Datasets:
ManuelAlv
/
Cancer

Dataset card Data Studio Files Community
1
input
stringlengths
600
32.7k
label
stringclasses
3 values
"The presence of 3R/3R polymorphism seemed to predict a higher ORR (100%) compared to the rest of the genotypes with a trend toward statistical significance (p =?0.055). In the subgroup analysis a significantly higher ORR to pemetrexed for wild-type EGFR patients showing a 3R/3R genotype (100%) compared to the 2R/2R (77.8%) 2R/3R (33.3%) and 3R/4R (0%) was observed (p =?0.017). Overall response rate to the treatment and polymorphisms observed Global distribution of polymorphisms (Pol) Response N (%) Stabilization or progression N (%) p value VNTR 2R/2R 7 (77.8) 2 (22.2) 0.055 3R/3R 7 (100) 0 (0) 2R/3R 4 (50) 4 (50) 3R/4R 0 (0) 1 (100) Pol VNTR (Subanalysis by EGFR status; group of native EGFR-patients) 2R/2R 7 (77.8) 2 (22.2) 0.017 3R/3R 7 (100) 0 (0) 2R/3R 2 (33.3) 4 (66.7) 3R/4R 0 (0) 1 (100) Global distribution of SNP Absence 6 (85.7) 1 (14.3) 0.626 Presence 12 (66.7) 6 (33.3) Global distribution of polymorphisms in 3?-UTR +6/+6 10 (83.3) 2 (16.7) 0.234 +6/-6 6 (54.5) 5 (45.5) -6/-6 2 (100) 0 (0) Pol 3?-UTR (Subanalysis by smoking habit stratification; group of active and former smokers) +6/+6 8 (100) 0 (0) 0.085 +6/-6 4 (50) 4 (50) -6/-6 2 (100) 0 (0) No statistically significant differences were observed comparing the presence and the absence of a SNP G >?C as shown in . Overall a non-significant correlation between the different 3?-UTR polymorphisms and the ORR was observed. However the genotype +6/+6 seemed to predict a higher ORR among active/former smokers (A/FS) compared to +6/-6 (100% vs. 50%; p =?0.085). Correlation between PFS and polymorphisms Regarding TSER polymorphisms we found a trend toward statistical significance (p =?0.089) in the differences in PFS observed among the different genotypes in favor of the 3R/3R genotype (A). Kaplan-Meier curves for progression-free survival (PFS) in months (mo) associated with the different TS polymorphisms. A: TSER genotypes. B: Presence or absence of SNP. C: 3´UTR genotypes. In the case of the absence or presence of a SNP at the third repetition (3R allele) we observed a non-significant increased PFS in the subgroup of patients showing an absence of SNP (B). Finally no significant correlations regarding the 3?UTR genotypes and PFS were observed (C). Correlation between OS and polymorphisms In this cohort we found a significant correlation between TSER polymorphisms and OS (A). The median OS was not reached for 3R/3R genotype patients whereas 2R/3R genotype subjects showed a 70 m OS followed by 3R/4R and 2R/2R genotypes with a median OS of 15 m and 13 m respectively (p =?0.019) (A). Kaplan-Meier curves for overall survival (OS) in months (mo) associated with the different TS polymorphisms. A: TSER genotypes. B: Presence or absence of SNP. C: 3´UTR genotypes. No significant differences in OS were observed with regards to the presence/absence of SNP (B) or regarding the 3?-UTR polymorphisms (C). Correlation between toxicity and polymorphisms The most frequent toxicity was grade (G)1 anemia (28%) and nausea (20%) and G2 leucopenia (40%). The most commom G3-4 toxicities were leucopenia (16%) asthenia (8%) anemia (4%) neutropenia (4%) and dyspnea (4%). Overall we found no significant correlations between the toxicity profiles experienced by the patients and the different TS genotypes (). Correlation between grades of toxicity and different genotypes Global distribution polymorphisms (Pol) No toxicity Grade 1-2 Grade 3-4 p value VNTR polymorphisms 2R/2R 2 (22.2) 4 (44.2) 3 (33.4) 0.545 3R/3R 2 (25) 5 (75) 0 (0) 2R/3R 2 (25) 4 (50) 2 (25) 3R/4R 1 (100) 0 (0) 0 (0) SNP polymorphisms Absence 3 (42.9) 4 (57.1) 0 (0) 0.3 Presence 4 (22.2) 9 (50) 5 (27.8) 3?-UTR polymorphisms +6/+6 3 (25) 6 (50) 3 (25) > 0.05 +6/-6 3 (27.3) 6 (54.5) 2 (18.2) -6/-6 1 (50) 1 (50) 0 (0) Discussion Pemetrexed a multitargeted antifolate drug is essential for the first and second-line as well as maintenance treatment of NSCLC patients with non-squamous histology [6]. TS is the main biological target of pemetrexed. Some studies have suggested that TS expression could be a predictive factor of response in NSCLC [19]. Moreover some VNTR genotypes have been associated with TS expression and activity in other tumor types such as colorectal cancer [17]. In NSCLC patients a correlation between different genotypes and the TS protein expression has been shown [20]. Shintani et al. [20] also confirmed that the TS mRNA levels were significantly higher in lung cancer tissues with the 3R/3R genotype as compared to those with the 2R/2R genotype. Nonetheless definitive studies addressing the correlation of the different genotypes of TS in circulating genomic DNA with response to the treatment PFS or OS in pemetrexed-treated NSCLC European patients are lacking. The potential influence of the EGFR status on those polymorphisms and their correlation with clinical outcome after pemetrexed-based treatment is also unexplored. A recent study by Hu et al. [21] investigated the different TS polymorphisms in genomic DNA of 90 Asian NSCLC patients. In contrast with our findings no specific genotype regarding the TSER or 3?-UTR polymorphisms studied seemed to correlate with a significant difference in ORR PFS or OS. This could be explained by substantial clinical differences between both populations. Our cohort was constituted by Caucasian patients compared to the Asian population studied by Hu et al. In addition our patients were mostly current or former smokers (72%) compared to the Asian population that showed 62% of never smokers. Also in our cohort the subjects mainly received pemetrexed-based chemotherapy as a first line regimen (92%) whereas the cohort studied by Hu et al. [21] was treated with pemetrexed as a second or further line in 62.2% of the cases. These remarkable differences in basic clinical characteristics and in particular the ethnicity between both cohorts are probably also explaining the differences observed in the 3?-UTR genotype frequency between our population and the one studied by Hu et al. In our cohort +6 bp/+6 bp +6 bp/-6 bp and -6 bp/-6 bp genotypes were found in 48% 44% and 8% of the cases respectively. In contrast0.078 47.8% and 44.4% were respectively found in the population studied by Hu et al. [21]. In a previous analysis performed on another Caucasian NSCLC population evaluated at the M.D. Anderson Cancer Center [22] a similar proportion of 3?-UTR genotypes according to our findings was observed (49.2% of +6 bp/+6 bp 42.4% of +6 bp/-6 bp and 8.4% of -6 bp/-6 bp). Additionally the low prevalence of the +6 bp/+6 bp genotype in an Asian population compared to our cohort may be confirmed by a recent study in which from 106 Asian NSCLC patients investigated none of them showed a +6 bp/+6 bp genotype in genomic circulating DNA [23]. Nontheless in this latter study [23] a significantly higher ORR was observed among patients showing a -6 bp/-6 bp 3?-UTR genotype compared to the ORR reported for patients presenting a -6 bp/+6 bp polymorphism (32.2% vs 12.7%; p =?0.008). Accordingly in our cohort a higher ORR in patients showing a -6 bp/-6 bp genotype compared to those presenting a -6 bp/+6 bp polymorphism was also observed (100% vs. 54.5%). However the statistical significance was not reached probably due to the relatively low number of patients included in our analysis. Interestingly enough in the subgroup analysis of our data the +6 bp/+6 bp genotype seemed to predict a higher ORR only among active/former smokers compared to +6 bp/-6 bp (100% vs. 50%; p =?0.085). This novel observation if validated in future studies could be relevant for selecting specific drugs for each patient in a second or third line setting. With regards to the TSER polymorphisms the presence of a 3R/3R polymorphism seemed to predict a higher ORR with a clear trend toward statistical significance (p =?0.055). Moreover that difference was even greater and statistically significant benefiting the subpopulation of wild-type EGFR patients. To our knowledge this is the first time that such observation has been made. An interesting preclinical study by Giovannetti et al. [24] investigated the activity profile of a combination therapy against NSCLC cell lines with different genotypes with erlotinib and pemetrexed. Remarkably pemetrexed increased EGFR phosphorylation and reduced Akt phosphorylation. Additionally erlotinib significantly reduced TS expression and activity. Thus when erlotinib and pemetrexed were combined a strong synergism in all NSCLC cells regardless of their genetic signature was observed. This potential crosstalk between the EGFR signaling pathway and the TS expression and activity could in part explain our novel findings showing a significantly higher ORR to pemetrexed in those wild-type EGFR patients harboring a 3R/3R polymorphism."
Lung_Cancer
"Data from the Colorado Plateau uranium miners cohort. Interestingly even though model 8 is produced from the flexible definition in (5)“(7) Figures 2 and 3 suggest that the assumption of independency holds here with shapes of the exposure-response and lag-response curves at different values of ?p and xp respectively being proportional and the maximum HR constantly experienced at lag 11. This result reinforces the fact that the cross-basis representation based on a truly bivariate exposure“lag“response function f · w(x?) may appropriately describe the specific independency case defined by the simpler representation f(x) · w(?) in (4). 3.5. Prediction for specific exposure histories The flexible modeling approach described here can be applied to predict the overall cumulative risk from (10) for a specific exposure history qh as outlined in Section 2.3. Table III illustrates the predicted HR from four different models in five alternative exposure scenarios. This approach previously proposed 17 provides clear and interpretable risk summaries from complex models in the presence of varying exposure patterns. The first two scenarios refer to a constant radon exposure of 20 and 100 WLM/year respectively in the past 10 years. As expected simple DLMs (models 1 and 4) predict a similar risk but substantially lower than the two DLNMs with a B-spline for f(x). In particular model 5 extends model 1 by allowing a nonlinear dependency for the unweighted cumulative exposure estimating a slightly lower risk when compared with the more flexible model 8 already described. The third scenario extends the exposure to 20 WLM/year in the previous 20 years while the fourth one assumes that a 10-year exposure to the same intensity ceased 10 years before. The comparative assessment of the four models is similar to the first two examples. The last scenario considers the risk of more remote exposures occurring 30“39 years ago. Interestingly models 1 and 5 provide identical estimates to the fourth scenario as the risk of past exposures is assumed constant along the whole lag period. Model 8 instead predicts no excess in lung cancer in the last scenario given at least 30 years passed from the last exposure to radon a lag period for which the lag“response curve in (bottom-left panel) displays a null risk. Table III Overall cumulative hazard ratio (with 95%CI) of lung cancer mortality associated with alternative scenarios of exposure histories to radon as predicted from models 145 and 8 described in Table II Model 1 Model 4 Model 5 Model 8 Exposure scenario x · c x · w(x?) f(x) · c f · w(x?) 20 WLM/year in the last 10 years 1.05 (1.04“1.06) 1.04 (1.03“1.05) 1.33 (1.22“1.46) 1.52 (1.31“1.76) 100 WLM/year in the last 10 years 1.27 (1.22“1.33) 1.20 (1.13“1.27) 1.96 (1.73“2.22) 2.37 (1.87“2.99) 20 WLM/year in the last 20 years 1.11 (1.09“1.14) 1.11 (1.09“1.14) 1.92 (1.56“2.35) 3.12 (2.29“4.24) 20 WLM/year 10“19 years ago 1.06 (1.05“1.07) 1.07 (1.06“1.09) 1.43 (1.28“1.61) 2.05 (1.70“2.48) 20 WLM/year 30“39 years ago 1.06 (1.05“1.07) 1.05 (1.00“1.11) 1.43 (1.28“1.61) 1.04 (0.64“1.70) WLM working-level months. The summaries illustrated in this section can be extended to predict how the risk evolves dynamically in time in association with time-varying exposures. Adopting a forward perspective the risk changes along an exposure profile with specific exposures events referring to different lags and producing a different exposure history. As an example displays the overall cumulative mortality risk within years 0“60 for an exposure to 20 WLM/year experienced in the first 15 years. Here model 8 predicts an HR peak of 2.94 (95%CI: 2.20“3.93) at around 20 years 5 years after the end of the exposure. The plot also suggests that model 4 assuming a log-linear exposure“response relationship seriously underestimates the risk of lung cancer for four decades predicting an HR at year 20 of 1.11 (95%CI: 1.09“1.13). Also the assumption of a constant risk along lags of a nonlinear relationship adopted in model 5 produces an underestimation of the predicted HR in the first part of the period followed by a clear overestimation in the last years. Trend of hazard ratio (HR) of lung cancer mortality in the period 1“60 years associated with radon exposure of 20 WLM/year experienced in years 1“15 predicted from models 8 (with 95%CI)5 and 4 as specified in Table II. 3.6. On linearity and the ™nonspecial™ case of log transformation The bottom-right panel of reports the exposure“response for the simple DLM in model 4 which predicts a substantially lower risk than the two DLNMs. This difference is also evident when comparing the HR range in Figures 1 and 2 (bottom-left panel). This discrepancy is related to the wrong assumption of a linear radon-mortality dependency with the fit of model 4 highly dependent on a few of very high exposure occurrences. A sensitivity analysis performed on the subset of subjects with a maximum yearly exposure to radon of less than 300 WLM/year (81.6% of the total) is illustrated in Section D.2 of the supporting information. The highly skewed distribution of exposure events to radon and the shape of the estimated exposure“response curve suggest a log transformation of the exposure. In fact this model can be still described as a DLNM in (5)“(7) characterized by a basis with dimension vx = 1 corresponding to f(x) = log(x + 1). A new model is defined by replacing the spline in model 8 with the log function. The comparison is presented in details in Section D.3 of the supporting information. Although this more parsimonious model slightly improves the fit with an AIC of 2148.6 it is worth noting that results are very similar as illustrated in Figure S4 (supporting information) suggesting that the spline function is flexible enough to recover the association. More generally different functions than those presented here can be used to define the exposure“response or lag structure. 4. Simulation study The performance of the extended DLNM framework is validated through simulations under different scenarios of exposure“lag“response associations. Specifically the framework is evaluated by estimating the relative bias coverage and relative root mean square error (RMSE) of the estimators derived from AIC and BIC selection and the empirical rejection rates for the hypotheses H0 : f(x) = x and H0 : w(?) = c of linearity and constant effects respectively. 4.1. Simulation design and data generation The simulation setting involves the generation of exposure profiles for a set of ns subjects the definition of scenarios with known bidimensional exposure“lag“response associations and the random generation of time-to-event occurrences from such scenarios. These steps are briefly summarized here with more detailed information provided in Section E of the supporting information. The time-varying exposure profiles for ns subjects are represented as series of occurrences xt at time t = 1 ¦100 generated by random exposure events with an intensity in the range 0“10. "
Lung_Cancer
"Competing interests The authors declare that they have no competing interests. Authors™ contributions JK PD and OR were responsible for the study design and implementation. JK and PD performed the data analysis. JK PD IC and OR contributed to the implementation and manuscript writing. All authors read and approved the final manuscript. Acknowledgement We thank Sarah Verlaan for thorough revision with regard to language. Tsao AS Wistuba I Roth JA Kindler HL Malignant pleural mesothelioma J Clin Oncol 2009 27 2081 2090 10.1200/JCO.2008.19.8523 19255316 Rusch VW Rosenzweig K Venkatraman E Leon L Raben A Harrison L Bains MS Downey RJ Ginsberg RJ A phase II trial of surgical resection and adjuvant high-dose hemithoracic radiation for malignant pleural mesothelioma J Thorac Cardiovasc Surg 2001 122 788 795 10.1067/mtc.2001.116560 11581615 Vogelzang NJ Rusthoven JJ Symanowski J Denham C Kaukel E Ruffie P Gatzemeier U Boyer M Emri S Manegold C Niyikiza C Paoletti P Phase III Study of Pemetrexed in Combination With Cisplatin Versus Cisplatin Alone in Patients With Malignant Pleural Mesothelioma J Clin Oncol 2003 21 2636 2644 10.1200/JCO.2003.11.136 12860938 Weder W Stahel R Bernhard J Bodis S Vogt P Ballabeni P Lardinois D Betticher D Schmid R Stupp R Ris HB Jermann M Mingrone W Roth AD Spiliopoulos A Swiss Group for Clinical Cancer Research Multicenter trial of neo-adjuvant chemotherapy followed by extrapleural pneumonectomy in malignant pleural mesothelioma Ann Oncol 2007 18 1196 1202 10.1093/annonc/mdm093 17429100 Treasure T Lang-Lazdunski L Waller D Bliss JM Tan C Snee M O™Brien M Thomas G Senan S O™Byrne K Kilburn LS Spicer J Landau D Edwards J Coombes G Darlison L Peto J MARS trialists Extra-pleural pneumonectomy versus no extra-pleural pneumonectomy for patients with malignant pleural mesothelioma: clinical outcomes of the Mesothelioma and Radical Surgery (MARS) randomised feasibility study Lancet Oncol 2011 12 763 772 10.1016/S1470-2045(11)70149-8 21723781 Janne PA Baldini E Patterns of failure following surgical resection for malignant pleural mesothelioma Thorac Surg Clin 2004 14 567 573 10.1016/j.thorsurg.2004.06.006 15559064 Krayenbuehl J Susann O Davis JB Ciernik IF Combined Photon and Electron 3D-Conformal versus Intensity Modulated Radiotherapy with an Integrated Boost for Adjuvant Treatment of Malignant Pleural Mesothelioma following Pleuropneumonectomy Int J Radiat Oncol Biol Phys 2007 69 1593 1599"
Lung_Cancer
"contributed to collection of the data. NI: contributed to interpretation of the study data. SI: contributed to interpretation of the radiological data. KW: contributed to the development of the analytic concept data analyses. KI: contributed to interpretation of the study data. KY: contributed to critical revision of the manuscript. All authors read and approved the final manuscript. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2466/14/14/prepub Acknowledgements This work is partially supported by Aichi Health Promotion Foundation and Grant-in-Aid. We thank an experienced medical editor in NAI Inc. for English check and revision. Mathers CD Loncar D Projections of global mortality and burden of disease from 2002 to 2030 PLoS Med 2006 3 11 e442 17132052 Mannino DM Buist AS Global burden of COPD: risk factors prevalence and future trends Lancet 2007 370 9589 765 773 17765526 Sekine Y Behnia M Fujisawa T Impact of COPD on pulmonary complications and on long-term survival of patients undergoing surgery for NSCLC Lung Cancer 2002 37 1 95 101 12057873 Lopez-Encuentra A Astudillo J Cerezal J Gonzalez-Aragoneses F Novoa N Sanchez-Palencia A Prognostic value of chronic obstructive pulmonary disease in 2994 cases of lung cancer Eur J Cardiothorac Surg 2005 27 1 8 13 15736303 Turner MC Chen Y Krewski D Calle EE Thun MJ Chronic obstructive pulmonary disease is associated with lung cancer mortality in a prospective study of never smokers Am J Respir Crit Care Med 2007 176 3 285 290 17478615 Raviv S Hawkins KA DeCamp MM Jr Kalhan R Lung cancer in chronic obstructive pulmonary disease: enhancing surgical options and outcomes Am J Respir Crit Care Med 2011 183 9 1138 1146 21177883 Fabbri LM Luppi F Beghe B Rabe KF Complex chronic comorbidities of COPD Eur Respir J 2008 31 1 204 212 18166598 Brunelli A Charloux A Bolliger CT Rocco G Sculier JP Varela G Licker M Ferguson MK Faivre-Finn C Huber RM ERS/ESTS clinical guidelines on fitness for radical therapy in lung cancer patients (surgery and chemo-radiotherapy) Eur Respir J 2009 34 1 17 41 19567600 Loganathan RS Stover DE Shi W Venkatraman E Prevalence of COPD in women compared to men around the time of diagnosis of primary lung cancer Chest 2006 129 5 1305 1312 16685023 Young RP Hopkins RJ Christmas T Black PN Metcalf P Gamble GD COPD prevalence is increased in lung cancer independent of age sex and smoking history Eur Respir J 2009 34 2 380 386 19196816 Mitsudomi T Kosaka T Endoh H Horio Y Hida T Mori S Hatooka S Shinoda M Takahashi T Yatabe Y Mutations of the epidermal growth factor receptor gene predict prolonged survival after gefitinib treatment in patients with non-small-cell lung cancer with postoperative recurrence J Clin Oncol 2005 23 11 2513 2520 15738541 Matsuo K Ito H Yatabe Y Hiraki A Hirose K Wakai K Kosaka T Suzuki T Tajima K Mitsudomi T Risk factors differ for non-small-cell lung cancers with and without EGFR mutation: assessment of smoking and sex by a case-control study in Japanese Cancer Sci 2007 98 1 96 101 17054433 Zhang J Zhou JB Lin XF Wang Q Bai CX Hong QY Prevalence of undiagnosed and undertreated chronic obstructive pulmonary disease in lung cancer population Respirology 2013 18 2 297 302 23051099 Matsuo M Hashimoto N Usami N Imaizumi K Wakai K Kawabe T Yokoi K Hasegawa Y Inspiratory capacity as a preoperative assessment of patients undergoing thoracic surgery Interact Cardiovasc Thorac Surg 2012 14 5 560 564 22307392 Pellegrino R Viegi G Brusasco V Crapo RO Burgos F Casaburi R Coates A van der Grinten CP Gustafsson P Hankinson J Interpretative strategies for lung function tests Eur Respir J 2005 26 5 948 968 16264058 Rabe KF Hurd S Anzueto A Barnes PJ Buist SA Calverley P Fukuchi Y Jenkins C Rodriguez-Roisin R Van Weel C Global strategy for the diagnosis management and prevention of chronic obstructive pulmonary disease: GOLD executive summary Am J Respir Crit Care Med 2007 176 6 532 555 17507545 Detterbeck FC Boffa DJ Tanoue LT The new lung cancer staging system Chest 2009 136 1 260 271 19584208 Maeda R Yoshida J Ishii G Hishida T Nishimura M Nagai K The prognostic impact of cigarette smoking on patients with non-small cell lung cancer J Thorac Oncol 2011 6 4 735 742 21258254 Rudin CM Avila-Tang E Harris CC Herman JG Hirsch FR Pao W Schwartz AG Vahakangas KH Samet JM Lung cancer in never smokers: molecular profiles and therapeutic implications Clin Cancer Res 2009 15 18 5646 5661 19755392 Matsuda A Matsuda T Shibata A Katanoda K Sobue T Nishimoto H Cancer incidence and incidence rates in Japan in 2007: a study of 21 population-based cancer registries for the monitoring of cancer incidence in Japan (MCIJ) project Jpn J Clin Oncol 2013 43 3 328 336 23296772 Society AC Cancer facts and figures 2013 2013 http://www.cancer./Research/CancerFactsFigures/CancerFactsFigures/2013-cancer-facts-and-figures.pdf Haiman CA Stram DO Wilkens LR Pike MC Kolonel LN Henderson BE Le Marchand L Ethnic and racial differences in the smoking-related risk of lung cancer N Engl J Med 2006 354 4 333 342 16436765 de Torres JP Marin JM Casanova C Cote C Carrizo S Cordoba-Lanus E Baz-Davila R Zulueta JJ Aguirre-Jaime A Saetta M Lung cancer in patients with chronic obstructive pulmonary disease“ incidence and predicting factors Am J Respir Crit Care Med 2011 184 8 913 919 21799072 Okada M Nishio W Sakamoto T Harada H Uchino K Tsubota N Long-term survival and prognostic factors of five-year survivors with complete resection of non-small cell lung carcinoma J Thorac Cardiovasc Surg 2003 126 2 558 562 12928658 Colice GL Shafazand S Griffin JP Keenan R Bolliger CT Physiologic evaluation of the patient with lung cancer being considered for resectional surgery: ACCP evidenced-based clinical practice guidelines (2nd edition) Chest 2007 132 3 Suppl 161S 177S 17873167 Baldwin DR White B Schmidt-Hansen M Champion AR Melder AM Diagnosis and treatment of lung cancer: summary of updated NICE guidance Bmj 2011 342 d2110 21525094 Fukuchi Y Nishimura M Ichinose M Adachi M Nagai A Kuriyama T Takahashi K Nishimura K Ishioka S Aizawa H COPD in Japan: the Nippon COPD epidemiology study Respirology 2004 9 4 458 465 15612956 Tashkin DP Celli B Decramer M Liu D Burkhart D Cassino C Kesten S Bronchodilator responsiveness in patients with COPD Eur Respir J 2008 31 4 742 750 18256071 Kobayashi S Suzuki S Niikawa H Sugawara T Yanai M Preoperative use of inhaled tiotropium in lung cancer patients with untreated COPD Respirology 2009 14 5 675 679 19476597 Bolukbas S Eberlein M Eckhoff J Schirren J Short-term effects of inhalative tiotropium/formoterol/budenoside versus tiotropium/formoterol in patients with newly diagnosed chronic obstructive pulmonary disease requiring surgery for lung cancer: a prospective randomized trial Eur J Cardiothorac Surg 2011 39 6 995 1000 20970351 Radiat Oncol Radiat Oncol Radiation Oncology (London England) 1748-717X BioMed Central 24456714 3946177 1748-717X-9-32 10.1186/1748-717X-9-32 Research Clinical outcome of postoperative highly conformal versus 3D conformal radiotherapy in patients with malignant pleural mesothelioma Krayenbuehl Jr´me 1 Jerome.krayenbuehlusz.ch Dimmerling Peter 1 peter.dimmerlingusz.ch Ciernik I Frank 2 3 ilja.ciernikklinikum-dessau.de Riesterer Oliver 1 oliver.riestererusz.ch 1Department of Radiation Oncology Zurich University Hospital Rmistrasse 100 8091 Zurich Switzerland 2Center for Clinical Research University of Zurich Zurich Switzerland 3Department of Radiotherapy and Radiation Oncology Dessau Municipal Hospital Dessau Germany 2014 24 1 2014 9 32 32 6 9 2013 3 1 2014 Copyright 2014 Krayenbuehl et al.; licensee BioMed Central Ltd. 2014 Krayenbuehl et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background Radiotherapy (RT) is currently under investigation as part of a trimodality treatment of malignant pleural mesothelioma (MPM). The introduction of highly conformal radiotherapy (HCRT) technique improved dose delivery and target coverage in comparison to 3-dimensional conformal radiotherapy (3DCRT). The following study was undertaken to investigate the clinical outcome of both radiation techniques. Methods Thirty-nine MPM patients were treated with neoadjuvant chemotherapy extrapleural pneumonectomy (EPP) and adjuvant RT. Twenty-five patients were treated with 3DCRT and 14 with HCRT (Intensity modulated radiotherapy or volumetric modulated arc therapy). Overall survival disease free survival locoregional recurrence and pattern of recurrence were assessed. A matched pair analysis was performed including 11 patients of each group. Results After matching for gender age histology tumor stage and resection status HCRT seemed superior to 3DCRT with a local relapse rate of 27.3% compared to 72.7% after 3DCRT (p = 0.06). The median time to local relapse was increased by 49% with HCRT in comparison to 3DCRT from 10.9 ± 5.4 months to 16.2 ± 3.1 months (p = 0.06). The median overall survival was 22.3 ± 15.3 months for HCRT and 21.2 ± 9.2 months for 3DCRT (p = 0.57). Recurrence analysis showed that in-field local relapses occurred in previously underdosed regions of the tumor bed in 16% of patients treated with 3DCRT and in 0% of HCRT patients. Conclusions The use of HCRT increases the probability of local control as compared to 3DCRT by improving target volume coverage. HCRT did not improve overall survival in this patient series due to the high rate of distant recurrences. Mesothelioma Radiation therapy Extrapleural pneumonectomy Volumetric modulated arc therapy Intensity modulated radiotherapy Multimodal therapy Introduction Malignant pleural mesothelioma (MPM) is a rare and aggressive malignancy associated with poor prognosis. Although MPM is often initially confined to the hemithorax it has a high potential for metastatic spread in the course of disease [1]. The mainstay of treatment is surgery consisting of either pleurectomy/decortication (PD) or radical extrapleural pneumonectomy (EPP) in combination with cisplatin/pemetrexed and in selected cases postoperative radiotherapy [2-5]. The rationale to apply postoperative radiotherapy after EPP has been the high rate of local recurrence after EPP alone of about 40% [6]. The pattern of pleural dissemination infiltrative growth and the manipulations within the chest cavity during surgery place the entire ipsilateral chest wall at high risk for post-surgical relapse especially at the diaphragm insertion the pericardium mediastinum and bronchial stump. Technically hemithoracic radiotherapy is challenging due to various reasons. Firstly the size of the volume to be treated is large and may cover up to six liters. Secondly the target lies in close proximity to various ans at risk (OAR) such as the heart ipsilateral kidney liver remaining lung esophagus and/or spinal cord. Thirdly the thoracic cavity has a complex shape with its costodiaphragmatic recess extending around the liver and the kidney. Previous publications showed that highly conformal radiotherapy (HCRT) such as intensity modulated radiotherapy (IMRT) or volumetric modulated arc therapy (VMAT) can improve the dose distribution in respect to target coverage and dose to OAR [78]. However to our knowledge there is no clinical study published that investigated and compared clinical outcome after both radiation techniques. In order to verify if the technical improvements introduced with IMRT or VMAT have translated into a clinical benefit we evaluated the clinical outcome of MPM patients treated with chemotherapy surgery and 3DCRT or HCRT at our institution. Material and methods We reviewed the clinical outcome of 39 consecutive patients treated either with 3DCRT (25 patients) or HCRT (11 IMRT patients and 3 VMAT patients). Patient staging was established using FDG-PET/CT and/or conventional thoraco-abdominal CT. The patients with clinical stage T1-T3 N0-2 M0 R0-2 were treated with 3 cycles of preoperative chemotherapy (pemetrexed and cisplatin) followed by EPP and RT [7]. All histological subtypes were accepted for RT. Patients were not selected for this review if they had metastatic disease or a local relapse before the start of RT. The study was approved by the local ethics committee of the University Hospital of Zurich. Radiation techniques The 3DCRT group was treated between 1999 and 2005. These patients were treated with 25 — 1.8 Gy?=?45 Gy to the hemithorax and subsequently in a second series a boost of 7 — 1.8 Gy?=?12.6 Gy was given to the incompletely resected area (total dose 57.6 Gy). Dose calculation was performed on Pinnacle planning system (Philips Medical Systems) for a linear accelerator (Clinac 2100C Varian Medical Systems). Details of the treatment technique have previously been published [7]. HCRT has been used at our institution since 2005 for the treatment of MPM patients. Of the 14 patients treated with HCRT 11 were treated with conventional static field IMRT and 3 patients with rotational IMRT (volumetric arc radiotherapy i.e. Rapid Arc® in the present series). IMRT and VMAT plans achieved similar dose distributions [910]."
Lung_Cancer
"Background A gene-based estimate of lung cancer risk in smokers has been shown to act as a smoking cessation motivator in hospital recruited subjects. The objective of this trial is to determine if this motivator is as effective in subjects recruited from an NHS primary care unit. Method/Design Subjects will be recruited by mailings using smoking entries on the GP electronic data-base (total practice population?=?32048) to identify smokers who may want to quit. Smoking cessation clinics based on medical centre premises will run for eight weeks. Clinics will be randomised to have the gene-based test for estimation of lung cancer risk or to act as controls groups. The primary endpoint will be smoking cessation at eight weeks and six months. Secondary outcomes will include ranking of the gene-based test with other smoking cessation motivators. Discussion The results will inform as to whether the gene-based test is both effective as motivator and acceptable to subjects recruited from primary care. Trial registration Registered with Clinical Trials.gov Registration number: NCT01176383. Smoking cessation Genetic test Lung cancer Background Gene testing in primary care is no longer limited by their exorbitant cost. The prices of genetic tests are dropping faster than Moore™s law for computing costs [1]. This leads the focus to shift from cost of genetic testing to the clinical value of individual gene tests. The recent development of gene-based tests that predicts the risk of lung cancer in smokers is an important example [2]. Despite the well accepted 10-15% probability of lung cancer in smokers 50% of smokers do not believe they are at significantly increased risk [3]. However over 80% of smokers would like to know their personal risk of lung cancer [4]. There is a plausible three way link between biomarkers for chronic obstructive pulmonary disease (COPD) a set of 20 single nucleotide polymorphisms (SNPs) associated with cancer risk and lung cancer [5-8] (). Research has shown a strong association between a high lung cancer susceptibility score derived from family history of cancer the 20 SNPs COPD history (Auckland formula) and the development of lung cancers whereas healthy smokers matched for age gender and lifetime smoking habits had a relatively low score (n?=?446 lung cancer subjects 484 healthy current smokers). The odds ratio for lung cancer risk varied from 0.2-3.2 depending on the genetic risk (p?<?0.001) [910]. The accuracy of the Auckland formula in estimating lung cancer risk for a score of >4 was: sensitivity 90% specificity 45% ( which also includes scores for 52 subjects who developed cancer from a six year prospective study of 1212 smokers and ex-smokers). The score for prediction of non-cancer was conducted with a follow up of just six years. It means that 45% of non-cancer subjects have a low cancer score and 55% have some degree of increased score. The 55% with increased scores have simply not been followed up long enough for lung cancers to develop yet. Notwithstanding this limitation there is now a 20 SNP gene test for prediction of lung cancer in smokers under the trade name Respiragene. Research that established the respiragene test. Distribution of the Respiragene score in a cross-sectional study of 484 control smokers (blue) and 446 with lung cancer (red) (Total?=?930) and from the prospective study of 52 lung cancer cases (green). Reference [8]. Two case-control studies showed a 5-10% increase in cessation with a single gene test of small effect [1112]. A small smoking cessation pilot study using spirometry results and explanations using the Fletcher-Peto diagram to explain risk demonstrated that patients find this is an acceptable method and the quit rate at 12 months was 27% [13]. In a randomised control trial patients were given either a full explanation of the results of spirometry testing including an estimation of lung age or just their forced expiratory volume in the first second (FEV1) without explanation (control group). The group of patients who were given the full explanation had a 7.2% higher quit rate than the control group [14]. Data from a hospital outpatient cohort in Auckland suggest a larger increase in quit rate with Respiragene test and the Auckland formula (). Subjects who were current smokers in the pre-contemplative and contemplative stage were randomised into either the test group or control group and only the test group had the Respiragene test. Counselling and follow-up was done by telephone. Using Auckland formula to incorporate the results of the Respiragene test clinical data and family history a score ranging 1-12 with associated risk level (moderate risk high risk very high risk) was calculated and explained to test subjects. Neither group were involved in any formal smoking cessation programme. Indeed of the 13 subjects that had managed to stop smoking (28% of the gene-tested group) 48% quit without any medical assistance and only 52% had nicotine replacement therapy [1516]. When compared with previous studies using telephone counselling alone [17] () there is a 20-25% improvement in smoking cessation with the Respiragene test (). The improvement in intention to quit increases from 56% before testing to 67% in smokers with an average smokers risk of lung cancer or 89% in smokers with a high risk of lung cancer [18]. Respiragene study in Auckland NZ (n?=?43) Cancer susceptibility scale (compared with normal lifetime risk) Cancer susceptibility score Estimated lifetime risk of lung cancer Initial intention to quit Proportion that stopped smoking at 2-4 weeks Proportion still not smoking at 6 months Expected result for telephone counselling () - - 15% 41% 10-20% 9-12% Telephone counselling?+?Respiragene test 1-2.3 (10-35% risk) 2.3-6.7 (35-65% risk) 6.7-8 (65%-80% risk) 27 had average risk score 15% 67% 8/27 (30%) 8 (30%) 16 had high or very high risk score 30-50% (4-10 times average risk) 89% 10/16 (63%) 6 (37.5%) Smoking cessation after Respiragene testing and estimation of lung cancer risk with telephone counselling in a small pilot study in Auckland NZ (n?=?43) compared with expected quit rate. Efficacy of the variety of smoking cessation strategies. Percent increase of success for six months over unaided attempts for each type of quitting (chart from West & Shiffman based on Cochrane review data). Totally unaided smoking cessation has a 3-6% success rate. Therefore telephone support () increases success rate by 6% = 9-12% quit rate. A large hospital trial using Respiragene for calculating lung cancer susceptibility is currently underway in the USA [19] but there are no planned UK investigations. This study fills that gap and uses the NHS framework for smoking cessation. Other studies have taken place looking at how lung functioning testing in COPD might motivate smokers to quit suggesting that it is feasible to conduct this sort of study [131420]. This protocol describes a trial to evaluate a gene-based risk test (using genetic and clinical data) as a smoking cessation motivator in smokers wishing to participate in an NHS primary care smoking cessation clinic (in the action stage of change) alongside the usual counselling and prescribing protocol. It will differ from previous studies using gene testing as a motivator however in that the NHS primary care counselling and prescribing protocol will include several other motivators (CO breath testing saliva cotinine testing and intensive counselling) whereas the Auckland trial using the same gene test had none of these. Also the method of recruitment will differ in that primary care subjects will of necessity be different from the Auckland hospital outpatient cohort [1516]. Research question Can the Respiragene test combined with an estimation of lung cancer susceptibility be used to increase the uptake adherence to and success rate in an established smoking cessation programme in subjects who want to quit in a National Health Service United Kingdom (NHS UK) setting? Hypothesis Genetic testing and estimation of lung cancer susceptibility should increase œsmoking cessation outcomes at six months to >30% (or 1.5-2 fold greater than usual care) irrespective of the risk scores assigned to subjects [11]. Method/Design This protocol has been approved by Surrey Research Ethics Committee at the Royal Surrey County Hospital Guildford Surrey UK. 1/Recruitment Focus groups A number of focus groups of different aged smokers will be held to enable them to contribute to the design of the study 2/ Recruitment Subjects will be recruited from a large general practice in Surrey (practice population=?>?30000). Smokers aged 20-70 years will be identified from the practice records and contacted by post by their GP. Patients who reply stating that they wish to stop smoking will be randomised (stratified randomisation to ensure equivalent age and gender mix) to two clinics (Figure 3) only one of which will include the gene-based test. Previous trials of genetic testing in association with smoking cessation achieved 83-100% of participants opting for the test depending on the method of recruitment [821]. There will be two mailings with SAEs for recruitment with the aim of recruiting at least 30 subjects per clinic (see Power calculations under heading œstatistics). In the first letter the patient™s GP asks the patient to give permission for the researcher to contact him/her to ask about taking part in smoking cessation research (with possible genetic risk testing) and encloses fact sheet 1 and a stamped addressed envelope (SAE) for reply. Figure 3 Consort 2010 flow diagram for GeTTS recruitment. Mailing 2. The principal investigator mails patient with Letter 2 to ask him/her if they would like to attend an 8-week smoking cessation clinic and asks if they would be willing to have a test for genetic susceptibility to development of lung cancer and encloses SAE for reply. Mailing 3. The principal investigator mails Group B subjects and Group A test-concordant subjects to confirm dates of the smoking cessation sessions and full patient information leaflet and consent form enclosed. The information sheet will be slightly different for group A and B. Non-test concordant subjects within group A will be invited to attend the practice nurse for smoking cessation. 3/Inclusion and exclusion criteria i. Inclusion criteria: Aged 20-70 years smoking more than 10 cigarettes daily. ii. Exclusion criteria: Aged under 20 years or over 70 years smoking less than 10 cigarettes daily history of major depression and other psychiatric conditions dementias and serious or terminal illness (cancers etc.). Patients on warfarin would be excluded due to interactions between warfarin and varenicline as varenicline will be used as the modern treatment of choice for smoking cessation. Patients who smoke less than 10 cigarettes/day and patients who did not wish to have a genetic test or do not wish to take part in a research study will be referred to the practice nurse for smoking cessation. 4/Smoking cessation clinics For group A subjects only subjects who have expressed an interest in having a genetic test and gene-based estimation of susceptibility to lung cancer in mailing 2 will be invited to participate (see referral for decliners above). For group B subjects all subjects willing to participate are invited to do so. Uptake into smoking cessation programme (i.e. proportion of invitees who accept invitation and attend clinic of those mailed invitation) will be recorded. All subjects who attend the first session of the research clinic will be asked by the principal investigator JN to sign a consent form and will be invited to raise any concerns about the protocol (as explained in the full information sheet). The consent form will then be countersigned by JN. Group A clinics and Group B clinics will be held on different weekdays at the same health centre premises. Test Subjects who attend Clinic A will be offered a fact sheet on the health risks of smoking (including lung cancer) and the option of the gene-based test for calculation of lung cancer susceptibility whilst subjects who attend Clinic B will be given the same fact sheet on the health risks of smoking (including lung cancer) but without any reference to the gene-based test. The principal investigator will be responsible for handing out the fact sheets and administering the gene-based test in Clinic A and for handing out and explaining the fact sheet in Clinic B. NHS Surrey™s Smoking Cessation Practitioners will lead in-house smoking cessation clinics A and B using the NHS smoking cessation guidelines [22] under the supervision of the principal investigator at the medical centre. There will be: ¢Introductory session which includes a new near patient test for salivary cotinine (nicotine metabolite) “ trade name SmokeScreen [23]. ¢At session 2 patients will be given advice on therapies for smoking cessation. We expect that most patients will opt for a course of varenicline and they will be advised to contact their GP for a prescription. ¢This is followed by seven more weekly sessions and a follow-up session at six months (Figure 4). Uptake and adherence to smoking cessation will be monitored by weekly carbon monoxide exhalation measurements (breath test). The principal investigator will be involved in clinic A administering the gene-based test and determining if subjects have COPD from practice records and history in session 1. Participants who are heavy smokers have a smokers cough and use a salbutamol inhaler can be judged to have COPD even if this is not entered in their GP records (all Group A & B subjects will have spirometry at their 6-month follow-up)."
Lung_Cancer
"MBSR is an 8-week group-based training consisting of meditation practices such as the bodyscan gentle yoga sitting and walking meditation. By repeatedly bringing attention back to the current experience participants gradually learn to disengage from dysfunctional thoughts and directly experience the emotions and bodily sensations of the present moment. MBSR aims to provide participants with the ability to step back from ruminating about the past or worrying about the future and simply allow experiences to unfold [2829]. A recent meta-analysis [30] of 13 nonrandomized studies and 9 randomized controlled trials (RCT) concluded there is positive evidence for the use of mindfulness-based interventions in reducing psychological distress in cancer patients. Among the RCT™s a reduction in symptom severity was found for both anxiety and depression corresponding to moderate pooled controlled effect sizes (Hedges™s g = 0.37 and Hedges™s g = 0.44 respectively) [30]. Though mindfulness-based interventions seem to be effective the authors note that across studies the majority of participants were women (85%) and diagnosed with breast cancer (77%). Compared to breast cancer patients patients with lung cancer are more often male older and have a poorer prognosis. Furthermore of these 22 studies only one study included the partners of the patients showing that partners also benefit from the MBSR training [31]. This is quite surprising since partners of cancer patients also report high levels of distress [32]. Aims The aim of the Mindfulness for Lung Oncology Nijmegen (MILON) study is to examine the effectiveness of MBSR compared to TAU in reducing psychological distress in patients with lung cancer and their partners. We hypothesize that patients in the MBSR group will report a lower level of psychological distress (i.e. anxiety and depressive symptoms) higher levels of quality of life quality of relationship and spirituality than those in the TAU group. Medical and societal costs will be lower in the MBSR versus TAU group. We expect partners in the MBSR group to report a lower level of psychological distress and higher levels of caregiver appraisal relationship quality and spirituality than their counterparts in the TAU group. With regard to the working mechanisms of the MBSR programme we will examine changes in mindfulness skills self-compassion rumination intrusion avoidance and adherence to MBSR. Methods/Design Study design The design of the ˜MILON™ study is a parallel group randomized controlled trial with an embedded process study. Participants are randomized between MBSR and TAU. The study protocol has been approved by our ethical review board (CMO Arnhem-Nijmegen) and registered under number 2011“519. Participants and procedure Patients and partners are recruited at the outpatient clinic of the Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre (RUNMC) by a nurse practitioner and the attending physician. Patients and partners are invited to participate together but both are welcome to participate on their own if they do not have a partner or their partner is not willing to participate. Patients and/or partners who are interested are provided with an information leaflet. If they are willing to participate they are invited for a research interview in which in- and exclusion criteria are assessed and informed consent is taken. At other participating hospitals (Department of Pulmonary Diseases Canisius-Wilhelmina Hospital Nijmegen; Department of Pulmonary Medicine Rijnstate Arnhem; Department of Oncology Elkerliek Hospital Helmond; Department of Pulmonary Medicine Jeroen Bosch Hospital; Department of Pulmonary Diseases Maas hospital Pantein Boxmeer) patients and their partners will be sent a letter with the invitation to participate in the study. One week later the researcher calls the patients to answer possible questions and asks whether the patient and partner are interested in participation. If so they are invited for a research interview at the RUNMC. Eligibility We include patients and/or partners of patients who are (a) diagnosed with cytologically or histologically proven non-small cell lung cancer or small cell lung cancer and (b) have received or are still under treatment. Exclusion criteria for both patient and partner include: (a) being under 18 years of age (b) not being able to understand or use the Dutch language (c) former participation in MBSR or Mindfulness-Based Cognitive Therapy (MBCT) (d) current and regular treatment by psychologist or psychiatrist (e) current participation in other psychosocial programme and (f) physical or cognitive (<26 on the Mini-Mental State Examination (MMSE)) impairments hampering participation in MBSR training or completion of questionnaires. Baseline Patients and partners are interviewed to obtain demographics and clinical characteristics after which they are screened for cognitive impairments with the MMSE [33]. After that baseline questionnaires including the Distress Thermometer (DT) [3435] are administered followed by randomization. shows the assessment instruments and time points at which the questionnaires are administered to patients and partners. Measurements and corresponding time points for patient and partner Measure Target T0 T1 T2 pt pr pt pr pt pr MMSE Cognitive impairments x x DT General distress x x HADS Psychological distress x x x x x x QLQ-C30 Quality of life x x x QLQ-LC13 Quality of life x x x SIP Impact of sickness x x x SPPIC Caregiver burden x x x CRA-SE Caregiver self-esteem x x x IMS-S Relationship satisfaction x x x x x x MIS Communication about cancer x x x x x x SAIL Spirituality x x x x x x FFMQ Mindfulness skills x x x x x x SCS Self-compassion x x x x x x RRS-EXT Rumination x x x x x x IES Psychological stress reaction x x x x x x Diary Health care use work absence Monthly during study period for pt Calendar Mindfulness adherence Monthly during study period for pt and pr Note. T0 = Baseline measurement; T1 = Post-intervention measurement; T2= 3-month follow-up measurement; pt = Patient; pr = Partner; MMSE = Mini Mental State Examination; DT = Distress Thermometer; HADS = Hospital Anxiety and Depression Scale; QLQ-C30 = Quality of Life “ Cancer; QLQ-LC13 = Quality of Life “ Lung Cancer; SIP = Sickness Impact Profile; SPPIC = Self-Perceived Pressure from Informal Care; CRA-SE = Caregiver Reaction Assessment “ Care-Derived Self-Esteem; IMS-S = Investment Model Scale-Satisfaction; MIS = Mutuality and Interpersonal Sensitivity; SAIL = Spiritual Attitude and Involvement List; FFMQ = Five Facet Mindfulness Questionnaire; SCS = Self-Compassion Scale; RRS-EXT = Rumination Response Scale “ Extended Version; IES = Impact of Event Scale. Randomization Randomization is stratified according to setting and minimized for (a) stage of disease (curative versus palliative) (b) baseline level of anxiety and depressive symptoms (anxiety or depression subscale score of Hospital Anxiety and Depression Scale (HADS) <8 versus ?8) (c) treatment during MBSR (no treatment versus chemo- and/or radiotherapy) and (d) participation (patient alone versus partner alone versus patient and partner together). Randomization is computerized using a randomization website specifically designed for this study on which the researcher can fill out the required data. The researcher communicates treatment allocation to the nurse practitioner who informs the patient and/or partner. Follow-up assessments Follow-up assessments take place post intervention and at three-month follow-up. Participants who have access to the internet and have an email address receive the questionnaires online. If not they receive the questionnaires on paper along with a reply envelope. In case of drop-out the researcher tries to contact the participant by phone to complete a minimum set of outcome measures and to identify the main reason for drop-out. Intervention The MBSR curriculum used is primarily based on the Mindfulness-Based Stress Reduction programme as developed by Kabat-Zinn [28] but contains some elements of the MBCT programme by Segal Williams and Teasdale [29] like psycho-education on the interrelatedness of feelings and thoughts. Moreover some modifications have been made to make the intervention more suitable for patients with lung cancer and their partners such as psycho-education about grief [36]. In addition a mindful communication exercise in which partners talk with each other about the cancer was added. The programme consists of 8 weekly 2.5-hour sessions a silent day between session six and seven and home practice assignments of about 45 minutes 6 days per week. Participants receive a set of CDs with guided mindfulness meditation exercises for home practice and a folder with information and home practice instructions for the forthcoming week. Table 2 shows the content of the MBSR programme per session. The MBSR courses are taught by mindfulness teachers with extensive training in MBSR. They all fulfil the advanced criteria of the Center for Mindfulness of the University of Massachusetts Medical School [37] and maintain a regular personal meditation practice. Teachers were trained supervised and assessed to ensure their competency levels met the qualification criteria to instruct the MBSR classes. During the trial teachers will receive weekly supervision and a number of sessions will be videotaped to evaluate competence and adherence with the Mindfulness-Based Interventions “ Teaching Assessment Criteria [38]. Table 2 Content of MBSR programme per session Theme of session Meditation exercise Didactic teaching Homework 1. Automatic pilot - Bodyscan - Intention of participating - Bodyscan - Raisin exercise - Eating one meal mindfully - Attention for routine activity 2. Mindfulness of the breath - Bodyscan - Imagery exercise to demonstrate relationship between thoughtsand feelings - Bodyscan - Sitting mediation with focus on breath - Attention for breath - Awareness of pleasant events - Attention for routine activity 3. Observing limits - Yoga while lying down - Seeing exercise to demonstrate difference between observation and interpretation - Bodyscan or yoga - 3-min breathing space - Sitting meditation - Awareness of unpleasant events - 3-min breathing space 4. Opening up to distress - Sitting mediation with focus on breath body and sound - Interrelatedness of feelings thoughts and bodily sensations - Bodyscan or yoga - Sitting meditation - 3-min breathing space - Psychoeducation about grief - Awareness of stress reactions - 3-min breathing space 5. Responding to distress - Sitting mediation with focus on breath body sound thoughts difficulty - Reacting versus responding - Meditation by choice - Coping with grief - Awareness of reaction in difficult situation - Walking meditation - Awareness of communication difficulties - 3-min breathing space - 3-min breathing space 6. Mindful communication - Yoga in standing position - Mindful communication exercise about effect of lung cancer with their own partner - Sitting meditation or yoga - 3-min breathing space - Awareness of communication - 3-min breathing space during stress Silent day - Varying meditation exercises"
Lung_Cancer
"assessed by ROC curves. The AUC value was 0.892 Relationship between serum KLK11 levels and clinicopathologic factors The relationships between KLK11 levels and clinicopathologic factors of lung cancer patients are shown in . The serum KLK11 levels did not differ significantly with age (P?=?0.569) sex (P?=?0.505) or histology (P?=?0.713). The levels of KLK11 were significantly correlated with tumor-node-metastasis (TNM) stage (P?=?0.000) lymph node metastases (P?=?0.000) and distant metastases (P?=?0.000).The clinicopathological factors of NSCLC and the association with KLK11 levelsFactorsnKLk11 (ng/ml) P- valueAge year0.569??60622.07?±?0.77?<60762.12?±?0.66Gender0.505?Male802.16?±?0.82?Female581.99?±?0.53Histology0.713?AC782.05?±?0.85?SCC602.01?±?0.53TNM stage0.000?I“II882.51?±?0.61?III“IV501.76?±?0.63Lymph node metastases0.000?Absent682.41?±?0.64?Present701.65?±?0.57Distant metastases0.000?Absent982.38?±?0.59?Present401.89?±?0.71 AC adenocarcinoma SCC squamous cell carcinoma Association of serum KLK11 levels with survival Finally we determined whether the baseline serum concentration of KLK11 would be a prognostic marker in NSCLC. The cutoff point of 1.05 ng/ml was selected to categorize patients as KLK11-high or low. Univariate analysis showed that serum KLK11 level was significantly correlated OS (P?=?0.002) and PFS (P?=?0.009) ().Univariate and multivariate analysis of KLK11 status with regard to PFS and OSVariablesPFSOSHR95 % CI P valueHR95 % CI P valueUnivariate analysis?KLK11 (Low vs. High)0.460.25“0.820.0090.360.19“0.690.002?Age (?60 vs. <60)1.230.67“2.280.5061.180.59“2.130.792?Gender (Male vs. Female)1.320.71“1.820.7821.190.69“1.980.673?Histology (AC vs. SCC)1.830.59“2.130.7921.340.65“1.980.546?Stage (I“II vs. III“IV)1.330.65“2.210.0010.931.09“3.440.025?Lymph node metastases (absent vs. present)1.421.04“1.940.2711.770.32“1.660.347?Distant metastases (absent vs. present)1.981.03“3.010.0391.871.04“2.990.075Multivariate analysis?KLK11 (low vs. high)0.530.29-0.970.0420.480.24-0.950.037?Age (?60 vs. <60)0.980.52-1.940.8341.061.28-3.010.128?Gender (male vs. Female)1.280.67-1.890.6721.140.46-2.140.542?Histology (AC vs. SCC)1.371.04-2.330.3151.260.64-2.560.424?Stage (I“II vs. III“IV)1.250.56-2.260.0011.961.02-3.770.043?Lymph node metastases (absent vs. present)1.130.81-1.570.1481.840.33-1.720.334?Distant metastases (absent vs. present)1.440.85-1.970.0981.890.99-2.350.051 HR hazard ratio CI confidence interval In multivariate analysis high KLK11 was found to be significantly associated with a longer PFS and OS (HR 0.53 and 0.48; P?=?0.042 and P?=?0.037 respectively). Kaplan“Meier survival curves (Fig. 3) further demonstrate that lung cancer patients with high KLK11 have substantially longer PFS and OS (P?<?0.05) compared to those with low KLK11 cancer. As expected disease stage was found to be strongly associated with decreased PFS and OS in both univariate and multivariate analyses (P?<?0.05).Fig. 3Kaplan“Meier survival curves for PFS and OS in patients with KLK11-high and -low NSCLC. Log-rank test determined that the PFS and OS in high KLK11 group were significantly longer than those in the low KLK11 group (P?=?0.003; P?=?0.018) Discussion During the last few years numerous studies have been published which attempt to refine our understanding of determinants of prognosis in lung cancer by analyzing tumor-associated markers thought to be of biologic relevance in the carcinogenic process. Proteolytic enzymes of several catalytic classes have emerged as important prognostic factors in cancer [12]. Among these enzymes are many members of human tissue kallikrein family of secreted serine proteases including KLK11 a promising biomarker for lung cancer diagnosis and prognosis [1113]. In the present study serum KLK11 levels were significantly elevated in patients with lung cancer compared with control subjects making them potential adjunctive tools for diagnosis of lung cancer. Furthermore at a cutoff point of 1.05 ng/ml KLK11 had a sensitivity of 91.3 % and a specificity of 72.5 % for the prediction of lung cancer. Importantly the serum KLK11 levels did not differ significantly with age gender and histology. The levels of KLK11 were significantly correlated with TNM stage the presence of lymph node and distant metastases. Several previous studies have reported an association between kallikrein mRNA expression and cancer prognosis [14“16]. KLK5 and KLK4 have been associated with poor prognosis in ovarian cancer and KLK5 has also been shown to be associated with poor prognosis in breast cancer [1718]. In contrast KLK8 and KLK9 expression have been reported to be favorable prognosis in ovarian cancer [1920]. In addition KLK12 is reported to be an independent and favorable prognostic marker for breast cancer [21]. Sasaki et al. [11] have indicated that there is a significant correlation between decreased KLK11 mRNA expression level and poor prognosis in lung cancer. This study supports the increasing body of literature demonstrating the expression of kallikrein family gene involvement in the prognosis of human cancers. The most striking association we observed in NSCLC patients was a significant correlation between increased KLK11 level and favorable prognosis. We have demonstrated that high KLK11 was significantly associated with an increased PFS and OS in univariate analysis. This relationship was further illustrated in the Kaplan“Meier survival curves. Multivariate analysis also indicated that KLK11 was an independent indicator of PFS and OS. In our data suggest that serum KLK11 may be a useful diagnostic biomarker and shows a promising potential as prognostic marker in NSCLC patients. More large-scale prospective studies are warranted to confirm the findings. Conflicts of interest None. References 1. Chen Z Wang T Cai L Su C Zhong B Lei Y Clinicopathological significance of non-small cell lung cancer with high prevalence of Oct-4 tumor cells J Exp Clin Cancer Res 2012 31 10 10.1186/1756-9966-31-10 22300949 2. Smith RA Cokkinides V Brawley OW Cancer screening in the United States 2009: a review of current American Cancer Society guidelines and issues in cancer screening CA Cancer J Clin 2009 59 27 41 10.3322/caac.20008 19147867 3. Oguz A Unal D Tasdemir A Karahan S Aykas F Mutlu H Lack of any association between blood groups and lung cancer independent of histology Asian Pac J Cancer Prev. 2013 14 453 456 10.7314/APJCP.2013.14.1.453 23534772 4. Jemal A Siegel R Xu J Ward E Cancer statistics 2010 CA Cancer J Clin 2010 60 277 300 10.3322/caac.20073 20610543 5. Sano A Sangai T Maeda H Nakamura M Hasebe T Ochiai A Kallikrein 11 expressed in human breast cancer cells releases insulin-like growth factor through degradation of IGFBP-3 Int J Oncol 2007 30 1493 1498 17487371 6. Luo LY Shan SJ Elliott MB Soosaipillai A Diamandis EP Purification and characterization of human Kallikrein 11 a candidate prostate and ovarian cancer biomarker from seminal plasma Clin Cancer Res 2006 12 742 750 10.1158/1078-0432.CCR-05-1696 16467084 7. McIntosh MW Liu Y Drescher C Urban N Diamandis EP Validation and characterization of human Kallikrein-11 as a serum marker for diagnosis of ovarian carcinoma Clin Cancer Res 2007 13 4422 4428 10.1158/1078-0432.CCR-06-2224 17671125 8. Unal D Tasdemir A Oguz A Eroglu C Cihan YB Turak EE Is human Kallikrein-11 in gastric cancer treated with surgery and adjuvant chemoradiotherapy associated with survival? Pathol Res Pract 2013 209 779 783 10.1016/j.prp.2013.09.004 24169449 9. Yu X Tang HY Li XR He XW Xiang KM Overexpression of human kallikrein 11 is associated with poor prognosis in patients with low rectal carcinoma Med Oncol 2010 27 40 44 10.1007/s12032-009-9167-2 19184568 10. Diamandis EP Bo±o CA Scorilas A Harbeck N Dorn J Schmitt M Human kallikrein 11: an indicator of favorable prognosis in ovarian cancer patients Clin Biochem 2004 37 823 829 10.1016/j.clinbiochem.2004.04.009 15329323 11. Sasaki H Kawano O Endo K Suzuki E Haneda H Yukiue H Decreased Kallikrein 11 messenger RNA expression in lung cancer Clin Lung Cancer 2006 8 45 48 10.3816/CLC.2006.n.032 16870045 12. Lei KF Liu BY Zhang XQ Jin XL Guo Y Ye M Development of a survival prediction model for gastric cancer using serine proteases and their inhibitors Exp Ther Med 2012 3 109 116 10.1084/jem.20110399 22969854 13. Planque C Li L Zheng Y Soosaipillai A Reckamp K Chia D A multiparametric serum kallikrein panel for diagnosis of non-small cell lung carcinoma Clin Cancer Res 2008 14 1355 1362 10.1158/1078-0432.CCR-07-4117 18316555 14. Alexopoulou DK Papadopoulos IN Scorilas A Clinical significance of kallikrein-related peptidase (KLK10) mRNA expression in colorectal cancer Clin Biochem 2013 46 1453 1461 10.1016/j.clinbiochem.2013.03.002 23499583 15. Talieri M Alexopoulou DK Scorilas A Kypraios D Arnogiannaki N Devetzi M Expression analysis and clinical evaluation of kallikrein-related peptidase 10 (KLK10) in colorectal cancer Tumour Biol 2011 32 737 744 10.1007/s13277-011-0175-4 21487810 16. Patsis C Yiotakis I Scorilas A Diagnostic and prognostic significance of human kallikrein 11 (KLK11) mRNA expression levels in patients with laryngeal cancer Clin Biochem 2012 45 623 630 10.1016/j.clinbiochem.2012.03.005 22429520 17. Xi Z Kaern J Davidson B Klokk TI Risberg B Trop© C Kallikrein 4 is associated with paclitaxel resistance in ovarian cancer Gynecol Oncol 2004 94 80 85 10.1016/j.ygyno.2004.03.044 15262123 18. Yousef GM Scorilas A Kyriakopoulou LG Rendl L Diamandis M Ponzone R Human kallikrein gene 5 (KLK5) expression by quantitative PCR: an independent indicator of poor prognosis in breast cancer Clin Chem 2002 48 1241 1250 12142380 19. Kountourakis P Psyrri A Scorilas A Markakis S Kowalski D Camp RL Expression and prognostic significance of kallikrein-related peptidase 8 protein levels in advanced ovarian cancer by using automated quantitative analysis Thromb Haemost 2009 101 541 546 19277417 20. Bo±o CA Kishi T Scorilas A Harbeck N Dorn J Schmalfeldt B Human kallikrein 8 protein is a favorable prognostic marker in ovarian cancer Clin Cancer Res 2006 12 1487 1493 10.1158/1078-0432.CCR-05-2106 16533772 21. Talieri M Devetzi M Scorilas A Pappa E Tsapralis N Missitzis I Human kallikrein-related peptidase 12 (KLK12) splice variants expression in breast cancer and their clinical impact Tumour Biol 2012 33 1075 1084 10.1007/s13277-012-0347-x 22351561 9502500 8794 Clin Cancer Res Clin. Cancer Res. Clinical cancer research : an official journal of the American Association for Cancer Research 1078-0432 24423612 4136748 10.1158/1078-0432.CCR-13-2195 NIHMS556385 Article HEDGEHOG-GLI signaling inhibition suppresses tumor growth in squamous lung cancer Huang Lingling 1 Walter Vonn 2 Hayes D. Neil 2 Onaitis Mark 1 1Duke University Department of Surgery 2University of North Carolina Department of Medicine Corresponding Author: Mark Onaitis DUMC Box 3305 Durham NC 27710 [email protected] phone: 919-684-6974 fax: 919-684-8508 4 4 2014 14 1 2014 15 3 2014 15 3 2015 20 6 1566 1575 Purpose Lung squamous cell carcinoma (LSCC) currently lacks effective targeted therapies. Previous studies reported overexpression of HEDGEHOG (HH)-GLI signaling components in LSCC. However they addressed neither the tumor heterogeneity nor the requirement for HH-GLI signaling. Here we investigated the role of HH-GLI signaling in LSCC and studied the therapeutic potential of HH-GLI suppression. Experimental Design Gene expression datasets of two independent LSCC patient cohorts were analyzed to study the activation of HH-GLI signaling. Four human LSCC cell lines were examined for HH-GLI signaling components. Cell proliferation and apoptosis were assayed in these cells after blocking the HH-GLI pathway by lentiviral-shRNA knockdown or small molecule inhibitors. Xenografts in immunodeficient mice were used to determine the in vivo efficacy of GLI inhibitor GANT61. Results In both cohorts activation of HH-GLI signaling was significantly associated with the classical subtype of LSCC. In cell lines genetic knockdown of SMO produced minor effects on cell survival while GLI2 knockdown significantly reduced proliferation and induced extensive apoptosis. Consistently the SMO inhibitor GDC-0449 resulted in limited cytotoxicity in LSCC cells whereas the GLI inhibitor GANT61 was very effective. Importantly GANT61 demonstrated specific in vivo anti-tumor activity in xenograft models of GLI-positive cell lines. Conclusion Our studies demonstrate an important role for GLI2 in LSCC and suggest GLI inhibition as a novel and potent strategy to treat a subset of LSCC patients. Squamous cell lung cancer HEDGEHOG GLI J Korean Med Sci J. Korean Med. Sci JKMS Journal of Korean Medical Science 1011-8934 1598-6357 The Korean Academy of Medical Sciences 24431917 3890464 10.3346/jkms.2014.29.1.129 Original Article Medical Imaging Computed Tomography Guided Percutaneous Injection of a Mixture of Lipiodol and Methylene Blue in Rabbit Lungs: Evaluation of Localization Ability for Video-Assisted Thoracoscopic Surgery Jin Kwang Nam 1 Lee Kyung Won 2 Kim Tae Jung 2 Song Yong Sub 3 Kim Dong Il 4 1Department of Radiology Seoul Metropolitan Government-Seoul National University Boramae Medical Center Seoul Korea. 2Department of Radiology Seoul National University Bundang Hospital Seongnam Korea. 3Department of Radiology Seoul National University Hospital Seoul Korea. 4Department of Pathology Green Cross Laboratories Yongin Korea. Address for Correspondence: Kyung Won Lee MD. Department of Radiology Seoul National University Bundang Hospital 82 Gumi-ro 173beon-gil Bundang-gu Seongnam 463-707 Korea. Tel: +82.31-787-7604 Fax: +82.31-787-4011 [email protected] 1 2014 26 12 2013 29 1 129 136 13 5 2013 22 10 2013 © 2014 The Korean Academy of Medical Sciences. 2014 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons./licenses/by-nc/3.0/) which permits unrestricted non-commercial use distribution and reproduction in any medium provided the original work is properly cited. Preoperative localization is necessary prior to video assisted thoracoscopic surgery for the detection of small or deeply located lung nodules. We compared the localization ability of a mixture of lipiodol and methylene blue (MLM) (0.6 mL 1:5) to methylene blue (0.5 mL) in rabbit lungs. CT-guided percutaneous injections were performed in 21 subjects with MLM and methylene blue. We measured the extent of staining on freshly excised lung and evaluated the subjective localization ability with 4 point scales at 6 and 24 hr after injections. For MLM radio-opacity was evaluated on the fluoroscopy. We considered score 2 (acceptable) or 3 (excellent) as appropriate for localization. The staining extent of MLM was significantly smaller than methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opacity of MLM was found in 13 subjects (62%). An appropriate localization rate of MLM was 100% with the use of the directly visible ability and radio-opacity of MLM. MLM provides a superior pulmonary localization ability over methylene blue. Lung Ethiodized Oil Methylene Blue Tomography X-Ray Computed Radiology Interventional Seoul National University College of Medicine 800-20120036 INTRODUCTION Preoperative localization is necessary for video-assisted thoracoscopic surgery (VATS) when pulmonary nodules are too small or distant from the visceral pleura to be detected (1-3). A failure to localize nodules disturbs the success of the thoracoscopic resection and leads to conversion to thoracotomy (4 5). There are two kinds of localizing procedures: marking with thoracoscopically directly visible "
Lung_Cancer
"MassArray analysis 1 Sequencing+pyrosequencing 1 Sequencing+pyrosequencing+high-resolution melting 2 Sequencing+restriction fragment length polymorphism 1 Sequencing+single-strand conformational analysis 1 Sequencing+Taqman+PNA clamp 1 Sequencing+Therascreen kit 5 Sequencing+Therascreen kit+CAST PCR 1 SNaPshot+single-strand conformational analysis 1 Therascreen kit+fragment length analysis+SNaPshot kit 1 Genotyping errors False positive False negative Sample no. EGFR mutation resulta Samples tested A a B a C a A a B a C a Total errors Error rate (%) Round 1 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 23 0 4 4 17.4 A1 2 c.2235_2249del p.(E746_A750del) 24 0 0 0 0.0 A2 3 Wild type 24 5 0 5 20.8 A3 4 Wild type 23 5 0 5 21.7 A4 5 c.2235_2249del p.(E746_A750del) 24 0 5 5 20.8 A5 6 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 24 0 5 5 20.8 A6 7 c.2235_2249del p.(E746_A750del) 24 0 1 1 4.2 A7 8 Wild type 23 0 0 0 0.0 A8 9 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 23 0 0 0 0.0 A9 10 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 24 0 1 1 4.2 A10 11 c.2235_2249del p.(E746_A750del) 107 1 0 1 0 2 1.9 B1 and C8 12 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 107 2 0 16 1 19 17.8 B2 and C3 13 c.2235_2249del p.(E746_A750del) 100 2 0 3 4 9 9.0 B3 and C9 14 Wild type 104 0 1 0 0 1 1.0 B4 and C1 15 Wild type 103 2 0 0 0 2 1.9 B5 and C4 16 Wild type 104 2 0 0 0 2 1.9 B6 and C6 17 Wild type 103 2 0 0 0 2 1.9 B7 and C7 18 c.2155G>A p.(G719S) 104 2 0 25 10 37 35.6 B8 and C10 19 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 106 0 0 7 2 9 8.5 B9 and C5 20 c.2155G>A p.(G719S) 104 0 0 9 0 9 8.7 B10 and C2 a External quality assessment scheme rounds “ first (A) second (B) and third (C). 2984705R 2786 Cancer Res Cancer Res. Cancer research 0008-5472 1538-7445 24860162 4102622 10.1158/0008-5472.CAN-13-3398 NIHMS599328 Mechanisms promoting escape from mitotic-stress induced tumor cell death Sinnott Rebecca 1 * Winters Leah 2 Larson Brittany 3 Mytsa Daniela 1 Taus Patrick 1 * Cappell Kathryn M. 4 Whitehurst Angelique W. 1 * # 1Department of Pharmacology and Lineberger Comprehensive Cancer Center University of North Carolina at Chapel Hill Chapel Hill NC 2Department of Anesthesiology University of Colorado Aurora CO 3Wake Forest University School of Medicine Winston-Salem NC 4Deparmtent of Medicine Stanford University Stanford CA * Current Institution: Simmons Comprehensive Cancer Center UT-Southwestern Medical Center Dallas TX. #Address correspondence to: Angelique Whitehurst PhD. UT-Southwestern Medical Center 6001 Forest Park Drive Dallas TX 75390-8807. Phone (214)-645-6066. 214-645-6347 angelique.whitehurstutsouthwestern.edu. 13 6 2014 23 5 2014 15 7 2014 15 7 2015 74 14 3857 3869 Non-small cell lung cancer (NSCLC) is notorious for its paltry responses to first-line therapeutic regimens. In contrast to acquired chemoresistance little is known about the molecular underpinnings of the intrinsic resistance of chemo-na¯ve NSCLC. Here we report that intrinsic resistance to paclitaxel in NSCLC occurs at a cell-autonomous level due to the uncoupling of mitotic defects from apoptosis. To identify components that permit escape from mitotic stress-induced death we employed a genome-wide RNAi-based strategy which combines a high-throughput toxicity screen with a live-cell imaging platform to measure mitotic fate. This strategy revealed that prolonging mitotic arrest with a small molecule inhibitor of the APC/Cyclosome could sensitize otherwise paclitaxel-resistant NSCLC. We also defined novel roles for CASC1 and TRIM69 in supporting resistance to spindle poisons. CASC1 which is frequently co-amplified with KRAS in lung tumors is essential for microtubule polymerization and satisfaction of the spindle assembly checkpoint. TRIM69 which associates with spindle poles and promotes centrosomal clustering is essential for formation of a bipolar spindle. Notably RNAi-mediated attenuation of CASC1 or TRIM69 was sufficient to inhibit tumor growth in vivo. On the basis of our results we hypothesize that tumor evolution selects for a permissive mitotic checkpoint which may promote survival despite chromosome segregation errors. Attacking this adaptation may restore the apoptotic consequences of mitotic damage to permit the therapeutic eradication of drug-resistant cancer cells. mitotic slippage pan-genomic RNAi screen paclitaxel CASC1 TRIM69 8811105 1399 Mol Carcinog Mol. Carcinog. Molecular carcinogenesis 0899-1987 1098-2744 23681825 4152901 10.1002/mc.22006 NIHMS619642 Heme-related gene expression signatures of meat intakes in lung cancer tissues Lam Tram Kim 1 2 * Rotunno Melissa 2 * Ryan Brid M. 3 Pesatori Angela C. 4 5 Bertazzi Pier Alberto 4 5 Spitz Margaret 6 Caporaso Neil E. 2 Landi Maria Teresa 2 § 1Cancer Prevention Fellowship Program Office of Preventive Oncology National Cancer Institute National Institutes of Health (NIH) DHHS Bethesda Maryland 2Division of Cancer Epidemiology and Genetics Genetic Epidemiology Branch National Cancer Institute National Institutes of Health (NIH) DHHS Bethesda Maryland 3Laboratory of Human Carcinogenesis Center for Cancer Research National Cancer Institute Bethesda Maryland 4EPOCA Epidemiology Research Center Universita™ degli Studi di Milano Milan 5Unit of Epidemiology Fondazione IRCCS Ospedale Maggiore Policlinico Mangiagalli e Regina Elena Milan Italy 6MD Anderson Cancer Center Houston Texas §To whom correspondence should be addressed. National Cancer Institute 6120 Executive Blvd. MSC 7114 Bethesda MD 20892-7248; landimmail.nih.gov; Fax: 301-402-4489 * The authors equally contributed to the presented work. 9 8 2014 16 5 2013 7 2014 03 9 2014 53 7 548 556 Lung cancer causes more deaths worldwide than any other cancer. In addition to cigarette smoking dietary factors may contribute to lung carcinogenesis. Epidemiologic studies including the Environment and Genetics in Lung cancer Etiology (EAGLE) have reported increased consumption of red/processed meats to be associated with higher risk of lung cancer. Heme-iron toxicity may link meat intake with cancer. We investigated this hypothesis in meat-related lung carcinogenesis using whole genome expression. We measured genome-wide expression (HG-U133A) in 49 tumor and 42 non-involved fresh frozen lung tissues of 64 adenocarcinoma EAGLE patients. We studied gene expression profiles by high-versus-low meat consumption with and without adjustment by sex age and smoking. Threshold for significance was a False Discovery Rate (FDR) ?0.15. We studied whether the identified genes played a role in heme-iron related processes by means of manually curated literature search and gene ontology-based pathway analysis. We found that gene expression of 232 annotated genes in tumor tissue significantly distinguished lung adenocarcinoma cases who consumed above/below the median intake of fresh red meats (FDR=0.12). Sixty-three (~28%) of the 232 identified genes (12 expected by chance p-value<0.001) were involved in heme binding absorption transport and Wnt signaling pathway (e.g. CYPs TPO HPX HFE SLCs WNTs). We also identified several genes involved in lipid metabolism (e.g. NCR1 TNF UCP3) and oxidative stress (e.g. TPO SGK2 MTHFR) that may be indirectly related to heme-toxicity. The study™s results provide preliminary evidence that heme-iron toxicity might be one underlying mechanism linking fresh red meat intake and lung cancer. Proc Natl Acad Sci U S A Proc. Natl. Acad. Sci. U.S.A pnas pnas PNAS Proceedings of the National Academy of Sciences of the United States of America 0027-8424 1091-6490 National Academy of Sciences 24550319 3932924 201320956 10.1073/pnas.1320956111 PNAS Plus Biological Sciences Medical Sciences PNAS Plus Mapping the molecular determinants of BRAF oncogene dependence in human lung cancer BRAF oncogene dependence in NSCLC Lin Luping a b Asthana Saurabh a b Chan Elton a b Bandyopadhyay Sourav b Martins Maria M. b Olivas Victor a b Yan Jenny Jiacheng a b Pham Luu b Wang Mingxue Michelle b Bollag Gideon c Solit David B. d Collisson Eric A. a b Rudin Charles M. e Taylor Barry S. a b f Bivona Trever G. a b 1 Departments of aMedicine and fEpidemiology and Biostatistics and bHelen Diller Family Comprehensive Cancer Center University of California San Francisco CA 94158; cPlexxikon Inc. Berkeley CA 94710; dHuman Oncology and Pathogenesis Program and eThoracic Oncology Service Memorial Sloan“Kettering Cancer Center New York NY 10065 1To whom correspondence should be addressed. E-mail: trever.bivonaucsf.edu. Edited by Arthur Weiss University of California San Francisco CA and approved January 15 2014 (received for review November 6 2013) Author contributions: L.L. G.B. D.B.S. E.A.C. C.M.R. B.S.T. and T.G.B. designed research; L.L. E.C. S.B. M.M.M. V.O. J.J.Y. L.P. and M.M.W. performed research; C.M.R. contributed new reagents/analytic tools; L.L. S.A. S.B. and B.S.T. analyzed data; and L.L. B.S.T. and T.G.B. wrote the paper. 18 2 2014 3 2 2014 111 7 E748 E757 Significance Oncogenic mutations in the BRAF kinase occur in 6“8% of nonsmall cell lung cancers (NSCLCs) but the biological and clinical relevance of these mutations is unclear. We uncovered mechanisms of resistance to BRAF inhibition in NSCLC using an integrated functional chemical genetics approach in human BRAF-mutant NSCLC cells and clinical specimens. Our results provide biological insights into the regulation of BRAF oncogene dependence and identify strategies to optimize outcomes in BRAF-mutant NSCLC patients. Oncogenic mutations in the BRAF kinase occur in 6“8% of nonsmall cell lung cancers (NSCLCs) accounting for more than 90000 deaths annually worldwide. The biological and clinical relevance of these BRAF mutations in NSCLC is incompletely understood. Here we demonstrate that human NSCLC cells with BRAFV600E but not other BRAF mutations initially are sensitive to BRAF-inhibitor treatment. However these BRAFV600E NSCLC cells rapidly acquire resistance to BRAF inhibition through at least one of two discrete molecular mechanisms: (i) loss of full-length BRAFV600E coupled with expression of an aberrant form of BRAFV600E that retains RAF pathway dependence or (ii) constitutive autocrine EGF receptor (EGFR) signaling driven by c-Jun“mediated EGFR ligand expression. BRAFV600E cells with EGFR-driven resistance are characterized by hyperphosphorylated protein kinase AKT a biomarker we validated in BRAF inhibitor-resistant NSCLC clinical specimens. These data reveal the multifaceted molecular mechanisms by which NSCLCs establish and regulate BRAF oncogene dependence provide insights into BRAF“EGFR signaling crosstalk and uncover mechanism-based strategies to optimize clinical responses to BRAF oncogene inhibition. targeted therapy combination therapy 101274235 33311 J Thorac Oncol J Thorac Oncol Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer 1556-0864 1556-1380 24662455 4084898 10.1097/JTO.0000000000000148 NIHMS560664 Membrane carbonic anhydrase IX (CAIX) expression and relapse risk in resected stage I-II non-small cell lung cancer Stewart D.J. MD Nunez M.I. MD Behrens C. MD Liu D. MS Lin Y. H. PhD Lee J.J. PhD Roth J. MD Heymach J. MD PhD Swisher S. MD Hong W.K. MD Wistuba I.I. MD University of Ottawa (DJS) and University of Texas MD Anderson Cancer Center (MIN CB DL YHL JJL JR JH SS WKH IIW) Correspondence: David J. Stewart MD FRCPC Head Division of Medical Oncology The Ottawa Hospital/University of Ottawa Ottawa ON Canada K1H 8L6 Telephone: 613-737-7700 — 70166 dstewarttoh.on.ca 25 5 2014 5 2014 01 5 2015 9 5 675 684 Background Adjuvant chemotherapy reduces recurrences of non-small cell lung cancer (NSCLC). To determine which patients need adjuvant chemotherapy we assessed factors associated with time to relapse (TTR). Methods In 230 resected stages I-II NSCLCs we correlated immunohistochemistry (IHC) scores for factors associated with cell growth rate growth regulation hypoxia cell survival and cell death with TTR. Results With a median follow-up of 82 (1-158) months for those alive and relapse-free at last follow-up median time to recurrence was not reached. The 2- and 5-year probabilities of maintaining freedom from recurrence were 80.7% (95% confidence interval [CI]:(75.3% 86.4%)) and 74.6% (95% CI:(68.6% 81.2%)) respectively. TTR curves flattened at an apparent cure rate of 70%. In multicovariate Cox models factors correlating with shorter TTR were membranous carbonic anhydrase IX (mCAIX) staining (any vs none hazard ratio [HR]=2.083 p=0.023) and node stage (N1 vs N0 HR=2.591 p=0.002). mCAIX scores correlated positively with tumor size grade squamous histology necrosis mitoses Ki67 p53 nuclear DNMT1 and cytoplasmic SHARP2 and correlated inversely with papillary histology EGFR mutation (trend) CTR1 and cytoplasmic HIF-1? VEGF DNMT1 and ERCC1. Conclusion Nodal stage and mCAIX IHC were the strongest independent predictors of shorter TTR in resected NSCLCs. mCAIX correlated with tumor size markers of tumor proliferation and necrosis and tumor genetic characteristics and paradoxically correlated inversely with the hypoxia markers HIF-1? and VEGF. Presence of mCAIX could help determine patients with high-risk of recurrence who might require adjuvant chemotherapy. carbonic anhydrase IX non-small cell lung cancer PLoS One PLoS ONE plos plosone PLoS ONE 1932-6203 Public Library of Science San Francisco USA 24595062 3942483 PONE-D-13-41012 10.1371/journal.pone.0090818 Research Biology Biochemistry Proteins Developmental Biology Morphogenesis Cell Migration Evolutionary Biology Evolutionary Systematics Phylogenetics Genetics Cancer Genetics Gene Expression Gene Function Model Organisms Animal Models Medicine Oncology Basic Cancer Research FTSJ2 a Heat Shock-Inducible Mitochondrial Protein Suppresses Cell Invasion and Migration FTSJ2 Characteristics and Functions in Cancer Cells Lai Cheng-Wei 1 Chen Hsiao-Ling 2 Lin Ken-Yo 1 Liu Fang-Chueh 1 3 Chong Kowit-Yu 4 Cheng Winston T. K. 5 Chen Chuan-Mu 1 * 1 Department of Life Sciences Agricultural Biotechnology Center iEGG center National Chung Hsing University Taichung Taiwan 2 Department of Bioresources Da-Yeh University Changhwa Taiwan 3 Department of Animal Nutrition Livestock Research Institute Council of Agriculture Tainan Taiwan 4 Department of Medical Biotechnology and Laboratory Science Chang Gung University Tao-Yuan Taiwan 5 Department of Animal Science and Biotechnology Tunghai University Taichung Taiwan Ahmad Aamir Editor Wayne State University School of Medicine United States of America * E-mail: chchen1dragon.nchu.edu.tw Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: HLC CMC. Performed the experiments: CWL KYL FCL. Analyzed the data: KYC CMC WTC. Contributed reagents/materials/analysis tools: FCL WTC. Wrote the paper: CWL CMC. 2014 4 3 2014 9 3 e90818 8 10 2013 5 2 2014 2014 Lai et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Ribosomal RNA large subunit methyltransferase J (RrmJ) an Escherichia coli heat shock protein is responsible for 2?-O-ribose methylation in 23S rRNA. In mammals three close homologs of RrmJ have been identified and have been designated as FTSJ1 FTSJ2 and FTSJ3; however little is known about these genes. In this study we characterized the mammalian FTSJ2 which was the most related protein to RrmJ in a phylogenetic analysis that had similar amino acid sequence features and tertiary protein structures of RrmJ. FTSJ2 was first identified in this study as a nucleus encoded mitochondrial protein that preserves the heat shock protein character in mammals in which the mRNA expressions was increased in porcine lung tissues and A549 cells after heat shock treatment. In addition a recent study in non-small cell lung cancer (NSCLC) suggested that the FTSJ2 gene is located in a novel oncogenic locus. However our results demonstrate that the expression of FTSJ2 mRNA was decreased in the more invasive subline (CL1-5) of the lung adenocarcinoma cells (CL1) compared with the less invasive subline (CL1-0) and overexpression of FTSJ2 resulted in the inhibition of cell invasion and migration in the rhabdomyosarcoma cell (TE671). In conclusion our findings indicate that mammalian FTSJ2 is a mitochondrial ortholog of E. coli RrmJ and conserves the heat shock protein properties. Moreover FTSJ2 possesses suppressive effects on the invasion and migration of cancer cells. This research was supported by grant NSC-98-2313-b-005-012 from the National Science Council and was partly supported by the Ministry of Education Taiwan Republic of China under the aiming top university plan (ATU-101-s0508). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Heat shock proteins (HSPs) and their biological functions are highly conserved from Escherichia coli to mammals [1]. The following five major classes of HSPs have been defined: HSP70s HSP60s HSP90s HSP110s and small HSPs. Protein folding refolding and disaggregation are well-known functions of HSPs [1] [2]. However there are still a number of proteins involved in the heat shock response that remain uncharacterized upon heat shock stress [3]. The E. coli enzyme RrmJ a 23S rRNA 2?-O-ribose methyltransferase (MTase) that was identified as a novel heat shock protein is the first gene of the rrmJ-ftsH heat shock operon and was first discovered in 1991 [3] [4]. RrmJ is required for the 2?-O-ribose methylation of U2552 in 23S rRNA [5]. Um2552 is one of the four 2?-O-ribose methylated nucleotides in E. coli rRNA and is located in the A-loop of the peptidyl transferase center of the ribosome [5] [6]. In a previous study the E. coli rrmJ deletion strain lost its adaptive ability upon heat shock stress [7]. This loss may have resulted from a change in the A-loop conformation and ribosome dissociation [7]“[9]. The heat shock protein RrmJ is conserved in both Prokaryota and Eukaryota [10]. In Saccharomyces cerevisiae there are three homologs of RrmJ including Trm7p Mrm2p and Spb1p. Trm7p is a tRNA 2?-O-ribose MTase that catalyzes the methylation of the nucleotides at positions 32 and 34 in the anticodon loop of tRNAPheTrp [11]. Mrm2p is a mitochondrial rRNA 2?-O-ribose MTase but is encoded by the nuclear genome. Similar to RrmJ Mrm2p catalyzes the formation of Um2791 which is located in the peptidyl transferase center in mitochondrial 21S rRNA in a position equivalent to that of Um2552 in E. coli. The mrm2 deletion strain shows growth defects in a glycerol-containing medium at 37°C indicating that this protein is important for mitochondrial function and is crucial for heat shock adaptation in yeast [12]. Spb1p is a nuclear protein composed of 841 amino acids and contains two functional domains: a small N-terminal RrmJ-like domain and a large C-terminal domain that is involved in rRNA maturation. Spb1p catalyzes the methylation of U2921 and G2922 in the A-loop of 25S rRNA which are equivalent to U2552 and G2553 in E. coli 23S rRNA respectively [13]“[16]. E. coli RrmJ and its three homologs in yeast all contain the four-residue sequence K-D-K-E which composes the catalytic center of RrmJ [10] [17]. Moreover the structures of the substrates of these three homologs and the positions of the methylated rRNA residues are very similar to those of E. coli RrmJ [6] especially Mrm2p because it is located in the mitochondria which are believed to be degenerated bacteria [18]. In mammals there are also three RrmJ homologs designated as FTSJ1 FTSJ2 and FTSJ3 that correspond to Trm7p Mrm2p and Spb1p respectively. In previous studies the mutation of human FTSJ1 has been shown to cause nonsyndromic X-linked mental retardation (NSXLMR) in Japanese families [19]. A FTSJ2 locus in the genome gene amplification and mRNA over-expression were discovered in several non-small cell lung cancer (NSCLC) tissue samples [20] and FTSJ3 was revealed to function in pre-rRNA processing [21] [22]. However little is known about these three homologs in mammals. Thus in this study we used E. coli RrmJ as a starting point to construct a phylogenetic tree containing several typological species and mammals which showed that FTSJ2 is an ortholog of RrmJ. Based on the highly conserved FTSJ2 protein sequences within mammals we established the basic characteristics of FTSJ2 and its gene expression during the heat shock response in different porcine tissues and human cancer cells. Because previous studies have shown the abnormal expression of FTSJ2 in NSCLC we further investigated the functions of FTSJ2 in cell invasion and migration using human lung adenocarcinoma and rhabdomyosarcoma cell lines. Materials and Methods Phylogenetic Analysis of the E. coli RrmJ Homologs The RrmJ domain of 39 protein sequences and the three out-group proteins fibrillarin (PDB code: 1FBN) [10] [23] vaccinia VP39 (1AV6) [24] and catechol-O- methyltransferase (1VID) [25] which are structurally and functionally similar to E. coli RrmJ were used for the construction of a phylogenetic tree. The distance matrix was calculated using the JTT model. The minimum evolution (ME) method with 1000 bootstrap replicates was performed using the MEGA5 program (www.megasoftware.net/) [26]. The nodes of the tree with a bootstrapping support of >50% are shown. Database Search for RrmJ Homologs and the Multiple Sequence Alignment BLASTp was used to search the complete protein sequences in the non-redundant (nr) database at the National Center for Biotechnology Information (NCBI) website. Fourteen proteins from humans Methanococcus jannaschii and three invertebrate species were obtained using E. coli RrmJ as a query and an E-value of <3e-08 was defined as the cut-off value. Twenty-two vertebrate proteins were found using human FTSJ1 FTSJ2 and FTSJ3 as the queries and a 50% amino acid identity was defined as the cut-off value in this search. "
Lung_Cancer
"The formal evaluation consists in the computation of different ?ci at each ith iteration given an exposure history qhi evaluated at a random time t between 41 and 100 for a random individual among the ns subjects. Indices of relative bias coverage and relative RMSE are derived from the following: (13) where I is an indicator function and ?? 1(1 ? ?) is the quantile function of the cumulative normal distribution related to probability 1 ? ? with ? = 0.05. The effect summary ?ci corresponds to the true effect from while is estimated from the best fitting model selected by AIC and BIC by using given the specific exposure history qhi of the random subject at the random time. This approach assures that the performance indicators in (13) are evaluated on the whole range of simulated exposure histories and do not depend on a specific choice. A visual inspection of performance is also provided by computing from the best-fitting models the grid of risk contributions defined in (9) composing the exposure“lag“response surface. Bias is then assessed across the surface by comparing the average fit of the the m = 500 models with the true exposure“lag“response relationship. A bidimensional display of coverage is also provided for each scenario. The performance of the AIC and BIC are also evaluated through their empirical rejection rate for the hypotheses of linearity or constant effect namely the proportion of times the selection procedure favors a model with a non-linear term for fe(x) and a non-constant term for we(?). When H0 is true namely fs(x) = x or ws(?) = c the rejection rate is an estimate of the probability of error of the selection criteria which wrongly select unnecessarily complex models. When H0 is false namely fs(x) ? x or ws(?) ? c the rejection rate is an estimate of the power of the selection criteria for identifying non-linearity and constant lag structures. In a formal hypothesis testing setting these measures would be interpreted as the type I error and the power of the test. 4.3. Results of the simulation study The results of simulations under the nine scenarios with ns = 400 producing approximately 300 uncensored events are summarized in tables in graphs. Table IV reports the formal evaluation of performance on the synthetic risk summary ?c in terms of relative bias coverage and relative RMSE. A visual assessment for three scenarios is provided in each column of the multi-panel . The true simulated exposure“lag response associations are displayed in the top panels while the other panels offer a comparison of the true lag“response and exposure“response curves at specific values with the average of the estimates from AIC and BIC-selected models together with a sample of 25 individual curves. Table IV Synthetic indices of relative bias coverage and relative root mean square error (RSME) for the nine scenarios of exposure“lag“response associations. Results from m = 500 simulated data sets with ns = 400 subjects Bias Coverage RMSE f(x) ? w(?) AIC BIC AIC BIC AIC BIC Linear-constant 0.01 0.01 0.91 0.94 0.07 0.04 Linear-decay 0.00 0.00 0.93 0.94 0.07 0.05 Linear-peak 0.01 0.01 0.92 0.90 0.08 0.07 Plateau-constant 0.06 0.13 0.84 0.72 0.08 0.09 Plateau-decay 0.04 0.14 0.90 0.74 0.09 0.13 Plateau-peak 0.07 0.21 0.87 0.62 0.11 0.18 Exponential-constant 0.01 0.03 0.90 0.80 0.09 0.09 Exponential-decay 0.05 0.04 0.93 0.87 0.12 0.13 Exponential-peak 0.00 0.17 0.91 0.75 0.12 0.17 Generally AIC-selected models offer a better performance with a lower relative bias and a coverage of confidence intervals closer to the 95% nominal value. The values of relative RMSE suggest that the higher variability of AIC-based estimators is often balanced by the higher bias affecting BIC. At least part of the bias can be attributed to lack of fit due to the insufficient flexibility of quadratic spline functions when used to fit logarithmic or exponential shapes. This phenomenon appears quite relevant for the plateau-type exposure response characterized by the highest relative bias in the order of 4“7% for AIC but up to 21% for BIC (see Table IV and second column). This pattern is confirmed by the results in Table V showing the average df in each dimension and the empirical rejection rates for the hypotheses of linearity and constant risk. The AIC selection is affected by moderate overfitting sometimes suggesting flexible models in scenarios of linear and/or constant risk. In contrast BIC shows severe underfitting often selecting simple models for complex exposure“lag“response associations in particular regarding linearity. Table V Average df in each dimension for the best fitting models selected through AIC and BIC (left part) and empirical rejection rate for the AIC and BIC-based selection for the hypotheses of linearity and constant risk (right part) for the nine scenarios of exposure“lag“response associations. Results from m = 500 simulated data sets with ns = 400 subjects Average df Empirical rejection rate f(x) w(?) H0 : f(x) = x H0 : w(?) = c f(x) ? w(?) AIC BIC AIC BIC AIC BIC AIC BIC Linear-constant 1.50 1.03 1.57 1.02 0.29* 0.03* 0.23* 0.01* Linear-decay 1.26 1.00 3.60 3.17 0.18* 0.00* 1.00 1.00 Linear-peak 1.22 1.00 4.02 3.72 0.15* 0.00* 1.00 0.98 Plateau-constant 2.26 1.54 1.47 1.00 0.82 0.47 0.19* 0.00* Plateau-decay 2.53 1.55 3.49 3.10 0.97 0.54 1.00 1.00 Plateau-peak 2.18 1.21 4.01 3.56 0.85 0.19 1.00 0.93 Exponential-onstant 2.20 1.56 1.43 1.00 0.83 0.52 0.16* 0.00* Exponential-decay 2.36 1.81 3.58 3.12 0.99 0.80 1.00 1.00 Exponential-peak 2.15 1.29 4.05 3.69 0.90 0.27 1.00 0.93 * H0 is true The undercoverage of confidence intervals as shown in Table IV can be attributed to both lack of fit and a posteriori model selection. The latter as discussed in Section 2.5 may generate undercoverage through the underestimation of the true sampling (co)variance. A comparison of the importance of the two sources can be provided by the assessment of undercoverage in the first scenario where linear and constant functions are actually among the options of the selection procedure and the underlying simulated association can be potentially recovered with no lack of fit. In this scenario AIC-selected models affected by overfitting show a coverage of 91% very close to the nominal value as illustrated in Table IV. The under-coverage seems to be proportional to the bias as confirmed by with a lower coverage corresponding to sections of the bidimensional space characterized by worse fit. Empirical coverage across the risk surfaces for three scenarios of exposure“lag“response associations (linear-constant plateau-decay and exponential-peak in each column). Results from m = 500 simulated data sets with ns = 400 subjects. The simulated examples with ns = 200 and ns = 800 generate approximately 150 and 600 uncensored events respectively. The versions of Tables IV“V and for these examples are reported in Tables S2“S5 and Figures S9“S10 of the supporting information. The comparison suggests that varying the sample size does not dramatically affect the performance of the AIC-based test apart from the expected different power in identifying nonlinear and noncostant exposure“time“response associations. Consistently AIC-based selection seems to perform well across the range of number of subjects included in the analysis with a small bias and reasonable coverage. The results of this simulation study are consistent with previous findings on one-dimensional models for exposure“lag“response associations assuming a linear exposure“response relationship 18. 5. Discussion In this contribution I illustrate a statistical framework for modeling temporal dependencies with time-varying exposures defined here as exposure“lag“response associations. The approach is based on the extension of distributed lag non-linear models a modeling class previously proposed in time series analysis 2324. The extended DLNM methodology brings together and extends previous methodological developments on the topic as summarized in. Briefly it provides a unified framework for different study designs and regression methods and is applicable to time series cross-sectional case-control survival and longitudinal data. A major advantage is the possibility to describe the lag structure of either linear or nonlinear exposure“response relationships through the choice of two functions that define the association along the dimensions of the predictor and lags including most of the previous approaches as special cases. The example in illustrates how such flexibility is important for obtaining correct estimates of the association. Model specification easily accounts for previous knowledge on the association and incorporates assumptions on the phenomenon to be investigated through the choice of specific functions lag period and constraints. Interpretation of complex exposure“lag“response associations is aided by the definition of simple summary measures of effect and prediction and by graphical representation. The modeling framework is defined through a neat and compact algebraic representation including the derivation of measures of uncertainty such as standard errors and confidence intervals. Estimation is carried out with standard regression models which do not require specialized optimization procedures and may include terms for multiple exposure“lag“response dependencies as shown for radon and smoking here. The parameterization prediction and graphical representation are carried out with few general functions implemented in a freely available and documented software as discussed in. A key issue of the DLNM methodology is about selecting the appropriate model among different options for modeling the bidimensional exposure“lag“response relationship. The simulation study in indicates that AIC-based selection performs reasonably well over a range of 150“600 uncensored events while the strong penalty of BIC induces the selection of models too simple to recover the underlying dependency. The overfitting characterizing AIC-selected models in scenarios of simple exposure“lag“response dependencies does not seriously affect its performance a result in line with previous findings 18. However AIC-selected models also suffer from bias and undercoverage of confidence intervals to some extent. Part of this seems to be related to the limited flexibility of the functions applied in the simulation study and may be described as a smoothing problem rather that an inherent limitation of the estimators. It should also be noted that the simulation study only evaluates a limited set of exposure“response and lag“response shapes simulated under the assumption of independency. Different functions such as cubic splines and more complex exposure“lag“response surfaces will be assessed in future simulation studies. Also an extension of DLNMs with penalized splines characterized by higher flexibility can be explored as well exploiting previous research on bivariate smoothing techniques 3031. A related problem is about the inferential procedures being conditional on a posteriori selection of the best-fitting model. Previous studies on unidimensional models have proposed a correction for the inflation of type I errors in tests on a constant effect along lags 1727. However this approach is not easily extended to the bidimensional setting of exposure“lag“response associations and the definition of a hypothesis testing procedure for DLNMs is left to future developments. Although a posteriori selection may also be a source of undercoverage of confidence intervals its impact seems to be limited if compared with that associated with lack of fit at least in the simple scenarios investigated in the simulation study. Another limitation is the lack of a formal testing procedure on the hypothesis of independency. As suggested in Section 3.4 a graphical assessment of the proportionality of exposure“response and lag“response curves such as those in Figure 3 can help investigating the issue. Further research is needed to provide more consistent inferential procedures in this setting. The analysis of the temporal evolution of the risk associated with protracted time-varying exposures has straightforward applications in different research fields. For example the DLNM methodology may be used to characterize the risk of chronic exposures to occupational or environmental factors to differentiate the role of exposures sustained at different ages in life course studies or to define the temporal frame of beneficial or adverse effects of drugs in clinical trials and pharmaco-epidemiology. The development of this methodology and software implementation provide a promising analytical tool for biomedical research. 6. Software and data All the analyses presented in this paper were performed using the R software version 3.0.1 32. The DLNM modeling framework is fully implemented in the package dlnm 25 by using the expressly extended version 2.0.0. The permutational algorithm for simulating time-to-event data in the presence of time-varying exposures is implemented in the package PermAlgo 29 version 1.0. Both packages are available through R from its central repository. The data of the Colorado Plateau uranium miners cohort in the form of a comma-separated values file is included in the supporting information¡ together with the R scripts for the analysis performed in the example and the simulation study of Sections 3“4 which are entirely reproducible. In particular the script example.R provides a short illustration of the modeling framework. Versions of the scripts updated to future versions of the dlnm package will be available at http://www.ag-myresearch.com. Distributed lag non-linear models were originally conceived and developed for describing temperature“health associations in time series data by Ben Armstrong. The data from the Colorado Plateau uranium miners cohort were collected by the researchers of National Institute for Occupational Safety and Health. I am grateful to Bryan Langholz for kindly making data and documentation available. The simulation study was performed using the high-processing computing system at the London School of Hygiene and Tropical Medicine. The final version of this article has been substantially improved following the comments of an unknown reviewer. This research was supported by a Methodology Research fellowship by Medical Research Council-UK (grant ID G1002296). References 1 Goodman PG Dockery DW Clancy L Cause-specific mortality and the extended effects of particulate pollution and temperature exposure Environmental Health Perspectives 2004 112 2 179 185 14754572 2 Elliott P Shaddick G Wakefield JC de Hoogh C Briggs DJ Long-term associations of outdoor air pollution with mortality in Great Britain Thorax 2007 62 12 1088 1094 17666438 3 Collet JP Sharpe C Belzile E Boivin JF Hanley J Abenhaim L Colorectal cancer prevention by non-steroidal anti-inflammatory drugs: effects of dosage and timing British Journal of Cancer 1999 81 1 62 8 10487613 4 Abrahamowicz M Bartlett G Tamblyn R du Berger R Modeling cumulative dose and exposure duration provided insights regarding the associations between benzodiazepines and injuries Journal of Clinical Epidemiology 2006 59 4 393 403 16549262 5 Checkoway H Pearce N Hickey JL Dement JM Latency analysis in occupational epidemiology Archives of Environmental Health 1990 45 2 95 100 2334237 6 Thomas DC Models for exposure-time-response relationships with applications to cancer epidemiology Annual Review of Public Health 1988 9 451 482 7 Breslow NL Day NE Statistical Methods in Cancer Research 1987 II Lyon International Agency for Reasearch on Cancer (IARC) 232 271 The desing and analysis of cohort studies chap. 6: Modelling the relationship between risk dose and time 8 Thomas DC Brown CC Chu KC Goldsmith DF Saracci R Proceedings of a symposium on time-related factors in cancer epidemiology Journal of Chronic Diseases 1987 40 Suppl. 2 1S 211S 9 Thomas DC Statistical Methods in Environmental Epidemiology 2009 New York Oxford University Press 279 300 chap. 13: Mechanistic models 10 Thomas DC Statistical methods for analyzing effects of temporal patterns of exposure on cancer risks Scandinavian Journal of Work Environment & Health 1983 9 4 353 366 11 Vacek PM Assessing the effect of intensity when exposure varies over time Statistics in Medicine 1997 16 5 505 513 9089959 12 Langholz B Thomas D Xiang A Stram D Latency analysis in epidemiologic studies of occupational exposures: application to the Colorado Plateau uranium miners cohort American Journal of Industrial Medicine 1999 35 3 246 256 9987557 13 Richardson DB Latency models for analyses of protracted exposures Epidemiology 2009 20 3 395 399 19262389 14 Hauptmann M Wellmann J Lubin JH Rosenberg PS Kreienbrock L Analysis of exposure-time-response relationships using a spline weight function Biometrics 2000 56 4 1105 1108 11129467 15 Hauptmann M Berhane K Langholz B Lubin J Using splines to analyse latency in the Colorado Plateau uranium miners cohort Journal of Epidemiology and Biostatistics 2001 6 6 417 424 11831677 16 Hauptmann M Pohlabeln H Lubin JH Jockel KH Ahrens W Bruske-Hohlfeld I Wichmann HE The exposure-time-response relationship between occupational asbestos exposure and lung cancer in two German case-control studies American Journal of Industrial Medicine 2002 41 2 89 97 11813213 17 Sylvestre MP Abrahamowicz M Flexible modeling of the cumulative effects of time-dependent exposures on the hazard Statistics in Medicine 2009 28 27 3437 3453 19708037 18 Abrahamowicz M Beauchamp ME Sylvestre MP Comparison of alternative models for linking drug exposure with adverse effects Statistics in Medicine 2012 31 11-12 1014 1030 22095719 19 Abrahamowicz M MacKenzie TA Joint estimation of time-dependent and non-linear effects of continuous covariates on survival Statistics in Medicine 2007 26 2 392 408 16479552 20 Berhane K Hauptmann M Langholz B Using tensor product splines in modeling exposure-time-response relationships: Application to the Colorado Plateau Uranium Miners cohort Statistics in Medicine 2008 27 26 5484 5496 18613262 21 Almon S The distributed lag between capital appropriations and expenditures Econometrica 1965 33 178 196 22 Schwartz J The distributed lag between air pollution and daily deaths Epidemiology 2000 11 3 320 326 10784251 23 Armstrong B Models for the relationship between ambient temperature and daily mortality Epidemiology 2006 17 6 624 631 17028505 24 Gasparrini A Armstrong B Kenward MG Distributed lag non-linear models Statistics in Medicine 2010 29 21 2224 2234 20812303 25 Gasparrini A Distributed lag linear and non-linear models in R: the package dlnm Journal of Statistical Software 2011 43 8 1 20 22003319 26 Thomas DC Statistical Methods in Environmental Epidemiology 2009 New York Oxford University Press chap. 6: Modelling exposure-time-response relationships 27 Mahmud M Abrahamowicz M Leffondré K Chaubey Y Selecting the optimal transformation of a continuous covariate in Cox's regression: Implications for hypothesis testing Communications in Statistics: Simulation and Computation 2006 35 1 27 45 28 Breslow NL Day NE Statistical Methods in Cancer Research 1987 II Lyon International Agency for Reasearch on Cancer (IARC) 178 231 The desing and analysis of cohort studies chap. 5: Fitting models to continuous data 29 Sylvestre MP Abrahamowicz M Comparison of algorithms to generate event times conditional on time-dependent covariates Statistics in Medicine 2008 27 14 2618 2634 17918753 30 Wood SN Generalized Additive Models: an Introduction with R 2006 Chapman & Hall/CRC 31 Eilers PHC Currie ID Durban M Fast and compact smoothing on large multidimensional grids Computational Statistics and Data Analysis 2006 50 1 61 76 32 R Development Core Team R: A Language and Environment for Statistical Computing R Foundation for Statistical Computing Vienna Austria 2013. http://www.R-project.org/ Supplementary material 9005373 1697 Eur J Cancer Eur. J. Cancer European journal of cancer (Oxford England : 1990) 0959-8049 1879-0852 24246704 3991133 10.1016/j.ejca.2013.10.006 NIHMS541404 Article Dosing to Rash: A Phase II Trial of the First-Line Erlotinib for Patients with Advanced Non-Small-Cell Lung Cancer an Eastern Cooperative Oncology Group Study (E3503) Brahmer JR M.D. M.Sc. 1 Lee JW Ph.D. 2 Traynor AM M.D. 3 Hidalgo MM M.D. Ph.D. 4 Kolesar JM Pharm.D. 3 Siegfried JM Ph.D. 5 Guaglianone PP M.D. 6 Patel JD M.D. 7 Keppen MD M.D. 8 Schiller JH M.D. 9 1Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins Baltimore Maryland 2Dana-Farber Cancer Institute Boston Massachusetts 3University of Wisconsin Madison Wisconsin 4Spain 5University of Pittsburgh Pittsburgh Pennsylvania 6Decatur Memorial Hospital Decatur Illinois 7Northwestern University Chicago Illinois 8Sanford Cancer Center Sioux Falls South Dakota 9University of Texas Southwestern Medical Center Dallas Texas Corresponding Author Julie R. Brahmer M.D. M.Sc. Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins Bunting Blaustein Cancer Research Building Room G94 1650 Orleans Street Baltimore MD 21287-0013 Office phone: 410-502-7159; Fax 410-614-9334; [email protected] 2 4 2014 15 11 2013 1 2014 01 1 2015 50 2 302 308 © 2013 Published by Elsevier Ltd. 2013 Background The development of a rash has been retrospectively associated with increased response and improved survival when treated with erlotinib at the standard dose of 150 mg per day. The objective of this trial was to evaluate the association of the activity of erlotinib in the first-line setting in patients with advanced non-small-cell lung cancer (NSCLC) with the development of a tolerable rash via dose escalation of erlotinib or tumor characteristics. Methods Patients with advanced NSCLC without prior systemic therapy were treated with erlotinib 150 mg orally per day. The dose was increased by 25 mg every two weeks until the development of grade 2/tolerable rash or other dose limiting toxicity. Tumor biopsy specimens were required for inclusion. Results The study enrolled 137 patients 135 were evaluable for safety and 124 were eligible and evaluable for response. Only 73 tumor samples were available for analysis. Erlotinib dose escalation occurred in 69/124 patients. Erlotinib was well tolerated with 70% of patients developing a grade 1/2 rash and 10% developing grade 3 rash. Response rate and disease control rate were 6.5% and 41.1% respectively. Median overall survival was 7.7 months. Toxicity and tumor markers were not associated with response. Grade 2 or greater skin rash and low pMAPK were associated with improved survival. Conclusions Overall survival was similar in this trial compared to first-line chemotherapy in this unselected patient population. Dose escalation to the development of grade 2 skin rash was associated with improved survival in this patient population. Bioinformatics Bioinformatics bioinformatics bioinfo Bioinformatics 1367-4803 1367-4811 Oxford University Press 25161229 4147902 10.1093/bioinformatics/btu449 btu449 Eccb 2014 Proceedings Papers Committee Original Papers Pathways and Molecular Networks Personalized identification of altered pathways in cancer using accumulated normal tissue data Ahn TaeJin 1 2 3 Lee Eunjin 1 2 Huh Nam 1 * Park Taesung 3 4 * 1Samsung Advanced Institute of Technology130 Suwon-si Gyeonggi-do 443-803 Korea 2Samsung Genome Institute Seoul 135-710 Korea 3Interdisciplinary Program in Bioinformatics and 4Department of Statistics Seoul National University Seoul South Korea *To whom correspondence should be addressed. 01 9 2014 22 8 2014 22 8 2014 30 17 i422 i429 © The Author 2014. Published by Oxford University Press. 2014 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial re-use distribution and reproduction in any medium provided the original work is properly cited. For commercial re-use please contact [email protected] Motivation: Identifying altered pathways in an individual is important for understanding disease mechanisms and for the future application of custom therapeutic decisions. Existing pathway analysis techniques are mainly focused on discovering altered pathways between normal and cancer groups and are not suitable for identifying the pathway aberrance that may occur in an individual sample. A simple way to identify individual™s pathway aberrance is to compare normal and tumor data from the same individual. However the matched normal data from the same individual are often unavailable in clinical situation. Therefore we suggest a new approach for the personalized identification of altered pathways making special use of accumulated normal data in cases when a patient™s matched normal data are unavailable. The philosophy behind our method is to quantify the aberrance of an individual sample's pathway by comparing it with accumulated normal samples. We propose and examine personalized extensions of pathway statistics overrepresentation analysis and functional class scoring to generate individualized pathway aberrance score. Results: Collected microarray data of normal tissue of lung and colon mucosa are served as reference to investigate a number of cancer individuals of lung adenocarcinoma (LUAD) and colon cancer respectively. Our method concurrently captures known facts of cancer survival pathways and identifies the pathway aberrances that represent cancer differentiation status and survival. It also provides more improved validation rate of survival-related pathways than when a single cancer sample is interpreted in the context of cancer-only cohort. In addition our method is useful in classifying unknown samples into cancer or normal groups. Particularly we identified ˜amino acid synthesis and interconversion™ pathway is a good indicator of LUAD (Area Under the Curve (AUC) 0.982 at independent validation). Clinical importance of the method is providing pathway interpretation of single cancer even though its matched normal data are unavailable. Availability and implementation: The method was implemented using the R software available at our Web site: http://bibs.snu.ac.kr/ipas. Contact: [email protected] or [email protected] Supplementary information: Supplementary data are available at Bioinformatics online. 1 INTRODUCTIONCancer arises from normal cells and can evolve to become malignant metastatic and/or resistant to therapy. The analysis of altered pathways in an individual cancer patient may help to understand the disease status and suggest customized anticancer therapies.It is straightforward to compare the molecular profile of an individual™s tumor and normal cells to discover molecular aberrances specific to his/her cancer. However it may not be feasible in the current clinical practice environment to perform a metastatic tumor biopsy at the time of treatment resistance in patients with advanced cancer (Dancey et al. 2012). A case study of custom-tailored medicine based on an individual™s genome and transcriptome highlights this limitation (Jones et al. 2010). A patient™s tumor had metastasized to the lung after surgery at the primary site. A biopsy from his lung tumor was analyzed by mutation and transcription profiling; however the patient™s normal lung tissue was not biopsied. Because there was no matched normal tissue messenger RNA (mRNA) expression in the patient™s own blood and information collected from various normal tissues were used to identify differentially expressed genes (DEGs). The results of pathway analysis based on DEGs integrated copy number variation and mutation information led the doctor to change the patient™s drug treatment and the disease was stabilized for 3 months.Although the personalized interpretation of pathways can be demanding most current pathway analyses have been developed to investigate deregulated pathways between two phenotype groups. Khatri et al. (2012) classified these methods into three types: overrepresentation analysis (ORA) functional class scoring (FCS) and a pathway topology (PT)-based approach.ORA approaches typically apply an arbitrary threshold value (e.g. fold change >2 or P < 0.05) on gene expression to assess whether the number of genes beyond threshold are significantly over- or underrepresented in the given pathway. There are two drawbacks to ORA. First it uses only the most significant genes and discards others thus resulting in information loss for marginally significant genes (Breitling et al. 2004). Second it considers only the number of genes and does not consider the magnitude of expression changes leading to information loss regarding the importance of genes (e.g. a gene with a fold change of 2.01 and a gene with a fold change of 4 are considered equally). Unlike ORA FCS methods do not discard genes with an arbitrary threshold but use all available genes which is an improvement over ORA (Tian et al. 2005). PT methods are essentially based on FCS methods with the addition that they consider network topology information. They compensate for the common limitation of ORA and FCS in reporting false-positive gene sets due to sets of overlapping genes. In our article we focus on ORA and FCS methods extending and implementing each for personalized pathway analysis.There are two exceptional studies examining individualized pathway analysis (Drier et al. 2013; Vaske et al. 2010). PARADIGM is a tool that infers a pathway status by using known functional structures. The method models the functional structure of pathway as a set of interconnected variables where the variables are omic objects such as DNA mRNA and protein where the interaction between variables describes the functional status of a pathway. PARADIGM may perform better with multiple omics as it uses known functional relationships between a gene or inter-gene DNA and protein. Hence it might not perform well with single layer omic data such as from mRNA microarrays.Drier et al. (2013) proposed a personal pathway deregulation score (PDS) which represents the distance of a single cancer sample from the median of normal samples on the principal curve. To calculate PDS they reduced the dimensions by principal component analysis and found the best principal curve using entire cohort samples containing both normal and/or different stages of cancers. Drier™s method performs better than PARADIGM in the mRNA only datasets of brain and colon cancers. Calculating PDS requires data dependent preprocessing steps including selecting the number of principal components to be used and filtering out noisy gene data to obtain optimized principal curves. PDS fully uses whole cohort data to interpret an individual™s pathway which can be a drawback in that it requires a number of cohort data to extract principal curve to interpret a single patient data. It has a limitation to interpret a single sample such as a patient™s recurrent tumor that is not accompanied with cohort dataset to extract the principal curve.Our proposed method is based on the comparison of one cancer sample with many accumulated normal samples (we use ˜nRef™ to refer to the accumulated normal samples) that is different from the previous studies in following sense."
