audio element . thus , the server logic 820 can be configured to communicate with a server 840 to selectively retrieve a print item and / or a print item element . the server 840 may be , for example , an mms server , an sms server , a game server , a text server , an image server , a message server , a calendar server , a contact server , and the like . fig9 illustrates a cellular telephone 900 configured with a wireless protocol adaptive print system . the system includes a data store 910 that may store a sub - element holder . which sub - element holders are stored in data store 910 and / or which sub - element holders are retrieved from data store 910 when processing print data on the cellular telephone 900 may depend on which cellular telephone print item transmission protocol ( s ) is supported by a protocol logic 920 . the protocol logic 920 may be configured to process wireless data transmissions across a wireless communication link where the wireless data transmissions are formatted according to certain specifications . for example , the protocol logic 920 may be configured to support wireless data transmissions in accordance with a bluetooth based network or an ieee 802 . 11 based network . similarly , the protocol logic 920 may be configured to transmit data written in languages like xhtml , xhtml - print , wml ( wireless markup language ), xml ( extensible markup language ), html ( hypertext markup language ), and the like . the system includes a content transforming logic 930 that may be configured to selectively process a print item 940 sub - element into a portion of a print job 950 based , at least in part , on whether the mobile device protocol logic 920 supports transmitting a print item sub - element type . for example , one implementation of bluetooth bpp may support preparing a jpeg file for transmission over a bluetooth based wireless network while another implementation of bluetooth bpp may not support preparing a gif file for transmission over a bluetooth based wireless network . the system can include data store 910 that stores a configurable print item sub - element holder . thus , in one example , the content - transforming logic 930 may be configured to place a processed print item sub - element in a configurable print item sub - element holder . the configurable print item sub - element holder may be , for example , an xhtml template , an xhtml - print template , and the like . but , there may be a variety of sub - element holders into which a print item sub - element may be placed . thus , in one example , the protocol logic 920 is configured to select a print item sub - element holder into which the content - transforming logic will process a print item sub - element based , at least in part , on attributes including , but not limited to , the number of print item sub - elements to be processed , the type of print item sub - elements to be processed , the variety of types of print item sub - elements to be processed , and a print data transmission protocol supported by the protocol logic 920 . by way of illustration , the protocol logic 920 may determine that there is one print item sub - element to place in print job 950 . this single print item sub - element may be a graphics file that includes a time stamp and a caption . furthermore , the protocol logic 920 may determine that a cover sheet is appropriate for this type of graphic ( e . g ., secure information ). thus , the protocol logic 920 may select a sub - element holder from data store 910 based on the protocol that will be employed to transmit the print job 950 to an image forming device and the number and type of elements ( e . g ., single time stamped captioned image of secure data ) in the print item . by way of further illustration , the protocol logic 920 may determine that there are four hundred print item sub - elements to place in print job 950 . for example , a user may desire to print out their entire contacts file . thus , the protocol logic 920 may select a modular sub - element holder from data store 910 that facilitates arranging multiple images and text on a single page , and that facilitates processing multiple instances of the page . furthermore , the protocol logic 920 may select a sub - element holder or set of sub - element holders that facilitate first and last page treatments , headers and footers and the like . it is to be appreciated that a configurable print item sub - element holder may support print functions including , but not limited to , positioning , centering , rotating , and scaling a print item sub - element . similarly , it is to be appreciated that a configurable print item sub - element holder may support print functions including , but not limited to , a first page treatment functionality , a last page treatment functionality , a header functionality , a footer functionality , a page numbering functionality , a multiple image - per - page functionality , a functionality for combining a text print item sub - element or one or more image print item sub - elements , and a time stamping functionality for a print job . the cellular telephone 900 may have applications or logics that have native data types . for example , a contact application may have a native data type for storing contacts . similarly , a calendar application may have a native data type for storing calendar information . while a contact and a calendar application are described , it is to be appreciated that a cellular telephone 900 and / or wireless devices for which it may act as a print server may have other applications with other native data types . thus , in one example , the content transforming logic 930 is configured to process a print item that includes a variable of a data type that is native to a cellular telephone 900 . in another example , the content transforming logic 920 is configured to process data types that are native to the cellular telephone 900 and that are dynamically extensible . as described above , various forms of filtering may be employed in a cellular telephone protocol adaptive print system . thus , cellular telephone 900 may include a filtering logic 960 configured to perform one or more of the filtering operations described above . fig1 illustrates an example image forming device 1000 that includes a compatible rf transceiver logic 1005 . the image forming device 1000 may include a memory 1010 configured to store a printer - ready object received from a cellular telephone where the object was prepared to conform with a print data transmission protocol . the image forming device 1000 may be configured to respond to queries from cellular telephones relating to print jobs . therefore , the image forming device 1000 may include a print service request logic 1015 that , when the image forming device 1000 is queried , can transmit information about the object stored in memory 1010 and / or the processing thereof in response to the print service query . the print service request logic 1015 may also , periodically , or under image forming device 1000 control , transmit information about the object stored in memory 1010 and / or the processing thereof . the print service request logic 1015 may be implemented , for example , as a logic . the print service request logic 1015 may also be configured to initiate the transmission of the data to a cellular telephone without receiving a query , status request or print service request . for example , one or more elements of the information about a print job can be automatically transmitted based on predetermined triggering events like a time period elapsing , a processing event occurring , and / or other event occurring . in this manner , the image forming device 1000 can provide automatic status updates to cellular telephones that have a print job being processed . it will also be appreciated that the print service request logic 1015 can also be configured to monitor and provide state information and the like for print data associated with multiple cellular telephones . additionally , the image forming device 1000 may include rendering logic 1025 configured to generate a printer - ready image from a received non - printer - ready object received , for example , in an imaging request . rendering varies based on the format of the data involved and the type of imaging device . in general , the rendering logic 1025 converts a high - level object - based description ( e . g ., the imaging request ) into a graphical image for a display or printing ( e . g ., the print - ready image ). for example , one form is ray - tracing that takes a mathematical model of a three - dimensional object or scene and converts it into a bitmap image . another example is the process of converting html into an image for display / printing . in another example , the image forming device 1000 may not have a rendering logic 1025 . in this case , a print job would be transmitted to the image forming device 1000 in a print - ready format . the image forming device 1000 may also include an image forming mechanism 1030 configured to generate an image onto print media from the print - ready image . the image forming mechanism 1030 may vary based on the type of imaging device 1000 and may include a laser imaging mechanism , other toner - based imaging mechanisms , an ink jet mechanism , digital imaging mechanism , or other imaging reproduction engine . a processor 1035 may be included that is implemented with logic to control the operation of the image - forming device 1000 . in one example , the processor 1035 includes logic that is capable of executing java instructions . other components of the image forming device 1000 are not described herein but may include media handling and storage mechanisms , sensors , controllers , and other components involved in the imaging process . fig1 illustrates an example data packet 1100 associated with systems and methods for cellular telephone protocol adaptive printing . information can be transmitted between various logics and / or communication components associated with cellular telephone protocol adaptive printing via a packet like data packet 1100 . example data packet 1100 includes a header field 1110 where information like the length and type of data packet 1100 may be stored . the header field 1110 may also include , for example , a source identifier that identifies , for example , a network or other address of the source of the data packet 1100 . the header field 1110 may also include , for example , a destination identifier that identifies , for example , a network or other address of the intended destination for the packet 1100 . thus , the header field 1110 may include , in one example , a cellular telephone address associated with a cellular telephone from which a print job originated and a network address of a printer to which the print job is to be delivered . it is to be appreciated that the source and destination identifiers may take forms including , but not limited to , globally unique identifiers ( guids ), uniform resource locations ( urls ), path names , and so on . other types and forms of information that can be included in the data packet 1100 that can depend on the communication protocol being employed . the data field 1120 may include various information intended to be communicated between the source and destination . example fields 1122 and 1124 are provided . by way of illustration , data associated with a cellular telephone protocol adaptive print system may be stored in field 1122 . this data may supply information about the set of wireless network protocols and specifications , hardware configurations , software configurations , wireless network file formats , printer - ready instruction file formats , printer - ready instruction languages , and so on that form a print data transmission protocol that facilitate transmitting a print job between a cellular telephone and an image forming device . by way of illustration , the print protocol information stored in field 1122 may identify a bluetooth standard associated with the protocol , an xhtml - print version associated with the protocol , a bluetooth bpp standard associated with the protocol and so on . field 1124 may store , for example , print item information . the print item information may be , for example , a print item identifier , a print item , and so on . fig1 illustrates an example cellular telephone 1200 that includes a cellular telephone adaptive protocol print system 1202 . in addition to the cellular telephone adaptive protocol print system 1202 , the cellular telephone 1200 may include a processing system that has , for example , a processor 1205 , an operating system 1210 , and an application programming interface ( api ) 1215 to facilitate communications between one or more of , the software application 1220 , the cellular telephone adaptive protocol print system 1202 , and the operating system 1210 . the processing system of the cellular telephone 1200 can be configured to execute a variety of software applications 1220 . other components of the cellular telephone 1200 may include a memory and / or storage 1235 that can include a computer - readable medium . the storage 1235 may also include a port that accepts and reads data stored on a removable memory card or other removable computer - readable medium . an interface 1240 can include a display screen , one or more buttons , a pointing device , or other types of devices that can communicate data to a user and receive input from a user . to perform wireless communication , a wireless transceiver logic 1245 is provided . depending on the wireless communication protocol desired , the transceiver logic 1245 can be configured according to different specifications . in one example , the wireless protocol is bluetooth based and the transceiver 1245 would include a bluetooth radio and antenna . other protocols include ieee 802 . 11 and other available wireless protocols . in one example , the wireless transceiver logic 1245 includes a radio frequency transceiver configured to transmit and receive radio frequency signals . infrared communication can also be employed . the transceiver logic 1245 may be , for example , a microchip in the cellular telephone 1200 or configured on a removable device like a pcmcia card ( pc card ) that can be connected and disconnected to the cellular telephone 1200 via a connection port or slot . in one example , the cellular telephone 1200 includes a digital camera 1260 . in this example , the cellular telephone 1200 may be referred to as a camera - enabled phone . the systems , methods , objects and so on described herein may be stored , for example , on a computer - readable medium . an example computer - readable medium can store , for example , processor executable instructions for a cellular telephone protocol adaptive printing method that includes identifying a cellular telephone print item to print , where the cellular telephone print item includes printable elements , identifying a print data transmission protocol by which a print job can be transmitted from a cellular telephone to an image forming device via a wireless communication link , identifying , from printable elements , print job candidate elements that can be processed into a printer - ready format according to the print data transmission protocol , selectively processing print job candidate elements into print job elements formatted according to the print data transmission protocol , and processing print job elements into a print job . while the above method is described being stored on a computer - readable medium , it is to be appreciated that other methods described herein can also be stored on a computer - readable medium . while the systems , methods , and so on have been illustrated by describing examples , and while the examples have been described in considerable detail , it is not the intention of the applicants to restrict or in any way limit the scope of the appended claims to such detail . it is , of course , not possible to describe every conceivable combination of components or methodologies for purposes of describing the systems , methods , and so on employed in mobile communication device printing . additional advantages and modifications will readily appear to those skilled in the art . therefore , the invention , in its broader aspects , is not limited to the specific details , the representative apparatus , and illustrative examples shown and described . accordingly , departures may be made from such details without departing from the spirit or scope of the applicants &# 39 ; general inventive concept . thus , this application is intended to embrace alterations , modifications , and variations that fall within the scope of the appended claims . furthermore , the preceding description is not meant to limit the scope of the invention . rather , the scope of the invention is to be determined by the appended claims and their equivalents . to the extent that the term “ includes ” is employed in the detailed description or the claims , it is intended to be inclusive in a manner similar to the term “ comprising ” as that term is interpreted when employed as a transitional word in a claim . furthermore , to the extent that the term “ or ” is employed in the claims ( e . g ., a or b ) it is intended to mean “ a or b or both ”. when the applicants intend to indicate “ only a or b but not both ” then the term “ only a or b but not both ” will be employed . thus , use of the term “ or ” herein is the inclusive , and not the exclusive use . see , bryan a . garner , a dictionary of modern legal usage 624 ( 2d . ed . 1995 ).

7Electricity

reference is now made to fig1 which is a pictorial illustration of a portable hand held device for hair removal , generally referenced 10 , constructed and operative in accordance with an embodiment of the present invention and to fig2 which is a cross section illustration of the device 10 of fig1 taken along the lines ii — ii . device 10 includes a housing 12 , a flash lamp 14 for providing heat and a pulsed broad band light suitable for hair removal , and an assembly 16 for supplying power for energizing and controlling the application of power to flash lamp 14 . flash lamp 14 can be a xenon flash lamp having a glass tube , but can also be any other suitable flash lamp . assembly 16 is preferably electrically connected to flash lamp 14 by electrically conducting insulated wires 9 . for the sake of clarity of illustration , wires 9 are not shown in fig2 . housing 12 of device 10 has an opening 21 therein . housing 12 is preferably made of a thermally insulating material , for example , a high temperature plastic or a ceramic material . housing 12 preferably has a sealing gasket 17 made from any suitable flexible material such as soft rubber for sealing the contact between housing 12 and a skin surface ( not shown ) on which opening 21 of housing 12 is placed before and during depilation . however , sealing gasket 17 is not critical to the operation of device 10 . however , it is desirable that sealing be achieved by pressing opening 21 against the skin . housing 12 includes internal surfaces 15 that may be coated with a diffusely reflective coating ( not shown ) of high reflectivity such as a finely divided titanium dioxide based coating or any other suitable heat resistant highly reflective coating . as described below , coating that reflect ir well but do not reflect radiation having long wavelengths may advantageously be used . reference is now made to fig3 which is a cross section illustrating another implementation of a portable hand held device 20 for hair removal , in accordance with another embodiment of the present invention . device 20 is similar to device 10 except that it includes a reflector 13 within housing 12 . flash lamp 14 is disposed within reflector 13 . for the sake of clarity of illustration , wires 9 between the flash lamp 14 and the assembly 16 are not shown in fig3 . housing 12 of device 20 has an opening 23 therein , having the function of opening 21 of device 10 . reference is now made to fig4 which is a schematic cross section illustration useful in understanding the method of operation of the device of fig2 . when opening 21 of device 10 is placed on skin 25 , a sealed air cavity 11 is formed between housing 12 and skin 25 . sealed air cavity 11 contains a volume of air 26 . sealing of the cavity is desirable and is preferably achieved by pressing gasket 17 against skin 25 . the region of skin 25 covered by opening 21 includes a plurality of hairs 27 . each of hairs 27 has a first part 31 which is disposed within hair follicles 33 and a second part 29 protruding outside of skin 25 in a direction generally distal from the surface of skin 25 . a user activates device 10 by energizing flash lamp 14 . for example , device 10 may be activated by the user by pressing a button ( not shown ) or activating a switch ( not shown ) positioned on assembly 16 or on any other suitable part of the device 10 . when assembly 16 energizes flash lamp 14 , flash lamp 14 produces a broad band light pulse having an approximate duration of 1 - 75 milliseconds and an energy density of preferably between 1 . 5 to 5 joule / cm 2 measured on the skin . the light pulse irradiates the region of skin 25 underlying opening 21 of housing 12 . the light pulse also irradiates hairs 27 . a part of the light pulse is absorbed by melanin pigment in hairs 27 . another smaller part of the light pulse is absorbed by the region of the skin 25 directly underneath the opening 21 . in preferred embodiments of the invention , the amount of energy pulsed through the flash lamp 14 is such that the absorption of the light by the region of skin 25 raises the temperature of the region of skin 25 . however , this temperature is preferably lower than the coagulation temperature of blood . preferably , the temperature of hair follicles 33 and skin 25 due to the absorption of radiation from the light pulse should not exceed 50 - 65 ° c . since most of the radiation from flash lamp 14 is absorbed by the melanin in the hair while only a small portion of the radiation is absorbed by the skin tissue , skin tissue which is more than about 0 . 2 mm from hair follicles 33 is heated negligibly . about half of the electrical energy used to energize flash lamp 14 is wasted to heat the flash lamp itself , heating flash lamp 14 to a much higher temperature than that of air volume 26 surrounding the flash lamp 14 . typically , in glass flash lamps the temperature of the flash lamp may reach a temperature between 600 - 800 ° c . and in quartz flash lamps the temperature of the flash lamp may reach a temperature between 1200 - 1600 ° c . the maximal temperature of the flash lamp is typically reached within 1 - 2 milliseconds . the air immediately adjacent to the flash lamp 14 is heated by the flash lamp . heat is conducted by convection from air adjacent flash lamp 14 to air which is further away from flash lamp 14 , creating a temperature gradient in the air contained in cavity 11 . the temperature of the air close to the flash lamp will be the highest and will decrease as the distance from flash lamp 14 increases . since each of hairs 27 protrudes from skin 25 along the sealed air cavity 11 in the general direction of the flash lamp 14 , those parts of hairs 27 that are closer to flash lamp 14 will be exposed to air having a higher temperature than the parts of the same hairs which are closer to skin 25 . thus , the part of a hair 27 closer to the flash lamp will be heated by the hot air to a higher temperature than the part of the same hair which are closer to skin 25 . heat will be conducted from the hotter parts of hair 27 towards first part 31 of hair 27 . the heat flow will increase the temperature of first part 31 and hair follicle 33 surrounding it to a temperature of approximately 70 - 100 ° c . which is sufficient to cause the coagulation of the blood capillaries supplying blood to hair follicle 33 . additionally , the temperature reached by many of the hairs at parts which are closer to the flash lamp are sufficiently high to cause burning or carbonization of a substantial portion of the hair thus effectively removing a substantial portion of the hair . it is noted that , it is not necessary to shave hairs 27 prior to hair removal by the methods of the present invention . however , if the hair is cut , shaved or otherwise shortened , it was found that hairs that have a shaft protruding roughly 2 mm or more from the skin surface in the general direction towards flash lamp 14 are removed more effectively by the device . the heat gradient in the volume of air 26 within air cavity 11 tends to equilibrate so that the air temperature near the surface of the region of skin 25 rises with time after the energizing of flash lamp 14 . to prevent the temperature of the skin from rising above 70 ° c ., housing 12 may be lifted away from skin 25 . lifting of housing 12 causes opening of air cavity 11 and prevents excess heating of the skin 25 allowing air at room temperature to contact the skin . alternatively or additionally , the heated air may be removed from the cavity . it is noted that , typically , hairs 27 are not necessarily aligned perpendicularly to the surface of the skin . hairs which are lying in a general direction parallel to the surface of the skin 25 will reach a temperature lower than hairs which are generally aligned perpendicular to the surface of the skin . thus , it may be desirable to align as many of hairs 27 as possible in a direction generally perpendicular to the surface of the skin . reference is now made to fig5 a which is a schematic partly cross - sectional partly functional diagram illustrating a portable hand held device 30 for hair removal , having an air pump 34 for assisting the proper alignment of hairs in accordance with a preferred embodiment of the present invention . device 30 includes a flash lamp 14 disposed within a housing 32 and an assembly 16 for energizing the lamp 14 . housing 32 has an opening 21 and differs from housing 12 of fig1 in that it is connected to air pump 34 , for example by a tube 36 . air pump 36 is preferably an electrical air pump but can be any other suitable small air pump . device 30 further preferably includes a controller 38 suitably connected to air pump 36 and to e assembly 16 . controller controls the timing of activation of air pump 36 and the timing of the energizing of flash lamp 14 by assembly 16 . controller 38 may also include a power source ( not shown ) for supplying power to air pump 36 . the power source may be an electrical battery , a mains operated power supply or any other suitable power source . alternatively , the power to operate air pump 36 may be supplied by a power source ( not shown ) included within assembly 16 and also used for energizing flash lamp 14 . air pump 36 is preferably a reversible air pump . reversing the direction of pumping respectively reverses the flow of air into and out of the cavity . device 30 is operated by placing opening 21 of the housing 32 on a region of skin 25 to be depilated and activating controller 38 . in a preferred embodiment of the invention , controller 38 first activates air pump 36 to pump some of the air out of a sealed air cavity 39 formed between housing 32 and the region of skin 25 adjacent opening 21 . the pumping action causes the erection of at least some of hairs 27 so that they do not lie against the skin by applying a gentle suction action to the region . this first action of the pump is desirable , but not essential for operation of the device . after partial alignment of the hairs is achieved , the pump is preferably turned off and controller 38 activates assembly 16 to energize flash lamp 14 . the light and heat pulse generated by flash lamp 14 operate to remove at least part of the hairs 27 as disclosed above in detail for the device 10 of fig1 . after the hair removing action is achieved and before the temperature of the region of skin 25 exceeds a value that might cause a skin burn ( which is roughly 0 . 5 seconds after energizing flash lamp 14 ), controller 38 automatically reverses the direction of air pumping by air pump 36 . this reversal pumps air at room temperature from outside of the device 30 into the housing 32 , dissipates the heat within the housing by displacing the volume of air within it with air at room temperature . the flow of air also cools the region of skin 25 to prevent the development of a skin burn . fig5 b shows a hair removal device 30 ′ in accordance with an alternative preferred embodiment of the invention . while suction is shown as being applied at the side of the cavity in fig5 a , it is more effectively applied at or near the top of the housing , as shown in fig5 b . furthermore , while , as shown in fig5 a , the hot air must leave the housing via opening 21 , valved openings 90 ( which open in direction 92 ) are provided on the side walls of the housing in fig5 b to aid in the entry of fresh air into the cavity and removal of air from the cavity by pump 36 . in this embodiment , pump 36 is preferably a purely suction pump . in operation the pump is preferably activated before the flash to raise the hair from the skin . then the pump operation is interrupted and the lamp is flashed . after a short time the pump is activated again to bring fresh air into the cavity and remove heat from the cavity and from the flash lamp . the time between the flashing of the lamp is such that the hair has enough time to conduct the heat to the follicle and heat it to the proper temperature for coagulation but not so long that the heat from the lamp reaches the skin to the extent that it causes burning or even , preferably , any discomfort . this time is in the order of 0 . 1 - 2 seconds , more preferably 0 . 2 - 1 seconds and most preferably about 0 . 5 seconds . it should be noted that the valves are kept closed immediately after flashing by the pressure build - up of the heat in the cavity . devices 30 and 30 ′ have the advantage of improving the efficiency of hair removal by improving the hair alignment and also has the advantage of being automatic obviating the need of timely manual lifting of the device by the user . additional methods of hair alignment are also possible . reference is now made to fig6 a and 6b . fig6 a is a schematic perspective breakaway view of a hair removal device 40 having a comb like hair aligning member 42 for hair alignment , in accordance with another preferred embodiment of the present invention . device 40 is similar to device 10 of fig1 except that device 40 includes hair aligning member 42 spanning across part of opening 21 . preferably , hair aligning member 42 is a flat thin comb - like member made from a metal such as stainless steel or from any other suitable material such as another metal , plastic , a ceramic material and the like . in a preferred embodiment of the invention hair aligning member 42 includes a plurality of teeth 44 separated by a plurality of narrow gaps 46 . typically , the width of the teeth 44 is approximately 0 . 7 millimeters and the width of the gaps 66 is approximately 0 . 2 millimeters . however , these dimensions may be varied to accommodate different hair thicknesses . furthermore , the hair aligning member 42 may be detachably attached to the housing 12 to facilitate quick attachment of various differently shaped hair aligning members ( not shown ) by the user . hair aligning member 42 may be attached to housing 12 such that when sealing gasket 17 is placed in contact with the skin , teeth 44 contact the skin . alternatively , hair aligning member 42 may be attached to housing 12 such that when sealing gasket 17 is placed in contact with the skin , teeth 44 do not contact the skin and are positioned a small distance above the skin . when device 40 is used for removing hair it is placed on the skin so that sealing gasket 17 contacts the skin . device 40 is moved along the skin in a direction parallel to the orientation of teeth 44 as indicated by an arrow 47 . this movement of device 40 along the skin causes some of the hairs ( not shown ) to enter gaps 44 and improves their alignment in a direction roughly perpendicular to the surface of the skin . after hair alignment , device 40 ( whose internal structure may differ from that shown in fig6 a and may have features shown in other figs .) is operated to remove hair as disclosed above . these actions of hair aligning followed by hair removing may be then repeated by the user either of the same skin area or on a different skin area . fig6 b is a schematic cross sectional view illustrating of device 40 of fig6 a positioned over a region of skin 25 . some of hairs 27 are shown disposed in gaps 46 between different pairs of teeth 44 . when device 40 in moved along the skin , comb like member 42 aligns and raises some of hairs 27 to facilitate hair removal . it is noted that while hair aligning member 42 is shaped like a comb , other implementations of the hair removal device may have other different forms of hair aligning members . for example , the hair aligning members may be constructed in the shape of flat flexible perforated metal sheets ( not shown ) having a plurality of openings therethrough such as the hair aligning members known in the art and used in electrical shaving machines . the construction of such aligning members is well known to those skilled in the art and will therefore not be further described . it is further noted that , the methods of hair removal disclosed hereinabove may also be applied to skin without including the first step of photothermal heating of the hair portions within the follicles to a temperature of between 50 - 65 ° c . as described above . while the selective heating of the hairs and hair follicles to a sub - coagulation temperature may improve the efficiency of hair removal , hairs can also be removed by the air heating action and subsequent burning and / or carbonization of the hairs caused by the heating of the hair shafts due to the hot air within the sealed air cavity . thus , hair can still be efficiently removed even in situations where the broad band light pulse from the flash lamp 14 does not efficiently reach the part of the hair shaft which is sheathed within the hair follicle because of partial or full blocking of the light pulse by the hair aligning member 42 or by other different forms of hair aligning members used in different embodiments of the present invention . it is still further noted that while the preferred embodiments of the hair removing device disclosed above are implemented using a glass xenon flash lamp , the life span of the flash lamp may be significantly improved by using a quartz xenon flash lamp . however , unlike the light generated by glass xenon flash lamps which does not include substantial ultraviolet ( uv ) radiation ( due to the absorbence of uv radiation by the glass tube of the xenon flash lamp ), the light generated by quartz xenon flash lamps includes uv light radiation in the spectral range between 200 - 400 nanometers that may cause damage to the skin tissue . when such quartz flash lamps are used , the light pulsed from the flash lamp has to be filtered to remove the undesirable portion of the uv radiation from the light reaching the skin . for example , if a comb member as shown in fig6 a and 6b is used , it may be made of orange or red colored perspex which blocks at least part of such light . reference is now made to fig7 and 8 which are schematic cross - sectional views of hair removal devices using different forms of filters for filtering the light pulse , in accordance with additional preferred embodiments of the present invention . fig7 illustrates a hair removal device 50 . device 50 is similar to device 10 of fig1 and 2 , except that device 50 uses a quartz flash lamp 54 instead of glass flash lamp 14 of device 10 and includes a filter 56 for filtering out the undesired uv radiation emitted by quartz flash lamp 54 . filter 56 can be a model 450fh90 - 25 long wave pass filter commercially available from andover corporation , nh , usa or merely a colored plastic . this long wave pass filter absorbs most of the radiation having a wavelength below 450 nanometers while transmitting most of the radiation having a wavelength above 450 nanometers . filter 56 may be any other suitable filter having the proper absorption properties to absorb the undesirable uv radiation while passing longer wavelengths of radiation , and having a sufficiently high thermal conductivity and a sufficiently low thermal mass to assure a high rate of heat flow from flash lamp 54 and the hot air surrounding it to filter 56 and the subsequent heat flow from filter 56 to air adjacent side 56 a of filter 56 facing towards the opening 21 . device 50 is used for hair removal as described above for device 10 except that the heat generated by pulsing the flash lamp 54 has to flow through uv filter 56 to form a temperature gradient in the sealed air cavity enclosed within filter 56 , the walls of housing 12 and the skin on which the device 50 is placed . it is noted that quartz xenon flash lamps may reach an initial temperature of 1200 - 1600 ° c . after pulsing . these temperatures which are higher than those attained by glass xenon flash lamps may compensate for the presence of filter 56 . it is further noted that , while filter 56 of fig7 is flat , filter 56 may have other suitable shapes and geometry . for example , filter 56 may be concave or convex . fig8 illustrates a hair removal device 60 which is similar to the device 50 , except that instead of the flat filter 54 of fig7 device 60 includes a cylindrical filter 66 attached to housing 12 . quartz flash lamp 54 is disposed within cylindrical filter 66 for filtering the broad band light generated by the flash lamp 54 as disclosed above . as indicated above , the use of a comb with filtration properties may obviate the need for an additional filter . the devices disclosed above may be used for removing hair from various body regions of the user such as the hands , legs face and other body regions . it is therefore desirable to provide the device of the present invention with a way of adapting the device for removing hair from body regions having different sizes and shapes . reference is now made to fig9 which is a schematic cross section illustrating a device for hair removal 70 adapted for use with a plurality of differently shaped extenders , in accordance with a preferred embodiment of the invention . device 70 includes a housing 15 having a raised collar 17 . device 70 further includes a quartz flash lamp 54 and an assembly 16 for energizing flash lamp 54 and for controlling the operation as disclosed above . device 70 also includes a uv filter 56 attached to housing 15 as disclosed above . an extender 63 is detachably attached to housing 17 . in a preferred embodiment of the invention extender 63 is attached to housing 15 by forcing the extender over raised collar 17 . extender 63 is a preferably hollow and has a first end 63 a attachable to the raised collar 17 and a second end 63 b for contacting the skin . extender 63 preferably has an aperture 19 defining an area for removing hairs . in one embodiment of the invention , extender 63 is a metal extender . however , extender 63 is desirably made of a thermally insulating material such as a plastic or a ceramic material . device 70 is operated by pressing aperture 19 against the skin and energizing quartz flash lamp 54 as disclosed above . it is noted that many different forms of extender 63 can be made , each having an aperture of a different shape and / or size for adapting device 70 for removing hair from different regions of skin of different organs such as the face the limbs and the like . reference is now made to fig1 - 12 which are schematic isometric views of three differently shaped extenders 65 , 67 and 69 useful for hair removal when used with the hair removal device 70 of fig9 . fig1 illustrates an extender 65 having a rectangular aperture 75 . fig1 illustrates an extender 67 having an ellipsoidal aperture 77 . fig1 illustrates an extender 69 having a circular aperture 79 . each of extenders 65 , 67 and 69 may be used with device 70 for removing hair from various skin regions . it is noted that , extenders 63 , 65 , 67 and 69 of fig9 - 12 , respectively , may also include a sealing gasket ( not shown ) attached to the end of the extender distal from device 70 and made from a soft resilient material such as soft rubber for better sealing of the contact region with the skin . extenders 63 , 65 , 67 and 69 of fig9 - 12 , respectively may or may not be internally coated as described above . in accordance with a preferred embodiment of the present invention , flash lamps 14 and 54 may be disposable to allow convenient replacement of the lamp once it is burnt out . it is noted that , while the preferred embodiments of the hair removing devices of fig1 - 9 have a housing shaped generally as a rectangular open box , other embodiments are possible in which the housing has other shapes such as a cylindrical shape , a triangular prism shaped open box , a truncated triangular prism shaped open box or any other suitable shape having an open side and capable of forming a sealed cavity when suitably placed on the skin . a preferred embodiment of the assembly 16 as shown in fig1 a , comprises two capacitors 100 and 102 , a charging resistor 103 , a power source 104 , a thyristor or other switch 106 and a trigger transformer 108 . such assemblies for energizing flash lamps ( and other suitable assemblies ) are well known in the art and will not be described further . for example , a suitable flash lamp assembled together with assembly 16 is commercially available from all electronics corporation , ca , usa , as flash assemblies under catalog numbers fsh - 1 and fsh - 4 . in the fsh - 1 flash assembly , flash lamp 14 is assembled with part of assembly 16 wherein a battery is wired thereto . in the fsh - 4 all components are connected to an assembly platform including flash lamp 14 and a battery . it is noted that , while the above commercially available flash assemblies fsh - 1 and fsh - 4 can be used to implement the present invention , other suitable commercially available systems can be used or modified to make them suitable for use in the present invention by changing any of their components to control the flow of electrical energy flowing through the flash lamp 14 . alternatively the assembly 16 may be constructed from commercially available electrical and electronic parts and commercially available flash lamps . for example , an embodiment of the hair removing device of the present invention was constructed by modifying commercially available components . the device was built by modifying a model instaflash 80 electronic flash unit ( for use on kodak ek - 8 instant cameras ), commercially available from sunpak corporation , tokyo , japan . the electronic assembly for energizing the unit included , inter alia , an electrolytic capacitor having a capacitance of 750 microfarads ( rated at 300 volts ). to increase the total charge available for discharging the flash lamp , six additional electrolytic capacitors , each having a nominal capacitance of 410 microfarads ( rated at 300 volts ) were electrically connected in parallel with the 750 microfarads capacitor , increasing the total capacitance to a nominal value of 3210 microfarads ( rated at 300 volts ). the original reflector and flash lamp of the flash unit were replaced with a model a 1033 flash tube with reflector , commercially available from the electronic goldmine , arizona , usa the flash lamp is 1 . 75 inches long and the reflector has a rectangular opening having the dimensions of approximately 21 by 44 . 3 mm . the approximate distance from the center of the flash lamp to the center of the area defined by the opening of the reflector is 14 mm . the reflector is made of a plastic material with a reflective coating . the calculated electrical energy stored by the capacitors of the modified unit is approximately 144 joule . it is estimated that more than 50 % of this energy is converted to heat during the flashing of the flash lamp . the modified flash unit was powered by four standard aa size 1 . 5 volt alkaline batteries or , alternatively , by a commercial 6 volts , 2 amperes dc power supply . both power sources gave essentially similar results . the opening of the reflector was placed in contact with the skin of the hand of one of the inventors of the present invention by lightly pressing the reflector against the skin and the flash unit was activated to energize the flash lamp . the reflector was lifted from the skin at about 0 . 5 seconds after the activation of the flash unit . it was found that lifting of the reflector from the skin at about 0 . 5 seconds after the activation of the flash lamp unit , results in efficient hair removal while preventing any pain sensation and undue heating of the region of skin 25 which was under the opening . however , it is noted that the optimal time of lifting of the device may vary in different embodiments of the device and may depend , inter alia , on the size and shape of the housing ( or reflector ), the distance of the flash lamp from the skin , the maximal temperature reached by the flash lamp , the degree of skin pigmentation and the particular region of skin which is being treated . in a preferred embodiment of the invention , as shown in fig1 b , a plurality of flash lamps are used , preferably connected in series . this embodiment results in a longer flash time , substantially equal to about twice the flash time when a single tube is used . however , when two tubes are used , the spectrum is shifter toward higher wavelengths and a lower radiation power density at the skin results . the heat generation remains practically the same as when a single tube is used . it is noted that the devices disclosed herein are only given by way of example and are not intended to limit the scope of the present invention . the structure and dimensions of the devices and the above disclosed parameters for activating and using the devices may be changed and modified according to the desired implementation of the device and may depend , inter alia , on the type and size of the flash lamp , the electrical charge required for pulsing the flash lamp , the type size and reflectivity of the reflector , the dimensions of the opening of the reflector or housing of the device and on the skin pigmentation of the person using the devices . furthermore , features shown in the various embodiments of the invention may be combined and / or omitted in other embodiments of the invention . it is further noted that , any of devices for removing hairs 10 , 20 , 30 , 40 , 50 , 60 and 70 described above may also include a device housing to which the various components of each device are attached . for example , the power assembly 16 and the housing 12 of the device 10 may be attached to a device housing . similarly , the power assembly 16 , the controller 38 , the housing 32 and the air pump 34 of the device 30 ( fig5 ), may all be attached to a device housing . it will be appreciated that device 10 , being a hand held , portable device directed for use by the user himself , has a size which allows it to fit into the palm of a hand . however , other preferred embodiments of the present invention are possible which are larger and do not fit in the palm of the hand . it will be appreciated by the person skilled in the art that the invention is not limited to what has been shown above . while the invention has been described with respect to a limited number of embodiments , it will be appreciated that many variations , modifications and other applications of the invention may be made . the terms “ include ” and “ comprise ” and their conjugations , when used in the claims mean “ including , but not necessarily limited to .”

0Human Necessities

referring to fig1 , a scanning system according to one embodiment of the invention comprises a number of scanners 10 , which can be for example static , moving gantry or mobile scanners , each of which is arranged to scan a cargo container to generate image data . in this case the scanners 10 are arranged over a roadway 11 so that they can scan road - going cargo trucks . a storage array 12 , threat detection processor 14 and job dispatcher 16 , which generally includes a computer with a processor , are all connected to the scanners 10 and to each other by a data switch 18 or other suitable data transmission system . the data switch is also connected to a network of workstations 20 . each of the workstations 20 includes a display 22 arranged to display the image data in the form of an image for viewing by an operator , and a user input 24 , in this case in the form of a mouse , which enables the operator to allocate one of a number of threat categories to each image . the scanners 10 are able to operate independently and at high throughput . a typical scanner comprises an x - ray generator 30 , a set of x - ray detector arrays 32 , 34 each comprising a number of individual detectors 36 each arranged to generate an output signal . the scanner may be a drive - through scanner , or it may include means , such as a movable gantry , to scan the cargo item through an x - ray beam which fires from the x - ray generator 30 through the cargo item and onto the set of x - ray detectors 36 . a two - dimensional image data set is formed by the scanner from the detector output signals . that data set contains information about the cargo item under inspection . in some embodiments more than one x - ray beam is used . in this case the beams may be used to generate two - dimensional image data sets , or three dimensional image data sets . in either case the image data from a series of scans is typically in a form that can be used to build up a three - dimensional image of the cargo item . the scanners 10 pass the image information through the data switch 18 which is able to route the information directly from the scanners 10 to the other nodes 12 , 14 , 16 , 20 . typically , a scan will generate data in the form of ethernet packets and the data switch 18 is therefore simply an ethernet switch . in the embodiment described here , data from the scanners 10 is passed directly to the central storage array 12 and the job dispatcher node 16 which is therefore arranged to receive from the generating scanner 10 the new cargo image data . the job dispatcher 16 is then arranged , on receipt of any new image data set , to allocate time on the threat detection processor 14 for automated analysis of the new image data . advantageously , the image data produced by the scanner 10 will have multi - energy attributes such that a detailed materials discrimination algorithm can be executed first by the threat detection processor 14 , followed by an automated detection algorithm . once the threat detection processor has analysed the image data produced by the scanner 10 , it is arranged to notify the job dispatcher 16 of its conclusions . if a threat item ( e . g . a material or device ) has been detected by the threat detection processor 14 , the job dispatcher 16 is arranged to allocate an operator to review the image data produced by the scanner to resolve the severity of the threat item ( s ) that were detected by the threat detection processor 14 , and to transmit the image data to one of the workstations 20 , or simply make the data available for retrieval and analysis by the operator . the operator will utilise one of the networked operator workstations 20 that has the capability to manipulate the image data for optimal display . once the operator has made their decision , and input it as an operator decision input to the workstation using the input device 24 , the result ( either that the cargo is in fact clear for onwards travel or that it does indeed contain threat materials or devices ) is forwarded to the job dispatcher 16 by the operator workstation . this can be done by sending the image data back with the decision attached to it in the form of a threat categorization , or by sending the decision , again for example as a threat categorization , with an identifier which uniquely identifies the image data set . the job dispatcher 16 is then arranged to notify the scanner 10 of the result . in the event that a cargo item is flagged or categorized by the operator at the workstation 20 as containing a threat material or device , the facility manager is also notified , and a traffic management system controlled as described in more detail below to direct the cargo items appropriately , such that the threat cargo item can be quarantined until such time as an operative is available for manual search of the cargo item . typically , the threat detection processor 14 can be optimised to deliver a low false alarm rate to minimise the congestion and process delays that are caused when a threat cargo item is detected . the corollary of this is that the true detection rate will also be low . in this situation , very few operators are required in order to inspect image data from large numbers of scanning devices . this ensures a low screening cost per cargo item . in this low false alarm rate scenario , it is reasonable to send a fraction of all the scanned images to the network of operators using random scheduling of cargo items which were cleared by the threat detection processor 14 . this ensures that good inspection coverage of all the cargo items that are passing through the facility is achieved . in a further mode of operation of the system , the balance between false alarm rate and detection probability is adjusted such that a higher detection rate is achieved but with a consequent increase in false alarm rate . in this scenario , more operators will be required in order to confirm or reject the cargo items following automated threat detection processing . at this higher false alarm rate level , it is unlikely that additional random inspection of automatically cleared containers will be required . the use of more operators pushes up the cost of screening containers but this comes at the benefit of an enhanced detection probability . the threat detection processor 14 can be set to any particular sensitivity to suit the environment in which the system is to be used . however in this embodiment the sensitivity of the threat detection processor 14 is adjustable so that the operation of the system can be adjusted to suit the prevailing conditions . this means that where the threat detection processor is arranged to allocate each item to one of a number of threat categories , corresponding to different levels of threat , the category to which any particular images will be allocated can be adjusted so as to adjust the proportion of items that will be allocated to each of the categories . the threat detection processor can be arranged to adjust this allocation on the basis of one or more inputs , for example inputs indicative of an overall threat level , the volume of traffic which needs to be scanned , or the number of operators available to review the images . in a modification to this arrangement , the threat detection processor 14 can be arranged to allocate the items in the same way at all times , and the job dispatcher 16 can be made adjustable so that it allocates jobs to the workstations , and controls the flow of traffic in a way which is variable and adjustable in response to the same variables . in a further embodiment of this invention , a further network node is added in the form of a threat injector 40 . the threat injector node 40 comprises a computer 42 having a processor 44 and memory 46 , with a library , stored in the memory 46 , of images of threat items that have been collected under controlled conditions using scanners identical to those 10 in use in the installation . using a scheduling algorithm that is controlled by the job dispatcher 16 , image data that has been cleared by the threat detection processor 14 is passed to the threat injector 40 . the threat injector 40 superimposes a threat object image from its library of stored images into the true cargo image in order to create a hybrid image that now contains a known threat in an otherwise clear image . this hybrid image is then dispatched by the job dispatcher 16 to one of the workstations 20 for an operator review . the operator will be expected to find and mark the threat object . when the operator threat categorization decision is input at the workstation 20 and returned to the job dispatcher 16 , the job dispatcher will send a notification to the workstation 20 to notify the operator that a known threat had been inserted into the image and will confirm whether the operator located the threat correctly . this information is then stored in a database of records , as part of one of the records which is relevant to the particular operator , in order to build up a picture of the individual operator &# 39 ; s performance standard . in a practical realisation of this invention , each workstation 20 can be arranged to display to an operator approximately 10 % hybrid threat images , and 90 % pure scanned images , in order to keep them occupied and well trained . the nature and complexity of the threat images that are injected are arranged to be variable and dependent on the identity of the operator , so that the testing can be balanced against the performance ability of the observer . this allows targeted training programmes to be established by the facility managers to ensure optimal human operation of the screening system . in a modification to this system , instead of a hybrid image being generated as described above , a test image representing a threat object is simply selected from a library of test images and sent to one of the work stations 20 , and the response of the operator monitored to see whether their categorization of the image is correct . the job dispatcher 16 can be arranged to allocate jobs to individual workstations or workstation operators on the basis simply of the current workload of each operator , which the job dispatcher can determine from the tasks it has already allocated , and results it is waiting for from each operator , and the threat category to which the threat detection processor has allocated the item . however where the system has a record or profile associated with each operator , the allocation of tasks to operators can also be made on the basis of the profile . for example in some case the threat detection processor may allocate items to different categories not just on the basis of a level of threat that it associates with the item , but also on the basis of the type of threat , for example the type of threat object that has been detected or the category of threat material that has been detected . where the operator profile includes types of threat that each operator is able to analyse , or a degree of proficiency of each operator at analysing each type of threat , the job dispatcher can allocate each task to an operator at least on the basis of this information to match each task to an operator suitable to perform it . each operator workstation 20 has the facility to annotate the displayed image , in response to inputs from the user input 24 , in order to mark up an image to indicate the presence and type of threat objects and materials that have been detected in the cargo item . in a further modification to this embodiment of this invention , to facilitate the smooth operation of each scanning device 10 , the job dispatcher 16 is able to cause the scanning system to route the passage of cargo items at its exit depending on the results of the automated detection processor and of any subsequent human inspection of the image data . for example , as shown in fig2 , each of the scanners 10 can have a holding bay 50 which a vehicle can enter after passing through the scanner , with a traffic control system , such as traffic lights 52 , arranged to direct vehicles that have passed through the scanner 10 into the holding bay , or past the holding bay 50 . if the automated threat detection processor 14 detected the presence of a threat item or material , of the traffic lights 52 adjacent to the scanner 10 will be controlled by the job dispatcher 16 to direct the load to the holding bay 50 until such time as the operator has input their response . when the operator response has been received by the job dispatcher 14 it is arranged to control further traffic controls , such as a further set of traffic lights 54 , to indicate that the cargo is free to leave the scanning site , or that it needs to move on to another area for example for manual searching . to maximise throughput of the installation , the automated threat detection processor 14 is arranged to generate a decision relating to a cargo item in a time period which is short compared to the overall scanning time for the cargo item . the job dispatcher 16 is arranged to be capable of allowing a scanner 10 to continue scanning new cargo items even if a cargo item is located in the associated holding bay 50 awaiting an operator decision . the embodiments of fig1 and 2 are arranged to scan and control cargo carried on road vehicles , and the traffic management systems therefore rely on traffic lights and other suitable indicators or signs to direct the driver of the vehicle where to drive . however in another embodiment the system is arranged to scan cargo transported by rail . in this case the traffic management systems comprise traffic lights and also points on the rail tracks , for example at the exits 62 from the scanners in fig3 , that can be switched to determine the route which the cargo takes . the job dispatcher 16 is also arranged to control queuing of multiple suspect cargo items in the holding bay in order to maximise throughput of the screening installation . referring to fig3 , in a further embodiment , a security installation is similar to that of fig2 but comprises a number of scanners 60 , each with an associated traffic control system 61 , and arranged to scan cargo items in parallel . the exits 62 from all of the scanners 60 lead to a shared quarantine area 64 that serves all of the scanning systems 60 . the traffic control systems 61 which comprise traffic lights or equivalent traffic management systems , are arranged to direct traffic either straight through scanners 60 to the exit of the scanning installation or , in the event of a threat being detected , to direct the load to the quarantine area 64 where further traffic management systems 66 are provided and arranged to route cargo loads to the exit of the installation following manual search as required . referring to fig4 , in further embodiments of the invention , which can be otherwise similar to those of fig1 to 3 , the job dispatcher 16 a is similar to that of fig1 , but is also arranged to receive , use and manage one or more different forms of information in addition to x - ray image data . this could typically include video images of the cargo load , which the job dispatcher 16 a is arranged to receive from one or more video cameras 70 . it can also include optical character recognition data related to container numbering , which can either be obtained by an image processor 72 arranged to process images from the video cameras , or a separate processor 74 arranged to receive and process images from an imaging device 76 specifically arranged to image a part of the container that carries the numbering . the information can also include scanned images of manifest information that may be provided with the cargo item . it may include data from secondary sensors such as weighbridge data from a weighbridge 78 indicative of the weight of the container , data from chemical detectors or ‘ sniffers ’ 80 indicative of the presence of one or more chemical compounds in the container , passive gamma ray data from a gamma ray detector 82 or neutron sensing data from a neutron sensor 84 . the secondary sensors are shown here is present at the scanner site and part of the installation , but any of them can equally be at a separate location , and arranged to store the data they provide on a data carrier so that it can be input to the job dispatcher , or to transmit the data to the job dispatcher with some form of identification of the container it relates to . where this ancillary data is available , the job dispatcher 16 a is typically arranged to pass the data to the automated threat detection processor which is arranged to use it as an input to the threat detection algorithm that it uses in order to assist it in making the best possible threat categorization decision . referring to fig5 , in a further embodiment of the invention a cargo security system is similar to that of fig3 and 4 , but the system is arranged to scan cargo carried by rail on a rail train 81 . the parts of the system are distributed over larger distances so as to enable an efficient flow of cargo traffic . the system is arranged to scan and categorize cargo arriving at a port 80 on a vessel 82 . the system includes a number of scanners , and all of the sources of secondary data described above with reference to fig4 , but these are distributed at a number of locations 84 along the rail route between the port 80 and a final quarantine or checking area . in particular the scanners 60 are at one location 84 a close to the port 80 where they can be used to scan the cargo shortly after it has been loaded onto the rail vehicle 81 , and the final checking area is provided at another location 84 b further away from the port which may be at a destination of the cargo where it is removed from the rail vehicle 81 carrying it , and any individual cargo items or containers which are identified as a possible threat can be checked without delaying the progress of containers which are not identified as a threat . a traffic management system similar to that of fig3 including rail points and traffic lights is used to control the route of each item of cargo , into or past the checking area 86 , dependent on the analysis of the scan data and other secondary data by the threat detection processor . this arrangement means that the cargo items do not need to be delayed close to the port 80 , and can be moving away from the port , and towards their final destination , while the threat detection analysis is being performed .

6Physics

the present invention enables treatment of ischemic events , including cerebral ischemia , and reperfusion injury associated with ischemic events . additionally , the present invention permits the treatment of ischemic events in a manner that avoids or minimizes the adverse effects associated with conventional treatments , such as reperfusion injury . the term &# 34 ; treatment &# 34 ; in its various grammatical forms refers to preventing , alleviating , minimizing or curing maladies or other adverse conditions . it has been discovered that plasmin and plasmin - forming proteins , a category that includes lys - plasminogen , a pre - activated zymogen of plasmin , can be used , in accordance with the present invention , to attenuate or avoid reperfusion injury following an ischemic event . this beneficial effect can be obtained even when reperfusion already has started . lys - plasminogen itself can be employed as a treatment . all forms of lys - plasminogen are considered suitable for use with this invention as long as they retain the ability to affect the benefits described above . also suitable for use pursuant to the present invention are fragments of lys - plasminogen and variants of lys - plasminogen , such as analogs , derivatives , muteins and mimetics of the natural molecule , that retain the ability to affect the benefits described above . fragments of lys - plasminogen refers to portions of the amino acid sequence of the lys - plasminogen polypeptide . these fragments can be generated directly from lys - plasminogen itself by chemical cleavage , by proteolytic enzyme digestion , or by combinations thereof . additionally , such fragments can be created by recombinant techniques employing genomic or cdna cloning methods . furthermore , methods of synthesizing polypeptides directly from amino acid residues also exist . the variants of lys - plasminogen can be produced by these and other methods . site - specific and region - directed mutagenesis techniques can be employed . see current protocols in molecular biology vol . 1 , ch . 8 ( ausubel et al . eds ., j . wiley & amp ; sons 1989 & amp ; supp . 1990 - 93 ); protein engineering ( oxender & amp ; fox eds ., a . liss , inc . 1987 ). in addition , linker - scanning and pcr - mediated techniques can be employed for mutagenesis . see pcr technology ( erlich ed ., stockton press 1989 ); current protocols in molecular biology , vols . 1 & amp ; 2 , supra . non - peptide compounds that mimic the binding and function of a peptide (&# 34 ; mimetics &# 34 ;) can be produced by the approach outlined in saragovi et al ., science 253 : 792 - 95 ( 1991 ). protein sequencing , structure and modeling approaches for use with any of the above techniques are disclosed in protein engineering , loc . cit . and current protocols in molecular biology , vols . 1 & amp ; 2 , supra . once a desired fragment or variant of lys - plasminogen is obtained , techniques described herein can be employed for determining whether the fragment or variant is effective for the above therapies , such as treatment of reperfusion injury and , if so , identifying an appropriate dosage range . the rat stroke model described in the example below is a simple and cost - efficient way of performing this testing in vivo . the present invention also contemplates the use of progenitors of lys - plasminogen , that is , precursors of lys - plasminogen as well as substances that act on a lys - plasminogen precursor to generate lys - plasminogen . illustrative of lys - plasminogen progenitors is glu - plasminogen , which is cleaved by an appropriate protease to generate lys - plasminogen . a substance effecting such a proteolytic cleavage is plasmin , the use of which falls within the scope of this invention as stated above . these rat stroke model described below is also useful for evaluating the effectiveness of lys - plasminogen progenitors . lys - plasminogen can be obtained by proteolytic cleavage of glu - plasminogen to remove amino acid sequences from glu - plasminogen . methods of producing lys - plasminogen are described in greater detail in european application 0 353 218 . see also neuwenhuizen , supra . an example presented below demonstrates a previously unknown effect of lys - plasminogen which implicates its efficacy , and that of the lys - plasminogen variants and progenitors as well as plasmin and plasmin - forming proteins , in the treatment of reperfusion injury . until now , lys - plasminogen was only known to function in fibrinolysis . it was not expected that plasmin or any plasmin - forming protein , such as lys - plasminogen , would be able to overcome the blood - brain barrier , which has been presumed to be necessary to be effective at the site of a cerebral ischemic event . other uses for lys - plasminogen exist as well . lys - plasminogen is helpful in treating subjects after cardiac arrest . lys - plasminogen administration may prevent the ischemic damage to neural cells . lys - plasminogen can also be used in the treatment of total body ischemia ( shock ), ischemia of the bowels and lower extremities and for the preservation of organs for transplant by preventing ischemia . administration methods include those used for clotlysis treatments , typically intravenous routes . the dosage of lys - plasminogen to be employed with this invention should be based on the weight of the subject and administered at a dosage of about 10 to 1000 caseinolytic units (&# 34 ; cu &# 34 ;)/ kg . preferably , the dosage should be about 100 to 600 cu / kg , and more preferably the dosage should be about 500 cu / kg . the lys - plasminogen can be administered during blood reperfusion , which would occur when lys - plasminogen is administered along with conventional clot lysis treatments such as t - pa . additionally , the beneficial effect of the lys - plasminogen can still be obtained when it is administered after reperfusion has already begun . preferably , the lys - plasminogen should be administered before or within about 30 minutes after reperfusion has begun . lys - plasminogen variants and progenitors should be administered in dosages that yield the same effect as the dosage ranges discussed above . a treatment in accordance with the present invention can be effected advantageously via administration of the above - described substances in the form of injectable compositions . a typical composition for such purpose comprises a pharmaceutically acceptable carrier . an exemplary composition in this context is a lys - plasminogen buffer vehicle ( 9 g / l nacl , 1 g / l na 3 citrate • 2h 2 o , 3 g / l l - lysine , 6 g / l nah 2 po 4 • 2h 2 o and 40 , 000 kiu / l aprotonin ). pharmaceutically acceptable carriers in this context include other aqueous solutions , non - toxic excipients , including salts , preservatives , buffers and the like , as described in remington &# 39 ; s pharmaceutical sciences , 15th ed . easton : mack publishing co . pp 1405 - 1412 and 1461 - 1487 ( 1975 ) and in the national formulary xiv ., 14th ed . washington : american pharmaceutical association ( 1975 ), the contents of which are hereby incorporated by reference . examples of non - aqueous solvents are propylene glycol , polyethylene glycol , vegetable oil and injectable organic esters such as ethyloleate . aqueous carriers include water , alcoholic / aqueous solutions , saline solutions , parenteral vehicles such as sodium chloride , ringer &# 39 ; s dextrose , etc . intravenous vehicles include fluid and nutrient replenishers . preservatives include antimicrobials , anti - oxidants , chelating agents and inert gases . the ph and exact concentration of the various components of the binding composition are adjusted according to routine skills in the art . see goodman and gilman &# 39 ; s the pharmacological basis for therapeutics ( 7th ed .). in this experimental series ,- the effects of lys - plasminogen on the sequelae of experimentally induced ischemia in rats was evaluated . two different approaches were employed to assess the neurologic consequences of ischemia . ischemia was induced in rats as described below . first , male sprague - dawley rats ( weight 300 - 400 g ) are anesthetized with 350 mg / kg choral hydrate i . p ., and a catheter was then inserted into the jugular vein . five milliliters of blood was withdrawn through the jugular catheter ( 100 iu heparin in the syringe ) in order to reduce mean arterial blood pressure to 50 mm hg . the prepared carotid arteries are exposed and clamped simultaneously with the blood withdrawal . the clamps are removed after a period of 30 minutes , and the withdrawn blood is reinfused ( reperfusion ). fibrin sealant ( tisseel ®) is applied to the wounds . the animals remain under anesthesia for a total of 24 hours ( 23 . 5 hours after reperfusion ). after regaining consciousness , each animal undergoes one of the following procedures : animals are maintained at constant body temperatures for a total of 24 hours , sacrificed with ether and the brains removed . assessment of brain edema was performed using modifications of methods published for other species . oh & amp ; betz , stroke 22 : 915 - 21 ( 1991 ). moisture content , which is an excellent parameter for assessing ischemia / reperfusion - induced edema of the brain , is determined as follows : both hemispheres are weighed , dried for 17 hours at 200 ° c ., and reweighed . moisture content is was calculated in percent of total moist weight according to the following formula : ## equ1 ## assessment of neurologic deficits : animals were assessed for neurologic deficits on the first , second and third post - operative days . wauquier et al ., neuropharmacology 28 : 837 - 46 ( 1989 ). state of consciousness , gait , muscle tone , performance on an overhead ladder tilted at 45 °, and performance on a vertically mounted rotating disk were evaluated on the basis of the scoring system shown in fig1 . a cumulative score for the three days is calculated ( maximum score = 54 ). lys - plasminogen ( immuno ag ) was administered intravenously by means of catheter into either the jugular or tail vein . these administrations were performed in increasing concentrations at various time points . ischemic animals treated with isotonic saline served as positive controls , while animals subjected to a sham operation and treated with isotonic saline served as negative controls . the above - described lys - plasminogen buffer was tested using each of these procedures in separate experiments . a summary of dosage , administration schedule , experimental procedures and results is set forth in fig2 . the results for 500 cu / kg lys - plasminogen ( and the buffer employed as a control ) are shown in fig3 and 4 for edema and fig5 and 6 for neurologic deficits . significance values were based on t - tests for edema and the kruskal - wallis test assuming a chi - square distribution for neurologic deficits . a dose of 500 cu / kg of lys - plasminogen showed a significant protective effect on the sequence of experimentally induced cerebral ischemia in rats . the schedule of administration did not play an essential role . notably , the lys - plasminogen still exerted a protective effect even when it was administered 30 minutes after the beginning of reperfusion . this contrasts with results obtained for the standard therapeutic measure flunarizine , which is a calcium antagonist used in clinical practice . flunarizine ( 0 . 63 mg / kg given intravenously ) was effective when administered in the reperfused blood , but had no effect when administered 30 minutes after reperfusion ( data not shown ). lys - plasminogen ( 500 cu / kg ) was capable of reversing the effects of cerebral ischemia as assessed on the basis of brain edema and neurologic deficits in a rat model of experimental ischemia . the buffer used in the lys - plasminogen preparation had no effect . in contrast to a standard therapeutic measure ( flunarizine ), lys - plasminogen was effective even when administered 30 minutes after reperfusion . it is to be understood that the description , figures and specific examples , while indicating preferred embodiments of the invention are given by way of illustration and are not intended to limit the present invention . various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from the discussion and disclosure contained herein .

8General tagging of new or cross-sectional technology

fig2 illustrates a schematic configuration of an exemplary ventilation system . the ventilation system includes a sleeve device 200 having at least one aperture thereon for gas transfer , a ventilator 210 coupled to the sleeve device 200 and a sensor 220 coupled to the sleeve device 200 . the sleeve device 200 includes at least one sleeve . in these embodiments shown in fig2 , the sleeve device 200 comprises a first sleeve 201 and a second sleeve 202 connected thereto . in some embodiments , the at least one aperture not shown is on the inner wall of the sleeve device 200 . as shown in fig2 , the pipeline 240 connects the sleeve device 200 and a gas cabinet 230 . in these embodiments , the sleeve device 200 is adjacent to a gas outlet 235 of the gas cabinet 230 . moreover , the sleeve device 200 and the pipeline 240 are substantially coaxial . in some embodiments , the ventilator 210 is coupled to the outer wall of the sleeve device 200 . the sleeve device 200 is adapted to transfer gas through the aperture thereon and between the inner and outer walls thereof . moreover , the design of the sleeve device 200 is adapted to connect with the physical feature of the gas outlet 235 of the gas cabinet 230 . the sleeve device 200 can be , for example , cylindrical , rectangular or any other shape that is suitable for connecting the sleeve device 200 to the gas outlet 235 of the gas cabinet 230 . the ventilator 210 is adapted to vent the gas flowing through the sleeve device 200 . in some embodiments , the ventilator 210 can be , for example , a vacuum generator . the term “ couple to ” describing the relationship between the ventilator 210 and the sleeve device 200 means that the ventilator 210 and the sleeve device 200 can be , e . g ., directly connected , connected through another device , such as a pipeline , or connected by any other method that can substantially perform the function of transferring gas from the sleeve device 200 to the ventilator 210 , or vice versa . the sensor 220 can be , for example , a sensor that can sense a relative moving between two objects , such as the sleeve device 200 and the gas outlet 235 of the gas cabinet 230 , or the first sleeve 201 and the second sleeve 202 . in some embodiments , the sensor 220 includes a switch coupled to the sleeve device 200 for sensing a relative movement between the first sleeve 201 and the second sleeve 202 . the sensor 220 will then generate a signal to control the ventilator 210 when sensing a relative movement between the sleeve device 200 and the gas outlet 235 of the gas cabinet 230 , or the first sleeve 201 and the second sleeve 202 , for example . the signal transfer can be accomplished by a standard industrial interface , such as rs232 , rs486 or ieee488 . 2 . the term “ couple to ” describing the relationship between the sensor 220 and the sleeve device 200 means that the sensor 220 and the sleeve device 200 can be , e . g ., directly connected , connected through the other device , such as a signal cable , or connected by any other method that can substantially perform the function of sensing a relative movement between two objects . fig3 illustrates a schematic configuration of an exemplary sleeve device . as shown in fig3 , the sleeve device 200 includes the first sleeve 201 and the second sleeve 202 . the pipeline 240 connects the first sleeve 201 and the second sleeve 202 . items in fig3 that are the same as items in fig2 are indicated by the same reference numerals . detailed descriptions of each of these items are not repeated . in these embodiments shown in fig3 , at least one aperture 203 is on the inner wall of the first sleeve 201 . as mentioned in fig2 , the sleeve device 200 can have any physical feature suitable for connecting the sleeve device 200 to the gas outlet 235 of the gas cabinet 230 . in these embodiments shown in fig3 , the sleeve device 200 including the first and second sleeves 201 and 202 respectively is cylindrical . moreover , the first sleeve 201 can move on the second sleeve 202 along the pipeline 240 toward a gas outlet . the at least one aperture 203 on the inner wall of the first sleeve 201 can be any shape , for example , round or square . there is no requirement as to how many apertures may be on the inner wall of the first sleeve 201 . however , it is more advantageous that the number of the apertures 203 are enough for efficiently transferring gas . in the embodiments shown in fig3 , the sensor 220 is coupled to the second sleeve 202 and is adapted to sense the relative moving between the first sleeve 201 and the second sleeve 202 . the ventilator 210 is coupled to the outer wall of the first sleeve 201 . it may be readily understood that the sensor 220 can be coupled to the first sleeve 201 , the second sleeve 202 or both , and that the ventilator 210 can coupled to the first sleeve 201 , the second sleeve 202 or both . fig4 a illustrates a schematic cross - sectional configuration of an exemplary embodiment showing a non - operational situation of the ventilation system . items in fig4 a that are the same as items in fig2 and 3 are indicated by the same reference numerals . they include the gas cabinet 230 , the gas outlet 235 of the gas cabinet 230 , the first sleeve 201 , the second sleeve 202 , the apertures 203 , the ventilator 210 , the sensor 220 and the pipeline 240 . detailed descriptions of these items are not repeated . the first sleeve 201 has an inner wall 205 and an outer wall 207 . as noted in fig2 , the sleeve device 200 including the first and second sleeves 201 and 202 respectively is adjacent to the gas outlet 235 of the gas cabinet 230 . in these embodiments shown in fig4 a , a gasket 236 connects to the gas outlet 235 of the gas cabinet 230 for sealing the gas outlet 235 and preventing gas leakage therefrom . when the sleeve device 200 does not create a relative movement to the gas outlet 235 of the gas cabinet 230 , or the first sleeve 201 does not create a relative movement to the second sleeve 202 , the sensor does not create a signal and sent to the ventilator 210 . therefore , no ventilation occurs under this situation . fig4 b illustrates a schematic cross - sectional configuration of an exemplary embodiment showing the ventilation system in operation . items in fig4 b that are the same as items in fig4 a are indicated by the same reference numerals . for disconnection of the pipeline 240 and the gas outlet 235 of the gas cabinet 230 , the gasket 236 is released from its connection to the gas outlet 235 of the gas cabinet 230 . the first sleeve 201 then moves toward the gas outlet 235 of the gas cabinet 230 along the pipeline 240 , and creates a relative movement between the first sleeve 201 and the second sleeve 202 , or between the sleeve device 200 and the gas outlet 235 of the gas cabinet 230 . the sensor 220 can sense the relative movement and generate a signal to control the ventilator 210 . in embodiments , the ventilator 210 starts venting gas leaked from the gas outlet 235 of the gas cabinet 230 . the leakage gas will flow through the aperture 203 of the first sleeve 201 and between the inner and outer walls of the first sleeve 201 to the ventilator 210 . although the present invention has been described in terms of exemplary embodiments , it is not limited thereto . rather , the appended claims should be constructed broadly to include other variants and embodiments of the invention which may be made by those skilled in the field of this art without departing from the scope and range of equivalents of the invention .

8General tagging of new or cross-sectional technology

fig1 illustrates an ip network in comprising a user equipment ue , a subscriber database 120 comprising policy related subscriber data 121 , policy rules pr , an anchor policy decision point apdp , serving policy decision points spdp1 , spdp2 , an anchor policy enforcement point apep , serving policy enforcement points spep1 , spep2 , an application function af , an aaa server aaa , an aaa proxy 131 and a home agent ha . the address of the serving policy decision point spdp1 is aspdp1 . a user equipment ue is attached to the network . the aaa server can be integrated with the hss server . a policy enforcement point ( pep ) is a function that requests for access to a resource or execution of a service . the pep requests evaluation of these access / service execution requests to a policy decision point ( pdp ). the pdp returns its decision to the pep and the pep enforces / carries out the decision that is returned by the pdp . the pep could e . g . block certain types of traffic according to the decision of the pdp or grant access to specific services . the main task of a policy decision point ( pdp ) is to evaluate requests addressed to the pep . it evaluates the request against a policy . the outcome of the policy evaluation is the ‘ decision ’ of the pdp . the pdp and the pep may be implemented as two distinct entities that intercommunicate by means of a protocol . an example of a pep and the pdp is the policy and charging rules enforcement function ( pcef ) and the policy and charging rules function ( pcrf ) in 3gpp pcc r7 . critical traffic , e . g . voice , will be controlled by the pcrf . an anchor pdp controls the pep from a policy management point of view and has access to policy rules pr and specific policy information for the mobile terminal , the policy related subscriber data 121 . a serving pdp is the one that controls the pep that the mobile terminal is connected to . these pdps could be situated everywhere in the network , e . g . in the access network , core network or service network . the policy rules could be stored everywhere , e . g . in the different pdps or in a separate policy database . in this particular embodiment they are stored in the anchor pdp . policy related subscriber data 121 , e . g . subscriber class or subscriber services , for a particular user / subscriber 110 are stored in the subscriber database 120 . the subscriber database is normally located in the home network h . protocol used between the subscriber database and a pdp could be e . g . ldap . an example of a subscriber database is the subscription profile repository in 3gpp r7 . the application function af is an element offering applications that require the control of ip bearer resources . the application function is capable of communicating with the pdp to transfer dynamic service information , which can then be used for selecting the appropriate charging rule and service based local policy by the pdp . one example of an application function is the p - cscf of the im cn subsystem . the home agent ha keeps among other things information about lo the current ip address of the user equipment . a mobile user equipment that attaches to the network will be assigned a local ip address . this address will be registered at the home agent . in mipv6 this is done in the message binding update from the user equipment to the home agent . in mipv4 the corresponding message is called registration request . the aaa function refers to protocols and supporting infrastructure for authentication , authorization and accounting ( aaa ) in ip networks . the purpose of aaa is to verify the identity of the user ( authentication ), to verify what types of service the user is entitled to ( authorization ) and to collect data necessary for billing the user for the service ( accounting ). if a mobile user accesses the network via another pep than the anchor pep , e . g . a serving pep , spep1 in a visiting network , the user is going to be associated to serving pdp spdp1 , that controls the spep1 . in this example he attaches to spep1 and the spdp1 assigned . to be able to enforce the proper policy decisions the spdp1 and the apdp must communicate with each other . preferably the apdp discover the spdp1 and initiate the pdp - pdp interaction . this could be done via the interface s9 mentioned in 3gpp ts 23 . 203 and tr 23 . 882 . to be able to set up a connection the invention proposes that one of the policy decision points , spdp1 or apdp , receives the address of the other one . to be able to do this , the invention introduces a method to deliver the address ( aspdp1 ) of the serving policy decision point to the anchor policy decision point . the method comprises the feature of including this address in the communication in the ip mobility procedure of the user equipment . a first embodiment describes a roaming scenario according to fig1 . in a first embodiment the anchor pdp is situated in the home operator network h and the serving pdp , spdp1 , is situated in a visited network v . the anchor pdp is also connected to an application function ( af ) situated in the home network h . the home agent ha is situated in the home network h and the user equipment is connecting to a policy enforcement point , spep1 , in the visiting network v . an aaa server is integrated with the hss server . there is an aaa proxy in the visited network . the method comprises the following steps . the user equipment ue attaches to the visited network . run an access authentication procedure . assign an home agent ( ha ) run dhcp discovery for assignment of the local ip address to the ue . configure the ue with the address ( aspdp1 ) of the spdp depending on the assigned ip address . ip session request is send to s - pdp run ip security between ue and the aaa server , via the aaa proxy , assign an home agent pop ( ha ) and include the ha in the successful response of the ip security . ha assigns a home ip - address of the ue and an anchor policy decision point apdp . apep , including the ha , sends ip session setup to the apdp . ue starts mip binding update or registration request to the ha including the s - pdp address . ha sends update request to a - pdp including the s - pdp address . the apdp creates a default pcc rule after interaction with the subscriber database 120 , initiates a pdp - pdp interface to push rules to the spdp1 . the spdp1 push rules after possible modification to the spep1 . the session id can be used to bind local ip address and the home ip address in apdp . the nodes and functions can be situated in all kind of constellations concerning the home network and the visited network . in e . g . a handover scenario , all the nodes and functions will be situated in the home network . in the handover case there is no need for an aaa proxy 131 . a second embodiment describes a handover scenario according to fig2 . both the anchor pdp , apdp , and the serving pdp , spdp1 , is situated in a home network h . the anchor pdp is also connected to an application function ( af ) situated in the home network h . the home agent ha is situated in the home network h and the user equipment is connecting to a policy enforcement point , spep1 also situated in the home network . there is no aaa proxy needed in this case . the method comprises the following steps . the user equipment ue attaches to a new access in the home network . run an access authentication procedure . assign an home agent ( ha ) run dhcp discovery for assignment of the local ip address to the ue . configure the ue with the address ( aspdp1 ) of the spdp depending on the assigned ip address . ip session request is send to s - pdp run ip security between ue and the aaa server , assign an home agent pop ( ha ) and include the ha in the successful response of the ip security . ha assigns a home ip - address of the ue and an anchor policy decision point apdp . apep , including the ha , sends ip session setup to the apdp . ue starts mip binding update or registration request to the ha including the s - pdp address . ha sends update request to a - pdp including the s - pdp address . the apdp creates a default pcc rule after interaction with the subscriber database 120 , initiates a pdp - pdp interface to push rules to the spdp1 . the spdp1 push rules after possible modification to the spep1 . the session id can be used to bind local ip address and the home ip address in apdp fig3 illustrates an user equipment ( ue ) used in the methods described above . it comprises means 330 for receiving the address aspdp1 of the serving policy decision point spdp1 associated to the user equipment ue , means 340 for storing an address aspdp1 of the serving policy decision point and means 350 for sending the address of the serving policy decision point to the home agent so that the home agent can forward the address of the serving policy decision point to the anchor policy decision point .

7Electricity

in the descriptions of the drawings and preferred embodiments , the term “ photon turbine ” is used to refer to the portion of the photon turbine generator ( ptg ) that includes the resonant cavities or waveguides ; any mechanisms , devices , or systems that support the resonators or waveguides ; and the surrounding structure in which the resonant cavities or waveguides are located , such as the fairing and the components located inside of the fairing . the term photon turbine generator , or ptg , comprises the photon turbine , the electrical generator coupled to the photon turbine , and any equipment that supports , regulates , or monitors the photon turbine or electrical generator . fig1 shows a cross - sectional view of a photon turbine generator ( ptg ) using a simple , z - shaped , folded resonator design . four mirrors 1 are supported on mounts 2 within a cylindrical structure 3 , which will be subjected to torques in a manner broadly similar to a squirrel cage or hamster wheel . the force due to radiation pressure is applied to the mirrors , transmitted through the mirror mounts , and transferred to the fairing 3 . all four mirrors 1 have the maximum possible reflectivity (& gt ; 99 . 9999 %) for the wavelength of the laser used in the ptg , thereby forming a power enhancement cavity . cavity as used herein simply refers to the space that defines the reflected photon beam . it may be an open cavity or a closed cavity . though reflection is disclosed as the primary means of directing photon energy throughout the present description , it will be appreciated by those skilled in the art that any method may be used to direct or guide the laser or em radiation , including but not limited to reflection , total internal reflection , refraction , and diffraction or the like . the laser generator 4 is located behind one of the mirrors of the resonant cavity . the laser generator 4 may use electrical , optical , or other means to stimulate the gain medium and produce the input laser beam 10 . the mirror mounts , or a separate support structure , may be used to hold the laser generator 4 securely in place . the circulating laser beam 5 travels back and forth between the four mirrors , retracing the same path over and over again . in this folded cavity , the laser beam strikes the end mirrors 1 perpendicularly , while reflecting off the other two mirrors 1 at a 45 degree angle of incidence . the net torque applied by the forces due to radiation pressure causes the photon turbine to rotate . ( please see fig6 and the sample mathematical equation in this specification for a detailed discussion of the torques produced in this resonator design .) the axis of rotation ( not shown in this view ) is halfway between the two mirrors shown at 45 degree angles . broadly speaking , the resonator itself forms the foundation of the photon turbine . this cross - sectional view features the resonant cavity and surrounding fairing 3 . for simplicity , and to keep the focus on the core structure of the ptg , various components that may support the resonant cavity , such as mode - matching optical devices and piezoelectric transducers , are not shown . these supportive devices may be mounted on the photon turbine as needed for optimal performance and operation of the resonant cavity . in this figure , and in most of the figures in this specification , a single line with arrowheads is shown to depict a laser beam . however , in practice , the laser beam diameter ( whether the laser is composed of a single beam or an array of beams ) should be as large as possible , utilizing the available mirror surface area to the fullest extent . by applying the laser beams to the maximum possible surface area of the mirrors 1 , the force applied to the mirrors 1 from radiation pressure may be maximized , thereby increasing the torque of the ptg . for simplicity and ease of explanation , only one resonant cavity is shown mounted on the photon turbine in fig1 . however , additional resonant cavities could be mounted on the photon turbine , thereby providing increased total torque . the resonant cavities or resonators may be designed with various confinement conditions and may comprise various geometries , various beam path lengths , various numbers of mirrors or reflective surfaces , and various types of mirrors or reflective surfaces . the resonator may comprise bulk optical components , waveguides , or both . the resonator may comprise a light path traveling through free space , a waveguide , or both . the resonator may be open or closed . furthermore , while this specification discusses resonators in which a vacuum or partial vacuum exists between the mirrors or reflective surfaces , it is possible for the laser beam to travel through other entities , such as air , glass , water , or other transparent liquids , solids , gases , or other materials . as example only , and without limitation , the cavity geometry may include any of a stable , unstable , unidirectional , bidirectional , multidirectional , a ring resonator or resonant cavity , a traveling wave resonator or resonant cavity , a standing wave resonator or resonant cavity , a plane - parallel resonator or resonant cavity , a linear resonator or resonant cavity , a fabry - perot resonator or resonant cavity , a folded resonator or resonant cavity , a telescopic laser resonator , a fiber ring resonator , an integrated pile ring resonator , an integrated - optic ring resonator , a microcavity , a microdisk , a microtoroid , a microsphere , a micropillar , a micropost , a resonator based on a defect in a photonic crystal , a near grazing resonator , a whispering gallery resonator , a circular resonator , an annular bragg reflector , a one - dimensional resonator or resonant cavity , a two - dimensional resonator or resonant cavity , a three - dimensional resonator or resonant cavity , a symmetric resonator , a mirrorless resonator , a roof resonator , a distributed - feedback resonator , an optical oscillator , an optical parametric oscillator , a multi - prism grating laser oscillator , a planar ring oscillator , a nonplanar ring oscillator , a confocal resonator , a concentric resonator , a concave - convex resonator , a conjugate resonator , a spherical resonator , a hemispherical resonator , a long - radius hemispherical resonator , a large - radius hemispherical resonator , a plane parallel resonator , a long - radius resonator , a bowtie resonator , a planar waveguide , a rectangular waveguide , a linear waveguide , a fiber waveguide , a hollow silica waveguide , a power enhancement cavity , a power recycling cavity , a laser supercavity , or a supercavity . note that in fig1 , the mirrors are depicted as planar . this was done for simplicity in the presentation of the torque diagram in fig6 and in the sample mathematical calculation . in practice , one or more of the mirrors in the resonant cavity would most likely be curved ( e . g ., spherical mirrors , long - radius mirrors , or large - radius mirrors ) to help ensure the stability of the resonant cavity . in other figures in this specification , some of the mirrors shown are curved . this is mainly intended to help show a variety of possible designs . those skilled in the art of resonator design may use whatever types of mirrors they consider to be appropriate for optimal performance and stability of the resonant cavity . the number of potential mirror combinations ( e . g ., spherical , long - radius , large - radius , planar ) is likely just as varied as the number of potential resonator geometries ( e . g ., folded cavity , ring cavity , closed - loop waveguide ) that may be used in the ptg . any shape of mirror or reflective surface may be used in the resonator , resonant cavity , or waveguide , including but not limited to planar , near - planar , long - radius , large - radius , plano - concave , plano - convex , concave , convex , spherical , parabolic , elliptical , conical , and polygonal designs . one important note regarding mirror curvatures : because the force of radiation pressure is substantially higher for a perpendicular reflection compared with an oblique reflection , a planar mirror will experience a greater force than a curved mirror when reflecting a laser beam of the same intensity at a perpendicular or normal angle of incidence . this is because the entire surface of the planar mirror receives the laser beam at a perpendicular angle of incidence , whereas with a curved mirror , only a small area on the principal axis would reflect the laser beam at a perpendicular angle of incidence , while the rest of the beam would reflect from the mirror at oblique angles . these oblique angles could be small or large , depending on the radius of curvature of the mirror and the precise location of the reflection of a photon off the mirror . thus , when designing resonators for the ptg , it may be preferable to use planar mirrors to receive perpendicular reflections . this way , the force of radiation pressure applied in a perpendicular reflection can be maximized , which may help to create the imbalance of torques that causes the rotation of the ptg . fig2 shows a perspective view of fig1 . the mirrors 1 extend longitudinally through the cylindrical fairing 3 , running along the axis of rotation . the laser generator 4 also extends throughout the fairing , directly behind one of the mirrors 1 . at the ends of the fairing 3 , a central shaft 6 extends in both directions . a conventional rotor 7 , which in this particular configuration contains the field windings 7 , is shown on the shaft 6 to the right of the photon turbine . the laser generator 4 produces the input laser beam 10 , which is inserted into the resonant cavity to form the circulating laser beam 5 . when the resonant cavities are established , the imbalance of torques applied to the mirrors 1 will cause the ptg to rotate in a counterclockwise direction 8 . the force of the radiation pressure on the mirrors of the resonant cavity is transferred through the mirror mounts 2 to the fairing 3 , which will rotate based on the net torque applied to it . in this drawing , and throughout this specification , a cylindrical fairing 3 is used to contain the resonators . this is merely one type of containment vessel . numerous other types or shapes of fairings or enclosures might be selected to contain one or more resonators . alternately , the ptg could be designed without a fairing and the resonator mirrors could apply torque to the shaft by another method , e . g . attaching the mirror mounts directly to the shaft . the cylinder is used in this specification for its simplicity and relatively good aerodynamic properties . the cylindrical fairing 3 in this figure would rotate on the same shaft 6 with the rotor field windings 7 . the fairing 3 is shown here with hatching for simplicity and to convey that this structure must be able to withstand significant forces that are applied to it . however , the fairing 3 does not have to be an entirely solid structure . instead , it may contain passages for electrical wiring or other components that support the ptg . any shape of fairing may be used , including but not limited to cylinders , spheres , spheroids , ovoids , toroids , and rings . while the resonator geometry shown in fig1 is depicted inside the fairing 3 in fig2 , the fairing 3 could be used to contain various resonator geometries . the resonator geometries shown in fig5 a , 8 , and 9 could also be extended through a cylindrical fairing . one or more resonators may be mounted inside of the fairing 3 to produce either clockwise or counterclockwise rotation 8 . fig3 shows a ptg with the laser generator 4 placed at the center of the resonant cavity . alternately , the laser generator 4 could be mounted directly in front of one of the mirrors or any other place inside the resonant cavity . in this ptg design , the laser generator 4 extends along the axis of rotation inside the cylindrical fairing 3 . a crossbeam 9 holds the laser generator 4 securely in place and may also contain or support electrical wiring , electrodes , diodes , or other means to stimulate the gain medium . the crossbeam 9 may also contain a heat transfer mechanism to help reduce the thermal stress on the gain medium . fig4 shows a ptg using the same mirror geometry as the ptgs in fig1 - 3 . however , the laser generator ( not shown ) is not located on the ptg in fig4 . rather than being mounted on the ptg , the laser generator is placed at a separate , stationary location . thus , a method for inserting the input laser beam 10 into the ptg is also shown . the input laser beam 10 produced at a separate location enters the photon turbine through a transparent outer wall 11 that is part of a waveguide attached to the cylindrical fairing 3 . the input laser beam 10 then travels inside the waveguide 11 that runs along the outer edge of the fairing 3 . the input laser beam 10 eventually enters a collimator 12 positioned behind one of the mirrors of the resonant cavity . the collimator 12 adjusts the direction of the laser beam so that it is inserted into the resonant cavity at the appropriate angle . with this method , the resonator can be continuously supplied with an input laser beam 10 . note that additional optical components may be placed between the collimator and the back side of the input mirror of the resonant cavity to facilitate operation of the resonant cavity . any method of inserting , injecting , coupling , locking , or directing the laser or em radiation into the resonant cavity or waveguide may be used , including but not limited to mode matching , impedance matching , photon tunneling , coupling prisms , lens coupling , grating coupling , diffractive coupling , direct coupling , air gap coupling , vacuum gap coupling , prism coupling , prism - film coupling , polarization coupling , nonlinear coupling , phase matching , evanescent coupling , coupling through the back of any mirror or reflective surface , deflection coupling , directional coupling , hole coupling , transmission coupling , multi - mode coupling , direct fiber coupling , energy coupling , near - field coupling , optical waveguide coupling , transition coupling , transitional coupling , dispersive coupling , lateral coupling , back coupling , edge coupling , plasmonic coupling , interference coupling , mesh coupling , cross coupling , double coupling , phase - generating coupling , side locking , dither locking , and the pound - drever - hall method . furthermore , any number of beams of em radiation may be coupled by any method into any number of resonators , resonant cavities , or waveguides . the waveguide 11 , which encircles the cylindrical fairing 3 , is rotationally symmetrical . the waveguide 11 would extend along the entire length of the cylindrical fairing 3 , forming an outer cylinder around it . thus , as the ptg rotates , the input laser beam 10 may be constantly inserted into the waveguide 11 , where it will bounce between the walls and eventually reach the collimator 12 , which it will pass through before entering the resonator . various other methods of inserting the input laser 10 into the resonant cavity of the ptg may be designed ( one of which is discussed in this specification ). this is only one example that might be useful for ptg designs in which the central shaft 6 does not run through the interior of the fairing 3 . waveguides of any type , including but not limited to planar , rectangular , linear , or fiber waveguides , may be used wherever the present disclosure calls for the use of waveguides . regardless of which method of insertion is used , it is important that the input laser beam 10 is applied continually to the resonator . if the resonator only receives intermittent power from the input laser beam 10 , this will reduce the amount of torque applied to the ptg . continual input power may be provided by either a pulsed laser or a continuous wave laser . the laser or em radiation used may be of any type , including but not limited to continuous wave , intermittent , pulsed , polarized , linearly polarized , circularly polarized , elliptically polarized , transversely polarized , plane polarized , or non - polarized . the laser or em radiation used is based on any mode of operation , including but not limited to transverse modes , longitudinal modes , single modes , multiple modes or multi - modes , parasitic modes , off - axis modes , degenerate modes , lower - order modes , higher - order modes , fundamental modes , gaussian modes , hermite - gaussian modes , laguerre - gaussian modes , and bessel modes . the laser or em radiation may be single - frequency , mode - locked , monochromatic , nonmonochromatic , plane wave , non plane wave , or may involve paraxial propagation . any beam quality , spectral brightness , spectral width , frequency spacing , or spatial distribution may be used . any presently known method , technique , or equipment may be used to establish or maintain the quality , direction , or performance of the laser or em radiation , including but not limited to optical isolators , optical diodes , collimating lenses , collimators , mode - matching optical components , piezoelectric transducers , piezo - controlled mirror actuators , and servo - controllers . whichever type of laser is used , it is advantageous to continually feed the photon turbine 16 with the input laser beam 10 , so that a constant torque , and therefore a constant power output , is maintained . fig5 a shows a ptg design that uses an alternate method for inserting the input laser beam 10 . this method involves inserting the input laser beam 10 into the end of the shaft 6 , which extends through the fairing 3 . because the shaft runs through the center of the fairing 3 , the resonator geometry of fig1 has been modified . the ptg shown in fig5 a comprises two resonant cavities — one on either side of the shaft 6 . note that the two resonator mirrors 1 closest to the shaft 6 do not produce any torque , because the force of radiation pressure is applied directly along the lever arm . part or all of the rim of the shaft 6 is transparent 13 to allow the input laser beam 10 to exit the shaft and enter the resonant cavities . a series of mirrors 14 making a 45 degree angle to the axis of rotation ( and 90 degree angles with each other ) are positioned inside the shaft 6 . all of the mirrors 14 in the series are semi - transparent , except for the last pairing , which have a high reflectivity . as shown in fig5 b , the input laser beam 10 is inserted into the end of the shaft 6 through a window 15 . instead of using a window , the shaft 6 could simply be left open or uncovered to allow the input laser beam 10 inside . after entering the shaft , the input laser beam 10 is distributed into the resonant cavities by a series of semi - transparent directional mirrors 14 . because the resonant cavities extend throughout nearly the entire length of the fairing 3 , the input laser beam 10 is inserted into the cavities incrementally , ensuring that each section of each resonant cavity receives an appropriate amount of the input laser beam 10 . the directional mirrors 14 , which are positioned in the shaft in v - shaped pairings 14 , can be provided with the precise degree of reflectivity to allow for the proper distribution of the input laser beam 10 throughout the resonant cavities . because the shaft 6 rotates in unison with the resonant cavities on either side of it , the series of semi - transparent directional mirrors 14 will remain properly aligned to insert the input laser beam 10 into the resonant cavities during rotation of the ptg . note that additional optical components may be placed between the shaft and the back side of the input mirrors of the resonant cavities to facilitate operation of the resonant cavities . this method of inserting the input laser beam 10 could be used for many different resonator configurations . once the input laser beam 10 is traveling through the shaft 6 , one or more directional mirrors 14 , can be used to guide the input laser beam 10 into the resonant cavities or waveguides . this technique of inserting the laser beam into the shaft 6 could be applied to other ptg designs in this specification , including fig8 and 9 . it could also be applied to many other types of resonator designs . fig6 schematically depicts the forces acting on the mirrors due to radiation pressure of the laser beam circulating inside the resonant cavity shown in fig1 - 4 . based on the different angles of incidence , different angles made by the forces with their lever arms , and different distances of the mirrors from the axis of rotation , an imbalance of torques will cause the ptg to rotate . with this particular design , the ptg will rotate in a counterclockwise direction . the following sample equation uses this resonator design to show the net torque acting on the photon turbine and highlights the potential of the ptg for extremely high efficiency . once the power of a circulating laser beam is determined , the three main variables to consider in the design of a resonator for a ptg are : ( 1 ) the angle of incidence of the circulating laser beam on each mirror or reflective surface ; ( 2 ) the angle that each mirror makes with the lever arm ; ( 3 ) and the length of the lever arm for each mirror . now let &# 39 ; s examine the potential power output and efficiency of the ptg shown in fig1 and 2 with a sample calculation . in fig6 , from the lower left to the upper right , the mirrors are indicated as a , b , c , and d . let &# 39 ; s assume that all four mirrors have a reflectivity of 99 . 99999 %. this will enable the average photon to make 10 million bounces before escaping the resonator . in this resonator , one round trip involves 6 bounces off of the mirrors . therefore , the power enhancement inside of the cavity is 10 million / 6 = 1 . 67 million . thus , an input laser beam of 1 kw would result in a circulating laser beam of 1 . 67 gw . the force applied by radiation pressure to a perpendicular reflective surface is 2 p / c . ( while this is the theoretical maximum amount of force from radiation pressure based on a perfectly reflecting surface , the extremely high reflectivity of the multilayer dielectric mirrors allows the use of this equation with negligible deviations ). the force from radiation pressure on an oblique reflective surface is 2 p ( cos 2 θ )/ c . thus , the forces acting on the mirrors are as follows : f b = 2 ( 1 . 67 × 10 9 w )( cos 45 °) 2 / 2 . 998 × 10 8 m / s = 5 . 57 n f c = 2 ( 1 . 67 × 10 9 w )( cos 45 °) 2 / 2 . 998 × 10 8 m / s = 5 . 57 n for simplicity , let &# 39 ; s assume that the center points of the two mirrors on each side of the axis of rotation form 30 - 60 - 90 triangles with the axis of rotation . also , let &# 39 ; s assume familiar ratios and units . so the sides of each triangle are : 1 m , 1 . 732 m , and 2 m . thus the distance from the axis of rotation to mirrors b and c is the square root of 3 , or 1 . 732 meters . the distance from the axis of rotation to mirrors a and d is 2 meters . because the force due to radiation pressure is always perpendicular to the reflective surface , the forces on the mirrors will make the following angles with their respective lever arms : now that we have the forces , distances , and angles made with the lever arms , the torque can be calculated for each mirror as follows : τ a = f a ( sin θ a ) d a = 11 . 14 n ( 0 . 866 )( 2 m )= 19 . 29 nm ( counterclockwise ) τ b = f b ( sin θ b ) d b = 5 . 57 n ( 0 . 707 )( 1 . 732 m )= 6 . 82 nm ( clockwise ) τ c = f c ( sin θ c ) d c = 11 . 14 n ( 0 . 707 )( 1 . 732 m )= 6 . 82 nm ( clockwise ) τ d = f d ( sin θ d ) d d = 11 . 14 n ( 0 . 866 )( 2 m )= 19 . 29 nm ( counterclockwise ) now that the net torque has been calculated , the power output of the generator can be determined . let &# 39 ; s assume that the ptg rotates at 3600 rpm . this equates to 60 rps . thus , the angular velocity is : this power output is significantly greater than the 1 kw of the input laser beam . if we assume that the input laser beam has a wall - plug efficiency of 50 %, then it would need 2 kw to operate . the power output of the ptg can provide this power , and have significant power ( 7 . 74 kw ) remaining to provide to various applications . while an onboard feedback control system would require some power , and there may be minor windage losses , these factors would not significantly affect the extremely high efficiency of the ptg . the efficiency of the ptg is : the size of the mirror that could accommodate a 1 . 67 gw circulating laser beam , assuming an optical damage threshold of 100 mw / cm 2 continuous wave , would be 16 . 7 cm 2 — about the size of a large coin . if this ptg were scaled up to the size of a large steam turbine , with mirrors that were 20 m × 2 m ( extending along the shaft , as in fig2 ), the total surface area would be 400 , 000 cm 2 . assuming the same rotational speed ( 3600 rpm ), the scaled - up ptg would produce 225 mw , based on the increased torque . thus , the ptg can produce both efficient power and large quantities of power when scaled up . mirrors with reflectivity & gt ; 99 . 9999 % are currently marketed by specialty optics companies . ultrahigh reflectance mirrors are used for a variety of applications , including cavity ringdown spectroscopy , gravitational wave detection , and ring laser gyroscopes . the expertise of manufacturers who provide extremely high reflectance mirrors for these fields could be utilized in the construction of a ptg . thus , for the purposes of the previous sample calculation , reflectivity of 99 . 99999 % was assumed . however , the ptg would still be a useful invention even with mirror reflectivity of 99 . 9999 % or lower . with lower mirror reflectivity , the likelihood of achieving overunity efficiency decreases , and therefore solar pumping of the input laser beam , rather than self - pumping , would likely be the most effective method of operating the ptg . however , to demonstrate the full potential and optimal manifestation of the ptg , the inventor has used the highest reflectivity that he has seen discussed in legitimate sources . fig7 a shows an overhead view of a ptg with the laser generator ( or laser generators ) located inside the photon turbine 16 . the resonant cavities or waveguides are located inside of the cylindrical fairing . the fairing provides a sealed container that may serve as a vacuum enclosure for the resonant cavities or waveguides . by evacuating the space ( or portions of the space ) inside of the fairing , an environment can be created to enable maximum power enhancement within the resonant cavities or waveguides . in addition to serving as a vacuum enclosure , the fairing provides an aerodynamic shell to allow for efficient high - speed rotation . the fairing contains the mirrors or reflective surfaces , mirror mounts , and electrical wiring , electrodes , diodes , or other equipment used to stimulate the gain media . it may also contain heat transfer mechanisms to help cool the mirrors or reflective surfaces , gain media , and other components . electrical wiring in the fairing may also provide electricity to optical or electrical components , such as pzts or piezo - controlled mirror actuators which may be used to enhance or facilitate operation of the resonant cavities . the electrical wiring could run within or along the shaft , or along any structural components , such as crossbeams or mirror mounts . electrical power may be provided to the photon turbine 16 using conventional means , such as slip ring assemblies or rotary transformers . in addition to the photon turbine 16 , the ptg also includes conventional power generation equipment 17 , including a rotor and stator . bearing assemblies 18 are positioned to support the shaft 6 . conventional mechanical bearings may be used for the ptg . for smaller - sized ptgs that may operate at high rotational speeds , magnetic bearings ( potentially with mechanical backup bearings ) might be useful for supporting the shaft . any type of bearing system may be used however , including but not limited to mechanical bearings in either a primary or backup capacity , magnetic bearings , active magnetic bearings , passive magnetic bearings , liquid bearings , fluid bearings , solid bearings , ceramic bearings , air bearings , and gas bearings . the initial start - up power for the ptg may be provided by an existing power supply . however , once the ptg has reached its operating speed , it can produce enough power such that a percentage of its output may be diverted to provide electricity to stimulate the gain medium . thus , the ptg would be “ self - pumped .” a self - pumped ptg would be capable of operating continuously for a long period of time — potentially for many years . the main limiting factor would be the lifetime of the laser . this is why diode lasers are an attractive option for the ptg . diode lasers may have lifetimes that allow for over 100 , 000 hours of continuous operation . other limiting factors for the ptg are the normal wear and tear of the electrical and mechanical equipment . thus , the ptg is not a perpetual motion machine . nor does it violate the second law of thermodynamics . its potential for greater than 100 % efficiency is a feature that has a limited duration — specifically , the lifetime of the gain medium and / or laser pumping devices . however , these components may be reused after they degrade or expire . for example , the crystals of diode lasers or diode - pumped solid - state lasers could be recycled and re - fabricated for future use in a ptg . as shown in fig7 a , some of the electrical output 19 from the stator is distributed to the application that the ptg is supplying power to ( e . g ., the electrical power grid , a vehicle , an electronic device ). the remainder of the electrical output is distributed back onto the photon turbine to pump the input laser and provide power to other components , such as a feedback control system or heat removal system . wiring runs from the stator 17 to a ptg control center 21 , which distributes electricity onto the photon turbine 16 through the bearing and power transfer assembly 20 . in addition to supplying the ptg with electricity to maintain operation of the resonant cavities or waveguides , the control center may be used to manage a feedback control system for optimal performance of the resonant cavities or waveguides , regulate a heat removal system , monitor the performance of various components onboard the photon turbine 16 , and oversee a safety system in which automatic shutdown of the input laser beam would be implemented under certain conditions ( e . g ., mirror misalignment , mirror damage , bearing failure , breach of the fairing by a foreign object ). the primary responsibility of the control center is to control the power of the input laser . by adjusting the power of the input laser , the amount of circulating power inside the resonator can be controlled . the control center 21 can determine the appropriate amount of laser pump power based on the electrical load placed on the ptg . thus , the ptg allows for precision control of torque through the control of the power of the input laser beam . precision control of torque is another advantage of the ptg over many existing electrical generators . to adjust the torque , the input laser beam may be adjusted in power , or even turned off temporarily . this will modify the power of circulating laser beam and therefore the torque with a nearly immediate response time . if a ptg has no electrical load placed on it ( e . g ., a computer , power tool , or vehicle that a ptg provides power to is not being used ), the control center 21 may reduce the power of the input laser beam , or turn off the input laser beam periodically . thus , the ptg could continue to spin at the normal operating speed — so that it will be prepared for a full electrical load when the device it is connected to is turned on — but usage of the laser generator would be minimized . the input laser beam would only need to provide enough power to enable the ptg to overcome any general countervailing forces , such as friction and air resistance , and maintain a constant angular speed . this is roughly analogous to the “ sleep ” or “ standby ” mode , such as implemented in a computer . by using only minimal power to keep the ptg spinning , the stress on the gain medium and pumping devices may be reduced and the laser lifetime increased . the control center 21 may also function as power conditioning equipment or a power management system operative to modify or adjust the electrical power output . the control center 21 may also be configured as a control mechanism to regulate the speed of the ptg , including but not limited to controlling the input laser , any type of braking system , or any method of applying counter - torque . fig7 b shows an alternate configuration of the ptg in which the input laser beam 10 is not produced on the photon turbine 16 . rather , the input laser beam 10 is produced at a separate location and is then inserted into the photon turbine 16 . this configuration removes the need to produce and manage the input laser beam while it is rotating on the ptg . however , it also requires a method of inserting the input laser beam into the photon turbine 16 while the ptg is rotating , in a manner that is capable of providing continual power ( which may be provided by various types of lasers , including pulsed or continuous wave lasers ) to the resonators . two methods of inserting the input laser beam into the photon turbine 16 are discussed in fig4 , 5 a , and 5 b . the shaft method of inserting the input laser beam is depicted in fig7 b . this ptg configuration uses an exciter 22 instead of a slip ring assembly to provide electricity to the ptg . if the laser generator 4 is not located on the ptg , it significantly reduces the need for electrical power onboard the ptg . the feedback control system and potentially a heat removal system would require some power , but these systems might be supported by the electricity produced by the exciter 22 . thus , in this configuration , the exciter 22 produces electricity not only for the rotor field windings , but also for the feedback control system , potential heat removal system , and any other systems or components supporting the ptg . in this configuration , the control center 21 provides electrical power to the laser generator 4 , which produces the input laser beam 10 . in this figure , the input laser beam 10 is aimed at a laser window 15 at the end of the shaft 6 . however , the input laser beam 10 may also be produced at a separate location , transmitted across an area using directional mirrors , and ultimately guided into the ptg , as shown in fig1 . various methods , including but not limited to a slip ring assembly , rotary transformer , or exciter could be used to provide electricity to the ptg . any of these devices may be used with any configuration of the ptg . fig7 a uses a slip ring assembly because stimulating an onboard gain medium might require a substantial amount of electricity , depending on the size and efficiency of the ptg . if the gain medium is not placed on the photon turbine 16 , the power requirements onboard the photon turbine will likely be substantially reduced , and the exciter may be a preferable option to provide onboard electricity . fig8 shows a cross - sectional view of a ptg using two ring resonators . this configuration shows that the ptg may be designed and operated with ring cavities . laser generators 4 are placed on a crossbeam 9 near the resonant cavities . the laser generators 4 produce the input laser beams 10 , which are inserted into the resonant cavities , thereby creating passive cavities . the triangular shaped resonators are pointed in opposite directions , so that their net torques are additive . each resonator produces a net torque in a counterclockwise direction . plural ring resonator cavities are arranged to be rotationally symmetrical around the longitudinal axis of the shaft 6 . the direction of the forces due to radiation pressure applied to the mirrors 1 farthest from the shaft 6 runs directly along the lever arms made between these mirrors and the axis of rotation 6 . thus , the torque provided by these mirrors is zero . of the two remaining mirrors 1 within each resonant cavity , the mirrors 1 mounted on the crossbeams 9 , which reflect the circulating laser beam 5 at a low angle of incidence , produce greater torque than the other mirrors 1 . this is because of the lower angle of incidence of the circulating laser beam 5 and larger angle that the force makes with the lever arm compared with the other mirrors 1 . the net torque on the photon turbine results in counterclockwise rotation of the ptg . neutralizing one of the mirrors 1 in each resonator by ensuring the force applied to it is coincident with the lever arm is not necessary to create an imbalance of torques when using this ptg design . however , this technique was used in this figure to highlight a useful tactic when designing resonant cavities for the ptg . positioning resonator mirrors 1 so that their forces extend directly along their lever arms , or placing mirrors directly adjacent to the axis of rotation 6 , may be useful ways to reduce or eliminate the torque of one or more of the mirrors in the resonant cavities or waveguides , thereby helping to create the imbalance of torques necessary to rotate the ptg . using a mirror geometry based on a narrow isosceles triangle can help to create the imbalance of torques that results in rotation of the ptg . by using a narrow isosceles triangle , the angle of incidence on one of the mirrors is lower than the other two mirrors . this results in a significantly greater force from radiation pressure on the mirror that receives the circulating laser beam 5 at a low angle of incidence . also , if the mirror with the lower angle of incidence is placed in line with the lever arm — as shown in fig8 by mounting this mirror on a radial crossbeam 9 — then the force will be applied perpendicularly to the lever arm . in contrast , the other mirrors may be positioned to create oblique angles with the lever arm , or be perpendicular to the lever arm . this further increases the difference in torque produced between the mirrors . as with the z - shaped folded ptg configuration , this configuration may include the gain medium either outside the resonators , resulting in passive cavities ( as shown in fig8 ), or inside the resonators , resulting in active cavities . a passive cavity would most likely involve a unidirectional circulating laser beam . an active cavity would involve a bidirectional circulating laser beam , unless an optical isolator or optical diode were used to produce a unidirectional circulating laser beam . either a unidirectional or bidirectional circulating laser beam would provide counterclockwise rotation . also , the laser generator 4 could be taken off this ptg and placed at a separate location . the input laser beam could then be inserted through the shaft ( as shown in fig5 b and 7 b ) or with another method and then distributed into the ring resonators . similar to fig2 , the ring resonators would extend through the length of the cylindrical fairing . the laser generator 4 , mounted on the crossbeams 9 , would also extend through the length of the fairing . fig9 shows a ptg that uses closed - loop waveguides extending outward from the shaft 6 . in the embodiment shown , the waveguides are straight and radial , though they may extend generally radially but not necessarily straight , for example in a spiral fashion or some other way , without departing from the scope of the present disclosure . four waveguides are shown , though more or fewer may be included . the waveguides are arranged generally in a rotationally symmetric way around the axis of the shaft 6 . the circulating laser beam 5 bounces back and forth inside the waveguides , striking the walls of the waveguides 23 with the same angle of incidence . the laser generators 4 are placed near the shaft 6 , behind one of the end mirrors 24 of each waveguide . end mirrors 24 positioned at both ends of each waveguide keep the circulating laser beam 5 in the waveguide . the circulating laser beam 5 applies the same amount of force due to radiation pressure against each wall . however the angle that the force makes with the axis of rotation 6 is different , depending on which wall is struck by the circulating laser beam 5 . for example , in the waveguide that extends rightward from the shaft , when the laser beam reflects off the top wall , the force applied is perpendicular to the lever arm . in contrast , when the circulating laser beam 5 reflects off the bottom wall , the force applied — which is perpendicular to the wall — forms an acute angle with the lever arm . thus , even though the forces applied against the walls are the same , the resulting torques are different . the torque applied to the top wall of the waveguide is greater than the torque applied to the bottom wall . thus , the ptg will rotate in a counterclockwise direction . end mirrors 24 are positioned perpendicularly to the circulating laser beam 5 at both ends of each waveguide . when the laser beam reaches the end of the waveguide , it strikes the end mirror 24 with a perpendicular angle of incidence . thus , the end mirror 24 directs the laser beam backward , so that it retraces the same path until it reaches the other end mirror 24 . in this configuration , the end mirrors are oriented so that they provide additional torque in the counterclockwise direction . when using this ptg design , it should be noted that , as the distance from the axis of rotation 6 increases , the difference in the torque produced between the reflections of the circulating laser beam 5 off the upper and lower walls 23 gradually decreases . for example , in the waveguide extending rightward from the shaft 6 , at great distances from the axis of rotation 6 , the angle made between the lever arm and the force of the radiation pressure against the lower wall will be only slightly less than perpendicular . given this tendency of the torques to cancel out at great distances from the shaft 6 , it is preferable to limit the length of each waveguide , so that a significant torque differential is maintained throughout the waveguide . for simplicity and to illustrate the basic design , only four waveguides are placed on the photon turbine in fig9 . in practice , the entire fairing could be filled with waveguides , which could extend outward from the shaft 6 in every direction , similar to spokes on a wheel . this would maximize the surface area available to receive em radiation , thereby increasing the potential torque and overall power output of the ptg . note that the same basic configuration of the ptg in fig9 could be designed using individual mirrors placed in a series , forming a folded cavity , rather than using a waveguide . however , the waveguide would allow for a greater total surface area , which could potentially receive greater torque from a circulating laser beam . similar to fig2 , the waveguides would extend through the length of the fairing 3 . thus , the waveguides would resemble four planes running through the fairing . each laser generator 4 would run along the length of the shaft 6 behind the end mirror of its corresponding waveguide . while the ptg configuration in fig9 uses passive cavities , it could also be designed to use active cavities , where the gain medium is placed inside the waveguides . alternately , the laser generator 4 could be placed at a separate location and the input laser beam 10 directed into the photon turbine , similar to fig5 b or 7 b . directional mirrors on the photon turbine could then guide portions of the input laser beam 10 into the various waveguides . fig1 and 11 show a ptg based on a resonant cavity that incorporates a fixed , stationary mirror . in this design , the surrounding cylinder 25 does not rotate , but rather is a stationary structure with a high reflectance mirror coating on its interior surface . this fixed structure will form a resonator with the mirrors mounted on the shaft 6 , which is placed inside of it . as shown in fig1 , seals 28 are placed at the location where the shaft 6 enters the cylinder 25 . this will allow the shaft 6 to rotate while enabling the interior of the cylinder 25 to be evacuated for optimal resonator performance . alternately , the entire cylindrical structure and shaft section of this ptg could be placed inside of a vacuum chamber , while the stator , which surrounds the field windings of the rotor , remains outside of the vacuum chamber . this would make heat dissipation on the rotor more challenging , but it may be a useful design option . regardless of how the vacuum conditions are established , in this configuration , the shaft 6 will rotate while the cylinder 25 , which is mounted on a pedestal base 42 , remains stationary . as shown in fig1 , the design of the resonator is broadly similar to a confocal unstable cavity . however , there are a few important differences . the convex mirrors 26 at the ends of the crossbeam 9 are essentially cut in half at the center . thus , on the right side of the crossbeam 9 , the top portion of a convex mirror 26 extends upward . on the left side of the crossbeam 9 , the bottom half of a convex mirror 26 extends downward . this helps to produce the imbalance of forces necessary to rotate the shaft 6 . the other notable difference from a confocal unstable cavity is the presence of the planar ( or long - radius ) mirrors 27 positioned on the other crossbeam 9 . these planar ( or long - radius ) mirrors 27 perpendicularly reflect the laser beam 5 that is reflected off the interior wall of the cylinder 25 , which acts as a concave mirror , regardless of where the mirrors mounted on the shaft 6 are located at a given time . thus , the circulating laser beam 5 is reflected directly back to the interior wall of the cylinder 25 , which then reflects the circulating laser beam 5 back onto the convex mirror 26 . thus , a folded cavity is formed between the three elements — the convex mirror , the cylindrical ( concave ) mirror , and the planar ( or long - radius ) mirror . because the force applied by the circulating laser beam 5 due to radiation pressure on the planar mirror ( or long - radius mirror ) 27 is perpendicular to the lever arm , and the force due to radiation pressure on the convex mirror is applied at an acute angle with the lever arm , there is an imbalance of torques , resulting in counterclockwise rotation of the shaft 6 . because the shaft 6 is placed inside of the cylinder 25 , which is a rotationally symmetrical structure , the resonant cavity should be maintained as the shaft 6 rotates . as with other ptg designs , the mirrors will move a very small distance during the time it takes a photon to make one round trip . by using the curved mirror of the cylinder 25 ( and , if necessary , a long - radius mirror 27 on the crossbeam 9 ), along with a feedback control system that may include pzts or piezo - controlled mirror actuators , the stability of the resonator can be maintained as the shaft 6 rotates . the requirements for precision control in maintaining resonance between a rotating object and a stationary object suggest that this configuration may be more complex to operate than other configurations discussed in this specification . in addition , some of the force of the radiation pressure is applied to the stationary cylindrical structure 25 , and thus does not directly contribute to rotating the shaft 6 ( although it does not detract from rotating the shaft 6 either by producing counter - torque ). however , this configuration is included here to illustrate a photon turbine with a resonator that comprises both fixed and rotating elements . it is another approach to designing a ptg that may be worthy of consideration . in contrast to gas turbines or steam turbines , the photon turbine does not rely on heat to cause its rotation . the resonator mirrors generally avoid heat by reflecting nearly all of the em radiation that strikes their surfaces . thus , broadly speaking , heat dissipation should be significantly less of a concern in the ptg than in other types of turbines . in addition , heat may be minimized by keeping the power of the circulating laser beam well below the optical damage threshold of the mirrors or reflective surfaces . it should be noted that the circulating power inside the resonators of the ptg does not have to be near the optical damage threshold of the mirrors . the efficiency of the ptg is a function of the reflectivity of the mirrors . thus , by using a circulating laser beam that stays well below the optical damage threshold of the resonator mirrors , a ptg could operate at a high level of efficiency while minimizing the risk of mirror damage and reducing the need for active cooling . applications in which a high power density may be preferable — such as transportation systems — might require the circulating power inside the resonators to be close to the optical damage threshold of the mirrors . however , for a power plant , a high power density is not necessary , as there should be ample space allocated for the ptg . in a power plant , the power of the circulating laser beam could be distributed on mirrors or reflective surfaces with large surface areas , thereby lowering the risk of optical damage and reducing the need for active cooling . however , even with absorption rates of a small fraction of 1 %, the resonator mirrors may be required to withstand a substantial amount of power from the circulating laser beam , which may lead to heat buildup on the mirrors . furthermore , the vacuum conditions in which the photon turbine may operate may make heat removal more challenging . various conventional methods may be used to remove heat from the components of the ptg . the following figures are simply intended to provide a few examples of how heat may be removed from the mirrors or reflective surfaces . there are many other methods , including active and passive techniques , that may be used to remove heat from the mirrors or reflective surfaces , as well as other components of the ptg . the following examples focus on a few methods that may be used to cool the resonator mirrors . identical or similar techniques may be applied to the other mirrors or reflective surfaces on the photon turbine . whichever method is used for thermal management of the ptg , it is important to ensure that the method does not interfere with the orientation or reflectivity of the mirrors , or the overall performance of the resonators . in fig1 - 15 , various methods of heat removal are shown . note that these are only a few potential options for heat removal . many other methods , both active and passive , could be used to remove heat from the resonator mirrors and other components of the photon turbine . any of the heat transfer methods discussed in this specification may be used alone , in combination with each other , or in combination with other methods not discussed in this specification . the heat removal mechanisms discussed in this specification focus on the mirrors or reflective surfaces of the ptg . cooling or thermal management of the gain medium and other components of the ptg may be achieved using conventional means . in some instances , the same method used to cool the resonator mirrors might also be used to cool the gain medium . the structures that secure the gain medium to the photon turbine may be used to provide direct contact cooling of the gain medium . note that the cooling requirements of the gain medium in an active cavity may be significantly greater than in a passive cavity , as the gain medium would be exposed to the high intensity circulating laser beam in an active cavity . if the laser generator is not located on the photon turbine , and is operated from a separate location , it may facilitate thermal management of the gain medium . for the rotor , stator , exciter , or bearings , conventional means may be used to provide cooling . fig1 shows heat transfer by radiation from the back side of a resonator mirror 1 . heat waves are shown between the mirror mounts 2 , moving toward the fairing 3 . the heat is emitted from the mirror 1 , passes through the vacuum , and ultimately is absorbed by the fairing 3 . the outer wall of the fairing 3 is in direct contact with the ambient air . thus , the heat absorbed by the fairing 3 can be removed by direct contact with the ambient air . if necessary , heat removal from the fairing 3 could be facilitated by jets of cold air or other gases , as shown in fig1 . given the vacuum conditions inside of the fairing , radiative heat transfer may be preferable to other methods . however , if the resonator mirrors cannot maintain optimal performance through radiation of heat , an active cooling system may be necessary . fig1 shows a heat pipe running from the shaft 6 to the back side of a resonator mirror 1 mounted on a crossbeam 9 . heat pipes , which are highly efficient mechanisms of heat transfer , could be especially useful for smaller - sized ptgs , where more active forms of cooling may be less convenient . the centrifugal force of the rotation of the ptg causes the liquid to flow from the top of the heat pipe 29 , near the shaft , to the bottom of the heat pipe 29 , adjacent to the mirror 1 . the heat pipe 29 may simply be an empty cavity or it may contain grooves 30 or a wick structure to facilitate the movement of the liquid toward the mirror 1 . the centrifugal force of the ptg may reduce or eliminate the need for a wick structure or grooves in the heat pipe 29 . the liquid will absorb heat from the mirror 1 , evaporate , and then travel through the vapor chamber 31 toward the shaft 6 . at the opposite end of the heat pipe , adjacent to the shaft , the vapor will condense and begin the cycle again . the outer portion of the shaft 6 , adjacent to the top of the heat pipe 29 , may be kept at a low temperature by various methods , which may include passing a cold fluid through it axially . thus , the heat absorbed from the heat pipe may be removed by a cold fluid ( liquid or gas ) that flows from one end of the shaft to the other . after the fluid exits the shaft and flows away from the ptg , the heat may be transferred from the fluid to the ambient air . fig1 shows active cooling using conduits 32 that run along the periphery of a resonator mirror 1 . the conduits 32 may be mounted 33 on the fairing 3 alongside of the mirror 1 . each conduit 32 provides an open passage 43 for a fluid , such as a liquid or gas , to circulate and remove heat from the mirror 1 . a cold fluid can be distributed onto the turbine using conventional means . the cold fluid runs through the conduits 32 , along the sides of the mirrors , absorbing heat , and then returns to the source , potentially off the ptg at a nearby location , to dissipate the collected heat . the conduits 32 may be simple linear or planar passages 43 , or they may contain microchannels , manifolds , or other means to distribute a cold fluid to the mirror 1 . various gases or liquids may be used as a coolant , including air or water . in addition , the same substance used to cool the rotor and / or stator may also be used in the conduits . hydrogen is often used to cool rotors , so it could potentially be used in the conduits to cool the mirrors . however , the use of a flammable substance such as hydrogen in close proximity to high - power lasers could pose a safety risk , and therefore , it may not be a suitable choice for a coolant . also , if a photon turbine is coupled with a high - temperature superconducting generator , liquid nitrogen could potentially be used in the cooling conduits . thus many different fluids may be used to cool the mirrors . the particular coolant selected would be based on several factors , including the amount of heat buildup on the mirrors and the optical damage threshold of the mirrors . in practice , any type of head transfer device or mechanism is used . in addition , any type of safety mechanism is used , which may include a protective barrier to contain , disperse , reduce , or eliminate any em radiation that may escape from the resonators , resonant cavities , or waveguides ; a coating on the interior surface that could reflect , scatter , or absorb the em radiation ; and any type of device or component that reduces or minimizes vibrations . the cooling conduits 32 in fig1 are shown running along the sides of the mirror 1 . if necessary , the conduits could also run along the back side of the mirror 1 . however , cooling at the sides of the mirror 1 may be preferable , because back side cooling may interfere with the insertion of the input laser beam 10 ( if a passive cavity is used ). also , if back side mirror cooling is used , the cooling conduits 32 may have to share space with other components , including mirror mounts and potentially pzt equipment . it should be noted that if a passive cavity is used in the ptg , one of the resonator mirrors functions as the input mirror , allowing the input laser beam to enter the cavity . the incoming laser beam must not be prevented from entering the resonant cavity by a cooling conduit on the backside of the input mirror . therefore , cooling of the input mirror could either be limited to its sides or periphery , or , it may be cooled on its back side if both the conduit and the coolant were transparent to the laser beam . thus , a transparent conduit containing air or water would be able to cool the backside of the mirror while allowing the input laser beam to enter the cavity . in addition to removing heat from the resonator mirrors , the conduits may also be used to remove heat from other ptg components , including laser pumping devices such as diodes , the gain medium ( if it is placed on the turbine ), directional mirrors , and electrical wiring . fig1 shows the cylindrical fairing of the photon turbine being cooled by jets of cold air or gas . the cold air or gas is conveyed to the ptg by a conduit 34 and then distributed onto the fairing through the nozzles 35 . with this method , the fairing ( or a section of it ) is constructed of a material with high thermal conductivity . when the cold air or gas is applied to the surface of the fairing , the temperature of the fairing is reduced , which will then reduce the temperature of the mirror mounts affixed to the interior of the fairing . the reduced temperature of the mirror mounts would then be able to absorb a greater amount of heat from the resonator mirrors . alternately , the conduit 34 could provide a liquid or mist for the nozzles 35 to apply to the fairing . this method of cooling by jets of air , gas , liquid , or mist might not transfer as much heat as other methods discussed in this specification . however , if only a small amount of heat dissipation is required , this may be a simple and convenient option . fig1 shows a power plant using a solar - pumped ptg . while a self - pumped configuration of the ptg is preferable , based on its overunity efficiency , a solar - pumped ptg would also be a useful configuration . rather than using its own power output to produce the input laser , as in the self - pumped configuration , a solar - pumped ptg would use sunlight to produce the input laser . in fig1 , heliostats 36 are used to direct sunlight to a central tower 37 . a central deflecting mirror 38 at the top of the central tower 37 deflects the incoming beams downward into a light pipe 39 , which delivers the sunlight to a laser generator 4 . the sunlight stimulates the gain medium , creating a solar - pumped input laser beam 41 , which is distributed to a ptg using guide mirrors 40 . in this drawing , the ptg is shown in an underground facility below the central tower 37 and field of heliostats 36 . however , the ptg could also be built aboveground , such as at the base of the central tower 37 . for simplicity , fig1 shows only one laser generator 4 and one ptg . however , the solar radiation collected could be applied to many gain media , producing many lasers , which could be distributed to many different ptgs . the ptg in this drawing uses a laser generator 4 located away from the ptg , rather than placing the laser generator 4 on the photon turbine 16 . the input laser beam enters the shaft 6 of the ptg , as previously shown in fig7 b . the design of the resonators inside of the fairing could be identical to those shown in fig5 a . or the resonators could be based on fig8 and 9 , but without the laser generator onboard , and with directional mirrors inside of the shaft to distribute the input laser beam to the resonant cavities or waveguides . alternately , the photon turbine in fig1 could use an entirely different design . in addition , a solar - pumped ptg could also use the method shown in fig4 to insert the input laser beam into the photon turbine . if that method were used , the resonator design may be based on fig1 . furthermore , another option would be to direct the sunlight into the shaft 6 of the ptg and then produce the solar - pumped lasers using laser generators placed onboard the photon turbine , either inside or outside of the resonant cavities or waveguides . for a given solar collection area , the amount of power that could be generated with a solar - pumped ptg is substantially greater than the power output provided by other forms of solar power , including solar thermal power and photovoltaic power . the world &# 39 ; s current largest solar thermal power plant has a capacity of 354 mw based on a mirror surface area of 6 . 5 km 2 . assuming the efficiency of the solar - pumped ptg in fig1 is 470 % ( identical to the ptg in the sample power calculation ), the power output can be calculated as follows : if the 6 . 5 km 2 mirror array receives a solar input of 1 kw / m 2 , the total solar radiation collected is 6 . 5 gw . with a ptg operating at 470 % efficiency , the power output would be 30 . 6 gw ( 6 . 5 gw × 4 . 7 )— approximately 100 times the output the world &# 39 ; s largest solar thermal power plant , and substantially greater than most , if not all , conventional power plants . even if mirrors of 99 . 9999 % reflectivity were used , instead of the 99 . 99999 % reflectivity assumed in the previous calculation , the power output would still be 3 . 06 gw . this power output is still an order of magnitude higher than a solar thermal plant with the equivalent solar collection area . it is also greater than the output of most large conventional power plants . thus , even when solar pumping is used ( as opposed to relying on surplus power from overunity efficiency ), the ptg is capable of producing substantially greater output and providing greater efficiency than existing power generators . it will be appreciated that variants of the above - disclosed and other features and functions , or alternatives thereof , may be desirably combined into many other different systems or applications . various presently unforeseen or unanticipated alternatives , modifications , variations , or improvements therein may be subsequently made by those skilled in the art which are also intended to be encompassed by the following claims .