Lung_Cancer
"25 Thus our results of a 2-year DFS rate of 80% and OS rate of 96% appear favorable by comparison. However it is prudent to be cautious because we lost 20 of 81 patients from the survival analysis because of consent withdrawal and a direct comparison of outcomes data among trials cannot account for differences in study populations eligibility and staging criteria and provisions for data collection and analysis. The spectrum of protein levels for ERCC1 and RRM1 significant correlation of levels between both molecules and distribution of patients into the 4 gene expression categories in the current study is consistent with previous experience.91213161826 However the current analysis method for biomarker evaluation (ie antibody-based assessment of in situ protein levels) is not suitable for general clinical implementation for several reasons. First ERCC1 has multiple isoforms that cannot be specifically distinguished by the available reagents and only 1 isoform appears to be involved in platinum-induced DNA damage repair.27 Second the monoclonal antibody 8F1 which is consistently used for ERCC1 protein expression analysis detects a second and unrelated protein that shares a common epitope with ERCC1.28“30 This observation may account for the highly batch-dependent performance of this antibody1827 which may explain the significantly lower ERCC1 values in the current study compared with prior results.16 Third protein levels for RRM1 in particular and to a lesser degree for ERCC1 appear to be influenced by the specimen processing and handling procedures used at collection sites.26 Finally although the method for immunofluorescence-based quantitative detection of both molecules performs well if all specimens to be analyzed are processed simultaneously there is considerable interassay variability if specimens need to be processed individually over an extended period of time as required for real-time patient decision-making.18 However it is important to note that the biochemical biophysical and cell biological evidence for ERCC1 and RRM1 as predictive molecules for platinum and gemcitabine efficacy remains undisputed.510“12273132 A small number of recent clinical trials have used ERCC1 prospectively for therapeutic decision-making. These include 2 randomized phase 3 trials in patients with advanced-stage NSCLC (1 published [NCT00499109]18 and the other terminated and unpublished [NCT00801736]) and 2 adjuvant trials 1 of which was a terminated and not yet published phase 2 trial [TAilored Post-Surgical Therapy in Early Stage NSCLC (TASTE) NCT00775385] and the other an ongoing phase 3 trial [International TAilored Chemotherapy Adjuvant trial (ITACA); EudraCT 2008-001764-36]. Results from the first trial (NCT00499109) demonstrated no improvement in patient survival; however the authors raised the possibility of a false-negative result because of an inexplicably divergent survival in an internal control group.18 The second trial (NCT00801736) and third trial (NCT00775385) were terminated early after the discovery of ERCC1 isoforms27 and specificity problems with the 8F1 antibody.28“30 The fourth trial is using ERCC1 and tumor thymidylate synthase mRNA expression levels for treatment assignment compared with a cisplatin-based control treatment with OS as the primary endpoint and a planned accrual of 700 patients. Results from these trials will help to further delineate the feasibility and technical issues mentioned above. The results of the current study demonstrated the feasibility of our biomarker-based decision algorithm in a multiinstitutional cooperative group environment for patients with surgically resected NSCLC. We identified that the current practice of evaluation and treatment for these patients may present an obstacle to rapid molecular-based decision-making. Although encouraging efficacy data emerged from this trial bioassays that specifically measure platinum-induced DNA damage repair must be developed before further clinical trials are launched that seek to tailor the use of these agents. "
Lung_Cancer
" In short EGFR activating mutations in exons 19 and 21 were initially identified by Sanger sequencing and confirmed by fragment length analysis for exon 19 deletions (FAM-labelled primer in an ABI prism 3130 DNA analyser (Applied Biosystems Foster City CA USA) and by Taqman assay for exon 21 (L858R) mutation. All tumor specimens were from the original biopsy taken prior to any treatment and before randomization. Testing was performed on ? 2mm2 of tissue obtained from one to three slides of 4-micron tissue sections which were subjected to laser capture microdissection to enrich for the presence of tumor cells. DNA was extracted using a standard laboratory protocol and tested at a single site in Spain in Laboratory of Oncology for EGFR activating mutations in exon 19 and 21 using a previously described method. The average turnaround time was approximately 5 days.[26] Bi-directional Sanger sequencing All samples tested by the EGFR PCR test were also tested by Sanger sequencing using DNA from FFPET specimens prepared by the cobas DNA Sample Preparation Kit and sequenced with 2— bidirectional Sanger sequencing by a CLIA-certified laboratory (SeqWright Houston TX USA) using a validated protocol. Repeat Sanger sequencing was performed to compare the detection of EGFR mutations from adjacent sections of tissue to minimize any impact of tissue heterogeneity used for the EGFR PCR test relative to the original LDT results. Also sequencing protocols vary by laboratory in terms of the percent tumor content/sample that requires macrodissection. DNA isolated with the cobas DNA Sample Preparation Kit and used for sequencing required ?10% tumor content. Average turnaround time to results was 7 days. The estimated limit of detection is approximately 20% mutant alleles.[30] Massively parallel pyrosequencing (MPP) Samples with valid EGFR PCR test results with adequate DNA remaining from the initial extraction were tested by a MPP method (454 GS Titanium 454 Life Sciences Branford CT USA) by a CLIA-certified laboratory (SeqWright Houston TX USA) using a validated protocol.[31] This method is a 5“7 day process that involves amplicon generation pooling ligation emulsion PCR amplification and massively parallel pyrosequencing with manual data analysis. The estimated limit of detection for the assay is 1.25% mutant alleles. [27] The MPP method was used to demonstrate performance of the EGFR PCR test to a more sensitive method and as an arbiter for discrepant cases observed between the LDT or the repeat Sanger sequencing. In order to preserve patient privacy associated with tested clinical samples raw MPP sequencing results were anonymized and presented in Table S1. Results Specimen demographics 487 (47%) of 1044 specimens screened for the EURTAC trial using LDTs were available for testing using the EGFR PCR test. The flow of samples through the study is shown in . Patient demographics and baseline tumor characteristics for all patients by LDT status are shown in . There were no significant differences between subsets of patients tested and patients not tested by the EGFR PCR test (p>0.05) for each LDT status (mutation detected mutation not detected) with the exception of country of the screening clinic. Clinical outcomes for patients based on the EGFR PCR test results Of the 174 patients enrolled in EURTAC trial specimens from 134 (77%) patients were available for testing using the EGFR PCR test. Excluding 11 patients with invalid EGFR PCR test results and 7 patients with a result of EGFR mutation not detected a total of 116 (67%) patients were mutation detected by the EGFR PCR test and evaluable for clinical outcome analysis (57 patients in the chemotherapy arm and 59 in the erlotinib arm). Clinical outcomes (PFS BORR and OS) are presented in . Among EGFR PCR test positive patients those treated with erlotinib had a significantly prolonged PFS when compared to patients treated with chemotherapy (p-value <0.0001 log-rank test); the median PFS was 10.4 months (95% CI: 8.0 to 13.8 months) and 5.4 months (95% CI: 4.4 to 6.8 months) for patients treated with erlotinib or chemotherapy respectively (). The HR based on the Cox proportional hazards model was reduced by 66% (HR 0.34; [95% CI: 0.21 to 0.54]) for patients in the erlotinib versus chemotherapy arm. One year after randomization a higher percentage of patients in the erlotinib compared with the chemotherapy arm were event-free (45% [95% CI: 32% to 59% versus 6% [95% CI: 0% to 15%] respectively). .0089518.g002 Kaplan-Meier curves of progression-free survival (PFS) for different treatments in treatment-na¯ve patients with non“small-cell lung cancer and EGFR mutation detected by the EGFR PCR test and LDT. .0089518.t002 Summary of Clinical Outcome Analysis among EGFR PCR test positive patients in the EURTAC trial. Chemotherapy (N?=?57) Erlotinib (N?=?59) PFS (Investigator) Patients with event 37 (64.9%) 47 (79.7%) Patients without eventa 20 (35.1%) 12 (20.3%) ?Time to event (months) ?Medianb (95%CI) 5.4 [4.4; 6.8] 10.4 [8.0; 13.8] ?p-Value (Log-Rank Test) <0.0001 ?Hazard Ratio (95% CI) 0.34 [0.21; 0.54] ?1 year estimate ?Patients remaining at risk 2 24 ?Event-free Rateb (95%CI) 6% [0%; 15%] 45% [32%; 59%] Best Overall Analysis Response rates (95% CI) 14.0% [ 6.3%; 25.8%] 59.3%[ 45.7%; 71.9%] Difference in Response Rates (%) 45.29% [ 28.8%; 61.7%] ?p-Value (Chi-squared Test) <.0001 Odds Ratio (95% CI) 8.93 [3.59; 22.19] OS Patients with event 35 (61.4%) 36 (61.0%) Patients without eventa 22 (38.6%) 23 (39.0%) ?Time to event (months) ?Medianb (95%CI) 20.8 [17.3; 29.4] 25.8 [16.1; 30.0] ?p-Value (Log-Rank Test) 0.5381 ?Hazard Ratio (95% CI) 0.86 [0.54; 1.38] ?2 - year estimate ?Patients remaining at risk 16 23 ?Event-free Rateb (95% CI) 43% [29%; 57%] 51% [38%; 64%] Note: All eligible patients enrolled in study ML20650 were determined as EGFR mutation detected by the LDT. Among those patients with EGFR mutation confirmed by the EGFR PCR test were included in this table. Event ?=? Death or progression free whichever comes first for PFS analysis and event?=?death for OS analysis. a censored. b Kaplan-Meier estimates. C including censored observations. BORR were higher in patients in the erlotinib arm (59.3% [95% CI: 45.7% to 71.9%]) compared to the chemotherapy arm (14.0% [95% CI: 6.3% to 25.8%]). Patients in the erlotinib arm were much more likely to respond to therapy than patients in the chemotherapy arm (odds ratio of 8.93 [95% CI: 3.59 to 22.19]). There was no significant difference in OS between the treatment arms (25.8 months in the erlotinib arm (95% CI: 16.1 to 30.0) and 20.8 months in the chemotherapy arm (95% CI: 17.3 to 29.4) (log-rank test p-value ?=?0.5381)). PFS BORR and OS results for EGFR PCR test positive patients did not differ significantly from those obtained in all patients enrolled in the EURTAC trial which suggests that the EGFR PCR test positive patients are representative of all EURTAC enrolled patients. For the 7 cases where the EGFR PCR test result was mutation not detected and discrepant with the LDT two cases resolved in favor of the LDT by MPP three cases resolved in favor of the EGFR PCR test and one sample was invalid for both Sanger and MPP and the other was in agreement between the EGFR PCR test and Sanger but not MPP (Table S2). Anecdotally 6 of the 7 patients were treated with erlotinib and only one patient achieved greater than or equal to median PFS based on the LDT or the EGFR PCR test. Comparison of EGFR PCR test and LDT results Among 432 specimens with valid results from both the EGFR PCR test and LDT the PPA NPA and OPA were 94.2% (146/155 CI: 89.3% 96.9%) 97.5% (270/277 CI: 94.9% 98.8%) and 96.3% (416/432 CI: 94.1% 97.7%) respectively (). Thus there was a high concordance between the original LDT and EGFR PCR test results. Among sixteen specimens with discordant results the EGFR PCR test result was confirmed by MPP in 68.8% (11/16) cases (Table S3). .0089518.t003 Agreement analysis between EGFR PCR test and LDT. SLCG LDT Total N?=?432 Mutation detected Mutation not detected EGFR PCR test Mutation detected 146 7 153 Mutation not detected 9 270 279 Total 155 277 432* ¢12 samples with inconclusive LDT results and 43 samples with invalid EGFR PCR test results were excluded. Positive percent agreement ?=?94.2% (95% CI [89.3“96.9%]). Negative percent agreement ?=?97.5% (95% CI [94.9“98.8%]). Overall percent agreement ?=?96.3% (95% CI [94.1“97.7%]). Comparison of the EGFR PCR test results with Sanger Sequencing Of 487 specimens tested using the EGFR PCR test and Sanger sequencing 406 gave valid results by both methods (38 were invalid by both methods five were invalid by EGFR PCR test and 38 were invalid by Sanger sequencing). The PPA NPA and OPA for EGFR PCR test compared with Sanger sequencing were 96.6% (112/116 CI: 91.7% 98.7%) 88.3% (256/290 CI: 84.1% 91.5%) and 90.6% (368/406 CI: 87.4% 93.1%; Table 4) respectively. Among 38 discordant results between the EGFR PCR test and Sanger sequencing MPP agreed with the EGFR PCR test result in 30 (78.9%) cases (Table S4). Sanger sequencing detected one L858R not detected by MPP and failed to detect 22 exon 19 deletions and 7 L858R mutations confirmed by MPP. Four MPP results were invalid and the remaining four results agreed with Sanger. The range of percent mutant alleles of the cases missed by Sanger was 3% to 60% with several specimens (n?=?16) under the estimated limit of detection for Sanger. .0089518.t004 Table 4 Agreement analysis between EGFR PCR test and Sanger sequencing. Sanger sequencing Total N?=?406 Mutation detected Mutation not detected EGFR PCR test Mutation detected 112 34 146 Mutation not detected 4 256 260 Total 116 290 406 *81 samples with invalid EGFR PCR test or Sanger sequencing results were excluded. Positive percent agreement ?=?96.6% (95% CI [91.5“98.7%]). Negative percent agreement ?=?88.3% (95% CI [84.1“91.5%]). Overall percent agreement ?=?90.6% (95% CI [87.4“93.1%]). Discussion This study supports the feasibility of performing a retrospective clinical validation of a companion diagnostic from prospective therapeutic clinical trials. The EGFR PCR test results were highly concordant (>96%) with the LDT results used to select patients for the EURTAC trial. As a consequence PFS and BORR of the subset of patients with EGFR mutations detected with the EGFR PCR test were comparable to the full cohort of patients enrolled in the EURTAC trial thus validating the use of the EGFR PCR test to select patients for treatment with anti-EGFR TKIs such as erlotinib. Median PFS survival was 9.7 versus 10.4 months for the erlotinib group and 5.2 versus 5.4 months for the LDTs and EGFR PCR test respectively. The BORR was 58% versus 59.3% months for the erlotinib group and 15% versus 14.0% for the LDTs and EGFR PCR test respectively. Among the 16 discordant specimens between the EGFR PCR test and LDTs a third mutation testing method agreed with the EGFR PCR test result in 11 cases. Of seven cases that were mutation detected by the EGFR PCR test and mutation not detected by the LDT 5 were confirmed by MPP. These patients could have potentially benefited from anti-EGFR TKI therapy. The EGFR PCR test had a number of technical advantages over the LDT used in the EURTAC trial. The LDT required laser capture microdissection of multiple tissue sections and involved 3 separate assays with a median turnaround time of 4.5 days. By comparison the EGFR PCR test required macrodissection only if the tumor content was <10% and can be performed in one day using a single 5 µm section. Furthermore the EGFR PCR test is a commercially available kit-based assay that provides an automated result rather than a manual process subject to interpretation and which can be performed by any qualified clinical laboratory. More than 80% of the specimens tested in this study were small biopsy specimens. The overall invalid rate for Sanger sequencing was 15.6% (76/487) compared to the EGFR PCR assay at 9% (43/487). However the invalid rate for the subset of specimens derived from resected specimens was 0% (0/109) likely because of sufficient tissue availability. Thus the assay is extremely robust when performed on resected tumor specimens and has an approximately 90% success rate on biopsy specimens which are often the only tumor sample available for testing in NSCLC. Sanger sequencing has been widely used to detect EGFR mutations.[30] [32] Similar to the overall invalid rates for the 134 EGFR mutation detected LDT samples enrolled in the EURTAC trial Sanger sequencing had a higher invalid rate (15.7%) compared to 8.2% for the EGFR PCR test. There were also 30 mutation not detected results for Sanger sequencing (22.4%) and 7 mutation not detected results for the EGFR PCR test (5.2%). With 21 invalid results and 30 mutation not detected results Sanger sequencing would have misclassified 38% of patients enrolled in the EURTAC trial. Similar invalid rates have been reported in three other studies suggesting that this methodology has limitations when applied to DNA from FFPET samples.[33] [34] [35] In addition Sanger sequencing has shown poor sensitivity in samples containing less than 20“25% mutant alleles.[35] [36] [37] When we compared the agreement between valid results for the EGFR PCR test with Sanger sequencing (n?=?406) there were 38 discordant cases of which 30 were confirmed by MPP. Twenty-nine of the 30 cases resulted in mutation detected status by the EGFR PCR test and would make these patients eligible for anti-EGFR therapy. Poor sensitivity of Sanger sequencing thus explains the relatively low NPA compared to EGFR PCR test observed in this study. Given the criticality of EGFR mutation testing in selecting specific therapies for life-threatening cancers such as advanced NSCLC robust and accurate assays with rapid turnaround time are preferred. Recent quality assurance studies to ascertain the mutation status of a standard panel of tumors have shown that different clinical laboratories do not correctly identify the mutation status of 100% of the panel members even when they are using the same or similar testing methodologies.[38] [39] For assays that involve mutation analysis of tumor samples important factors contributing to the assay performance include analytic standardization validation of reagents and methodology laboratory experience and the appropriate involvement of the pathologist. In conclusion results of the present study indicate that the cobas EGFR mutation test is a highly robust and highly accurate companion diagnostic assay to select patients for treatment with anti-EGFR therapies such as erlotinib. Supporting Information Table S1 Listing of MPP Result. (PDF) Click here for additional data file. Table S2 Outcome from samples discrepant between the cobas EGFR PCR test and LDT that were enrolled in the clinical trial (cobas MND/LDT MD). (PDF) Click here for additional data file. Table S3 Agreement results between discordant EGFR PCR and LDT tests. (PDF) Click here for additional data file. Table S4 MPP results from resolution analysis of discordant specimens between EGFR PCR test and Sanger sequencing. (PDF) Click here for additional data file. We would like to acknowledge Patrick O'Donnell and Karen Yu for their contributions to this study. References 1 ChapmanPB HauschildA RobertC HaanenJB AsciertoP et al (2011) Improved survival with vemurafenib in melanoma with BRAF V600E mutation. N Engl J Med364: 2507“251621639808 2 OuSH BartlettCH Mino-KenudsonM CuiJ IafrateAJ (2012) Crizotinib for the treatment of ALK-rearranged non-small cell lung cancer: a success story to usher in the second decade of molecular targeted therapy in oncology. Oncologist17: 1351“1375 3 O'BryantCL WengerSD KimM ThompsonLA (2013) Crizotinib: a new treatment option for ALK-positive non-small cell lung cancer. Annals Pharmacotherapy47: 189“197 4 SunJM ChoiYL WonJK HirschFR AhnJS et al (2012) A dramatic response to crizotinib in a non-small-cell lung cancer patient with IHC-positive and FISH-negative ALK. J Thorac Oncol7: e36“3823154564 5 Administration USFaD (2010) Class Labeling Changes to anti-EGFR monoclonal antibodies cetuximab (Erbitux) and panitumumab (Vectibix): KRAS Mutations. 6 HarbisonCT HorakCE LedeineJM MukhopadhyayP MaloneDP et al (2012) Validation of Companion Diagnostic for Detection of Mutations in Codons 12 and 13 of the KRAS Gene in Patients with Metastatic Colorectal Cancer: Analysis of the NCIC CTG CO.17 Trial. Arch Pathol Lab Med137: 820“82723030695 7 MaemondoM InoueA KobayashiK SugawaraS OizumiS et al (2010) Gefitinib or chemotherapy for non“small-cell lung cancer with mutated EGFR. N Engl J Med362: 2380“2388 8 MokTS WuYL ThongprasertS YangCH ChuDT et al (2009) Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. N Engl J Med361: 947“95719692680 9 ZhouC WuYL ChenG FengJ LiuXQ et al (2011) Erlotinib versus chemotherapy as first-line treatment for patients with advanced EGFR mutation-positive non-small-cell lung cancer (OPTIMAL CTONG-0802): a multicentre open-label randomised phase 3 study. Lancet Oncol12: 735“74221783417 10 HirschFR KabbinavarF EisenT MartinsR SchnellFM et al (2011) A randomized phase II biomarker-selected study comparing erlotinib to erlotinib intercalated with chemotherapy in first-line therapy for advanced non-small-cell lung cancer. J Clin Oncol29: 3567“3573 11 RosellR CarcerenyE GervaisR VergnenegreA MassutiB et al (2012) Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre open-label randomised phase 3 trial. Lancet Oncol13: 239“24622285168 12 SequistLV MartinsRG SpigelD GrunbergSM SpiraA et al (2008) First-line gefitinib in patients with advanced non-small-cell lung cancer harboring somatic EGFR mutations. J Clin Oncol26: 2442“244918458038 13 MitsudomiT MoritaS YatabeY NegoroS OkamotoI et al (2010) Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label randomised phase 3 trial. Lancet Oncol11: 121“12820022809 14 KosakaT YatabeY EndohH YoshidaK HidaT et al (2006) Analysis of epidermal growth factor receptor gene mutation in patients with non-small cell lung cancer and acquired resistance to gefitinib. Clin Cancer Res12: 5764“576917020982 15 LynchTJ BellDW SordellaR GurubhagavatulaS OkimotoRA et al (2004) Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med350: 2129“213915118073 16 PaezJG JannePA LeeJC TracyS GreulichH et al (2004) EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science304: 1497“1500 17 PaoW MillerV ZakowskiM DohertyJ PolitiK et al (2004) EGF receptor gene mutations are common in lung cancers from œnever smokers and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A101: 13306“1331115329413 18 PaoW MillerVA PolitiKA RielyGJ SomwarR et al (2005) Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is associated with a second mutation in the EGFR kinase domain. PLoS2: 225“235 19 RielyGJ PolitiKA MillerVA PaoW (2006) Update on epidermal growth factor receptor mutations in non-small cell lung cancer. Clin Cancer Res12: 7232“7241 20 SharmaSV BellDW SettlemanJ HaberDA (2007) Epidermal growth factor receptor mutations in lung cancer. Nat Rev Cancer7: 169“18117318210 21 GarridoP de CastroJ ConchaA FelipE IslaD et al (2012) Guidelines for biomarker testing in advanced non-small-cell lung cancer. A national consensus of the Spanish Society of Medical Oncology (SEOM) and the Spanish Society of Pathology (SEAP). Clin & Transl Oncol14: 338“349 22 KeedyVL TeminS SomerfieldMR BeasleyMB JohnsonDH et al (2011) American Society of Clinical Oncology provisional clinical opinion: epidermal growth factor receptor (EGFR) Mutation testing for patients with advanced non-small-cell lung cancer considering first-line EGFR tyrosine kinase inhibitor therapy. J Clin Oncol29: 2121“212721482992 23 EttingerDS AkerleyW BeplerG BlumMG ChangA et al (2010) Non-small cell lung cancer. J Natl Compr Canc Netw8: 740“801 24 LindemanNI CaglePT BeasleyMB ChitaleDA DacicS et al (2013) Molecular Testing Guideline for Selection of Lung Cancer Patients for EGFR and ALK Tyrosine Kinase Inhibitors: Guideline from the College of American Pathologists International Association for the Study of Lung Cancer and Association for Molecular Pathology. J Mol Diagn15: 415“45323562183 25 Administration USFaD (2013) FDA approves first companion diagnostic to detect gene mutation associated with a type of lung cancer. 26 RosellR MoranT QueraltC PortaR CardenalF et al (2009) Screening for epidermal growth factor receptor mutations in lung cancer. N Engl J Med361: 958“96919692684 27 O'Donnell PF Jane; Shyu Johnny; Current Robert; Rehage Taraneh; Tsai Julie; Christensen Mari; Tran Ha Bich; Chien Sean; Wei Wen; Lawrence H. Jeffrey; Soviero Steven; Wu Lin. A real-time PCR assay for detecting EGFR mutations in formalin-fixed paraffin-embedded tissue (FFPET) specimens of non-small cell lung cancer (NSCLC). 2012; Chicago IL. 28 O'Donnell PFJ ShyuJ CurrentR RehageT TsaiJ Christensen M. Bich TranH Shih-ChangC WeiW LawrenceHJ WuL SovieroS (2013) A Real-Time PCR Assay for Detecting EGFR Mutations in Formalin-Fixed Paraffin-Embedded Tissue Specimens of Non-Small Cell Lung Cancer. BMC Cancer13: 21023621958 29 (2011) cobas EGFR Mutation Test CE-IVD Package Insert Roche Molecular Systems Inc. USA. 30 CondeE AnguloB TangM MorenteM Torres-LanzasJ et al (2006) Molecular context of the EGFR mutations: evidence for the activation of mTOR/S6K signaling. Clin Cancer Res12: 710“71716467080 31 MarguliesM EgholmM AltmanWE AttiyaS BaderJS et al (2005) Genome sequencing in microfabricated high-density picolitre reactors. Nature437: 376“38016056220 32 AnguloB Garcia-GarciaE MartinezR Suarez-GauthierA CondeE et al (2010) A commercial real-time PCR kit provides greater sensitivity than direct sequencing to detect KRAS mutations: a morphology-based approach in colorectal carcinoma. J Mol Diagn12: 292“299 33 Gallegos RuizMI FloorK RijmenF GrunbergK RodriguezJA et al (2007) EGFR and K-ras mutation analysis in non-small cell lung cancer: comparison of paraffin embedded versus frozen specimens. Cell Oncol29: 257“26417452778 34 OginoS KawasakiT BrahmandamM YanL CantorM et al (2005) Sensitive sequencing method for KRAS mutation detection by Pyrosequencing. J Mol Diag7: 413“421 35 AndersonS BloomKJ ValleraDU RueschoffJ MeldrumC et al (2012) Multisite Analytic Performance Studies of a Real-Time Polymerase Chain Reaction Assay for the Detection of BRAF V600E Mutations in Formalin-Fixed Paraffin-Embedded Tissue Specimens of Malignant Melanoma. Arch Pathol Lab Med136: 1385“139122332713 36 TanYH LiuY EuKW AngPW LiWQ et al (2008) Detection of BRAF V600E mutation by pyrosequencing. Pathology40: 295“29818428050 37 KotoulaV CharalambousE BiesmansB MalousiA VrettouE et al (2009) Targeted KRAS mutation assessment on patient tumor histologic material in real time diagnostics. PLoS One4: e774619888477 38 Beau-FallerM DegeorgesA RollandE MounawarM AntoineM et al (2011) Cross-Validation "
Lung_Cancer
"This CTL clone specifically recognized peptide-pulsed T2 cells and H2228 cells expressing HLA-A*02:01 and EML4-ALK that had been treated with IFN-? 48 h prior to examination. CTL activity was inhibited by an anti-HLA-class I monoclonal antibody (W6/32) consistent with a class I-restricted mechanism of cytotoxicity. These results suggest that this peptide (RLSALESRV) is a novel HLA-A*02:01-restricted CTL epitope and that it may be a new target for antigen-specific immunotherapy against EML4-ALK-positive cancers. EML4-ALK peptide vaccine CTL clone lung cancer Introduction Lung cancer is one of the main causes of cancer-related mortality. Approximately 85% of lung cancers are diagnosed as non-small cell lung cancer (NSCLC) and the overall survival (OS) rate for advanced NSCLC is poor. The 5-year survival rate is 5% for stage IIIb NSCLC and <1% for stage IV NSCLC (1). Treatment for NCSLC is determined by the patient™s clinical and tumor characteristics performance status (PS) the histological subtype and tumor genotype/phenotype. Recently there have been many studies concerning agents that target molecular changes such as mutations in the epidermal growth factor receptor (EGFR) and the fusion oncogene EML4-ALK in which the echinoderm microtubule-associated protein-like 4 (EML4) is fused with the intracellular domain of anaplastic kinase (ALK) (2“4). Although significant advances have been made in the treatment of NSCLC using molecular targeted therapies such as erlotinib and crizotinib the median OS for patients with advanced NSCLC remains low (56) and acquired resistance to target agents is a major clinical problem. Therefore the development of novel therapies is needed (7). Immunotherapy manipulates the immune system to control and eradicate cancer. Many recent studies provide evidence suggesting that immunotherapeutic manipulations are viable in many tumor types including lung cancer. Numerous trials of peptide vaccines autologous cellular therapy T cell-directed antibody therapy and monoclonal antibody therapy for lung cancer have been carried out around the world (8“10) and some of them have shown favorable results (11“13). The EML4-ALK fusion gene was identified in NSCLC patients by a team led by Professor H. Mano. This fusion gene was formed as the result of a small inversion within the short arm of chromosome 2 that joins differing portions of the EML4 gene with a portion of the ALK gene (1415). As a result of this fusion constant dimerization of the kinase domain of ALK is induced and its catalytic activity increases consequently. The EML4-ALK fusion gene is mainly identified in young never/former light smokers with NSCLC (16). It is estimated that approximately 5% of all NSCLC cases have this fusion gene. A few reports have also identified EML4-ALK in other cancers namely breast cancer and colorectal cancer (1718). For the most part the EML4-ALK fusion gene and other mutations such as those in EGFR and KRAS are mutually exclusive (19). The chromosomal inversion does not always occur in the same location and multiple EML4-ALK variants have been identified (19). At least 11 variants have been reported. The most common variants are E13;A20 (variant 1) and E6a/b;A20 (variant 3a/b) which have been detected in 33% and 29% of NSCLC patients respectively (14). PF-02341066 (crizotinib) is an ALK inhibitor currently under clinical development. Kwak et al conducted an open-label multi-center two-part phase I trial and found a remarkable 57% overall response rate and a 72% 6-month progression-free survival rate (20). In spite of the marked antitumor activity of crizotinib ALK-positive cancers invariably gain resistance to crizotinib. In the case of ALK-positive cancers as well as EGFR-mutant lung cancer resistance develops on average within the first 2 years of therapy (21). The main resistance mutations are L1196M a gatekeeper mutation and C1156M. In addition to ALK mutations other known mechanisms for acquired resistance include ALK amplification (2122) and EGFR activation (2324). To overcome resistance new ALK inhibitors are currently in early phase studies (25). Novel combinatorial strategies to overcome crizotinib resistance and further improve the clinical outcome are needed. We focused on this new fusion array as a novel target of immunotherapy. There are several methods to detect EML4-ALK NSCLC including polymerase chain reaction (PCR) immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) (19). These methods detect high-level EML4-ALK fusion gene expression. Passoni et al identified two HLA-A*02:01-restricted ALK-derived peptides that induce peptide-specific CTL lines (26). We focused on the EML4 array as a novel epitope of immunotherapy. We identified a candidate 9- or 10-amino acid array of novel epitopes using the Bioinformatics and Molecular Analysis Section (BIMAS) software and analyzed its potential as a new immunotherapy epitope with respect to its ability to induce anticancer activity. We then induced and generated a peptide-specific CTL clone from peripheral blood lymphocytes of HLA-A*02:01-positive healthy donors. We report here that an EML4-ALK-derived peptide-specific human CTL clone recognized peptide-pulsed T2 cells and HLA-A*02:01-positive and EML4-ALK-positive tumor cells pretreated with IFN-?. Furthermore we showed that immunotherapy with this novel epitope peptide has potential for treatment of EML4-ALK-positive NSCLC. Materials and methods Peptides Human EML4-ALK-derived peptides carrying binding motifs for HLA-A*02:01-/HLA-A*24:02-encoded molecules were identified by HLA-peptide binding predictions using the BIMAS program (http://bimas.dcrt.nih.gov/molbio/hla_bind/index.html). We purchased a total of seven EML4-ALK-derived peptides carrying HLA-A*02:01 binding motifs and two peptides carrying HLA-A*24:02 binding motifs from Geneworld (Tokyo Japan). Cell lines The H2228 human lung adenocarcinoma cell line and EML4-ALK fusion protein variant 3 (E6; A20) were kindly provided by Professor S. Yano (Kanazawa University). T2 is a lymphoblastoid cell line that lacks TAP function and has HLA-A*02:01 molecules that can easily be loaded with exogenous peptides. T2A24 is the same cell line but with HLA-A*24:02 instead. T2 and T2A24 cells were cultured in RPMI medium supplemented with 10% heat-inactivated FBS. HLA-A*02:01/HLA-A*24:02 binding assay In order to determine the binding ability of the predicted peptides to HLA-A*02:01/HLA-A*24:02 molecules an in vitro cellular binding assay was performed as reported previously (27). Briefly after incubation of the T2/T2A24 cells in culture medium at 26°C for 18 h cells were washed with PBS and suspended in 1 ml Opti-MEM (Invitrogen Carlsbad CA USA) with or without 100 ?g peptide and then incubated at 26°C for 3 h and at 37°C for 3 h. After washing with PBS HLA-A*02:01/HLA-A*24:02 expression was measured by flow cytometry using a FITC-conjugated and HLA-A*02:01-/HLA-A*24:02-specific monoclonal antibody (mAb) and the mean fluorescence intensity was recorded. Generation of dendritic cells CD14+ cells were isolated from human peripheral blood mononuclear cells (PBMCs) using human CD14 microbeads (Miltenyi Biotec Bergisch Gladbach Germany). Immature dendritic cells (DCs) were generated from CD14+ cells using interleukin (IL)-4 (10 ng/ml; PeproTech Inc. Rocky Hill NJ USA) and granulocyte-macrophage colony-stimulating factor (GM-CSF; 10 ng/ml; PeproTech) in RPMI-1640 medium supplemented with 10% FBS. Maturation of DCs was induced by prostaglandin E2 (PGE2; 1 ?g/ml; Sigma St. Louis MO USA) and tumor necrosis factor (TNF-)-? (10 ng/ml; PeproTech). Induction of EML4-ALK-derived peptide-specific CTLs from PBMCs CD8+ cells were isolated from PBMCs using human CD8 microbeads (Miltenyi Biotec Bergisch Gladbach Germany). CD8+ cells (2—106) were stimulated by peptide-pulsed irradiated autologous mature DCs (1—105). Autologous DCs were prepared from a limited supply; artificial antigen presenting cells (aAPCs) (K562/A2 or A24/CD80/CD83) were alternatively used for further examination. After 1 week these cells were stimulated twice per week by peptide-pulsed irradiated artificial APC-A2 or artificial APC-A24 cells (1—105). Supplementation with 10 IU/ml IL-2 (Proleukin; Novartis Pharmaceuticals Basel Switzerland) and 10 ng/ml IL-15 (PeproTech) was performed every 3 to 4 days between stimulations (28). IFN-? ELISPOT assay Specific secretion of IFN-? from human CTLs in response to stimulator cells was assayed using the IFN-? ELISPOT kit (BD Biosciences) according to the manufacturer™s instructions. Stimulator cells were pulsed with peptide for 2 h at room temperature and then washed. Responder cells were incubated with stimulator cells for 20 h. The resulting spots were counted using an ELIPHOTO counter (Minerva Tech Tokyo Japan). HIV-gag (77“85) (SLYNTYATL) was used as an irrelevant peptide in the CTL assay. Generation of CTL clones Cultured cells were incubated with peptide-pulsed T2/T2A24 cells at a ratio of 2:1 for 3.5 h at 37°C. CD107a-specific antibodies (BioLegend San Diego CA USA) were included in the mixture during the incubation period. CD8+CD107a+ cells were sorted using a FACSAria II cell sorter (BD Biosciences). Sorted CTLs were stimulated and the CTL clones were established as described previously (29). Flow cytometry H2228 cells with or without pretreatment with 100 U/ml IFN-? (PeproTech) for 48 h were harvested and stained with anti-HLA-A2 Ab-FITC (MBL Japan) and analyzed using a FACSCanto II flow cytometer (BD Biosciences). Flow cytometry data were analyzed using FlowJo software. Cytotoxicity assay The cytotoxic capacity was analyzed using the Terascan VPC system (Minerva Tech Tokyo). The CTL clone was used as the effector cell type. Target cells treated with 100 U/ml IFN-? (PeproTech) 42 h previously were labeled through incubation in calcein-AM solution for 30 min at 37°C. The labeled cells (1—104) were then co-cultured with the effector cells for 4“6 h. Fluorescence intensity was measured before and after the culture period and specific cytotoxic activity was calculated as described previously (29). HLA-A*02:01 blocking of T-cell activity was tested by pre-incubating the target cells with anti-HLA-A -B -C mAb (W6/32) or an isotype control mAb (mIgG2a?; BioLegend San Diego CA USA). Results Identification of HLA-A*02:01-/HLA-A*24:02-restricted EML4-ALK-derived peptides As candidate EML4-ALK- derived and HLA-A*02:01-/HLA-A*24:02-restricted CTL epitopes we selected nine peptides with highly predicted scores for HLA-A*02:01/HLA-A*24:02 binding calculated using BIMAS software (Tables I and II) and evaluated their ability to bind to HLA-A*02:01/HLA-A*24:02 molecules. All nine peptides were able to bind HLA-A*02:01/HLA-A*24:02 molecules (Fig. 1). Generation of an EML4-ALK-derived peptide-specific CTL clone from human PBMCs We next assessed the capacity of EML4-ALK-derived peptides to generate peptide-specific CTLs in vitro from human PBMCs of HLA-A*02:01/HLA-A*24:02 healthy donors. CTLs were induced by three stimulations with DCs or artificial APCs loaded with the EML4-ALK-derived peptides. CTLs were tested for specificity for each peptide using the IFN-? ELISPOT assay. Peptides A B and C could induce peptide-specific CTLs that were able to specifically recognize T2 cells pulsed with each peptide but not T2 cells without peptides (Fig. 2). Peptides B and C were able to induce CTLs from only one donor (healthy donor 3 for peptide B and healthy donor 4 for peptide C) but peptide A was able to induce CTLs in three of four donors (healthy donors 2 3 and 4). Based on this result we used peptide A for further examinations. Next we obtained one CTL clone from peptide A-specific CTLs that was able to specifically recognize T2 cells pulsed with peptide A but not T2 cells pulsed with an irrelevant HIV-gag peptide using single cell sorting with a CD107a antibody. The population of CD8+CD107a+ cells represented 0.984% of all stimulated cells (Fig. 3A). These cells were sorted as single cells in each well of a 96-well plate. Twenty-one days after cell sorting peptide specificity was assessed using the IFN-? ELISPOT assay (Fig. 3B). The established clone reacted to the T2 cells pulsed with peptide A but not to T2 cells pulsed with the irrelevant HIV-gag peptide. These results indicate that a peptide A-specific CTL clone was successfully established from PBMCs from a healthy donor. The EML4-ALK-specific CTL clone recognizes HLA-A*02:01+ lung carcinoma cells with the EML4-ALK variant 3a/b incubated with IFN-? We next evaluated the ability of the EML4-ALK-specific CTL clone to recognize the cancer cell line H2228 which expresses HLA-A*02:01 and EML4-ALK using the IFN-? ELISPOT assay. Even though the EML4-ALK-specific CTL clone failed to recognize H2228 cells it did recognize those pretreated with 100 U/ml IFN-? 48 h prior to examination (Fig. 4A). We examined the effect of IFN-? on H2228 cells. Incubating target cells with IFN-? for 48 h increased the expression of MHC class I molecules on the cell surface (Fig. 4B). This result indicates that the peptide A-specific CTL clone was able to recognize H2228 cells because of increased expression of MHC-class I on the H2228 cell surface. Specific IFN-? production by the peptide A-specific CTL clone was detectable in H2228 cells treated with IFN-?. The specificity was abolished by an anti-HLA-class I mAb but not by an isotype control suggesting that the observed production was HLA-A2 restricted (Fig. 4C). A cytotoxicity assay was also performed. The peptide A-specific CTL clone was able to specifically lyse H2228 cells pretreated with IFN-? 48 h prior to examination. This specific lysis was blocked by the anti-HLA-class I mAb but not by the isotype control. These results indicate that the peptide A-specific CTL clone showed cytotoxicity and the ability to produce IFN-? against HLA-A*02:01+ EML4-ALK+ NSCLC cell lines (Fig. 5). Discussion In the present study we identified a new tumor-associated CTL epitope (peptide A) derived from EML4-ALK which binds to HLA-A*02:01 molecules and we were able to establish a peptide-specific CTL clone from human PBMCs that specifically recognized cognate peptide-pulsed T2 cells and HLA-A*02:01 tumor cells expressing EML4-ALK that had been pretreated with IFN-?. EML4-ALK-positive lung cancers are highly sensitive to ALK inhibition. However as with trastuzumab or gefitinib (3031) patients typically gain resistance within 1 to 2 years of starting therapy (23). We aimed to overcome these difficulties with immunotherapy. We identified a glypican-3 (GPC3)-derived peptide and showed that GPC3-specific CTL frequency after vaccination correlated with OS. OS was significantly longer in patients with high GPC3-specific CTL frequencies than in those with low frequencies (32). This indicates that the ability to induce a peptide-specific CTL clone is important for effective immunotherapy. We also revealed that GPC3 is an ideal target for anticancer immunotherapy since it is specifically overexpressed in hepatocellular carcinoma (HCC) (33“35). In the present study we chose a peptide array from EML4-ALK from which we were able to induce a peptide-specific CTL clone. EML4-ALK is a strong oncogene overexpressed in cancer cells of NSCLC breast cancer kidney cancer and colon cancer (17). We performed RT-PCR and assayed the EML4 DNA levels of certain lung cancer cell lines. H2228 cells express EML4 moderately but at higher levels than other lung cancer cell lines. EML4 expression has been reported as highly expressed in CD8+ T cells. RT-PCR showed that EML4 DNA levels were high in PBMCs and CD8+ T cells. Because of a lack of suitable antibodies we could not perform western blotting. However our success at inducing a peptide A-specific CTL clone from CD8+ T cells indicated that the CTL clone had no cytotoxicity against CD8+ T cells. This CTL clone could not recognize cancer cell lines without the ability to increase the amount of HLA class I presented on cell surfaces. Further examination is needed to achieve higher tumor reactivity. Combination chemotherapy or radiation therapy plus immunotherapy was recently reported to have a synergistic effect (36). Moreover some mechanisms of synergy between radiation therapy chemotherapy and immunotherapy have been revealed (37). In one of the mechanisms these therapies upregulated tumor antigens and MHC moieties. These results suggest that combination therapy could be used to make tumor cell lines more susceptible to this peptide A-specific CTL clone-mediated cytolysis (38“41). In addition this treatment may be able to overcome resistance to ALK inhibition. Some resistance mechanisms for targeting drugs have been examined. The most commonly identified causes of resistance are point mutations such as L1196M (42“44) G1269A (22) and S1206Y (21). These point mutations occur in the tyrosine kinase domain which plays an important role in oncogenesis. Our peptide array was selected from EML4 which has no correlation with these point mutations. It is possible that this treatment is effective for tumor cells resistant to ALK inhibitors. In this study we identified a new epitope peptide derived from the EML4-ALK fusion gene. We successfully induced an HLA-A*02:01-restricted peptide-specific CTL clone that demonstrated cytotoxicity for EML4-ALK-positive tumor cells. This is a new epitope-based vaccine therapy design for EML4-ALK-positive cancer cells. In order to obtain a stronger effect further analysis is needed. Acknowledgements We thank Professor S. Yano for providing the H2228 cell line which possesses the EML4-ALK fusion gene Professor H. Mano for providing the EML4-ALK fusion DNA and Professor N. Hirano for providing artificial APCs. This study was supported in part by Health and Labor Science Research Grants for Clinical Research and Third Term Comprehensive Control Research for Cancer from the Ministry of Health Labor and Welfare Japan and the National Cancer Center Research and Development Fund (25-A-7). References 1 Silvestri GA Tanoue LT Margolis ML The noninvasive staging of non-small cell lung cancer: the guidelines Chest 123 147S 156S 2003 12527574 2 Reck M What future opportunities may immuno-oncology provide for improving the treatment of patients with lung cancer? Ann Oncol 23 Suppl 8 viii28 viii34 2012 22918925 3 Chang SC Chang CY Shih JY The role of epidermal growth factor receptor mutations and epidermal growth factor receptor-tyrosine kinase inhibitors in the treatment of lung cancer Cancers 3 2667 2678 2011 24212826 4 Gridelli C Peters S Sgambato A Casaluce F Adjei AA Ciardiello F ALK inhibitors in the treatment of advanced NSCLC Cancer Treat Rev 40 300 306 2014 23931927 5 Hall RD Gray JE Chiappori AA Beyond the standard of care: a review of novel immunotherapy trials for the treatment of lung cancer Cancer Control 20 22 31 2013 23302904 6 Jackman DM Miller VA Cioffredi LA Impact of epidermal growth factor receptor and KRAS mutations on clinical outcomes in previously untreated non-small cell lung cancer patients: results of an online tumor registry of clinical trials Clin Cancer Res 15 5267 5273 2009 19671843 7 West H Oxnard GR Doebele RC Acquired resistance to targeted therapies in advanced non-small cell lung cancer: new strategies and new agents Am Soc Clin Oncol Educ Book 2013 10.1200/EdBook_AM.2013.33.e272 http://meetinglibrary.asco.org/content/198-132 8 Wu YL Park K Soo RA INSPIRE: a phase III study of the BLP25 liposome vaccine (L-BLP25) in Asian patients with unresectable stage III non-small cell lung cancer BMC Cancer 11 430 2011 21982342 9 Tyagi P Mirakhur B MAGRIT: the largest-ever phase III lung cancer trial aims to establish a novel tumor-specific approach to therapy Clin Lung Cancer 10 371 374 2009 19808198 10 Quoix E Ramlau R Westeel V Therapeutic vaccination with TG4010 and first-line chemotherapy in advanced non-small-cell lung cancer: a controlled phase 2B trial Lancet Oncol 12 1125 1133 2011 22019520 11 Brahmer JR Tykodi SS Chow LQ Safety and activity of anti-PD-L1 antibody in patients with advanced cancer N Engl J Med 366 2455 2465 2012 22658128 12 Lynch TJ Bondarenko I Luft A Ipilimumab in combination with paclitaxel and carboplatin as first-line treatment in stage IIIB/IV non-small-cell lung cancer: results from a randomized double-blind multicenter phase II study J Clin Oncol 30 2046 2054 2012 22547592 13 Topalian SL Hodi FS Brahmer JR Safety activity and immune correlates of anti-PD-1 antibody in cancer N Engl J Med 366 2443 2454 2012 22658127 14 Soda M Choi YL Mano H Identification of the transforming EML4-ALK fusion gene in non-small-cell lung cancer Nature 448 561 566 2007 17625570 15 Bonanno L Favaretto A Rugge M Role of genotyping in non-small cell lung cancer treatment: current status Drugs 71 2231 2246 2011 22085382 16 Fukui T Yatabe Y Mitsudomi T Clinicoradiologic characteristics of patients with lung adenocarcinoma harboring EML4-ALK fusion oncogene Lung Cancer 77 319 325 2012 22483782 17 Lin E Li L Guan Y Exon array profiling detects EML4-ALK fusion in breast colorectal and non-small cell lung cancers Mol Cancer Res 7 1466 1476 2009 19737969 18 Robertson FM Petricoin EF III Cristofanilli M Presence of anaplastic lymphoma kinase in inflammatory breast cancer Springerplus 2 497 2013 24102046 19 Sasaki T Rodig SJ J¤nne PA The biology and treatment of EML4-ALK non-small cell lung cancer Eur J Cancer 46 1773 1780 2010 20418096 20 Kwak EL Bang YJ Iafrate AJ Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer New Engl J Med 363 1693 1703 2010 20979469 21 Katayama R Shaw AT Engelman JA Mechanisms of acquired crizotinib resistance in ALK-rearranged lung cancers Sci Transl Med 4 120ra17 2012 22 Doebele RC Pilling AB Camidge DR Mechanisms of resistance to crizotinib in patients with ALK gene rearranged non-small cell lung cancer Clin Cancer Res 18 1472 1482 2012 22235099 23 Shaw AT Engelman JA ALK in lung cancer: past present and future J Clin Oncol 31 1105 1111 2013 23401436 24 Sasaki T Koivunen J J¤nne PA A novel ALK secondary mutation and EGFR signaling cause resistance to ALK kinase inhibitors Cancer Res 71 6051 6060 2011 21791641 25 Latif M Saeed A Kim SH Journey of the ALK-inhibitor CH5424802 to phase II clinical trial Arch Pharm Res 36 1051 1054 2013 23700294 26 Passoni L Scardino A Gambacorti-Passerini C ALK as a novel lymphoma-associated tumor antigen: identification of 2 HLA-A2.1-restricted CD8+T-cell epitopes Blood 99 2100 2106 2002 11877285 27 Hirohashi Y Torigoe T Maeda A An HLA-A24-restricted cytotoxic T lymphocyte epitope of a tumor-associated protein survivin Clin Cancer Res 8 1731 1739 2002 12060610 28 Hirano N Butler MO Xia Z Engagement of CD83 ligand induces prolonged expansion of CD8+T cells and preferential enrichment for antigen specificity Blood 107 1528 1536 2006 16239433 29 Yoshikawa T Nakatsugawa M Sakemura N HLA-A2- restricted glypican-3 peptide-specific CTL clones induced by peptide vaccine show high avidity and antigen-specific killing activity against tumor cells Cancer Sci 102 918 925 2011 21281401 30 Robinson KW Sandler AB EGFR tyrosine kinase inhibitors: difference in efficacy and resistance Curr Oncol Rep 15 396 404 2013 23674236 31 Lesniak D Sabri S Abdulkarim B Spontaneous epithelial- mesenchymal transition and resistance to HER-2-targeted therapies in HER-2-positive luminal breast cancer PLoS One 8 e71987 2013 23991019 32 Sawada Y Yoshikawa T Nakatsura T Phase I trial of a glypican-3-derived peptide vaccine for advanced hepatocellular carcinoma: immunologic evidence and potential for improving overall survival Clin Cancer Res 18 3686 3696 2012 22577059 33 Nakatsura T Yoshitake Y Nishimura Y Glypican-3 overexpressed specifically in human hepatocellular carcinoma is a novel tumor marker Biochem Biophys Res Commun 306 16 25 2003 12788060 34 Okabe H Satoh S Nakamura Y Genome-wide analysis of gene expression in human hepatocellular carcinomas using cDNA microarray: identification of genes involved in viral carcinogenesis and tumor progression Cancer Res 61 2129 2137 2001 11280777 35 Saito-Hisaminato A Katagiri T Nakamura Y Genome-wide profiling of gene expression in 29 normal human tissues with a cDNA microarray DNA Res 9 35 45 2002 12056413 36 Weir GM Liwski RS Mansour M Immune modulation by chemotherapy or immunotherapy to enhance cancer vaccines Cancers 3 3114 3142 2011 24212948 37 Hodge JW Ardiani A Gameiro SR The tipping point for combination therapy: cancer vaccines with radiation chemotherapy or targeted small molecule inhibitors Semin Oncol 39 323 339 2012 22595055 38 Garnett CT Palena C Hodge JW Sublethal irradiation of human tumor cells modulates phenotype resulting in enhanced killing by cytotoxic T lymphocytes Cancer Res 64 7985 7994 2004 15520206 39 Gelbard A Garnett CT Hodge JW Combination chemotherapy and radiation of human squamous cell carcinoma of the head and neck augments CTL-mediated lysis Clin Cancer Res 12 1897 1905 2006 16551875 40 Kaneno R Shurin GV Shurin MR Chemotherapeutic agents in low noncytotoxic concentrations increase immunogenicity of human colon cancer cells Cell Oncol 34 97 106 2011 41 Ramakrishnan R Assudani D Gabrilovich DI Chemotherapy enhances tumor cell susceptibility to CTL-mediated killing during cancer immunotherapy in mice J Clin Invest 120 1111 1124 2010 20234093 42 Choi YL Soda M Yamashita Y EML4-ALK mutations in lung cancer that confer resistance to ALK inhibitors N Engl J Med 363 1734 1739 2010 20979473 43 Katayama R Khan TM Benes C Therapeutic strategies to overcome crizotinib resistance in non-small cell lung cancers harboring the fusion oncogene EML4-ALK Proc Natl Acad Sci USA 108 7535 7540 2011 21502504 44 Lovly CM Pao W Escaping ALK inhibition: mechanisms of and strategies to overcome resistance Sci Transl Med 4 120ps2 2012 Figure 1 EML4-ALK-derived peptides bound to HLA-A2 or HLA-A24 molecules. In vitro cellular peptide binding assays for HLA-A*02:01 (A) or HLA-A*24:02 (B) were performed using a FACS system. Figure 2 IFN-? release by in vitro-induced anti-EML4-ALK CTLs. CD8+ T cells from four healthy donors were stimulated with EML4-ALK-derived peptide-pulsed autologous DCs and aAPCs. CTLs induced by EML4-ALK-derived peptides (1—105) were stimulated with T2 cells pulsed with or without 1 ?M EML4-ALK-derived peptides. IFN-?-producing CTLs were detected by IFN-? ELISPOT assay. DCs dendritic cells; aAPCs artificial antigen presenting cells; CTLs cytotoxic T cells. Figure 3 Peptide A-specific CTL clone established from anti-EML4-ALK CTL. (A) Peptide A-specific CTL clones established using CD107a single cell sorting. Peptide A-specific CTLs (1—105) were incubated with peptide-pulsed T2 cells (5—104) with CD107a-specific antibodies for 3.5 h at 37°C. CD8+CD107a+ cells were sorted using a FACSAria II cell sorter. Square CD8+CD107a+ cells that are peptide A-specific CTL clones. (B) Recognition of peptide-pulsed T2 cells by peptide A-specific CTL clones. A peptide A-specific CTL clone (1—104 cells) was incubated with stimulator cells that had been pulsed with 1 ?M peptide A or HIV-gag peptide. IFN-?-producing CTLs were detected by IFN-? ELISPOT assay. CTLs cytotoxic T cells. Figure 4 Recognition of lung carcinoma cells expressing HLA-A*02:01 and the EML4-ALK fusion gene by the peptide A-specific CTL clone. The peptide A-specific CTL clone recognized H2228 cells pretreated with IFN-? 48 h prior to the assay. (A) The peptide A-specific CTL clone (1—104 cells) was incubated with H2228 cells with or without IFN-?. IFN-? production was detected by IFN-? ELISPOT assay. (B) IFN-? increased expression of HLA-A2 presented on H2228 cells. Incubation of H2228 cells with 100 U/ml IFN-? for 48 h increased HLA-A2 presentation on the cells. Dotted line HLA-A2 on H2228 cells without IFN-?. Black line HLA-A2 on H2228 cells incubated with IFN-? (higher than on H2228 cells without IFN-?). Dashed line and shaded region: no staining of H2228 cells with/without IFN-?. (C) Inhibition of IFN-? production by an anti-HLA-class I mAb. Blocking experiments were performed using an HLA-A -B -C-specific mAb (W6/32) or an isotype control mAb (mIgG2a?). The peptide A-specific CTL clone was incubated with H2228 cells (HLA-A*02:01+/EML4-ALK+) pretreated with IFN-? 48 h prior to examination. IFN-?-producing CTL clones were detected by IFN-? ELISPOT assay. The bar graph shows the percentage of inhibition. CTL cytotoxic T cell. Figure 5 Cytotoxic activity of the peptide A-specific CTL clone against H2228 cells. The peptide A-specific CTL clone was incubated with H2228 cells pretreated with IFN-? 48 h prior to the assay at various E/T ratios and specific lysis was assessed. Blocking experiments were performed using the HLA-A -B -C-specific mAb (W6/32) or the isotype control mAb (mIgG2a?). CTL cytotoxic T cell. Table I HLA-A2 peptide binding predictions of the BIMAS program. Peptide name Peptide sequence Binding scorea A RLSALESRV 69.552 B AISEDHVASV 90.183 C TVLKAALADV 51.79 D KLIPKVTKT 59.989 E YLLPTGEIV 237.82 F MLIWSKTTV 118.238 G VMLIWSKTTV 315.95 a Binding scores were estimated using BIMAS software (http://www-bimas.cit.nih.gov/mobio/hla_bind/). Table II HLA-A24 peptide binding predictions of the BIMAS program. Peptide name Peptide sequence Binding scorea H NYDDIRTEL 369.6 I VYFIASVVVL 200 a Binding scores were estimated using BIMAS software (http://www-bimas.cit.nih.gov/mobio/hla_bind/). Diagn Pathol Diagn Pathol Diagnostic Pathology 1746-1596 BioMed Central 24972450 4085714 1746-1596-9-128 10.1186/1746-1596-9-128 Research Overexpression of both platelet-derived growth factor-BB and vascular endothelial growth factor-C and its association with lymphangiogenesis in primary human non-small cell lung cancer Liu Jiannan 1 2 [email protected] Liu Chuanyong 1 [email protected] Qiu Liyun 3 [email protected] Li Juan 1 [email protected] Zhang Pei 1 [email protected] Sun Yuping 1 [email protected] 1Department of Oncology Jinan Central Hospital Affiliated to Shandong University No. 105.Jiefang Road Jinan Shandong 250013 P.R. China 2Department of Oncology Yuhuangding Hospital Yantai Shandong 264000 P.R. China 3Department of Pharmacology Jinan Central Hospital Affiliated to Shandong University Jinan Shandong 250013 P.R. China 2014 27 6 2014 9 128 128 1 4 2014 13 6 2014 Copyright © 2014 Liu et al.; licensee BioMed Central Ltd. 2014 Liu et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License ( http://creativecommons.org/licenses/by/4.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver ( http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article unless otherwise stated. Abstract Background Metastatic spread of tumor through lymphatic vasculature is an important adverse prognostic factor in a variety of human cancer and tumor lymphangiogenesis requires the interplay of several growth factors. Platelet-derived growth factor (PDGF)-BB and vascular endothelial growth factor (VEGF)-C are two important molecules involving in tumor metastasis and lymphangiogenesis. Therefore the aim of this study was to investigate the coexpression of PDGF-BB and VEGF-C in primary human non-small cell lung cancer (NSCLC) and its association with lymphangiogenesis."
Lung_Cancer
"Human Genome Variation Society (HGVS) (Human Genome Variation Society (HGVS) 2014). For example we considered that it was not acceptable to report the amino acid change only as redundancy in the genetic code means that different changes at the nucleotide level can result in the same change at the amino acid level. In the results of this EQA scheme suggest that the technical quality of EGFR mutational analysis could be improved as evidenced from a high level of diagnostic errors. Overall the standard of reporting was acceptable. These findings also underline the importance of EQA as a mechanism to reveal errors in methodology and to ensure an adequate quality of molecular testing. Regular participation in EQA should be seen as a routine part of the diagnostic testing process for all labs helping to improve and standardise their processes. We have established a model for a robust and scalable EQA that can contribute to global optimisation and improvements in the overall quality of EGFR testing for patients with NSCLC. We thank the laboratories for their participation in this study. We also thank AstraZeneca for the provision of an unrestricted grant to allow the development to the scheme; and Horizon Diagnostics for their support in quantitative validation of the materials. Dr Normanno is supported by a grant from Associazione Italiana per la Ricerca sul Cancro (AIRC). Supplementary Information accompanies this paper on British Journal of Cancer website (http://www.nature.com/bjc) The authors declare no conflict of interest. Angulo B Garcia-Garcia E Martinez R Suarez-Gauthier A Conde E Hidalgo M Lopez-Rios F 2010 A commercial real-time PCR kit provides greater sensitivity than direct sequencing to detect KRAS mutations: a morphology-based approach in colorectal carcinoma J Mol Diagn 12 292 299 20203003 Bellon E Ligtenberg MJ Tejpar S Cox K de Hertogh G de Stricker K Edsjo A Goulis V Hofler G Jung A Kotsinas A Laurent-Puig P Lopez-Rios F Hansen TP Rouleau E Vandenberghe P van Krieken JJ Dequeker E 2011 External quality assessment for KRAS testing is needed: setup of a European program and report of the first joined regional quality assessment rounds Oncologist 16 467 478 21441573 Deans ZC Bilbe N O'Sullivan B Lazarou LP de Castro DG Parry S Dodson A Taniere P Clark C Butler R 2013 Improvement in the quality of molecular analysis of EGFR in non-small-cell lung cancer detected by three rounds of external quality assessment J Clin Pathol 66 319 325 23378269 Deans ZC Tull J Beighton G Abbs S Robinson DO Butler R 2011 Molecular genetics external quality assessment pilot scheme for KRAS analysis in metastatic colorectal cancer Genet Test Mol Biomarkers 15 777 783 21851273 De Luca A Normanno N 2010 Predictive biomarkers to tyrosine kinase inhibitors for the epidermal growth factor receptor in non-small-cell lung cancer Curr Drug Targets 11 851 864 20388064 European Molecular Genetics Quality Network (EMQN)2014EMQN home page. Available at http://www.emqn. (accessed 18 January 2014). Fukuoka M Wu YL Thongprasert S Sunpaweravong P Leong SS Sriuranpong V Chao TY Nakagawa K Chu DT Saijo N Duffield EL Rukazenkov Y Speake G Jiang H Armour AA To KF Yang JC Mok TS 2011 Biomarker analyses and final overall survival results from a phase III randomized open-label first-line study of gefitinib versus carboplatin/paclitaxel in clinically selected patients with advanced non-small-cell lung cancer in Asia (IPASS) J Clin Oncol 29 2866 2874 21670455 Hindson BJ Ness KD Masquelier DA Belgrader P Heredia NJ Makarewicz AJ Bright IJ Lucero MY Hiddessen AL Legler TC Kitano TK Hodel MR Petersen JF Wyatt PW Steenblock ER Shah PH Bousse LJ Troup CB Mellen JC Wittmann DK Erndt NG Cauley TH Koehler RT So AP Dube S Rose KA Montesclaros L Wang S Stumbo DP Hodges SP Romine S Milanovich FP White HE Regan JF Karlin-Neumann GA Hindson CM Saxonov S Colston BW 2011 High-throughput droplet digital PCR system for absolute quantitation of DNA copy number Anal Chem 83 8604 8610 22035192 Human Genome Variation Society (HGVS)2014Nomenclature for the description of sequence variants. Available at http://www.hgvs./mutnomen/ (accessed 18 January 2014). International anisation for Standardization (ISO)2012ISO 15189:2012 Medical laboratories”requirements for quality and competence. Available at http://www.iso./iso/home/store/catalogue_ics/catalogue_detail_ics.htm?csnumber=56115 (accessed 18 January 2014). Linardou H Dahabreh IJ Kanaloupiti D Siannis F Bafaloukos D Kosmidis P Papadimitriou CA Murray S 2008 Assessment of somatic k-RAS mutations as a mechanism associated with resistance to EGFR-targeted agents: a systematic review and meta-analysis of studies in advanced non-small-cell lung cancer and metastatic colorectal cancer Lancet Oncol 9 962 972 18804418 Lopez-Rios F Angulo B Gomez B Mair D Martinez R Conde E Shieh F Tsai J Vaks J Current R Lawrence HJ Gonzalez de Castro D 2013 Comparison of molecular testing methods for the detection of EGFR mutations in formalin-fixed paraffin-embedded tissue specimens of non-small cell lung cancer J Clin Pathol 66 381 385 23386666 Maemondo M Inoue A Kobayashi K Sugawara S Oizumi S Isobe H Gemma A Harada M Yoshizawa H Kinoshita I Fujita Y Okinaga S Hirano H Yoshimori K Harada T Ogura T Ando M Miyazawa H Tanaka T Saijo Y Hagiwara K Morita S Nukiwa T 2010 Gefitinib or chemotherapy for non-small-cell lung cancer with mutated EGFR N Engl J Med 362 2380 2388 20573926 Mitsudomi T Morita S Yatabe Y Negoro S Okamoto I Tsurutani J Seto T Satouchi M Tada H Hirashima T Asami K Katakami N Takada M Yoshioka H Shibata K Kudoh S Shimizu E Saito H Toyooka S Nakagawa K Fukuoka M 2010 Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label randomised phase 3 trial Lancet Oncol 11 121 128 20022809 Mok TS Wu YL Thongprasert S Yang CH Chu DT Saijo N Sunpaweravong P Han B Margono B Ichinose Y Nishiwaki Y Ohe Y Yang JJ Chewaskulyong B Jiang H Duffield EL Watkins CL Armour AA Fukuoka M 2009 Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma N Engl J Med 361 947 957 19692680 Normanno N De Luca A Bianco C Strizzi L Mancino M Maiello MR Carotenuto A De Feo G Caponigro F Salomon DS 2006 Epidermal growth factor receptor (EGFR) signaling in cancer Gene 366 2 16 16377102 Normanno N Pinto C Taddei G Gambacorta M Castiglione F Barberis M Clemente C Marchetti A 2013 Results of the First Italian External Quality Assurance Scheme for somatic EGFR mutation testing in non-small-cell lung cancer J Thorac Oncol 8 773 778 23575414 Rosell R Carcereny E Gervais R Vergnenegre A Massuti B Felip E Palmero R Garcia-Gomez R Pallares C Sanchez JM Porta R Cobo M Garrido P Longo F Moran T Insa A De Marinis F Corre R Bover I Illiano A Dansin E de Castro J Milella M Reguart N Altavilla G Jimenez U Provencio M Moreno MA Terrasa J Munoz-Langa J Valdivia J Isla D Domine M Molinier O Mazieres J Baize N Garcia-Campelo R Robinet G Rodriguez-Abreu D Lopez-Vivanco G Gebbia V Ferrera-Delgado L Bombaron P Bernabe R Bearz A Artal A Cortesi E Rolfo C Sanchez-Ronco M Drozdowskyj A Queralt C de Aguirre I Ramirez JL Sanchez JJ Molina MA Taron M Paz-Ares L 2012 Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre open-label randomised phase 3 trial Lancet Oncol 13 239 246 22285168 Sharma SV Bell DW Settleman J Haber DA 2007 Epidermal growth factor receptor mutations in lung cancer Nat Rev Cancer 7 169 181 17318210 Thunnissen E Bovee JV Bruinsma H van den Brule AJ Dinjens W Heideman DA Meulemans "
Lung_Cancer
" Total patient questionnaire scores by the multidisciplinary team in the intervention group at baseline (pre) and at the end of the study (post). A low score indicates better experience. Each symbol represents the mean score for each trust in the intervention group. The maximum possible score for the questionnaire is 11. Quality improvement plan themes Quality improvement plan theme Number of plans Multidisciplinary team effectiveness 31 Diagnostic pathways 13 Treatment pathways 9 Access to clinical nurse specialists 8 Clinical trial recruitment 4 Patient experience 2 Baseline (2009) national lung cancer audit indicators Control ( n =47) Intervention ( n =31) Excluded ( n =67) P -value Mean (%) s.e.m. Mean (%) s.e.m. Mean (%) s.e.m. Control vs intervention vs non-participant control vs intervention Case ascertainment 158.1 38.6 122.0 7.2 107.4 3.6 0.220 0.455 Discussed at the MDT meeting 95.2 0.7 93.7 1.7 90.9 1.9 0.155 0.370 Histological confirmation rate 75.7 1.2 76.4 1.8 78.4 1.6 0.409 0.739 Active treatment 59.5 1.2 55.9 2.2 59.5 1.5 0.305 0.131 Surgery (all cases) 13.4 0.6 13.0 0.8 14.2 0.7 0.469 0.648 SCLC (chemo) 65.1 2.2 66.5 3.9 63.3 2.7 0.746 0.733 Seen by CNS 70.3 3.8 76.6 3.2 58.3 4.2 0.007 0.243 CNS present diagnosis 44.0 3.8 49.4 5.4 38.7 3.8 0.237 0.403 Abbreviations: CNS=clinical nurse specialist; MDT=mulitdisciplinary team; SCLC=small-cell lung cancer. Data are shown as mean and s.e. proportion of patients. BMC Cancer BMC Cancer BMC Cancer 1471-2407 BioMed Central 24386906 3893473 1471-2407-14-3 10.1186/1471-2407-14-3 Study Protocol Study protocol of a randomized controlled trial comparing Mindfulness-Based Stress Reduction with treatment as usual in reducing psychological distress in patients with lung cancer and their partners: the MILON study Schellekens Melanie PJ 1 Melanie.Schellekensradboudumc.nl van den Hurk Desiree GM 2 Desiree.vandenHurkradboudumc.nl Prins Judith B 3 Judith.Prinsradboudumc.nl Molema Johan 2 Johan.Molemaradboudumc.nl Donders A Rogier T 4 Rogier.Dondersradboudumc.nl Woertman Willem H 4 Willem.Woertmanradboudumc.nl van der Drift Miep A 2 Miep.vanderDriftradboudumc.nl Speckens Anne EM 1 Anne.Speckensradboudumc.nl 1Department of Psychiatry Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 2Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 3Department of Medical Psychology Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 4Department of Epidemiology Biostatistics and Health Technology Assessment Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 2014 3 1 2014 14 3 3 28 6 2013 19 12 2013 Copyright 2014 Schellekens et al.; licensee BioMed Central Ltd. 2014 Schellekens et al.; licensee BioMed Central Ltd. This is an open access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. Background Lung cancer is the leading cause of cancer death worldwide and characterized by a poor prognosis. It has a major impact on the psychological wellbeing of patients and their partners. Recently it has been shown that Mindfulness-Based Stress Reduction (MBSR) is effective in reducing anxiety and depressive symptoms in cancer patients. The generalization of these results is limited since most participants were female patients with breast cancer. Moreover only one study examined the effectiveness of MBSR in partners of cancer patients. Therefore in the present trial we study the effectiveness of MBSR versus treatment as usual (TAU) in patients with lung cancer and their partners. Methods/Design A parallel group randomized controlled trial is conducted to compare MBSR with TAU. Lung cancer patients who have received or are still under treatment and their partners are recruited. Assessments will take place at baseline post intervention and at three-month follow-up. The primary outcome is psychological distress (i.e. anxiety and depressive symptoms). Secondary outcomes are quality of life (only for patients) caregiver appraisal (only for partners) relationship quality and spirituality. In addition cost-effectiveness ratio (only in patients) and several process variables are assessed. Discussion This trial will provide information about the clinical and cost-effectiveness of MBSR compared to TAU in patients with lung cancer and their partners. Trial registration ClinicalTrials.gov NCT01494883. Mindfulness-based stress reduction Lung cancer patients Partners Psychological distress Randomized controlled trial Background With an estimated 1.4 million deaths per year lung cancer is the leading cause of death by cancer worldwide. Even with the best available treatment five-year survival is merely 16% and about 60 to 70% of patients die within the first year after diagnosis [1]. This poor prognosis is often caused by a late diagnosis as the presentation usually occurs when the lung cancer is advanced. Patients may develop burdensome symptoms like pain dyspnoea fatigue and cough and they may undergo radical treatment including surgery chemo- and radiotherapy. Not surprisingly lung cancer has a major impact on the psychological wellbeing of patients and their family. Akechi and colleagues [2] showed that 19% of patients with advanced lung cancer meets the criteria of psychiatric disorders especially depressive and adjustment disorders. Of patients who had been successfully treated for lung cancer 15% met the criteria for a minor or major depressive disorder [3]. The prevalence rate of depressive and anxiety symptoms among lung cancer patients ranges from 20 to 47% [4-7]. Compared to patients with other cancer diagnoses lung cancer patients report the highest rates of distress (43 to 58%) [89] resulting in a lower quality of life [10]. Family friends and especially partners of patients with lung cancer also have to deal with its psychological impact [11-14]. Partners not only provide emotional and practical support they also have to cope with their own concerns including the uncertainty regarding the course of the illness and the fear of losing their partner [15]. More than 50% of partners of lung cancer patients report negative emotional effects of caregiving [16]. Around 40% of partners of patients with advanced lung cancer report high levels of distress [17]. The relationship between patient and partner can also be affected by the cancer. It has been shown that some partners report a lower quality of their relationship after the diagnosis of lung cancer [18]. Though numerous studies examined the psychological distress of lung cancer patients and their partners [2-22] not much research is done on how to alleviate distress in these groups [23]. In addition the available studies on managing the psychosocial care needs of cancer patients and their families have focused on care at the very end of life (e.g. [24-26]). Recently studies have demonstrated that palliative care initiated early in treatment improves the quality of life and depressive symptoms of lung cancer patients [1027]. This stresses the importance of integrating psychosocial care for lung cancer patients and their partners early in the treatment rather than instigating it once life-prolonging therapies fail. In the past ten years MBSR has become a promising psychosocial intervention for cancer patients. Mindfulness is defined as intentionally paying attention to moment-by-moment experiences in a non-judgmental way [28]. MBSR is an 8-week group-based training consisting of meditation practices such as the bodyscan gentle yoga sitting and walking meditation. By repeatedly bringing attention back to the current experience participants gradually learn to disengage from dysfunctional thoughts and directly experience the emotions and bodily sensations of the present moment. MBSR aims to provide participants with the ability to step back from ruminating about the past or worrying about the future and simply allow experiences to unfold [2829]. A recent meta-analysis [30] of 13 nonrandomized studies and 9 randomized controlled trials (RCT) concluded there is positive evidence for the use of mindfulness-based interventions in reducing psychological distress in cancer patients. Among the RCT€™s a reduction in symptom severity was found for both anxiety and depression corresponding to moderate pooled controlled effect sizes (Hedges€™s g = 0.37 and Hedges€™s g = 0.44 respectively) [30]. Though mindfulness-based interventions seem to be effective the authors note that across studies the majority of participants were women (85%) and diagnosed with breast cancer (77%). Compared to breast cancer patients patients with lung cancer are more often male older and have a poorer prognosis. Furthermore of these 22 studies only one study included the partners of the patients showing that partners also benefit from the MBSR training [31]. This is quite surprising since partners of cancer patients also report high levels of distress [32]. Aims The aim of the Mindfulness for Lung Oncology Nijmegen (MILON) study is to examine the effectiveness of MBSR compared to TAU in reducing psychological distress in patients with lung cancer and their partners. We hypothesize that patients in the MBSR group will report a lower level of psychological distress (i.e. anxiety and depressive symptoms) higher levels of quality of life quality of relationship and spirituality than those in the TAU group. Medical and societal costs will be lower in the MBSR versus TAU group. We expect partners in the MBSR group to report a lower level of psychological distress and higher levels of caregiver appraisal relationship quality and spirituality than their counterparts in the TAU group. With regard to the working mechanisms of the MBSR programme we will examine changes in mindfulness skills self-compassion rumination intrusion avoidance and adherence to MBSR. Methods/Design Study design The design of the €˜MILON€™ study is a parallel group randomized controlled trial with an embedded process study. Participants are randomized between MBSR and TAU. The study protocol has been approved by our ethical review board (CMO Arnhem-Nijmegen) and registered under number 2011€“519. Participants and procedure Patients and partners are recruited at the outpatient clinic of the Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre (RUNMC) by a nurse practitioner and the attending physician. Patients and partners are invited to participate together but both are welcome to participate on their own if they do not have a partner or their partner is not willing to participate. Patients and/or partners who are interested are provided with an information leaflet. If they are willing to participate they are invited for a research interview in which in- and exclusion criteria are assessed and informed consent is taken. At other participating hospitals (Department of Pulmonary Diseases Canisius-Wilhelmina Hospital Nijmegen; Department of Pulmonary Medicine Rijnstate Arnhem; Department of Oncology Elkerliek Hospital Helmond; Department of Pulmonary Medicine Jeroen Bosch Hospital; Department of Pulmonary Diseases Maas hospital Pantein Boxmeer) patients and their partners will be sent a letter with the invitation to participate in the study. One week later the researcher calls the patients to answer possible questions and asks whether the patient and partner are interested in participation. If so they are invited for a research interview at the RUNMC. Eligibility We include patients and/or partners of patients who are (a) diagnosed with cytologically or histologically proven non-small cell lung cancer or small cell lung cancer and (b) have received or are still under treatment. Exclusion criteria for both patient and partner include: (a) being under 18 years of age (b) not being able to understand or use the Dutch language (c) former participation in MBSR or Mindfulness-Based Cognitive Therapy (MBCT) (d) current and regular treatment by psychologist or psychiatrist (e) current participation in other psychosocial programme and (f) physical or cognitive (<26 on the Mini-Mental State Examination (MMSE)) impairments hampering participation in MBSR training or completion of questionnaires. Baseline Patients and partners are interviewed to obtain demographics and clinical characteristics after which they are screened for cognitive impairments with the MMSE [33]. After that baseline questionnaires including the Distress Thermometer (DT) [3435] are administered followed by randomization. shows the assessment instruments and time points at which the questionnaires are administered to patients and partners. Measurements and corresponding time points for patient and partner Measure Target T0 T1 T2 pt pr pt pr pt pr MMSE Cognitive impairments x x DT General distress x x HADS Psychological distress x x x x x x QLQ-C30 Quality of life x x x QLQ-LC13 Quality of life x x x SIP Impact of sickness x x x SPPIC Caregiver burden x x x CRA-SE Caregiver self-esteem x x x IMS-S Relationship satisfaction x x x x x x MIS Communication about cancer x x x x x x SAIL Spirituality x x x x x x FFMQ Mindfulness skills x x x x x x SCS Self-compassion x x x x x x RRS-EXT Rumination x x x x x x IES Psychological stress reaction x x x x x x Diary Health care use work absence Monthly during study period for pt Calendar Mindfulness adherence Monthly during study period for pt and pr Note. T0 = Baseline measurement; T1 = Post-intervention measurement; T2= 3-month follow-up measurement; pt = Patient; pr = Partner; MMSE = Mini Mental State Examination; DT = Distress Thermometer; HADS = Hospital Anxiety and Depression Scale; QLQ-C30 = Quality of Life €“ Cancer; QLQ-LC13 = Quality of Life €“ Lung Cancer; SIP = Sickness Impact Profile; SPPIC = Self-Perceived Pressure from Informal Care; CRA-SE = Caregiver Reaction Assessment €“ Care-Derived Self-Esteem; IMS-S = Investment Model Scale-Satisfaction; MIS = Mutuality and Interpersonal Sensitivity; SAIL = Spiritual Attitude and Involvement List; FFMQ = Five Facet Mindfulness Questionnaire; SCS = Self-Compassion Scale; RRS-EXT = Rumination Response Scale €“ Extended Version; IES = Impact of Event Scale. Randomization Randomization is stratified according to setting and minimized for (a) stage of disease (curative versus palliative) (b) baseline level of anxiety and depressive symptoms (anxiety or depression subscale score of Hospital Anxiety and Depression Scale (HADS) <8 versus ?8) (c) treatment during MBSR (no treatment versus chemo- and/or radiotherapy) and (d) participation (patient alone versus partner alone versus patient and partner together). Randomization is computerized using a randomization website specifically designed for this study on which the researcher can fill out the required data. The researcher communicates treatment allocation to the nurse practitioner who informs the patient and/or partner. Follow-up assessments Follow-up assessments take place post intervention and at three-month follow-up. Participants who have access to the internet and have an email address receive the questionnaires online. If not they receive the questionnaires on paper along with a reply envelope. In case of drop-out the researcher tries to contact the participant by phone to complete a minimum set of outcome measures and to identify the main reason for drop-out. Intervention The MBSR curriculum used is primarily based on the Mindfulness-Based Stress Reduction programme as developed by Kabat-Zinn [28] but contains some elements of the MBCT programme by Segal Williams and Teasdale [29] like psycho-education on the interrelatedness of feelings and thoughts. Moreover some modifications have been made to make the intervention more suitable for patients with lung cancer and their partners such as psycho-education about grief [36]. In addition a mindful communication exercise in which partners talk with each other about the cancer was added. The programme consists of 8 weekly 2.5-hour sessions a silent day between session six and seven and home practice assignments of about 45 minutes 6 days per week. Participants receive a set of CDs with guided mindfulness meditation exercises for home practice and a folder with information and home practice instructions for the forthcoming week. shows the content of the MBSR programme per session. The MBSR courses are taught by mindfulness teachers with extensive training in MBSR. They all fulfil the advanced criteria of the Center for Mindfulness of the University of Massachusetts Medical School [37] and maintain a regular personal meditation practice. Teachers were trained supervised and assessed to ensure their competency levels met the qualification criteria to instruct the MBSR classes. During the trial teachers will receive weekly supervision and a number of sessions will be videotaped to evaluate competence and adherence with the Mindfulness-Based Interventions €“ Teaching Assessment Criteria [38]. Content of MBSR programme per session Theme of session Meditation exercise Didactic teaching Homework 1. Automatic pilot - Bodyscan - Intention of participating - Bodyscan - Raisin exercise - Eating one meal mindfully - Attention for routine activity 2. Mindfulness of the breath - Bodyscan - Imagery exercise to demonstrate relationship between thoughtsand feelings - Bodyscan - Sitting mediation with focus on breath - Attention for breath - Awareness of pleasant events - Attention for routine activity 3. Observing limits - Yoga while lying down - Seeing exercise to demonstrate difference between observation and interpretation - Bodyscan or yoga - 3-min breathing space - Sitting meditation - Awareness of unpleasant events - 3-min breathing space 4. Opening up to distress - Sitting mediation with focus on breath body and sound - Interrelatedness of feelings thoughts and bodily sensations - Bodyscan or yoga - Sitting meditation - 3-min breathing space - Psychoeducation about grief - Awareness of stress reactions - 3-min breathing space 5. Responding to distress - Sitting mediation with focus on breath body sound thoughts difficulty - Reacting versus responding - Meditation by choice - Coping with grief - Awareness of reaction in difficult situation - Walking meditation - Awareness of communication difficulties - 3-min breathing space - 3-min breathing space 6. Mindful communication - Yoga in standing position - Mindful communication exercise about effect of lung cancer with their own partner - Sitting meditation or yoga - 3-min breathing space - Awareness of communication - 3-min breathing space during stress Silent day - Varying meditation exercises "
Lung_Cancer
"METHODS These experiments were conducted on left lungs (n = 6) taken from freshly slaughtered pigs. The laser and the monopolar cutter were fixed in a hydraulic mover. The laser was focused at a distance of 3 cm to the lung tissue and the monopolar cutter was fixed in pressure-free contact with the lung surface. Both instruments were manoeuvred at a speed of 5 10 and 20 mm/s in a straight line at an output of 100 watts over the lung surface. The lung lesions that ensued were then examined macro- and microscopically. The same procedures were repeated at a distance of 1 cm creating parallel lesions in order to analyse the lung tissue in between the lesions for thermal damage. In addition two implanted capsules in the lung tissue simulating a lung nodule were resected with either the laser or the monopolar cutter. The resection surfaces were then examined by magnetic resonance imaging and histology for tissue damage. Finally we created a 2-cm wide mark on the lung surface to test the resection capacity of both instruments within 1 min. RESULTS The laser created sharply delineated lesions with a vaporization and coagulation zone without thermal damage of the surrounding lung tissue. With lowering the working speed each zone was extended. At a working speed of 10 mm/s the mean vaporization depth using the laser was 1.74 ± 0.1 mm and the mean coagulation depth was 1.55 ± 0.09 mm. At the same working speed the monopolar cutter demonstrated a greater cutting effect (mean vaporization depth 2.7 ± 0.11 mm; P < 0.001) without leaving much coagulation on the resection surface (mean coagulation depth 1.25 ± 0.1 mm; P = 0.002). In contrast to the laser the monopolar cutter caused thermal damage of the adjacent lung tissue. The adjacent tissue injury was detected in histological examination as well as in the MRI findings. Adjacent lung tissue after lung metastasectomy using the monopolar cutter was hyper-intensive in T2-weighted MR imaging indicating a severe tissue damage. No significant changes in signal intensity were observed in T2-weighted imaging of the adjacent lung tissue after using the laser for lung resection. One minute of laser applied at a 100-watt output penetrated a lung surface area of 3.8 ± 0.4 cm2 compared with 4.8 ± 0.6 cm2 of surface after application of the monopolar cutter (P = 0.001). S The monopolar cutter possesses indeed a greater cutting capacity than the laser but it also causes more adjacent tissue injury. Thus laser resection might be preferred for lung metastasectomy. Electrosurgical scalpel Laser Lung metastases Lung resection Tissue damage BMC Urol BMC Urol BMC Urology 1471-2490 BioMed Central 24612599 3975282 1471-2490-14-26 10.1186/1471-2490-14-26 Research an-specific and tumor-size-dependent responses to sunitinib in clear cell renal cell carcinoma Tsuchiya Norihiko 1 tsuchiyamed.akita-u.ac.jp Yuasa Takeshi 2 takeshi.yuasajfcr.or.jp Maita Shinya 1 yamightyyahoo.co.jp Narita Shintaro 1 narishindoc.med.akita-u.ac.jp Inoue Takamitsu 1 takamitudoc.med.akita-u.ac.jp Numakura Kazuyuki 1 numakuradoc.med.akita-u.ac.jp Saito Mitsuru 1 mitsaitomed.akita-u.ac.jp Satoh Shigeru 1 shigerusdoc.med.akita-u.ac.jp Yonese Junji 2 jyonesejfcr.or.jp Habuchi Tomonori 1 thabuchidoc.med.akita-u.ac.jp 1Department of Urology Akita University Graduate School of Medicine Akita Japan 2Department of Urology Cancer Institute Hospital Japanese Foundation for Cancer Research Tokyo Japan 2014 11 3 2014 14 26 26 20 7 2013 28 2 2014 Copyright 2014 Tsuchiya et al.; licensee BioMed Central Ltd. 2014 Tsuchiya et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. Background Tyrosine kinase inhibitors (TKIs) have been used as standard therapy for patients with advanced renal cell carcinoma (RCC). However information on factors predicting response to treatment with TKIs is lacking. This study aimed to assess the association between initial tumor size involved ans pre-treatment C-reactive protein (CRP) levels and reduction in tumor size in patients with clear cell RCC (CCRCC) treated with sunitinib. Methods Patients with advanced CCRCC with target lesions with a maximum diameter???10 mm treated with sunitinib were evaluated. The tumor diameter representing the best overall response was designated as the post-treatment tumor diameter. Results A total of 179 lesions in 38 patients were analyzed. an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderate inverse association with percent reduction in post-treatment tumor diameter (R?=?0.341). Lung lesions showed significantly greater percent reductions in diameter than liver and kidney lesions (P?=?0.007 and 0.002 respectively). Furthermore based on a CRP cut-off level of 2.0 mg/dl mean tumor size reduction was significantly greater in patients with low CRP levels than in patients with high CRP levels in lesions with diameters?<?20 mm (P?=?0.002). CRP level had no effect on mean size reduction in lesions with a diameter???20 mm. Conclusions Patients with CCRCC with smaller lung metastatic lesions and lower CRP levels may achieve greater percent reductions in tumor size with sunitinib therapy than patients with extra-pulmonary lesions large lung lesions and/or higher CRP levels. Advanced renal cell carcinoma Sunitinib Tumor size Tumor response C-reactive protein Background In the era of cytokine therapy tumor response to treatment in advanced or metastatic renal cell carcinoma (RCC) has been reported to vary according to the ans involved [12]. Longer overall survival and a higher response rate to therapy with interferon-? or a combination of interleukin-2 and interferon-? were observed in patients with only lung metastasis compared with those with extra-pulmonary metastasis [12]. Complete remission (CR) after treatment with tyrosine kinase inhibitors (TKIs) which mainly target vascular endothelial growth factor receptors remains a rare event but most patients who do achieve CR have either lung metastasis alone or only lymph node involvement [34]. However most cancer clinical trials evaluate tumor response using the response evaluation criteria in solid tumors (RECIST) in which the longest diameters of target lesions in multiple ans are summed. Tumor response in individual metastatic lesions in specific ans has not been delineated. A reduction in tumor size >10% calculated as the sum of the longest diameter of the target lesions was significantly associated with both time to treatment failure and overall survival suggesting that size reduction of target lesions may predict the outcome of treatment with TKIs [5]. In addition Yuasa et al. recently demonstrated that a smaller initial tumor size predicted a good response to TKIs and that the maximum response was achieved in lung lesions [6]. TKIs have shown significant clinical benefit in advanced clear cell RCC (CCRCC) in large randomized trials [7-9]. However the reported objective responses vary according to the different types of TKIs and a recent phase II trial failed to demonstrate any clinical efficacy of sunitinib in non-CCRCC [10]. Tumor size reduction may thus be affected by many factors including initial tumor size involved ans tumor histology tumor aggressiveness or type of TKI used. In this study we evaluated the association between initial tumor size of individual lesions in specific ans and reduction in tumor size in patients with CCRCC treated with sunitinib. Methods Patients and tumor measurement A total of 38 patients with advanced CCRCC who received at least two cycles of sunitinib at Akita University Hospital and at the Cancer Institute Hospital of the Japanese Foundation for Cancer Research were enrolled in this institutional review-board-approved retrospective study. Pathological diagnosis was made by radical nephrectomy in 30 patients and by percutaneous biopsy in eight patients who were not indicated for surgical treatment because of a significantly higher total volume of metastatic lesions compared with the primary lesion. The initial dose of sunitinib was 50 mg/day which was reduced to 37.5 mg/day based on the patient€™s physique age and performance status. Sunitinib was initiated on a 28 days on/14 days off schedule and a dose reduction to 25 mg/day or complete cessation was considered in the event of grade 3 or higher toxicity according to the Common Terminology Criteria for Adverse Events (CTC-AE). All lesions were evaluated using a multidetector computed tomography scanner and lesions???10 mm in diameter were considered target lesions. The maximum diameter of each target lesion was measured before treatment with sunitinib (pre-treatment tumor diameter) and every 2€“3 months thereafter. The tumor diameter at the point when best overall response was achieved based on the RECIST version 1.0 was adopted as the post-treatment tumor diameter. In this study the most common metastatic ans including lung liver and lymph nodes as well as the kidney were subjected to analysis. Statistical analysis The association between pre-treatment tumor diameter and percent change between pre- and post-treatment tumor diameters for each lesion was assessed by Pearson€™s correlation coefficient. The Kruskal Wallis test was used to compare differences in percent change in tumor diameter between the four different ans. The Mann€“Whitney U test was used to compare differences between two groups. A receiver-operator curve (ROC) was constructed to find the pre-treatment tumor diameter predicting tumor response to sunitinib treatment. A value of P?<?0.05 was considered statistically significant. Results Patients and target lesions The patients included 30 men and eight women with a median age of 62 years (range 27€“81 years). The patients€™ characteristics are listed in Table 1. The best response to sunitinib treatment was CR in one patient (3%) partial response (PR) in 11 (29%) stable disease (SD) in 23 (61%) and progressive disease (PD) in three (8%). The objective response rate was 32% and the clinical benefit rate (CR?+?PR?+?SD for at least 3 months) was 92%. A total of 179 lesions ranging from 10 to 106 mm were measured and analyzed in 38 patients. These lesions were localized as follows: 124 in the lung 12 in the liver 24 in the lymph nodes and 19 in the kidney. Of the 15 patients with kidney tumors seven who underwent nephrectomy had target lesions in the contralateral kidney including two patients with multiple lesions. The remaining eight patients had primary kidney tumors that were diagnosed by percutaneous needle biopsy. Table 1 Patients€™ characteristics Characteristic No. of patients (%) Sex ??Male 30 (78.9) ??Female 8 (21.1) Age y ??Median [range] 62 [27€“81] ECOG performance status ??0 25 (65.8) ??1 7 (18.4) ??> 1 6 (15.8) MSKCC risk category ??Favorable 8 (21.1) ??Intermediate 20 (52.6) ??Poor 10 (26.3) Target ans ??Lung 31 (81.6) ??Liver 6 (15.8) ??Lymph node 11 (28.9) ??Kidney 15 (39.5) Nephrectomy ??Yes 30 (78.9) ??No (biopsy) 8 (21.1) Prior treatments ??None 27 (71.1) ??Cytokines alone 4 (10.5) ??Sorafenib?±?cytokines 7 (18.4) Associations between pre-treatment tumor diameter and percent change in target lesion size in different ans The associations between pre-treatment tumor diameter and percent change in size of each target lesion in each of four ans were analyzed separately. an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderately positive association with percent change in post-treatment tumor diameter (R?=?0.341 Figure 1). There were fewer target lesions in the other three ans than in the lung and there was no association between liver lymph node or kidney lesion size and percent change in post-treatment tumor diameter (Figure 1). The percent changes in target lesion size differed significantly between the four individual ans (P?=?0.0007 by the Kruskal Wallis test). The mean (± SD) percent changes in target lesion size in the lung liver lymph nodes and kidney were ?27.1?±?33.5 0.5?±?29.4 ?16.7?±?19.6 and ?2.7?±?21.7 respectively. Target lesions in the lung showed the greatest change in size which was significantly greater than in the liver and kidney (P?=?0.007 and 0.002 respectively). There was no difference in the percent change in target lesion size between the lung and lymph nodes (P?=?0.114) (Figure 2). Figure 1 Association between pre-treatment tumor size and percent change in lesion size after sunitinib treatment. Association between pre-treatment tumor size and percent change in size was analyzed for lesions in the lung (a) liver (b) lymph nodes (c) and kidney (d). The pre-treatment size of lung lesions showed a moderately positive association with percent size change after treatment with sunitinib while no association was observed in the liver lymph nodes and kidney. Figure 2 Percent change in target lesion size in different ans. The reduction in lesion size was significantly greater in lung lesions compared with liver and kidney lesions. Lung lesions with an initial diameter?<?17.3 mm (median) showed a significant percent reduction in size compared with lesions???17.3 mm. No significant differences in relation to initial lesion size were observed in the liver lymph nodes and kidney. Lesions in each an were divided into two groups according to the median pre-treatment diameter and percent changes in tumor diameter were compared between the two groups. Lung lesions with a pre-treatment diameter less than the median value of 17.3 mm showed a significant percent reduction in diameter compared with tumors???17.3 mm (P?=?0.002). There were no differences in the percent change in relation to size above or below the median value in other ans (Figure 2). Cut-off value for pre-treatment tumor diameter predicting response to sunitinib in lung metastasis ROC curves were drawn to determine cut-off values predicting 30% and 50% reductions in the diameter of lung metastatic lesions (Figure 3). The cut-off predicting a 30% reduction in diameter was 16.5 mm with a sensitivity of 69.6% specificity of 58.2% and an area under the curve (AUC) of 0.662. The cut-off predicting a 50% reduction in diameter was also 16.5 mm with a sensitivity of 67.0% specificity of 77.8% and an AUC of 0.752. Using this cut-off value the percent change in lesion size for lesions?<?16.5 mm was ?41.7?±?35.5% while that for lesions???16.5 mm was ?16.2?±?26.9% (P?=?0.0005). Figure 3 Cut-off values of initial lung tumor size for predicting 30% and 50% reductions in diameter after sunitinib treatment. Based on ROC analysis the cut-off values of initial lung lesion size for predicting reductions in diameter of both 30% and 50% were 16.5 mm. Influence of pre-treatment CRP value cytoreductive nephrectomy and treatment line on percent change in target lesion size in the lung Metastatic lung lesions were categorized into two groups based on pre-treatment C-reactive protein (CRP) levels. The mean diameter and percent change in lesion size in patients with CRP?<?2.0 mg/ml were 19.0?±?9.3 mm and ?38.3?±?30.5% respectively while those in patients with CRP???2.0 mg/ml were 28.3?±?20.6 mm and ?9.6?±?33.9% respectively. The lesions were further divided into three subgroups according to pre-treatment diameter?<?20 mm ? 20 to?<?40 mm and???40 mm. Percent changes were compared between lesions in patients with CRP?<?2.0 mg/dl (low CRP) and those with CRP???2.0 mg/dl (high CRP) in each subgroup. For lesions?<?20 mm patients with low CRP had significantly greater reductions in tumor diameter than patients with high CRP (?43.8?±?33.4% vs. ?15.3?±?37.7% P?=?0.0019). In patients with lesions ?20 to?<?40 mm there was a tendency towards a greater reduction in patients with low CRP compared with high CRP though the difference was not significant (?29.0?±?17.3% vs. ?12.4?±?30.2% P?=?0.054) and similarly there was no significant association between tumor reduction and CRP level in patients with lesions???40 mm (?13.3?±?20.6 vs. 6.8?±?17.4 P?=?0.151) (Figure 4). Figure 4 Influence of CRP on percent change in lung lesion size. In patients with lung lesions?<?20 mm the percent reduction in size was significantly greater in patients with low compared with high CRP levels. Meanwhile CRP level had a marginal effect on size reduction in lesions???20 to?<?40 mm and no effect in lesions???40 mm. Percent changes in size were compared between lung lesions in patients in each diameter subgroup who did and did not undergo cytoreductive nephrectomy. There were no lung lesions???40 mm in patients who did not undergo cytoreductive nephrectomy. There was no significant difference between mean percent change in lesion size in patients with and without cytoreductive nephrectomy (?36.1?±?32.6 vs. ?28.2?±?41.9 P?=?0.421 and ?20.4?±?25.1 vs. ?32.0?±?21.9 P?=?0.307 in lesions?<?20 mm and???20 mm respectively). Similarly there was no significant difference in percent change in lesion size between lung lesions in patients treated as first-line therapy and those treated as second-line or later therapy in any diameter subgroup (?38.1?±?37.7 vs. ?32.1?±?33.9 P?=?0.280; ?23.5?±?21.6 vs. ?17.5?±?23.3 P?=?0.803; and 3.5?±?2.6 vs. 1.9?±?22.9 P?>?0.9 in lesions?<?20 mm ? 20 to?<?40 mm and???40 mm respectively). Discussion A previous study on metastatic RCC by Yuasa et al. demonstrated that: 1) smaller initial tumor size predicted a good response to TKIs; 2) the greatest response was achieved in patients with lung lesions; and 3) there was no difference in tumor response between patients treated with sorafenib and sunitinib [6]. However these results raised several specific questions. First tumor histology and progression risk may affect the response to TKIs. TKIs are associated with a good response in patients with CCRCC but are less effective against non-CCRCC [10]. Similarly patients with favorable risk factors have a greater chance of a good tumor response than those with poorer risk factors. Second there is the possibility of bias in terms of the types of TKI selected; given that sunitinib showed a higher response rate than sorafenib [78] patients with larger or more rapidly-growing tumors may be allocated sunitinib rather than sorafenib in clinical practice. Third efficacy based on initial tumor size may differ between different ans; although the previous study compared mean lesion-size reductions between different ans they did not compare the effect of initial tumor size in individual ans. It is therefore unclear if the association between initial lesion size and tumor response was observed in each an or if the association could be attributed to the fact that most of the small lesions were lung metastases which showed a good response to TKIs. The current study only included CCRCC patients treated with sunitinib. We found that lung lesions showed the greatest response to sunitinib and detected a modest correlation between initial tumor diameter and reduction in lesion size while even small lesions in other ans failed to respond. However the number of extra-pulmonary tumors assessed was too small to determine statistical significance and further studies with larger numbers of tumors are needed to obtain conclusive results. Only lesions with an initial diameter?<?20 mm achieved a CR in this study indicating that a lung-tumor reduction of?>?50% might be limited to smaller lesions. The cut-off value of 16.5 mm for a?>?50% reduction in diameter was calculated using ROC analysis with a sensitivity of 67.0% and a specificity of 77.8%. Some physicians may prefer conservative therapies without TKIs or a watchful waiting strategy in CCRCC patients with only small lung metastatic lesions [11]. Furthermore cytokine therapies are still employed in CCRCC patients especially in Japan because of their low toxicity and ability to achieve long-term stable disease [12]. However the present results suggest that smaller lung lesions are associated with a greater chance of response to TKIs and it is therefore important not to miss the opportunity for early initiation of TKI treatment in patients with PD during watchful waiting periods or cytokine therapy. Several studies have investigated the response of primary kidney lesions to TKIs [13-15]. Kroon et al. reported that smaller primary lesions were more responsive to treatment and that tumors of 5€“7 cm may benefit from neoadjuvant treatment followed by nephron-sparing surgery. In contrast our results showed that the response of kidney lesions to sunitinib was independent of initial tumor size and many smaller lesions exhibited no response. A possible explanation for this difference may be the selection of patients; most of the kidney lesions were investigated in the neoadjuvant setting in Kroon et al.€™s study while all the patients with kidney lesions in the current study had an extensive metastatic tumor burden. The different patient backgrounds may have led to different responses to TKIs particularly in small kidney lesions. CRP is an acute phase protein produced by the liver in response to various conditions such as inflammation infection and malignancy [16]. In the cytokine era elevated serum CRP level has been suggested as a biomarker for predicting poor survival in RCC patients [17-19]. Yasuda et al. recently demonstrated that CRP was a significant predictive marker for prognosis in metastatic RCC patients treated with TKIs [20]. In the current study the size reduction of lung lesions in patients with high serum CRP levels was lower than that in patients with low CRP levels irrespective of the initial size. This lower response to sunitinib in patients with higher serum CRP levels may be attributed to an aggressive disease status reflected by higher CRP levels the acquisition of resistance to therapeutic agents through an increase in inflammatory mediators in the cancer-cell microenvironment or compromised drug metabolism induced by such mediators associated with CRP [21]. Tumor response to treatment is currently assessed by imaging based on RECIST criteria [22]. However although marked central necrosis is often detected in lesions with a small size reduction after treatment with TKIs RECIST only considers one-dimensional lesional size changes suggesting that it may substantially underestimate the actual tumor response. Several studies recently reported novel criteria which may improve response assessment by evaluating changes in tumor attenuation and morphology on contrast-enhanced computed tomography scans in addition to size changes [522-26]. The results of this study therefore need to be interpreted carefully because lesions in different ans may exhibit distinct response patterns in imaging. Moreover the current study did not demonstrate an association between tumor response and patient survival and it is possible that percent change in tumor size might not correlate directly with survival. Further studies are needed to determine the influence of an-specific response patterns to TKI treatment on survival. Conclusions The results suggest that tumor-size reduction depends on initial tumor size and the ans involved as well as systemic reaction to the lung tumor as indicated by CRP levels. CCRCC patients with lung metastatic lesions?<?20 mm in diameter and lower CRP levels may achieve greater reductions in tumor size with sunitinib therapy than those with extra-pulmonary lesions lung lesions???20 mm in diameter"
Lung_Cancer
"Activation of the NLRP3 inflammasome is dependent on the generation of ROS [33]. Verifying the inhibitory effect of luteoloside on the proliferation and metastasis of HCC cells was accomplished by inhibiting the NLRP3 inflammasome; the levels of NLRP3 inflammasome protein of different treatment groups were determined. The results showed a significant decrease in the expression of NLRP3 of Huh-7 and SMMC-7721 cells treated with luteoloside (25 µM and 50 µM) compared with the non-treated control cells (Fig. 4A line 1; 4B). Caspase-1 is a family member of intracellular cysteine proteases and they are first synthesized as inactive pro-caspase-1. Upon stimulation pro-caspase-1 zymogen is self activated by proteolytic cleavage into the enzymatically active heterodimer composed of two 10- and 20-kDa subunits. Inflammasome elicits the proteolytic maturation and secretion of interleukin-1? (IL-1?) and IL-18 through caspase-1 activity [17] which was also assessed in luteoloside treated Huh-7 and SMMC-7721 HCC cells. The results from this experiment suggests that luteoloside decreases the proteolytic cleavage of pro-caspase-1 in both Huh-7 and SMMC-7721 HCC cells in a dose-dependent fashion compared with non-treated control cells (Fig. 4A line 2; 4C). Furthermore treatment of luteoloside decreased the expression level of IL-1? in both Huh-7 and SMMC-7721 HCC cells (Fig. 4A line 3; 4D). The results indicate that luteoloside suppresses the proliferation and metastasis of HCC cells by inhibition of NLRP3 inflammasome (Fig. 4E). .0089961.g004 Luteoloside suppresses the NLRP3 inflammasome activation. (A) Western blot analyses of NLRP3 Caspase-1 (p10) and IL-1? protein expression in Huh-7 and SMMC-7721 cells exposed two different concentrations of luteoloside for 48 h. (B“D) Relative quantitation of NLRP3 Caspase-1 (p10) and IL-1?. (E) A hypothetical cascade pathway of NLRP3 inflammasome suppressed by luteoloside. * P<0.05; ** P<0.01; *** P<0.001 versus non-luteoloside-treated control group. Luteoloside Inhibits in vivo Proliferation and Metastasis of HCC Cells The results obtained from in vitro studies showed that treatment of HCC cells with luteoloside inhibits the proliferation migration and invasion capacity of these cells. To determine the in vivo effects of luteoloside we performed in vivo proliferation and metastasis study. The average size and weight of xenografts in the luteoloside-treated group were dramatically smaller and lighter than those of the control group (P?=?0.0026 and P?=?0.0417 respectively). (Fig. 5c 5d). Therefore the luteoloside treatment significantly inhibited the growth of the xenograft with inhibition rates (versus the control volume and weight of the tumors) of 44.1 and 53.1% respectively. Furthermore we injected SMMC-7721 cells into the lateral tail veins of nude mice (n?=?10) and evaluated the metastatic growth of cells in the lung. After 8 weeks the luteoloside-treated mice displayed a statistically significantly lower number of lung metastases than the control group mice (P?=?0.0003) indicative of extravasation and tumor growth in the lung (Fig. 5e). When lungs underwent hematoxylin and eosin staining lung metastases were observed in all ten mice intravenously injected SMCC-7721 cells only whereas no obvious lung metastases were observed in the mice intravenously injected SMMC-7721 cells with luteoloside treated (Fig. 5f 5g). It is worth noting that no difference in mouse weight was observed between the treatment group and the control group suggesting that luteoloside has no adverse effects on mouse growth. .0089961.g005 Luteoloside inhibits tumorigenic and spontaneous lung metastatic capabilities of SMMC-7721 cells. (A) Subcutaneous injection of SMMC-7721 cells plus luteoloside treatment in nude mice inhibited tumor growth. (B) Tail vein injection of SMMC-7721 cells plus luteoloside treatment in nude mice inhibited the metastasis of SMMC-7721 cells. (a) 2—106 SMMC-7721 cells were subcutaneously injected into the right upper flank of each mouse. When tumors were observable the animals were equally divided into two groups (ten per group). The first group received only 0.2 ml of vehicle material by gavage daily and served as a control group. The second group of animals received luteoloside (2 mg/kg body weight) in vehicle respectively for 4 weeks. At the termination of the experiment the mice were sacrificed and the tumors were weighed immediately after dissection. The yellow arrow shows the tumor. (b) The photo of tumors isolated from killed nude mice of the indicated groups. (c-d) The volume and weight of the tumors. (e) Number of metastatic nodules on the surface of the lungs of mice injected with SMMC-7721 (n?=?10 mice in per group) are presented as the means and SEM. (f-g) Representative pictures of lungs with or without metastatic nodules are shown (H&E staining). * P<0.05; ** P<0.01; *** P<0.001 versus non-luteoloside-treated control group. Scale bar: 30 µm. Discussion HCC is a rapidly fatal disease with a life expectancy of about 6 months from the time of the diagnosis. Therapeutic strategies employed to date have significantly improved the prognosis for patients with unresectable HCC. This emphasizes the need for investigating the molecular mechanisms responsible for HCC development and seeking effective and non-cytotoxic chemical agents for chemoprevention and treatment. However few synthetic antineoplastic compounds have been identified to be effective for the treatment of this disease [3]. In this respect more and more researchers paid much attention to natural active compounds for cancer chemoprevention and treatment. In the present study luteoloside which was previously found to exert antineoplastic effect was clearly demonstrated to inhibit the proliferation of all six human hepatoma cell lines (Fig. 1B 1C). In in vivo experiments we obtained the same results (Fig. 5A). Invasion and metastasis two of the most important hallmarks of cancer are the leading lethal factors for malignant cancer especially for HCC [34]. The long-term survival of HCC patients after curative resection is still confronted by the major obstacle of a high recurrence rate which is mainly due to the spread of intrahepatic metastases [25]. Therefore the identification of metastatic factors and an understanding of the underlying molecular pathways that are involved in the progression of metastasis become critical issues. Evidences are accumulating that some flavonoids could significantly inhibit the invasion and metastasis of HCC cells [35] [36]. In this study luteoloside was shown to dramatically inhibit HCC cell migration invasion and metastasis both in vitro (Fig. 2; Movies S1“S4) and in vivo (Fig. 5B). ROS such as superoxide (O2?) and hydrogen peroxide (H2O2) are constantly produced during metabolic processes in all living species. Under normal physiological conditions cellular ROS generation is counterbalanced by the action of antioxidant enzymes and other redox molecules. The balance between O2? generation and elimination is important for maintaining proper cellular redox states. Recent evident suggests that a moderate increase in ROS can stimulate cell proliferation invasion and metastasis [37] [38]. However the precise molecular signaling events of such a regulation are not yet well characterized. In this study we found that luteoloside could significantly decrease the ROS level of HCC cells such as Huh-7 and SMMC-7721 cells (Fig. 3). NLRP3 was recently identified to form a cytoplasmic complex known as the NLRP3 inflammasome which potently modulates innate immune function by regulating the maturation and secretion of pro-inflammatory cytokines such as interleukin-1? (IL-1?) [39]. Activation of the NLRP3 inflammasome is dependent on the generation of ROS [40] [41]. In fact all known NLRP3 activators generate ROS and conversely inhibitors of ROS block inflammasome activation [33]. The NLRP3 inflammasome functions as a positive regulator of tumor cells proliferation and metastasis [17] [32] [42]. Several studies have demonstrated that some flavonoids were found to suppress NLRP3 inflammasome activation [43] [44]. Our results showed that luteoloside could significantly decrease the expression of NLRP3 protein of Huh-7 and SMMC-7721 HCC cells (Fig. 4A lane 1; 4B). Furthermore luteoloside also decreased the expression level of caspase-1 (p10) (Fig. 4A lane 2; 4C) and IL-1? (Fig. 4A lane 3; 4D). Based on the results of the present study the mechanisms by which luteoloside inhibits HCC cells is summarized in Fig. 4E. In addition we found that luteoloside had no significantly effect on the cell apoptosis (Figure S1). Earlier studies have shown that induction of autophagy could result in decreases in mitochondrial ROS generation NLRP3 protein level and pro-IL-1? processing [45]. However in this study we found that luteoloside had no significantly effect on the protein levels of LC3 and Beclin 1 (Figure S2) two important autophagy markers. The new classification of cell death established by the Nomenclature Committee on Cell Death (NCCD) was based on molecular features [46] [47]. According to this classification cell deaths can be roughly divided into: apoptosis (caspase dependent extrinsic apoptosis and caspase-independent intrinsic apoptosis) necrosis autophagy cell death and other tentative definitions of cell death modalities including anoikis entosis pyroptosis netosis and cornification. In HCC at least four types of cell death pathways have been observed and studied including apoptosis [48] necrosis [49] autophagy [50] anoikis [51] None of the above described cell deaths contribute to HCC proliferation and metastasis equally and HCC progression is not dependent entirely on any single cell death pathway. In this study we found that luteoloside had no significantly effects on the cell apoptosis or autophagy. Further study is underway to explore whether luteoloside has significantly effects on other kinds of cell death. Luteoloside significantly inhibited the proliferation of HCC cells in vitro and in vivo. But luteoloside had no significantly effect on the cell apoptosis or autophagy. J¸rgensen et al have shown that the predominant effect of nilotinib a kind of tyrosine kinase inhibitor is antiproliferative rather than proapoptotic. They further suggested that combining nilotinib with other drugs should be carefully considered from the point of view of merely inducing G0/G1 block without apoptosis [52]. Papeleu et al found Trichostatin A a drug candidate for cancer therapy could inhibit cell proliferation at different steps of the cell cycle. But they also found Trichostatin A did not induce apoptosis in cells. Their finding supports its use in the treatment of proliferative disorders [53]. So from another perspective perhaps the predominant effect of luteoloside is antiproliferative rather than an œexecutor of cell death. Further studies are required to explore this possibility. To the best of our knowledge this is the first to show that luteoloside a flavone subclass of flavonoids inhibits the proliferation invasion and metastasis of HCC cells through inhibition of NLRP3 inflammasome. Our findings provide an important basis for a further exploration towards understanding the action mechanisms of luteoloside and possibly its beneficial effect in the prevention of tumor proliferation invasion and metastasis. Supporting Information Figure S1 Luteoloside does not affect the apoptosis rate of Huh-7 and SMMC-7721 cells. (A“B) The effect of luteoloside on caspase activity. Cells were plated in a 96-well plate. Overnight the cells were incubated with different concentrations of luteoloside. After 24 hours caspase-3/7 activity was measured using the Caspase-Glo® 3/7 Assay (Promega Madison WI). The caspase-3/7 activity was proportionate to the produced luminescence intensity. (C) Detection of DNA ladder formation in Huh-7 and SMMC-7721 cells after treatment with luteoloside for 24 hours. (D) Hoechst 33342 staining. The cells treated with luteoloside and stained with Hoechst 33342. Arrows show apoptotic small bodies. NS not significant (P>0.05). Scale bars: 1 µm. (TIF) Click here for additional data file. Figure S2 Luteoloside does not affect autophagy. Western blot analyses of LC3 and Beclin 1 protein expression in Huh-7 and SMMC-7721 cells exposed two different concentrations of luteoloside for 48 h. (TIF) Click here for additional data file. Movie S1 The migration of non-luteoloside-treated SMMC-7721 cells into the wound was monitored using a CellVoyager CV1000 confocal scanner system. The images were acquired every hour for 72 hours. (MP4) Click here for additional data file. Movie S2 The migration of luteoloside-treated SMMC-7721 cells into the wound was monitored using a CellVoyager CV1000 confocal scanner system. The images were acquired every hour for 72 hours. (MP4) Click here for additional data file. Movie S3 The migration of non-luteoloside-treated Huh-7 cells into the wound was monitored using a CellVoyager CV1000 confocal scanner system. The images were acquired every 0.5 hour for 48 hours. (MP4) Click here for additional data file. Movie S4 The migration of luteoloside-treated Huh-7 cells into the wound was monitored using a CellVoyager CV1000 confocal scanner system. The images were acquired every 0.5 hour for 48 hours. (MP4) Click here for additional data file. We thank Dr. Sheng Zhao for assistance in the preparation of this manuscript. References 1 SiegelR NaishadhamD JemalA (2013) Cancer statistics 2013. CA Cancer J Clin63: 11“3023335087 2 El-SeragHB (2011) Hepatocellular carcinoma. N Engl J Med365: 1118“112721992124 3 LiS DongP WangJ ZhangJ GuJ et al (2010) Icariin a natural flavonol glycoside induces apoptosis in human hepatoma SMMC-7721 cells via a ROS/JNK-dependent mitochondrial pathway. Cancer Lett298: 222“23020674153 4 SahasrabuddheVV GunjaMZ GraubardBI TrabertB SchwartzLM et al (2012) Nonsteroidal anti-inflammatory drug use chronic liver disease and hepatocellular carcinoma. J Natl Cancer Inst104: 1808“181423197492 5 FanSH ZhangZF ZhengYL LuJ WuDM et al (2009) Troxerutin protects the mouse kidney from D-galactose-caused injury through anti-inflammation and anti-oxidation. Int Immunopharmacol9: 91“9619000936 6 FanSH ZhangZF WangYY ZhengYL LuJ et al (2012) Purple sweet potato color attenuates D-galactose-induced renal injury in mice by inhibiting the expression of NF-?B-dependent inflammatroy genes. J Med Plants Res6: 3694“3704 7 Zamora-RosR FedirkoV TrichopoulouA Gonz¡lezCA BamiaC et al (2013) Dietary flavonoid lignan and antioxidant capacity and risk of hepatocellular carcinoma in the European prospective investigation into cancer and nutrition study. Int J Cancer133: 2429“244323649669 8 WalterA Etienne-SelloumN BrasseD KhalloufH BronnerC et al (2010) Intake of grape-derived polyphenols reduces C26 tumor growth by inhibiting angiogenesis and inducing apoptosis. FASEB J24: 3360“336920442318 9 IorioF BosottiR ScacheriE BelcastroV MithbaokarP et al (2010) Discovery of drug mode of action and drug repositioning from transcriptional responses. Proc Natl Acad Sci U S A107: 14621“1462620679242 10 HuC KittsDD (2004) Luteolin and luteolin-7-O-glucoside from dandelion flower suppress iNOS and COX-2 in RAW264.7 cells. Mol Cell Biochem265: 107“11315543940 11 SunX SunGB WangM XiaoJ SunXB (2011) Protective effects of cynaroside against H2O2-induced apoptosis in H9c2 cardiomyoblasts. J Cell Biochem112: 2019“202921445859 12 XiongJ LiS WangW HongY TangK et al (2013) Screening and identification of the antibacterial bioactive compounds from Lonicera japonica Thunb. leaves. Food Chem138: 327“33323265495 13 BaskarAA IgnacimuthuS MichaelGP Al NumairKS (2011) Cancer chemopreventive potential of luteolin-7-O-glucoside isolated from Ophiorrhiza mungos Linn. Nutr Cancer63: 130“13821161823 14 van DeventerHW BurgentsJE WuQP WoodfordRM BrickeyWJ et al (2010) The inflammasome component NLRP3 impairs antitumor vaccine by enhancing the accumulation of tumor-associated myeloid-derived suppressor cells. Cancer Res70: 10161“1016921159638 15 AndersonOA FinkelsteinA ShimaDT (2013) A2E induces IL-1? production in retinal pigment epithelial cells via the NLRP3 inflammasome. PLoS One8: e6726323840644 16 HuaKF ChouJC LamY TasiYL ChenA et al (2013) Polyenylpyrrole Derivatives Inhibit NLRP3 Inflammasome Activation and Inflammatory Mediator Expression by Reducing Reactive Oxygen Species Production and Mitogen-Activated Protein Kinase activation. PLoS One8: e7675424116148 17 AhmadI MuneerKM TamimiIA ChangME AtaMO et al (2013) Thymoquinone suppresses metastasis of melanoma cells by inhibition of NLRP3 inflammasome. Toxicol Appl Pharmacol270: 70“7623583630 18 ChenGY Nº±ezG (2011) Inflammasomes in intestinal inflammation and cancer. Gastroenterology141: 1986“199922005480 19 ChenLC WangLJ TsangNM OjciusDM ChenCC et al (2012) Tumour inflammasome-derived IL-1? recruits neutrophils and improves local recurrence-free survival in EBV-induced nasopharyngeal carcinoma. EMBO Mol Med4: 1276“129323065753 20 ChowMT TschoppJ M¶llerA SmythMJ (2012) NLRP3 promotes inflammation-induced skin cancer but is dispensable for asbestos-induced mesothelioma. Immunol Cell Biol90: 983“98623010873 21 Ungerb¤ckJ BelenkiD Jawad ul-HassanA FredriksonM Frans©nK et al (2012) Genetic variation and alterations of genes involved in NF?B/TNFAIP3- and NLRP3-inflammasome signaling affect susceptibility and outcome of colorectal cancer. Carcinogenesis33: 2126“213422843550 22 FanS NiuY TanN WuZ WangY et al (2013) LASS2 enhances chemosensitivity of breast cancer by counteracting acidic tumor microenvironment through inhibiting activity of V-ATPase proton pump. Oncogene32: 1682“169022580606 23 SethmanCR HawigerJ (2013)"
Lung_Cancer
"The proband™s father (II-5) and sister (III-5) were both unaffected and peripheral blood samples were obtained from these individuals. Some family members who were not considered as critical for this study were excluded from the pedigree chart to preserve confidentiality. Whole-exome sequencing was performed for individuals II-4 II-5 III-4 and III-5. After obtaining permission from the Institutional Review Board at Okayama University Hospital and informed consent from the patients and other family members we performed a whole-exome sequencing study. Tumor DNA samples from II-4 tumor and peripheral blood DNA samples from III-4 and peripheral blood DNA samples from two unaffected family members (II-5 and III-5) were used for the analysis. The candidate germline alterations were restricted to 29 variants by comparing the whole-exome sequencing results between the patients and the unaffected family members. Among them we focused on a point mutation in the human epidermal growth factor receptor 2 (HER2/neu) gene (NM_004448 G660D GGC to GAC) which was located in exon 17 encoding the transmembrane domain of HER2 (Supplementary Tables 1“3). This alteration was confirmed by direct sequencing (A). We also confirmed that there was no copy number gain of HER2 in the examined tumors based on the degree of read-depth in the whole-exome sequencing results. Of note no mutations in genes known to cause lung cancers were detected for tumors from III-4 and II-4. . DNA and amino acid sequences in the transmembrane domain of HER2. A) Direct Sanger sequencing of the proband (III-4) her affected mother (II-4) and her unaffected sister (III-5). The results indicated that G660D was a germline mutation. B) Direct sequencing of a sporadic lung adenocarcinoma with a HER2 V659E mutation. V659E was found to be of somatic origin based on the sequencing results of the peritumoral lung tissue from the same specimen. All the sequence variants were confirmed by independent polymerase chain reaction amplifications and were sequenced in both directions. C) Interspecies conservation of the transmembrane domain of HER2 (UCSC Genome Browser http://genome.ucsc.edu accessed September 12 2013). The yellow highlight indicates the N-terminal glycine zipper motif Thr652-X3-Ser656-X3-Gly660 a tandem variant of a GG4-like motif of human HER2. Codons 659 and 660 in human HER2 are highly conserved among the listed vertebrate species (shown in red). X. tropicalis = Xenopus tropicalis. We considered that somatic mutations in the HER2 transmembrane domain might act as driver mutations in lung cancer. Hence we sequenced exon 17 of the HER2 in the tumor samples of 315 sporadic non“small cell lung cancer patients of which 253 were adenocarcinomas. Although the HER2 G660D mutation was not detected a novel nonsynonymous mutation V659E (GTT to GAA) next to codon 660 was identified in one of these patients. This patient was histologically diagnosed as nonmucinous adenocarcinoma in situ and the patient had neither smoking history nor apparent family history of lung cancer. This V659E mutation was certainly a somatic mutation because it was not identified in the peritumoral lung tissue of the same patient (B). The alignment of HER2 amino acid sequences showed high conservation of valine 659 and glycine 660 among vertebrates (C). HER2 somatic mutations have been reported in 2% to 4% of lung adenocarcinomas (5“7). However all reported mutations were restricted to its tyrosine kinase domain (67). According to the cBioPortal for Cancer Genomics (http://www.cbioportal./public-portal/ accessed September 12 2013) the same genetic mutation in the HER2 has not been reported in any type of cancer. Interestingly a previous study reported that a mutation in the transmembrane domain (V664E) of the rat neu gene which corresponds to V659E in its human homolog HER2 induced oncogenic transformation (8). In addition in vivo experiments showed that the HER2 V659E mutation contributed to the stability of HER2 dimers resulting in the dysregulated receptor activation and subsequent cell transformation (910). Furthermore the novel mutations were located within the glycine zipper motif Thr652-X3-Ser656-X3-Gly660 a tandem variant of the GG4-like motif at the N-terminal portion of the transmembrane domain which was critically related to the dimerization of HER2 (C) (911). Accordingly we performed a functional analysis of the mutant HER2 proteins. We found that the degradation of HER2 protein after the administration of cycloheximide was slower in G660D and V659E mutants as compared with wild-type (Supplementary A) indicating the higher stability of the mutant proteins than wild-type protein. In addition results of a phospho-mitogen“activated protein kinase array indicated the activation of Akt and p38? (data not shown). Indeed Akt is known to be activated by HER2 by phosphatidylinositol 3-kinase and leads to increased cell growth and survival (1213). Also the activation of p38 was shown to contribute to the viability of lung adenocarcinoma cells derived from never or light smokers (1415). A western blot analysis for Akt and p38 successfully confirmed the upregulation of both phospho-Akt and phospho-p38 expression in the mutant HER2 transfectants (Supplementary B). Because the G660D alteration in HER2 might have been the cause of the lung cancer in the pedigree studied we investigated whether familial aggregation of cancer in other ans could be seen in this pedigree. We found that II-1 and II-6 developed renal and gastric cancers respectively; however both of them also had lung cancer. The reason why other types of clinically apparent malignances were rarely found in this pedigree is unclear. The G660D germline mutation may be tolerated in ans other than the lung. This study had some limitations. First the carcinogenic potential of the HER2 mutation at the transmembrane domain should be confirmed in other models such as transgenic mice. Second the rarity of these mutations in sporadic lung cancers may be the limitation for generalizability to other cases even if targeting therapies for similar types of HER2 mutation were developed. In we identified a novel germline mutation in the transmembrane domain of the HER2 in familial lung adenocarcinomas. Somatic mutation in the HER2 transmembrane domain may be a possible cause of sporadic lung adenocarcinomas. Funding This study was supported by a Grant-in Aid for Scientific Research from the Ministry of Education Culture Sports Science and Technology of Japan (25293302 to ST). H. Yamamoto J. Soh S. Miyoshi and S. Toyooka conceived the project. K. Higasa M. Sakaguchi K. Shien and K. Ichimura performed the experiments. H. Yamamoto J. Soh M. Furukawa S. Hashida N. Takigawa K. Kiura K. Tsukuda and S. Toyooka collected the samples and assisted with the experiments. H. Yamamoto K. Higasa K. Shien and K. Matsuo analyzed the data. H. Yamamoto K. Higasa M. Sakaguchi F. Matsuda and S. Toyooka prepared the manuscript with input from the other authors. S. Miyoshi F. Matsuda and S. Toyooka supervised the project. The authors declared no conflicts of interest. References 1. BellDWGoreIOkimotoRA Inherited susceptibility to lung cancer may be associated with the T790M drug resistance mutation in EGFR. Nat Genet. 2005;37(12):1315“131616258541 2. IkedaKNomoriHMoriTSasakiJKobayashiT Novel germline mutation: EGFR V843I in patient with multiple lung adenocarcinomas and family members with lung cancer. Ann Thorac Surg. 2008;85(4):1430“143218355544 3. OhtsukaKOhnishiHKuraiD Familial lung adenocarcinoma caused by the EGFR V843I germ-line mutation. J Clin Oncol. 2011;29(8):e191“e19221172876 4. van NoeselJvan der VenWHvan OsTA Activating germline R776H mutation in the epidermal growth factor receptor associated with lung cancer with squamous differentiation. J Clin Oncol. 2013;31(10):e161“e16423358982 5. PaoWGirardN New driver mutations in non-small-cell lung cancer. Lancet Oncol. 2011;12(2):175“18021277552 6. ShigematsuHTakahashiTNomuraM Somatic mutations of the HER2 kinase domain in lung adenocarcinomas. Cancer Res. 2005;65(5):1642“164615753357 7. StephensPHunterCBignellG Lung cancer: intragenic ERBB2 kinase mutations in tumours. Nature. 2004;431(7008):525“52615457249 8. BargmannCIHungMCWeinbergRA Multiple independent activations of the neu oncogene by a point mutation altering the transmembrane domain of p185. Cell. 1986;45(5):649“6572871941 9. BocharovEVMineevKSVolynskyPE Spatial structure of the dimeric transmembrane domain of the growth factor receptor ErbB2 presumably corresponding to the receptor active state. J Biol Chem. 2008;283(11):6950“695618178548 10. FleishmanSJSchlessingerJBen-TalN A putative molecular-activation switch in the transmembrane domain of erbB2. Proc Natl Acad Sci U S A. 2002;99(25):15937“1594012461170 11. MineevKSBocharovEVPustovalovaYEBocharovaOVChupinVVArsenievAS Spatial structure of the transmembrane domain heterodimer of ErbB1 and ErbB2 receptor tyrosine kinases. J Mol Biol. 2010;400(2):231“24320471394 12. BaselgaJSwainSM Novel anticancer targets: revisiting ERBB2 and discovering ERBB3. Nat Rev Cancer. 2009;9(7):463“47519536107 13. EngelmanJA Targeting PI3K signalling in cancer: opportunities challenges and limitations. Nat Rev Cancer. 2009;9(8):550“56219629070 14. MountziosGPlanchardDBesseB Mitogen-activated protein kinase activation in lung adenocarcinoma: a comparative study between ever smokers and never smokers. Clin Cancer Res. 2008;14(13):4096“410218593986 15. PlanchardDCamara-ClayetteVDorvaultNSoriaJCFouretP p38 Mitogen-activated protein kinase signaling ERCC1 expression and viability of lung cancer cells from never or light smoker patients. Cancer. 2012;118(20):5015“502522415779 Oncotarget Oncotarget ImpactJ Oncotarget 1949-2553 Impact Journals LLC 24519909 3996653 Research Paper Sp1-mediated microRNA-182 expression regulates lung cancer progression Yang Wen-Bin 1 Chen Ping-Hsin 2 Hsu Tsung-I 3 Fu Tzu-Fun 4 Su Wu-Chou 5 Liaw Hungjiun 6 Chang Wen-Chang 7 Hung Jan-Jong 1 2 3 7 1 Institute of Bioinformatics and Biosignal Transduction College of Bioscience in Biotechnology National Cheng Kung University Tainan 701 Taiwan 2 Department of Pharmacology College of Medicine National Cheng Kung University Tainan 701 Taiwan 3 Center for Infectious Disease and Signal Transduction Research National Cheng Kung University Tainan 701 Taiwan 4 Department of Medical Laboratory Science and Biotechnology College of Medicine National Cheng Kung University Tainan 701 Taiwan 5 Department of Internal Medicine College of Medicine and Hospital National Cheng Kung University Tainan 701 Taiwan 6 Department of Life Sciences College of Bioscience in Biotechnology National Cheng Kung University Tainan 701 Taiwan 7 Graduate Institute of Medical Sciences College of Medicine and Center for Neurotrauma and Neuroregeneration Taipei Medical University Taipei 110 Taiwan Correspondence to:petehung [email protected] 2 2014 25 1 2014 5 3 740 753 18 11 2013 24 11 2014 Copyright: © 2014 Yang et al. 2014 This is an open-access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Our recent study indicated that overexpression of Sp1 enhances the proliferation of lung cancer cells while represses metastasis. In this study we found that the transcriptional activity of FOXO3 was increased but its protein levels decreased following Sp1 expression. Sp1 increased expression of miR-182 which was then recruited to the 3'-untranslated region of FOXO3 mRNA to silence its translational activity. Knockdown of miR-182 inhibited lung cancer cells growth but enhanced the invasive and migratory abilities of these cells through increased N-cadherin expression. Repression of FOXO3 expression in the miR-182 knockdown cells partially reversed this effect suggesting that miR-182 promotes cancer cell growth and inhibits cancer metastatic activity by regulating the expression of FOXO3. The expression of several cancer metastasis-related genes such as ADAM9 CDH9 and CD44 was increased following miR-182 knockdown. In in the early stages of lung cancer progression Sp1 stimulates miR-182 expression which in turn decreases FOXO3 expression. This stimulates proliferation and tumor growth. In the late stages Sp1 and miR-182 decline thus increasing FOXO3 expression which leads to lung metastasis. Sp1 miR-182 FOXO3 Lung cancer INTRODUCTION Post-transcriptional regulation plays an important role in diverse cellular processes such as development neurogenesis and cancer progression [1-3]. MicroRNAs (miRNAs) have emerged as important post-transcriptional regulators that inhibit mRNA translation or induce mRNA cleavage by base pairing with a seed region in the 3'-untranslated region (3'-UTR) of target genes [4 5]. Recent studies have shown that dysregulation of miRNAs contributes to the initiation progression metastasis and drug resistance of cancer [6 7]. For example miR-200c targets Kras to regulate Kras expression during tumorigenesis [8]. Furthermore several upregulated and downregulated miRNAs have been identified in lung cancer the most frequently diagnosed cancer and the most common cause of cancer-related death worldwide [9-11]. Identification of early-detection biomarkers and precise diagnosis are necessary if lung cancer patients are to receive efficacious therapeutic treatment quickly. Several factors such as USP17 have been identified as potential biomarkers for lung cancer [12 13]. Circulating miRNAs could also serve as useful clinical biomarkers for the screening of high-risk populations and the detection solid tumors in the early stages of cancer progression [14 15]. miRNAs offer new targets for cancer therapy [16 17]. Therefore a detailed understanding of the mechanisms underlying miRNA production and function is important. Identification of miRNA target genes and the use of gene set enrichment analysis have clarified the function role of miRNAs. However the molecular mechanisms that regulate of miRNA biogenesis are still largely unknown. Recent studies have shown that transcription factors (TFs) regulate not only the expression of protein-encoding genes but also miRNA biogenesis through RNA polymerase II-dependent transcription [18]. Several TFs including p53 c-myc and HIF1? that directly recognize miRNA promoters and regulate miRNA transcription have been reported [19-21]. Specificity protein 1 (Sp1) which belongs to the specificity protein/ Krüppel-like family was the first TF identified in mammalian cells. Sp1 contains three Cys2His2-type zinc finger DNA binding motifs that recognize GC-rich promoter sequences [22]. Sp1 regulates thousands of coding genes such as those encoding cyclin A2 p21cip1/waf1 E-cadherin and Sp1 itself. These genes are involved in a variety of physiological processes including cell cycle progression and cell migration [23-26]. Sp1 also regulates the expression of noncoding genes. Sp1 forms a complex with NF-?B to downregulate miR-29b expression through the recruitment of histone deacetylase (HDAC) 1 and HDAC3 in leukemia and thereby contributes to the growth of leukemia cells [27]. Sp1 also forms a complex with HDAC4 to downregulate miR-200a expression in hepatocellular carcinoma and contributes to cell proliferation and migration [28]. In addition Sp1 is an activator of miR-34c miR-132 and miR-365 expression [29-31]. However no studies have assessed whether Sp1 regulates the expression of miRNAs involved in lung tumorigenesis. Because the accumulation of Sp1 is required for lung tumor growth further investigation of Sp1-mediated miRNA regulation is needed. In this study we showed that Sp1 suppressed FOXO3 expression via post-transcriptional regulation. To elucidate whether miRNAs were involved in this process we used a systematic screening approach to identify Sp1-regulated miRNAs. We identified a novel Sp1-regulated miRNA miR-182 in lung cancer cells and demonstrated that Sp1 downregulated FOXO3 expression by upregulating miR-182 expression. Our results show that miR-182 functions as an oncomiR to enhance cancer cell proliferation and acts as a tumor suppressor to inhibit cancer metastasis. RESULTS Sp1 regulates miR-182 expression Our previous studies demonstrated that Sp1 is involved in KrasG12D-induced lung tumorigenesis [23 32]. Using cDNA microarray analysis we found that Sp1 increased oncogene expression and decreased tumor suppressor gene expression. In the present study we initially used software to analyze the promoters of all identified miRNAs. According to the miRBase database the human genome contains 1600 miRNA genes. We investigated whether Sp1 participates in the regulation of intergenic miRNAs. First we screened the upstream (-1 kb) flanking sequences of intergenic miRNAs. Using the TFSEARCH program we identified 205 intergenic miRNAs that contained potential binding sites for Sp1. Because Sp1 is upregulated in lung cancer and the expression of its target genes is altered we next examined the expression of these miRNAs in lung cancer. According to previous studies the expression patterns of 22 miRNAs differed significantly in lung cancer tissue and normal lung tissue (Supplementary Table S1). In most of these studies miR-182 which contains two putative Sp1 binding sites within its upstream region was upregulated in lung cancer. When we examined miR-182 expression we found that miR-182 was decreased in Sp1-knockdown cells but increased in IMR-90 cells that overexpressed GFP-Sp1 (Figure 1A and 1B) suggesting that Sp1 positively regulates miR-182 expression."