8General tagging of new or cross-sectional technology

fig1 is a side view , partially broken away and partially in section of a revolver incorporating the firing mechanism of the present invention ; fig2 is an elevational view of the firing mechanism of the revolver shown in fig1 with the parts disposed in the positions they assume when the trigger nears the end of its stroke as it is being pulled during double - action , portions of the gun being shown broken away and partly in section ; fig3 is a view similar to fig1 but on a smaller scale and showing the parts in the positions they assume at the instant the gun is fired ; fig4 is a perspective view of the hammer by itself ; and the revolver 10 consists basically of a frame 12 , a chamber cylinder 14 rotatably mounted in a central opening 16 of frame 12 , a barrel 17 , a hammer 18 , a trigger 20 , an indexing pawl or hand 22 and a cylinder lock 24 . frame 12 includes a trigger - guard 26 and a tang - portion 28 , on which the grip ( not shown ) is fastened . barrel 17 is rigidly mounted in the front of frame 12 and has rear extension 30 that projects a short distance into the central opening 16 into close proximity with the front end - wall of cylinder 14 . cylinder 14 is mounted on a spindle 32 , the rear end of which protrudes a short distance from the rear face of cylinder 14 for engagement within a hole 33 in frame 12 . spindle 32 extends forward from cylinder 14 below the barrel 17 and is journaled in a cylinder crane ( not shown ), by which it may be swung out laterally of frame 12 in order to reload the cylinder in the usual manner . a ratchet wheel 40 is mounted concentrically on cylinder 14 at its rear end for rotation therewith and has a plurality of radially disposed teeth which are engaged by the indexing hand 22 in sequence for rotating cylinder 14 in order to index the chambers one at a time into alignment with the barrel 17 . trigger 20 is pivoted on the frame 12 about a pivot pin 42 between its normal position of rest shown in fig1 and retracted or fired position shown in fig3 . cylinder hand 22 is pivotally connected at its lower end to a rearwardly and upwardly projecting portion 43 of trigger 20 by a pivot pin 44 and is resiliently urged forward at its upper end by means of a spring ( not shown ) for engagement of its nose 45 with ratchet 40 . each time trigger 20 is retracted , hand 22 indexes cylinder 14 to move the next chamber into line with the barrel where it is held by cylinder lock 24 . as illustrated in fig5 the upper portion of trigger 20 is centrally slotted at 46 to receive a gear - segment 48 , which is rigidly fixed to the trigger by means of pins 42 and 44 . one end of pin 44 projects through the far side of the trigger as viewed in the drawings into a hole at the lower end of cylinder hand 22 , thereby pivotally connecting the hand 22 to trigger 20 . the other pin 42 is the trigger pivot pin . a pair of conventionally shaped sear - noses 49 ( fig3 and 5 ) is provided on the slotted rear extension 43 of trigger 20 cocking engagement with a corresponding pair of cocking feet 50 fig3 and 4 ) on hammer 18 for cocking the hammer in single - action in the usual manner . hammer 18 pivots between its cocked position shown in fig2 and its fired position of fig3 but instead of being journaled directly on the hammer pin in the conventional manner , is arranged to pivot on a pair of pivot plates 51 , each of which in this instance consists of a circular disk forming a trunnion . each disk 51 is received within one of a pair of enlarged circular openings 52 , 52 ( fig . 4 ) co - axially disposed in opposite sides of hammer 18 , openings 52 , 52 forming the bearing surfaces for the hammer as it pivots on being cocked and fired . disks 51 in turn are pivoted eccentrically about a hammer pin 53 supported at both ends in frame 12 . as best seen in fig1 and 4 , the lower portion of hammer 18 is centrally slotted in order to form depending , parallel side walls 54 , 54 , between which is slidably received a gear - plate 55 having a series of teeth 56 that mesh with the gear teeth on the trigger - segment 48 . gear - plate 55 is rigidly fastened by means of a clevis pin 57 to the two eccentric disks 51 for pivotal movement therewith about hammer pin 53 , the clevis pin 57 extending through gear - plate 55 with its ends engaging within holes in each of the eccentric disks 51 . accordingly , disks 51 and gear - plate 55 are movable as a unit about the hammer pin 53 between the position shown in fig1 in which the pin 57 is located in an elevated position higher than the hammer pin 53 and the position shown in fig3 where pin 57 is lower than the hammer pin 53 . it is apparent therefore that in addition to pivoting about the eccentric disks 51 , hammer 18 is also movable bodily relative to the hammer pin 53 and , therefore , to the frame 12 . thus , in the position shown in fig1 the striking portion 58 of hammer 18 is disposed above , and consequently out of registry with , the firing pin 59 , whereas in the position shown in fig3 the hammer is lowered bodily within frame 12 , so that the striking portion 58 is aligned with the firing pin for discharging a cartridge . the main hammer spring 60 is held in compression between a shoulder on the hammer strut 61 and an apertured plate 62 seated within the tang portion 28 of frame 12 , with the upper end of strut 61 bearing against a pin 63 on hammer 18 in the usual manner . as shown in fig3 hammer 18 has just been driven by the main spring 60 from its cocked position into engagement with the firing pin 59 in order to fire the gun . pivoted to a projection 64 on the lower rear portion of gear - plate 55 is a sear lever 65 by which gear - plate 55 drivingly engages a sear notch 66 in the under edge of hammer 18 for cocking the hammer by means of the trigger in order to fire the gun in double - action . a torsion spring 67 urges sear lever 65 in a counterclockwise direction as viewed in the drawings about its pivot pin 68 toward engagement with wear notch 66 when both the hammer and the trigger are in their normal positions of rest as shown in fig1 . thus , when the trigger is pulled in double - action ( i . e . without first cocking the hammer ), trigger - segment 48 pivots gear - plate 55 counterclockwise , and since the nose 69 of sear lever 65 is resiliently held in engagement with sear notch 66 , the hammer 18 is driven in the same direction until it reaches its cocked position ( fig2 ). at the same time counterclockwise movement of gear - plate 55 has pivoted eccentric disks 51 about hammer pin 53 , lowering hammer 18 into alignment with the firing pin 59 so that when the hammer is released it will strike the firing pin . an elongated finger 70 pivotally mounted on the front portion of sear lever 65 extends forward into the slot 46 in trigger 20 under the gear - segment 48 . the rear end of finger 70 is formed in such a manner that it can pivot freely when the trigger is forward ( fig1 ), but is prevented from pivoting clockwise relative to sear lever 65 after the gear - plate 55 has been rotated far enough to bring a foot - portion 71 on finger 70 into contact with an abutment surface 72 on the sear lever 65 . thus , as illustrated in fig2 where the sear lever 65 has been moved forward as the trigger is retracted , the foot - portion 71 is shown engaging the surface 72 so that finger 70 is lifted into contact at its free end with the under edge of gear - segment 48 . continued movement of gear - plate 55 as trigger 20 is retracted causes the sear lever 65 to be pivoted clockwise about its pivot pin 68 to the position shown in fig2 where the sear nose 69 is on the point of releasing the hammer . any further retraction of the trigger will move the sear nose 69 clear of notch 66 allowing the hammer 18 to fall under the pressure of the main spring 60 , and the parts will then assume the position shown in fig3 . operation of the gun in single - action is similar to that of a conventional revolver firing mechanism except that when the hammer is retracted by the thumb - piece 19 , it is simultaneously lowered from its safe position ( fig1 ) into alignment with the firing pin 59 . thus , as the hammer is pivoted counterclockwise , the cocking feet 50 engage the under edges of the trigger - extension 43 , pivoting trigger 20 clockwise , so that trigger gear - segment 48 then pivots gear - plate 55 and eccentric disks 51 counterclockwise . such pivotal movement of eccentric disks 51 results in the point about which hammer 18 pivots being lowered to bring the striking portion 58 of the hammer into alignment with the firing pin . when the hammer is fully cocked by engagement of its cocking feet 50 with the sear - noses 49 on trigger - extension 43 , trigger 20 is partially retracted in a cocking position , so that when it is pulled to fire the gun , the hammer will be released in the usual manner . it will also be noted that during firing , the hammer is held in its lowered position for alignment of its striking nose 58 with the firing pin until the trigger is released . however , if the hammer is accidentally jarred out of cocking engagement with the sear - noses 49 , as for example if the revolver is inadvertently dropped , the trigger will be immediately returned to its forward - most position by the pressure of the main spring 60 on hammer 18 , causing the hammer to be lifted to its inoperative position out of alignment with the firing pin . the gun can therefore be fired only when the trigger has been intentionally pulled . from the foregoing , it will be apparent that the hammer is lowered and raised into and out of alignment with the firing pin by means of eccentric disks 51 , which in turn for all practical purposes form part of the gear - plate 55 and , therefore , pivot in one direction or the other in direct conjunction with the movement of the trigger . consequently , whether the hammer is retracted by the thumbpiece 19 in single action firing or by the trigger in doubleaction , trigger 20 is moved by a predetermined amount corresponding to the amount of movement of the hammer . furthermore , retraction of the trigger , whether directly by the shooter &# 39 ; s trigger finger or indirectly on manually cocking the hammer , results in a corresponding movement of gear - plate 55 so that eccentric disks 51 lower the hammer into alignment with the firing pin . on the other hand , unless the trigger is actually intentionally pulled in order to fire the gun , there is no way that the gun can be discharged . for example , if the hammer should accidentally fall during single - action while being cocked or by being jarred out of cocking engagement with the trigger , the pressure of the main spring 60 on the hammer immediately pivots the eccentrics 51 clockwise until the trigger 20 returns to its forward position before the hammer can strike the firing - pin . likewise , if the hammer accidentally receives a forwardly directed blow when it is in its uncocked position , there is no danger whatsoever that a live cartridge in the cylinder 14 can be discharged , due to the fact that the hammer is out of alignment with the firing pin 59 . another advantage of eccentrically mounting the hammer is that the trigger is constantly urged forward by the hammer spring 60 through gear - plate 55 and gear - segment 48 , thereby eliminating the need for a separate trigger - return spring .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

referring to fig1 of the drawings , a fuel cell power plant for a vehicle removes carbon monoxide in reformate gas produced by a reformer 3 by a carbon monoxide oxidizer 20 comprising two prox reactors 20 a , 20 b , and supplies an anode 4 a of a fuel cell stack 4 with hydrogen - rich gas . air is supplied from an air pump 6 b to a cathode 4 b of the fuel cell stack 4 . the hydrogen - rich gas and the oxygen in the air cause electrode reactions shown by the following chemical equations ( 1 ), ( 2 ) at the anode 4 a and cathode 4 b . anode 4 a : h 2 → 2 h + + 2 e − ( 1 ) due to the power generated by these electrode reactions , the fuel cell stack 4 generates power . a vehicle drive motor , not shown , is connected to the fuel cell stack 4 . fuel gas from a fuel tank 1 and water from a water tank 2 are respectively supplied to the reformer 3 . the fuel gas may be a hydrocarbon fuel such as methanol or gasoline . if methanol is used as the fuel gas , the reformer 3 generates reformate gas according to the chemical reactions shown by the following chemical equations ( 3 ), ( 4 ). the reformate gas has hydrogen ( h ) as its main component , and contains carbon monoxide ( co ). if the carbon monoxide is supplied to the fuel cell stack 4 , it causes a decline of power generating efficiency of the fuel cell stack 4 , and poisons the catalyst at the anode 4 a of the fuel cell stack 4 . therefore , the carbon monoxide in the reformate gas is removed by the carbon monoxide oxidizer 20 , and hydrogen - rich gas in which the carbon monoxide concentration has been sufficiently reduced is supplied to the anode of the fuel cell stack 4 . the preferential oxidation reaction which takes place in the first prox reactor 20 a and second prox reactor 20 b of the carbon monoxide oxidizer 20 , may be represented by the following chemical equation ( 5 ). due to equation ( 5 ), the carbon monoxide oxidizer 20 decreases the co concentration in the reformate gas from the order of several percent to about 100 ppm in the first prox reactor 20 a , and then from about 1000 ppm to less than 20 ppm in the second prox reactor 20 b . the oxygen ( o 2 ) required for the preferential oxidation reaction is respectively supplied as air to the first prox reactor 20 a via a valve 7 , and to the second prox reactor 20 b via a valve 8 . the air pump 6 a has a function to supply air constantly under a constant pressure . therefore , the air supply flow rate to the first prox reactor 20 a is determined by the opening of the valve 7 . likewise , the old air supply flow rate to the second prox reactor 20 b is determined by the opening of the valve 8 . the valves 7 , 8 comprise electro - magnetic valves of which the opening is varied according to opening signals respectively output by the controller 5 . the controller 5 controls the opening of the valves 7 , 8 depending on the carbon monoxide concentration in the reformate gas and the temperatures of the first prox reactor 20 a and second prox reactor 20 b . the first prox reactor 20 a and second prox reactor 20 b have identical specifications . for this purpose , a co concentration sensor 11 which detects the carbon monoxide concentration in the reformate gas produced by the reformer 3 is installed midway in a pipe leading reformate gas from the reformer 3 to the carbon monoxide oxidizer 20 . also , a temperature sensor which detects the catalyst temperature of the first prox reactor 20 a and a temperature sensor 10 which detects the catalyst temperature of the second prox reactor 20 b , are provided . the detection data from these sensors are respectively input to the controller 5 as signals . the controller 5 comprises a microprocessor having a central processing unit ( cpu ), read - only memory ( rom ), random access memory ( ram ) and input / output interface ( i / o interface ). the controller may also comprise plural microcomputers . when the temperature or pressure in the reformer 3 varies , the co concentration in reformate gas may rise above the co concentration in the normal running state . in such a case , the air supply flow rate to the prox reactors 20 a , 20 b must be increased so that the co concentration in the hydrogen - rich gas supplied to the fuel cell stack 4 does not increase , and the carbon monoxide removal efficiency is enhanced . however , when the air supply flow rate to the prox reactors 20 a , 20 b is increased , the catalyst temperature rises due to the preferential oxidation reaction which is an exothermic reaction , and the catalyst may deteriorate . the controller 5 therefore , when the catalyst temperature is lower than the predetermined temperature , opens the valves 7 , 8 to increase the air supply flow rate to the prox reactors 20 a , 20 b , and when the catalyst temperature is higher than the predetermined temperature , it closes the valves 7 , 8 to decrease the air supply flow rate to the prox reactors 20 a , 2 b . next , referring to fig2 , a routine of controlling the air supply flow rate executed by the controller 5 to perform this control will be described . this routine is executed at an interval of 0 . 1 seconds during the running of the fuel cell power plant . the routines for controlling the air supply flow rate according to other embodiments described later , are all repeatedly executed at an interval of 0 . 1 seconds during the running of the power plant . first , the controller 5 , in a step s 11 , reads the temperature detected by the temperature sensor 9 , in a step s 12 , reads the temperature detected by the temperature sensor 10 , and in a step s 13 , reads the temperature detected by the co concentration sensor 11 . in a following step s 14 , the detected co concentration in the reformate gas is compared with a preset specified concentration . from the allowable co concentration in the hydrogen - rich gas supplied to the fuel cell stack 4 , and the co removal performance of the prox reactors 20 a , 20 b during normal running , the allowable co concentration in the reformate gas can be calculated . the specified concentration is a value set based on the allowable co concentration . a typical specified concentration range is 1 – 2 %. when the co concentration in the reformate gas is lower than the specified concentration , the controller 5 immediately terminates the routine without proceeding to subsequent steps . this is because , in this case , the co concentration in the hydrogen - rich gas remains within the allowable range even if the air supply flow rate to the prox reactors 20 a , 20 b is not increased . when the co concentration in the reformate gas is not lower than the specified concentration , in a step s 15 , the controller 5 compares the catalyst temperature of the first prox reactor 20 a with a predetermined temperature . the predetermined temperature is set to a value within the activation temperature range of the catalyst . a typical predetermined temperature is within the range of 140 ° c . to 160 ° c . when the catalyst temperature of the first prox reactor 20 a is not lower than the predetermined temperature , in a step s 16 , the controller 5 throttles the valve 7 by a fixed amount . due to this processing , as the air flow rate supplied to the first prox reactor 20 a decreases , the preferential oxidation reaction amount in the first prox reactor 20 a decreases , and the catalyst temperature correspondingly decreases . after the processing of the step s 16 , the controller 5 performs the processing of a step s 18 . when the catalyst temperature of the first prox reactor 20 a is lower than the predetermined temperature , the controller 5 performs the processing of a step s 17 . in the step s 17 , a map having the characteristics shown in fig3 prestored in a memory is looked up , and the air flow rate required to reach a target co conversion rate is calculated from the co concentration in the reformate gas . a typical target co conversion rate is 95 %. referring to fig3 , when the co concentration in reformate gas is for example 2 %, in order for the first prox reactor 20 a to reach the co conversion rate of 95 %, an air supply flow rate of 120 liter / minute corresponding to a point a is required . the controller 5 adjusts the opening of the valve 7 so that the air flow rate calculated in this way is realized . the controller 5 further calculates the co concentration in the gas flowing from the first prox reactor 20 a by the following equation ( 6 ): calculating the co concentration flowing from the first prox reactor 20 a using equation ( 6 ) when the co concentration in the inflowing gas is 2 % and the co conversion rate is 95 % as described above , the calculation results shown by the following equation ( 7 ) are obtained : after the opening of the valve 7 is adjusted in the step s 16 or 17 , in the step s 18 , the controller 5 compares the catalyst temperature of the second prox reactor 20 b with the aforesaid predetermined temperature . according to this embodiment , a common predetermined temperature is used in the steps s 15 and s 18 , but different predetermined temperatures may also be used for catalysts having different activities in the first prox reactor 20 a and second prox reactor 20 b . when the catalyst temperature of the second prox reactor 20 b is not lower than the predetermined temperature , in a step s 19 , the controller 5 throttles the opening of the valve 8 by a fixed amount . due to this processing , as the air flow rate supplied to the second prox reactor 20 b decreases , the preferential oxidation reaction amount in the second prox reactor 20 b decreases , and the catalyst temperature decreases correspondingly . after the processing of the step s 19 , the controller 5 terminates the routine . when the catalyst temperature of the second prox reactor 20 b is lower than the predetermined temperature , the controller 5 performs the processing of a step s 20 . in the step s 20 , the air flow rate required to reach the target co conversion rate is calculated from the co concentration of the inflowing gas by looking up the map having the characteristics shown in fig3 which was looked up in the step s 17 . as described above , the first prox reactor 20 a and second prox reactor 20 b have identical specifications , so the same map can be used in the steps s 17 and s 20 , but if the specifications of the first prox reactor 20 a and second prox reactor 20 b are different , different maps are used . here , the co concentration in the inflowing gas is the co concentration in the gas flowing out of the first prox reactor 20 a calculated in the equation ( 7 ). the controller 5 adjusts the opening of the valve 8 to realize the air flow rate thus obtained , in a next step s 21 . after the processing of the step s 21 , the controller 5 terminates the routine . as a result of executing the above routine , when the co concentration in the reformate gas rises , the air flow rates supplied to the first prox reactor 20 a and second prox reactor 20 b increase until the catalysts in the first prox reactor 20 a and second prox reactor 20 b reach the predetermined temperature , and the co removal performance of the first prox reactor 20 a and second prox reactor 20 b are enhanced . on the other hand , when either one of catalyst temperatures of the first prox reactor 20 a and second prox reactor 20 b is not lower than the predetermined temperature , the catalyst temperature of the corresponding prox reactor is reduced to the predetermined temperature by decreasing the air flow rate supplied to that prox reactor . therefore , by executing this routine , in a carbon monoxide oxidizer comprising plural prox reactors arranged in series , the carbon monoxide removal performance can be optimized while preventing rise of catalyst temperature in the prox reactors . next , referring to fig4 , a second embodiment of this invention will be described . the hardware construction of this embodiment is identical to that of the first embodiment . in this embodiment , only the routine for controlling the air supplier flow rate performed by the controller 5 is different from that of the first embodiment as shown by fig4 . in this embodiment , the air flow rate is determined based on a difference between the upper limiting temperature for catalyst activation of the first prox reactor 20 a and second prox reactor 20 b , and the detected catalyst temperatures . the openings of the valves 7 , 8 are adjusted correspondingly . the upper limiting temperature for catalyst activation is the highest value within the temperature range when the catalyst is activated . a typical upper limiting temperature for catalyst activation is within the range of 200 ° c .– 240 ° c . according to this embodiment , a common upper limiting temperature for catalyst activation is used for the first prox reactor 20 a and second prox reactor 20 b , but when different catalysts are used in the first prox reactor 20 a and second prox reactor 20 b , different upper limiting temperatures for catalyst activation are used according to the characteristics of these catalysts . the processing of the steps s 11 – s 14 is identical to that of the first embodiment . in the step s 14 , when the co concentration of the reformate gas is not lower than the specified concentration , the controller 5 performs the processing of a step s 31 . in the step s 14 , when the co concentration of the reformate gas is lower than the specified concentration , the controller 5 immediately terminates the routine . in the step s 31 , the controller 5 calculates a temperature difference δt 1 between the upper limiting temperature for catalyst activation and the temperature of the first prox reactor 20 a . in a following step s 32 , the controller 5 calculates a temperature difference δt 2 between the upper limiting temperature for catalyst activation and the temperature of the second prox reactor 20 b . in a following step s 33 , it is determined whether or not one of the temperature difference δt 1 and temperature difference δt 2 is a negative value . when one of these values is a negative value , in a step s 34 , the controller 5 throttles the opening of the valve of the prox reactor for which the temperature difference was a negative value by a fixed amount . after the processing of the step s 34 , the controller 5 terminates the routine . when , in the step s 33 , neither of the temperature differences are negative values , in a step s 35 , the controller 5 compares the temperature difference δt 1 and temperature difference δt 2 . when the temperature difference δt 1 is larger than the temperature difference δt 2 , in a step s 38 , the controller 5 looks up the map having the characteristics shown in fig3 prestored in the memory , and calculates the air flow rate required to reach the target co conversion rate from the co concentration detected by the co concentration sensor 11 . this calculation is identical to the calculation of the step s 17 of the routine of fig2 according to the first embodiment . further , the controller 5 adjusts the opening of the valve 7 so that the calculated air flow rate is realized . on the other hand , when the temperature difference δt 1 is not larger than the temperature difference δt 2 , the controller 5 continuously performs the processing of steps s 36 and s 37 . in the step s 36 , the controller 5 calculates the co concentration of the gas flowing into the second prox reactor 20 b . to do this , the controller 5 first calculates the co conversion rate of the first prox reactor 20 a by looking up the map having the characteristics shown in fig3 from the co concentration detected by the co concentration sensor 11 and the air flow rate supplied to the first prox reactor 20 a . next , the co concentration of the outflowing gas is calculated by substituting the co concentration detected by the co concentration sensor 11 and the co conversion rate obtained into equation ( 6 ). this is effectively the co concentration of the gas flowing into the second prox reactor 20 b . in the step s 37 , the controller 5 adjusts the air flow rate required to reach the target co conversion rate by looking up the map having the characteristics shown in fig3 from the co concentration of the gas flowing into the second prox reactor 20 b . the controller 5 further adjusts the opening of the valve 8 to realize the calculated air flow rate . after the processing of the step s 37 , the controller 5 terminates the routine . due to the processing of this routine , when the co concentration of the reformate gas is not lower than the specified concentration , the controller 5 determines whether or not the catalyst temperature of one of the prox reactors exceeds the upper limiting temperature for catalyst activation , and when it does exceed this temperature , the air supply flow rate to the corresponding prox reactor is reduced . on the other hand , when neither of the catalyst temperatures of the prox reactors exceeds the upper limiting temperature for catalyst activation , the air supply flow rate to the prox reactor which is at a relatively low temperature , i . e . the prox reactor which has more tolerance for temperature rise , is increased . therefore , the carbon monoxide removal performance can be optimized while effectively preventing rise in the catalyst temperatures of the prox reactors . next , referring to fig5 , 6 , a third embodiment of this invention will be described . the hardware construction of this embodiment is identical to that of the first and second embodiments . in this embodiment , only the routine for controlling the air supply flow rate executed by the controller 5 shown in fig5 is different from those of the first and second embodiments . in this embodiment , increments of the co conversion rates are determined based on the temperature differences δt 1 , δt 2 between the upper limiting temperature for catalyst activation and the catalyst temperatures of the prox reactors as shown in fig6 , and the air supply flow rate to the prox reactors is determined based on the determined increments . referring to fig5 , the processing of the steps s 11 to s 14 and steps s 31 to s 34 is identical to that of the second embodiment . in the step s 33 , the controller 5 , when neither of the temperature differences δt 1 , δt 2 are negative values , i . e ., when both of them are positive values , the processing of steps s 41 to s 43 is performed . in the step s 41 , the controller 5 increases the co conversion rates of the first prox reactor 20 a and second prox reactor 20 b respectively in the proportion of δt 1 : δt 2 from the target co conversion rate . in this embodiment , let the target co conversion rate of the first prox reactor 20 a be 95 %, and the target co conversion rate of the second prox reactor 20 b be 98 %. also , let the target co concentration of hydrogen - rich gas flowing from the second prox reactor 20 b be 20 ppm . increments δn 1 , δn 2 in the co conversion rate of the first prox reactor 20 a and second prox reactor 20 b , have the relationship of the following equation ( 8 ): if the co concentration of the reformate gas flowing into the first prox reactor 20 a is cin , and the first prox reactor 20 a and second prox reactor 20 b decrease the co concentration cin in the reformate gas to the co concentration of 20 ppm in the outflowing gas , the following relation ( 10 ) between cin , δn 1 , δn 2 should be satisfied . cin is the concentration detected by the co concentration sensor 11 . therefore , the increments δn 1 , δn 2 in the co conversion rate of the first prox reactor 20 a and second prox reactor 20 b can be calculated from the following equations ( 9 ), ( 10 ). in the step s 42 , the controller 5 calculates the air flow rate supplied to the first prox reactor 20 a from the sum of the target co conversion rate of 95 % and increment δn 1 by looking up a map having the characteristics shown in fig3 prestored in the memory . the controller 5 further adjusts the opening of the valve 7 so that the calculated air flow rate is realized . in the next step s 36 , in an identical manner to that of the second embodiment , the co concentration in the gas flowing into the second prox reactor 20 b is calculated . in the next step s 43 , the air flow rate supplied to the second prox reactor 20 b is likewise calculated from the sum of the target co conversion rate of 98 % and increment δn 2 by looking up a map having the characteristics shown in fig3 . the controller 5 further adjusts the opening of the valve 8 so that the calculated air flow rate is realized . after the processing of the step s 43 , the controller 5 terminates the routine . according to this embodiment , the air flow rate supplied to the prox reactors is increased according to the differences δt 1 , δt 2 between the upper limiting temperatures for catalyst activation and the catalyst temperatures of the prox reactors , so the co concentration can be efficiently reduced by using all the temperature differences between the upper limiting temperatures for catalyst activation and the catalyst temperatures of the prox reactors . on the other hand , due to the steps s 33 , s 34 , when either one of the catalyst temperatures of the prox reactors is not less than the upper limiting temperatures for catalyst activation , the air flow rate supplied to the corresponding prox reactor ( s ) can be reduced , so transient increase of the catalyst temperatures of the prox reactors can be prevented as in the first and second embodiments . next , referring to fig7 , 8 , a fourth embodiment of this invention will be described . according to this embodiment , the hardware construction is different from that of the first - third embodiments . specifically , in this embodiment , instead of the co concentration sensor 11 which detects the co concentration in the reformate gas generated by the reformer 3 , a concentration sensor 12 which detects the co concentration in the hydrogen - rich gas supplied to the fuel cell stack 4 from the second prox reactor 20 b is provided . the remaining features of the hardware are identical to those of the first - third embodiments . according to this embodiment , the controller 5 executes a routine for controlling the air supply flow rate shown in fig8 . in this routine , the processing of the steps s 11 , s 12 , s 31 – s 35 is identical to that of the routine of fig5 of the second embodiment . referring to fig8 , the controller 5 , in the step s 11 , reads the temperature detected by the temperature sensor 9 , in , the step s 12 , reads the temperature detected by the temperature sensor 10 , and in a step s 51 , reads the co concentration of the hydrogen - rich gas detected by the concentration sensor 12 . in a following step s 52 , the co concentration of the hydrogen - rich gas and a hydrogen - rich gas specified concentration are compared . the hydrogen - rich gas specified concentration is the upper limiting value of the co concentration which does not affect the power generating performance of the fuel cell stack 4 . typically , the specified concentration of the hydrogen - rich gas is 30 ppm . if the co concentration of the hydrogen - rich gas is lower than the specified concentration , the controller 5 does not proceed to subsequent steps , and immediately terminates the routine . if the co concentration of the hydrogen - rich gas is not lower than the specified concentration , the controller 5 performs the processing of the steps s 31 – s 35 which were described in relation to the second embodiment . in the step s 35 , when the temperature difference δt 1 is larger than the temperature difference δt 2 , the controller 5 , in a step s 53 , increases the opening of the valve 7 so that the air flow rate supplied by the valve 7 increases by a fixed amount . on the other hand , when the temperature difference δt 1 is not larger than the temperature difference δt 2 , the controller 5 , in a step s 54 , increases the opening of the valve 8 so that the air flow rate supplied to the valve 8 increases by a fixed amount . after the processing of the steps s 53 or s 54 , the controller 5 terminates the routine . according to this embodiment , if the co concentration of the hydrogen - rich gas supplied to the fuel cell stack 4 is not lower than the hydrogen - rich specified concentration , the controller 5 increases the air flow rate supplied to one of the prox reactors according to the temperature differences δt 1 , δt 2 , and repeats this operation until the co concentration of the hydrogen - rich gas falls to the hydrogen - rich gas specified concentration . in other words , the air flow rate supplied to the prox reactors 20 a , 20 b is feedback - controlled based on the co concentration of the hydrogen - rich gas . the co conversion rate of the first prox reactor 20 a and second prox reactor 20 b are not necessarily constant due to temperature variation and catalyst deterioration . however , if the air flow rate supplied is feedback - controlled based on the co concentration of the hydrogen - rich gas , the co concentration of the hydrogen - rich gas can always be suppressed below the hydrogen - rich gas specified concentration even if there is scatter in the performance of the prox reactors 20 a , 20 b . according to this embodiment , the air flow rate supplied is increased to whichever of the prox reactors has the higher tolerance for increase of catalyst temperature , so temperature rise above the upper limiting temperature for catalyst activation due to the increase of air flow rate can effectively be prevented . next , referring to fig9 , a fifth embodiment of this invention will be described . the hardware construction of this embodiment is identical to that of the fourth embodiment . in this embodiment , only the routine for controlling the air supply flow rate executed by the controller 5 is different from the fourth embodiment . referring to fig9 , the processing of the steps s 11 , s 12 , steps s 51 , s 52 and steps s 31 – s 34 of this routine are identical to the routine of fig8 in the fourth embodiment . in this routine , the method of feedback - controlling the air flow rate supplied to the prox reactors 20 a , 20 b based on the co concentration of the hydrogen - rich gas , is different from that of the fourth embodiment . in the fourth embodiment , of the two prox reactors 20 a , 20 b , only the air flow rate supplied to the reactor having the larger temperature difference is increased by a fixed increment , but according to this embodiment , the air flow rates supplied to the prox reactors 20 a , 20 b are both increased , and gains g 1 , g 2 applied to the calculation of the increase amount of the air supply flow rate are made to vary dynamically according to the temperature differences δt 1 , δt 2 . specifically , in a step s 55 , the controller 5 determines the ratio of the air increase amount gains g 1 , g 2 according to the temperature differences δt 1 , δt 2 by the following equation ( 11 ). herein , the sum value of the air increase amount gains g 1 , g 2 is fixed , and this sum value is first determined by experiment or simulation . the values of the air increase amount gains g 1 , g 2 are determined from this sum value and the ratio of the air increase amount gains g 1 , g 2 obtained from equation ( 11 ). in a following step s 56 , the controller 5 calculates an increment δq 1 of the air supply flow rate to the first prox reactor 20 a by multiplying a first basic increment for the first prox reactor 20 a by the air increase amount gain g 1 . likewise , an increment δq 2 of the air supply flow rate to the second prox reactor 20 b is calculated by multiplying a second basic increment for the second prox reactor 20 b by the air increase amount gain g 2 . the first basic increment and second basic increment are fixed values predetermined by experiment or simulation . in a next step s 57 , the opening of the valve 7 is adjusted based on the increment δq 1 of the air supply flow rate to the first prox reactor 20 a , and the opening of the valve 8 is adjusted based on the increment δq 2 of the air supply flow rate to the second prox reactor 20 b . also in this embodiment , as in the fourth embodiment , the co concentration in the hydrogen - rich gas can always be suppressed below the specified concentration even if there is scatter in the performance of the prox reactors . further , the air supply flow rate to the prox reactors is increased according to the differences δt 1 , δt 2 between the upper limiting temperature for catalyst activation and the catalyst temperatures of the prox reactors , so the co concentration can be efficiently reduced making use of all the temperature differences between the upper limiting temperature for catalyst activation and the catalyst temperatures of the prox reactors . next , a sixth embodiment of this invention will be described referring to fig1 , 11 and fig1 a , 12 b . in this embodiment , the hardware construction is different from that of the first - third embodiments . specifically , in this embodiment , instead of the co concentration sensor 11 which detects the co concentration of reformate gas generated by the reformer 3 a flow rate sensor 13 which detects the flow rate of reformate gas generated by the reformer 12 is installed midway in the pipe leading reformate gas from the reformer 3 to the carbon monoxide oxidizer 20 . the remaining features of the construction are identical to those of the first - third embodiments . in this embodiment , instead of the routine of fig2 in the first embodiment , the controller 5 executes a routine for controlling the air supply flow rate shown in fig1 . in this embodiment , the opening of the valves 7 , 8 are first initialized to an opening corresponding to a specified flow rate of reformate gas . n herein , the specified flow rate corresponds to a flow rate when the power plant is running steadily . referring to fig1 , the processing of the steps s 11 , s 12 is identical to the routine of fig2 of the first embodiment . the processing of the steps s 31 – s 34 is identical to the routine of fig5 of the second embodiment . in a step s 61 following the step s 12 , the controller 5 reads the reformate gas flow rate detected by the flow rate sensor 13 . in a next step s 62 , it is determined whether the reformate gas flow rate is equal to the specified flow rate . when the reformate gas flow rate is equal to the specified flow rate , the controller 5 immediately terminates the routine without preceding to subsequent steps . when the reformate gas flow rate is not equal to the specified flow rate , the controller 5 performs the processing of the steps s 31 – s 34 as in the routine of fig4 of the second embodiment . in the step s 33 , when neither of the temperature differences δt 1 , δt 2 are not negative values , in a step s 63 , the controller 5 calculates a basic variation amount δqa 1 of the air flow rate supplied to the first prox reactor 20 a from the reformate gas flow rate by looking up a map having the characteristics shown in fig1 a which is prestored in the memory . referring to fig1 a , the basic variation amount δqa 1 in this map means the variation amount from a specified flow rate qa 1 r of the air supply flow rate when the reformate gas flow rate increases as shown by the dotted line relative to the specified flow rate . in a following step s 64 , the controller 5 calculates a basic variation amount δqa 2 of the air flow rate supplied to the second prox reactor 20 b from the gas flow rate flowing into the second prox reactor 20 b by looking up a map having the characteristics shown in fig1 b which is prestored in the memory . herein , the gas flow rate flowing into the second prox reactor 20 b is the gas flow rate flowing out of the first prox reactor 20 a , and this may be approximated to the sum of the reformate gas flow rate flowing into the first prox reactor 20 a and the air flow rate supplied to the first prox reactor 20 a . referring to fig1 b , the basic variation amount δqa 2 in this map is the variation amount from the specified flow rate of the air supply flow rate when the inflowing gas flow rate increases as shown by the dotted line relative to the specified flow rate . in a next step s 65 , the controller 5 calculates an air flow rate qa 1 ′ supplied to the first prox reactor 20 a and an air flow rate qa 2 ′ supplied to the second prox reactor 20 b by applying the following equations ( 12 ), ( 13 ). in a next step s 66 , the opening of the valve 7 is adjusted so that the air flow rate qa 1 ′ is realized , and the opening of the valve 8 is adjusted so that the air flow rate qa 2 ′ is realized . after the processing of the step s 66 , the controller 5 terminates the routine . in fig1 a , 12 b , it was assumed that the basic variation amounts δqa 1 , δqa 2 were positive values , but when the reformate gas flow rate has decreased from the specified flow rate , the basic variation amounts δqa 1 , δqa 2 become negative values . as can be seen from equations ( 12 ), ( 13 ), in this case , the air flow rate qa 1 ′ is a smaller value than the specified air flow rate qa 1 r , and the air flow rate qa 2 ′ is a smaller value than the specified air flow rate qa 2 r . if the catalyst temperature of one of the first prox reactor 20 a and second prox reactor 20 b is not less than the upper limiting temperature for catalyst activation , the opening of the valves 7 or 8 is decreased as in all the other embodiments , so that the air flow rate supplied to the corresponding first prox reactor 20 a or second prox reactor 20 b is decreased . therefore , the carbon monoxide removal performance can be optimized while preventing catalyst temperature rise of the prox reactors . next , referring to fig1 , 14 , a seventh embodiment of this invention will be described . this embodiment is different from the other embodiments in terms of the hardware construction . referring to fig1 , according to this embodiment , the co concentration sensor or flow rate sensor is not used . according to this embodiment , when the fuel cell power plant is running steadily , it is assumed that the co concentration and flow rate of reformate gas are respectively constant . instead of the routine of fig2 of the first embodiment , the controller 5 executes a routine for controlling the supply air flow rate shown in fig1 . the processing of the steps s 11 , s 12 is identical to the routine of fig2 according to the first embodiment . the processing of the steps s 31 – s 34 is identical to the routine of fig4 according to the second embodiment . in steps s 63 , s 64 , when both of the temperature differences δt 1 , δt 2 are not negative values , the controller 5 , in a step s 71 , applies the following equations ( 14 ), ( 15 ), and calculates the air supply flow rate qna 1 ′ to the first prox reactor 20 a and the air supply flow rate qna 2 ′ to the prox reactor 20 b from the temperature differences δt 1 , δt 2 . where , qna 1 = specified air flow rate supplied to the first prox reactor 20 a , and where , qna 2 = specified air flow rate supplied to the second prox reactor 20 b , and the correction coefficients c 1 , c 2 are respectively set experimentally . in a following step s 72 , the controller 5 adjusts the opening of the valve 7 so that the calculated air flow rate qna 1 ′ is realized , and adjusts the opening of the valve 8 so that the calculated air flow rate qna 2 ′ is realized . after the processing of the step s 72 , the controller 5 terminates the routine . in this embodiment also , the air supply flow rate to the prox reactor having a higher tolerance for temperature rise is increased based on the catalyst temperatures of the first prox reactor 20 a and second prox reactor 20 b , so excessive catalyst temperature rise can be prevented , and the carbon monoxide removal performance of the of the first prox reactor 20 a and second prox reactor 20 b can be utilized to the maximum . in this embodiment , the co concentration sensor or flow rate sensor is not used , so the construction of the device can be simplified . the contents of tokugan 2002 - 88058 , with a filing date of mar . 27 , 2002 in japan , are hereby incorporated by reference . although the invention has been described above by reference to certain embodiments of the invention , the invention is not limited to the embodiments described above . modifications and variations of the embodiments described above will occur to those skilled in the art , in light of the above teachings . for example , in all the aforesaid embodiments , the carbon monoxide oxidizer 20 is comprised of the two prox reactors 20 a , 20 b , but this invention may be applied also to a carbon monoxide removal device comprising three or more prox reactors . the embodiments of this invention in which an exclusive property or privilege is claimed are defined as follows :

8General tagging of new or cross-sectional technology

referring to fig1 the programmable character display module 10 of the invention includes : a flexible substrate 12 ; a plurality of electrical conductors 14 and 16 , which can be oriented along an x - axis of the substrate ; a plurality of electrical conductors 18 and 20 , which can be oriented along a y - axis of the substrate ; a plurality of spaced apart character displays 22 , 24 , 26 , and 28 , which can be formed by separate light emitting diodes ( leds ) arranged in a 5 × 7 row - and - column character array as illustrated , that are electrically connected to selected ones of the x - axis electrical conductors and of the y - axis electrical conductors ; and , inflexible transparent material 32 , 34 , 36 , and 38 , which can be a conventional epoxy flowed into position and suitably cured to its inflexible state , that encapsulates both the character displays and respective adjoining portions 42 , 44 , 46 , and 48 of the substrate , which thereby converts the adjoining portions from the flexible state to the inflexible state so that any damage to the character displays by an applied force is substantially minimized or eliminated . a portion of the programmable character display module 10 is shown by fig2 and 3 as an enlarged view for purposes of clarity of description and a better understanding of the invention . the flexible substrate 12 has a base substrate sheet 50 and an overlay sheet 52 on the base sheet . the overlay sheet 52 is preferably bonded to the base sheet 50 which develops a flexible bonded joint 54 as more clearly shown by fig5 . the base sheet 50 can be a relatively thin , stable , dielectric and flexible sheet cut to a desired shape with the electrical conductors , such as conductors 14 and 18 , positioned on the base sheet in a desired geometric layout ; for example , the x - and y - axes layout as shown . the electrical conductors can be applied to the base sheet by any one of several conventional processes such as photo etch . in the programmable character display module 10 as shown by fig2 the electrical conductors 14 and 18 terminate at a plurality of similar connector pads 56 and 58 , respectively . the overlay sheet 52 , which can have the same physical properties as the base sheet 50 , has a plurality of display apertures like display aperture 60 as shown by fig2 and 3 selectively positioned in the overlay sheet to register with the connector pads , such as connector pads 56 and 58 . the flexible substrate 12 is completed by bonding the overlay sheet 52 to the base sheet 50 as described hereinbefore . with the exception of the display apertures , such as aperture or window 60 , the resulting bonded joint 54 ( see fig5 ) seals the flexible substrate either hermetically or otherwise as may be required for the end use of the display module 10 . referring to fig2 , and 5 , the perimeter edge 62 of the display aperture 60 is not bonded to the base sheet 50 and is formed with an irregular contour . for example , the perimeter edge 62 is jagged and , as illustrated , can be serrated . the perimeter edge 62 of each display aperture , such as display aperture 60 , in the overlay sheet 52 is bent away and spaced from the base sheet 50 to develop an angular relationship therebetween which is more clearly shown at 64 of fig5 . the desirable results obtained from the serrated perimeter edge 62 and its bent or angular relationship 64 are described hereinafter . as shown by fig3 when the character display 22 is positioned within the display aperture 60 of the overlay sheet 52 and electrically connected to the selected connector pads 56 and 58 ( see fig2 ), the perimeter edge 62 encloses the character display interjacent the display and the adjoining portion 42 of the substrate 12 . since the lighted character display 22 is relatively fragile , particularly when the display is an array of leds as shown by fig3 the flexible substrate 12 is converted to an inflexible state at the display aperture 60 and its adjoining portion 42 by flowing the transparent material 32 over the array . the transparent material , which can be the conventional epoxy as described hereinbefore , flows over and under the perimeter edge 62 onto the adjoining portion 42 and under the perimeter edge into the angular volume 64 developed by the spaced - apart perimeter edge and the base sheet 50 . a plurality of grip apertures 70 , 72 , 74 , and 76 , as shown by fig3 and 5 , in the adjoining portion 42 permit the material 32 to flow from the obverse surface of the flexible substrate 12 to its reverse surface as clearly shown by fig5 . when the transparent material 32 cures to the rigid or inflexible state , it is securely locked to the flexible substrate 12 by the material within the grip apertures 70 , 72 , 74 , and 76 , and by the material engulfing not only the perimeter edge 62 but also the angular volume 64 . the resulting inflexible , transparent material 32 encapsulates the character display 22 , display aperture 60 , perimeter edge 62 , and adjoining portion 42 ; this protects the character display 22 from damage by any applied forces , and prevents loss of integrity in the electrical connections made between the character display and the connector pads 56 and 58 ( see fig2 ) which could result from the flexing thereof . as will be evidenced from the foregoing description , certain aspects of the invention are not limited to the particular details of construction as illustrated , and it is contemplated that other modifications and applications will occur to those skilled in the art . it is , therefore , intended that the appended claims shall cover such modifications and applications that do not depart from the true spirit and scope of the invention .

6Physics

with reference to fig2 , the real - time particulate matter measuring system includes solid particle counting system ( spcs ) 30 , spcs computer 32 , and diffusion charger ( dc ) 34 . spcs 30 includes pre - classifier 40 , hot diluter ( pnd 1 ) 42 and associated temperature controller 44 , evaporation unit 46 and associated temperature controller 48 , cold diluter ( pnd 2 ) 50 , and condensation particle counter ( cpc ) 52 . pre - classifier 40 is used to keep the cut - off size of aerosol in the range of 2 . 5 to 10 μm . by running hot diluter 42 at high dilution air temperature with temperature controller 44 , and heating the sample in the range of 300 to 400 ° c . in evaporation unit 46 , particles formed by volatile material and sulfate particles are vaporized to gas phase . following cold dilution at cold diluter 50 , all particles formed by volatile material and sulfate are removed . solid particles move into cpc 52 , and concentration of the solid particles is measured at cpc 52 . in the case where hot diluter 42 and evaporation unit 46 are run at lower temperature to avoid vaporization of volatile material and sulfate particles to gas phase , all particles move into cpc 52 with the flow , and total particle concentration is measured at cpc 52 . by connecting the inlet of diffusion charger 34 to the upstream side of cpc 52 in the spcs 30 , diffusion charger 34 takes samples at the same place as cpc 52 . the computer control and data acquisition system 32 for spcs 30 is used to obtain signals from diffusion charger 34 , which is calibrated to measure surface area and mass concentration in real - time . different calibration curves for mass concentration on solid and total particles with diffusion charger 34 can be stored in the spcs computer 32 . for example , the calibration curve for solid particle mass concentration is selected when the hot diluter and evaporation unit in the spcs run at high temperature . otherwise , the calibration curve for total particle mass concentration is selected . as described above , cpc 52 measures number concentration , and dc 34 measures surface area and mass concentration in real - time . the average diameter , diameter concentration , volume concentration , and average effective density for measured particles , either solid or total particles , can be calculated as : d p ⁡ ( t - td ) = s t - td π ⁢ ⁢ n t l t - td = d p ⁡ ( t - td ) ⁢ n t v t - td = 1 6 ⁢ π ⁢ ⁢ d p ⁡ ( t - td ) 3 ⁢ n t ρ eff ⁡ ( t - td ) = m t - td v t - td where td is the delay time of the cpc against the dc ; d p ( t − td ) is average diameter for surface area at time t − td ; s t − td is surface area measured with the dc at time t − td ; n t is the number concentration measured by the cpc at time t ; l t − td is particle diameter concentration at time t − td ; v t − td is volume concentration at time t − td ; ρ eff ( t − td ) is the average effective density at time t − td ; m t − td is the mass concentration measured by the dc at time t − td . with the current technique , the response time of the dc is much faster than that of the cpc . therefore , there is a delay time correction involved in the above equations . delay time td can be measured by running the real - time particulate matter measuring system under transient conditions . it is a constant at the fixed system configuration . in summary , there are seven functions obtained from this embodiment of the real - time particulate matter measuring system : 1 . number concentration 2 . particle diameter concentration 3 . surface area 4 . mass concentration 5 . average diameter 6 . volume concentration 7 . average effective density with reference to fig3 , the real - time particulate matter measuring system includes spcs 60 , spcs computer 62 , and diameter concentration instrument 64 . spcs 60 includes pre - classifier 70 , hot diluter ( pnd 1 ) 72 and associated temperature controller 74 , evaporation unit 76 and associated temperature controller 78 , cold diluter ( pnd 2 ) 80 , and condensation particle counter ( cpc ) 82 . the inlet of diameter concentration instrument 64 is connected to the upstream side of cpc 82 in the spcs 60 . diameter concentration instrument 64 takes samples at the same place as cpc 82 . the computer control and data acquisition system 62 for spcs 60 is used to obtain signals from diameter concentration instrument 64 , which is calibrated to measure particle diameter concentration and mass concentration in real - time . different calibration curves for mass concentration on solid and total particles with diameter concentration instrument 64 can be stored in spcs computer 62 . for example , the calibration curve for solid particle mass concentration is selected when the hot diluter and evaporation unit in the spcs run at high temperature . otherwise , the calibration curve for total particle mass concentration is selected . cpc 82 measures particle number concentration . the diameter concentration instrument 64 measures diameter concentration and mass concentration in real - time . the average diameter , surface area , volume concentration , and average effective density for measured particles , either solid or total particles , can be calculated as : d p ⁡ ( t - td ) = l t - td n t s t - td = π ⁢ ⁢ d p ⁡ ( t - td ) 2 ⁢ n t v t - td = 1 6 ⁢ π ⁢ ⁢ d p ⁡ ( t - td ) 3 ⁢ n t ρ eff ⁡ ( t - td ) = m t - td v t - td where td is the delay time of the cpc against the diameter concentration instrument ; d p ( t − td ) is average diameter for particle diameter concentration at time t − td ; l t − td is particle diameter concentration measured with the diameter concentration instrument at time t − td ; s t − td is surface area at time t − td ; n t is the number concentration measured by the cpc at time t ; v t − td is volume concentration at time t − td ; ρ eff ( t − td ) is the average effective density at time t − td ; m t − td is the mass concentration measured by the diameter concentration instrument at time t − td . the delay time of the cpc against the diameter concentration instrument , td , can be measured by running the real - time particulate matter measuring system under transient conditions . if there is no delay time between the cpc and the diameter concentration instrument , td is equal to zero . the sign ( negative and positive ) of td reflects that the diameter concentration instrument either faster or slower than the cpc . in summary , there are seven functions obtained from this embodiment of the real - time particulate matter measuring system : 1 . number concentration 2 . particle diameter concentration 3 . surface area 4 . mass concentration 5 . average diameter 6 . volume concentration 7 . average effective density the following procedures may be used to measure either solid or total particles in the illustrated embodiments : a . solid particle measurement : the temperature controllers for the hot diluter and evaporation unit are set at high temperatures . for example , the temperature controller for the hot diluter is set at a temperature higher than 150 ° c ., and the temperature controller for the evaporation unit is set at 300 to 400 ° c . thus , particles formed by volatile material and sulfur compound are removed . the cpc and diffusion charger ( dc ) or diameter concentration instrument measure solid particles only . to avoid saturation of the cpc and dc or diameter concentration instrument , the dilution ratios for the hot diluter and the cold diluter can be adjusted to higher values . b . total particle measurement : the temperature controllers for the hot diluter and evaporation unit are set at room temperature or turned off . as a result , total particles including solid , volatile , and sulfur compound particles flow into the cpc and diffusion charger ( dc ) or diameter concentration instrument . to avoid saturation of the cpc and dc or diameter concentration instrument , the dilution ratios for the hot diluter and the cold diluter can be adjusted to higher values . while embodiments of the invention have been illustrated and described , it is not intended that these embodiments illustrate and describe all possible forms of the invention . rather , the words used in the specification are words of description rather than limitation , and it is understood that various changes may be made without departing from the spirit and scope of the invention .

6Physics

an embodiment of the invention will now be described with reference to fig1 ( a ) and 1 ( b ) which are a block diagram showing the embodiment and a partial detail block diagram of a control unit of the embodiment . in the figures , 1a , 1b and 1c denote drive units for driving industrial robots , welding devices and other machines provided in a single production line and 2a , 2b and 2c , control units for the robots , welding machines and the other machines , respectively . the arrangement is such that drive commands are supplied via a machine control unit 3 to those machines which are to be driven simultaneously . 4 denotes an i / o port and 5 denotes a microprocessor in which an amount of voltage drop in each of the machines , a permissible amount of voltage drop in a power source and a priority ranking of the machines , etc . are stored in memories rom 5a and ram 5c together with drive programs for the respective machines . under the control of a cpu 5b , a total amount of voltage drop for the machines which are simultaneously driven at each set time according to the drive programs is obtained , and it is detected whether the total amount of voltage drop is smaller than a predetermined value . further , if the total amount of voltage drop exceeds the predetermined value , ones of the machines which are to be driven simultaneously are selected from the machines , so that a total amount of voltage drops produced by activating the selected machines is made within the predetermined value . instructions for designating the selected machines are supplied to the respective control units 2a to 2c . more specifically , as shown in fig1 ( b ), the machine control unit 3 includes a totalization unit 11 for totalizing the amounts of voltage drop in the machines that are to be driven simultaneously at set times according to the machine drive programs ; a judgment unit 12 for judging whether or not the total amount of voltage drop is within a predetermined value ; a selection unit 13 for selecting the machines to be driven simultaneously with reference to their priorities based on the result of judgment in the judgment unit 12 ; and a drive instruction producing unit 14 for applying drive instructions to the selected machines . when the total amount of the voltage drop exceeds the predetermined value , in the selection unit 13 machine ( s ) having lower priorities ; which are low in an amount of work performed are excluded from the group of the simultaneously driven machines and the start of drive thereof is deferred . next , the operation will be described with reference to the flowchart of fig2 . first , the total amount of voltage drop in the machines that are to be driven simultaneously is calculated in the totalization unit 11 ( step s21 ). the judgment unit 12 operates to judge whether or not the total amount of voltage drop is within the predetermined value ( step s22 ). if it is within the predetermined value , the selection unit 13 and the drive instruction producing unit 14 operate to drive all of the machines which have been subjected to the totalization ( step s23 ). on the other hand , if it exceeds the predetermined value , the machines having lower priorities , which are lower in the amount of work to be performed , are excluded by the selection unit 13 so as to bring the total amount of voltage drops to be within the predetermined value ( step s24 ). then , the machines that have not been excluded are simultaneously driven by the drive instruction producing unit 14 ( step s25 ). subsequently , the totalization unit 11 operates to assign higher priorities to the machines that have been excluded and a total amount of voltage drop in the machines that are to be driven simultaneously is again calculated by the totalization unit 11 ( step s26 ). the judgment unit 12 then judges whether or not the total amount thereof is within the predetermined value ( step s27 ). if it is , the operation advances to the step s23 , while if it exceeds the predetermined value , those of the machines added on later which have lower priorities are excluded so as to bring the total amount of voltage drop to be within the predetermined value again ( step s28 ) and the operation then advances to the above mentioned step s25 . needless to say , although the above embodiment is an example relating to industrial robots and welding machines , the present invention is available in effecting overall control for machines including conveyors , etc . another embodiment of the present invention where a plurality of industrial robots are provided in a single production line will be described hereinafter . provided that the predetermined value of the power supply voltage drop is 4 , a problem may occur at an operation period of time t 1 or t 7 where the total amount of the voltage drop in robots a , b and c which are driven simultaneously as illustrated in the operation patterns shown in fig3 exceeds the predetermined value of 4 . in this case , the total amount of voltage drop in time period t 1 and t 7 is 6 . in fig3 v 1 indicates a time period when the robot moves in an accelerating mode and an amount of voltage drop is 2 ; v 2 , a time period when the robot moves in a constant speed mode and the voltage drop amount is 0 ; v 3 , a time period when the robot moves in a decelerating mode and the voltage drop amount is 2 ; and v o , a time period when the robot is stopped and there is no voltage drop . in fig1 ( b ) and fig4 which is a block diagram of another embodiment of the present invention , 101a , 101b and 101c are drive units for the robots a , b and c that are installed in a single production line , and 102a , 102b and 102c are control units for the robots a , b and c . the arrangement is such that drive instructions are supplied via the machines control unit 3 to those robots which it has been decided to drive simultaneously . in fig4 elements that are same as those in fig1 ( a ) bear the same reference numerals and detailed description therefore is omitted intentionally . under the control of the cpu 5b , operation patterns in accordance with the drive programs of the various robots are divided with the set time periods , and the voltage drops of the robots that are simultaneously driven in each time period are totalized . then , it is detected whether the total amount of voltage drop is within a predetermined value . as a result , if it exceeds the predetermined value , the robots that are to be simultaneously driven are selected so that the total voltage drop comes within the predetermined value and instructions are applied to the units 101a to 102c through the machine control unit 3 . more specifically , as mentioned above with reference to fig1 ( b ), the control unit 3 includes the totalization unit 11 , the judgment unit 12 , the selection unit 13 and drive instruction selection unit 14 . in the totalization unit 11 , an operation pattern of each robot is divided into plural parts with set time periods , the divided patterns are classified into four patterns in the accelerating mode , the decelerating mode , the constant speed operation mode and the stop mode , and a total amount of voltage drop in the robots driven simultaneously is calculated based on voltage drop values which are set with respect to the respective operation patterns described above in advance . the judgment unit 12 operates to judge whether or not the total amount of voltage drop thus obtained by the totalization unit 11 is within a predetermined value . when the total amount of voltage drop exceeds the predetermined value , the selection unit 13 operates to select robots that are to be driven simultaneously and defer the action of robots not selected to the next time period . the drive instruction producing means 14 then applies drive instructions to the selected robots that are to be driven simultaneously . with this configuration , the operating pattern in the example of prior art shown in fig3 is controlled in such a manner as shown in fig5 . in more detail , in the prior art example , the total amount of voltage drops in the time periods t1 and t7 is 6 , which exceeds the permissible predetermined value of 4 . but in this embodiment , the start of action of the robot c is delayed by one time period and deferred to the time period t2 thereby resulting in making the total amount of voltage drop equal to 4 or less in all the time periods . consequently , there is no occurrence of a voltage drop exceeding the limit . needless to say , although the above embodiment was described with reference to three robots a , b and c , advantages can be made still greater by effecting control covering a larger number of robots , welding machines or other robots , etc . as described above , the invention restricts the number of robots that are driven simultaneously if the total amount of voltage drop exceeds a prescribed value in a production line provided with a plurality of machines such as robots , welding machines and other machines . therefore , there is no occurrence of a voltage drop beyond the maximum limit and no occurrence of imperfect welding or incorrect robot action .

8General tagging of new or cross-sectional technology

referring to fig1 , a bending press 10 with downstroke operation has an upper die 10 which , during a working cycle , moves vertically downwardly towards a lower die 14 and a workpiece 16 supported on the lower die . the upper and lower dies 12 , 14 have respective die edges 18 , 20 of the desired shape for bending the workpiece into a particular form . during an active operating cycle , an open gap 22 between the upper die 12 and workpiece 16 gradually diminishes in size . a control unit 24 is provided for controlling bending press 12 , which might be activated , for example , with the help of a foot pedal 26 . a holding arm is arranged at the respective ends of upper die 12 . the holding arms 28 carry a light emitter 30 and a position resolving light receiver 32 at respective longitudinal ends of upper die 12 and are components of an optoelectronic sensor . light emitter 30 includes a light source , such as a laser diode and a transmission optic ( not shown ), which enlarges the emitted light into a light beam 34 . light receiver 32 includes a cmos - matrix receiver which is illuminated by light beam 34 . light beam 34 extends along lower die edge 18 of the upper die 12 across the open gap 22 . as is shown in fig2 and 3 , light beam 34 is enlarged so that it completely illuminates the preferably rectangular light receiver 32 . at the point where light beam 34 impacts light receiver 32 , the cross - section of the light beam is preferably greater than the light - sensitive surface of the light receiver to assure that the receiver is completely illuminated even during vibrations or minor misalignments of the receiver . as is seen in fig2 and 3 , which show a circular light beam 34 , the beam completely covers the rectangular receiver 32 and even extends past its sides . the active part of receiver 32 ( which is shown in fig2 and 3 in a speckled dark gray ) defines a three - dimensional protected zone 36 within light beam 34 between upper die 12 and lower die 14 as is further described below . a sensor which includes a control and processing unit , which may be part of the overall control for the machine , detects an interruption of light beam 34 within the protected zone 36 and generates a switching or control signal when such an interruption of the light beam is detected . the control signal is used , for example , to arrest the motion of upper die 12 and protect the operator against injuries from the moving upper die 12 , as could otherwise occur , for example , during the insertion of a workpiece 16 into open gap 22 . the functions of a bending press constructed in accordance with fig1 during a normal operating mode for bending a flat plate are described in greater detail with reference to fig2 a - 2 f . each of fig2 a - 2 f shows in cross - section the lower die edge 18 of upper die 12 , the upper die edge 20 of lower die 14 , workpiece 16 supported thereon , the light beam 34 with its round cross - section , and a light receiver 32 which is illuminated by the light beam . at different points during a working cycle , different groups of individual cmos - receiving elements of light receiver 32 are activated as is illustrated in the drawings . such an activated group of receiving elements is shown in a speckled dark gray in the drawings . only the active receiving elements are monitored for possible interruptions of light beam 34 for purposes of initiating a stopping operation , should that be required . the arrangement or pattern of the active receiving elements determines the cross - section of the protected zone 36 . the lower half of each of fig2 a - 2 b is a timing diagram in which an arrow visually indicates several points of the bending press during an operating cycle . fig2 a shows the beginning of an operating cycle . the upper die is at its beginning position at the upper dead point . light beam 34 illuminates the entire receiver 32 so that all of its receiving elements are active , and the protected zone has its maximum size . as the operating cycle progresses , the upper die is lowered as shown in fig2 b . the size of the protected zone 36 remains unchanged until the size of opening gap 22 in the direction of tool movement has been reduced to that of protected zone 36 and the upper tool has reached the switching point . the upper tool can move relatively rapidly until then . in the event an object intrudes into protected zone 36 , the upper die would be stopped within the protected zone . in the event the die has moved sufficiently so that opening gap 22 is smaller than protected zone 36 in the direction of movement , that is , when the lower side of the protected zone has reached and traveled to below the upper surface of the workpiece , as is illustrated in fig2 c , a section 38 of receiver 32 is beneath workpiece 16 . section 38 of receiver 32 is deactivated as shown in fig2 c by light gray lines . thus , the size of the protected zone 36 in the direction of tool movement is reduced to the size of opening gap 22 . the downward movement of upper die 12 continues at a lower closing speed which continuously reduces the size of protected zone 36 until it reaches the muting point , as illustrated in fig2 d . the muting point is defined as and is reached when the size of the opening gap has been reduced so that a finger can no longer extend into the gap , which in turn means that the moving die no longer poses a significant danger . at this point , the size of the gap is typically about 9 mm and all receiving elements of light receiver 32 are deactivated , as can be seen in fig2 d . the downward motion of upper die 12 continues until it touches workpiece 16 , as illustrated in fig2 e . this point is referred to as the “ contact point ” when the workpiece 16 becomes clamped between the upper and lower dies 12 , 14 . the operating cycle continues and comes to an end when workpiece 16 has been appropriately deformed , as is illustrated in fig2 f . thereafter the upper die 12 is raised to its upper dead point , and a new operating cycle in accordance with fig2 a - 2 f can begin . the above - described method for securing bending press 10 and the required configuration of the sensors have the advantage that the opening gap between the upper die 12 and the workpiece 16 results in a protected zone 36 of greatest possible size during each of the operational phases of a work cycle as shown in fig2 a - 2 f . when the opening gap 12 is sufficiently large , the size of protected zone 36 corresponds to that of receiver 32 . when the opening gap 22 is smaller , the entire remaining opening gap is controlled in accordance with the present invention so that a danger of possible injury due to reaching into the opening gap can always be detected . since different workpieces 16 have differing dimensions , and especially different thicknesses , the switching point , the muting point and the contact point can occur at differing points in time during a work cycle . in one embodiment of the present invention , these points can be established by performing a test run , during which the motion sequences of the upper tool are automatically learned and then stored for future reference . in accordance with another embodiment of the invention , the operation of the securing system and method is described for a different operating mode . as an example , fig3 a - 3 f show a so - called box bending mode in which a box or box - shaped article 40 is being bent . in such an operating mode , a portion of the three - dimensional box can at times unavoidably intrude into light beam 34 during an operating cycle . fig3 a - 3 f show how the protected zone 36 can be adapted for such applications in accordance with the present invention . fig3 a shows the position of lower edge 18 of upper die 12 , of light beam 34 , of receiver 32 , and of protected zone 36 at the beginning of an operating cycle . fig3 a shows that even at that point a small portion of light beam 34 is covered by box 40 . however , this has no influence on the operation of the press because the intrusion occurs outside the protected zone 36 . as the working cycle continues , box 40 begins to extend into protected zone 36 , as shown in fig3 b . however , the safety device of the present invention recognizes this as a permitted intrusion and therefore deactivates one - half 36 . 1 of the protected zone . the other half 36 . 2 of the protected zone remains active . downward motion of upper die 12 continues until the opening gap has been reduced in size to that of protected zone 36 in the direction of movement . depending on the height of the opening gap , a further section 38 . 2 of protected zone 36 becomes deactivated . this section 38 . 2 corresponds to the area of protected zone 36 which is beneath box 40 and overlies lower die 14 . as the upper die 12 continues to be lowered , the remaining active protected zone becomes continuously smaller . according to fig3 d , the upper die 12 continues to be lowered until it reaches the muting point , which corresponds to the muting point shown in fig2 d . from this point on , the entire protected zone 36 is deactivated . in accordance with fig3 e and 3 f , the upper tool continues to be lowered to the contact point and until the box has been completely bent . for this embodiment of the invention too , the thickness of the sheet metal , its upper surface and the corresponding switching , muting and contact points are initially learned with the help of an operational test run of the upper die for establishing these reference points . for simple geometric forms of box 40 , it is possible not to completely deactivate the half 36 . 1 of protected zone 36 , but to continuously reduce the size of section 36 . 1 as well as of section 36 . 2 following the switching point . other box configurations than those illustrated can of course be worked on in accordance with the present invention .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

referring to fig1 , a plan view of one embodiment of a cylinder mandrel 21 illustrates a smooth cylindrical surface 23 interrupted just before each end by a pair of grooves 25 . the grooves 25 are utilized by other structures to help engage and move the cylinder mandrel 21 when its hot . other structures can be used , including projections , loops , and other structures . an internal bore 27 is seen in dashed line format in fig1 . referring to fig2 , a view looking into the end of the cylinder mandrel 21 of fig1 illustrating its hollow through bore 27 . as can be seen the bore 27 is large to leave the cylinder mandrel 21 with a relatively thin wall , but not so thin that the grooves 25 cannot be effectively made with enough depth to provide a catch to an edge of another structure so as to enable the other structure to engage the grooves . in one embodiment , where the exterior diameter of the smooth cylindrical surface 23 of the cylinder mandrel 21 is to have a diameter of 0 . 50 inches , the internal diameter of the bore 27 is preferably about 0 . 44 inches . this leaves 0 . 06 inches to be distributed to both sides to yield a wall thickness of about 0 . 03 inches . the grooves 25 may then be about 0 . 20 inches deep , and possibly as much as 0 . 06 inches wide . overall , the cylinder mandrel 21 may be about 6 . 5 inches long . the use of a large bore 27 permits a relatively thin walled cylinder mandrel 21 which will hold up well under rolling pressure , less metal material for faster heating , quicker cooking and quicker cooling after cooking , and a bore through which hot liquid oil may freely circulate . holes or apertures which extend circumferentially about the cylinder mandrel 21 can be added for increased oil circulation and quick draining , but in such a case , the draining cannot be controlled and directed as it can with a solid cylinder mandrel 21 . further , the surface 23 need not be smooth , but may also be longitudinally grooved to give more hot oil the ability to circulate around the flauta being cooked , so long as the grooves are thin enough ( perhaps along with a layer of flauta which is not very pasty ) to cause the flauta material to sink into the longitudinal grooves within the cylinder mandrel 21 . referring to fig3 , a rolling support 31 is shown combined ( although they need not be ) with a the cylinder mandrel ( cylinder mandrel 21 ) unloading and cooked flauta drainage support 33 , hereafter referred to as unloading and drainage support 33 . although shown as having a common board 35 , the rolling support 31 and unloading and drainage support 33 may have separate boards . on the unloading and drainage support 33 , a vertical stop 37 is used as a low friction guide along which a cylinder mandrel 21 can slide as the cylinder mandrel 21 is rolled over a circular area 39 used for circular shaped flauta or a rectangular area 41 used for rectangular shaped flauta . the vertical stop 37 also sets the position of the flauta material from the end of the cylinder mandrel 21 . a lowered surface 43 may be provided to give some additional clearance for grasping the flauta material and cylinder mandrel 21 after the flauta material is rolled on it . typically the cylinder mandrel 21 will be placed about an inch toward the inside of the material on the side farthest from the unloading and drainage support 33 , the end edge is placed over the cylinder mandrel 21 in the direction of the unloading and drainage support 33 , and then the cylinder mandrel 21 is rolled in a tight manner to form wrapped configuration . once the flauta material is rolled onto the cylinder mandrel 21 , the flauta material should be held manually tightly as the wrapped flauta and cylinder mandrel 21 are transferred . since the rolling support 31 and unloading and drainage support 33 are shown as an integrated unit , the unloading and unloading and drainage support 33 ( hereafter drainage support ) will be discussed . on the same side of the board 35 as the vertical stop 37 , a channel 45 having an overall “ u ” shape is seen . the far side has a straight edge , but the near side has a series of notches 47 , each having a “ v ” upper portion and a curved lower portion ( as will be seen in greater detail ). this structure facilitates the engagement of the near side of the channel 45 with the grooves 25 on the cylinder mandrel 21 . this enables the cylinder mandrels 21 to be removed from a structure supporting them in a configuration approximating their spacing seen in fig3 . also seen on one of the cylinder mandrels 21 is a cooked shell 49 . because the near side of the channel 45 is raised an inch or two above the level of the board 35 , and because the other ends of the cylinder mandrels 21 are supported at board 35 level , the cylinder mandrels 21 are tilted . this enables any excess cooking oil , either within the cylinder mandrels 21 , or on the outside to drain into a separate area or container or absorbent material which may optionally be provided . in the alternative , other structures may be provided to support the cylinder mandrels 21 without touching the board 35 and possibly at a lesser angle of tilt . a catch basin may be provided to collect the excess oil . referring to fig4 , a frying support 51 is seen . frying support 51 includes a handle portion 53 , a support structure 55 , and a multi support tray 57 . the handle portion 53 may be angled for maximum ease and utilization for a given orientation immersion fryer ( not shown ). the handle portion 53 may be removable from or permanently affixed to the support structure 55 . the support structure 55 has a structure which provides force matching between the handle portion 53 and the multi support tray 57 . the multi support tray 57 is seen as a sharply angled undulation series of slots and ridges . it is understood that the purpose of the multi support tray 57 is to provide adequate support for a wrapped flauta and cylinder mandrel 21 before cooking which will stably support it in its wrapped condition before and throughout the cooking process . the wrapped flauta and cylinder mandrel 21 may be formed from a single sheet of material and may have a series of guard tabs 59 to enable the multi support tray 57 to be tilted in the direction longitudinal with respect to the ridges without loss of the wrapped flauta and cylinder mandrel 21 . the guard tabs 59 in essence create a drainage side preference where turning and drainage can occur without touching the wrapped flauta and cylinder mandrel 21 . it is understood that the triangular folds of the multi support tray 57 are generally good for supporting a round wrapped flauta and cylinder mandrel 21 and also for supporting a wide variety of other shapes of wrapped flauta and cylinder mandrel 21 . the shape of the multi support tray 57 can vary to become more complementary to the shape of the wrapped flauta and cylinder mandrel 21 . the dimensions which have been found to work well for multi support tray 57 include a length of material from peak to peak of about 1 . 25 inches , where each section is angled at about ninety degrees . each of the guard tabs by have a square dimension of about 0 . 4 inches . after folding , the multi support tray 57 is about 5 . 0 inches by about 5 . 5 inches with the longer unfolded dimension extending away from the support structure 55 . before folding , each of the folds is approximately 1 inch , which causes the unfolded multi support tray 57 to have a dimension of about 5 . 5 inches by about 8 . 0 inches . the mounting of the support structure 55 in fig4 is along an edge of the multi support tray 57 . an alternative location is along the serpentine edge of the multi support tray 57 , especially adjacent the location in which the guard tabs 59 are shown in fig4 . also seen in fig4 are some details of the handle portion 53 including a pair of outwardly directed members 61 which fits through a slot 63 on the support structure 55 and into engagement with a pair of apertures 65 . a sliding hold off member 67 can be moved downward to lock the handle portion 53 into place . referring to fig5 , a top view of an unfolded multi support tray 57 indicates a location of an alternative support structure with dashed lines indicating a support area 71 . a series of openings 73 are shown which , given the dimensions set forth above , may be formed as 0 . 5 inch diameter holes prior to folding . referring to fig6 , a folded box bracket is seen as a support structure 75 which may be advantageously located in the support area 71 seen in fig5 . support structure 75 has a lower plate 77 which will be tack welded to the multi support tray 57 . a pair of laterally extending wings 79 will extend the interference of an upper plate 71 of the support structure 75 which naturally guards or interferes with the middle two “ v ” shaped channels of the multi support tray 57 . the presence and location of the support structure 75 , along with the presence of the laterally extending wings 79 , provides a stop for all four “ v ” shaped channels seen . the upper plate 81 has a pair of side plates 83 and 85 , each of which have opposing upper tab folds 87 . the upper tab folds 87 help guide the ends of the handle portion 53 in the same manner as was explained for fig4 , and prevents a hinge action between the portions of the handle portion 53 adjacent ends 61 . the structure needed to prevent forward motion should be slight as the loaded weight upon the multi support tray 57 should urge the weight of the handle portion 53 adjacent a vertical plate 81 . stuffing of the cooked shell 49 can be accomplished with a variety of structures and techniques . where a cream is stuffed , a smaller pipe can be introduced to extrude material as the pipe is withdrawn back through the shell 49 . stuffing with solid foodstuffs presents a completely different set of problems . stuffing with shredded meat , for example , can be difficult . shredding the stuffing material to too small a size can change the taste and consistency of the final foodstuff structure . another problem is support , both during stuffing and during eating . where the stuffing material has no structural support contribution , the shell 49 can collapse when bitten . where a material having significant structural characteristics are stuffed , it can catch and block further insertion . where it is further forced , it can break the shell 49 either upon the occurrence of a blockage , as well as upon over - stuffing . the alternative of using thicker and more structurally hardened shells 49 detracts from the aesthetic and quality of the finished food product . the design and construction of a completely automated mechanical stuffer will either result in significant breakage of the shells 49 , or will be prohibitively expensive . a mechanical stuffing system is described which will permit rapid manual stuffing along with minimal chance for breakage of the shell 49 . a simple stuffing support 85 is seen which is formed from a single sheet of material and which has four , upwardly folded flaps . a base 87 supports an end flap 89 and a pair of side flaps 91 and a front flap 93 . end flap 89 is designed as a food stop . the front flap 93 has a pair of slots occupied by bushings 95 , which may be preferably made of nylon or plastic . referring to fig8 , a side view of the bushing 95 is seen as having an “ h ” shape , including a main cylindrical body having a pair of enlarged flanges . this enables the bushing 95 to be supported between a semi - circular support and yet allow easy removal for cleaning and the like . referring to fig9 , a front view of the simple stuffing support 85 without the bushings 93 reveals a pair of front slots 97 each having a central circular portion 99 and a pair of flanking angled openings 101 . the slots 97 have approximately the same shape as the slots 47 which were partially seen in fig3 . the bushings 93 are used to provide a low friction transition surface and create minimum wear on a push rod , and depending upon the design of the push rod can be used to help retain the push rods in operational use by preventing their slipping past the bushings 93 . the spacing of the slots 97 represent a wider spacing than is absolutely necessary to accommodate two shells 49 , and “ u ” shaped spacers can be located on the base 87 to provide support and separation for the two shells 49 located within the simple stuffing support 85 . referring to fig1 , a plan view of a stuffer rod 111 which can be cylindrical , oval , or square . stuffer rod 111 , if cylindrical , will have a first diameter cylindrical portion 113 and a second diameter cylindrical portion 115 , and if square will have a first width cylindrical portion 113 and a second width cylindrical portion 115 . the discussion will be continued based upon a cylindrical stuffer rod 111 , but in the case of a square or other shaped stuffer rod 111 , the openings in the bushings 95 will be appropriately matched . in one instance , a portion 113 having a diameter of about three eighths of an inch and a rod portion 115 having a diameter of about five - sixteenths of an inch may work well . a reduced diameter rod portion is used in conjunction with the bushings 95 to help prevent the stuffer rod 111 from becoming inadvertently dis - engaged from a stuffer box ( to be shown ) when the simple stuffing support 85 is used to support both cooked shells 49 and the stuffer box ( to be shown ). a series of etched lines 117 and 119 may be formed to indicated to the user the maximum run and minimum engagement positions for the stuffer rod 111 . this will help self train the user not to over - extend the stuffer rod 111 when stuffing begins , such as line 119 , and not to continue stuffing once the stuffer rod shows resistance at a given level , such as line 117 . referring to fig1 , a plan view of a stuffer rod 121 having a constant cross sectional dimension is seen . as before , the stuffer rod 121 can have any cross sectional shape , including cylindrical , oval , square , rectangular , pentagonal , hexagonal , and the like . in this instance , a single structure a diameter of about three eighths of an inch is seen . this dimension will work with the stuffer box to be seen in subsequent figures , as well as through bushings 95 having a larger internal diameter , as there is no larger diameter portion to be captured . the constant diameter rod 121 may used for a less bulky material which may not be subject to shearing , for a given sized stuffer box dimension . a series of etched lines 123 and 125 may be formed to indicated to the user the maximum run and minimum engagement positions for the stuffer rod 121 . a stuffer apparatus will pass food to be stuffed through the bushings 95 of the simple stuffing support 85 . as before , especially for a commercial production operation a pump operated stuffer may be used . for smaller operations , the main requirement of a stuffer unit is that it be simple and easy to clean thoroughly . referring to fig1 , a perspective of a stuffer box 131 is seen . a base 133 interfits with a four sided box 135 . two of the sides of the box 135 , including sides 137 and 139 are lower than two other opposite sides 141 and 143 . in one embodiment of the invention , the lower edge of sides 137 and 139 may simply overlap the outside of the base 133 , where the lower edges of sides 141 and 143 fit into grooves ( not completely seen in fig1 ) and form a stable engagement . the base 133 has lowered grooves to interfit with the lower edges of sides 137 and 139 to insure that the box 135 is properly oriented with respect to the base 133 . from a wall 145 of the base 133 a pair of canula shaped conduits 147 and 149 are seen . the longer extent of the cannulated shapes of the canula shaped conduits 147 and 149 at the bottom extent of the canula shaped conduits 147 and 149 . this enables the canula shaped conduits 147 and 149 to become more easily inserted into the ends of the cooked shells 49 . having the ends of the canula shaped conduits 147 and 149 oriented to the bottom will insure that less food spillage will occur upon docking and un - docking of the stuffer box 131 with respect to the simple stuffing support 85 . also partially seen in fig1 is a hopper feed area 151 surrounding a hopper opening 153 . both the hopper feed area 151 and hopper opening 153 may be machined into an upper surface 155 of the base 133 . the removable four sided box 135 gives the cleaner wide open access to the hopper feed area 151 , hopper opening 153 , and upper surface 155 . the canula shaped conduit 147 is in fluid communication with its respective hopper opening 153 , while the canula shaped conduit 149 is in fluid communication with its respective hopper opening ( not seen in fig1 ). both the canula shaped conduits 147 and 149 and their respective hopper openings are in communication with their respective through bores which extend horizontally through the base 133 . the back openings cannot be seen in fig1 but are located just under the side 143 . the stuffer rods 111 and 121 operate from the back openings . referring to fig1 , a top plan view of the base 133 with the four sided box 135 removed illustrates further details . back openings are seen as back opening 161 which is in fluid communication with a through bore 163 , the hopper opening 153 and canula shaped conduit 147 . similarly , a back opening 165 is in fluid communication with a through bore 167 , a hopper opening 169 and canula shaped conduit 147 . the through bores 163 and 167 will have a shape matching the stuffer rods 111 and 121 . hopper opening 169 is surrounded by a hopper feed area 171 . a front groove 173 for supporting a lower edge of the side 141 is seen , as is a rear groove 175 for supporting a lower edge of the side 143 . referring to fig1 , a side view of the base 133 is seen along with a clearer view of the grooves 173 and 175 . as can be seen from fig1 and 14 , the bores 163 and 167 are generally linear . note also that the hopper feed areas 151 and 171 could be closer together , but that separation enables additional control of the material fed through those hopper feed areas 151 and 171 . referring to fig1 , a top down view illustrates the mating parts of the simple stuffing support 85 which supports a pair of cooked shells 49 and the stuffer box 131 . also seen for the first time is one or more shell separator structures 181 which may be a simple “ u ” shaped channel tack welded to the base 87 of the simple stuffing support 85 . note that the canula shaped conduits 147 and 149 are seen as extending into the cooked shells , and that one of the shell separator structures 181 is positioned somewhat as a stop for stabilizing the stuffer box 131 in the direction of the cooked shells 49 . any material within the four sided box 135 will fall into the hopper openings 153 and 169 where it may be gently pushed forward by the stuffer rod 121 ( or stuffer rod 111 ). the spacing shown between the front flap 93 and the stuffer box 131 may exist or there may be a close fit . where the structures 181 are moveable , such as by engagement in a series of slots in the base 87 of the simple stuffing support 85 , the structures 181 can be moved about to accommodate different lengths of cooked shells 49 , and different sized stuffer boxes 131 . where stuffer rod 111 is used , note that its withdrawal will be limited by the bushings 95 to prevent the end of the stuffer rod 111 from becoming disengaged from the stuffer box 131 and thus saving the time necessary to re - insert it . this enables a much more mechanically affirmative mode of action . movement of stuffer rod 111 may be set to either partially or completely clear the hopper opening 153 to enable material present over hopper feed area 151 and hopper opening 153 will fall into the hopper feed area 151 . each time the stuffer rod 111 is advanced , the material within the feed area 151 will be advanced through the canula shaped conduit 147 and into the shell 49 . it is understood that the hopper feed area 151 and hopper opening 153 could be made longer to load more material per forward stroke of the stuffer rod 121 , but increasing the length of the hopper opening 153 could also compact the food stuffing present and subject the shell to a greater chance of damage or breakage . the smaller the amount loaded with each stroke of the stuffer rod 121 , the more gentle the loading steps will become . referring to fig1 - 19 , one embodiment of a handling tool 191 is seen . the handling tool 191 is described which can be used to engage , carry and disengage the hollow open ends of the cylinder mandrel 21 . the handling tool 191 has a main cylindrical body 193 which should be long enough to manually grasp with enough distance between main cylindrical body 193 and a conical section 195 which will be inserted into the through bore 27 of cylinder mandrel 21 to form an interference fit . the interference fit will depend upon the force with which the handling tool 191 is inserted , as well as the taper of the conical section 195 . a blunt end 197 is provided to make the handling tool 191 less of an injury and destruction threat during use . a sharp tip might encourage user to more rapidly approach the cylinder mandrel 21 and a missed engagement would cause either damage to the cooked shell 49 or hand contact with the cylinder mandrel 21 . at the end of the handling tool 191 opposite the conical section 195 an end plate 199 is located . the end plate carries a curved notch 201 which should closely match the outer diameter of the cylindrical surface 23 of the cylinder mandrel 21 . the axial edges of the curved notch 201 may be sharply angled . at the end of the main cylindrical body 193 is an end plate 197 which functions as a combination end member , shell removal fitting and cleaning fitting . as an end member , it acts as an end grasp register for the main cylindrical body 193 so that users can “ feel ” the end of the handling tool 191 and preferentially keep the hand nearest the end . as a shell removal fitting , the end plate 199 curved notch 201 is made to fit over the exterior surface of the cylinder mandrel 21 and urged along the surface to help remove the cooked shell 49 . this use enables the user to avoid touching the hot cylinder mandrel 21 just after cooking , as well as the hot cooked shell 49 . as a cleaning fitting , the end plate 199 curved notch 201 can be closely conforming to the exterior of the smooth cylindrical surface 23 of the cylinder mandrel 21 so that movement of the end plate 199 along its length removes all debris including bits of the cooked shell 49 which either remained or was inadvertently stuck to the cylinder mandrel 21 , as well as any debris the cylinder mandrel 21 may have picked up from the last cooking operation . referring to fig1 , an alternative embodiment of a cylinder mandrel is seen as a cylinder mandrel 211 . cylinder mandrel 211 may have the same dimensions for a smooth cylindrical surface 213 as were seen for smooth cylindrical surface 23 . a pivot fitting 215 may be spring loaded to urge a keeper 217 against the smooth cylindrical surface 213 . the nature of the spring fitting ( not shown in fig1 ) may be simply to urge the keeper 217 in one direction , or it may act with a cam action to enable the keeper 217 to assume a right angle with respect to the smooth cylindrical surface 213 to facilitate wrapping of the flauta material . in this position , the pivot fitting 215 may be freely rotatable about the axis of the smooth cylindrical surface 213 to enable the main extent of the cylinder mandrel 211 to rotate with respect to the pivot fitting 215 . in the alternative , a tool such as a spring loaded pliers with radius gripping tips can be utilized with cylinder mandrels 21 . a handle 219 can be used to manipulate the keeper 217 . note that the fitting pivot point is raised slightly in the view of fig1 with no flauta material present , so that a more even contact of the keeper 217 against the flauta material can occur when the flauta material is present . the keeper 217 can have a curvature about the smooth cylindrical surface 213 to match it , or more preferably of a lesser curvature to provide a better match with the exterior of the rolled flauta material which the keeper 217 is to hold in place . at the end of the cylinder mandrel 211 , a fitting 221 may include a flange 223 which is engaged by a fitting cylinder 225 which can attach to another structure . it is contemplated that a number of cylinder mandrels 211 may be supported by a common support to enable complete immersion in cooking oil so that more of the flauta material and the shell 49 produced may have a more direct contact with the cooking oil . the cylinder mandrel 211 and the combination of the cylinder mandrel 21 along with the multi support tray 57 are just two example of a structures which facilitate securing of the flauta material in place during cooking . the system of the present invention can be used to prepare shells 49 and stuff any cook hardened material with meats , vegetables , desserts , and more . cooking of the flauta material may be accomplished in a preheated deep fryer to a range of 300 360 degrees , but other cooking media and environment may be used . when utilizing some layers of material with which the shell 49 is formed , it may be necessary to pre - heat or pre - moisturize to obtain better self - adherence . once rapid production begins the cylinder mandrel 21 may remain hot , and handling with the handling tool 191 permits a better result in which the cylinder mandrel 21 remains hot and covered with oil . in terms of operation of the invention , place a tapered end of the conical section 195 of the handling tool 191 engages a cylinder mandrel 21 and is used to transfer it to the circular area 39 or rectangular area 41 of the rolling support 31 . the cylinder mandrel 21 is placed about an one inch from the leading edge of a sheet of flauta material with the cylinder mandrel 21 pushed against the vertical stop 37 . the leading edge of the flauta material is rolled over the cylinder mandrel 21 until it tucks in enough to begin rolling until it is completely wrapped around the cylinder mandrel 21 . keeping the roll tight , the cylinder mandrel 21 covered with the flauta material is transferred to one of the “ v ” shaped slots of the multi support tray 57 and placed in a position to make sure the outer , free edge of the rolled flauta material is facing down to keep it from unraveling . the weight of the cylinder mandrel 21 will keep it in place and shape . the frying support 51 is loaded with other wrapped cylinder mandrels 21 , and are immersed , supported by the multi support tray 57 , in a deep fryer . after cooking for 1 - 2 minutes ( depending upon the temperature of the oil and the type of flauta material used , lift the frying support 51 and allow some drainage over the cooking oil . any tilting of the multi support tray 57 should be done with the guard tabs 59 or laterally extending wings 79 downward . the frying support 51 is positioned so that each protruding end of the cylinder mandrel 21 is over a corresponding notch 47 of the channel 45 . as the frying support 51 is lowered , each of the grooves 25 of the exposed cylinder mandrel 21 engages its associated notch 47 . once lowered , the frying support 51 the grooves 25 on the cylinder mandrels will hook themselves on the notches 47 . as the frying support 51 is then moved laterally away from the channel 45 , the cylinder mandrels 21 bearing the cooked shell 49 are dragged from the multi support tray 57 and supported at an angle over the board 35 . next , the handling tool 191 can be used to begin to slide the shell 49 away from the channel 45 along its cylinder mandrel 21 . the handling tool 191 can be used to lift the cylinder mandrel 21 to enable the shell 49 to clear the board 35 . the shells 49 are then transferred to the simple stuffing support 85 between a side flap 91 and a shell separator structure 181 . the assembled stuffer box 131 is mated with the simple stuffing support 85 , and food to be stuffed is added to the assembled stuffer box 131 . depending on the foodstuff selected , stuffer rod 111 or 121 is used to perform the stuffing operation . each stuffing stroke should terminate when the user feels resistance on the stuffer rod 111 or 113 . once the shell 49 is full , the stuffer rod 111 or 113 is removed from the stuffer box 131 and the filled shell is removed from the simple stuffing support 85 . all of the components of the inventive system can be made in a variety of materials — plated metal , wire mesh metal , wire mesh rod , or approved plastics , hardwood , or any other moldable materials in a variety of colors . metals used can be aluminum , iron , steel , stainless steel , titanium and more . although the stuffer box 131 has been shown as having a two piece construction for ease of cleaning and a dual stuffing capacity , a stuffer can be used with unitary or multiple parts and may have multiple stuffing capacity . two stuffer box 131 can be used with a two sided stuffing support 85 to stuff shells 49 from the middle outwardly . the stuffing combination shown in fig1 or other stuffer can be made to work in a vertical or angled position . the operation of the stuffing rods 111 and 121 within the stuffer box can be made to operate by motor . all sizes for all components of fig1 - 19 can be varied as needed . through bores 167 , 27 , and stuffer rods 111 and 121 can be of any shape , square , triangular , hexagonal , octagonal , and the like . while the present invention has been described in terms of a food preparation system , and particularly to a multi - component user friendly system for semi - automated production of cooked shells , the present invention may be applied in any situation where formation and stuffing of structures is desired to yield a complete and integrated cooked shell production system of a scale from manual to batch - continuous operation . although the invention has been derived with reference to particular illustrative embodiments thereof , many changes and modifications of the invention may become apparent to those skilled in the art without departing from the spirit and scope of the invention . therefore , included within the patent warranted hereon are all such changes and modifications as may reasonably and properly be included within the scope of this contribution to the art .

0Human Necessities

referring more specifically to the drawings for illustrative purposes , the present invention is embodied in the apparatus generally shown in fig1 through fig1 . it will be appreciated that the apparatus may vary as to configuration and as to details of the parts without departing from the basic concepts as disclosed herein . fig1 shows the actuators of an embodiment of an adjustable guide rail system 10 according to the invention guiding a product bottle 12 ( shown in phantom ). the product bottle 12 has sides 14 and a top 16 , and is shown resting on top of a moving conveyor system 18 . also shown is a right side guide rail assembly 20 comprising a top rail 22 a and a bottom rail 22 b , as well as a similar left side guide rail assembly 24 comprising a top rail 26 a and a bottom rail 26 b . mounted in a fixed relationship to the conveyor is an actuator sleeve 28 through a guide extension rod 30 slidably extends . a lever 32 is pivotally connected to one end of the guide extension rod 30 by means of a clevis 34 . the lever 32 is also pivotally connected by a clevis 36 to a lever support 38 . the lever 32 rotates in response to movements of the piston rod 42 of an actuator 44 attached to the opposing end of the lever 32 by a clevis 40 . the actuator is preferably a hydraulic actuator cylinder attached to a support bracket 46 with a clevis 48 . the actuator is controlled by means of fluid communication with an upper actuator input 50 and a lower actuator input 52 . fig2 shows the guide rail for the conveyor adjusted for a product package 54 ( shown in phantom ) which is smaller than the package 12 shown in fig1 . the right 20 and left 24 guide assemblies are extended to guide the package 54 along the conveyor . the right side guide extension rod 30 is shown nearly fully extended as a result of lever 32 being moved by actuator cylinder 44 which is retracted . a side view of the adjustable guide rail system guiding a large container package 12 along the conveyer is shown in fig3 . referring now to fig4 an embodiment of guide rail control device 70 according to the invention is shown . the control device 70 exemplified in this figure has an open frame housing which comprises a first plate 72 , a second plate 74 and an interposing set of four corners 76 a - d which define the edges of the housing . a first bushing 78 on the first plate 72 and a second bushing 80 on the second plate 74 retain a crankshaft 82 onto which are connected a crank lever arm 84 and a crank handle 86 . the crankshaft 82 has a threaded portion 88 , preferably using acme - type threads , upon which a control plate 90 is threadably disposed . the control plate 90 is shown herein as a plate with a welded nut . it can be seen that rotation of the crank lever arm 84 by means of the handle 86 forces the control plate 90 to move along the threaded crankshaft portion 88 in a direction that depends on the direction of crank rotation . a piston rod 92 with a threaded end 94 is threadably engaged with the control plate 90 . movements of the control plate 90 force the extension or retraction of piston rod 92 . piston rod 92 slides within control cylinder 96 , and a fluid connection port 98 on control cylinder 96 provides fluidic communication with an actuator , such as the actuator cylinder 44 shown in fig1 . for the sake of clarity , a single control cylinder is depicted in fig4 whereas typically a plurality of such control cylinders would be attached to the guide rail control device 70 . the control device 70 additionally comprises a limit setting arm 100 upon which are annularly disposed collars forming a wide limit stop 102 and a narrow limit stop 104 . the limit stops 102 , 104 can be locked , preferably by set - screws , onto the limit setting arm in positions to prevent the control device from being set overly wide or narrow for the specific conveyor in use . a rear view of the control cylinder side of the control device 70 is shown in fig5 . additional cylinder mounting holes 106 b - h indicate positions on this particular control device where additional control cylinders can be attached . fig6 shows a front view of the crank handle side of the control device 70 . fig7 shows fluidic connections between the guide rail actuators 10 , the control device 70 , and a pressurized gas source 110 . the guide rails 20 , 24 in fig7 are shown in a fully open ( wide ) position . pressurized gas from a source 110 is supplied via a hose 112 which splits off at a “ t ”- fitting 114 to a first gas hose 116 and second gas hose 118 to supply a biasing pressure to the actuation cylinders 44 and 120 . counter - clockwise rotation of crank handle 86 and crankshaft 82 moves the control plate 90 away from the maximum width stop 102 while forcing retraction of piston rod 92 into control cylinder 96 . as the piston rod 92 moves the cylinder &# 39 ; s internal piston , fluid is displaced from the cylinder chamber through first pressure hose 122 into the upper port 50 of the first actuator cylinder 44 which causes piston rod 42 of the actuator 44 to retract in response . movement of piston rod 42 is translated by lever 32 to move guide extension rod 30 and the attached guide rail 20 toward the center of the conveyor 18 , the movement being mirrored by guide rail 24 driven by actuator 120 . continued counter - clockwise rotation of the handle 86 causes continued movement of the guide rails 20 , 24 toward one another . a second control cylinder 124 in fig7 is coupled to the same control plate 90 to provide simultaneous control of the second actuation cylinder 120 through a second pressure hose 126 . although a single pair of control cylinders 96 , 124 are shown in fig7 it should be recognized that this system can accommodate a large number of control cylinders . fig8 is a schematic diagram shown an example of a typical installation 130 of the adjustable guide rails on a conveyor line . a conveyor 132 is shown in which a total of eight guide rail adjusters 134 a - h are used . guide rail control device 70 contains a series of control cylinders as described above ( not shown ) from which a series of hoses 136 are routed to each guide rail actuator 134 a - h . a bias force to each actuator is supplied via a common gas pressure hose 138 from the gas pressure source 110 . it can seen from this diagram that it is possible to quickly change the guide rail position for an entire assembly line with a few turns of the handle on the guide rail control device . the embodiment described by fig1 through fig8 is preferably used with a 30 - 40 psi air system as the source of gas pressure biasing and a food grade hydraulic oil used for driving the pistons . tests performed on the system produce rail positioning repeatability of +/− 0 . 020 inches which exceeds accuracy requirements for the industry , since production systems considered to require highly accurate guide rail positioning typically operate with adjustment tolerances of +/− 0 . 0625 inches . it should be recognized that the present invention exemplified by the described embodiment provides a means for simultaneously adjusting a series of guide rails from a remote position . the ability to remotely adjust a guide rail provides for more rapid setup of a conveyor while it eliminates the need to gain physical access to adjustment brackets of inner lanes of a conveyor . simultaneous adjustment of a series of guide rails along a single lane conveyor was previously described in regards to fig8 . an example of operator adjustment of the guide rails on a conveyor are as follows : the described use of a combination gas / fluid control and actuation means is the preferred method of implementing the invention ; however other methods , which may provide varying levels of success , can alternatively be employed . for example , the gas pressure biasing force can be replaced with a mechanical biasing means , such as springs , which operate against the force of the actuation piston being moved by fluidic pressure from a control cylinder . another embodiment of the adjustable guide rail system 150 is shown in fig9 where a master / slave cylinder coupling is used instead of a separate pressurized gas source . this embodiment of a guide rail control device 152 has a control cylinder 154 whose piston 156 and rod 158 provide fluidic communication with two ports 160 , 162 . a first port 160 of control cylinder 154 is connected to the second port 164 of a first actuation cylinder 166 by hose 168 , while the second port 162 of control cylinder 154 is similarly coupled to the first port 170 of the first actuation cylinder 166 , by hose 172 . the piston rod 174 and piston 176 of the first actuation cylinder 166 has been substantially retracted as the control plate 178 has been advanced by counter - clockwise rotation of the crank 180 . counter - clockwise crank rotation forces retraction of the piston rod 158 with piston 156 deeper into the cylinder , thereby forcing fluid through port 160 into the upper port 164 of the first actuation cylinder while drawing fluid from the lower port 170 of the actuation cylinder 166 which is drawn into port 162 of the control cylinder . movement of the crank handle in the clockwise direction causes a corresponding reversal of the fluid directions , therefore moving the piston 176 of the actuation cylinder 166 in the opposite direction . fig1 shows an embodiment 190 of the invention which employs directly mounted actuators oriented horizontally rather than vertically as previously described . vertical supports 192 , 194 are provided along the sides of the conveyor to which are mounted actuation cylinders 196 , 198 . the piston rod of these cylinders 202 , 204 , is directly connected to the guide rail assemblies 204 , 206 . these hydraulic actuation cylinders are connected to the guide rail control device and respond to fluid communication from the control device in the same manner as the previously described actuation cylinders . as can be seen , the adjustable guide rail system of the present invention provides a simple system for adjusting the guide rails of a conveyor . it will be appreciated that the invention can be implemented in a variety of ways without departing from the inventive principles . for example , the mechanics of the actuating mechanisms can be varied to use rotating arms , instead of slidable rods , while various forms of hydraulic actuators and control elements may be substituted . the coupling mechanisms between the actuator cylinder and the guide rail assembly may additionally be configured to provide differential guide rail movements , or reversing movements , in response to control device adjustments . these non - linear movements may be desired along a conveyor to adjust side to side product positioning in response to batch setting changes . it should also be recognized , that although the preferable manual input to the guide rail control device is described , a variety of motor drive units could be coupled to the guide rail control device to replace or augment the use of the manual input . accordingly , it will be seen that this invention can be implemented in a variety of ways to position conveyor guard rails and related mechanisms . although the description above contains many specificities , these should not be construed as limiting the scope of the invention but as merely providing illustrations of some of the presently preferred embodiments of this invention . thus the scope of this invention should be determined by the appended claims and their legal equivalents .

1Performing Operations; Transporting

in the following detailed description and in the several figures of the drawing , like elements are identified with like reference numerals . the figures are not to scale , and relative feature sizes may be exaggerated for illustrative purposes . an exemplary vehicle on which a sensor or antenna array may be installed is an airship , i . e . a lighter - than - air craft . antenna arrays and components described below are not limited to this application , however . for the sake of this example , the airship may be a stratospheric craft on the order of 300 meters in length . the airship may be preferably semi - rigid or non - rigid in construction . the airship may include an outer balloon structure or skin which may be inflated , with internal ballonets filled with air to displace helium in the airship for airlift control . fig1 shows an exemplary airship in simplified isometric view . the airship 10 includes an outer skin surface 12 , a nosecone region 20 , a stern region 30 , horizontal fins 32 and a vertical tail fin 34 . propulsion pods 36 are provided and may include propellers and drive units . an avionics and systems bay 40 is provided on the underbelly of the airship . the interior of the airship may include a helium bay portion 22 separated from the remainder of the interior by a bulkhead 24 . in an exemplary embodiment , the airship 10 carries a space - fed dual band antenna , comprising a plurality of arrays . in an exemplary configuration , the space - fed dual band antenna arrays may each operate as a feed - through lens or reflective array . in this exemplary embodiment , one conformal array 50 is installed with a primary array 52 on a flank of the airship to provide antenna coverage of the left and right side relative to the airship , and one planar array 70 with a primary array 72 ( fig3 a ) on the bulkhead 24 in a nose region to cover the front and back regions relative to the airship . in an exemplary embodiment , the primary array of the side array 50 may measure on the order of 25 m × 40 m , while the primary array 72 ( fig4 a ) of the planar array 70 in the nosecone region may be about 30 m × 30 m in size . in an exemplary embodiment , each of the space - fed arrays employs a dual - band shared aperture design . an exemplary embodiment of a lens array includes two facets , a pick - up side with the elements facing the feed ( power source ) and the radiating aperture . a space - fed design may simplify the feed network and reduce the rf insertion and fan - out loss by distributing the rf power through the free space to a large number of radiating elements ( 4 million for x - band , and about 6000 for a uhf band in one exemplary embodiment ). dc and low power beam scan digital command circuitry may be sandwiched inside the lens array in an exemplary embodiment . the rf circuit portion may be separated from the dc and digital electronics circuit portion . fig2 is a simplified schematic block diagram illustrating a dual band electronically steerable array ( esa ) system suitable for use on the airship 10 . the avionics bay 40 has mounted therein a set of power supplies 40 - 1 , high band ( x - band ) receivers 40 - 2 , low band ( uhf ) receivers 40 - 3 and 40 - 5 , a low band exciter 40 - 4 , an x - band exciter 40 - 6 , and a controller 40 - 7 including a master beam steering controller ( bsc ) 40 - 8 . the receivers and exciters are connected to the feed array 100 . in this exemplary embodiment , the x - band feed array 100 b is divided into a receive channel including a set 100 b - 1 of radiator elements , and a transmit channel including a set 100 b - 2 of radiator elements . in an exemplary embodiment , the receive channel includes , for each radiator element 100 b - 1 , a low noise amplifier , e . g . 100 b - 1 a , whose input may be switched to ground during transmit operation , an azimuth re feed network , e . g . network 100 b - 1 b , a mixer , e . g . 100 b - 1 c , for mixing with an if carrier for down converting received signals to baseband , a bandpass filter , e . g . 100 b - 1 d , and an analog - to - digital converter ( adc ), e . g . 100 b - 1 e , for converting the received signals to digital form . the digitized signals from the respective receive antenna elements 100 b - 1 are multiplexed through multiplexers , e . g . multiplexer 100 b - 1 f and transmitted to the x - band receivers 40 - 2 , e . g ., through an optical data link including fiber 100 b - 1 g . in an exemplary embodiment , the transmit x - band channel includes an optical fiber link , e . g . fiber 100 b - 3 , connecting the x - band exciter 40 - 6 to an optical waveform control bus , e . g . 100 b - 4 , having outputs for each set of radiating elements 100 b - 2 to respective waveform memories , e . g . 100 b - 5 , a digital - to - analog converter , e . g . 100 b - 6 , a lowpass filter , e . g . 100 b - 7 , an upcoverting mixer 100 b - 8 , an azimuth feed network 100 b - 10 , coupled through a high power amplifier , e . g . 100 b - 11 to a respective radiating element . the control bus may provide waveform data to the waveform memory to select data defining a waveform . in an exemplary embodiment , the low - band feed array includes a transmit / receive ( t / r ) module , e . g . 100 a - 1 a , for each low - band radiator element , coupled to the respect receive and transmit low - band channels . the t / r modules each include a low noise amplifier ( lna ) for receive operation and a high power amplifier for transmit operation . the input to the low noise amplifiers may be switched to ground during transmit operation . in an exemplary embodiment , the outputs from adjacent lnas may be combined before downconversion by mixing with an if carrier signal , e . g . by mixer 100 a - 1 b . the downconverted signal may then be passed through a bandpass filter , e . g . 100 a - 1 c , and converted to digital form by an adc , e . g . 100 a - 1 d . the digitized received signal may then be passed to the low band receivers , e . g . 40 - 3 , for example by an optical data link including an optical fiber 100 a - 1 e . in an exemplary embodiment , the transmit low - band channel includes the low band exciter 40 - 4 , a waveform memory 100 a - 1 g , providing digital waveform signals to a dac , e . g . 100 a - 1 h , a low pass filter , e . g . 100 a - 1 i , and an upconverting mixer , e . g . 100 a - 1 j , providing a transmit signal to the t / r module for high power amplification and transmission by the low band radiating elements of the array 100 a . fig2 also schematically depicts an exemplary lens array , in this case array 50 , which is fed by the feed array 100 . the array 50 includes the pick up array elements on the side facing the feed array , and the radiating aperture elements facing away from the feed array . exemplary embodiments of feed arrays will be described in further detail below . fig2 a illustrates a fragment of an exemplary feed array 100 for dual band operation , showing exemplary low band radiating elements and high band radiating elements . this example includes 4 - 8 rows of radiating elements spaced and weighted to produce a proper feed pattern in the elevation ( el ) plane with minimum spillover and taper loss . this is a practice known to a skilled designer and is similar to a situation encountered in a reflector antenna design . for example , the array 100 includes a uhf feed array 100 a , comprising 4 rows of radiating elements 100 a - 1 . an exemplary suitable radiating element is a flared notch dipole radiating element described , for example , in u . s . pat . no . 5 , 428 , 364 . the rows of radiating elements have a longitudinal extent along the airship axis . the array 100 further includes an x - band feed array 100 b , arranged along a top edge of the uhf feed array 100 a . the x - band feed array may , in an exemplary embodiment , be a scaled version of the uhf feed array 100 a , and similar radiating elements may be employed in the x - band feed array 100 b as for the uhf array . other radiating elements may alternatively be employed , e . g . radiating patches or slots . in an exemplary embodiment , the x - band array 100 b has a longitudinal extent which may the same length as the uhf array , but its height is much smaller , since the size of the radiating elements are scaled down to the wavelength of a frequency in the x - band . fig2 b shows a fragmentary , broken - away portion of the x - band array 100 b , with an array of radiating elements 100 b - 1 . the top layer 100 b - 2 may be a protective dielectric layer or cover . the feed array 100 is oversized in length along the airship axis , about 48 m in this embodiment ; so that signals returned from a wide region in the azimuth ( horizontal ) direction may be focused in the feed region with minimal spillover . in an exemplary embodiment , the signals include multiple beams synthesized by a digital beam former , e . g . beamformer 40 - 8 ( fig2 ). feed location and the structural support for the placement of the feed array may be traded off , based on the consideration of factors such as instantaneous bandwidth , construction issues of the airship and weight distribution . fig3 a diagrammatically illustrates two exemplary feed locations for the nose cone planar array 70 . for this array , the primary lens array 72 is mounted on the bulkhead 24 , which is generally orthogonal to the longitudinal axis of the airship . one exemplary location for the feed array 80 for this array is at the top of the outer surface of the airship skin , and is denoted by reference 80 - 1 . a second exemplary location for the feed array for planar array 70 is at the bottom of the airship , denoted by reference 80 - 2 . in an exemplary embodiment , the feed array is oversized in length with respect to the primary array , e . g . 20 % longer than a 30 m length of the primary array . in an exemplary embodiment , the feed array may be mounted on the outside of the airship . the feed array may be curved to conform to the outer surface of the airship , and phase corrections may be applied to the feed array to compensate for the curvature . fig3 b diagrammatically illustrates several exemplary locations for the feed array 54 for the conformal side array 50 . for this array , the primary lens array 52 is mounted on a flank of the skin surface of the airship . the feed array 60 may be mounted at one of many locations , to produce a feed - through beam 56 a and a reflected beam 54 b . for example , one exemplary feed array 60 - 1 is located within the interior space of the airship . the feed array 60 - 1 may be implemented with a relatively small feed array , less than one meter in height in one exemplary embodiment , which may be relatively light and with a wide bandwidth , and provides a relatively small blockage profile for energy reflected by the primary array 52 . feed array 60 - 2 is mounted on the skin surface of the airship , at a location close to the top of airship . feed array 60 - 3 is mounted within the interior space of the airship , at approximately a center of the interior space facing the primary feed array . the location of 60 - 3 may be undesirable for ballonet airship construction . another location is that of feed array 60 - 4 , on a lower quadrant of the skin surface on a side of the airship opposite that of the primary feed array . this location may provide good weight management , but may be undesirable in terms of bandwidth . a fifth location is that of feed array 60 - 5 , which is located on the same side of the airship as feed array 60 - 4 but in the upper quadrant . for some applications , the location of feed array 60 - 5 may provide better performance relative to the locations of feed arrays 60 - 1 to 60 - 4 . depending on the location of the feed array , different electrical lengths to the respective top and bottom edges of the primary array from the feed array may create different time delays , making it more difficult to use phase shifters to correct for the different path lengths . location 60 - 5 results in fairly closely equal path lengths ( from feed array to top of primary array and to bottom of feed array . in an exemplary embodiment , the flank - mounted dual - band aperture 50 includes a primary array 52 formed by many one - square - meter tile panels 54 , as shown in fig5 , e . g . one thousand of the tile panels for a one thousand square meter aperture size . in this example , the array 52 is 25 m by 40 m , although this particular size and proportion is exemplary ; other primary arrays could have tiles which are larger or smaller , and be composed of fewer or larger numbers of tiles . the tiles may be attached to the outer skin of the airship , e . g ., using glue , tie - downs , rivets , snap devices or hook and loop attachments . one exemplary material suitable for use as the skin is a 10 mil thick fluoropolymer layer with internal vectran ™ fibers . another exemplary skin material is polyurethane with vectran ™ fibers . fig4 a is an isometric view of the airship 10 with the conformal side array 52 positioned on one flank . fig4 b is an enlarged view of a portion of the airship and array within circle 4 b depicted in fig4 a , depicting some of the tile panels 54 . fig4 c is an isometric view of one tile panel 54 , depicting the front face of the tile panel . fig4 d is an isometric view similar to fig4 c , but depicting the back face of the tile panel 54 . fig4 c illustrates features of an exemplary uhf band lens assembly , comprising spaced dielectric substrates 54 - 1 and 54 - 2 . in an exemplary embodiment , the substrates 54 - 1 and 54 - 2 may be fabricated on flexible circuit boards . in an exemplary embodiment for a uhf band , the substrates are spaced apart a spacing distance of 15 cm . fabricated on the front face 54 - 2 a of substrate 54 - 2 are a plurality of spaced long slot radiators 54 - 3 . the radiators are elongated slots or gaps in a conductive layer pattern . the slots 54 - 3 may be formed in the conductive layer on the front surface by photolithographic techniques . in an exemplary uhf embodiment , the slots have a relatively large width , e . g . 4 cm , which allows room to place uhf circuit devices , e . g phase shifter and switch structures , in the slot opening . in one exemplary embodiment , the radiator slots are fed by probes , e . g . probes 54 - 7 ( fig7 ) coupled to dipole pick up elements 54 - 6 ( fig6 ). in an exemplary embodiment , the long slot radiators are disposed at an orthogonal polarization relative to the dipole pick up elements . long slot radiators as described in us 2005 / 0156802 may be employed in an alternate embodiment . fig4 d illustrates the back face of the tile 54 , and features of an x - band lens assembly . in an exemplary embodiment , the x - band lens array is fabricated on board assembly 54 - 2 , and may be constructed by standard procedures using multi - layer circuit board technology ( rf - on - flexible circuit board layers ) to package the dc and digital beam control electronics . the total thickness of the x - band lens array assembly is about 2 cm back to back in an exemplary embodiment , for one wavelength at an x - band operating frequency , while the low band aperture is about 17 cm thick , with 15 cm quarter - wave spacing for a wire mesh or grid 54 - 1 b ( fig4 d ) from the long slot radiators . still referring to fig4 d , the back face 54 - 1 a of substrate 54 - 1 has formed thereon a wire grid 54 - 1 b . in an exemplary embodiment , the wire grid may be fabricated using photolithographic techniques to remove portions of a conductive layer , e . g ., a copper layer , formed on the surface to define separated conductive wires on the dielectric substrate surface . the conductive wires of the grid are disposed in an orthogonal sense relative to the long slot radiators 54 - 3 . the wire grid or thin - wire mesh 54 - 1 b serves as a reflecting ground plane for the long slot radiator elements 54 - 3 . in an exemplary uhf embodiment , the spacing of the thin wires may be about 6 cm , or one tenth of a wavelength at uhf band . the long slots radiate a field horizontally polarized , chosen for the low band applications including foliage penetration . in an exemplary embodiment , the wire grid may have virtually no effect on x - band operation , due to the wide spacing at x - band wavelengths . fig5 - 7 illustrate an exemplary dual - band aperture design for the primary array 52 in further detail . fig5 is an isometric view of a tile panel 54 , illustrating the separation between the substrates 54 - 1 and 54 - 2 . and depicting structural stand offs 54 - 4 between the substrates . fig6 is an inverted close - up isometric view of a portion of the tile panel of fig5 , showing a bow - tie dipole element 54 - 6 , a corresponding twin - wire feed line 54 - 5 and a long slot radiator 54 - 3 . the standoffs are positioned outside the skin of the airship , in an exemplary embodiment . the twin lead feed lines 54 - 5 connect to respective vertical bow - tie uhf dipole elements 54 - 6 . each bow - tie dipole element 54 - 6 picks up power from the feed array 60 , and transfers the power to a long slot element on the front face through a pair of twin - wire feed lines 54 - 5 with a polarization 90 degree twist . the signal goes through a phase shifter and excites the long slot through a feed probe 54 - 7 . the phase shifter and a lumped element transformer matching the impedance of the radiator at each end are sandwiched in a multi - layer circuit board shared inside the x - band array . the x - band elements are vertically polarized , and positioned on both the pick - up side and the radiating side of the aperture , as illustrated in fig6 , 6 a and 7 . rows of x - band elements 54 - 8 are fabricated on dielectric substrate strips 54 - 9 which are supported in parallel , spaced relation on both sides of the substrate 54 - 1 in an exemplary embodiment . the dielectric substrates 54 - 9 are attached orthogonally to the substrate 54 - 1 , and extend parallel to the long slot radiators 54 - 3 . the x - band elements 54 - 8 in an exemplary embodiment may be radiating elements described , for example , in u . s . pat . no . 5 , 428 , 364 . an exemplary spacing between the x - band radiator strips 54 - 9 is one - half wavelength at x - band , about 0 . 6 inch ( 1 . 5 cm ).] fig6 a depicts a fragment of an exemplary embodiment of the x - band lens array formed on board assembly 54 - 1 . the x - band radiator strips 54 - 9 in an exemplary embodiment are each on the order on one cm in height , with a spacing of one half wavelength . the substrate assembly 54 - 1 may include a multilayer printed circuit board , in which the conductive layer defining the uhf long slot radiators is buried . x - band phase shifter circuits and control layers , generally depicted as 54 - 10 may also be embedded within the multilayer circuit board assembly . low band electronics may also be embedded within the multilayer printed circuit board assembly . a ground plane and cover layer 54 - 11 is disposed between the strips . in an exemplary embodiment , a polarization twist isolates high band and low band signals , and also between the pick - up side and the radiating side of the lens array . on transmit , both the low band ( uhf ) and high band ( x - band ) sources transmit vertically ( v ) polarized signals to the lens array . the h - polarized mesh ground plane 54 - 1 b is transparent to these transmitted signals . the uhf pick - up elements or dipoles 54 - 6 pick up the vertically polarized signal , transfers the power through the twin - wire feed 54 - 5 to excite the long slot 54 - 3 , which radiates an h - polarized wave into space . an h - polarized wave radiates backward , but will be reflected by the orthogonal h - polarized mesh 54 - 1 b . a polarization twist isolates the pickup side and the radiating side of the uhf lens array , i . e the twist between the dipole pickup elements 54 - 6 and the long slots 54 - 3 . for x band , there is a ground plane ( see fig6 a ), which isolates the pickup elements on the bottom and the radiating elements on the top . the radiating elements are spaced one quarter wavelength from the groundplane , and the pickup elements are also spaced one quarter wavelength from the ground plane . the grid 54 - 1 b provides a groundplane for the uhf long slot radiators only ; the ground plane for the x - band lens also serves as the ground plane for the uhf dipoles . thus , for the uhf array , the pickup and the radiating elements do not share a common ground plane . since the dipoles 54 - 6 are at cross - polarization to the wire grid 54 - 1 b , the dipoles can be located close to the wire grid without impacting performance . effectively the distance between the pickup elements and the radiating elements may be one - quarter wavelength instead of one - half wavelength , a reduction is size which may be important at uhf frequencies . fig7 is an isometric view of a tile panel 54 , diagrammatically illustrating long slot radiators 54 - 3 , feed probes 54 - 7 and phase shifter electronics . in an exemplary embodiment , a space - fed array can be operated as a feed - through lens or as a reflective array , depending on which side of the airship is to be covered . this may be accomplished in an exemplary embodiment by separating the phase shifter circuitry between the pick up and radiating aperture elements into two halves , each providing a variable phase shift between 0 and 180 degrees , and inserting a switch at the mid - point to allow the signal to pass through or be reflected . an exemplary embodiment is depicted in fig8 , a schematic diagram of a space - fed array . fig8 illustrates space - fed array 50 , comprising a primary array 52 and a feed array 60 . the feed array 60 includes a plurality of feed radiating elements 68 a , a plurality of t / r ( transmit / receive ) modules 68 b and a feed network 68 c . rf energy is applied at i / o port 68 d , and is distributed through the feed network and the t / r modules to the respective feed elements , to form a beam 66 which illuminates the primary array 52 . the primary array 52 includes a first side set of radiating elements 58 a , a first set of 180 degree phase shifters 58 b , a set of switches 58 c , a second set of 180 degree phase shifters 58 d and a second set of radiating elements 58 e . fig8 a illustrates an exemplary embodiment of one set of 0 to 180 degree analog phase shifters 58 b , 58 d of the array of fig8 , connected through a switch 58 c . the switch 58 c selectively connects the midpoint node 58 f between the phase shifters to ground . when in the open position , energy from one set of phase shifter / radiating element passes through the node to the opposite phase shifter / radiating element . this is the feed through mode position . when the switch is closed , creating a short to ground , energy arriving at the midpoint node is reflected by the short circuit , providing a reflection mode . fig8 b is a simplified schematic diagram of an exemplary embodiment of a switch and phase shifter circuit suitable for implementing the circuit elements of fig8 a for the low band ( uhf ). in this exemplary embodiment , the filters 58 b - 1 and 58 d - 1 are implemented as tunable lumped element filter phase shifters , with the tunable elements provided by varactor diodes biased to provide variable capacitance . the switch 58 c - 1 may be implemented by a shunt diode or mems switch . the switches and tunable elements may be controlled by the beam steering controller 50 - 1 ( fig2 ). fig8 c is a simplified schematic diagram of an exemplary embodiment of a switch and phase circuit suitable for implementing the circuit elements of fig8 a for the high band ( x - band ). in this exemplary embodiment , the filters 58 b - 2 and 58 d - 2 are implemented as reflection phase shifters each comprising a 3 db hybrid coupler and varactor diodes to provide variable capacitance . reflection phase shifters are described , for example , in u . s . pat . no . 6 , 741 , 207 . the switch 58 c - 2 may be implemented by a shunt diode or mems switch . in an exemplary embodiment of a uhf lens array , each uhf bow - tie dipole element 54 - 6 picks up power from the uhf feed array and transfers the power to a uhf long slot element 54 - 3 on the front face of substrate 54 - 2 via a twin wire transmission line feed 54 - 4 . fig9 is a schematic diagram of an exemplary embodiment of rf circuitry between a twin wire transmission line feed 54 - 4 and a long slot element 54 - 3 . a lumped element balun 54 - 10 , varactor diodes 54 - 12 , a pin diode 54 - 13 , dc blocking capacitors 54 - 14 and inductors 54 - 11 are packaged as surface mounted devices ( smd ) and are mounted on top of a multilayer rf flexible circuit board comprising substrate 54 - 2 . a microstrip line may used to connect the smd s together to form a switched varactor lumped element filter phase shifter circuit . a shift in transmission phase through the lumped element filter is the result of changing the capacitance of the varactor as the bias voltage is varied across the varactor devices . the pin diode 54 - 13 serves a shunt switch in the center of the phase shifter circuit . each end of the phase shifter circuit is connected to the single ended ports of the baluns 54 - 10 and 54 - 15 which essentially are lumped element transformers that provides impedance matching and transmission line mode conversion to both the orthogonally mounted twin wire line and coplanar long slot element at their respective probe points . the smds and the resulting phase shifter circuits may be relatively small in comparison to the dimension of the gap across the uhf long slot 54 - 3 . as a result the phase shifter and balun circuitries may be placed across a portion of the gap , as depicted diagrammatically in fig1 , on one side at the long slot probe point while running a trace 54 - 3 a to the side of the gap to excite the voltage potential across the gap at the probe point to generate the radiating fields . the dc bias circuits for the varactor and pin diodes , and the signal and control lines to the phase shifter circuits are not shown in fig9 . in an exemplary embodiment , the signal and control lines may be buried within the multilayer rf flex circuit board and routed to the surface via plated through holes . fig1 is a schematic diagram of an exemplary embodiment of x - band lens array circuitry . the x - band lens element circuitry may include microstrip transmission line components 54 - 20 , varactor diodes 54 - 21 , a pin diode 54 - 22 and dc blocking capacitors 54 - 23 . these components may be used to make up flared dipole baluns 54 - 25 and switched varactor diode reflection phase shifter circuit 54 - 26 . the varactor diodes may be used in branchline coupler circuits 54 - 24 . as shown in fig1 , the reflection phase shifter circuit 54 - 26 employs a set of microstrip 3 db branchline quadrature couplers 54 - 24 whose outputs are terminated with the varactor diodes 54 - 21 . the shift in reflection phase off the diode termination is the result of changing the capacitance of the varactor , as the bias voltage is varied across the varactor . other quadrature coupler configuration may alternatively be used . in an exemplary embodiment , a pin diode 54 - 22 serves as a shunt switch in the center of the phase shifter circuit 54 - 26 . the balun circuit 54 - 25 includes a microstrip 0 degree / 180 degree power divider with transmission line transformers to provide impedance matching and transmission line mode conversion from microstrip line to coupled microstrip on the rf flexible circuit board to the orthogonally mounted coplanar strips transmission lines that feed the dipoles . other balun configurations may alternatively be used . in an exemplary embodiment , to ensure adequate fit of the microstrip phase shifter circuitry within the x - band lattice , half of the phase shifter circuit 54 - 26 may be mounted on the surface of the rf flexible circuit board ( substrate 54 - 2 ) with the radiating dipole elements 54 - 9 while the other half is mounted on the opposite surface of the rf flexible circuit board with the pick - up dipole elements 54 - 8 . the pin diode shunt switch 54 - 22 may be mounted on the rf flexible circuit board surface 54 - 27 facing the pick - up elements 54 - 8 . the rf connections between the two phase shifter circuit halves may be accomplished using a set of plated through holes configured in the form of a caged coaxial interconnect line 54 - 30 , illustrated in fig1 and 12 a - 12 c . the interconnect line 54 - 30 includes an input microstrip conductor line 54 - 31 having a terminal end 54 - 31 a which is connected to a plated via 54 - 32 extending through the substrate 54 - 2 . a pattern of surrounding ground vias and pads 54 - 33 and connection pattern 54 - 34 provides a caged coaxial pattern pad 54 - 35 . an output microstrip conductor 54 - 36 had a terminal end connected to the plated via 54 - 32 on the opposite side of the substrate , and a pattern of surrounding pads and connection pattern 54 - 37 , 54 - 38 is formed . spaced microstrip ground planes 54 - 39 and 54 - 40 are formed in buried layers of the substrate 54 - 2 . using a similar caged coaxial approach , a coupled microstrip on the rf flexible circuit board surface can transition to orthogonally mounted coplanar strip ( cps ) transmission line as shown in fig1 and 13 a - 13 d . in this exemplary embodiment , input coupled microstrip conductor lines 54 - 51 and a surrounding connected ground plane vias and pad pattern 54 - 53 are formed on one surface of the substrate 54 - 2 . a caged twin wire line pattern 54 - 52 is formed by the plated vias and surrounding ground vias ( fig1 b ), thus defining a shielded twin wire line 54 - 53 as depicted in fig1 c . on the opposite substrate surface , coplanar strips 54 - 55 with an orthogonal h - plane bend are connected to the twin leads to form an electrical rf connection to the dipole 54 - 8 . microstrip groundplanes 54 - 56 , 54 - 57 are disposed in a buried layer within the substrate and on a surface of the substrate . note that the dc biased circuits and the signal and control lines to the phase shifter circuits are not shown . the signal and control lines may be buried within the multilayer rf flexible circuit board and routed to the surface via plated through holes . aspects of embodiments of the disclosed subject matter may include one or more of the following : the use of a space feed to reduce rf loss and feed complexity to power a large number , e . g . in one exemplary embodiment , 4 million , x - band radiating elements . interleaving of uhf and x - band radiating elements over the same aperture . dual band operation over x band and uhf bands , with the frequency ratio 20 : 1 for x and uhf . exploitation of polarization twist to isolate high band , low band , and between the pick - up side and the radiating side of the lens array . use of feed - through and reflective modes to cover both forward and backward directions . although the foregoing has been a description and illustration of specific embodiments of the subject matter , various modifications and changes thereto can be made by persons skilled in the art without departing from the scope and spirit of the subject matter as defined by the following claims .

7Electricity

referring now to the drawings , and more particularly to fig1 , there is shown a tissue machine for the production of tissue paper of intermediate quality and of premium quality . machine 1 includes forming section 2 , inventive device 3 and drying section 4 . tissue web 10 is formed in forming section 2 . for this purpose , a fibrous stock suspension is sprayed by headbox 5 into a gap which is formed by permeable belt 8 and outer forming wire 7 . both clothings 7 , 8 are directed over forming roll 6 whereby the fibrous suspension is dewatered and tissue web 10 is formed . forming roll 6 is a full jacket roll . dewatering of fibrous web 10 occurs only through the outer wire . permeable belt 8 is in the embodiment of a fabric with a structured surface . this has raised and indented zones , whereby the indented zones form pockets . the raised and indented zones are arranged uniformly on the fabric surface . ornament structures can also be superimposed . during forming of fibrous web 10 in the area of forming roll 6 the pockets are filled with paper fibers of the fibrous stock suspension . this causes pillow - type voluminous zones in tissue web 10 in the areas of the pockets . structured fabric 8 has equal or fewer than 55 . 7 pockets per cm 2 ( 360 pockets per inch 2 ). in this example , structured fabric 8 is a single ply , 4 - strand fabric with a warp thread density of 20 . 9 threads per cm ( 53 threads / inch ). the permeability is 700 cfm . the warp threads have a diameter of 0 . 30 mm and the weft threads have a diameter of 0 . 35 mm . contact area 33 of fabric 8 with a flat surface , as for example the surface of yankee drying cylinder 19 , is 25 %. fabric 8 is endless , in other words it has no seam . formed tissue web 10 , is transported through entire tissue machine 1 lying on fabric 8 up to the transfer to the surface of yankee drying cylinder 19 . after forming section 2 , the tissue web is directed to the first press zone of device 3 which consists of the first and a second press zone . in device 3 the tissue web is dewatered to a dry content of above 35 %. first press zone 15 . 1 is formed by a suction roll 13 and by a permeable press element — press belt 11 . tissue web 10 is carried through first press zone 15 . 1 between structured fabric 8 and felt 9 . the pressing pressure is generated by press belt 11 which is tensioned at 50 kn / m and amounts to approximately 71 kpa at a suction roll diameter of , for example , 1 . 4 m . first press zone 15 . 1 is designed so that a fluid , in this case heated air , can flow through tissue web 10 during the pressing procedure . hood 12 is provided for the supply of heated air . hood 12 includes steam shower 29 at the beginning of first press zone 15 . 1 for optional addition of steam . the flow direction ( arrow ) for the air and the steam is very important . the heated air flows first through press belt 11 , then through structured fabric 8 , then through tissue web 10 and after that through a permeable support belt , felt 9 . the heated air with the water from tissue web 10 is sucked off by suction roll 13 . the vacuum is in the range of 0 . 3 to 0 . 4 bar . support belt 9 is in the embodiment of a felt in accordance with vector technology . a felt according to this technology includes a woven base fabric onto which a nonwoven so - called vector layer consisting of coarse felt fibers is applied onto the side facing the fibrous web . the fibers of this layer are arranged three - dimensionally and have a count of more than 67 dtex . this means coarse fibers are used to produce this layer . this has the advantage that this felt layer is very open and can therefore be easily dewatered . the air permeability of this layer is in the range of 80 cfm . the air permeability of the felt is approximately 20 cfm . moreover , the three - dimensional arrangement of the coarse fibers in the vector layer give the felt good resilience when running through the press nip . the felt is hereby compressed and springs back after the press nip , almost to its original thickness . the vector layer may have a base weight range of 100 g / m 2 to 500 g / m 2 . the vector layer is covered , for example , by at least one structure of laid fibers consisting of finer fibers which comes into contact with the fibrous web . felt 9 has high resiliency characteristics . the dynamic modulus for compressibility “ g ” is equal or higher than 0 . 5 n / mm 2 . the dynamic stiffness k * of felt 9 is less than 100000 n / mm . collecting tank 14 is provided at the uncovered section of suction roll 13 to remove the thrown off water . after first press zone 15 . 1 , dewatered tissue web 10 , arranged between structured fabric 8 and felt 9 , is directed for additional dewatering through second press zone 15 . 2 . press zone 15 . 2 is formed by two rolls 16 , 17 . lower roll 16 which comes into contact with felt 9 is a soft , blind bored and grooved roll . the surface of the roll can have a hardness of 30 to 33 p & amp ; j . this roll consists , for example , of a roll core with a roll cover . the thickness of the roll cover is around 20 mm . the roll cover is selected so that — due to water absorption — the hardness becomes softer during operation of the roll by 4 to 5 p & amp ; j points . lower roll 16 which comes into contact with felt 9 can also be in the embodiment of a suction press roll to increase the dewatering efficiency . in this case roll 16 is connected to a vacuum system which is not illustrated here . opposite element 17 of the second press zone may be in the embodiment of a smooth and / or hard roll . the surface of this roll is provided by a roll cover , whereby the thickness of the cover is approximately 15 mm . the surface has a hardness in the range of 0 to 1 p & amp ; j . the line force of the second press zone 15 . 2 may be in a range of 20 kn / m to 90 kn / m . depending on the configuration of press zone 15 . 2 the maximum pressing pressure is in the range between 2 to 3 . 5 mpa . important influential parameters are softness of clothings 8 , 9 and rolls 16 , 17 , 17 ′, as well as their diameters . the maximum pressing pressure of second press zone 15 . 2 is greater than the maximum pressing pressure of first press zone 15 . 1 . an additional embodiment provides that opposite element 17 ′ of second press zone 15 . 2 conspires with opposite element 13 of first press zone 15 . 1 , thereby forming the second press zone in cooperation with opposite element 13 of the first press zone . beside the first and second press nip 15 . 2 which is formed by opposite element 17 and press element 16 an additional third press nip is provided in an additional embodiment which is formed by roll 17 ′ and opposite element 13 of the first press zone . after second press zone 15 . 2 , tissue web 10 is separated from felt 9 . tissue web 10 runs together with structured fabric 8 to a third press nip which is formed by suction roll 18 and yankee drying cylinder 19 . in this press nip the fibrous web is pressed against the surface of the yankee cylinder only in the area of the contact area ( 20 % to 32 %) of structured fabric 8 . the tissue web is separated from fabric 8 and transferred to hot drying cylinder surface 19 . further drying takes place there and in the area of hot air hood 20 . finally , tissue web 10 is creped by means of scraper 21 and taken off drying cylinder surface 19 . coating applicator nozzle 22 which is already known is provided at drying cylinder 19 to apply a medium . tissue machine 1 includes cantilevered device 37 which makes fast replacement of clothing possible and thereby renders machine 1 for the production of another tissue quality in another machine configuration convertible . moreover , machine 1 includes guide rolls 30 , 31 , 32 which are not required for the illustrated machine configuration , but are provided already for other configurations . referring now to fig2 , there is shown press zone 15 . 2 in an enlarged illustration . felt 9 is directed away from tissue web 10 which is lying on structured fabric 8 . structured fabric 8 has a lower compressibility than felt 9 . since felt 9 is softer than fabric 8 , good contact is established - also in the area of the pockets of fabric 8 — between tissue web 10 and felt 9 . this favors dewatering thereby achieving a higher dry content of the tissue web . referring now to fig3 , there is shown a machine configuration according to the present invention which is required to produce tissue webs of premium quality . the machine configuration illustrated in fig1 was hereby modified through removal or opening of second press zone 15 . 2 . the remaining machine elements and clothing are consistent with those in fig1 . this also applies to the component identifications . referring now to fig4 , there is shown a machine configuration according to the present invention for the production of tissue webs of standard quality . for this , both press zones 15 . 1 , 15 . 2 were removed or bypassed . structured fabric 8 from fig1 and fig3 was replaced by felt 8 . the only press nip is formed by suction press roll 18 and drying cylinder 19 . this configuration requires the least energy , however produces tissue webs with the lowest specific volume . referring now to fig5 , there is shown a schematic illustration of a structured fabric according to the present invention in which the crimps were sanded in order to enlarge the contact area . in this example , the side contacted by the paper and the opposite side are sanded . it is however appropriate if only the paper contact side is sanded . while this invention has been described with respect to at least one embodiment , the present invention can be further modified within the spirit and scope of this disclosure . this application is therefore intended to cover any variations , uses , or adaptations of the invention using its general principles . further , this application is intended to cover such departures from the present disclosure as come within known or customary practice in the art to which this invention pertains and which fall within the limits of the appended claims .