Lung_Cancer
"Methods: We updated a case“cohort study nested within a cohort of 267?400 female textile workers in Shanghai China. We compared exposure histories of 1456 incident lung cancers cases diagnosed during 1989“2006 with those of a reference subcohort of 3022 workers who were free of lung cancer at the end of follow-up. We applied Cox proportional hazards modelling to estimate exposure“response trends adjusted for age and smoking for cumulative exposures lagged by 010 and 20 years and separately for time windows of ?15 and >15 years since first exposure. Results: We observed no associations between cumulative exposure and lung cancer irrespective of lag interval. In contrast analyses by exposure time windows revealed modestly elevated but not statistically significant relative risks (?1.27) at the highest three exposure quintiles for exposures that occurred >15 years since first exposure. Conclusions: The findings do not support a protective effect of endotoxin but are suggestive of possible lung cancer promotion with increasing time since first exposure. endotoxin lipopolysaccharide lung cancer epidemiology textile industry occupational health Br J Cancer Br. J. Cancer British Journal of Cancer 0007-0920 1532-1827 Nature Publishing Group 24651386 3992504 bjc2014146 10.1038/bjc.2014.146 Clinical Study A multicentre randomised controlled trial of reciprocal lung cancer peer review and supported quality improvement: results from the improving lung cancer outcomes project Improving lung cancer outcomes project results Russell G K 1 Jimenez S 1 Martin L 1 Stanley R 2 Peake M D 1 3 Woolhouse I 1 4 * 1Clinical Standards Department Royal College of Physicians London NW14LE UK 2Clinical Audit Support Unit NHS Information Centre for Health and Social Care Leeds LS16AE UK 3Department of Respiratory Medicine Glenfield Hospital Leicester LE39QP UK 4Department of Respiratory Medicine Queen Elizabeth Hospital Birmingham Birmingham B152WB UK *E-mail: ian.woolhouseuhb.nhs.uk 15 04 2014 20 03 2014 110 8 1936 1942 19 12 2013 11 02 2014 24 02 2014 Copyright 2014 Cancer Research UK 2014 Cancer Research UK From twelve months after its original publication this work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-sa/3.0/ Background: Results from the National Lung Cancer Audit demonstrate unexplained variation in outcomes. Peer review with supported quality improvement has been shown to reduce variation in other areas of health care but has not been formally tested in cancer multidisciplinary teams. The aim of the current study is to assess the impact of reciprocal peer-to-peer review visits with supported quality improvement and collaborative working on lung cancer process and outcome measures. Methods: English lung cancer teams were randomised to usual care or facilitated reciprocal peer review visits followed by 12 months of supported quality improvement. The primary outcome was change in the following national audit indicators; mulitdisciplinary team discussion histological confirmation active treatment surgical resection small-cell chemotherapy and specialist nurse review. Patient experience was measured using a new lung cancer patient questionnaire in the intervention group. Results: Thirty teams (31 trusts) entered the intervention group and 29 of these submitted a total of 67 quality improvement plans. Active treatment increased in the intervention group (n=31) by 5.2% compared with 1.2% in the control group (n=48 mean difference 4.1% 95% CI ?0.1 to 8.2% P=0.055). The remaining audit indicators improved similarly in all groups. Mean patient experience scores in the intervention group did not change significantly during the study but a significant improvement was seen in the scores for the five teams with the worst baseline scores (0.86 to 0.22 P<0.001). Conclusions: Reciprocal peer review with supported quality improvement was feasible and effective in stimulating quality improvement activity but resulted in only modest improvements in lung cancer treatment rates and patient experience. lung cancer multidisciplinary quality improvement peer Lung cancer is the commonest cause of cancer death in England and Wales with around 38?000 cases diagnosed each year and ?35?000 deaths. Data from the National Lung Cancer Audit (NLCA) demonstrate significant variation in process and outcome measures across England. In 2009 there was a three-fold difference in survival and active treatment rates which persisted following case mix adjustment (Beckett et al 2012). Furthermore reported lung cancer outcomes in the UK are worse than other comparable European countries (Walters et al 2013) and have improved little in recent years (Khakwani et al 2013). It has been estimated that if survival rates were increased to that of the best in Europe around 1300 lives could be saved each year in the United Kingdom (Abdel-Rahman et al 2009). Variation in health care is not unique to lung cancer and addressing unwarranted variation is challenging (Wise 2010). Although external regulation may have a role in some areas this approach is more difficult to apply to the complex pathways involved in lung cancer diagnosis and treatment. Peer review with supported quality improvement offers a promising alternative but the evidence for its effectiveness is limited. The Washington State's Surgical Care and Outcomes Assessment Program utilised a peer support programme to share the best practice which led to a significant reduction in post-operative complications (Kwon et al 2012). Within the United Kingdom the national COPD resources and outcomes project demonstrated that reciprocal peer-to-peer review led to only limited quantitative differences in the quality of services offered (Roberts et al 2012). A qualitative analysis of this study identified a number of barriers to improvement including difficulties in establishing effective working relationships funding changes and service re-design. In 2003 the Institute for Healthcare Improvement described the collaborative model to achieve a breakthrough improvement (Institute for Healthcare Improvement 2003). Collaboratives allow teams working on the same issue to share good practice and innovation permitting others to take these ideas and implement them in the context of their own anisation resources and case mix. Pronovost et al (2006) successfully employed this collaborative approach together with supported quality improvement to implement five evidence-based interventions on the intensive care unit resulting in the reduction in catheter-related bloodstream infections to zero. These studies offer a persuasive proof of concept but the absence of a control group or of patient-specific outcomes measures limits their implementation in other disease areas such as cancer. The aim of the current study is to determine whether a programme of reciprocal peer-to-peer review visits with supported quality improvement and collaborative working can significantly improve lung cancer process and outcome measures and thus reduce unwarranted variation in outcomes. Materials and methods Study design We conducted a prospective randomised controlled trial. Study population One hundred and sixty-two English NHS trusts were identified from the 2008 NLCA annual report. Centres only providing treatment (not diagnostics) orthopaedic hospitals and ambulance trusts were excluded. Invitations to participate were sent to the remaining 152 trusts. Trusts who agreed to participate and who had 2008 NLCA case ascertainment rates of > 50% expected were paired before randomisation on the basis of contrasting results for four key indicators from the NLCA. The indicators were active treatment rates surgical resection rates median survival and the proportion of patients assessed by a clinical nurse specialist. Each trust was colour coded for each indicator red if below the national average and green if above. By placing each trust with its colour-coded indicators on a map we were able to pair trusts on the basis of a contrasting mixture of red and green indicators and a travel time between centres of around 2?h. On the basis of data from the national COPD resources and outcomes project we determined that we would be able to complete 30 peer review visits during the lifetime of the project thus allowing 30 lung cancer multidisciplinary teams (15 pairs) to be randomised into the intervention arm. Randomisation was performed in a blinded fashion by assigning a random number to each pair of trusts and then allocating pairs numbered 1“15 to the intervention group. The remaining trusts formed either the control group (if they had agreed to participate) or the non-participant group and had no further contact with the study team but continued to submit data to the NLCA as usual. Intervention The study timeline is shown in Figure 1. Following introductory workshops the multidisciplinary teams within each pair undertook facilitated reciprocal site visits. The visits consisted of observation of the host team's multidisciplinary team meeting three discussion sessions focusing on the functioning of the mulitdisciplinary team meeting the host team's NLCA data and patient experience questionnaire results. The final session aimed to identify the focus of improvement work to be undertaken by the host team. The quality improvement facilitator introduced a structured template for the quality improvement plans and provided a short introduction to using the model of improvement to guide implementation of the plans. Over the next 12 months the quality improvement facilitator provided support via electronic mail telephone and follow-up visits where required. Teams within the intervention group supported each other via mini-collaboratives in the form of web-based teleconferences and two face-to-face workshops. Outcomes Changes in process and outcome were assessed using data from local quality-improving plans and the following indicators from the NLCA: the proportion of patients discussed at a multidisciplinary team meeting histological confirmation rate active treatment rate surgical resection rate the proportion of patients with small-cell lung cancer receiving chemotherapy and the proportion of patients seen by a lung cancer nurse specialist. Patient experience was assessed in the intervention group using a new lung cancer-specific patient experience questionnaire designed in collaboration with the Roy Castle Lung Cancer Foundation. The questionnaire included 11 questions selected with permission from the previously validated 2004 national cancer patient survey. The questions covered the following domains: communication privacy respect and dignity and three free text questions (see Appendix I). Participating teams were asked to distribute 30 questionnaires to patients recently seen in their services. The clinical nurse specialists distributed the questionnaires to patients who anonymously returned them to the Royal College of Physicians. An independent qualitative ethnographic evaluation of the study was undertaken by the Social Science Applied to Healthcare Improvement Research Group at the University of Leicester. Statistical methods Data were tested for normality using the Shapiro“Wilk test. Baseline NLCA indicators were taken from the 2009 NLCA report and the intervention control and non-participant groups were compared using a ?2- test. The changes in NLCA indicators from 2009 to 2011 were compared using an independent t-test. Patient experience questionnaire responses for each question were labelled and re-coded to separate them into the worst patient experience category (score 1) vs all other responses (score 0). These scores were then summated to create a domain and a total patient experience score with a possible range of 0“11 whereby a higher score indicates a worse patient experience. Analyses were performed using the statistical software package SPSS (International Business Machines Corp. Armonk NY USA). Funding and ethics The study was funded by a ˜Closing the Gap' grant from the Health Foundation. The National Research Ethics Service confirmed that the study was service evaluation and quality improvement and did not require ethical review. Results One hundred trusts (66%) replied to the invitation to participate and 91 (61%) agreed to participate in the study. Eighty-one trusts had 2008 NLCA data of sufficient quality to allow pairing. Two trusts provided a joint multidisciplinary team allowing 40 pairs of multidisciplinary teams to be created. One pair agreed to act as a pilot and was excluded from further analysis. Of the remaining 39 pairs 15 pairs (31 trusts) were randomised to the intervention group. The remaining 24 pairs formed the control group. During the study two trusts in the control group amalgamated to form one trust so the total number of trusts in the control group was 47 (Figure 2). Quality improvement plans Two hundred and thirty medical professionals from 31 trusts participated in the review visits. Twenty-nine teams submitted a total of 67 quality improvement plans. The issues identified in the quality improvement plans are shown in Table 1. Eighteen teams collected local data to measure impact. An example of such data is shown in Figure 3. This trust identified small-cell lung cancer chemotherapy as an area for improvement. They introduced a number of changes to their diagnostic and treatment pathways including prioritisation of small-cell pathology reporting faxing of the results to the multidisciplinary team coordinator and lung nurse specialist to allow early booking of oncology appointments. These changes were monitored using a run chart that demonstrated a reduction in the time from multidisciplinary team meeting to chemotherapy treatment and an increase in the proportion of small-cell lung cancer patients receiving chemotherapy from 60% in 2009 to 71% in 2011. National lung cancer audit indicators Baseline (2009) NLCA indicators for the intervention control and non-participant groups were similar (Table 2). The mean change for each NLCA indicator from baseline to 2011 in the intervention and control group is shown in Figure 4. The proportion of patients receiving active anti-cancer treatment in the intervention group increased by 5.2% compared with 1.2% in the controls (mean difference 4.1% 95% CI ?0.1 to 8.2% P=0.055). The remaining NLCA indicators improved similarly both in the intervention and control groups. Patient experience In the intervention group patient experience questionnaires were returned by 438 patients from 30 multidisciplinary teams at baseline (return rate 49%) and 372 patients from 27 trusts following the intervention (return rate 41%). Baseline total scores were low (0“1.31) indicating high levels of patient satisfaction with the care received although there was a statistically significant (P<0.001) variation in results by the multidisciplinary team (Figure 5). In particular the proportion of patients responding yes to the question ˜did you find that the person who told you about your diagnosis did so with sufficient sensitivity/care?' varied significantly by 57%“100% (P<0.001). The total questionnaire scores did not change significantly during the study (0.22“0.17 P=0.377) however the variation by the multidisciplinary team reduced (Figure 5). Given that the study aimed to bring the standard of the lower performing trusts to that of the best we performed a post hoc analysis for the five trusts with the worst baseline patient experience scores. This demonstrated that the mean total score improved significantly for these trusts from 0.86 to 0.22 P<0.001. The biggest improvement in this group was seen in the proportion of patients responding yes to the question ˜did you find that the person who told you about your diagnosis did so with sufficient sensitivity/care?' which increased from 75% to 90% (P=0.05). One multidisciplinary team in this group achieved this improvement by using their baseline questionnaire results as a lever to encourage attendance at an advanced communications skills course. "
Lung_Cancer
"In the liver lymphatic vessels run parallel to the interlobular vessels and bile duct. Lymphatic vessels can be classified as deep or superficial lymphatic collecting ducts. Superficial lymphatic collecting ducts are often found in the connective tissues of the liver capsule and the lymph is transferred into the parasternal paracardial and abdominal lymph nodes. The deep lymphatic collecting ducts connect to one another to form upstream and downstream trunks which transport lymph into the phrenic lymph nodes around the terminal segment of the inferior vena cava and hepatic and left gastric lymph nodes. Thus lymphatic metastasis of liver carcinoma may be found in the hepatic hilar upper abdominal and retroperitoneal lymph nodes because of the parallel distribution between lymphatic vessels and major abdominal blood vessels. In addition skip metastasis may be found in several groups of lymph nodes. Overall PLC is rare in liver carcinoma. To date to the best of our knowledge PLC has not been identified in patients who have undergone liver transplantation due to liver carcinoma. PLC patients usually develop progressive dyspnea cough weight loss fatigue and other symptoms accompanied by hypoxemia restrictive ventilatory dysfunction and diffusion dysfunction [5]. The history of cancer or surgery and characteristic features identified on lung CT scans can be used to diagnose PLC after exclusion of interstitial pneumonia pulmonary fibrosis sarcoidosis pulmonary embolism heart failure and hematogenous disseminated pulmonary tuberculosis. Biopsy and subsequent pathologic examination are not required for the diagnosis of PLC [69]. In the early stages lung CT shows interstitial lesions linear and reticular shadows and interlobar fissure thickening. Approximately one-third of PLC patients present with pleural effusion (unilateral or bilateral). Once patients develop dyspnea other findings may be present including irregular thickening of the tracheal vascular bundles and interlobular septa as well as multiple beaded small nodules of varying sizes (usually smaller than 3 mm in diameter) distributed along the interlobular septa and pleura. In our present case report the patient was suspected to have interstitial pneumonia due to Pneumocystis carinii after transplantation. Thus management was geared toward removing the edema and treating the pulmonary infection (SMZ and caspofungin); however the response to treatment was poor. On the basis of examination of cancer cells in the pleural effusion and the PET-CT scan PLC was subsequently diagnosed. The positive rate of cancer cells in pleural effusion is 40% to 50%. This diagnostic accuracy rate may increase if the sediment from the pleural effusion is used for examination after being kept for 24 hours. Although biopsy via bronchoscopy pleurocentesis lung puncture or thoracoscopy and subsequent pathologic examination may confirm the diagnosis of PLC biopsy increases the risk of pneumothorax. Sputum collection is relatively easy but examination of exfoliated cells in the sputum is associated with a low positive rate [3]. Lung CT and PET-CT findings and cytology from the pleural effusion can confirm the diagnosis of PLC. Although a false-negative diagnosis of primary liver carcinoma is possible with the use of PET-CT (40% to 50%) PET-CT has favorable sensitivity in the detection of extrahepatic metastasis of liver carcinoma. Acikgoz et al. [10] reported that the detection rate of extrahepatic metastatic foci ?1 cm in diameter was as high as 92.9% in liver carcinoma patients after liver transplantation. There is evidence that the specificity of PET-CT for PLC is 100% and that the sensitivity is 86%. The mean SUV in the region of PLC (1.37?±?0.64) was significantly greater than that in the normal lung (0.5?±?0.29) (P?<?0.0001) [11]. Thus combined examinations have an elevated detection rate compared to a single examination. Examinations selected according to the disease condition may significantly increase the detection rate. To date no effective strategies have been developed for the treatment of PLC. Currently antitumor therapy and antispasmodic therapy of the airway with theophylline or ?2-adrenergic receptor agonists are used. However these treatments usually have poor efficacy and PLC is associated with a poor prognosis. Patients usually develop progressive dyspnea and die as a result of respiratory failure and/or heart failure. Approximately 50% to 85% of PLC patients have a survival time between 3 and 6 months [1213]. In our patient PLC progressed rapidly because of immunosuppression after liver transplantation. Although immunosuppressive therapy was discontinued promptly the severity of the patient™s symptoms increased rapidly and he died as a result of respiratory failure within 1 month. In 1975 Kane et al. [14] reported the autopsy findings from 7524 patients with solid cancers that originated from the prostate breast stomach pancreas and liver. Involvement of the pulmonary lymphatic system by cancer cells was noted in 1085 patients (only 1% of these patients died as a result of respiratory failure). Although PLC is rarely reported in liver carcinoma the incidence of liver carcinoma“induced PLC might be far higher than previously reported. In addition liver carcinoma is highly malignant and progresses rapidly."
Lung_Cancer
"We retrospectively reviewed 91 patients with stage III NSCLC treated with definitive chemoradiation. All patients underwent a pretreatment diagnostic contrast enhanced CT (CE-CT) followed by a 4D-CT for treatment simulation. We used the average (average-CT) and expiratory (T50-CT) images from the 4D-CT along with the CE-CT for texture extraction. Histogram gradient co-occurrence gray-tone difference and filtration-based techniques were used for texture feature extraction. Penalized Cox regression implementing cross-validation was used for covariate selection and modeling. Models incorporating texture features from the 3 image types and CPFs were compared to models incorporating CPFs alone for overall survival (OS) local-regional control (LRC) and freedom from distant metastases (FFDM). Predictive Kaplan-Meier curves were generated using leave-one-out cross-validation. Patients were stratified based on their predicted outcome being above/below the median. Reproducibility of texture features was evaluated using test-retest scans from independent patients and quantified using concordance correlation coefficients (CCC). We compared models incorporating the reproducibility seen on test-retest scans to our original models and determined the classification reproducibility. Results Models incorporating both texture features and CPFs demonstrated a significant improvement in risk stratification compared to models using CPFs alone for OS (p=0.046) LRC (p=0.01) and FFDM (p=0.005). The average CCC was 0.890.91 and 0.67 for texture features extracted from the average-CT T50-CT and CE-CT respectively. Incorporating reproducibility within our models yielded 80.4 (SD=3.7) 78.3 (SD=4.0) and 78.8 (SD=3.9) percent classification reproducibility in terms of OS LRC and FFDM respectively. Conclusions Pretreatment tumor texture may provide prognostic information beyond what is obtained from CPFs. Models incorporating feature reproducibility achieved classification rates of ~80%. External validation would be required to establish texture as a prognostic factor. Br J Radiol Br J Radiol bjr The British Journal of Radiology 0007-1285 1748-880X The British Institute of Radiology. 25051977 4148827 14276 10.1259/bjr.20140276 Full Paper Cardiac/Chest Meta-analysis of CT-guided transthoracic needle biopsy for the evaluation of the ground-glass opacity pulmonary lesions J Yang et al Meta-analysis of CT-guided biopsy the GGO lesions Yang J-S MD 1 Liu Y-M MD 2 Mao Y-M MD 1 Yuan J-H MD 1 Yu W-Q MD 1 Cheng R-D MD 3 Hu T-Y MD 1 Cheng J-M MD 4 Wang H-y MD 5 1 Department of Radiology Zhejiang Provincial People's Hospital Hangzhou Zhejiang China 2 Department of Nephrology Zhejiang Provincial People's Hospital Hangzhou Zhejiang China 3 Department of Rehabilitation Medicine Zhejiang Provincial People's Hospital Hangzhou Zhejiang China 4 Department of Radiology Second Affiliated Hospital of Wenzhou Medical University Wenzhou Zhejiang China 5 Department of Sonography Hangzhou First People's Hospital Hangzhou Zhejiang China Address correspondence to: Mr Tingyang Hu. E-mail: hutingyangzj126.com 10 2014 October 2014 28 8 2014 87 1042 20140276 8 4 2014 Received on April 8 2014 3 7 2014 Revised on July 3 2014 21 7 2014 Accepted on July 21 2014 2014 The Authors. Published by the British Institute of Radiology 2014 The British Institute of Radiology Objective: This meta-analysis is to determine the overall diagnostic yield of CT-guided transthoracic needle biopsy (TNB) of ground-glass opacity (GGO) lesions. Methods: A PubMed search was performed using œground-glass opacity crossed with œcore biopsy and œneedle biopsy. Test performance characteristics with the use of forest plots summary receiver operating characteristic curves and bivariate random effects models were summarized. Adverse events if reported were recorded. Results: Our search identified 52 citations of which 6 diagnostic studies evaluated 341 patients. Pooled specificity estimates were 0.94 [95% confidence interval (CI) 0.84“0.98] and sensitivity estimates were 0.92 (95% CI 0.88“0.95) respectively. The positive likelihood ratio was 11.27 (95% CI 4.2“30.6) the negative likelihood ratio was 0.1 (95% CI 0.06“0.19) the diagnostic odds ratio was 131.38 (95% CI 39.6“436.0) and the area under the curve was 0.97. Conclusion: Our data suggest that the CT-guided TNB is likely to be a useful tool for tissue diagnosis and may serve as an alternative for further patient management with GGO lesions. However considering the limited studies and patients included large scale studies are needed to verify these findings. Advances in knowledge: Some studies about CT-guided TNB of GGO lesions have been published most have been small single-institution case series. To our knowledge our study is the first systematic analysis about CT-guided TNB of GGO lesions. ScientificWorldJournal ScientificWorldJournal TSWJ The Scientific World Journal 1537-744X Hindawi Publishing Corporation 24592197 3921948 10.1155/2014/902748 Research Oxidative Status and Acute Phase Reactants in Patients with Environmental Asbestos Exposure and Mesothelioma Sezgi Cengizhan 1 * Taylan Mahsuk 1 Selimoglu Sen Hadice 1 Evliyao?lu Osman 2 Kaya Halide 1 Abakay Ozlem 1 Abakay Abdurrahman 1 Tanr?kulu Abdullah Cetin 1 Senyi?it Abdurrahman 1 1Department of Pulmonary Diseases School of Medicine Dicle University 21280 Diyarbakir Turkey 2Department of Biochemistry School of Medicine Dicle University 21280 Diyarbakir Turkey *Cengizhan Sezgi: cengizhansezgigmail.com Academic Editors: E. Hopper-Be N. Sunaga and J. Thrasher 2014 23 1 2014 2014 902748 28 8 2013 19 11 2013 Copyright 2014 Cengizhan Sezgi et al. 2014 This is an open access distributed under the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. Background and Objectives. The aim of this study was to investigate inflammatory indicators and oxidative status in patients with asbestos exposure with and without mesothelioma and to compare results with data from healthy subjects. Methods. Eighty people with exposure to environmental asbestos and without any disease 46 mesothelioma patients and a control group of 50 people without exposure to environmental asbestos were enrolled in this prospective study. Serum total oxidant level (TOL) total antioxidant capacity (TAC) and oxidative stress index (OSI) CRP transferrin ceruloplasmin ?-1 antitrypsin ferritin and copper levels were measured. Results. Mesothelioma group exhibited higher TOL OSI ?1-antitrypsin ferritin and copper levels as compared to the other groups (P < 0.001 P = 0.007 P < 0.0001 P < 0.001 and P < 0.001 resp.). Transferrin was lower in the mesothelioma group than in the other two groups (P < 0.001). The asbestos group had higher TOL TAC ?1-antitrypsin and transferrin levels (P < 0.001 P < 0.001 P < 0.001 and P < 0.001 resp.) as well as lower OSI and ferritin levels as compared to the control group (P < 0.001 and P < 0.001). Conclusions. We believe that elevated acute phase reactants and oxidative stress markers (TOL and OSI) in the mesothelioma group can be used as predictive markers for the development of asbestos-related malignancy. 1. Introduction Asbestos causes pulmonary fibrosis pleural diseases and malignancies. However the pathogenesis of asbestos-related diseases has not been clearly shown [1]. Recent studies indicate that increased production of reactive oxygen species (ROS) caused by asbestos plays an important role in this pathogenesis [2]. Oxidative stress occurs as a result of the failure to neutralize ROS with enzymatic and nonenzymatic systems [3]. Elevated levels of ROS lead to cell damage through peroxidation of double-chain fatty acids protein and DNA [4]. Moreover ROS have been shown to cause apoptosis inflammation and proliferation [5]. Previous studies have shown that exposure to asbestos leads to oxidative stress by revealing reduced levels of antioxidant enzymes such as superoxide dismutase catalase glutathione peroxidase and heme oxygenase [2 6]. However individual values of these enzymes may not correctly reflect total oxidant or total antioxidant status. Erel developed a new automated and colorimetric measurement method for total oxidant level (TOL) and total antioxidant capacity (TAC) while the ratio of these two parameters (TOL/TAC) is used for the calculation of oxidative stree index (OSI) which in turn allows the assessment of balance between ROS and antioxidant systems [7]. To our knowledge there is not any study evaluating oxidative stress in malignant mesothelioma (MM) and asbestos exposure in such detail in the literature. Chronic inflammation induced by different biologic and chemical factors has been shown to be a significant predisposing factor in the development of various an cancers [8]. For example chronic inflammatory bowel disease is a predisposing factor of colon cancer chronic B and C hepatitis are predisposing factors of hepatocellular carcinoma and chronic gastritis induced by Helicobacter pylori is a predisposing factor of gastric cancer [9“11]. Similarly there are studies investigating the link between chronic inflammation associated with long-term asbestos exposure and mesothelioma [12 13]. Authors claim that chronic inflammation triggered by asbestos exposure leads to increased production of ROS from inflammatory cells or alteration of immunocompetent cells and later reduction of tumor immunity [14 15]. "
Lung_Cancer
"Here we report a case of solitary lung metastasis of eyelid sebaceous carcinoma and discuss the clinical implication of surgery for a solitary pulmonary metastasis from sebaceous carcinoma. Case presentation A 77-year-old woman underwent left upper lid resection in April 2006 for sebaceous carcinoma of the eyelid. The surgical margin was negative for cancer cells. In January 2008 she had developed a recurrence in the left upper eyelid and underwent radiotherapy with a total dose of 57.6 Gy of proton beam therapy followed by orbital exenteration of the left eye [1112]. In July 2012 positron emission tomography“computed tomography (PET-CT) revealed a solitary pulmonary nodule 0.5 cm in size in the right upper lobe of the patient™s lung which had increased to 1.1 cm by September 2013 (A). PET-CT revealed a focus of increased uptake in that nodule with a standardized uptake value of 3.7 (B). There was no evidence of other metastatic disease on PET-CT scans. In September 2013 the patient underwent video-assisted thoracoscopic wedge resection of the pulmonary nodule. Frozen sections using oil red O stain revealed accentuation of lipid and presences of foamy cytoplasm in tumor cells which was positive for lipid staining (). Permanent histology demonstrated tumor cells with foamy cytoplasm and atypical nuclei accompanying numerous lipid globules within the cytoplasm () consistent with metastasis of eyelid sebaceous carcinoma. At the last follow-up 7 months after resection there was no loco-regional recurrence or distant metastasis of the tumor after surgery. Computed tomography (CT) and positron emission tomography of the tumors. (A) Chest CT showed a 1.1 cm nodule in the anterior segment of the right upper lobe (arrow). (B) PET-CT showed fluorodeoxyglucose accumulation with a Standardized uptake value (SUV) of 3.7 (arrowhead). Accentuation of lipid by staining. The lipid globules have a red color (frozen sections oil red O magnification?—?100). Sebaceous carcinoma cells. Foamy and frothy cytoplasm and atypical nuclei occurred with numerous lipid globules within the cytoplasm of the tumors cells seen as clear spaces (hematoxylin and eosin magnification?—?100). Discussion Sebaceous carcinoma of the eyelid refers to a group of carcinomas derived from sebaceous gland cells that occur in the ocular adnexa. It can be invasive in the eyelid and conjunctiva and can metastasize to regional lymph nodes and distant ans [81314]. Treatment strategies for primary eyelid sebaceous carcinoma are surgery radiotherapy and chemotherapy [15-17]. Distant hematogenous metastases to the lung liver and brain have a mortality rate as high as 30% [1618]. However few reports demonstrated the surgical treatment of metastatic eyelid sebaceous carcinoma. Standard treatment strategy for pulmonary metastatic sebaceous carcinoma has not yet been established because of the limited number of cases. Chemotherapy regimens in existing reports are largely based on the combination regimens commonly used in the treatment of other forms of poorly differentiated carcinomas of the head and neck region [1920]. Husain et al. reported combined chemotherapy of carboplatin and docetaxel for the patient who had multiple lung and lymph node metastases which resulted in a 30% decrease in tumor size but the efficacy of this regimen for sebaceous carcinoma has not yet been fully evaluated [21]. Radiotherapy for primary eyelid sebaceous carcinoma was described in several reports; however there have been no reports describing radiotherapy for pulmonary metastatic eyelid sebaceous carcinoma [2223]. Resection of pulmonary metastases in patients with sebaceous carcinoma is controversial. However our case suggests that a surgical approach to lung metastasis of eyelid sebaceous carcinoma could prolong survival in certain subgroups of patients namely those with a limited number of metastatic nodules or a significant disease-free interval. The possibility of metastasis from eyelid sebaceous carcinoma or primary lung cancer cannot be predicted only on the basis of radiologic findings or disease-free interval. In the present case we could successfully differentiate solitary lung metastasis of eyelid sebaceous carcinoma from primary lung cancer using oil red O stain which stains lipid has a red color on frozen sections. Conclusion We report a rare case of solitary lung metastasis of eyelid sebaceous carcinoma which was successfully resected and differentiated from primary lung cancer using oil red O stain on frozen sections. Pulmonary resection is a good option for the treatment and diagnosis of metastatic eyelid sebaceous carcinoma. Consent Written informed consent was obtained from the patient for the publication of this case presentation and accompanying images. A copy of the written consent is available for the review by the Editor-in-Chief of this journal. Abbreviations CT: Computed tomography; FDG: Fluorodeoxyglucose; PET: Positron emission tomography. Competing interests The authors declare that they have no competing interests. Authors™ contributions KK and TO wrote the manuscript. KK TO KA and IK performed surgery. YH and KE carried out the pathological examination. MK and TG were involved in the final editing. All authors approved the final manuscript. Cook BE Jr Bartley GB Cook BE Jr Bartley GB Treatment options and future prospects for the management of eyelid malignancies: an evidence-based update Ophthalmology 2001 108 2088 2209 quiz 2099“2100 2121 10.1016/S0161-6420(01)00796-5 11713084 Lai TF Huilgol SC Selva D James CL Eyelid sebaceous carcinoma masquerading as in situ squamous cell carcinoma Dermatol Surg 2004 30 222 225 10.1111/j.1524-4725.2004.30069.x 14756656 Leibovitch I Selva D Huilgol S Davis G Dodd T James CL Intraepithelial sebaceous carcinoma of the eyelid misdiagnosed as Bowen™s disease J Cutan Pathol 2006 33 303 308 10.1111/j.0303-6987.2006.00423.x 16630181 Pereira PR Odashiro AN Rodrigues-Reyes AA Correa ZM de Souza Filho JP Burnier MN Jr Histopathological review of sebaceous carcinoma of the eyelid J Cutan Pathol 2005 32 496 501 10.1111/j.0303-6987.2005.00371.x 16008694 Sinard JH Immunohistochemical distinction of ocular sebaceous carcinoma from basal cell and squamous cell carcinoma Arch Ophthalmol 1999 117 776 783 10.1001/archopht.117.6.776 10369589 Chao AN Shields CL Krema H Shields JA Outcome of patients with periocular sebaceous gland carcinoma with and without conjunctival intraepithelial invasion Ophthalmology 2001 108 1877 1883 10.1016/S0161-6420(01)00719-9 11581065 Shields JA Demirci H Marr BP Eagle RC Jr Shields CL Sebaceous carcinoma of the eyelids: personal experience with 60 cases Ophthalmology 2004 111 2151 2157 10.1016/j.ophtha.2004.07.031 15582067 Shields JA Demirci H Marr BP Eagle RC Jr Shields CL Sebaceous carcinoma of the ocular region: a review Surv Ophthalmol 2005 50 103 122 10.1016/j.survophthal.2004.12.008 15749305 Yen MT Tse DT Wu X Wolfson AH Radiation therapy for local control of eyelid sebaceous cell carcinoma: report of two cases and review of the literature Ophthal Plast Reconstr Surg 2000 16 211 215 10.1097/00002341-200005000-00008 10826762 Wang JK Liao SL Jou JR Lai PC Kao SC Hou PK Chen MS Malignant eyelid tumours in Taiwan Eye (Lond) 2003 17 216 220 10.1038/sj.eye.6700231 12640409 Zenda S Kawashima M Nishio T Kohno R Nihei K Onozawa M Arahira S Ogino T Proton beam therapy as a nonsurgical approach to mucosal melanoma of the head and neck: a pilot study Int J Radiat Oncol Biol Phys 2011 81 135 139 10.1016/j.ijrobp.2010.04.071 20950948 Zenda S Kohno R Kawashima M Arahira S Nishio T Tahara M Hayashi R Kishimoto S Ogino T Proton beam therapy for unresectable malignancies of the nasal cavity and paranasal sinuses Int J Radiat Oncol Biol Phys 2011 81 1473 1478 10.1016/j.ijrobp.2010.08.009 20961697 Ginsberg J Present Status of Meibomian gland carcinoma Arch Ophthalmol 1965 73 271 277 10.1001/archopht.1965.00970030273022 14237799 Rao NA Hidayat AA McLean IW Zimmerman LE Sebaceous carcinomas of the ocular adnexa: a clinicopathologic study of 104 cases with five-year follow-up data Hum Pathol 1982 13 113 122 10.1016/S0046-8177(82)80115-9 7076199 Gardetto A Rainer C Ensinger C Baldissera I Piza-Katzer H Sebaceous carcinoma of the eyelid: a rarity worth considering Br J Ophthalmol 2002 86 243 244 10.1136/bjo.86.2.243 11815355 Kass LG Hornblass A Sebaceous carcinoma of the ocular adnexa Surv Ophthalmol 1989 33 477 490 10.1016/0039-6257(89)90049-0 2658172 Lan MC Lan MY Lin CZ Ho DM Ho CY Sebaceous carcinoma of the eyelid with neck metastasis Otolaryngol Head Neck Surg 2007 136 670 671 10.1016/j.otohns.2006.08.019 17418274 Boniuk M Zimmerman LE Sebaceous carcinoma of the eyelid eyebrow caruncle and orbit Trans Am Acad Ophthalmol Otolaryngol 1968 72 619 642 5706692 Midena E Angeli CD Valenti M de Belvis V Boccato P Treatment of conjunctival squamous cell carcinoma with topical 5-fluorouracil Br J Ophthalmol 2000 84 268 272 10.1136/bjo.84.3.268 10684836 Yeatts RP Engelbrecht NE Curry CD Ford JG Walter KA 5-Fluorouracil for the treatment of intraepithelial neoplasia of the conjunctiva and cornea Ophthalmology 2000 107 2190 2195 10.1016/S0161-6420(00)00389-4 11097594 Husain A Blumenschein G Esmaeli B Treatment and outcomes for metastatic sebaceous cell carcinoma of the eyelid Int J Dermatol 2008 47 276 279 10.1111/j.1365-4632.2008.03496.x 18289332 Hata M Koike I Omura M Maegawa J Ogino I Inoue T Noninvasive and curative radiation therapy for sebaceous carcinoma of the eyelid Int J Radiat Oncol Biol Phys 2012 82 605 611 10.1016/j.ijrobp.2010.12.006 21300468 Howrey RP Lipham WJ Schultz WH Buckley EG Dutton JJ Klintworth GK Rosoff PM Sebaceous gland carcinoma: a subtle second malignancy following radiation therapy in patients with bilateral retinoblastoma Cancer 1998 83 767 771 10.1002/(SICI)1097-0142(19980815)83:4<767::AID-CNCR20>3.0.CO;2-P 9708943 101274235 33311 J Thorac Oncol J Thorac Oncol Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer 1556-0864 1556-1380 24736085 4271824 10.1097/JTO.0000000000000082 NIHMS648380 Article A Randomized Placebo-Controlled Multicenter Biomarker-Selected Phase 2 Study of Apricoxib in Combination with Erlotinib in Patients with Advanced Non“Small-Cell Lung Cancer Gitlitz Barbara J. MD * Bernstein Eric MD   Santos Edgardo S. MD ¡ Otterson Greg A. MD § Milne Ginger PhD ? Syto Mary MS ¶ Burrows Francis PhD ¶ Zaknoen Sara MD ¶ *University of Southern California Keck School of Medicine Norris Comprehensive Cancer Center Los Angeles California  Providence Cancer Center Portland Oregon ¡University of Miami Sylvester Comprehensive Cancer Center Miami Florida §Ohio State University Columbus Ohio ?Vanderbilt University Nashville Tennessee ¶Tragara Pharmaceuticals San Diego California Address for correspondence: Barbara Gitlitz MD University of Southern California Keck School of Medicine Norris Comprehensive Cancer Center 1441 Eastlake Avenue Suite 3400 Los Angeles CA 90089. [email protected] 13 12 2014 4 2014 19 12 2014 9 4 577 582 Copyright © 2013 by the International Association for the Study of Lung Cancer 2013 Cyclooxygenase-2 (COX-2) overexpression is associated with a poor prognosis in non“small-cell lung cancer (NSCLC) and may promote resistance to epidermal growth factor receptor inhibitors. This randomized phase 2 trial evaluated apricoxib a novel COX-2 inhibitor in combination with erlotinib in biomarker-selected patients. Patients with stage IIIB/IV NSCLC previously treated with platinum-based chemotherapy were randomized (2:1) to 400 mg/day apricoxib plus 150 mg/day erlotinib (AP/E) or placebo plus erlotinib (P/E) in 21-day cycles until disease progression or unacceptable toxicity. The primary endpoint was time to progression (TTP). A decrease of 50% or more from baseline urinary prostaglandin E2 metabolite after a 5-day open-label run-in period was used to select eligible patients. One hundred twenty patients (median age 64 years) were randomized (78 to AP/E and 42 to P/E). Overall median TTP was 1.8 months in the AP/E group and 2.1 months in the P/E group with a 12% objective response rate in both groups (intent-to-treat analysis). A subgroup analysis in patients aged 65 years or younger demonstrated a statistically significant TTP benefit for AP/E (hazard ratio 0.5 [95% confidence interval: not applicable“0.9]; p=0.018) and overall survival advantage at minimum 1-year follow-up (median 12.2 versus 4.0 months; hazard ratio=0.5; p=0.021). The most common adverse events were rash diarrhea fatigue and nausea. Toxicity contributed to early discontinuations in patients aged more than 65 years treated with AP/E. This is the first randomized placebo-controlled study of a COX-2 inhibitor in NSCLC to use a prospective patient-selection strategy. Although AP/E seemed to improve TTP and overall survival in a subset of patients aged 65 years or younger the primary endpoint of the trial was not met. Non“small-cell lung cancer Apricoxib Erlotinib Cyclooxygenase-2 inhibitor Prostaglandin E2 metabolite 0413066 2830 Cell Cell Cell 0092-8674 1097-4172 24630729 4040459 10.1016/j.cell.2014.02.031 NIHMS573682 Article Genetic and Clonal Dissection of Murine Small Cell Lung Carcinoma Progression by Genome Sequencing McFadden David G. 1 5 Papagiannakopoulos Thales 1 5 Taylor-Weiner Amaro 3 5 Stewart Chip 3 5 Carter Scott L. 3 5 Cibulskis Kristian 3 Bhutkar Arjun 1 McKenna Aaron 3 Dooley Alison 1 Vernon Amanda 1 Sougnez Carrie 3 Malstrom Scott 1 Heimann Megan 1 Park Jennifer 1 Chen Frances 1 Farago Anna F. 1 Dayton Talya 1 Shefler Erica 3 Gabriel Stacey 3 Getz Gad 3 4 * Jacks Tyler 1 2 * 1Koch Institute for Integrative Cancer Research and Department of Biology Massachusetts Institute of Technology Cambridge MA 02142 USA 2Howard Hughes Medical Institute Massachusetts Institute of Technology Cambridge MA 02142 USA 3Cancer Program Broad Institute of MIT and Harvard Cambridge MA 02142 USA 4Cancer Center and Department of Pathology Massachusetts General Hospital Boston MA 02114 USA *Correspondence: gadgetz@broadinstitute. (G.G.) [email protected] (T.J.) 5 Co-first author 6 5 2014 13 3 2014 13 3 2015 156 6 1298 1311 ©2014 Elsevier Inc. 2014 Summary Small cell lung carcinoma (SCLC) is a highly lethal smoking-associated cancer with few known targetable genetic alterations. Using genome sequencing we characterized the somatic evolution of a genetically engineered mouse model (GEMM) of SCLC initiated by loss of Trp53 and Rb1. We identified alterations in DNA copy number and complex genomic rearrangements and demonstrated a low somatic point mutation frequency in the absence of tobacco mutagens. Alterations targeting the tumor suppressor Pten occurred in the majority of murine SCLC studied and engineered Pten deletion accelerated murine SCLC and abrogated loss of Chr19 in Trp53; Rb1; Pten compound mutant tumors. Finally we found evidence for polyclonal and sequential metastatic spread of murine SCLC by comparative sequencing of families of related primary tumors and metastases. We propose a temporal model of SCLC tumorigenesis with implications for human SCLC therapeutics and the nature of cancer-genome evolution in GEMMs. J Natl Cancer Inst J. Natl. Cancer Inst jnci jnci.j JNCI Journal of the National Cancer Institute 0027-8874 1460-2105 Oxford University Press US 24317180 3906987 10.1093/jnci/djt338 Brief Communication Novel Germline Mutation in the Transmembrane Domain of HER2 in Familial Lung Adenocarcinomas Yamamoto Hiromasa Higasa Koichiro Sakaguchi Masakiyo Shien Kazuhiko Soh Junichi Ichimura Koichi Furukawa Masashi Hashida Shinsuke Tsukuda Kazunori Takigawa Nagio Matsuo Keitaro Kiura Katsuyuki Miyoshi Shinichiro Matsuda Fumihiko Toyooka Shinichi Affiliations of authors:Department of Thoracic Breast and Endocrinological Surgery (HY KS JS MF SH KT SM ST) Department of Clinical Genomic Medicine (KS ST) Department of Cell Biology (MS) Department of Pathology (KI) and Department of Hematology Oncology and Respiratory Medicine (KK) Okayama University Graduate School of Medicine Dentistry and Pharmaceutical Sciences Okayama Japan; Center for Genomic Medicine Kyoto University School of Medicine Kyoto Japan (KH FM); Department of General Internal Medicine 4 Kawasaki Medical School Okayama Japan (NT); Department of Preventive Medicine Kyushu University Faculty of Medical Sciences Fukuoka Japan (KM). Correspondence to: Shinichi Toyooka MD PhD Okayama University Graduate School of Medicine Dentistry and Pharmaceutical Sciences Clinical Genomic Medicine/Thoracic Breast and Endocrinological Surgery 2-5-1 Shikata-cho Kita-ku Okayama Okayama 700“8558 Japan (e-mail: [email protected]). 1 2014 7 12 2013 7 12 2013 106 1 djt338 7 7 2013 14 10 2013 16 10 2013 © The Author 2013. Published by Oxford University Press. 2013 This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs licence (http://creativecommons./licenses/by-nc-nd/3.0/) which permits non-commercial reproduction and distribution of the work in any medium provided the original work is not altered or transformed in any way and that the work is properly cited. For commercial re-use please contact [email protected] We encountered a family of Japanese descent in which multiple members developed lung cancer. Using whole-exome sequencing we identified a novel germline mutation in the transmembrane domain of the human epidermal growth factor receptor 2 (HER2) gene (G660D). A novel somatic mutation (V659E) was also detected in the transmembrane domain of HER2 in one of 253 sporadic lung adenocarcinomas. Because the transmembrane domain of HER2 is considered to be responsible for the dimerization and subsequent activation of the HER family and downstream signaling pathways we performed functional analyses of these HER2 mutants. Mutant HER2 G660D and V659E proteins were more stable than wild-type protein. Both the G660D and V659E mutants activated Akt. In addition they activated p38 which is thought to promote cell proliferation in lung adenocarcinoma. Our findings strongly suggest that mutations in the transmembrane domain of HER2 may be oncogenic causing hereditary and sporadic lung adenocarcinomas. Familial lung cancers are rare among human malignancies. Recent studies have reported that germline mutations in the epidermal growth factor receptor (EGFR) gene predispose the development of lung cancer. Reported familial lung adenocarcinomas with a germline EGFR mutation such as T790M carry secondary somatic EGFR mutations including exon 19 deletion and exon 21 L858R mutation (1“4). We encountered a family of Japanese descent in which multiple members developed lung cancer (). The proband (III-4) was a 53-year-old woman with multiple lung adenocarcinomas in bilateral lungs. She was a light smoker with a 1.2-pack-year history of smoking. She had undergone a left lower lobectomy for multiple lung adenocarcinomas at the age of 44 years. Her mother (II-4) a never smoker also had multiple lung adenocarcinomas. Partial pulmonary resections of two tumors were performed for II-4 for the purpose of diagnosis after pleural dissemination was found during surgery and multiple lesions were removed in a lobectomy or partial resections in III-4. A histological examination of the resected tumors in II-4 revealed nonmucinous adenocarcinoma in situ and nonmucinous minimally invasive adenocarcinoma whereas the histological findings of pleural dissemination indicated mucus-containing adenocarcinoma. Those of III-4 contained various subtypes of adenocarcinoma including nonmucinous and mucinous adenocarcinoma in situ and invasive mucinous adenocarcinoma. In addition normal-appearing lung parenchyma obtained from a lobectomy in III-4 revealed innumerable small preinvasive lesions implying the presence of precancerous changes throughout the lung (Supplementary available online). Sequencing analyses of EGFR exons 18 to 21 and KRAS as well as an immunohistochemical staining for ALK protein in the resected tumors indicated no genetic alterations in these genes. The pedigree chart suggested that lung cancer was inherited in an autosomal dominant manner. . Pedigree chart of a Japanese family in which multiple members developed lung cancer. The boxes and circles indicate men and women respectively. The numbers at the bottom of each member indicate the age at the time of death or the time of the analysis. An oblique line shows deceased family members. The proband (III-4) had multiple lung adenocarcinomas (arrow). Tumor tissue nonmalignant lung tissue and peripheral blood samples were obtained from III-4. The proband™s mother (II-4) also had multiple lung adenocarcinomas and tumor and nonmalignant lung tissue samples were available. "
Lung_Cancer
"In current study a semi-Markov model along with two-parametric Weibull and Log-logistic distribution were used for measuring the time-dependency transition probabilities and calculating the direct medical costs LYGs and QALYs gained of the practice presented in the trial [15]. A cost-effectiveness evaluation was performed to analysis the economic impact of maintenance gefitinib therapy for patients with locally advanced/metastatic NSCLC with unknown EGFR mutations. Base case analyses of 1- 3- 6- and 10-year time horizon showed an unfavorable ICER of $184829 $19214 $19328 and $21308 per QALY gained respectively. OSA and PSA all revealed that the model we applied was robust to the results. Monte Carlo simulations of 1000 cases suggested that all ICERs for maintenance gefitinib therapy were higher than the recommended WTP threshold (3—per-capita GDP) of cost-effectiveness guidelines from Word Health anization (WHO). There are 31 province-level administrative units in Chinese mainland the per-capita GDP of which differs significantly. In 2011 for example it ranged from $2495 in Guizhou province to $13392 in Tianjin city [31]. According to the recommended threshold of WHO [25] the WTP threshold of different province-level administrative units extended from $7485 (3—$2495) to $40176 (3—$13392) per QALY gained which exceeded the sensitivity range of the WTP (about $17700 to $26300) obtained from PSA of the current study. Obviously local government could take fully into account covering maintenance gefitinib treatment following first-line platinum-based chemotherapy for locally advanced/metastatic NSCLC with unknown EGFR mutations in accordance with local economic development level. Cost-effective probability for different economic level provinces displayed in could supply available information for local governments when gefitinib is approved by local governments™ finance before it has access to the directory of drugs for national basic medical insurance in China. .0088881.t004 The cost-effective probabilities of gefitinib arm for 31 provinces of Chinese mainland. Region Per-capita GDP ($) WTP (3—Per-capita GDP $) Cost-effective Probability Mainland China 5449.71 16349 0 More affluent regionsa >8767 >26300 1.00 Guangdong 7819 23457 0.932 Liaoning 7795 23385 0.926 Fujian 7344 22032 0.717 Shandong 7273 21819 0.655 Less affluent regionsb <5900 <17700 0 a Consist of Tianjin Shanghai Beijing Jiangsu Zhejiang and Inner Mongolia. b Consist of Jilin Chongqing Hubei Hebei Shanxi Ningxia Heilongjiang Shangxi Xinjiang Hunan Qinghai Henan Hainan Jiangxi Sichuan Guangxi Anhui Tibet Gansu Yuannan and Guizhou. A number of different survival models such as Weibull Exponential Log-logistic Gompertz et al can be used to perform extrapolation according to the observed trial data [32]. It is therefore very vital to choose the justifiable extrapolation approach to ensure the associated results of economic analysis confident to decision makers. In the current study after the deviance information criterion test (reported by Jackson et al [33] to alternative models introduced by Latimer [32] we chose Weibull and Log-logistic for PFS and OS respectively instead of Weibull for extrapolating both PFS and OS curves like the previous study undertaken by Zhu J et al [23]. In addition a hazard ration (HR) of PFS was applied to derive the PFS curve for the gefitinib strategy in the previous study [23]. Latimer however in the resent published paper pointed out that the HR used may cause bias because of the requirement of the assumptions“that is the HR was from a related model and was constant over time [34]. Obviously the bias should be considered especially if the HR impacts the results markedly. Unfortunately the HR of PFS was one of the two most influential parameters on the basis of one-way sensitivity analyses performed by Zhu J et al [23]. In view of the above cases independent parametric models were fitted to both control and experimental groups in our study. Utility of PFS played a great role in the results not only in the resent study [23] but also in the current study. Nafees et al [28] reviewed that all toxicities (diarrhoea rash nausea and vomiting neutropenia fatigue and hair loss) were related to pulling utility down significantly. Of the toxicities rash and diarrhoea were associated with maintenance gefitinib strategy as reported the clinical trial [15]. For higher accuracy we weighted the utility of PFS according to the risks of the rash and diarrhoea which were displayed in . In particularly one point revealed by one-way sensitivity analysis () should be highlighted that the price of gefitinib would be the most significant parameter that could reduce the ICER. With the gefitinib price reduction of 20% discount the ICER decreased to $16731 per QALY gained which is very close to the WTP threshold of $16349 per QALY. Therefore if the price of gefitinib decreases >20% maintenance gefitinib therapy after the standard chemotherapy in patients with locally advanced/metastatic NSCLC may be a cost-effectiveness strategy. There are some limitations in the present study. First using Weibull and Log-logistic distribution to extrapolate the survival curves beyond the time scope of the trial was an unavoidable limitation of this process. There is not enough survival data provided by the short follow-ups of the clinical trial to compare the long-term outcomes estimated by the model. Our results should be updated when long-term survival data are available. Another important limitation is that the utility weight parameters originated from the published literature that may not reflect Chinese patients™ trait. It is an inevitable limitation of the current analysis because utilities data are not yet available for China. Fortunately opinions from Chinese oncologists suggested that quality of life of locally advanced or metastatic NSCLC patients in China should not be of significant difference from abroad patients. Finally because there is no head-to-head clinical trial comparing maintenance gefitinib with other maintenance drugs (eg erlotinib) after the standard chemotherapy of four chemotherapeutic cycles we have not conducted a cost-effectiveness analysis of gefitinib in comparison with other maintenance therapies. Although the current estimates were derived from just one study which is also the only phase III trial compared maintenance gefitinib treatment in patients with locally advanced/metastatic NSCLC according to our literature search we believe that the analysis of our study based on a current Chinese phase III trial and the justifiable extrapolation approach can provide important reference information for decision makers in China. First of all the clinical study itself is a multicentre double-blind randomized controlled-trial (RCT) which represents the best evidence available and is deemed to be the most accepted scientific method of determining the benefit of a drug or a therapeutic procedure. Second the analysis method applied in our study was reliable and widely used in economic evaluations especially in the field of medical and health care. In addition the Log-logistic and two parameters Weibull model matched the survival curves of the clinical trial satisfactorily () which shows that the model we constructed can mirror the effectiveness data of the trial commendably. And then direct medical costs related to each strategy were estimated including maintenance gefitinib therapy treatment of major adverse events routine follow-up treatment for patients without progression follow-up treatment in PS state and terminal-phase cost. Although the costs originated from our previous study [26] the published literature [27] or estimates according to local charges based on expert opinion all of them stemmed from a Chinese health care system perspective as well as in view of patients with advanced NSCLC which echoed the purpose of the current study. Last but not least to reflect substantial uncertainty of the input parameters the sensitivity analyses (including OSA and PSA) were conducted for each key parameter and all sensitivity analyses revealed that the model we applied was robust to the results. In conclusion according to the recommended WTP threshold (3—per-capita GDP) of cost-effectiveness guidelines from WHO maintenance gefitinib therapy after the standard chemotherapy of four chemotherapeutic cycles in locally advanced/metastatic NSCLC patients with unknown EGFR mutations is likely to be not cost-effective for Chinese mainland from the Chinese health care system perspective. Local governments with different economic level however could take fully into account covering maintenance gefitinib treatment. Because for rich regions (the per-capita GDP> $8767) the new strategy seems to be a reasonable option and if the per-capita GDP ranges from $5900 to $8767 the maintenance therapy may be favourable in terms of the different cost-effective probabilities. Decreasing the price of gefitinib the most significant parameter that could reduce the ICER should be considered to as a preferential factor for meeting widely treatment demands in China. Prof. L.B. Peng and J.H. Li are the guarantors for the overall content. The authors greatly thank many clinicians and the data managers who have recorded the initial data diligently of medicines over the years. In particular they thank Ouyang Lihui Wang Siying Zhao Ziying and Qiu Zhenhua for their help in the data collection and valuable discussions and advices. References 1 JemalA BrayF (2011) Center MM Ferlay J Ward E et al (2011) Global cancer statistics. CA Cancer J Clin61: 69“9021296855 2 FathiAT BrahmerJR (2008) Chemotherapy for advanced stage non-small cell lung cancer. Semin Thorac Cardiovasc Surg20: 210“21619038730 3 GovindanR PageN MenszternD ReadW TierneyR et al (2006) Changing epidemiology of small-cell lung cancer in the United States over the last 30 years: analysis of the surveillance epidemiologic and end results database. J Clin Oncol24: 4539“454417008692 4 Nation Comprehensive Cancer Network (2013) Non“small cell lung cancer (version 2.2014). Available: http://www.nccn./professionals/physician_gls/pdf/nscl.pdf Accessed 21 January 2014. 5 AzzoliCG BakerJS TeminS PaoW AliffT et al (2009) American Society of Clinical Oncology Clinical Practice Guideline update on chemotherapy for stage IV non-small-cell lung cancer. J Clin Oncol27: 6251“626619917871 6 D™Addario G Felip E (2009) Non-small-cell lung cancer: ESMO clinical recommendations for diagnosis treatment and follow-up. Ann Oncol (Suppl 4): 68“70. 7 BareschinoMA SchettinoC RossiA MaioneP SaccoPC et al (2011) Treatment of advanced non small cell lung cancer. J Thorac Dis3: 122“13322263075 8 BrodowiczT KrzakowskiM ZwitterM TzekovaV RamlauR et al (2006) Cisplatin and gemcitabine first-line chemotherapy followed by maintenance gemcitabine or best supportive care in advanced non-small cell lung cancer: a phase III trial. Lung Cancer52: 155“16316569462 9 FidiasPM DakhilSR LyssAP LoeschDM WaterhouseDM et al (2009) Phase III study of immediate compared with delayed docetaxel after front-line therapy with gemcitabine plus carboplatin in advanced non-small-cell lung cancer. J Clin Oncol27: 591“59819075278 10 CiuleanuT BrodowiczT ZielinskiC KimJH KrzakowskiM et al (2009) Maintenance pemetrexed plus best supportive care versus placebo plus best supportive care for non-small-cell lung cancer: a randomised double-blind phase 3 study. Lancet374: 1432“144019767093 11 CappuzzoF CiuleanuT StelmakhL CicenasS Szcz©snaA et al (2010) Erlotinib as maintenance treatment in advanced non-small-cell lung cancer: a multicentre randomised placebo-controlled phase 3 study. Lancet Oncol11: 521“52920493771 12 Paz-AresL de MarinisF DediuM ThomasM PujolJL et al (2012) Maintenance therapy with pemetrexed plus best supportive care versus placebo plus best supportive care after induction therapy with pemetrexed plus cisplatin for advanced non-squamous non-small-cell lung cancer (PARAMOUNT): a double-blind phase 3 randomized controlled trial. Lancet Oncol13: 247“25522341744 13 CohenMH JohnsonJR ChattopadhyayS TangS JusticeR et al (2010) Approval summary: erlotinib maintenance therapy of advanced/metastatic non-small cell lung cancer (NSCLC). Oncologist15: 1344“135121148614 14 CohenMH CortazarP JusticeR PazdurR (2010) Approval summary: pemetrexed maintenance therapy of advanced/metastatic nonsquamous non-small cell lung cancer (NSCLC). Oncologist15: 1352“135821148615 15 ZhangL MaS SongX HanB ChengY et al (2012) Gefitinib versus placebo as maintenance therapy in patients with locally advanced or metastatic non-small-cell lung cancer (INFORM; C-TONG 0804): a multicentre double-blind randomised phase 3 trial. Lancet Oncol13: 466“47522512843 16 WalleserS RayJ BischoffH Vergnen¨greA RoseryH et al (2012) Maintenance erlotinib in advanced non-small cell lung cancer: cost-effectiveness in EGFR wild-type across Europe. Clinicoecon Outcomes Res4: 269“27523028234 17 Vergnen¨greA RayJA ChouaidC GrossiF BischoffHG et al (2012) Cross-market cost-effectiveness analysis of erlotinib as first-line maintenance treatment for patients with stable non-small cell lung cancer. Clinicoecon Outcomes Res4: 31“3722347803 18 GreenhalghJ McLeodC BagustA BolandA FleemanN et al (2010) Pemetrexed for the maintenance treatment of locally advanced or metastatic non-small cell lung cancer. Health Technol Assess14: 33“3921047489 19 KleinR WielageR MuehlenbeinC LiepaAM BabineauxS et al (2010) Cost-effectiveness of pemetrexed as first-line maintenance therapy for advanced nonsquamous non-small cell lung cancer. J Thor Oncol5: 1263“1272 20 TsuchiyaT FukudaT FuruiyeM KawabuchiK (2011) Pharmacoeconomic analysis of consolidation therapy with pemetrexed after first-line chemotherapy for non-small cell lung cancer. Lung Cancer74: 521“52921570734 21 Matter-WalstraK JoergerM K¼hnelU SzucsT PestalozziB et al (2012) Cost-Effectiveness of Maintenance Pemetrexed in Patients with Advanced Nonsquamous-Cell Lung Cancer from the Perspective of the Swiss Health Care System. Value Health15: 65“7122264973 22 ZengXH PengLB LiJH ChenGN TanCQ et al (2013) Cost-Effectiveness of Continuation Maintenance Pemetrexed after cisplatin and pemetrexed chemotherapy for Advanced Non-squamous Non-small-cell Lung Cancer: estimates from the Chinese Perspective of Health Care System. Clin Ther35: 54“6523328269 23 ZhuJ LiT WangXH YeM CaiJ et al (2013) Gene-guided Gefitinib switch maintenance therapy for patients with advanced EGFR mutation-positive Non-small cell lung cancer: an economic analysis. BMC Cancer13: 3923360224 24 China Center for Health Economic Research. China Guidelines for Pharmacoeconomic Evaluations (Version 8) [in Chinese] (2010) Available: http://www.cpa..cn/Article/UploadFiles/201011/2010112509052247.pdfAccessed 21 January 2014. 25 WHO. Cost-effectiveness thresholds. Available: http://www.who.int/choice/costs/CER_thresholds/en/ Accessed 21 January 2014. 26 ZengXH KarnonJ WangSY WuB WanXM et al (2012) The cost of treating advanced non-small cell lung cancer: estimates from the Chinese experience. PLoS ONE7: e4832323118985 27 WuB ChenH ShenJ YeM (2011) Cost-effectiveness of adding rh-endostatin to first-line chemotherapy in patients with advanced non-small-cell lung cancer in China. Clin Ther33: 1446“145521992806 28 NafeesB StaffordM GavrielS BhallaS WatkinsJ (2008) Health state utilities for non small cell lung cancer. Health Qual Life Out6: 84 29 National Cancer Institute (2013) SEER Stat Fact Sheets: Lung and Bronchus Cancer. Available: http://seer.cancer.gov/statfacts/html/lungb.html Accessed 21 January 2014. 30 LiuQ WangB KongY ChengKK (2011) China™s primary health-care reform. Lancet377: 2064“206621453962 31 National Bureau of Statistics of China (2012) China statistical yearbook 2012. Available: http://www.stats.gov.cn/english/ Accessed 21 January 2014. 32 Latimer N (2011) NICE DSU Technical Support Document 14: Undertaking survival analysis for economic evaluations alongside clinical trials“extrapolation with patient-level data. Available: http://www.nicedsu..uk Accessed 21 January 2014. 33 JacksonCH SharplesLD ThompsonSG (2010) Survival models in health economic evaluations: Balancing fit and parsimony to improve prediction. Int J Biostat6: 34 34 LatimerNR (2013) Survival analysis for economic evaluations alongside clinical trials“extrapolation with patient-level data: inconsistencies limitations and a practical guide. Med Decis Making33: 743“75423341049 0374236 2771 Cancer Cancer Cancer 0008-543X 1097-0142 24711210 4219619 10.1002/cncr.28683 NIHMS637693 Article Guideline-Concordant Cancer Care and Survival Among American Indian/Alaskan Native Patients Javid Sara H. MD 1 Varghese Thomas K. MD MS 1 Morris Arden M. MD 2 Porter Michael P. MD MS 3 He Hao PhD 1 Buchwald Dedra MD 4 Flum David R. MD MPH 1 for the Collaborative to Improve Native Cancer Outcomes (CINCO) 1Department of Surgery Surgical Outcomes Research Center School of Medicine University of Washington Seattle Washington 2Department of Surgery School of Medicine University of Michigan Ann 3Department of Urology Surgical Outcomes Research Center School of Medicine University of Washington Seattle Washington 4Division of General Internal Medicine School of Medicine University of Washington Seattle Washington Corresponding author: Sara H. Javid MD University of Washington 1959 NE Pacific Street Box 356410 Seattle WA 98195; Fax: (206) 543-8136; [email protected] 27 10 2014 07 4 2014 15 7 2014 04 11 2014 120 14 2183 2190 © 2014 American Cancer Society. 2014 BACKGROUND American Indians/Alaskan Natives (AI/ANs) have the worst 5-year cancer survival of all racial/ethnic groups in the United States. Causes for this disparity are unknown. The authors of this report examined the receipt of cancer treatment among AI/AN patients compared with white patients. METHODS This was a retrospective cohort study of 338204 patients who were diagnosed at age ?65 years with breast colon lung or prostate cancer between 1996 and 2005 in the Surveillance Epidemiology and End Results-Medicare database. Nationally accepted guidelines for surgical and adjuvant therapy and surveillance were selected as metrics of optimal guideline-concordant care. Treatment analyses compared AI/ANs with matched whites. RESULTS Across cancer types AI/ANs were less likely to receive optimal cancer treatment and were less likely to undergo surgery (P ? .025 for all cancers). Adjuvant therapy rates were significantly lower for AI/AN patients with breast cancer (P <.001) and colon cancer (P = .001). Rates of post-treatment surveillance also were lower among AI/ANs and were statistically significantly lower for AI/AN patients with breast cancer (P = .002) and prostate cancer (P <.001). Nonreceipt of optimal cancer treatment was associated with significantly worse survival across cancer types. Disease-specific survival for those who did not undergo surgery was significantly lower for patients with breast cancer (hazard ratio [HR] 0.62) colon cancer (HR 0.74) prostate cancer (HR 0.52) and lung cancer (HR 0.36). Survival rates also were significantly lower for those patients who did not receive adjuvant therapy for breast cancer (HR 0.56) colon cancer (HR 0.59) or prostate cancer (HR 0.81; all 95% confidence intervals were <1.0). "
Lung_Cancer
"We found a similar result in H1299 PAX6 KD cells (A). Another relevant cyclin regulating G1/S progression is cyclin E [17]. We also determined whether cyclin E was regulated by PAX6 expression. As a result cyclin E expression was not affected by the stable shRNA-mediated knockdown of PAX6 in lung cancer cells (data not shown). This demonstrates that PAX6 might promote cell growth by inducing cyclin D1 expression. .0085738.g004 Cyclin D1 expression and pRB phosphorylation was inhibited while PAX6 expression was suppressed. A B The expression of cyclin D1 pRB and the phosphorylated pRB in A549 PAX6 KD A549 NC A549 cells as well as H1299 PAX6KD H1299NC H1299 cells was determined by Western blotting. ?-actin and GAPDH expression level was measured as internal loading controls respectively. Cyclin D1 and pRB levels were measured by the gray level and were normalized by internal loading controls. Data are expressed as mean ±SEM. Times of the experiments are listed above the histograms. *P <0.05 **P <0.01. The major substrate of cyclin D1-CDK4/6 complexes is retinoblastoma protein (pRB) [18]. Thus pRB S780 protein phosphorylation was also detected by Western blotting (B). The S780 phosphorylation of pRB was decreased when PAX6 expression was inhibited in A549 cells. A similar result was obtained when H1299 PAX6 KD cells were used (B). MAPK signal pathway was suppressed by the inhibition of PAX6 The MAPK (mitogen activated protein kinase) pathway has been implicated in the regulation of G1/S transitions and cell mitosis [19]. In our study some central regulatory molecules of MAPK pathways were examined using western blot analysis. As shown in the phosphorylation levels of ERK1/2 and p38 were decreased both in A549 PAX6 KD and H1299 PAX6 KD cells. It indicated that the MAPK signal was weakened resulted from the RNAi interference of PAX6. .0085738.g005 The phosphorylation levels of ERK1/2 and p38 were suppressed by the inhibiton of PAX6 expression. Western-blot analysis of A549 A549 NC A549 PAX6 KD H1299 H1299NC H1299 PAX6 KD with antibodies to ERK1/2 (A) p38(B) and their phosphorylated forms were shown in the figure. GAPDH and ?-actin was used as internal loading controls respectively. ERK1/2 and p38 levels were normalized by GAPDH and ?-actin respectively. Data are expressed as mean ±SEM. All the experiments were repeated three times. *P <0.05 **P <0.01. PAX6 was highly expressed in lung cancer tissue Pax6 mRNA in lung cancer tissue as well as matched adjacent tissue was detected to confirm the role of PAX6 in lung cancer. The clinical characteristics of the 52 patients are listed in . As shown in A PAX6 mRNA was abundantly expressed in tumor tissue as compared to adjacent normal tissues. The expression of PAX6 represented by a cancer-to-adjacent nontumorous tissue ratio for each individual was indicated in B. PAX6 expression in lung cancer tissue was higher than that in each matched adjacent normal tissue in all but three cases (B). The statistic results were listed in table 2 and the ratio (tumor/adjacent tissue) of 65% patients (34 samples) exceeded 100. That is to say in most cases PAX6 was mainly expressed in lung cancer tissues. .0085738.g006 PAX6 mRNA was highly expressed in primary lung cancer tissues and lung cancer cell lines. A Real-time PCR analysis of the PAX6 expression level in lung cancer tissues as well as the matched adjacent tissues from 52 patients. The PAX6 mRNA level was normalized by ?-actin expression level. B Each column represents the relative ratio of PAX6 mRNA in primary NSCLC versus adjacent lung tissue and the line across the graph represents the value 1 and 10 respectively. All the experiments were repeated three times. **P <0.01. .0085738.t002 The relative ratio of PAX6 mRNA in primary NSCLC versus adjacent nontumorous lung tissue. PAX6 mRNA level (Tumor/adjacent tissue) 0“1 1“100 100“10000 10000“100000 Number of patients 3 15 19 15 Discussion In our study the function of PAX6 in lung cancer cells was investigated. The growth ability of A549 and H1299 cells was declined when PAX6 expression was inhibited by specific PAX6 shRNA. We suggest that PAX6 promotes G1-S progression by activating the MAPK signal pathway. And PAX6 was highly expressed in lung cancer tissues and lung cancer cell lines. The transcription factor PAX6 plays different roles in different tumors. It is frequently expressed in pancreatic cancer and retinoblastoma cells implicating an oncogenic function while PAX6 is recognized as a tumor suppressor in gliomas and prostate cancer [6] [10] [11] [20] [21].PAX6 expression is significantly reduced in glioblastomas and the expression level is correlated with longer patient survival [22]. PAX6 suppresses glioblastoma cell growth anchorage-independent growth and glioma angiogenesis as well as invasiveness of glioblastoma cell via inhibition of matrix metalloproteinase-2 (MMP2) expression and vascular endothelial growth factor A (VEGFA) expression [20] [23] [24]. "
Lung_Cancer
"observed depth in DNA-WGS and an alternate probability of the predicted DNA MAF. The number of true positives and false positives were tabulated at each model discrimination threshold i.e. P-value or score. The step function of these points (number of false positives versus number of true positives) generated a performance curve in absolute counts that is equivalent to a ROC curve without the denominators of total positives and negatives which were constant and unknown for the validation cohort. Between models performance curves were compared by area under the curve from 0 to 3000 false positives and by the number of true positives (proportional to sensitivity) at fixed numbers of false positives (proportional to 1 ? specificities) of 250 500 and 1000). P-values were calculated to provide evidence for the change in area under the curve and sensitivity estimates using permutation (see ˜Simulation analysis™ methods). RESULTS Mutation detection models Existing methods to detect somatic mutations are based on either DNA sequencing alone or on RNA sequencing alone and do not integrate more than one type of sequencing (913“17). In order to test whether integrating DNA-WES and RNA-seq enables superior somatic mutation detection versus the current standard of DNA-WES alone a new method was developed called UNCeqR. UNCeqR contains different models for detecting somatic mutations based on different sequencing input and statistical modeling. Briefly UNCeqRMETA integrates tumor DNA-WES and RNA-seq UNCeqRDNA uses tumor DNA-WES and UNCeqRRNA uses tumor RNA-seq. UNCeqR software is available at http://lbg.med.unc.edu/tools/unceqr. Evaluation in simulated tumor sequencing To test our hypothesis that somatic mutation detection based on integrated RNA-seq and DNA-WES is superior to that based on DNA-WES alone simulated tumor genomes were generated so that the entire genome space is a completely defined truth of positive and negative somatic mutations. In brief for each patient's sequencing 500 mutant sites were sampled for each site a mutant allele was randomly sampled and then aligned reads in the real RNA-seq and DNA-WES were edited to have the mutant allele at a rate of a fixed MAF (Supplementary Figure S2). By using real sequencing as the basis of the simulation authentic sequencing depths random errors (sequencing and alignment) and patients™ germline variants were preserved. Sequencing from the lung cancer quadruplet cohort was used for simulation. Patients™ DNA-WES and RNA-seq had large and similar numbers of sequenced nucleotides (DNA-WES median: 10.6 billion RNA-seq median: 10.2 billion; Kruskal-Wallis P = 0.54) indicating no significant imbalance in total sequencing. UNCeqR models were applied to the simulated tumor sequencing and detected mutations were compared against the truth by receiver operating characteristic curves. In simulations with a 10% MAF (A) the UNCeqRMETA model had significantly superior performance over UNCeqRDNA (difference in area under the curve P < 0.01); in other words UNCeqRMETA achieved a greater true positive rate (greater sensitivity) at the same false positive rate (same specificity) than UNCeqRDNA. In simulations with a 20% MAF (B) UNCeqRMETA continued to be superior to UNCeqRDNA (difference in area under the curve P < 0.01) although the gain in 20% MAF simulations was less (roughly 50% less) than the gain in 10% MAF simulations. This demonstrates that adding RNA-seq improved sensitivity particularly when the mutation signal that is MAF was low. UNCeqRMETA and UNCeqRDNA had large and clear superior performance to UNCeqRRNA which incurred false positives at a higher rate. Alternative ways to integrate RNA and DNA (taking the union or intersection of UNCeqRDNA and UNCeqRRNA) were both inferior to UNCeqRMETA (Supplementary Figure S3). Therefore in simulation UNCeqRMETA achieved superior performance over UNCeqRDNA with the largest gains occurring in mutations with low MAF. . Mutation detection performance in simulated tumor genomes. Model performance is displayed as receiver operating characteristic curves. Sensitivity plateaus below 1 because simulated mutations include sites with zero tumor sequencing depth in DNA and/or RNA (see ˜Simulation analysis™ methods). Validation by whole genome sequencing To validate the superior performance of integrated DNA-WES and RNA-seq mutation detection (UNCeqRMETA) over DNA-WES only detection (UNCeqRDNA) tumor and germline whole genome DNA sequencing (DNA-WGS) was used as an independent measure of truth for evaluating DNA-WES and RNA-seq mutation detections. Following a published validation procedure (4) mutation detections were interrogated in patient-matched DNA-WGS to determine if a mutation detection was a true positive that is present in the tumor specimen and absent from the germline specimen or false positive that is absent from the tumor specimen or present in the germline specimen. For each mutation model true positives and false positives were summed at each discrimination threshold (e.g. P-value) to generate a performance curve by which true positive rates could be compared at the same false positive rates (see methods for further description). These curves demonstrated that UNCeqRMETA achieved overall superior performance than UNCeqRDNA (difference in area under the curve P < 0.01) and at fixed false positive thresholds (250 500 and 1000) thus validating the result from simulated tumor genomes (). Therefore in real tumor sequencing integrated DNA and RNA mutation detection by UNCeqRMETA outperformed DNA-only mutation detection. . Validation of mutation detection by whole genome sequencing. The number of true positives and false positives of mutation detection models are plotted as step functions. At fixed false positive totals (250 500 or 1000) each pair of models was compared for differences in number of true positives (*). The published mutation set (46) did not include mutation rankings and was not amenable to rank-based statistical analysis. Other models displayed overall reduced performance relative to UNCeqRMETA and UNCeqRDNA. As another DNA-only control a leading (45) DNA-WES mutation caller from Illumina Strelka (17) was run on the same DNA-WES. Strelka exhibited inferior performance overall smaller true positive rates at fixed false positive rates and never achieved the sensitivity of UNCeqRMETA or UNCeqRDNA (). Strelka had greater sensitivity than UNCeqRMETA or UNCeqRDNA at the highest extreme of specificity; however at UNCeqR's minimum false positive rate Strelka's sensitivity was only ?70% of either UNCeqR model. Providing another DNA-only control previously published mutations of this cohort made by heterogeneous pipelines (46915“16) had reduced sensitivity than UNCeqRMETA and UNCeqRDNA at the same false positive rate (256 false positives). At this false positive rate indel mutation detections were rare in all models (maximum 1.7%) with UNCeqRMETA and UNCeqRDNA having no significant difference in indel precision (number of true positives divided by the sum of false positives and true positives 92 and 96% respectively) but both having greater indel precision than Strelka (83%) and previously published mutations (82%) (proportions test P < 0.001). Taking the union or intersection of UNCeqRDNA and UNCeqRRNA had higher false positive rates and inferior performance than UNCeqRMETA or UNCeqRDNA (Supplementary Figure S4A). Integrating Strelka with an RNA-seq mutation detector SNVmix did not result in superior performance versus Strelka UNCeqRDNA or UNCeqRMETA (Supplementary Figure S4A). Providing a separate source of validation UNCeqRMETA detected nearly all mutations that were published as validated by targeted resequencing within this cohort (up to 97% depending on the model threshold; Supplementary Figure S5). Repeating this analysis with a slightly increased true positivity definition minimum two confirming tumor WGS DNA reads maintained all findings listed above (Supplementary Figure S4B). Increased mutation signal in RNA-seq To analyze integrated mutation detection across larger cohorts UNCeqR was applied to the lung and breast triplet cohorts (n = 871) and using model thresholds with the same empirically estimated specificity (500 false positives in DNA-WGS validation sequencing marked as triangle point in UNCeqRMETA P-value ? 1.1 × 10?9 UNCeqRDNA P-value ? 9.3 × 10?9). About half (49%) of UNCeqRMETA mutations had no RNA evidence and were based only on DNA evidence. Surprisingly among UNCeqRMETA expressed somatic mutations (those with RNA and DNA mutant read evidence) the MAF in RNA was often significantly greater than in DNA (lung: 21% of expressed mutations breast: 17% fdr < 0.05) (Figure 3A and Supplementary Figure S6A). This increase was often >2-fold (lung: 12% of expressed mutations breast: 11%). In contrast DNA MAF was significantly greater than RNA MAF at much lower frequency (lung: 2% of expressed mutations breast: 3% fdr < 0.05). As a control germline variants were detected in germline DNA-WES and patient-matched germline RNA-seq relative to the reference genome by UNCeqRMETA under the same settings as somatic mutation detection (Figure 3B and Supplementary Figure S6B). In contrast to expressed somatic mutations expressed germline variants displayed rare significant differences in allele fraction (RNA greater than DNA: lung: 0.8% breast: 0.7%; DNA > RNA: lung 0.1% breast: 0.3%). Therefore the prevalent increased mutation signal in RNA-seq was cancer-specific. Figure 3. Mutation signal in RNA versus DNA. Mutant allele fraction distributions of UNCeqRMETA expressed mutations from the lung triplet cohort tumor sequencing (A). Germline variant allele fraction distributions of expressed germline variants from lung quadruplet cohort germline sequencing (B). Diagonal lines indicate equal allelic fraction between DNA and RNA with points above the diagonal having greater allelic fraction in RNA below the diagonal greater allelic fraction in DNA. Breast cancer somatic mutation and germline allele distributions in Supplementary Figure S6. Distributions of MAF difference among driver genes having a significant difference in MAF over all mutations (C). MAF distributions for all TP53 UNCeqRMETA mutations expressed and unexpressed (C and D). In addition to the genome-wide phenomenon the increased mutation signal in RNA versus DNA might additionally be frequent in cancer driver genes. Lung and breast cancer's driver genes (46) with at least 10% prevalence were analyzed for differences in RNA to DNA MAF across all mutations whether expressed or not. Eight driver genes had significantly different MAF between DNA and RNA (Wilcoxon signed rank test fdr < 0.05; Figure 3C). All of these genes had greater median MAF in RNA than in DNA including an oncogene PIK3CA and tumor suppressors such as TP53. The TP53 MAF distributions of lung and breast cancer had remarkable similarities (Figure 3D) in that nonsynonymous and splice site mutations had extremely high RNA MAF relative to DNA MAF often 2-fold greater. Stop-gain and frameshift mutations in TP53 had greater MAF in DNA versus RNA but these decreases were less common and had a smaller magnitude in MAF difference. The TP53 results extend an earlier report in lung cancer using direct sequencing of TP53 RNA transcripts which found mutant transcript predominant expression (46). In summary expressed mutations tend to have larger mutation signal in RNA than in DNA. Importantly this effect was common among driver genes suggesting that integrating DNA and RNA for mutation detection provides the best opportunity to identify cancer causing mutations. Because DNA copy number can affect the quantity of tumor versus germline DNA at a locus tumor DNA copy number alterations were compared among mutations with a significantly greater MAF in RNA versus DNA and vice versa. Mutations with greater MAF in RNA exhibited a small (roughly 5%) relative increase in DNA copy number deletions (Supplementary Figure S7) suggesting that RNA is beneficial to detect mutations in regions of genome deletion. MAF differences in TP53 mutations did not associate with either DNA amplifications or DNA deletions (Supplementary Figure S7). Large gains in low purity tumors Because low tumor purity (caused by normal contamination and multiple clones) can affect mutation detection (28) the outcome of integrating RNA-seq and DNA-WES in mutation detection was compared among tumors by their purity. The rate of mutation gain after adding RNA-seq to DNA-WES was non-uniform both in the breast and lung triplet cohorts such that the greatest gains occurred in tumors having the lowest purity. Specifically tumors™ total mutation ratio (the number of mutations detected by UNCeqRMETA over UNCeqRDNA) had significant negative correlation with tumor purity in both lung and breast cancer (Figure 4A). Mutation gains were largest among tumors with purity <40%. In addition tumors™ average difference in mutation signal between RNA and DNA (the mean difference of RNA MAF to DNA MAF across all expressed UNCeqRMETA mutations) also had significant negative correlation with tumor purity both in lung and breast cancer (Figure 4B). Therefore tumors with low purity had the largest RNA-seq mutation signal and gained the most new mutations after incorporation of RNA-seq evidence. Figure 4. Tumor purity effects on mutation detection. Lines summarize breast and lung triplet cohorts displaying total mutation ratios (A) or mean mutant allele fraction difference within expressed mutations (B) among tumors binned by tumor purity quintile and plotted at midpoint. Pearson's correlation tests compared the association of mutation ratio and MAF associations among triplet cohort tumors (P). MAF distributions from two exemplar low purity tumors™ mutations (C and D). Diagonal lines indicate equal MAF in DNA-WES and RNA-seq with mutations above the diagonal having greater MAF in RNA below the diagonal greater MAF in DNA. Unexpressed mutations are marked along the horizontal axes in (C and D). Examples of low purity tumors with large mutation gains include a low purity breast tumor that had 1.8 total mutation ratio and a mean 0.18 difference in mutation signal among expressed mutations. Two of this tumor's mutations with much larger signal in RNA than DNA occurred in PIK3CA (p.H1047R) and GATA3 (p.S412fs) (Figure 4C). These mutations occur in major mutational hotspots (47) and are also characteristic molecular drivers for the Luminal A expression subtype (648) of which this tumor is a member. Incorporation of RNA-seq evidence was essential to identify these two driving mutations; e.g. there was only 1 DNA read with the PIK3CA mutation but 29 mutant reads in RNA-seq (Figure 5). An example lung tumor had a 1.2 total mutation ratio and an average 0.22 difference in mutation signal among expressed mutations including CDKN2A (p.H98P) and TP53 (p.R273H) which exhibited very large RNA MAF (at 100 and 84%) relative to DNA MAF (at 43 and 46%) (Figure 4D). These PIK3CA GATA3 and TP53 mutations were not detected by earlier studies utilizing DNA-WES alone (46) emphasizing the advantage of RNA integration. In summary the addition of RNA-seq to DNA-WES substantially boosted mutation sensitivity for low purity tumors. Figure 5. Example of somatic mutation only detectable by RNA and DNA integration. Mutation detected by UNCeqRMETAP = 1e-16. Read alignment display from integrative genomics viewer (43) for a low purity breast tumor at the major mutational hotspot of PIK3CA (47). Increased mutation rates of driver and therapeutically-targeted genes To determine if UNCeqRMETA made new mutation discoveries in patients™ tumor genomes UNCeqRMETA mutations were compared to previously published patient mutation profiles on the triplet cohorts (46). Specifically tumors™ non-silent mutations (those that change protein sequence and can contribute to cancer development) of UNCeqRMETA that were novel compared to published profiles were tabulated within genes known to be relevant in cancer development (187 genes from the Cancer Gene Census (49) and published driver genes (46)). Five hundred and sixty-seven novel mutations were detected covering 67% of these cancer-relevant genes. 69% of these novel mutations had DNA-WES and RNA-seq evidence indicating that the addition of RNA contributed to the vast majority of these novel mutations. Grouped by patients 44% of patients™ tumors had an increase of at least one new mutation in this cancer-relevant gene set and among patient tumors with zero published mutations in this gene set 42% had at least one new mutation discovered by UNCeqRMETA. Grouped by gene many of these novel mutations comprised large gains in absolute counts and in percent increase (Figure 6A and B) including MAP3K1 and GATA3 in breast cancer and NOTCH2 and CDKN2A in lung cancer. These gains spanned all nucleotide mutation types (substitution insertion and deletion) and protein coding impacts; for instance novel GATA3 mutations had abundant novel frameshift insertion frameshift deletion non-synonymous and nonsense mutations (Supplementary Figure S8). Notably mutation rates for genes targeted by drugs were increased by UNCeqRMETA specifically PIK3CA FGFR2 and ERBB2. Therefore UNCeqRMETA largely advanced published state-of-the-art mutation profiles with cancer-relevant mutations by utilizing the integration of RNA-seq and DNA-WES. Figure 6. Novel mutation discoveries in cancer-relevant genes. Increases in mutation absolute count versus relative increase are displayed for selected genes (A and B). Percentage increase is the number of novel UNCeqRMETA mutations over the number of published mutations (46)for a gene. Absolute counts for select genes among breast (C) and lung (D) cancer expression subtypes. Breast cancer subtypes (48) were previously found to have distinct rates of mutations across four genes (TP53 GATA3 MAP3K1 and PIK3CA) and in combination with other evidence such as pathway alterations are understood to be driven by their distinct somatic alterations (6). Across these four genes novel mutations detected by UNCeqRMETA occurred most frequently in tumors of the same expression subtype as had been previously reported. Specifically the greatest number of novel mutations occurred in the following subtypes: TP53 in Basal MAP3K1 in Luminal A PIK3CA in Luminal A and GATA3 in Luminal A and Luminal B (Figure 6C). In lung cancer there were appreciable increases in NOTCH1 and NOTCH2. The largest numbers of novel UNCeqRMETA NOTCH1 and NOTCH2 mutations occurred in different lung cancer expression subtypes (50) of Classical and Basal respectively (Figure 6D). Combining novel UNCeqR non-silent mutations with those previously reported both of these genes now had significant association with expression subtype (NOTCH1 Fisher's test P < 0.02; NOTCH2 Fisher's test P < 0.03). Therefore the advance of UNCeqRMETA over published mutation profiles included new subtype-specific driving mutations new putative subtype-specific driver genes and new patients with mutations in driver genes. DISCUSSION Herein we sought to determine if adding patient-matched RNA-seq to DNA-WES would improve somatic mutation detection. To this end we developed UNCeqR a first-of-its-kind method that integrates RNA-seq and DNA-WES to detect somatic mutations. By simulation and validation in whole genome sequencing the UNCeqRMETA model that integrates DNA and RNA had significantly superior performance to models based on DNA alone (UNCeqRDNA Strelka and published mutation profiles). Then we applied UNCeqR to large breast and lung cohorts (n = 871) and analyzed their integrated RNA and DNA mutations resulting in several novel characterizations of tumor genomics. We report for the first time a remarkable finding that low purity tumors experience the largest gains in total mutations and in mutation signal (MAF) when adding RNA-seq to DNA-WES. Also we originally report that that MAF tends to be elevated in RNA versus DNA among expressed genes and that this phenomenon is cancer-specific. Based on these observations we conclude that rare cancerous cells within a tumor may exhibit over-expression relative to the tumor's normal cells which increases the concentration of cancer cell's mutations in a locus™ expressed transcripts thus boosting the RNA mutation signal. In contrast low purity tumors™ DNA mutation signal even if copy number altered may be drowned out by the normal cell DNA and cannot achieve the magnitude of the RNA mutation signal. High purity tumors™ smaller increases in RNA mutant allele signal versus DNA could be caused by mutant allele-specific expression or the presence of minor cancer clones within the tumor. In summary RNA-seq when added to DNA-WES is particularly useful for mutation detection in low purity tumors. For mutations with therapeutic significance highly sensitive and specific assays are essential for informing patient therapy and for clinical trials investigating new agents. Relative to published mutations derived from DNA-WES alone the UNCeqRMETA mutations derived from patient-matched DNA-WES and RNA-seq increased the numbers of patients with mutations in genes that are targets for several drugs in clinical trials such as PIK3CA and ERBB2 and for drugs with correlative evidence such as FGFR2 (51). Clinical trials such as NCT01670877 which involve ERBB2 sequencing (52) may be influenced to include RNA-seq due the large mutation rate increase reported here. Although the relative increase in PIK3CA mutations was modest compared to other genes in breast cancer this improved sensitivity is vital for affected patients and could lead to positive clinical trial outcomes. For example some novel canonical mutations in PIK3CA had many mutant "
Lung_Cancer