3Textiles; Paper

referring initially to fig1 there may be seen generally at 1 , a first preferred embodiment of a printing press cylinder with oscillation damping in accordance with the present invention . in the longitudinal , cross - sectional view of the printing press cylinder , generally at 1 , as seen in fig1 there is not shown the inclusion of one or more cylinder channels and the various devices , such as printing plate or rubber sheet clamping devices or gripper devices which are customarily located in one or more of the channels . these cylinder channels are depicted somewhat schematically at 32 in fig4 and 8 . it will be understood that these channels extend axially along the outer periphery of the cylinder 1 , generally parallel to an axis of rotation 6 of the cylinder , and that there may be more or less channels 32 than are depicted in fig4 and 8 . the printing press cylinder 1 , shown in fig1 includes a one - piece , rotation - symmetrical cast body having a cylinder shell 2 and two cylinder end faces 3 and 4 . in the interior of the cylinder shell 2 and also being a part of the printing press cylinder 1 , is an approximately drum - shaped core 7 . the cylinder core 7 extends in the direction of the cylinder axis 6 and is fixedly connected to the inside of the cylinder shell 2 by a ring - shaped bar 8 which is located centered in the axial direction . the cylinder core 7 has core journals 9 and 11 on its ends facing in the direction of the cylinder axis 6 . the end faces 3 and 4 of the printing press cylinder shell 2 have axle journals 12 and 13 extending towards the exterior . these journals 12 and 13 are seated in walls of the press frame 17 and 18 by roller bearings 14 and 16 . the two core journals 9 and 11 are connected in an oscillation - damping manner to the axle journals 12 and 13 by means of an oscillation - damping material , for example by bushings 19 and 21 of polyurethane . a drive gear wheel 22 is connected with the axle journal 13 by screws 23 and an interposed spacer ring 24 . the printing press cylinder 1 has filling openings 26 on its end faces 3 and 4 . it is made of cast steel or cast gray iron , for example . in accordance with present process technology , the core 7 is cast as one piece with the rest of the cylinder . the molding sand can be removed through the filling openings 26 . separation of the core journals 9 and 11 from the axle journals 12 and 13 takes place after pre - processing by means of chip removal . when this first preferred embodiment of the printing press cylinder 1 is caused to be rotated , the cylinder shell 2 is caused to oscillate because of the structure of the channels 32 and their associated clamping assemblies . this oscillation is transmitted to the cylinder core 7 through the ring - shaped bar 8 . the oscillations transmitted to the cylinder core are then transformed by friction from a mechanical force to heat energy in the bushings 19 and 21 . one particular advantage of this first preferred embodiment lies in its one piece construction . the cylinder core 7 , with its ring - shaped bar 8 is used simultaneously to dampen oscillations and also as a counter - pressure device to prevent bending of the printing press cylinder 1 in the radial direction . turning now to fig2 there may be seen a second preferred embodiment of a printing press cylinder with oscillation damping in accordance with the present invention . in this and subsequent preferred embodiments , the same numbers will be used to identify corresponding elements in each embodiment . a longitudinal section through this second preferred embodiment of a one - piece printing press cylinder 1 , which may be fabricated from cast steel or cast gray iron , is shown in fig2 . the cylinder core 27 is embodied to be generally cylinder - shaped and is fixedly connected in the axial direction 6 with the axle journals 12 and 13 . on its end faces , the core 27 is partially connected with the end faces 3 and 4 of the printing press shell 2 . the cylinder core 27 is totally connected with the inside of the cylinder shell 2 of the printing press cylinder 1 by means of oscillation - damping material 28 which surrounds the cylinder core 27 . in accordance with process technology , the cylinder core 27 was cast with the rest of the cylinder . the oscillation - damping material 28 can be inserted through filling openings 26 after removal of the molding sand . such oscillation - damping material 28 can consist , for example , of polyurethane ; bulk material such as sand ; or of viscous oscillation damping media such as high - viscosity oil . when using viscous materials , it is desirable to employ a diaphragm , which is connected with the filling openings 26 , for volume equalization . the cylinder shell 2 of the printing press cylinder is excited to oscillate by the channel vibration . these oscillations are conveyed between the core 27 and the surface of the cylinder shell 2 as a result of the inserted oscillation - damping material 28 . the core 27 acts as a counter - mass in respect to the oscillating surface of the cylinder shell 2 . the oscillations are damped out in the oscillation - damping material 28 . one of the advantages of this second preferred embodiment of the printing press cylinder with oscillation damping is its one - piece construction which allows low production tolerances and less costly manufacture . referring now to fig3 and 4 , there may be seen a third preferred embodiment of a printing press cylinder with oscillation damping in accordance with the present invention . as may be seen in fig3 and 4 a cylinder core 29 , which is essentially cylindrical , is fixedly connected with the inside of the cylinder shell 2 by two bars 31 , located opposite from each other and extending radially from the cylinder axis 6 . the bars 31 are disposed angularly offset in relation to the cylinder channels 32 . the end faces 3 and 4 of the printing press cylinder 1 are fixedly connected with the axle journals 12 and 13 . as previously described in connection with the second preferred embodiment of fig2 the cylinder core 29 has been cast as one with the rest of the cylinder . the oscillation - damping materials 28 of fig2 is also employed and is inserted into the interior of the cylinder shell 2 through the filling openings 26 . turning now to fig5 a longitudinal section through a fourth preferred embodiment of a one - piece printing press cylinder 1 in accordance with the invention is shown . the essentially cylindrical cylinder core 33 is completely surrounded by oscillation - damping material 34 . the outer side of the oscillation - damping material 34 is in contact with the cylinder shell 2 and the end faces 3 and 4 of the printing press shell 2 of the cylinder 1 . the end faces 3 and 4 are fixedly connected with the axle journals 12 and 13 . in accordance with process technology , the cylinder core 33 is cast in one step together with the entire printing press cylinder i . after removal of the molding sand through the filling openings 26 and the molding the oscillation - damping material 34 around the core 33 , the casting spurs which attach the core 33 to the shell 2 are separated from the cylinder shell 2 by boring so that there is no longer a metallic connection between the core 33 and the front faces 3 and 4 of the shell 2 . as was the case with the previously described preferred embodiments , the cylinder shell 2 of the printing press cylinder 1 is excited to oscillate by the channel vibrations . these oscillations are converted in the oscillation - damping material 34 . the core 33 is used as a counter - mass with respect to the cylinder shell 2 . polyurethane with a metallic granulate for mass adjustment can be advantageously used in this case as an oscillation - damping material . the weight of the oscillation - damping material 34 can be varied by changing the amount of metallic granulate added . the advantage of this fourth embodiment lies particularly in that in addition to the one - piece structure of the printing press cylinder 1 , the core 33 is not metallically connected with the cylinder shell 2 . in this way the printing press cylinder 1 itself has a lower oscillation - damping mass . the oscillations of the cylinder shell 2 can reach the core 33 only indirectly and through the oscillation - damping material 34 . in fig6 there may be seen a longitudinal cross - sectional view of a fifth preferred embodiment of a printing press cylinder with oscillation damping in accordance with the present invention . in this fifth embodiment , the cylinder core 36 is generally cylindrical and has two core journals 9 and 11 at its axial ends . the cylinder shell 2 , as was the situation with prior embodiments has end faces 3 and 4 which are provided with axle journals 12 and 13 . in this embodiment , the cylinder core 36 was cast with the largest possible mass as one piece with the cylinder . after placing oscillation - damping material 34 around the core 36 , the core 36 is separated from the cylinder shell 2 by removing the casting spurs by boring , so that the core 36 and the core journals 9 and 11 no longer have a metallic connection with the cylinder shell 2 or the cylinder end faces 3 and 4 . the space between the core journals 9 and 11 and the axle journals 12 and 13 is also filled with oscillation - damping material 34 after the boring process . there may be seen in fig7 a sixth preferred embodiment of a printing press cylinder with oscillation damping in accordance with the present invention . in this embodiment the one piece cylinder shell 2 is securely connected with the end faces 3 and 4 and these end faces 3 and 4 are securely connected with the axle journals 12 and 13 which extend in an axial direction . balls 37 have been inserted into the interior space formed by the cylinder shell 2 and the end faces 3 and 4 of the printing press cylinder 1 . the balls 37 preferably have a diameter of 2 . 5 to 3 mm and preferably are made of steel . the balls 37 can be inserted through the filling openings 26 . the balls 37 are used as the core as well as the oscillation - damping material . compacting of the balls 37 can be performed by shaking . in addition , it is possible to dispose a pre - stressing device in the interior of the printing press cylinder 1 which , if needed , further compacts the balls 37 . the cylinder can also be made of several parts . the cylinder shell 2 is excited to oscillate by the channel vibration . these oscillations are transferred to the balls 37 adjoining the inside of the cylinder shell 2 . these oscillations are increasingly reduced by the impact and movement processes which cause losses of force . the oscillation effect can also be increased by additionally employing viscous damping agents , such as oil or grease which can be added to the space in the cylinder shell 2 in addition to the steel balls 37 . a seventh preferred embodiment of the printing press cylinder with oscillation damping is shown in fig8 which is a transverse cross - sectional view of the printing press cylinder 1 . in this seventh embodiment , the cylinder is shown having two diametrically spaced channels 32 . the printing press cylinder shown in fig8 is structured generally the same as the cylinder 1 which is shown in fig7 . the difference is that the entire cylinder chamber formed by the cylinder shell 2 and its end faces 3 and 4 is not filled with steel balls 37 , as was the case in the device shown in fig7 . instead , in this seventh preferred embodiment two ball - filled containers 38 are attached to the interior of the cylinder shell 2 adjacent the channels 32 . these containers are diametrically spaced from each other and extend generally parallel to the axis of rotation 6 of the cylinder 1 . since the cylinder channels 32 are the area of the cylinder 1 where the oscillations are generated , it is desirable to attach a ball container 38 adjacent each channel 32 . it is advantageous to attach a plurality of evenly spaced , equally weighted ball containers 38 so that no added balancing is needed . in this seventh preferred embodiment , it is preferable to utilize steel balls having a diameter of 2 . 5 to 3 mm in the ball container 38 . it will be understood that the printing press cylinder 1 of the seventh preferred embodiment must be made so that the ball container or containers 38 can be attached to the cylinder shell &# 39 ; s inner walls . the cylinder can be made in several pieces or can have an end face that allows for the insertion and attachment of the ball containers 38 . these containers must be firmly attached to the cylinder shell . they are preferably made of sheet metal and can be screwed or clamped or otherwise attached to the cylinder shell . while preferred embodiments of a printing press cylinder with oscillation damping in accordance with the present invention have been set forth fully and completely hereinabove , it will be apparent to one of skill in the art that a number of changes in , for example , the length and diameter of the cylinder , the number of channels , the type of clamps or grippers placed in the channels and the like can be made without departing from the true spirit and scope of the subject invention which is accordingly to be limited only by the following claims .

1Performing Operations; Transporting

the detailed description set forth below in connection with the appended drawings is intended as a description of the presently preferred embodiments of safety syringes provided in accordance with practice of the present invention and is not intended to represent the only forms in which the present invention may be constructed or utilized . the description sets forth the features and the steps for constructing and using the safety syringes of the present invention in connection with the illustrated embodiments . it is to be understood , however , that the same or equivalent functions and structures may be accomplished by different embodiments that are also intended to be encompassed within the spirit and scope of the invention . also , as denoted elsewhere herein , like element numbers are intended to indicate like or similar elements or features . referring now to fig1 , an exemplary syringe 10 with a retractable carriage 12 provided in accordance with aspects of the present invention is shown . in one exemplary embodiment , the syringe 10 , which may be of any standard sizes such as 5 ml or 10 ml , comprises a barrel 14 , a proximal end 16 with a grip flange 18 , and a distal end 20 with an opening 22 for receiving a standard needle hub having a needle attached thereto ( not shown ). the barrel 14 defines a wall surface which has an exterior surface 24 and an interior surface 26 , which defines an interior cavity 28 . positioned in the interior cavity 28 are the plunger 30 , which has a push flange 32 on one end and a plunger tip or seal 34 on another end , and the carriage 12 . in one exemplary embodiment , the carriage 12 comprises a male luer tip 36 , a sealing ring 38 , and a pair of proximally extending arms 40 a , 40 b . the sealing ring 38 is configured to seal against the interior surface 26 of the barrel 14 and in combination with a portion of the interior surface 26 of the barrel 14 defines a volume enclosure , which is variable depending on the position of the plunger 30 and plunger tip 34 relative to the barrel . a lumen 42 is defined through the axial center of the carriage 12 for fluid communication between the interior cavity 28 of the syringe and exteriorly of the barrel 14 variable volume enclosure . the plunger tip 34 is dynamically sealed against the interior surface 26 of the barrier by well known methods . the proximally extending arms 40 a , 40 b are cantilevered to the base of the sealing ring 38 by a pair of integrally molded bridges 42 a , 42 b ( fig2 ). the cantilevered configuration permit the arms 40 a , 40 b to flex radially inwardly in the direction of the longitudinal axis defined by the lengthwise central axis of the barrel for reasons discussed further below . just proximal of the bridges 42 a , 42 b are the raised ridges 44 a , 44 b and the male detents 46 a , 46 b , which matingly engage with the female detents 48 a , 48 b formed in the interior surface 26 of the barrel 14 when the carriage 12 is in the ready to use position . two actuated ramps 50 a , 50 b are positioned further proximal of the male detents 46 a , 46 b . in one exemplary embodiment , the actuated ramps 50 a , 50 b incorporate diagonal faces for imparting a pair of component forces to the arms 40 a , 40 b when pushed by the plunger 30 to flex the arms 40 a , 40 b radially inwardly , as further discussed below . the actuated ramps 50 a , 50 b terminate in a hook - like configuration for engaging with the shroud 62 ( fig1 ). the barrel 14 , plunger 30 , carriage 12 , and plunger tip 34 may be made from known materials currently used in the art . in one exemplary embodiment , the barrel 14 comprises two tapered sections . a first tapered section 52 is formed in the interior cavity 28 of the barrel and acts as a shoulder to stop the distal or forward advancement of the plunger tip 34 . the second tapered section 54 is formed on the exterior surface 24 of the barrel 14 for aesthetic appeal that may otherwise be eliminated . alternatively , the tapered sections 52 , 54 may be squared , or may incorporate a combination of a squared finish and a tapered finish . the barrel is preferably transparent or semi - transparent and may include indicia such as labeling , markings , or other features for references . in one exemplary embodiment , the plunger 30 incorporates a pair of elongated plates 55 a , 55 b having a plus (“+”)- shaped cross - section . one or more push plates 56 may be formed on plunger 30 for reinforcement . a distally projecting post or tip holder 58 is positioned distal of the one or more push plates 56 for positioning the plunger tip 34 thereon . a plunger disc 60 is formed on the distally projecting post 58 and is preferably spaced from the most distal push plate 56 by a gap , which should be of sufficient width for accommodating a portion of the plunger tip 34 , as further discussed below . a generally cylindrical shroud 62 is positioned distal of the plunger disc 60 having a pusher end 64 ( fig2 ) and a pair of receiving slots 66 . in one exemplary embodiment , the pusher end 64 and the plunger disc 60 each comprises a tapered surface for reasons further discussed below . the receiving slots 66 should have a dimension sufficient to receive the hook - like ends of the actuated ramps 50 a , 50 b . the shroud 62 comprises a distal end surface 67 having a pair of openings 69 for receiving the proximally extending arms 40 a , 40 b of the carriage 12 . the plunger tip 34 comprises a bore 68 for receiving the shroud 62 . in one exemplary embodiment , the bore 68 of the plunger tip comprises a first diameter section 70 , a second diameter section 72 , and a third diameter section 74 ( fig2 ). however , the internal bore 68 can have a same diameter by modifying the dimensions of the post 58 , shroud 62 , and / or carriage 12 . an inwardly extending ring 76 is formed on the proximal end of the plunger tip 34 and sized to form a size - on - size friction fit with the distally projecting post 58 of the plunger 30 . a second inwardly extending ring 78 spaced from the first inwardly extending ring 76 is positioned at the transition between the second diameter section 72 and the third diameter section 74 of the plunger tip . the space or gap 80 between the first 76 and second 78 inwardly extending rings functions as an activation gap and is configured to receive the plunger disc 60 when the plunger 30 is advanced distally to activate or retract the carriage 12 , as further discussed below . in an alternative plunger tip 34 ′ embodiment ( fig2 b ), the second inwardly extending ring 78 may be omitted and the proximal end 61 of shroud 62 ′ extended or moved further proximal to be adjacent the distal side of extending ring 76 ′. this eliminates the need for a gap 80 and simplifies the form of plunger tip 34 ′. the alternative plunger tip 34 ′ otherwise functions the same as the plunger tip 34 of fig1 and 2 . to use the syringe 10 , a commercially available needle attached to a needle hub ( not shown ) is first mounted onto the luer tip 36 . because the syringe 10 has a luer tip 36 and not a permanently attached needle on the carriage 12 , different needle sizes may be mounted onto the luer tip for aspirating , withdrawing a sample , or performing an injection . preferably , if the syringe is used to withdraw a sample , the needle with the needle hub should include a tip protector or clip for covering the needle tip . with the barrel 14 filled with a medicinal fluid , which can be any number of fluids , to a desired volume and the needle injected into a subject , the plunger 30 is advanced distally with a distally directed force f d in the direction of the needle to discharge the fluid . the injection is completed when the plunger tip 34 contacts the shoulder or first tapered section 52 of the barrel 14 . at this point , preferably the needle is withdrawn from the subject by pulling on the plunger 30 via the push flange 32 while pushing the barrel 14 distally against the patient &# 39 ; s skin . the needle and carriage 12 retraction into the barrel are simultaneously accomplished as described in detail below . alternatively , the needle can be withdrawn from the patient prior to retracting the needle into the barrel 14 . to retract the carriage 12 with the needle still mounted thereto , the plunger 30 is further advanced distally with an activated force f a sufficient to bend the proximally extending arms 40 a , 40 b inwardly at the bridges 42 a , 42 b , which act as fulcrum points . in one exemplary embodiment , the activated force f a is greater than the distally advancing force f d so that a user in using the syringe 10 can feel a clear delineation between injecting a fluid and withdrawing the carriage 12 . the bending of the arms 40 a , 40 b occur when the pusher end 64 of the shroud 62 , which preferably comprises a tapered face , contacts the actuated ramps 50 a , 50 b of the arms 40 a , 40 b and impart a pair of component forces . the arms 40 a , 40 b bend radially inwardly and the male detents 46 a , 46 b separate from the female detents 48 a , 48 b as the plunger 30 advances distally under an actuated force f a . the arms continue to bend as until the hook - like ends of the actuated ramps 50 a , 50 b latch with the receiving slots 66 a , 66 b located in of the shroud 62 . when the activated force f a is no longer applied , the arms 40 a , 40 b , due to their resiliency , snap radially outwardly a small radial distance to securely engage with the slots 66 a , 66 b ( fig2 ). during the activation step , the plunger disc 60 pushes against the inwardly extending ring 76 of the plunger tip 34 until the ring 76 , due to its resiliency , pops over the disc 60 so that the disc can then move into the activated space 80 . as readily apparent , subsequent to the plunger tip 34 abutting the shoulder 52 of the barrel and stop moving , the plunger 30 may still move distally relative to the plunger tip to disengage the carriage 12 from the barrel 14 . unrestrained , the carriage 12 and needle ( not shown ) can then be retracted into the interior cavity 28 of the barrel 14 by grasping and pulling on the push flange 32 proximally to retract the needle into the barrel 14 . to prevent retracting the carriage 12 too far into the barrel 14 and possibly dislodge the carriage 12 from the barrel 14 and to also prevent the needle from protruding back out the distal end 20 of the barrel , in one exemplary embodiment , a stop ring 82 ( fig2 ), which may comprise an annular projection on the interior surface 26 of the barrel near the grip flange 18 , may be incorporated to hold the plunger 30 in the completely retracted position . the plunger 30 may include a notch 84 along each edge of the elongated plates 55 a , 55 b to provide a breaking point for breaking off the plunger and avoiding accidentally pushing the needle distally into an unprotected position . once the carriage 12 is retracted into the barrel and the plunger 30 broken off , the syringe may be safely disposed of per standard protocols . for aligning the hooks on the actuated ramps 50 a , 50 b of the carriage 12 with the receiving slots 66 a , 66 b located on the shroud 62 of the plunger 30 , alignment plates 86 a , 86 b may be incorporated at the proximal end 16 of the barrel 14 . the alignment plates 86 a , 86 b may be integrally molded with the push flange 18 via living hinges 88 and then glued , welded , or engaged to the push flange 18 by detents . alternatively , the alignment plates 86 a , 86 b may be separately attached to the push flange 18 via adhesive , welding , or detents without the living hinges 88 . referring to fig2 a , which is an exemplary plan view of the alignment plates 86 a , 86 b , each alignment plate 86 a or 86 b comprises a gripping portion 90 and a semi - circular portion 92 comprising a slot 94 and a part of a slot 96 . the two alignment plates 86 a , 86 b come together at a parting line and the two part slots 96 on each alignment plate makes a whole slot . the two whole slots 94 are sized to receive one rectangular plate 55 a of the plunger 30 while the partial slots 96 together receive the other rectangular plate 55 b of the plunger 30 . cooperation between the alignment plates 86 a , 86 b and the rectangular plates 55 a , 55 b prevents the plunger 30 from angularly rotating and misaligning the hooks on the actuated ramps 50 a , 50 b with the receiving slots 66 a , 66 b located on the shroud 62 . turning now to fig3 , an alternative manual retractable syringe 98 provided in accordance with aspects of the present invention is shown . the syringe 98 has features that are similar with features described above for the syringe 10 shown with reference to fig1 - 2a with the exception of the plunger tip 100 and the manner in which the plunger tip engages and interacts with the plunger 30 . in the present syringe 98 embodiment , the shroud 62 incorporates two openings 102 a , 102 b at the distal end surface 67 for receiving the proximally extending arms 40 a , 40 b . the plunger tip 100 comprises a bore 101 having a substantially uniform inside diameter for receiving the shroud 62 . an inwardly extending ring 104 is incorporated at the proximal end of the plunger tip 100 and sized to form a size - on - size friction fit with the distally projecting post 58 of the plunger 30 . in the ready to use configuration of fig3 , the inwardly extending ring 104 abuts the plunger disc 106 located on the post 58 of the plunger 30 , which in the present embodiment does not incorporate a tapered face . a shroud 62 comprising a pair of receiving slots 66 and pusher end 64 is disposed inside the bore 101 of the plunger tip 100 for engaging with the hooks on the carriage 12 and retracting the same into the barrel 14 . the syringe 98 may be used and the carriage 12 may be retracted into the barrel 14 in the same manner as described above with reference to the syringe 10 of fig1 and 2 . more particularly , following an injection , the distal end of the plunger tip 100 abuts the barrel shoulder 52 and the proximally extending arms 40 a , 40 b of the carriage 12 project into the openings 69 of the distal end surface 67 of the shroud 62 . to retract the carriage 12 , an activated force f a is then applied on the plunger 30 to further advance the plunger distally relative to the distal end of the plunger tip 100 . this activated force f a causes the pusher end 64 of the shroud 62 to exert a pair of component forces to the actuated ramps 50 a , 50 b , which then bends the proximally extending arms 40 a , 40 b radially inwardly . at the same time , the plunger disc 106 pushes against the inwardly extending ring 104 and compresses the plunger tip 100 ( fig4 ). the carriage 12 may be withdrawn proximally into the barrel 14 when the male detents 46 a , 46 b disengage from the female detents 48 a , 48 b and the hooks on the end of the arms 40 a , 40 b engage the receiving slots 66 located on the shroud 62 . during the retraction procedure , the plunger tip 100 will expand in the distal direction until it touches or reaches near the proximal edge 108 of the side ridges 44 a , 44 b of the carriage 12 . fig5 shows another alternative retractable syringe 110 provided in accordance with aspects of the present invention . the syringe 110 is similar to the syringes of fig1 - 4 with the exception the carriage 112 and the manner in which it engages the barrel 114 and is retracted by the plunger 116 . in one exemplary embodiment , the carriage 112 incorporates a pair of actuated pistons 118 a , 118 b formed in two wells 120 located on the carriage . the carriage 112 further comprises a female lock 122 around a luer tip 36 , and a hub 124 proximal of the actuated pistons 118 a , 118 b . the hub 124 incorporates a flange 126 for abutting against the shoulder 128 located on the barrel 114 to axially align the carriage 112 relative to the barrel 114 during engagement of the carriage 112 to the barrel 114 . the hub 124 includes a proximal surface 127 having a configuration to accommodate the contour of the distal end surface 130 of the plunger tip 132 . the carriage 112 comprises a bore 133 which defines a lumen 134 for fluid communication between the variable interior cavity 28 of the barrel 114 and the needle ( not shown ) which may be mounted to the syringe by the way of mounting a needle hub to the luer tip 36 . in one exemplary embodiment , the bore 133 incorporates two inward projections for interacting with the plunger 116 . the first projection 136 is located near the opening of the luer tip 36 and has a tapered or sloped surface on a proximal side . on the edge opposite the sloped surface , the first projection 136 preferably comprises a square finish , for reasons further discussed below . the second projection 138 is formed subjacent the two actuated pistons 118 a , 118 b . to fixedly secure the carriage 112 to the barrel 114 , the barrel incorporates a pair of hinged hooks 140 at the distal end of the barrel . the hinge hooks 140 engage an edge of the wells 120 located on the carriage 112 to lock the carriage to the barrel . the hinge hooks 140 can be integrally molded on the carriage 112 . in one exemplary embodiment , the plunger tip 132 incorporates a bore for receiving the extension pin or distally projected post 142 of the plunger 116 , an internal space or cavity 145 , and a pair of extension legs 144 a , 144 b for setting a gap between certain parts of the plunger 116 and of the plunger tip 132 . a gap or a space 146 located in between the extension legs 144 a , 144 b are configured to receive a drum 148 located at the base of the extension pin 142 . the gap or space 146 should have sufficient depth to receive the drum 148 and not delimit or restrict the hooks on the plunger 116 from grabbing the first projection 136 located in the luer tip 36 , as further discussed below . the plunger 116 also comprises a flange 147 set in the internal space 145 of plunger tip 132 , and in one exemplary embodiment , comprises a tapered face on its distal side to facilitate assembly over the tip holder . flange 147 secures plunger tip 132 to the plunger 116 during aspiration of a fluid . the internal space 145 should be sufficiently long to allow the flange 147 to move from a proximal end within the internal space 145 to a distal end during activation so as not to delimit or hinder the hooks 152 from grabbing first projection 136 . a hooking rod 150 comprising a pair of hooks 152 ( fig6 ) extends from the distal end of the extension pin 142 for hooking engagement with the first projection 136 located in the bore of the luer tip 36 . the hooks 152 are configured to deflect when moved distally past a reduced diameter created in the bore of the luer tip by the first projection 136 to grab the square face of the first projection 136 in a detent configuration . to retract the carriage 112 into the interior cavity 28 of the barrel 114 , the plunger 116 is first advanced distally with a distally directed force f d until the distal end surface 130 of the plunger tip 132 contacts the proximate surface 127 of the hub 124 of the carriage 112 . in this position , the distal end of the extension pin 142 should reside just proximal of the second projection 138 located subjacent the actuated pistons 118 a , 118 b ( fig5 ). as a distally actuated force f a force is then applied to the plunger 116 , the force causes the extension legs 144 a , 144 b to bend outwardly , which then moves the extension pin 142 past the second projection 138 to push the actuated pistons 118 a , 118 b radially outwardly . concurrently therewith , the actuated pistons 118 a , 118 b push the hinged hooks 140 on the barrel to unlock the hinged hooks 140 from the wells 120 . also at the same time , the hooks 152 on the hooking rod 150 moves distal of the first projection 136 to then grab the projection . when the plunger is moved in the opposite proximal direction , the interaction between the hooks 152 and the first projection retracts the carriage 112 into the barrel 114 . although alignment plates 86 a , 86 b are not required to align parts of the plunger 116 to parts of the carriage 112 , the plates 86 a , 86 b may be included to prevent retracting the plunger 116 completely outside of the barrel 114 . alternatively or in addition thereto , a stop ring 82 may be incorporated near the proximal end of the barrel to engage with the proximal most push plate 56 on the plunger 116 to prevent proximal movement of the plunger . the plunger can then be broken off at the notches 84 , as previously described . in another alternative embodiment ( not shown ), the hooking rod 150 and hooks 152 are eliminated from the end of the extension pin 142 of the syringe of fig5 . a second set of actuated pins proximal of the existing actuated pins 118 a , 118 b on the carriage 112 are added , which are to be actuated and engaged by a pair of projections or ramps located on the extension pin 142 . in this alternative embodiment , the extension pin 142 would actuate the first set of actuated pins 118 a , 118 b to disengage the carriage 112 from the barrel 114 and the two projections or ramps on the extension pin 142 would latch or engage with the second set of actuated pins to grab the carriage 112 . once the plunger is retracted , the cooperation between the ramps and the second set of activated pins retract the carriage proximally into the barrel . in this embodiment , the diameter of the extension pin proximal of the two projections or ramps ( i . e ., the base of the extension pin ) should have the same diameter as the largest cross - sectional dimension of the projections or ramps measured at their widest peaks . fig7 is another alternative retractable syringe 154 provided in accordance with aspects of the present invention . the syringe 154 is substantially similar to the syringe 110 described above with reference to fig5 and 6 with the exception of the plunger tip 156 and extension pin 158 of the plunger 160 , which are different . in the present embodiment , the extension legs 144 a , 144 b of the plunger tip are eliminated and a bore 162 incorporated with an annular ring 164 . a proximal end annular ring 166 spaced apart from the interior annular ring 164 is also incorporated . the two rings define an activation space or gap 168 for accommodating a part of the extension pin 158 , as further discussed below . a pair of plunger discs 172 , 174 are incorporated with the base 170 of the extension pin 158 for cooperating with the plunger tip 156 . the distal most plunger disc 174 preferably comprises a tapered surface for facilitating advancing the disc past the interior annular ring 164 . in one exemplary embodiment , the proximal most plunger disc 172 incorporates a square finish for pushing the proximal annular ring 166 of the plunger tip 156 distally when a distally directed force f d is applied . however , a slight taper , of less angular offset than the distal most disc 174 , may be incorporated by the proximal most disc 172 to facilitate moving the disc 172 past the end annular ring 166 when an activated force f a is applied ( fig8 ). to retract the carriage 112 into the interior cavity 28 of the barrel 114 , the plunger 160 is first advanced distally with a distally directed force f d until the distal end surface 130 of the plunger tip 156 contacts the proximal surface 127 of the carriage 112 . in this position , the distal end of the extension pin 158 should reside just proximal of the second projection 138 located subjacent the actuated pistons 118 a , 118 b . as a distally actuated force f a force is then applied on the plunger 160 , the force causes the two plunger discs 172 , 174 to move past the two annular rings 166 , 164 positioned inside the bore 162 of the plunger tip 156 , which concurrently moves the extension pin 158 past the second projection 138 to push the actuated pistons 118 a , 118 b radially outwardly . also concurrently therewith , the actuated pistons 118 a , 118 b push the hinged hooks 140 on the barrel 114 to unlock the hinged hooks 140 from the wells 120 . also at the same time , the hooks 152 on the hooking rod 150 moves distal of the first projection 136 to then grab the projection . the carriage 112 can now be retracted by pulling on the plunger 160 in the proximal direction . the plunger 160 can then be broken off as previously described . fig9 shows yet another alternative manual retract syringe 176 provided in accordance with aspects of the present invention . the syringe 176 is substantially similar to the syringes 110 , 154 described above with reference to fig5 - 8 with the exception of the plunger tip 178 and extension pin 183 of the plunger 180 , which are different . more particularly , the extension pin 183 in the present embodiment extends directly from the distal most push plate 56 on the plunger 180 without a base or a drum . in addition , the plunger tip 178 has a single annular end ring 182 without internal annular rings . the extension pin 183 comprises a flange 185 located just distal of the annular end ring 182 . the flange 185 is preferably tapered on its distal side to facilitate assembly through the annular end ring 182 , but flat on its proximal side to secure the plunger tip 178 on plunger 180 during aspiration of a fluid . the bore or cavity 184 inside the plunger tip 178 should be sufficiently dimension to permit flexing of the plunger tip when compressed by the plunger 180 ( fig1 ). to retract the carriage 112 into the interior cavity 28 of the barrel 114 , the plunger 180 is first advanced distally with a distally directed force f d until the distal end surface 130 of the plunger tip 178 contacts the proximal surface 127 of the carriage 112 . in this position , the distal end of the extension pin 183 should reside just proximal of the second projection 138 located subjacent the actuated pistons 118 a , 118 b . as a distally actuated force f a force is then applied on the plunger 180 , the force causes the push plate 56 to push against the annular ring 182 of the plunger tip 178 and compresses the plunger tip ( fig1 ). at the same time , the extension pin 183 travels past the second projection 138 to push the actuated pistons 118 a , 118 b radially outwardly . also , concurrently therewith , the actuated pistons 118 a , 118 b push the hinged hooks 140 on the barrel 114 to unlock the hinged hooks 140 from the wells 120 on the carriage 112 . also at the same time , the hooks 152 on the hooking rod 150 moves distal of the first projection 136 to then grab the projection . the carriage 112 can now be retracted by pulling on the plunger in the proximal direction . the plunger can then be broken off at the notches 84 , as previously described . referring now to fig1 , an automatic needle retract syringe 186 provided in accordance with aspects of the present invention is shown . the syringe 186 comprises a syringe barrel 188 , a plunger 190 with a plunger tip 192 , and a carriage 194 that is spring loaded with a spring 196 . the barrel 188 in the present embodiment comprises a gripping section 198 having a grip flange 18 and an enlarged barrel section 200 sized to receive a part of the push flange 202 on the plunger 190 . in one exemplary embodiment , the proximal end 204 of the enlarged barrel section 200 comprises a projection or ring for engaging with the perimeter of the push flange 202 when the push flange is pushed up against the barrel 188 to retract the needle ( fig1 and 13 ), as further discussed below . alternatively , the diameter of the enlarged barrel section 200 could be sized to form an interference fit with the push flange 202 when the same is moved into the barrel to retract the needle . distally of the gripping section 198 is the variable chamber section 206 , which stores fluid to be infused or injected and varies in volume depending on the position of the plunger tip 192 relative to the barrel 188 . distal of the variable chamber section 206 is the engagement chamber 208 . the engagement chamber 208 comprises a first engagement section 210 comprising an annular interior surface 212 that cooperates with the carriage 194 to compress a holding tire 214 , which may be made from any number of elastomeric rubber or of the same elastomer as the plunger tip 192 . distal thereof is the second engagement section 211 . the compressed holding tire 214 acts as an anchor to hold the carriage 194 in place or position , which then allows the spring 196 to be compressed between the end wall 216 at the distal end 218 of the barrel 188 and the shoulder 220 located near the base 222 of the carriage 194 . as readily apparent , the holding tire 214 should have a compression force exerted on it by the carriage 194 and the barrel 188 sufficient to resists the spring force generated by the compressed spring 196 . additional hold on the holding tire 214 can come from the projection 244 located at the shoulder 241 of the barrel 188 . a passage or lumen 224 is formed at the axial center of the carriage 194 to permit fluid communication between the interior cavity of the barrel 188 and outside the barrel . in one exemplary embodiment , a needle 226 comprising a needle tip is permanently secured to the carriage 194 via gluing the same to the carriage at the glue well 228 . in one exemplary embodiment , the plunger 190 comprises a first tubular section 230 and a second tubular section 232 , which defines an exterior shoulder 234 therebetween . the plunger tip 192 is positioned on the exterior surface of the first tubular section 230 and abuts the exterior shoulder 234 . interiorly , a plug 236 , which can be made from an elastomer material , is compressed against the interior surface of the second tubular section 232 by its base section 238 , which is relatively larger than its frontal projection 240 . prior to activating the spring ( fig1 ), the distal end of the plug 236 , the cylindrical end of the first tubular section 230 , and the plunger tip 192 are substantially aligned so that they occupy substantially all of the head space of the variable chamber section 206 to substantially discharge all of the fluid within the barrel . to facilitate this goal , the shoulder 241 between the variable chamber section 206 and the engagement chamber 208 can be square to minimize head space . alternatively , the plunger 192 can be shaped to occupy substantially all of the head space . to retract the carriage 194 , the plunger 190 is first moved distally with a distally directed force f d until the distal end surface of the plunger tip 192 contacts the shoulder 241 located at the interface between the first engaging section 210 and the variable chamber 206 . at this point , the end tip or distal tip 229 of the first tubular section 230 of the plunger 190 contacts the holding tire 214 and the proximal end 231 of the carriage 194 contacts the tip of the plug 236 . when an actuated force f a is then applied on the plunger 190 , the first tubular section 230 of the plunger 190 moves over the proximal end of the carriage 194 in a telescoping fashion . at the same time , the plunger tip 212 is compressed by the exterior shoulder 234 on the plunger 190 and the shoulder 241 on the barrel 188 . further plunger 190 distal movement causes the tip 229 of the tubular portion 230 to move the holding tire 214 distally off the base section 222 of the carriage 194 and the base 238 of the plug 236 away from the interior surface of the first tubular section 230 . in one exemplary embodiment , the holding tire 214 and the base 238 of the plug are released simultaneously from their respective seats when the plunger 190 moves distally to retract the carriage 194 . in an alternative embodiment , the holding tire 214 moves off of its seat prior to the base 238 of the plug 236 moves off of its seat . still alternatively , the base 238 of the plug 236 moves off of its seat prior to the holding tire 214 moves off of its seat . once both the holding tire 214 and the plug 236 move off of their respective seats , the spring 196 is released and launches proximally in the direction of the push flange 202 . because they are either directly or indirectly in contact with the spring 196 , the carriage 194 , the needle 226 , and the plug 236 are also simultaneously launched distally by the spring . the spring action thus retracts the needle 226 into the interior cavity of the plunger 190 to thereby prevent accidental contact with the needle tip ( fig1 ). to further assist in securing the holding tire 214 against its seat , which is the mating surface area provided by the interior surface of the barrel and the base 222 of the carriage 194 , in one exemplary embodiment , a projection 244 is incorporated at the shoulder 241 inside surface of the barrel 188 . the raised area 244 aids in snapping the holding tire 214 in place against the spring force when the plunger is in a withdrawn position . in one exemplary embodiment , the plunger push flange 202 is seated inside a recessed section 242 ( fig1 and 13 ) of the enlarged barrel section 200 of the barrel 188 following the retraction of the carriage . because the push flange 202 incorporates a smooth contour , the plunger 190 is made difficult to be grasped and moved proximally . in an alternative embodiment , a detent engagement between the barrel and the push flange may be incorporated to further deter access to the used needle . an alternative automatic needle retract syringe 246 provided in accordance with aspects of the invention is shown in fig1 - 15 . the syringe 246 is substantially similar to the syringe 186 described above with reference to fig1 - 13 with the exception of the plunger tip 248 and plunger first tubular section 230 , which are different . in the present embodiment , the plunger tip 248 incorporates a pair of extension legs 250 a , 250 b and the first tubular section 230 of the plunger 190 incorporates a flange 227 . the extension legs 250 a , 250 b establish a gap or space between the exterior shoulder 234 on the plunger 190 and the plunger tip 248 when the syringe is in a ready to use position and during an injection when a distally directed force f d is applied . the flange 227 of plunger 190 first tubular section 230 is positioned at the proximal end of space 251 inside the plunger tip 248 . the flange 227 secures the plunger tip 248 onto plunger 190 during aspiration of a fluid , and in one exemplary embodiment comprises a tapered face on its distal side . however , when an actuated force f a is applied on the plunger 190 , the shoulder 234 bends the extension legs 250 a , 250 b outwardly to permit further distal movement of the plunger 190 relative to the plunger tip to retract the carriage 194 ( fig1 ). during activation , the flange 227 moves from a proximal position to a distal position within the space 251 ( fig1 ). in the ready to retract position ( fig1 ), the plunger tip 248 , plug 236 , and first tubular section 230 of the plunger 190 should occupy substantially all of the head space of the variable volume chamber to minimize fluid waste . in this configuration , the plunger tip 248 should be in contact with the shoulder 252 on the barrel 188 , the end tip 229 of the plunger 190 should be in contact with the holding tire 214 , and the proximal end 231 of the carriage 194 should be in contact with the plug 236 . thus , as the plunger 190 is then moved distally to retract the carriage 194 , the extension legs 250 a , 250 b are bent outwardly by the shoulder 234 , the holding tire 214 and the plug 236 are moved off of their respective seats , and the spring 196 is released to expand and retract the carriage 194 ( fig1 ) into the interior cavity of the barrel 188 . fig1 and 17 show yet another alternative automatic needle retract syringe 254 provided in accordance with aspects of the present invention . the syringe 254 is substantially similar to the syringes 186 , 246 described above with reference to fig1 - 15 with the exception of the plunger tip 256 , which is different . in addition , the first tubular section 230 of the plunger 190 has been slightly modified to cooperate with the plunger tip 256 , as further discussed below . the plunger tip 256 in the present embodiment comprises a distal annular ring 258 and a proximal annular ring 260 , which define a space 262 therein between . the distal and proximal annular rings 258 , 260 form a size - on - size friction fit with the exterior surface of the first tubular section 230 of the plunger . internally , a projection 264 on the first tubular portion 230 contacts the interior surface of the space 262 of the plunger tip 256 . the contact between the interior surface of the space 262 and the projection 264 provide added resistance against movement of the plunger tip 256 relative to the plunger 190 during proximal movement of the plunger , i . e ., during aspiration of a fluid . in addition , the projection 264 establishes a gap between the proximal annular ring 260 and the exterior shoulder 234 formed at the intersection of the first tubular portion 230 and the second tubular portion 232 . still further , the projection 264 facilitates aspirating fluid into the syringe by securing the plunger tip 256 from falling off of the first tubular portion 230 when the plunger moves proximal . alternatively , a second projection or flange 172 ( as shown in fig7 and 8 ) can be incorporated just proximal of the plunger tip 256 , just proximal of the annular ring 260 , to further secure the plunger tip 256 on the plunger 190 . if incorporated , the proximal annular ring 260 of the plunger tip 256 would be secured in the gap between both projections 264 and 172 . when the plunger 190 is in position to retract the carriage 194 ( fig1 ), the plunger tip 256 , plug 236 , and first tubular section 230 of the plunger 190 should occupy substantially all of the head space of the variable volume chamber to minimize fluid waste . in this configuration , the plunger tip 256 should be in contact with the shoulder 252 on the barrel 188 , the end tip 229 of the plunger 190 should be in contact with the holding tire 214 , and the proximal end 231 of the carriage 194 should be in contact with the plug 236 . thus , as the plunger 190 is then moved distally to retract the carriage 194 , the actuated force f a overcomes the friction between the plunger tip 256 and the first tubular portion 230 and allows the plunger 190 to move relative to the plunger tip 256 . concurrently therewith , the holding tire 214 and the plug 236 are moved off of their respective seats and the spring 196 is released to expand and retract the carriage 194 ( fig1 ) into the interior cavity of the barrel . in the alternative embodiment ( not shown ), the most proximal projection 172 ( as shown in fig7 and 8 ) would be forced under the proximal annular ring 260 when an actuated force f a is applied . turning now to fig1 , a syringe 266 for use with a needle hub 268 having a spring loaded retractable needle 270 provided in accordance with aspects of the present invention is shown . the barrel 272 in the present embodiment comprises an integrally molded luer tip 274 and a female lock 276 at the distal end 278 and a grip flange 280 at the proximal end 282 . a plunger 284 is positioned internally of the barrel . the plunger 284 comprises an elongated tube 286 defining a bore 288 , and four rectangular plates or fins 290 attached to the tube 286 with both the fins and tube attached to the push flange 292 , which has an opening 294 for molding the tube 286 and a frangible seal 296 for holding an end cap 297 at the distal end of the tube ( fig1 and 19 ). preferably , the bore 288 has a greater inside diameter than the end cap 297 , for reasons explained below . the opening 294 is then sealed with a plug 298 . the plunger 284 also includes a push plate 300 and a distally projecting tip holder 302 , which is located proximal of an extension pin 304 , and which makes up part of the tube 286 . the extension pin 304 is sized to fit within the luer tip 274 , which is sized to receive the needle hub 268 , as further discussed below . in one exemplary embodiment , the elongated tube 286 is cylindrical in shape . however , other elongated shaped bodies may be incorporated without deviating from the scope of the present invention . the plunger tip 308 comprises an opening 310 for accommodating the extension pin 304 , a proximal annular ring 312 forming a size - on - size friction fit with the tip holder 302 , and a pair of proximally extending extension legs 314 a , 314 b . in one exemplary embodiment , the extension legs 314 a , 314 b and the annular ring 312 contact both the push plate 300 and the tip holder plate 316 . however , a small gap between the annular ring 312 and the tip holder plate 316 is acceptable . in one exemplary embodiment , the needle hub 268 useable with the syringe 266 of the present embodiment comprises a housing 318 , which comprises a distal housing structure 320 having a needle 270 protruding therefrom , a proximal housing structure 322 having male threads 320 thereon for threaded engagement with the female lock 276 , a central activation compartment 324 disposed therebetween , and a bore 326 defined therethrough . a generally cylindrical tube 323 with optional support fins 325 are located at the distal end of the needle hub 268 . the bore 326 extends through the cylindrical tube 323 and has a size sufficient to accommodate the needle 270 and a spring 327 , as further discussed below . at the distal end of the cylindrical tube 323 is an annular cap 329 having a close tolerance fit with the outside diameter of the needle 270 . the annular cap 329 provides an anchor and supports one end of the spring 327 , as further discussed below . exteriorly , the housing 318 is tapered inwardly in the direction from the proximal housing structure 322 towards the distal housing structure 320 , although a straight cylinder or wall may be acceptable . at the central activation compartment 324 , the housing incorporates two wells 328 a , 328 b ( fig1 ), which form two thin - walled sections 330 with the bore 326 of the hub 268 . the thin - walled sections 330 each include a bulge section 332 that forms a receiving space inside the bore 326 for mating engagement with the needle sleeve 334 , as further discussed below . referring to fig1 in addition to fig1 , the thin - walled sections 330 of the wells 328 a , 328 b each includes a base section 336 , a transition section 338 , which is tapered or angled from the base section , and a gripping section 340 , where the bulge 332 is located . alternatively , a single well with a single thin - walled section may be incorporated in the needle hub . the needle sleeve 334 ( fig1 ) comprises a generally elongated tube that includes a bulge section 342 and a bore . in one exemplary embodiment , the exterior surface 344 of the sleeve 334 comprises an undulating surface for increased gripping engagement with the gripping sections 340 of the wells 328 a , 328 b . to secure the needle 270 to the sleeve 334 , the sleeve bore comprises a glue well 346 for gluing the needle to the sleeve ( fig1 ). to assemble the needle hub 268 , the spring 327 is first mounted over the combination needle 270 and needle sleeve 334 . the needle 270 and spring 327 are then inserted into the bore 326 of the needle hub 268 from the proximal end opening of the hub . the needle 270 is pushed distally through the bore 326 until the needle sleeve 334 engages the gripping section 340 of the needle hub , at the two wells 328 a , 328 b . in one exemplary embodiment , the engagement is achieved when the bulge 342 on the sleeve 334 fits into the space provided by the bulge 332 of the gripping section 240 . to retract the needle 270 , the plunger 284 is first moved distally with a distally directed force f d until the distal end surface of the plunger tip 308 contacts the shoulder or end 348 of the barrel 272 . at this point , the extension pin 304 is positioned inside the luer tip 274 with the end cap 297 on the extension pin 304 slightly spaced apart from the proximal end 350 of the needle 270 ( fig1 ). as an actuated force f a is then applied to the plunger 284 , the push plate 300 moves distally to bend the extension legs 314 a , 314 b inwardly ( or outwardly if the extensions legs 314 a , 314 b were positioned closer to the tip holder 302 ). concurrently therewith , the extension pin 304 moves forward and causes the transition section 338 of the wells 328 a , 328 b to deform outwardly to separate from the bulge 342 on the needle sleeve 334 . the forward motion also pushes the end cap 297 of the extension pin 304 against the proximal end 350 of the needle 270 . because the needle 270 is anchored by the needle sleeve 334 abutting against the hub 268 , the needle 270 pushes back against the end cap 297 with an equal but opposite force and causes the frangible seal 296 to tear or separate . the proximal end 350 of the needle 270 eventually completely tears the end cap 297 from the extension pin 304 , which then provides a passage for the spring 327 to expand . the expanding spring 327 then pushes the needle sleeve 336 proximally , which is attached to the needle 270 and pushes the needle proximally into the bore 288 located in the plunger 284 to thereby prevent accidental contact with the needle tip . once the needle is retracted , the syringe may be safely disposed of per normal protocols . as best shown in fig1 and 20 , when the actuated force f d is applied to the plunger 284 to retract the needle 270 , the plunger moves distally relative to the plunger tip 308 . as discussed above , this relative movement is provided by a gap between the tip holder plate 316 of the syringe tip holder 302 and the end surface 313 of the plunger tip 308 . said gap should be of sufficient dimension so as to not delimit the proximal end 350 of the needle 270 from puncturing the frangible seal 296 . referring now to fig2 , an alternative syringe 352 for use with a needle hub 268 having a spring loaded retractable needle 270 provided in accordance with aspects of the present invention is shown . the syringe 352 is substantially similar to the syringe 266 described above with reference to fig1 - 20 with the exception of the plunger tip 354 , which is different . in addition , the tip holder 356 of the plunger 284 has been slightly modified to cooperate with the plunger tip 354 , as further discussed below . the plunger tip 354 in the present embodiment comprises an internal bore 358 comprising an internal diameter sized to frictionally engage the exterior surface of the tip holder 356 . as before , a gap for relative movement between the plunger tip 354 and the plunger 284 are provided inside the plunger tip bore , between the distal end of the tip holder 356 and the end surface 360 of the plunger tip 354 . the proximal end of the plunger tip 354 abuts the push plate 300 on the plunger 284 . this contact enables the push plate 300 to move the plunger tip 354 distally when a distally directed force f d is applied , and to compress the plunger tip to retract the needle 270 when an actuated force f a is applied . the mechanism for retracting the needle 270 for the needle hub 268 is the same as that discussed above with reference to the needle hub of fig1 - 20 . turning now to fig2 , an alternative syringe 362 for use with a needle hub 268 having a spring loaded retractable needle 270 provided in accordance with aspects of the present invention is shown . the syringe 362 is substantially similar to the syringes 266 , 352 described above with reference to fig1 - 21 with the exception of the plunger tip 364 , which is different . in addition , the tip holder 366 of the plunger 284 has been slightly modified to cooperate with the plunger tip 364 , as further discussed below . in the present embodiment , the plunger tip 364 incorporates a groove 368 in the interior bore 358 of the plunger tip . the groove 368 is sized to receive a plunger disc 370 on the plunger 284 and allows it to move distally upon application of an actuated force f a as described below . in one exemplary embodiment , the pusher plate 300 is located apart from the proximal annular ring 372 of the plunger tip 364 when in the ready to use position . to retract the needle 270 , the plunger is first advanced from a proximal to a distal position shown in fig2 . at this position , the end surface 360 of the plunger tip 364 contacts the end shoulder 348 of the barrel 272 . when an actuated force f a is then applied to the plunger 284 , the plunger disc 370 moves distally within groove 368 of the plunger tip 364 and the plunger 284 moves distally relative to the end surface 360 of the plunger tip . the pusher plate 300 moves to meet the proximal annular ring 372 of the plunger tip 364 . concurrently therewith , the extension pin 304 contacts the needle 270 to retract the needle as discussed above with reference to fig1 - 20 . turning now to fig2 , a partial cross - sectional view of an alternative needle hub 374 provided in accordance with aspects of the present invention is shown . the needle hub 374 is substantially similar to the needle hub 268 described above with reference to fig1 - 20 with the exception of the way in which the gripping section 340 of the wells 328 a , 328 b of the needle hub grips the needle 376 . the needle hub 374 may be used with any of the syringes 266 , 352 , 362 described above with reference to fig1 , 21 , and 22 and may be actuated to retract the needle 376 the same way as described with those syringes 266 , 352 , 362 . however , instead of utilizing a needle sleeve 334 ( fig1 ), in the present embodiment , the proximal end of the needle 376 incorporates a crimp or a bulge 378 . the bulge or crimp 378 may be made by pinching the needle to create a crimp or by a controlled compression process to create a bulge . the needle hub 374 may be assembled by first positioning a spring 327 over the needle 376 , which then rests on an end against the bulge or crimp 378 . the combination needle 376 and spring 327 is then inserted into the bore 326 of the needle hub and pushed distally until the bulge or crimp 378 engages with the space provided by the bulge 332 formed in the thin - walled sections 330 of the wells 328 a , 328 b . once engaged , the crimp or bulge 378 and the annular ring or cap 329 on the tube section 323 of the needle hub ( see , e . g ., fig1 ) compresses the spring and loads the needle 376 for retraction . yet another aspect of the present invention is the utilization of protective sheaths to shield the needle tips from accidental contact therewith . one exemplary safety syringe assembly 380 comprising a syringe 382 and a protective sheath unit 384 is shown in fig2 . the protective sheath unit 384 is configured or sized to fit a standard sized syringe by incorporating provisions for receiving the standard sized syringe into the interior bore of the protective sheath unit 384 to form the syringe assembly 380 , as further discussed below . the protective sheath unit 384 comprises a sheath cover 386 telescopically positioned over an inner shell 394 ( fig2 ). in one exemplary embodiment , the sheath cover 386 comprises an engagement base 388 comprising a pair of opposed trigger levers 390 with each having a receptacle 391 . the receptacle 391 on each trigger lever 390 is removably engaged to an ear 392 located on the inner shell 394 to retain the sheath cover 386 and the inner shell 394 in removable engagement , with reverse detent configuration being acceptable . the trigger levers 390 may be formed by incorporating a pair of notches 396 a , 396 b to the engagement base 388 to create a pivot point or fulcrum 398 . each trigger lever 390 extends beyond the grip flange 400 at the proximal end 402 of the sheath cover 386 by a trigger tip 393 . the trigger tip 393 has a sufficient length to interact with an actuator 404 located on the syringe 382 to launch the sheath cover , as further discussed below . as readily apparent to a person of ordinary skill in the art , one or more than two trigger levers may be incorporated without deviating from the spirit and scope of the present invention . note that while fig2 discloses the plunger 382 being in a second position with the plunger tip . 462 in contact with the end wall of the svringe barrel . fig2 a discloses the plunger being in a first position , which is a position in which the plunger tip 462 is displaced from the end wall of the syringe barrel . the actuator 404 located on the plunger 406 just distal of the push flange 408 is configured to release the receptacles 391 from the two ears 392 on the inner shell 394 to thereby release the sheath cover 386 from the inner shell 394 . in one exemplary embodiment , the actuator 404 comprises a frustoconical front section 410 and a frustoconial base section 412 separated from one another by an intermediate section 414 . the actuator 404 is slidably mounted over the plunger 406 and frictionally engaged thereto . more specifically , in one exemplary embodiment , the actuator 404 comprises an inner shroud 416 comprising an opening sized to frictionally engage the elongated plates 55 a , 55 b of the plus (“+”)- shaped cross - section of the plunger 406 . an annular groove 418 between the inner shroud 416 and the frustoconical front section 410 allows the inner shroud 416 to flex when slid over the plunger , which may be further facilitated by optionally incorporating a plurality of slits or notches on the inner shroud 416 along the lengthwise or axial direction of the plunger to facilitate flexing . the frustoconical front section 410 of the actuator 404 is configured to push the trigger tip 393 radially outwardly away from the axis defined by the plunger 406 to disengage the receptacles 391 from the ears 392 . the actuator 404 may incorporate different configurations provided there is a tapered distal surface , such as the frustoconical front section 410 of the actuator 404 of fig2 . one such alternative is shown in fig2 , which is a split actuator design . the split actuator 434 comprises two symmetrical actuator plates 436 each comprising a tapered push surface 438 and an engagement surface 440 comprising a full slot 442 and a part slot 444 . the two part slots 444 on the two actuator plates 436 form two full slots that together with the other two full slots 442 engage the plus (“+”)- shaped cross - section of the plunger 406 . the two actuator plates 436 may be assembled over the plunger 406 by gluing or welding the two tabs 446 of each actuator plate to the corresponding two tabs of the other actuator plate . instead of or in addition thereto , detents may be used to attach the two actuator plates 436 together . still alternatively , a tapered surface for actuating the trigger levers 390 may be integrally molded to the plunger ( not shown ). a cap cover 448 may be incorporated for covering the distal end of the syringe 382 by removably engaging the cap base 450 of the cap cover to the luer lock on the syringe . the cap cover can be removed and discarded prior to mounting a needle and needle hub to the luer lock ( fig2 ), as further discussed below . in one exemplary embodiment , a distal stop lever 420 and a proximal stop lever 422 are incorporated on the sheath cover 386 . the two stop levers 420 , 422 are formed by molding a pair of u - shaped notches 424 on the sheath cover 386 to create proximally facing levers having lever tips 426 , 428 and lever bases 429 , which act as fulcrums . the two stop levers 420 , 422 are preferably formed along a common lengthwise surface of the sheath cover 396 and aligned with a rectangular slot 430 on the inner shell 394 , which is located subjacent the two levers 420 , 422 . the length of the levers 420 , 422 measured from their respective bases 429 to their respective tips 426 , 428 can differ from one another and should be of sufficient length so as to adequately permit the sheath cover 386 to project relative to the inner shell 394 to shield the needle tip , as further discussed below . although the two levers 420 , 422 are shown aligned to the rectangular slot 430 , only the distal stop lever 420 should be aligned to the rectangular slot 430 and the proximal stop lever 422 may be positioned elsewhere on the sheath cover 386 . still alternatively , the distal stop lever 420 may engage with a different structure than the rectangular slot 430 to delimit the forward distal movement of the sheath cover . still yet in another alternative embodiment , an identical distal stop lever 420 and proximal stop lever 422 are incorporated on an opposed surface of the sheath cover 430 . a cone section 432 is located distal of the two levers 420 , 422 at the distal most section of the sheath cover 386 . the cone section 432 tapers inwardly from the periphery of the tubular section 433 of the sheath cover 386 , which in one embodiment is generally cylindrical in shape . the cone section 432 includes an opening 452 dimensioned to accommodate the luer lock , as further discussed below . optionally , the cone section 432 may be eliminated and the tubular section 433 extended further distally . fig2 is a semi - schematic cross - sectional side view of the safety syringe assembly 380 of fig2 taken from the same angle . in the ready to use position shown , the sheath cover 386 is spring loaded to the inner shell 394 via a compressed spring 454 . more particularly , in one exemplary embodiment , a shoulder 456 formed intermediate of the tubular section 433 and the engagement base section 388 and the shoulder at the holding flange 458 at the proximal end of the inner shell 394 define a containment space for containing the spring 454 in a compressed position . the containment space is fixed or locked by the cooperation between the receptacles 391 on the trigger levers 390 and the ears 392 on the inner shell 394 ( fig2 ), which maintains the spring in the compressed configuration . thus , when the ears 392 are disengaged from the receptacles 391 , the spring is released and the sheath cover 386 moves distally relative to the inner shell 394 to cover the needle , as further discussed below . the inner shell 394 is sized to accommodate a standard sized syringe 382 , which can be made to accommodate any sizes . the inside diameter of the inner shell 394 should have an interference fit with the outer surface of the barrel 460 of the syringe . the standard sized syringe 382 includes standard syringe components , such as a plunger 406 , plunger tip 462 , and a barrel 460 having a luer lock 464 and a luer tip 466 . the luer tip 466 is adapted to receive a needle hub 468 comprising a needle 470 , which is removeably secured to the barrel by threading to the luer lock 464 . alternatively , the luer lock can be eliminated and the opening 452 on the sheath cover 386 made somewhat smaller . to completely discharge fluid contained in the barrel or to completely expel air from the barrel prior to aspirating fluid into the barrel without activating the trigger levers 390 to release the sheath cover 386 , the plunger tip 462 incorporates a trigger gap and the plunger 406 lengthens to accommodate the actuator 404 . the trigger gap incorporated in the plunger tip 462 is similar to the gap incorporated in the plunger tips used with the syringes described above with reference to fig1 - 22 . in particular , the plunger tip 462 comprises an inward extending ring 78 sized to engage a groove defined by the proximal plunger disc 172 and the distal plunger disc 174 . the distal plunger disc 174 is spaced apart from the proximal interior wall 472 of the plunger tip 462 by a gap . the gap , as previously discussed , allows the plunger 406 to move distally relative to the exterior end wall 474 and proximal interior wall 472 of the plunger tip 462 when an actuated force f a is applied . in the fully expelled or discharged position shown in fig2 and 25 , the ends of the two trigger tips 393 only slightly contact the frustoconical front section 410 of the actuator 404 or is spaced apart from the surface of the frustoconical front section 410 by a small gap , in the order of a few mils to about ⅛ of an inch . this arrangement enables the plunger 406 to move the plunger tip 462 distally to fully expel or discharge fluid inside the syringe barrel 460 without triggering the trigger levers 390 . accordingly , in a preferred embodiment , there is a gap between the grip flange 476 of the syringe and the distal end of the inner shroud 416 of the actuator 404 that is less than the gap between the distal plunger disc 174 and the proximal interior wall 472 of the plunger tip 462 . as readily apparent to a person of ordinary skill in the art , the gap and the angle of the frustoconical front section 410 of the actuator 404 must cooperate to move the trigger levers 390 radially outwardly a sufficient amount to clear the height of the ears 392 so that the receptacles 391 will separate from the ears . fig2 is a semi - schematic cross - sectional side view of fig2 taken along line f 27 - f 27 . the safety syringe 380 is shown in an activated state just prior to launching the sheath cover 386 distally relative to the inner shell 394 to cover the needle tip , which is shown in fig2 . the syringe 380 is activated by first moving the plunger 406 distally with a distally directed force f d . this moves the plunger 406 until the plunger tip 462 abuts the end of the barrel 460 ( fig2 ). in a clinical situation , at this point , the needle 470 can be withdrawn from a subject or the spring can first be triggered as described below . to cover the needle tip , an actuated force f a is then applied on the plunger 406 to move the plunger relative to the plunger tip 462 . this actuated force causes the inward extending ring 78 on the plunger tip 462 to disengage from the groove defined by the proximal plunger disc 172 and the distal plunger disc 174 on the plunger . concurrently therewith , the actuator 404 moves distally and the frustoconical front section 410 pushes the trigger tips 393 of the trigger levers 390 radially outwardly away from the axis defined by the needle 470 to separate the ears 392 from the receptacles 391 . the separation releases the restraint on the spring 454 , which then expands and launches the sheath cover 386 distally relative to the inner shell 394 ( fig2 ). the distally travel of the sheath cover 386 is delimited by the two distal stop levers 420 located on the sheath cover , as previously discussed . in particular , the distal stop levers 420 each incorporates an inward tab or ear 478 at the lever tip 428 to abut the distal edge 480 ( fig2 and 29 ) of the rectangular slot 430 on the inner shell 394 , which cooperate to stop the distal travel of the sheath cover 386 . to prevent retracting the sheath cover 386 proximally after shielding the needle tip , the proximal stop levers 422 on the sheath cover engage the distal end 482 of the inner shell 394 . the proximal stop levers 422 are molded with an inherent radial inward bias for flexing inwardly when traveled distal of the inner shell 394 . thus , as the lever tips 426 travel just distal of the distal edge 482 of the inner shell 394 , the proximal stop levers 422 are unbiased and move to their normal radially inwardly position to cause the lever tips 426 to abut with the distal edge 482 . this then delimits the sheath cover 386 from moving proximally to expose the needle tip . fig2 is a semi - schematic perspective view of the inner shell 394 provided in accordance with aspects of the present invention . the inner shell 394 comprises a generally tubular shell , which in one exemplary embodiment comprises a generally cylindrical shape . the inner shell 394 has a holding flange 458 at its proximal end and a distal edge 482 at its distal end . a pair of ears 392 for cooperating with the receptacles 391 on the trigger levers 390 are evenly spaced on the holding flange 458 . although the holding flange 458 is shown as a continuous ring , a non - continuous ring , such as spaced apart ribs , may also be incorporated . to facilitate mounting the sheath unit 384 over a syringe , the inner shell 394 may incorporate longitudinal slots for added flexibility . the sheath unit 384 shown in fig2 - 29 are useable with various syringes , which in the preferred embodiment include syringes with triggering mechanisms . for example , fig3 shows the sheath unit 384 of fig2 - 29 useable with an alternative syringe 484 . the alternative syringe 484 , like the syringe of fig2 - 25 , incorporates a plunger 406 and plunger tip 34 having a trigger gap 486 to enable the safety syringe to completely discharge fluid or expel air prior to aspirating fluid without activating the sheath cover 386 . subsequent to an injection , the sheath unit 384 may be activated to shield the needle tip by applying an activated force to move the plunger 406 relative to the plunger tip 34 , as previously discussed . the plunger tip 34 shown is similar to the plunger tip described above with reference to fig1 and 2 . other syringes useable with the sheath unit 384 include the syringe described with reference to fig2 and 25 having a syringe tip similar to any one of syringe tips described with reference to fig3 - 22 . although limited embodiments of the syringe assemblies and their components have been specifically described and illustrated herein , many modifications and variations will be apparent to those skilled in the art . accordingly , it is to be understood that the syringe assemblies and their components constructed according to principles of this invention may be embodied other than as specifically described herein . the invention is defined in the following claims .