"Accordingly the protease inhibitor E-64d partially suppressed TFP-induced cell death. Moreover we demonstrate that lysosomal targeting of TFP was critical for its cytotoxic activity because inhibition of vacuolar adenosine triphosphatase by BafA1 which dissipates the lysosomal pH gradient and prevents intra-lumenal entrapment of lysosomotropic compounds (e.g. phenothiazines) in their protonated forms18 largely abolished TFP-induced cell death. Overall these data demonstrate that phenothiazines can modulate lysosomal functions in human LC cells as the amount of endogenous LC3-II is correlated with autophagic vesicle formation and conversion of LC3-I into LC3-II is a hallmark of autophagic activity and changes in these processes were observed upon phenothiazine treatment especially in SCLC. The lysosome has recently emerged as a promising target for anticancer therapy because lysosome-initiated cell death can operate independently of p53 and downstream caspases19 20 pathways that are often functionally inactivated in a variety of human tumors.2122 23 Also in our studies lysosomal perturbation occurred despite mutation in p53 and was not influenced by intrinsic sensitivity/resistance toward conventional chemotherapeutic agents. From our data we cannot rule out that SCLC cells or tumors with wt p53 or p53 null status could potentially respond differently yet our opinion is that in this context p53 status is not the main factor that regulates phenothiazine monotherapy response of SCLC. However the disparate sensitivities that exist between but also within SCLC and NSCLC indicate intrinsic differences in lysosomal activity suggesting that not all SCLC cells will be equally susceptible to phenothiazine-based treatment. Hence we sought to reveal whether lysosome-associated parameters can be used to predict the sensitivity of human LC cells to phenothiazines. Indeed using a limited number of SCLC and NSCLC cell lines we found that sensitivity to phenothiazines inversely correlated with baseline LysoTracker Green retention which was generally higher in NSCLC. Meanwhile sensitivity to phenothiazines correlated positively with the magnitude by which LysoTracker retention was lost upon treatment which tends to be more pronounced in SCLC. This suggests that lysosomes in the tested panel of SCLC cells may be less abundant and/or have higher intra-lumenal pH and are therefore more prone to functional perturbations. These findings require however further validation in a wider panel of SCLC cell lines to make a final . Also as LysoTracker Green only stain lysosomes in live cells alternative methodologies need to be developed to assess definitively whether lysosomal mass and/or pH is altered in clinical SCLC specimens such as for example tissue microarray staining with LC3-II upon treatment. Nevertheless consistent with this idea a number of different SCLC cell lines (H69 H82 H592 and U-1285) exhibited increased sensitivity toward several well-known lysosome-disrupting agents such as TMX CQ quinacrine and ammonium chloride (NH4Cl) all of which elicited larger changes in LysoTracker retention in SCLC cells as compared with NSCLC counterparts. By contrast we found that the CaM antagonist W7 neither induced LC3-II accumulation nor was selectively cytotoxic in SCLC cells. In addition the expression of D2R was comparable in our cell lines panel. Therefore the enhanced cytotoxicity of phenothiazines in SCLC that we report here most likely derives from lysosomal dysregulation rather than preferential inhibition of CaM or neurotransmitter signaling two established activities of phenothiazines.5 In addition it is worth noting that NSCLC cell lines in general exhibited a higher basal autophagy than SCLC counterparts which may render them less sensitive to chemically induced lysosomal perturbation. Similar observations have been reported by other investigators implicating autophagy as a pro-survival mechanism in NSCLC.24 25 Multiple studies on human and mouse cell lines have demonstrated the cytotoxic potential of phenothiazines given as monotherapy.4 In addition a few case reports exist that described anecdotal evidence for the antitumor activity of phenothiazines in vivo.2627 28 While the clinical utility of phenothiazines for anticancer treatment needs to be further analyzed through in vivo using SCLC xenograft transgenic murine SCLC models and possibly also patient-derived xenografts we believe our data in SCLC cell lines provide an important rationale for such analysis. Indeed it has been shown that at advanced stages several types of human cancers rely on lysosomes/autophagy for survival and metastasis.29 This is not surprising given that tumors frequently experience metabolic and replication stress.30 31 Therefore it is conceivable that tumors with high stress load and relatively low lysosomal activity could be particularly sensitive to phenothiazines. Given that SCLC initially are typically sensitive to conventional CT but rapidly develop resistance our data support clinical trials where phenothiazines are administered as second-line treatment for tumors that become refractory to standard treatment. "
Lung_Cancer
"or paclitaxel (200 mg/m2)/carboplatin (area under the curve 6.0) on day 1 every 3 weeks. Chemotherapy was continued for at least three cycles. Gefitinib was administered until the disease progressed intolerable toxicities developed or consent was withdrawn. The protocol recommended that the crossover regimen be used as a second-line treatment. Clinical Assessments The antitumor response to treatment was assessed using computed tomography every 2 months. Unidirectional measurements were adopted on the basis of the Response Evaluation Criteria in Solid Tumors (version 1.0).23 PFS was evaluated from the date of randomization to the date when disease progression was first observed or death occurred. The treatment response and PFS were determined by an external review of computed tomography scans by experts who were not aware of the treatment assignments. Overall survival (OS) was evaluated from the date of randomization to the date of death. Statistical Analysis To assess prognostic factors for OS we used univariate and multivariate Cox proportional hazards models. Kaplan“Meier survival curves were constructed for PFS and OS and differences between groups were identified using the log-rank test. Differences in response rates were identified using Fisher™s exact test. Each analysis was two sided with a 5% significance level and a 95% confidence interval. All analyses were performed using SAS for Windows software (release 9.1; SAS Institute Cary NC). RESULTS Patient Population A total of 230 chemonaive patients were enrolled in the NEJ002 study: 115 patients were assigned to receive gefitinib and 115 were assigned to receive carboplatin-paclitaxel (Fig. 1). To evaluate the efficacy of gefitinib in NSCLC patients with uncommon EGFR mutations we analyzed the data of 114 patients in the gefitinib group and 111 patients in the carboplatin-paclitaxel group. We identified five patients who had uncommon EGFR mutations in each group. Two patients who had common mutations and were treated with first-line chemotherapy consisting of carboplatin-paclitaxel were excluded from the PFS analysis in the NEJ002 study. However both were treated with gefitinib and were included in this post-hoc analysis. The demographic and disease characteristics of the patients with uncommon EGFR mutations were similar to those of patients with common EGFR mutations (). The characteristics of each patient with uncommon EGFR mutations are shown in supplementary Table S1 (Supplemental Digital Content 1 http://links.lww.com/JTO/A494). FIGURE 1. Enrollment randomization and follow-up of the study patients. TABLE 1. Patient Characteristics Survival Factors In the univariate analysis of 225 patients who received gefitinib at any point uncommon EGFR mutations had a significant detrimental effect on survival (). We also identified performance statuses 1 and 2 distant metastasis brain metastasis stable disease and progressive disease as significant predictors of worse prognosis for standard chemotherapy and stable disease and progressive disease as significant predictors of worse prognosis for gefitinib. When these variables were included in the Cox proportional hazards model we found that uncommon EGFR mutations performance statuses 1 and 2 stable disease and progressive disease for standard chemotherapy and stable disease and progressive disease for gefitinib had significant hazard ratios (). TABLE 2. Univariate and Multivariate Analysis by Cox Proportional Hazards Model Uncommon EGFR Mutations and Survival The Kaplan“Meier curve for OS for uncommon versus common EGFR mutations is shown in A. The OS was significantly shorter among patients with uncommon EGFR mutations compared with OS of those with common EGFR mutations in the overall population (12 versus 28.4 months; p = 0.002). A significantly shorter survival time was observed in patients with uncommon EGFR mutations compared with survival time in those with common EGFR mutations in the gefitinib group (11.9 versus 29.3 months; p < 0.001) (Fig. 2B). However a similar survival time was observed between the subgroups of uncommon and common EGFR mutations in the carboplatin-paclitaxel group (22.8 versus 28 months; p= 0.358) (Fig. 2C). FIGURE 2. The overall survival curves of patients with common mutations and uncommon mutations in the entire population (A) the gefitinib group (B) and the carboplatin-paclitaxel group (C). To examine whether the sequence of platinum doublet and gefitinib affected OS we performed a further subgroup analysis. The survival time tended to be shorter among patients receiving first-line gefitinib compared with the survival time among those receiving first-line carboplatin-paclitaxel in the uncommon EGFR mutation group (11.9 versus 22.8 months; p = 0.102). Consistent with previous publications a similar survival time was observed between patients receiving first-line gefitinib and those receiving first-line carboplatin-paclitaxel in the common EGFR mutation group (29.3 versus 28 months; p = 0.378). Uncommon EGFR Mutations PFS and Response In the gefitinib group the median PFS was significantly shorter for patients with uncommon EGFR mutations compared with median PFS of those with common EGFR mutations (2.2 versus 11.4 months; p < 0.001) (Fig. 3A). By contrast the median PFS did not differ significantly between patients with uncommon EGFR mutations and those with common EGFR mutations in the carboplatin-paclitaxel group (5.9 versus 5.4 months; p = 0.847) (Fig. 3B). The objective response rate was significantly lower in patients with uncommon EGFR mutations compared with the objective response rate in those with common EGFR mutations when treated with gefitinib (20% versus 76%; p = 0.017) (supplementary Table S2 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). By contrast similar objective response rates were observed for patients with uncommon EGFR mutations and those with common EGFR mutations in the carboplatin-paclitaxel group (20% versus 32%; p = 0.336) (supplementary Table S2 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). FIGURE 3. Progression-free survival curves in the gefitinib group (A) and the carboplatin-paclitaxel group (B) according to the type of epidermal growth factor receptor mutation. DISCUSSION Recent studies suggest that NSCLC patients with uncommon EGFR mutations are less responsive to EGFR-TKIs compared with patients with L858R and exon 19 deletions.9“20 However the efficacy of EGFR-TKIs in NSCLC patients with uncommon mutations has not been fully elucidated. We conducted a post-hoc analysis of the NEJ002 study to evaluate the effectiveness of gefitinib against NSCLC with G719X or L861Q. The NEJ002 study comparing gefitinib and standard carboplatin-paclitaxel chemotherapy as the first-line treatment for patients with EGFR mutations demonstrated no significant difference in OS between gefitinib and carboplatin-paclitaxel.6 In contrast to other phase 3 trials investigating EGFR-TKIs for patients with common EGFR mutations of exon 19 deletion and L858R the NEJ002 is the only study that included uncommon EGFR mutations of G719X and L861Q. The current study clearly demonstrated that NSCLC patients with the uncommon EGFR mutations G719X and L861Q had shorter survival than the survival of those with an exon 19 deletion or L858R mutation (Fig. 2). Our results are consistent with other clinical studies on EGFR-TKIs in patients with uncommon EGFR mutations (supplementary Table S3 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). The overall response rate to EGFR-TKIs in patients with uncommon EGFR mutations was 41% which is lower than the response rate to TKIs (62%“83%) of patients with common EGFR mutations.7824 In the NEJ002 study G719X included G719C and G719S. No patients harbored G719A. To investigate the effectiveness of gefitinib on each uncommon EGFR mutations we evaluated the difference in OS between patients with uncommon EGFR mutations (G719C versus G719S and G719X versus L861Q). There was no significant difference between these subgroups (data not shown). This study showed that the PFS and OS tended to be shorter among patients treated with first-line gefitinib compared with PFS and OS among those treated with first-line carboplatin-paclitaxel in the uncommon EGFR mutation group (supplementary Table S2 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). We also found poor disease control rate with gefitinib in patients with uncommon mutations. Three of five patients with uncommon mutations in the gefitinib group had progressive disease. By contrast no patients with uncommon mutations had progressive disease in the carboplatin-paclitaxel group. Although the number of patients with uncommon mutations in each treatment group was small platinum-doublet therapy might be a better choice than gefitinib for first-line therapy in patients with uncommon EGFR mutations. Because some of patients with uncommon mutations showed good clinical response to gefitinib in this study and they seemed to be heterogeneous in terms of response to gefitinib administration of gefitinib should be considered for patients with uncommon mutations when disease progression was observed after first-line chemotherapy. In vitro studies have indicated that the affinity of gefitinib for EGFR proteins with uncommon EGFR mutations is lower than the affinity of gefitinib for EGFR proteins with common EGFR mutations.25 A sixfold or 14-fold higher concentration of gefitinib was required to inhibit the growth of cells expressing G719X or L861Q respectively compared with cells expressing L858R.26 These results may explain the lack of response to gefitinib in patients with uncommon EGFR mutations. The authors also examined the sensitivity of G719X and L861Q mutations to erlotinib and irreversible TKIs.27 Cells expressing G719X were less resistant to erlotinib than gefitinib in vitro; however L861Q was resistant to both erlotinib and gefitinib. In contrast to erlotinib irreversible TKIs inhibited the growth of cells with G719X or L861Q at a lower concentration than those with wild-type EGFR. Indeed Sequist et al.28 reported that the effectiveness of an irreversible pan-ErbB receptor TKI neratinib on NSCLC patients with G719X. Niratinib induced partial responses in three of four patients with G719X and the fourth had durable stable disease for 40 weeks. It may be beneficial to evaluate erlotinib as a treatment for NSCLCs with G719X and irreversible EGFR-TKIs as treatments for NSCLCs with G719X and L861Q. Because previous phase 3 trials that investigated erlotinib or irreversible TKIs for NSCLC with EGFR mutations did not include uncommon EGFR mutations further clinical studies may need to be performed.7829 Another possible strategy for the treatment of uncommon EGFR mutations is the combination of EGFR-TKIs and cytotoxic agents. Our group has undertaken a randomized phase 3 trial to compare gefitinib plus carboplatin plus pemetrexed with gefitinib monotherapy for patients with NSCLC with an exon 19 deletion or an L858R G719X or L861Q EGFR mutation (NEJ009; University Hospital Medical Information Network Clinical Trials Registry [UMIN-CTR] number UMIN000006340). The data from this study will advance the treatment of NSCLC with uncommon EGFR mutations. In conclusion our post-hoc analysis clearly demonstrated shorter survival of TKI-treated patients with uncommon EGFR mutations compared with survival of those with common EGFR mutations. Furthermore the data suggest that the first-line chemotherapy may be relatively effective for NSCLC with uncommon EGFR mutations. ACKNOWLEDGMENTS Special thanks to Hiromi Odagiri for her expert assistance with data collection and management. This study was supported by the Tokyo Cooperative Oncology Group. The first two authors contributed equally to this work. Disclosure: Dr. Yoshizawa received grants and lecture fees from AstraZeneca; Dr. Maemondo received lecture fees from AstraZeneca and Chugai; Dr. Inoue received lecture fees from AstraZeneca and Chugai; Dr. Gemma received grants and lecture fees from AstraZeneca; Dr. Hagiwara received patent fees from Mitsubishi Chemical Medience consulting fees and lecture fees from AstraZeneca; Dr. Kobayashi received grants from Novartis Nihon Kayaku Chugai Shionogi Kyowa Kirin Yakult Taiho and AstraZeneca and lecture fees from AstraZeneca Chugai and Bristol-Myers Squibb. The remaining authors declare no conflict of interest. REFERENCES 1. Kim ES Hirsh V Mok T Gefitinib versus docetaxel in previously treated non-small-cell lung cancer (INTEREST): a randomised phase III trial. Lancet 2008 372 1809 1818 19027483 2. Shepherd FA Rodrigues Pereira J Ciuleanu T National Cancer Institute of Canada Clinical Trials Group Erlotinib in previously treated non-small-cell lung cancer. N Engl J Med 2005 353 123 132 16014882 3. Lynch TJ Bell DW Sordella R Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004 350 2129 2139 15118073 4. Paez JG EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 2004 304 1497 1500 15118125 5. Mitsudomi T Morita S Yatabe Y West Japan Oncology Group Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label randomised phase 3 trial. Lancet Oncol 2010 11 121 128 20022809 6. Maemondo M Inoue A Kobayashi K North-East Japan Study Group Gefitinib or chemotherapy for non-small-cell lung cancer with mutated EGFR. N Engl J Med 2010 362 2380 2388 20573926 7. Rosell R Carcereny E Gervais R Spanish Lung Cancer Group in Collaboration with Groupe Français de Pneumo-Cancérologie and Associazione Italiana Oncologia Toracica Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre open-label randomised phase 3 trial. Lancet Oncol 2012 13 239 246 22285168 8. Zhou C Wu YL Chen G Erlotinib versus chemotherapy as first-line treatment for patients with advanced EGFR mutation-positive non-small-cell lung cancer (OPTIMAL CTONG-0802): a multicentre open-label randomised phase 3 study. Lancet Oncol 2011 12 735 742 21783417 9. Mitsudomi T Yatabe Y Mutations of the epidermal growth factor receptor gene and related genes as determinants of epidermal growth factor receptor tyrosine kinase inhibitors sensitivity in lung cancer. Cancer Sci 2007 98 1817 1824 17888036 10. Pallis AG Voutsina A Kalikaki A ˜Classical™ but not ˜other™ mutations of EGFR kinase domain are associated with clinical outcome in gefitinib-treated patients with non-small cell lung cancer. Br J Cancer 2007 97 1560 1566 18000506 11. Maheswaran S Sequist LV Nagrath S Detection of mutations in EGFR in circulating lung-cancer cells. N Engl J Med 2008 359 366 377 18596266 12. Sequist LV Martins RG Spigel D First-line gefitinib in patients with advanced non-small-cell lung cancer harboring somatic EGFR mutations. J Clin Oncol 2008 26 2442 2449 18458038 13. Costa DB Nguyen KS Cho BC Effects of erlotinib in EGFR mutated non-small cell lung cancers with resistance to gefitinib. Clin Cancer Res 2008 14 7060 7067 18981003 14. Masago K Fujita S Irisa K Good clinical response to gefitinib in a non-small cell lung cancer patient harboring a rare somatic epidermal growth factor gene point mutation; codon 768 AGC > ATC in exon 20 (S768I). Jpn J Clin Oncol 2010 40 1105 1109 20522446 15. Rizvi NA Rusch V Pao W Molecular characteristics predict clinical outcomes: prospective trial correlating response to the EGFR tyrosine kinase inhibitor gefitinib with the presence of sensitizing mutations in the tyrosine binding domain of the EGFR gene. Clin Cancer Res 2011 17 3500 3506 21558399 16. De Pas T Toffalorio F Manzotti M Activity of epidermal growth factor receptor-tyrosine kinase inhibitors in patients with non-small cell lung cancer harboring rare epidermal growth factor receptor mutations. J Thorac Oncol 2011 6 1895 1901 21841502 17. Wu JY Yu CJ Chang YC Effectiveness of tyrosine kinase inhibitors on œuncommon epidermal growth factor receptor mutations of unknown clinical significance in non-small cell lung cancer. Clin Cancer Res 2011 17 3812 3821 21531810 18. Ong M Kwan K Kamel-Reid S Neoadjuvant erlotinib and surgical resection of a stage iiia papillary adenocarcinoma of the lung with an L861Q activating EGFR mutation. Curr Oncol 2012 19 e222 e226 22670114 19. Ackerman A Goldstein MA Kobayashi S Costa DB EGFR delE709_T710insD: a rare but potentially EGFR inhibitor responsive mutation in non-small-cell lung cancer. J Thorac Oncol 2012 7 e19 e20 22982663 20. Sharma A Tan TH Cheetham G Rare and novel epidermal growth factor receptor mutations in non-small-cell lung cancer and lack of clinical response to gefitinib in two cases. J Thorac Oncol 2012 7 941 942 22722798 21. Nagai Y Miyazawa H Huqun Genetic heterogeneity of the epidermal growth factor receptor in non-small cell lung cancer cell lines revealed by a rapid and sensitive detection system the peptide nucleic acid-locked nucleic acid PCR clamp. Cancer Res 2005 65 7276 7282 16105816 22. Tanaka T Matsuoka M Sutani A Frequency of and variables associated with the EGFR mutation and its subtypes. Int J Cancer 2010 126 651 655 19609951 23. Therasse P Arbuck SG Eisenhauer EA New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer National Cancer Institute of the United States National Cancer Institute of Canada. J Natl Cancer Inst 2000 92 205 216 10655437 24. Mitsudomi T Yatabe Y Epidermal growth factor receptor in relation to tumor development: EGFR gene and cancer. FEBS J 2010 277 301 308 19922469 25. Yun CH Boggon TJ Li Y Structures of lung cancer-derived EGFR mutants and inhibitor complexes: mechanism of activation and insights into differential inhibitor sensitivity. Cancer Cell 2007 11 217 227 17349580 26. Kancha RK von Bubnoff N Peschel C Duyster J Functional analysis of epidermal growth factor receptor (EGFR) mutations and potential implications for EGFR targeted therapy. Clin Cancer Res 2009 15 460 467 19147750 27. Kancha RK Peschel C Duyster J The epidermal growth factor receptor-L861Q mutation increases kinase activity without leading to enhanced sensitivity toward epidermal growth factor receptor kinase inhibitors. J Thorac Oncol 2011 6 387 392 21252719 28. Sequist LV Besse B Lynch TJ Neratinib an irreversible pan-ErbB receptor tyrosine kinase inhibitor: results of a phase II trial in patients with advanced non-small-cell lung cancer. J Clin Oncol 2010 28 3076 3083 20479403 29. Miller VA Hirsh V Cadranel J Afatinib versus placebo for patients with advanced metastatic non-small-cell lung cancer after failure of erlotinib gefitinib or both and one or two lines of chemotherapy (LUX-Lung 1): a phase 2b/3 randomised trial. Lancet Oncol 2012 13 528 538 22452896 Clin Orthop Relat Res Clin. Orthop. Relat. Res Clinical Orthopaedics and Related Research 0009-921X 1528-1132 Springer US Boston 24249538 3971232 3385 10.1007/s11999-013-3385-9 Clinical Research Does Intensity of Surveillance Affect Survival After Surgery for Sarcomas? Results of a Randomized Noninferiority Trial Puri Ajay MS [email protected] Gulia Ashish MS Hawaldar Rohini PhD Ranganathan Priya MD Badwe Rajendra A. MS Orthopaedic Oncology Tata Memorial Hospital Room No. 45 E Borges Road Mumbai India Tata Memorial Hospital Mumbai India Anaesthesiology Critical Care and Pain Tata Memorial Hospital Mumbai India Surgical Oncology Tata Memorial Hospital Mumbai India 19 11 2013 5 2014 472 5 1568 1575 30 7 2013 8 11 2013 © The Association of Bone and Joint Surgeons® 2013 Background Whether current postoperative surveillance regimes result in improved overall survival (OS) of patients with extremity sarcomas is unknown. Questions/purposes We hypothesized that a less intensive followup protocol would not be inferior to the conventional followup protocol in terms of OS. We (1) assessed OS of patients to determine if less intensive followup regimens led to worsened survival and asked (2) whether chest radiograph followup group was inferior to CT scan followup group in detecting pulmonary metastasis; and (3) whether less frequent (6-monthly) followup interval was inferior to more frequent (3-monthly) followup in detecting pulmonary metastasis and local recurrence. Methods A prospective randomized single-center noninferiority trial was conducted between January 2006 and June 2010. On the basis of 3-year survival of 60% with intensive more frequent followup 500 nonmetastatic patients were randomized to demonstrate noninferiority by a margin (delta) of 10% (hazard ratio [HR] 1.36). The primary end point was OS at 3 years. The secondary objective was to compare disease-free survival (DFS) (time to recurrence) at 3 years. At minimum followup of 30 months (median 42 months; range 30“81 months) 178 deaths were documented. Results Three-year OS and DFS for all patients was 67% and 52% respectively. Three-year OS was 67% and 66% in chest radiography and CT groups respectively (HR 0.9; upper 90% confidence interval [CI] 1.13). DFS rate was 54% and 49% in chest radiography and CT groups respectively (HR 0.82; upper 90% CI 0.97). Three-year OS was 64% and 69% in 6-monthly and 3-monthly groups respectively (HR 1.2; upper 90% CI 1.47). DFS was 51% and 52% in 6-monthly and 3-monthly groups respectively (HR 1.01; upper 90% CI 1.2). Almost 90% of local recurrences were identified by patients themselves. Conclusions Inexpensive imaging detects the vast majority of recurrent disease in patients with sarcoma without deleterious effects on eventual outcomes. Patient education regarding self-examination will detect most instances of local recurrence although this was not directly assessed in this study. Although less frequent visits adequately detected metastasis and local recurrence this trial could not conclusively demonstrate noninferiority in OS for a 6-monthly interval of followup visits against 3-monthly visits. Level of Evidence Level I therapeutic study. See Guidelines for Authors for a complete description of levels of evidence. issue-copyright-statement © The Association of Bone and Joint Surgeons® 2014 101528555 37539 Nat Commun Nat Commun Nature communications 2041-1723 24572595 3982882 10.1038/ncomms4365 NIHMS562641 Article Characterizing the genetic basis of methylome diversity in histologically normal human lung tissue Shi Jianxin 1 Marconett Crystal N. 2 3 Duan Jubao 4 Hyland Paula L. 1 Li Peng 1 Wang Zhaoming 1 Wheeler William 5 Zhou Beiyun 6 Campan Mihaela 2 3 Lee Diane S. 2 3 Huang Jing 7 Zhou Weiyin 1 Triche Tim 8 Amundadottir Laufey 1 Warner Andrew 9 Hutchinson Amy 1 Chen Po-Han 2 3 Chung Brian S.I. 2 3 Pesatori Angela C. 10 Consonni Dario 10 Bertazzi Pier Alberto 10 Bergen Andrew W. 11 Freedman Mathew 12 13 Siegmund Kimberly D. 8 Berman Benjamin P. 8 14 Borok Zea 3 6 Chatterjee Nilanjan 1 Tucker Margaret A. 1 Caporaso Neil E. 1 Chanock Stephen J. 1 Laird-Offringa Ite A. 2 3 Landi Maria Teresa 1 1Division of Cancer Epidemiology and Genetics National Cancer Institute NIH DHHS Bethesda MD 20892 USA 2Department of Surgery USC/Norris Comprehensive Cancer Center Keck School of Medicine Los Angeles CA 90089 USA 3Department of Biochemistry and Molecular Biology USC/Norris Comprehensive Cancer Center Keck School of Medicine Los Angeles CA 90089 USA 4Center for Psychiatric Genetics Department of Psychiatry and Behavioral Sciences North Shore University Health System Research Institute University of Chicago Pritzker School of Medicine Evanston IL 60201 USA 5Information Management Services Inc. Rockville MD 20852 USA 6Will Rogers Institute Pulmonary Research Center and Division of Pulmonary Critical Care and Sleep Medicine USC Keck School of Medicine Los Angeles CA 90089 USA 7Laboratory of Cancer Biology and Genetics Center for Cancer Research National Cancer Institute NIH DHHS Bethesda MD 20892 USA 8Bioinformatics Division Department of Preventive Medicine University of Southern California Los Angeles CA 90089 USA 9Pathology/Histotechnology Laboratory Laboratory Animal Sciences Program Frederick National Laboratory for Cancer Research Frederick Maryland21702 USA 10Unit of Epidemiology IRCCS Fondazione Ca™ Granda Ospedale Maggiore Policlinico and Department of Clinical Sciences and Community Health University of Milan Milan20122 Italy 11Molecular Genetics Program Center for Health Sciences SRI Menlo Park CA 94025 USA 12Program in Medical and Population Genetics The Broad Institute Cambridge MA 02142 USA 13Department of Medical Oncology The Center for Functional Cancer Epigenetics Dana-Farber Cancer Institute Boston MA 02215 14USC Epigenome Center and USC/Norris Comprehensive Cancer Center Los Angeles CA 90089 USA Correspondence: [email protected] 4 4 2014 27 2 2014 27 8 2014 5 3365 3365 The genetic regulation of the human epigenome is not fully appreciated. Here we describe the effects of genetic variants on the DNA methylome in human lung based on methylation-quantitative trait loci (meQTL) analyses. We report 34304 cis- and 585 trans-meQTLs a genetic-epigenetic interaction of surprising magnitude including a regulatory hotspot. These findings are replicated in both breast and kidney tissues and show distinct patterns: cis-meQTLs mostly localize to CpG sites outside of genes promoters and CpG islands (CGIs) while trans-meQTLs are over-represented in promoter CGIs. meQTL SNPs are enriched in CTCF binding sites DNaseI hypersensitivity regions and histone marks. Importantly 4 of the 5 established lung cancer risk loci in European ancestry are cis-meQTLs and in aggregate cis-meQTLs are enriched for lung cancer risk in a genome-wide analysis of 11587 subjects. Thus inherited genetic variation may affect lung carcinogenesis by regulating the human methylome. Introduction DNA methylation plays a central role in epigenetic regulation. Twin studies have suggested that DNA methylation at specific CpG sites can be heritable12; however the genetic effects on DNA methylation have been investigated only in brain tissues34 adipose tissues56 and lymphoblastoid cell lines (LCL)7. Most studies were based on the Illumina HumanMethylation27 array which has a low density and mainly focuses on CpG-sites mapping to gene promoter regions. While the functional role of DNA methylation in non-promoter or non-CpG Island (CGI) regions remains largely unknown evidence shows roles in regulating gene splicing8 and alternative promoters9 silencing of intragenic repetitive DNA sequences10 and predisposing to germline and somatic mutations that could contribute to cancer development1112. Notably a recent study13 suggests that most DNA methylation alterations in colon cancer occur outside of promoters or CGIs in so called CpG island shores and shelves and the Cancer Genome Project has reported high mutation rates in CpG regions outside CGI in multiple cancers14. Although expression QTLs (eQTLs) have been extensively studied in different cell lines and tissues15 the minimal overlap observed between cis-acting meQTLs and eQTLs (?5“10%)347 emphasizes the necessity of mapping meQTLs that may function independently of nearby gene expression. This might reveal novel mechanisms for genetic effects on cancer risk particularly since many of the established cancer susceptibility SNPs map to non-genic regions. Lung diseases constitute a significant public health burden. About 10 million Americans had chronic obstructive pulmonary disease in 201216 and lung cancer continues to be the leading cancer-related cause of mortality worldwide17. To provide functional annotation of SNPs particularly those relevant to lung diseases and traits we systematically mapped meQTLs in 210 histologically normal human lung tissues using Illumina Infinium HumanMethylation450 BeadChip arrays which provide a comprehensive platform to interrogate the DNA methylation status of 485512 cytosine targets with excellent coverage in both promoter and non-promoter regions (Fig. 1a) CGI and non-CGI regions (Fig. 1b) and gene and non-gene regions. Thus our study enables the characterization of genetic effects across the methylome in unprecedented detail. Moreover since DNA methylation exhibits tissue specific features18 we investigated whether similar meQTLs could be identified in other tissues. Results Identification of cis-acting meQTLs We profiled DNA methylation for 244 fresh-frozen histologically normal lung samples from non-small cell lung cancer (NSCLC) patients from the Environment and Genetics in Lung cancer Etiology (EAGLE) study19. A subset of 210 tissue samples that passed quality control and had germline genotype data from blood samples20 was used for meQTL analysis. The analysis was restricted to 338456 autosomal CpG probes after excluding those annotated in repetitive genomic regions or that harbored genetic variants. The distribution of methylation levels differed strongly across distinct types of genomic regions (Supplementary Fig. 1ab). Consistent with previous studies21 CpG sites in promoter or CGI regions were largely unmethylated while those in other regions were largely methylated (Supplementary Fig. 1ab). We performed cis-meQTL analysis for each methylation trait by searching for SNPs within 500kb of the target CpG-site in each direction (1Mb overall). The genetic association was tested under an additive model between each SNP and each normalized methylation probe adjusting for sex age plate population stratification and methylation-based principal component analysis (PCA) scores. Controlling FDR at 5% (P=4.0×10?5) we detected cis-meQTLs for 34304 (10.1% of 338456) CpG probes (Supplementary ) mapping to 9330 genes. A more stringent threshold (P=6.0×10?6) at FDR=1% detected cis-meQTLs for 27043 CpG probes mapping to 8479 genes. Moreover with a 200kb window (100kb from both sides) instead than 1Mb we detected 40650 cis-meQTLs (P=2.0×10?4) controlling for FDR=5%. The methylation distribution in CpG sites detected with meQTLs differed substantially from those without meQTLs (Supplementary Fig. 1ab). The peak SNPs were equally distributed on either side of the target CpG-sites with a median distance (?) of 11.8 kb. The proportion of explained phenotypic variance (h2) ranged from 7.7% to 79.8% (Supplementary Fig. 1c) "
Lung_Cancer
"The staining extent of MLM was significantly smaller than methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opacity of MLM was found in 13 subjects (62%). An appropriate localization rate of MLM was 100% with the use of the directly visible ability and radio-opacity of MLM. MLM provides a superior pulmonary localization ability over methylene blue. Lung Ethiodized Oil Methylene Blue Tomography X-Ray Computed Radiology Interventional Seoul National University College of Medicine 800-20120036 INTRODUCTION Preoperative localization is necessary for video-assisted thoracoscopic surgery (VATS) when pulmonary nodules are too small or distant from the visceral pleura to be detected (1-3). A failure to localize nodules disturbs the success of the thoracoscopic resection and leads to conversion to thoracotomy (4 5). There are two kinds of localizing procedures: marking with thoracoscopically directly visible materials and marking with radio-opaque materials. Examples of directly visible materials are hook wire methylene blue and indocyanine green. Ethiodized oil (lipiodol) barium and iodine contrast agents are used for radio-opaque markers. Each marking method has strong and weak points. Localization with a hook wire is easy to perform but carries a high risk of pneumothorax and a propensity to dislodge during transport and surgical preparation (6 7). Methylene blue and indigo carmine have a tendency to diffuse over a large area by the time the operation is done and render localization features inadequate (8 9). The use of a radio-opaque marker (such as barium or lipiodol) requires an intraoperative fluoroscopy to confirm an adequate excision as well as lead to increased radiation exposure (10-13). The use of mixture has been reported to make up for the weakness of marking materials. For example the problem of dye diffusion has led to attempts to use a mixture of dye with various materials such as cyanoacrylate adhesive or collagen or autologous blood (14-16). However they have not been widely used for localization due to difficulties in making and manipulation. Lipiodol and methylene blue are commonly used materials for localization (17-20). We hypothesized that lipiodol reduces the spread of methylene blue and provides additional localization opportunities by its radio-opacity. The use of a mixture of lipidol and methylene blue (MLM) for a percutaneous injection material requires a high success rate for appropriate localization and a low complication rate. To our knowledge there have been no reports that evaluate the availability of MLM as a percutaneous injection material in human lungs. This study compared MLM with methylene blue as a percutaneous injection material for pulmonary localization in rabbit lungs. MATERIALS AND METHODS Animal preparation This study was performed after approval by the Institutional Animal Care and Use Committee (IACUC) in Seoul National University Hospital biomedical research institute (IACUC approval No. 11-0356). Twenty-four adult New Zealand White rabbits were used. We recorded their weight before the procedures. The animals were randomly divided into two groups: Group A (n=12) and Group B (n=12) each sacrificed at about 6 hr and 24 hr after percutaneous injections respectively (Fig. 1). Six hours after percutaneous injections were same day operations of the preoperative localization; and 24 hr after percutaneous injections were next day operations of the preoperative localization. The injection of each material was done in all 24 subjects because we injected methylene blue and MLM at two different lung sites for each subject. Percutaneous injection materials: mixture of lipiodol and methylene blue versus methylene blue A pilot study was performed to decide the optimal amount of materials for percutaneous injections. Methylene blue (1% 100 mg/mL TERA Pharmaceuticals Buena Park CA USA) of 0.3 to 0.9 mL was used for human lung localization in previous studies by Wicky et al. (18) and Vandoni et al. (19). In the pilot study with rabbit lungs we injected 0.1 mL and 0.05 mL of methylene blue and MLM in four subjects. We found that staining was extensive (more than half height of one lobe) with 0.1 mL and localized (about 1 cm of staining diameter) with 0.05 mL for both methylene blue and MLM. Extensive dispersion made it difficult to find exact injecting sites; subsequently 0.05 mL of methylene blue was administered. We made variable mix ratios of lipiodol and methylene blue in vitro; 1:1 1:2 1:3 1:4 and 1:5 in order to find an appropriate mixing ratio of lipiodol (480 mg Iodine/mL Andre Guerbet Aulnay-sous-Bois France) and methylene blue. The separation of two materials occurred instantly after mechanical blending to the fat-soluble character of lipiodol and the water-soluble character of methylene blue. A higher concentration of lipiodol in MLM resulted in increased uneven blending and rapid separation. A mixture with a 1:6 (or lower) mixing ratio contained a minimal amount of lipiodol and it might make it difficult to be detected on the fluoroscopy; subsequently we decided that 1:5 was an appropriate mixing ratio for injection. A total of 0.06 mL of MLM (0.01 mL of lipiodol plus 0.05 mL of methylene blue) was administrated in each subject to avoid the effect of different volumes of methylene blue to the diffusion extent of the materials. CT guided percutaneous injections Percutaneous injection was performed with computed tomography (CT) guidance (Discovery CT750 HD; GE Healthcare Waukesha WI USA). We performed pre-procedural CT scans in order to determine an appropriate skin entry site for the successful placement of a needle in the desired location. The desired location was the basal portion of both caudal lobes around the mid-scapula line. We tried to situate the needle tip at 5 mm depth from the visceral pleura and avoid passing through the pulmonary vessels. We placed the needle of 20 gauze and 3.5 cm length in the lung parenchyma after marking the appropriate skin entry site. The parameters of CT used in our study were: tube voltage of 120 kV tube current of 25 mA slice thickness of 2 mm thickness and gantry rotation speed of 350 milliseconds. We connected 1 mL syringe to the needle hub and retracted the syringe piston to confirm that no blood was aspirated after the needle tip was accurately located within the desired location. We then injected the materials and immediately removed the needle. On the procedural CT scan we measured the distance from the skin-entry to the needle tip and the depth from visceral pleura to the needle tip. A post-procedural CT scan identified procedure-related complications that included the leakage of injecting materials and pneumothorax; in addition we recorded the extent shape and density of radio-opacity of MLM after injection. The extent of MLM was defined as a maximum diameter of the radio-opacities. The shape of radio-opacity was categorized into 3 groups (small faint nodular scattered nodular and discrete compact nodular). We recorded the injection time to measure the time interval between injection and sacrifice. Fluoroscopic examinations A successful localization of lipiodol was determined by fluoroscopic examination; subsequently we evaluated the radio-opacity of MLM using the fluoroscopy X-ray unit (BV Pulsera; Philips Medical Systems Best The Netherlands) at the immediate post-procedure session and the follow up session at 6 hr in Group A and 24 hr in Group B. The parameters of fluoroscopy were: tube voltage of 59 kV and tube current of 946 mA. We obtained anteroposterior fluoroscopic images of the thorax of the rabbit with a 17 cm of field of view. A radio-opaque ruler of 5 cm was located near the rabbit in order to estimate the exact size of lipiodol opacity. We recorded the time of the fluoroscopic examinations and the radiographic findings of MLM (size and shape of the radio-opacity). Evaluation of the staining and radio-opacity We assessed the directly visible staining on the freshly excised lung surface and radio-opacity of MLM on the fluoroscopic examinations using 4-point scoring in order to compare the localization ability of MLM and methylene blue as a percutaneous injection material. A blind reviewer who was unaware of the injection materials assessed the staining ability. In order to evaluate the staining ability the blind reader reviewed the photographic images of the freshly excised lung specimens obtained before formalin fixations and rated the staining by 4-point scores: 0=non-visualization of staining 1=inappropriate; extensive dispersion made it difficult to find accurate injecting locations 2=acceptable; available to estimate injecting locations in spite of the dispersion and 3=excellent definitely localized staining (Fig. 2). The maximum diameter of the staining extent on the lung surface was measured. We calculated and compared scores and extent of staining between two materials. For the fluoroscopic findings the radio-opacity of MLM was evaluated using 4-point scoring: 0=no detectable radio-opacity 1=inappropriate minimally increased opacity 2=acceptable low density of increased opacity 3=excellent compact nodular increased opacity (Fig. 3). We compared the average scores of initial and follow up fluoroscopic examinations. We considered a score of 0 or 1 as inappropriate and a score of 2 or 3 as appropriate for localization for both staining and radio-opacity. We compared the number of appropriate or excellent localization between MLM and methylene blue. Sacrifice and histopathologic examinations Both freshly excised entire lungs were used as final specimens. The lung tissues were fixed in 10% neutral formalin embedded in paraffin and cut into 5 µm thick slices after we took photographs to record staining on the lung surface. We made 4 axial slices that covered the center of the staining. The slices were subjected to hematoxylin-eosin (H-E) stain to the evaluate lung parenchymal change. We evaluated the presence or absence of neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus. The extent of each histopathologic finding was estimated using visual grading scores as 0 (no) 1 (focal) or 2 (diffuse). Localized parenchymal change (<50% of total area) surrounded by normal lung was defined as focal. Extensive lung parenchymal change (?50% of total area) that replaced normal lung was defined as diffuse. An experienced pathologist with eight years of experience reviewed all slices. The overall severity of the lung parenchymal change was defined as a total score by adding visual grading scores for each histopathologic finding. We compared the overall severity score between MLM and methylene blue as well as between Group A and Group B. Statistical analysis All data are expressed as mean±standard deviation (SD) unless otherwise stated. Comparisons of the average scores were performed by two-tailed unpaired Student's t-test or Mann-Whitney test. We used a Fisher's exact test to compare the number of subjects in the subgroups. Linear by linear association evaluated the association of the extent of lung parenchymal change and materials or groups. Null hypotheses of no difference were rejected if the P values were less than 0.05. The statistical analysis was performed with commercially available statistical software IBM SPSS Statistics version 20.0 (IBM Corp. in Armonk NY USA). RESULTS Subject characteristics procedural records time interval of injection and examinations Among the 24 subjects included in our study successful CT-guided percutaneous injections into the desired location of the lung were achieved in 21 subjects (11 in Group A and 10 in Group B). Three subjects died during anesthesia. Mean weight was 3.2±0.2 kg for Group A and 3.3±0.2 kg for Group B. Injection depth from visceral pleura to needle tip was 0.4±0.1 cm (range: 0.3-0.6 cm) for MLM and 0.4±0.1 cm (range: 0.3-0.7 cm) for methylene blue (P=0.43). Distance from skin to needle tip was 2.8±0.6 cm (range: 2.1-5.0 cm) for MLM and 2.8±0.3 cm (range: 2.2-3.5 cm) for methylene blue (P=0.83). Of 42 CT-guided percutaneous injections total number of procedure related complications was 10 (24%) including 7 leakage (all in MLM) and 3 pneumothorax (2 in MLM 1 in methylene blue). The complication rate in MLM was significantly higher than methylene blue (43% vs 5%) (P=0.004). On post-procedural CT images the extent of the radio-opacity of MLM was 1.3±0.4 cm (range: 0.7-2.0 cm) for Group A and 0.6±0.3 cm (range: 0.3-1.1 cm) for Group B. Discrete compact nodular opacity was achieved in 15 subjects (72%) scattered nodular opacities in 3 (14%) and small faint opacity in 3 (14%) (Fig. 4). The average value of radio-opacity of MLM was 1415±856 HU (range: 307-2768 HU). The interval between injection and sacrifice was 7.9±0.1 hr (range: 7.8-8.0 hr) for Group A and 23.5±0.1 hr (range: 23.4-23.7 hr) for Group B. Time from injection to initial and follow up fluoroscopy was 3.4±0.5 hr (range: 2.5-4.2 hr) and 6.8±0.4 hr (range: 6.3-7.7 hr) for Group A and 1.5±0.4 hr (range: 0.9-2.1 hr) and 22.6±0.4 hr (range: 21.9-23.2 hr) for Group B respectively. Scores and extent of staining and radio-opacity Table 1 demonstrates the staining extent and localization ability of MLM and methylene blue. In total groups the staining extent of MLM was significant smaller than methylene blue (0.6 cm vs 1.0 cm P<0.001). MLM showed a significantly higher staining ability score than methylene blue (2.8 vs 2.2 P=0.010). Radio-opacity in the initial fluoroscopy was not significantly different from the follow up (2.0 vs 1.9 P=0.49). Table 2 showed the number of subjects in each score of localization ability of staining or radio-opacity. In Group A appropriate staining was 100% for both MLM and methylene blue. In Group B appropriate staining was 90% for MLM and 70% for methylene blue. Appropriate staining of MLM was not significantly different from that of methylene blue (95% vs 86% P=0.61); however excellent staining in MLM was significantly higher than methylene blue (81% vs 38% P=0.011) (Table 3). Table 4 shows the localization ability of MLM regarding both staining ability and radio-opacity. There was no subject with a score of 0 or 1 in both radio-opacity and staining. MLM achieved appropriate staining or radio-opacity in 21 subjects (100%) with a dual localization feature. Histopathologic findings Table 5 demonstrates the results of the histopathologic findings. In all lung specimens both methylene blue and MLM showed acute lung parenchymal change that included neutrophil infiltration hemorrhage and foam cell in alveolus (Fig. 4). Comparing the two materials the number of specimen having neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus was similar in each extent. In terms of all features the number of specimen that showed diffuse extent was more in Group B than Group A for both MLM and methylene blue. The extent of the histopathologic findings was not significantly associated with the materials for all histopathologic features (Table 5). Among the histopathologic findings the extent of vasculitis was significantly associated with Group for both MLM and methylene blue (P=0.002 for both MLM and methylene blue). Focal or diffuse extent of vasculitis was more frequently found in Group A than Group B (P=0.001 for both MLM and methylene blue). The overall severity of lung parenchymal change was not different between MLM and methylene blue (5.6±1.6 vs 5.7±1.5 P=0.839); in addition Group B showed a significantly higher overall severity score of lung parenchymal change than Group A (6.6±1.6 vs 4.7±0.9 P=0.005). DISCUSSION The results of this study show that MLM is a useful percutaneous injection material for a successful localization in the lung. The average staining score of MLM was significantly higher than methylene blue (2.8±0.5 vs 2.2±0.7 P=0.010). In terms of staining the appropriate localization rate (acceptable or excellent staining) in our study was 95% using MLM. The result was in close agreement with previous studies that showed a high success performance rate of lipiodol localization (99%-100%) (21-23). An appropriate localization rate (acceptable or excellent staining) of methylene blue injection was 86% in our study. This is lower than the results found in previous studies where the success rate of methylene blue injection was 96%-100% (18 20). We found that an acceptable (or excellent staining rate) of MLM and methylene blue was not significantly different (95% vs 86% P=0.610). However MLM showed excellent staining for localization in 17 (81%) of 21 subjects and was significantly higher than methylene blue (38%) (P=0.011). The results indicate that lipiodol reduced the spread of methylene blue. This is the first study to indicate that MLM is an available percutaneous injection material for localization with superior staining ability compared to methylene blue. The complication rate was 43% in MLM and 5% in the methylene blue (P=0.004). Possible complications after percutaneous injection for pulmonary localization include pneumothorax leakage hemorrhage pain hemoptysis hemothorax and embolism. Previous studies reported that the complication rate was 17-29% for lipiodol and 33% for methylene blue (2023 24). The complication rate of MLM in the current study was higher than the results of previous studies mainly due to the leakage of MLM into the pleural cavity (n=9). This difference was probably because the distance from the pleura to the injecting needle tip (0.4±0.1 cm for MLM) was inadequate to avoid leakage into the pleural cavity. In the previous studies of lipiodol marking for localization the mean distance from the pleura to the target nodule was 1.0-1.9 cm (22-24) more than twice our study. The results indicate that the high complication rate of our study is associated with the inserting procedure of the needle rather than MLM itself. The dispersion of methylene blue throughout the lung parenchyma may lead to unnecessarily large wedge resections; in addition some have reported instances of the dispersion of methylene blue throughout the entire pleural surface or intraoperative identification failure due to severe anthracosis of the visceral pleura. The failure rate was reported to be 0%-13% with the use of methylene blue (1819 25). The results are similar to our study and indicate that inappropriate staining on the lung surface was 14% in methylene blue. In this study we found that the dispersion of methylene blue in MLM through the lung parenchyma was significantly smaller than methylene blue (0.6±0.3 cm vs 1.0±0.4 cm P<0.05). The result implies that lipiodol reduces the spread of methylene blue in lung parenchyma. Regarding the score of radio-opacity 38% of MLM showed non-visualization or minimally increased opacity on the fluoroscopic examinations. It means the proportion of lipiodol in MLM at the time of the percutaneous injection was too small to be detected. Post-procedural CT images also revealed that 3 subjects had small faint radio-opacity after the injection of MLM. It suggests that the uneven blending of lipiodol and methylene blue occurred during the preparation of MLM. Water-insolubility of lipiodol would result in the uneven mixing of water soluble methylene blue after mechanical blending of the two materials. Further research is required to reduce non-homogeneity of MLM at the time of injection. Previous studies reported the availability of a mixture of methylene blue with other materials such as collagen or autologous blood (15 16). They performed VATS resection on the same day as localization. In our study we evaluated the localization ability of MLM on the same day of localization (6 hr) as well as 24 hr after injection. Localization is usually performed on the day of surgery. This requires the simultaneous use of the CT and the operating room which is not always available. Surgeries on the next day of localization were reported in several published articles (26 27). MLM shows a prolonged localization ability of up to 24 hr in terms of staining ability and radio-opacity. Stable localization ability is the advantage of MLM in our study. Due to uneven blending of MLM one subject (10%) showed inappropriate staining and appropriate radio-opacity and required an intraoperative fluoroscopic examination to detect MLM. Possible radiation exposure is a drawback of MLM. We would like to justify the use of intraoperative fluoroscopy because the operator can avoid radiation exposure with a lead apron. In regards to the risk-benefit for patients lowering the risk of detection failure is thought to be more important than radiation exposure. Histopathologic examinations showed lung parenchymal changes in all specimens. Both methylene blue and MLM induced acute lung injury that included neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus (Table 5). The results of our study are similar to those of a previous study by Kwon et al. (28) that showed that lipiodol led to acute lung injury. They described that lipiodol creates the histopathologic feature of acute lung injury such as peripheral endothelial cell damage neutrophil infiltration necrosis hemorrhage alveolar wall destruction vasculitis emboli (or thrombi in arteriole) and macrophages in the alveolar space (28). In our results the extent of lung parenchymal change was not associated with the materials for all histopathologic features. In addition the overall severity score of lung parenchymal change in MLM was not different from methylene blue (5.6 and 5.7 P=0.839). This suggests that MLM shows similar histopathologic effects in the lung parenchyma to methylene blue. The overall severity score of parenchymal change was higher in Group B (follow up interval of 24 hr) than Group A (follow up interval of 6 hr) (6.6 vs 4.7 P=0.005). The extent of lung parenchymal change depends on the time interval. Acute lung injury after the percutaneous injection of lipiodol or methylene blue was reported in animal studies (28 29); however there are no clinical results that show the adverse effect of acute lung injury in human lungs. Injection material (such as barium) can potentially complicate the pathologic diagnosis of the target lesion due to acute inflammation (29 30). To our knowledge no study has indicated that lipiodol or methylene blue hinders the histopathologic diagnosis of target lesions in human lungs. The small amount of material injection in human lungs might not create a significant parenchymal change or disrupt underlying lung disease. It is necessary to avoid directly injecting materials into the target lesion in human lungs in order to avoid the adverse effect of injection materials on underlying lung disease (especially ground glass opacity nodule or potential benign lesion). There were several limitations in our study. First we included only a small number of subjects. Second the overall localization success rate was low and the complication rate was high (compared to the results of previous studies) due to the difficulty in an accurate percutaneous injection at the desired location and depth in the small sized rabbit lung. Third we used a 1 mL syringe with manual administration to inject materials in the lung parenchyma and there were possible individual difference in the administering volume of materials. Fourth we could not evaluate complications such as intractable pain material related anaphylaxis or embolism. Fifth we could not evaluate if the histopathologic changes had any effect on underlying lung disease because the lung parenchyma of the experimental rabbits were normal. Finally we did not evaluate a successful localization for the true target lesion in lung parenchyma. The criteria for appropriate staining and radio-opacity were subjective. We expect that further clinical studies might provide an answer to if MLM can be a useful percutaneous injection material for localization in the human lung. In conclusion MLM is available for percutaneous injection for the pulmonary localization. The results of this study showed that MLM provides superior ability for appropriate localization than that of methylene blue. Further research on human lungs can clarify the availability of MLM as a CT guided percutaneous injection material. This study was supported by grant from the Seoul National University College of Medicine Research Fund 2012 (800-20120036). We have no potential conflicts of interest or commercial involvement to disclose. 1 Nakashima S Watanabe A Obama T Yamada G Takahashi H Higami T Need for preoperative computed tomography-guided localization in video-assisted thoracoscopic surgery pulmonary resections of metastatic pulmonary nodules Ann Thorac Surg 2010 89 212 218 20103238 2 Chen S Zhou J Zhang J Hu H Luo X Zhang Y Chen H Video-assisted thoracoscopic solitary pulmonary nodule resection after CT-guided hookwire localization: 43 cases report and literature review Surg Endosc 2011 25 1723 1729 21181200 3 Ciriaco P Negri G Puglisi A Nicoletti R Del Maschio A Zannini P Video-assisted thoracoscopic surgery for pulmonary nodules: rationale for preoperative computed tomography-guided hookwire localization Eur J Cardiothorac Surg 2004 25 429 433 15019673 4 Suzuki K Nagai K Yoshida J Ohmatsu H Takahashi K Nishimura M Nishiwaki Y Video-assisted thoracoscopic surgery for small indeterminate pulmonary nodules: indications for preoperative marking Chest 1999 115 563 568 10027460 5 Seo JM Lee HY Kim HK Choi YS Kim J Shim YM Lee KS Factors determining successful computed tomography-guided localization of lung nodules J Thorac Cardiovasc Surg 2012 143 809 814 22104686 6 Gossot D Miaux Y Guermazi A Celerier M Friga J The hook-wire technique for localization of pulmonary nodules during thoracoscopic resection Chest 1994 105 1467 1469 8181339 7 Pittet O Christodoulou M Pezzetta E Schmidt S Schnyder P Ris HB Video-assisted thoracoscopic resection of a small pulmonary nodule after computed tomography-guided localization with a hook-wire system: experience in 45 consecutive patients World J Surg 2007 31 575 578 17318707 8 Chen W Chen L Yang S Chen Z Qian G Zhang S Jing J A novel technique for localization of small pulmonary nodules Chest 2007 131 1526 1531 17494801 9 Bernard A Resection of pulmonary nodules using video-assisted thoracic surgery: the Thorax Group Ann Thorac Surg 1996 61 202 204 8561553 10 Martin AE Chen JY Muratore CS Mayo-Smith WW Luks FI Dual localization technique for thoracoscopic resection of lung lesions in children J Laparoendosc Adv Surg Tech A 2009 19 S161 S164 18999984 11 Kawanaka K Nomori H Mori T Ikeda K Ikeda O Tomiguchi S Yamashita Y Marking of small pulmonary nodules before thoracoscopic resection: injection of lipiodol under CT-fluoroscopic guidance Acad Radiol 2009 16 39 45 19064210 12 Yamagami T Miura H Yoshimatsu R Tanaka O Ono S Iehara T Hosoi H Nishimura T Experience of fluoroscopy-aided thoracoscopic resection of pulmonary nodule localised with Lipiodol in a child J Med Imaging Radiat Oncol 2011 55 401 403 21843175 13 Iwasaki Y Nagata K Yuba T Hosogi S Kohno K Ohsugi S Kuwahara H Takemura Y Yokomura I Fluoroscopy-guided barium marking for localizing small pulmonary lesions before video-assisted thoracic surgery Respir Med 2005 99 285 289 15733503 14 Yoshida J Nagai K Nishimura M Takahashi K Computed tomography-fluoroscopy guided injection of cyanoacrylate to mark a pulmonary nodule for thoracoscopic resection Jpn J Thorac Cardiovasc Surg 1999 47 210 213 10402768 15 Nomori H Horio H Colored collagen is a long-lasting point marker for small pulmonary nodules in thoracoscopic operations Ann Thorac Surg 1996 61 1070 1073 8607658 16 McConnell PI Feola GP Meyers RL Methylene blue-stained autologous blood for needle localization and thoracoscopic resection of deep pulmonary nodules J Pediatr Surg 2002 37 1729 1731 12483642 17 Hu J Zhang C Sun L Localization of small pulmonary nodules for videothoracoscopic surgery ANZ J Surg 2006 76 649 651 16813634 18 Wicky S Mayor B Cuttat JF Schnyder P CT-guided localizations of pulmonary nodules with methylene blue injections for thoracoscopic resections Chest 1994 106 1326 1328 7956378 19 Vandoni RE Cuttat JF Wicky S Suter M CT-guided methylene-blue labelling before thoracoscopic resection of pulmonary nodules Eur J Cardiothorac Surg 1998 14 265 270 9761435 20 Lenglinger FX Schwarz CD Artmann W Localization of pulmonary nodules before thoracoscopic surgery: value of percutaneous staining with methylene blue AJR Am J Roentgenol 1994 163 297 300 7518642 21 Ikeda K Nomori H Mori T Kobayashi H Iwatani K Yoshimoto K Kawanaka K Impalpable pulmonary nodules with ground-glass opacity: success for making pathologic sections with preoperative marking by lipiodol Chest 2007 131 502 506 17296654 22 Nomori H Horio H Naruke T Suemasu K Fluoroscopy-assisted thoracoscopic resection of lung nodules marked with lipiodol Ann Thorac Surg 2002 74 170 173 12118752 23 Watanabe K Nomori H Ohtsuka T Kaji M Naruke T Suemasu K Usefulness and complications of computed tomography-guided lipiodol marking for fluoroscopy-assisted thoracoscopic resection of small pulmonary nodules: experience with 174 nodules J Thorac Cardiovasc Surg 2006 132 320 324 16872957 24 Kim YD Jeong YJ I H Cho JS Lee JW Kim HJ Lee SH Kim DH Localization of pulmonary nodules with lipiodol prior to thoracoscopic surgery Acta Radiol 2011 52 64 69 21498328 25 Mayo JR Clifton JC Powell TI English JC Evans KG Yee J McWilliams AM Lam SC Finley RJ Lung nodules: CT-guided placement of microcoils to direct video-assisted thoracoscopic surgical resection Radiology 2009 250 576 585 19188326 26 Lee NK Park CM Kang CH Jeon YK Choo JY Lee HJ Goo JM CT-guided percutaneous transthoracic localization of pulmonary nodules prior to video-assisted thoracoscopic surgery using barium suspension Korean J Radiol 2012 13 694 701 23118567 27 Kamiyoshihara M Ishikawa S Morishita Y Pulmonary cryptococcosis diagnosed by video-assisted thoracoscopic surgery with CT-guided localization: report of a case Kyobu Geka 2000 53 795 797 10935411 28 Kwon WJ Kim HJ Jeong YJ Lee CH Kim KI Kim YD Lee JH Direct lipiodol injection used for a radio-opaque lung marker: stability and histopathologic effects Exp Lung Res 2011 37 310 317 21574876 29 Jang HS Effect of drugs for preoperative localization of thoracoscopy to histopathologic change in rabbit lung Seoul the Catholic University of Korea 2000 27 Dissertation 30 Okumura T Kondo H Suzuki K Asamura H Kobayashi T Kaneko M Tsuchiya R Fluoroscopy-assisted thoracoscopic surgery after computed tomography-guided bronchoscopic barium marking Ann Thorac Surg 2001 71 439 442 11235684 Fig. 1 Overview of the experimental design. Animals were randomly divided into two groups: Group A (n = 12) was sacrificed 6 hr after percutaneous injection and Group B (n = 12) was sacrificed 24 hr after a CT guided percutaneous injection of MLM and methylene blue. Fig. 2 Examples of evaluation of staining on the lung surface. Photographs show (A) the extensive staining (score 1) (B) localized dispersion of staining (score 2) and (C) minimal dispersion of staining (score 3). The white lines on the bottom of the figure are markings of the ruler. The distance between two lines is one centimeter. Fig. 3 Examples of assessment of radio-opacity on the fluoroscopic examinations. The fluoroscopic images show (A) a minimally increased opacity (arrow) (score 1) (B) a low density of increased opacity (arrow) (score 2) and (C) a compact nodular increased opacity (arrow) (score 3). Fig. 4 CT and corresponding photomicrograph of lung specimen. MLM in Group B (A-D); (A)"
Lung_Cancer
"Toxicity was not significantly correlated with a specific TS genotype. Thymidylate synthase Polymorphisms Epidermal growth factor receptor Predictive factors Prognostic factors Non-small cell lung cancer Background Lung cancer represents the most frequent cause of cancer deaths. More than 225000 new cases were diagnosed during 2012 only in the United States of America accounting for approximately 160000 annual deaths [12]. More than 50% of the patients diagnosed with non-small cell lung cancer (NSCLC) present advanced disease (stage III and IV) at onset. The most common histology is adenocarcinoma representing approximately 80% of all cases [3]. Pemetrexed is a multitargeted antifolate drug and one of the latest active drugs against NSCLC [4] approved for the first-line [5] (in combination with cisplatin) [6] and second-line treatment (monotherapy) of patients with non-squamous histology [7]. More recently pemetrexed gained approval for its use as a single-agent maintenance therapy [8] after response/stabilization to four cycles of a platinum doublet with or without pemetrexed. Thymidylate synthase (TS) is the main biological target of antifolate drugs such as pemetrexed or 5-fluorouracil. Different studies have evaluated the correlation between tumor TS expression and TS genotype and the prognosis of patients with different cancer types treated with antifolates [9-11]. In NSCLC constitutive expression of TS is lower in tumors with adenocarcinoma histology than among those with squamous differentiation [12]. This finding could possibly explain the higher efficacy of the drug among non-squamous histology patients. The potential predictive role of TS polymorphisms in NSCLC has never been studied in a European population. In addition how differential TS genotypes may impact on the outcome of patients depending on their smoking status or with Epidermal Growth Factor Receptor (EGFR) activating mutations tumors is to be determined. Finally although the toxicity profile described in most patients receiving pemetrexed in combination or as a single agent is usually favorable there are several reported cases of fundamentally dermatological hematological and potentially serious renal toxicities even when the recommended vitamin prophylaxis guidelines have been followed [13-15]. Nonetheless the tumor TS levels or its polymorphisms in each patient could explain these cases of severe toxicity as it has been suggested in other neoplasms treated with other antifolate drugs [9]. The potential association between different TS genotypes and the toxicity experienced by a European population of patients with NSCLC receiving pemetrexed is also to be studied. Three different types of polymorphisms have been described in the TS gene. In the gene promoter there is a variable number of tandem repeats (VNTR) of 28 pb in the 5?- region. Thus cases of two or three repetitions of this tandem TS gene promoter enhancer region (TSER) have been described [16]. A second type of polymorphism consists in a change in a single nucleotide (G >?C) in one of the sequences of the repetition comprising a single nucleotide polymorphism (SNP) [16]. A third modality of polymorphisms consists in the deletion or insertion of 6 pair of bases (bp) in the 3?-UTR region (untranslated region) [16]. In summary the potential usefulness of TS genotype as an independent prognostic factor or predictor of response to pemetrexed-based regimens in a European NSCLC population has not been studied. Similarly no clear evidence is available about the potential correlation between the different TS genotypes and the toxicity experienced by those patients. Therefore we decided to investigate the three known polymorphisms of TS gene and their correlation with objective response rate (ORR) progression-free survival (PFS) and overall survival (OS) as well as toxicity in European patients with advanced NSCLC treated with pemetrexed-based regimens. Methods Patients and samples Overall 25 consecutive stage III-IV NSCLC patients treated at a single institution from which peripheral blood samples were available were analyzed. All of them received pemetrexed-based regimens in the first second or third line settings according to our institutional therapeutic protocols. After the informed consent was obtained from all patients 10 ml of peripheral blood samples were collected before the administration of the first cycle of a pemetrexed-containing regimen. "
Lung_Cancer
".0087629.g002 Example of a progressive patient on PET (mP) and conventional imaging. Progressive patient with right upper lobe NSCLC associated with mdiastinal lymphadenopathy lung and bone metastases (patient #2). Sum of the SUVmax of the 5 most hypermetabolic lesions (2 lung lesions 2 mediastinal lymph nodes one hilar lesion) were 35.2 44.3 (+26%) and 59.9 (+70%) for PET1 PET2 (% versus PET1) and PET3 (% versus PET1) respectively. Based on a SUVmax cut-off value of ?21.6 the patient was classified as mP on PET2 in accordance with RECIST evaluation on CT scan (performed 57 days after starting erlotinib). mP was confirmed on PET3 with the appearance of a new lesion (subcarinal adenopathy) and a 70% increase of SUVmax. .0087629.g003 New subcarinal adenopathy on PET3 (same patient as ). .0087629.g004 Example of an mNP patient. Non-progressive patient with right upper lobe NSCLC associated with mediastinal lymphadenopathy lung liver and bone metastases (patient #6). Sum of the SUVmax of the 5 most hypermetabolic lesions (2 lung lesions 2 mediastinal lymph nodes one liver lesion) were 45.6 19.7 (?56.7%) and 12.7 (?72%) for PET1 PET2 (% versus PET1) and PET3 (% versus PET1) respectively. Based on a SUVmax cut-off value of ?21.6 the patient was classified as mNP on PET2 in accordance with RECIST evaluation on CT scan (performed 58 days after starting erlotinib). mNP was confirmed on PET3 with almost complete extinction of the various lesions and a 72% decrease of SUVmax. .0087629.g005 Example of left lower lobe pulmonary target lesion (same patient as ). .0087629.g006 Example of a patient with discordant PET2 and conventional imaging. Patient with right upper lobe NSCLC associated with subcarinal lymphadenopathy and ipsilateral lung metastasis (patient #9). Sum of the SUVmax of the most hypermetabolic lesions (2 lung lesions 1 mediastinal lymph node) were 25.2 29.3 (+16.3%) and 23.8 (?5.4%) for PET1 PET2 (% versus PET1) and PET3 (% versus PET1) respectively. Based on a SUVmax cut-off value of ?21.6 the patient was classified as mP on PET2 in contrast with RECIST evaluation on CT scan (performed 71 days after starting erlotinib). This patient was subsequently reclassified as mNP on PET3 in accordance with RECIST evaluation with a 5.4% decrease of SUVmax (cut-off: 18.5%). In 9/10 patients semi-quantitative analysis on PET3 revealed response information concordant with PET2 studies. ROC analyses were also performed for SUV changes between PET1 and PET3. For SUVmax sensitivity specificity PPV NPV and accuracy were 0.810.83 1 and 0.9 respectively for an ?18.5% cut-off value and an AUC of 0.76 (95% CI; 0.44 to 1.08; P?=?0.17). For SUVpeak sensitivity specificity PPV NPV and accuracy were 10.81 0.83 and 0.9 respectively for a ?3.9% cut-off value with an AUC of 0.8 (95% CI; 0.5108 to 1.089; P?=?0.12). Patients were classified identically with SUVmax and SUVpeak (4 with true progressive disease 5 with true non-progressive disease and one with false non-progressive disease). Due to the appearance of new lesions on PET the patient #7 who was falsely classified as NP by semi-quantitative analysis of PET was correctly reclassified as P. Finally PET3 correctly classified all 10 patients (5 in group P; 5 in group NP) in whom a third [18F]FDG-PET was performed when compared with RECIST evaluation (P?=?.0079 Fisher's exact test). Patient outcome PFS and OS were 91 and 338 days respectively. Using the SUVmax or SUVpeak cut-off defined by ROC analyses on PET2 patients were classified into 2 groups: metabolic progressive (n?=?8; mP) or metabolic non-progressive (n?=?4; mNP). mNP patients showed prolonged PFS (n?=?4; median survival 292 days) compared to mP patients (n?=?8; median 64 days) (HR 0.27; 95% CI 0.04 to 0.59; P?=?0.007; ). Improved PFS observed in mNP patients was followed by prolonged OS (1031 days versus 1249 days; HR 0.34; 95% CI 0.06 to 0.84; P?=?0.03; ). The first patient with EGFR mutation showed a PFS and OS of only 190 days and 296 days respectively due to erlotinib toxicity (grade IV neurotoxicity) resulting in early discontinuation of treatment. The second patient with EGFR mutation achieved the longest PFS and OS (727 and 1249 days respectively). .0087629.g007 Kaplan-Meier estimates of PFS and OS. No statistically significant difference (P?=?0.007) in PFS was observed between metabolic non-progressive (mNP) patients (median PFS 292 days ; range 190“727) and metabolic (mP) progressive patients (median PFS 64 days ; range: 37“216). Improved PFS in non-progressive patients was associated with prolonged OS (mNP; n?=?4; median OS: 1031 days ; 296 to 1249 days versus mP; n?=?8 ; 337 5 days ; 71 to 734 days) (HR 0.34; 95% CI 0.06 to 0.84; P?=?0.03). Discussion Despite the widespread use of [18F]FDG-PET/CT in NSCLC staging a large-scale study recently failed to confirm an overall survival gain in NSCLC patients.[17] This result highlights the value of [18F]FDG-PET/CT in unmet clinical needs such as prediction of residual NSCLC after surgery[18] neoadjuvant therapy[19] or antineoplastic therapy.[20] Prediction of response to antineoplastic therapies would appear to be particularly adapted to targeted therapies that do not induce rapid tumor shrinkage. NSCLC preclinical models have validated this hypothesis with both gefitinib[21] and erlotinib.[22] This original method could compensate for the weakness of RECIST criteria and has led to the proposal of evaluation of new criteria by addition metabolic evaluation by FDG-PET to CT scan.[23] The value of PET in evaluation of response to new targeted therapies emerged in the early 2000 s with the first reports on the efficacy of imatinib mesylate in Gastro Intestinal Stromal Tumor (GIST). Subsequently many studies have confirmed that PET is able to identify very early (i.e. only 24 hours after initiation of treatment) a decrease in glucose metabolism which is correlated with overall survival and progression-free survival of patients with GIST.[24] [25] In the present exploratory study a decrease in SUVmax of at least 21.6% soon after starting therapy (9±3 days) was able to discriminate progressive from non-progressive patients and was associated with improved PFS and OS. This result confirms the results of Mileshkin et al. who showed in a series of 51 patients receiving second- or third-line treatment with erlotinib that an early (14 days) [18F]FDG-PET partial metabolic response was associated with improved PFS and OS even in the absence of subsequent RECIST response.[26] Evaluation of response by [18F]FDG-PET can be performed semi-quantitatively for instance by establishing a SUV cut-off to discriminate metabolic progressive patients from non-metabolic progressive patients. This patient classification (mP/mNP) seems to be more appropriate to assess response to cytostatic therapy that is designed to stabilize disease rather than achieve complete response. The main difficulty of this approach is the overlap of SUV changes between mP and mNP patients. Furthermore different cut-off variations can be expected depending on the types of SUV measured the types of drugs used and the types of tumors which increase the difficulty of establishing a reliable SUV cut-off. However despite the absence of consensus on the most appropriate cut-off value it is generally admitted that the rationale for metabolic response or non-progression of tumor is decreased [18F]FDG tumor uptake or at least stability of tumor uptake over time respectively. Another limitation of semi-quantitative analysis of FDG-PET is that it does not take into account the development of new lesions. However PET detection of new lesions early in the course of therapy has been reported to be a strong independent predictive factor of OS in NSCLC patients treated by EGFR inhibitor.[27] Our findings are consistent with this observation as new lesions occurred in 2/8 patients correctly classified as progressive on PET2 and in 4/5 patients correctly classified as progressive on PET3. One patient (patient #7) was reclassified as mP on PET3 due to the appearance of a new lesion despite a decrease of SUVmax to below the cut-off value. As in our study previous studies failed to demonstrate any difference between SUVmax and SUVpeak.[22] [28] However SUVmax remains the standard for semi-quantitative [18F]FDG-PET assessment probably because is a parameter that can be reliably reproduced by independent operators. It is noteworthy that in our study no significant difference in mean SUV values was observed between PET1 PET2 and PET3 which can be explained by the nature of the cytostatic therapy. 11/12 patients were correctly classified (P versus NP) by PET2 and 10/10 were correctly classified by PET3 by applying the SUV cut-off determined by ROC analysis. In 9/10 patients PET3 revealed response information concordant with PET2. The only patient with discordant [18F]FDG-PET findings was classified by SUV analysis as progressive on PET2 and non-progressive on PET3. Blood glucose injected dose or uptake time were normal and/or not significantly different between PET2 and PET3 (1.16 and 1.4 g/l; 261 and 262 MBq; 60 and 75 min respectively) excluding any to methodology-related error. A flare-up phenomenon could be proposed as described on several occasions on [18F]FDG-PET during cytotoxic treatments for squamous cell carcinoma in prostate cancer patients with bone metastases[29]“[33] and particularly NSCLC patients treated with erlotinib presenting an osteoblastic bone flare-up response mimicking disease progression.[34] Benz et al also described a case of flare-up on early PET in a NSCLC patient treated by erlotinib.[27] Another explanation is that the P/NP classification probably increases mismatches of response assessments related to a discordant outcome of patients with stable disease.[27] Our results suggest that therapeutic efficacy PFS and OS of erlotinib therapy can be predicted 2 weeks after starting erlotinib. These data are consistent with the data of a retrospective study recently published by Kobe et al.[26] [35] At the present time anticancer therapy is currently monitored in the context of hormone-sensitive cancers by regular assay of tumor markers (such as prostate-specific antigen in prostate cancer). The efficacy of hormonal therapy is reflected by a decrease in blood levels of the marker. When the marker remains elevated hormonal therapy is considered to be ineffective and is therefore stopped. Repeated PET imaging can be considered to be a promising approach to evaluate cancer therapy such as targeted therapies that do not induce tumor shrinkage. This new approach appears to be supported by the results of recent clinical trials. The ˜Tarceva Versus Docetaxel or Pemetrexed for Second Line Chemotherapy of Advanced Stage NSCLC™ (TITAN) trial failed to demonstrate an improvement in OS with erlotinib compared to chemotherapy in unselected NSCLC patients receiving second-line treatment (HR?=?0.96; 95% CI 0.78“1.19; p?=?0.73).[36] In a similar group of NSCLC patients the results of the TAILOR trial indicated a highly significant increase of PFS in favor of docetaxel (HR?=?0.71; 95% CI 0.53“0.95; p?=?0.02) versus erlotinib.[37] We consider that evaluation of the metabolic response to erlotinib could provide useful information to rapidly identify patients in whom erlotinib therapy is ineffective especially in EGFR patients without EGFR-activating mutations or unknown status. [18F]FDG-PET could also become a theranostic tool for clinicians. By stopping ineffective therapy earlier physicians can rapidly propose other drugs to a larger proportion of patients with better performance status. This approach could increase the number of patients included in early trials and accelerate drug development. However no medico-economic study has been conducted to determine whether the additional costs induced by [18F]FDG-PET are compensated by the decreased costs of drug (erlotinib) and medical care induced by side effects. Our study highlights the need for more prospective and randomized studies to evaluate the theranostic use of [18F]FDG-PET for management of erlotinib therapy in NSCLC including medico-economic considerations."
Lung_Cancer
"Non-Small-Cell Lung Cancer J Exp Clin Cancer Res 2012 31 77 22992338 PLoS One one 1932-6203 Public Library of Science San Francisco USA 24887068 4041776 PONE-D-14-02596 .0098621 Research Medicine and Health Sciences Oncology Cancer Treatment Radiation Therapy Feasibility of Proton Transmission-Beam Stereotactic Ablative Radiotherapy versus Photon Stereotactic Ablative Radiotherapy for Lung Tumors: A Dosimetric and Feasibility Study Lung SABR Using Transmission Proton Beams Mou Benjamin Beltran Chris J. * Park Sean S. Olivier Kenneth R. Furutani Keith M. Department of Radiation Oncology Mayo Clinic Rochester Minnesota United States of America Deutsch Eric Editor Institut Gustave Roussy France * E-mail: Beltran.Chrismayo.edu Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: BM KMF SSP KRO CJB. Analyzed the data: BM KMF SSP KRO CJB. Contributed reagents/materials/analysis tools: BM KMF SSP KRO CJB. Wrote the paper: BM KMF SSP KRO CJB. 2014 2 6 2014 9 6 e98621 21 1 2014 6 5 2014 2014 Mou et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Stereotactic ablative radiotherapy is being increasingly adopted in the treatment of lung tumors. The use of proton beam therapy can further reduce dose to normal structures. However uncertainty exists in proton-based treatment plans including range uncertainties large sensitivity to position uncertainty and calculation of dose deposition in heterogeneous areas. This study investigated the feasibility of proton transmission beams i.e. without the Bragg peak to treat lung tumors with stereotactic ablative radiotherapy. We compared three representative treatment plans using proton transmission beams versus conformal static-gantry photon beams. It was found that proton treatment plans using transmission beams passing through the patient were feasible and demonstrated lower dose to normal structures and markedly reduced treatment times than photon plans. This is the first study to demonstrate the feasibility of proton-based stereotactic ablative radiotherapy planning for lung tumors using proton transmission beams alone. Further research using this novel approach for proton-based planning is warranted. The authors have no support or funding to report. Introduction Stereotactic ablative radiotherapy (SABR) plays an essential role in the treatment of patients with medically inoperable early stage lung cancer and oligometastasis. The use of protons for lung SABR is emerging as an appealing treatment option because of its potential to deliver higher doses of conformal radiotherapy and spare normal tissues better than traditional photons [1] [2] [3] [4]. This can be achieved because of the natural characteristics of proton beams that deposit its dose at depth with no exit dose referred to as a Bragg peak. However conventional dosimetric models fail to accurately model how protons scatter and deposit dose in highly heterogeneous areas which leads to uncertainties in proton treatment plans [5]. In addition the uncertainties in the stopping power of the various tissues in the body and the interplay effect between spot scanning proton therapy and the target motion leads to large uncertainties in the treatment of lung tumors [5] [6]. In this study we report on the feasibility of proton transmission-beam SABR (PT-SABR) for lung tumors which uses the transmission portion of a spot scanning proton beam i.e. without the Bragg peak. This technique eliminates the major uncertainties of proton therapy mentioned above by having the proton beams pass through the patient. In addition the use of the transmission beam allows an entire field to be treated in one breath hold. This quick treatment and decreased uncertainties lead to smaller planning volumes. To the best of the authors™ knowledge this is the first report on the use of this novel approach to plan SABR with protons without using the Bragg peak which may have dosimetric advantages over photon treatments. Materials and Methods Ethics Statement Written informed consent was obtained from all patients registered in the SABR database. This study including the consent procedure was approved by the Mayo Clinic institutional review board. Patient Cohort Patients were identified from a prospectively collected institutional database of patients treated with SABR. Patients with lung tumors less than one centimetre in maximum dimension were included. The radiation treatment plans of three patients were extracted from the treatment planning system. All patients were treated using three-dimensional conformal multiple static-gantry photon beams. Plans were normalized so that 95% of the planning target volume (PTV) received at least 95% of the prescription dose. The prescription doses for these plans were adjusted to 34 Gy in one fraction based on the recently reported results of Radiation Therapy Oncology Group (RTOG) 0915 which established this dose fractionation regimen as a possible standard dose to be used in future trials [7]. Dose calculations for photon plans used the anisotropic analytical algorithm. Proton Treatment Planning A machine was commissioned in Eclipse v.10 (Varian Medical Systems Palo Alto CA) which allowed for planning and calculating transmission dose plans. The spot size (sigma) of the transmission beam which had an energy of 229 MeV was 2.2 mm. A proton plan that only used the transmission portion of the beam was created for each patient. Proton beam arrangements were selected so that no beams entered through the heart or spinal cord and allowed up to two non-coplanar beams. Four to five beams were used to keep the skin dose comparable to photon plans. The energy of the protons for each spot of a field was 229 MeV; this ensured the Bragg peak was not located within the patient. Dose calculations for the transmission portion of the proton beam were verified with Monte Carlo (Geant4). The proton plans were normalized so that the internal target volume (ITV) receives at least 95% of prescription dose including when range and position errors were included (3.5% and 2 mm) which is standard for spot scanning proton therapy. ITVs were created based on motion of the gross tumor volume in three dimensions using four-dimensional computed tomography image data. The dose constraints from RTOG 0915 were compared for the photon and proton plans as well as the total time that would be required to deliver the treatment. The radiotherapy delivery time per beam was estimated at 1 nC per second for proton therapy which is readily achievable by most spot scanning proton centers and 600 MU per minute for the photon plans. Differences in dosimetric and treatment planning parameters between photon and proton plans were analyzed with two-sided paired t-tests using SAS version 9.2 (SAS Institute Inc. Cary NC). Results The ITVs of the three tumors measured 0.220.42 and 0.99 cubic centimeters. All three proton plans had excellent coverage of the ITV. For all ITVs over 99.4% of the volume received at least 95% of the prescription dose including when uncertainties were examined. This was comparable with the photon plans where 100% of the ITVs received at least 95% of the prescription dose. For most normal tissues lower doses to these ans were achieved with the proton plans compared to the photon plans (). In fact (near) complete sparing of the spinal cord heart and esophagus was possible with protons through careful selection of beam angles (). .0098621.g001 Dose-volume histogram comparison of ans at risk. .0098621.t001 Dosimetric comparison of photon and proton plans. Parameter Photon Proton P-value Mean Range Mean Range Internal target volume (cc) 0.54 0.22“0.99 0.54 0.22“0.99 N/A Spinal cord Maximum dose (Gy) 5.66 2.39“8.07 1.97 0.00“3.06 0.04 Lungs (bilateral) Mean lung dose (Gy) 1.35 0.95“1.92 0.69 0.03“1.36 0.12 V20 (%) 0.66 0.39“1.20 0.49 0.16“1.01 0.06 V5 (%) 7.32 5.4“11.30 6.65 2.96“11.70 0.56 Heart Mean dose (Gy) 8.36 6.27“12.51 0.00 0.00“0.00 0.13 Skin Maximum dose (Gy) 11.75 9.86“13.28 11.40 7.37“16.23 0.89 Esophagus Maximum dose (Gy) 6.49 2.98“9.43 3.40 0.00“7.51 0.05 Homogeneity Index 1.25 1.21“1.29 1.07 1.03“1.11 0.06 Conformity Index 17.14 8.23“30.05 3.47 2.17“4.64 0.15 Proton plans used four to five non-coplanar beams compared to nine to ten beams for photon plans (Figure 2). The average number of monitor units per field was 818 (range 758“871) with photons and only 38 (range 31“59) with protons. This would translate to an average beam-on time per field of 82 seconds versus 6 seconds for photon and proton plans respectively. These differences in monitor units and beam-on time were statistically significant with P<0.01(Table 2). .0098621.g002 Figure 2 Comparison of isodose distributions. Proton (left) and photon (right) treatment plans. .0098621.t002 Table 2 Comparison of treatment time between photon and proton plans. Parameter Photon Proton P-value Mean Range Mean Range Total monitor units (MU) 7929 6820“8713 178 122“235 <0.01 Fields 9.7 9“10 4.7 4“5 N/A Average MU/field 818 758“871 38 30.5“46.9 <0.01 Beam on time per field (seconds) 81.8 75.6“87.1 5.8 4.7“7.2 <0.01 Discussion Exploiting the transmission beam in proton therapy planning has significant potentials for dose escalation and re-irradiation in lung tumors and eliminates the concern over the uncertainty of the stopping power and its impact on the Bragg peak location. PT-SABR planning requires fewer beams than photons and careful selection of optimal beam angles allows for minimal dose to adjacent normal tissues and tumor dose escalation which may translate to improved local control rates. RTOG 0915 showed that 34 Gy in a single fraction was comparable to 48 Gy in four fractions [7] and the dosimetric constraints from the protocol were easily achieved using both proton and photon plans for patients in this study. Further optimization with proton therapy can allow even higher doses to be delivered while still respecting established dosimetric constraints for normal tissues. This may translate to better tumor control but requires more investigation in a clinical setting. Patients planned with PT-SABR required fewer beams (5 vs. 10) which reduce the total treatment time and the low dose outside the tumor. The average monitor units per field for PT-SABR plans"
Lung_Cancer
"Tumor markers play a key role in patient management for many malignancies. The potential uses of serum tumor markers include aiding early diagnosis determining prognosis prospectively predicting response or resistance to specific therapies and monitoring therapy in patients with advanced disease. Kallikrein-related peptidases 11 (KLK11) is a member of the human kallikrein gene family which localized on chromosome 19q13.4 [5]. Recent studies have reported that KLK11 has been expressed in many cancers including prostate cancer [6] ovarian cancer [7] gastric cancer [8] as well as rectal carcinoma [9]. An immunofluorometric assay study demonstrated that KLK11 expression in ovarian cancer tissues is a marker of favorable prognosis since patients with KLK-positive tumors exhibit a longer progression-free survival (PFS) and overall survival (OS) [10]. Additionally Sasaki et al. [11] reported that lower KLK11 mRNA expression in lung cancer is an indicator of poor prognosis in patients with lung cancer. However there seems to be a paucity of research concerned with serum KLK11 expression in NSCLC. For this reason the goal of the present study was to investigate the baseline serum levels of KLK11 in patients with NSCLC to determine its potential diagnostic and prognostic roles. Materials and methods Patients A total of 138 patients with NSCLC were examined at the Nanjing Chest Hospital between January 2006 and May 2008. The cohort of patients included 80 (58.0 %) male and 58 (42.0 %) female subjects with a median age of 56 years (range 45“68 years). The clinical features of the patients are summarized in . Follow-up lasted through December 2012 with a median follow-up period of 22 months for living patients (range 3“80 months). PFS was defined as the time interval between the date of diagnosis and the date of disease relapse. OS was defined as the time interval between the date of diagnosis and the date of death.Clinical characteristics of NSCLC patients and controlsVariablesNSCLCControl P valueSubject no.13840Age year57.8?±?10.254.6?±?7.80.614Male/Female80/5826/140.325Histology?AC78?SCC60 AC adenocarcinoma SCC squamous cell carcinoma The diagnosis of lung cancer was made using various methods: sputum cytology fine-needle aspiration or bronchoscopy as dictated by the patient™s presentation. Pathologists interpreted the cytology or histology of tissue biopsy. Lung cancer was staged using a widely used classification system and the staging procedure included a clinical examination; CT of the chest abdomen and brain; abdominal ultrasonography; bone scanning; and positron emission tomography. The study protocol was approved by the ethics committee of Nanjing Chest Hospital. All patients provided written informed consent before enrollment. Measurement of serum KLK11 levels Serum samples from each individual were obtained at the time of diagnosis before any therapeutic measures were started (surgery chemotherapy or radiation). Samples were centrifuged at 1500—g for 10 min at ?4 °C. The supernatant was stored at ?80 °C for assessment of the levels of KLK11. The KLK11 concentration was determined by ELISA with the commercial KLK11 ELISA Ready-SET-Go kit (eBioscience San Diego CA). All samples were blinded to the technologists running the assays and the code was broken to the statisticians after the database was constructed. Statistical analysis Statistical software (SPSS for Windows version 18) was used for the analysis. Differences between independent groups were examined by the Mann“Whitney U test. To determine the diagnostic accuracy of KLK11 receiver operating characteristic (ROC) curves were retrieved from logistic regression analysis and the area under the curve (AUC) was calculated. Univariate survival analysis was performed using the Kaplan“Meier method and the log-rank test. Multivariate analysis was conducted to determine an independent impact on survival using the Cox proportional hazard method. P?<?0.05 was considered statistically significant. Results Comparison of serum KLK11 levels between NSCLC patients and controls As shown in Fig. 1 the concentration of KLK11 was significantly higher in patients with NSCLC (2.04?±?0.86 ng/ml) than in those with the controls (0.93?±?0.52 ng/ml) (P?<?0.01).Fig. 1Levels of KLK11 in NSCLC. Among 138 NSCLC patients the serum levels of KLK11 were 2.04?±?0.86 ng/ml which were significantly higher than 0.93?±?0.52 ng/ml in healthy controls (P?<?0.01) Diagnostic value of KLK11 in NSCLC A ROC curve analysis was carried out to assess the value of KLK11 in NSCLC. The area under the ROC curve was 0.892 (confidence interval (95 % CI) 0.841“0.942). With a cutoff point of 1.05 ng/ml which was defined as the normal value based on the mean value plus two standard deviation obtained from healthy controls serum KLK11 has a sensitivity of 65.9 % (91/138) a specificity of 82.5 % (33/40) an accuracy of 69.7 % (124/178) a positive predictive value of 92.9 % (91/98) and a negative predictive value of 41.3 % (33/80) (Fig. 2).Fig. 2ROC of KLK11 for the diagnosis of NSCLC. Serum levels of KLK11 among 138 NSCLC patients and 40 healthy controls were determined. The diagnostic potentials of KLK11 were assessed by ROC curves. The AUC value was 0.892 Relationship between serum KLK11 levels and clinicopathologic factors The relationships between KLK11 levels and clinicopathologic factors of lung cancer patients are shown in . The serum KLK11 levels did not differ significantly with age (P?=?0.569) sex (P?=?0.505) or histology (P?=?0.713). The levels of KLK11 were significantly correlated with tumor-node-metastasis (TNM) stage (P?=?0.000) lymph node metastases (P?=?0.000) and distant metastases (P?=?0.000).The clinicopathological factors of NSCLC and the association with KLK11 levelsFactorsnKLk11 (ng/ml) P- valueAge year0.569??60622.07?±?0.77?<60762.12?±?0.66Gender0.505?Male802.16?±?0.82?Female581.99?±?0.53Histology0.713?AC782.05?±?0.85?SCC602.01?±?0.53TNM stage0.000?I“II882.51?±?0.61?III“IV501.76?±?0.63Lymph node metastases0.000?Absent682.41?±?0.64?Present701.65?±?0.57Distant metastases0.000?Absent982.38?±?0.59?Present401.89?±?0.71 AC adenocarcinoma SCC squamous cell carcinoma Association of serum KLK11 levels with survival Finally we determined whether the baseline serum concentration of KLK11 would be a prognostic marker in NSCLC. The cutoff point of 1.05 ng/ml was selected to categorize patients as KLK11-high or low. Univariate analysis showed that serum KLK11 level was significantly correlated OS (P?=?0.002) and PFS (P?=?0.009) ().Univariate and multivariate analysis of KLK11 status with regard to PFS and OSVariablesPFSOSHR95 % CI P valueHR95 % CI P valueUnivariate analysis?KLK11 (Low vs. High)0.460.25“0.820.0090.360.19“0.690.002?Age (?60 vs. <60)1.230.67“2.280.5061.180.59“2.130.792?Gender (Male vs. Female)1.320.71“1.820.7821.190.69“1.980.673?Histology (AC vs. SCC)1.830.59“2.130.7921.340.65“1.980.546?Stage (I“II vs. III“IV)1.330.65“2.210.0010.931.09“3.440.025?Lymph node metastases (absent vs. present)1.421.04“1.940.2711.770.32“1.660.347?Distant metastases (absent vs. present)1.981.03“3.010.0391.871.04“2.990.075Multivariate analysis?KLK11 (low vs. high)0.530.29-0.970.0420.480.24-0.950.037?Age (?60 vs. <60)0.980.52-1.940.8341.061.28-3.010.128?Gender (male vs. Female)1.280.67-1.890.6721.140.46-2.140.542?Histology (AC vs. SCC)1.371.04-2.330.3151.260.64-2.560.424?Stage (I“II vs. III“IV)1.250.56-2.260.0011.961.02-3.770.043?Lymph node metastases (absent vs. present)1.130.81-1.570.1481.840.33-1.720.334?Distant metastases (absent vs. present)1.440.85-1.970.0981.890.99-2.350.051 HR hazard ratio CI confidence interval In multivariate analysis high KLK11 was found to be significantly associated with a longer PFS and OS (HR 0.53 and 0.48; P?=?0.042 and P?=?0.037 respectively). Kaplan“Meier survival curves (Fig. 3) further demonstrate that lung cancer patients with high KLK11 have substantially longer PFS and OS (P?<?0.05) compared to those with low KLK11 cancer. As expected disease stage was found to be strongly associated with decreased PFS and OS in both univariate and multivariate analyses (P?<?0.05).Fig. 3Kaplan“Meier survival curves for PFS and OS in patients with KLK11-high and -low NSCLC."
Lung_Cancer
"Methods A literature search was undertaken until July 2013 to identify the comparative studies evaluating disease-free survival rates and survival rates. The pooled odds ratios (OR) and the 95% confidence intervals (95% CI) were calculated with the fixed or random effect models. Results Six retrospective studies were included in our meta-analysis. These studies included a total of 546 patients: 235 patients were treated with VATS and 311 patients were treated with open thoracotomy. The VATS and the thoracotomy did not demonstrate a significant difference in the 1-3-5-year survival rates and the 1-year disease-free survival rate. There were significant statistical differences between the 3-year disease free survival rate (p?=?0.04) which favored open thoracotomy. Conclusions The VATS approach is a safe and feasible treatment in terms of the survival rate for metastatic lung cancer compared with the thoracotomy. The 3-year disease-free survival rate in the VATS group is inferior to that of open thoracotomy. The VATS approach could not completely replace open thoracotomy. The authors have no support or funding to report. Introduction Metastasectomy is considered a beneficial treatment for a patient with metastatic lung cancer whose primary tumor has been well controlled[1].After surgery 5-year survival rates of 30% to 50% could be achieved depending on the underlying primary cancer[2]“[4].In practice the surgical approaches to pulmonary metastases are variable. Video-assisted thoracoscopic surgery (VATS) is an emerging technique; many procedures that had previously required a thoracotomy have been performed with the minimally invasive VATS. VATS has been used for the treatment of pulmonary metastases. The routine use of VATS for the treatment of respectable metastatic lung cancer remains controversial. Critics of the VATS approach have argued that it might not be an equivalent oncological operation[5] [6]. A prospective study by Cerfolio[7]found that 22% of the nodules that could be detected by thoracotomy were missing by VATS.Whether the VATS approach can provide a satisfactory outcome is unknown. An evidenced-based investigation of the VATS approach is needed we undertook this meta-analysis to achieve a more objective assessment of the published studies and to provide a more accurate comparison between VATS and thoracotomy for metastatic lung cancer. Methods Search Strategy Electronic searches were of the MEDLINECochrane Controlled Trial Register (CENTRAL) Ovid MEDILINE PubMed and Embase databases were performed until July 2013.The following MeSH search headings were used: œmetastatic lung cancer œpulmonary metastases œvideo-assisted thoracic surgery œthoracotomy and œcomparative study.We searched the reference lists of relevant studies reviews editorials lettersand meeting s. We used the Science Citation Index to cross-reference for further studies that met our criteria. Study Selection The studies included in this meta-analysis were based on our predetermined criteria as follows: (1) clinical trials that include the full text of the paper published in peer-reviewed English journals or reports of presentations at major thoracic surgery meetings; (2) comparison of the efficacy of VATS to that of thoracotomy in patients with metastatic lung cancer; and (3) similarity in the patients' baseline characteristics. Data extraction and quality assessment Two independent reviewers (Siyuan and Wenya) assessed the quality and the risk of bias of the included trials as follows: (1) the studies that did not include a comparative group with surgery as a form of intervention were excluded; (2) the trials focusing on patients undergoing surgery for primary lung cancer were excluded; (3) the studies on robotic video-assisted thoracic surgery were excluded; (4) if there was an overlap between authors centers or patient cohorts evaluated in the published literature only the most recent report was included; (5) studies published more than 20 years ago were excluded because of the significant technological changes that has occurred. The s were evaluated with the Downs and Black quality assessment method[8]. Discrepancies between the two investigators were resolved by discussion and consensus with a senior investigator. The final results were reviewed by two senior investigators (Lin and Jiang).The disease-free survival was defined as the date of the initial metastasectomy until the date of a recurrence. Statistical and sensitivity analyses The meta-analysis was performed using the RevMan 5.1.0. software package. The odds ratio (OR) or the mean difference with 95% confidence intervals (95% CI) was calculated for the dichotomous outcomes and the continuous outcomes respectively. A P value<0.05 was considered a significant difference in the value between the two groups. We used the I2 statistic to investigate the heterogeneity among the studies.The heterogeneity was explored by X2 and I2; I2<25% and I2>50% reflect a small and large inconsistency respectively. P<0.05 was considered significant. If there were a statistical difference in terms of the heterogeneity (P?0.05) a random-effect model was selected to pool the data. Otherwise a fixed-effect model was used. Taking into account the presence of different sample sizes of the included studies a sensitivity analysis was performed to compare the of 1-year survival rate and the 3-year disease free survival rate between VATS and open thoracotomy. Publication bias A funnel plot was used to explore bias. Asymmetry in the funnel plot of trial size against treatment effect was used to assess the risk of bias. Results Description of the studies Six retrospective cohort studies the met our criteria were included in this meta-analysis. A total of 546 patients were included in the six studies;235 patients were allocated to the VATS group whereas 311 were allocated to the open thoracotomy group to evaluate their survival rate.The search algorithm results of the search strategies and selection criteria are shown in Fig 1. The patient characteristics and evaluation index are shown in . .0085329.g001 Identification of studies for inclusion. .0085329.t001 Study Design Country NO(V/O) Gender (M/F) Mean age (years) Assessment score Nakajima2001[28] OC Japan 45/55 V59/41 O34/21 V55±15 O55±14 13 Mutsaerts2002[29] OC Netherlands 8/12 NR NR 19 Nakas2009[30] OC UK 25/27 V16/9 O 19/8 V69 O66 16 Carballo2009[31] OC USA 36/135 V18/18 O82/53 V58.5 O49 15 Gossot2009[32] OC France 31/29 V21/10 O13/16 V43 O40 18 Chao2012[33] OC Taiwan 90/53 V49/41 O35/18 NR 13 V VATS; O Open thoracotomy; NR Not reported; OC observational cohort. Assessment of Recurrence and Survival Six studies documented the 1-year survival rateand there was no significant heterogeneity among the six studies (x2?=?3.79 P?=?0.58I2?=?0%).A fixed effect model was used.The combined result is shown in Fig 2(OR?=?1.15; 95%CI 0.72“1.84; p?=?0.58). Because of the heterogeneity in sample size the sensitivity analyses were conducted using larger sample sizes. There was no difference between the two surgical methods with an OR of 1.00(95%CI 0.55“1.79) and with heterogeneity(?2?=?3.23P?=?0.07 I2?=?69%). Five studies reported the 3-year survival rate and heterogeneity was identified through the five studies (x2?=?11.32P?=?0.02I2?=?65%); and a random effect model was adopted (OR?=?1.07; 95%CI 0.50“2.27; p?=?0.86) (Fig 3). Three studies compared the 5-year survival rate (OR?=?0.96; 95%CI 0.34“2.71; p?=?0.93) with certain heterogeneity(x2?=?8.86P?=?0.01I2?=?77%) (Fig 4). .0085329.g002 1-year survival rate. Forest plot of the Odds Ratio(OR) of the 1-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g003 Figure 3 3-year survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g004 Figure 4 5-year survival rate. Forest plot of the Odds Ratio(OR) of the 5-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Four studies compared the 1-year disease free survival rate (OR?=?1.31; 95% CI 0.79“2.19; p?=?0.30)finding no significant heterogeneity among these studies (x2?=?1.82P?=?0.61I2?=?0%) (Fig 5) and four studies compared the 3-year disease free survival rate (OR?=?0.59; 95% CI0.38“0.91; p?=?0.02) finding no significant heterogeneity (x2?=?1.82P?=?0.61I2?=?0%) between the patients who underwent VATS and those who underwent open thoracotomy (Fig 6). Because of the heterogeneity in the sample size sensitivity analyses were conducted using larger sample size studies; however there was no difference between the two surgical methods with an OR of 1.71 (95% CI1.02“2.89) and with heterogeneity (?2?=? 3.07P ?=?0.22 I2?=?35%). There were significant 3-year disease free survival rate benefits with open thoracotomy. We attempted to evaluate the 5-year disease free survival rate.Only two studies reported these ratesand the published data were not sufficient for the combined analysis. .0085329.g005 Figure 5 1-year disease-free survival rate. Forest plot of the Odds Ratio(OR) of the 1-year disease free survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g006 Figure 6 3-year disease-free survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Publication bias Publication bias might exist when nonsignificant findings remain unpublishedthus artificially inflating the apparent magnitude of an effect.The funnel plots of the study are shown in Figure 7.The funnel plots of the 1-year survival rate following VATS and thoracotomy for the treatment of metastatic lung cancer showed asymmetry which suggested that there was some publication bias. .0085329.g007 Figure 7 Funnel plot of the outcome of 1-year survival rate. Discussion Many tumors can metastasize to the lungand colorectal and breast tumors are the most common primary tumors[9].Pulmonary resection has been shown to be beneficial for patients with resectable and isolated pulmonary metastases[10]. Traditional open thoracotomy and VATS are two principally different surgical methods for pulmonary metastasectomy.The selection of an approach depends more on the theoretical knowledge and personal experience of the surgeon than on the evidence. Over the past two decades several studies have demonstrated the benefits of VATS that included less postoperative pain shorter hospital stays a smaller degree of immunosuppression and enhanced recovery and the ability to tolerate adjuvant therapy[11]“[13]. Whether the long-term advantages are comparable to those of open thoracotomy is not well documented. The major deficiency of the VATS approach is that nodules might be undetected by VATS that might be detected by manual palpation during thoracotomy; such missing nodules are not imaged on a preoperative CT scan. The VATS approach has long been controversial because VATS does not consistently detect all the metastases and it is recognized that complete resection remains a major determining factor of survival [14].The detection rate of HRCT for pulmonary metastases is 78“84%[15]“[17].Kayton[18]found that 35% of the pathologically verified metastases were missed by CT. In the International Registry of Lung Metastases study of 5206 patients the 5-year survival rate was 36% for complete resection compared with 13% incomplete resectoin[19]. It is not certain whether the nodule imaged on a CT scan and resected by VATS is the correct one [14]. Those who disagree with the use of VATS hypothesize that VATS-related recurrence is commonly observed including port-site recurrence and resection stump recurrence[20]. Johnstone reported 23 cases of port-site chest wall recurrence related to VATS[21]. They hypothesized that the thoracoscopic approach should only be used in patients with a solitary lesion and when resection is requried for diagnostic purposes. The surgeons who favor the VATS approach advocate that VATS minimizes pain and trauma to the patients and that the VATS group might have an improved tolerance of chemotherapy which would likely ensure delivery of planned post-resection adjuvant therapy without a reduction in dosage or delay. The standard surgical procedure for pulmonary metastases is wedge resection that usually does not require manipulation of the pulmonary hilum which is appropriate for the VATS approach.They hypothesiezd that a lesion overlooked by CT but detected by palpation might not result in a survival gain[22] [23] and may be partially compensated for by carefully follow-up.Flores[24] hypothesized that the VATS group might demonstrate a great number of metachronous tumors over time;however the metachronous lesions in each group was similar. Our work suggests that thoracoscopic resection of metastatic lung cancer is a safe and curative procedure with 13 and 5-year survival rates comparable to those of thoracotomy. Patients with metastatic lung cancer are likely to relapse in the lung and after lung metastasectomy by VATS patients might benefit from a second metastasectomy. We hypothesize that earlier chemotherapy and radiation are essential to maximizing survival. Our study might be subject to pretreatment selection bias because most of the patients selected for open thoracotomy had multiple lesions and high risk and were not suitable for treatment with VATS.The missing lesions perhaps skewed the data more toward VATS as an equivalent procedure. We were also interested in the recurrence of cancerand the disease-free survival rates were evaluated. This study demonstrates a similar 1-year disease-free survival rate;however the 3-year disease-free survival rate is inferior for three reasons. First unrelated cancer deaths were included in our analysis of the 13 and 5-year overall survival which might account for VATS having a comparable overall survival rate but an inferior disease-free survival rate. Secondthe patients in the VATS group might have lesions that are missed and there are more likely to relapse in the lung leading to the inferior 3-year disease-free survival rate.Third some of our included studies were in the early period of VATS development when the technology was immature and some of the complications can now be prevented with more experience. Schaeff[25] reported 23 cases of port-site recurrence associated with VATS that occurred before 1998.The number of cases studied was small and the observation period was limitied. Spiral computed tomography has a far higher detection rate today than it did 20 years ago;so small lesions can be accurately localized before surgery[26] which ensures the success of VATS. With advances in imaging technology palpaiton during open thoracotomy is becoming less important.The latest VATS technology has a high-definition resolution and the flexible-tip thoracoscope enables complete inspection of the pleural cavity.These advancements ensure that VATS is an ideal method for patients with a solitary and relatively small peripheral lesions.Tamas[27] hypothesizes that palpation is necessary in a therapeutic metastasectomy as opposed to a diagnostic procedure.Whether patients with multiple lesions should be treated with open thoracotomy or VATS is controversial. This study is the first meta-analysis of the oncological outcome of thoracoscopic surgery for the treatment of metastatic lung cancer. In our work we observed that VATS might be a promising treatment for metastatic lung cancer. No randomized trials existing to guide doctors in the field of metastatic lung cancer currently. A prospective randomized study of the different surgical strategies is needed. Limitation No randomized controlled trials existing to comparing VATS with thoracotomy have been conducted. Heterogeneity was observed between the sample size and the years covered. Most studies are limited to small observational studies and single-institution case series. For these reasonsthere are only a total of 546 patients were included in the two groups for a study period spans more than a decade. Two of the studies comprise almost 65% of the patients and one study has only 20 patients; there are potential sources of bias in our work.Additional randomized controlled trials in the studies we accessed would have increased the strength of our results.There is a bias for the English language. Conclusion In our meta-analysis we found that for patients with metastatic lung cancer comparing VATS with thoracotomy showed almost equivalent survival rates. The VATS can not replace open thoracotomy completely. Further study is neededand a large multicenter randomized trial comparing VATS and thoracotomy would be ideal. Supporting Information Checklist S1 PRISMA Checklist. (DOC) Click here for additional data file. References 1 RuschVW (2010) Pulmonary metastasectomy: a moving target. J Thorac Oncol5: S130“13120502246 2 CassonAG PutnamJB NatarajanG JohnstonDA MountainC et al (1992) Five-year survival after pulmonary metastasectomy for adult soft tissue sarcoma. Cancer69: 662“6681730117 3 van HalterenHK van GeelAN HartAA ZoetmulderFA (1995) Pulmonary resection for metastases of colorectal origin. Chest107: 1526“15317781341 4 KandiolerD KromerE TuchlerH EndA MullerMR et al (1998) Long-term results after repeated surgical removal of pulmonary metastases. Ann Thorac Surg65: 909“9129564899 5 McCormackPM BainsMS BeggCB BurtME DowneyRJ et al (1996) Role of video-assisted thoracic surgery in the treatment of pulmonary metastases: results of a prospective trial. Ann Thorac Surg62: 213“216 discussion 216“217.8678645 6 SaishoS NakataM SawadaS YamashitaM SaekiH et al (2009) Evaluation of video-assisted thoracoscopic surgery for pulmonary metastases: 11-years of experience. Surg Endosc23: 55“6118437482 7 CerfolioRJ BryantAS McCartyTP MinnichDJ (2011) A prospective study to determine the incidence of non-imaged malignant pulmonary nodules in patients who undergo metastasectomy by thoracotomy with lung palpation. Ann Thorac Surg91: 1696“1700 discussion 1700“1691.21619965 8 DownsSH BlackN (1998) The feasibility of creating a checklist for the assessment of the methodological quality both of randomised and non-randomised studies of health care interventions. J Epidemiol Community Health52: 377“3849764259 9 KondoH OkumuraT OhdeY NakagawaK (2005) Surgical treatment for metastatic malignancies. Pulmonary metastasis: indications and outcomes. Int J Clin Oncol10: 81“8515864692 10 PorterGA CantorSB WalshGL RuschVW LeungDH et al (2004) Cost-effectiveness of pulmonary resection and systemic chemotherapy in the management of metastatic soft tissue sarcoma: a combined analysis from the University of Texas M. D. Anderson and Memorial Sloan-Kettering Cancer Centers. J Thorac Cardiovasc Surg127: 1366“137215115994 11 PetersenRP PhamD BurfeindWR HanishSI TolozaEM et al (2007) Thoracoscopic lobectomy facilitates the delivery of chemotherapy after resection for lung cancer. Ann Thorac Surg83: 1245“1249 discussion 1250.17383320 12 PaulS AltorkiNK ShengS LeePC HarpoleDH et al (2010) Thoracoscopic lobectomy is associated with lower morbidity than open lobectomy: a propensity-matched analysis from the STS database. J Thorac Cardiovasc Surg139: 366“37820106398 13 WhitsonBA GrothSS DuvalSJ SwansonSJ MaddausMA (2008) Surgery for early-stage non-small cell lung cancer: a systematic review of the video-assisted thoracoscopic surgery versus thoracotomy approaches to lobectomy. Ann Thorac Surg86: 2008“2016 discussion 2016“2008.19022040 14 EckardtJ LichtPB (2012) Thoracoscopic versus open pulmonary metastasectomy: a prospective sequentially controlled study. Chest142: 1598“160222677347 15 AmbrogiV PaciM PompeoE MineoTC (2000) Transxiphoid video-assisted pulmonary metastasectomy: relevance of helical computed tomography occult lesions. Ann Thorac Surg70: 1847“185211156082 16 MargaritoraS PorziellaV D'AndrilliA CesarioA GalettaD et al (2002) Pulmonary metastases: can accurate radiological evaluation avoid thoracotomic approach? Eur J Cardiothorac Surg21: 1111“111412048094 17 ParsonsAM DetterbeckFC ParkerLA (2004) Accuracy of helical CT in the detection of pulmonary metastases: is intraoperative palpation still necessary? Ann Thorac Surg78: 1910“1916 discussion 1916“1918.15561000 18 KaytonML HuvosAG CasherJ AbramsonSJ RosenNS et al (2006) Computed tomographic scan of the chest underestimates the number of metastatic lesions in osteosarcoma. J Pediatr Surg41: 200“206 discussion 200“206.16410133 19 Long-term results of lung metastasectomy: prognostic analyses based on 5206 cases. The International Registry of Lung Metastases. J Thorac Cardiovasc Surg113: 37“499011700 20 MutsaertsEL ZoetmulderFA RutgersEJ (2001) Port site metastasis as a complication of thoracoscopic metastatectomy. Eur J Surg Oncol27: 327“32811373113 21 JohnstonePA RohdeDC SwartzSE FetterJE WexnerSD (1996) Port site recurrences after laparoscopic and thoracoscopic procedures in malignancy. J Clin Oncol14: 1950“19568656265 22 TreasureT (2007) Pulmonary metastasectomy: a common practice based on weak evidence. Ann R Coll Surg Engl89: 744“74817999813 23 RothJA PassHI WesleyMN WhiteD PutnamJB et al (1986) Comparison of median sternotomy and thoracotomy for resection of pulmonary metastases in patients with adult soft-tissue sarcomas. Ann Thorac Surg42: 134“1383741009 24 FloresRM IhekweazuUN RizkN DycocoJ BainsMS et al (2011) Patterns of recurrence and incidence of second primary tumors after lobectomy by means of video-assisted thoracoscopic surgery (VATS) versus thoracotomy for lung cancer. J Thorac Cardiovasc Surg141: 59“6421055770 25 SchaeffB PaolucciV ThomopoulosJ (1998) Port site recurrences after laparoscopic surgery. A review. Dig Surg15: 124“1349845574 26 ChenYR YeowKM LeeJY SuIH ChuSY et al (2007) CT-guided hook wire localization of subpleural lung lesions for video-assisted thoracoscopic surgery (VATS). J Formos Med Assoc106: 911“91818063512 27 MolnarTF GebitekinC TurnaA (2010) What are the considerations in the surgical approach in pulmonary metastasectomy? J Thorac Oncol5: S140“14420502249 28 NakajimaJ TakamotoS TanakaM TakeuchiE MurakawaT et al (2001) Thoracoscopic surgery and conventional open thoracotomy in metastatic lung cancer. Surg Endosc15: 849“85311443456 29 MutsaertsEL ZoetmulderFA MeijerS BaasP HartAA et al (2002) Long term survival of thoracoscopic metastasectomy vs metastasectomy by thoracotomy in patients with a solitary pulmonary lesion. Eur J Surg Oncol28: 864“86812477479 30 NakasA KlimatsidasMN EntwisleJ Martin-UcarAE WallerDA (2009) Video-assisted versus open pulmonary metastasectomy: the surgeon's finger or the radiologist's eye? Eur J Cardiothorac Surg36: 469“47419464921 31 CarballoM MaishMS JaroszewskiDE HolmesCE (2009) Video-assisted thoracic surgery (VATS) as a safe alternative for the resection of pulmonary metastases: a retrospective cohort study. J Cardiothorac Surg4: 1319239710 32 GossotD RaduC GirardP Le CesneA BonvalotS et al (2009) Resection of pulmonary metastases from sarcoma: can some patients benefit from a less invasive approach? Ann Thorac Surg87:"
Lung_Cancer
"Overexpression of GFP-Sp1 decreased FOXO3 mRNA and protein levels in a dose-dependent manner (C panel a) whereas knockdown of Sp1 expression increased FOXO3 mRNA and protein levels (C panel b). These results indicate that Sp1 negatively regulates FOXO3 expression. Sp1 negatively regulates FOXO3 expression through regulating miR-182 (A) The Sp1 and FOXO3 levels in clinical lung tissue samples were studied by IHC staining using antibodies against Sp1 and FOXO3 respectively. (B) Cell lysates were harvested from various cell lines for Western blotting using antibodies against FOXO3 and Sp1 and tubulin as an internal control. (C) Adeno-GFP-Sp1 viruses were infected into IMR-90 cells for 48 h and FOXO3 mRNA and protein were studied by RT-PCR and Western blotting respectively. GAPDH served as the internal control (panel a). Scramble and Sp1 shRNAs were transfected into H1299 for 48 h then FOXO3 mRNA and protein levels were studied by RT-PCR and Western blotting (panel b). (D) Scramble and Sp1 shRNAs were transfected into H1299 for 48 h and then cells were harvested at indicated time points following cycloheximide treatment for studying the Sp1 and FOXO3 levels with Western blotting. The levels of FOXO3 protein from three independent experiments were quantified using tubulin as an internal control. (E) Plasmids pGL2 or pGL2-FOXO3 (-1000/+50) were cotransfected with GFP or GFP-Sp1 into H1299 cells for 24 h then cell lysates were harvested for luciferase activity assays. (F) Adeno-GFP-Sp1 viruses were infected into H1299 cells for 24 h and cells were then transfected with pGL3 or pGL3-FOXO3-3'UTR plasmid for 24 h. Cells lysates were harvested for luciferase activity assays. (G) H1299 cells which were infected with GFP-Sp1 adenovirus for 24 h were then transfected with pGL3 or pGL3-FOXO3-3'UTR plasmid for 24 h. Total RNA was extracted at various time points following actinomycin D treatment. The mRNA levels of luciferase were determined by using quantitative RT-PCR and quantified using GAPDH as an internal control. Data are representative of three independent experiments each of which was performed in triplicate and presented as the mean ± SEM. The level of statistical significance determined by t-test (* p<0.05; ** p<0.01). Next we investigated the mechanism by which Sp1 regulates FOXO3 expression. FOXO3 protein half-life was studied after Sp1 knockdown. Knockdown of Sp1 expression did not affect FOXO3 protein stability (D). We then constructed a luciferase reporter construct containing the FOXO3 promoter (-1000/+50) to study the effect of Sp1 on the promoter-mediated transcription of FOXO3 (E). GFP-Sp1 overexpression significantly enhanced the luciferase activity indicating that Sp1 positively regulated FOXO3 transcription (E). However FOXO3 mRNA and protein levels decreased as shown in C. The data shown in indicated that Sp1 increased miR-182 expression which suggests that post-transcriptional processing contributes to the regulation of FOXO3 expression. Thus the 3'-UTR of FOXO3 might play an important role in stabilizing FOXO3 mRNA and in FOXO3 translation. Consequently a luciferase reporter construct containing the 3?-UTR of FOXO3 was generated. GFP-Sp1 overexpression reduced the luciferase activity (F). Furthermore the stability of the luciferase mRNA containing the 3?-UTR sequence of FOXO3 decreased dramatically upon GFP-Sp1 overexpression (G). These results indicate that Sp1 regulates FOXO3 expression through transcriptional and post-transcriptional regulation with a net negative effect on FOXO3 expression. miR-182 inhibits lung cancer metastasis activity The data shown in indicated that miR-182 positively regulated lung cancer cell growth. Therefore the role of miR-182 in lung cancer metastasis was studied (). The morphology of miRZip-182 cells was markedly altered: circular structures of actin filaments were absence and pseudopodia were enriched suggesting that miR-182 decreased the cells' migratory ability (A). Indeed knockdown of miR-182 expression increased the migration ability of lung cancer cells suggesting that miR-182 inhibits lung cancer migration (B). Moreover transwell migration assays showed that knockdown of miR-182 expression enhanced cell's invasive capacity (C). In mice injected with miRZip-182-treated cells the knockdown of miR-182 expression also increased the number of nodules in the lung suggesting that miR-182 represses metastatic ability in vivo (D). The effects of miR-182 knockdown were partially reversed by knockdown of FOXO3 suggesting that miR-182 functions as a suppressor of lung cancer metastasis by repressing FOXO3 expression (E panel a). The endothelial-mesenchymal transition (EMT) marker N-cadherin increased after miR-182 knockdown but this effect was abolished by FOXO3 knockdown. Thus miR-182 might repress lung cancer metastasis by decreasing the expression of N-cadherin (E panel b). However the expression of other genes regulated by miR-182 might also play a role in metastasis (F and Supplementary Figure S3). Therefore we generated gene expression profiles using microarray analysis. Functional grouping analysis using DAVID bioinformatics resources showed that 19 of the genes differentially regulated by miR-182 knockdown were related to cell migration. The expression of these genes was increased in miR-182-knockdown cells indicating that they are potential targets of miR-182 (F). Many metastasis-related genes such as CD44 CDH9 and ADAM9 were upregulated after the knockdown of miR-182 expression (F). miR-182 attenuates lung cancer cell metastasis (A) Immunofluorescent staining of Alexa Fluor 568-conjugated phalloidin that is a high-affinity probe for F-actin (red) in miRZip and miRZip-182 stably expressed H1299 cells. DNA was stained with DAPI (blue). Stained cells were photographed under a fluorescence microscope at x 600 magnification. (B) Confluent monolayers of miRZip or miRZip-182 stably expressed H1299 cells were wounded and incubated for an additional 16 h (panel a). Migratory area was calculated for quantification (panel b). (C) The migration activities of H1299 cells (2 x 104) expressing miRZip or miRZip-182 were studied by Transwell chambers. (D) The miRZip or miRZip-182 stably expressed H1299 cells (4 x 106) were suspended in 100 ?l of PBS and injected into the lateral tail vein of SCID mice. After 8 weeks all mice were killed and the number of pulmonary tumor nodules was calculated after fixation of lungs with 4% formaldehyde for 48 h (panel a) and the number of pulmonary metastatic tumor nodules was counted (panel b). (E) FOXO3 and miR-182 in H1299 cells were knockdown by shFOXO3 and miRZip-182 respectively and then migration of cells (3 x 104) was studies by Transwell chambers (panel a). In addition cell lysates were harvested from FOXO3 and miR-182 knockdown cells for Western blotting using antibodies against N-cadherin ?-catenin vimentin FOXO3 and tubulin (panel b) respectively. (F) Heat map of the 19 of genes from miRZip and miRZip-182 microarray data the red color represents genes that are upregulated and the green color represents genes that are downregulated. The level of statistical significance determined by t-test (* p<0.05; ** p<0.01; *** p<0.001). DISCUSSION Our recent studies showed that Sp1 increased the growth of lung cancer cells but inhibits metastatic activity [23 32]. In the present study we found that Sp1 which accumulated in the early stages of cancer positively regulated miR-182 gene expression to silence FOXO3 expression and thereby promote cancer cell growth. In addition decreased levels of Sp1 in the late stages of cancer increased the expression of FOXO3 and N-cadherin leading to cancer metastasis (). (A) Clinical samples from lung cancer patients of stage I and IV were used to study the Sp1 level by IHC staining with anti-Sp1 antibodies (B) Schematic diagram illustrates Sp1 regulates miR-182 to silence FOXO3 expression in early and late stages of lung cancer progression. Sp1 functions as a transcriptional activator by recruiting p300 to its target genes and as a repressor by the recruiting HDACs. Because Sp1 accumulates in several types of cancer including lung cancer [33] understanding the Sp1 transcriptional regulatory network may provide novel insights into the molecular origins and treatment of lung cancer. In our previous studies of lung cancer we found that Sp1 was highly upregulated in the early stages of cancer progression but partially down regulated in the late stages. Our previous studies also showed that regulation of Sp1 protein stability by phosphorylation and sumoylation contributed to its expression in the early and late stages of cancer respectively [32]. Kras activation and the Notch pathway might activate ERK1/2 to phosphorylate Sp1 thus stabilizing Sp1 in the early stages of cancer [32 34]. In the late stages Sp1 could be sumoylated leading to recruitment of its E3-ligase RNF4 followed by polyubiquitination and degradation [32]. To clarify the molecular mechanism underlying gene regulation by Sp1 we used microarray analysis to assess gene expression in KrasG12D-induced lung tumor transgenic mice and identified thousands of genes potentially regulated by Sp1 [23]. However some of the genes do not harbor a conserved Sp1 binding motif within their promoter region suggesting that another regulatory mechanism is involved in Sp1-mediated gene regulation. "
Lung_Cancer
"Therefore in depth studies should be still needed to enhance its antitumor and antimetastatic activities in vivo. Fortunately the in vivo results also exhibited that niclosamide can reduce expression of Ki67 and increase expression of cleaved caspase-3 in tumor cells compared with vehicle treated group. Furthermore accumulating evidence suggests that Stat3 plays an important role in up-regulating VEGF gene expression and inducing tumor angiogenesis under both physiological and pathological conditions [16] [42]. Inhibition of Stat3 can result in the suppression of tumor angiogenesis which was also observed in tumor tissues treated with niclosamide in this study. These results suggested that niclosamide may have a role in the treatment of angiogensis. Breast cancer is progressing toward increasingly malignant behavior in tumorigenic and metastatic stages. In the process of metastasis tumor cells will leave the primary tumor in breast and metastasize to distant sites (lung liver and lymph node) where they establish secondary tumors [36] [43]. Moreover it has been reported that Src/FAK/MMP (Matrix metalloproteinase) involved pathway is critical for breast cancer cell migration and invasion [34] [44]. Therefore inhibition of the step is a promising approach to antitumor and antimetastasis treatment [34]. In this study our observations indicated that niclosamide can inhibit breast cancer migration and invasion in vitro by down-regulating FAK phosphorylation at tyrsion residue 925 and Src- phosphorylation at tyrsion residue 416. Furthermore in our animal experiments administrations of niclosamide at the dose of 20 mg/kg significantly inhibited breast tumor metastasis to lung (D). Overall these results suggested that niclosamide may be a potential candidate for treating breast cancer metastasis. A recent studies showed that Stat3 is frequently activated not only in diverse cancer cells by common oncogenic pathways but also in tumor endothelial and myeloid cells including Gr1+/CD11b+ (MDSCs) and tumor-associated macrophages mediating immune suppression [34] [45]. Meanwhile myeloid cells and other immune cells are critical components of the tumor microenvironment and an excess of MDSCs can promote tumor angiogenesis and influence antitumor immune responses. Therefore MDSCs play a central role in carcinoma progression in tumor-bearing mice and cancer patients [46]. In this study our data showed that the treatment of mice with niclosamide caused a significant decrease in the number of MDSCs in tumors compared with that of vehicle treated group. It is therefore conceivable that blocking Stat3 signaling with niclosamide in vivo can induce immune-mediated antitumor effects. In the results presented here are to our knowledge the first study to demonstrate that niclosamide can inhibit breast cancer cell growth by inducing apoptosis and block cell migration and invasion. In addition niclosamide suppressed the breast tumor growth without significant toxicity."
Lung_Cancer
"The associations between BMI and total mortality appeared to be stronger with increasing HRs beginning at lower BMI values in whites compared to blacks and the racial difference was more pronounced in women ( ). For the highest compared to the reference category of BMI the magnitudes of the HRs were similar between white (HR=2.62 95% CI: 2.12 3.23) and black (HR=2.42 95% CI: 1.25 4.68) men but appeared to be stronger for white (HR=2.68 95% CI: 2.27 3.17) versus black (HR=1.83 95% CI: 1.28 2.61) women ( ). After adjusting for reporting error using NHANES data associations between BMI and mortality generally became slightly more negative with the exception of the highest category of BMI in black men and the lowest category of BMI in black women which became more strongly positive. Nonetheless the shapes of the BMI curves remained largely similar ( ). In a sensitivity analysis we further excluded all former smokers which reduced somewhat the excess risk of death observed among those with a low BMI but otherwise results were similar (data not shown). We also excluded those who died within the first year of follow-up but found that the results were largely unchanged (data not shown). We also examined associations between BMI and cardiovascular disease and cancer mortality among blacks and whites ( Supplementary ). Among white men and women a high BMI was associated with an increased risk of cancer and to a greater extent cardiovascular disease mortality. Among black men and women BMI was positively associated with cardiovascular mortality but not with cancer mortality; however the number of cancer deaths in these populations was small. We further examined BMI and all-cause mortality for men and women by age education and marital status ( Supplementary and 3). In all subgroups of white men and women there was a positive and significant association between BMI and risk of death. The association differed according to age in women and education in men with stronger relationships observed among younger white women (P-interaction <0.001) and more educated white men (P-interaction=0.002). Among blacks the association was slightly stronger in those who were 65 years or younger at baseline but the interaction with age was not significant. Education did not modify the BMI-mortality association in black men or women. However a strong positive association between BMI and mortality was observed among married but not unmarried black men (P-interaction=0.001). Finally we examined BMI at age 20 and BMI change between age 20 and baseline in relation to total mortality (). We found that compared to the reference group (22.5“<25.0) higher categories of BMI at age 20 were associated with increased total mortality in white men and women but this association appeared to be weaker in blacks possibly due to smaller numbers of deaths. Compared to gaining less than five units of BMI between age 20 and baseline gaining more than 10 units was associated with a significantly elevated risk of death in whites and in black men; however no association was observed among black women. Discussion In this large prospective U.S. cohort we found a positive association between BMI and mortality which appeared to be weaker in blacks particularly black women compared to whites. When compared with the reference group of a BMI of 22.5“<25.0 mortality increased monotonically with greater BMI in healthy non-smoking white men and women which largely confirmed previous findings 5“6. Among healthy non-smoking black men and women the bottoms of these curves were flatter and increasing risks of death with greater BMI were observed only at higher BMI levels (?35.0). Similarly associations of BMI at age 20 and BMI change with mortality appeared to be weaker in blacks than in whites. Our findings for BMI and all-cause mortality may be evaluated against those of several other large prospective studies conducted in the U.S. including the NIH-AARP Diet and Health Study 10 the Cancer Prevention Study-II 9 the Southern Community Cohort Study 19 and the Reasons for Geographic and Racial Differences in Stroke study 20 in which the shape of BMI-mortality curves among black and white men and women were also directly compared within the same cohort. The first three studies used the same reference BMI category that was used in our study and similarly found a weaker association between higher BMI categories and mortality in black women than in white women; among black women the BMI-mortality association was relatively flat until BMI?40. For men the NIH-AARP study found a similar BMI-mortality relationship between blacks and whites while the Southern Community Cohort Study showed an elevated mortality with higher BMI only among whites. Results from the Cancer Prevention Study were inconclusive due to limited numbers of black men in the extreme BMI categories. In the Reasons for Geographic and Racial Differences in Stroke study increased mortality was associated with higher BMI in white men and women; however there was no significant elevation in mortality among overweight and obese black men and women. Our results differed with those of the Black Women™s Health Study which reported an association that was largely similar to that found in white women11. This discrepancy may be partly due to the fact that our study included an older population (49“78 years) while the participants in the Black Women™s Health Study were somewhat younger (21“69 years). As shown in our study and others the association between BMI and mortality tended to be stronger in younger populations than in older populations 6 9“10. Nevertheless like the Black Women™s Health Study the Multiethnic Cohort Study observed similar BMI-mortality associations across racial/ethnic groups 21 and similar to our study included participants who were middle-to-older aged (45“75 years). Thus there may be other differences across studies such as socioeconomic or demographic factors that could account for these inconsistencies. Our findings confirmed those from previous studies showing a positive association of BMI with cancer and cardiovascular mortality in whites 6 9. We observed a positive association between BMI and cardiovascular but not cancer mortality in both black men and women. The results were consistent with those from the Black Women™s Health Study 11. Because only a subset of cancers are obesity-related 22“24 differences in site-specific cancer mortality rates between blacks and whites may partially account for the differences in the BMI-cancer mortality association. However the relatively small number of cancer deaths in our study precluded us from examining the relationship between BMI and death from specific cancers. Consistent with previous studies we found that higher BMI at age 20 was linked to higher mortality in whites; however this association appeared to be weaker among blacks. Moreover excess weight gain since age 20 was also associated with higher mortality in whites and in black men but not in black women. Although results from the ARIC Study showed significantly elevated mortality among black men and women who had a young-adulthood BMI of over 30 15 we were unable to examine risks of death at higher values of young-adulthood BMI among blacks in this cohort due to the small number of deaths. However both the ARIC study and our study found possible racial difference across lower values of BMI with weaker associations found in blacks."
Lung_Cancer
"CR1 also modulates the complement cascade activation by preventing formation of classical and alternative pathway convertases and by acting as a cofactor for factor I mediated inactivation of C3b and C4b [89]. It has been demonstrated that chronic inflammation can predispose to cancer development and spread [10] as a fundamental component of innate immunity the complement cascade consists of potential proinflammatory molecules especially C3 and C5. Moreover complement activation and abnormal expression in tumor tissues has been demonstrated [11]. Considering the important role of CR1 in complement activation innate immunity and chronic inflammation CR1 has emerged as a molecule of immense interest in gaining insight into the susceptibility to cancer. CR1 gene is located on the Chromosome 1 at the locus 1q32 [12]. Various polymorphisms have been studied including the intronic and exonic density polymorphism for their ability to alter the density of erythrocyte CR1 on the cell membranes [13-15]. There are also the molecular weight variants due to insertion-deletion polymorphisms [16]. Up to now there have been very few studies on the association of genetic variants of CR1 with susceptibility to autoimmune and inflammatory diseases. It has been proposed that genetic variant at CR1 gene (rs6656401) might influence the susceptibility to late-onset Alzheimer™s disease [17]. CR1 expression in Peripheral Blood Mononuclear Cells (PBMCs) may be a new biomarker for prognosis of nasopharyngeal carcinoma and a potential therapeutic target [18]. Recently it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However the association of genetic variants of CR1 with risk of lung cancer remains unexplored. Worldwide lung cancer is the most common cancer in terms of both incidence and mortality [20]. NSCLC is the most common subtype of lung cancer and less aggressive and metastic than SCLC. Although cigarette smoking is the predominant risk factor for lung cancer inherited genetic characteristics are presumed to account in part for this interindividual variation in lung cancer susceptibility. Recently several genome-wide association studies have demonstrated the common genetic variations associated with susceptibility to lung cancer [21-24]. Given the involvement of the complement system in coordinating innate immunity and inflammatory response [25] further examination of the potential association between genetic variation of CR1 genes and lung cancer is warranted. In the current study we conducted a case-control study to investigate the association of tag SNPs in CR1 gene with the risk of NSCLC and effect of the interaction of gene-environment on the risk of NSCLC. Results Subject characteristics The frequency distributions of select characteristics in cases and control subjects were shown in . The mean age (±SD) was 59.6?±?10.5 years for the cancer patients and 57.2?±?13.3 years for the controls. No significant difference was found in the mean age between cases and controls (P?=?0.470). There was no significant difference in proportion of sex and smoking status between cases and controls (P?=?0.832 and P?=?0.321 respectively). However there was significant difference between cases and controls when compared by pack-year smoked (P = 0.001). The heavy smokers (?25 pack-year) accounted for 61.5% in cases but only 45.5% in controls which suggested that cigarette smoking was a prominent contributor to the risk of lung cancer. Of the 470 case patients 178 (37.9%) were diagnosed as adenocarcinoma 238 (50.6%) as squamous cell carcinoma and 100 (%) as other types including large cell carcinoma (n?=?49) and mixed cell carcinoma (n?=?5). Distributions of select characteristics in cases and control subjects Variables ???Cases (n?=?470) ???Controls (n?=?470) No (%) No (%) P a ???Sex 0.832 ???Male 324 68.9 328 69.8 ???Female 146 31.1 142 30.2 ???Age 0.470 ???<50 84 17.9 96 20.4 ???50-59 177 37.7 187 39.8 ???60-69 129 27.4 111 23.6 ????70 80 17.0 76 16.2 ???Smoking status 0.321 ???Non-smoker 265 56.4 281 59.8 ???Smoker 205 43.6 189 40.2 ???Pack-year smoked 0.001 ???<25 75 36.6 96 50.8 ????25 130 63.4 93 49.2 aTwo-sided ?2 test. Association of CR1 tag SNP with NSCLC risk Total 13 selected tag SNPs of CR1 in HapMap database among Chinese population were analyzed. Except for rs9429782 polymorphism the genotype distributions of other SNPs in controls were consistent to Hardy-Weinberg equilibrium. Therefore we excluded the rs9429782 from further analysis. In order to screen the genetic variants that confer the susceptibility to lung cancer 12 candidate tagSNPs were genotyped in a case-control study consisting of 470 lung cancer patients and 470 cancer-free controls as shown in . Importantly genotype frequency of one intronic SNP (rs7525160 G?>?C) in cases was found to be significantly different from those of controls (?2?=?6.339 P=0.042). Further multivariate regression model with adjustment for age gender and smoking status was used to assess the association between rs7525160 G?>?C polymorphism and the risk of NSCLC. The results indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC with OR (95% CI) of 1.52 (1.02-2.28) compared with the GG genotype. Other tagSNPs of CR1 were not significantly associated with the risk of NSCLC in our study population (P >0.05). Genotype frequencies of CRI among cases and controls and their association with non-small cell lung cancers CRI Genotypes ??Controls (n?=?470) ??Cases (n?=?470) OR (95% CI ) * P No (%) No (%) rs7525160 ??GG 176 37.5 139 29.6 1.00 (ref.) ??CG 228 48.5 256 54.5 1.38 (1.04-1.85) 0.041 ??CC 66 14.0 75 15.9 1.52 (1.02-2.28) 0.028 rs3886100 ??GG 117 24.9 105 22.4 1.00 (ref.) ??AG 223 47.4 253 53.8 1.33 (0.97-1.81) 0.078 ??AA 130 27.7 112 23.8 1.06 (0.73-1.54) 0.755 rs11118167 ??TT 348 74.1 353 75.1 1.00 (ref.) ??CT 111 23.6 102 21.7 0.89 (0.65-1.21) 0.457 ??CC 11 2.3 15 3.2 1.35 (0.61-3.01) 0.461 rs9429782 ??GG 250 53.2 261 55.5 1.00 (ref.) ??GT 220 46.8 209 44.5 0.89 (0.69-1.16) 0.388 rs10494885 ??CC 178 37.9 164 34.9 1.00 (ref.) ??CT 224 47.6 232 49.4 1.11 (0.83-1.47) 0.490 ??TT 68 14.5 74 15.7 1.20 (0.81-1.78) 0.365 rs7542544 ??CC 128 27.2 108 23.0 1.00 (ref.) ??AC 223 47.5 252 53.6 1.21 (0.88-1.67) 0.239 ??AA 119 25.3 110 23.4 0.90 (0.62-1.30) 0.897 rs6691117 ??AA 324 68.9 327 69.6 1.00 (ref.) ??AG 131 27.9 128 27.2 0.98 (0.73-1.31) 0.888 ??GG 15 3.2 15 3.2 0.96 (0.46-2.02) 0.923 rs6656401 ??GG 436 92.8 447 95.1 1.00 (ref.) ??AG 34 7.2 23 4.9 0.68 (0.39-1.18) 0.174 ??AA 0 0.0 0 0.0 NC§ rs2296160 ??CC 185 39.4 194 41.3 1.00 (ref.) ??CT 226 48.1 220 46.8 0.91 (0.69-1.21) 0.521 ??TT 59 12.5 56 11.9 0.90 (0.59-1.37) 0.606 rs9429942 ??TT 452 96.2 457 97.2 1.00 (ref.) ??CT 18 3.8 13 2.8 0.77 (0.37-1.61) 0.482 ??CC 0 0.0 0 0.0 NC§ rs4844600 ??GG 171 36.4 179 38.1 1.00 (ref.) ??AG 230 48.9 228 48.5 0.92 (0.70-1.22) 0.571 ??AA 69 14.7 63 13.4 0.87 (0.58-1.31) 0.513 rs3818361 ??CC 187 39.8 188 40.0 1.00 (ref.) ??CT 224 47.7 224 47.7 0.98 (0.74-1.29) 0.868 ??TT 59 12.5 58 12.3 0.96 (0.63-1.46) 0.848 rs17048010 ??TT 301 64.0 286 60.8 1.00 (ref.) ??CT 154 32.8 164 34.9 1.09 (0.82-1.43) 0.556 ??CC 15 3.2 20 4.3 1.40 (0.70-2.79) 0.343 *Adjusted by age sex and smoking status; §NC not calculated. Summary of MDR gene-gene interaction results Models Training bal. acc. (%) Testing bal. acc. (%) P value Cross-validation consistency rs7525160 54.03 50.53 0.828 7/10 rs4844600 rs10494885 55.45 49.32 0.989 3/10 rs4844600 rs10494885 rs7525160 57.60 48.48 0.623 6/10 Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene interaction models is listed in . The SNP rs7525160 in CR1 had the highest testing balanced accuracy among 12 SNPs. The three-way interaction model among rs4844600 rs10494885 and rs7525160 showed high testing balance accuracy and cross validation consistency but the testing balanced accuracy was lower than the two-way gene-gene interaction in NSCLC. For each model the interaction was not significant (P?>?0.05). Table 4 Risk of CR1 genotypes with NSCLC by smoking status Smoking status CR1 genotype GG * OR (95% CI) § P value CG?+?CC * OR (95% CI) § P value Non-smoker 84/99 1.00 (reference) 181/182 1.15 (0.81-1.65) 0.440 Smoker 55/77 0.86 (0.54-1.38) 0.528 150/112 1.72 (1.15-2.59) 0.009 <25 pack-years 19/41 0.59 (0.31-1.10) 0.099 56/55 1.32 (0.81-2.61) 0.266 ?25 pack-years 36/36 1.18 (0.67-2.08) 0.562 94/57 2.01 (1.26-3.20) 0.003 *Number of cases/number of controls. §Data were calculated by logistic regression and adjusted for age and gender. Interaction of CR1 SNP with smoking Cigarette smoking is a well-known risk for lung cancer so stratification by smoking status was performed to investigate the association of rs7525160 G?>?C variant with the risk of NSCLC. As shown in Table 4 the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) suggesting that the CR1 rs7525160 G?>?C polymorphism is a smoking-modifying risk factor for susceptibility to NSCLC. When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year) consistently GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). The P value for heterogeneity of the stratification analysis by smoking status is 0.015. However the P value for interaction between rs7525160 polymorphism and smoking is 0.172 and the power for the interaction is 0.49. Discussion The chronic airway inflammation and dysfunctional immune system might promote pulmonary carcinogenesis. Implicated in the immune and inflammatory responses the complement cascade plays a pivotal role in the development of cancer. Thus it is likely that the genetic variants of CR1 in the complement system confer the susceptibility to lung cancer. In this study we have for the first time demonstrated that one intronic SNP (rs7525160 G?>?C) out of 13 tag SNPs of CR1 was associated with the risk of NSCLC in Chinese population. Notably the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. MDR analysis also showed that there was no gene-gene interaction among 12 tag SNPs in CR1 gene. Moreover the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) indicating this SNP is a smoking-modifying risk factor for susceptibility to NSCLC. To the best of our knowledge this study shed new insight into the interplay of genetic variation of CR1 with lung cancer risk. More importantly it highlights the potential gene-environmental interaction influences the susceptibility to lung cancer. The complement system has been proposed to get involved in innate immunity with the ability to œcomplement antibody-mediated elimination of immune complex and foreign pathogens [26]. Upon complement activation the biologically active peptides C5a and C3a elicit a lot of pro-inflammatory effects and could be closely associated with tumorigenesis [27]. Complement proteins play a dual role in the tumor microenvironment. On one hand they exert a defensive effect against tumor through complement or antibody-dependent cytotoxicity [128]. On the other hand they may escape from immunosurveillance and facilitate carcinogenesis [2]. Specifically a number of experimental evidence has suggested an association between complement activation and tumor growth [2930] which provides a strong biologically link between the abnormal expression and activity of complement cascade and carcinogenesis. Till now a few studies have been carried out to demonstrate the association of genetic variants in complement proteins with susceptibility to cancer. A significant association of CR2 SNP (rs3813946) with the development of nasopharyngeal carcinoma was indicated in Cantonese population [31] and the genetic variations of complement system genes C5 and C9 plays a potential role in susceptibility to non-Hodgkin lymphoma (NHL) [32]. Recently it has been shown that complement factor H Y402H polymorphism interact with cigarette smoking to confer the susceptibility to lung cancer [33]. Furthermore it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However whether the genetic variants of CR1 are related to the risk of lung cancer remains unknown. In this case-control study we found an intronic SNP (rs7525160 G?>?C) with CC genotype was significantly associated with an increased risk of NSCLC. Consistently our results were in accordance with the study that genetic polymorphisms in innate immunity genes may play a role in the carcinogenesis of lung cancer [34]. It is likely that some genetic variations in strong link disequilibrium with this intronic SNP (rs7525160 G?>?C) are functional which provides a new insight into the hallmarks in susceptibility to lung cancer and further functional experiments are warranted to address the proposal. Functionally human CR1 exists on the surface of almost all peripheral blood cells and plays a key role in immune complex clearance and complement inhibition at the cell surface by binding to activated products C3b and C4b [435]. CR1 also possesses cofactor activity for the serum protease factor I and is thus involved in the generation of further fragments of C3/4b with the activation of complement cascade and the cellular immune response [4]. In our study the association of CR1 polymorphism with lung cancer is biologically plausible in that the intronic polymorphism could affect the density of CR1 molecules on the cell surface thereby contributing to autoimmune disorders and neoplasm. Tobacco smoking is an established risk factor for susceptibility to lung cancer. However not all people who suffer from lung cancer are smokers. Lung cancer in non-smokers can be induced by second hand smoke air pollutants and diesel exhaust [36-39]. Our present data showed significant difference of pack-year smoked but not smoking status between NSCLC cases and controls which suggested the important role of other environmental factors in the development of NSCLC. Tobacco could induce chronic and sustained inflammation in lung microenvironment contributing to pulmonary carcinogenesis in smokers [40]. Support also comes from the epidemiologic data regarding inflammation and lung cancer [41]. CR1 an important molecule implicated in immunity and inflammation could protect the host from invasion of exogenous chemicals derived from cigarette smoking. Genetic variant of CR1 could alter gene function and result in deregulation of the inflammatory and immune responses thereby modulating the susceptibility to lung cancer. More importantly we observed a potential interaction of this SNP (rs7525160 G?>?C) with smoking status suggesting the gene-environmental interaction plays a prominent role in the susceptibility to lung cancer. Our present study has its limitation. Our patients may not be representative of total NSCLC patients at large because they were recruited from only one hospital. In addition due to the relatively small sample size further case-control studies are still needed to replicate and extend our findings. Conclusion We conducted a case-control study in Chinese subjects and found an intronic SNP (rs7525160 G?>?C) of CR1 was significantly associated with lung cancer risk. To the best of our knowledge this study provides the first evidence that genetic variant of CR1 (rs7525160 G?>?C) was a smoking-modifying contributor to the development of lung cancer. Methods Study subjects This case-control study consisted of 470 patients with histopathologically confirmed NSCLC and 470 cancer-free controls. All subjects were genetic unrelated ethnic Han Chinese. Patients were recruited between January 2008 and December 2012 at Tangshan Gongren Hospital (Tangshan China). There were no age gender or stage restrictions however patients with previous malignancy or metastasized cancer from other organs were excluded. The response rate for patients was 94%. The controls were randomly selected from a pool of a cancer-free population from a nutritional survey conducted in the same region. The selection criteria for control subjects included: i) no individual history of cancer; ii) frequency matched to cases according to gender age (±5 years); iii) the residential region; and iv) the time period for blood sample collection. At recruitment informed consent was obtained from each subject and each participant was then interviewed to collect detailed information on demographic characteristics. This study was approved by the institutional review board of Hebei United University. Tag SNPs selection and genotyping Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs with an r2 threshold of 0.80 and minor allele frequency (MAF) greater than 1%. Furthermore we also added two potential functional polymorphisms rs9429942 and rs6691117 [4243]. Therefore we included 13 SNPs in our study which represents common genetic variants in Chinese population. Genotyping was performed at Bomiao Tech (Beijing China) using iPlex Gold Genotyping Asssy and Sequenom MassArray (Sequenom San Diego CA USA). Sequenom™s MassArray Designer was used to design PCR and extension primers for each SNP. Primer information for selected tag SNPs was listed in Table 5. Table 5 Primers used in this study SNP_ID Alleles 1st-PCR primer sequences 2nd-PCR primer sequences UEP sequences rs7525160 G/C ACGTTGGATGCAAAATCAAGGTTTAAAGTC ACGTTGGATGTTCTGACATGTACTGCCTGC CCCTGTTGCCTGGGTTTTTCT rs3886100 G/A ACGTTGGATGGGCCTCAGATCCTCAAAATC ACGTTGGATGTGAGCTGTTTCAGCCAAGAG GAGCCAAGAGGACACTTAG rs11118167 T/C ACGTTGGATGATGTGTGTAGTCACTTAGCC ACGTTGGATGATAATGGCAGATTTAAGGGC CAATGATAAATGAATACTGTGTTCTATC rs9429782 G/T ACGTTGGATGACACGCGGGATCCATCGGAA ACGTTGGATGAACGAGTTTCGCTGGCAGAG GGTGCAGCAGCAGAG rs10494885 C/T ACGTTGGATGGTGTAATGCCACAGACATGC ACGTTGGATGCCAGCCAACTGACCTTTATG CTTCTGATTTTCTTTCCTGTTAC rs7542544 C/A ACGTTGGATGGCTAAGAGCCATTAGTGTGC ACGTTGGATGAACGTGGTGGTGCCCAAACA CCATGACCCCAAAGC rs6691117 A/G ACGTTGGATGAGAGTACCAGGAAACAGGAG ACGTTGGATGACCCTACCATGACAAACCCG CCGGGCTGACATCTAAATCTGA rs6656401 G/A ACGTTGGATGAAAGGACACACACAGAGGAG ACGTTGGATGCGTTGATGTTCCTTGGCTTG CTCTGTCTCCATCTTCTC rs2296160 C/T ACGTTGGATGCCAGAATTCCTCAGCAAAAC ACGTTGGATGCCAGAGTGATGTTTTGTGAC CGTGCCTTTTGTCTTCCTTTTAGGT rs9429942 T/C"
Lung_Cancer
"Here we report a case of solitary lung metastasis of eyelid sebaceous carcinoma and discuss the clinical implication of surgery for a solitary pulmonary metastasis from sebaceous carcinoma. Case presentation A 77-year-old woman underwent left upper lid resection in April 2006 for sebaceous carcinoma of the eyelid. The surgical margin was negative for cancer cells. In January 2008 she had developed a recurrence in the left upper eyelid and underwent radiotherapy with a total dose of 57.6 Gy of proton beam therapy followed by orbital exenteration of the left eye [1112]. In July 2012 positron emission tomography“computed tomography (PET-CT) revealed a solitary pulmonary nodule 0.5 cm in size in the right upper lobe of the patient™s lung which had increased to 1.1 cm by September 2013 (A). PET-CT revealed a focus of increased uptake in that nodule with a standardized uptake value of 3.7 (B). There was no evidence of other metastatic disease on PET-CT scans. In September 2013 the patient underwent video-assisted thoracoscopic wedge resection of the pulmonary nodule. Frozen sections using oil red O stain revealed accentuation of lipid and presences of foamy cytoplasm in tumor cells which was positive for lipid staining (). Permanent histology demonstrated tumor cells with foamy cytoplasm and atypical nuclei accompanying numerous lipid globules within the cytoplasm () consistent with metastasis of eyelid sebaceous carcinoma. At the last follow-up 7 months after resection there was no loco-regional recurrence or distant metastasis of the tumor after surgery. Computed tomography (CT) and positron emission tomography of the tumors. (A) Chest CT showed a 1.1 cm nodule in the anterior segment of the right upper lobe (arrow). (B) PET-CT showed fluorodeoxyglucose accumulation with a Standardized uptake value (SUV) of 3.7 (arrowhead). Accentuation of lipid by staining. The lipid globules have a red color (frozen sections oil red O magnification?—?100). Sebaceous carcinoma cells. Foamy and frothy cytoplasm and atypical nuclei occurred with numerous lipid globules within the cytoplasm of the tumors cells seen as clear spaces (hematoxylin and eosin magnification?—?100). Discussion Sebaceous carcinoma of the eyelid refers to a group of carcinomas derived from sebaceous gland cells that occur in the ocular adnexa. It can be invasive in the eyelid and conjunctiva and can metastasize to regional lymph nodes and distant ans [81314]. Treatment strategies for primary eyelid sebaceous carcinoma are surgery radiotherapy and chemotherapy [15-17]. Distant hematogenous metastases to the lung liver and brain have a mortality rate as high as 30% [1618]. However few reports demonstrated the surgical treatment of metastatic eyelid sebaceous carcinoma. Standard treatment strategy for pulmonary metastatic sebaceous carcinoma has not yet been established because of the limited number of cases. Chemotherapy regimens in existing reports are largely based on the combination regimens commonly used in the treatment of other forms of poorly differentiated carcinomas of the head and neck region [1920]. Husain et al. reported combined chemotherapy of carboplatin and docetaxel for the patient who had multiple lung and lymph node metastases which resulted in a 30% decrease in tumor size but the efficacy of this regimen for sebaceous carcinoma has not yet been fully evaluated [21]. Radiotherapy for primary eyelid sebaceous carcinoma was described in several reports; however there have been no reports describing radiotherapy for pulmonary metastatic eyelid sebaceous carcinoma [2223]. Resection of pulmonary metastases in patients with sebaceous carcinoma is controversial. However our case suggests that a surgical approach to lung metastasis of eyelid sebaceous carcinoma could prolong survival in certain subgroups of patients namely those with a limited number of metastatic nodules or a significant disease-free interval. The possibility of metastasis from eyelid sebaceous carcinoma or primary lung cancer cannot be predicted only on the basis of radiologic findings or disease-free interval. In the present case we could successfully differentiate solitary lung metastasis of eyelid sebaceous carcinoma from primary lung cancer using oil red O stain which stains lipid has a red color on frozen sections. Conclusion We report a rare case of solitary lung metastasis of eyelid sebaceous carcinoma which was successfully resected and differentiated from primary lung cancer using oil red O stain on frozen sections. Pulmonary resection is a good option for the treatment and diagnosis of metastatic eyelid sebaceous carcinoma. Consent Written informed consent was obtained from the patient for the publication of this case presentation and accompanying images. A copy of the written consent is available for the review by the Editor-in-Chief of this journal. Abbreviations CT: Computed tomography; FDG: Fluorodeoxyglucose; PET: Positron emission tomography. Competing interests The authors declare that they have no competing interests. Authors™ contributions KK and TO wrote the manuscript. KK TO KA and IK performed surgery. YH and KE carried out the pathological examination. MK and TG were involved in the final editing. All authors approved the final manuscript. Cook BE Jr Bartley GB Cook BE Jr Bartley GB Treatment options and future prospects for the management of eyelid malignancies: an evidence-based update Ophthalmology 2001 108 2088 2209 quiz 2099“2100 2121 10.1016/S0161-6420(01)00796-5 11713084 Lai TF Huilgol SC Selva D James CL Eyelid sebaceous carcinoma masquerading as in situ squamous cell carcinoma Dermatol Surg 2004 30 222 225 10.1111/j.1524-4725.2004.30069.x 14756656 Leibovitch I Selva D Huilgol S Davis G Dodd T James CL Intraepithelial sebaceous carcinoma of the eyelid misdiagnosed as Bowen™s disease J Cutan Pathol 2006 33 303 308 10.1111/j.0303-6987.2006.00423.x 16630181 Pereira PR Odashiro AN Rodrigues-Reyes AA Correa ZM de Souza Filho JP Burnier MN Jr Histopathological review of sebaceous carcinoma of the eyelid J Cutan Pathol 2005 32 496 501 10.1111/j.0303-6987.2005.00371.x 16008694 Sinard JH Immunohistochemical distinction of ocular sebaceous carcinoma from basal cell and squamous cell carcinoma Arch Ophthalmol 1999 117 776 783 10.1001/archopht.117.6.776 10369589 Chao AN Shields CL Krema H Shields JA Outcome of patients with periocular sebaceous gland carcinoma with and without conjunctival intraepithelial invasion Ophthalmology 2001 108 1877 1883 10.1016/S0161-6420(01)00719-9 11581065 Shields JA Demirci H Marr BP Eagle RC Jr Shields CL Sebaceous carcinoma of the eyelids: personal experience with 60 cases Ophthalmology 2004 111 2151 2157 10.1016/j.ophtha.2004.07.031 15582067 Shields JA Demirci H Marr BP Eagle RC Jr Shields CL Sebaceous carcinoma of the ocular region: a review Surv Ophthalmol 2005 50 103 122 10.1016/j.survophthal.2004.12.008 15749305 Yen MT Tse DT Wu X Wolfson AH Radiation therapy for local control of eyelid sebaceous cell carcinoma: report of two cases and review of the literature Ophthal Plast Reconstr Surg 2000 16 211 215 10.1097/00002341-200005000-00008 10826762 Wang JK Liao SL Jou JR Lai PC Kao SC Hou PK Chen MS Malignant eyelid tumours in Taiwan Eye (Lond) 2003 17 216 220 10.1038/sj.eye.6700231 12640409 Zenda S Kawashima M Nishio T Kohno R Nihei K Onozawa M Arahira S Ogino T Proton beam therapy as a nonsurgical approach to mucosal melanoma of the head and neck: a pilot study Int J Radiat Oncol Biol Phys 2011 81 135 139 10.1016/j.ijrobp.2010.04.071 20950948 Zenda S Kohno R Kawashima M Arahira S Nishio T Tahara M Hayashi R Kishimoto S Ogino T Proton beam therapy for unresectable malignancies of the nasal cavity and paranasal sinuses Int J Radiat Oncol Biol Phys 2011 81 1473 1478 10.1016/j.ijrobp.2010.08.009 20961697 Ginsberg J Present Status of Meibomian gland carcinoma Arch Ophthalmol 1965 73 271 277 10.1001/archopht.1965.00970030273022 14237799 Rao NA Hidayat AA McLean IW Zimmerman LE Sebaceous carcinomas of the ocular adnexa: a clinicopathologic study of 104 cases with five-year follow-up data Hum Pathol 1982 13 113 122 10.1016/S0046-8177(82)80115-9 7076199 Gardetto A Rainer C Ensinger C Baldissera I Piza-Katzer H Sebaceous carcinoma of the eyelid: a rarity worth considering Br J Ophthalmol 2002 86 243 244 10.1136/bjo.86.2.243 11815355 Kass LG Hornblass A Sebaceous carcinoma of the ocular adnexa Surv Ophthalmol 1989 33 477 490 10.1016/0039-6257(89)90049-0 2658172 Lan MC Lan MY Lin CZ Ho DM Ho CY Sebaceous carcinoma of the eyelid with neck metastasis Otolaryngol Head Neck Surg 2007 136 670 671 10.1016/j.otohns.2006.08.019 17418274 Boniuk M Zimmerman LE Sebaceous carcinoma of the eyelid eyebrow caruncle and orbit Trans Am Acad Ophthalmol Otolaryngol 1968 72 619 642 5706692 Midena E Angeli CD Valenti M de Belvis V Boccato P Treatment of conjunctival squamous cell carcinoma with topical 5-fluorouracil Br J Ophthalmol 2000 84 268 272 10.1136/bjo.84.3.268 10684836 Yeatts RP Engelbrecht NE Curry CD Ford JG Walter KA 5-Fluorouracil for the treatment of intraepithelial neoplasia of the conjunctiva and cornea Ophthalmology 2000 107 2190 2195 10.1016/S0161-6420(00)00389-4 11097594 Husain A Blumenschein G Esmaeli B Treatment and outcomes for metastatic sebaceous cell carcinoma of the eyelid Int J Dermatol 2008 47 276 279 10.1111/j.1365-4632.2008.03496.x 18289332 Hata M Koike I Omura M Maegawa J Ogino I Inoue T Noninvasive and curative radiation therapy for sebaceous carcinoma of the eyelid Int J Radiat Oncol Biol Phys 2012 82 605 611 10.1016/j.ijrobp.2010.12.006 21300468 Howrey RP Lipham WJ Schultz WH Buckley EG Dutton JJ Klintworth GK Rosoff PM Sebaceous gland carcinoma: a subtle second malignancy following radiation therapy in patients with bilateral retinoblastoma Cancer 1998 83 767 771 10.1002/(SICI)1097-0142(19980815)83:4<767::AID-CNCR20>3.0.CO;2-P 9708943 101274235 33311 J Thorac Oncol J Thorac Oncol Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer 1556-0864 1556-1380 24736085 4271824 10.1097/JTO.0000000000000082 NIHMS648380 Article A Randomized Placebo-Controlled Multicenter Biomarker-Selected Phase 2 Study of Apricoxib in Combination with Erlotinib in Patients with Advanced Non“Small-Cell Lung Cancer Gitlitz Barbara J. MD * Bernstein Eric MD   Santos Edgardo S. MD ¡ Otterson Greg A. MD § Milne Ginger PhD ? Syto Mary MS ¶ Burrows Francis PhD ¶ Zaknoen Sara MD ¶ *University of Southern California Keck School of Medicine Norris Comprehensive Cancer Center Los Angeles California  Providence Cancer Center Portland Oregon ¡University of Miami Sylvester Comprehensive Cancer Center Miami Florida §Ohio State University Columbus Ohio ?Vanderbilt University Nashville Tennessee ¶Tragara Pharmaceuticals San Diego California Address for correspondence: Barbara Gitlitz MD University of Southern California Keck School of Medicine Norris Comprehensive Cancer Center 1441 Eastlake Avenue Suite 3400 Los Angeles CA 90089. [email protected] 13 12 2014 4 2014 19 12 2014 9 4 577 582 Copyright © 2013 by the International Association for the Study of Lung Cancer 2013 Cyclooxygenase-2 (COX-2) overexpression is associated with a poor prognosis in non“small-cell lung cancer (NSCLC) and may promote resistance to epidermal growth factor receptor inhibitors. This randomized phase 2 trial evaluated apricoxib a novel COX-2 inhibitor in combination with erlotinib in biomarker-selected patients. Patients with stage IIIB/IV NSCLC previously treated with platinum-based chemotherapy were randomized (2:1) to 400 mg/day apricoxib plus 150 mg/day erlotinib (AP/E) or placebo plus erlotinib (P/E) in 21-day cycles until disease progression or unacceptable toxicity. The primary endpoint was time to progression (TTP). A decrease of 50% or more from baseline urinary prostaglandin E2 metabolite after a 5-day open-label run-in period was used to select eligible patients. One hundred twenty patients (median age 64 years) were randomized (78 to AP/E and 42 to P/E). Overall median TTP was 1.8 months in the AP/E group and 2.1 months in the P/E group with a 12% objective response rate in both groups (intent-to-treat analysis). A subgroup analysis in patients aged 65 years or younger demonstrated a statistically significant TTP benefit for AP/E (hazard ratio 0.5 [95% confidence interval: not applicable“0.9]; p=0.018) and overall survival advantage at minimum 1-year follow-up (median 12.2 versus 4.0 months; hazard ratio=0.5; p=0.021). The most common adverse events were rash diarrhea fatigue and nausea. Toxicity contributed to early discontinuations in patients aged more than 65 years treated with AP/E. This is the first randomized placebo-controlled study of a COX-2 inhibitor in NSCLC to use a prospective patient-selection strategy. Although AP/E seemed to improve TTP and overall survival in a subset of patients aged 65 years or younger the primary endpoint of the trial was not met. Non“small-cell lung cancer Apricoxib Erlotinib Cyclooxygenase-2 inhibitor Prostaglandin E2 metabolite 0413066 2830 Cell Cell Cell 0092-8674 1097-4172 24630729 4040459 10.1016/j.cell.2014.02.031 NIHMS573682 Article Genetic and Clonal Dissection of Murine Small Cell Lung Carcinoma Progression by Genome Sequencing McFadden David G. 1 5 Papagiannakopoulos Thales 1 5 Taylor-Weiner Amaro 3 5 Stewart Chip 3 5 Carter Scott L. 3 5 Cibulskis Kristian 3 Bhutkar Arjun 1 McKenna Aaron 3 Dooley Alison 1 Vernon Amanda 1 Sougnez Carrie 3 Malstrom Scott 1 Heimann Megan 1 Park Jennifer 1 Chen Frances 1 Farago Anna F. 1 Dayton Talya 1 Shefler Erica 3 Gabriel Stacey 3 Getz Gad 3 4 * Jacks Tyler 1 2 * 1Koch Institute for Integrative Cancer Research and Department of Biology Massachusetts Institute of Technology Cambridge MA 02142 USA 2Howard Hughes Medical Institute Massachusetts Institute of Technology Cambridge MA 02142 USA 3Cancer Program Broad Institute of MIT and Harvard Cambridge MA 02142 USA 4Cancer Center and Department of Pathology Massachusetts General Hospital Boston MA 02114 USA *Correspondence: gadgetz@broadinstitute. (G.G.) [email protected] (T.J.) 5 Co-first author 6 5 2014 13 3 2014 13 3 2015 156 6 1298 1311 ©2014 Elsevier Inc. 2014 Summary Small cell lung carcinoma (SCLC) is a highly lethal smoking-associated cancer with few known targetable genetic alterations. Using genome sequencing we characterized the somatic evolution of a genetically engineered mouse model (GEMM) of SCLC initiated by loss of Trp53 and Rb1. We identified alterations in DNA copy number and complex genomic rearrangements and demonstrated a low somatic point mutation frequency in the absence of tobacco mutagens. Alterations targeting the tumor suppressor Pten occurred in the majority of murine SCLC studied and engineered Pten deletion accelerated murine SCLC and abrogated loss of Chr19 in Trp53; Rb1; Pten compound mutant tumors. Finally we found evidence for polyclonal and sequential metastatic spread of murine SCLC by comparative sequencing of families of related primary tumors and metastases. We propose a temporal model of SCLC tumorigenesis with implications for human SCLC therapeutics and the nature of cancer-genome evolution in GEMMs. J Natl Cancer Inst J. Natl. Cancer Inst jnci jnci.j JNCI Journal of the National Cancer Institute 0027-8874 1460-2105 Oxford University Press US 24317180 3906987 10.1093/jnci/djt338 Brief Communication Novel Germline Mutation in the Transmembrane Domain of HER2 in Familial Lung Adenocarcinomas Yamamoto Hiromasa Higasa Koichiro Sakaguchi Masakiyo Shien Kazuhiko Soh Junichi Ichimura Koichi Furukawa Masashi Hashida Shinsuke Tsukuda Kazunori Takigawa Nagio Matsuo Keitaro Kiura Katsuyuki Miyoshi Shinichiro Matsuda Fumihiko Toyooka Shinichi Affiliations of authors:Department of Thoracic Breast and Endocrinological Surgery (HY KS JS MF SH KT SM ST) Department of Clinical Genomic Medicine (KS ST) Department of Cell Biology (MS) Department of Pathology (KI) and Department of Hematology Oncology and Respiratory Medicine (KK) Okayama University Graduate School of Medicine Dentistry and Pharmaceutical Sciences Okayama Japan; Center for Genomic Medicine Kyoto University School of Medicine Kyoto Japan (KH FM); Department of General Internal Medicine 4 Kawasaki Medical School Okayama Japan (NT); Department of Preventive Medicine Kyushu University Faculty of Medical Sciences Fukuoka Japan (KM). Correspondence to: Shinichi Toyooka MD PhD Okayama University Graduate School of Medicine Dentistry and Pharmaceutical Sciences Clinical Genomic Medicine/Thoracic Breast and Endocrinological Surgery 2-5-1 Shikata-cho Kita-ku Okayama Okayama 700“8558 Japan (e-mail: [email protected]). 1 2014 7 12 2013 7 12 2013 106 1 djt338 7 7 2013 14 10 2013 16 10 2013 © The Author 2013. Published by Oxford University Press. 2013 This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs licence (http://creativecommons./licenses/by-nc-nd/3.0/) which permits non-commercial reproduction and distribution of the work in any medium provided the original work is not altered or transformed in any way and that the work is properly cited. For commercial re-use please contact [email protected] We encountered a family of Japanese descent in which multiple members developed lung cancer. Using whole-exome sequencing we identified a novel germline mutation in the transmembrane domain of the human epidermal growth factor receptor 2 (HER2) gene (G660D). A novel somatic mutation (V659E) was also detected in the transmembrane domain of HER2 in one of 253 sporadic lung adenocarcinomas. Because the transmembrane domain of HER2 is considered to be responsible for the dimerization and subsequent activation of the HER family and downstream signaling pathways we performed functional analyses of these HER2 mutants. Mutant HER2 G660D and V659E proteins were more stable than wild-type protein. Both the G660D and V659E mutants activated Akt. In addition they activated p38 which is thought to promote cell proliferation in lung adenocarcinoma. Our findings strongly suggest that mutations in the transmembrane domain of HER2 may be oncogenic causing hereditary and sporadic lung adenocarcinomas. Familial lung cancers are rare among human malignancies. Recent studies have reported that germline mutations in the epidermal growth factor receptor (EGFR) gene predispose the development of lung cancer. Reported familial lung adenocarcinomas with a germline EGFR mutation such as T790M carry secondary somatic EGFR mutations including exon 19 deletion and exon 21 L858R mutation (1“4). We encountered a family of Japanese descent in which multiple members developed lung cancer (). The proband (III-4) was a 53-year-old woman with multiple lung adenocarcinomas in bilateral lungs. She was a light smoker with a 1.2-pack-year history of smoking. She had undergone a left lower lobectomy for multiple lung adenocarcinomas at the age of 44 years. Her mother (II-4) a never smoker also had multiple lung adenocarcinomas. Partial pulmonary resections of two tumors were performed for II-4 for the purpose of diagnosis after pleural dissemination was found during surgery and multiple lesions were removed in a lobectomy or partial resections in III-4. A histological examination of the resected tumors in II-4 revealed nonmucinous adenocarcinoma in situ and nonmucinous minimally invasive adenocarcinoma whereas the histological findings of pleural dissemination indicated mucus-containing adenocarcinoma. Those of III-4 contained various subtypes of adenocarcinoma including nonmucinous and mucinous adenocarcinoma in situ and invasive mucinous adenocarcinoma. In addition normal-appearing lung parenchyma obtained from a lobectomy in III-4 revealed innumerable small preinvasive lesions implying the presence of precancerous changes throughout the lung (Supplementary available online). Sequencing analyses of EGFR exons 18 to 21 and KRAS as well as an immunohistochemical staining for ALK protein in the resected tumors indicated no genetic alterations in these genes. The pedigree chart suggested that lung cancer was inherited in an autosomal dominant manner. . Pedigree chart of a Japanese family in which multiple members developed lung cancer. The boxes and circles indicate men and women respectively. The numbers at the bottom of each member indicate the age at the time of death or the time of the analysis. An oblique line shows deceased family members. The proband (III-4) had multiple lung adenocarcinomas (arrow). Tumor tissue nonmalignant lung tissue and peripheral blood samples were obtained from III-4. The proband™s mother (II-4) also had multiple lung adenocarcinomas and tumor and nonmalignant lung tissue samples were available. "
Lung_Cancer
" discrete and compact nodular opacity (arrowheads) (B) focal neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E —12.5) (C) scattered small nodular opacities of lipiodol (long arrows) and faint nodular opacity (arrowheads) (D) focal hemorrhage and necrosis (arrowheads) with diffuse neutrophil infiltration (short arrows) (H&E —12.5). MLM in Group A (E F); (E) faint nodular lipiodol opacity (arrows) (F) focal hemorrhage (arrows) with diffuse neutrophil infiltration (arrowheads) (H&E —12.5). Methylene blue in Group A (G H); (G) faint nodular opacity (arrowheads) and (H) focal extent of neutrophil infiltration necrosis and hemorrhage (arrowheads) (H&E —12.5). Staining extent and localization ability of MLM versus methylene blue Data are mean±standard deviation. Numbers in parentheses are ranges. N/A indicates not available. *Non-parametric Mann-Whitney test was performed to compare the average score of MLM and methylene blue. MLM mixture of lipiodol and methylene blue. Localization ability score of staining and radio-opacity for MLM as well as methylene blue Data are numbers of subjects. Numbers in parentheses are percentages. MLM mixture of lipiodol and methylene blue. Comparison of localization ability between MLM and methylene blue in total subjects (n = 42) We considered a score of 2 or 3 as appropriate and 3 as excellent for localization respectively. Numbers in parentheses are percentages. *Fisher's exact test compared the proportion of appropriate or excellent staining between the mixture and methylene blue. MLM mixture of lipiodol and methylene blue. Localization ability of MLM: Evaluation of radio-opacity and staining score Data are given as numbers of subjects. Numbers in parentheses are percentages. MLM mixture of lipiodol and methylene blue. Histopathologic findings of lung specimens after percutaneous injections Data are numbers of subjects. Numbers in parentheses are percentages. N/A indicates not available. *Linear by linear association was performed between material and the extent of the histopathologic findings.  Linear by linear association was performed between groups and the extent of the histopathologic findings. MLM mixture of lipiodol and methylene blue. PLoS One one 1932-6203 Public Library of Science San Francisco USA 24819391 4018408 PONE-D-13-46027 .0096911 Research Biology and Life Sciences Biochemistry Biomarkers Genetics Heredity Medicine and Health Sciences Diagnostic Medicine Epidemiology Biomarker Epidemiology Cancer Epidemiology Health Care Environmental Health Oncology Cancer Risk Factors Environmental Causes of Cancer Pathology and Laboratory Medicine Public and Occupational Health Pulmonology Environmental and Occupational Lung Diseases Single Nucleotide Polymorphism in ATM Gene Cooking Oil Fumes and Lung Adenocarcinoma Susceptibility in Chinese Female Non-Smokers: A Case-Control Study ATM Polymorphism and Risk of Lung Adenocarcinoma Shen Li 1 2 Yin Zhihua 1 2 Wu Wei 1 2 Ren Yangwu 1 2 Li Xuelian 1 2 Zhou Baosen 1 2 * 1 Department of Epidemiology School of Public Health China Medical University Heping District Shenyang Liaoning Province China 2 Key Laboratory of Cancer Etiology and Intervention University of Liaoning Province China Chang Jeffrey S. Editor National Health Research Institutes Taiwan * E-mail: bszhoumail.cmu.edu.cn Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: LS. Performed the experiments: LS YR XL. Analyzed the data: LS WW ZY. Contributed reagents/materials/analysis tools: LS ZY XL BZ. Wrote the paper: LS. Obtained informed consent from subjects: Baosen Zhou. 2014 12 5 2014 9 5 e96911 3 11 2013 12 4 2014 2014 Shen et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44 95% confidence interval (CI) 1.02“2.02 P?=?0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89 95%CI 1.03“3.49 P?=?0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. This study was supported by grant no. 81272293 from National Natural Science Foundation of China grant no. 81102194 from National Natural Science Foundation of China and grant no. 00726 from China Medical Board. The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Lung cancer is the leading cause of cancer-related deaths both worldwide and in China. Although cigarette smoke is the major risk factor for lung cancer only a fraction of smokers develop this disease [1] suggesting that host genetic susceptibility may play an important role in the development of lung cancer. Recent genetic susceptibility studies of lung cancer have focused on single nucleotide polymorphisms (SNPs) in candidate genes among which DNA repair genes are increasingly studied because of their critical role in maintain genome integrity. Genetic variations in DNA repair genes are thought to affect DNA repair capacity and deficits in DNA repair capacity may lead to genetic instability and carcinogenesis [2] [3]. As one of the DNA repair genes ataxia-telangiectasia mutated (ATM) gene which is responsible for the multisystem autoxomal recessive disorder ataxia-telangiectasia (A“T) plays a crucial role in the recognition signaling and repair of DNA damage especially DNA double-strand breaks (DSBs) [4] [5]. The ATM protein is a member of phosphoinositide 3-kinase (PI-3 kinases) and can be activated by DSBs caused by ionizing radiation or reactive oxygen intermediates [6] [7]. Once activated ATM can phosphorylate various downstream substates that function in cell cycle arrest apoptosis and DNA repair such as p53 NBS1 BRCA1 and Chk2 [8] [9]. Therefore genetic variants in ATM gene may lead to the structure and function change of the protein and act as important factors indicating individual susceptibility to cancer. ATM -111G>A (rs189037) resides in the promoter of ATM gene. Increasing studies have shown that variations in the DNA promoter sequence may potentially alter the affinities of multiple regulatory proteins-DNA interactions or the specificity of the transcriptional process [10]“[13]. Although this polymorphism makes no amino acid change the alleles may have different binding affinity to the transcription factor and exhibit different levels of mRNA expression [14] [15]. Zhang et al. [16]declared that ATM rs189037 AA genotype was associated with a lower ATM mRNA levels than GG genotype in lung tissue samples. Their results showed that the G-to-A change might create a transcriptional inhibitor-binding site for ATM rs189037 A allele promoter and subsequently reduce the ATM mRNA expression. Consequently lower expression of ATM might cause elevated sensitivity to ionizing radiation defects in the activation of cell cycle checkpoints a reduced capacity for DNA repair and abnormal apoptosis. All of these features would contribute to increased individual cancer susceptibility. In recent years a number of studies have evaluated the association between this polymorphism and cancer risk such as thyroid carcinoma [17] oral cancer [18] breast cancer [19] leukemia [20] nasopharyngeal carcinoma [21] glioma [22] and lung caner [23]“[25]. Previous studies of ATM rs189037 have included cigarette smokers as cases and controls that made it difficult to judge whether this polymorphism were associated with lung cancer or tobacco use. Considering the facts in China the incidence and death rate of lung cancer in women continues to increase and this phenomenon is frequently occurring in those who have never smoked. In order to have a better control of confounding of gender or smoking we performed a case-control study to identify the association between the polymorphism of ATM rs189037 and the risk of lung cancer in the non-smoking females in Chinese Han population. We also investigated the interaction between genetic polymorphism and environmental exposure in lung cancer. Methods Subjects This hospital-based case-control study included 487 lung cancer patients and 516 cancer-free hospital controls. All subjects were female non-smokers and they were from unrelated ethic Han Chinese. The cases were recruited during January 2002 to November 2012 at Liaoning Cancer Hospital & Institute. All patients were histologically confirmed to have lung cancer before any radiotherapy and chemotherapy. During the same time controls were selected from patients with other lung diseases but free of cancer history and symptom. Controls suffered mainly from bronchitis pneumonias fibrosis sarcoidosis chronic obstructive pulmonary disease and emphysema. Controls were all non-smoking females and frequency-matched to case subjects for age (±5 years). This study was approved by the institutional review board of China Medical University and written informed consent was obtained from each participant or each participant's representatives if direct consent could not be obtained. Data Collection A total of 10 ml of venous blood was collected from each patient. Patients were interviewed to collect information for demographics and environmental exposure at the time they were admitted to hospital. Information concerning demographic characteristics passive smoking cooking oil fume exposure fuel smoke exposure family history of cancer occupational exposure and dietary habit was obtained for each case and control by trained interviewers. An individual was defined as a smoker if she had consumed a total of 100 cigarettes in her lifetime; otherwise she was considered as a non-smoker. About fuel smoke exposure participants who used coal-fuel-burning stoves without chimneys were regarded as fuel smoke exposure. For exposure to cooking oil fumes participants were mainly asked about the method of cooking and eyes or throat irritation. For cooking methods participants were asked whether they cooked food in a stir-frying way and how many times a week; for eyes or throat irritation participants were asked how often they felt eyes or throat irritated by the oily smoke. There were four possible responses ranging from œnever œseldom œsometimes and œfrequently. Subjects were considered as cooking oil fume exposure if they met criteria as follows: (1) have cooked for over 15 years; (2) cooked food in a stir-frying way for more than twice a week; (3) felt eyes or throat irritated by oily smoke. Exposure for cooking oil fume was categorized as an indicator variable equal to 1 if participants reported frequently or sometimes and equal to 0 otherwise. Genotype Analysis Genomic DNA was extracted from peripheral blood samples by the conventional phenol-chloroform extraction method. SNP was genotyped by investigators blinded to case-control status in order to avoid any genotyping bias using TaqMan methodology and read with the Sequence Detection Software on an Applied Biosystems 7500 FAST Real-Time PCR System according to the manufacturer's instructions (Applied Biosystems Foster City CA). Amplification was done under the following conditions: 95°C for 10 min followed by 47 cycles of 92°C for 30 s and 60°C for 1 min. In this study 487 lung cancer patients and 516 controls were all genotyped successfully and 5% duplicated samples were randomly selected to assess the reproducibility for quality control with a concordance rate of 100%. Statistical Analysis The x2 test and t test were applied to estimate differences in demographic variables and distributions of genotypes between cases and controls. The association of genotypes of ATM rs189037 with risk of lung cancer was estimated by computing the odds ratios (ORs) and 95% confidence intervals (CIs) in unconditional logistic regression analysis. The Hardy-Weinberg equilibrium (HWE) was tested using goodness-fit x2 test to compare the genotype frequencies in the control subjects from those expected. A logistic regression model was used to evaluate gene-environment interactions. All data were analyzed with Statistical Product and Service Solutions (SPSS) v13.0 for Windows if not otherwise specified. All statistical analysis were two-sided and the significance level was set at P<0.05. Results Population characteristics A total of 487 lung cancer and 516 age-matched cancer-free controls were enrolled in this study. As shown in the mean ages of cases and controls (mean ±S.D.) were almost identical (56.5±11.7 and 56.3±12.5 respectively). All cases were female non-smoking lung cancer patients. No statistically significant difference was found between cases and controls in terms of age (P?=?0.248) and monthly income (P?=?0.084). Cases included 434 non-small cell lung cancer (NSCLC) patients and 53 small cell carcinoma patients. In the NSCLC cases there were 320 adenocarcinomas 73 squamous cell carcinomas and 41 other tumors with a variety of different pathologies (such as large cell carcinomas mixed cell carcinomas or undifferentiated carcinomas). .0096911.t001 Characteristics of lung cancer cases and controls. Variables Cases(%) Controls(%) P value Female 487 516 Mean age (years) 56.5±11.7 56.3±12.5 0.248a Income (yuan/month) 628.9±419.3 563.5±387.6 0.084a Never smoker 487 516 Histological type NSCLC 434(89.1) Adenocarcinoma 320(65.7) Squamous cell carcinoma 73(15.0) Small cell carcinoma 53(10.9) Other 41(8.4) a Student's t-test was used to compare the frequency distributions of demographic variables between the cases and controls. Association analysis The observed genotype frequencies among the control subjects was in agreement with that expected under the Hardy-Weinberg equilibrium (P?=?0.119). The distribution of ATM rs189037 genotypes among subjects were displayed in . "
Lung_Cancer
" In the current study how miR-21 interplays with PI3K/Akt signaling pathway under our experimental conditions is not clear. However it is reported that molecules such as PTEN have been proposed to be involved in NSCLC cells' radioresistance [36 37] and miR-21 is related to PTEN with high possibility [30 38]. In addition since PTEN PI3K and Akt are closely related it is one of the possible mechanisms that PTEN may play a role in PI3K/Akt signaling pathway mediated radiosensitization of A549 cells by miR-21 knockdown but this still needs further comfirmation in future studies. In summary the present study found that downregulation of miRNA-21 sensitized radioresistant NSCLC A549 cells to IR by inhibiting cell proliferation and enhancing apoptosis through inhibition of PI3K/Akt signaling pathway. This information may be useful to develop new treatments for the clinical therapy of NSCLC patients. Further analysis on targets of miR-21 is still of considerable interest as they may reveal novel radiotherapy sensitization strategies for radioresistant NSCLC. Conflict of Interests The authors declare that there is no conflict of interests regarding the publication of this paper. Authors' Contribution Yongfu Ma and Hui Xia contributed equally to this work. 1 Jemal A Siegel R Ward E Cancer statistics 2008 CA: Cancer Journal for Clinicians 2008 58 2 71 96 2-s2.0-41349099104 2 Siegel R Naishadham D Jemal A Cancer statistics 2012 CA: Cancer Journal for Clinicians 2012 62 1 10 29 2-s2.0-84855792427 3 Fidias P Novello S Strategies for prolonged therapy in patients with advanced non-small-cell lung cancer Journal of Clinical Oncology 2010 28 34 5116 5123 2-s2.0-78650491373 21041704 4 Fuld AD Dragnev KH Rigas JR Pemetrexed in advanced non-small-cell lung cancer Expert Opinion on Pharmacotherapy 2010 11 8 1387 1402 2-s2.0-77952119805 20446853 5 Whitehurst AW Bodemann BO Cardenas J Synthetic lethal screen "
Lung_Cancer
"In this study we identified a novel pathway for Sp1-mediated activation wherein miR-182 expression downregulated the expression of FOXO3 a known miR-182 target gene [35]. Sp1 activated miR-182 and FOXO3 at the transcriptional level; however FOXO3 protein expression decreased. These results suggest that post-transcriptional regulation by miRNAs is a powerful mechanism by which to control the final level of protein expression. Many coding genes with Sp1 binding element(s) in their promoters harbor conserved miRNA target sequences in their 3'-UTR. To our knowledge this is first study to demonstrate that Sp1 regulates the expression of a target gene by regulating promoter activity and post-transcriptional processing in parallel. Few studies have characterized the regulation of miRNA by Sp1. Herein using a bioinformatics approach we identified several miRNAs potentially regulated by Sp1 including miR-182. We then showed that Sp1 specifically targets the miR-182 promoter region and activates miR-182 expression. miR-182 reportedly forms a gene cluster with two adjacent miRNAs (miR-96 and miR-183) [35]. The expression of miR-96 and miR-183 also decreased following Sp1 knockdown (Supplementary Figure S2A). Moreover we also investigated the binding of Sp1 to the miR-212 promoter because the latter contains 13 putative Sp1 binding sites (Supplementary Table S1). We found that Sp1 bound to the miR-212 promoter sequence (Supplementary Figure S2B and S2C). Interestingly a recent study showed that FOXO3 is a direct target of miR-212 in the neurons of patients with Alzheimer's disease [36]. miR-182 and miR-212 might cooperate to downregulate FOXO3 expression upon Sp1 overexpression. We cannot rule out this possibility. However depletion of miR-182 was sufficient to impair the Sp1-mediated reduction of FOXO3 expression in our experiments (C) suggesting that miR-182 is the major regulator of FOXO3 in lung cancer cells. Several studies have shown that miR-182 is upregulated in lung cancer. This suggests that miR-182 plays a positive role in lung tumorigenesis. However in two studies of miR-182 function in lung cancer miR-182 inhibited the proliferation of human lung adenocarcinoma cells [37 38]. Our results in this study provide several pieces of evidence to support the notion that miRNA-182 is a positive regulator of lung cancer cell proliferation. Firstly miR-182 was upregulated in the majority of lung cancer clinical samples and lung cancer cell lines examined. Secondly miR-182 knockdown inhibited cell cycle progression and cell growth. Finally miR-182 knockdown reduced lung tumor growth in vivo. Discrepancies in the role of miRNA-182 in lung cancer cell proliferation might derive from the different experimental designs of the studies. For example because miR-182 expression is upregulated in lung cancer we knocked down its expression and examined the effects on cancer cell proliferation. However other studies that described a negative role of miR-182 in lung cancer used miR-182 overexpression to study miR-182's role in cancer cell proliferation. Overexpression conditions can alter the function of many genes [39]. For example Sp1 accumulates in most of cancers; knockdown of Sp1 expression decreases cell proliferation but Sp1 overexpression also attenuates cancer cell growth [40]. Because post-translational modifications affect protein function overexpressed proteins might not be completely processed which could affect their function. Previous studies in melanoma and hepatocellular carcinoma indicated that miR-182 enhanced tumor metastasis [35 41]. However our data as shown in indicated that miR-182 knockdown altered cell morphology and increased migration and invasion activities. In addition miR-182 knockdown increased N-cadherin levels suggesting that miR-182 promotes the mesenchymal to epithelial transition (MET) [42]. Previous studies have shown that TIMP-2 enhances the E-cadherin/?-catenin complex in A549 lung cancer cells [43]. Whether Sp1 or miR-182 regulates TIMP-1 in lung cancer needs to be addressed in future studies. Finally miR-182 levels were lower in CL1-5 cells then in CL1-0 cells resulting in increased metastatic activity in CL1-5. Collectively our data suggest that miR-182 inhibits lung cancer metastasis. Our previous study indicated that Sp1 is down regulated in the late stages of lung cancer progression [32]. Therefore in the late stages of lung tumorigenesis miR-182 expression was down regulated compared with expression in the early stages which led to tumor metastasis through at least in part an increase in FOXO3 expression. It is still not clear why miR-182 has different roles in different types of cancer; this awaits further study. Although we found that FOXO3 is involved in miR-182-mediated lung cancer progression FOXO3 knockdown did not completely abolish the effects of miR-182 knockdown suggesting that other genes regulated by miR-182 contribute to the inhibition of metastasis by miR-182. With this in mind we determined the expression profile of miR-182-regulated genes. Many metastasis-related genes were induced in miR-182-knockdown cells including CD44 ADAM9 and CDH9. CD44 which localizes to the cell membrane is reportedly involved in cell migration in various cancer types [44]. Recent studies also showed that tumor initiating cells with high CD44 expression maintained lung cancer tumorigenicity and drug resistance [45]. Another metastasis-related gene induced by miR-182 knockdown ADAM9 cleaves membrane proteins such as E-cadherin [46]. A previous study showed that combined Kras and Wnt pathway activation increased the incidence of lung cancer formation [47]. Given that ADAM9 is also involved in the activation of the Wnt pathway Sp1 and miR-182 might connect the Kras and the Wnt pathway. In addition CDH9 also involves in the cancer metastasis [48]. In we showed that miR-182 is an Sp1-activated miRNA whose expression increased in lung cancer. miR-182 functioned not only as an oncomiR for lung cancer growth but also as a suppressor of lung cancer metastasis. MATERIALS AND METHODS Cell culture and transfection Human lung cancer cell lines A549 H1299 CL 1-0 and 1-5 were cultured in Dulbecco's modified Eagle's medium (Invitrogen Carlsbad CA) human diploid fibroblasts IMR were cultured in Minimum Essential Media (Invitrogen) and human bronchial epithelial cells BEAS-2B was cultured in RPMI 1640 Medium (Thermo Scientific Rockford IL). All of culture mediums contained 10% fetal bovine serum 100 U/ml penicillin G sodium and 100 ?g/ml streptomycin sulfate (Invitrogen). Cells were cultured at 37? and 5% CO2."