0Human Necessities

referring now to the drawings , wherein like reference numerals designate identical or corresponding parts , and more particularly to fig1 thereof , there is illustrated a drawing of a pair of 3d glasses 100 with a radio frequency identification ( rfid ) tag 101 embedded according to an embodiment of the present invention . the 3d glasses may be constructed such that the rfid tag 101 is maintained in a cut - out area of a left temple 104 of the glasses . the tag may be secured to the cut - out area ( or , in other embodiments , other portions of the glasses , e . g ., nose piece / frame 105 , right temple 108 , etc ) via adhesives or other attachment mechanisms . the rfid tag may be further secured via a cover ( e . g ., cover 103 ), and may include a ridge ( or grooves ) 102 to engage either the rfid tag or matching portions of the cut - out area . in other embodiments , the rfid tag is molded directly into or on a surface of the glasses . in yet other embodiments , the rfid is attached to the exterior of the frame of the glasses . in yet further embodiments , the rfid tag constitutes a portion of the frame of the glasses ( e . g ., rather than being , for example , molded into a temple of the glasses , the rfid tag is the temple , or a portion of the temple , of the glasses . while rfid is specifically discussed , it should be understood that other electronic or wireless mechanisms may be substituted for the rfid tag ( s ) of the invention along with other related equipment ( e . g ., scanners ) associated with the electronic and / or wireless devices so chosen . it is also assumed that the reader has a basic understanding of 3d glasses , such as 3d glasses 100 , which are utilized by theaters and other venues , and that the lenses 106 ( left ) and 107 ( right ) are specific to the type of projections utilized ( e . g ., polarization based , spectral separation , etc . ), and the advantages ( environmentally and cost savings ) that occur by re - use of the glasses . right temple 108 may also have embedded an anti - shoplifting device ( e . g ., a device based on acousto - magnetic technology ). in one embodiment , the rfid tag and anti - shoplifting devices are combined and / or embedded in a same area of the glasses frame . as explained in more detail below , the invention , and particularly the 3d glasses with embedded rfid tag embodiment , will establish or enable one or more methods for data collection used in other aspects and / or embodiments of the invention . for example , the invention allows for embodiments that include metric collection such as customer usage data , glasses quality , date of manufacture , as well as ticketing and re - collection of glasses from theater patrons . the invention is advantageous in the rental model of 3d glasses in that it allows accurate measurements of usage that could enable alternate revenue generating methods including , but not limited to , exhibitor per - glasses licensing , leasing , and distribution . the rental model is explained in healy et al ., u . s . provisional patent application 61 / 316 , 277 , entitled “ method and apparatus for 3d glasses rental systems ,” the contents of which are incorporated herein in their entirety for all purposes . data gathered from embedded rfid tags ( rfid chips ) may be used to forecast replenishment stock due to deterioration of the glasses with use and washing . data gathered may also be used to highlight theaters with abnormally high failures for follow up corrective action , including increased charges . quality assurance procedures or methods may use the data to address field problems , issue corrective action and recover costs from suppliers , as appropriate . fig2 is an illustration of a tray 200 containing 3d glasses and a scanning device ( scanner ) 210 according to an embodiment of the present invention . the invention or portions thereof may be practiced on individual glasses , in a fully or partially loaded tray , boxed glasses , or glasses in bins , among other possibilities . preferably , the scanning device is an rfid scanner and operates to takes an inventory of the glasses via acquisition of the rfid tag embedded in each pair of glasses . the scanner may be handheld or mounted in an appropriate scanning location . multiple scanning devices may be mounted at various points in any process flow . for example , scanners may be mounted at a loading dock , a doorway , at the lift gate of a truck ( or loading area of any vehicle designated to transport the trays and / or glasses ), at an entrance to a washing area or washing machine , inspection area , etc . rfid tags may also be used on the trays themselves to track inventory of trays . in one embodiment , scans of glasses loaded in trays populates a database that includes a tray id ( or group of tray ids ) associated with each pair of glasses scanned . data from these scans may be utilized , for example , to identify trays that might carry a higher glasses damage rate and may help identify defective trays . in addition , such scans may also be linked to employees who process or transport the trays and thereby identify employees who may need to be counseled on tray handling or other aspects of the business . fig3 is a flowchart of a process 300 utilizing 3d glasses with embedded rfid tags according to an embodiment of the present invention . at step 310 , a tray of glasses ( e . g ., washed glasses ) are scanned . the glasses are loaded into a tray that may be similar to tray 200 , but other trays and / or packaging may be utilized . the glasses are then shipped to a venue , such as a theater ( step 320 ). a vendor that delivers the glasses to the theater or other venue may be a same vendor that services other items at the theater such as , for example , replenishment of refreshment supplies , a servicer of vending or gaming machines ( e . g ., coin - op pinball , electronic games , snacks , etc ), or other such service that has an existing infrastructure for delivery to the theaters . the vendor that performs washing and accounting of the glasses may be the same as performs the shipment or make work in conjunction with the shipping vendor . after delivery , the glasses are distributed from the racks to theater patrons who then use the glasses to view a show or presentation . after use , the glasses are collected and placed back into the trays . preferably , the glasses are collected by having the patrons put them into the trays ( or collected in a bin or other collections device and then placed in the tray by a theater employee or by an employee of the vendor / service company picking up the used glasses ). after loading the trays , the glasses are returned to a service depot ( vendor &# 39 ; s location ) for inventory and / or testing / evaluation ( e . g ., steps 330 & amp ; 340 ). inventory and notes of condition / test results are made in conjunction with a scan of the rfid tags in each pair of glasses ( scan 335 ). inventory includes determining if all of the glasses delivered to the theater were returned . notes include indications of the type of wear or damage that may have occurred to individual or specific groups of glasses . the glasses are sent for cleaning , which may be performed , for example , by any of the processes noted in the above referenced patent application and / or healy et al ., u . s . patent application 61 / 314 , 044 , entitled “ 3d glasses washing and storage rack ,” the contents of which are incorporated herein in their entirety for all purposes . if the glasses are re - usable ( e . g ., pass quality testing ( step 350 )), they are made available for re - use . as noted in the flow chart , scanning may occur on cleaned glasses in trays ( e . g ., as part of step 310 ), prior to shipment . alternatively , with appropriate data connections , scanning may occur during shipment ( e . g ., while in a delivery truck ), at the time of delivery to theaters , or at theaters . the examples provided by process 3000 being exemplary . in addition , the process may be modified in content or order of steps , but preferably scans are made at a convenient time to assure inventory control and note shrinkage and or other qa issues that occur with any particular pair of glasses or sets of glasses . fig4 is a graph illustrating a cost analysis / targets 400 for 3d glasses rental operations according to an embodiment of the present invention . for exemplary purposes , the graph shows a relatively flat vendor profitability , which provides a price where a vendor providing 3d glasses to theaters will remain profitable absent higher than projected ( i . e ., the vendor profitability point includes normal wear & amp ; tear shrinkage ). as shrinkage increases , the cost of the shrinkage is billed back to the theaters that cause the shrinkage which allows the vendor to maintain the same level of profitability . the causation of the shrinkage is determined by evaluation and inventory controls set in place using the rfid scanning . along these same lines , the process 300 may be modified to include any of the following : a vendor or partner would scan the serial number of every pair of clean 3d glasses being shipped to a theater and automatically reconcile used ( dirty ) 3d glasses being received back from the theater for washing . this would eliminate the need to manually count product exiting and entering the cleaning facility and would allow for automatic billing , especially for product shrinkage . data gathered may be utilized by the vendor to predict over / under shrinkage rates thus triggering increased or decreases in orders for new glasses . optimizing the 3d glasses supply chain . data gathered may be used for information gathering on the 3d glasses usage by theater , theater chain , region , state , city , country , geographical region , etc . this information could highlight areas where shrinkage is particularly high or low and allow the vendor to dynamically adjust prices to ensure profitability and competitive edge . it would also provide the vendor an opportunity to target installations with marketing campaigns to lower shrinkage ( utilizing an environmental story for example ) if shrinkage rates were impacting our business . data gathered may also be used to predict usage patterns for movies from particular directors , studios or distributors , and account for the effects of seasons or weather , thus assisting the operations team in planning up coming events , such as some of the recent block buster 3d titles . data gathered may also be used to support a business model where a vendor or partner provides a sliding cost scale for theaters , by automatically rewarding theaters with low shrinkage and billing those with high shrinkage — see fig4 , for example . in one embodiment higher shrinkage theaters would pay more per pair of glasses rented . in another embodiment a higher price is paid by each theater with a rebate given back to the theaters that increases with lower shrinkage . there is also an inherent incentive for each theater manager to keep shrinkage low . as theaters roll up their 3d rental finance numbers to their corporate office , theaters with high shrinkage would have higher operating costs which may trigger their corporate office to investigate , setting internal theater targets for their managers . this would benefit the vendor through lower stock replenishment rates . this would be an automated process for the vendor or partner , keeping costs down , and minimizing inventory linear equations may be utilized to determine shrinkage costs per theater . for example , the formula : where y = theater cost , and x = shrinkage rate may be used for a minimum profit margin of $ 0 . 60 . for example , a theater cost of $ 0 . 60 occurs with zero shrinkage , and a theater cost of $ 0 . 85 occurs if shrinkage is 25 %. actual numbers for minimal profit margin and cost of shrinkage may take any form and may be adjusted based on different designs and quality of the glasses , washing equipment , chemicals , etc . rather than calculating profit , the data gathered may also be use to reduce inventory levels to the minimum required for full service to theaters under contract for rental glasses . the entire process and results of the invention helps maintain a positive environmental effect over disposable glasses by lowering the number of glasses needed to a minimum , thus reducing manufacturing , transportation , lower damage means less glasses going to landfill . there are inexpensive scanners on the market today that can scan approx 800 rfid tags in about 2 - 3 seconds . this could be an in - line incoming and outgoing process . data gather could also be used to identify anomalies in product performance . for example , if the data showed an abnormally high failure rate in the field , say 3d glasses frames were braking , we could correlate 3d glasses serial numbers and potentially identify a quality or reliability issue with a batch and look to recover cost from the 3d glasses manufacturer . functionalities could be added to help improving theater management . for example , collecting data on actual occupied seats per screen at a multi - screen theater or issuing monetary credits to the 3d glasses so that it could be used by patrons to purchase concessions before , during and after each show . fig5 a - 5d are multi - view drawings of 3d glasses with rfid illustrating antenna placement installation options according to embodiments of the present invention . for example , possible antenna surfaces include either left or right temples , and lens frames . fig6 is a drawing illustrating antenna design options according to embodiments of the present invention . antenna placement could be in any of the noted locations or any combination of locations , including a same location as where the rfid chip is embedded , or the location of rfid embedding and another frame member of the glasses , or all frame members of the glasses . preferable locations include the right temple ( e . g ., see conductor 630 on right temple or frame ), lens frames ( e . g ., see conductor 630 imbedded / insert molded ( for example ) in glasses frame ), and left temple ( e . g ., see conductor 640 which could be part of left temple ). for antenna conductors that may straddle frame parts , a conductive hinge between the frame parts may also form part of the conductor ( e . g ., a hinge between a temple part of the frame and lens area of the frame may be utilized to connect conductors in the temple with conductors in the lens area of the frame ). regardless of location , the antenna / conductor interfaces or provides for the transmission of signals to / from rfid chip 610 . in one embodiment the conductor , or antenna , has greater gain than normally utilized with rfid or similar wireless devices , extending the range at which glasses may be scanned . such an improvement may be utilized to allow tracking of glasses within a theater , or other use monitoring . in one embodiment , scanners in the theater may locate general seating locations ( or exact depending on accuracy ). in the event complaints are received on viewing quality , the patrons seating location along with the glasses utilized may be logged and utilized for follow - up review related to either the glasses or other theater operations . although the present invention has been described herein with reference to 3d glasses and particularly a rental model for 3d glasses , the devices and processes of the present invention may be applied to other rentable items having similar qualities . in describing preferred embodiments of the present invention illustrated in the drawings , specific terminology is employed for the sake of clarity . however , the present invention is not intended to be limited to the specific terminology so selected , and it is to be understood that each specific element includes all technical equivalents which operate in a similar manner . for example , when describing an rfid tag , any other equivalent device , such as a wireless id transmitter , or other device having an equivalent function or capability , whether or not listed herein , may be substituted therewith . furthermore , the inventors recognize that newly developed technologies not now known may also be substituted for the described parts and still not depart from the scope of the present invention . all other described items , including , but not limited to rfids , scanners , anti - shoplifting devices , trays , delivery methods , accounting methods or practices , other rental models , etc should also be considered in light of any and all available equivalents . portions of the present invention may be conveniently implemented using a conventional general purpose or a specialized digital computer or microprocessor programmed according to the teachings of the present disclosure , as will be apparent to those skilled in the computer art . appropriate software coding can readily be prepared by skilled programmers based on the teachings of the present disclosure , as will be apparent to those skilled in the software art . the invention may also be implemented by the preparation of application specific integrated circuits or by interconnecting an appropriate network of conventional component circuits , as will be readily apparent to those skilled in the art based on the present disclosure . the present invention includes a computer program product which is a storage medium ( media ) having instructions stored thereon / in which can be used to control , or cause , a computer to perform any of the processes of the present invention . the storage medium can include , but is not limited to , any type of disk including floppy disks , mini disks ( md &# 39 ; s ), optical discs , dvd , hd - dvd , blue - ray , cd - roms , cd or dvd rw +/−, micro - drive , and magneto - optical disks , roms , rams , eproms , eeproms , drams , vrams , flash memory devices ( including flash cards , memory sticks ), magnetic or optical cards , sim cards , mems , nanosystems ( including molecular memory ics ), raid devices , remote data storage / archive / warehousing , or any type of media or device suitable for storing instructions and / or data . stored on any one of the computer readable medium ( media ), the present invention includes software for controlling both the hardware of the general purpose / specialized computer or microprocessor , and for enabling the computer or microprocessor to interact with a human user or other mechanism utilizing the results of the present invention . such software may include , but is not limited to , device drivers , operating systems , and user applications . ultimately , such computer readable media further includes software for performing the present invention , as described above . included in the programming ( software ) of the general / specialized computer or microprocessor are software modules for implementing the teachings of the present invention , including , but not limited to , capturing ids of devices for inventory , capturing and placing data related to 3d glasses , trays , and usage thereof in a database and analyzing the data to identify usage trends , shrinkage , and other data related to the efficiency or quality of the devices , particularly as it relates to 3d glasses and their quality for 3d viewing and continued re - use , and the display , storage , or communication of results according to the processes of the present invention . the present invention may suitably comprise , consist of , or consist essentially of , any of element ( the various parts or features of the invention and their equivalents as described herein ). further , the present invention illustratively disclosed herein may be practiced in the absence of any element , whether or not specifically disclosed herein . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of claims to be included in a subsequently filed utility patent application , the invention may be practiced otherwise than as specifically described herein . referring again to the drawings , and more particularly to fig7 thereof , there is illustrated a glasses storage and washing rack b 100 according to an embodiment of the present invention . the storage and washing rack b 100 includes features that enable more efficient washing , drying , storage , distribution , and collection of glasses . the storage and washing rack includes mechanisms to hold glasses in place via a tray slide - on / slide - off design . preferably , the glasses stacked and nested into each other increasing the number of glasses per tray over existing glass washing trays . the glasses are held vertically in position to maximize both washing and drying capability and are positioned so that excess water is easily wiped away ( either manually or via automated mechanisms ). an interlocking design for washing and stacking of trays is also provided . part number b 110 ( 1 ) name : handles , left ( b 110 a ) and right ( b 110 b ) ( 2 ) function : ( a ) to hand carry the rack ; ( b ) to lock the upper rack in position horizontally and vertically for stacking ( in conjunction with the two bottom parallel welded support rods — b 111 a , b 111 b ). ( 3 ) structural description : ¼ ″ diameter stainless steel rod formed into a left and right handle as part of a frame which supports two formed ¼ ″ diameter stainless steel welded support rods on the bottom parallel to the handles ( b 111 a , b 111 b ) and two formed ¼ ″ diameter stainless steel welded support rods on top perpendicular to the handles ( b 115 a , b 115 b ). ( 4 ) other devices that may be utilized : this rack is designed to work with a commercial dishwasher with an automatic detergent , rinse agent and sanitizer dispenser and an in - line water heater . part number b 112 a , b 112 b , b 113 a , b 114 b ( 1 ) name : glasses stack support rod . ( 2 ) function : ( a ) to position and support the individual stacks of glasses and welded glasses positioning structures ( b 114 , b 116 ). ( b ) to position and support three stacks of glasses welded in position as a subassembly onto the rack frame . two subassemblies are welded to the frame ( left subassembly : b 112 a , b 112 b , right subassembly b 113 a , b 113 b ) as shown parallel to the handles ( b 110 a , b 110 b ). ( 3 ) structural description : straight ¼ ″ diameter stainless steel rods 19 . 5 ″ long . part number b 114 a , b 114 b is a glasses stack temple support frame . the glasses temple support frame positions the glasses in the stack by holding a part of the frames ( e . g ., the temple area , inside frame front where temples connect to frame front , or other locations ) of the glasses in conjunction with the nose support rods ( b 116 a , b 116 b ). each glasses stack has a left ( b 114 a - 116 a ) and right ( b 114 b - 116 b ) side where glasses are interleaved as they are stacked . the glasses temple support frame may provide support for another rack stacked on top by creating a support frame perpendicular to the nose support rod of the rack stacked on top of the support frame which prevents the stacked rack from touching or damaging the stack of glasses below the support frame . the glasses temple support frame may be constructed , for example , as a frame welded from 3 / 16 ″ diameter stainless steel rod formed to provide a left and right glasses stack support structure with a left and right side . part number b 116 a , b 116 b illustrate glasses stack nose support rods . the nose support rods position the glasses in the stack by holding the nose area of the glasses in conjunction with the temple support frame ( b 114 a , b 114 b ) and support a rack when stacked on top of another rack for washing , drying , storage , etc . by providing a support rod perpendicular to the temple support frame ( b 114 a , b 114 b ) of the lower rack . each rack may have , for example , as illustrated , 12 support points ( 2 per each glasses stack temple support frame ). the nose support rods may be formed from ¼ ″ diameter stainless steel rod welded in position onto the glasses stack support rods , in , for example , 3 places per subassembly ( left b 112 a , b 112 b and right b 113 a , b 113 b ) for a total of 6 per rack . when welded into position , the glasses stack nose support rod provides approximately a ½ ″ gap between the nose support rod and the temple support frame on each side which allows loading and stacking of the glasses . the sizing of the gap may vary , for example , depending on a design of the glasses . among the other advantages and features described herein , the present invention provides for more efficient operation of theaters equipped with re - usable glasses that are washed between uses . various embodiments provide for a reduced number of trays needed per theater deployment and a lower initial investment cost for the theatres . increased storage and washing capacities ( e . g ., by increasing the number of 3d glasses that can be held per tray and thereby increases the number of glasses washed per cycle ). the invention is environmentally more friendly that current systems by using less energy , less chemicals , less water , less employee time needed for washing ( the invention is easier to load and unload compared to existing systems ). the invention reduces the amount of storage area that is needed between movies . the invention is more efficient and does a better job of washing than current systems . by maintaining the glass lenses in a vertically oriented position , less spotting occurs from washing operations . removal of excess water is facilitated not only by maintaining the glasses oriented for easy wiping , but also the glasses are held securely allowing employees to shake the trays to dislodge larger amounts of residual water and then wipe down if / as necessary . manufacturing of the invention is also environmentally friendly compared to existing systems , as the trays according to the present invention require less welding , less grinding , less materials ( e . g ., steel wire ), and that less trays are needed , less shipping and packaging to fully equip a theater ( or an outsource washing company ). fig8 a - 8c are 3 view drawings of a washing / storage rack loaded with stacked and nested 3d glasses according to an embodiment of the present invention . a top view b 210 illustrates the glasses held vertically and stacked into columns . each pair of glasses is held between a nose support and temple support member . in each column , a first stack of glasses is held by a first set of nose and temple support members and a second stack of glasses are held by a second set of nose and temple support members for each column . the first and second stacks of glasses are held facing opposite directions forming the illustrated columns . front view b 220 illustrates one side of three different columns . the lenses of each column are held vertically ( improving run - off which reduces spotting and improving access and efficiency of any wide drying that may be necessary or desirable while the glasses are in the rack ). side view b 230 illustrates nesting and interlocking that also improves the efficiency of the rack according to the present invention . the frames of the glasses are nested as the temples of one stack fit within the temples of another stack . the frames of the glasses are interlocked as the temples of one frame fit inside the temples of a second frame whose temples fit inside the first frame . such interlocking is further facilitated by interlocking at a curvature of the glass frames temples . fig9 is a drawing of a washing / storage rack according to another embodiment of the present invention . in this embodiment the nose frame members are a single wire having a bend which facilitates fitting the glasses into the gap between the nose frame member and temple frame support member . the temple support member b 314 may specified , for example , as ø4 . 76 [ 0 . 19 ] ss304 6 - pl welded 30 - pl . handle b 315 may be more sturdily constructed by , for example , as ø6 . 35 [ 0 . 25 ] ss304 15 - pl welded 29 pl . fig1 is a drawing of a pair of stacked washing / storage racks according to an embodiment of the present invention . in this manner , the racks / trays provide a highly efficient storage system whose capacity is easily varied by adding or removing racks . the efficiency of the stacked racks is also utilized in washing machine where the stacks are simply stacked as loaded into the machine or washing conveyor , or may be pre - stacked and loaded as a unit of n racks at the same time . fig1 is a drawing of a front view of the stacked washing / storage racks of fig1 according to the present invention . each washing / storage rack ( or tray ) has handles b 510 and support rails b 511 . as shown , the handles b 510 of the bottom tray interlock with support rails b 511 of the upper tray . interlocking of the racks provides support and security when the trays are stacked in storage , when washing , during shipment or other transport , and / or when distributing / collecting glasses . other configuration including special additional parts may be utilized to facilitate interlocking of the trays , but preferably the interlocking is accomplished through the orientation of existing frame members , as shown here in exemplary form , to reduce parts and complexity . fig1 provides a side view of the stacked washing / storage racks of fig1 according to the present invention . fig1 is an exemplary process for distributing , collecting , washing , and storing 3d glasses in a theater operation according to an embodiment of the present invention . the process can be a continuous loop . at step b 710 distribute glasses from washing / storage rack ( s ), glasses in a washing / storage rack are distributed to patrons / customers of , for example , a 3d theater . the glasses in the rack may be positioned , for example , behind a sales counter of the theater or at a distribution / collection point in / near the theater . at step b 720 , the theater patron utilizes the glasses to watch a feature film or other presentation . other than theaters and feature films , the system may also be implemented for teleconferencing , viewing remote unmanned activities ( planet or space exploration , uavs , etc ), or other activities , sporting events in large stadiums with screens capable of displaying 3d ( e . g . nfl &# 39 ; s new dallas cowboys stadium ) or nba &# 39 ; s newer arenas , airliners equipped with appropriate displays , or other activities . at step b 730 , the theater patrons ( or other user ) return the glasses to a collection point where they are loaded into a washing / storage rack . the glasses remain in the washing storage rack through transport , washing , drying , and / or storage until re - utilized as needed ( e . g ., steps b 740 - b 770 , leading back to distribution , step b 710 ). the washing , drying , and / or storage necessary may be implemented entirely within the theater or other activity operations . alternatively , washing of the glasses may be performed by an outside contractor that either picks up glasses or receives them via shipment ( e . g ., fed - ex / ups , etc .). the glasses remain in the storage / washing rack throughout shipment , washing , and re - delivery ( as needed ) to the theater or other activities operation . storing the glasses may be transitory storage such as , for example , storage between shows or waiting for washing , and / or longer term storage at a theater or in a warehouse ( e . g ., washing contractors warehouse , wholesale distribution warehouse , vendor &# 39 ; s showroom or stockroom , etc .). in yet another embodiment , the glasses are provided to the theater / venue on a rental model where , for example , the glasses are not owned by the venue , but are rented as needed . the rental model could , for example , follow a similar process flow as illustrated by fig1 but the theater / venue would pay per use / wash of the glasses . in such a model , the theater would not have the expense of purchasing the glasses . in the various rental , contractor , and / or theater operations models , the glasses remain in the storage / washing rack throughout shipment , washing , and re - delivery ( as needed ) to the theater or other activities operation . storing the glasses may be transitory storage such as , for example , storage between shows or waiting for washing , and / or longer term storage at a theater or in a warehouse ( e . g ., washing contractors warehouse , wholesale distribution warehouse , vendor &# 39 ; s showroom or stockroom , etc .). fig1 a - 14d are drawing views of yet another washing / storage rack ( tray ) design according to an embodiment of the present invention . fig1 a - 15d are drawing views of a rack b 900 according to another embodiment of the present invention , including the perspective view , a side view b 910 , a front view b 920 , and a top view b 930 . the support members for holding glasses are arranged so that the glasses are stacked vertically in a folded position . the support members are arranged such that the stacks of glasses are close together . as shown , a nose support rod and a temple support frame are utilized for each stack . this embodiment has advantages in packing and distribution in that the frame arms are not interlocked which allows for more efficient packing and potentially distribution . in one embodiment , the rental model is implemented by an existing theater service organization ( e . g ., popcorn , candy , film distribution entities ) that currently have storage and transportation networks to theaters and would be ideally positioned to pick up and carry a glasses rental model or business plan . this embodiment is also better suited for contractor and rental models according to the present invention . fig1 a - 16c are drawing views of the rack according to fig1 a - 15d stacked with another rack according to the present invention . as shown in a perspective view b 1000 , side view b 1010 and front view b 1020 , a top portion of a first frame of a rack fits or interlocks with a bottom portion of another similar rack . fig1 a - 17d are drawing views of the rack according to fig1 a - 15d loaded with glasses as would be utilized in a 3d rental model or other embodiments of the present invention . a perspective view b 1100 , side view b 1110 , top view b 1115 , and a front view b 1120 illustrate the placement of stacked folded glasses ( e . g ., stacked folded glasses column b 1105 ). the lenses of the folded glasses are vertically oriented . the washing storage racks provided as described herein and their equivalents have many advantages . among others , the rack design allows the glasses frames to overlap for space efficient packing which allows high density and efficient washing , drying and storage . the rack design may also be more packing and distribution friendly , for example , by stacking the glasses in a folded position . the rack is stackable for efficient washing , drying and storage . the rack design allows nearly vertical orientation of the lenses for efficient washing and drying which also helps to prevent spotting while drying . the rack design allows for shaking water off after washing which improves drying time and further reduces spotting during drying . the rack design allows space between both sides of lenses for air flow to improve drying time with natural ventilation , forced air or cloth dry . the rack and stacked racks are ergonomically designed for loading and handling a maximum number of glasses while maintaining a safe load ( in some embodiments , 2 stacked racks are less than 40 lbs which is the maximum load for a commercial dishwasher ). the rack design provides a minimal osha horizontal measurement , and asymmetric angle when calculating the osha recommended weight limit ( rwl ) for loading a commercial dishwasher . the rack and stacked rack design also help reduce the osha lifting frequency factor by allowing a maximum number of glasses to be washed per cycle , thereby reducing the frequency of lifts per minute required between 3d movie presentations . weight of the racks may be reduced by reducing the gauge of the materials from which the racks are constructed . however , for strength , the outer frame should preferably maintained at a gauge sufficient to handle both picking up two fully loaded racks and sufficient to protect the glasses loaded into the frames during shipment ( e . g ., cargo shifts and / or dropping during shipment ) or when stacked for storage ( e . g ., ¼ ″ stainless steel wire ). the internal and / or cross - members of the racks make better candidates for smaller gauge weight saving design modifications ( e . g ., 3 / 16 ″ stainless steel wire ). such weight savings are realized , for example , in fig1 and 15 which illustrate selected components produced from materials of a reduced gauge . the same may be provided in other embodiments described herein and their equivalents . accordingly , the invention may be embodied in any of the forms described herein , including , but not limited to the following b series enumerated example embodiments ( beees ) which describe structure , features , and functionality of some portions of the present invention : beee0 . a 3d glasses rental model incorporating a glasses washing rack utilized in a theater operation having at least one set of glasses worn by the public on different occasions wherein the glasses washing rack is configured to maintain glasses in a stacked formation in the glasses washing rack while installed and being washed in a washing machine . beee1 . a glasses washing rack utilized in a theater operation having at least one set of glasses worn by the public on different occasions wherein the glasses washing rack is configured to maintain glasses in a stacked formation in the glasses washing rack while installed and being washed in a washing machine . beee2 . the glasses washing rack according to beee1 , wherein the glasses are 3d viewing glasses utilized by a digital cinema theater . beee3 . the glasses washing rack according to beee1 , wherein the glasses washing rack is utilized in a process at a cinema theater where glasses are distributed from the rack and collected and stored in the rack where they remain through transport , washing , and storage until needed for re - distribution . beee4 . the glasses washing rack according to beee3 , wherein washing in the process is performed by a contractor that services the cinema theater . a first set of support members attached to the frame and configured hold a plurality of glasses on top of each other in a stack . beee6 . the method according to beee5 , wherein the rack is designed to allow frames of the glasses to overlap for efficient packing and high density washing , drying , and storage , provide a nearly vertical orientation of the lenses for efficient washing , drying , and spot prevention , secure the glasses so as to allow for shaking water off after washing , provide space between both sides of lenses for air flow to improve drying time with natural ventilation , forced air , and / or cloth dry , provide ergonomically oriented features for loading and handling a maximum number of glasses while maintaining a safe osha approved load and rack dimensions . beee7 . the glasses washing and storage tray according to beee5 , wherein the first set of support members comprises a first support member positioned to be on an outside of a pair of glasses when installed in the washing and storage tray , and a second support member positioned to be on an inside of the pair of glasses when installed in the washing and storage tray . beee8 . the glasses washing and storage tray according to beee7 , wherein the first support member comprises at least one vertical bar configured to contact an outside portion of a frame of a pair of glasses when installed in the washing and storage tray . beee9 . the glasses according to beee8 , wherein the second support member comprises at least one vertical bar configured to contact an inside portion of a frame of the pair of glasses when installed in the washing and storage tray . beee10 . the glasses washing and storage tray according to beee9 , wherein the outside portion of the frame comprises a nose piece or bridge of the glasses , and the inside portion of the frame comprises at least one of a temple and front frame portion of the glasses . beee11 . the glasses according to beee9 , wherein the second support member comprises a left vertical post configured to contact a left side of the glasses when installed and a right vertical post configured to contact a right side of the glasses when installed . beee12 . the glasses according to beee9 , wherein the first support member and the second support member form a gap configured to secure glasses when installed in the tray . beee13 . the glasses according to beee12 , wherein glasses , when installed in the tray , are stacked on top of each other and secured between the same first and second support members . beee14 . the glasses according to beee13 , further comprising a second set of first and second support members positioned in the tray such that when additional glasses are installed in the tray , the installed glasses on the first set of support members and the second set of support members are nested and form a hollow column . beee15 . the glasses washing and storage tray according to beee14 , wherein temple portions of the installed glasses are interlocked . beee16 . a method of 3d glasses management , comprising the steps of : installing a set of 3d glasses in a rack wherein the glasses are stacked on top of each other with lenses of the glasses held vertically in a plurality of stacks ; transporting and storing the set of 3d glasses while installed in the rack ; and beee17 . the method according to beee16 , wherein the plurality of stacks are arranged in pairs of stacks with glasses in a first stack of the paired stacks facing a first direction and nested with a second stack of the paired stacks facing a second direction and pairs of glasses in the first stack are interlocked with pairs of glasses in the second stack . beee18 . the method according to beee16 , wherein the step of washing is performed by a contractor offsite of a venue that utilizes the glasses . beee19 . the method according to beee16 , wherein the glasses are intended to remain in the rack at all times except when distributed to a user . a retrieval component comprising a methodology for retrieving glasses from a 3d venue ; a washing component comprising a large scale washing device for loading glasses and washing and sterilizing the glasses ; and beee21 . the business architecture according to beee20 , wherein the retrieval , washing , and delivery components are all performed while the glasses are loaded into a washing / storage rack . beee22 . the business architecture according to beee18 , wherein the washing / storage rack comprises frame members positioned to secure the glasses in a plurality of nested interlocked stacks . beee23 . the business architecture according to beee18 , wherein the washing / storage rack comprises frame members positioned to secure the glasses in a plurality of non - nested , non - interlocked stacks each pair of glasses folded with lenses held in vertical orientation . beee23 . the business architecture according to beee18 , wherein the washing / storage rack comprises frame members positioned to secure the glasses in a plurality of non - nested , non - interlocked stacks each pair of glasses folded with lenses held in vertical orientation , wherein internal components of the rack are constructed of smaller gauge material compared to main frame members of the rack . in various embodiments , the washing rack configurations described herein may be utilized , amongst other possibilities , in theater / 3d venue operations , by a contractor servicing a theater / 3d venue , and / or in a rental model where a theater / 3d venue rents glasses ( e . g ., on a per use basis ). thus , the present invention provides a method , device , business architectures and more for stacking , securing , storing , and glasses , and particularly 3d glasses . the invention saves cost and is greener than current washing racks in that the efficiency of washing , amount of glasses washed per load etc . are increased reducing energy costs , the new racks are easier to load increasing employee efficiency , and the racks are less costly to manufacture . accordingly , the invention has excellent utilitarian value for 3d cinema operators who seek to increase efficiency and reduce costs . the rack provides space for mounting glasses nested in opposite directions and stacked in a rack that is secure , and the racks themselves are stackable . in describing preferred and exemplary embodiments of the present invention as may also be illustrated in the drawings , specific terminology is employed for the sake of clarity . however , the present invention is not intended to be limited to the specific terminology so selected , and it is to be understood that each specific element includes all technical equivalents which operate in a similar manner . for example , when describing a frame member , any other equivalent device , such as an arm , extension , brace , bar , or other device having an equivalent function or capability , whether or not listed herein , may be substituted therewith . furthermore , the inventors recognize that newly developed technologies not now known may also be substituted for the described parts and still not depart from the scope of the present invention . all other described items , including , but not limited to trays , interlocking mechanisms , nesting , tray stacking , process operations including any of distribution , collection , washing , transport and / or storage of glasses and racks , etc should also be considered in light of any and all available equivalents . the present invention may suitably comprise , consist of , or consist essentially of , any of element ( the various parts or features of the invention , and their equivalents as described herein . further , the present invention illustratively disclosed herein may be practiced in the absence of any element , whether or not specifically disclosed herein . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . and again , it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein . the present invention includes a business model or architecture that includes a retrieval component for retrieving glasses from a 3d venue , a washing component comprising a large scale washing device for loading glasses and washing and sterilizing the glasses , and a delivery component comprising a delivery of washed glasses to a 3d venue . the business model may be based on a rental arrangement wherein the glasses are owned by a rental company and rented to the 3d venue . the retrieving , washing , and delivery components may be , for example , handled entirely by the rental or leasing company which then bills the venue based on how many pairs of glasses are utilized . as noted above , a dust cover may be utilized to help prevent dust from collecting on lenses of the glasses while stored ( or during transport ) in the racks . the rack is also useful as part of a shipping system with boxes and / or containers , where the racks securely hold glasses and are stacked inside a shipping box and / or loaded into a container . such shipping may be , for example , the shipment of new glasses from manufacturing to a distributor or venue , and / or shipment between remote washing facilities and a venue . in one embodiment , the glasses are shipped in stacked racks that may be individually dust covered ( or covered as a group ) and loaded into re - useable shipping boxes . the shipping boxes may then be loaded into a container , trucks or other transport mechanisms . preferably , the shipping boxes contain support mechanisms positioned to directly abut and support the larger ( and stronger ) frame members of the racks . accordingly , the invention may be embodied in any of the forms described herein , including , but not limited to the following c series enumerated example embodiments ( ceees ) which describe structure , features , and functionality of some portions of the present invention : ceee1 . a glasses washing rack utilized in a theater operation having at least one set of glasses worn by the public on different occasions wherein the glasses washing rack is configured to maintain glasses in a stacked formation in the glasses washing rack while installed and being washed in a washing machine . ceee2 . the glasses washing rack according to ceee1 , wherein the glasses are 3d viewing glasses utilized by a digital cinema theater . ceee3 . the glasses washing rack according to ceee1 , wherein the glasses washing rack is utilized in a process at a cinema theater where glasses are distributed from the rack and collected and stored in the rack where they remain through transport , washing , and storage until needed for re - distribution . ceee4 . the glasses washing rack according to ceee3 , wherein washing in the process is performed by a contractor that services the cinema theater . a frame ; and a first set of support members attached to the frame and configured hold a plurality of glasses on top of each other in a stack . ceee6 . the method according to ceee5 , wherein the rack is designed to allow frames of the glasses to overlap for efficient packing and high density washing , drying , and storage , provide a nearly vertical orientation of the lenses for efficient washing , drying , and spot prevention , secure the glasses so as to allow for shaking water off after washing , provide space between both sides of lenses for air flow to improve drying time with natural ventilation , forced air , and / or cloth dry , provide ergonomically oriented features for loading and handling a maximum number of glasses while maintaining a safe osha approved load and rack dimensions . ceee7 . the glasses washing and storage tray according to ceee5 , wherein the first set of support members comprises a first support member positioned to be on an outside of a pair of glasses when installed in the washing and storage tray , and a second support member positioned to be on an inside of the pair of glasses when installed in the washing and storage tray . ceee8 . the glasses washing and storage tray according to ceee7 , wherein the first support member comprises at least one vertical bar configured to contact an outside portion of a frame of a pair of glasses when installed in the washing and storage tray . ceee9 . the glasses according to ceee8 , wherein the second support member comprises at least one vertical bar configured to contact an inside portion of a frame of the pair of glasses when installed in the washing and storage tray . ceee10 . the glasses washing and storage tray according to ceee9 , wherein the outside portion of the frame comprises a nose piece or bridge of the glasses , and the inside portion of the frame comprises at least one of a temple and front frame portion of the glasses . ceee11 . the glasses according to ceee9 , wherein the second support member comprises a left vertical post configured to contact a left side of the glasses when installed and a right vertical post configured to contact a right side of the glasses when installed . ceee12 . the glasses according to ceee9 , wherein the first support member and the second support member form a gap configured to secure glasses when installed in the tray . ceee13 . the glasses according to ceee12 , wherein glasses , when installed in the tray , are stacked on top of each other and secured between the same first and second support members . ceee14 . the glasses according to ceee13 , further comprising a second set of first and second support members positioned in the tray such that when additional glasses are installed in the tray , the installed glasses on the first set of support members and the second set of support members are nested and form a hollow column . ceee15 . the glasses washing and storage tray according to ceee14 , wherein temple portions of the installed glasses are interlocked . ceee16 . a method of 3d glasses management , comprising the steps of : installing a set of 3d glasses in a rack wherein the glasses are stacked on top of each other with lenses of the glasses held vertically in a plurality of stacks ; transporting and storing the set of 3d glasses while installed in the rack ; and ceee17 . the method according to ceee16 , wherein the plurality of stacks are arranged in pairs of stacks with glasses in a first stack of the paired stacks facing a first direction and nested with a second stack of the paired stacks facing a second direction and pairs of glasses in the first stack are interlocked with pairs of glasses in the second stack . ceee18 . the method according to ceee16 , wherein the step of washing is performed by a contractor offsite of a venue that utilizes the glasses . ceee19 . the method according to ceee16 , wherein the glasses are intended to remain in the rack at all times except when distributed to a user . a retrieval component comprising a methodology for retrieving glasses from a 3d venue ; a washing component comprising a large scale washing device for loading glasses and washing and sterilizing the glasses ; and ceee21 . the business architecture according to ceee20 , wherein the retrieval , washing , and delivery components are all performed while the glasses are loaded into a washing / storage rack . ceee22 . the business architecture according to ceee18 , wherein the washing / storage rack comprises frame members positioned to secure the glasses in a plurality of nested interlocked stacks . thus , the present invention provides a method , device , business architectures and more for stacking , securing , storing , and glasses , and particularly 3d glasses . the invention saves cost and is greener than current washing racks in that the efficiency of washing , amount of glasses washed per load etc . are increased reducing energy costs , the new racks are easier to load increasing employee efficiency , and the racks are less costly to manufacture . accordingly , the invention has excellent utilitarian value for 3d cinema operators who seek to increase efficiency and reduce costs . the rack provides space for mounting glasses nested in opposite directions and stacked in a rack that is secure , and the racks themselves are stackable . in describing preferred and exemplary embodiments of the present invention as may also be illustrated in the drawings , specific terminology is employed for the sake of clarity . however , the present invention is not intended to be limited to the specific terminology so selected , and it is to be understood that each specific element includes all technical equivalents which operate in a similar manner . for example , when describing a frame member , any other equivalent device , such as an arm , extension , brace , bar , or other device having an equivalent function or capability , whether or not listed herein , may be substituted therewith . furthermore , the inventors recognize that newly developed technologies not now known may also be substituted for the described parts and still not depart from the scope of the present invention . all other described items , including , but not limited to trays , interlocking mechanisms , nesting , tray stacking , process operations including any of distribution , collection , washing , transport and / or storage of glasses and racks , etc should also be considered in light of any and all available equivalents . the present invention may suitably comprise , consist of , or consist essentially of , any element ( the various parts or features of the invention , and their equivalents as described herein ). further , the present invention illustratively disclosed herein may be practiced in the absence of any element , whether or not specifically disclosed herein . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein .

6Physics

fig4 shows a manchester decoding apparatus according to the present invention , which includes a first decoding unit 100 for sampling a synchronous manchester code by synchronizing a transmitted nonsynchrounous manchester code to a shift of a clock signal clock -- r and for dividing the clock signal clock -- r and for computing the synchronous signal and for exclusively oring the synchronous manchester code and the synchronous signal and for outputting an nrz code , a checking unit 200 for receiving a synchronous code from the first decoding unit 100 and for sequentially detecting a bit value shifted in accordance with a clock signal and for checking a tolerance with respect to the shift at a bit cell central portion , a multiplexer 300 for selectively selecting an nrz code and a synchronous signal outputted from the first decoding unit in accordance with a detection signal outputted from the tolerance checking unit 200 , a synchronous signal detecting unit 400 for receiving the nrz code and the synchronous signal from the multiplexer 300 and for detecting a bit value of an nrz code which is shifted in accordance with a synchronous signal sync , and a second decoding unit 500 for receiving an nrz code and a synchronous signal sync from the multiplexer 300 and for outputting an nrz data and a receiving clock signal rx -- clk in accordance with a synchronous signal sync outputted from the synchronous signal detecting unit 400 . the first decoding unit 100 includes a first flipflop 11 for receiving the nonsynchronous manchester code manchester -- code and the clock signal clock -- r and for sampling the synchronous manchester code at an increasing edge of the clock signal clock -- r and for noninverting the synchronous manchester code ; a second flipflop 12 for holding the synchronous signal noninverted in accordance with the clock signal and for noninverting the 1 / 2 divided synchronous signal ; an exclusive or - gate 13 for exclusively oring the synchronous manchester code outputted from the first flipflop s -- manchester -- 1 by receiving it through one end thereof and the synchronous clock signal clock -- 1 outputted from the second flipflop 12 by receiving it through the other end thereof and for outputting an nrz code nrz -- 1 ; a third flipflop 15 for receiving the nonsynchronous manchester code and the clock signal clock -- r inverted by the inverter 14 and for sampling the synchronous manchester code at an increasing edge of the inverted clock signal clock -- r ; a fourth flipflop 16 for holding the synchronous signal inverted and outputted in accordance with an inverting clock signal clock -- r and for noninverting the 1 / 2 divided synchronous signal clock -- 2 ; and an exclusive or - gate 17 for exclusively oring the synchronous manchester code s -- manchester -- 2 outputted from the third flipflop 15 by receiving it through one terminal and the synchronous clock signal clock -- 2 outputted from the fourth flipflop 16 by receiving it through the other terminal thereof and for outputting an nrz code nrz -- 2 . the tolerance checking unit 200 includes a buffer 21 for buffering the clock signal clock -- r ; a fifth flipflop 22 for receiving a synchronous manchester code s -- manchester -- 1 from the first flipflop 11 and for sequentially shifting the bit value of the synchronous manchester code s -- manchester -- 1 by one bit in accordance with a clock signal clock -- r outputted from the buffer 21 ; a sixth flipflop 23 for receiving the synchronous manchester code s -- manchester -- 1 shifted from the fifth flipflop 22 and for sequentially shifting the bit value the synchronous manchester code s -- manchester -- 1 by one bit in accordance with a clock signal clock -- r outputted from the buffer 21 ; a seventh flipflop for receiving the synchronous manchester code s -- manchester -- 1 shifted from the sixth flipflop 23 and for sequentially shifting the bit value of the synchronous manchester code s -- manchester -- 1 by one bit in accordance with a clock signal clock -- r outputted from the buffer 21 ; a nand - gate for receiving the bit values shifted by the fifth flipflop 22 , the sixth flipflop 23 , and the seventh flipflop 24 and for detecting the bit values &# 34 ; 1 , 1 , 1 &# 34 ;; an inverter 26 for inverting the detection signal of the nand - gate 25 ; a nor - gate 27 for receiving the bit values shifted at the noninverted terminal q of the fifth flipflop 22 , the sixth flipflop 23 , and the seventh flipflop 24 and for detecting a bit value &# 34 ; 0 , 0 , 0 &# 34 ;; an or - gate 28 for receiving the detection signal inverted by the inverter 26 through one terminal thereof and for receiving the detection signal outputted from the nor - gate 27 though the other terminal thereof and for checking a specification ( tolerance ) of the dubiety of the synchronous manchester code s -- manchester -- 1 ; and an eighth flipflop 29 for noninverting the voltage vcc to a control signal in accordance with an output signal of the or - gate 28 . the multiplexer 300 includes a first multiplexer 31 for receiving nrx codes nrz -- 1 and nrz -- 2 from the xor - gates 13 and 17 of the first decoding unit 100 and for selectively outputting the nrz -- 3 code in accordance with a control signal outputted from the tolerance checking unit 200 ; and a second multiplexer 32 for receiving synchronous signals clock -- 1 and clock -- 2 from the second and fourth flipflops 12 and 16 and for selectively outputting a synchronous signal in accordance with a control signal outputted from the tolerance checking unit 200 . the synchronous detection unit 400 includes an inverter 41 for inverting the synchronous clock signal outputted from the second multiplexer 32 ; a ninth flipflop 42 for sequentially shifting the bit values of the nrz code nrz -- 3 outputted from the first multiplexer 31 by one bit in accordance with an inverted synchronous clock signal , a tenth flipflop 43 for receiving the nrz code nrz -- 3 shifted by the ninth flipflop 42 in accordance with a synchronous clock signal inverted by the inverter 41 and for shifting the bit values by one bit ; a nand - gate 44 for receiving the bit value shifted by the tenth flipflop 43 through one terminal and for receiving the bit value shifted by the ninth flipflop 42 and for detecting a synchronous bit value ; an inverter 45 for inverting the output of the nand - gate 44 ; and an eleventh flipflop 46 for outputting the voltage vcc as a synchronous signal sync in accordance with the output signal of the inverter 45 . the second decoding unit 500 includes a latch device 51 for receiving an nrz code outputted from the first multiplexer 31 and for outputting an nrz data in accordance with a synchronous signal sync outputted from the eleventh flipflop 46 , and a latch device 52 for receiving a synchronous signal sync outputted from the second multiplexer 32 and for outputting a receiving clock signal rx -- clk in accordance with a synchronous signal sync outputted from the eleventh flipflop 46 . in addition , a carrier sense ( crs ) signal is commonly inputted to the inverted cdn terminal of all of the flipflops except for an sdn terminal sdn of the sixth flipflop 23 , and vcc is applied to the inverted cdn terminal cdn of the sixth flipflop 23 . the operation of a manchester encoding apparatus according to the present invention will now be explained with reference to fig4 through 7 . to begin with , as shown in fig5 when a nonsychronous code of 10 bps is transmitted to the receiving side , the externally applied crs signal is changed from a low level to a high level , and is applied to the inverted cdn terminals of all of the flipflops except for an inverted sdn terminal sdn of the sixth flipflop 23 and the sixth flipflop 23 , and all of the flipflops are enabled . thereafter , the first flipflop 11 receives a nonsynchronous manchester code of 10 bps and a clock signal of 20 mhz and samples the nonsynchronous manchester code manchester -- code at an increasing edge of the clock signal of 20 mhz and outputs a synchronized manchester code , and the second flipflop 12 holds a synchronous clock signal inverted in accordance with a clock signal clock -- r of 20 mhz to an input terminal d and outputs a 1 / 2 divided synchronous signal clock -- 1 of 10 mhz . therefore , the exclusive or - gate 13 xors the synchronous manchester code s -- manchester -- 1 outputted from the first flipflop 11 through one terminal and the synchronous clock signal clock -- 1 outputted from the second flipflop from the other terminal and outputs an nrz code nrz -- 1 . in addition , the third flipflop 15 receives a nonsynchronous manchester code manchester -- code of 10 mbps and a clock signal clock -- r of 20 mhz inverted by the inverter 14 , and samples the synchronous manchester s -- manchester -- 2 at an increasing edge of the clock signal clock -- r of 20 mhz and outputs a synchronous manchester code , and the fourth flipflop 16 holds a synchronous clock signal inverted in accordance with an inverted clock signal clock -- r of 20 mhz through an input terminal d and outputs a 1 / 2 synchronous clock signal clock -- 2 of 10 mhz . therefore , the exclusive or - gate 17 xors a synchronous manchester code s -- manchester -- 2 outputted from the third flipflop 15 through one terminal thereof and a synchronous clock signal clock -- 2 outputted from the fourth flipflop 16 through the other terminal thereof and outputs an nrz code nrz -- 2 . thereafter , the buffer 21 of the tolerance checking unit 200 buffers the clock signal clock -- r of 20 mhz , and the fifth flipflop 22 receives the clock signal clock -- r of 20 mhz outputted from the buffer 21 and the synchronous manchester code s -- manchester -- 1 outputted from the first flipflop 11 , shifts sequentially the bit value of the synchronous manchester code s -- manchester -- 1 at an increasing edge of the clock signal clock -- r of 20 mhz by one bit , and the sixth flipflop 23 receives the synchronous manchester code s -- manchester -- 1 shifted by the fifth flipflop 22 in accordance with a clock signal clock -- r of 20 mhz outputted from the buffer 21 and sequentially shifts the bit value by one bit , and the seventh flipflop 24 receives the synchronous manchester code s -- manchester -- 1 shifted by the sixth flipflop 21 in accordance with a clock signal clock -- r of 20 mhz outputted from the buffer 23 and sequentially shifts the bit value by one bit . thereafter , the nand - gate 25 receives the bit value of the synchronous manchester code s -- manchester -- 1 shifted by the fifth flipflop 22 , the sixth flipflop 23 , and the seventh flipflop 24 and detects the bit value &# 34 ; 1 , 1 , 1 &# 34 ; of which the dubiety of the received manchester code is deviated from the specification , and the nor - gate 27 receives the bit values of the synchronous manchester code s -- manchester -- 1 shifted by the fifth flipflop 22 , the sixth flipflop 23 , and the seventh flipflop 24 and detects the bit value &# 34 ; 0 , 0 , 0 &# 34 ; of which the dubiety of the received manchester code is deviated from the specification . that is , as shown in fig6 and 7 , in case that a shift , which occurs at a central portion of the bit cell of the transmitted nonsynchronous manchester code , occurs 10 ns before or after , since the bit value of the synchronous code s -- manchester -- 1 may be a high level over 100 ns or a low level over 100 ns , the states &# 34 ; 1 , 1 , 1 &# 34 ; and &# 34 ; 0 , 0 , 0 &# 34 ; are detected , and the output of the multiplexer 300 is controlled , so that the correctly sampled synchronous manchester code is selected . thereafter , the or - gate 28 receives a detection signal of the nand - gate 25 outputted from the inverter through one terminal and receives a detection signal outputted from the nor - gate 27 through the other terminal and detects the dubiety of the manchester code is deviated from the tolerance specification and outputs to the clock terminal of the eighth flipflop , and the eighth flipflop 29 outputs the voltage vcc to the first multiplexer 31 of the multiplexer 300 and the strobe terminal s of the second multiplexer 32 as a control signal in accordance with a detection signal of the or - gate 28 . that is , when the output value of the or - gate 28 is &# 34 ; 1 &# 34 ;, the eighth flipflop 29 noninverts a high level control signal so that the bit value of the manchester code can be detected at a decreasing edge , and in case that the output value of the or - gate 28 is &# 34 ; 0 &# 34 ;, that is , the dubiety of the synchronous manchester code is normal , the eighth flipflop 29 noninverts a low level control signal so that the bit value of the manchester code can be detected at an increasing edge . therefore , the first multiplexer 31 of the multiplexer 300 receives an nrz code nrz -- 1 outputted from the exclusive or - gate 13 and receives the nrz code nrz -- 2 outputted from the exclusive or - gate 17 through the input terminal i1 , and when a control signal inputted from the eighth flipflop 29 to the strobe terminal s is a low level , and the first multiplexer 31 thereof outputs an nrz code nrz -- 1 detected at an increasing edge of the receiving clock signal clock -- r of 20 mhz , and when a control signal inputted to the strobe terminal s is a high level , it outputs an nrz code nrz -- 2 detected at a decreasing edge of the inverted receiving clock signal clock -- r of 20 mhz . in addition , the second multiplexer 32 receives the synchronous signal clock -- 1 of 10 mhz outputted from the second flipflop 12 through the input terminal i0 and receives the synchronous signal clock -- 2 of 10 mhz outputted from the fourth flipflop 16 through the input terminal i1 , and when the control signal inputted to the strobe terminal s ia low level , the second multiplexer 32 outputs the synchronous signal clock -- 1 , and when the control signal inputted to the strobe terminal s is a high level , it outputs the synchronous signal clock -- 2 . to begin with , when the control signal inputted to the strobe terminal s is a high level , the ninth flipflop 42 of the synchronous bit detection unit 400 receives the nrz code nrz -- 2 outputted from the first multiplexer 31 through the input terminal d , and receives the synchronous signal clock -- 2 outputted from the second multiplexer 32 through the inverter 41 and the clock terminal thereof , and sequentially noninverts the bit value of the nrz code nrz -- 2 by one bit in accordance with the synchronous clock signal clock -- 2 , and the tenth flipflop 43 receives the synchronous clock signal clock -- 2 inverted by the inverter 41 and sequentially receives the bit value of the nrz code nrz -- 2 shifted by the ninth flipflop 42 , and sequentially noninverts the bit value of the nrz code nrz -- 2 by one bit in accordance with the inverted synchronous signal clock -- 2 . thereafter , the nand - gate 44 receives the bit value of the nrz code nrz -- 2 outputted from the ninth flipflop 42 through one terminal , and receives the bit value of the nrz code nrz -- 2 outputted from the tenth flipflop 43 through the other terminal , and outputs a low level synchronous bit detection signal when the synchronous bit value &# 34 ; 1 , 1 &# 34 ; is detected . thereafter , the low level synchronous detection signal is inverted to a high level by the inverter 45 and inputted to the clock terminal of the eleventh flipflop 46 , and the eleventh flipflop 46 noninverts the voltage v cc , clocked to the output of the inverter 45 and applied to the input terminal d , to the second decoding unit 500 as a synchronous signal sync . therefore , the latch device 51 of the second decoding unit 500 outputs the nrz code nrz -- 2 outputted from the first multiplexer 31 in accordance with a high level synchronous signal sync outputted from the eleventh flipflop 46 and computes the nrz data nrz data , and the latch 52 outputs the synchronous signal clock -- 2 outputted from the second multiplexer 32 in accordance with a high level synchronous signal sync outputted from the eleventh flipflop 46 and computes the receiving clock signal rx -- clk , so that the nrz data nrz data and the synchronous clock signal rx -- clk which are necessary for the system are outputted from a lan control unit ( not shown ). meanwhile , when the control signal inputted to the strobe terminal s of the first multiplexer 31 and the second multiplexer 32 is a low level , the ninth flipflop 42 of the synchronous bit detection unit 400 receives an nrz code nrz -- 1 outputted from the first multiplexer 31 through the input terminal d thereof and receives the synchronous clock signal outputted from the second multiplexer 32 through the clock terminal thereof through the inverter 41 and sequentially nonconverts the bit value of the nrz code nrz -- 1 in accordance with a synchronous clock signal clock -- 1 , and the tenth flipflop 43 receives the synchronous clock signal clock -- 1 inverted by the inverter 41 through the clock terminal thereof and sequentially receives the bit value of the nrz code nrz -- 1 shifted by the ninth flipflop 42 and nonconverts the bit value of the nrz code nrz -- 1 by one bit in accordance with an inverted synchronous clock signal clock -- 1 . thereafter , the nand - gate 44 receives the bit value of the nrz code nrz -- 1 outputted from the ninth flipflop 42 through one terminal , and receives the bit value of the nrz code nrz -- 1 outputted from the tenth flipflop through the other terminal , and when the synchronous bit value 1 , 1 are detected , the nand gate 44 outputs a low level signal . in addition , a low level signal is inverted into a high level by the inverter 45 and inputted to the clock terminal of the eleventh flipflop 46 , and the eleventh flipflop 46 outputs voltage vcc to the second decoding unit 500 as a synchronous detection signal sync in accordance with a high level signal outputted from the inverter 45 . therefore , the latch device 51 of the second decoding unit 500 receives the nrz code nrz -- 1 outputted from the first multiplexer 31 and outputs the nrz code nrz -- 1 in accordance with a high level synchronous signal sync outputted from the eleventh flipflop 46 , and computes the nrz data nrz data , and the latch device 52 outputs the synchronous clock signal clock -- 1 outputted from the second multiplexer 32 in accordance with a high level synchronous signal sync outputted from the latch device 52 and computes the synchronous receiving clock signal rx -- clk , and the nrz data nrz -- data and the synchronous receiving clock signal rx -- clk which are necessary for the system are outputted from the lan control unit ( not shown ). as described above , the decoding apparatus for a manchester code is directed to decoding the nrz data and the synchronous receiving clock signal through a more simple circuit construction without adopting a phase - clocked loop ( pll ), resolving the disadvantages of a difficult fabrication process and the increasing chip size which are caused due to the use of the delay size , and detecting the synchronous signal which the lan controller requires . although the preferred embodiments of the present invention have been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as described in the accompanying claims .

6Physics

the invention will be described in further detail by the following embodiments and the accompanying drawings . it is assumed that traffics with the attribute requirements of three kinds of different qos require services at core network ( cn ) 11 side of a high speed downlink packet access system . a method for supporting the traffics with different qos by high speed downlink packet access system is shown in fig3 and 4 , the supporting method comprises the steps of : step a , when the traffics with the attribute requirements of three kinds of different qos require services at core network ( cn ) 11 side of the high speed downlink packet access system , the attributes of qos is set by core network ( cn ) 11 based on the contracts and characteristics of three kinds of services , and a radio access bearer assignment request is transmitted via radio access network application part a ( ranap ) 22 of core network ( cn ) 11 to transfer the set attribute values of qos to the radio access network application part b ( ranap ) 23 of the service radio network controller ( srnc ) 12 ; step b , the attributes of qos of the traffics are mapped onto the parameters that are operable by the radio link control layer a 121 , the high speed media access control layer 311 , and the physical layer by the service radio network controller ( srnc ) 12 . the parameters that are operable by the radio link control layer a 121 are the mapped parameters of qos of the logical channels ; the parameters that are operable by the high speed media access control layer 311 are the mapped parameters of qos of the transport channels ; and the parameters that are operable by the physical layer are the mapped parameters of qos of the physical channels . step c , the parameters of the logical channel part that can be set in radio link control layer a 121 are set by the layer a 121 of the service radio network controller ( srnc ) 12 , and the setup of the channels and the associated set parameters are informed to the mobile station by transmitting the radio bearer service setup signaling by the radio resource control a 27 of the radio link control layer a 121 to the radio resource control b 28 of the mobile station 21 ; step d , the parameters of the transport channel part and the physical channel parameters that can not be set by the radio link control layer are transferred by the service radio network controller ( srnc ) 12 to the high speed media access control layer 311 and the physical layer at the base station 31 side through the radio link setup request signaling , allowing the high speed media access control layer 311 and the physical layer at the base station 31 side to set the parameters that can be set in their own layers ; and the radio link setup request signaling is transmitted by the base station application part a 41 of the service radio network controller ( srnc ) 12 to the base station application part b 12 of the base station 14 ; step e , the data queues corresponding to the different transport channels on the interface iub / iur for storing the attributes of the different qos for the different mobile stations are setup by the high speed media access control layer 311 at the base station 31 side based on the received parameters of transport channel part . the attribute requirements of the transport channel are thus the attribute requirements of the queues ; step f , a controlled parameter table of the queue operation in the scheduling method is set by the high speed media access control layer 311 at the base station 31 side based on the queue attributes . the queue scheduling method performs the data scheduling based on the controlled parameter table to ensure the attribute requirements of qos of the transport channels . in step a , the attribute values set by core network ( cn ) 11 comprise alternative ran parameter variables , the alternative maximum bit rate information , and the alternative maximum bit rate , and the like . refer to table 2 in the chapter of background art . the mapped parameters of qos of the logical channels comprise the priority of the logical channels and rlc parameters . rlc parameters comprise rlc mode , rlc mode being divided into an acknowledgement mode and an unacknowledgement mode ; the size of rlc window ; a mechanism for discarding the rlc packets ; size of rlc pdu ; and the mechanism parameters of plc ack and polling ; the mapped parameters of qos of the transport channels comprise the priority of the transport channels , the number of transport channels , and the transport channel attributes ; the transport channel attributes comprise the maximum bit rate of the transport channel attributes , a residual bit error code ratio of the transport channel data , a guaranteed bit rate of the transport channel data , and a delay requirement of the transport channel data ; the mapped parameters of qos of the physical channels comprise the type of the physical channel and the number of the channel codes . the type of the physical channel is fixed as a high speed downlink shared channel for the high speed data traffics . an initial value can be set for the number of the channel codes , however , the scheduling of the media access control layer will be changed at each transmission time . in step d , the parameters of qos transferred by the request signaling which is setup by the radio link of the service radio network controller ( srnc ) 12 comprise : the information of downlink shared channels , how many hs - dsch are setup , how many information structures are available ; the flags of the high speed downlink shared channels ; the statistic descriptor of the transport channel sources , the attributes of the transport channels , the priority of the resources assignment and retention ; the indicator of priority scheduling ; block error rate ; a window start point expected by the downlink data to receive ; a window end point expected by the downlink data to receive ; and the transport channel attributes comprise the maximum bit rate of the transport channel attributes , a residual bit error rate of the transport channel data , a guaranteed bit rate of the transport channel data , and a delay requirement of the transport channel data . in step c , the transport format sets of the parameters , which are associated with qos and transferred by the radio bearer service request signaling , are deleted completely , the settings of the other parameters of qos are the same as that in the method for supporting the traffics with different qos by the rel99 system , comprising the radio bearer information domain ; the signaling setup by rb ; the associated information set by rlc ; the mode of rlc , including an acknowledgement mode and a unacknowledgement mode , and not including transmittance mode ; if it is the acknowledgement mode , the following domain will be set : discarding the transmission rlc , mainly , the different processing mode for discarding rlc pdu will be selected , for example , it will be based on whether the timer has an explicit signaling or not , the maximum re - transferring rate , and the like ; indicating whether it is divided into segments or not ; the mapped information of the radio bearer , and the like . refer to table 6 for the substantial parameters . the residual bit error code ratio of the transport channel data & lt ; a21 ; then , the following controlled parameters can be set and the value assignment is performed : the number of the physical code channels will be determined when scheduling the data ; the residual bit error code ratio of the transport channel data & lt ; a22 ; then , the following controlled parameters can be set and the value assignment is performed : the number of the physical code channel will be determined when scheduling the data ; the residual bit error code ratio of the transport channel data & lt ; a23 ; then , the following controlled parameters can be set and the value assignment is performed : the number of the physical code channel will be determined when scheduling the data . it is necessary to add and maintain the parameter table in the high speed media access control layer , the table corresponds to the queue one by one ; when the data of the number of the physical channel codes are scheduled , it is determined based on the modulation and encoding method and the amount of the data to be transmitted , so it is at a dynamic state ; the parameters apart from the number of the physical channel codes are determined by the high speed media access control layer ( mac - hs ) 311 , which has been implemented at the base station 31 side ( node b ) since the queues are setup , and can be reset , therefore it is at a semi static state . as shown in fig5 in step f , the data scheduling steps performed by the queue scheduling method based on the controlled parameter tables are described as follows : scanning the queues for the first time , if there is no data with the valid life time period = 0 in the queue , then new data will be retrieved from queue 1 to select the physical channel codes for transmitting ; if the transmitting is unsuccessful , then the modulation and encoding method is 1 . updating the controlled parameters of the queues as follows : queue 1 data : the valid life time period of data in the queue = 4 , and one re - transferred data , the delay of the re - transferred data ( number of tti )= 3 ; queue 2 data : the valid life time period of data in the queue = 4 , the transmission time interval ( tti ) will be decreased by 1 ; queue 3 data : the valid life time period of data in the queue = 4 , the transmission time interval ( tti ) will be decreased by 1 ; scanning the queues for the second time , if there is no data with the valid life time period = 0 in the queue , then the re - transferred data will be scanned , because the delay of re - transferred data ( number of tti )= 3 , and the type of the modulation and encoding method is 2 at the time , so the re - transferred data is not transmitted , and data will be retrieved from queue 1 to select the physical channel codes for transmitting , and the transmitting is successful . updating the controlled parameters of the queues as follows : queue 1 data : the valid life time period of data in the queue = 4 , and one re - transferred data , the delay of the re - transferred data ( number of tti )= 2 , the transmission time interval ( tti ) is decreased by 1 ; queue 2 data : the valid life time period of data in the queue = 3 , the transmission time interval ( tti ) is decreased by 1 ; queue 3 data : the valid life time period of data in the queue = 3 , the transmission time interval ( tti ) will be decreased by 1 ; scanning the queues for the third time , if there is no data with the valid life time period = 0 in the queue , then the re - transferred data will be scanned , because the delay of re - transferred data ( number of tti )= 2 , and the type of the modulation and encoding method is 1 at the time , so the re - transferred data is transmitted , the transmitting is unsuccessful . updating the controlled parameters of the queues as follows : queue 1 data : the valid life time period of data in the queue = 3 , the transmission time interval ( tti ) is decreased by 1 . there is one re - transferred data , the delay of the re - transferred data ( number of tti )= 1 , the transmission time interval ( tti ) is decreased by 1 ; queue 2 data : the valid life time period of data in the queue = 2 , the transmission time interval ( tti ) is decreased by 1 ; queue 3 data : the valid life time period of data in the queue = 2 , the transmission time interval ( tti ) will be decreased by 1 ; scanning the queues for the fourth time , if there is no data with the valid life time period = 0 in the queue , and the type of the modulation and encoding method is 2 at the time , then the re - transferred data will not be transmitted , and data will be retrieved from queue 2 to select the physical channel codes for transmitting , and the transmitting is successful . updating the controlled parameters of the queues as follows : queue 1 data : the valid life time period of data in the queue = 2 , the transmission time interval ( tti ) is decreased by 1 . there is one re - transferred data , the delay of the re - transferred data ( number of tti )= 0 , the transmission time interval ( tti ) is decreased by 1 ; queue 2 data : the valid life time period of data in the queue = 5 ; queue 3 data : the valid life time period of data in the queue = 1 , the transmission time interval ( tti ) will be decreased by 1 ; scanning the queues for the fifth time , if there is no data with the valid life time period = 0 in the queue , then the re - transferred data will be scanned , because the delay of the re - transferred data ( number of tti )= 0 , and the type of the modulation and encoding method is 2 at the time , even though the modulation and encoding method is not matched , the re - transferred data will be transmitted , and the transmitting is successful . updating the controlled parameters of the queues as follows : queue 1 data : the valid life time period of data in the queue = 1 , the transmission time interval ( tti ) is decreased by 1 . queue 2 data : the valid life time period of data in the queue = 5 ; queue 3 data : the valid life time period of data in the queue = 0 , the transmission time interval ( tti ) will be decreased by 1 ; scanning the queues for the sixth time , the valid life time period of the data in the queue = 1 , and the data will be retrieved from queue to select a suitable number of the physical code channels , and the transmitting is successful . updating the controlled parameters of the queues as follows : queue 1 data : the valid life time period of data in the queue = 0 , the transmission time interval ( tti ) is decreased by 1 . queue 2 data : the valid life time period of data in the queue = 4 , the transmission time interval ( tti ) is decreased by 1 ; queue 3 data : the valid life time period of data in the queue = 5 ; in the method , the priority of the re - transferred data scheduling = the priority of the original queue + the delay of the re - transferred data ( number of tti ), the smaller the data , the higher the priority for scheduling will be ; the scheduling priority of the queue data that do not have a valid life time period of 0 = the valid life time period + queue priority + whether it has been scheduled or not , the smaller the data , the higher the priority for scheduling will be ; when new data are being transmitted , the number of the physical channels may be selected based on the amount of data , and the modulation and encoding method selected currently by the adaptive modulation and encoding function ( amc ). from the above description and drawings , it will be understood by those of ordinary skill in the art that the particular embodiments shown and described are for purposes of illustration only and are not intended to limit the scope of the present invention . those of ordinary skill in the art will recognize that the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . references to details of particular embodiments are not intended to limit the scope of the invention .