Lung_Cancer
"The recurrence rate Q is used to evaluate the reliability of logic relationships as follows:(5)where represents the number of recurrance times of a logic relationship in all random trials and is the number of all random trials. Mapping probe-phenotype relationships to gene-phenotype relationships On the basis of lower and higher probe-phenotype logic relationships lower and higher gene-phenotype logic relationships are generated as follows. Suppose all the probes detecting genes and form a set and where and are the size of the set and and respectively. 1. If () is the unique probe of that is related with a phenotype then the gene relates with in the same way as . Moreover the coefficient of the - lower logic relationship is equal to the mean uncertainty coefficient of the - lower logic relationship in both directions. If ( and ) is the unique probe pair related with a phenotype then the gene pair is related with in the same way as the probe pair . Moreover the coefficient of the - higher logic relationship is the mean uncertainty coefficient of the - higher logic relationship in both directions. 2. Suppose is a probe set of gene where is the size of the set and . Every probe in the above set is related with a phenotype by a lower logic relationship. We define as the mean of and where and are real numbers. If is the largest element in then is related with the phenotype in the same way as the probe and its coefficient is equal to . Similarly suppose is the probe pair set of gene pairwise where is the size of the set. Every probe pair in the above probe pair set is related with a phenotype by a higher logic relationship. If is the maximum mean uncertainty coefficient in then the gene pair is related with the phenotype in the same way as the probe pair and the coefficient of - higher logic relationship is equal to . Earlier relationship-inference methods We adapt the two earlier methods suitable for mining gene-phenotype relationships. These methods are described as follows: The non-negative matrix factorization (NMF) method is a model selection method. Given a positive matrix of size the NMF algorithm iteratively computes an approximation where and are nonnegative matrics with size and respectively [18]. Each column of represents a metagene and the number of columns () is typically equal to the number of phenotypes. Entry denotes the expression level of metagene in cluster . Entry represents the coefficient of gene in metagene . Genes which are more active in the genome have higher coefficient values. When the coefficient values are sorted in descending order the first one represents the most active gene while the last one represents the least active. That is the larger coefficient of a gene in a metagene the closer relationship between the gene and a phenotype. In this work we chose the alternate least squares as the algorithm to factorize into because of the algorithm's speed and robustness. The NMF method is implemented in Matlab using the NMF:DTU toolbox (http://cogsys.imm.dtu.dk/toolbox/nmf/index.html). The relevance analysis (RA) method identifies a potential biological association between a gene and a phenotype by a mutual information value [20]. The mutual information for two discrete random variables and is calculated as:(6)where is the probability that is the joint probability that and represents a probe profile and denotes a phenotype profile. The classification ability of probes We evaluate the discriminating ability of probes by constructing a classification model. Given that the competitive neural network (CNN) has produced promising classification accuracy we apply CNN to build the classification model in this work. Next we calculate the classification accuracy which is used as the measure of the probes' classification ability. The competitive neural network consists of three layers which are the input layer the competitive layer and output layer respectively. An input vector consists of the binary probe data of the evaluated probes in a specimen. During the learning process for each input vector the neurons in the competitive layer compete with each other and the one with the weight vector closest to the input vector is chosen as the winner. The wining neuron is picked up by the output layer and the output layer classifies the input vector to that class. The classification accuracy is the ratio of the number of specimens which are correctly classified to the total number of specimens. Gene ontology analysis To check how significant the GO term (a pair of GO terms) related with phenotypes the p-value score and enrichment value are used for gene ontology analysis. The Gorilla is a web tool to calculate both the p-value score and the enrichment value of a GO term at the top of a ranked list of all genes [46]. We use the Gorilla to compute an exact p-value score and enrichment value for a GO term's significance as follows. Firstly we rank all the genes by the coefficients of gene-phenotype pairwise combinations. Then all the gene are uploaded into the Gorilla. Finally the Gorilla exports the exact p-value score and enrichment value for a GO term's significance. In addition we pay attention to the GO terms which are associated with the genes or gene pairs selected. We map the genes (gene pairs) into GO terms and obtain the GO terms (a pair of GO terms) which are related with phenotypes. The p-value score is defined as the probability of obtaining no less number of the same number of gene (genes pairs) by chance by the hypergeometric distribution. It is calculated as follows:(7)where represents the total number of gene (gene pairs) is the number of gene (gene pairs) involved in lower (higher) logic relationships represents the total number of gene (gene pairs) associated with pairs of GO terms and represents the number of the discovered gene (gene pairs) which are associated with the given GO term (a pair of GO terms). The enrichment value of a GO term (a pair of GO terms) is calculated as follows:(8)where and are the same with those in the e.q (7). In the analysis the significance of a GO term (a pair of GO terms) mainly depends on the p-value scores as it describes well from a biological point of view. Supporting Information Appendix S1 Significant GO terms obtained by Gorilla. (PDF) Click here for additional data file. Appendix S2 The phenotype data and the probe data. (ZIP) Click here for additional data file. Appendix S3 Matlab codes of the current relationship-inference method. (ZIP) Click here for additional data file. Table S1 List of probe-AC lower and higher logic relationships identified. (PDF) Click here for additional data file. Table S2 List of gene-AC lower and higher logic relationships each of which is generated from more than one probe-AC lower and higher logic relationship. (PDF) Click here for additional data file. Table S3 List of gene-AC/SCC lower and higher logic relationships identified in this paper. (PDF) Click here for additional data file. Table S4 Probes sorted by the non-negative matrix factorization method. (XLSX) Click here for additional data file. Table S5 Two datasets involved the genes which are related with NSCLC. One dataset includes high frequency genes and the other contains the genes which are down or up regulated in NSCLC compared to the normal tissue. (XLSX) Click here for additional data file. Table S6 Gene pairs related with AC or SCC through the logic function AND or XOR. (PDF) Click here for additional data file. Table S7 The genes and probes included in GPL570. (ZIP) Click here for additional data file. "
Lung_Cancer
"materials and marking with radio-opaque materials. Examples of directly visible materials are hook wire methylene blue and indocyanine green. Ethiodized oil (lipiodol) barium and iodine contrast agents are used for radio-opaque markers. Each marking method has strong and weak points. Localization with a hook wire is easy to perform but carries a high risk of pneumothorax and a propensity to dislodge during transport and surgical preparation (6 7). Methylene blue and indigo carmine have a tendency to diffuse over a large area by the time the operation is done and render localization features inadequate (8 9). The use of a radio-opaque marker (such as barium or lipiodol) requires an intraoperative fluoroscopy to confirm an adequate excision as well as lead to increased radiation exposure (10-13). The use of mixture has been reported to make up for the weakness of marking materials. For example the problem of dye diffusion has led to attempts to use a mixture of dye with various materials such as cyanoacrylate adhesive or collagen or autologous blood (14-16). However they have not been widely used for localization due to difficulties in making and manipulation. Lipiodol and methylene blue are commonly used materials for localization (17-20). We hypothesized that lipiodol reduces the spread of methylene blue and provides additional localization opportunities by its radio-opacity. The use of a mixture of lipidol and methylene blue (MLM) for a percutaneous injection material requires a high success rate for appropriate localization and a low complication rate. To our knowledge there have been no reports that evaluate the availability of MLM as a percutaneous injection material in human lungs. This study compared MLM with methylene blue as a percutaneous injection material for pulmonary localization in rabbit lungs. MATERIALS AND METHODS Animal preparation This study was performed after approval by the Institutional Animal Care and Use Committee (IACUC) in Seoul National University Hospital biomedical research institute (IACUC approval No. 11-0356). Twenty-four adult New Zealand White rabbits were used. We recorded their weight before the procedures. The animals were randomly divided into two groups: Group A (n=12) and Group B (n=12) each sacrificed at about 6 hr and 24 hr after percutaneous injections respectively (Fig. 1). Six hours after percutaneous injections were same day operations of the preoperative localization; and 24 hr after percutaneous injections were next day operations of the preoperative localization. The injection of each material was done in all 24 subjects because we injected methylene blue and MLM at two different lung sites for each subject. Percutaneous injection materials: mixture of lipiodol and methylene blue versus methylene blue A pilot study was performed to decide the optimal amount of materials for percutaneous injections. Methylene blue (1% 100 mg/mL TERA Pharmaceuticals Buena Park CA USA) of 0.3 to 0.9 mL was used for human lung localization in previous studies by Wicky et al. (18) and Vandoni et al. (19). In the pilot study with rabbit lungs we injected 0.1 mL and 0.05 mL of methylene blue and MLM in four subjects. We found that staining was extensive (more than half height of one lobe) with 0.1 mL and localized (about 1 cm of staining diameter) with 0.05 mL for both methylene blue and MLM. Extensive dispersion made it difficult to find exact injecting sites; subsequently 0.05 mL of methylene blue was administered. We made variable mix ratios of lipiodol and methylene blue in vitro; 1:1 1:2 1:3 1:4 and 1:5 in order to find an appropriate mixing ratio of lipiodol (480 mg Iodine/mL Andre Guerbet Aulnay-sous-Bois France) and methylene blue. The separation of two materials occurred instantly after mechanical blending to the fat-soluble character of lipiodol and the water-soluble character of methylene blue. A higher concentration of lipiodol in MLM resulted in increased uneven blending and rapid separation. A mixture with a 1:6 (or lower) mixing ratio contained a minimal amount of lipiodol and it might make it difficult to be detected on the fluoroscopy; subsequently we decided that 1:5 was an appropriate mixing ratio for injection. A total of 0.06 mL of MLM (0.01 mL of lipiodol plus 0.05 mL of methylene blue) was administrated in each subject to avoid the effect of different volumes of methylene blue to the diffusion extent of the materials. CT guided percutaneous injections Percutaneous injection was performed with computed tomography (CT) guidance (Discovery CT750 HD; GE Healthcare Waukesha WI USA). We performed pre-procedural CT scans in order to determine an appropriate skin entry site for the successful placement of a needle in the desired location. The desired location was the basal portion of both caudal lobes around the mid-scapula line. We tried to situate the needle tip at 5 mm depth from the visceral pleura and avoid passing through the pulmonary vessels. We placed the needle of 20 gauze and 3.5 cm length in the lung parenchyma after marking the appropriate skin entry site. The parameters of CT used in our study were: tube voltage of 120 kV tube current of 25 mA slice thickness of 2 mm thickness and gantry rotation speed of 350 milliseconds. We connected 1 mL syringe to the needle hub and retracted the syringe piston to confirm that no blood was aspirated after the needle tip was accurately located within the desired location. We then injected the materials and immediately removed the needle. On the procedural CT scan we measured the distance from the skin-entry to the needle tip and the depth from visceral pleura to the needle tip. A post-procedural CT scan identified procedure-related complications that included the leakage of injecting materials and pneumothorax; in addition we recorded the extent shape and density of radio-opacity of MLM after injection. The extent of MLM was defined as a maximum diameter of the radio-opacities. The shape of radio-opacity was categorized into 3 groups (small faint nodular scattered nodular and discrete compact nodular). We recorded the injection time to measure the time interval between injection and sacrifice. Fluoroscopic examinations A successful localization of lipiodol was determined by fluoroscopic examination; subsequently we evaluated the radio-opacity of MLM using the fluoroscopy X-ray unit (BV Pulsera; Philips Medical Systems Best The Netherlands) at the immediate post-procedure session and the follow up session at 6 hr in Group A and 24 hr in Group B. The parameters of fluoroscopy were: tube voltage of 59 kV and tube current of 946 mA. We obtained anteroposterior fluoroscopic images of the thorax of the rabbit with a 17 cm of field of view. A radio-opaque ruler of 5 cm was located near the rabbit in order to estimate the exact size of lipiodol opacity. We recorded the time of the fluoroscopic examinations and the radiographic findings of MLM (size and shape of the radio-opacity). Evaluation of the staining and radio-opacity We assessed the directly visible staining on the freshly excised lung surface and radio-opacity of MLM on the fluoroscopic examinations using 4-point scoring in order to compare the localization ability of MLM and methylene blue as a percutaneous injection material. A blind reviewer who was unaware of the injection materials assessed the staining ability. In order to evaluate the staining ability the blind reader reviewed the photographic images of the freshly excised lung specimens obtained before formalin fixations and rated the staining by 4-point scores: 0=non-visualization of staining 1=inappropriate; extensive dispersion made it difficult to find accurate injecting locations 2=acceptable; available to estimate injecting locations in spite of the dispersion and 3=excellent definitely localized staining (Fig. 2). The maximum diameter of the staining extent on the lung surface was measured. We calculated and compared scores and extent of staining between two materials. For the fluoroscopic findings the radio-opacity of MLM was evaluated using 4-point scoring: 0=no detectable radio-opacity 1=inappropriate minimally increased opacity 2=acceptable low density of increased opacity 3=excellent compact nodular increased opacity (Fig. 3). We compared the average scores of initial and follow up fluoroscopic examinations. We considered a score of 0 or 1 as inappropriate and a score of 2 or 3 as appropriate for localization for both staining and radio-opacity. We compared the number of appropriate or excellent localization between MLM and methylene blue. Sacrifice and histopathologic examinations Both freshly excised entire lungs were used as final specimens. The lung tissues were fixed in 10% neutral formalin embedded in paraffin and cut into 5 µm thick slices after we took photographs to record staining on the lung surface. We made 4 axial slices that covered the center of the staining. The slices were subjected to hematoxylin-eosin (H-E) stain to the evaluate lung parenchymal change. We evaluated the presence or absence of neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus. The extent of each histopathologic finding was estimated using visual grading scores as 0 (no) 1 (focal) or 2 (diffuse). Localized parenchymal change (<50% of total area) surrounded by normal lung was defined as focal. Extensive lung parenchymal change (?50% of total area) that replaced normal lung was defined as diffuse. An experienced pathologist with eight years of experience reviewed all slices. The overall severity of the lung parenchymal change was defined as a total score by adding visual grading scores for each histopathologic finding. We compared the overall severity score between MLM and methylene blue as well as between Group A and Group B. Statistical analysis All data are expressed as mean±standard deviation (SD) unless otherwise stated. Comparisons of the average scores were performed by two-tailed unpaired Student's t-test or Mann-Whitney test. We used a Fisher's exact test to compare the number of subjects in the subgroups. Linear by linear association evaluated the association of the extent of lung parenchymal change and materials or groups. Null hypotheses of no difference were rejected if the P values were less than 0.05. The statistical analysis was performed with commercially available statistical software IBM SPSS Statistics version 20.0 (IBM Corp. in Armonk NY USA). RESULTS Subject characteristics procedural records time interval of injection and examinations Among the 24 subjects included in our study successful CT-guided percutaneous injections into the desired location of the lung were achieved in 21 subjects (11 in Group A and 10 in Group B). Three subjects died during anesthesia. Mean weight was 3.2±0.2 kg for Group A and 3.3±0.2 kg for Group B. Injection depth from visceral pleura to needle tip was 0.4±0.1 cm (range: 0.3-0.6 cm) for MLM and 0.4±0.1 cm (range: 0.3-0.7 cm) for methylene blue (P=0.43). Distance from skin to needle tip was 2.8±0.6 cm (range: 2.1-5.0 cm) for MLM and 2.8±0.3 cm (range: 2.2-3.5 cm) for methylene blue (P=0.83). Of 42 CT-guided percutaneous injections total number of procedure related complications was 10 (24%) including 7 leakage (all in MLM) and 3 pneumothorax (2 in MLM 1 in methylene blue). The complication rate in MLM was significantly higher than methylene blue (43% vs 5%) (P=0.004). On post-procedural CT images the extent of the radio-opacity of MLM was 1.3±0.4 cm (range: 0.7-2.0 cm) for Group A and 0.6±0.3 cm (range: 0.3-1.1 cm) for Group B. Discrete compact nodular opacity was achieved in 15 subjects (72%) scattered nodular opacities in 3 (14%) and small faint opacity in 3 (14%) (Fig. 4). The average value of radio-opacity of MLM was 1415±856 HU (range: 307-2768 HU). The interval between injection and sacrifice was 7.9±0.1 hr (range: 7.8-8.0 hr) for Group A and 23.5±0.1 hr (range: 23.4-23.7 hr) for Group B. Time from injection to initial and follow up fluoroscopy was 3.4±0.5 hr (range: 2.5-4.2 hr) and 6.8±0.4 hr (range: 6.3-7.7 hr) for Group A and 1.5±0.4 hr (range: 0.9-2.1 hr) and 22.6±0.4 hr (range: 21.9-23.2 hr) for Group B respectively. Scores and extent of staining and radio-opacity Table 1 demonstrates the staining extent and localization ability of MLM and methylene blue. In total groups the staining extent of MLM was significant smaller than methylene blue (0.6 cm vs 1.0 cm P<0.001). MLM showed a significantly higher staining ability score than methylene blue (2.8 vs 2.2 P=0.010). Radio-opacity in the initial fluoroscopy was not significantly different from the follow up (2.0 vs 1.9 P=0.49). Table 2 showed the number of subjects in each score of localization ability of staining or radio-opacity. In Group A appropriate staining was 100% for both MLM and methylene blue. In Group B appropriate staining was 90% for MLM and 70% for methylene blue. Appropriate staining of MLM was not significantly different from that of methylene blue (95% vs 86% P=0.61); however excellent staining in MLM was significantly higher than methylene blue (81% vs 38% P=0.011) (Table 3). Table 4 shows the localization ability of MLM regarding both staining ability and radio-opacity. There was no subject with a score of 0 or 1 in both radio-opacity and staining. MLM achieved appropriate staining or radio-opacity in 21 subjects (100%) with a dual localization feature. Histopathologic findings Table 5 demonstrates the results of the histopathologic findings. In all lung specimens both methylene blue and MLM showed acute lung parenchymal change that included neutrophil infiltration hemorrhage and foam cell in alveolus (Fig. 4). Comparing the two materials the number of specimen having neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus was similar in each extent. In terms of all features the number of specimen that showed diffuse extent was more in Group B than Group A for both MLM and methylene blue. The extent of the histopathologic findings was not significantly associated with the materials for all histopathologic features (Table 5). Among the histopathologic findings the extent of vasculitis was significantly associated with Group for both MLM and methylene blue (P=0.002 for both MLM and methylene blue). Focal or diffuse extent of vasculitis was more frequently found in Group A than Group B (P=0.001 for both MLM and methylene blue). The overall severity of lung parenchymal change was not different between MLM and methylene blue (5.6±1.6 vs 5.7±1.5 P=0.839); in addition Group B showed a significantly higher overall severity score of lung parenchymal change than Group A (6.6±1.6 vs 4.7±0.9 P=0.005). DISCUSSION The results of this study show that MLM is a useful percutaneous injection material for a successful localization in the lung. The average staining score of MLM was significantly higher than methylene blue (2.8±0.5 vs 2.2±0.7 P=0.010). In terms of staining the appropriate localization rate (acceptable or excellent staining) in our study was 95% using MLM. The result was in close agreement with previous studies that showed a high success performance rate of lipiodol localization (99%-100%) (21-23). An appropriate localization rate (acceptable or excellent staining) of methylene blue injection was 86% in our study. This is lower than the results found in previous studies where the success rate of methylene blue injection was 96%-100% (18 20). We found that an acceptable (or excellent staining rate) of MLM and methylene blue was not significantly different (95% vs 86% P=0.610). However MLM showed excellent staining for localization in 17 (81%) of 21 subjects and was significantly higher than methylene blue (38%) (P=0.011). The results indicate that lipiodol reduced the spread of methylene blue. This is the first study to indicate that MLM is an available percutaneous injection material for localization with superior staining ability compared to methylene blue. The complication rate was 43% in MLM and 5% in the methylene blue (P=0.004). Possible complications after percutaneous injection for pulmonary localization include pneumothorax leakage hemorrhage pain hemoptysis hemothorax and embolism. Previous studies reported that the complication rate was 17-29% for lipiodol and 33% for methylene blue (2023 24). The complication rate of MLM in the current study was higher than the results of previous studies mainly due to the leakage of MLM into the pleural cavity (n=9). This difference was probably because the distance from the pleura to the injecting needle tip (0.4±0.1 cm for MLM) was inadequate to avoid leakage into the pleural cavity. In the previous studies of lipiodol marking for localization the mean distance from the pleura to the target nodule was 1.0-1.9 cm (22-24) more than twice our study. The results indicate that the high complication rate of our study is associated with the inserting procedure of the needle rather than MLM itself. The dispersion of methylene blue throughout the lung parenchyma may lead to unnecessarily large wedge resections; in addition some have reported instances of the dispersion of methylene blue throughout the entire pleural surface or intraoperative identification failure due to severe anthracosis of the visceral pleura. The failure rate was reported to be 0%-13% with the use of methylene blue (1819 25). The results are similar to our study and indicate that inappropriate staining on the lung surface was 14% in methylene blue. In this study we found that the dispersion of methylene blue in MLM through the lung parenchyma was significantly smaller than methylene blue (0.6±0.3 cm vs 1.0±0.4 cm P<0.05). The result implies that lipiodol reduces the spread of methylene blue in lung parenchyma. Regarding the score of radio-opacity 38% of MLM showed non-visualization or minimally increased opacity on the fluoroscopic examinations. It means the proportion of lipiodol in MLM at the time of the percutaneous injection was too small to be detected. Post-procedural CT images also revealed that 3 subjects had small faint radio-opacity after the injection of MLM. It suggests that the uneven blending of lipiodol and methylene blue occurred during the preparation of MLM. Water-insolubility of lipiodol would result in the uneven mixing of water soluble methylene blue after mechanical blending of the two materials. Further research is required to reduce non-homogeneity of MLM at the time of injection. Previous studies reported the availability of a mixture of methylene blue with other materials such as collagen or autologous blood (15 16). They performed VATS resection on the same day as localization. In our study we evaluated the localization ability of MLM on the same day of localization (6 hr) as well as 24 hr after injection. Localization is usually performed on the day of surgery. This requires the simultaneous use of the CT and the operating room which is not always available. Surgeries on the next day of localization were reported in several published articles (26 27). MLM shows a prolonged localization ability of up to 24 hr in terms of staining ability and radio-opacity. Stable localization ability is the advantage of MLM in our study. Due to uneven blending of MLM one subject (10%) showed inappropriate staining and appropriate radio-opacity and required an intraoperative fluoroscopic examination to detect MLM. Possible radiation exposure is a drawback of MLM. We would like to justify the use of intraoperative fluoroscopy because the operator can avoid radiation exposure with a lead apron. In regards to the risk-benefit for patients lowering the risk of detection failure is thought to be more important than radiation exposure. Histopathologic examinations showed lung parenchymal changes in all specimens. Both methylene blue and MLM induced acute lung injury that included neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus (Table 5). The results of our study are similar to those of a previous study by Kwon et al. (28) that showed that lipiodol led to acute lung injury. They described that lipiodol creates the histopathologic feature of acute lung injury such as peripheral endothelial cell damage neutrophil infiltration necrosis hemorrhage alveolar wall destruction vasculitis emboli (or thrombi in arteriole) and macrophages in the alveolar space (28). In our results the extent of lung parenchymal change was not associated with the materials for all histopathologic features. In addition the overall severity score of lung parenchymal change in MLM was not different from methylene blue (5.6 and 5.7 P=0.839). This suggests that MLM shows similar histopathologic effects in the lung parenchyma to methylene blue. The overall severity score of parenchymal change was higher in Group B (follow up interval of 24 hr) than Group A (follow up interval of 6 hr) (6.6 vs 4.7 P=0.005). The extent of lung parenchymal change depends on the time interval. Acute lung injury after the percutaneous injection of lipiodol or methylene blue was reported in animal studies (28 29); however there are no clinical results that show the adverse effect of acute lung injury in human lungs. Injection material (such as barium) can potentially complicate the pathologic diagnosis of the target lesion due to acute inflammation (29 30). To our knowledge no study has indicated that lipiodol or methylene blue hinders the histopathologic diagnosis of target lesions in human lungs. The small amount of material injection in human lungs might not create a significant parenchymal change or disrupt underlying lung disease. It is necessary to avoid directly injecting materials into the target lesion in human lungs in order to avoid the adverse effect of injection materials on underlying lung disease (especially ground glass opacity nodule or potential benign lesion). There were several limitations in our study. First we included only a small number of subjects. Second the overall localization success rate was low and the complication rate was high (compared to the results of previous studies) due to the difficulty in an accurate percutaneous injection at the desired location and depth in the small sized rabbit lung. Third we used a 1 mL syringe with manual administration to inject materials in the lung parenchyma and there were possible individual difference in the administering volume of materials. Fourth we could not evaluate complications such as intractable pain material related anaphylaxis or embolism. Fifth we could not evaluate if the histopathologic changes had any effect on underlying lung disease because the lung parenchyma of the experimental rabbits were normal. Finally we did not evaluate a successful localization for the true target lesion in lung parenchyma. The criteria for appropriate staining and radio-opacity were subjective. We expect that further clinical studies might provide an answer to if MLM can be a useful percutaneous injection material for localization in the human lung. In conclusion MLM is available for percutaneous injection for the pulmonary localization. The results of this study showed that MLM provides superior ability for appropriate localization than that of methylene blue. Further research on human lungs can clarify the availability of MLM as a CT guided percutaneous injection material. This study was supported by grant from the Seoul National University College of Medicine Research Fund 2012 (800-20120036). We have no potential conflicts of interest or commercial "
Lung_Cancer
"protein is a member of phosphoinositide 3-kinase (PI-3 kinases) and can be activated by DSBs caused by ionizing radiation or reactive oxygen intermediates [6] [7]. Once activated ATM can phosphorylate various downstream substates that function in cell cycle arrest apoptosis and DNA repair such as p53 NBS1 BRCA1 and Chk2 [8] [9]. Therefore genetic variants in ATM gene may lead to the structure and function change of the protein and act as important factors indicating individual susceptibility to cancer. ATM -111G>A (rs189037) resides in the promoter of ATM gene. Increasing studies have shown that variations in the DNA promoter sequence may potentially alter the affinities of multiple regulatory proteins-DNA interactions or the specificity of the transcriptional process [10]“[13]. Although this polymorphism makes no amino acid change the alleles may have different binding affinity to the transcription factor and exhibit different levels of mRNA expression [14] [15]. Zhang et al. [16]declared that ATM rs189037 AA genotype was associated with a lower ATM mRNA levels than GG genotype in lung tissue samples. Their results showed that the G-to-A change might create a transcriptional inhibitor-binding site for ATM rs189037 A allele promoter and subsequently reduce the ATM mRNA expression. Consequently lower expression of ATM might cause elevated sensitivity to ionizing radiation defects in the activation of cell cycle checkpoints a reduced capacity for DNA repair and abnormal apoptosis. All of these features would contribute to increased individual cancer susceptibility. In recent years a number of studies have evaluated the association between this polymorphism and cancer risk such as thyroid carcinoma [17] oral cancer [18] breast cancer [19] leukemia [20] nasopharyngeal carcinoma [21] glioma [22] and lung caner [23]“[25]. Previous studies of ATM rs189037 have included cigarette smokers as cases and controls that made it difficult to judge whether this polymorphism were associated with lung cancer or tobacco use. Considering the facts in China the incidence and death rate of lung cancer in women continues to increase and this phenomenon is frequently occurring in those who have never smoked. In order to have a better control of confounding of gender or smoking we performed a case-control study to identify the association between the polymorphism of ATM rs189037 and the risk of lung cancer in the non-smoking females in Chinese Han population. We also investigated the interaction between genetic polymorphism and environmental exposure in lung cancer. Methods Subjects This hospital-based case-control study included 487 lung cancer patients and 516 cancer-free hospital controls. All subjects were female non-smokers and they were from unrelated ethic Han Chinese. The cases were recruited during January 2002 to November 2012 at Liaoning Cancer Hospital & Institute. All patients were histologically confirmed to have lung cancer before any radiotherapy and chemotherapy. During the same time controls were selected from patients with other lung diseases but free of cancer history and symptom. Controls suffered mainly from bronchitis pneumonias fibrosis sarcoidosis chronic obstructive pulmonary disease and emphysema. Controls were all non-smoking females and frequency-matched to case subjects for age (±5 years). This study was approved by the institutional review board of China Medical University and written informed consent was obtained from each participant or each participant's representatives if direct consent could not be obtained. Data Collection A total of 10 ml of venous blood was collected from each patient. Patients were interviewed to collect information for demographics and environmental exposure at the time they were admitted to hospital. Information concerning demographic characteristics passive smoking cooking oil fume exposure fuel smoke exposure family history of cancer occupational exposure and dietary habit was obtained for each case and control by trained interviewers. An individual was defined as a smoker if she had consumed a total of 100 cigarettes in her lifetime; otherwise she was considered as a non-smoker. About fuel smoke exposure participants who used coal-fuel-burning stoves without chimneys were regarded as fuel smoke exposure. For exposure to cooking oil fumes participants were mainly asked about the method of cooking and eyes or throat irritation. For cooking methods participants were asked whether they cooked food in a stir-frying way and how many times a week; for eyes or throat irritation participants were asked how often they felt eyes or throat irritated by the oily smoke. There were four possible responses ranging from œnever œseldom œsometimes and œfrequently. Subjects were considered as cooking oil fume exposure if they met criteria as follows: (1) have cooked for over 15 years; (2) cooked food in a stir-frying way for more than twice a week; (3) felt eyes or throat irritated by oily smoke. Exposure for cooking oil fume was categorized as an indicator variable equal to 1 if participants reported frequently or sometimes and equal to 0 otherwise. Genotype Analysis Genomic DNA was extracted from peripheral blood samples by the conventional phenol-chloroform extraction method. SNP was genotyped by investigators blinded to case-control status in order to avoid any genotyping bias using TaqMan methodology and read with the Sequence Detection Software on an Applied Biosystems 7500 FAST Real-Time PCR System according to the manufacturer's instructions (Applied Biosystems Foster City CA). Amplification was done under the following conditions: 95°C for 10 min followed by 47 cycles of 92°C for 30 s and 60°C for 1 min. In this study 487 lung cancer patients and 516 controls were all genotyped successfully and 5% duplicated samples were randomly selected to assess the reproducibility for quality control with a concordance rate of 100%. Statistical Analysis The x2 test and t test were applied to estimate differences in demographic variables and distributions of genotypes between cases and controls. The association of genotypes of ATM rs189037 with risk of lung cancer was estimated by computing the odds ratios (ORs) and 95% confidence intervals (CIs) in unconditional logistic regression analysis. The Hardy-Weinberg equilibrium (HWE) was tested using goodness-fit x2 test to compare the genotype frequencies in the control subjects from those expected. A logistic regression model was used to evaluate gene-environment interactions. All data were analyzed with Statistical Product and Service Solutions (SPSS) v13.0 for Windows if not otherwise specified. All statistical analysis were two-sided and the significance level was set at P<0.05. Results Population characteristics A total of 487 lung cancer and 516 age-matched cancer-free controls were enrolled in this study. As shown in the mean ages of cases and controls (mean ±S.D.) were almost identical (56.5±11.7 and 56.3±12.5 respectively). All cases were female non-smoking lung cancer patients. No statistically significant difference was found between cases and controls in terms of age (P?=?0.248) and monthly income (P?=?0.084). Cases included 434 non-small cell lung cancer (NSCLC) patients and 53 small cell carcinoma patients. In the NSCLC cases there were 320 adenocarcinomas 73 squamous cell carcinomas and 41 other tumors with a variety of different pathologies (such as large cell carcinomas mixed cell carcinomas or undifferentiated carcinomas). .0096911.t001 Characteristics of lung cancer cases and controls. Variables Cases(%) Controls(%) P value Female 487 516 Mean age (years) 56.5±11.7 56.3±12.5 0.248a Income (yuan/month) 628.9±419.3 563.5±387.6 0.084a Never smoker 487 516 Histological type NSCLC 434(89.1) Adenocarcinoma 320(65.7) Squamous cell carcinoma 73(15.0) Small cell carcinoma 53(10.9) Other 41(8.4) a Student's t-test was used to compare the frequency distributions of demographic variables between the cases and controls. Association analysis The observed genotype frequencies among the control subjects was in agreement with that expected under the Hardy-Weinberg equilibrium (P?=?0.119). The distribution of ATM rs189037 genotypes among subjects were displayed in Table 2. Using subjects with the ATM rs189037 GG genotype as the reference group we calculated the ORs and 95%CIs for heterozygous carriers of GA genotype and homozygous carriers of AA genotype. No significant difference was observed between lung cancer cases and controls in each test (P>0.05). In order to increase the statistical power we combined the GA genotype with the AA genotype to compare with GG genotype as a dominant model and combined the GA genotype with the GG genotype to compare with AA genotype as a recessive model. The results indicated that individuals with AA genotype had a significantly elevated risk of lung adenocarcinoma compared with those carrying the GG or GA genotype (OR?=?1.44 95%CI 1.02“2.02 P?=?0.039). .0096911.t002 Table 2 Distribution of ATM rs189037 genotypes and ORs for lung cancer cases and controls. Genotype Cases(%) Controls(%) ORc 95%CI P overall (n?=?487) GG 148(30.4) 152(29.5) ref GA 240(49.3) 272(52.7) 0.91 0.68“1.20 0.494 AA 99(20.3) 92(17.8) 1.11 0.77“1.59 0.590 dominant modela 0.96 0.73“1.25 0.742 recessive modelb 1.18 0.86“1.61 0.313 NSCLC (n?=?434) GG 129(29.7) 152(29.5) ref GA 213(49.1) 272(52.7) 0.92 0.68“1.24 0.573 AA 92(21.2) 92(17.8) 1.18 0.81“1.71 0.397 dominant model 0.98 0.74“1.30 0.906 recessive model 1.24 0.90“1.71 0.192 Adenocarcinoma (n?=?320) GG 94(29.4) 152(29.5) ref GA 150(46.9) 272(52.7) 0.89 0.64“1.23 0.485 AA 76(23.7) 92(17.8) 1.33 0.90“1.99 0.156 dominant model 1.00 0.74“1.36 0.987 recessive model 1.44 1.02“2.02 0.039* Squamous cell carcinoma (n?=?73) GG 24(32.9) 152(29.5) ref GA 39(53.4) 272(52.7) 0.90 0.52“1.56 0.706 AA 10(13.7) 92(17.8) 0.69 0.32“1.51 0.355 dominant model 0.85 0.50“1.43 0.537 recessive model 0.74 0.37“1.50 0.400 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c adjusted for age and data were calculated by unconditional logistic regression. According to the results above we assumed that ATM rs189037 AA genotype might affect lung adenocarcinoma risk among non-smoking Chinese females. To test this hypothesis and explore the gene-environment interaction we adopted all the lung adenocarcinoma patients and cancer-free controls whose information about environmental risk factors were completely obtained such as fuel smoke exposure cooking oil fume exposure passive smoking and family history of cancer. Cases and controls were not included in the association analysis if any item of their environmental risk factors data was incomplete. After screening we had 242 lung adenocarcinoma cases and 277 cancer-free controls that were eligible. Selected demographic variables and environmental risk factors for the cases and controls were listed in Table 3. .0096911.t003 Table 3 Basic demographic data and environmental risk factor in lung adenocarcinoma cases and controls. Variable Cases(%) Controls(%) P value Female 242 277 Mean age (±S.D.) 55.7±11.6 56.6±11.0 0.346a Income(yuan/month) 626.5±384.0 558.1±391.4 0.066a Education Never 26(10.7) 26(9.4) 0.305 Elementary school 111(45.9) 141(50.9) Junior school 76(31.4) 69(24.9) Senior school and upwards 29(12.0) 41(14.8) Fuel smoke exposure 66(27.3) 76(27.4) 0.967b Cooking oil fume exposure 86(35.5) 70(25.3) 0.011b* Family history of cancer 26(10.7) 30(10.8) 0.975b Passive smoking exposure 141(58.3) 158(57.0) 0.778b *P<0.05. a Student's t-test was used to compare the frequency distribution of demographic variables between the cases and controls. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure cooking oil fume exposure family history of cancer passive smoking between the cases and controls. As shown in Table 3 the mean ages of lung adenocarcinoma cases and controls (mean±S.D.) were similar (P>0.05). All cases were female non-smokers. There was no significant difference in the distribution of education fuel smoke exposure family history of cancer and passive smoking status between cases and controls. However the cases were more likely than the controls to report cooking oil fume exposure (P?=?0.011). Table 4 summarized the relationship between ATM rs189037 genotypes and lung adenocarcinoma risk with the stratification analysis of cooking oil fume exposure. The results indicated that in the recessive model (AA vs GA/GG) individuals carrying AA genotype had a 1.69-fold risk of lung adenocarcinoma compared with those carrying GA or AA genotype (95%CI 1.09“2.61 P?=?0.019). Considering the difference in the distribution of cooking oil fume exposure between cases and controls we conducted the stratification analysis. Our data revealed that AA homozygous carriers had an increased risk of lung adenocarcinoma among women who were never or seldom exposed to cooking oil fume (OR?=?1.89 95%CI 1.03“3.49 P?=?0.040). To well-understood the possible interaction between rs189037 polymorphism and cooking oil fumes exposure next we conducted a combined analysis. But there was no significant correlation found between this SNP and cooking oil fumes exposure. .0096911.t004 Table 4 Overall association stratification analysis and combined analysis between ATM rs189037 polymorphism and lung adenocarcinoma risk. Comparison model Genotype ORc 95%CI P value Overall GG ref GA 0.89 0.59“1.35 0.592 AA 1.57 0.93“2.62 0.089 dominant modela 1.05 0.70“1.55 0.825 recessive modelb 1.69 1.09“2.61 0.019* Stratified by cooking oil fuel exposure Yes GG ref GA 0.72 0.34“1.54 0.395 AA 1.19 0.43“3.24 0.740 dominant modela 0.81 0.39“1.68 0.573 recessive modelb 1.48 0.62“3.52 0.381 No GG ref GA 0.94 0.57“1.56 0.811 AA 1.89 1.03“3.49 0.040* dominant modela 1.16 0.72“1.87 0.542 recessive modelb 1.97 1.18“3.29 0.009* Cooking oil fumes exposure-genotype combined analysis non-exposed GG ref non-exposed GA 0.91 0.55“1.50 0.714 non-exposed AA 1.71 0.94“3.09 0.078 exposed GG 1.99 0.96“4.12 0.063 exposed GA 1.58 0.88“2.82 0.127 exposed AA 2.07 0.87“4.93 0.099 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c the overall test was adjusted for age fuel smoke exposure cooking oil fume exposure family history of cancer and passive smoking and the stratified analysis was adjusted for age fuel smoke exposure family history of cancer and passive smoking. Discussion It is well known that smoking is the most important risk factor for lung cancer but in the past 30years the incidence and death rate of lung cancer continues to increase in women who have a low rate of smoking [26]“[28]. Adenocarcinoma accounts for about 40% of all lung cancer with a higher incidence in women especially in those who have never smoked. Undoubtedly female non-smokers are the ideal subjects to examine unknown yet important environmental and genetic factors of lung adenocarcinoma. Exposure to cooking oil fume fuel smoke passive smoking and occupational exposures have been implicated as possible risk factors among Chinese women mainly based on Chinese people's traditional diet habits lifestyle and social environment [29] [30]. So we designed this study to evaluate the association between genetic variant and environmental risk factors and lung adenocarcinoma in female non-smokers. To date the association between ATM rs189037 and host susceptibility to lung "
Lung_Cancer
"s/Design A parallel group randomized controlled trial is conducted to compare MBSR with TAU. Lung cancer patients who have received or are still under treatment and their partners are recruited. Assessments will take place at baseline post intervention and at three-month follow-up. The primary outcome is psychological distress (i.e. anxiety and depressive symptoms). Secondary outcomes are quality of life (only for patients) caregiver appraisal (only for partners) relationship quality and spirituality. In addition cost-effectiveness ratio (only in patients) and several process variables are assessed. Discussion This trial will provide information about the clinical and cost-effectiveness of MBSR compared to TAU in patients with lung cancer and their partners. Trial registration ClinicalTrials.gov NCT01494883. Mindfulness-based stress reduction Lung cancer patients Partners Psychological distress Randomized controlled trial Background With an estimated 1.4 million deaths per year lung cancer is the leading cause of death by cancer worldwide. Even with the best available treatment five-year survival is merely 16% and about 60 to 70% of patients die within the first year after diagnosis [1]. This poor prognosis is often caused by a late diagnosis as the presentation usually occurs when the lung cancer is advanced. Patients may develop burdensome symptoms like pain dyspnoea fatigue and cough and they may undergo radical treatment including surgery chemo- and radiotherapy. Not surprisingly lung cancer has a major impact on the psychological wellbeing of patients and their family. Akechi and colleagues [2] showed that 19% of patients with advanced lung cancer meets the criteria of psychiatric disorders especially depressive and adjustment disorders. Of patients who had been successfully treated for lung cancer 15% met the criteria for a minor or major depressive disorder [3]. The prevalence rate of depressive and anxiety symptoms among lung cancer patients ranges from 20 to 47% [4-7]. Compared to patients with other cancer diagnoses lung cancer patients report the highest rates of distress (43 to 58%) [89] resulting in a lower quality of life [10]. Family friends and especially partners of patients with lung cancer also have to deal with its psychological impact [11-14]. Partners not only provide emotional and practical support they also have to cope with their own concerns including the uncertainty regarding the course of the illness and the fear of losing their partner [15]. More than 50% of partners of lung cancer patients report negative emotional effects of caregiving [16]. Around 40% of partners of patients with advanced lung cancer report high levels of distress [17]. The relationship between patient and partner can also be affected by the cancer. It has been shown that some partners report a lower quality of their relationship after the diagnosis of lung cancer [18]. Though numerous studies examined the psychological distress of lung cancer patients and their partners [2-22] not much research is done on how to alleviate distress in these groups [23]. In addition the available studies on managing the psychosocial care needs of cancer patients and their families have focused on care at the very end of life (e.g. [24-26]). Recently studies have demonstrated that palliative care initiated early in treatment improves the quality of life and depressive symptoms of lung cancer patients [1027]. This stresses the importance of integrating psychosocial care for lung cancer patients and their partners early in the treatment rather than instigating it once life-prolonging therapies fail. In the past ten years MBSR has become a promising psychosocial intervention for cancer patients. Mindfulness is defined as intentionally paying attention to moment-by-moment experiences in a non-judgmental way [28]. MBSR is an 8-week group-based training consisting of meditation practices such as the bodyscan gentle yoga sitting and walking meditation. By repeatedly bringing attention back to the current experience participants gradually learn to disengage from dysfunctional thoughts and directly experience the emotions and bodily sensations of the present moment. MBSR aims to provide participants with the ability to step back from ruminating about the past or worrying about the future and simply allow experiences to unfold [2829]. A recent meta-analysis [30] of 13 nonrandomized studies and 9 randomized controlled trials (RCT) concluded there is positive evidence for the use of mindfulness-based interventions in reducing psychological distress in cancer patients. Among the RCT™s a reduction in symptom severity was found for both anxiety and depression corresponding to moderate pooled controlled effect sizes (Hedges™s g = 0.37 and Hedges™s g = 0.44 respectively) [30]. Though mindfulness-based interventions seem to be effective the authors note that across studies the majority of participants were women (85%) and diagnosed with breast cancer (77%). Compared to breast cancer patients patients with lung cancer are more often male older and have a poorer prognosis. Furthermore of these 22 studies only one study included the partners of the patients showing that partners also benefit from the MBSR training [31]. This is quite surprising since partners of cancer patients also report high levels of distress [32]. Aims The aim of the Mindfulness for Lung Oncology Nijmegen (MILON) study is to examine the effectiveness of MBSR compared to TAU in reducing psychological distress in patients with lung cancer and their partners. We hypothesize that patients in the MBSR group will report a lower level of psychological distress (i.e. anxiety and depressive symptoms) higher levels of quality of life quality of relationship and spirituality than those in the TAU group. Medical and societal costs will be lower in the MBSR versus TAU group. We expect partners in the MBSR group to report a lower level of psychological distress and higher levels of caregiver appraisal relationship quality and spirituality than their counterparts in the TAU group. With regard to the working mechanisms of the MBSR programme we will examine changes in mindfulness skills self-compassion rumination intrusion avoidance and adherence to MBSR. Methods/Design Study design The design of the ˜MILON™ study is a parallel group randomized controlled trial with an embedded process study. Participants are randomized between MBSR and TAU. The study protocol has been approved by our ethical review board (CMO Arnhem-Nijmegen) and registered under number 2011“519. Participants and procedure Patients and partners are recruited at the outpatient clinic of the Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre (RUNMC) by a nurse practitioner and the attending physician. Patients and partners are invited to participate together but both are welcome to participate on their own if they do not have a partner or their partner is not willing to participate. Patients and/or partners who are interested are provided with an information leaflet. If they are willing to participate they are invited for a research interview in which in- and exclusion criteria are assessed and informed consent is taken. At other participating hospitals (Department of Pulmonary Diseases Canisius-Wilhelmina Hospital Nijmegen; Department of Pulmonary Medicine Rijnstate Arnhem; Department of Oncology Elkerliek Hospital Helmond; Department of Pulmonary Medicine Jeroen Bosch Hospital; Department of Pulmonary Diseases Maas hospital Pantein Boxmeer) patients and their partners will be sent a letter with the invitation to participate in the study. One week later the researcher calls the patients to answer possible questions and asks whether the patient and partner are interested in participation. If so they are invited for a research interview at the RUNMC. Eligibility We include patients and/or partners of patients who are (a) diagnosed with cytologically or histologically proven non-small cell lung cancer or small cell lung cancer and (b) have received or are still under treatment. Exclusion criteria for both patient and partner include: (a) being under 18 years of age (b) not being able to understand or use the Dutch language (c) former participation in MBSR or Mindfulness-Based Cognitive Therapy (MBCT) (d) current and regular treatment by psychologist or psychiatrist (e) current participation in other psychosocial programme and (f) physical or cognitive (<26 on the Mini-Mental State Examination (MMSE)) impairments hampering participation in MBSR training or completion of questionnaires. Baseline Patients and partners are interviewed to obtain demographics and clinical characteristics after which they are screened for cognitive impairments with the MMSE [33]. After that baseline questionnaires including the Distress Thermometer (DT) [3435] are administered followed by randomization. Table 1 shows the assessment instruments and time points at which the questionnaires are administered to patients and partners. Table 1 Measurements and corresponding time points for patient and partner Measure Target T0 T1 T2 pt pr pt pr pt pr MMSE Cognitive impairments x x DT General distress x x HADS Psychological distress x x x x x x QLQ-C30 Quality of life x x x QLQ-LC13 Quality of life x x x SIP Impact of sickness x x x SPPIC Caregiver burden x x x CRA-SE Caregiver self-esteem x x x IMS-S Relationship satisfaction x x x x x x MIS Communication about cancer x x x x x x SAIL Spirituality x x x x x x FFMQ Mindfulness skills x x x x x x SCS Self-compassion x x x x x x RRS-EXT Rumination x x x x x x IES Psychological stress reaction x x x x x x Diary Health care use work absence Monthly during study period for pt Calendar Mindfulness adherence Monthly during study period for pt and pr Note. T0 = Baseline measurement; T1 = Post-intervention measurement; T2= 3-month follow-up measurement; pt = Patient; pr = Partner; MMSE = Mini Mental State Examination; DT = Distress Thermometer; HADS = Hospital Anxiety and Depression Scale; QLQ-C30 = Quality of Life “ Cancer; QLQ-LC13 = Quality of Life “ Lung Cancer; SIP = Sickness Impact Profile; SPPIC = Self-Perceived Pressure from Informal Care; CRA-SE = Caregiver Reaction Assessment “ Care-Derived Self-Esteem; IMS-S = Investment Model Scale-Satisfaction; MIS = Mutuality and Interpersonal Sensitivity; SAIL = Spiritual Attitude and Involvement List; FFMQ = Five Facet Mindfulness Questionnaire; SCS = Self-Compassion Scale; RRS-EXT = Rumination Response Scale “ Extended Version; IES = Impact of Event Scale. Randomization Randomization is stratified according to setting and minimized for (a) stage of disease (curative versus palliative) (b) baseline level of anxiety and depressive symptoms (anxiety or depression subscale score of Hospital Anxiety and Depression Scale (HADS) <8 versus ?8) (c) treatment during MBSR (no treatment versus chemo- and/or radiotherapy) and (d) participation (patient alone versus partner alone versus patient and partner together). Randomization is computerized using a randomization website specifically designed for this study on which the researcher can fill out the required data. The researcher communicates treatment allocation to the nurse practitioner who informs the patient and/or partner. Follow-up assessments Follow-up assessments take place post intervention and at three-month follow-up. Participants who have access to the internet and have an email address receive the questionnaires online. If not they receive the questionnaires on paper along with a reply envelope. In case of drop-out the researcher tries to contact the participant by phone to complete a minimum set of outcome measures and to identify the main reason for drop-out. Intervention The MBSR curriculum used is primarily based on the Mindfulness-Based Stress Reduction programme as developed by Kabat-Zinn [28] but contains some elements of the MBCT programme by Segal Williams and Teasdale [29] like psycho-education on the interrelatedness of feelings and thoughts. Moreover some modifications have been made to make the intervention more suitable for patients with lung cancer and their partners such as psycho-education about grief [36]. In addition a mindful communication exercise in which partners talk with each other about the cancer was added. The programme consists of 8 weekly 2.5-hour sessions a silent day between session six and seven and home practice assignments of about 45 minutes 6 days per week. Participants receive a set of CDs with guided mindfulness meditation exercises for home practice and a folder with information and home practice instructions for the forthcoming week. Table 2 shows the content of the MBSR programme per session. The MBSR courses are taught by mindfulness teachers with extensive training in MBSR. They all fulfil the advanced criteria of the Center for Mindfulness of the University of Massachusetts Medical School [37] and maintain a regular personal meditation practice. Teachers were trained supervised and assessed to ensure their competency levels met the qualification criteria to instruct the MBSR classes. During the trial teachers will receive weekly supervision and a number of sessions will be videotaped to evaluate competence and adherence with the Mindfulness-Based Interventions “ Teaching Assessment Criteria [38]. Table 2 Content of MBSR programme per session Theme of session Meditation exercise Didactic teaching Homework 1. Automatic pilot - Bodyscan - Intention of participating - Bodyscan - Raisin exercise - Eating one meal mindfully - Attention for routine activity 2. Mindfulness of the breath - Bodyscan - Imagery exercise to demonstrate relationship between thoughtsand feelings - Bodyscan - Sitting mediation with focus on breath - Attention for breath - Awareness of pleasant events - Attention for routine activity 3. Observing limits - Yoga while lying down - Seeing exercise to demonstrate difference between observation and interpretation - Bodyscan or yoga - 3-min breathing space - Sitting meditation - Awareness of unpleasant events - 3-min breathing space 4. Opening up to distress - Sitting mediation with focus on breath body and sound - Interrelatedness of feelings thoughts and bodily sensations - Bodyscan or yoga - Sitting meditation - 3-min breathing space - Psychoeducation about grief - Awareness of stress reactions - 3-min breathing space 5. Responding to distress - Sitting mediation with focus on breath body sound thoughts difficulty - Reacting versus responding - Meditation by choice - Coping with grief - Awareness of reaction in difficult situation - Walking meditation - Awareness of communication difficulties - 3-min breathing space - 3-min breathing space 6. Mindful communication - Yoga in standing position - Mindful communication exercise about effect of lung cancer with their own partner - Sitting meditation or yoga - 3-min breathing space - Awareness of communication - 3-min breathing space during stress Silent day - Varying meditation exercises - Silent lunch and tea break 7. Taking care of yourself - Sitting meditation ending in choiceless awareness - Exercise on taking care of yourself by examining how to improve balance in life - Meditation without CD - Yoga or walking meditation - Reflect on training - 3-min breathing space 8. The rest of your life - Bodyscan - Reflection on training - Further sources of information - Short sitting meditation - Maintaining practice Outcome measures Primary outcome measure Psychological distress The primary outcome measure is the total score on the HADS [39-41] which is developed to measure psychological distress in somatic patient populations. It consists of a 7-item anxiety (HADS-A) and 7-item depression (HADS-D) subscale. The HADS shows good psychometric properties in the general medical population including oncology patients [42]. Internal consistency as measured with Cronbach™s ? varied from .84 to .90 [4042].Test-retest reliability was good as Pearson™s r > .80 were obtained [4043]. Though the cut-off scores of the HADS vary among populations [44] in lung cancer patients they have found to be <8 versus ?8 on the HADS-A or HADS-D [45]. The HADS has been shown to be highly correlated with the Beck Depression Inventory [42]. It has previously been used in intervention studies of mindfulness and shown to be sensitive to change (e.g. [46]). Secondary outcome measures Quality of life (only for patients) The European Organisation for Research and Treatment of Cancer (EORTC) Core Quality of Life Questionnaire (QLQ-C30) [47] is included along with the supplemental Lung Cancer questionnaire module (QLQ-LC13) [48]. The QLQ-C30 is designed to use in clinical trials on physical treatments for cancer patients. It incorporates five functional scales (physical role cognitive emotional social) three symptom scales (fatigue pain nausea and vomiting) a global health and quality of life scale and an array of single-item symptom measures. After revisions in the role functioning global health and physical functioning scale internal consistency of the subscales varied between .65 and .94 except for the cognitive functioning scale with ? varying from .56 to .63 [474950]. Test-retest reliability varied from .63 to .86 [51]. The lung cancer questionnaire module is designed to supplement the core questionnaire and comprises specific symptoms associated with lung cancer (coughing haemoptysis dyspnoea pain) and side-effects from conventional chemo- and radiotherapy (hair loss neuropathy sore mouth dysphagia). While the multi-item dyspnoea scale showed high internal consistency the pain subscale did not. When combined with the dyspnoea and pain items of the core questionnaire both the dyspnoea (? = .86) and pain (? = .71) subscale showed high internal consistency. Since the QLQ-C30 and QLQ-LC13 are mainly focused on physical symptoms we added the items Social Interaction and Alertness Behavior of the Sickness Impact Profile (SIP) [52]. Internal consistency was .94 and test-retest reliability was .92. The SIP correlated with self-assessed sickness and dysfunction [52]. Caregiver appraisal (only for partners) We use the 9-item Self-Perceived Pressure from Informal Care (SPPIC) [53] to assess the extent to which caregiving is experienced as burdensome. To also measure positive aspects of caregiving the 9-item subscale Care-Derived Self-Esteem of the Caregiver Reaction Assessment (CRA-SE) [54] is included. Internal consistency of the SPPIC was .79 and of the CRA-SE was .73. The SPPIC and CRA-SE were unrelated to each other [55]. Relationship quality To measure relationship satisfaction we included the 10-item Satisfaction subscale of the Investment Model Scale (IMS-S) [56]. The IMS-S starts with 5 items that measure concrete examplars of satisfaction to enhance the comprehensibility of the global items which are utilized to form the construct. Internal consistency varied from .79 to .95 and the IMS-S was related to the Dyadic Adjustment Scale. Also the Mutual Interpersonal Sensitivity scale (MIS) [57] is included to measure communication between partners about the cancer. It contains 18 items and is divided into two scales: open communication and avoiding negative thoughts about the cancer. Spirituality is measured with the Spiritual Attitude and Involvement List (SAIL) [58] and consists of 26 items divided into the subscales meaningfulness trust acceptance caring for others connectedness with nature transcendent experiences and spiritual activities. The internal consistency varied from .74 to .88 and test-retest reliability varied from .77 to .92. All subscales except for connectedness with nature were related with the Functional Assessment of Chronic Illness Therapy “ Spiritual Well-Being Scale. Costs (only for patients) The cost-effectiveness evaluation is carried out from a societal perspective considering direct as well as indirect health costs. Data on costs are collected prospectively using a diary in which participants register a) health care utilization: the type of care and its duration and b) cancer-related absence from work. Unit cost estimates are derived from the national manual for cost prices in the health care sector [59]. Costs of reduced ability to work are estimated using the friction costs method which results in a more realistic estimate than the human capital approach [60]. Treatment costs of MBSR are calculated using activity-based-costing methods thus measuring actual resources (time of therapist time of patients facilities) used. All unit cost prices are adjusted to 2013 prices. Unit cost estimates are combined with resource utilization data to obtain a net cost per patient over the entire follow-up period. Process measures Mindfulness skills are examined with the 39-item Five Facet Mindfulness Questionnaire (FFMQ) [6162]. The FFMQ is based on an exploratory factor analysis of five mindfulness measures which allowed items from different instruments to form factors providing an empirical integration of these independent attempts to operationalize mindfulness. This led to the following five subscales: observing describing acting with awareness non-judging of inner experience and non-reactivity to inner experience. Internal consistency varied from .72 to .93 among the different subscales. Most subscales were related to meditation experience Psychological Well-Being scales and psychological symptoms including the Brief Symptom Inventory [61]. FFMQ is sensitive to change in mindfulness-based interventions and is found to mediate the relationship between mindfulness practice and improvements in psychological symptoms (e.g. [63]). Self-compassion is assessed with the Self Compassion Scale (SCS) [6465] which has 26 items and is divided into six subscales: self-kindness v"
Lung_Cancer
"We lack biomarkers for identifying aggressive primary tumor subsets that give rise to metastases and impact early cancer detection and treatment. Many solid tumors are known to accumulate hyaluronan (HA) a glycosaminoglycan which is also produced by the tumor cells themselves. We report a quantitative approach for uncovering breast cancer heterogeneity using fluorescent HA to detect differential binding patterns to CD44 and RHAMM/HMMR receptors. This approach permits identification of tumor-cell subsets that bind high levels of HA and may be applicable to other ligands/receptors and disease models. Despite representing the invasive/metastatic subset of parental tumors unexpectedly the high HA-binding subset was slow-growing and is thus likely to be a source of dormancy and relapse. Tumor heterogeneity confounds cancer diagnosis and the outcome of therapy necessitating analysis of tumor cell subsets within the tumor mass. Elevated expression of hyaluronan (HA) and HA receptors receptor for HA-mediated motility (RHAMM)/HA-mediated motility receptor and cluster designation 44 (CD44) in breast tumors correlates with poor outcome. We hypothesized that a probe for detecting HA“HA receptor interactions may reveal breast cancer (BCa) cell heterogeneity relevant to tumor progression. A fluorescent HA (F-HA) probe containing a mixture of polymer sizes typical of tumor microenvironments (10“480 kDa) multiplexed profiling and flow cytometry were used to monitor HA binding to BCa cell lines of different molecular subtypes. Formulae were developed to quantify binding heterogeneity and to measure invasion in vivo. Two subsets exhibiting differential binding (HA?/low vs. HAhigh) were isolated and characterized for morphology growth and invasion in culture and as xenografts in vivo. F-HA“binding amounts and degree of heterogeneity varied with BCa subtype were highest in the malignant basal-like cell lines and decreased upon reversion to a nonmalignant phenotype. Binding amounts correlated with CD44 and RHAMM displayed but binding heterogeneity appeared to arise from a differential ability of HA receptor-positive subpopulations to interact with F-HA. HAhigh subpopulations exhibited significantly higher local invasion and lung micrometastases but unexpectedly lower proliferation than either unsorted parental cells or the HA?/low subpopulation. Querying F-HA binding to aggressive tumor cells reveals a previously undetected form of heterogeneity that predicts invasive/metastatic behavior and that may aid both early identification of cancer patients susceptible to metastasis and detection/therapy of invasive BCa subpopulations. tumor cell heterogeneity hyaluronan binding heterogeneity index PLoS One one 1932-6203 Public Library of Science San Francisco USA 24454921 3893258 PONE-D-13-41069 .0085702 Research Biology Biochemistry Bioenergetics Energy-Producing Processes Metabolism Carbohydrate Metabolism Metabolic Pathways Oxygen Metabolism Protein Metabolism Cofactors Drug Discovery Enzymes Genetics Gene Expression Medicine Drugs and Devices Drug Research and Development Drug Discovery Hematology Hematologic Cancers and Related Disorders Leukemias Acute Lymphoblastic Leukemia Nutrition Obstetrics and Gynecology Breast Cancer Oncology Cancers and Neoplasms Hematologic Cancers and Related Disorders Leukemias Breast Tumors Oncology Agents Metabolic Effects of Acute Thiamine Depletion Are Reversed by Rapamycin in Breast and Leukemia Cells Thiamine Depletion and Metabolism in Cancer Cells Liu Shuqian 1 Miriyala Sumitra 2 Keaton Mignon A. 3 Jordan Craig T. 4 Wiedl Christina 5 Clair Daret K. St. 2 Moscow Jeffrey A. 1 * 1 Department of Pediatrics University of Kentucky College of Medicine Lexington Kentucky United States of America 2 Graduate Center for Toxicology University of Kentucky College of Medicine Lexington Kentucky United States of America 3 Metabolon Inc Durham North Carolina United States of America 4 Division of Hematology Hematologic Malignancies and Stem Cell Transplantation University of Colorado Denver Colorado United States of America 5 Department of Pediatrics Virginia Commonwealth University Richmond Virginia United States of America Ahmad Aamir Editor Wayne State University School of Medicine United States of America * E-mail: jmoscowuky.edu Competing Interests: One of the authors of this paper Mignon A. Keaton was employed by Metabolon Inc. during the data acquisition and analysis phases of the study. Dr. Keaton is no longer employed by Metabolon. Her employment history does not alter the authors' adherence to all the PLOS ONE policies on sharing data and materials. Conceived and designed the experiments: MAK CTJ DKS JAM. Performed the experiments: SL SM MAK CTJ CW. Analyzed the data: MAK DKS JAM. Contributed reagents/materials/analysis tools: SM MAK CTJ CW DKS JAM. Wrote the paper: MAK CTJ JAM. 2014 15 1 2014 9 1 e85702 8 10 2013 5 12 2013 2014 Liu et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Thiamine-dependent enzymes (TDEs) control metabolic pathways that are frequently altered in cancer and therefore present cancer-relevant targets. We have previously shown that the recombinant enzyme thiaminase cleaves and depletes intracellular thiamine has growth inhibitory activity against leukemia and breast cancer cell lines and that its growth inhibitory effects were reversed in leukemia cell lines by rapamycin. Now we first show further evidence of thiaminase therapeutic potential by demonstrating its activity against breast and leukemia xenografts and against a primary leukemia xenograft. We therefore further explored the metabolic effects of thiaminase in combination with rapamycin in leukemia and breast cell lines. Thiaminase decreased oxygen consumption rate and increased extracellular acidification rate consistent with the inhibitory effect of acute thiamine depletion on the activity of the TDEs pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase complexes; these effects were reversed by rapamycin. Metabolomic studies demonstrated intracellular thiamine depletion and the presence of the thiazole cleavage product in thiaminase-treated cells providing validation of the experimental procedures. Accumulation of ribose and ribulose in both cell lines support the thiaminase-mediated suppression of the TDE transketolase. Interestingly thiaminase suppression of another TDE branched chain amino ketoacid dehydrogenase (BCKDH) showed very different patterns in the two cell lines: in RS4 leukemia cells it led to an increase in BCKDH substrates and in MCF-7 breast cancer cells it led to a decrease in BCKDH products. Immunoblot analyses showed corresponding differences in expression of BCKDH pathway enzymes and partial protection of thiaminase growth inhibition by gabapentin indicated that BCKDH inhibition may be a mechanism of thiaminase-mediated toxicity. Surprisingly most of thiaminase-mediated metabolomic effects were also reversed by rapamycin. Thus these studies demonstrate that acute intracellular thiamine depletion by recombinant thiaminase results in metabolic changes in thiamine-dependent metabolism and demonstrate a previously unrecognized role of mTOR signaling in the regulation of thiamine-dependent metabolism. No current external funding sources for this study. Introduction Thiamine (vitamin B1) is a cofactor for enzymes involved in critical metabolic processes involving energy production biomass generation and amino acid catabolism. Despite the requirement for this vitamin in these central processes the role of thiamine and thiamine-dependent enzymes (TDEs) in cancer development and treatment has received little attention although a recent review has summarized the potential importance of TDE™s in cancer metabolism [1]. Unlike antifolates which have a well-established role in cancer therapy analogous small molecule thiamine antagonists are relatively inert leading to a that TDE pathways could not be important as an anticancer targets. However the limitations of small molecule TDE inhibitors should not be confused with the potential role of TDEs as anticancer therapeutic targets. Antifolates can be effective because intracellular folates only transiently associate with enzymes during the catalytic process allowing for inhibition of enzyme activity by molecules designed to bind more tightly than the intracellular substrates. In contrast intracellular thiamine activated by phosphorylation remains tightly bound to enzyme complexes during the catalytic cycle leaving little opportunity for inhibitors to displace it once the complex has assembled. This inherent pharmacologic challenge could disguise the potential of targeting TDEs for cancer therapy. We have previously shown down-regulation of thiamine transporter gene expression in tumors compared to normal tissues [2] [3] and more recently have shown that a low thiamine diet delays onset of mammary tumors in MMTV(her2) mice [4] an effect that is abrogated by a high fat diet. These observations have led to our hypothesis that TDE pathways are altered as part of the overall changes in energy metabolism that occurs in cancer cells and that these changes could produce metabolic vulnerabilities that could be exploited by therapies aimed at TDE activities. To take a novel path in the exploration of TDEs in cancer we have studied the cytotoxic activity of the bacterial enzyme thiaminase which cleaves thiamine into its pyrimidine and thiazole moieties [5]. Thiaminase overcomes the limitations of small molecule TDE "
Lung_Cancer
"However as in the phase I study a stabilisation of median haemoglobin values for multiple cycles as well as low rate of all-grade anaemia was observed. The result provides some support for the hypothesis that VEGF is a negative regulator of erythropoiesis and its inhibitors may have a role in the management of anaemia. The toxicity profile of this trial was consistent with published data on cisplatin plus pemetrexed and with the known effects of ziv-aflibercept with the exception of a higher than anticipated rate of RPLS (Gadgeel 2012). Hypertension was the third most frequent TEAE and is a known adverse effect of anti-VEGF therapies. However higher response rate was observed among patients who developed hypertension during the treatment than among those who did not in a post hoc analysis. This observation is consistent with data from ECOG 4599 that suggested improved outcomes associated with bevacizumab in patients developing hypertension on therapy (Dahlberg et al 2010). Although cases of RPLS have been observed in other ziv-aflibercept studies the 7% rate observed in this study was much higher. It should be noted that the dose and schedule of ziv-aflibercept in this study at 6?mg?kg?1 every 21 days is different from the one approved in colorectal cancer at 4?mg?kg?1 every 14 days (Van Cutsem et al 2012) although the dose intensity is the same at 2?mg?kg?1 per week. At the recommended phase II dose of 6?mg?kg?1 for ziv-aflibercept no RPLS was reported in the phase I study that used the same regimen (N=7 at that dose level; Diaz-Padilla et al 2012) or in another phase I study of ziv-aflibercept/cisplatin/docetaxel (N=17 at that dose level; Freyer et al 2012) nor in combination with docetaxel in the VITAL study (N=456 in the combination arm; Ramlau et al 2012). A meta-analysis of safety data from three large placebo-controlled studies reported no RPLS among 1333 patients treated with ziv-aflibercept in combination with standard chemotherapy (Allegra et al 2012). It is likely that the development of RPLS may be regimen dependent rather than dose or schedule dependent. Reversible posterior leukoencephalopathy syndrome is described as a brain-capillary leak syndrome frequently related to hypertension fluid retention and possibly the cytotoxic effects of immunosuppressive agents on the vascular endothelium (Hinchey et al 1996). Risk factors include female sex hypertension and renal dysfunction (Vaughn et al 2008) as well as anticancer agents: 75% were diagnosed in women and 71% were associated with combination regimens (Marinella and Markert 2009). Bevacizumab and gemcitabine have been most commonly associated with RPLS. Treatment including cisplatin without concomitant anti-VEGF therapy has been associated with RPLS (Ito et al 1998) whereas pemetrexed before this study was not. Consistent with the literature the three cases of RPLS were all diagnosed in women which may be related to an anticancer drug“oestrogen interaction inducing altered cerebral vasoreactivity and endothelial dysfunction. Agents that decrease VEGF signalling increases the risk of RPLS (including bevacizumab sunitinib sorafenib and ziv-aflibercept) suggesting a class effect toxicity (Glusker et al 2006). Clinical features of RPLS are neurological symptoms characterized by headaches altered mental status visual disturbances or seizures and systemic signs such as hypertension. Onset is variable ranging from hours to 1 month after completing therapy (Lee et al 2008). Characteristic findings in brain MRI demonstrate bilateral symmetric parieto-occipital subcortical and cortical vasogenic oedema (Bartynski 2008). Removal of the causative agent and treatment of hypertension and renal insufficiency are indicated for RPLS which is usually but not always reversible clinically. In this phase II study was designed to evaluate ziv-aflibercept in combination with cisplatin and pemetrexed in patients with untreated advanced/metastatic non-squamous NSCLC. However three confirmed and two suspected but unconfirmed cases of RPLS led to the early termination of the trial. The reason for the increased incidence of RPLS might be related to declining CrCL and/or increased BP. Although ORR and median PFS were in accordance with most historical first-line NSCLC studies this combination of ziv-aflibercept/cisplatin/pemetrexed will not be further pursued in NSCLC. Future efforts to identify predictive biomarkers of anti-VEGF agents are warranted. This study was supported by Sanofi and Regeneron Pharmaceuticals. We thank all the patients who participated in this study. We also thank all the participating study sites and the investigators and research staff. This work is published under the standard license to publish agreement. After 12 months the work will become freely available and the license terms will switch to a Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. Drs Liu Gao and DiCioccio are employees of Regeneron Pharmaceuticals Inc. The remaining authors declare no conflict of interest. Allegra CJ Tabernero J Rougier P Scagliotti GV Philip PA Lakomy R Ramlau R Assadourian S Chevalier S Van Cutsem E 2012 Meta-analysis of anti-VEGF class adverse events from three double-blind (Db) placebo (Pbo)-controlled phase III trials with IV aflibercept (Afl) J Clin Oncol 30 (Suppl 4 561 Bartynski WS 2008 Posterior reversible encephalopathy syndrome part 1: fundamental imaging and clinical features AJNR Am J Neuroradiol 29 1036 1042 18356474 Dahlberg SE Sandler AB Brahmer JR Schiller JH Johnson DH 2010 Clinical course of advanced non-small-cell lung cancer patients experiencing hypertension during treatment with bevacizumab in combination with carboplatin and paclitaxel on ECOG 4599 J Clin Oncol 28 949 954 20085937 de Groot JF Lamborn KR Chang SM Gilbert MR Cloughesy TF Aldape K Yao J Jackson EF Lieberman F Robins HI Mehta MP Lassman AB DeAngelis LM Yung WKA Chen A Prados MD Wen PY 2011 Phase II study of aflibercept in recurrent malignant glioma: A North American Brain Tumor Consortium Study "
Lung_Cancer
"These results indicate that FTSJ2 is involved in the inhibition of cancer cell migration and invasion. .0090818.g006 Inhibition of cell migration and invasion upon the over-expression of hFTSJ2 in TE671 cancer cells. (A) The wound healing assay showing that the TE671-hFTSJ2 cells had a reduced migration compared with the untransfected TE671 cells at 12 hours after wounding. (B) Cell migration area at 12 hours after wounding ([healing area/wounding area]—100%). (C) Invasion assay showing that the TE671-hFTSJ2 cells had a reduced invasion compared with the untransfected TE671 cells. The cells that penetrated the Trans-well membrane are shown in purple. (D) Quantity of the cells that invaded the Trans-well membrane ([Giemsa positive area/total area]—100%). The values are equal to?=?the means±SE; n?=?3; *P<0.05 vs. untransfected TE671 cells. Discussion In this study we characterized the mammalian FTSJ2 protein which we presumed to be an ortholog of E. coli RrmJ. RrmJ is known as a 2?-O-ribose MTase which methylates U2552 in the A-loop of the peptidyl transferase center in the 23S rRNA [5]. Um2552 is one of the four 2?-O-methylated nucleotides in rRNA [6]. In a previous study a lack of U2552 methylation has been found to influence the tertiary interactions of U2552 U2555 and C2556; to reduce the conformational dynamics of the A-loop [8]; and to subsequently decrease the ribosome stability and translation efficiency [7] [9] [37]. These results indicate the importance of RrmJ and the methylation of U2552. In our phylogenetic analysis in this study the RrmJ homologs clustered into the following three groups in Eukaryota: FTSJ1/Trm7p FTSJ2/Mrm2p and FTSJ3/Spb1p (). In a comparison of the divergent distance between RrmJ and the ancestral roots of each group FTSJ2/Mrm2p showed the closest relation to RrmJ. In the FTSJ2/Mrm2p protein group S. cerevisiae Mrm2p has been studied extensively. In the mitochondrial rRNA of S. cerevisiae only three nucleotides are modified including the U2791 of the 21S rRNA which is 2?-O-ribose-methylated by Mrm2p. It has been proposed that Mrm2p is the mitochondrial RrmJ ortholog in S. cerevisiae according to the equivalent catalytic positions of Um2791 in the S. cerevisiae mitochondrial 21S rRNA and Um2552 in the E. coli 23S rRNA [6] [12]. However mammalian FTSJ2 remains uncharacterized. Thus we performed a sequence alignment of human FTSJ2 with RrmJ Mrm2p and FtsJ2 in M. jannaschii and three typological invertebrate species () and we compared the 3D structures of RrmJ human FTSJ2 and porcine FTSJ2 (Figure S1). A previous study showed the highly conserved catalytic tetrad K-D-K-E in site-specific 2?-O-ribose MTases [10] and this catalytic tetrad was also present in our sequence alignment. Furthermore a sequence alignment revealed the highly conserved amino acids involved in SAM binding. However interestingly the 3D structure of human FTSJ2 showed a different orientation for the first residue of the catalytic tetrad (lysine) compared with RrmJ. This difference may indicate a different A-loop structure of the rRNA substrate or a different catalytic mechanism of the FTSJ2/Mrm2p protein in mammals. Because S. cerevisiae Mrm2p is localized in the mitochondria [12] we hypothesized that hFTSJ2 is a mitochondrial protein. We used immunofluorescence and Western blot analysis to verify that hFTSJ2 was predominantly located in the mitochondria but not in the nucleus or cytoplasm (Figures 3C and 3D). In addition E. coli RrmJ is well known as a heat shock protein. The rrmJ mRNA expression increases over 20-fold after heat shock [3] and the rrmJ deletion strain fails to adapt to heat shock temperatures [7]. In S. cerevisiae the growth of the mrm2 deletion strain at 37°C is slightly reduced on glucose-containing medium and severely reduced on glycerol-containing medium [12]. Thus to evaluate the heat shock response of the RrmJ ortholog in mammals we tested the heat shock response of piglets at 30°C or 35°C. The large intestine lung and bladder showed an up-regulated expression of Ftsj2 mRNA at temperatures of 30°C and 35°C but only the lung tissue demonstrated a simultaneous heat shock response with the up-regulation of Hsp70.2 mRNA (). This finding in the lung may have been caused by the direct exposure of this tissue to the increased temperature through the inhalation of hot air. However under these heat shock treatments for the piglets only 5 (small intestine muscle lung kidney and liver) of the 11 tissues showed an up-regulation tendency of Hsp70.2 expression possibly because of the systemic effect of the response of the warm-blooded piglets to the heat shock stress. Furthermore to eliminate this systemic effect and to confirm the FTSJ2 mRNA up-regulation in the lung a human lung adenocarcinoma cell line (A549) was subjected to heat shock for 1 hour and allowed to recover at 37°C. The results of this experiment showed a 1.5-fold increase in the hFTSJ2 expression at both 42°C and 45°C and then a gradual return to its normal level after the recovery period (). Although the exact role of FTSJ2 in the heat shock response in mammals is unknown these results indicate that FTSJ2 inherited the HSP characteristics of its orthologs in E. coli and S. cerevisiae. In the previous studies of HSPs such as HSP70 and HSP90 it has been demonstrated that the heat shock responses are highly conserved during evolution. From Prokaryota to Eukaryota and Protozoa to Metazoa the HSPs represented the universal protein structures and similar physiological functions and following evolution the HSPs diverged and translocated into different anelles [1] [2] [38]“[40]. These characteristics are in alignment with the results of the RrmJ phylogenic analysis and the conservation of the heat shock response properties in mammals. In addition to certain small HSPs (i.e. HSP32 HSP25 and HSP22) most of the HSPs are expressed in all types of tissues [2] [41] and our results showed that Ftsj2 was expressed in all of the 13 normal piglet tissues (Figure S2). These results indicated that FTSJ2 was not only involved in the heat shock response but also might be necessary for mitochondrial functions under normal condition according to the mitochondrial localization of FTSJ2. In addition previous functional studies have shown that the HSPs (i.e. HSP70 and HSP90) are involved in tumorigenesis and the inhibition of apoptosis in cancer cells [40] [42]“[44]. Similarly the amplification of the genetic locus of FTSJ2 has been discovered in several NSCLC clinical samples and was considered as a novel oncogenic locus [20]. In our study the expression of FTSJ2 was also shown in different cancer cells (hepatocarcinoma lung adenocarcinoma and rhabdomyosarcoma cells). However in the human lung adenocarcinoma cell sublines CL1-0 and CL1-5 [45] we found that hFTSJ2 mRNA was decreased in the more invasive CL1-5 cells compared with the less invasive CL1-0 cells. Moreover the TE671-hFTSJ2 cells which over-expressed the hFTSJ2 protein showed a decrease in cell migration and invasion (). These results indicate that the mitochondrial hFTSJ2 protein exhibits an additional function to suppress cancer cell metastasis. Previous reports have suggested that hFTSJ2 functions in the mitochondria. Thus it is reasonable that FTSJ2 is required for extensive ATP production through respiration in the mitochondria of proliferating cancer cells [46]“[48]. In contrast according to recent studies a mitochondrial complex I and NAD+/NADH imbalance enhances the metastasis of breast cancer cell lines [49] and the dynamics of mitochondrial fusion or fission also regulates cell migration and invasion [50] [51]. These results indicate that the invasiveness of cells is affected by the condition and state of their mitochondria. In we characterized FTSJ2 as an ortholog of the E. coli 23S rRNA 2?-O-ribose MTase and showed that it functions in the mitochondria. We also provided evidence that FTSJ2 is a novel heat shock protein that is over-expressed after heat shock treatment in both piglet lung and lung adenocarcinoma cells. Surprisingly FTSJ2 may also be involved in the inhibition of cancer cell migration and invasion by influencing the mitochondrial functions. Accession Numbers The GenBank accession numbers of the protein sequences which were used in the phylogenetic tree construction and the protein sequences alignment are labeled in and . The protein coding regions of the porcine Ftsj1 and Ftsj2 mRNA were first sequenced in this study and the GenBank accession numbers of the corresponding porcine Ftsj1 and Ftsj2 mRNA are EU694401 and EU694400 respectively and the porcine FTSJ1 and FTSJ2 proteins are ACH57153 and ACH57152 respectively. Supporting Information Figure S1 Three-dimensional protein structures of E. coli RrmJ human FTSJ2 and porcine FTSJ2. (A) The protein structure of E. coli RrmJ which was resolved by B¼gl et al. (2000) (PDB ID: 1EIZ) [7]. (B) The protein structure of human FTSJ2 which was resolved by Wu et al. (2009) (PDB ID: 2NYU) [36]. (C) The protein structure of porcine FTSJ2 which was predicted using the SWISS-MODEL website with human FTSJ2 as a template. The ?-helices and ?-strands are shown in green and yellow respectively. The SAM residues and the K-D-K-E catalytic center are shown in the ball and stick representations respectively. (TIF) Click here for additional data file. Figure S2 Porcine Ftsj2 mRNA expression in porcine tissues. (A) Expression of porcine Ftsj2 mRNA as measured by semi-quantitative RT-PCR. Porcine ?-actin mRNA was used as a loading control. (B) Quantification of the porcine Ftsj2 mRNA expression which normalized to the ?-actin mRNA expression. The values are equal to?=?the means of duplicate experiments. (TIF) Click here for additional data file. The authors would like to thank Dr. Jeremy J.W. Chen for providing the CL1-0 and CL1-5 cell lines. We also like to thank our colleagues (Drs. Tung-Chou Tsai Yu-Tang Tung and Zi-Lun Lai) in the Molecular Embryology and DNA Methylation Laboratory for their help with discussions and technical issues. References 1 AngM LiberekK SkowyraD ZyliczM GeopoulosC (1991) Biological role and regulation of the universally conserved heat shock proteins. J Biol Chem266: 24233“242361761528 2 BenjaminIJ McMillanDR (1998) Stress (heat shock) proteins: molecular chaperones in cardiovascular biology and disease. Circ Res83: 117“1329686751 3 RichmondCS GlasnerJD MauR JinH BlattnerFR (1999) Genome-wide expression profiling in Escherichia coli K-12. Nucleic Acids Res27: 3821“383510481021 4 OguraT TomoyasuT YukiT MorimuraS BeggKJ et al (1991) Structure and function of the ftsH gene in Escherichia coli. Res Microbiol142: 279“2821925026 5 CaldasT BinetE BoulocP CostaA DesgresJ et al (2000) The FtsJ/RrmJ heat shock protein of Escherichia coli is a 23 S ribosomal RNA methyltransferase. J Biol Chem275: 16414“1641910748051 6 LapeyreB (2004) Conserved ribosomal RNA modification and their putative roles in ribosome biogenesis and translation. Curr Genet12: 263“284 7 B¼glH FaumanEB StakerBL ZhengF KushnerSR et al (2000) RNA methylation under heat shock control. Mol Cell6: 349“36010983982 8 BlanchardSC PuglisiJD (2001) Solution structure of the A loop of 23S ribosomal RNA. Proc Natl Acad Sci USA98: 3720“372511259644 9 CaldasT BinetE BoulocP RicharmeG (2000) Translational defects of Escherichia coli mutants deficient in the Um(2552) 23S ribosomal RNA methyltransferase RrmJ/FTSJ. Biochem Biophys Res Commun271: 714“71810814528 10 FederM PasJ WyrwiczLS BujnickiJM (2003) Molecular phylogenetics of the RrmJ/fibrillarin superfamily of ribose 2?-O-methyltransferases. Gene302: 129“13812527203 11 PintardL LecointeF BujnickiJM BonnerotC GrosjeanH et al (2002) Trm7p catalyses the formation of two 2?-O-methylriboses in yeast tRNA anticodon loop. EMBO J21: 1811“182011927565 12 PintardL BujnickiJM LapeyreB BonnerotC (2002) MRM2 encodes a novel yeast mitochondrial 21S rRNA methyltransferase. EMBO J21: 1139“114711867542 13 BonnerotC PintardL LutfallaG (2003) Functional redundancy of Spb1p and a snR52-dependent mechanism for the 2?-O-ribose methylation of a conserved rRNA position in yeast. Mol Cell12: 1309“131514636587 14 KresslerD RojoM LinderP CruzJ (1999) Spb1p is a putative methyltransferase required for 60S ribosomal subunit biogenesis in Saccharomyces cerevisiae. Nucleic Acids Res27: 4598“460810556316 15 LapeyreB PurushothamanSK (2004) Spb1p-directed formation of Gm2922 in the ribosome catalytic center occurs at a late processing stage. Mol Cell16: 663“66915546625 16 PintardL KresslerD LapeyreB (2000) Spb1p is a yeast nucleolar protein associated with Nop1p and Nop58p that is able to bind S-adenosyl-L-methionine in vitro. Mol Cell Biol20: 1370“138110648622 17 HagerJ StakerBL B¼glH JakobU (2002) Active site in RrmJ a heat shock-induced methyltransferase. J Biol Chem277: 41978“4198612181314 18 YangD OyaizuY OyaizuH OlsenGJ WoeseCR (1985) Mitochondrial origins. Proc Natl Acad Sci USA82: 4443“44473892535 19 FreudeK HoffmannK JensenLR DelatyckiMB des PortesV et al (2004) Mutations in the FTSJ1 gene coding for a novel S-adenosylmethionine-binding protein cause nonsyndromic X-linked mental retardation. Am J Hum Genet75: 305“30915162322 20 CampbellJM LockwoodWW BuysTP ChariR CoeBP (2008) Integrative genomic and gene expression analysis of chromosome 7 identified novel oncogene loci in non-small cell lung cancer. Genome51: 1032“103919088816 21 MorelloLG ColtriPP QuaresmaAJ SimabucoFM SilvaTC (2011) The human nucleolar protein FTSJ3 associates with NIP7 and functions in pre-rRNA processing. PLoS One6: e2917422195017 22 SimabucoFM MorelloLG Arag£oAZ Paes LemeAF ZanchinNI (2012) Proteomic characterization of the human FTSJ3 preribosomal complexes. J Proteome Res11: 3112“312622540864 23 WangH BoisvertD KimKK KimR KimSH (2000) Crystal structure of a fibrillarin homologue from Methanococcus jannaschii a hyperthermophile at 1.6 A resolution. EMBO J19: 317“32310654930 24 HodelAE GershonPD QuiochoFA (1998) Structural basis for sequence-nonspecific recognition of 5?-capped mRNA by a cap-modifying enzyme. Mol Cell1: 443“4479660928 25 VidgrenJ SvenssonLA LiljasA (1994) Crystal structure of catechol O- methyltransferase. Nature368: 354“3588127373 26 TamuraK PetersonD PetersonN StecherG NeiM et al (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood evolutionary distance and maximum parsimony methods. Mol Biol Evol28: 2731“273921546353 27 PollastriG McLysaghtA (2005) Porter: a new accurate server for protein secondary structure prediction. Bioinformatics21: 1719“172015585524 28 LiuFC ChenHL ChongKY HsuAL ChenCM (2008) Production of recombinant porcine colipase secreted by Pichia pastoris and its application to improve dietary fat digestion and growth of postweaning piglets. Biotechnol Prog24: 1333“134119194948 29 LiuFC ChenHL LinW TungYT LaiCW et al (2010) Application of porcine lipase secreted by Pichia pastoris to improve fat digestion and growth performance of postweaning piglets. J Agric Food Chem58: 3322“332920166658 30 ChangTP YuSL LinSY HsiaoYJ ChangGC et al (2010) Tumor suppressor HLJ1 binds and functionally alters nucleophosmin via activating enhancer binding protein 2alpha complex formation. Cancer Res70: 1656“166720145123 31 HuangJT TsengCP LiaoMH LuSC YehWZ et al (2013) Hepatitis C virus replication is modulated by the interaction of nonstructural protein NS5B and fatty acid synthase. J Virol87: 4994“500423427160 32 TungYT ChenHL LeeCY ChouYC LeePY et al (2013) Active component of danshen (Salvia miltiorrhiza Bunge) Tanshinone I attenuates lung tumorigenesis via inhibitions of VEGF Cyclin A and Cyclin B expressions. Evid Based Complement Alternat Med2013: e319247 33 ChenHL LaiYW ChenCS ChuTW LinW et al (2008) Probiotic Lactobacillus casei expressing human lactoferrin elevates antibacterial activity in the gastrointestinal tract. Biometals23: 543“55420148305 34 TungYT ChenHL YenCC LeePY TsaiHC et al (2013) Bovine lactoferrin inhibits lung cancer growth through suppression of both inflammation and expression of vascular endothelial growth factor. J Dairy Sci96: 2095“210623462173 35 TsaiSW TungYT ChenHL ShenCJ ChuangCH et al (2013) Treadmill running upregulates the expression of acetylcholine receptor in rat gastrocnemius following botulinum toxin A injection. J Orthop Res31: 125“13122733692 36 Wu H Dong A Zeng H Loppnau P Weigelt J et al. (2009) PDB ID: 2NYU. 37 WiderakM KernR MalkiA RicharmeG (2005) U2552 methylation at the ribosomal A-site is a negative modulator of translational accuracy. Gene347: 109“11415715963 38 LindquistS (1986) The heat-shock response. Annu Rev Biochem55: 1151“11912427013 39 Radosevic-StasicB JakovacH GrebicD TrobonjacaZ Mrakovcic-SuticI et al (2012) Heat shock protein Gp96 as potential regulator of morphostasis after partial hepatectomy in mice. Curr Aging Sci5: 254“26223387888 40 SiegelinMD (2013) Inhibition of the mitochondrial Hsp90 chaperone network: a novel efficient treatment strategy for cancer?Cancer Lett333: 133“14623376257 41 VerschuureP TatardC BoelensWC GrongnetJF DavidJC (2003) Expression of small heat shock proteins HspB2 HspB8 Hsp20 and cvHsp in different tissues of the perinatal developing pig. Eur J Cell Biol82: 523“53014629120 42 MosserDD MorimotoRI (2004) Molecular chaperones and the stress of oncogenesis. Oncogene23: 2907“291815077153 43 LeeHW LeeEH KimSH RohMS JungSB et al (2013) Heat shock protein 70 (HSP70) expression is associated with poor prognosis in intestinal type gastric cancer. Virchows Arch463: 489“49523913168 44 YangX WangJ ZhouY WangY WangS et al (2012) Hsp70 promotes chemoresistance by blocking Bax mitochondrial translocation in ovarian cancer cells. Cancer Lett321: 137“14322281241 45 ChuYW YangPC YangSC ShyuYC HendrixMJ et al (1997) Selection of invasive and metastatic subpopulations from a human lung adenocarcinoma cell line. Am J Respir Cell Mol Biol17: 353“3609308922 46 ChengZ RistowM (2013) Mitochondria and metabolic homeostasis. Antioxid Redox Signal19: 240“24223432475 47 ChoiI KimJ JeongHK KimB JouI et al (2013) PINK1 deficiency attenuates astrocyte proliferation through mitochondrial dysfunction reduced AKT and increased p38 MAPK activation and downregulation of EGFR. Glia61: 800“81223440919 48 KangR TangD SchapiroNE LouxT LiveseyKM et al (2013) The HMGB1/RA GE inflammatory pathway promotes pancreatic tumor growth by regulating mitochondrial bioenergetics. Oncogene33: 567“57723318458 49 SantidrianAF Matsuno-YagiA RitlandM SeoBB LeBoeufSE et al (2013) Mitochondrial complex I activity and NAD+/NADH balance regulate breast cancer progression. J Clin Invest123: 1068“108123426180 50 LinCS LeeHT LeeSY ShenYA WangLS et al (2012) High mitochondrial DNA copy number and bioenergetic function are associated with tumor invasion of esophageal squamous cell carcinoma cell lines. Int J Mol Sci13: 11228“1124623109849 51 ZhaoJ ZhangJ YuM XieY HuangY et al (2013) Mitochondrial dynamics regulates migration and invasion of breast cancer cells. Oncogene32: 4814“482423128392 J Thorac Oncol J Thorac Oncol JTO Journal of Thoracic Oncology 1556-0864 1556-1380 Lippincott Williams & Wilkins 24419415 4132025 00009 10.1097/JTO.0000000000000048 Original Articles Non-Small Cell Lung Cancer Effectiveness of Gefitinib against Non“Small-Cell Lung Cancer with the Uncommon EGFR Mutations G719X and L861Q Watanabe Satoshi MD PhD * Minegishi Yuji MD PhD   Yoshizawa Hirohisa MD PhD * Maemondo Makoto MD PhD ¡ Inoue Akira MD PhD § Sugawara Shunichi MD PhD ? Isobe Hiroshi MD PhD ¶ Harada Masao MD PhD # Ishii Yoshiki MD PhD ** Gemma Akihiko MD PhD   Hagiwara Koichi MD PhD    Kobayashi Kunihiko MD PhD ¡¡ *Bioscience Medical Research Center Niigata University Medical and Dental Hospital Niigata Japan;  Department of Internal Medicine Division of Pulmonary Medicine Infections Disease and Oncology Nippon Medical School Tokyo Japan; ¡Department of Respiratory Medicine Miyagi Cancer Center Miyagi Japan; §Department of Respiratory Medicine Tohoku University Sendai Japan; ?Department of Pulmonary Medicine Sendai Kousei Hospital Sendai Japan; ¶Department of Medical Oncology KKR Sapporo Medical Center Sapporo Japan; #Department of Respiratory Medicine National Hospital anization Hokkaido Cancer Center Sapporo Japan; **Department of Pulmonary Medicine and Clinical Immunology Dokkyo Medical University School of Medicine Mibu Japan;   Department of Respiratory Medicine Saitama Medical University Saitama Japan; and ¡¡Department of Respiratory Medicine Saitama International Medical Center Saitama Japan. Address for correspondence: Hirohisa Yoshizawa MD PhD Bioscience Medical Research Center Niigata University Medical and Dental Hospital 1“754 Asahimachi-dori Niigata 951“8510 Japan. E-mail: [email protected] 2 2014 23 1 2014 9 2 189 194 Copyright © 2013 by the International Association for the Study of Lung Cancer 2013 This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivitives 3.0 License where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially. Introduction: In non“small-cell lung cancer an exon 19 deletion and an L858R point mutation in the epidermal growth factor receptor (EGFR) are predictors of a response to EGFR-tyrosine kinase inhibitors. However it is uncertain whether other uncommon EGFR mutations are associated with sensitivity to EGFR-tyrosine kinase inhibitors. Methods: A post-hoc analysis to assess prognostic factors was performed with the use of patients with EGFR mutations (exon 19 deletion L858R G719X and L861Q) who were treated with gefitinib in the NEJ002 study which compared gefitinib with carboplatin-paclitaxel as the first-line therapy. Results: In the NEJ002 study 225 patients with EGFR mutations received gefitinib at any treatment line. The Cox proportional hazards model indicated that performance status response to chemotherapy response to gefitinib and mutation types were significant prognostic factors. Overall survival (OS) was significantly shorter among patients with uncommon EGFR mutations (G719X or L861Q) compared with OS of those with common EGFR mutations (12 versus 28.4 months; p = 0.002). In the gefitinib group (n = 114) patients with uncommon EGFR mutations had a significantly shorter OS (11.9 versus 29.3 months; p < 0.001). By contrast OS was similar between patients with uncommon mutations and those with common mutations in the carboplatin-paclitaxel group (n = 111; 22.8 versus 28 months; p = 0.358). Conclusions: The post-hoc analyses clearly demonstrated shorter survival for gefitinib-treated patients with uncommon EGFR mutations compared with the survival of those with common mutations and suggest that the first-line chemotherapy may be relatively effective for non“small-cell lung cancer with uncommon EGFR mutations. Gefitinib G719X L861Q NEJ002 Uncommon epidermal growth factor receptor mutations OPEN-ACCESS TRUE The clinical efficacy of epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) such as gefitinib and erlotinib has been demonstrated in non“small-cell lung cancer (NSCLC) patients in whom standard chemotherapy has failed.12 Further studies have revealed that the presence of activating mutations in the EGFR kinase domain is strongly associated with the therapeutic efficacy of EGFR-TKIs.34 Randomized phase 3 trials have demonstrated that EGFR-TKIs significantly improve median progression-free survival (PFS) compared with platinum-doublet therapy in EGFR-mutated patients.5“8 However not all mutations in the EGFR kinase domain are responsive to EGFR-TKI treatment. These phase 3 trials have shown that EGFR-TKIs are effective for patients with common EGFR mutations such as an exon 19 deletion or the L858R point mutation which account for more than 90% of EGFR mutations. Retrospective studies and case reports suggest that some uncommon mutations are associated with sensitivity to EGFR-TKIs.9“20 These mutations include G719X in exon 18 which accounts for approximately 3% of EGFR mutations and L861Q in exon 21 which represents approximately 2% of EGFR mutations. However these uncommon EGFR mutations have not been clearly shown to be predictive markers for the efficacy of EGFR-TKIs because of their low frequency. To investigate the efficacy of gefitinib in patients with uncommon mutations we conducted a post-hoc analysis of the NEJ002 which compared gefitinib and carboplatin-paclitaxel as first-line therapies for advanced NSCLC with activating EGFR mutations. PATIENTS AND METHODS Patient Population We retrospectively analyzed the data of 225 patients who received gefitinib treatment at any point in the NEJ002 study.6 The eligibility criteria of the NEJ002 study included the presence of advanced NSCLC harboring an EGFR mutation (exon 19 deletion or L858R G719X or L861Q point mutation) without the resistant EGFR mutation T790M (identified using the peptide nucleic acid“locked nucleic acid polymerase chain reaction clamp method) no history of chemotherapy an age of 75 years or younger a performance status of 0 to 1 and appropriate an function.2122 Patients provided a written informed consent. The study was conducted in accordance with the Helsinki Declaration of the World Medical Association. The protocol was approved by the institutional review board of each participating institution. Treatment Eligible patients were randomly assigned to receive either gefitinib (250 mg/day)"
Lung_Cancer
"ne 78-diol 910-epoxide (BPDE) which involved in inducing DNA adducts and thus made a predisposition to lung adenocarcinoma [32]“[34]. Besides the method of cooking and throat or eyes irritation the interviewers also asked each woman the information on cooking oil fumes exposure such as the types of cooking oils she used the frequency she used stir frying or deep frying to prepare food ventilation conditions and the use of a fume extractor. Increasing epidemiological studies have reported cooking method and types of cooking oils on lung cancer susceptibility among Chinese females. Seow et al.[35]found that women who reported that they stir fried daily had a significantly increased risk of lung cancer (OR?=?2.0 95%CI 1.0“3.8) and risk was enhanced for those who stir fried meat daily (OR?=?2.7 95%CI 1.3“5.5). The elevated lung cancer risk might be attributed to heterocyclic amines generated during frying of meats. In addition the frequency of stir frying seemed to be related with lung cancer susceptibility. Gao et al. [36]investigated the association between the frequency of stir frying and lung cancer risk in Chinese females they observed that stir frying more than 30 dishes per week was associated with high risk of lung cancer (OR?=?2.6 95%CI 1.3“5.0). In a case-control study in northeast China Wu-Williams et al.[37] found that women who deep fried twice per month had a 2.1-fold increased risk of developing lung cancer than those who never used deep frying method. And there was a significant trend in risk with increasing number of meals cooked by deep frying. Also this kind of correlation was found in both non-smokers and lung adenocarcinoma population. For types of cooking oils Zhong et al.[38] reported that soybean oil was most commonly used in Shanghai and the use of rapeseed oil was associated with a higher risk of lung cancer (OR?=?1.84 95%CI 1.12“3.03). In this study we observed that ATM rs189037 AA genotype carriers were more susceptible to lung adenocarcinoma than GA or GG genotype carriers in a recessive model. This might not give direct support for AA genotype as a risk factor for lung adenocarcinoma. But the results reflected that G allele might be a protective factor for lung adenocarcinoma. So we compared AA genotype with GA genotype and our data showed that women who were AA genotype carriers had an elevated risk of lung adenocarcinoma (OR?=?1.74 95%CI 1.10“2.74 P?=?0.018). In other words GA genotype might be protective for developing lung adenocarcinoma. In the stratified analysis of cooking oil fumes exposure we also found that AA genotype carriers had a predisposition to lung adenocarcinoma in women who had no exposure of cooking oil fumes (OR?=?1.89 95%CI 1.03“3.49). Considering that G allele might be a protective factor for lung adenocarcinoma we then compared AA genotype with GA genotype to further validate our previous results. And it turned out that in the non-exposed group women who were AA genotype carriers had a higher risk of lung adenocarcinoma than those GA genotype carriers (OR?=?1.98 95%CI 1.15“3.40 P?=?0.014) which was in accordance with our previous data that G allele might be a protective factor for lung adenocarcinoma. But in the combined analysis of interaction of cooking oil fumes exposure and rs189037 polymorphism no significant association was found. We have described the distribution of any possible factors such as age passive smoking status fuel smoke exposure family history of cancer between cooking oil fumes exposed group and non-exposed group that might affect the association but none of these seemed to be different between exposed group and non-exposed group (). As tumor is a multifactorial disease we could infer that there might be other risk factors playing a role in the development of lung adenocarcinoma. We tended to believe that there might be other host genetic susceptibility or unknown risk factors caused the results. .0096911.t005 Comparisons of distribution of risk factors between cooking oil fumes exposed group and non-exposed group. Variable Exposed(%) Non-exposed(%) P value Mean age (±S.D.) 56.3±11.7 56.1±11.1 0.871a Fuel smoke exposure 44(28.2%) 98(27.0%) 0.777b Passive smoking exposure 96(61.5%) 203(55.9%) 0.235b Family history of cancer 19(12.2%) 37(10.2%) 0.504b a Student's t-test was used to compare the frequency distribution of demographic variables between the exposed group and non-exposed group. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure family history of cancer passive smoking between the exposed group and non-exposed group. There are several limitations in the current study. First hospital-based studies are likely to include some controls with non-malignant lung diseases especially those associated with chronic inflammatory processes are suspected to have predisposing factors for lung cancer. The ORs we found may be underestimated. Second the statistical power of the study may be limited by the relatively small sample size of subjects. In addition other SNPs in ATM gene and in this pathway may be involved in the risk of lung adenocarcinoma gene-gene interaction and haplotypes may offer more clues to clarity the association between host genetic susceptibility and lung adenocarcinoma risk. But it is noteworthy that our study investigated the association between ATM rs189037 polymorphism and lung adenocarcinoma risk in a non-smoking females population for the first time. Meanwhile we explored the combined effects of cooking oil fumes exposure and ATM rs189037 polymorphism on lung adenocarcinoma risk. As our small sample size and only one SNP genotyped large-scale studies with gene-gene and gene-environment interactions in different races and population are required to validate our findings. Conclusions In summary this hospital-based case-control study showed that ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore ATM rs189037 AA genotype might be a risk factor affecting lung adenocarcinoma among females without cooking oil fume exposure. References 1 MattsonME PollackES CullenJW (1987) What are the odds that smoking will kill you?American journal of public health77: 425“4313826460 2 WeiQ ChengL HongWK SpitzMR (1996) Reduced DNA repair capacity in lung cancer patients. Cancer Res56: 4103“41078797573 3 SpitzMR WeiQ DongQ AmosCI WuX (2003) Genetic susceptibility to lung cancer: the role of DNA damage and repair. Cancer Epidemiol Biomarkers Prev12: 689“69812917198 4 KurzEU Lees-MillerSP (2004) DNA damage-induced activation of ATM and ATM-dependent signaling pathways. DNA Repair (Amst)3: 889“90015279774 5 PetriniJH StrackerTH (2003) The cellular response to DNA double-strand breaks: defining the sensors and mediators. Trends Cell Biol13: 458“46212946624 6 LavinMF KozlovS (2007) ATM activation and DNA damage response. Cell Cycle6: 931“94217457059 7 SavitskyK Bar-ShiraA GiladS RotmanG ZivY et al (1995) A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science268: 1749“17537792600 8 KastanMB LimDS (2000) The many substrates and functions of ATM. Nat Rev Mol Cell Biol1: 179“18611252893 9 KastanMB BartekJ (2004) Cell-cycle checkpoints and cancer. Nature432: 316“32315549093 10 TaulanM LopezE GuittardC ReneC BauxD et al (2007) First functional polymorphism in CFTR promoter that results in decreased transcriptional activity and Sp1/USF binding. Biochem Biophys Res Commun361: 775“78117678620 11 SchultzJ LorenzP IbrahimSM KundtG GrossG et al (2009) The functional -443T/C osteopontin promoter polymorphism influences osteopontin gene expression in melanoma cells via binding of c-Myb transcription factor. Mol Carcinog48: 14“2318459127 12 MenzaghiC ParoniG De BonisC SoccioT MarucciA et al (2006) The -318 C>G single-nucleotide polymorphism in GNAI2 gene promoter region impairs transcriptional activity through specific binding of Sp1 transcription factor and is associated with high blood pressure in Caucasians from Italy. J Am Soc Nephrol17: S115“11916565233 13 FreyUH HaunerH JockelKH MantheyI BrockmeyerN et al (2008) A novel promoter polymorphism in the human gene GNAS affects binding of transcription factor upstream stimulatory factor 1 Galphas protein expression and body weight regulation. Pharmacogenet Genomics18: 141“15118192900 14 GiladS ChessaL KhosraviR RussellP GalantyY et al (1998) Genotype-phenotype relationships in ataxia-telangiectasia and variants. Am J Hum Genet62: 551“5619497252 15 TeraokaSN TelatarM Becker-CataniaS LiangT OnengutS et al (1999) Splicing defects in the ataxia-telangiectasia gene ATM: underlying mutations and consequences. Am J Hum Genet64: 1617“163110330348 16 ZhangL YangM BiN FangM SunT et al (2010) ATM polymorphisms are associated with risk of radiation-induced pneumonitis. Int J Radiat Oncol Biol Phys77: 1360“136820171797 17 XuL MorariEC WeiQ SturgisEM WardLS (2012) Functional variations in the ATM gene and susceptibility to differentiated thyroid carcinoma. J Clin Endocrinol Metab97: 1913“192122438227 18 BauD-T ChangC-H TsaiM-H ChiuC-F TsouY-A et al (2010) Association Between DNA Repair Gene ATM Polymorphisms and Oral Cancer Susceptibility. Laryngoscope120: 2417“242221108427 19 WangH-C ChangW-S TsaiR-Y TsaiC-W LiuL-C et al (2010) Association between Ataxia Telangiectasia Mutated Gene Polymorphisms and Breast Cancer in Taiwanese Females. Anticancer Research30: 5217“522121187516 20 WangC-H WuK-H YangY-L PengC-T TsaiF-J et al (2011) Association between Ataxia Telangiectasia Mutated Gene Polymorphisms and Childhood Leukemia in Taiwan. Chinese Journal of Physiology54: 413“41822229509 21 WangHM ShiYS LiQS LiuY ZhengXK (2011) [Association between single nucleotide polymorphism locus rs189037 in the promoter of ATM gene and nasopharyngeal carcinoma susceptibility in Cantonese]. Nan Fang Yi Ke Da Xue Xue Bao31: 1863“186622126766 22 ZhaoP ZouP ZhaoL YanW KangC et al (2013) Genetic polymorphisms of DNA double-strand break repair pathway genes and glioma susceptibility. BMC Cancer13: 23423663450 23 LoYL HsiaoCF JouYS ChangGC TsaiYH et al (2010) ATM polymorphisms and risk of lung cancer among never smokers. Lung Cancer69: 148“15420004998 24 HsiaTC TsaiCW LiangSJ ChangWS LinLY et al (2013) Effects of ataxia telangiectasia mutated (ATM) genotypes and smoking habits on lung cancer risk in Taiwan. Anticancer Res33: 4067“407124023351 25 KimJH KimH LeeKY ChoeKH RyuJS et al (2006) Genetic polymorphisms of ataxia telangiectasia mutated affect lung cancer risk. Hum Mol Genet15: 1181“118616497724 26 BelaniCP MartsS SchillerJ SocinskiMA (2007) Women and lung cancer: epidemiology tumor biology and emerging trends in clinical research. Lung Cancer55: 15“2317084482 27 ThomasL DoyleLA EdelmanMJ (2005) Lung cancer in women: emerging differences in epidemiology biology and therapy. Chest128: 370“38116002959 28 ZangEA WynderEL (1996) Differences in lung cancer risk between men and women: examination of the evidence. J Natl Cancer Inst88: 183“1928632492 29 ShiH HeQ DaiX ZhouB (2005) [Study on risk factors of lung cancer in non-smoking women]. Zhongguo Fei Ai Za Zhi8: 279“28221108882 30 KoYC ChengLS LeeCH HuangJJ HuangMS et al (2000) Chinese food cooking and lung cancer in women nonsmokers. Am J Epidemiol151: 140“14710645816 31 ChenT DongB LuZ TianB ZhangJ et al (2010) A functional single nucleotide polymorphism in promoter of ATM is associated with longevity. Mech Ageing Dev131: 636“64020816691 32 ChiangTA WuPF KoYC (1999) Identification of carcinogens in cooking oil fumes. Environ Res81: 18“2210361022 33 ChenH YangM YeS (1992) A study on genotoxicity of cooking fumes from rapeseed oil. Biomed Environ Sci5: 229“2351449658 34 YangSC JenqSN KangZC LeeH (2000) Identification of benzo[a]pyrene 78-diol 910-epoxide N2-deoxyguanosine in human lung adenocarcinoma cells exposed to cooking oil fumes from frying fish under domestic conditions. Chem Res Toxicol13: 1046“105011080053 35 SeowA PohWT TehM EngP WangYT et al (2000) Fumes from meat cooking and lung cancer risk in Chinese women. Cancer Epidemiol Biomarkers Prev9: 1215“122111097230 36 GaoYT BlotWJ ZhengW ErshowAG HsuCW et al (1987) Lung cancer among Chinese women. International Journal of Cancer40: 604“609 37 Wu-WilliamsAH DaiXD BlotW XuZY SunXW et al (1990) Lung cancer among women in north-east China. Br J Cancer62: 982“9872257230 38 ZhongL GoldbergMS GaoYT JinF (1999) Lung cancer and indoor air pollution arising from Chinese-style cooking among nonsmoking women living in Shanghai China. Epidemiology (Cambridge Mass)10: 488“494 PLoS One PLoS ONE plos plosone PLoS ONE 1932-6203 Public Library of Science San Francisco USA 24586842 3934888 PONE-D-13-30257 .0089518 Research Article Biology Genetics Genetic mutation Mutation types Cancer genetics Medicine Clinical research design Retrospective studies Diagnostic medicine Pathology Clinical pathology Test evaluation Oncology Cancer detection and diagnosis Cancer screening Cancer treatment Chemotherapy and drug treatment Clinical trials (cancer treatment) Cancers and neoplasms Lung and intrathoracic tumors Non-small cell lung cancer Oncology agents Clinical Validation of a PCR Assay for the Detection of EGFR Mutations in Non“Small-Cell Lung Cancer: Retrospective Testing of Specimens from the EURTAC Trial EGFR Mutation Testing in NSCLC in EURTAC Trial Benlloch Susana 1 * Botero Maria Luisa 1 Beltran-Alamillo Jordi 1 Mayo Clara 1 Gimenez-Capitán Ana 1 de Aguirre Itziar 2 Queralt Cristina 2 Ramirez Jose Luis 2 Cajal Santiago Ramón y. 1 6 Klughammer Barbara 3 Schlegel Mariette 3 Bordogna Walter 3 Chen David 4 Zhang Guili 5 Kovach Barbara 5 7 Shieh Felice 5 7 Palma John F. 5 Wu Lin 5 Lawrence H. Jeffrey 5 7 Taron Miquel 1 2 1 Pangaea Biotech SL Barcelona Spain 2 Medical Oncology Service-ICO Hospital Germans Trias i Pujol Badalona Spain 3 F. Hoffmann-La Roche Basel Switzerland 4 Genentech South San Francisco California United States of America 5 Roche Molecular Systems Pleasanton California United States of America 6 Pathology Department Vall d'Hebron University Hospital Universidad Autónoma de Barcelona Barcelona Spain 7 Roche Molecular Systems Pleasanton California United States of America Minna John D. Editor Univesity of Texas Southwestern Medical Center at Dallas United States of America * E-mail: [email protected] Competing Interests: BK MS WB DC GZ JFP LW are all current employees of Roche. BK DC JFP and LW have stock holdings in Roche. BK and HJL are former Roche employees and HJL has stock in Roche and has served as a paid consultant. FS was a paid consultant to Roche. SB JBA CM AGC are current employees of Pangaea Biotech. MLB is a former Pangaea employee. MT and SRyC have stock holdings in Pangaea Biotech. IdA CQ JLR are current employees of Medical Oncology Service-ICO Hospital Germans Trias i Pujol. This does not alter the authors' adherence to all the PLOS ONE policies on sharing data and materials. Conceived and designed the experiments: MT HJL. Performed the experiments: CM AGC JBA IdA CQ JLR. Analyzed the data: SB DC GZ CM AGC JBA IdA CQ JLR FS LW JFP HJL MT. Contributed reagents/materials/analysis tools: SB MLB JBA CM AGC IdA CQ JLR SRyC BK MS WB DC GZ BK FS LW JFP HJL MT. Wrote the paper: SB MLB JBA CM AGC IdA CQ JLR SRyC BK MS WB DC GZ BK FS LW JFP HJL MT. 2014 25 2 2014 9 2 e89518 23 7 2013 21 1 2014 2014 Benlloch et al This is an open-access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. The EURTAC trial demonstrated that the tyrosine kinase inhibitor (TKI) erlotinib was superior to chemotherapy as first-line therapy for advanc"
Lung_Cancer
"Among biomarkers genes have been used to distinguish AC from SCC in practice and other six genes were newly discovered biomarkers for distinguishing subtypes. Furthermore NKX2-1 has been considered as a molecular target for the targeted therapy of AC and other genes may be novel molecular targets. By gene ontology analysis we found that two biological processes (˜epidermis development™ and ˜cell adhesion™) were closely related with the tumorigenesis of subtypes of NSCLC. More generally the current method could be extended to other complex diseases for distinguishing subtypes and detecting the molecular targets for targeted therapy. The authors' work is supported by the National Natural Science Foundation of China (Grant Nos. 61100145 61033003 and 91130034). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Lung cancer is the leading cause of cancer-related deaths in the world [1]. It has been divided into two classes by the World Health anization (WHO): non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) [2]. NSCLC which has two major subtypes: adenocarcinoma (AC) and squamous cell carcinoma (SCC) accounts for more than a half of all lung cancer cases [2]. However less than of NSCLC patients survive beyond five years [3]. The limited effectiveness of the diagnosis and treatment of NSCLC is mainly caused by the difficulty to distinguish the subtypes and the limited knowledge about the pathogenesis mechanisms of subtypes of NSCLC. NSCLC is a system disease and the difference of AC and SCC may be reflected on the cellular and molecular level. Traditional methods rely on visual cell morphology (e.g. size of tumor and histological features) to distinguish subtypes which are based on cellular level [4]“[6]. It has been proposed that traditional methods could effectively distinguish SCLC from NSCLC because of the clear distinction between the morphology of SCLC cells and that of NSCLC cells [7]. However the morphological difference among the subtypes of NSCLC remains unclear [8]. Multiple molecular level data (mRNA microRNA and methylation data) between NSCLC and normal have been used for analyzing dysfunctions of NSCLC [9]. It was suggested that the discriminating ability of genes obtained by mRNA data was significant greater than those by microRNA and methylation data. Therefore it is reasonable to retrieve valuable genes and biological processes that have great discriminating ability between AC and SCC on the mRNA level. A targeted therapeutic agent is designed to interfere with a specific molecular target which plays a crucial role for tumor growth and progression [10]. For example which is a targeted therapeutic agent for the targeted therapy of NSCLC is a monoclonal antibody for VEGF. The gene VEGF is crucial because it is higher expressed in lung cancer than in normal lung [11]. Hence the molecules which play distinct roles between cancer and normal may be important for selecting therapeutic agents. Although targeted therapy shows clinical benefits targeted agents have not enabled targeted therapies to change clinical outcome dramatically. Moreover existing targeted therapeutic schedules may be suitable for the prognostic of a special subtype of NSCLC. For example only patients with non-SCC are better to use [12]. Therefore it is necessary to research the molecular mechanisms that are related with the subtypes of NSCLC to develop effective methods to distinguish AC from SCC and novel therapeutic agents special for the subtypes of NSCLC. The expression patterns of several genes are found to be special for the subtypes of diseases. For example the NKX2-1 gene is expressed in lung AC [13]. The knockdown of NKX2-1 results growth inhibition in lung AC cell. Therefore the presence of lung AC depends on the expression of NKX2-1 [14]. Another example is involved in the research of esophageal cancer the combination of the genes GATA6 and SPRR3 may discriminate among normal epithelium Barrett's dysplasia and Barrett's esophagus associated AC [15]. Some special relationships exist between the gene pair (GATA6 and SPRR3) and the phenotypes of esophageal cancer. Such examples suggest the existence of relationships between genes and the subtypes of diseases. The methods that indirectly identify gene-phenotype relationships can be roughly divided into three common steps: construct a gene-gene (or protein-protein) network and a phenotype-phenotype network by pooling interaction data from several databases; connect the gene-gene (or protein-protein) network with the phenotype-phenotype network; use an algorithm (e.g. random walk with restart on heterogeneous network algorithm) to infer pairwise gene-phenotype relationships [16] [17]. However the noise from the integration of data limits the effectiveness of the detection of gene-phenotype relationships. Many methods have been developed to directly associate single molecules to phenotypes. The nonnegative matrix factorization (NMF) method is a dimensionality-reducing algorithm to obtain a set of metagenes and associated coefficients [18]. Each phenotype corresponds to a metagene. The coefficient of a gene in a metagene represents the closeness of the relationship between the gene and the phenotype corresponding to the metagene. This method requires to filter several data to ensure the nonnegative condition which may loss some useful information. Linear correlation coefficients were used to measure genotype-phenotype associations between single proteins in a microbe and the microbe's phenotypes [19]. Slonim et al. used the relevance analysis method (RA) to infer gene-phenotype relationships by estimating mutual information [20]. However phenotype traits are often influenced not by a single gene but by combinations of genes. Association rule mining (ARM) is a data mining technique to extract if-then rules with the general form [21]. Bowers et al. designed the logic analysis method to obtain if-then rules from an item or a combination of items to another one. Previous studies have been done to infer logic relationships among genes or proteins using pairwise and triplet logic analysis on expression data or phylogenetic profiles [22]. However if-then rules may not have many biological cases unless the converse relation holds as well [23]. In this paper we improve the logic analysis method to mine the necessary and sufficient conditions for the presence states (presence or absence) of phenotypes [22]. The current method takes into consideration both a single gene and a gene pair which may influence phenotypes. We apply the method to infer gene-subtype relationships based on AC and SCC specimens. It is suggested that the expression patterns (expression or no-expression) of identified genes are necessary and sufficient conditions for the presence states of AC or SCC. The effectiveness of the current method is demonstrated on NSCLC and normal specimens. Our results show that the current method outperforms the two existing methods (the NMF method and the RA method) in recall rate and classification accuracy. This work could help to find the biomarkers to distinguish the subtypes of diseases and to design novel targeted therapeutic agents for diseases as well as reveal the biological processes which are closely related with diseases. Results We applied our method to identify relationships between genes and two major subtypes of NSCLC (AC and SCC). Further the performance comparison of our method with those of the two earlier methods (the NMF method and the RA method) was made by comparing two measures (the recall rate and classification accuracy) on the data of GSE18842 which contains similar numbers of NSCLC and normal specimens. The biomarkers as well as biological processes which were closely related with the subtypes of NSCLC could be obtained from several interesting relationships between genes and subtypes of NSCLC. Identification of gene-subtype lower and higher logic relationships Given that the number of AC specimens () was much larger than that of SCC specimens () () we randomly selected the fixed number (i.e.) of AC specimens to ensure the similar number of specimens for different phenotypes. We exacted the columns of binary probe data as well as those of phenotype profile data which correspond to the selected AC specimens and all of the SCC specimens. The new binary probe data and phenotype profile data were formed by the exacted columns of binary probe data and phenotype profile data maintaining the relative positions of columns. The new binary probe data had size where the first columns corresponded to AC specimens and the last columns refered to SCC specimens. The new phenotype profile data had size where the first row represented AC and the second one represented SCC. For convenience we defined the first and second row of the new phenotype profile data as AC profile data and SCC profile data respectively. The subtypes of NSCLC data comprised the new binary probe data and the new phenotype profile data. We applied our method to the subtypes of NSCLC data to mine gene-subtype logic relationships. 10.1371/journal.pone.0094644.t001 Data source. Subtype No.(n) AC GSE10245(40) GSE37745(106) GSE18842(14) GSE28571 (50) SCC GSE10245(18) GSE37745(66) GSE18842(32) GSE28571 (28) Normal ” ” GSE18842(45) ” ˜No.™ is the accession number from the Gene Expression Omnibus (GEO) database in NCBI; ˜n™ is the number of specimens; ˜”™ means there are no specimens from the corresponding data set. Identification of probe-subtype lower and higher logic relationships Based on the subtypes of NSCLC data we calculated the uncertainty coefficient for a subtype of NSCLC predicted by a probe (or a probe pair) as well as the uncertainty coefficient for a probe (or a probe pair) predicted by the subtype in the reverse direction. The same procedure was applied to random binary probe data and phenotype profile data. The maximum random uncertainty coefficients for logic pairwise and triplet combinations were used as the thresholds for lower and higher logic relationships respectively. That is the association of a probe or a probe pair with a subtype was considered significant if and only if its uncertainty coefficients in both directions were found to be greater than the maximal value obtained from the random data. Let and be the thresholds of lower and higher logic relationships respectively. We obtained logic pairwise combinations and logic triplet combinations with uncertainty coefficients higher than and respectively. Because the significance of the discovered logic pairwise and triplet combinations cannot be exactly verified by the limited knowledge of gene-subtype interactions a statistical analysis is deserved to be estimated [24]. Suppose the significance level was . The p-values were all zeros for the discovered logic pairwise and triplet combinations which were smaller than the significance level. The results of the statistical analysis showed that the discovered logic pairwise and triplet combinations did not interact randomly. Next we evaluated the false discovery rate (FDR) to control the global significance of the discovered logic pairwise and triplet combinations."
Lung_Cancer
"The VATS approach is a safe and feasible treatment in terms of the survival rate for metastatic lung cancer compared with the thoracotomy. The 3-year disease-free survival rate in the VATS group is inferior to that of open thoracotomy. The VATS approach could not completely replace open thoracotomy. The authors have no support or funding to report. Introduction Metastasectomy is considered a beneficial treatment for a patient with metastatic lung cancer whose primary tumor has been well controlled[1].After surgery 5-year survival rates of 30% to 50% could be achieved depending on the underlying primary cancer[2]“[4].In practice the surgical approaches to pulmonary metastases are variable. Video-assisted thoracoscopic surgery (VATS) is an emerging technique; many procedures that had previously required a thoracotomy have been performed with the minimally invasive VATS. VATS has been used for the treatment of pulmonary metastases. The routine use of VATS for the treatment of respectable metastatic lung cancer remains controversial. Critics of the VATS approach have argued that it might not be an equivalent oncological operation[5] [6]. A prospective study by Cerfolio[7]found that 22% of the nodules that could be detected by thoracotomy were missing by VATS.Whether the VATS approach can provide a satisfactory outcome is unknown. An evidenced-based investigation of the VATS approach is needed we undertook this meta-analysis to achieve a more objective assessment of the published studies and to provide a more accurate comparison between VATS and thoracotomy for metastatic lung cancer. Methods Search Strategy Electronic searches were of the MEDLINECochrane Controlled Trial Register (CENTRAL) Ovid MEDILINE PubMed and Embase databases were performed until July 2013.The following MeSH search headings were used: œmetastatic lung cancer œpulmonary metastases œvideo-assisted thoracic surgery œthoracotomy and œcomparative study.We searched the reference lists of relevant studies reviews editorials lettersand meeting s. We used the Science Citation Index to cross-reference for further studies that met our criteria. Study Selection The studies included in this meta-analysis were based on our predetermined criteria as follows: (1) clinical trials that include the full text of the paper published in peer-reviewed English journals or reports of presentations at major thoracic surgery meetings; (2) comparison of the efficacy of VATS to that of thoracotomy in patients with metastatic lung cancer; and (3) similarity in the patients' baseline characteristics. Data extraction and quality assessment Two independent reviewers (Siyuan and Wenya) assessed the quality and the risk of bias of the included trials as follows: (1) the studies that did not include a comparative group with surgery as a form of intervention were excluded; (2) the trials focusing on patients undergoing surgery for primary lung cancer were excluded; (3) the studies on robotic video-assisted thoracic surgery were excluded; (4) if there was an overlap between authors centers or patient cohorts evaluated in the published literature only the most recent report was included; (5) studies published more than 20 years ago were excluded because of the significant technological changes that has occurred. The s were evaluated with the Downs and Black quality assessment method[8]. Discrepancies between the two investigators were resolved by discussion and consensus with a senior investigator. The final results were reviewed by two senior investigators (Lin and Jiang).The disease-free survival was defined as the date of the initial metastasectomy until the date of a recurrence. Statistical and sensitivity analyses The meta-analysis was performed using the RevMan 5.1.0. software package. The odds ratio (OR) or the mean difference with 95% confidence intervals (95% CI) was calculated for the dichotomous outcomes and the continuous outcomes respectively. A P value<0.05 was considered a significant difference in the value between the two groups. We used the I2 statistic to investigate the heterogeneity among the studies.The heterogeneity was explored by X2 and I2; I2<25% and I2>50% reflect a small and large inconsistency respectively. P<0.05 was considered significant. If there were a statistical difference in terms of the heterogeneity (P?0.05) a random-effect model was selected to pool the data. Otherwise a fixed-effect model was used. Taking into account the presence of different sample sizes of the included studies a sensitivity analysis was performed to compare the of 1-year survival rate and the 3-year disease free survival rate between VATS and open thoracotomy. Publication bias A funnel plot was used to explore bias. Asymmetry in the funnel plot of trial size against treatment effect was used to assess the risk of bias. Results Description of the studies Six retrospective cohort studies the met our criteria were included in this meta-analysis. A total of 546 patients were included in the six studies;235 patients were allocated to the VATS group whereas 311 were allocated to the open thoracotomy group to evaluate their survival rate.The search algorithm results of the search strategies and selection criteria are shown in Fig 1. The patient characteristics and evaluation index are shown in . .0085329.g001 Identification of studies for inclusion. .0085329.t001 Study Design Country NO(V/O) Gender (M/F) Mean age (years) Assessment score Nakajima2001[28] OC Japan 45/55 V59/41 O34/21 V55±15 O55±14 13 Mutsaerts2002[29] OC Netherlands 8/12 NR NR 19 Nakas2009[30] OC UK 25/27 V16/9 O 19/8 V69 O66 16 Carballo2009[31] OC USA 36/135 V18/18 O82/53 V58.5 O49 15 Gossot2009[32] OC France 31/29 V21/10 O13/16 V43 O40 18 Chao2012[33] OC Taiwan 90/53 V49/41 O35/18 NR 13 V VATS; O Open thoracotomy; NR Not reported; OC observational cohort. Assessment of Recurrence and Survival Six studies documented the 1-year survival rateand there was no significant heterogeneity among the six studies (x2?=?3.79 P?=?0.58I2?=?0%).A fixed effect model was used.The combined result is shown in Fig 2(OR?=?1.15; 95%CI 0.72“1.84; p?=?0.58). Because of the heterogeneity in sample size the sensitivity analyses were conducted using larger sample sizes. There was no difference between the two surgical methods with an OR of 1.00(95%CI 0.55“1.79) and with heterogeneity(?2?=?3.23P?=?0.07 I2?=?69%). Five studies reported the 3-year survival rate and heterogeneity was identified through the five studies (x2?=?11.32P?=?0.02I2?=?65%); and a random effect model was adopted (OR?=?1.07; 95%CI 0.50“2.27; p?=?0.86) (Fig 3). Three studies compared the 5-year survival rate (OR?=?0.96; 95%CI 0.34“2.71; p?=?0.93) with certain heterogeneity(x2?=?8.86P?=?0.01I2?=?77%) (Fig 4). .0085329.g002 1-year survival rate. Forest plot of the Odds Ratio(OR) of the 1-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g003 3-year survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g004 5-year survival rate. Forest plot of the Odds Ratio(OR) of the 5-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Four studies compared the 1-year disease free survival rate (OR?=?1.31; 95% CI 0.79“2.19; p?=?0.30)finding no significant heterogeneity among these studies (x2?=?1.82P?=?0.61I2?=?0%) (Fig 5) and four studies compared the 3-year disease free survival rate (OR?=?0.59; 95% CI0.38“0.91; p?=?0.02) finding no significant heterogeneity (x2?=?1.82P?=?0.61I2?=?0%) between the patients who underwent VATS and those who underwent open thoracotomy (Fig 6). Because of the heterogeneity in the sample size sensitivity analyses were conducted using larger sample size studies; however there was no difference between the two surgical methods with an OR of 1.71 (95% CI1.02“2.89) and with heterogeneity (?2?=? 3.07P ?=?0.22 I2?=?35%). There were significant 3-year disease free survival rate benefits with open thoracotomy. We attempted to evaluate the 5-year disease free survival rate.Only two studies reported these ratesand the published data were not sufficient for the combined analysis. .0085329.g005 Figure 5 1-year disease-free survival rate. Forest plot of the Odds Ratio(OR) of the 1-year disease free survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g006 Figure 6 3-year disease-free survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Publication bias Publication bias might exist when nonsignificant findings remain unpublishedthus artificially inflating the apparent magnitude of an effect.The funnel plots of the study are shown in Figure 7.The funnel plots of the 1-year survival rate following VATS and thoracotomy for the treatment of metastatic lung cancer showed asymmetry which suggested that there was some publication bias. .0085329.g007 Figure 7 Funnel plot of the outcome of 1-year survival rate. Discussion Many tumors can metastasize to the lungand colorectal and breast tumors are the most common primary tumors[9].Pulmonary resection has been shown to be beneficial for patients with resectable and isolated pulmonary metastases[10]. Traditional open thoracotomy and VATS are two principally different surgical methods for pulmonary metastasectomy.The selection of an approach depends more on the theoretical knowledge and personal experience of the surgeon than on the evidence. Over the past two decades several studies have demonstrated the benefits of VATS that included less postoperative pain shorter hospital stays a smaller degree of immunosuppression and enhanced recovery and the ability to tolerate adjuvant therapy[11]“[13]. Whether the long-term advantages are comparable to those of open thoracotomy is not well documented. The major deficiency of the VATS approach is that nodules might be undetected by VATS that might be detected by manual palpation during thoracotomy; such missing nodules are not imaged on a preoperative CT scan. The VATS approach has long been controversial because VATS does not consistently detect all the metastases and it is recognized that complete resection remains a major determining factor of survival [14].The detection rate of HRCT for pulmonary metastases is 78“84%[15]“[17].Kayton[18]found that 35% of the pathologically verified metastases were missed by CT. In the International Registry of Lung Metastases study of 5206 patients the 5-year survival rate was 36% for complete resection compared with 13% incomplete resectoin[19]. It is not certain whether the nodule imaged on a CT scan and resected by VATS is the correct one [14]. Those who disagree with the use of VATS hypothesize that VATS-related recurrence is commonly observed including port-site recurrence and resection stump recurrence[20]. Johnstone reported 23 cases of port-site chest wall recurrence related to VATS[21]. They hypothesized that the thoracoscopic approach should only be used in patients with a solitary lesion and when resection is requried for diagnostic purposes. The surgeons who favor the VATS approach advocate that VATS minimizes pain and trauma to the patients and that the VATS group might have an improved tolerance of chemotherapy which would likely ensure delivery of planned post-resection adjuvant therapy without a reduction in dosage or delay. The standard surgical procedure for pulmonary metastases is wedge resection that usually does not require manipulation of the pulmonary hilum which is appropriate for the VATS approach.They hypothesiezd that a lesion overlooked by CT but detected by palpation might not result in a survival gain[22] [23] and may be partially compensated for by carefully follow-up.Flores[24] hypothesized that the VATS group might demonstrate a great number of metachronous tumors over time;however the metachronous lesions in each group was similar. Our work suggests that thoracoscopic resection of metastatic lung cancer is a safe and curative procedure with 13 and 5-year survival rates comparable to those of thoracotomy. Patients with metastatic lung cancer are likely to relapse in the lung and after lung metastasectomy by VATS patients might benefit from a second metastasectomy. We hypothesize that earlier chemotherapy and radiation are essential to maximizing survival. Our study might be subject to pretreatment selection bias because most of the patients selected for open thoracotomy had multiple lesions and high risk and were not suitable for treatment with VATS.The missing lesions perhaps skewed the data more toward VATS as an equivalent procedure. We were also interested in the recurrence of cancerand the disease-free survival rates were evaluated. This study demonstrates a similar 1-year disease-free survival rate;however the 3-year disease-free survival rate is inferior for three reasons. First unrelated cancer deaths were included in our analysis of the 13 and 5-year overall survival which might account for VATS having a comparable overall survival rate but an inferior disease-free survival rate. Secondthe patients in the VATS group might have lesions that are missed and there are more likely to relapse in the lung leading to the inferior 3-year disease-free survival rate.Third some of our included studies were in the early period of VATS development when the technology was immature and some of the complications can now be prevented with more experience. Schaeff[25] reported 23 cases of port-site recurrence associated with VATS that occurred before 1998.The number of cases studied was small and the observation period was limitied. Spiral computed tomography has a far higher detection rate today than it did 20 years ago;so small lesions can be accurately localized before surgery[26] which ensures the success of VATS. With advances in imaging technology palpaiton during open thoracotomy is becoming less important.The latest VATS technology has a high-definition resolution and the flexible-tip thoracoscope enables complete inspection of the pleural cavity.These advancements ensure that VATS is an ideal method for patients with a solitary and relatively small peripheral lesions.Tamas[27] hypothesizes that palpation is necessary in a therapeutic metastasectomy as opposed to a diagnostic procedure.Whether patients with multiple lesions should be treated with open thoracotomy or VATS is controversial. This study is the first meta-analysis of the oncological outcome of thoracoscopic surgery for the treatment of metastatic lung cancer. In our work we observed that VATS might be a promising treatment for metastatic lung cancer. No randomized trials existing to guide doctors in the field of metastatic lung cancer currently. A prospective randomized study of the different surgical strategies is needed. Limitation No randomized controlled trials existing to comparing VATS with thoracotomy have been conducted. Heterogeneity was observed between the sample size and the years covered. Most studies are limited to small observational studies and single-institution case series. For these reasonsthere are only a total of 546 patients were included in the two groups for a study period spans more than a decade. Two of the studies comprise almost 65% of the patients and one study has only 20 patients; there are potential sources of bias in our work.Additional randomized controlled trials in the studies we accessed would have increased the strength of our results.There is a bias for the English language. Conclusion In our meta-analysis we found that for patients with metastatic lung cancer comparing VATS with thoracotomy showed almost equivalent survival rates. The VATS can not replace open thoracotomy completely. Further study is neededand a large multicenter randomized trial comparing VATS and thoracotomy would be ideal. Supporting Information Checklist S1 PRISMA Checklist. (DOC) Click here for additional data file. References 1 RuschVW (2010) Pulmonary metastasectomy: a moving target. J Thorac Oncol5: S130“13120502246 2 CassonAG PutnamJB NatarajanG JohnstonDA MountainC et al (1992) Five-year survival after pulmonary metastasectomy for adult soft tissue sarcoma. Cancer69: 662“6681730117 3 van HalterenHK van GeelAN HartAA ZoetmulderFA (1995) Pulmonary resection for metastases of colorectal origin. Chest107: 1526“15317781341 4 KandiolerD KromerE TuchlerH EndA MullerMR et al (1998) Long-term results after repeated surgical removal of pulmonary metastases. Ann Thorac Surg65: 909“9129564899 5 McCormackPM BainsMS BeggCB BurtME DowneyRJ et al (1996) Role of video-assisted thoracic surgery in the treatment of pulmonary metastases: results of a prospective trial. Ann Thorac Surg62: 213“216 discussion 216“217.8678645 6 SaishoS NakataM SawadaS YamashitaM SaekiH et al (2009) Evaluation of video-assisted thoracoscopic surgery for pulmonary metastases: 11-years of experience. Surg Endosc23: 55“6118437482 7 CerfolioRJ BryantAS McCartyTP MinnichDJ (2011) A prospective study to determine the incidence of non-imaged malignant pulmonary nodules in patients who undergo metastasectomy by thoracotomy with lung palpation. Ann Thorac Surg91: 1696“1700 discussion 1700“1691.21619965 8 DownsSH BlackN (1998) The feasibility of creating a checklist for the assessment of the methodological quality both of randomised and non-randomised studies of health care interventions. J Epidemiol Community Health52: 377“3849764259 9 KondoH OkumuraT OhdeY NakagawaK (2005) Surgical treatment for metastatic malignancies. Pulmonary metastasis: indications and outcomes. Int J Clin Oncol10: 81“8515864692 10 PorterGA CantorSB WalshGL RuschVW LeungDH et al (2004) Cost-effectiveness of pulmonary resection and systemic chemotherapy in the management of metastatic soft tissue sarcoma: a combined analysis from the University of Texas M. D. Anderson and Memorial Sloan-Kettering Cancer Centers. J Thorac Cardiovasc Surg127: 1366“137215115994 11 PetersenRP PhamD BurfeindWR HanishSI TolozaEM et al (2007) Thoracoscopic lobectomy facilitates the delivery of chemotherapy after resection for lung cancer. Ann Thorac Surg83: 1245“1249 discussion 1250.17383320 12 PaulS AltorkiNK ShengS LeePC HarpoleDH et al (2010) Thoracoscopic lobectomy is associated with lower morbidity than open lobectomy: a propensity-matched analysis from the STS database. J Thorac Cardiovasc Surg139: 366“37820106398 13 WhitsonBA GrothSS DuvalSJ SwansonSJ MaddausMA (2008) Surgery for early-stage non-small cell lung cancer: a systematic review of the video-assisted thoracoscopic surgery versus thoracotomy approaches to lobectomy. Ann Thorac Surg86: 2008“2016 discussion 2016“2008.19022040 14 EckardtJ LichtPB (2012) Thoracoscopic versus open pulmonary metastasectomy: a prospective sequentially controlled study. Chest142: 1598“160222677347 15 AmbrogiV PaciM PompeoE MineoTC (2000) Transxiphoid video-assisted pulmonary metastasectomy: relevance of helical computed tomography occult lesions. Ann Thorac Surg70: 1847“185211156082 16 MargaritoraS PorziellaV D'AndrilliA CesarioA GalettaD et al (2002) Pulmonary metastases: can accurate radiological evaluation avoid thoracotomic approach? Eur J Cardiothorac Surg21: 1111“111412048094 17 ParsonsAM DetterbeckFC ParkerLA (2004) Accuracy of helical CT in the detection of pulmonary metastases: is intraoperative palpation still necessary? Ann Thorac Surg78: 1910“1916 discussion 1916“1918.15561000 18 KaytonML HuvosAG CasherJ AbramsonSJ RosenNS et al (2006) Computed tomographic scan of the chest underestimates the number of metastatic lesions in osteosarcoma. J Pediatr Surg41: 200“206 discussion 200“206.16410133 19 Long-term results of lung metastasectomy: prognostic analyses based on 5206 cases. The International Registry of Lung Metastases. J Thorac Cardiovasc Surg113: 37“499011700 20 MutsaertsEL ZoetmulderFA RutgersEJ (2001) Port site metastasis as a complication of thoracoscopic metastatectomy. Eur J Surg Oncol27: 327“32811373113 21 JohnstonePA RohdeDC SwartzSE FetterJE WexnerSD (1996) Port site recurrences after laparoscopic and thoracoscopic procedures in malignancy. J Clin Oncol14: 1950“19568656265 22 TreasureT (2007) Pulmonary metastasectomy: a common practice based on weak evidence. Ann R Coll Surg Engl89: 744“74817999813 23 RothJA PassHI WesleyMN WhiteD PutnamJB et al (1986) Comparison of median sternotomy and thoracotomy for resection of pulmonary metastases in patients with adult soft-tissue sarcomas. Ann Thorac Surg42: 134“1383741009 24 FloresRM IhekweazuUN RizkN DycocoJ BainsMS et al (2011) Patterns of recurrence and incidence of second primary tumors after lobectomy by means of video-assisted thoracoscopic surgery (VATS) versus thoracotomy for lung cancer. J Thorac Cardiovasc Surg141: 59“6421055770 25 SchaeffB PaolucciV ThomopoulosJ (1998) Port site recurrences after laparoscopic surgery. A review. Dig Surg15: 124“1349845574 26 ChenYR YeowKM LeeJY SuIH ChuSY et al (2007) CT-guided hook wire localization of subpleural lung lesions for video-assisted thoracoscopic surgery (VATS). J Formos Med Assoc106: 911“91818063512 27 MolnarTF GebitekinC TurnaA (2010) What are the considerations in the surgical approach in pulmonary metastasectomy? J Thorac Oncol5: S140“14420502249 28 NakajimaJ TakamotoS TanakaM TakeuchiE MurakawaT et al (2001) Thoracoscopic surgery and conventional open thoracotomy in metastatic lung cancer. Surg Endosc15: 849“85311443456 29 MutsaertsEL ZoetmulderFA MeijerS BaasP HartAA et al (2002) Long term survival of thoracoscopic metastasectomy vs metastasectomy by thoracotomy in patients with a solitary pulmonary lesion. Eur J Surg Oncol28: 864“86812477479 30 NakasA KlimatsidasMN EntwisleJ Martin-UcarAE WallerDA (2009) Video-assisted versus open pulmonary metastasectomy: the surgeon's finger or the radiologist's eye? Eur J Cardiothorac Surg36: 469“47419464921 31 CarballoM MaishMS JaroszewskiDE HolmesCE (2009) Video-assisted thoracic surgery (VATS) as a safe alternative for the resection of pulmonary metastases: a retrospective cohort study. J Cardiothorac Surg4: 1319239710 32 GossotD RaduC GirardP Le CesneA BonvalotS et al (2009) Resection of pulmonary metastases from sarcoma: can some patients benefit from a less invasive approach? Ann Thorac Surg87: 238“24319101304 33 ChaoYK ChangHC WuYC LiuYH HsiehMJ et al (2012) Management of lung metastases from colorectal cancer: video-assisted thoracoscopic surgery versus thoracotomy”a case-matched study. Thorac Cardiovasc Surg60: 398“40422228090 101150042 30118 Mol Cancer Res Mol. Cancer Res. Molecular cancer research : MCR 1541-7786 1557-3125 24202705 3946989 10.1158/1541-7786.MCR-13-0300 NIHMS538386 œNEDD9 Depletion Leads to MMP14 Inactivation by TIMP2 and Prevents Invasion and Metastasis. McLaughlin Sarah L. 5 * Ice Ryan J. 5 * Rajulapati Anuradha 5 Kozyulina Polina Y. 1 Livengood Ryan H. 4 Kozyreva Varvara K. 5 Loskutov Yuriy V. 5 Culp Mark V. 3 Weed Scott A. 2 5 Ivanov Alexey V. 1 5 Pugacheva Elena N. 1 5 # 1Department of Biochemistry West Virginia University School of Medicine Morgantown WV 26506 2Department of Neurobiology and Anatomy West Virginia University School of Medicine Morgantown WV 26506 3Department of Statistics West Virginia University School of Medicine Morgantown WV 26506 4Department of Pathology West Virginia University School of Medicine Morgantown WV 26506 5Mary Babb Randolph Cancer Center West Virginia University School of Medicine Morgantown WV 26506 #Corresponding author: Elena N. Pugacheva Mailing address: Department of Biochemistry and Mary Babb Randolph Cancer Center PO Box 9142 1 Medical Center Drive West Virginia University School of Medicine Morgantown WV 26506. Phone: (304) 293-5295; Fax: (304) 293-4667; [email protected] S.L. McLaughlin* and R. J. Ice* contributed equally to this work. 17 12 2013 07 11 2013 1 2014 01 1 2015 12 1 69 81 The scaffolding protein NEDD9 is an established pro-metastatic marker in several cancers. Nevertheless the molecular mechanisms of NEDD9 driven metastasis in cancers remain ill defined. Here using a comprehensive breast cancer (BCa) tissue microarray it was show that increased levels of NEDD9 protein significantly correlated with the transition from carcinoma in situ to invasive carcinoma. Similarly it was shown that NEDD9 overexpression is a hallmark of highly invasive BCa cells. Moreover NEDD9 expression is crucial for the protease-dependent mesenchymal invasion of cancer cells at the primary site but not at the metastatic site. Depletion of NEDD9 is sufficient to suppress invasion of tumor cells in vitro and in vivo leading to decreased circulating tumor cells (CTCs) and lung metastases in xenograft models. Mechanistically NEDD9 localized to invasive pseudopods and was required for local matrix degradation. Depletion of NEDD9 impaired invasion of cancer cells through inactivation of membrane-bound matrix metalloproteinase MMP14 by excess TIMP2 on the cell surface. Inactivation of MMP14 is accompanied by reduced collagenolytic activity of soluble metalloproteinases MMP2 and MMP9. Re-expression of NEDD9 is sufficient to restore the activity of MMP14 and the invasive properties of BCa cells in vitro and in vivo. Collectively these findings uncover critical steps in NEDD9-dependent invasion of BCa cells."
Lung_Cancer
"Diagnostic assessment programs (DAPs) appear to be a promising model for enabling ICC. The purpose of this study was to explore how DAP structure and function enable ICC and whether that may be associated with anizational and clinical outcomes. Methods A case study approach will be used to explore ICC among eight DAPs that vary by type of cancer (lung breast) academic status and geographic region. To describe DAP function and outcomes and gather information that will enable costing recommendations expressed in DAP standards and clinical guidelines will be assessed through retrospective observational study. Data will be acquired from databases maintained by participating DAPs and the provincial cancer agency and confirmed by and supplemented with review of medical records. We will conduct a pilot study to explore the feasibility of estimating the incremental cost-effectiveness ratio using person-level data from medical records and other sources. Interviews will be conducted with health professionals staff and referring physicians from each DAP to learn about barriers and facilitators of ICC. Qualitative methods based on a grounded approach will be used to guide sampling data collection and analysis. Discussion Findings may reveal opportunities for unique structures interventions or tools that enable ICC that could be developed implemented and evaluated through future research. This information will serve as a formative needs assessment to identify the nature of ongoing or required improvements which can be directly used by our decision maker collaborators and as a framework by policy makers cancer system managers and DAP managers elsewhere to strategically plan for and implement diagnostic cancer services. Inter-professional collaborative care Multidisciplinary care team Inter-professional relations Communication Cooperative behavior Diagnostic assessment program Breast cancer Lung cancer Background Need for collaborative cancer care Most cancer patients require multimodal assessment and treatment including radiologic and pathologic detection confirmation and characterization and surgery chemotherapy and/or radiation for cure or palliation [1]. Following initial treatment patient needs vary as they undergo follow-up surveillance to detect recurrent or secondary cancer with many facing physiological and psychosocial difficulties as a result of their cancer and/or its treatment [2]. In addition most cancer patients require management to prevent or treat co-morbid conditions [3]. Thus cancer management is complex and compounded by the fact that multimodal care is delivered by different professionals in different settings and at different time points. Research has established that coordinated collaborative service delivery improves clinical (i.e. mortality length of stay readmission) and patient-reported (i.e. satisfaction health related quality of life) outcomes for a variety of acute and chronic conditions including cancer [145]. This concept of inter-professional collaborative care (ICC) requires ongoing interaction among various types of health professionals to assess plan negotiate provide and review care for individual patients [6]. Barriers of collaborative cancer care It has been proposed that one-third of cancer cases could be prevented another third cured and the rest effectively treated if management consistently complied with existing guidelines [7]. Most cancer management guidelines recommend ICC but do not specify how this can be achieved [8]. A non-systematic review of the literature on ICC in cancer found that formal policies and structures improved treatment decisions implementation of treatment decisions documentation of treatment decisions attendance at joint meetings professional diversity at meetings completeness of information presented at meetings management according to guideline recommendations time to diagnosis or treatment survival role identification among team members team effectiveness and staff wellbeing [9]. However timely and appropriate ICC was challenged by many patient provider team and system level factors [10]. Other barriers included strategic differences across anizations limited administrative support and identified leads for the collaborative process and anizational and individual provider reluctance to share resources and power [11]. Given multiple associated benefits efforts are needed to promote and support ICC for the clinical management of cancer patients. First improved understanding of which ICC approaches lead to improved patient provider and anizational or system outcomes is required so that we can meaningfully evaluate whether and how cancer patients experience ICC [1213]. Further understanding of how various ICC models lead to beneficial patient provider institutional and health system outcomes will provide insight on when and in what way to implement these models. Our research on collaborative cancer care We have jointly conducted several research studies that identified numerous challenges of ICC for cancer and evaluated the availability and impact of interventions to support ICC. ARG surveyed and interviewed Ontario clinicians and managers involved in cancer care across several studies. Participants identified numerous ICC challenges such as timely access to testing for diagnosis and staging lack of human and technical resources identifying and communicating with specialists coordinating referral to and back from specialists confusion among multidisciplinary team members about who was to coordinate management and the need for system level support [14-19]. Interventions to support ICC suggested by participants included patient held medical records cancer specific medical record standardized referral and reply forms centralized cancer diagnostic facilities regional outreach clinics and use of telemedicine. ARG conceptually analyzed the literature to describe models of ICC [20]. Determinants of positive objective and subjective patient team and anizational outcomes included system or anizational support team structure and team processes. ARG reviewed empirical research evaluating ICC for cancer patients [20]. Twenty-two studies of mixed design published between 2001 and 2009 were eligible. The majority of studies (17/22) assessed the role of general practitioners and supportive/palliative care workers in cancer patient follow-up. Five of 22 studies evaluated ICC for diagnosis or treatment decision making. Apart from tumor boards no studies described interventions to enable ICC. Collectively this research suggests that most cancer providers function through parallel or consultative rather than integrated models of care. FCW spearheaded several investigations to describe and evaluate multidisciplinary cancer conferences (MCCs) as an intervention to support ICC. Also known as tumor boards these are defined as regularly scheduled meetings where healthcare providers discuss the treatment of individual cancer patients [1]. First she chaired a multidisciplinary panel to issue an evidence- and consensus-based guideline describing MCCs [1]. FCW conducted a systematic review of the literature to examine the impact of ICC on clinical outcomes [21]."
Lung_Cancer
"Actin was probed by antibody from Sigma (catalog no. 1978). The gene expression nucleosome positioning and ChIP-seq data have been submitted to Gene Expression Omnibus (http:/www.ncbi.nlm.nih.gov/geo/) under accession numbers GSE40194 GSE40300 GSE40363 and GSE18182. RESULTS We analyzed expression of 1722 regulatory factors including ones involved in cancer metastasis (27“29) in transcriptome profiles of 382 lung cancer clinical cases. Our analyses identified that a metastasis suppressor NME2 (also known as NM23 H2/NDPK) was significantly down regulated in advanced stages across four independent data sets (P < 0.05 student's t-test; Supplementary Figure S1a). Details of this analysis including further experiments performed by us which confirmed that NME2 can induce anti-metastatic changes in lung adenocarcinoma-derived A549 cells are provided as supplementary material (Supplementary Information and Supplementary Figures S1b“d). Next we determined NME2 occupancy nucleosome positions and transcriptomes before and after induction of NME2 levels in A549 cells. As NME2 is endogenously expressed in A549 cells we used the term ˜NME2 induced™ to refer to the cellular state following increase of NME2 levels. To ascertain whether NME2 protein level after induction in A549 cells was still in the physiological range we analyzed protein expression of NME2 in normal lung lysates and tumor lung and compared with NME2-induced A549 cells. Our comparative analysis clearly showed that NME2 level within induced A549 cells were within physiological range (Supplementary Figure S1e). Genome-wide NME2 binding promoter-nucleosome occupancy and the transcriptional state ChIP followed by massively parallel sequencing (ChIP-seq) was performed in replicate for both conditions before and after inducing NME2 (A). Out of roughly 7 million sequence reads >80% uniquely aligned to the reference human genome in each case (Supplementary Figure S2a). Using ChIP-seq reads enriched in NME2 relative to IgG we found 2005 and 11 017 peaks before and after inducing NME2 in A549 cells respectively. Although number of NME2 binding sites increased after induction a close inspection of peaks (sites of NME2 binding to DNA) showed that their chromosome-wise distribution was largely similar in both cases (A: Circos plot and Supplementary Figures S2b and c). The replicates were also similar (A: Circos plot and Supplementary Figure S2d). The frequency of TFBSs was also largely similar before and after induction of NME2 (Supplementary Figure S2e). A 12-mer consensus motif identified using Gibbs sampler (30) was present in >70% of the ChIP-seq peaks (B upper panel). We noted that the motif found from ChIP-seq was similar to the one reported earlier from analysis of a single promoter (31) and unpublished data of Thakur et al. (submitted for publication) As expected in more than 50% cases the NME2 motif occurred within 50 bp of the center of peak (B lower panel). We next performed transcriptome profiling of A549 cells before and after NME2 induction. Comparative analysis of the expression profiles revealed 1679 genes as differentially expressed (781 genes were up and 898 genes down regulated (P < 0.05)) in NME2-induced cells; out of these we found at least one NME2 binding site (in the induced condition) within 10 kb of the TSS in as many as 1235 genes. We next asked whether altered state of chromatin in regulatory regions influenced NME2 occupancy and consequent gene expression changes. To test this nucleosome positions were determined in the A549 cells before and after NME2 induction. Mono-nucleosomes were isolated by MNase digestion and we mapped nucleosome positions to putative promoter regions (?7.5 kb to 2.5 kb of TSSs) using tiled microarrays (A) and found 157 634 and 162 570 nucleosomes before and after NME2 induction respectively. Next we checked the relationship between overall number of nucleosomes on each promoter and the expression level of corresponding gene and found that enriched promoter-nucleosome occupancy correlated with decreased expression of corresponding genes (r = ?0.73; P < 0.05 before NME2 induction and r = ?0.80; P < 0.05 after NME2 induction Pearson correlation; B). Target site proximal promoter-nucleosome repositioning upon NME2 expression We noted distinct occurrence of nucleosomes with respect to TSSs across promoters for many genes which showed a phased pattern that was consistent with previous studies of nucleosome distribution in human and yeast (153233) (C). On comparing the two states before and after NME2 induction we found ?11.4% (18 024/157 634) nucleosomes on 1022 genes were repositioned in the NME2-induced condition. We also found that a large number of genes with repositioned nucleosomes were differentially expressed between the two states (830 out of 1022 genes (P < 0.05)) (D). It is important to note that in contrast to B which showed that a high overall increased number of nucleosomes on a given promoter relates to decreased expression D showed that differential expression of genes here resulted from repositioning (and not overall exclusion or gain) of nucleosomes within promoter. Interestingly most repositioning events after NME2 induction were observed near TSSs (D upper panel). We next checked target-site nucleosome occupancy before and after NME2 induction (A). On analyzing relative occurrence we found lower number of positioned nucleosomes in the vicinity (?300“500 bp) of NME2 target sites in cells after NME2 induction (B). Out of 3956 NME2 target sites (within ?7.5 to +2.5 kb of TSS) unique to the NME2-induced cells 1257 (31%) present on 1119 putative promoters were found to either overlap or were within 300 bases of a nucleosome in cells before NME2 induction. Furthermore 870 (?70%) of the 1257 sites were found to be nucleosome-free in the NME2-induced condition which involved repositioning of 870 nucleosomes in 791 genes on NME2 induction. Together these findings indicate that many of the NME2 binding sites occupied by nucleosomes in the un-induced condition in A549 cells became NME2-bound (and nucleosome-free) in the NME2-induced condition. To analyze nucleosome repositioning with respect to the NME2 target site after versus before NME2 induction we calculated the distance of nucleosome shift between the two conditions as ?Ndisplacement (C left panel) and found ?64% nucleosomes shifted by more than 300 bp in the NME2-induced condition. In order to test the significance of the noted nucleosome shift we also calculated this distribution in A549 cells where NME2 was depleted (see below) relative to control A549 cells. Observed distributions were significantly altered following induction of NME2; in contrast on NME2 depletion we did not find any repositioning in most cases (Wilcoxon rank sum test; P = 0.00016; C right panel). Next we plotted the 870-nucleosome positions (found within 300 bp of an NME2 target site in the un-induced condition) before and after NME2 induction. This showed a loss in anized nucleosome occurrence around NME2 binding sites in NME2-induced cells relative to the un-induced condition (D). We further noted that expression of all the 791 genes with repositioned nucleosomes was significantly altered in the NME2-induced condition (P < 0.05 student's t-test D). For validation we compared nucleosome occupancy and NME2 binding using quantitative real-time PCR in six genes. In all cases low nucleosome occupancy signal was detected along with high NME2 occupancy in cells after NME2 induction as compared to that observed in un-induced cells (). Target sites are nucleosome occupied in cells with depleted levels of NME2 We reasoned that in addition to induced NME2; A549 cells with depleted levels of NME2 would provide a suitable model to test nucleosome positioning/NME2 occupancy in a contrasting situation. To test this we generated a stable NME2-depleted A549 cell line (see Materials and Methods). Following this we determined nucleosome positions in the NME2-depleted cells. All the 870 NME2 binding sites that were nucleosome-free in the NME2-induced condition and occupied in the un-induced state (D) were also found to be nucleosome-occupied in the NME2-depleted condition. "
Lung_Cancer
"or paclitaxel (200 mg/m2)/carboplatin (area under the curve 6.0) on day 1 every 3 weeks. Chemotherapy was continued for at least three cycles. Gefitinib was administered until the disease progressed intolerable toxicities developed or consent was withdrawn. The protocol recommended that the crossover regimen be used as a second-line treatment. Clinical Assessments The antitumor response to treatment was assessed using computed tomography every 2 months. Unidirectional measurements were adopted on the basis of the Response Evaluation Criteria in Solid Tumors (version 1.0).23 PFS was evaluated from the date of randomization to the date when disease progression was first observed or death occurred. The treatment response and PFS were determined by an external review of computed tomography scans by experts who were not aware of the treatment assignments. Overall survival (OS) was evaluated from the date of randomization to the date of death. Statistical Analysis To assess prognostic factors for OS we used univariate and multivariate Cox proportional hazards models. Kaplan“Meier survival curves were constructed for PFS and OS and differences between groups were identified using the log-rank test. Differences in response rates were identified using Fisher™s exact test. Each analysis was two sided with a 5% significance level and a 95% confidence interval. All analyses were performed using SAS for Windows software (release 9.1; SAS Institute Cary NC). RESULTS Patient Population A total of 230 chemonaive patients were enrolled in the NEJ002 study: 115 patients were assigned to receive gefitinib and 115 were assigned to receive carboplatin-paclitaxel (Fig. 1). To evaluate the efficacy of gefitinib in NSCLC patients with uncommon EGFR mutations we analyzed the data of 114 patients in the gefitinib group and 111 patients in the carboplatin-paclitaxel group. We identified five patients who had uncommon EGFR mutations in each group. Two patients who had common mutations and were treated with first-line chemotherapy consisting of carboplatin-paclitaxel were excluded from the PFS analysis in the NEJ002 study. However both were treated with gefitinib and were included in this post-hoc analysis. The demographic and disease characteristics of the patients with uncommon EGFR mutations were similar to those of patients with common EGFR mutations (). The characteristics of each patient with uncommon EGFR mutations are shown in supplementary Table S1 (Supplemental Digital Content 1 http://links.lww.com/JTO/A494). FIGURE 1. Enrollment randomization and follow-up of the study patients. TABLE 1. Patient Characteristics Survival Factors In the univariate analysis of 225 patients who received gefitinib at any point uncommon EGFR mutations had a significant detrimental effect on survival (). We also identified performance statuses 1 and 2 distant metastasis brain metastasis stable disease and progressive disease as significant predictors of worse prognosis for standard chemotherapy and stable disease and progressive disease as significant predictors of worse prognosis for gefitinib. When these variables were included in the Cox proportional hazards model we found that uncommon EGFR mutations performance statuses 1 and 2 stable disease and progressive disease for standard chemotherapy and stable disease and progressive disease for gefitinib had significant hazard ratios (). TABLE 2. Univariate and Multivariate Analysis by Cox Proportional Hazards Model Uncommon EGFR Mutations and Survival The Kaplan“Meier curve for OS for uncommon versus common EGFR mutations is shown in A. The OS was significantly shorter among patients with uncommon EGFR mutations compared with OS of those with common EGFR mutations in the overall population (12 versus 28.4 months; p = 0.002). A significantly shorter survival time was observed in patients with uncommon EGFR mutations compared with survival time in those with common EGFR mutations in the gefitinib group (11.9 versus 29.3 months; p < 0.001) (Fig. 2B). However a similar survival time was observed between the subgroups of uncommon and common EGFR mutations in the carboplatin-paclitaxel group (22.8 versus 28 months; p= 0.358) (Fig. 2C). FIGURE 2. The overall survival curves of patients with common mutations and uncommon mutations in the entire population (A) the gefitinib group (B) and the carboplatin-paclitaxel group (C). To examine whether the sequence of platinum doublet and gefitinib affected OS we performed a further subgroup analysis. The survival time tended to be shorter among patients receiving first-line gefitinib compared with the survival time among those receiving first-line carboplatin-paclitaxel in the uncommon EGFR mutation group (11.9 versus 22.8 months; p = 0.102). Consistent with previous publications a similar survival time was observed between patients receiving first-line gefitinib and those receiving first-line carboplatin-paclitaxel in the common EGFR mutation group (29.3 versus 28 months; p = 0.378). Uncommon EGFR Mutations PFS and Response In the gefitinib group the median PFS was significantly shorter for patients with uncommon EGFR mutations compared with median PFS of those with common EGFR mutations (2.2 versus 11.4 months; p < 0.001) (Fig. 3A). By contrast the median PFS did not differ significantly between patients with uncommon EGFR mutations and those with common EGFR mutations in the carboplatin-paclitaxel group (5.9 versus 5.4 months; p = 0.847) (Fig. 3B). The objective response rate was significantly lower in patients with uncommon EGFR mutations compared with the objective response rate in those with common EGFR mutations when treated with gefitinib (20% versus 76%; p = 0.017) (supplementary Table S2 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). By contrast similar objective response rates were observed for patients with uncommon EGFR mutations and those with common EGFR mutations in the carboplatin-paclitaxel group (20% versus 32%; p = 0.336) (supplementary Table S2 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). FIGURE 3. Progression-free survival curves in the gefitinib group (A) and the carboplatin-paclitaxel group (B) according to the type of epidermal growth factor receptor mutation. DISCUSSION Recent studies suggest that NSCLC patients with uncommon EGFR mutations are less responsive to EGFR-TKIs compared with patients with L858R and exon 19 deletions.9“20 However the efficacy of EGFR-TKIs in NSCLC patients with uncommon mutations has not been fully elucidated. We conducted a post-hoc analysis of the NEJ002 study to evaluate the effectiveness of gefitinib against NSCLC with G719X or L861Q. The NEJ002 study comparing gefitinib and standard carboplatin-paclitaxel chemotherapy as the first-line treatment for patients with EGFR mutations demonstrated no significant difference in OS between gefitinib and carboplatin-paclitaxel.6 In contrast to other phase 3 trials investigating EGFR-TKIs for patients with common EGFR mutations of exon 19 deletion and L858R the NEJ002 is the only study that included uncommon EGFR mutations of G719X and L861Q. The current study clearly demonstrated that NSCLC patients with the uncommon EGFR mutations G719X and L861Q had shorter survival than the survival of those with an exon 19 deletion or L858R mutation (Fig. 2). Our results are consistent with other clinical studies on EGFR-TKIs in patients with uncommon EGFR mutations (supplementary Table S3 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). The overall response rate to EGFR-TKIs in patients with uncommon EGFR mutations was 41% which is lower than the response rate to TKIs (62%“83%) of patients with common EGFR mutations.7824 In the NEJ002 study G719X included G719C and G719S. No patients harbored G719A. To investigate the effectiveness of gefitinib on each uncommon EGFR mutations we evaluated the difference in OS between patients with uncommon EGFR mutations (G719C versus G719S and G719X versus L861Q). There was no significant difference between these subgroups (data not shown). This study showed that the PFS and OS tended to be shorter among patients treated with first-line gefitinib compared with PFS and OS among those treated with first-line carboplatin-paclitaxel in the uncommon EGFR mutation group (supplementary Table S2 Supplemental Digital Content 1 http://links.lww.com/JTO/A494). We also found poor disease control rate with gefitinib in patients with uncommon mutations. Three of five patients with uncommon mutations in the gefitinib group had progressive disease. By contrast no patients with uncommon mutations had progressive disease in the carboplatin-paclitaxel group. Although the number of patients with uncommon mutations in each treatment group was small platinum-doublet therapy might be a better choice than gefitinib for first-line therapy in patients with uncommon EGFR mutations. Because some of patients with uncommon mutations showed good clinical response to gefitinib in this study and they seemed to be heterogeneous in terms of response to gefitinib administration of gefitinib should be considered for patients with uncommon mutations when disease progression was observed after first-line chemotherapy. In vitro studies have indicated that the affinity of gefitinib for EGFR proteins with uncommon EGFR mutations is lower than the affinity of gefitinib for EGFR proteins with common EGFR mutations.25 A sixfold or 14-fold higher concentration of gefitinib was required to inhibit the growth of cells expressing G719X or L861Q respectively compared with cells expressing L858R.26 These results may explain the lack of response to gefitinib in patients with uncommon EGFR mutations. The authors also examined the sensitivity of G719X and L861Q mutations to erlotinib and irreversible TKIs.27 Cells expressing G719X were less resistant to erlotinib than gefitinib in vitro; however L861Q was resistant to both erlotinib and gefitinib. In contrast to erlotinib irreversible TKIs inhibited the growth of cells with G719X or L861Q at a lower concentration than those with wild-type EGFR. Indeed Sequist et al.28 reported that the effectiveness of an irreversible pan-ErbB receptor TKI neratinib on NSCLC patients with G719X. Niratinib induced partial responses in three of four patients with G719X and the fourth had durable stable disease for 40 weeks. It may be beneficial to evaluate erlotinib as a treatment for NSCLCs with G719X and irreversible EGFR-TKIs as treatments for NSCLCs with G719X and L861Q. Because previous phase 3 trials that investigated erlotinib or irreversible TKIs for NSCLC with EGFR mutations did not include uncommon EGFR mutations further clinical studies may need to be performed.7829 Another possible strategy for the treatment of uncommon EGFR mutations is the combination of EGFR-TKIs and cytotoxic agents. Our group has undertaken a randomized phase 3 trial to compare gefitinib plus carboplatin plus pemetrexed with gefitinib monotherapy for patients with NSCLC with an exon 19 deletion or an L858R G719X or L861Q EGFR mutation (NEJ009; University Hospital Medical Information Network Clinical Trials Registry [UMIN-CTR] number UMIN000006340). The data from this study will advance the treatment of NSCLC with uncommon EGFR mutations. In conclusion our post-hoc analysis clearly demonstrated shorter survival of TKI-treated patients with uncommon EGFR mutations compared with survival of those with common EGFR mutations. Furthermore the data suggest that the first-line chemotherapy may be relatively effective for NSCLC with uncommon EGFR mutations. ACKNOWLEDGMENTS Special thanks to Hiromi Odagiri for her expert assistance with data collection and management. This study was supported by the Tokyo Cooperative Oncology Group. The first two authors contributed equally to this work. Disclosure: Dr. Yoshizawa received grants and lecture fees from AstraZeneca; Dr. Maemondo received lecture fees from AstraZeneca and Chugai; Dr. Inoue received lecture fees from AstraZeneca and Chugai; Dr. Gemma received grants and lecture fees from AstraZeneca; Dr. Hagiwara received patent fees from Mitsubishi Chemical Medience consulting fees and lecture fees from AstraZeneca; Dr. Kobayashi received grants from Novartis Nihon Kayaku Chugai Shionogi Kyowa Kirin Yakult Taiho and AstraZeneca and lecture fees from AstraZeneca Chugai and Bristol-Myers Squibb. The remaining authors declare no conflict of interest. REFERENCES 1. Kim ES Hirsh V Mok T Gefitinib versus docetaxel in previously treated non-small-cell lung cancer (INTEREST): a randomised phase III trial. Lancet 2008 372 1809 1818 19027483 2. Shepherd FA Rodrigues Pereira J Ciuleanu T National Cancer Institute of Canada Clinical Trials Group Erlotinib in previously treated non-small-cell lung cancer. N Engl J Med 2005 353 123 132 16014882 3. Lynch TJ Bell DW Sordella R Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004 350 2129 2139 15118073 4. Paez JG EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 2004 304 1497 1500 15118125 5. Mitsudomi T Morita S Yatabe Y West Japan Oncology Group Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label randomised phase 3 trial. Lancet Oncol 2010 11 121 128 20022809 6. Maemondo M Inoue A Kobayashi K North-East Japan Study Group Gefitinib or chemotherapy for non-small-cell lung cancer with mutated EGFR. N Engl J Med 2010 362 2380 2388 20573926 7. Rosell R Carcereny E Gervais R Spanish Lung Cancer Group in Collaboration with Groupe Français de Pneumo-Cancérologie and Associazione Italiana Oncologia Toracica Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre open-label randomised phase 3 trial. Lancet Oncol 2012 13 239 246 22285168 8. Zhou C Wu YL Chen G Erlotinib versus chemotherapy as first-line treatment for patients with advanced EGFR mutation-positive non-small-cell lung cancer (OPTIMAL CTONG-0802): a multicentre open-label randomised phase 3 study. Lancet Oncol 2011 12 735 742 21783417 9. Mitsudomi T Yatabe Y Mutations of the epidermal growth factor receptor gene and related genes as determinants of epidermal growth factor receptor tyrosine kinase inhibitors sensitivity in lung cancer. Cancer Sci 2007 98 1817 1824 17888036 10. Pallis AG Voutsina A Kalikaki A ˜Classical™ but not ˜other™ mutations of EGFR kinase domain are associated with clinical outcome in gefitinib-treated patients with non-small cell lung cancer. Br J Cancer 2007 97 1560 1566 18000506 11. Maheswaran S Sequist LV Nagrath S Detection of mutations in EGFR in circulating lung-cancer cells. N Engl J Med 2008 359 366 377 18596266 12. Sequist LV Martins RG Spigel D First-line gefitinib in patients with advanced non-small-cell lung cancer harboring somatic EGFR mutations. J Clin Oncol 2008 26 2442 2449 18458038 13. Costa DB Nguyen KS Cho BC Effects of erlotinib in EGFR mutated non-small cell lung cancers with resistance to gefitinib. Clin Cancer Res 2008 14 7060 7067 18981003 14. Masago K Fujita S Irisa K Good clinical response to gefitinib in a non-small cell lung cancer patient harboring a rare somatic epidermal growth factor gene point mutation; codon 768 AGC > ATC in exon 20 (S768I). Jpn J Clin Oncol 2010 40 1105 1109 20522446 15. Rizvi NA Rusch V Pao W Molecular characteristics predict clinical outcomes: prospective trial correlating response to the EGFR tyrosine kinase inhibitor gefitinib with the presence of sensitizing mutations in the tyrosine binding domain of the EGFR gene. Clin Cancer Res 2011 17 3500 3506 21558399 16. De Pas T Toffalorio F Manzotti M Activity of epidermal growth factor receptor-tyrosine kinase inhibitors in patients with non-small cell lung cancer harboring rare epidermal growth factor receptor mutations. J Thorac Oncol 2011 6 1895 1901 21841502 17. Wu JY Yu CJ Chang YC Effectiveness of tyrosine kinase inhibitors on œuncommon epidermal growth factor receptor mutations of unknown clinical significance in non-small cell lung cancer. Clin Cancer Res 2011 17 3812 3821 21531810 18. Ong M Kwan K Kamel-Reid S Neoadjuvant erlotinib and surgical resection of a stage iiia papillary adenocarcinoma of the lung with an L861Q activating EGFR mutation. Curr Oncol 2012 19 e222 e226 22670114 19. Ackerman A Goldstein MA Kobayashi S Costa DB EGFR delE709_T710insD: a rare but potentially EGFR inhibitor responsive mutation in non-small-cell lung cancer. J Thorac Oncol 2012 7 e19 e20 22982663 20. Sharma A Tan TH Cheetham G Rare and novel epidermal growth factor receptor mutations in non-small-cell lung cancer and lack of clinical response to gefitinib in two cases. J Thorac Oncol 2012 7 941 942 22722798 21. Nagai Y Miyazawa H Huqun Genetic heterogeneity of the epidermal growth factor receptor in non-small cell lung cancer cell lines revealed by a rapid and sensitive detection system the peptide nucleic acid-locked nucleic acid PCR clamp. Cancer Res 2005 65 7276 7282 16105816 22. Tanaka T Matsuoka M Sutani A Frequency of and variables associated with the EGFR mutation and its subtypes. Int J Cancer 2010 126 651 655 19609951 23. Therasse P Arbuck SG Eisenhauer EA New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer National Cancer Institute of the United States National Cancer Institute of Canada. J Natl Cancer Inst 2000 92 205 216 10655437 24. Mitsudomi T Yatabe Y Epidermal growth factor receptor in relation to tumor development: EGFR gene and cancer. FEBS J 2010 277 301 308 19922469 25. Yun CH Boggon TJ Li Y Structures of lung cancer-derived EGFR mutants and inhibitor complexes: mechanism of activation and insights into differential inhibitor sensitivity. Cancer Cell 2007 11 217 227 17349580 26. Kancha RK von Bubnoff N Peschel C Duyster J Functional analysis of epidermal growth factor receptor (EGFR) mutations and potential implications for EGFR targeted therapy. Clin Cancer Res 2009 15 460 467 19147750 27. Kancha RK Peschel C Duyster J The epidermal growth factor receptor-L861Q mutation increases kinase activity without leading to enhanced sensitivity toward epidermal growth factor receptor kinase inhibitors. J Thorac Oncol 2011 6 387 392 21252719 28. Sequist LV Besse B Lynch TJ Neratinib an irreversible pan-ErbB receptor tyrosine kinase inhibitor: results of a phase II trial in patients with advanced non-small-cell lung cancer. J Clin Oncol 2010 28 3076 3083 20479403 29. Miller VA Hirsh V Cadranel J Afatinib versus placebo for patients with advanced metastatic non-small-cell lung cancer after failure of erlotinib gefitinib or both and one or two lines of chemotherapy (LUX-Lung 1): a phase 2b/3 randomised trial. Lancet Oncol 2012 13 528 538 22452896 Clin Orthop Relat Res Clin. Orthop. Relat. Res Clinical Orthopaedics and Related Research 0009-921X 1528-1132 Springer US Boston 24249538 3971232 3385 10.1007/s11999-013-3385-9 Clinical Research Does Intensity of Surveillance Affect Survival After Surgery for Sarcomas? Results of a Randomized Noninferiority Trial Puri Ajay MS [email protected] Gulia Ashish MS Hawaldar Rohini PhD Ranganathan Priya MD Badwe Rajendra A. MS Orthopaedic Oncology Tata Memorial Hospital Room No. 45 E Borges Road Mumbai India Tata Memorial Hospital Mumbai India Anaesthesiology Critical Care and Pain Tata Memorial Hospital Mumbai India Surgical Oncology Tata Memorial Hospital Mumbai India 19 11 2013 5 2014 472 5 1568 1575 30 7 2013 8 11 2013 © The Association of Bone and Joint Surgeons® 2013 Background Whether current postoperative surveillance regimes result in improved overall survival (OS) of patients with extremity sarcomas is unknown. Questions/purposes We hypothesized that a less intensive followup protocol would not be inferior to the conventional followup protocol in terms of OS. We (1) assessed OS of patients to determine if less intensive followup regimens led to worsened survival and asked (2) whether chest radiograph followup group was inferior to CT scan followup group in detecting pulmonary metastasis; and (3) whether less frequent (6-monthly) followup interval was inferior to more frequent (3-monthly) followup in detecting pulmonary metastasis and local recurrence. Methods A prospective randomized single-center noninferiority trial was conducted between January 2006 and June 2010. On the basis of 3-year survival of 60% with intensive more frequent followup 500 nonmetastatic patients were randomized to demonstrate noninferiority by a margin (delta) of 10% (hazard ratio [HR] 1.36). The primary end point was OS at 3 years. The secondary objective was to compare disease-free survival (DFS) (time to recurrence) at 3 years. At minimum followup of 30 months (median 42 months; range 30“81 months) 178 deaths were documented. Results Three-year OS and DFS for all patients was 67% and 52% respectively. Three-year OS was 67% and 66% in chest radiography and CT groups respectively (HR 0.9; upper 90% confidence interval [CI] 1.13). DFS rate was 54% and 49% in chest radiography and CT groups respectively (HR 0.82; upper 90% CI 0.97). Three-year OS was 64% and 69% in 6-monthly and 3-monthly groups respectively (HR 1.2; upper 90% CI 1.47). DFS was 51% and 52% in 6-monthly and 3-monthly groups respectively (HR 1.01; upper 90% CI 1.2). Almost 90% of local recurrences were identified by patients themselves. Conclusions Inexpensive imaging detects the vast majority of recurrent disease in patients with sarcoma without deleterious effects on eventual outcomes. Patient education regarding self-examination will detect most instances of local recurrence although this was not directly assessed in this study. Although less frequent visits adequately detected metastasis and local recurrence this trial could not conclusively demonstrate noninferiority in OS for a 6-monthly interval of followup visits against 3-monthly visits. Level of Evidence Level I therapeutic study. See Guidelines for Authors for a complete description of levels of evidence. issue-copyright-statement © The Association of Bone and Joint Surgeons® 2014 101528555 37539 Nat Commun Nat Commun Nature communications 2041-1723 24572595 3982882 10.1038/ncomms4365 NIHMS562641 Article Characterizing the genetic basis of methylome diversity in histologically normal human lung tissue Shi Jianxin 1 Marconett Crystal N. 2 3 Duan Jubao 4 Hyland Paula L. 1 Li Peng 1 Wang Zhaoming 1 Wheeler William 5 Zhou Beiyun 6 Campan Mihaela 2 3 Lee Diane S. 2 3 Huang Jing 7 Zhou Weiyin 1 Triche Tim 8 Amundadottir Laufey 1 Warner Andrew 9 Hutchinson Amy 1 Chen Po-Han 2 3 Chung Brian S.I. 2 3 Pesatori Angela C. 10 Consonni Dario 10 Bertazzi Pier Alberto 10 Bergen Andrew W. 11 Freedman Mathew 12 13 Siegmund Kimberly D. 8 Berman Benjamin P. 8 14 Borok Zea 3 6 Chatterjee Nilanjan 1 Tucker Margaret A. 1 Caporaso Neil E. 1 Chanock Stephen J. 1 Laird-Offringa Ite A. 2 3 Landi Maria Teresa 1 1Division of Cancer Epidemiology and Genetics National Cancer Institute NIH DHHS Bethesda MD 20892 USA 2Department of Surgery USC/Norris Comprehensive Cancer Center Keck School of Medicine Los Angeles CA 90089 USA 3Department of Biochemistry and Molecular Biology USC/Norris Comprehensive Cancer Center Keck School of Medicine Los Angeles CA 90089 USA 4Center for Psychiatric Genetics Department of Psychiatry and Behavioral Sciences North Shore University Health System Research Institute University of Chicago Pritzker School of Medicine Evanston IL 60201 USA 5Information Management Services Inc. Rockville MD 20852 USA 6Will Rogers Institute Pulmonary Research Center and Division of Pulmonary Critical Care and Sleep Medicine USC Keck School of Medicine Los Angeles CA 90089 USA 7Laboratory of Cancer Biology and Genetics Center for Cancer Research National Cancer Institute NIH DHHS Bethesda MD 20892 USA 8Bioinformatics Division Department of Preventive Medicine University of Southern California Los Angeles CA 90089 USA 9Pathology/Histotechnology Laboratory Laboratory Animal Sciences Program Frederick National Laboratory for Cancer Research Frederick Maryland21702 USA 10Unit of Epidemiology IRCCS Fondazione Ca™ Granda Ospedale Maggiore Policlinico and Department of Clinical Sciences and Community Health University of Milan Milan20122 Italy 11Molecular Genetics Program Center for Health Sciences SRI Menlo Park CA 94025 USA 12Program in Medical and Population Genetics The Broad Institute Cambridge MA 02142 USA 13Department of Medical Oncology The Center for Functional Cancer Epigenetics Dana-Farber Cancer Institute Boston MA 02215 14USC Epigenome Center and USC/Norris Comprehensive Cancer Center Los Angeles CA 90089 USA Correspondence: [email protected] 4 4 2014 27 2 2014 27 8 2014 5 3365 3365 The genetic regulation of the human epigenome is not fully appreciated. Here we describe the effects of genetic variants on the DNA methylome in human lung based on methylation-quantitative trait loci (meQTL) analyses. We report 34304 cis- and 585 trans-meQTLs a genetic-epigenetic interaction of surprising magnitude including a regulatory hotspot. These findings are replicated in both breast and kidney tissues and show distinct patterns: cis-meQTLs mostly localize to CpG sites outside of genes promoters and CpG islands (CGIs) while trans-meQTLs are over-represented in promoter CGIs. meQTL SNPs are enriched in CTCF binding sites DNaseI hypersensitivity regions and histone marks. Importantly 4 of the 5 established lung cancer risk loci in European ancestry are cis-meQTLs and in aggregate cis-meQTLs are enriched for lung cancer risk in a genome-wide analysis of 11587 subjects. Thus inherited genetic variation may affect lung carcinogenesis by regulating the human methylome. Introduction DNA methylation plays a central role in epigenetic regulation. Twin studies have suggested that DNA methylation at specific CpG sites can be heritable12; however the genetic effects on DNA methylation have been investigated only in brain tissues34 adipose tissues56 and lymphoblastoid cell lines (LCL)7. Most studies were based on the Illumina HumanMethylation27 array which has a low density and mainly focuses on CpG-sites mapping to gene promoter regions. While the functional role of DNA methylation in non-promoter or non-CpG Island (CGI) regions remains largely unknown evidence shows roles in regulating gene splicing8 and alternative promoters9 silencing of intragenic repetitive DNA sequences10 and predisposing to germline and somatic mutations that could contribute to cancer development1112. Notably a recent study13 suggests that most DNA methylation alterations in colon cancer occur outside of promoters or CGIs in so called CpG island shores and shelves and the Cancer Genome Project has reported high mutation rates in CpG regions outside CGI in multiple cancers14. Although expression QTLs (eQTLs) have been extensively studied in different cell lines and tissues15 the minimal overlap observed between cis-acting meQTLs and eQTLs (?5“10%)347 emphasizes the necessity of mapping meQTLs that may function independently of nearby gene expression. This might reveal novel mechanisms for genetic effects on cancer risk particularly since many of the established cancer susceptibility SNPs map to non-genic regions. Lung diseases constitute a significant public health burden. About 10 million Americans had chronic obstructive pulmonary disease in 201216 and lung cancer continues to be the leading cancer-related cause of mortality worldwide17. To provide functional annotation of SNPs particularly those relevant to lung diseases and traits we systematically mapped meQTLs in 210 histologically normal human lung tissues using Illumina Infinium HumanMethylation450 BeadChip arrays which provide a comprehensive platform to interrogate the DNA methylation status of 485512 cytosine targets with excellent coverage in both promoter and non-promoter regions (Fig. 1a) CGI and non-CGI regions (Fig. 1b) and gene and non-gene regions. Thus our study enables the characterization of genetic effects across the methylome in unprecedented detail. Moreover since DNA methylation exhibits tissue specific features18 we investigated whether similar meQTLs could be identified in other tissues. Results Identification of cis-acting meQTLs We profiled DNA methylation for 244 fresh-frozen histologically normal lung samples from non-small cell lung cancer (NSCLC) patients from the Environment and Genetics in Lung cancer Etiology (EAGLE) study19. A subset of 210 tissue samples that passed quality control and had germline genotype data from blood samples20 was used for meQTL analysis. The analysis was restricted to 338456 autosomal CpG probes after excluding those annotated in repetitive genomic regions or that harbored genetic variants. The distribution of methylation levels differed strongly across distinct types of genomic regions (Supplementary Fig. 1ab). Consistent with previous studies21 CpG sites in promoter or CGI regions were largely unmethylated while those in other regions were largely methylated (Supplementary Fig. 1ab). We performed cis-meQTL analysis for each methylation trait by searching for SNPs within 500kb of the target CpG-site in each direction (1Mb overall). The genetic association was tested under an additive model between each SNP and each normalized methylation probe adjusting for sex age plate population stratification and methylation-based principal component analysis (PCA) scores. Controlling FDR at 5% (P=4.0×10?5) we detected cis-meQTLs for 34304 (10.1% of 338456) CpG probes (Supplementary ) mapping to 9330 genes. A more stringent threshold (P=6.0×10?6) at FDR=1% detected cis-meQTLs for 27043 CpG probes mapping to 8479 genes. Moreover with a 200kb window (100kb from both sides) instead than 1Mb we detected 40650 cis-meQTLs (P=2.0×10?4) controlling for FDR=5%. The methylation distribution in CpG sites detected with meQTLs differed substantially from those without meQTLs (Supplementary Fig. 1ab). The peak SNPs were equally distributed on either side of the target CpG-sites with a median distance (?) of 11.8 kb. The proportion of explained phenotypic variance (h2) ranged from 7.7% to 79.8% (Supplementary Fig. 1c) "
Lung_Cancer
"Therefore the development of novel approaches for the treatment of NSCLC including targeted gene treatment as a radiosensitizer to treat this lethal disease is urgently needed to enhance the survival rate in patients. microRNAs (miRNAs) [11] are a class of short noncoding RNAs that function as a regulation for gene expression via targeting mRNA for degradation or inhibition of translation [12]. miRNAs are new factors implicated in regulating the expression of genes involved in tumorigenic processes such as inflammation cell cycle regulation stress response differentiation apoptosis and invasion and over the past decade they have been found to have key roles in cancers [13“15] including lung cancer [16]. Moreover recent studies have suggested a link between expression of some miRNAs and radiotherapy particularly in lung cancer [17“19]. microRNA-21 (miR-21) is a miRNA which has been reported to be overexpressed in many human malignancies including NSCLC [20“22]. Interestingly miR-21 was found to be upregulated in radiotherapy resistant NSCLC cells relative to radiosensitive counterparts [18]. In addition Wang et al. also reported that comparing with radiotherapy resistant NSCLC patients miR-21 was greatly downregulated in radiotherapy sensitive group [23]. Considering miR-21 as a putative regulator of NSCLC radiotherapy resistance we explore the role of miR-21 in radiotherapy resistance of NSCLC A549 cells and the potential molecular mechanism in the present study. 2. Materials and Methods 2.1. Cell Culture The NSCLC cell line A549 was cultured in Dulbecco's modified Eagle's medium (Invitrogen Carlsbad CA) supplemented with 10% fetal bovine serum 100?U/mL penicillin and 100??g/mL streptomycin. Cell cultures were incubated in a humidified atmosphere of 5% CO2 at 37°C. 2.2. Transfection Anti-miR-21 (5?-UCAACAUCA-GUCUGAUAAGCUA-3?) and the negative control oligonucleotides (NC 5?-CAGUACUUUUG-UGUAGUACAA-3?) were obtained from Ambion Inc. (Austin TX USA). The transfection was performed using LipofectamineTM 2000 (Invitrogen USA) according to the instructions provided by the manufacturer. The transfected cells were resuspended and cultured in regular culture medium for 48?h before analysis. 2.3. Detection of miR-21 by TaqMan Real-Time PCR PCR-based detection of miR-21 was performed by the TaqMan miRNA assays (ABI Forest City CA) as described previously [24 25]. The real-time PCR results recorded as threshold cycle numbers (Ct) were normalized against an internal control (U6 RNA) and then expressed as fold changes [25]. 2.4. Ionizing Radiation 48?h after anti-miR-21 or anti-miR-NC transfection subconfluent cell monolayers were treated with ?-ray ionizing radiation (IR) from a 60Co source (PLA General Hospital Beijing China) at a rate of 2.4?Gy/min. 2.5. Clonogenic Survival Analysis After exposure to various doses of IR cells were trypsinized washed and replated at 200 cells per 10-cm dishes. Cells were grown for 14 days fixed with ethanol and stained with Giemsa to detect colonies. The number of colonies containing at least 50 cells was determined and surviving fractions were calculated. 2.6. MTT Assay Twenty-four hours before IR 200??L cells were seeded to 96-well microtiter plate at 5 — 104 cells/mL. Three days after IR 10??L MTT reagent was added to each well followed by incubation for 4?h at 37°C. The supernatants were aspirated and the reaction was terminated by adding 100??L DMSO. The contents of the plates were mixed for 10?min and the absorbance was read at 490?nm. All experiments were performed three times and the average results were calculated. 2.7. Flow Cytometry Attached cells were harvested at 48?h after IR for apoptosis detection using the annexin V-FITC apoptosis detection kit (Sigma Louis MO). Briefly the cells were washed twice with DPBS and then were resuspended in 1— binding buffer at a concentration of 1 — 106 cells/mL. 5??L of annexin V-FITC conjugate and 10??L of propidium iodide solution were added to 500??L of each cell suspension in a plastic 12?mm — 75?mm test tube followed by incubation at room temperature for 15?min and protection from light. The fluorescence of the cells was determined immediately with a flow cytometer. 10?ng/mL of PI3K activator IGF-1 (Prospec-Tany Rehovot Israel) was used in the apoptosis assay. 2.8. Western Blot Analysis Cells were lysed in lysis buffer (20?mM Tris-HCl pH 7.4 150?mM?NaCl 1% Triton X-100 0.1?mM?EDTA 1?mM?EGTA 2?mM sodium orthovanadate 2?mM?NaF and Complete TM Protease Inhibitor Mix [Roche Applied Science Mannheim Germany]) for 20?min on ice and cleared by centrifugation at 12000?rpm and 4°C. Proteins were resolved on a 10% SDS PAGE gel transferred onto nitrocellulose membranes and blocked with 5% nonfat dry milk in TBST (10?mM Tris-HCl pH 7.5 100?mM?NaCl and 0.05% Tween 20) followed by incubation with a primary antibody [total and anti-phosphorylated-Akt (Ser473) antibody (Cell Signaling Biotechnology Beverly MA USA)]. Blots were washed and incubated with horseradish peroxidase-conjugated secondary antibody. Antibody complexes were visualized using an enhanced chemiluminescence-Western blotting detection system (Thermo Fisher Scientific Inc. Rockford IL USA). 2.9. Statistical Analysis Statistical analysis was performed using SPSS 13.0. The results from three independent experiments were presented as the means ± standard deviation. Statistical analyses were done by Student's t-test. P value < 0.05 was considered statistically significant. 3. Results 3.1. miR-21 Expression Was Knocked down in A549 Cells by Anti-miR-21 Transfection To confirm knockdown efficiency of anti-miR-21 transfection the relative of miR-21 expression level was detected by real-time quantitative RT-PCR. Compared with anti-miR-NC-transfected A549 cells the level of miR-21 expression in anti-miR-21-transfected cells was significantly decreased by about 64% (). 3.2. Downregulation of miR-21 Inhibited Survival Capacity of A549 Cells after IR To assess whether miR-21 downregulation could sensitize NSCLC A549 cells to IR the A549 cells transfected with either anti-miR-NC or anti-miR-21 were irradiated and their response was analysed. In clonogenic survival analysis we observed the expected decreased survival capacity of A549 cells transfected with anti-miR-21 14 days after IR (). Forty-eight hours after transfection A549 cells were treated with various doses of IR (0246 or 8?Gy) and the survival fractions upon IR were detected. As shown in after IR at 46 or 8?Gy the survival fraction of A549 cells in anti-miR-21-transfected group (0.61 ± 0.06 0.43 ± 0.08 and 0.27 ± 0.07 resp.) was significantly lower than that in anti-miR-NC-transfected group (0.83 ± 0.08 0.76 ± 0.11 and 0.65 ± 0.10 resp.) indicating that downregulation of miR-21 could significantly enhance the sensitivity of A549 cells to IR. 3.3. Downregulation of miR-21 Suppressed Proliferation of A549 Cells after IR To confirm the increased IR sensitivity of A549 cells the effect of miR-21 on cell proliferation was further analysed at 72?h after IR (). Downregulation of miR-21 expression was found to reduce cell proliferation as demonstrated by the decreased proliferation index of cells transfected with anti-miR-21 compared with anti-miR-NC (75.6 ± 18.96% versus 100% P < 0.05). Importantly a more pronounced growth inhibition of A549 cells was found when miR-21 was knocked down in combination with IR. This inhibition of cell growth in the combined treatment (anti-miR-21 + IR) was found to be significantly higher compared with that in the sole IR treatment group (proliferation index: 36.1 ± 8.48% versus 73.2 ± 21.37% P < 0.05 ). This indicates that knockdown of miR-21 sensitizes radioresistant NSCLC A549 cells to radiation. 3.4. Downregulation of miR-21 Enhanced Apoptosis of A549 Cells Induced by IR We next explored the role of miR-21 in the apoptosis of NSCLC A549 cells induced by IR. Anti-miR-21 or anti-miR-NC was transfected into A549 cells and was exposed (or sham exposed) to 8?Gy of IR. As shown in the percentage of apoptosis cells in miR-21 knockdown group (anti-miR-21) was significantly higher than that of negative control group (anti-miRNA-NC) at the dose 8?Gy (61.5 ± 15.62 versus 21.2 ± 5.35 P < 0.05) indicating that miR-21 knockdown may enhance radiosensitivity of A549 cells by promoting apoptosis and thus confirm a role for miR-21 in the regulation of radiotherapy response of NSCLC. 3.5. Downregulation of miR-21 Inactivated PI3K/Akt Signaling Pathway Induced by IR Because the PI3K/Akt signaling pathway is associated with apoptosis we subsequently examined the potential effects of miR-21 on the activation of PI3K/Akt pathways by IR to explore the potential molecular mechanisms. The activation of PI3K/Akt signaling pathways was measured by Akt phosphorylation on Ser473. By Western blot we found that the endogenous level of phospho-Akt expression (Ser473) in anti-miR-21-transfected A549 cells was downregulated compared to that in anti-miR-NC-transfected A549 cells after IR (Figure 5). Interestingly phospho-Akt (Ser473) expression was significantly increased in the case of being treated with IGF-1 a PI3K activator in anti-miR-NC-transfected A549 cells and even in anti-miR-21-transfected A549 cells after IR (Figure 5). This suggested that activation of PI3K/Akt signaling pathway by IR in A549 cells was suppressed by knockdown of miR-21 and the suppression was reversed by PI3K activator IGF-1. 3.6. miR-21 Knockdown Caused Promotion on Apoptosis Induced by IR Was Mediated by PI3K/Akt Signaling Pathway To further confirm the molecular mechanisms of radiosensitization by miR-21 knockdown in NSCLC A549 cells we next treated the cells with or without PI3K activator IGF-1 and then examined the effects of miR-21 downregulation on cell apoptosis induced by IR. As shown in Figure 6 without IGF-1 treatment the cell apoptosis induced by IR was significantly increased in anti-miR-21-transfected A549 cells (61.5 ± 15.62%) compared with that in anti-miR-NC-transfected A549 cells (21.2 ± 5.35% P < 0.05). However after activation of PI3K/Akt signaling pathway the cell apoptosis induced by IR was inhibited in either anti-miR-21-transfected or anti-miR-NC-transfected A549 cells. The percentage of cell apoptosis was not significantly different between these two groups (18.1 ± 5.55% versus 18.3 ± 5.15% P > 0.05). These data showed that in the condition of PI3K/Akt activation knockdown of miR-21 did not promote the apoptosis of A549 cells induced by IR suggesting that PI3K/Akt signaling pathway was the downstream target of miR-21 and the promotive effects of miR-21 knockdown on apoptosis induced by IR were mediated by PI3K/Akt signaling pathway. 4. Discussion It is well known that the acquisition of resistance to radiotherapy which greatly increases patient morbidity and mortality is a significant problem in the treatment of NSCLC. Effective treatment which can sensitize the radioresistant NSCLC to radiotherapy is always being sought. Recently some miRNAs were found to be related to radioresistance. Among them miR-21 is reported to play a role in radioresistance of cancer including glioblastoma [26 27] breast cancer [28] and rectal cancer [29]. But up to now few researches have studied the correlations between miR-21 expression and radiotherapy sensitivity of NSCLC. Liu et al. reported that miR-21 expression promotes radioresistance in NSCLC but the related molecular mechanisms were not revealed [30]. The roles of miR-21 in the radiotherapy response of NSCLC are not fully understood and remain to be elucidated. Thus in the current study we investigated whether miR-21 could affect the radiosensitivity of NSCLC A549 cells and found that downregulation of miR-21 significantly enhanced the sensitivity of A549 cells to radiotherapy through inhibition of PI3K/Akt signaling pathway. Our data showed that following the transfection of anti-miR-21 into A549 cells the inhibition of survival fraction caused by various doses of IR was enhanced compared with radiotherapy alone. This result suggests that miR-21 is closely associated with the therapeutic efficiency of IR on radioresistant A549 cells and downregulation of miR-21 may sensitize A549 cells to IR. It is reported that miR-21 could stimulate growth in NSCLC [30 31]. Accordingly we also found that the proliferation of A549 cells was inhibited after miR-21 knockdown. Moreover the inhibition of cell proliferation induced by combination of miR-21 knockdown and IR was more pronounced compared with either miR-21 knockdown or IR treatment indicating that miR-21 knockdown plays a crucial role in the combined inhibition of cell proliferation and silencing miR-21 may increase the sensitivity of A549 cells to IR. Cell apoptosis induced by IR is one of the most important effects of tumor radiotherapy. Furthermore miR-21 is reported to be an antiapoptotic factor in lung cancer [32 33]. So we hypothesized that it is possible that miR-21 could affect the apoptosis of NSCLC induced by IR. Our current results demonstrated that miR-21 knockdown promoted apoptosis of A549 cells induced by IR indicating that the expression of miR-21 could affect radiosensitivity of NSCLC cells which might be associated with inhibition of apoptosis. This is also in agreement with the previous report [30]. To explore the potential molecular mechanisms of radiosensitization by miR-21 knockdown in NSCLC A549 cells we focused on analysis of PI3K/Akt signaling pathway because the influence of PI3K/Akt signaling pathway on IR-induced apoptotic propensity is well documented [34 35]. We examined whether downregulation of miR-21 could affect Akt phosphorylation at Ser473 and/or its total expression and found that miR-21 knockdown suppressed the activation of PI3K/Akt signaling pathway by IR in A549 cells. In addition the apoptosis induced by IR was enhanced in A549 cells after miR-21 knockdown. This data indicates that the stimulative effects of miR-21 knockdown on A549 cell apoptosis induced by IR are related to the inactivation of PI3K/Akt signaling pathway. Furthermore with the treatment of PI3K activator IGF-1 we found that the apoptosis of A549 cells induced by IR was not promoted even if miR-21 was downregulated. Our results suggest that the promotive effects of miR-21 knockdown on A549 cell apoptosis induced by IR depend on the inactivation of PI3K/Akt signaling pathway. In the current study how miR-21 interplays with PI3K/Akt signaling pathway under our experimental conditions is not clear. However it is reported that molecules such as PTEN have been proposed to be involved in NSCLC cells' radioresistance [36 37] and miR-21 is related to PTEN with high possibility [30 38]. In addition since PTEN PI3K and Akt are closely related it is one of the possible mechanisms that PTEN may play a role in PI3K/Akt signaling pathway mediated radiosensitization of A549 cells by miR-21 knockdown but this still needs further comfirmation in future studies. In summary the present study found that downregulation of miRNA-21 sensitized radioresistant NSCLC A549 cells to IR by inhibiting cell proliferation and enhancing apoptosis through inhibition of PI3K/Akt signaling pathway. This information may be useful to develop new treatments for the clinical therapy of NSCLC patients. Further analysis on targets of miR-21 is still of considerable interest as they may reveal novel radiotherapy sensitization strategies for radioresistant NSCLC. Conflict of Interests The authors declare that there is no conflict of interests regarding the publication of this paper. Authors' Contribution Yongfu Ma and Hui Xia contributed equally to this work. 1 Jemal A Siegel R Ward E Cancer statistics 2008 CA: Cancer Journal for Clinicians 2008 58 2 71 96 2-s2.0-41349099104 2 Siegel R Naishadham D Jemal A Cancer statistics 2012 CA: Cancer Journal for Clinicians 2012 62 1 10 29 2-s2.0-84855792427 3 Fidias P Novello S Strategies for prolonged therapy in patients with advanced non-small-cell lung cancer Journal of Clinical Oncology 2010 28 34 5116 5123 2-s2.0-78650491373 21041704 4 Fuld AD Dragnev KH Rigas JR Pemetrexed in advanced non-small-cell lung cancer Expert Opinion on Pharmacotherapy 2010 11 8 1387 1402 2-s2.0-77952119805 20446853 5 Whitehurst AW Bodemann BO Cardenas J Synthetic lethal screen identification of chemosensitizer loci in cancer cells Nature 2007 446 7137 815 819 2-s2.0-34147198467 17429401 6 le P©choux C Role of postoperative radiotherapy in resected non-small cell lung cancer: a reassessment based on new data Oncologist 2011 16 5 672 681 2-s2.0-79956276306 21378080 7 Danesi R Pasqualetti G Giovannetti E Pharmacogenomics in non-small-cell lung cancer chemotherapy Advanced Drug Delivery Reviews 2009 61 5 408 417 2-s2.0-67349279836 19292993 8 R¶del F Hoffmann J Distel L Survivin as a radioresistance factor and prognostic and therapeutic target for radiotherapy in rectal cancer Cancer Research 2005 65 11 4881 4887 2-s2.0-19644370614 15930309 9 Lee S Lim MJ Kim MH An effective strategy for increasing the radiosensitivity of Human lung Cancer cells by blocking Nrf2-dependent antioxidant responses Free Radical Biology & Medicine 2012 53 807 816 22684019 10 Provencio M S¡nchez A Garrido P Valc¡rce F New molecular targeted therapies integrated with radiation therapy in lung cancer Clinical Lung Cancer 2010 11 2 91 97 2-s2.0-77952511165 20199974 11 Lee RC Feinbaum RL Ambros V The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14 Cell 1993 75 5 843 854 2-s2.0-0027751663 8252621 12 Iorio MV Croce CM MicroRNAs in cancer: small molecules with a huge impact Journal of Clinical Oncology 2009 27 34 5848 5856 2-s2.0-73349125465 19884536 13 White NMA Fatoohi E Metias M Jung K Stephan C Yousef GM Metastamirs: a stepping stone towards improved cancer management Nature Reviews Clinical Oncology 2011 8 2 75 84 2-s2.0-79551602747 14 Farazi TA Spitzer JI Morozov P Tuschl T MiRNAs in human cancer Journal of Pathology 2011 223 2 102 115 2-s2.0-78650034475 21125669 15 Croce CM Causes and consequences of microRNA dysregulation in cancer Nature Reviews Genetics 2009 10 10 704 714 2-s2.0-70349320158 16 Ortholan C Puissegur M-P Ilie M Barbry P Mari B Hofman P MicroRNAs and lung cancer: new oncogenes and tumor suppressors new prognostic factors and potential therapeutic targets Current Medicinal Chemistry 2009 16 9 1047 1061 2-s2.0-65649152994 19275611 17 Oh J-S Kim J-J Byun J-Y Kim I-A Lin28-let7 modulates radiosensitivity of human cancer cells with activation of K-ras International Journal of Radiation Oncology Biology Physics 2010 76 1 5 8 2-s2.0-72049101611 18 Salim H Akbar NS Zong D miRNA-214 modulates radiotherapy response of non-small cell lung cancer cells through regulation of p38MAPK apoptosis and senescence British Journal of Cancer 2012 107 1361 1373 22929890 19 Yan D Ng WL Zhang X Targeting DNA-PKcs and ATM with miR-101 sensitizes tumors to radiation PLoS ONE 2010 5 7 article e11397 2-s2.0-77958133262 20 Markou A Sourvinou I Vorkas PA Yousef GM Lianidou E Clinical evaluation of microRNA expression profiling in non small cell lung cancer Lung Cancer 2013 81 388 396 23756108 21 Li S Liang Z Xu L Zou F MicroRNA-21: a ubiquitously expressed pro-survival factor in cancer and other diseases Molecular and Cellular Biochemistry 2012 360 1-2 147 158 2-s2.0-83555164788 21909994 22 Yang M Shen H Qiu C High expression of miR-21 and miR-155 predicts recurrence and unfavourable survival in non-small cell lung cancer European Journal of Cancer 2013 49 604 615 23099007 23 Wang X-C Du L-Q Tian L-L Expression and function of miRNA in postoperative radiotherapy sensitive and resistant patients of non-small cell lung cancer Lung Cancer 2011 72 1 92 99 2-s2.0-79952195451 20728239 24 Lao K Xu NL Yeung V Chen C Livak KJ Straus NA Multiplexing RT-PCR for the detection of multiple miRNA species in small samples Biochemical and Biophysical Research Communications 2006 343 1 85 89 2-s2.0-33645106895 16529715 25 Chen C Ridzon DA Broomer AJ Real-time quantification of microRNAs by stem-loop RT-PCR Nucleic Acids Research 2005 33 20 article e179 2-s2.0-29144470346 26 Griveau A Bejaud J Anthiya S Avril S Autret D Garcion E Silencing of miR-21 by locked nucleic acid-lipid nanocapsule complexes sensitize human glioblastoma cells to radiation-induced cell death International Journal of Pharmaceutics 2013 454 765 774 23732394 27 Li Y Zhao S Zhen Y A miR-21 inhibitor enhances apoptosis and reduces G2-M accumulation induced by ionizing radiation in human glioblastoma U251 cells Brain Tumor Pathology 2011 28 3 209 214 2-s2.0-80955180085 21618027 28 Anastasov N Hofig I Vasconcellos IG Radiation resistance due to high expression of miR-21 and G2/M checkpoint arrest in breast cancer cells Radiation Oncology 2012 7 article 206 29 Drebber U Lay M Wedemeyer I Altered levels of the onco-microRNA 21 and the tumor-supressor microRNAs 143 and 145 in advanced rectal cancer indicate successful neoadjuvant chemoradiotherapy International Journal of Oncology 2011 39 2 409 415 2-s2.0-79959960546 21567082 30 Liu ZL Wang H Liu J Wang ZX MicroRNA-21 (miR-21) expression promotes growth metastasis and chemo- or radioresistance in non-small cell lung cancer cells by targeting PTEN Molecular and Cellular Biochemistry 2013 372 35 45 22956424 31 Zhang J-G Wang J-J Zhao F Liu Q Jiang K Yang G-H MicroRNA-21 (miR-21) represses tumor suppressor PTEN and promotes growth and invasion in non-small cell lung cancer (NSCLC) Clinica Chimica Acta 2010 411 11-12 846 852 2-s2.0-77956061393 32 Hatley ME Patrick DM Garcia MR Modulation of K-Ras-dependent lung tumorigenesis by MicroRNA-21 Cancer Cell 2010 18 3 282 293 2-s2.0-77956501846 20832755 33 Seike M Goto A Okano T MiR-21 is an EGFR-regulated anti-apoptotic factor in lung cancer in never-smokers Proceedings of the National Academy of Sciences of the United States of America 2009 106 29 12085 12090 2-s2.0-67749110399 19597153 34 Qiu W Leibowitz B Zhang L Yu J Growth factors protect intestinal stem cells from radiation-induced apoptosis by suppressing PUMA through the PI3K/AKT/p53 axis Oncogene 2010 29 11 1622 1632 2-s2.0-77949655884 19966853 35 Lei Y Li HX Jin WS The radiosensitizing effect of Paeonol on lung adenocarcinoma by augmentation of radiation-induced apoptosis and inhibition of the PI3K/Akt pathway International Journal of Radiation Biology 2013 89 12 1079 1086 23875954 36 Kim EJ Jeong JH Bae S Kang S Kim CH Lim YB mTOR inhibitors radiosensitize PTEN-deficient non-small-cell lung cancer cells harboring an EGFR activating mutation by inducing autophagy Journal of Cellular Biochemistry 2013 114 1248 1256 23592446 37 Jung IL Kang HJ Kim KC Kim IG PTEN/pAkt/p53 signaling pathway correlates with the radioresponse of non-small cell lung cancer International Journal of Molecular Medicine 2010 25 4 517 523 2-s2.0-77749289244 20198299 38 Roy S Yu Y Padhye SB Sarkar FH Majumdar AP Difluorinated-curcumin (CDF) restores PTEN expression in colon cancer cells by down-regulating miR-21 PLoS One 2013 8 article e68543 miR-21 expression was knocked down by transfecting NSCLC A549 cells with anti-miR-21. miR-21 expression in A549 cells at 48?h after transfection with anti-miR-NC or anti-miR-21 was detected by TaqMan real-time quantitative RT-PCR. The mean and standard deviation of expression levels relative to U6 expression levels are shown and are normalized to the expression in A549 cells transfected with anti-miR-NC. All experiments were performed at least in triplicate. *P < 0.05 versus cells transfected with anti-miR-NC. Clonogenic survival of NSCLC A549 cells after varying doses of ionizing radiation. A549 cells were transfected with either anti-miR-21 or anti-miR-NC and 48?h later were irradiated followed by a further incubation for 24?h at 37°C before trypsinization and plating for clonogenic survival. After 14-day incubation colonies were stained and the surviving fractions were determined. *P < 0.05 versus cells transfected with anti-miR-NC. Each value represents the means ± SD for three independent experiments. Proliferation of NSCLC A549 cells after ionizing radiation (IR). A549 cells were transfected with either anti-miR-21 or anti-miR-NC and 48?h later were exposed to 8?Gy of IR and the growth characteristics of A549 cells were determined by MTT assay 72 hours after IR. The anti-miR-NC-transfected sample was normalized to 100% cell viability. The data represent the means ± SD of three separate experiments. Student's t-test was used to analyze the statistics (*P < 0.05)."
Lung_Cancer
"Adenocarcinoma including cases with bronchioloalveolar carcinoma. Expression of miR-182 and correlations miR-182 was homogenously expressed mainly in the cytoplasm of tumor cells. There was also some unspecific nuclear staining (). The scoring was based on cytoplasmic staining. There was no staining of stromal cells except for weak nuclear staining of some fibroblasts. We tested correlations between miR-182 and angiogenic and hypoxia molecular markers. We found significant correlations between miR-182 and FGF2 (r?=??0.147; P?=?0.010) HIF2? (r?=?0.115; P?=?0.047) and MMP-7 (r?=?0.172; P?=?0.003). Univariate analysis As shown in the clinicopathological variables performance status (P?=?0.016) histology (P?=?0.028) tumor differentiation (P?<?0.001) surgical procedure (P?=?0.007) pathological stage (P?<?0.001) tumor status (P?<?0.001) nodal status (P?<?0.001) and vascular infiltration (P?=?0.001) were significant prognostic indicators for DSS. The results from the univariate analyses on miR-182 are presented in and Figures 2 and 3. In the whole cohort there was a tendency towards a better prognosis for those with tumors overexpressing miR-182 (P?=?0.062 ). In subgroup analyses patients with stage II disease had a significantly improved prognosis if they overexpressed miR-182 (P?=?0.003 E). In the histological subgroup SCC high tumor cell miR-182 expression was associated with superior prognosis when compared to low expression (P?=?0.042 A) while for large cell carcinomas the trend was opposite (C). miR-182 in tumor cells and stroma as predictors for disease-specific survival in NSCLC patients (univariate analysis; log-rank test) and results of Cox regression analysis summarizing significant independent prognostic factors Characteristics Pts (n) Pts (%) Median survival (months) 5-year survival (%) Univariate (P) Multi-variate (P) HR (95% CI) Total (n?=?335) 0.062 0.098 0.73 ??Low 190 57 98 55 (0.50-1.06) ??High 115 34 NR 62 ??Missing 30 9 Pathological stage Stage I (n?=?143) 0.97 NE NE ??Low 87 61 190 73 ??High 56 39 NR 73 Stage II (n?=?127) 0.003 0.020 0.50 ??Low 80 63 33 39 0.28-0.90 ??High 47 37 NR 63 Stage III (n?=?35) 0.69 NE NE ??Low 23 66 23 39 ??High 12 34 15 17 Histology ??SCC (n?=?172) 0.042 0.048 0.57 ??Low 104 60 NR 58 0.33-0.99 ??High 68 40 NR 74 AC (n?=?106) 0.316 NE NE ??Low 69 65 47 45 ??High 37 35 57 50 LCC (n?=?27) 0.285 NE NE ??Low 17 63 NR 80 ??High 10 37 58 39 Statistically significant results in bold font. Abbreviations:NR not reached PS performance status SCC squamous cell carcinoma AC adenocarcinoma LCC large-cell carcinoma NE not entered due to insignificance. Adenocarcinoma including cases with bronchioloalveolar carcinoma. Disease-specific survival curves according to tumor cell expression of miR-182 in the whole cohort of patients. Disease-specific survival curves according to tumor cell expression of A) miR-182 in SCC B) miR-182 in AC C) miR-182 in LCC D) miR-182 in stage I patients E) miR-182 in stage II patients F) miR-182 in stage III patients. Multivariate analysis In the total cohort performance status (P?=?0.008) histology (P?=?0.001) tumor differentiation (P?=?0.007) tumor status (P?=?0.007) nodal status (P?=?0.022) and vascular infiltration (P?=?0.004) all were independent prognostic factors. Results of the multivariate analysis for miR-182 expression are presented in . Examining the total material high miR-182 expression tended towards an independent association with a better prognosis (HR 0.73 CI 95% 0.50-1.06 P?=?0.098). Among stage II patients however high tumor cell expression of miR-182 was an independent positive prognostic factor (HR 0.50 CI 95% 0.28-0.90 P?=?0.020). Also in SCC patients with a high miR-182 expression had an independent favorable outcome (HR 0.57 CI 95% 0.33-0.99 P?=?0.048). Co-expression of miR-182 with FGF2 and MMP-7 Among markers examined for correlations with miR-182 FGF2 and MMP-7 showed the strongest correlations. We assessed the co-expression combinations between miR-182 and FGF2 and MMP-7 respectively. The co-expression of low miR-182/high FGF2 was associated with poor survival (P?=?0.017) as shown in A. The combination showed an independently significant adverse prognosis compared to high miR-182/low FGF2 (HR 1.92 P?=?0.015 ). Patients expressing high miR-182/high MMP-7 had a better survival than other combinations (P?=?0.036 B). In the multivariate analyses high miR-182/high MMP-7 showed an independently better prognosis than low miR-182/low MMP-7 (HR 0.49 P?=?0.015 ). In the SCC subgroup we found an even bigger difference between these groups both in univariate and multivariate analyses (C ). Disease-specific survival curves according to tumor cell co-expression of miR-182 and A) FGF2 in the whole cohort of patients B) MMP-7 in the whole cohort of patients C) MMP-7 in SCC and D) MMP-7 in AC. Results of Cox regression analysis summarizing co-expressions of miR-182 with FGF2 and MMP-7 respectively Hazard ratio 95% CI P Co-expression of miR-182/FGF2 0.021 ??High miR-182/low FGF2 1.00 ??High miR-182/high FGF2 and low miR-182/low FGF2 1.26 0.74-2.13 0.39 ??Low miR-182/high FGF2 1.92 1.14-3.24 0.015 Co-expression of miR-182/MMP-7 0.032 ??Low miR-182/low MMP-7 1.00 ??Low miR-182/high MMP-7 and high miR-182/low MMP-7 0.71 0.48-1.05 0.086 ??High miR-182/high MMP-7 0.49 0.27-0.87 0.015 Co-expression of miR-182/MMP-7 squamous cell carcinoma 0.040 ??Low miR-182/low MMP-7 1.00"
Lung_Cancer
"Testing bal. acc. (%) P value Cross-validation consistency rs7525160 54.03 50.53 0.828 7/10 rs4844600 rs10494885 55.45 49.32 0.989 3/10 rs4844600 rs10494885 rs7525160 57.60 48.48 0.623 6/10 Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene interaction models is listed in . The SNP rs7525160 in CR1 had the highest testing balanced accuracy among 12 SNPs. The three-way interaction model among rs4844600 rs10494885 and rs7525160 showed high testing balance accuracy and cross validation consistency but the testing balanced accuracy was lower than the two-way gene-gene interaction in NSCLC. For each model the interaction was not significant (P?>?0.05). Risk of CR1 genotypes with NSCLC by smoking status Smoking status CR1 genotype GG * OR (95% CI) § P value CG?+?CC * OR (95% CI) § P value Non-smoker 84/99 1.00 (reference) 181/182 1.15 (0.81-1.65) 0.440 Smoker 55/77 0.86 (0.54-1.38) 0.528 150/112 1.72 (1.15-2.59) 0.009 <25 pack-years 19/41 0.59 (0.31-1.10) 0.099 56/55 1.32 (0.81-2.61) 0.266 ?25 pack-years 36/36 1.18 (0.67-2.08) 0.562 94/57 2.01 (1.26-3.20) 0.003 *Number of cases/number of controls. §Data were calculated by logistic regression and adjusted for age and gender. Interaction of CR1 SNP with smoking Cigarette smoking is a well-known risk for lung cancer so stratification by smoking status was performed to investigate the association of rs7525160 G?>?C variant with the risk of NSCLC. As shown in the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) suggesting that the CR1 rs7525160 G?>?C polymorphism is a smoking-modifying risk factor for susceptibility to NSCLC. When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year) consistently GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). The P value for heterogeneity of the stratification analysis by smoking status is 0.015. However the P value for interaction between rs7525160 polymorphism and smoking is 0.172 and the power for the interaction is 0.49. Discussion The chronic airway inflammation and dysfunctional immune system might promote pulmonary carcinogenesis. Implicated in the immune and inflammatory responses the complement cascade plays a pivotal role in the development of cancer. Thus it is likely that the genetic variants of CR1 in the complement system confer the susceptibility to lung cancer. In this study we have for the first time demonstrated that one intronic SNP (rs7525160 G?>?C) out of 13 tag SNPs of CR1 was associated with the risk of NSCLC in Chinese population. Notably the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. MDR analysis also showed that there was no gene-gene interaction among 12 tag SNPs in CR1 gene. Moreover the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) indicating this SNP is a smoking-modifying risk factor for susceptibility to NSCLC. To the best of our knowledge this study shed new insight into the interplay of genetic variation of CR1 with lung cancer risk. More importantly it highlights the potential gene-environmental interaction influences the susceptibility to lung cancer. The complement system has been proposed to get involved in innate immunity with the ability to œcomplement antibody-mediated elimination of immune complex and foreign pathogens [26]. Upon complement activation the biologically active peptides C5a and C3a elicit a lot of pro-inflammatory effects and could be closely associated with tumorigenesis [27]. Complement proteins play a dual role in the tumor microenvironment. On one hand they exert a defensive effect against tumor through complement or antibody-dependent cytotoxicity [128]. On the other hand they may escape from immunosurveillance and facilitate carcinogenesis [2]. Specifically a number of experimental evidence has suggested an association between complement activation and tumor growth [2930] which provides a strong biologically link between the abnormal expression and activity of complement cascade and carcinogenesis. Till now a few studies have been carried out to demonstrate the association of genetic variants in complement proteins with susceptibility to cancer. A significant association of CR2 SNP (rs3813946) with the development of nasopharyngeal carcinoma was indicated in Cantonese population [31] and the genetic variations of complement system genes C5 and C9 plays a potential role in susceptibility to non-Hodgkin lymphoma (NHL) [32]. Recently it has been shown that complement factor H Y402H polymorphism interact with cigarette smoking to confer the susceptibility to lung cancer [33]. Furthermore it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However whether the genetic variants of CR1 are related to the risk of lung cancer remains unknown. In this case-control study we found an intronic SNP (rs7525160 G?>?C) with CC genotype was significantly associated with an increased risk of NSCLC. Consistently our results were in accordance with the study that genetic polymorphisms in innate immunity genes may play a role in the carcinogenesis of lung cancer [34]. It is likely that some genetic variations in strong link disequilibrium with this intronic SNP (rs7525160 G?>?C) are functional which provides a new insight into the hallmarks in susceptibility to lung cancer and further functional experiments are warranted to address the proposal. Functionally human CR1 exists on the surface of almost all peripheral blood cells and plays a key role in immune complex clearance and complement inhibition at the cell surface by binding to activated products C3b and C4b [435]. CR1 also possesses cofactor activity for the serum protease factor I and is thus involved in the generation of further fragments of C3/4b with the activation of complement cascade and the cellular immune response [4]. In our study the association of CR1 polymorphism with lung cancer is biologically plausible in that the intronic polymorphism could affect the density of CR1 molecules on the cell surface thereby contributing to autoimmune disorders and neoplasm. Tobacco smoking is an established risk factor for susceptibility to lung cancer. However not all people who suffer from lung cancer are smokers. Lung cancer in non-smokers can be induced by second hand smoke air pollutants and diesel exhaust [36-39]. Our present data showed significant difference of pack-year smoked but not smoking status between NSCLC cases and controls which suggested the important role of other environmental factors in the development of NSCLC. Tobacco could induce chronic and sustained inflammation in lung microenvironment contributing to pulmonary carcinogenesis in smokers [40]. Support also comes from the epidemiologic data regarding inflammation and lung cancer [41]. CR1 an important molecule implicated in immunity and inflammation could protect the host from invasion of exogenous chemicals derived from cigarette smoking. Genetic variant of CR1 could alter gene function and result in deregulation of the inflammatory and immune responses thereby modulating the susceptibility to lung cancer. More importantly we observed a potential interaction of this SNP (rs7525160 G?>?C) with smoking status suggesting the gene-environmental interaction plays a prominent role in the susceptibility to lung cancer. Our present study has its limitation. Our patients may not be representative of total NSCLC patients at large because they were recruited from only one hospital. In addition due to the relatively small sample size further case-control studies are still needed to replicate and extend our findings. Conclusion We conducted a case-control study in Chinese subjects and found an intronic SNP (rs7525160 G?>?C) of CR1 was significantly associated with lung cancer risk. To the best of our knowledge this study provides the first evidence that genetic variant of CR1 (rs7525160 G?>?C) was a smoking-modifying contributor to the development of lung cancer. Methods Study subjects This case-control study consisted of 470 patients with histopathologically confirmed NSCLC and 470 cancer-free controls. All subjects were genetic unrelated ethnic Han Chinese. Patients were recruited between January 2008 and December 2012 at Tangshan Gongren Hospital (Tangshan China). There were no age gender or stage restrictions however patients with previous malignancy or metastasized cancer from other organs were excluded. The response rate for patients was 94%. The controls were randomly selected from a pool of a cancer-free population from a nutritional survey conducted in the same region. The selection criteria for control subjects included: i) no individual history of cancer; ii) frequency matched to cases according to gender age (±5 years); iii) the residential region; and iv) the time period for blood sample collection. At recruitment informed consent was obtained from each subject and each participant was then interviewed to collect detailed information on demographic characteristics. This study was approved by the institutional review board of Hebei United University. Tag SNPs selection and genotyping Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs with an r2 threshold of 0.80 and minor allele frequency (MAF) greater than 1%. Furthermore we also added two potential functional polymorphisms rs9429942 and rs6691117 [4243]. Therefore we included 13 SNPs in our study which represents common genetic variants in Chinese population. Genotyping was performed at Bomiao Tech (Beijing China) using iPlex Gold Genotyping Asssy and Sequenom MassArray (Sequenom San Diego CA USA). Sequenom™s MassArray Designer was used to design PCR and extension primers for each SNP. Primer information for selected tag SNPs was listed in Table 5. Table 5 Primers used in this study SNP_ID Alleles 1st-PCR primer sequences 2nd-PCR primer sequences UEP sequences rs7525160 G/C ACGTTGGATGCAAAATCAAGGTTTAAAGTC ACGTTGGATGTTCTGACATGTACTGCCTGC CCCTGTTGCCTGGGTTTTTCT rs3886100 G/A ACGTTGGATGGGCCTCAGATCCTCAAAATC ACGTTGGATGTGAGCTGTTTCAGCCAAGAG GAGCCAAGAGGACACTTAG rs11118167 T/C ACGTTGGATGATGTGTGTAGTCACTTAGCC ACGTTGGATGATAATGGCAGATTTAAGGGC CAATGATAAATGAATACTGTGTTCTATC rs9429782 G/T ACGTTGGATGACACGCGGGATCCATCGGAA ACGTTGGATGAACGAGTTTCGCTGGCAGAG GGTGCAGCAGCAGAG "
Lung_Cancer
"associated with lung cancer with squamous differentiation. J Clin Oncol. 2013;31(10):e161“e16423358982 5. PaoWGirardN New driver mutations in non-small-cell lung cancer. Lancet Oncol. 2011;12(2):175“18021277552 6. ShigematsuHTakahashiTNomuraM Somatic mutations of the HER2 kinase domain in lung adenocarcinomas. Cancer Res. 2005;65(5):1642“164615753357 7. StephensPHunterCBignellG Lung cancer: intragenic ERBB2 kinase mutations in tumours. Nature. 2004;431(7008):525“52615457249 8. BargmannCIHungMCWeinbergRA Multiple independent activations of the neu oncogene by a point mutation altering the transmembrane domain of p185. Cell. 1986;45(5):649“6572871941 9. BocharovEVMineevKSVolynskyPE Spatial structure of the dimeric transmembrane domain of the growth factor receptor ErbB2 presumably corresponding to the receptor active state. J Biol Chem. 2008;283(11):6950“695618178548 10. FleishmanSJSchlessingerJBen-TalN A putative molecular-activation switch in the transmembrane domain of erbB2. Proc Natl Acad Sci U S A. 2002;99(25):15937“1594012461170 11. MineevKSBocharovEVPustovalovaYEBocharovaOVChupinVVArsenievAS Spatial structure of the transmembrane domain heterodimer of ErbB1 and ErbB2 receptor tyrosine kinases. J Mol Biol. 2010;400(2):231“24320471394 12. BaselgaJSwainSM Novel anticancer targets: revisiting ERBB2 and discovering ERBB3. Nat Rev Cancer. 2009;9(7):463“47519536107 13. EngelmanJA Targeting PI3K signalling in cancer: opportunities challenges and limitations. Nat Rev Cancer. 2009;9(8):550“56219629070 14. MountziosGPlanchardDBesseB Mitogen-activated protein kinase activation in lung adenocarcinoma: a comparative study between ever smokers and never smokers. Clin Cancer Res. 2008;14(13):4096“410218593986 15. PlanchardDCamara-ClayetteVDorvaultNSoriaJCFouretP p38 Mitogen-activated protein kinase signaling ERCC1 expression and viability of lung cancer cells from never or light smoker patients. Cancer. 2012;118(20):5015“502522415779 Oncotarget Oncotarget ImpactJ Oncotarget 1949-2553 Impact Journals LLC 24519909 3996653 Research Paper Sp1-mediated microRNA-182 expression regulates lung cancer progression Yang Wen-Bin 1 Chen Ping-Hsin 2 Hsu Tsung-I 3 Fu Tzu-Fun 4 Su Wu-Chou 5 Liaw Hungjiun 6 Chang Wen-Chang 7 Hung Jan-Jong 1 2 3 7 1 Institute of Bioinformatics and Biosignal Transduction College of Bioscience in Biotechnology National Cheng Kung University Tainan 701 Taiwan 2 Department of Pharmacology College of Medicine National Cheng Kung University Tainan 701 Taiwan 3 Center for Infectious Disease and Signal Transduction Research National Cheng Kung University Tainan 701 Taiwan 4 Department of Medical Laboratory Science and Biotechnology College of Medicine National Cheng Kung University Tainan 701 Taiwan 5 Department of Internal Medicine College of Medicine and Hospital National Cheng Kung University Tainan 701 Taiwan 6 Department of Life Sciences College of Bioscience in Biotechnology National Cheng Kung University Tainan 701 Taiwan 7 Graduate Institute of Medical Sciences College of Medicine and Center for Neurotrauma and Neuroregeneration Taipei Medical University Taipei 110 Taiwan Correspondence to:petehung petehungmail.ncku.edu.tw 2 2014 25 1 2014 5 3 740 753 18 11 2013 24 11 2014 Copyright: 2014 Yang et al. 2014 This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Our recent study indicated that overexpression of Sp1 enhances the proliferation of lung cancer cells while represses metastasis. In this study we found that the transcriptional activity of FOXO3 was increased but its protein levels decreased following Sp1 expression. Sp1 increased expression of miR-182 which was then recruited to the 3'-untranslated region of FOXO3 mRNA to silence its translational activity. Knockdown of miR-182 inhibited lung cancer cells growth but enhanced the invasive and migratory abilities of these cells through increased N-cadherin expression. Repression of FOXO3 expression in the miR-182 knockdown cells partially reversed this effect suggesting that miR-182 promotes cancer cell growth and inhibits cancer metastatic activity by regulating the expression of FOXO3. The expression of several cancer metastasis-related genes such as ADAM9 CDH9 and CD44 was increased following miR-182 knockdown. In in the early stages of lung cancer progression Sp1 stimulates miR-182 expression which in turn decreases FOXO3 expression. This stimulates proliferation and tumor growth. In the late stages Sp1 and miR-182 decline thus increasing FOXO3 expression which leads to lung metastasis. Sp1 miR-182 FOXO3 Lung cancer INTRODUCTION Post-transcriptional regulation plays an important role in diverse cellular processes such as development neurogenesis and cancer progression [1-3]. MicroRNAs (miRNAs) have emerged as important post-transcriptional regulators that inhibit mRNA translation or induce mRNA cleavage by base pairing with a seed region in the 3'-untranslated region (3'-UTR) of target genes [4 5]. Recent studies have shown that dysregulation of miRNAs contributes to the initiation progression metastasis and drug resistance of cancer [6 7]. For example miR-200c targets Kras to regulate Kras expression during tumorigenesis [8]. Furthermore several upregulated and downregulated miRNAs have been identified in lung cancer the most frequently diagnosed cancer and the most common cause of cancer-related death worldwide [9-11]. Identification of early-detection biomarkers and precise diagnosis are necessary if lung cancer patients are to receive efficacious therapeutic treatment quickly. Several factors such as USP17 have been identified as potential biomarkers for lung cancer [12 13]. Circulating miRNAs could also serve as useful clinical biomarkers for the screening of high-risk populations and the detection solid tumors in the early stages of cancer progression [14 15]. miRNAs offer new targets for cancer therapy [16 17]. Therefore a detailed understanding of the mechanisms underlying miRNA production and function is important. Identification of miRNA target genes and the use of gene set enrichment analysis have clarified the function role of miRNAs. However the molecular mechanisms that regulate of miRNA biogenesis are still largely unknown. Recent studies have shown that transcription factors (TFs) regulate not only the expression of protein-encoding genes but also miRNA biogenesis through RNA polymerase II-dependent transcription [18]. Several TFs including p53 c-myc and HIF1? that directly recognize miRNA promoters and regulate miRNA transcription have been reported [19-21]. Specificity protein 1 (Sp1) which belongs to the specificity protein/ Kr¼ppel-like family was the first TF identified in mammalian cells. Sp1 contains three Cys2His2-type zinc finger DNA binding motifs that recognize GC-rich promoter sequences [22]. Sp1 regulates thousands of coding genes such as those encoding cyclin A2 p21cip1/waf1 E-cadherin and Sp1 itself. These genes are involved in a variety of physiological processes including cell cycle progression and cell migration [23-26]. Sp1 also regulates the expression of noncoding genes. Sp1 forms a complex with NF-?B to downregulate miR-29b expression through the recruitment of histone deacetylase (HDAC) 1 and HDAC3 in leukemia and thereby contributes to the growth of leukemia cells [27]. Sp1 also forms a complex with HDAC4 to downregulate miR-200a expression in hepatocellular carcinoma and contributes to cell proliferation and migration [28]. In addition Sp1 is an activator of miR-34c miR-132 and miR-365 expression [29-31]. However no studies have assessed whether Sp1 regulates the expression of miRNAs involved in lung tumorigenesis. Because the accumulation of Sp1 is required for lung tumor growth further investigation of Sp1-mediated miRNA regulation is needed. In this study we showed that Sp1 suppressed FOXO3 expression via post-transcriptional regulation. To elucidate whether miRNAs were involved in this process we used a systematic screening approach to identify Sp1-regulated miRNAs. We identified a novel Sp1-regulated miRNA miR-182 in lung cancer cells and demonstrated that Sp1 downregulated FOXO3 expression by upregulating miR-182 expression. Our results show that miR-182 functions as an oncomiR to enhance cancer cell proliferation and acts as a tumor suppressor to inhibit cancer metastasis. RESULTS Sp1 regulates miR-182 expression Our previous studies demonstrated that Sp1 is involved in KrasG12D-induced lung tumorigenesis [23 32]. Using cDNA microarray analysis we found that Sp1 increased oncogene expression and decreased tumor suppressor gene expression. In the present study we initially used software to analyze the promoters of all identified miRNAs. According to the miRBase database the human genome contains 1600 miRNA genes. We investigated whether Sp1 participates in the regulation of intergenic miRNAs. First we screened the upstream (-1 kb) flanking sequences of intergenic miRNAs. Using the TFSEARCH program we identified 205 intergenic miRNAs that contained potential binding sites for Sp1. Because Sp1 is upregulated in lung cancer and the expression of its target genes is altered we next examined the expression of these miRNAs in lung cancer. According to previous studies the expression patterns of 22 miRNAs differed significantly in lung cancer tissue and normal lung tissue (Supplementary Table S1). "
Lung_Cancer
"In this study we identified a novel pathway for Sp1-mediated activation wherein miR-182 expression downregulated the expression of FOXO3 a known miR-182 target gene [35]. Sp1 activated miR-182 and FOXO3 at the transcriptional level; however FOXO3 protein expression decreased. These results suggest that post-transcriptional regulation by miRNAs is a powerful mechanism by which to control the final level of protein expression. Many coding genes with Sp1 binding element(s) in their promoters harbor conserved miRNA target sequences in their 3'-UTR. To our knowledge this is first study to demonstrate that Sp1 regulates the expression of a target gene by regulating promoter activity and post-transcriptional processing in parallel. Few studies have characterized the regulation of miRNA by Sp1. Herein using a bioinformatics approach we identified several miRNAs potentially regulated by Sp1 including miR-182. We then showed that Sp1 specifically targets the miR-182 promoter region and activates miR-182 expression. miR-182 reportedly forms a gene cluster with two adjacent miRNAs (miR-96 and miR-183) [35]. The expression of miR-96 and miR-183 also decreased following Sp1 knockdown (Supplementary Figure S2A). Moreover we also investigated the binding of Sp1 to the miR-212 promoter because the latter contains 13 putative Sp1 binding sites (Supplementary Table S1). We found that Sp1 bound to the miR-212 promoter sequence (Supplementary Figure S2B and S2C). Interestingly a recent study showed that FOXO3 is a direct target of miR-212 in the neurons of patients with Alzheimer's disease [36]. miR-182 and miR-212 might cooperate to downregulate FOXO3 expression upon Sp1 overexpression. We cannot rule out this possibility. However depletion of miR-182 was sufficient to impair the Sp1-mediated reduction of FOXO3 expression in our experiments (C) suggesting that miR-182 is the major regulator of FOXO3 in lung cancer cells. Several studies have shown that miR-182 is upregulated in lung cancer. This suggests that miR-182 plays a positive role in lung tumorigenesis. However in two studies of miR-182 function in lung cancer miR-182 inhibited the proliferation of human lung adenocarcinoma cells [37 38]. Our results in this study provide several pieces of evidence to support the notion that miRNA-182 is a positive regulator of lung cancer cell proliferation. Firstly miR-182 was upregulated in the majority of lung cancer clinical samples and lung cancer cell lines examined. Secondly miR-182 knockdown inhibited cell cycle progression and cell growth. Finally miR-182 knockdown reduced lung tumor growth in vivo. Discrepancies in the role of miRNA-182 in lung cancer cell proliferation might derive from the different experimental designs of the studies. For example because miR-182 expression is upregulated in lung cancer we knocked down its expression and examined the effects on cancer cell proliferation. However other studies that described a negative role of miR-182 in lung cancer used miR-182 overexpression to study miR-182's role in cancer cell proliferation. Overexpression conditions can alter the function of many genes [39]. For example Sp1 accumulates in most of cancers; knockdown of Sp1 expression decreases cell proliferation but Sp1 overexpression also attenuates cancer cell growth [40]. Because post-translational modifications affect protein function overexpressed proteins might not be completely processed which could affect their function. Previous studies in melanoma and hepatocellular carcinoma indicated that miR-182 enhanced tumor metastasis [35 41]. However our data as shown in indicated that miR-182 knockdown altered cell morphology and increased migration and invasion activities. In addition miR-182 knockdown increased N-cadherin levels suggesting that miR-182 promotes the mesenchymal to epithelial transition (MET) [42]. Previous studies have shown that TIMP-2 enhances the E-cadherin/?-catenin complex in A549 lung cancer cells [43]. Whether Sp1 or miR-182 regulates TIMP-1 in lung cancer needs to be addressed in future studies. Finally miR-182 levels were lower in CL1-5 cells then in CL1-0 cells resulting in increased metastatic activity in CL1-5. Collectively our data suggest that miR-182 inhibits lung cancer metastasis. Our previous study indicated that Sp1 is down regulated in the late stages of lung cancer progression [32]. Therefore in the late stages of lung tumorigenesis miR-182 expression was down regulated compared with expression in the early stages which led to tumor metastasis through at least in part an increase in FOXO3 expression. It is still not clear why miR-182 has different roles in different types of cancer; this awaits further study. Although we found that FOXO3 is involved in miR-182-mediated lung cancer progression FOXO3 knockdown did not completely abolish the effects of miR-182 knockdown suggesting that other genes regulated by miR-182 contribute to the inhibition of metastasis by miR-182. With this in mind we determined the expression profile of miR-182-regulated genes. Many metastasis-related genes were induced in miR-182-knockdown cells including CD44 ADAM9 and CDH9. CD44 which localizes to the cell membrane is reportedly involved in cell migration in various cancer types [44]. Recent studies also showed that tumor initiating cells with high CD44 expression maintained lung cancer tumorigenicity and drug resistance [45]. Another metastasis-related gene induced by miR-182 knockdown ADAM9 cleaves membrane proteins such as E-cadherin [46]. A previous study showed that combined Kras and Wnt pathway activation increased the incidence of lung cancer formation [47]. Given that ADAM9 is also involved in the activation of the Wnt pathway Sp1 and miR-182 might connect the Kras and the Wnt pathway. In addition CDH9 also involves in the cancer metastasis [48]. In we showed that miR-182 is an Sp1-activated miRNA whose expression increased in lung cancer. miR-182 functioned not only as an oncomiR for lung cancer growth but also as a suppressor of lung cancer metastasis. MATERIALS AND METHODS Cell culture and transfection Human lung cancer cell lines A549 H1299 CL 1-0 and 1-5 were cultured in Dulbecco's modified Eagle's medium (Invitrogen Carlsbad CA) human diploid fibroblasts IMR were cultured in Minimum Essential Media (Invitrogen) and human bronchial epithelial cells BEAS-2B was cultured in RPMI 1640 Medium (Thermo Scientific Rockford IL). All of culture mediums contained 10% fetal bovine serum 100 U/ml penicillin G sodium and 100 ?g/ml streptomycin sulfate (Invitrogen). Cells were cultured at 37? and 5% CO2."