7Electricity

reference is now made to fig1 of the drawing which clearly illustrates in schematic fashion the various components which make up the optically pumped continuous wave ( cw ) semiconductor ring laser 10 of the present invention . semi - conductor ring laser 10 of this invention incorporates therein a ring - type resonant cavity 12 which is defined by a plurality of optically aligned reflecting elements such as mirrors 14 , 16 , and 18 . although the exact number of mirrors which define the ring - type resonant cavity may vary within the scope of this invention , one of these mirrors ( 18 ) can be used as an output coupler and therefore should have a transmissivity of between 0 . 5 % and 50 %. the other mirrors , 14 and 16 , utilized to bound the resonant cavity are generally flat and highly reflective . an example of a typical overall cavity length would be approximately 3 . 5 meters . the lasing medium of this invention is made up of a very thin semiconductor platelet crystal 20 such as cadmium sulfide ( cds ), cd se 1 - x , or in 1 - x ga x as y p 1 - y which is preferably less than 30 microns or optimally between 5 to 6 microns in thickness . it is essential that the thickness of semiconductor crystal 20 be thin enough to permit transmission therethrough . the semiconductor crystal 20 is mounted upon an optically transparent , substantially nonreflective , substrate 22 , which has extremely good heat conducting properties . an example of a material which meets the above criteria would be sapphire which has an antireflection coating thereon . crystal 20 is secured to substrate 22 by means of using a thin film of low viscosity silicone oil 23 applied upon substrate 22 adjacent semiconductor crystal 20 . the semiconductor crystal 20 is held in place on sapphire substrate 22 by surface tension . the oil layer 23 is often less than 5 micrometers thick and does not crack when cooled . it is essential that the sapphire substrate 22 be transparent to the wavelength of laser operation in order for operation of the ring laser 10 of this invention to take place . in view of the substantial heat generated in ring laser operation , the sapphire substrate 22 must be adequately cooled . therefore , it is mounted within a dewar - type cooling chamber 26 containing a vacuum therein and which meets certain essential criteria set forth below . cooling chamber 26 , for example , may be of the type set forth in u . s . patent application ser . no . 552 , 555 filed herewith by two of the present inventors and now u . s . pat . no . 4 , 495 , 782 issued on jan . 29 , 1985 and incorporated herein by reference . additional heat removal from crystal 20 can be obtained by mounting a second transparent , heat conductive element 22 &# 39 ;, shown in phantom in the drawing , adjacent the other side of crystal 20 . heat conductive element 22 &# 39 ; is also preferably in the form of a slab of sapphire material mounted adjacent crystal 20 . in this manner crystal 20 is sandwiched between a pair of heat removing elements which allow the passage of the laser beam therethrough . the semiconductor crystal / sapphire combination ( 20 , 22 ) is held in place within vacuum / cooling chamber 26 for movement with the chamber in two directions . this movement includes translational movement along the x , y axes by means of a translational stage 27 . any suitable cooling source such as liquid nitrogen is contained within a coolant reservoir 31 which is operably connected to sapphire substrate 22 ( or sapphire 22 &# 39 ;). the interior of cooling chamber 26 is maintained evacuated by means of any suitable vacuum pump 33 . in addition , it is essential that the cooling chamber 26 have a pair of windows 28 and 29 , prefereably made of glass also transparent to the wavelength of the laser beam passing therethrough . these windows 28 and 29 , respectively , are situated in front of and behind the semiconductor crystal platelet 20 so as to allow the passage of electromagnetic radiation therethrough . focusing / defocusing means are positioned external of the cooling chamber . the focusing / defocusing means are both in the form of conventional microscope objective 30 and 32 placed in front of the semiconductor crystal 20 and in back of the semiconductor crystal 20 , respectively . by mounting microscope objectives 30 and 32 upon movable mounts or stages 35 and 37 , respectively , it is possible to move the microscope objectives 30 and 32 along the z axis in order to focus the incoming pump beam onto the semiconductor crystal 20 as well as focus and defocus the intracavity semiconductor laser beam . an example of the microscope objectives 30 and 32 which can be used with the present invention could be a leitz ef 10 / 0 . 25p microscope objective . the semiconductor lasing medium 20 is optically pumped longitudinally by a laser beam 40 emanating from any suitable pump laser source 42 such as , for example , a continuous wave 476 nm ar + laser . pump beam 40 is directed into the ring resonant cavity 12 by a conventional polarizing beam splitter 44 . this polarizing beam splitter 44 is capable of distinguishing between the vertically polarized 476 nm ar + pump light 40 and the horizontally polarized output 46 and 48 of the semiconductor laser 10 of this invention . focusing of the pump beam 40 onto the semiconductor crystal 20 to a spot size of approximately 5 micrometers is accomplished by means of the microscope objective 30 . in addition , the microscope objectives 30 and 32 serve to appropriately focus and defocus the bidirectional laser beam within resonant cavity 12 . as shown graphically in fig2 of the drawing a line - width as small as approximately 0 . 015 nm can be obtained with the present invention without any line - width narrowing elements . it should be noted , however , that by the introduction of a prism into the resonant cavity 12 for tuning , this line - width can be reduced even further to approximately 0 . 006 nm . the prism can be utilized within cavity 12 as a replacement for mirror 14 . the full tuning range with such a prism would be 2 . 5 nm ( 493 . 6 - 496 . 1 nm ). additional tuning with the present invention can be achieved by changing the temperature of crystal 20 from approximately 85 k . to approximately 140 k . this is accomplished by the provision of a controllable heating element 47 within cooling chamber 26 . such change in temperature can result in varying the wavelength from approximately 494 to 502 nm . referring once again to fig1 of the drawing , the outputs 46 and 48 of laser 10 can be obtained through output coupling element 18 , which is most instances has a transmittance of 8 %. using an output coupler with a 30 % transmittance , for example , a maximum power of 20 mw per beam with a slope efficiency of 15 % and a power conversion efficiency of approximately 10 % in the tem oo mode can be accomplished with the present invention . although , in contrast to conventional dye ring lasers there is no significant increase in the ratios of powers between the two outputs 46 and 48 of semiconductor ring laser 10 of this invention , coupling back one of the beams with a retroreflecting mirror can result in an output power of more than 40 mw in a single output beam . this output power is illustrated graphically in fig3 of the drawing . in order to illustrate an alternate embodiment of this invention capable of providing such increased output , reference is now made to fig4 of the drawing which depicts schematically an optically pumped semiconductor ring laser 60 in which the ring laser is operated in a manner resembling unidirectionally . it is to be noted that for purposes of ease of understanding of this aspect of the invention , those elements included in laser 60 which are identical to the elements depicted with respect to semiconductor ring laser 10 illustrated in fig1 will be given identical reference numerals . therefore , the makeup and operation of such elements can be found earlier in the specification with respect to the detailed description of optically pumped semiconductor ring laser 10 . in order to accomplish the single output 62 obtained with ring laser 60 , a retroreflecting mirror 49 is utilized and an optical diode 64 is placed within the resonant cavity 12 . in the embodiment shown in fig4 of the drawing optical diode 64 is made up of a conventional faraday rotator 66 in conjunction with a conventional crystaline quartz half - wave plate 68 . such an arrangement , for example , provides a 33 % polarization rotation and a differential loss of approximately 0 . 30 . in order to insure that after rotation the vertically polarized component of the laser beam can be ejected from the resonant cavity 12 , a polarizing beam splitter 70 is inserted within the resonant cavity 12 between microscope objective 32 and the optical diode 64 . in addition , the polarizing beam splitter 44 is placed directly within the ring resonant cavity 12 rather than external thereto as with respect to ring laser 10 . another unique feature of the semiconductor ring laser 60 of the present invention resides in the fact that the fabry - perot etalon formed by the faces of the semiconductor crystal 20 are capable of providing an optical diode effect by itself . this effect is produced by the unequal reflectivities of the two faces of the crystal 20 , combined with the gain in the medium between . the reflectivities ( for example , approximately 0 . 21 and 0 . 06 ) are unequal because of the asymmetrical mounting of the crystal itself . it should be noted , however , that this asymmetry would be eliminated if a second sapphire element 22 &# 39 ; were used . with the sandwiched crystal as shown in fig1 the mounting of crystal 20 would be considered symmetrical . the differential reflection loss between the two surfaces of the fabry - perot can be as high as 0 . 50 with a net gain in crystal 20 of 1 . 8 with virtually no reflection for the counterclockwise propagating beam . in fact , it was found that the optical diode effect formed by the fabry - perot of crystal 20 was stronger than the effect created by optical diode 64 formed by the faraday rotator 66 and the half - wave plate 68 . a ratio between the counterclockwise and clockwise beam intensity as high as 5 can be obtained when both optical diode effects are utilized within the resonant cavity 12 of ring laser 60 depicted in fig4 if ring laser 60 was set to favor the counterclockwise beam illustrated by the arrow in fig4 . the ratio was decreased to 2 when the preferred direction of the fabry - perot diode was reversed . under all circumstances , however , the lasing threshold for the clockwise and the counterclockwise beams was exactly the same , as was the wavelength . although this invention has been described with reference to particular embodiments , it will be understood that this invention is also capable of further and other embodiments within the spirit and scope of the apended claims . for example , although an ar + laser 42 is generally utilized as the pumping laser , lasing could also be accomplished with the 488 -, 473 - , and 458 - nm lines , pumping even 200 mev above the bandgap with the cds crystal is possible without absorption - depth problems . it is further possible with this invention to extend the use of semiconductor ring lasers 10 and 60 to a variety of other semiconductor elements such as , for example , cdse , cdsse and ingaasp crystals using a 514 - nm ar + pump or other pump sources such as a kr + laser . furthermore , several crystals can be mounted adjacent each other on the same sapphire substrate 22 thereby yielding a ring laser easily tunable from 500 to near infrared .

7Electricity

in an aluminum smelting cell operated with inert anodes , oxygen bubbles are generated predominately on the bottom and , to a lesser extent , on the submerged sides of the inert anodes . these bubbles rise to the surface as a bubble curtain . the bubbles reduce the density of the bath in the vicinity of the anode , resulting in a buoyancy force . flow under conventional anode designs is relatively weak . the present invention utilizes a slight slope on the bottom of each anode and the orientation of the slope directions in a group of anodes to drive cell circulation . this cell circulation can include the entire cell or a region of the cell containing several anodes , preferably four or more anodes . alumina point feeders are positioned to feed into the circulation . cell circulation results in flow loops inside , outside and under the group ( s ) of anodes . if the anode bottom is flat , bubbles roll off the bottom and up the anode sides substantially uniformly around the anode circumference . this creates circulation in the vertical , radial planes bounded by the anode , the surface , the cell wall and the metal pad . if the anode bottom is sloped slightly in accordance with the present invention , bubble - driven flow is biased in the direction of the slope . this tends to drive local circulation in the cell in the direction of the slope , defined herein as the predominate bubble - driven flow direction ( pbdfd ). when several inert anodes are grouped together their slope directions can be oriented so that the cell circulation is reinforced by each anode in turn . for example , a rectangular cell may contain a rectangular array of four anodes with bottom slopes of 0 . 5 - 3 degrees measured from a horizontal plane . proceeding around the cell in a counterclockwise direction , if the pbdfd of each anode is not perpendicular to an adjacent cell wall and rotated 90 degrees relative to the preceding anode , a counterclockwise circulation pattern will be produced in the bath . fig1 is a partially schematic side view of a portion of an electrolysis cell 10 including an inert anode 12 having an angled lower surface 14 . the inert anode 12 is partially submerged in a molten electrolytic bath 16 which comprises , for example , naf and aif 3 in a controlled ratio . during operation of the cell 10 , a molten metal pad 18 is formed at the bottom of the cell . the molten metal pad 18 has a depth m , while the bath 16 has a depth b . the distance between the upper surface of the molten metal pad 18 and the lowermost surface of the inert anode 12 is known as the anode cathode distance ( acd ). in a typical aluminum smelting cell , the distance m may be about 3 inches , the distance b may be about 7 inches , and the acd may be about 3 inches . as shown in fig1 a pbdfd bubble flow pattern is generated as a result of the angled lower surface 14 . fig2 is a partially schematic top view of an electrolysis cell 20 in accordance with an embodiment of the present invention having four inert anodes 22 , 23 , 24 and 25 . the lower surface of each inert anode is slightly angled in accordance with the present invention to provide a pbdfd bubble flow pattern within the electrolytic bath 26 of the cell 20 . as shown in fig2 the angled lower surface of each inert anode is oriented at a 90 ° angle with respect to its adjacent inert anodes . in this manner , a counter - clockwise circulation pattern is generated in the electrolytic bath 26 . fig3 is a partially schematic top view of an electrolysis cell 30 in accordance with another embodiment of the present invention having eighteen inert anodes 32 which generate a pbdfd pattern . in this embodiment , the angled lower surfaces of the inert anodes 32 are oriented such that three separate flow patterns are generated in the cell 30 . the group of six inert anodes at the left side of the cell 30 shown in fig3 generate a clockwise flow pattern . similarly , the group of six inert anodes at the right of the cell 30 generate a clockwise flow pattern . the central group of six inert anodes shown in fig3 generate a counter - clockwise flow pattern in the middle of the cell 30 . fig4 is a partially schematic top view of another electrolysis cell 34 having eighteen inert anodes 36 in accordance with a further embodiment of the present invention . in this embodiment , the angled lower surfaces of the inert anodes 36 are oriented such that they generate a serpentine flow pattern in the cell 34 . fig5 is a partially schematic top view of an array 40 of inert anode clusters 41 - 48 . in this embodiment , the inert anodes in each individual cluster have angled lower surfaces oriented in the same direction . adjacent clusters are arranged such that an overall clockwise pbdfd flow pattern is generated by the array 40 . this invention would not be suitable for cells including consumable carbon anodes because carbon anodes “ burn off ” into a characteristic shape over time due to reaction with species in the bath . carbon anodes are changed in sequence so that only a small percentage of them would retain the initial slope at any time . in contrast , the slopes on the bottom of inert anodes in accordance with the present invention are substantially preserved over the life of the anodes . therefore , once initiated by proper sloping and orienting of a group of anodes , the circulation should continue indefinitely . it is noted that sloped anodes have been proposed for use in a cell operating with a sloped drainable cathode and without a metal pad . in this type of cell the slopes of the anodes and cathodes are parallel and current density is uniform . the present invention relates primarily to cells that have a metal pad , resulting in a flat cathode . when a sloped anode is used in a cell with a flat metal pad one disadvantage is that the current density is higher at the lower end of the slope . high current density is detrimental to corrosion resistance of the inert anode . in accordance with the present invention , it has been found that only a very slight slope , e . g ., 0 . 5 - 3 degrees , is required to achieve a preferred bubble - driven flow direction . by using a group of anodes to reinforce the effect , good circulation can be achieved without creating regions of high current density . by applying this invention so as to create circulation loops with sloped and oriented anodes and position feeders in optimized locations , the time to achieve uniformity can be reduced substantially , e . g ., to a few minutes . another advantage of inducing cell circulation is that fewer feeders are needed to achieve adequate uniformity in alumina concentration . alumina fed through a point feeder can be distributed quickly over a relatively large distance by the circulation loop . without inducing cell circulation and relying only on local circulation , several feeders are required for each anode in order to maintain near saturated conditions everywhere under the anode bottom . another advantage of a sloped anode is reduced voltage drop . the additional voltage drop across a bubble layer in an inert anode cell has been calculated from pilot cell data to be 0 . 5 - 1 . volt , compared to 0 . 25 volt with a carbon anode . this increase is due to the smaller bubble size on the inert anode . grooves in the anode bottoms have been proposed to reduce the voltage drop , but such grooves result in corners with high current density and are more expensive to manufacture . a slight slope on the anode bottom has been found to reduce the voltage drop across the bubble layer without large variations in current density . another advantage of a slight slope is anode protection . bath contains dissolved aluminum and may contain small droplets of undissolved aluminum . maintaining coverage of the anode sides with oxygen bubbles results in an oxidizing barrier that minimizes reaction of the aluminum with the anode . these bubbles are relatively small , on the order of 1 mm in diameter , compared to those generated on carbon anodes ( 1 cm - 1 m ) because the alumina concentration must be maintained at or near saturation and the bubble size varies inversely with alumina concentration . if the anode bottom has a steep slope , bubbles , especially large ones , will tend to flow up the higher half of the anode , leaving the lower half relatively unprotected . in contrast , a curtain of small bubbles will protect the entire sides of anodes that have only a slight slope . another advantage of the present sloped anode is that , relative to a flat anode , bath turbulence is increased in the region adjacent to the anode in the pbdfd . this region is preferred for adding alumina from a point feeder since heat transfer and mixing are enhanced .

2Chemistry; Metallurgy

a system or process constructed and implemented according to the principles disclosed herein integrates the chemical - free oxidation of a photocatalytic decontamination process with a biological decontamination system to eliminate the thm and haa precursors in drinking water . fig1 illustrates a block diagram of one embodiment of a decontamination system 100 constructed in accordance with the disclosed principles . as illustrated , the source water 110 to be decontaminated is provided into the system 100 , for example , via a pump 120 . the source water 110 may be groundwater or surface water , or other similar water to be decontaminated . in addition , the source water 110 may have some type of pretreatment ( not illustrated ) applied to it before being introduced into the present system 100 . such a pretreatment may include a coagulation / sedimentation process , such as those found in conventional approaches . the photocatalytic decontamination process , such as the type disclosed in u . s . pat . no . 5 , 554 , 300 , is then performed using a photocatalytic reactor 230 . the photocatalytic decontamination process serves to oxidize natural organic matter into low - molecular weight , biologically degradable organics . in exemplary systems , tio2 may be employed as the photoreactant in the photocatalytic decontamination system 130 , which as discussed in the above - incorporated &# 39 ; 300 patent , binds to organic contaminants and then those bound particles are irradiated with uv light to induce a photocatalytic reaction on the organic contaminants . of course , other similar photo reactants may also be selected for the photocatalytic decontamination system 130 . downstream from the photocatalytic decontamination system 130 is a biological decontamination system 140 . the biological decontamination system 140 is configured to receive the output from the photocatalytic decontamination system 130 . the biological decontamination system 140 will further reduce the concentration of organic compounds in the water ( or similar contaminated fluid ) with the ultimate result being to produce high - quality water that can be disinfected with simple chlorine ( i . e ., sodium hypochlorite ) or similar disinfectant 150 prior to the distribution system or network 160 used to distribute the water for drinking purposes . in addition , in accordance with the disclosed principles , the water is disinfected as described above , while minimizing the concentration of thms and haas in the distribution due to a marked reduction or elimination of natural organic matter in the distribution water stream provided to the distribution network 160 . the low molecular weight of the biologically degradable organics in the non - toxic water that the photocatalytic decontamination system 130 produces is ideal for feeding into any biological decontamination process 140 . exemplary biological processes 140 are readily found in the existing field . specifically , the photocatalytic decontamination system 130 breaks down the natural organic matter in the water to a biologically degradable level that the biological process 140 can reduce or eliminate altogether . put succinctly , the disclosed novel use of a photocatalytic decontamination system 130 prior to a biological process 140 “ turns liver into candy ” for the organisms present in the biological process 140 . moreover , this is done in a chemical - free manner , since the output stream from the photocatalytic decontamination system 130 does not include any residual oxidants ( e . g ., hydrogen peroxide ), nor are any chemical additives needed in order to break down the organic matter to a biodegradable level that can be processes by the biological process 140 . furthermore , utilizing a biological process 140 downstream of a photocatalytic decontamination system 130 significantly reduces operating cost of the photocatalytic system 130 . more specifically , the energy requirements required for the photocatalytic process to mineralize all or substantially all of the natural organic matter into co 2 and water is 10 - 100 times greater than the energy required to oxidize the natural organic matter into biologically degradable compounds . looking at the downstream biological system 140 , there are many forms of biological processes that can be used . for example , it could consist of a simple biologically active activated carbon bed in which the carbon is allowed to ‘ ripen ’ with biological activity in the absence of a disinfectant or oxidant . this type of biological system 140 is simple , has a small footprint , and would have negligible operating costs . of course , other biological processes for biodegrading the broken down naturally occurring organic materials present after the photocatalytic decontamination process 130 may also be employed . turning back to the photocatalytic decontamination process 130 employed prior to the biological decontamination process 140 , the photocatalytic decontamination process 130 is an alternative treatment technology which can destroy natural organic matter such that there is insufficient organic matter to react with the chlorine . however , when the photocatalytic decontamination process 130 is employed prior to chlorination , the level of thms ( and typically haas ) in a water supply would actually be increased without the secondary process of the biological system 140 . table 1 , shown below , illustrates total thm ( i . e ., tthm ) data from a test performed by the present inventors on actual well water from a municipal water treatment plant in ontario , canada , once a photocatalytic decontamination process 130 was employed alone . as provided in table 1 , the thms formed in the water increased with increasing treatment , rather than decreased . the reason this increase occurred is that the photocatalytic decontamination process oxidized the larger natural organic matter compounds into smaller compounds at these treatment levels . when those smaller compounds are left in the water without any additional processing , those compounds then can convert to thms and haas . since there is an increase in natural organic matter available to convert to thm , the thm count necessarily increases . similar research by arizona state university ( asu ) on thm prevention through photocatalytic decontamination pretreatment showed similar results to table 1 . although the asu research demonstrated that the photocatalytic decontamination process could be used to eventually reduce thm levels , the treatment levels needed during the photocatalytic decontamination process to achieve the reduced thm levels were cost prohibitive . in accordance with the disclosed principles , however , the photocatalytic decontamination process is conducted at a level that would increase thm formation , rather than at the extreme levels needed to eliminate natural organic matter compounds altogether and thus reduce thm formation . stated another way , to conduct the photocatalytic decontamination process at a level that is not cost prohibitive actually increases the chance for thm ( and typically haa ) formation since the natural organic matter is broken down into biodegradable - sized molecules , and therefore it would be counterintuitive for practitioners to implement a photocatalytic process in the manner taught herein . however , when such a photocatalytic process is immediately followed by a biological treatment process , as discovered by the present inventors , this otherwise increase in the potential for thms and haas is prevented . the phenomena of reducing molecular weight of natural organic matter within water with a photocatalytic decontamination process has been demonstrated previously during treatment of oilfield wastewater . fig2 illustrates two chromatograms 200 that demonstrate how the molecular weight of natural organic matter is drastically reduced with a photocatalytic decontamination process . looking at the chromatograms 200 , the upper graph 210 is the influent , while the lower graph 220 is the post - photocatalytic decontamination sample . as illustrated , the smaller molecular weight compounds shown on the left side of the bottom graph 220 are the biodegradable - sized organic compounds that can form thms and haas over time , without the downstream biological process disclosed herein being implemented . typical by - products from the photocatalytic decontamination process are non - toxic , and consist mainly of benign compounds such as aldehydes , ketones and primarily carboxylic acids . fig3 illustrates a graph 300 setting forth toxicity data from a photocatalytic decontamination process test on soil washing liquid . as shown in the graph 300 , the photocatalytic decontamination process 130 readily destroys organics into benign , non - toxic organics , which would be bio - degradable to the downstream biological decontamination process 140 . the benefits of having non - toxic organics in the output of the decontamination process is self - explanatory , as compared to the residual oxidants present in the output of advanced oxidation processes ( aops ), such as ozone or hydrogen peroxide - base systems . thus , an important aspect of an approach in accordance with the disclosed principles is that the photocatalytic decontamination system 130 operates without the use of hydrogen peroxide , ozone or other aggressive oxidants . other aops all require such oxidants , which are typically added into the photocatalytic system ( s ). however , such processes do not consume all of the oxidants , and thus emit residual oxidant even after the decontamination process . accordingly , the use of a photocatalytic process that does not include oxidant additives is a key benefit of the disclosed principles . specifically , it permits the use of a biological process to be included immediately after the photocatalytic decontamination system . in stark contrast , using popular traditional aops that include ozone or hydrogen peroxide , etc . upstream of a biological process would require an intermediate process to eliminate the residual oxidant before the water reaches the biological process . such oxidants would be detrimental to the biological process since they are aggressive disinfectants , which would attack the biological process , rendering it less effective or useless altogether . consequently , it would be counterintuitive , and indeed potentially detrimental , to employ a conventional aop that employs oxidants additives with the disclosed principles , since doing so would either detrimentally affect the downstream biological process , or would require the use of an additional oxidant removal system or systems that significantly increase the complexity and operational costs of the decontamination system . another key benefit of the use of a photocatalytic decontamination process without oxidant additives , as disclosed herein , is that the oxidative by - products are consistent , thus making a consistent feed to any biological process . specifically , influent from different contaminated sources can vary greatly in their chemistry of contamination . when variable incoming chemistry is treated with other aops like the ozone or hydrogen peroxide processes discussed above , the levels of oxidant additives typically vary based on the incoming chemistry . however with photocatalytic decontamination processes as disclosed herein , the output of these processes results in a very stable bi - product . thus , although incoming chemistry to the beginning of the system 100 may vary , the photocatalytic decontamination process 130 produces a stable output which is more predictably treated by the downstream biological process 140 . while various embodiments in accordance with the disclosed principles have been described above , it should be understood that they have been presented by way of example only , and are not limiting . thus , the breadth and scope of the invention ( s ) should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the claims and their equivalents issuing from this disclosure . furthermore , the above advantages and features are provided in described embodiments , but shall not limit the application of such issued claims to processes and structures accomplishing any or all of the above advantages . additionally , the section headings herein are provided for consistency with the suggestions under 37 c . f . r . 1 . 77 or otherwise to provide organizational cues . these headings shall not limit or characterize the invention ( s ) set out in any claims that may issue from this disclosure . specifically , a description of a technology in the “ background ” is not to be construed as an admission that technology is prior art to any invention ( s ) in this disclosure . furthermore , any reference in this disclosure to “ invention ” in the singular should not be used to argue that there is only a single point of novelty in this disclosure . multiple inventions may be set forth according to the limitations of the multiple claims issuing from this disclosure , and such claims accordingly define the invention ( s ), and their equivalents , that are protected thereby . in all instances , the scope of such claims shall be considered on their own merits in light of this disclosure , but should not be constrained by the headings herein .

8General tagging of new or cross-sectional technology

the present invention resides in a hydrocarbon fuel having particulate emissions suppressant properties . for the purposes of the present invention , a hydrocarbon fuel shall mean either a liquid or gaseous hydrocarbon fuel . in particular , the present invention relates to hydrocarbon fuel compositions comprising at least one cyclic aldehyde polymer and at least one orthoester so as to reduce the particulate emissions resulting from the combustion of the hydrocarbon fuel . it should be noted that reference to cyclic aldehyde polymer or orthoester is inclusive of both a single species of cyclic aldehyde polymer or orthoester and to a mixture of species of cyclic aldehyde polymers or orthoesters . preferably the cyclic aldehyde polymer is of the formula : ## str1 ## where r 9 , r 10 , and r 11 are the same or different and are hydrogen or a c 1 to c 10 organic radical and x is from 0 to 4 . when x is 2 or more , r 11 may be the same or different organic radical in each repeating segment . preferably , r 9 , r 10 , and r 11 are the same or different aliphatic , alicyclic , or aromatic derived radicals , more preferably alkyl , alkenyl , or alkynyl radicals . examples of suitable cyclic aldehyde polymers are 1 , 3 , 5 - trioxane ; 2 , 4 , 6 - trimethyl - 1 , 3 , 5 - trioxane ; 2 , 4 , 6 - tripropyl - 1 , 3 , 5 - trioxane ; and 2 , 4 , 6 , 8 - tetramethyl - 1 , 3 , 5 , 7 - tetroxocane . one method by which cyclic aldehyde polymers may be prepared is by heating aldehydes in the presence of an acid catalyst . preferably the orthoester is of the formula : ## str2 ## where r 1 is hydrogen or a monovalent organic radical comprising from 1 to about 20 carbon atoms and r 2 , r 3 , r 4 , r 5 , r 6 , r 7 , and r 8 are the same or different monovalent organic radicals comprising from 1 to about 20 carbon atoms . preferably , r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , r 7 , and r 8 are the same or different monovalent radicals derived from an aliphatic , alicyclic or aromatic compound comprising from 1 to about 10 carbon atoms . still more preferably r 1 , r 2 , r 3 , r 4 , r 5 , r 6 , r 7 , and r 8 are the same or different monovalent radical derived from an aliphatic or alicyclic compound comprising from 1 to about 10 carbon atoms and still more preferably the same or different alkyl , alkenyl or alkynyl radical comprising from 1 to about 10 carbon atoms . examples of an orthoester of the formula i type are trimethyl orthoacetate , dimethylethyl orthoacetate , diethylmethyl orthoacetate , di - n - propylethyl orthoacetate , di - n - butylethyl orthoacetate , trimethyl orthopropionate , trimethyl orthobutyrate , dimethylpentyl orthoformate , trimethyl orthoisobutyrate , diethylmethyl orthohexanoate , diisobutylethyl orthoformate , trimethyl orthocyclohexanecarboxylate , trimethyl ortho - para - toluate , and trimethyl orthobenzoate . the preferred orthoester of the formula i type is trimethyl orthoacetate . examples of orthoesters of the formula ii type are a tetraalkyl orthocarbonate , such as tetramethyl orthocarbonate , tetraethyl orthocarbonate , tetrapropyl orthocarbonate , tetrabutyl orthocarbonate , trimethylbutyl orthocarbonate , dimethyldibutyl orthocarbonate , or tetra - n - hexyl orthocarbonate , or other orthocarbonates , such as tetraphenyl orthocarbonate . the preferred orthoester of the formula ii type is tetramethyl orthocarbonate . generally , the composition is comprised of a hydrocarbon fuel and a sufficient amount of at least one cyclic aldehyde polymer and at least one orthoester to reduce the particulate emissions from the combustion of the fuel . preferably , the cyclic aldehyde polymer in the fuel comprises from about 0 . 1 to about 50 weight percent of the total amount of cyclic aldehyde polymer and orthoester . the cyclic aldehyde polymer and orthoester are usually present from about 0 . 05 to about 49 volume percent , preferably from about 0 . 05 to about 10 volume percent , and more preferably from about 0 . 1 to about 5 volume percent based upon the total volume of fuel , cyclic aldehyde polymer , and orthoester . typically , the cyclic aldehyde polymer , which is normally present as a solid , is admixed into the orthoester and this mixture is admixed by dissolution into the hydrocarbon fuel . when the cyclic aldehyde polymer and orthoester are admixed into a liquid hydrocarbon fuel , particularly a middle distillate fuel , it may be difficult to dissolve large concentrations of the cyclic aldehyde polymer into the fuel . thus , with middle distillate fuels , the preferred amount of cyclic aldehyde polymer and orthoester is from about 0 . 05 to about 10 volume percent . as stated above , hydrocarbon fuels useful for the practice of the present invention include both liquid and gaseous hydrocarbon fuels , such as residual fuels , petroleum middle distillate fuels , methane , ethane , propane , acetylene , or natural gas . it should be noted that any hydrocarbon fuel in which the cyclic aldehyde polymer in combination with the orthoester can be admixed to prepare a composition in accordance with the present invention is suitable for the purposes of the present invention . preferably , the hydrocarbon fuel is a petroleum middle distillate fuel , residual fuel , propane or acetylene , and more preferably diesel fuel or residual fuel . a preferred hydrocarbon fuel of this invention is generally classified as a petroleum middle distillate fuel boiling in the range of 350 ° f . to 700 ° f . the most common petroleum middle distillate fuels are kerosene , diesel fuels , aviation fuels , and some heating oils . residual fuels , which are also a preferred hydrocarbon fuel , include heating oils , such as grade no . 4 and 6 heating fuels . the hydrocarbon fuel composition of the present invention may also comprise any of the known conventional additives , such as carburetor detergents , dyes , oxidation inhibitors , etc . the following examples serve to further illustrate and instruct one skilled in the art the best mode of practicing this invention and are not intended to be construed as limiting thereof . trimethyl orthoacetate ( tmoa ) is produced by adding a cooled mixture ( 32 ° f .) of 135 grams of acetonitrile , 109 grams of anhydrous methyl alcohol , 85 grams of anhydrous diethyl ether and 40 grams of dry hydrogen chloride to a 1 - liter pyrex glass flask . this mixture is allowed to stand in a refrigerator overnight at 32 ° f ., during which the mixture solidifies into a cake of white , shining plates . the ether is decanted from the product and the product is dried under vacuum ( 1 . 0 mm hg ) over sodium lime for twenty - four hours to remove excess hydrogen chloride . the reaction produces the intermediate reaction product acet - imino - methyl - ether hydrochloride . next , 310 grams of acet - imino - methyl - ether hydrochloride , absolutely dry and free of hydrogen chloride is reacted with 409 grams of methyl alcohol in a 2 - liter tightly stoppered pyrex glass flask at room temperature with occasional shaking . ammonium chloride formed in the reaction is removed by filtration . the filtrate is contacted with 2 grams of fused potassium carbonate to remove free hydrogen chloride . the reaction product is fractionated under a vacuum of 50 mm hg at a temperature of 87 ° f . to recover trimethyl orthoacetate . the following examples demonstrate the reduction of particulate emissions from the combustion of a gaseous hydrocarbon fuel , propane , containing trimethyl orthoacetate ( tmoa ), as prepared in example 1 , and trioxane ( tox ). the procedure for measuring the particulate emissions involves combusting the propane in a laminar diffusion flame which is generated and stabilized using a 1 . 9 centimeter ( cm ) diameter capillary burner . the burner consists of three concentrically positioned stainless steel tubes which have respective inner diameters of 0 . 4 millimeters ( mm ), 1 . 1 mm and 1 . 8 centimeters . positioned within and between these tubes are stainless steel hypodermic tubes ( 0 . 84 mm ). propane , the desired amount of trioxane and trimethyl orthoacetate , and nitrogen are provided through the central tube with oxygen and nitrogen provided through the middle tube . through the outer concentric tube , a shroud of nitrogen is provided to shield the flame from atmospheric oxygen . the oxygen , nitrogen , and propane are metered into the tubes of the burner through calibrated glass rotometers . the total flow rates of oxygen and nitrogen for all of the examples is 0 . 96 and 2 . 35 liters per minute ( l / min ), respectively . particulate emission rates are measured as a function of the propane flow rate as listed below in table 1 for each example . the trioxane and trimethyl orthoacetate are added through a 90 ° &# 34 ; pneumatic &# 34 ; nebulizer and monitored with a motorized syringe pump . the flow rate for the total trimethyl orthoacetate and trioxane combination in microliters per minute ( ml / min ), mole percent ( m %) of tmoa and tox , and test durations for each example are listed below in table 1 . fuels were also run using no additive and using only trimethyl orthoacetate in order to provide a comparison with the present invention . the burner is enclosed in a circular cross - sectional quartz chimney ( 7 cm inner diameter by 45 cm long ) which is fitted with a filter holder for collecting particulate emissions . while the following examples demonstrate the invention using propane as the hydrocarbon fuel , a reduction of particulate emissions would be demonstrated upon the combustion of other fuels comprising a particulate reducing amount of a cyclic aldehyde and orthoester . the invention is advantageously employed with fuels exhibiting relatively high particulate emissions , such as middle distillate fuels . thus , while the invention finds use in reducing particulate emissions from the combustion of any hydrocarbon fuel , it is particularly preferable when the fuel is a middle distillate fuel ( i . e . diesel fuel ). the particulate emission rates are measured by drawing the exhaust out of the chimney through a fluorocarbon - coated glass fiber filter using a rotary vane vacuum pump . the weight of particulate matter collected on the filter is determined by weighing the filter before and after the test and subtracting the former from the latter . the mole percent ( m %) of trimethyl orthoacetate and trioxane used and the results of the particulate emissions measurement for each example are listed below in table 2 . table 1______________________________________ flow rate testpropane tmoa and tox mole % durationexample ( l / min ) ( ml / min ) tmoa tox ( minutes ) ______________________________________2 0 . 20 0 0 0 53 0 . 20 12 . 75 0 . 82 0 . 63 54 0 . 20 26 . 33 1 . 67 1 . 29 55 0 . 20 12 . 75 1 . 10 0 56 0 . 20 26 . 33 2 . 24 0 57 0 . 23 0 0 0 58 0 . 23 12 . 75 0 . 74 0 . 57 59 0 . 23 26 . 33 1 . 51 1 . 17 510 0 . 23 12 . 75 0 . 99 0 511 0 . 23 26 . 33 2 . 02 0 512 0 . 25 0 0 0 513 0 . 25 12 . 75 0 . 67 0 . 52 514 0 . 25 26 . 33 1 . 37 1 . 06 515 0 . 25 12 . 75 0 . 90 0 516 0 . 25 26 . 33 1 . 84 0 5______________________________________ table 2______________________________________ mean soot no . sootexample mole % collection rate of reductionno . tox tmoa ( milligrams / minute ) runs ( percent ) ______________________________________2 0 0 9 . 86 12 03 0 . 63 0 . 82 9 . 55 3 3 . 14 1 . 29 1 . 67 9 . 40 3 4 . 75 0 1 . 10 9 . 42 4 4 . 46 0 2 . 24 9 . 65 7 2 . 17 0 0 11 . 47 30 08 0 . 57 0 . 74 11 . 02 3 3 . 99 1 . 17 1 . 51 10 . 96 7 4 . 510 0 0 . 99 11 . 13 10 2 . 911 0 2 . 02 10 . 83 8 5 . 512 0 0 11 . 05 37 -- 13 0 . 52 0 . 67 10 . 79 4 2 . 414 1 . 06 1 . 37 10 . 44 7 5 . 515 0 0 . 90 10 . 68 6 3 . 416 0 1 . 84 10 . 20 9 7 . 7______________________________________ as seen above in table 2 , the tox and tmoa combination does effect a reduction in particulate emissions over those runs without any additive ( examples 2 , 7 , and 12 ). furthermore , examples 4 and 8 exhibit better soot reduction than examples 6 and 10 , respectively , with the latter only using tmoa . it should be noted that as the loading of tox and tmoa increases soot reduction increases , as seen from a comparison of high loadings in examples 4 , 9 , and 14 with low loadings in examples 3 , 8 , and 13 , respectively . obviously , many modifications and variations of the invention , as hereinbefore set forth , may be made without departing from the spirit and scope thereof , and therefore only such limitations should be imposed as are indicated in the appended claims .

2Chemistry; Metallurgy

before explaining the disclosed embodiment of the present invention in detail it is to be understood that the invention is not limited in its application to the details of the particular arrangement shown since the invention is capable of other embodiments . also , the terminology used herein is for the purpose of description and not of limitation . fig1 a is an exploded view of a first preferred embodiment 1 of the novel attachable and detachable blade 10 and mounting arm 40 . fig1 b is a side view of the embodiment 1 of fig1 a with the blade 10 and arm 40 attached to one another . fig1 c is a bottom view of fig1 b along arrow a . fig1 d is an enlarged view of the spring lock attachment 50 for the embodiment of fig1 a . fig1 e is an enlarged view of a flat head screw fastener 22 for use with embodiment 1 of fig1 a . referring to fig1 a - 1e , planar shaped ceiling fan blade 10 includes three keyhole slots arranged in a triangular pattern through the wide planar portion 11 of the blade 10 . each keyhole slot includes a wide diameter base 12 , 14 , 16 , and a narrow longitudinal portion 13 , 15 , 17 , respectively . mounting arm 40 includes a flat generally heart shaped blade mounting portion 41 having decorative ridged edge 44 across one end and a narrower region 45 connecting to a curved narrow connecting arm portion 46 . flat headed fasteners such as philips head or regular head screws 22 , 24 , 26 have threads ( only thread 23 is shown in fig1 e ) which screwably attach to mateably threads within hollow stems 33 , 35 , 37 , respectively . a spring clip 50 has an elongated metal steel strip base 50 b with one end 51 wrapped about stem 37 above raised step 57 and the other end 52 abuting against raised step 59 . spring bent tab 54 has a flat strip base 50 can be further attached to an upper portion of curved narrow connecting arm portion 46 by and adhesive . the other end of mounting arm 40 includes a curved ceiling fan motor mount 48 having through - holes 49 in portions 43 , that enable fasteners such as screws ( not shown ) for mounting to a centrally located conventional ceiling fan motor 90 ( represented in fig1 c ). optionally , rubber washers / grommets can be used with stems 33 , 35 , 37 to provide vibration isolation and a closer fit between the wood and metal components . to be used , the wide diameter areas 12 , 14 , and 16 are positioned to fit down in the direction of arrow b 1 , over and about the flat headed fasteners 22 , 24 , and 26 . simultaneously , the bent tab 54 of the spring clip 50 protrudes through longitudinal key slot opening 17 . sliding and pulling the blade 10 outward in the direction of arrow b 2 , causes the bent tab 54 to depress in the direction of arrow b 4 . as tip 11 clears over , bent tab 54 pops up so that the bottom face of blade 10 abuts flush against upper surface 42 of blade mounting portion 41 . the natural expansion of bent tab 54 of spring clip 50 keeps blade tip 11 pushed in the direction of arrow b 2 allowing keyhole narrow longitudinal portions 13 , 15 , and 17 , to surround stems 33 , 35 , and 37 , respectively . by depressing bent tab 54 in the direction of arrow b 4 , blade 11 can be pushed in the direction of arrow b 5 to allow the keyhole wide diameter areas 12 , 14 and 16 to be able to pass about flat headed fasteners 22 , 24 , 26 , thereby allowing the blade to be detached from the mounting arm 40 . fig1 f is a side cross - sectional view of fig1 b with an optional gasket 60 . fig1 g is an exploded view of the optional gasket 60 having openings 62 , 64 , 66 , and mounting arm 40 of fig1 f . referring to fig1 f and 1g , a flat gasket formed of material such as but not limited to rubber and plastic can be shaped to conform to the perimeter shape of hear shaped blade mounting portion 41 allowing the blade 10 to be more tightly attached to mounting arm 40 . fig2 a is an exploded view 100 of a second preferred embodiment of the detachable blade 110 , mounting arm 140 and cover cap 160 . fig2 b is a bottom view of the second preferred embodiment 100 of fig2 a . fig2 c is a perspective view of the upper surface 161 of the cover cap 160 used in fig2 a - 2b . fig2 d is a cross - sectional view of an assembled embodiment 100 of fig2 a along the direction of arrow c 3 . referring to fig2 a - 2d , embodiment 100 includes planar shaped ceiling fan blade 110 having three keyhole slots arranged in a triangular pattern through the wide planar portion 111 of the blade 110 . each keyhole slot includes a wide diameter bases 113 , 115 , 117 and a narrow longitudinal portions 112 , 114 , 116 , respectively . mounting arm 140 includes a flat generally paddle shaped blade mounting portion 141 having an outer wider end 144 and a narrower region 145 connecting to a curved narrow connecting arm portion 146 . flat headed fasteners with stems ( such as those described in the previous embodiment ) 122 , 124 , 126 are arranged in a triangular pattern on the underside 142 of blade mounting portion 141 . the other end of mounting arm 140 includes a curved ceiling fan motor mount 148 having through - holes 149 that enable fasteners such as screws ( not shown ) for mounting to a centrally located conventional ceiling fan ( not shown ). a cover cap 160 has a molded plastic base 161 with a decorated ridged end 168 and an opposite narrower tip end . stud projections 162 , 164 and 166 each being expandable and depressible with flattened tips , each having tapered bases 163 , 165 , 167 can be molded as part of the plastic base 161 . in operation , each wide diameter bases wide diameter bases 113 , 115 , 117 of the keyhole slots in the blade 110 are moved in the direction of arrow c 1 to overly respective flat head fasteners 122 , 124 and 126 until blade 110 is flush to abut against surface 142 . then blade 110 is moved in the direction of arrow c 3 until the stem portions of the respective flat head fasteners 122 , 124 and 126 surround respective keyhole narrow longitudinal portions 112 , 114 , 116 . next cover cap 160 is moved in the direction of arrow c 2 so that expandable stud projections 162 , 164 and 166 pass through wide diameter openings 113 , 115 and 117 and through narrower matching through - holes 132 , 134 and 136 after which the angled heads of the stud projections expand to snappably lock the cover cap 160 and blade 110 to mounting arm 140 . individually squeezing each of the angled stud projection tips and reversing the assembling steps allows the blade 110 to be removed . fig3 a is a top exploded view 200 of a third preferred embodiment of the detachable blade 210 and mounting arm 240 , 250 . components 246 and 248 conform to similar components of the preceding embodiments . fig3 b is a side view of the mounting arm 240 , 250 of fig3 a along arrow d 2 . fig3 c is a front view of the mounting arm 240 , 250 of fig3 b along arrow d 3 . fig3 d is a top view of the mounting arm 240 , 250 of fig3 a without a cover plate 250 . fig3 e is a side view of the latching piston 264 for use with the embodiment 200 of fig3 a . referring to fig3 a - 3e , embodiment 200 includes a mounting arm 240 with blade mounting section wherein a semi - circular top flat plate 250 is attached to a like bottom plate 270 by screw fasteners 251 with a rectangular slot opening 260 therebetween . two latching pistons 262 , 264 each having latching handles 263 , 267 pass through openings 252 in top plate 250 . inner springs 265 and 266 allow the pistons 262 , 264 to move in the direction of arrows d 4 and d 5 , respectively within cylindrical housings 272 , 274 . inner end 212 of ceiling fan blade 210 has a narrow width portion with angled outer edges 213 , 215 and interior facing grooved indentations 217 , 219 . moving blade 210 in the direction of arrow d 1 inserts narrow planar end 212 into slot 260 so that sides 214 , 216 slide along interior sides 261 , 269 of slot 260 . the outer angled edges 213 , 215 cause pistons 262 , 264 to compress their respective springs 266 and 265 , respectively , until the pistons 262 , 264 expand and snap into the grooved indentations 217 , 219 of the blade 210 . to remove the blade 210 , latching handles 263 , 267 are manually moved in the direction of arrows d 4 and d 5 , respectively , allowing blade 210 to be separated from slot 260 of mounting arm 240 . fig4 a is an exploded view of a fourth preferred embodiment 300 of the detachable blade 310 and mounting arm 340 . fig4 b is a side view of the mounting arm 340 of fig4 a along arrow e 1 . fig4 c is a front view of the mounting arm 340 of fig4 b along arrow e 2 . fig4 d is a top view of the mounting arm 340 of fig4 b - 4c without a top plate cover 350 . fig4 e is a side view of the latching piston 364 and latching handle 367 for use with the embodiment 300 of fig4 a - 4d . referring to fig4 a - 4e , mounting arm 340 includes curved narrow connecting arm portion 346 and curved ceiling fan motor mount 348 similar to those described in the previous embodiments . arm mount 340 further includes two parallel plates 350 and 370 which are connected to one another through a central housing 382 by screw fasteners 351 . the width of central housing 382 , 384 , is smaller that the width of the plates 350 , 370 so that edges of the plates 350 , 370 form overhanging lips 381 , 383 to the sides of central housing 382 , ( shown more clearly in fig4 c . between central housings 382 are dual chambers 387 , 385 for supporting two opposing piston rods 362 , 364 each having angled outer tips . piston rods 362 , 364 are supported at their respective rear portions by opposing springs 365 and 369 , respectively , so that the piston rods 362 and 364 can compress within their respective chambers 387 and 385 . referring again to fig4 a - 4e , a partial view of a single planar blade 310 is shown having a generally rectangular shaped slot opening 311 , 313 , 315 through the blade 310 at one end and opposing interior grooves 317 , 319 . when blade 310 is moved in the direction of arrow e 3 , the inner side walls 313 , 315 of the slot pass through the overhanging lip areas 381 , 383 between the parallel plates 350 and 370 of the mounting arm 340 . outer angled tips of piston rods 362 , 364 cause the piston rods to compress against their respective springs 365 , 369 until side grooves 317 and 319 within the blade 310 allow the piston rods 362 , 364 to expand into the side grooves 317 , 319 locking the blade 310 to the mounting arm 340 . latch handles 363 and 367 can be manually moved towards each other to allow the blade 310 to be separated from mounting arm 340 . fig5 a is an exploded view of a fifth preferred embodiment 400 of the detachable blade 410 and mounting arm 440 . fig5 b is a side view of the mounting arm 440 of fig5 a along g 1 and the blade 410 positioned above . fig5 c is a front view of the mounting arm 440 of fig5 b along arrow g 2 . fig5 d is a top view of the blade 410 first positioned over the mounting arm 440 . fig5 e is a top view of the blade 410 and mounting arm 440 of fig5 d after blade 410 is pulled in the direction of arrow h 2 . referring to fig5 a - 5c , mounting arm 440 includes curved narrow connecting arm portion 446 and curved ceiling fan motor mount 448 similar to those described in the previous embodiments . arm mount 440 further includes top plate 450 with uneven sides and bottom substantially rectangular planar plate 470 which are connected to one another through a central housing 482 and 484 by screw fasteners 451 . central housing 484 has side extension portions 489 on both sides ( only one is shown ) and central housing 482 has front side extension portions 487 on both sides ( only one is shown ). top plate 450 has opposing side wings 452 ( only one is shown ) and front edge wings 454 ( only one is shown ). side wings 452 and 454 are larger in size than side extension portions 487 , 489 . the width of central housing 482 , 484 with side extensions 487 , 489 , is smaller than the width of the plates 450 , 470 so that side wings 452 , 454 of the plates 450 , and sides 471 , 473 of bottom plate 470 form overhanging lips to the sides of central housing 482 , 484 ( shown more clearly in fig5 c ). referring to fig5 a , planar blade 410 has a generally rectangular shaped slot formed between opening tip portions 413 , 415 , first cut - out rectangular grooves 414 , 416 , opposing angular grooves 417 , 419 , and extending rear tip portions 412 , 418 with rear cut - out rectangular grooves 421 , 422 and end wall 411 . assembling the blade 410 to the mounting arm 440 is first shown by fig5 b , where front and rear tip portions 413 , 415 and 412 , 418 of blade 410 are positioned parallel to and over and in front of top plate wings 452 and 454 , and moved downward in the direction of arrows g 3 and h 1 . fig5 d is a top portion of blade 410 after being laid over mounting arm 440 so that interior extending portions 413 , 415 , 412 , 418 of the blade slot 410 fit about wings 452 , 454 of top plate 450 and central housing side extensions 487 , 489 to abut against bottom plate 470 . next blade 410 is pulled away from mounting arm 440 in the direction of h 2 as finally shown in fig5 e so that piston rod 464 compresses into chamber 485 and then extends outward into blade slot cut - out groove 414 and central housing side extensions 489 abut against portions of blade slot tip portions 413 , 415 . blade slot tip portions 413 , 415 also become sandwiched between top plate wings 452 , 454 and bottom plate lips 471 , 473 of bottom plate 470 . furthermore , central housing side extensions 487 abut against blade slot rear tip portions 412 , 418 . blade slot rear tip portions 412 and 418 also become sandwiched between top plate wings 454 and bottom plate lips 471 , 473 . the final assembled arrangement of fig5 e keeps blade 410 locked into mounting arm 410 when centrifugal forces occur when the blade 410 is spinning . to remove the blade 410 from the mounting arm 440 , latch handle 467 is moved back against spring 469 , and the above steps are then reversed . while the invention has been described , disclosed , illustrated and shown in various terms of certain embodiments or modifications which it has presumed in practice , the scope of the invention is not intended to be , nor should it be deemed to be , limited thereby and such other modifications or embodiments as may be suggested by the teachings herein are particularly reserved especially as they fall , within the breadth and scope of the claims here appended .

8General tagging of new or cross-sectional technology

fig1 shows a drill string 2 suspended by a derrick 4 for drilling a borehole 6 into the earth for minerals exploration and recovery , and in particular the recovery of petroleum or natural gas . a bottom - hole assembly ( bha ) 8 is located at the bottom of the borehole 6 and comprises a drill bit 10 . in directional drilling , the bha 8 may have a downhole steerable drilling system 9 . as the drill bit 10 rotates down hole , it cuts into the earth allowing the drill string 2 to advance , forming the borehole 6 . for the purpose of understanding how these systems may be operated , for the type of steerable drilling system 9 illustrated in fig1 , the drill bit 10 may be one of numerous types well known to those skilled in the oil and gas exploration business . this is just one of many types and configurations of bottom hole assemblies 8 , however , and is shown only for illustration . there are numerous downhole arrangements and rig and equipment configurations possible for use for drilling boreholes into the earth with top drive systems 12 , and the present disclosure is not limited to the particular configurations as detailed herein . fig2 and 3 are side views of components of a drilling rig top drive system 12 according to an embodiment of the present invention . a dual ball upper internal blowout preventer ( ibop ) 20 according to an embodiment of the present invention is mounted to the rig along with other components of the top drive drilling rig , including a yoke 17 , a pipe handler frame 15 , and a hydraulic cylinder 13 ( fig2 ). the dual ball upper ibop 20 includes two ball valves 22 , 24 inside a single housing . the first upper ibop valve 22 and the second upper ibop valve 24 are both adapted for controlling well pressure and drilling mud flow . fig2 shows the relative location of the upper ibop valves 22 , 24 with respect to the other drilling rig components . a single valve lower ibop 300 with single ball valve 301 is connected below the dual upper ibop 20 . below the lower ibop 300 is a bell - mouth 302 which receives the top end of a pipe segment or pipe stand . as shown in fig3 , the dual ball upper ibop 20 is connected to the main output shaft 26 of the top drive system 12 , and is exemplary of one manner in which this dual ball upper ibop 20 may be implemented on a drill rig with a top drive system 12 . in one embodiment the ibop 20 is threaded directly to the output shaft 26 . the output shaft 26 is rotated by the top drive 12 . the dual ball upper ibop 20 is not limited only to these types of drilling systems . the dual ball upper ibop 20 with first and second valves 22 , 24 is connected to the top drive system 12 and forms a part of the drill string , as indicated in fig2 and 3 . turning to fig4 , a detailed view of a dual upper ibop 20 is shown according to an embodiment of the invention . the dual upper ibop 20 includes two separate valve assemblies 22 , 24 and is referred to as a “ dual ” upper ibop . the dual upper ibop 20 includes a mud flow passage 28 through the center of the ibop , along the central longitudinal axis of the ibop . each valve assembly 22 , 24 can be rotated through 90 degrees to open or close the valve to allow or block mud flow through the ibop 20 . the dual upper ibop 20 may replace an existing single upper ibop valve in a typical drill rig . further details of the dual upper ibop 20 are described below , including the arrangement of the valves 22 , 24 , the actuating mechanism , the single - end loading capability , and the compact length . in one embodiment , the dual upper ibop valve assembly 20 consists of two substantially independent valve assemblies 22 , 24 inside a single ibop housing 23 . in one embodiment , the two ibop valve assemblies 22 , 24 each include a ball valve 30 , 32 , and the ibop may be referred to as a dual ball upper ibop . in other embodiments , the valves 22 , 24 could be plug valves or other suitable valves . the first valve 22 may be located at the top , above the second valve , and the second valve 24 may be located at the bottom , or vise versa . when the dual upper ibop 20 is installed , one valve is identified as the primary valve , and the other valve as the back - up valve . either valve may function as the primary valve . in one embodiment , the first valve 22 is the primary functioning ibop valve , and the second valve 24 is the back - up ibop valve . as mentioned , the valves 22 , 24 may be ball valves 30 , 32 , as shown in fig4 . in one embodiment , each ball valve 30 , 32 is similar to a ball valve in a single upper ibop valve . in other embodiments , the valves 22 , 24 may have other designs , depending on system requirements and interchangeability . in one embodiment , the dual upper ibop assembly 20 occupies the same space in the drill string as an existing single upper ibop valve . thus , an existing drilling rig with a single upper ibop valve can be retrofitted with a dual upper ibop 20 by simply removing the single upper ibop valve and replacing it with the dual upper ibop 20 , without adding any additional length or width to the drill string . the ball valves 30 , 32 each include a generally spherical ball 36 , 37 . each ball is seated between a fixed seat 34 , 35 and a floating seat 42 , 43 with proper sealing arrangements . the fixed and floating seats provide arcuate surfaces that rest against the balls 36 , 37 to trap the balls inside the ibop housing 23 . the fixed seats 34 , 35 are fixed to the ibop housing 23 such as by threads or other mechanical fasteners . the floating seats 42 , 43 are biased against other components to apply a force to the respective ball 36 , 37 to hold the ball in place between the two seats . in one embodiment , one or more springs 38 , such as a wavy circular spring or other type of spring , urges against the floating seats 42 , 43 , forcing the seat against the respective spherical ball 36 , 37 . the spring and floating seat thereby urge the ball against the fixed seat 34 , 35 on the other side of the ball . in the event that the ball valve is closed against pressure from the wellbore , the pressure from the wellbore lifts the ball 36 , 37 from the respective fixed seat 34 , 35 and presses the ball against the respective floating seat 42 , 43 . the contact of the ball against the arcuate surface of the floating seat creates a pressure seal along the contact area between the ball and the floating seat , to contain pressure from the well . in the event of pressure from above , such as the comparatively low pressure from the mud pump , the floating seat 42 , 43 urges the ball 36 , 37 against the fixed seat 34 , 35 below the ball to create a positive seal . a mud flow passage 28 through the center of the ibop continues through the ball and seat components . each ball 36 , 37 includes a bore 40 through the ball , and the bore can be aligned with the mud flow passage 28 through the ibop to allow mud flow . the ball can be rotated through 90 degrees to move a solid side of the ball into the mud flow passage 28 , blocking further passage of mud or other fluid through the ibop 20 ( shown in fig5 ). each ball 36 , 37 is connected to two internal crank assemblies , one on each side of the ball , identified as 41 a and 41 b respectively . it should be noted that in other embodiments , each ball may be connected to only one crank assembly . these internal crank assemblies 41 a , 41 b are located within the housing 23 . each assembly 41 a , 41 b includes an internal crank 51 connected to a universal coupling 53 . the coupling 53 fits into a slot in the side of each ball . each crank 51 has a hexagonal opening 50 on the outer side , facing away from the ball , for engagement with an external crank assembly which is used to rotate the ball between open and closed positions , as described in more detail below . in other embodiments , the opening 50 can take other suitable shapes other than hexagonal , such as the shape of a square , triangle , or star . as mentioned above , in one embodiment , the dual upper ibop 20 includes two valves 22 , 24 inside a single housing 23 . the single housing 23 reduces the number of external connections or couplings that would otherwise be needed to connect two separate valve assemblies together . the housing 23 includes an upper end 46 and a lower end 47 . the upper end 47 is toward the top drive system 12 , and the lower end 47 is toward the borehole 6 . both valve assemblies 22 , 24 ( including the valve and associated seats , springs , seals , and other components ) can be loaded into the housing 23 from the same end , in one embodiment the upper end 46 . that is , the dual upper ibop valve assembly 20 has the capability of being assembled from one end of the housing 23 , and as such be characterized as a “ single end loading ” dual upper ibop valve . this capability is shown in fig4 , where both valves 22 , 24 are loaded into the housing 23 through the upper end 46 . the upper and lower ends 46 , 47 each have an opening 46 a , 47 a that communicates with the mud flow passage 28 through the ibop . each opening may have internal threads 46 b , 47 b . the opening 46 a and the mud flow passage 28 through the upper end 46 are wide enough in diameter to receive the valves 22 , 24 . the valve 24 can be received into the ibop housing 23 through the opening 46 a , arranged between seats 35 and 43 , and subsequently the other valve 22 can be loaded into the ibop and seated above the lower valve 24 . a retainer ring 71 is provided above the valve 22 , capturing the spring 38 between the ring 71 and the floating seat 42 . the diameter of the opening 46 a is selected to be wide enough to receive these valves and seats and corresponding components into the housing 23 . it should be noted that the ibop can be designed to provide single - end loading from either the upper end 46 or the lower end 47 . the embodiment of fig4 provides loading from the upper end 46 . in either case , the two valves are both loaded from the same end , and are functionally configured in the same way ( as described in more detail below ). due to the single end loading capability , the opening 47 a at the lower end 47 of the ibop is not limited by the size of the valves 22 , 24 . because both valves 22 , 24 are inserted through the opening 46 a at the upper end , the diameter of the opening 47 a at the lower end is not constrained by a minimum size to receive the valves . instead , the diameter of the lower opening 47 a is free to be smaller than the valves 22 , 24 . this freedom of design allows the lower opening 47 a to be sized for a desired component below the ibop 20 . for example , in one embodiment , a lower single ibop assembly 300 ( shown in fig8 ) may be attached to the lower end 47 of the dual upper ibop 20 , between the ibop 20 and the drill string . the lower ibop valve 300 provides the required regulatory redundancy for safety . in one scenario , the lower ibop 300 may be smaller in diameter than the dual upper ibop 20 and may be sized to fit within the drill string or casing string in the wellbore , so that it can be detached from the upper ibop 20 and deployed into the wellbore as needed . the single - end loading capability of the upper ibop 20 enables this flexibility in sizing of the lower ibop 300 . the single - end loading capability of the dual upper ibop 20 also provides flexibility with other design features at the lower end 47 of the ibop . for example , in the embodiment shown in fig4 , an internal shoulder or step 64 is provided between the threads 47 b and the second valve 24 . the lower fixed seat 35 rests against this step 64 . the diameter of the opening through the step 64 may be smaller than the diameter of the valves 22 , 24 and the opening 46 a . the single - end loading capability of the ibop 20 also enables the two ball valves 30 , 32 to have the same configuration with respect to the borehole . each ball valve 30 , 32 includes a ball 36 , 37 trapped between two seats , as described above . when the valve is assembled , the fixed seat 34 , 35 is inserted first , followed by the ball 36 , 37 , followed by the floating seat 42 , 43 . thus , the floating seat is oriented toward the opening through which the valve was inserted , between that opening and the ball . if the two valves 30 , 32 were inserted through different openings , for example the upper valve through an upper opening and the lower valve through a lower opening , then the two floating seats would face away from each other , toward the respective openings , and the two fixed seats would face toward each other . such a configuration would result in one valve having a fixed seat toward the wellbore , and the other valve having a floating seat toward the wellbore . by contrast , valves 30 , 32 of the single - end loading ibop 20 in fig4 are both inserted through the upper opening 46 a , and therefore both floating seats are toward the top , and both fixed seats toward the bottom . both valves 30 , 32 have the same orientation with respect to the borehole . in fig4 , both valves 30 , 32 include a fixed seat toward the borehole ( toward the lower end 47 of the ibop ) and a floating seat toward the top drive ( toward the upper end 46 of the ibop ). if the valve is needed to control a pressure kick , the pressure will originate from the borehole side , lifting the ball 36 , 37 off of the fixed seat 34 , 35 and pressing it against the floating seat 42 , 43 . in both cases , the ball is pressed against its respective floating seat , since both floating seats are toward the top end 46 . therefore , the single - end loading capability of the ibop 20 enables both of the dual valves 22 , 24 to have the same configuration ( the orientation of the fixed and floating seats ) with respect to the high - pressure side , which simplifies design and testing of the valves . in one embodiment , the single - end loaded dual upper ibop 20 includes nesting components , which reduce the overall length of the ibop 20 . for example , as shown in fig4 , the floating seat 43 for the valve 24 and the fixed seat 34 for the valve 22 are nested , with the seats overlapping each other as noted at area a . the seats 43 , 34 each have a stepped shape , with the floating seat 43 fitting within the fixed seat 34 . the spring 38 is placed between the two seats , to urge the floating seat 43 toward the lower ball 37 . this nested , overlapping configuration reduces the overall axial length of the ibop 20 . because both valves 22 , 24 are loaded into the housing 23 from the same opening , the seats 43 , 34 of the two valves can be configured to nest together . similarly , the upper floating seat 42 and the retainer ring 71 have a nested configuration , overlapping as noted at area b . in one embodiment , the overall length of the ibop 20 as shown in fig4 is about 24 - 30 inches . the upper end 46 of the ibop 20 includes internal threads 46 b , which in one embodiment are configured to mate with the output shaft 26 of the top drive 12 . the lower end 47 includes internal threads 47 b , which in one embodiment are configured to mate with the drill string , or with a lower ibop valve such as the lower single ibop 300 ( fig8 ). another embodiment of a dual upper ibop 20 ′ is shown in fig5 . the ibop 20 ′ includes two valves 22 , 24 within a single housing 23 . in the embodiment shown , the valves 22 , 24 are ball valves . the first valve 22 is shown in the open position , while the second valve 24 is closed . the closed valve 24 has been rotated to move a solid side of the ball 37 a into the mud flow path 28 , blocking the path . each valve can be rotated through 90 degrees between the open and closed positions . fig5 also shows an external actuator assembly 166 that is used to operate the valves , to open or close them . as shown in fig5 , the actuator assembly 166 includes an actuator shell or sleeve 68 mounted around the housing 23 , externally of the two valves 22 , 24 , and two external crank assemblies 44 a , 44 b ( one on the left side of the figure and one on the right ) associated with each valve . the external crank assemblies 44 a , 44 b for each valve are coupled on one end to the respective internal crank assembly 41 a , 41 b and at the other end to the actuator sleeve 68 . the actuator sleeve 68 moves up and down with respect to the housing 23 , to operate the crank assemblies to rotate the valves between the open and closed positions . this is just one of many types and configurations of actuators , however , and other arrangements and configurations of actuators may be used with the dual upper ibop . further details of the actuator assembly are described below . fig6 - 7 show a dual upper ibop 20 ″ with an actuator assembly 66 , according to an embodiment of the invention . the actuator assembly 66 is used to operate the valves 22 , 24 within the dual upper ibop 20 ″. both valves can be operated by a single actuator assembly . the actuator assembly 66 controls both valves . because the ibop 20 ″ is a dual valve assembly with two valves , rather than a single ibop with only one valve , the actuator assembly 66 is used to perform two functions — to hold one of the two valves in a fixed ( typically open ) position , and to operate the other valve to open or close it . for example , the first valve 22 may be acting as the primary valve , and the second valve 24 may be the back - up valve . initially , the actuator assembly holds both valves open , allowing mud or other fluid flow through the ibop . in the event of a pressure kick , a test event , or a mud - saver function , the actuator assembly 66 can be operated to close the first ( primary ) valve while continuing to hold the second valve open . thus the actuator assembly 66 is designed to operate either valve while maintaining the other valve locked in the open position . in an emergency event , both valves can be closed . as shown in fig6 , the actuator assembly 66 includes an actuator sleeve 68 that is mounted externally of the ibop housing 23 and that is slidable with respect to the housing 23 . to operate the valves , the actuator sleeve 68 engages four external cranks 54 a , 54 b , 55 a , 55 b coupled to the two valves 22 , 24 , respectively . two of the cranks 54 a and 55 a are visible from the view in fig6 , and the other two are on the opposite side of the dual upper ibop 20 ″. the description below refers to the visible cranks 54 a and 55 a in fig6 , and it should be understood that the same operations are taking place on the opposite side with cranks 54 b and 55 b . when the sleeve 68 is translated between the upper and lower ends of the ibop 20 ″, the sleeve rotates one of the two cranks 54 a , 55 a to open or close one of the valves , while retaining the other crank in a fixed position . the cranks 54 a , 55 a are shown in fig6 with their arms 57 pointed downwardly and to the right ( in the orientation of the figure ). in this position , both valves 22 , 24 are open . to close one of the valves , the crank is rotated through 90 degrees in the counter - clockwise direction , until the crank arm is pointed upwardly and to the right . the cranks 54 a , 55 a extend externally of the housing 23 to engage the actuator sleeve 68 . the cranks 54 a , 55 a include a projection such as an internal arm 59 ( shown in fig5 ) that engages the hexagonal hole 50 of the internal crank assemblies 41 a , 41 b ( shown in fig4 ). as a result , rotation of the external cranks 54 a , 55 a is transmitted to the internal crank assemblies 41 a , 41 b . the internal crank assemblies 41 a , 41 b fit into a slot in the outer surface of the balls , as described above , and thus rotation of the internal cranks causes a corresponding rotation of the balls , thus rotating the balls into the open or closed position . the external cranks 54 a , 55 a pass through a slot 73 in the actuator sleeve 68 to engage the valves 22 , 24 . the actuator assembly 66 is configured to operate the first , primary valve between the open and closed positions while maintaining the second , back - up valve in the open position . to rotate one crank but not both cranks , the actuator sleeve 68 is provided with a plate 70 bolted to the sleeve . the plate includes a recess 72 that receives an end of the arm 57 of the first crank 54 a , and a stop or wall 74 that contacts an end of the arm 57 of the second crank 55 a . when the actuator sleeve 68 is moved toward the upper end 46 of the ibop , the plate 70 moves with the sleeve , and the wall 74 slides along the second crank 55 a , preventing the arm 57 of the crank from rotating counter - clockwise . the wall 74 thus prevents the crank 55 a from rotating the second valve 24 into the closed position . the wall 74 retains the second valve 24 in the open position . at the same time , as the sleeve 68 and plate 70 move upwardly , the recess 72 and its side edges or arms 72 a engage the arm of the first crank 54 a and rotate it counter - clockwise . the recess 72 is deep enough to allow the crank to rotate through its arc . this in turn rotates the first valve 22 into the closed position . thus , the first valve is closed while the second valve is held open . the sleeve 68 can be translated back down toward the second end 47 to open the first valve , while still holding the second valve open . the plate 70 can be removed from the sleeve 68 by removing the screws 75 . with the plate removed , either crank 54 a , 55 a can be rotated to the desired position , opening or closing the valves 22 , 24 . when the cranks and valves are in the desired position , the plate 70 is replaced . the plate can be attached to the sleeve 68 in either of two orientations — with the recess 72 engaging the upper crank 54 a or engaging the lower crank 55 a . thus , the plate 70 can operate either crank while holding the other crank in a fixed position , and the fixed position can be chosen to be either open or closed . typically the fixed position will be open so that the back - up valve is held open while the primary valve is operated . the actuator sleeve 68 includes a groove or channel 76 , which can be located at any convenient position along the sleeve . the groove 76 could alternatively be provided as a space between two rims or flanges 78 . the groove 76 receives a yoke 17 ( see fig9 ) which is in turn connected to a hydraulic cylinder or other actuator . the cylinder and yoke move the sleeve 68 up and down with respect to the housing 23 , to operate the crank that is engaged with the recess 72 . the groove 76 and yoke 17 are provided to accommodate the rotation of the ibop 20 ″, as the ibop is rotated along with the top drive output shaft 26 and the drill string . the yoke 17 does not rotate with the ibop . the groove 76 and rims 78 allow translational force from the yoke 17 to be transmitted to the sleeve 68 while isolating the yoke 17 from rotation of the ibop . the cylinder can be controlled remotely , such that operation of the cylinder , actuator sleeve , and valves can be controlled from a remote location . a controller may be provided to send signals between a remote control station and the cylinder . as an alternative to the two cranks 54 a and 55 a shown in fig6 , the non - operational crank ( the crank held in a fixed position by the wall 74 ) can be replaced by a plate such as the plate 81 shown in fig6 a . the plate 81 includes a protrusion such as a male hexagonal arm 83 that engages the female hexagonal ( or other shaped ) hole 50 in the internal crank assembly of one of the two valves ( see fig4 ). the plate 81 is bolted to the housing 23 with the male hexagonal arm 83 engaging the female hexagonal hole 50 , to fix the position of the valve and prevent the valve from rotating . the actuator 66 can be used to operate the other crank , to rotate the other valve between the open and closed positions . the plate 81 provides a secure way to fix the position of the back - up valve , such as to lock it into the open position . in this instance , the wall or stop 74 is not needed , as the plate 81 replaces the non - operating crank 55 a . to operate the back - up valve , the plate 81 is removed and replaced with the crank ( such as crank 55 a ), which can then be operated by the actuator sleeve 68 to rotate the valve . the ibop 20 ″ with actuator assembly 66 is also shown in fig7 . this figure shows the dual crank assemblies provided on each side of the ibop , and indicates the location of the four cranks 54 a , b and 55 a , b . in this embodiment , each valve includes two crank mechanisms , one on each side of the valve . also shown in fig7 is a cover plate 80 attached to the sleeve 68 to cover the cranks , the plate 70 , and the screws 75 . this cover plate 80 is provided to protect these components and to prevent loose components from falling to the rig floor . the cover plate 80 may include one or more windows 82 to view the position of the cranks . fig8 shows a dual upper ibop 200 with actuator assembly 66 . the actuator assembly is shown with the recess 72 of the plate 70 engaging the lower crank 55 a . the dual upper ibop 200 is attached at its lower end to a single lower ibop valve 300 , which is provided as required by regulation . the single lower ibop 300 may be attached to the dual upper ibop 200 via the lower threads 47 b ( see fig4 ). optionally , clamps such as the clamps 84 shown in fig8 may also be provided to secure the connection between the ibops 200 , 300 . another embodiment of an actuator assembly 66 ′ is shown in fig9 . in this case , the cranks 54 a , 55 a for the upper and lower valves are offset about the circumference of the ibop . two separate plates 70 are provided , one to engage each crank . each plate 70 includes one side with a wall 74 and an opposite side with a recess 72 . the plate can be removed and reversed to place either the wall or the recess in engagement with the crank . the crank can be positioned in the desired position to open or close the respective valve , and the plate can then be used to either operate the crank or to retain the crank in the desired position . in fig9 , the recess 72 engages the upper crank 54 a , which is currently in the open position ( pointed down ), and the wall 74 engages the lower crank 55 a , which is also in the open position ( pointed down ). fig9 also shows the yoke 17 with two rollers 19 that fit into the groove 76 to transmit translational movement from the yoke 17 to the sleeve 68 while the sleeve 68 is rotating . another embodiment of an actuator assembly 166 is shown in fig1 . this actuator assembly includes a sleeve 68 , internal crank mechanisms 41 a , 41 b , external crank assemblies 44 a , 44 b , and external cranks 54 , 55 ( only one of which , 55 b , is shown in the figure ). the external crank 55 b is coupled to the other crank assemblies through several components , and an exploded view is shown in fig1 . in this embodiment , the engagement of the sleeve 68 and the cranks 54 , 55 utilizes a rotation of a shaft 60 to rotate each valve 22 , 24 . referring now to fig1 , disclosed , and externally mounted on the housing 23 , are four crank housing actuator assemblies shown generally as 44 a and 44 b ( a pair for each valve 22 , 24 ). each assembly engages an internal assembly 41 a , 41 b , which includes a crank 51 that is attached to each ball . each crank 51 engages the ball 36 such that rotation of the crank 51 causes rotation of the ball . each crank 51 has a hexagonal hole 50 facing outwardly , away from the ball . the external crank assembly 44 a , 44 b includes a hexagonal shaft end 48 that mates with the hexagonal holes 50 . the mating hexagonal shape of the shaft end 48 and the hole 50 causes rotation of the shaft end 48 to be transmitted to the crank 51 , and thereby to the ball . the shaft end 48 is rotated by movement of the shell 68 and crank 54 , as described further below . the vertical motion of the actuator shell 68 is integrated with cam rollers 52 a sliding in a horizontal slot 52 b . movement of the shell 68 thus causes an angular movement of the crank 55 b . this movement in turn rotates the shaft 60 and the shaft end 48 , causing a rotation of the crank 51 and the attached ball . thus the angular motion of the crank arm assemblies rotates the balls 36 , 37 to open and close the valves . the rotation of the crank 55 b of the crank assembly 44 b is passed through a first threaded sleeve 56 through a hex drive 58 and threaded shaft 60 , which then passes through a threaded sleeve 62 to engage the crank assembly 44 b and thus the crank 51 and ball 37 . this crank system assembly ( 44 b , 48 , 62 , 60 , 58 , 56 , 52 a , 52 b , 55 b ) is installed over the dual ball upper ibop valve assembly . an actuator arm assembly such as a yoke shaped arm is provided with two cam rollers that fit into a groove in the actuator sleeve 68 , to transmit motion to the sleeve 68 ( see fig9 ). a hydraulic cylinder may be mounted on the rig , for example on a pipe handler frame ( see fig2 ), through a linkage to slide the actuator sleeve vertically up and down . the crank arm assemblies with the cam rollers are captured by a retainer on the crank housing assemblies preventing them from sliding out but allow them the freedom to rotate . the vertical motion of the actuator shell with the crank arm assembly cam rollers sliding horizontally in the slots generates a circular motion applying a torque to rotate the ball valve through 90 degrees either clockwise or counterclockwise directions , to open and close the valve as desired . the actuator assembly 166 may be used to operate one valve while retaining the other valve open or closed . as described above , the shaft 60 , sleeve 62 , and end 48 can be connected to the hexagonal hole 50 to transmit rotation from the crank 55 b to the ball 37 . however , these components can be disengaged such that movement of the actuator sleeve 68 and rotation of the crank 55 b does not operate the valve , thus allowing the sleeve 68 to move without actuating the back - up valve . the assembly includes the threaded adjustment sleeve 62 running over the threaded drive shaft 60 . a hexagon drive on the end of the drive shaft would screw the threaded adjustment sleeve 62 in and out clockwise and counterclockwise , engaging and disengaging the crank assemblies 44 a , 44 b of the first and second valves , respectively . the engaged first valve becomes the functional valve and the disengaged second valve becomes the nonfunctional , back - up valve which is maintained open . the threaded adjustment sleeves 62 are automatically locked in that position against the hexagonal hole in the crank housing assembly . the threaded adjustment sleeves 62 would have two distinct positions — either screwed in clockwise to a stop to engage or screwed out counter clockwise to a stop to disengage the cranks 44 a , 44 b . the crank that is engaged with the respective crank arm assembly would then either open or close the respective ball valve . the crank arm assembly of the disengaged and locked second valve would continue to go through their angular motions freely similar to the crank arm assemblies of the engaged and operating first valve . however , the disengaged feature of the threaded adjustment sleeves would keep the ball valve from operating and the locked feature would keep the ball valve from accidentally closing . nylon inserts ( not shown ) in the threaded adjustment sleeves may provide sufficient friction to prevent inadvertent rotation of the ball when they are in their home positions . it would be apparent to those skilled in the art that many modifications of the dual upper ibop valve assembly 20 disclosed herein are possible without departing from the teachings of the present invention . for example , alternate components which are equivalent to components already described herein may be used . in addition it may be desirable to modify the disclosed valve assembly so it may have a different number of crank housing assemblies , each connected to an actuator shell and an actuator arm assembly . a method of assembling and disassembling a dual upper ibop is provided according to another embodiment of the invention . to assemble the valves , break - out the existing single upper ibop valve from the drill string ( as done routinely ) and install a new dual upper ibop valve assembly with the new actuator shell 68 . the new dual upper ibop is installed by engaging the upper and lower threads 46 b , 47 b with the drill string or top drive and / or by clamping the ibop to the components of the drill string . once the dual upper ibop is installed , the actuator shell 68 is positioned over the dual upper ibop valve assembly in the neutral position so that the horizontal slots for the crank assemblies are lined up with the center of each valve . attention must be paid to match the orientation of the hexagonal holes ( 50 ) in the internal cranks with the hexagonal shafts ( 48 ) in the crank housing assemblies . next , the four crank housing sub - assemblies are installed and secured . one of the two valves is identified as the operational valve and the other valve as the back - up . for actuator assembly 166 , the two threaded adjustment sleeves for the operational valve are screwed in clockwise to their stops . the other two threaded adjustment sleeves , for the non - operational back - up valve , are retracted counter - clockwise to their stops . for actuator assembly 66 , the plates 70 are attached with the recess 72 engaging the crank of the operational valve , and the wall 74 engaging the crank of the non - operational valve ( or the plate 81 may be used ). when switching from the first valve to the second valve , to reverse functions of the two ibop valves and utilize the back - up valve , the positions of the threaded adjustment sleeves or plates are reversed . in one embodiment , a method for operating an internal blowout preventer in a top drive drilling system includes providing an internal blowout preventer with a housing having first and second openings at opposite first and second ends of the housing , and loading first and second valves into the housing through the first opening . the actuator sleeve is then attached to the housing and coupled the actuator sleeve to the first and second valves . the method also includes configuring the actuator sleeve to operate the first valve , and configuring the actuator sleeve to maintain the second valve in a fixed position , such as the open position . the actuator sleeve can then be translated along the housing to operate the first valve . the present invention has been described in particular relation to the drawings attached hereto , and it should be understood that other and further modifications apart from those shown or suggested herein , may be made within the scope and spirit of the present invention .

4Fixed Constructions

in fig1 and 2 , the distal femur 1 is shown with the femoral component 2 fixed in place . the outer bearing surface of the femoral component is a replica of the anatomic distal femur for the purpose of illustration , but this can be modified slightly for purposes of smoothing , making surfaces of definable geometrical parameters , or manufacturability . a baseline anatomically representative femur is defined as a femoral prosthesis comprising a distal bearing surface that duplicates that of an anatomic femur . the distal bearing surface shape can be taken from an individual natural femur . alternatively , it can also be an average shape determined for a collection of cadaveric knees . it can also be an average shape determined from a collection of mri scans , either normal knees , or knees with some degeneration as seen in osteoarthritis . the averaging method can either be by a scaling process followed by the definition of numerous sagittal slices and then averaging the slices , from which a new composite three - dimensional shape is made . it can also use a surfacing software which places a mean surface through a point cloud in space , the points determined directly from digitizing cadaveric knees , or determining points from mri sections , where the initial step is to scale and position the point clouds . the outer femoral bearing surface is the same as the articular cartilage but includes the intercondylar areas 8 , 11 , 12 , and 22 , which are smoothly continuous with the condylar bearing surfaces 9 , 10 , 20 , 21 . the superior of the patella flange 3 can be extended from the cartilage bearing surface by approximately 5 mm to increase the contact with the anatomic patella or a resurfaced patella . the femoral component includes the lateral prominence 5 and the medial prominence 6 of the patella groove 4 . the patella groove 7 continues smoothly into the intercondylar area 8 . this area is continued into the posterior 23 , and is blended at each side with the posterior lateral 21 and posterior medial 20 femoral condyles . the inclusion of the intercondylar area into the bearing surfaces is that the central part of the tibial component will interface during function , thus providing a larger surface area for motion guiding and stability . the entire periphery of the femoral component 2 is ideally continuous with the distal femur 1 . this could be achieved by using a customized approach for each femur . however it is recognized that for a system of total knees with a finite number of sizes , for a given femur , even the closest size of component will have some discrepancy with the bone to which it is fitted . it might therefore be an advantage if the height of the posterior femoral condyles 24 , 25 is made a few millimeters higher than the average size of femur . fig3 and 4 show the shape of the femoral component 2 and bone cuts which are required for fitting . the cuts shown are typical of standard faceted cuts used for fitting the femoral components of most of today &# 39 ; s total knee systems . the facets consist of the postero - lateral 30 , postero - medial 31 , distal lateral 32 , distal medial 33 and anterior 34 . there are usually smaller additional facets at approximately 45 degrees to the above cuts 35 , 36 , 37 , and 38 . of particular interest are the bone cuts used for the intercondylar area 39 . these are shown as rectangular cuts which preserve sufficient wall thickness of the femoral component 2 . the resulting shaped housing is of relatively small dimensions requiring only a small amount of bone resection . in a sagittal view the anterior housing face makes an angle of approximately 60 degrees to the horizontal . in an alternative embodiment , the proximal surface of intercondylar area 39 may be formed as a smooth surface at least partially conformal with the distal surface of intercondylar area 39 thereby providing a constant wall thickness . the wall thickness in an exemplary embodiment is approximately 2 mm . this configuration has the advantage of requiring the removal of less bone than the rectangular cut embodiment . in addition , the absence of rectangular corners minimizes the possibility of high stress areas . the required bone resection may be cut with a box chisel or curved rasp . fig5 shows a lateral view of the femoral component 2 with the positions of three sections . the section at 0 degrees flexion 43 is in a vertical frontal plane . the section at 45 degrees flexion 44 is halfway between a vertical frontal plane and a transverse horizontal plane . the section at 90 degrees flexion 45 is on a transverse horizontal plane . the sectional profiles of the lateral 41 and medial 40 condyles , differ and are based on the known anatomic shapes . this difference is important in terms of preserving the correct lengths of the lateral and medial collateral ligaments during the entire range of flexion - extension . the prominence of the patella flange on the lateral side 42 is a normal feature of the anatomic knee , which maintains the patella in the trochlea groove without lateral dislocation . the amount of prominence varies between patients , in particular between males and females . the prominence is generally less with females than males . in any case , the prominence can be reduced , in order to reduce the tensions in the anterior soft tissue structures , thereby facilitating a high flexion range . fig6 shows the sectional views 43 , 44 , 45 together with preferred dimensions . the sections are generally similar in shape . the height of the housing h 47 is 16 mm at 0 degrees flexion and 19 mm at 45 and 90 degrees flexion . preferred values are within 2 mm of these values . the radius of the dome s 48 is 8 mm in all sections , with a preferred value within 2 mm . the frontal radius of the lateral 49 and medial 50 femoral condyles is 22 mm with a preferred value within 2 mm . the angle of the sides of the housing a 51 , 52 is 70 degrees to the horizontal within a preferred value within 5 degrees . the exception is the angle at 0 degrees flexion which is closer to 60 degrees in order to provide normal tracking of a retained anatomic patella . while the frontal shape of the housing seen on the abovementioned coronal sections can be rectangular for convenience of bone preparation , for preservation of more bone , the sections can be rounded 53 , 54 , 55 so as to provide a uniform wall thickness of approximately 2 mm . rounding of the corners of the coronal sections of the femoral component and corresponding bone resection can also reduce undesirable stress concentrations . a baseline tibial surface may be generated from the mating femoral bearing surface as an envelope of the composite of multiple distal femoral bearing surfaces positioned , with respect to said tibial component , throughout the full range of flexure angles and axial rotation angles . the full range of flexion - extension typically extends from approximately 150 degrees flexion to − 6 degrees extension while the full range of axial rotation angles is typically 10 to 20 degrees . the baseline tibial surface thus generated will exhibit complete conformity between the two surfaces in full extension , full flexion , and at the sides . while this will maximize contact area and minimize contact stresses , it is undesirable for three reasons . firstly , it does not allow for any positional errors in placing the components at surgery . secondly , any small manufacturing errors could result in contacts at the edges of the plastic tibial component . thirdly in function , shear forces will cause the femoral component to contact the edges of the tibial surface , possibly resulting in deformity . hence some lack of conformity between the femoral and tibial surfaces is desirable . for convenience this is preferably effected on the tibial surface . starting with the generated baseline tibial surface , a proximal tibial bearing surface may be generated by modifying the baseline tibial surface . one such modification is to ‘ flatten ’ the tibial surface mathematically . fig7 , 8 , 9 , 10 show this visually , where fig7 and 9 are the baseline tibial surfaces 70 generated directly by , and conformal with , the femoral component , while fig8 and 10 show the ‘ flattened surfaces ’ of the proximal tibial bearing surface . this flattening is achieved by defining a transverse reference plane containing the lowest point on the tibial bearing surfaces , and then scaling the height , above the transverse reference plane , of each point on the tibial bearing surface by a scaling constant having a value less than 1 ( one ). in the above figures , the exemplary scaling constant is 0 . 7 , which is chosen for visualization purposes . the preferred value of the scaling constant for functional purposes is one that will allow approximately ± 1 mm medial - lateral laxity . in some embodiments the constant has been empirically found to be in the range of 0 . 8 - 0 . 9 . fig1 and 12 are two views of the tibial component 70 with a scaling constant of 0 . 9 . the central anterior surface 73 is in contact with the femoral component in approximately 3 - 6 degrees of hyperextension , which will allow for variations between individuals , but also as a soft stop to prevent excessive hyperextension , as the femoral component rocks upwards as it extends further . the lateral bearing surface 71 is generally flat in an anterior - posterior direction , or with a shallow dishing of approximately 80 - 100 mm radius seen in the sagittal plane . this shallow region extends close to the posterior 74 . the medial bearing surface 72 is dished in the central region allowing only 2 - 4 mm of anterior - posterior displacement of the femur on the tibia . this dished region is shown as 75 . the posterior central region 77 makes contact with the femur in high flexion after approximately 90 degrees flexion . this region enhances the contact area providing a continuous contact with the tibial surface extending from the lateral to the medial condyle . as shown , the tibial component has no provision for a notch in the proximal tibia at the location of the posterior cruciate ligament . alternatively , a pcl notch can be provided in region 79 . the surface of central hump 78 ( which has been truncated ), is generated by conformal contact with the corresponding surface of the articulating femoral component . the slopes leading into the hump 78 are in smooth continuity with the surrounding bearing surfaces 71 , 72 , 73 , 77 . this allows for smoothness of internal - external rotation of the femoral surface on the tibial surface . a refinement of the sagittal sections ( sec ) of the tibial surface is shown schematically in fig1 a . it has been described that the tibial surface is generated from a multiplicity of positions of the femoral component and that part of the generation includes posterior displacements of the femoral component on the tibia so as to produce flat regions ff in the centers of the lateral and medial plateaus . the resulting section comprises an anterior circular segment having a first radius 80 , a flat center segment 81 , and a posterior circular segment having a second radius 82 . this can be refined ( shown dotted in fig1 a ) wherein the resulting section comprises an anterior circular segment having a first radius 83 , directly meeting a posterior circular segment having a second radius 85 , at location 84 . fig1 shows the femur 1 and femoral component 2 at 150 degrees of flexion . the femoral - tibial contact location 94 is close to the center of the tibia or a few millimeters posterior , as is the case for the anatomic knee . in the latter such high flexion is achieved by the posterior femur impacting the posterior horn of the medial meniscus , and levering over it . for a total knee this is not possible because of the rigidity of the materials . hence one solution , shown in fig1 , is to relieve the posterior of the tibial surface 93 . this relieved tibial surface 95 is defined by taking the continuous surface of the posterior femoral condyle 90 and the femur 92 , and subtracting the combined surface from the tibial component 93 . this subtraction can usually be carried out as shown , or for a femoral component where the posterior medial femoral condyle is extended superiorly . note the subtraction is best carried out with the femur in a range of displaced and rotated orientations to include all functional positions . in embodiments presented herein , the replacement of the function of the cruciates and the menisci of the anatomic knee , may be improved , so as to cause more normal medial pivot action , lateral femoral rollback in flexion , and roll - forward in extension . the embodiments herein presented incorporate features , in addition to those of the previous design , comprising retention of the intercondylar tibial eminences 78 and matching intercondylar femoral surfaces 22 . these features provide the required medial - lateral constraint and also help to generate some of the anatomic motion characteristics described above . a further advantage of using anatomic surfaces , especially on the femur , is that anatomic patella tracking will occur , important for quadriceps mechanics . the addition of the intercondylar guiding surfaces 22 , provides a more definitive guidance to the pivotal motion . the intercondylar guiding surfaces 22 cause the femur to displace posteriorly in flexion , but because of greater medial than lateral tibial dishing , most of the posterior displacement will occur on the lateral side , more closely resembling normal anatomic motion . the intercondylar guiding surface 22 is designed to be in contact with tibial eminence 78 throughout flexion , providing a smooth motion and continuous guidance to the motion . the surfaces are rounded and always have contacts over discrete areas , rather than being small ‘ point contacts ’ at corners or edges . the intercondylar guiding surfaces 22 may be configured to minimize the required bone resection . in embodiments , normal medial pivot action may be enhanced by making the antero - medial femoral surface steeper . femoral surface steepness may be increased by removal of material from the anterior portion of the medial condyle . this steeper medial condylar anterior surface when articulated with a correspondingly steeper anterior tibial surface , produces the desired anterior - posterior displacement stabilization . while the invention has been described with respect to preferred embodiments , those skilled in the art will readily appreciate that various changes and / or modifications can be made to the invention without departing from the spirit or scope of the invention as defined by the appended claims . all documents cited herein are incorporated by reference herein where appropriate for teachings of additional or alternative details , features and / or technical background .

0Human Necessities

this inventive embodiment uses a common everyday object and converted the object into a useful learning tool . the tool helps toddlers master the art of walking . this occurs since a horizontal bar can be repositioned at any level from the floor . in one case , providing an obstacle to step over , and in another case , providing a horizontal grip that the toddler can use to practice walking . in addition , the vertical grips can be adjusted in height to address the growth of the toddler . fig1 a illustrates a coffee table 1 - 1 . this is a typical coffee table with a rectangular top surface 1 - 2 of 5 by 1 . 5 feet standing 13 . 5 inches high . the table has 4 legs and cross support beams to bold the legs in place . fig1 b illustrates the invention where the table in fig1 a has been flipped into the upside down mode 1 - 3 with the top surface 1 - 2 of the table in contact with the floor . the table was flipped to expose the legs and cross support beams . this structure exposes the legs 1 - 4 to 1 - 7 and cross support beams 1 - 8 to 1 - 11 . two of the cross support beams 1 - 8 and 1 - 10 are 3 inches in height measured from the bottom surface of the table top 1 - 12 . the remaining two cross support beams 1 - 9 and 1 - 11 are 6 inches from the bottom surface of the table top . the flipped table was in the presence of a toddler 1 - 13 who became intrigued with the new structure . the toddler 1 - 13 approached the structure and attempted to step over the cross support beam 1 - 8 unaided . fig2 illustrates that the toddler 1 - 13 has failed to step over the cross support beam 1 - 8 and instead collapsed on their own legs . however , as fig3 illustrates , the toddler 1 - 13 refuses to give up and this time approached one of the legs 1 - 4 in the drawing 3 - 1 . the toddler grips onto the leg 1 - 4 and uses this leg as a support to cross over the cross support beam 1 - 8 as illustrated in the drawing 4 - 1 in fig4 . this time the toddler was successful and now was within the area corralled by the cross support beams as depicted in the drawing 5 - 1 in fig5 . in fig6 , the drawing 6 - 1 illustrates that the toddler 1 - 13 now uses the leg 1 - 5 as a grip to step over the cross support beam 1 - 10 and support the toddler . as the drawing 7 - 1 in fig7 shows , the toddler 1 - 13 is again successful . the toddler continued to repeat the process of stepping over the cross support beam using the legs as grips . each attempt showed improvement and the toddler continued playing with the table in the upside down mode until the toddler developed the confidence to attempt an independent stepping of the cross support beam again . fig8 illustrates the toddler preparing to perform an independent step over the cross support beam 1 - 8 as depicted in 8 - 1 . fig9 depicts the toddler 1 - 13 stepping their right foot over the cross support beam 1 - 8 unaided as indicated in 9 - 1 . fig1 shows the drawing 10 - 1 where the toddler has successfully stepped over the cross support beam . fig1 illustrates the toddler 1 - 13 stepping their right foot over the cross support beam 1 - 10 while the drawing in 12 - 1 of fig1 a shows that the toddler 1 - 13 has successfully negotiated the cross support beams at a height of 3 inches . fig1 b illustrates the table 1 - 1 being flipped 180 ° into the right side up mode and positioned next to the toddler 1 - 13 . interestingly , the table in the upside down mode presents itself as an inviting structure to the toddler which further enticed the toddler to seek further investigation . their first attempt of the toddler was to step over the cross support beam unaided , but ended up being unsuccessful . the legs appearing as “ grips ” provided support to the toddler while stepping over the cross support beams that were 3 inches high . the support that the grip gave to the toddler allowed the toddler to practice stepping over the cross support beam until the toddle developed the ability to step independently over the beam . once the toddler mastered this stepping , the table can be flipped right side up into the right side up mode and serve as the useful function of a coffee table . one embodiment of the invention is that a table can be flipped upside down into the upside down mode and serve as a tool to improve the kinematic of the leg movement of a toddler who is just learning to step over obstacles . once the step at the given height is mastered , the table can be flipped right side up into the right side up mode and used as a table again . another embodiment is to introduce height adjustment the cross support beams into the table 13 - 1 . fig1 a illustrates the table in the upside down mode where the cross support beam 13 - 6 can be positioned over the range of various heights 13 - 14 . this structure exposes the legs 13 - 2 to 13 - 5 and cross support beams 13 - 6 to 13 - 9 . three of the legs show a ball - like addition 13 - 10 to 13 - 12 added to the end of the leg ( not shown on the last leg to simplify drawing ). these serve to provide an easy grip for the toddler as well as providing a soft protection against the point of the leg if the toddler falls . in addition , the exposed components can be covered with protective foam so that a falling toddler would not hit any hard surfaces . the junction between a proposed cross support beam 13 - 13 and the leg 13 - 2 is highlighted by the dotted oval 13 - 15 . several possibilities are provided for the view 13 - 16 provided in fig1 a . the first possibility is illustrated using fig1 b through fig1 d that presents one way of adjusting the height of the cross support beam 13 - 13 . fig1 b presents one possibility of what can be inside the view 13 - 16 of fig1 a which shows the leg 13 - 2 a with perforated holes 13 - 17 . fig1 c illustrates the view 13 - 15 demonstrating the coupling of the leg 13 - 2 a with the cross support beam 13 - 13 a . a collar 13 - 19 that slides on the outside diameter of the leg 13 - 2 a couples the cross support beam 13 - 13 a to the leg . a sleeve 13 - 18 that moves back and forth as illustrated is used to adjust the height of the cross support beam 13 - 13 a . the detail of the mechanism is further depicted in fig1 d which shows the sleeve 13 - 18 pushed to the left by a spring loaded assemble ( not shown ) inside the sleeve 13 - 18 . this exposes the pin 13 - 21 which is inserted into one of the holes 13 - 17 in the leg 13 - 2 a . to adjust the cross support beam 13 - 13 a , the sleeve is pulled to the right against the spring loaded assembly causing the pin 13 - 21 to be withdrawn within the cross support beam 13 - 13 a thereby allowing the cross support beam 13 - 13 a to move vertically . the view of 13 - 15 of fig1 a as applied to another apparatus that can be used to adjust the height of the cross support beams is illustrated in fig1 a . the leg 13 - 2 b is coupled to the beam 13 - 13 b by the coupling unit 14 - 3 and adjusted by the sleeve 14 - 2 . the sleeve rotates clockwise to loosen and counter clockwise to tighten the cross support beam to the leg . the view 14 - 4 along the length of the leg is further illustrated in fig1 b . the sleeve 14 - 2 has a thread on the inside diameter that matches the thread 14 - 5 associated with the belt 14 - 6 . as the sleeve is turned counter clockwise the belt 14 - 6 tightens around the leg 13 - 2 b and develops a friction that prevents the vertical movement of the cross support beam 13 - 13 b . a pin or clamp 14 - 7 is used to hold the belt to the beam 13 - 13 b . another embodiment of cross support beam adjustment apparatus 14 - 8 is illustrated in fig1 c . the leg 13 - 2 c supports a bolt 14 - 9 ( exposed portion can be rubber coated ) whose shaft 14 - 10 has threads and connected to a nut 14 - 11 that is secured to the cross support beam 13 - 13 c . as the bolt is turned clockwise , the cross support beam 13 - 13 c is lifted . similarly , when turned counter clockwise , the beam 13 - 13 c lowers . a vertical slot assembly apparatus is illustrated in fig1 d and fig1 e . the view 13 - 16 of the leg in fig1 a for this additional embodiment is depicted in fig1 d as the drawing 14 - 13 . fig1 e illustrates the leg 13 - 2 d with the cross support beam 13 - 13 d having a hook structure 14 - 14 that engages into the slots illustrated in fig1 d . the height of the cross support beam is adjusted by positioning the beam 13 - 13 d into another slot of the leg 13 - 2 . a yet additional apparatus to attach the cross support beam 13 - 13 e to the leg 13 - 2 e is depicted in fig1 f . the cross support beam 13 - 13 e is coupled to a clamp that holds onto the leg 13 - 2 e . the clamp comprises a lower portion 14 - 15 that fits half way around the leg 13 - 2 e and is connected to a pin 14 - 16 . the pin 14 - 16 allows the upper portion 14 - 17 of the clamp to rotate around the pin 14 - 16 to form the clamp . a pin or screw 14 - 18 is used to tighten the upper portion of the clamp to the lower portion of the clamp so that the cross support beam is firmly coupled to the leg 13 - 2 e . another apparatus of a table flipped upside down 15 - 1 is illustrated in fig1 . the number of legs and cross support beams that are used can vary depending on the cost of the final product , the exercise that the apparatus is targeting in the toddler , and the area displaced by the table . the legs are 15 - 2 to 15 - 7 where each has a telescopic leg extension 15 - 8 to 15 - 11 . the leg extensions for legs 15 - 5 and 15 - 6 are not illustrated . each leg has a grip 15 - 12 to 15 - 17 . the cross support beams 15 - 18 to 15 - 24 can be adjusted by using one of the earlier presented adjustable assemblies . a toddler interactive electronic device 15 - 25 can be hung from one of the beams and provide a reward to the toddler if the toddler enters different segmented sections of the surface 15 - 26 . each of the cross support beams can be individually adjustable in height so that the toddler can be challenged as they master stepping over each obstacle or beam . once the cross support beams have a height that greater than the hip of the toddler , the cross support beam becomes a horizontal grip that the toddler can use to hold and either practice walking or master horizontal grip holding . a first embodiment of the telescoping leg is illustrated in fig1 a . the leg 15 - 7 has a sliding telescopic leg extension 15 - 11 that can be adjusted 16 - 2 by sliding the leg into the cavity and adjusting the length of the extension 16 - 3 . fig1 b illustrates a collar 16 - 4 that tightens the extension when rotated in the direction as shown . another apparatus to hold the extension is provided in fig1 c . the collar 16 - 5 is snapped tightened by the assembly 16 - 6 . once snapped , the collar immobilizes the extension to the leg . another apparatus for leg height adjustments is to screw extensions 16 - 7 to 16 - 11 onto the end of the legs . an example is illustrated in fig1 e which shows a short extension 16 - 11 screwed onto the end of the leg 15 - 7 . fig1 depicts the table 17 - 1 in the upside down mode having flat strips 17 - 2 to 17 - 8 coupling the tops of the legs together to provide additional strength . the table top is not shown for simplicity . a movable or positional step 17 - 10 is illustrated snapped to the horizontal beam 15 - 19 and can be used by the toddler to learn how to step up and to step down the positional step . the toddler can hold onto the grip 15 - 13 while learning the step movements . the positional step can be stored to a clip on the bottom surface of the table top . a 3 - d perspective view 17 - 9 of the corner of the table edge is presented is presented in fig1 a and fig1 b . the flat strips 17 - 4 and 17 - 3 have slots that accept the other . an attachment ( rivet , screw , bolt ) 18 - 1 in fig1 a couples both flat strips 17 - 4 and 17 - 3 to the leg 15 - 3 . a press fitted assembly 18 - 2 with a lip 18 - 3 is presented in fig1 b . the entire assemble can be press fitted together until the lip of the assembly snaps into place within the leg 15 - 3 . the upside down table in fig1 can be flipped right side up as shown by 19 - 1 and as illustrated in fig1 and stood on the legs to provide a table surface 15 - 26 for the toddler . note that the height of the table can be adjusted as the toddler grows . besides adjusting all legs to the same height , the legs can be adjusted to make a slanting table to allow the toddler to draw pictures where the toddler &# 39 ; s back is less curved . the table with a flat surface in the right side up mode and a slope of the flat surface can be adjusted by varying the length distribution of the telescopic legs finally , it is understood that the above description is only illustrative of the principles of the current invention . it is understood that the various embodiments of the invention , although different , are not mutually exclusive . in accordance with these principles , those skilled in the art may devise numerous modifications without departing from the spirit and scope of the invention . the toddler gym can use electronic motors to turn any screws in the supports such that the length of the legs or height of the cross support beams can be adjusted by mechanical gears drive by electronic motors . the toddler gym can have at least one processor comprising a cpu ( central processing unit ), microprocessor , multi - core - processor , dsp , a front end processor , or a co - processor . all of the supporting elements to operate these processors ( memory , disks , monitors , keyboards , power supplies , etc ), although not necessarily shown , are known by those skilled in the art for the operation of the entire system .

6Physics

in the figures , identical or functionally identical parts or light beams are provided with the same reference symbols . the embodiment of a device 1 according to the invention depicted in fig1 is used for applying light 4 to an inner surface 2 of a schematically illustrated cylinder 3 . in particular , a circular focus area 5 is to be formed with the device 1 according to the invention on the inner surface 2 of the cylinder 3 . the device 1 is in the illustrated embodiment located inside the cylinder 3 . in the illustrated embodiment , the device 1 includes four light sources 6 which may , for example , be the ends of optical fibers , wherein laser light can be coupled into the optical fibers . the light 4 emanating from the light sources 6 ( see exemplary distribution with three light sources in fig1 ) is collimated by collimating means 7 ( see exemplary distribution with three light sources in fig1 ) and reflected by mirrors 8 onto compressing means 9 , wherein the compressing means 9 are realized by a reflective four - sided pyramid . fig1 shows an exemplary distribution for three light sources downstream of the compressing means 9 . the device further includes a cone 10 with a reflective outer surface onto which the compressed light 4 is reflected by the pyramid . starting from this cone 10 , the light 4 is directed radially outwards onto the reflective inner surface of a hollow cone 11 where the light is reflected upwardly in fig1 , so that the light 4 now propagates again in the axial direction of the cylinder 3 . the cone 10 with the reflective outer surface and the hollow cone 11 with the reflective inner surface together form beam expansion means configured to expand and shape the light 4 so that the beam cross - section of the light has off - center an intensity maximum or several intensity maxima . in this context , see the exemplary distribution with three light sources in fig2 . a first embodiment of a beam transformation device 12 according to the invention is arranged downstream of the hollow cone 11 in the propagation direction of the light 4 . the beam transformation device 12 is shown again in more detail in fig9 . the beam transformation device 12 includes a plurality of cylindrical lens arrays 121 , each having a plurality of cylindrical lenses 122 . the individual cylindrical lens arrays 121 are arranged in a ring . each of the cylinder axes z of the cylindrical lenses 122 is oriented approximately at an angle γ of 45 ° relative to the radial direction r of the ring . the individual cylindrical lenses 122 are formed , for example , as biconvex lenses with a convex surface on the entrance side and a convex surface on the exit side of the beam transformation device 12 . here , the mutual distance of these two convex surfaces to each other corresponds in particular to the sum of the focal lengths of these two convex surfaces or to twice the focal lengths of the convex surfaces if the focal lengths are equal . each of the cylindrical lenses 122 then forms a kepler telescope . fig7 and fig8 each show respective schematic views illustrating the unit vectors of sub - beams of the light 4 in a projection onto a plane perpendicular to the mean direction of propagation of the light 4 before entering into and after exiting from the beam transformation means 12 . as can be seen , the unit vectors are rotated by 90 ° by the cylindrical lenses that are oriented at an angle of 45 ° relative to the radial direction . this adds a sagittal component to the previously collimated sub - beams of the light 4 . fig3 to fig5 illustrate this relationship . fig3 to fig5 show distributions of beam trajectories in a projection onto a plane perpendicular to the cylindrical axis of a cylindrical medium in which the light propagates . fig3 illustrates a distribution typical for meridional rays and fig4 shows a distribution of beam trajectories typical for sagittal rays . the sub - beams of the light 4 have for full collimation essentially only a meridional component . when passing through the beam transformation device 12 , a sagittal component is added to the sub - beams of the light 4 . such distribution having a sagittal component is shown in fig5 . another hollow cone 13 with a reflective inner surface is arranged in the propagation direction of light 4 downstream of the beam transformation device 12 . the light 4 is reflected at the inner surface of the hollow cone 13 toward a homogenizing means 14 , as shown schematically in fig6 . the homogenizing means 14 is constructed as a hollow cylinder with a reflective , patterned inner surface 15 . the patterns of the inner surface 15 are concave cylinder sections with cylinder axes extending parallel to the cylinder axis of the hollow cylinder . the concave cylinder sections are arranged consecutively in the circumferential direction of the hollow cylinder . the homogenizing means 14 can be significantly longer than shown in the schematic diagram of fig6 . the light 4 is homogenized in the homogenizing means 14 by multiple reflections on the inner surface 15 so as to produce substantially the same intensity along the entire circular focus area 5 . the homogenization is enhanced by admixing to the light 4 with the beam transformation device 12 a sagittal component , as described with reference to fig3 to fig5 . fig2 illustrates how low the homogeneity is without the beam transformation device 12 . in contrast , fig2 shows a very homogeneous distribution of the light 4 across the circular focus area 5 . fig2 shows how low the homogeneity is without the homogenizing means 14 . in contrast , fig2 shows a very homogeneous distribution of the light 4 across the circular focus area 5 . the patterning of the homogenizing means 14 also ensures good homogenization of the circular focus area 5 on the inner surface 2 of the cylinder 3 . the light 4 exiting from the homogenizing means 14 is focused by a lens means acting as a focusing means 16 onto the inner surface 2 of the cylinder 3 onto which light 4 is to be applied . the lens means 16 is formed in particular as a toroidal lens means 16 producing a circular focus area 5 on the inner surface 2 of the cylinder 3 . the toroidal lens means 16 includes a peripheral torus - shaped outer surface 17 , by which the light 4 is refracted such that the light 4 is focused on the inner surface 2 of the cylinder 3 . the second embodiment shown in fig2 differs from the first embodiment shown in fig1 in that a mirror means 18 also operating as a focusing means is employed instead of the lens means 16 . the mirror means 18 is constructed in particular as a toroidal mirror means 18 , so that the toroidal mirror means 18 also produces a circular focus area 5 on the inner surface 2 of the cylinder 3 . in this case , the toroidal mirror means 18 has a reflective toroidal inner surface 19 , by which the light 4 is reflected onto the inner surface 2 of the cylinder 3 . fig1 and fig1 show a second embodiment of a beam transformation device 20 according to the invention . this second embodiment includes two consecutively arranged cylindrical lens arrays 21 , 22 , wherein the cylinder axes of the cylindrical lenses 23 , 24 of these cylindrical lens arrays 21 , 22 enclose an angle of 45 ° with one another . also in this embodiment , the individual cylindrical lenses 23 , 24 are each formed for example as biconvex lenses with a convex surface on the entrance side and a convex surface on the exit side of the beam transformation device 20 . the mutual distance between these two convex surfaces to each other corresponds in particular to the sum of the focal lengths of these two convex surfaces or to twice the focal length of the convex surfaces if the focal lengths are equal . each of the cylindrical lenses 23 , 24 forms hereby a kepler telescope . in fig1 , the azimuth angle of an incident light beam is denoted by a 1 , and the azimuth angle of the exiting light beam by a 3 . a 2 indicates the azimuth angle of the light beam after exiting from the first cylindrical lens array 21 . furthermore , fig1 shows the directions z 23 and z 24 of the cylinder axes of the cylindrical lenses 23 , 24 of the cylindrical lens arrays 21 , 22 . these enclose an angle of 45 ° with each other . fig1 illustrates how the azimuth angle of a light beam passing through the beam transformation device 20 is rotated by the two cylindrical lens arrays 21 , 22 together by 90 °. in this case , the angle α between the azimuth angle a 1 and the direction z 23 is transformed by the first cylindrical lens array 21 by an angle − α . thereafter , the angle β between the azimuth angle a 2 and the direction z 24 is transformed by the second cylindrical lens array 22 by an angle − β . accordingly , due to the angle of 45 ° between the directions of z 23 and z 24 of the cylinder axes of the cylindrical lenses 23 , 24 , the azimuth angle of the light beam passing through the beam transformation device 20 is rotated by 90 °. fig1 shows another embodiment of a beam transformation device 25 , which is constructed similar to the beam transformation device 20 shown in fig1 and fig1 , but includes four instead of two cylindrical lens arrays . in particular , two first cylindrical lens array 21 and two second cylindrical lens arrays 22 , which are arranged consecutively in the propagation direction of the light , are provided in the beam transformation device 25 .

6Physics

the following description of the preferred embodiment is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . for purposes of clarity , the same reference numbers will be used in the drawings to identify similar elements . as used herein , the term “ module ” refers to an application specific integrated circuit ( asic ), an electronic circuit , a processor ( shared , dedicated , or group ) and memory that execute one or more software or firmware programs , a combinational logic circuit , and / or other suitable components that provide the described functionality . referring to fig1 , an exemplary vehicle 10 includes an engine 12 , a transmission 14 , and an engine control module ( ecm ) 16 . the operation of a two - step switching roller finger follower ( srff ) mechanism 28 is controlled by a control valve ( cv ) 30 that controls a fluid supply ( not shown ) to a hydraulic lash adjuster 29 . the ecm 16 monitors the operation of the vehicle 10 using various engine sensors . the ecm 16 communicates with a fluid pressure sensor 18 , an engine speed sensor 22 , an engine voltage sensor 24 , and an engine temperature sensor 26 . the fluid pressure sensor 18 generates a signal indicating the fluid pressure within a hydraulic lash adjuster 29 fluid gallery ( not shown ), and the engine speed sensor 22 generates a signal indicating engine speed ( rpm ). in various embodiments , the fluid pressure sensor 18 can be positioned in other fixed engine fluid galleries including but not limited to a cam phaser gallery ( not shown ). the engine voltage sensor 24 generates a signal indicating the operating voltage of the engine electric system , and the engine temperature sensor 26 generates a signal indicating the operating temperature of the engine . the ecm 16 includes memory 20 that stores a look - up table 50 , as depicted in fig4 , for utilization in commanding the cv 30 to switch the operating mode of the srff mechanism 28 . in various embodiments , rather than switching among operating modes of the srff mechanism 28 , specific operating modes of the srff 28 may be commanded to be deactivated from operation . such embodiments are known in the art and include but are not limited to valve deactivation systems . referring now to fig2 and 3 , a switching roller finger follower ( srff ) mechanism 28 is schematically depicted . it is appreciated that the srff mechanism 28 is merely exemplary in nature . the srff mechanism 28 includes an inner arm assembly 150 and an outer arm assembly 152 which are pivotably joined by a pivoting pin 154 . the inner arm assembly 150 includes a low - lift contact 156 which interfaces with a low - lift cam lobe ( not shown ) of a camshaft ( not shown ). the outer arm assembly 152 includes a pair of high - lift contacts 158 a , 158 b as depicted in fig2 , that are configured for contact with a pair of high - lift cams lobes ( not shown ) of the camshaft and are positioned on either side of the low - lift contact 156 . the inner arm assembly 150 defines a cavity 160 in which a portion of a hydraulic lash adjuster ( not shown ) can be inserted and about which the inner arm assembly 150 may also pivot . as depicted in fig3 , a locking pin housing 162 contains locking pins 164 a , 164 b . the locking pins 164 a , 164 b restrict the independent movement of the outer arm assembly 152 from the inner arm assembly 150 about the pivoting pin 154 when the locking pins 164 a , 164 b are in an engaged position . the end faces 165 a , 165 b of locking pins 164 a , 164 b , respectively exist in fluid communication with a source of fluid pressure 166 such as a fluid supply ( not shown ). the fluid supply is fed from the hydraulic lash adjuster ( not shown ) to the locking pin housing 162 through a fluid supply hole 168 . the fluid supply from the hydraulic lash adjuster is controlled by a solenoid or cv , as depicted in fig1 at 30 . at predetermined engine operating ranges , the ecm , as depicted in fig1 at 16 , can cause the cv 30 to switch the fluid supply of the hydraulic lash adjuster from a lower pressure ( p 1 ) ( not shown ) to a higher pressure ( p 2 ) ( not shown ) within the locking pin housing 162 . when fluid pressure ( p 2 ) is sufficiently high , the pressure exerted on the locking pins 164 a , 164 b is sufficient to overcome the resistance provided by the springs 170 a , 170 b resulting in the locking pins 164 a , 164 b being extended from their retracted position ( shown ) to an engaged position ( not shown ). while the locking pins 164 a , 164 b are in an engaged position , the outer arm assembly 152 is locked to the inner arm assembly 150 and causes the valve ( not shown ) to follow the high lift cam ( not shown ) that interfaces with the high - lift contacts 158 a , 158 b . fig3 depicts the srff mechanism 28 configured to operate in low - lift mode . in “ normal ” ( fluid pressure supply at p 1 ) operation , or “ low - lift ” mode , the low lift cam lobe causes the inner arm assembly 150 to pivot to a second position in accordance with the low - lift cam &# 39 ; s prescribed geometry and thereby open a valve ( not shown ) a first predetermined amount . in various embodiments , a different low mode lift profile may exist for each of the adjacent valves in any given cylinder . the pressure inside the locking pin housing 162 is sufficiently low such that the locking pins 164 a , 165 b remain in the retracted position . the low pressure fluid supply ( p 1 ), which enters the inner arm assembly 150 at the cavity 160 and is fed through the hydraulic lash adjuster , is of insufficient pressure to compress the spring 170 and cause the locking pins 164 a , 164 b to engage in order to lock the inner arm assembly 150 for motion dependent on the outer arm assembly 152 . in this condition , the valve ( not shown ) moves due to the low lift cam ( not shown ) interfacing with the low - lift contact on the inner arm ( 150 ). in a high - lift mode ( not shown ), the ecm 16 instructs the cv 30 to increase the fluid pressure in the locking pin housing 162 to a higher pressure state ( p 2 ) sufficiently such that the locking pins 164 a , 164 b compress the springs 170 a , 170 b , respectively and is in an engaged position resulting in the outer arm assembly 152 being locked to the inner , low lift arm 150 and thus prevented to independently pivot about the pivoting pin 154 . the outer arm assembly 152 pivots to a third position in accordance with the high - lift cam lobe geometry causing the valve to open to a second predetermined amount greater than the first predetermined amount . the present invention recognizes that in various embodiments , switching the fluid supply from p 1 to p 2 can cause the locking pins 164 a , 164 b to retract and therefore disengage the outer arm assembly 152 from the inner arm assembly 150 and prevent the valve ( not shown ) from following the high lift cam ( not shown ) that interfaces with the high - lift contacts 158 . additionally , the present invention envisions further embodiments that may require maintaining a fluid supply at a pressure state of p 2 in which p 2 represents “ normal ” operation of the srff mechanism 28 . in such embodiments , the ecm 16 instructs the cv 30 to decrease the fluid pressure in the locking pin housing 162 to a lower pressure state ( p 1 ) in order to engage or disengage the locking pins 164 a , 164 b . the present invention further envisions an embodiment having a single locking pin 164 serve to engage the outer arm assembly 152 . referring now to fig4 , a hydraulic control system 32 includes monitoring and transmitting signals received from engine sensors including but not limited to the engine speed sensor 22 , the engine voltage sensor 24 , and the engine temperature sensor 26 . a two - step change flag 34 indicates that the engine requires a change in the lift mode of the srff mechanism 28 to maintain appropriate engine operation . a srff positioning module 38 monitors the two - step change flag 34 and compares the measured engine operating speed , rpm op , received from the engine speed sensor 22 to a predetermined rpm range . if the value of rpm op is within the predetermined rpm range and the two - step change flag 34 is set , the srff positioning module 38 enables the cv command module 40 . the command module 40 commands the cv 30 to change its state of operation by generating and transmitting a state change command to the cv 30 . in accordance with the state change command , the cv 30 switches the fluid supply provided to the locking pin housing 162 via the hydraulic lash adjuster from a low pressure state ( p 1 ) to a higher pressure state ( p 2 ). when the command module 40 commands the cv 30 to change its state , a timer module 42 stores the clock time of this command as t a . a comparison module 44 monitors the fluid pressure sensor 18 and compares the pressure within the fluid gallery of the hydraulic lash adjuster 29 to a predetermined pressure threshold . when the comparison module 44 detects a signal from the fluid pressure sensor 18 that the pressure exerted by the fluid supply within the fluid gallery of the hydraulic lash adjuster 29 has exceeded or fallen below a predetermined threshold , the timer module 42 stores this second clock time as t b . the timer module 42 then calculates the time difference between t a and t b as the time response , t act , of the cv 30 to the change of state command . an update module 46 receives signals from the engine speed sensor 22 , the engine voltage sensor 24 , and the engine temperature sensor 26 indicating the engine operating condition . the update module 46 then retrieves a desired time , t des , of the cv 30 from a lookup table 50 that corresponds to the engine operating condition sensed by the update module 46 . the update module 46 compares the value of t act to t des . if the value of t act has exceeded a predetermined time range about t des , the update module 46 assigns a new value to t des by setting t des equal to t act and stores the new value t des in the look - up table 50 as a function of the engine operating condition . referring now to fig5 , the hydraulic control system 32 will be described in further detail . in step 100 , if the engine 12 is turned on , the ecm 16 will be operational and proceed to step 102 . if the engine is not turned on , the ecm 16 will not be operational and the hydraulic control system 32 will not be initiated . in step 102 , the srff positioning module 38 determines whether the engine is operating within a predetermined rpm range . the predetermined rpm range is an engine and mechanism specific range . if the engine operating speed , rpm op , is not within the predetermined rpm range , the process ends . if the rpm op is within the predetermined rpm range , the srff positioning module 38 , in step 104 , determines whether a two - step change flag 34 is set indicating that the engine requires a change in the lift mode of srff mechanism 28 . if a position change of the srff mechanism 28 is not required and the two - step change flag 34 is not set , the process ends . if the two - step change flag 34 is set , the srff positioning module 38 enables the command module 40 . in step 106 , the command module 40 generates and transmits a state change command directing the cv 30 to change its state of operation by switching the fluid supply provided to the locking pin housing 162 from either a low pressure state ( p 1 ) to a higher pressure state ( p 2 ) or from p 2 to p 1 . additionally in step 106 , the timer module 42 stores the time of the sate change command as a first time , t a . in step 108 , when the comparison module 44 detects that the pressure exerted by the change in fluid supply has either exceeded or fallen below a predetermined pressure threshold within the locking pin housing 162 , the timer module 42 stores the corresponding time as a second time , t b . in step 110 , the timer module 42 calculates the time difference between t a and t b as t act . the response time of the hydraulic control system 32 is based on t act . in step 112 , the update module 46 determines the engine operating condition by monitoring the engine speed sensor 22 , the engine voltage sensor 24 , and the engine temperature sensor 26 . in step 114 , the update module 46 retrieves a desired time of the hydraulic control system 32 , t des , from a look - up table 50 that corresponds to engine operating condition in step 112 . in step 116 , the update module 46 compares the value t act t to t des . if the update module 46 determines that t act is within a predetermined time range , about t des , the process ends . if the update module 46 determines that t act t has exceeded the predetermined time range about t des , the update module 46 assigns a new value to t des by setting t des equal to t act in step 118 . in step 120 , the look - up table 50 stores the value t des as a function of the engine operating point read in step 112 . the process ends in step 122 . important to note is that the applicability of the present invention is not limited to embodiments that employ srff technology but is additionally applicable to valve train technologies that utilize a cv to control the activation of a hydraulic system to regulate valve events . such valve train technologies include but are not limited to displacement on demand technologies and other related vva technologies . additionally , the scope of the invention is not limited to embodiments that solely implement engine component or system control valves . the current invention is applicable to various systems that employ valve control operations including but not limited to transmission torque converters , clutches and brakes . those skilled in the art can now appreciate from the foregoing description that the broad teachings of the present invention can be implemented in a variety of forms . therefore , while this invention has been described in connection with particular examples thereof , the true scope of the invention should not be so limited since other modifications will become apparent to the skilled practitioner upon a study of the drawings , the specification and the following claims .

5Mechanical Engineering; Lightning; Heating; Weapons; Blasting

with reference first to fig1 an apparatus 2 for recycling oil filters may be incorporated into a cabinet 4 mounted on casters 6 , enabling the apparatus 2 to be moved readily from place to place . in the lower half of the cabinet 4 is a compartment , access to which is gained by opening door 8 , where receptacles for collecting used oil obtained by crushing the oil filters and the crushed filters themselves may be placed . in the upper half of the cabinet 4 , covered with panel 10 secured by screws 12 in fig1 is the mechanism which crushes the oil filters . shown in fig1 are a button 14 to activate the mechanism , and a light 16 to indicate the mechanism has been so activated . finally , in fig1 a crushing compartment 18 and a crank 20 , by which crushed oil filters may be removed from the crushing compartment 18 , are visible . turning now to fig2 the apparatus 2 is shown following the removal of panel 10 and the opening of door 8 . in the lower half of the cabinet 4 , the receptacles 22 for oil and crushed oil filters are shown , that for the oil being directly below the crushing compartment 18 . in the upper half of the cabinet 4 , in addition to elements previously mentioned above , are shown in the crusher plate 24 , and the means 26 for moving the crusher plate 24 to crush an oil filter within crushing compartment 18 and to withdraw the crusher plate 24 after an oil filter has been crushed . crank 20 has been removed to permit panel 10 to be removed from cabinet 4 . also shown in fig2 are a stop plate 25 and a spring 27 , the purpose of both of which will be set forth hereinbelow . the present invention is an improvement for an apparatus 2 of this variety . the improvement itself resides in the crushing compartment 18 itself , shown in greater detail in fig3 and 4 . fig3 is a front view of the crushing compartment 18 , and includes , for completeness , crank 20 in its proper position . the crushing compartment 18 is defined by four side walls 28 and a base 30 . crusher plate 24 , not a part of the crushing compartment 18 of the present invention , is shown in its fully retracted , or raised , position by a dashed - line outline . one of side walls 28 has a door 32 for access to the interior of the crushing compartment 18 , as shown in fig3 . the door 32 may be mounted on hinges 34 , and may be provided with a knob 36 and a latch 38 . with reference now to fig4 a sectional view of the crushing compartment 18 , also showing stop plate 25 and crusher plate 24 , another of the side walls 28 is separated from the base 30 to provide a first opening 40 in the crushing compartment 18 for removing a crushed oil filter therefrom without opening door 32 . first opening 40 extends for the width of the base 30 . a u - shaped member 42 is disposed on the base 30 . the u - shaped member 42 has a base 44 with a width substantially equal to the width of base 30 , and has arms 46 extending from base 44 . the arms 46 have a length greater than the length of base 30 , so that they extend out through first opening 40 when the base 44 of the u - shaped member 42 is adjacent to the side wall 28 opposite the first opening 40 . side wall 28 opposite the first opening 40 may be provided with a second opening 48 , which , like first opening 40 , extends for the width of the base 30 to accommodate the base 44 of the u - shaped member 42 . arms 46 may be disposed in recesses 49 adjacent to the base 30 in the other two side walls 28 , so that they may not be damaged by crusher plate 24 . a plate - like member 50 , attached to the arms 46 of the u - shaped member 42 and extending therebetween in a direction substantially parallel to the base 44 of the u - shaped member 42 , may be used to substantially cover first opening 40 from outside the crushing compartment 18 when the base 44 of the u - shaped member 42 is adjacent to the side wall 28 opposite the first opening 40 , that is , when an oil filter is in the process of being crushed in the crushing compartment 18 . a pair of oil filters 51 are also shown resting on base 30 of crushing compartment 18 . the base 30 of crushing compartment 18 may be provided with a plurality of holes 52 , so that used oil from a crushed oil filter may drain therethrough from the crushing compartment 18 . holes 52 are also shown in the enlarged sectional view , taken as indicated by line 5 -- 5 in fig4 provided in fig5 . it may also be seen in fig5 that arm 46 is disposed in a recess 49 adjacent to the base 30 in side wall 28 , and that base 44 of u - shaped member 42 may pass through second opening 48 in the other side wall 28 . the u - shaped member 42 may be moved back and forth across the base 30 to sweep a crushed oil filter from the crushing compartment 18 through first opening 40 as follows . above first opening 40 on side wall 28 are mounted a first and a second axle - holding member 54 , each having a hole to accommodate axle 56 . a first and a second elongated members 58 extend from axle 56 , to which they ar rigidly affixed adjacent to the first and second axle - holding members 54 , respectively , down to the arms 46 of the u - shaped member 42 . each of the first and second elongated members 58 is attached to an arm 46 of u - shaped member 42 by such means as a nut 60 and bolt 62 . finally , crank 20 is also rigidly affixed to axle 56 , although for the sake of clarity this is not shown in fig4 . referring together to fig4 and 6 , the latter of which shows the removal of a crushed oil filter 53 from crushing compartment 18 , it should now be clear how the present invention operates . by turning crank 20 , which , it will be recalled , is disposed outside panel 10 on apparatus 2 in fig1 and which is attached to axle 56 , in a clockwise direction , first and second elongated members 58 pull arms 46 of u - shaped member 42 to the left in fig4 thereby sweeping the base 44 of u - shaped member 42 across base 30 of crushing compartment 18 to remove any crushed oil filter 53 therefrom through first opening 40 , and to sweep any remaining oil , which has not drained through passages 52 , toward first opening 40 from which it may drip into one of the receptacles 22 disposed therebelow . thereafter , turning crank 20 in a counterclockwise direction will restore the crushing compartment 18 to the configuration shown in fig4 . referring again to fig4 and 6 , it may now be observed that stop plate 25 , which is mounted adjacent to crushing compartment 18 in cabinet 4 in fig2 prevents u - shaped member 42 from being completely withdrawn from crushing compartment 18 when crank 20 , which is attached to axle 56 , is turned in a clockwise direction . further , referring again to fig2 spring 27 may be extended between a fixed member of cabinet 4 to bolt 64 . as may be observed in fig4 and 6 , bolt 64 is attached to axle 56 . when crank 20 is turned in a clockwise direction to clear crushing compartment 18 of a crushed oil filter 53 , spring 27 will be stretched beyond its normal length . spring 27 will thereby generate a restoring force , which will help to return u - shaped member 42 completely within the crushing compartment 18 , thereby restoring the crushing compartment 18 to the configuration shown in fig4 . modifications to the above would be obvious to those skilled in the art without bringing a device so modified beyond the scope of the appended claims .

8General tagging of new or cross-sectional technology