Lung_Cancer
"NSCLC and 40 healthy controls were collected. The concentration of KLK11 was measured by enzyme-linked immunosorbent assay (ELISA). The concentration of KLK11 in NSCLC was significantly higher compared to that in the controls (P?<?0.01). The serum KLK11 levels decreased with stage presence of lymph node and distant metastases regardless of histology age and sex. With a cutoff point of 1.05 ng/ml KLK11 showed a good diagnostic performance for NSCLC. Univariate analysis revealed that NSCLC patients with serum high KLK11 had a longer overall survival (OS) and progression-free survival (PFS) than those with low KLK11 (HR of 0.36 P?=?0.002; HR of 0.46 P?=?0.009). Cox multivariate analysis indicated that KLK11 was an independent prognostic indicator of PFS and OS (HR of 0.53 P?=?0.042; HR of 0.48 P?=?0.037). Kaplan“Meier survival curves further confirmed that patients with high KLK11 have longer PFS and OS (P?=?0.003 and P?=?0.018 respectively). In the measurement of KLK11 might be a useful diagnostic and prognostic test for NSCLC patients. Keywords Kallikrein-related peptidases 11 Non-small cell lung cancer Diagnosis Prognosis issue-copyright-statement International Society of Oncology and BioMarkers (ISOBM) 2014 Introduction Lung cancer is the leading cause of cancer-related death worldwide with more than 1.2 million deaths each year [1]. Non-small cell lung cancer (NSCLC) accounts for 80“85 % of total lung malignancies [2]. Although advances in noninvasive methods have improved our ability to detect lung cancer more than 75 % of lung cancer patients present an advanced stage of disease [3] and they have little prospect of effective and curative treatment with 5-year survival rates of less than 15 % [4]. Tumor markers play a key role in patient management for many malignancies. The potential uses of serum tumor markers include aiding early diagnosis determining prognosis prospectively predicting response or resistance to specific therapies and monitoring therapy in patients with advanced disease. Kallikrein-related peptidases 11 (KLK11) is a member of the human kallikrein gene family which localized on chromosome 19q13.4 [5]. Recent studies have reported that KLK11 has been expressed in many cancers including prostate cancer [6] ovarian cancer [7] gastric cancer [8] as well as rectal carcinoma [9]. An immunofluorometric assay study demonstrated that KLK11 expression in ovarian cancer tissues is a marker of favorable prognosis since patients with KLK-positive tumors exhibit a longer progression-free survival (PFS) and overall survival (OS) [10]. Additionally Sasaki et al. [11] reported that lower KLK11 mRNA expression in lung cancer is an indicator of poor prognosis in patients with lung cancer. However there seems to be a paucity of research concerned with serum KLK11 expression in NSCLC. For this reason the goal of the present study was to investigate the baseline serum levels of KLK11 in patients with NSCLC to determine its potential diagnostic and prognostic roles. Materials and methods Patients A total of 138 patients with NSCLC were examined at the Nanjing Chest Hospital between January 2006 and May 2008. The cohort of patients included 80 (58.0 %) male and 58 (42.0 %) female subjects with a median age of 56 years (range 45“68 years). The clinical features of the patients are summarized in . Follow-up lasted through December 2012 with a median follow-up period of 22 months for living patients (range 3“80 months). PFS was defined as the time interval between the date of diagnosis and the date of disease relapse. OS was defined as the time interval between the date of diagnosis and the date of death.Clinical characteristics of NSCLC patients and controlsVariablesNSCLCControl P valueSubject no.13840Age year57.8?±?10.254.6?±?7.80.614Male/Female80/5826/140.325Histology?AC78?SCC60 AC adenocarcinoma SCC squamous cell carcinoma The diagnosis of lung cancer was made using various methods: sputum cytology fine-needle aspiration or bronchoscopy as dictated by the patient™s presentation. Pathologists interpreted the cytology or histology of tissue biopsy. Lung cancer was staged using a widely used classification system and the staging procedure included a clinical examination; CT of the chest abdomen and brain; abdominal ultrasonography; bone scanning; and positron emission tomography. The study protocol was approved by the ethics committee of Nanjing Chest Hospital. All patients provided written informed consent before enrollment. Measurement of serum KLK11 levels Serum samples from each individual were obtained at the time of diagnosis before any therapeutic measures were started (surgery chemotherapy or radiation). Samples were centrifuged at 1500—g for 10 min at ?4 °C. The supernatant was stored at ?80 °C for assessment of the levels of KLK11. The KLK11 concentration was determined by ELISA with the commercial KLK11 ELISA Ready-SET-Go kit (eBioscience San Diego CA). All samples were blinded to the technologists running the assays and the code was broken to the statisticians after the database was constructed. Statistical analysis Statistical software (SPSS for Windows version 18) was used for the analysis. Differences between independent groups were examined by the Mann“Whitney U test. To determine the diagnostic accuracy of KLK11 receiver operating characteristic (ROC) curves were retrieved from logistic regression analysis and the area under the curve (AUC) was calculated. Univariate survival analysis was performed using the Kaplan“Meier method and the log-rank test. Multivariate analysis was conducted to determine an independent impact on survival using the Cox proportional hazard method. P?<?0.05 was considered statistically significant. Results Comparison of serum KLK11 levels between NSCLC patients and controls As shown in Fig. 1 the concentration of KLK11 was significantly higher in patients with NSCLC (2.04?±?0.86 ng/ml) than in those with the controls (0.93?±?0.52 ng/ml) (P?<?0.01).Fig. 1Levels of KLK11 in NSCLC. Among 138 NSCLC patients the serum levels of KLK11 were 2.04?±?0.86 ng/ml which were significantly higher than 0.93?±?0.52 ng/ml in healthy controls (P?<?0.01) Diagnostic value of KLK11 in NSCLC A ROC curve analysis was carried out to assess the value of KLK11 in NSCLC. The area under the ROC curve was 0.892 (confidence interval (95 % CI) 0.841“0.942). With a cutoff point of 1.05 ng/ml which was defined as the normal value based on the mean value plus two standard deviation obtained from healthy controls serum KLK11 has a sensitivity of 65.9 % (91/138) a specificity of 82.5 % (33/40) an accuracy of 69.7 % (124/178) a positive predictive value of 92.9 % (91/98) and a negative predictive value of 41.3 % (33/80) (Fig. 2).Fig. 2ROC of KLK11 for the diagnosis of NSCLC. Serum levels of KLK11 among 138 NSCLC patients and 40 healthy controls were determined. The diagnostic potentials of KLK11 were assessed by ROC curves. The AUC value was 0.892 Relationship between serum KLK11 levels and clinicopathologic factors The relationships between KLK11 levels and clinicopathologic factors of lung cancer patients are shown in . The serum KLK11 levels did not differ significantly with age (P?=?0.569) sex (P?=?0.505) or histology (P?=?0.713). The levels of KLK11 were significantly correlated with tumor-node-metastasis (TNM) stage (P?=?0.000) lymph node metastases (P?=?0.000) and distant metastases (P?=?0.000).The clinicopathological factors of NSCLC and the association with KLK11 levelsFactorsnKLk11 (ng/ml) P- valueAge year0.569??60622.07?±?0.77?<60762.12?±?0.66Gender0.505?Male802.16?±?0.82?Female581.99?±?0.53Histology0.713?AC782.05?±?0.85?SCC602.01?±?0.53TNM stage0.000?I“II882.51?±?0.61?III“IV501.76?±?0.63Lymph node metastases0.000?Absent682.41?±?0.64?Present701.65?±?0.57Distant metastases0.000?Absent982.38?±?0.59?Present401.89?±?0.71 AC adenocarcinoma SCC squamous cell carcinoma Association of serum KLK11 levels with survival Finally we determined whether the baseline serum concentration of KLK11 would be a prognostic marker in NSCLC. The cutoff point of 1.05 ng/ml was selected to categorize patients as KLK11-high or low. Univariate analysis showed that serum KLK11 level was significantly correlated OS (P?=?0.002) and PFS (P?=?0.009) (Table 3).Table 3Univariate and multivariate analysis of KLK11 status with regard to PFS and OSVariablesPFSOSHR95 % CI P valueHR95 % CI P valueUnivariate analysis?KLK11 (Low vs. High)0.460.25“0.820.0090.360.19“0.690.002?Age (?60 vs. <60)1.230.67“2.280.5061.180.59“2.130.792?Gender (Male vs. Female)1.320.71“1.820.7821.190.69“1.980.673?Histology (AC vs. SCC)1.830.59“2.130.7921.340.65“1.980.546?Stage (I“II vs. III“IV)1.330.65“2.210.0010.931.09“3.440.025?Lymph node metastases (absent vs. present)1.421.04“1.940.2711.770.32“1.660.347?Distant metastases (absent vs. present)1.981.03“3.010.0391.871.04“2.990.075Multivariate analysis?KLK11 (low vs. high)0.530.29-0.970.0420.480.24-0.950.037?Age (?60 vs. <60)0.980.52-1.940.8341.061.28-3.010.128?Gender (male vs. Female)1.280.67-1.890.6721.140.46-2.140.542?Histology (AC vs. SCC)1.371.04-2.330.3151.260.64-2.560.424?Stage (I“II vs. III“IV)1.250.56-2.260.0011.961.02-3.770.043?Lymph node metastases (absent vs. present)1.130.81-1.570.1481.840.33-1.720.334?Distant metastases (absent vs. present)1.440.85-1.970.0981.890.99-2.350.051 HR hazard ratio CI confidence interval In multivariate analysis high KLK11 was found to be significantly associated with a longer PFS and OS (HR 0.53 and 0.48; P?=?0.042 and P?=?0.037 respectively). Kaplan“Meier survival curves (Fig. 3) further demonstrate that lung cancer patients with high KLK11 have substantially longer PFS and OS (P?<?0.05) compared to those with low KLK11 cancer. As expected disease stage was found to be strongly associated with decreased PFS and OS in both univariate and multivariate analyses (P?<?0.05).Fig. 3Kaplan“Meier survival curves for PFS and OS in patients with KLK11-high and -low NSCLC. Log-rank test determined that the PFS and OS in high KLK11 group were significantly longer than those in the low KLK11 group (P?=?0.003; P?=?0.018) Discussion During the last few years numerous studies have been published which attempt to refine our understanding of determinants of prognosis in lung cancer by analyzing tumor-associated markers thought to be of biologic relevance in the carcinogenic process. Proteolytic enzymes of several catalytic classes have emerged as important prognostic factors in cancer [12]. Among these enzymes are many members of human tissue kallikrein family of secreted serine proteases including KLK11 a promising biomarker for lung cancer diagnosis and prognosis [1113]. In the present study serum KLK11 levels were significantly elevated in patients with lung cancer compared with control subjects making them potential adjunctive tools for diagnosis of lung cancer. Furthermore at a cutoff point of 1.05 ng/ml KLK11 had a sensitivity of 91.3 % and a specificity of 72.5 % for the prediction of lung cancer. Importantly the serum KLK11 levels did not differ significantly with age gender and histology. The levels of KLK11 were significantly correlated with TNM stage the presence of lymph node and distant metastases. Several previous studies have reported an association between kallikrein mRNA expression and cancer prognosis [14“16]. KLK5 and KLK4 have been associated with poor prognosis in ovarian cancer and KLK5 has also been shown to be associated with poor prognosis in breast cancer [1718]. In contrast KLK8 and KLK9 expression have been reported to be favorable prognosis in ovarian cancer [1920]. In addition KLK12 is reported to be an independent and favorable prognostic marker for breast cancer [21]. Sasaki et al. [11] have indicated that there is a significant correlation between decreased KLK11 mRNA expression level and poor prognosis in lung cancer. This study supports the increasing body of literature demonstrating the expression of kallikrein family gene involvement in the prognosis of human cancers. The most striking association we observed in NSCLC patients was a significant correlation between increased KLK11 level and favorable prognosis. We have demonstrated that high KLK11 was significantly associated with an increased PFS and OS in univariate analysis. This relationship was further illustrated in the Kaplan“Meier survival curves. Multivariate analysis also indicated that KLK11 was an independent indicator of PFS and OS. In our data suggest that serum KLK11 may be a useful diagnostic biomarker and shows a promising potential as prognostic marker in NSCLC patients. More large-scale prospective studies are warranted to confirm the findings. Conflicts of interest None. References 1. Chen Z Wang T Cai L Su C Zhong B Lei Y Clinicopathological significance of non-small cell lung cancer with high prevalence of Oct-4 tumor cells J Exp Clin Cancer Res 2012 31 10 10.1186/1756-9966-31-10 22300949 2. Smith RA Cokkinides V Brawley OW Cancer screening in the United States 2009: a review of current American Cancer Society guidelines and issues in cancer screening CA Cancer J Clin 2009 59 27 41 10.3322/caac.20008 19147867 3. Oguz A Unal D Tasdemir A Karahan S Aykas F Mutlu H Lack of any association between blood groups and lung cancer independent of histology Asian Pac J Cancer Prev. 2013 14 453 456 10.7314/APJCP.2013.14.1.453 23534772 4. Jemal A Siegel R Xu J Ward E Cancer statistics 2010 CA Cancer J Clin 2010 60 277 300 10.3322/caac.20073 20610543 5. Sano A Sangai T Maeda H Nakamura M Hasebe T Ochiai A Kallikrein 11 expressed in human breast cancer cells releases insulin-like growth factor through degradation of IGFBP-3 Int J Oncol 2007 30 1493 1498 17487371 6. Luo LY Shan SJ Elliott MB Soosaipillai A Diamandis EP Purification and characterization of human Kallikrein 11 a candidate prostate and ovarian cancer biomarker from seminal plasma Clin Cancer Res 2006 12 742 750 10.1158/1078-0432.CCR-05-1696 16467084 7. McIntosh MW Liu Y Drescher C Urban N Diamandis EP Validation and characterization of human Kallikrein-11 as a serum marker for diagnosis of ovarian carcinoma Clin Cancer Res 2007 13 4422 4428 10.1158/1078-0432.CCR-06-2224 17671125 8. Unal D Tasdemir A Oguz A Eroglu C Cihan YB Turak EE Is human Kallikrein-11 in gastric cancer treated with surgery and adjuvant chemoradiotherapy associated with survival? Pathol Res Pract 2013 209 779 783 10.1016/j.prp.2013.09.004 24169449 9. Yu X Tang HY Li XR He XW Xiang KM Overexpression of human kallikrein 11 is associated with poor prognosis in patients with low rectal carcinoma Med Oncol 2010 27 40 44 10.1007/s12032-009-9167-2 19184568 10. Diamandis EP Borgo±o CA Scorilas A Harbeck N Dorn J Schmitt M Human kallikrein 11: an indicator of favorable prognosis in ovarian cancer patients Clin Biochem 2004 37 823 829 10.1016/j.clinbiochem.2004.04.009 15329323 11. Sasaki H Kawano O Endo K Suzuki E Haneda H Yukiue H Decreased Kallikrein 11 messenger RNA expression in lung cancer Clin Lung Cancer 2006 8 45 48 10.3816/CLC.2006.n.032 16870045 12. Lei KF Liu BY Zhang XQ Jin XL Guo Y Ye M Development of a survival prediction model for gastric cancer using serine proteases and their inhibitors Exp Ther Med 2012 3 109 116 10.1084/jem.20110399 22969854 13. Planque C Li L Zheng Y Soosaipillai A Reckamp K Chia D A multiparametric serum kallikrein panel for diagnosis of non-small cell lung carcinoma Clin Cancer Res 2008 14 1355 1362 10.1158/1078-0432.CCR-07-4117 18316555 14. Alexopoulou DK Papadopoulos IN Scorilas A Clinical significance of kallikrein-related peptidase (KLK10) mRNA expression in colorectal cancer Clin Biochem 2013 46 1453 1461 10.1016/j.clinbiochem.2013.03.002 23499583 15. Talieri M Alexopoulou DK Scorilas A Kypraios D Arnogiannaki N Devetzi M Expression analysis and clinical evaluation of kallikrein-related peptidase 10 (KLK10) in colorectal cancer Tumour Biol 2011 32 737 744 10.1007/s13277-011-0175-4 21487810 16. Patsis C Yiotakis I Scorilas A Diagnostic and prognostic significance of human kallikrein 11 (KLK11) mRNA expression levels in patients with laryngeal cancer Clin Biochem 2012 45 623 630 10.1016/j.clinbiochem.2012.03.005 22429520 17. Xi Z Kaern J Davidson B Klokk TI Risberg B Trop C Kallikrein 4 is associated with paclitaxel resistance in ovarian cancer Gynecol Oncol 2004 94 80 85 10.1016/j.ygyno.2004.03.044 15262123 18. Yousef GM Scorilas A Kyriakopoulou LG Rendl L Diamandis M Ponzone R Human kallikrein gene 5 (KLK5) expression by quantitative PCR: an independent indicator of poor prognosis in breast cancer Clin Chem 2002 48 1241 1250 12142380 19. Kountourakis P Psyrri A Scorilas A Markakis S Kowalski D Camp RL Expression and prognostic significance of kallikrein-related peptidase 8 protein levels in advanced ovarian cancer by using automated quantitative analysis Thromb Haemost 2009 101 541 546 19277417 20. Borgo±o CA Kishi T Scorilas A Harbeck N Dorn J Schmalfeldt B Human kallikrein 8 protein is a favorable prognostic marker in ovarian cancer Clin Cancer Res 2006 12 1487 1493 10.1158/1078-0432.CCR-05-2106 16533772 21. Talieri M Devetzi M Scorilas A Pappa E Tsapralis N Missitzis I Human kallikrein-related peptidase 12 (KLK12) splice variants expression in breast cancer and their clinical impact Tumour Biol 2012 33 1075 1084 10.1007/s13277-012-0347-x 22351561 9502500 8794 Clin Cancer Res Clin. Cancer Res. Clinical cancer research : an official journal of the American Association for Cancer Research 1078-0432 24423612 4136748 10.1158/1078-0432.CCR-13-2195 NIHMS556385 Article HEDGEHOG-GLI signaling inhibition suppresses tumor growth in squamous lung cancer Huang Lingling 1 Walter Vonn 2 Hayes D. Neil 2 Onaitis Mark 1 1Duke University Department of Surgery 2University of North Carolina Department of Medicine Corresponding Author: Mark Onaitis DUMC Box 3305 Durham NC 27710 [email protected] phone: 919-684-6974 fax: 919-684-8508 4 4 2014 14 1 2014 15 3 2014 15 3 2015 20 6 1566 1575 Purpose Lung squamous cell carcinoma (LSCC) currently lacks effective targeted therapies. Previous studies reported overexpression of HEDGEHOG (HH)-GLI signaling components in LSCC. However they addressed neither the tumor heterogeneity nor the requirement for HH-GLI signaling. Here we investigated the role of HH-GLI signaling in LSCC and studied the therapeutic potential of HH-GLI suppression. Experimental Design Gene expression datasets of two independent LSCC patient cohorts were analyzed to study the activation of HH-GLI signaling. Four human LSCC cell lines were examined for HH-GLI signaling components. Cell proliferation and apoptosis were assayed in these cells after blocking the HH-GLI pathway by lentiviral-shRNA knockdown or small molecule inhibitors. Xenografts in immunodeficient mice were used to determine the in vivo efficacy of GLI inhibitor GANT61. Results In both cohorts activation of HH-GLI signaling was significantly associated with the classical subtype of LSCC. In cell lines genetic knockdown of SMO produced minor effects on cell survival while GLI2 knockdown significantly reduced proliferation and induced extensive apoptosis. Consistently the SMO inhibitor GDC-0449 resulted in limited cytotoxicity in LSCC cells whereas the GLI inhibitor GANT61 was very effective. Importantly GANT61 demonstrated specific in vivo anti-tumor activity in xenograft models of GLI-positive cell lines. Conclusion Our studies demonstrate an important role for GLI2 in LSCC and suggest GLI inhibition as a novel and potent strategy to treat a subset of LSCC patients. Squamous cell lung cancer HEDGEHOG GLI J Korean Med Sci J. Korean Med. Sci JKMS Journal of Korean Medical Science 1011-8934 1598-6357 The Korean Academy of Medical Sciences 24431917 3890464 10.3346/jkms.2014.29.1.129 Original Article Medical Imaging Computed Tomography Guided Percutaneous Injection of a Mixture of Lipiodol and Methylene Blue in Rabbit Lungs: Evaluation of Localization Ability for Video-Assisted Thoracoscopic Surgery Jin Kwang Nam 1 Lee Kyung Won 2 Kim Tae Jung 2 Song Yong Sub 3 Kim Dong Il 4 1Department of Radiology Seoul Metropolitan Government-Seoul National University Boramae Medical Center Seoul Korea. 2Department of Radiology Seoul National University Bundang Hospital Seongnam Korea. 3Department of Radiology Seoul National University Hospital Seoul Korea. 4Department of Pathology Green Cross Laboratories Yongin Korea. Address for Correspondence: Kyung Won Lee MD. Department of Radiology Seoul National University Bundang Hospital 82 Gumi-ro 173beon-gil Bundang-gu Seongnam 463-707 Korea. Tel: +82.31-787-7604 Fax: +82.31-787-4011 [email protected] 1 2014 26 12 2013 29 1 129 136 13 5 2013 22 10 2013 2014 The Korean Academy of Medical Sciences. 2014 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use distribution and reproduction in any medium provided the original work is properly cited. Preoperative localization is necessary prior to video assisted thoracoscopic surgery for the detection of small or deeply located lung nodules. We compared the localization ability of a mixture of lipiodol and methylene blue (MLM) (0.6 mL 1:5) to methylene blue (0.5 mL) in rabbit lungs. CT-guided percutaneous injections were performed in 21 subjects with MLM and methylene blue. We measured the extent of staining on freshly excised lung and evaluated the subjective localization ability with 4 point scales at 6 and 24 hr after injections. For MLM radio-opacity was evaluated on the fluoroscopy. We considered score 2 (acceptable) or 3 (excellent) as appropriate for localization. The staining extent of MLM was significantly smaller than methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opacity of MLM was found in 13 subjects (62%). An appropriate localization rate of MLM was 100% with the use of the directly visible ability and radio-opacity of MLM. MLM provides a superior pulmonary localization ability over methylene blue. Lung Ethiodized Oil Methylene Blue Tomography X-Ray Computed Radiology Interventional Seoul National University College of Medicine 800-20120036 INTRODUCTION Preoperative localization is necessary for video-assisted thoracoscopic surgery (VATS) when pulmonary nodules are too small or distant from the visceral pleura to be detected (1-3). A failure to localize nodules disturbs the success of the thoracoscopic resection and leads to conversion to thoracotomy (4 5). There are two kinds of localizing procedures: marking with thoracoscopically directly visible materials and marking with radio-opaque materials. Examples of directly visible materials are hook wire methylene blue and indocyanine green. Ethiodized oil (lipiodol) barium and iodine contrast agents are used for radio-opaque markers. Each marking method has strong and weak points. Localization with a hook wire is easy to perform but carries a high risk of pneumothorax and a propensity to dislodge during transport and surgical preparation (6 7). Methylene blue and indigo carmine have a tendency to diffuse over a large area by the time the operation is done and render localization features inadequate (8 9). The use of a radio-opaque marker (such as barium or lipiodol) requires an intraoperative fluoroscopy to confirm an adequate excision as well as lead to increased radiation exposure (10-13). The use of mixture has been reported to make up for the weakness of marking materials. For example the problem of dye diffusion has led to attempts to use a mixture of dye with various materials such as cyanoacrylate adhesive or collagen or autologous blood (14-16). However they have not been widely used for localization due to difficulties in making and manipulation. Lipiodol and methylene blue are commonly used materials for localization (17-20). We hypothesized that lipiodol reduces the spread of methylene blue and provides additional localization opportunities by its radio-opacity. The use of a mixture of lipidol and methylene blue (MLM) for a percutaneous injection material requires a high success rate for appropriate localization and a low complication rate. To our knowledge there have been no reports that evaluate the availability of MLM as a percutaneous injection material in human lungs. This study compared MLM with methylene blue as a percutaneous injection material for pulmonary localization in rabbit lungs. MATERIALS AND METHODS Animal preparation This study was performed after approval by the Institutional Animal Care and Use Committee (IACUC) in Seoul National University Hospital biomedical research institute (IACUC approval No. 11-0356). Twenty-four adult New Zealand White rabbits were used. We recorded their weight before the procedures. The animals were randomly divided into two groups: Group A (n=12) and Group B (n=12) each sacrificed at about 6 hr and 24 hr after percutaneous injections respectively (Fig. 1). Six hours after percutaneous injections were same day operations of the preoperative localization; and 24 hr after percutaneous injections were next day operations of the preoperative localization. The injection of each material was done in all 24 subjects because we injected methylene blue and MLM at two different lung sites for each subject. Percutaneous injection materials: mixture of lipiodol and methylene blue versus methylene blue A pilot study was performed to decide the optimal amount of materials for percutaneous injections. Methylene blue (1% 100 mg/mL TERA Pharmaceuticals Buena Park CA USA) of 0.3 to 0.9 mL was used for human lung localization in previous studies by Wicky et al. (18) and Vandoni et al. (19). In the pilot study with rabbit lungs we injected 0.1 mL and 0.05 mL of methylene blue and MLM in four subjects. We found that staining was extensive (more than half height of one lobe) with 0.1 mL and localized (about 1 cm of staining diameter) with 0.05 mL for both methylene blue and MLM. Extensive dispersion made it difficult to find exact injecting sites; subsequently 0.05 mL of methylene blue was administered. We made variable mix ratios of lipiodol and methylene blue in vitro; 1:1 1:2 1:3 1:4 and 1:5 in order to find an appropriate mixing ratio of lipiodol (480 mg Iodine/mL Andre Guerbet Aulnay-sous-Bois France) and methylene blue. The separation of two materials occurred instantly after mechanical blending to the fat-soluble character of lipiodol and the water-soluble character of methylene blue. A higher concentration of lipiodol in MLM resulted in increased uneven blending and rapid separation. A mixture with a 1:6 (or lower) mixing ratio contained a minimal amount of lipiodol and it might make it difficult to be detected on the fluoroscopy; subsequently we decided that 1:5 was an appropriate mixing ratio for injection. A total of 0.06 mL of MLM (0.01 mL of lipiodol plus 0.05 mL of methylene blue) was administrated in each subject to avoid the effect of different volumes of methylene blue to the diffusion extent of the materials. CT guided percutaneous injections Percutaneous injection was performed with computed tomography (CT) guidance (Discovery CT750 HD; GE Healthcare Waukesha WI USA). We performed pre-procedural CT scans in order to determine an appropriate skin entry site for the successful placement of a needle in the desired location. The desired location was the basal portion of both caudal lobes around the mid-scapula line. We tried to situate the needle tip at 5 mm depth from the visceral pleura and avoid passing through the pulmonary vessels. We placed the needle of 20 gauze and 3.5 cm length in the lung parenchyma after marking the appropriate skin entry site. The parameters of CT used in our study were: tube voltage of 120 kV tube current of 25 mA slice thickness of 2 mm thickness and gantry rotation speed of 350 milliseconds. We connected 1 mL syringe to the needle hub and retracted the syringe piston to confirm that no blood was aspirated after the needle tip was accurately located within the desired location. We then injected the materials and immediately removed the needle. On the procedural CT scan we measured the distance from the skin-entry to the needle tip and the depth from visceral pleura to the needle tip. A post-procedural CT scan identified procedure-related complications that included the leakage of injecting materials and pneumothorax; in addition we recorded the extent shape and density of radio-opacity of MLM after injection. The extent of MLM was defined as a maximum diameter of the radio-opacities. The shape of radio-opacity was categorized into 3 groups (small faint nodular scattered nodular and discrete compact nodular). We recorded the injection time to measure the time interval between injection and sacrifice. Fluoroscopic examinations A successful localization of lipiodol was determined by fluoroscopic examination; subsequently we evaluated the radio-opacity of MLM using the fluoroscopy X-ray unit (BV Pulsera; Philips Medical Systems Best The Netherlands) at the immediate post-procedure session and the follow up session at 6 hr in Group A and 24 hr in Group B. The parameters of fluoroscopy were: tube voltage of 59 kV and tube current of 946 mA. We obtained anteroposterior fluoroscopic images of the thorax of the rabbit with a 17 cm of field of view. A radio-opaque ruler of 5 cm was located near the rabbit in order to estimate the exact size of lipiodol opacity. We recorded the time of the fluoroscopic examinations and the radiographic findings of MLM (size and shape of the radio-opacity). Evaluation of the staining and radio-opacity We assessed the directly visible staining on the freshly excised lung surface and radio-opacity of MLM on the fluoroscopic examinations using 4-point scoring in order to compare the localization ability of MLM and methylene blue as a percutaneous injection material. A blind reviewer who was unaware of the injection materials assessed the staining ability. In order to evaluate the staining ability the blind reader reviewed the photographic images of the freshly excised lung specimens obtained before formalin fixations and rated the staining by 4-point scores: 0=non-visualization of staining 1=inappropriate; extensive dispersion made it difficult to find accurate injecting locations 2=acceptable; available to estimate injecting locations in spite of the dispersion and 3=excellent definitely localized staining (Fig. 2). The maximum diameter of the staining extent on the lung surface was measured. We calculated and compared scores and extent of staining between two materials. For the fluoroscopic findings the radio-opacity of MLM was evaluated using 4-point scoring: 0=no detectable radio-opacity 1=inappropriate minimally increased opacity 2=acceptable low density of increased opacity 3=excellent compact nodular increased opacity (Fig. 3). We compared the average scores of initial and follow up fluoroscopic examinations. We considered a score of 0 or 1 as inappropriate and a score of 2 or 3 as appropriate for localization for both staining and radio-opacity. We compared the number of appropriate or excellent localization between MLM and methylene blue. Sacrifice and histopathologic examinations Both freshly excised entire lungs were used as fi"
Lung_Cancer
"About half (49%) of UNCeqRMETA mutations had no RNA evidence and were based only on DNA evidence. Surprisingly among UNCeqRMETA expressed somatic mutations (those with RNA and DNA mutant read evidence) the MAF in RNA was often significantly greater than in DNA (lung: 21% of expressed mutations breast: 17% fdr < 0.05) (A and Supplementary Figure S6A). This increase was often >2-fold (lung: 12% of expressed mutations breast: 11%). In contrast DNA MAF was significantly greater than RNA MAF at much lower frequency (lung: 2% of expressed mutations breast: 3% fdr < 0.05). As a control germline variants were detected in germline DNA-WES and patient-matched germline RNA-seq relative to the reference genome by UNCeqRMETA under the same settings as somatic mutation detection (B and Supplementary Figure S6B). In contrast to expressed somatic mutations expressed germline variants displayed rare significant differences in allele fraction (RNA greater than DNA: lung: 0.8% breast: 0.7%; DNA > RNA: lung 0.1% breast: 0.3%). Therefore the prevalent increased mutation signal in RNA-seq was cancer-specific. . Mutation signal in RNA versus DNA. Mutant allele fraction distributions of UNCeqRMETA expressed mutations from the lung triplet cohort tumor sequencing (A). Germline variant allele fraction distributions of expressed germline variants from lung quadruplet cohort germline sequencing (B). Diagonal lines indicate equal allelic fraction between DNA and RNA with points above the diagonal having greater allelic fraction in RNA below the diagonal greater allelic fraction in DNA. Breast cancer somatic mutation and germline allele distributions in Supplementary Figure S6. Distributions of MAF difference among driver genes having a significant difference in MAF over all mutations (C). MAF distributions for all TP53 UNCeqRMETA mutations expressed and unexpressed (C and D). In addition to the genome-wide phenomenon the increased mutation signal in RNA versus DNA might additionally be frequent in cancer driver genes. Lung and breast cancer's driver genes (46) with at least 10% prevalence were analyzed for differences in RNA to DNA MAF across all mutations whether expressed or not. Eight driver genes had significantly different MAF between DNA and RNA (Wilcoxon signed rank test fdr < 0.05; C). All of these genes had greater median MAF in RNA than in DNA including an oncogene PIK3CA and tumor suppressors such as TP53. The TP53 MAF distributions of lung and breast cancer had remarkable similarities (D) in that nonsynonymous and splice site mutations had extremely high RNA MAF relative to DNA MAF often 2-fold greater. Stop-gain and frameshift mutations in TP53 had greater MAF in DNA versus RNA but these decreases were less common and had a smaller magnitude in MAF difference. The TP53 results extend an earlier report in lung cancer using direct sequencing of TP53 RNA transcripts which found mutant transcript predominant expression (46). In summary expressed mutations tend to have larger mutation signal in RNA than in DNA. Importantly this effect was common among driver genes suggesting that integrating DNA and RNA for mutation detection provides the best opportunity to identify cancer causing mutations. Because DNA copy number can affect the quantity of tumor versus germline DNA at a locus tumor DNA copy number alterations were compared among mutations with a significantly greater MAF in RNA versus DNA and vice versa. Mutations with greater MAF in RNA exhibited a small (roughly 5%) relative increase in DNA copy number deletions (Supplementary Figure S7) suggesting that RNA is beneficial to detect mutations in regions of genome deletion. MAF differences in TP53 mutations did not associate with either DNA amplifications or DNA deletions (Supplementary Figure S7). Large gains in low purity tumors Because low tumor purity (caused by normal contamination and multiple clones) can affect mutation detection (28) the outcome of integrating RNA-seq and DNA-WES in mutation detection was compared among tumors by their purity. The rate of mutation gain after adding RNA-seq to DNA-WES was non-uniform both in the breast and lung triplet cohorts such that the greatest gains occurred in tumors having the lowest purity. Specifically tumors™ total mutation ratio (the number of mutations detected by UNCeqRMETA over UNCeqRDNA) had significant negative correlation with tumor purity in both lung and breast cancer (A). Mutation gains were largest among tumors with purity <40%. In addition tumors™ average difference in mutation signal between RNA and DNA (the mean difference of RNA MAF to DNA MAF across all expressed UNCeqRMETA mutations) also had significant negative correlation with tumor purity both in lung and breast cancer (B). Therefore tumors with low purity had the largest RNA-seq mutation signal and gained the most new mutations after incorporation of RNA-seq evidence. . Tumor purity effects on mutation detection. Lines summarize breast and lung triplet cohorts displaying total mutation ratios (A) or mean mutant allele fraction difference within expressed mutations (B) among tumors binned by tumor purity quintile and plotted at midpoint. Pearson's correlation tests compared the association of mutation ratio and MAF associations among triplet cohort tumors (P). MAF distributions from two exemplar low purity tumors™ mutations (C and D). Diagonal lines indicate equal MAF in DNA-WES and RNA-seq with mutations above the diagonal having greater MAF in RNA below the diagonal greater MAF in DNA. Unexpressed mutations are marked along the horizontal axes in (C and D). Examples of low purity tumors with large mutation gains include a low purity breast tumor that had 1.8 total mutation ratio and a mean 0.18 difference in mutation signal among expressed mutations. Two of this tumor's mutations with much larger signal in RNA than DNA occurred in PIK3CA (p.H1047R) and GATA3 (p.S412fs) (C). These mutations occur in major mutational hotspots (47) and are also characteristic molecular drivers for the Luminal A expression subtype (648) of which this tumor is a member. Incorporation of RNA-seq evidence was essential to identify these two driving mutations; e.g. there was only 1 DNA read with the PIK3CA mutation but 29 mutant reads in RNA-seq (). An example lung tumor had a 1.2 total mutation ratio and an average 0.22 difference in mutation signal among expressed mutations including CDKN2A (p.H98P) and TP53 (p.R273H) which exhibited very large RNA MAF (at 100 and 84%) relative to DNA MAF (at 43 and 46%) (D). These PIK3CA GATA3 and TP53 mutations were not detected by earlier studies utilizing DNA-WES alone (46) emphasizing the advantage of RNA integration. "
Lung_Cancer
"ChIP assays were performed with anti-acetyl-H3 (panel b) and anti-Sp1 antibodies (panel c). DNA was extracted for PCR with miR-182 and p21 primers. Data were quantified after three independent experiments (panel d). (F) A549 cells were harvested for DAPA with a biotin-conjugated p21 and miR-182 promoter probes and samples were analyzed by Western blotting using anti-Sp1 antibodies (panel a). Data were quantified after three independent experiments (panel b). (G) Plasmids GFP or GFP-Sp1 were co-transfected with pGL2 pGL2-miR-182 WT or mutation plasmids into H1299 cells for 24 h and then cells were harvested for luciferase activity assays. Data are representative of three independent experiments each of which was performed in triplicate and presented as the mean ± SEM. The level of statistical significance determined by t-test (* p<0.05; ** p<0.01). Because Sp1 is highly expressed in lung cancer we studied the expression of Sp1 and miR-182 in various lung cancer cell lines and patient samples (). Compared with normal human lung cells (BEAS-2B) lung cancer cell lines expressed higher levels of miR-182 (A). We also assessed the correlation between the miR-182 and Sp1 expression patterns. Sp1 levels in clinical lung tissue samples were highly elevated in the tumorous sections of the lung accompanied by increased expression of miR-182 (B). To confirm this result Sp1 and miR-182 levels were measured in 32 lung cancer patients. Sp1 and miR-182 were upregulated by more than 1.3-fold in 59.4% of the lung adenocarcinoma specimens when compared to expression in normal tissue (C). These results indicate that Sp1 expression positively correlates with miR-182 expression (D). The miR-182 level correlates to Sp1 level Total RNA and cell lysates were prepared from indicated cell lines (A) or from clinical lung tissues of lung cancer patients (B). The miR-182 level was determined by stem-loop RT-PCR and Sp1 level was studied by Western blotting with anti-Sp1 antibodies. U6 and tubulin served as the internal control. (C) Total RNA and cell lysates were prepared from 32 paired normal lung tissues and lung adenocarcinoma samples. The miR-182 level was studied by stem-loop RT-PCR and Sp1 levels were studied by RT-PCR. (D) The relationship between Sp1 and the miR-182 level in the 32 lung cancer samples was statistically analyzed using Fisher's exact test. miR-182 increases lung tumor growth The data shown in indicated that Sp1 regulated miR-182 expression during lung tumorigenesis. To identify the specific gene targets of miR-182 we searched public miRNA target prediction databases (miRDB miRWalk and TargetScanHuman) for candidate target genes. By combining the data from these three databases we identified 161 genes potentially regulated by miR-182 (Supplementary Figure S1A). Moreover pathway analysis using Ingenuity software indicated that the cellular growth and proliferation pathway had the highest score when the association of these 161 genes with biological pathways was examined. This suggests that miR-182 may play a functional role in cancer-associated processes (Supplementary Figure S1B). Indeed when miR-182 was knocked down with miRZip-182 shRNA the percentage of cells in G2/M and sub-G1 phases increased suggesting that miR-182 positively regulated cell cycle progression in the lung cancer cells (A). To further elucidate miR-182's effect on the cell cycle cells were synchronized at prometaphase using nocodazole treatment. After removing nocodazole more miRZip-182 than miRZip cells remained in G2/M phase providing further evidence that miR-182 positively regulates cell cycle progression (B). Consistently knockdown of miR-182 expression inhibited cell growth (C). miR-182 increases cancer cell proliferation (A) The miRZip and miRZip-182 stably expressed H1299 cells were fixed with 70% ethanol and stained with propidium iodide for cell cycle analysis by FACS. (B) Mitotic cells were released into growth by removing nocodazole then fixed at indicated time points for cell cycle progression assay by FACS. (C) The growth rates of miRZip and miRZip-182 stably expressed H1299 cells were calculated by cell counting within 5 days. Data are representative of six independent experiments and presented as the mean ± SEM. (D) Bioluminescent imaging was performed on 10 severe combined immunodeficient (SCID) mice implanted with miRZip and miRZip-182 stable expression H1299 cells (106 cells/mouse) at day 14 (panel a) then image signal was analyzed using Living Image software and presented as total flux measurements in photons/second (panel b). (E) Tumors from SCID mice implanted with miRZip and miRZip-182 stable expression H1299 cells for 4 weeks are shown (panel a) and tumor weights were analyzed (panel b). Data are representative of ten independent experiments and are presented as the mean ± SEM. The level of statistical significance determined by t-test (* p<0.05; ** p<0.01; *** p<0.001). To confirm the effect of miR-182 on tumor formation cells stably expressing with miRZip or miRZip-182 were implanted into SCID mice and tumor growth was monitored in vivo (D). The miRZip lentivector contains a copGFP gene and the GFP signal in miRZip-182-expressing cells was lower than that in miRZip control cells (D). Furthermore tumor volume and tumor weight were also lower in miRZip-182-implanted mice than in miRZip-implanted mice (N = 10 per group) (E). These results suggest that miR-182 overexpression facilitates lung tumor growth in vivo. Sp1 inhibits FOXO3 expression by inducing miR-182 expression To investigate the molecular mechanism underlying miR-182-mediated cancer cell proliferation we studied an important miR-182 target gene FOXO3. FOXO3 expression was higher in cells stably expressing miRZip-182 than in control cells (A). Knockdown of miR-182 expression enhanced the luciferase activity of a pGL3 vector containing the 3?-UTR of FOXO3 (B) indicating that miR-182 downregulated FOXO3 expression. Further to determine whether Sp1 downregulated FOXO3 expression through miR-182 GFP-Sp1 was expressed in cells stably expressing miRZip-182 (C). Overexpression of GFP-Sp1 reduced FOXO3 protein expression in miRZip stable cells but increased FOXO3 levels in miRZip-182-expressing cells implying that different effect of Sp1 is existed on the regulation of FOXO3 expression. Regulation of FOXO3 by miR-182 and Sp1 (A) Lenti-miRZip and lenti-miRZip-182 viruses were infected into H1299 for 96 h individually. FOXO3 level was studied by Western blotting with anti-FOXO3 antibodies and miR-182 level was studied by stem-loop RT-PCR. (B) Plasmids pGL3 and pGL3-FOXO3-3'UTR were transfected into miRZip and miRZip-182 stably expressed H1299 cells for 24 h and then cells were harvested for luciferase activity assays. (C) Different doses of GFP-Sp1 adenovirus were infected into the miRZip and miRZip-182 stably expressed H1299 cells for 48 h. FOXO3 level was studied by Western blotting using anti-FOXO3 antibodies (panel a). Quantitative results from three independent experiments are shown (panel b). The level of statistical significance was determined by t-test (* p<0.05; *** p<0.001). Therefore we further investigated the relationship between Sp1 and miR-182 in the context of FOXO3 regulation. The expression of Sp1 and FOXO3 in patients with lung cancer was examined (A). In normal tissue samples Sp1 levels were low and FOXO3 levels were high. In tumor tissue samples two Sp1 expression patterns i.e. high and low Sp1 expression were identified. Samples with higher Sp1 levels exhibited lower FOXO3 levels whereas samples with lower Sp1 levels exhibited higher FOXO3 levels suggesting that there is an inverse correlation between Sp1 and FOXO3 levels in lung specimen (A). The levels of FOXO3 and Sp1 in the lung cancer cell lines A549 H1299 CL 1-0 and CL 1-5 were studied (B). Higher levels of Sp1 expression were accompanied by lower levels of FOXO3 expression in A549 and CL 1-0 cells and lower levels of Sp1 expression were accompanied by higher levels of FOXO3 expression in H1299 and CL 1-5 cells suggesting that there is an inverse correlation between Sp1 and FOXO3 expression in lung tumorigenesis. Overexpression of GFP-Sp1 decreased FOXO3 mRNA and protein levels in a dose-dependent manner (C panel a) whereas knockdown of Sp1 expression increased FOXO3 mRNA and protein levels (C panel b). These results indicate that Sp1 negatively regulates FOXO3 expression. Sp1 negatively regulates FOXO3 expression through regulating miR-182 (A) The Sp1 and FOXO3 levels in clinical lung tissue samples were studied by IHC staining using antibodies against Sp1 and FOXO3 respectively. (B) Cell lysates were harvested from various cell lines for Western blotting using antibodies against FOXO3 and Sp1 and tubulin as an internal control. (C) Adeno-GFP-Sp1 viruses were infected into IMR-90 cells for 48 h and FOXO3 mRNA and protein were studied by RT-PCR and Western blotting respectively. GAPDH served as the internal control (panel a). Scramble and Sp1 shRNAs were transfected into H1299 for 48 h then FOXO3 mRNA and protein levels were studied by RT-PCR and Western blotting (panel b). (D) Scramble and Sp1 shRNAs were transfected into H1299 for 48 h and then cells were harvested at indicated time points following cycloheximide treatment for studying the Sp1 and FOXO3 levels with Western blotting. The levels of FOXO3 protein from three independent experiments were quantified using tubulin as an internal control. (E) Plasmids pGL2 or pGL2-FOXO3 (-1000/+50) were cotransfected with GFP or GFP-Sp1 into H1299 cells for 24 h then cell lysates were harvested for luciferase activity assays. (F) Adeno-GFP-Sp1 viruses were infected into H1299 cells for 24 h and cells were then transfected with pGL3 or pGL3-FOXO3-3'UTR plasmid for 24 h. Cells lysates were harvested for luciferase activity assays. (G) H1299 cells which were infected with GFP-Sp1 adenovirus for 24 h were then transfected with pGL3 or pGL3-FOXO3-3'UTR plasmid for 24 h. Total RNA was extracted at various time points following actinomycin D treatment. The mRNA levels of luciferase were determined by using quantitative RT-PCR and quantified using GAPDH as an internal control. Data are representative of three independent experiments each of which was performed in triplicate and presented as the mean ± SEM. The level of statistical significance determined by t-test (* p<0.05; ** p<0.01). Next we investigated the mechanism by which Sp1 regulates FOXO3 expression. FOXO3 protein half-life was studied after Sp1 knockdown. Knockdown of Sp1 expression did not affect FOXO3 protein stability (D). We then constructed a luciferase reporter construct containing the FOXO3 promoter (-1000/+50) to study the effect of Sp1 on the promoter-mediated transcription of FOXO3 (E). GFP-Sp1 overexpression significantly enhanced the luciferase activity indicating that Sp1 positively regulated FOXO3 transcription (E). However FOXO3 mRNA and protein levels decreased as shown in C. The data shown in indicated that Sp1 increased miR-182 expression which suggests that post-transcriptional processing contributes to the regulation of FOXO3 expression. Thus the 3'-UTR of FOXO3 might play an important role in stabilizing FOXO3 mRNA and in FOXO3 translation. Consequently a luciferase reporter construct containing the 3?-UTR of FOXO3 was generated. GFP-Sp1 overexpression reduced the luciferase activity (F). Furthermore the stability of the luciferase mRNA containing the 3?-UTR sequence of FOXO3 decreased dramatically upon GFP-Sp1 overexpression (G). These results indicate that Sp1 regulates FOXO3 expression through transcriptional and post-transcriptional regulation with a net negative effect on FOXO3 expression. miR-182 inhibits lung cancer metastasis activity The data shown in indicated that miR-182 positively regulated lung cancer cell growth. Therefore the role of miR-182 in lung cancer metastasis was studied (Figure 6). The morphology of miRZip-182 cells was markedly altered: circular structures of actin filaments were absence and pseudopodia were enriched suggesting that miR-182 decreased the cells' migratory ability (Figure 6A). Indeed knockdown of miR-182 expression increased the migration ability of lung cancer cells suggesting that miR-182 inhibits lung cancer migration (Figure 6B). Moreover transwell migration assays showed that knockdown of miR-182 expression enhanced cell's invasive capacity (Figure 6C). In mice injected with miRZip-182-treated cells the knockdown of miR-182 expression also increased the number of nodules in the lung suggesting that miR-182 represses metastatic ability in vivo (Figure 6D). The effects of miR-182 knockdown were partially reversed by knockdown of FOXO3 suggesting that miR-182 functions as a suppressor of lung cancer metastasis by repressing FOXO3 expression (Figure 6E panel a). The endothelial-mesenchymal transition (EMT) marker N-cadherin increased after miR-182 knockdown but this effect was abolished by FOXO3 knockdown. Thus miR-182 might repress lung cancer metastasis by decreasing the expression of N-cadherin (Figure 6E panel b). However the expression of other genes regulated by miR-182 might also play a role in metastasis (Figure 6F and Supplementary Figure S3). Therefore we generated gene expression profiles using microarray analysis. Functional grouping analysis using DAVID bioinformatics resources showed that 19 of the genes differentially regulated by miR-182 knockdown were related to cell migration. The expression of these genes was increased in miR-182-knockdown cells indicating that they are potential targets of miR-182 (Figure 6F). Many metastasis-related genes such as CD44 CDH9 and ADAM9 were upregulated after the knockdown of miR-182 expression (Figure 6F). Figure 6 miR-182 attenuates lung cancer cell metastasis (A) Immunofluorescent staining of Alexa Fluor 568-conjugated phalloidin that is a high-affinity probe for F-actin (red) in miRZip and miRZip-182 stably expressed H1299 cells. DNA was stained with DAPI (blue). Stained cells were photographed under a fluorescence microscope at x 600 magnification. (B) Confluent monolayers of miRZip or miRZip-182 stably expressed H1299 cells were wounded and incubated for an additional 16 h (panel a). Migratory area was calculated for quantification (panel b). (C) The migration activities of H1299 cells (2 x 104) expressing miRZip or miRZip-182 were studied by Transwell chambers. (D) The miRZip or miRZip-182 stably expressed H1299 cells (4 x 106) were suspended in 100 ?l of PBS and injected into the lateral tail vein of SCID mice. After 8 weeks all mice were killed and the number of pulmonary tumor nodules was calculated after fixation of lungs with 4% formaldehyde for 48 h (panel a) and the number of pulmonary metastatic tumor nodules was counted (panel b). (E) FOXO3 and miR-182 in H1299 cells were knockdown by shFOXO3 and miRZip-182 respectively and then migration of cells (3 x 104) was studies by Transwell chambers (panel a). In addition cell lysates were harvested from FOXO3 and miR-182 knockdown cells for Western blotting using antibodies against N-cadherin ?-catenin vimentin FOXO3 and tubulin (panel b) respectively. (F) Heat map of the 19 of genes from miRZip and miRZip-182 microarray data the red color represents genes that are upregulated and the green color represents genes that are downregulated. The level of statistical significance determined by t-test (* p<0.05; ** p<0.01; *** p<0.001). DISCUSSION Our recent studies showed that Sp1 increased the growth of lung cancer cells but inhibits metastatic activity [23 32]. In the present study we found that Sp1 which accumulated in the early stages of cancer positively regulated miR-182 gene expression to silence FOXO3 expression and thereby promote cancer cell growth. In addition decreased levels of Sp1 in the late stages of cancer increased the expression of FOXO3 and N-cadherin leading to cancer metastasis (Figure 7). Figure 7 (A) Clinical samples from lung cancer patients of stage I and IV were used to study the Sp1 level by IHC staining with anti-Sp1 antibodies (B) Schematic diagram illustrates Sp1 regulates miR-182 to silence FOXO3 expression in early and late stages of lung cancer progression. Sp1 functions as a transcriptional activator by recruiting p300 to its target genes and as a repressor by the recruiting HDACs. Because Sp1 accumulates in several types of cancer including lung cancer [33] understanding the Sp1 transcriptional regulatory network may provide novel insights into the molecular origins and treatment of lung cancer. In our previous studies of lung cancer we found that Sp1 was highly upregulated in the early stages of cancer progression but partially down regulated in the late stages. Our previous studies also showed that regulation of Sp1 protein stability by phosphorylation and sumoylation contributed to its expression in the early and late stages of cancer respectively [32]. Kras activation and the Notch pathway might activate ERK1/2 to phosphorylate Sp1 thus stabilizing Sp1 in the early stages of cancer [32 34]. In the late stages Sp1 could be sumoylated leading to recruitment of its E3-ligase RNF4 followed by polyubiquitination and degradation [32]. To clarify the molecular mechanism underlying gene regulation by Sp1 we used microarray analysis to assess gene expression in KrasG12D-induced lung tumor transgenic mice and identified thousands of genes potentially regulated by Sp1 [23]. However some of the genes do not harbor a conserved Sp1 binding motif within their promoter region suggesting that another regulatory mechanism is involved in Sp1-mediated gene regulation. In this study we identified a novel pathway for Sp1-mediated activation wherein miR-182 expression downregulated the expression of FOXO3 a known miR-182 target gene [35]. Sp1 activated miR-182 and FOXO3 at the transcriptional level; however FOXO3 protein expression decreased. These results suggest that post-transcriptional regulation by miRNAs is a powerful mechanism by which to control the final level of protein expression. Many coding genes with Sp1 binding element(s) in their promoters harbor conserved miRNA target sequences in their 3'-UTR. To our knowledge this is first study to demonstrate that Sp1 regulates the expression of a target gene by regulating promoter activity and post-transcriptional processing in parallel. Few studies have characterized the regulation of miRNA by Sp1. Herein using a bioinformatics approach we identified several miRNAs potentially regulated by Sp1 including miR-182. We then showed that Sp1 specifically targets the miR-182 promoter region and activates miR-182 expression. miR-182 reportedly forms a gene cluster with two adjacent miRNAs (miR-96 and miR-183) [35]. The expression of miR-96 and miR-183 also decreased following Sp1 knockdown (Supplementary Figure S2A). Moreover we also investigated the binding of Sp1 to the miR-212 promoter because the latter contains 13 putative Sp1 binding sites (Supplementary Table S1). We found that Sp1 bound to the miR-212 promoter sequence (Supplementary Figure S2B and S2C). Interestingly a recent study showed that FOXO3 is a direct target of miR-212 in the neurons of patients with Alzheimer's disease [36]. miR-182 and miR-212 might cooperate to downregulate FOXO3 expression upon Sp1 overexpression. We cannot rule out this possibility. However depletion of miR-182 was sufficient to impair the Sp1-mediated reduction of FOXO3 expression in our experiments (C) suggesting that miR-182 is the major regulator of FOXO3 in lung cancer cells. Several studies have shown that miR-182 is upregulated in lung cancer. This suggests that miR-182 plays a positive role in lung tumorigenesis. However in two studies of miR-182 function in lung cancer miR-182 inhibited the proliferation of human lung adenocarcinoma cells [37 38]. Our results in this study provide several pieces of evidence to support the notion that miRNA-182 is a positive regulator of lung cancer cell proliferation. Firstly miR-182 was upregulated in the majority of lung cancer clinical samples and lung cancer cell lines examined. Secondly miR-182 knockdown inhibited cell cycle progression and cell growth. Finally miR-182 knockdown reduced lung tumor growth in vivo. Discrepancies in the role of miRNA-182 in lung cancer cell proliferation might derive from the different experimental designs of the studies. For example because miR-182 expression is upregulated in lung cancer we knocked down its expression and examined the effects on cancer cell proliferation. However other studies that described a negative role of miR-182 in lung cancer used miR-182 overexpression to study miR-182's role in cancer cell proliferation. Overexpression conditions can alter the function of many genes [39]. For example Sp1 accumulates in most of cancers; knockdown of Sp1 expression decreases cell proliferation but Sp1 overexpression also attenuates cancer cell growth [40]. Because post-translational modifications affect protein function overexpressed proteins might not be completely processed which could affect their function. Previous studies in melanoma and hepatocellular carcinoma indicated that miR-182 enhanced tumor metastasis [35 41]. However our data as shown in Figure 6 indicated that miR-182 knockdown altered cell morphology and increased migration and invasion activities. In addition miR-182 knockdown increased N-cadherin levels suggesting that miR-182 promotes the mesenchymal to epithelial transition (MET) [42]. Previous studies have shown that TIMP-2 enhances the E-cadherin/?-catenin complex in A549 lung cancer cells [43]. Whether Sp1 or miR-182 regulates TIMP-1 in lung cancer needs to be addressed in future studies. Finally miR-182 levels were lower in CL1-5 cells then in CL1-0 cells resulting in increased metastatic activity in CL1-5. Collectively our data suggest that miR-182 inhibits lung cancer metastasis. Our previous study indicated that Sp1 is down regulated in the late stages of lung cancer progression [32]. Therefore in the late stages of lung tumorigenesis miR-182 expression was down regulated compared with expression in the early stages which led to tumor metastasis through at least in part an increase in FOXO3 expression. It is still not clear why miR-182 has different roles in different types of cancer; this awaits further study. Although we found that FOXO3 is involved in miR-182-mediated lung cancer progression FOXO3 knockdown did not completely abolish the effects of miR-182 knockdown suggesting that other genes regulated by miR-182 contribute to the inhibition of metastasis by miR-182. With this in mind we determined the expression profile of miR-182-regulated genes. Many metastasis-related genes were induced in miR-182-knockdown cells including CD44 ADAM9 and CDH9. CD44 which localizes to the cell membrane is reportedly involved in cell migration in various cancer types [44]."
Lung_Cancer
"Division of Anatomic and Molecular Pathology Division of Laboratory and Genomic Medicine 660 Euclid Ave. #8118 St. Louis MO 63110. eduncavagepath.wustl.edu 1 7 2015 7 2014 16 4 405 417 6 3 2014 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved. 2014 American Society for Investigative Pathology and the Association for Molecular Pathology This document may be redistributed and reused subject to certain conditions. The identification of recurrent gene rearrangements in the clinical laboratory is the cornerstone for risk stratification and treatment decisions in many malignant tumors. Studies have reported that targeted next-generation sequencing assays have the potential to identify such rearrangements; however their utility in the clinical laboratory is unknown. We examine the sensitivity and specificity of ALK and KMT2A (MLL) rearrangement detection by next-generation sequencing in the clinical laboratory. We analyzed a series of seven ALK rearranged cancers six KMT2A rearranged leukemias and 77 ALK/KMT2A rearrangement“negative cancers previously tested by fluorescence in situ hybridization (FISH). Rearrangement detection was tested using publicly available software tools including Breakdancer ClusterFAST CREST and Hydra. Using Breakdancer and ClusterFAST we detected ALK rearrangements in seven of seven FISH-positive cases and KMT2A rearrangements in six of six FISH-positive cases. Among the 77 ALK/KMT2A FISH-negative cases no false-positive identifications were made by Breakdancer or ClusterFAST. Further we identified one ALK rearranged case with a noncanonical intron 16 breakpoint which is likely to affect its response to targeted inhibitors. We report that clinically relevant chromosomal rearrangements can be detected from targeted gene panel“based next-generation sequencing with sensitivity and specificity equivalent to that of FISH while providing finer-scale information and increased efficiency for molecular oncology testing. Biomed Res Int Biomed Res Int BMRI BioMed Research International 2314-6133 2314-6141 Hindawi Publishing Corporation 24524077 3913339 10.1155/2014/485067 Research Investigating the Feasibility of Rapid MRI for Image-Guided Motion Management in Lung Cancer Radiotherapy http://orcid./0000-0002-3275-4160 Sawant Amit 1 * Keall Paul 2 Pauly Kim Butts 3 Alley Marcus 3 Vasanawala Shreyas 3 Loo Jr. Billy W. 3 Hinkle Jacob 4 Joshi Sarang 4 1University of Texas Southwestern Medical Center Dallas TX 75235 USA 2University of Sydney Sydney NSW 2006 Australia 3Stanford University Stanford CA 95305 USA 4University of Utah Salt Lake City UT 84112 USA *Amit Sawant: amit.sawantutsouthwestern.edu Academic Editor: Jack Yang 2014 12 1 2014 2014 485067 17 4 2013 6 11 2013 7 11 2013 Copyright 2014 Amit Sawant et al. 2014 This is an open access distributed under the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. Cycle-to-cycle variations in respiratory motion can cause significant geometric and dosimetric errors in the administration of lung cancer radiation therapy. A common limitation of the current strategies for motion management is that they assume a constant reproducible respiratory cycle. In this work we investigate the feasibility of using rapid MRI for providing long-term imaging of the thorax in order to better capture cycle-to-cycle variations. Two nonsmall-cell lung cancer patients were imaged (free-breathing no extrinsic contrast and 1.5?T scanner). A balanced steady-state-free-precession (b-SSFP) sequence was used to acquire cine-2D and cine-3D (4D) images. In the case of Patient 1 (right midlobe lesion ~40?mm diameter) tumor motion was well correlated with diaphragmatic motion. In the case of Patient 2 (left upper-lobe lesion ~60?mm diameter) tumor motion was poorly correlated with diaphragmatic motion. Furthermore the motion of the tumor centroid was poorly correlated with the motion of individual points on the tumor boundary indicating significant rotation and/or deformation. These studies indicate that image quality and acquisition speed of cine-2D MRI were adequate for motion monitoring. However significant improvements are required to achieve comparable speeds for truly 4D MRI. Despite several challenges rapid MRI offers a feasible and attractive tool for noninvasive long-term motion monitoring. 1. Introduction Respiratory motion causes significant uncertainties in tumor delineation radiotherapy (RT) dose calculations and delivery particularly in the case of thoracic tumors (e.g. lung liver) [1]. The management of respiratory motion has been an active area of research over the last decade. Several investigational as well as clinically implemented respiratory motion management strategies have been described in the literature [1]. However a common limitation of most of these strategies is that they rely on image-guidance techniques that make simplifying assumptions about respiratory motion and do not adequately capture cycle-to-cycle variations which invariably occur in all patients. Modern motion-managed radiotherapy typically uses four-dimensional computed tomography (4DCT) as the tool of choice for pretreatment anatomic imaging (also termed as œCT simulation or œCT-sim in the literature). In this technique Lung_Cancer CT projections are acquired over several respiratory cycles from successive œslabs in the body. At the same time an external surrogate (e.g. an optical marker) records the amplitude of respiration. Based on the surrogate motion trace the reconstructed slices are sorted into 6“10 volumes over a single respiratory average cycle where each volume represents a specific phase of respiration (inhalation through exhalation) [2“4]. This retrospectively reconstructed œmovie of a single respiratory cycle serves as the anatomical ground truth for all subsequent stages of radiotherapy (contouring treatment planning and dose delivery). It is well recognized however that respiratory motion is far more complex than can be characterized by a single average cycle. Cycle-to-cycle variations such as baseline shifts and changes in the amplitude and/or frequency of the respiratory waveform are inadequately accounted for in 4DCT-based planning and can lead to significant geometric and therefore dosimetric errors [5]. Furthermore binning CT projection data acquired over several cycles into a single cycle leads to severe image artifacts. For example Yamamoto et al. found that 45 of 50 patients had at least one artifact with mean magnitude of 11.6?mm (range: 4.4“56.0?mm) [6]. In a separate study Persson et al. found that 4DCT artifacts caused significant uncertainties in the delineation of the gross tumor volume (GTV) in 16 out of 19 patients [7]. Finally the equivalent dose for 4DCT is quite high (29“40?mSv) about 4 times higher than that for 3DCT (3“10?mSv) [8]. Such high imaging dose discourages long-term monitoring and frequent imaging. Due to these limitations 4DCT-based image guidance provides an incomplete picture of respiration-induced spatial and temporal changes in the thoracic anatomy. The aim of this work is to investigate the feasibility of using rapid magnetic resonance imaging (MRI) as a nonionizing imaging modality to capture long-term and/or frequent information about respiratory motion and its effects on the movement and deformation of lung tumors and surrounding critical ans. The fundamental difference and therefore advantage of cine MRI are that unlike 4DCT the MR image (i.e. slice or volume) is acquired prospectively thereby capturing an actual instance of the patient anatomy which is closer to reality compared to an average estimate of the anatomical state that is represented by 4DCT. Prospective acquisition also enables MRI to overcome the two main challenges that limit the utility of 4DCT images namely the ability to capture cycle-to-cycle variations and elimination of binning-related image artifacts. In addition due to the fact that MRI does not involve ionizing radiation there is no dose penalty for repeated imaging (as opposed to 4DCT). The use of rapid cine-2D as well as 4D MRI for radiotherapy guidance has been previously reported in the literature. In cine-2D MRI a slice of the anatomy is selected at arbitrary orientation and imaged repeatedly in time. 4D MRI is conceptually similar except that in this case an entire volume is selected and imaged. Plathow et al. have reported cine-2D imaging of lung cancer patients at ~3 frames per second (fps) [9] and 4D imaging of malignant pleural mesothelioma patients at ~1 volume/s [10] under slow-breathing conditions using a 1.5?T scanner. Von Siebenthal et al. have reported on a 4D MR imaging technique using retrospective stacking of cine-2D slices [11]. Biederer et al. report 4D MRI of a ventilated chest phantom that uses porcine lung with embedded agarose nodules to simulate tumors [12]. More recently Cai et al. have reported a 4D MRI study of a moving phantom using a technique that uses retrospective sorting of cine-2D slices [13]. To our knowledge there has been no systematic study of rapid lung MRI in the context of image-guided radiotherapy (IGRT) motion management under realistic (prospective acquisition free-breathing human subjects) conditions. In this work we present a pilot investigation of prospective rapid cine-2D and cine-3D (commonly termed as œ4D in radiotherapy and the MRI literature) MRI of two nonsmall-cell lung cancer (NSCLC) patients under free-breathing conditions without externally administered contrast. Subsequently we compute and analyze the motion trajectories of tumors and structures of interest. Our current goal is to demonstrate the feasibility and the utility of rapid MR imaging to monitor respiratory motion over multiple cycles and obtain guidance information about the motion deformation and the interplay between lung tumors and surrounding critical ans. Our long-term goal (beyond the current scope) is to use the information obtained from rapid MRI to augment and potentially correct 4DCT images. 2. Methods 2.1. Imaging of NSCLC Patients Two NSCLC patients were imaged following informed consent. Patient number 1 was a 67-year old female with an ~40?mm diameter right midlobe tumor. Patient number 2 was an 80-year old male with an ~60?mm diameter left upper-lobe tumor. Both patients were scanned on a 1.5?T scanner (GE Signa). Both patients were scanned in the supine position under free-breathing conditions and without externally administered contrast. For each patient a 4-channel cardiac coil was centered around the tumor. cine-2D time series in the coronal and sagittal planes were acquired using a balanced steady-state free precession (b-SSFP) sequence and the images were reconstructed using the vendor's in-built software. In all cases except one (Patient number 1 coronal series) half-Fourier acquisition was used in order to achieve higher imaging speed. In the case of Patient number 2 an additional 3D+t (4D) scan of a tumor-inclusive coronal slab (8 slices each 5?mm thick) was acquired using the b-SSFP sequence in the 3D mode and in conjunction with parallel imaging (acceleration = 4). The 4D images were reconstructed using the autocalibrating reconstruction for Cartesian imaging (ARC) algorithm [14]. Table 1 summarizes the image acquisition parameters for the cine-2D and the 4D acquisitions. 2.2. Motion Analysis For each time series from Table 1 the motion trajectories of the tumor and structures of interest were determined as follows. A fluid-flow-based deformable image registration previously validated for RT applications [15“17] was applied to each time series to compute deformation vector fields (DVFs) across the temporal dimension. In order to reduce errors and achieve high computation speed (i.e. fewer iterations) the registration was performed in two stages-rigid registration which accounted for gross translation and affine transformations of the tumor and ans followed by deformable registration which accounted mainly for tumor and an deformation. For each time series a reference image was selected (typically at mid-inhale) and ~15 points each on the tumor boundary and the diaphragm were manually selected. Subsequently the motion trajectory of each pixel on a contour was determined from the DVFs. The validity of using diaphragmatic motion as a surrogate for tumor motion was examined by calculating the correlation between the average motion trajectory of the pixels comprising the diaphragm boundary with the average trajectory of the pixels comprising the tumor boundary. The presence of complex motion such as tumor rotation and/or deformation was tested by comparing the motion trajectory of the tumor centroid with those of the selected points on the tumor boundary. 3. Results and Discussion Figure 1 shows MR images acquired from Patient number 1 (Figures 1(a) and 1(b)) and Patient number 2 (Figures 1(c) and 1(d)). The acquisition times per image ranged from ~0.15 to 0.27?s”speeds adequate for monitoring most respiratory motion. In each case the tumor mass (indicated by an arrow) can be clearly delineated against the background of lung parenchyma."
Lung_Cancer
"The overfitting characterizing AIC-selected models in scenarios of simple exposure“lag“response dependencies does not seriously affect its performance a result in line with previous findings 18. However AIC-selected models also suffer from bias and undercoverage of confidence intervals to some extent. Part of this seems to be related to the limited flexibility of the functions applied in the simulation study and may be described as a smoothing problem rather that an inherent limitation of the estimators. It should also be noted that the simulation study only evaluates a limited set of exposure“response and lag“response shapes simulated under the assumption of independency. Different functions such as cubic splines and more complex exposure“lag“response surfaces will be assessed in future simulation studies. Also an extension of DLNMs with penalized splines characterized by higher flexibility can be explored as well exploiting previous research on bivariate smoothing techniques 3031. A related problem is about the inferential procedures being conditional on a posteriori selection of the best-fitting model. Previous studies on unidimensional models have proposed a correction for the inflation of type I errors in tests on a constant effect along lags 1727. However this approach is not easily extended to the bidimensional setting of exposure“lag“response associations and the definition of a hypothesis testing procedure for DLNMs is left to future developments. Although a posteriori selection may also be a source of undercoverage of confidence intervals its impact seems to be limited if compared with that associated with lack of fit at least in the simple scenarios investigated in the simulation study. Another limitation is the lack of a formal testing procedure on the hypothesis of independency. As suggested in Section 3.4 a graphical assessment of the proportionality of exposure“response and lag“response curves such as those in can help investigating the issue. Further research is needed to provide more consistent inferential procedures in this setting. The analysis of the temporal evolution of the risk associated with protracted time-varying exposures has straightforward applications in different research fields. For example the DLNM methodology may be used to characterize the risk of chronic exposures to occupational or environmental factors to differentiate the role of exposures sustained at different ages in life course studies or to define the temporal frame of beneficial or adverse effects of drugs in clinical trials and pharmaco-epidemiology. The development of this methodology and software implementation provide a promising analytical tool for biomedical research. 6. Software and data All the analyses presented in this paper were performed using the R software version 3.0.1 32. The DLNM modeling framework is fully implemented in the package dlnm 25 by using the expressly extended version 2.0.0. The permutational algorithm for simulating time-to-event data in the presence of time-varying exposures is implemented in the package PermAlgo 29 version 1.0. Both packages are available through R from its central repository. The data of the Colorado Plateau uranium miners cohort in the form of a comma-separated values file is included in the supporting information¡ together with the R scripts for the analysis performed in the example and the simulation study of Sections 3“4 which are entirely reproducible. In particular the script example.R provides a short illustration of the modeling framework. Versions of the scripts updated to future versions of the dlnm package will be available at http://www.ag-myresearch.com. Distributed lag non-linear models were originally conceived and developed for describing temperature“health associations in time series data by Ben Armstrong. The data from the Colorado Plateau uranium miners cohort were collected by the researchers of National Institute for Occupational Safety and Health. I am grateful to Bryan Langholz for kindly making data and documentation available. The simulation study was performed using the high-processing computing system at the London School of Hygiene and Tropical Medicine. The final version of this has been substantially improved following the comments of an unknown reviewer. This research was supported by a Methodology Research fellowship by Medical Research Council-UK (grant ID G1002296). References 1 Goodman PG Dockery DW Clancy L Cause-specific mortality and the extended effects of particulate pollution and temperature exposure Environmental Health Perspectives 2004 112 2 179 185 14754572 2 Elliott P Shaddick G Wakefield JC de Hoogh C Briggs DJ Long-term associations of outdoor air pollution with mortality in Great Britain Thorax 2007 62 12 1088 1094 17666438 3 Collet JP Sharpe C Belzile E Boivin JF Hanley J Abenhaim L Colorectal cancer prevention by non-steroidal anti-inflammatory drugs: effects of dosage and timing British Journal of Cancer 1999 81 1 62 8 10487613 4 Abrahamowicz M Bartlett G Tamblyn R du Berger R Modeling cumulative dose and exposure duration provided insights regarding the associations between benzodiazepines and injuries Journal of Clinical Epidemiology 2006 59 4 393 403 16549262 5 Checkoway H Pearce N Hickey JL Dement JM Latency analysis in occupational epidemiology Archives of Environmental Health 1990 45 2 95 100 2334237 6 Thomas DC Models for exposure-time-response relationships with applications to cancer epidemiology Annual Review of Public Health 1988 9 451 482 7 Breslow NL Day NE Statistical Methods in Cancer Research 1987 II Lyon International Agency for Reasearch on Cancer (IARC) 232 271 The desing and analysis of cohort studies chap. 6: Modelling the relationship between risk dose and time 8 Thomas DC Brown CC Chu KC Goldsmith DF Saracci R Proceedings of a symposium on time-related factors in cancer epidemiology Journal of Chronic Diseases 1987 40 Suppl. 2 1S 211S 9 Thomas DC Statistical Methods in Environmental Epidemiology 2009 New York Oxford University Press 279 300 chap. 13: Mechanistic models 10 Thomas DC Statistical methods for analyzing effects of temporal patterns of exposure on cancer risks Scandinavian Journal of Work Environment & Health 1983 9 4 353 366 11 Vacek PM Assessing the effect of intensity when exposure varies over time Statistics in Medicine 1997 16 5 505 513 9089959 12 Langholz B Thomas D Xiang A Stram D Latency analysis in epidemiologic studies of occupational exposures: application to the Colorado Plateau uranium miners cohort American Journal of Industrial Medicine 1999 35 3 246 256 9987557 13 Richardson DB Latency models for analyses of protracted exposures Epidemiology 2009 20 3 395 399 19262389 14 Hauptmann M Wellmann J Lubin JH Rosenberg PS Kreienbrock L Analysis of exposure-time-response relationships using a spline weight function Biometrics 2000 56 4 1105 1108 11129467 15 Hauptmann M Berhane K Langholz B Lubin J Using splines to analyse latency in the Colorado Plateau uranium miners cohort Journal of Epidemiology and Biostatistics 2001 6 6 417 424 11831677 16 Hauptmann M Pohlabeln H Lubin JH Jockel KH Ahrens W Bruske-Hohlfeld I Wichmann HE The exposure-time-response relationship between occupational asbestos exposure and lung cancer in two German case-control studies American Journal of Industrial Medicine 2002 41 2 89 97 11813213 17 Sylvestre MP Abrahamowicz M Flexible modeling of the cumulative effects of time-dependent exposures on the hazard Statistics in Medicine 2009 28 27 3437 3453 19708037 18 Abrahamowicz M Beauchamp ME Sylvestre MP Comparison of alternative models for linking drug exposure with adverse effects Statistics in Medicine 2012 31 11-12 1014 1030 22095719 19 Abrahamowicz M MacKenzie TA Joint estimation of time-dependent and non-linear effects of continuous covariates on survival Statistics in Medicine 2007 26 2 392 408 16479552 20 Berhane K Hauptmann M Langholz B Using tensor product splines in modeling exposure-time-response relationships: Application to the Colorado Plateau Uranium Miners cohort Statistics in Medicine 2008 27 26 5484 5496 18613262 21 Almon S The distributed lag between capital appropriations and expenditures Econometrica 1965 33 178 196 22 Schwartz J The distributed lag between air pollution and daily deaths Epidemiology 2000 11 3 320 326 10784251 23 Armstrong B Models for the relationship between ambient temperature and daily mortality Epidemiology 2006 17 6 624 631 17028505 24 Gasparrini A Armstrong B Kenward MG Distributed lag non-linear models Statistics in Medicine 2010 29 21 2224 2234 20812303 25 Gasparrini A Distributed lag linear and non-linear models in R: the package dlnm Journal of Statistical Software 2011 43 8 1 20 22003319 26 Thomas DC Statistical Methods in Environmental Epidemiology 2009 New York Oxford University Press chap. 6: Modelling exposure-time-response relationships 27 Mahmud M Abrahamowicz M Leffondré K Chaubey Y Selecting the optimal transformation of a continuous covariate in Cox's regression: Implications for hypothesis testing Communications in Statistics: Simulation and Computation 2006 35 1 27 45 28 Breslow NL Day NE Statistical Methods in Cancer Research 1987 II Lyon International Agency for Reasearch on Cancer (IARC) 178 231 The desing and analysis of cohort studies chap. 5: Fitting models to continuous data 29 Sylvestre MP Abrahamowicz M Comparison of algorithms to generate event times conditional on time-dependent covariates Statistics in Medicine 2008 27 14 2618 2634 17918753 30 Wood SN Generalized Additive Models: an Introduction with R 2006 Chapman & Hall/CRC 31 Eilers PHC Currie ID Durban M Fast and compact smoothing on large multidimensional grids Computational Statistics and Data Analysis 2006 50 1 61 76 32 R Development Core Team R: A Language and Environment for Statistical Computing Lung_Cancer Background The development of a rash has been retrospectively associated with increased response and improved survival when treated with erlotinib at the standard dose of 150 mg per day. The objective of this trial was to evaluate the association of the activity of erlotinib in the first-line setting in patients with advanced non-small-cell lung cancer (NSCLC) with the development of a tolerable rash via dose escalation of erlotinib or tumor characteristics. Methods Patients with advanced NSCLC without prior systemic therapy were treated with erlotinib 150 mg orally per day. The dose was increased by 25 mg every two weeks until the development of grade 2/tolerable rash or other dose limiting toxicity. Tumor biopsy specimens were required for inclusion. Results The study enrolled 137 patients 135 were evaluable for safety and 124 were eligible and evaluable for response. Only 73 tumor samples were available for analysis. Erlotinib dose escalation occurred in 69/124 patients. Erlotinib was well tolerated with 70% of patients developing a grade 1/2 rash and 10% developing grade 3 rash. Response rate and disease control rate were 6.5% and 41.1% respectively. Median overall survival was 7.7 months. Toxicity and tumor markers were not associated with response. Grade 2 or greater skin rash and low pMAPK were associated with improved survival. Conclusions Overall survival was similar in this trial compared to first-line chemotherapy in this unselected patient population. Dose escalation to the development of grade 2 skin rash was associated with improved survival in this patient population. Bioinformatics Bioinformatics bioinformatics bioinfo Bioinformatics 1367-4803 1367-4811 Oxford University Press 25161229 4147902 10.1093/bioinformatics/btu449 btu449 Eccb 2014 Proceedings Papers Committee Original Papers Pathways and Molecular Networks Personalized identification of altered pathways in cancer using accumulated normal tissue data Ahn TaeJin 1 2 3 Lee Eunjin 1 2 Huh Nam 1 * Park Taesung 3 4 * 1Samsung Advanced Institute of Technology130 Suwon-si Gyeonggi-do 443-803 Korea 2Samsung Genome Institute Seoul 135-710 Korea 3Interdisciplinary Program in Bioinformatics and 4Department of Statistics Seoul National University Seoul South Korea *To whom correspondence should be addressed. 01 9 2014 22 8 2014 22 8 2014 30 17 i422 i429 © The Author 2014. Published by Oxford University Press. 2014 This is an Open Access distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial re-use distribution and reproduction in any medium provided the original work is properly cited. For commercial re-use please contact [email protected] Motivation: Identifying altered pathways in an individual is important for understanding disease mechanisms and for the future application of custom therapeutic decisions. Existing pathway analysis techniques are mainly focused on discovering altered pathways between normal and cancer groups and are not suitable for identifying the pathway aberrance that may occur in an individual sample. A simple way to identify individual™s pathway aberrance is to compare normal and tumor data from the same individual. However the matched normal data from the same individual are often unavailable in clinical situation. Therefore we suggest a new approach for the personalized identification of altered pathways making special use of accumulated normal data in cases when a patient™s matched normal data are unavailable. The philosophy behind our method is to quantify the aberrance of an individual sample's pathway by comparing it with accumulated normal samples. We propose and examine personalized extensions of pathway statistics overrepresentation analysis and functional class scoring to generate individualized pathway aberrance score. Results: Collected microarray data of normal tissue of lung and colon mucosa are served as reference to investigate a number of cancer individuals of lung adenocarcinoma (LUAD) and colon cancer respectively. Our method concurrently captures known facts of cancer survival pathways and identifies the pathway aberrances that represent cancer differentiation status and survival. It also provides more improved validation rate of survival-related pathways than when a single cancer sample is interpreted in the context of cancer-only cohort. In addition our method is useful in classifying unknown samples into cancer or normal groups. Particularly we identified ˜amino acid synthesis and interconversion™ pathway is a good indicator of LUAD (Area Under the Curve (AUC) 0.982 at independent validation). Clinical importance of the method is providing pathway interpretation of single cancer even though its matched normal data are unavailable. Availability and implementation: The method was implemented using the R software available at our Web site: http://bibs.snu.ac.kr/ipas. Contact: [email protected] or [email protected] Supplementary information: Supplementary data are available at Bioinformatics online. 1 INTRODUCTIONCancer arises from normal cells and can evolve to become malignant metastatic and/or resistant to therapy. The analysis of altered pathways in an individual cancer patient may help to understand the disease status and suggest customized anticancer therapies.It is straightforward to compare the molecular profile of an individual™s tumor and normal cells to discover molecular aberrances specific to his/her cancer. However it may not be feasible in the current clinical practice environment to perform a metastatic tumor biopsy at the time of treatment resistance in patients with advanced cancer (Dancey et al. 2012). A case study of custom-tailored medicine based on an individual™s genome and transcriptome highlights this limitation (Jones et al. 2010). A patient™s tumor had metastasized to the lung after surgery at the primary site. A biopsy from his lung tumor was analyzed by mutation and transcription profiling; however the patient™s normal lung tissue was not biopsied. Because there was no matched normal tissue messenger RNA (mRNA) expression in the patient™s own blood and information collected from various normal tissues were used to identify differentially expressed genes (DEGs). The results of pathway analysis based on DEGs integrated copy number variation and mutation information led the doctor to change the patient™s drug treatment and the disease was stabilized for 3 months.Although the personalized interpretation of pathways can be demanding most current pathway analyses have been developed to investigate deregulated pathways between two phenotype groups. Khatri et al. (2012) classified these methods into three types: overrepresentation analysis (ORA) functional class scoring (FCS) and a pathway topology (PT)-based approach.ORA approaches typically apply an arbitrary threshold value (e.g. fold change >2 or P < 0.05) on gene expression to assess whether the number of genes beyond threshold are significantly over- or underrepresented in the given pathway. There are two drawbacks to ORA. First it uses only the most significant genes and discards others thus resulting in information loss for marginally significant genes (Breitling et al. 2004). Second it considers only the number of genes and does not consider the magnitude of expression changes leading to information loss regarding the importance of genes (e.g. a gene with a fold change of 2.01 and a gene with a fold change of 4 are considered equally). Unlike ORA FCS methods do not discard genes with an arbitrary threshold but use all available genes which is an improvement over ORA (Tian et al. 2005). PT methods are essentially based on FCS methods with the addition that they consider network topology information. They compensate for the common limitation of ORA and FCS in reporting false-positive gene sets due to sets of overlapping genes. In our we focus on ORA and FCS methods extending and implementing each for personalized pathway analysis.There are two exceptional studies examining individualized pathway analysis (Drier et al. 2013; Vaske et al. 2010). PARADIGM is a tool that infers a pathway status by using known functional structures. The method models the functional structure of pathway as a set of interconnected variables where the variables are omic objects such as DNA mRNA and protein where the interaction between variables describes the functional status of a pathway. PARADIGM may perform better with multiple omics as it uses known functional relationships between a gene or inter-gene DNA and protein. Hence it might not perform well with single layer omic data such as from mRNA microarrays.Drier et al. (2013) proposed a personal pathway deregulation score (PDS) which represents the distance of a single cancer sample from the median of normal samples on the principal curve. To calculate PDS they reduced the dimensions by principal component analysis and found the best principal curve using entire cohort samples containing both normal and/or different stages of cancers. Drier™s method performs better than PARADIGM in the mRNA only datasets of brain and colon cancers. Calculating PDS requires data dependent preprocessing steps including selecting the number of principal components to be used and filtering out noisy gene data to obtain optimized principal curves. PDS fully uses whole cohort data to interpret an individual™s pathway which can be a drawback in that it requires a number of cohort data to extract principal curve to interpret a single patient data. It has a limitation to interpret a single sample such as a patient™s recurrent tumor that is not accompanied with cohort dataset to extract the principal curve.Our proposed method is based on the comparison of one cancer sample with many accumulated normal samples (we use ˜nRef™ to refer to the accumulated normal samples) that is different from the previous studies in following sense. The proposed method is suitable to adopt single-layer omics data and expendable to interpret a patient in the context of many published or user-defined pathway gene sets. PARADIGM has less freedom in terms of data and gene sets as it prefers multi-layered omics data and requires predefined functional structure among omics objects. Unlike PDS which extracts the principal curve from entire cohort data our method does not assume an individual sample belongs to a cohort. We introduce using accumulated normal tissue data as a reference. This is a simple and biologically intuitive guideline in such a case to interpret a single sample that lack cohort data.Our method provides a series of analysis steps which consists of four parts: data processing gene-level statistics individualized pathway aberrance score (iPAS) and a significance test. To discover the most feasible method for iPAS we extend existing pathway analysis techniques namely ORA and FCS to properly reflect the nature of testing one cancer to many normal samples.To demonstrate that iPAS captures biologically and clinically relevant information in a sensible valid and useful manner we apply it to samples of lung and colon adenocarcinoma. We show that our representation generates clinically relevant stratifications and outcome predictors which would not have been achieved when the same data are analyzed by the conventional method that does not use accumulated normal data.Our empirical study suggests two different strategies depending on the biological question that iPAS is focused on. In the case of cancer diagnosis a method that uses the inter-gene correlation structure of the accumulated normal samples performs best. In the case of cancer prognosis a simple averaging of all member genes™ standardized gene expression values performs best.2 METHODS AND MATERIALS2.1 Gene expression dataWe built nRef by the manual curation of data obtained from NCBI GEO (Barrett et al. 2012). Microarray data of adjacent normal tissues obtained from patients undergoing surgery were selected to serve as the nRef. Data from biopsied samples primary cultures of normal tissues and post-mortem donors were not included in the nRef. We collected 120 nRef for lung 60 from GSE19804 (Lu et al. 2011) 27 from GSE7670 (Su et al. 2007) and 33 from GSE10072 (Landi et al. 2008). Samples came from individuals with variable smoking histories and different ethnic backgrounds. We collected 101 nRef™ for colon concentrating on normal mucosa tissue samples from six datasets available at GEO. To evaluate the effectiveness of our method in survival analysis we used Beer™s data of 442 lung adenocarcinomas (LUADs) (Beer et al. 2002) to discover survival-related pathways and validated the associations of 61 LUAD samples of GSE8894 (Lee et al. 2008). The pathway based identification of LUAD were tested on 120 cancers and 120 normal samples of GSE19804 GSE7670 and GSE10071. Further validation was conducted with 48 cancers and 35 normal samples collected from GSE19188 (Hou et al. 2010) and GSE31547. For patient stratification by colon cancer differentiation status we used 566 microarrays of GSE39582 (Marisa et al. 2013) which provided in a separate manner 443 for discovery 123 for validation. GSE17536 (Smith et al. 2010) was also used for validation.2.2 Pathway dataInformation from gene sets representing biological pathways were obtained from REACTOME (Croft et al. 2011) which are also provided in the Molecular Signature Database (Subramanian et al. 2005). Pathways with small number of genes are more easily understood by human experts. We decided to filter out pathways of which gene set size is >97. The cutoff covers at least 80% of contents of each public pathway resources. Of 674 pathways in REACTOME 583 pathways (86.7%) remained after filtering by the gene set size.2.3 Individualized analysis using the nRefThe aim of our approach is to identify altered pathways in an individual by making use of the nRef. A schematic diagram of our method of individualized pathway analysis is described in Figure 1 and the following sections describe each step. Fig. 1.Schematic description of individualized pathway analysis using accumulated normal data (nRef). An individual™s tumor data are normalized with the nRef. Gene expression is standardized by mean and SD of the nRef. The iPAS is calculated from standardized gene expression values in the pathway. Null distribution calculated from the nRef provides significance2.3.1 Data preprocessing and gene-level statisticsExpression level was defined by using the robust multichip average (Irizarry et al. 2003). For datasets using different microarrays only those with probes in common from Affymetrix U133A to Affymetrix U133Plus 2.0 were used for further analysis. For individual tumor cases we performed quantile normalization (Bolstad et al. 2003) after combining the single tumor microarray with all nRef samples. In cases of genes with multiple probes gene expression level was summarized by averaging probe-level expression. Individual tumor sample gene expression was standardized using the mean and standard deviation of the reference.2.3.2 "
Lung_Cancer
"Discussion A previous study on metastatic RCC by Yuasa et al. demonstrated that: 1) smaller initial tumor size predicted a good response to TKIs; 2) the greatest response was achieved in patients with lung lesions; and 3) there was no difference in tumor response between patients treated with sorafenib and sunitinib [6]. However these results raised several specific questions. First tumor histology and progression risk may affect the response to TKIs. TKIs are associated with a good response in patients with CCRCC but are less effective against non-CCRCC [10]. Similarly patients with favorable risk factors have a greater chance of a good tumor response than those with poorer risk factors. Second there is the possibility of bias in terms of the types of TKI selected; given that sunitinib showed a higher response rate than sorafenib [78] patients with larger or more rapidly-growing tumors may be allocated sunitinib rather than sorafenib in clinical practice. Third efficacy based on initial tumor size may differ between different ans; although the previous study compared mean lesion-size reductions between different ans they did not compare the effect of initial tumor size in individual ans. It is therefore unclear if the association between initial lesion size and tumor response was observed in each an or if the association could be attributed to the fact that most of the small lesions were lung metastases which showed a good response to TKIs. The current study only included CCRCC patients treated with sunitinib. We found that lung lesions showed the greatest response to sunitinib and detected a modest correlation between initial tumor diameter and reduction in lesion size while even small lesions in other ans failed to respond. However the number of extra-pulmonary tumors assessed was too small to determine statistical significance and further studies with larger numbers of tumors are needed to obtain conclusive results. Only lesions with an initial diameter?<?20 mm achieved a CR in this study indicating that a lung-tumor reduction of?>?50% might be limited to smaller lesions. The cut-off value of 16.5 mm for a?>?50% reduction in diameter was calculated using ROC analysis with a sensitivity of 67.0% and a specificity of 77.8%. Some physicians may prefer conservative therapies without TKIs or a watchful waiting strategy in CCRCC patients with only small lung metastatic lesions [11]. Furthermore cytokine therapies are still employed in CCRCC patients especially in Japan because of their low toxicity and ability to achieve long-term stable disease [12]. However the present results suggest that smaller lung lesions are associated with a greater chance of response to TKIs and it is therefore important not to miss the opportunity for early initiation of TKI treatment in patients with PD during watchful waiting periods or cytokine therapy. Several studies have investigated the response of primary kidney lesions to TKIs [13-15]. Kroon et al. reported that smaller primary lesions were more responsive to treatment and that tumors of 5“7 cm may benefit from neoadjuvant treatment followed by nephron-sparing surgery. In contrast our results showed that the response of kidney lesions to sunitinib was independent of initial tumor size and many smaller lesions exhibited no response. A possible explanation for this difference may be the selection of patients; most of the kidney lesions were investigated in the neoadjuvant setting in Kroon et al.™s study while all the patients with kidney lesions in the current study had an extensive metastatic tumor burden. The different patient backgrounds may have led to different responses to TKIs particularly in small kidney lesions. CRP is an acute phase protein produced by the liver in response to various conditions such as inflammation infection and malignancy [16]. In the cytokine era elevated serum CRP level has been suggested as a biomarker for predicting poor survival in RCC patients [17-19]. Yasuda et al. recently demonstrated that CRP was a significant predictive marker for prognosis in metastatic RCC patients treated with TKIs [20]. In the current study the size reduction of lung lesions in patients with high serum CRP levels was lower than that in patients with low CRP levels irrespective of the initial size. This lower response to sunitinib in patients with higher serum CRP levels may be attributed to an aggressive disease status reflected by higher CRP levels the acquisition of resistance to therapeutic agents through an increase in inflammatory mediators in the cancer-cell microenvironment or compromised drug metabolism induced by such mediators associated with CRP [21]. Tumor response to treatment is currently assessed by imaging based on RECIST criteria [22]. However although marked central necrosis is often detected in lesions with a small size reduction after treatment with TKIs RECIST only considers one-dimensional lesional size changes suggesting that it may substantially underestimate the actual tumor response. Several studies recently reported novel criteria which may improve response assessment by evaluating changes in tumor attenuation and morphology on contrast-enhanced computed tomography scans in addition to size changes [522-26]. The results of this study therefore need to be interpreted carefully because lesions in different ans may exhibit distinct response patterns in imaging. Moreover the current study did not demonstrate an association between tumor response and patient survival and it is possible that percent change in tumor size might not correlate directly with survival. Further studies are needed to determine the influence of an-specific response patterns to TKI treatment on survival. Conclusions The results suggest that tumor-size reduction depends on initial tumor size and the ans involved as well as systemic reaction to the lung tumor as indicated by CRP levels. CCRCC patients with lung metastatic lesions?<?20 mm in diameter and lower CRP levels may achieve greater reductions in tumor size with sunitinib therapy than those with extra-pulmonary lesions lung lesions???20 mm in diameter and/or higher CRP levels. Abbreviations RCC: Renal cell carcinoma; TKI: Tyrosine kinase inhibitor; RECIST: Response evaluation criteria in solid tumors; CCRCC: Clear cell RCC; CTC-AE: Common Terminology criteria for Adverse Events; ROC: Receiver-operator curve; AUC: Area under the curve; CRP: C-reactive protein. Competing interests Norihiko Tsuchiya and Tomonori Habuchi received honoraria from Pfizer Japan Inc. Authors™ contributions NT TY JY and TH were involved in the conception and design of the study. TY KN MS and SM were involved in the provision of patients™ clinical data. NT and TH drafted the manuscript. SN TI SS supported the manuscript writing. All authors have read and approved the final manuscript. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2490/14/26/prepub Acknowledgements There were no external sources of funding. Akaza H Kawai K Tsukamoto T Fujioka T Tomita Y Kitamura T Ozono S Miki T Naito S Zembutsu H Successful outcomes using combination therapy of interleukin-2 and interferon-alpha for renal cell carcinoma patients with lung metastasis Jpn J Clin Oncol 2010 40 7 684 689 10.1093/jjco/hyq027 20382632 Flanigan RC Salmon SE Blumenstein BA Bearman SI Roy V McGrath PC Caton JR Jr Munshi N Crawford ED Nephrectomy followed by interferon alfa-2b compared with interferon alfa-2b alone for metastatic renal-cell cancer N Engl J Med 2001 345 23 1655 1659 10.1056/NEJMoa003013 11759643 Albiges L Oudard S Negrier S Caty A Gravis G Joly F Duclos B Geoffrois L Rolland F Guillot A Laguerre B Legouffe E Kohser F Dietrich PY Theodore CA Escudier B Complete remission with tyrosine kinase inhibitors in renal cell carcinoma J Clin Oncol 2012 30 5 482 487 10.1200/JCO.2011.37.2516 22231040 Staehler M Haseke N Zilinberg E Stadler T Karl A Siebels M Durr HR Siegert S Jauch KW Bruns CJ Stief CG Complete remission achieved with angiogenic therapy in metastatic renal cell carcinoma including surgical intervention Urol Oncol 2010 28 2 139 144 10.1016/j.urolonc.2009.03.033 19576802 Krajewski KM Guo M Van den Abbeele AD Yap J Ramaiya N Jagannathan J Heng DY Atkins MB McDermott DF Schutz FA Pedrosa I Choueiri TK Comparison of four early posttherapy imaging changes (EPTIC; RECIST 1.0 tumor shrinkage computed tomography tumor density Choi criteria) in assessing outcome to vascular endothelial growth factor-targeted therapy in patients with advanced renal cell carcinoma Eur Urol 2011 59 5 856 862 10.1016/j.eururo.2011.01.038 21306819 Yuasa T Urakami S Yamamoto S Yonese J Nakano K Kodaira M Takahashi S Hatake K Inamura K Ishikwa Y Fukui I Tumor size is a potential predictor of response to tyrosine kinase inhibitors in renal cell cancer Urology 2011 77 4 831 835 10.1016/j.urology.2010.12.008 21316083 Motzer RJ Hutson TE Tomczak P Michaelson MD Bukowski RM Rixe O Oudard S Negrier S Szczylik C Kim ST Chen I Bycott PW Baum CM Figlin RA Sunitinib versus interferon alfa in metastatic renal-cell carcinoma N Engl J Med 2007 356 2 115 124 10.1056/NEJMoa065044 17215529 Escudier B Eisen T Stadler WM Szczylik C Oudard S Siebels M Negrier S Chevreau C Solska E Desai AA Rolland F Demkow T Hutson TE Gore M Freeman S Schwartz B Shan M Simantov R Bukowski RM Sorafenib in advanced clear-cell renal-cell carcinoma N Engl J Med 2007 356 2 125 134 10.1056/NEJMoa060655 17215530 Rini BI Escudier B Tomczak P Kaprin A Szczylik C Hutson TE Michaelson MD Gorbunova VA Gore ME Rusakov IG Negrier S Ou YC Castellano D Lim HY Uemura H Tarazi J Cella D Chen C Roosbrook B Kim S Motzer RJ Comparative effectiveness of axitinib versus sorafenib in advanced renal cell carcinoma (AXIS): a randomised phase 3 trial Lancet 2011 378 9807 1931 1939 10.1016/S0140-6736(11)61613-9 22056247 Tannir NM Plimack E Ng C Tamboli P Bekele NB Xiao L Smith L Lim Z Pagliaro L Araujo J Aparicio A Matin S Wood CG Jonasch E A phase 2 trial of sunitinib in patients with advanced Non-clear cell renal cell carcinoma Eur Urol 2012 62 6 1013 1019 10.1016/j.eururo.2012.06.043 22771265 Chin AI Lam JS Figlin RA Belldegrun AS Surveillance strategies for renal cell carcinoma patients following nephrectomy Rev Urol 2006 8 1 1 7 16985554 Fujioka T Obara W Evidence-based clinical practice guideline for renal cell carcinoma: the Japanese Urological Association 2011 update Int J Urol 2012 19 6 496 503 10.1111/j.1442-2042.2012.03031.x 22621218 van der Veldt AA Meijerink MR van den Eertwegh AJ Bex A de Gast G Haanen JB Boven E Sunitinib for treatment of advanced renal cell cancer: primary tumor response Clin Cancer Res 2008 14 8 2431 2436 10.1158/1078-0432.CCR-07-4089 18413834 Kroon BK de Bruijn R Prevoo W Horenblas S Powles T Bex A Probability of downsizing primary tumors of renal cell carcinoma by targeted therapies is related to size at presentation Urology 2012 81 1 111 115 23153934 Abel EJ Culp SH Tannir NM Tamboli P Matin SF Wood CG Early primary tumor size reduction is an independent predictor of improved overall survival in metastatic renal cell carcinoma patients treated with sunitinib Eur Urol 2011 60 6 1273 1279 10.1016/j.eururo.2011.07.008 21784574 Gabay C Kushner I Acute-phase proteins and other systemic responses to inflammation N Engl J Med 1999 340 6 448 454 10.1056/NEJM199902113400607 9971870 Bromwich E McMillan DC Lamb GW Vasey PA Aitchison M The systemic inflammatory response performance status and survival in patients undergoing alpha-interferon treatment for advanced renal cancer Br J Cancer 2004 91 7 1236 1238 10.1038/sj.bjc.6602152 15354220 Casamassima A Picciariello M Quaranta M Berardino R Ranieri C Paradiso A Lorusso V Guida M C-reactive protein: a biomarker of survival in patients with metastatic renal cell carcinoma treated with subcutaneous interleukin-2 based immunotherapy J Urol 2005 173 1 52 55 10.1097/01.ju.0000146713.50673.e5 15592024 Ramsey S Lamb GW Aitchison M Graham J McMillan DC Evaluation of an inflammation-based prognostic score in patients with metastatic renal cancer Cancer 2007 109 2 205 212 10.1002/cncr.22400 17149754 Yasuda Y Saito K Yuasa T Kitsukawa S Urakami S Yamamoto S Yonese J Takahashi S Fukui I Prognostic impact of pretreatment C-reactive protein for patients with metastatic renal cell carcinoma treated with tyrosine kinase inhibitors Int J Clin Oncol 2012 18 5 884 889 22886358 Slaviero KA Clarke SJ Rivory LP Inflammatory response: an unrecognised source of variability in the pharmacokinetics and pharmacodynamics of cancer chemotherapy Lancet Oncol 2003 4 4 224 232 10.1016/S1470-2045(03)01034-9 12681266 Eisenhauer EA Therasse P Bogaerts J Schwartz LH Sargent D Ford R Dancey J Arbuck S Gwyther S Mooney M Rubinstein L Shankar L Dodd L Kaplan R Lacombe D Verweij J New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1) Eur J Cancer 2009 45 2 228 247 10.1016/j.ejca.2008.10.026 19097774 Han KS Jung DC Choi HJ Jeong MS Cho KS Joung JY Seo HK Lee KH Chung J Pretreatment assessment of tumor enhancement on contrast-enhanced computed tomography as a potential predictor of treatment outcome in metastatic renal cell carcinoma patients receiving antiangiogenic therapy Cancer 2010 116 10 2332 2342 20225226 Nathan PD Vinayan A Stott D Juttla J Goh V CT response assessment combining reduction in both size and arterial phase density correlates with time to progression in metastatic renal cancer patients treated with targeted therapies Cancer Biol Ther 2010 9 1 15 19 10.4161/cbt.9.1.10340 20009542 Hittinger M Staehler M Schramm N Ubleis C Becker C Reiser M Berger F Course of size and density of metastatic renal cell carcinoma lesions in the early follow-up of molecular targeted therapy Urol Oncol 2012 30 5 695 703 10.1016/j.urolonc.2010.10.011 21865061 Choi H Charnsangavej C Faria SC Macapinlac HA Burgess MA Patel SR Chen LL Podoloff DA Benjamin RS Correlation of computed tomography and positron emission tomography in patients with metastatic gastrointestinal stromal tumor treated at a single institution with imatinib mesylate: proposal of new computed tomography response criteria J Clin Oncol 2007 25 13 1753 1759 10.1200/JCO.2006.07.3049 17470865 Oncol Rep Oncol. Rep Oncology Reports 1021-335X 1791-2431 D.A. Spandidos 24842630 4067423 10.3892/or.2014.3198 or-32-01-0033 Articles Identification of a novel HLA-A*02:01-restricted cytotoxic T lymphocyte epitope derived from the EML4-ALK fusion gene YOSHIMURA MAYUKO 1 2 TADA YOSHITAKA 1 3 OFUZI KAZUYA 1 YAMAMOTO MASAKAZU 2 NAKATSURA TETSUYA 1 3 1Division of Cancer Immunotherapy Exploratory Oncology Research and Clinical Trial Center National Cancer Center Kashiwa Chiba 277-8577 Japan 2Department of Gastroenterological Surgery Tokyo Women™s Medical University Shinzyukuku Tokyo 162-8666 Japan 3Research Institute for Biomedical Sciences Tokyo University of Science Chiba 278-0022 Japan Correspondence to: Dr Tetsuya Nakatsura Division of Cancer Immunotherapy Exploratory Oncology Research and Clinical Trial Center National Cancer Center 6-5-1 Kashiwanoha Kashiwa Chiba 277-8577 Japan E-mail: [email protected] 7 2014 19 5 2014 19 5 2014 32 1 33 39 21 3 2014 23 4 2014 Copyright © 2014 Spandidos Publications 2014 This is an open-access article licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License. The article may be redistributed reproduced and reused for non-commercial purposes provided the original source is properly cited. Cancer immunotherapy is a promising new approach to cancer treatment. It has been demonstrated that a high number of tumor-specific cytotoxic T cells (CTLs) is associated with increased disease-specific survival in lung cancer patients. Identification of superior CTL epitopes from tumor antigens is essential for the development of immunotherapy for malignant tumors. The EML4-ALK fusion gene was recently identified in a subset of non-small cell lung cancers (NSCLCs). In this study we searched for HLA-A*02:01- and HLA-A*24:02-restricted epitopes derived from EML4-ALK by screening predicted EML4-ALK-derived candidate peptides for the induction of tumor-reactive CTLs. Nine EML4-ALK-derived peptides were selected by a computer algorithm based on a permissive HLA-A*02:01 or HLA-A*24:02 binding motif. One of the nine peptides induced peptide-specific CTLs from human peripheral blood mononuclear cells. We were able to generate a peptide-specific CTL clone. This CTL clone specifically recognized peptide-pulsed T2 cells and H2228 cells expressing HLA-A*02:01 and EML4-ALK that had been treated with IFN-? 48 h prior to examination. CTL activity was inhibited by an anti-HLA-class I monoclonal antibody (W6/32) consistent with a class I-restricted mechanism of cytotoxicity. These results suggest that this peptide (RLSALESRV) is a novel HLA-A*02:01-restricted CTL epitope and that it may be a new target for antigen-specific immunotherapy against EML4-ALK-positive cancers. EML4-ALK"
Lung_Cancer
"TP53 17(22.4%) 7(41.2%) 1(16.7%) 9(17.3%) 0(0.0%) VHL 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) Missense mutation distribution in the exons and functional domains of EGFR Out of 76 sequenced lung cancer samples 36.1% of EGFR mutations were missense along exon 19 50.0% were missense along exon 21 5.6% along exon 20 and 8.3% along exon 18 (Fig. 2A). These mutations were in and around the tyrosine kinase domain of EGFR (Fig. 2B“3C). Activating mutations in the tyrosine kinase domain of the EGFR gene stimulates protein tyrosine kinase which leads to activation of signaling pathways associated with cell growth and survival. Mutations in the extracellular domain of EGFR is often associated with the amplification of genes in other cancers [12]. 57.7% of EGFR-associated lung cancers were adenocarcinomas () and 86.7% of EGFR mutations associated with ˜high differentiation™ cancers (). In our sample set 50% of EGFR-associated lung cancers metastasized to local regions 27.3% to lymphs and 46.2% of cancers metastasized to distant ans in our sample set (). .0095228.g002 Missense mutation distribution in the exons and function domains of EGFR. A. Frequencies of detected mutations in different exons. B. Mutation distribution in exons. C. Mutation distribution in functional domains. .0095228.g003 Missense mutation distribution in the exons and function domains of KRAS. A. Frequencies of detected mutations in different exons. B. Mutation distribution in exons. C. Mutation distribution in functional domains. Missense mutation distribution in the exons and functional domains of KRAS Out of 76 sequenced Lung cancer samples 100% of KRAS mutations were missense along exon 2 (Fig. 3A). The 34G>T mutations result in an amino acid substitution at position 12 in KRAS from a glycine (G) to a cysteine (C) or a valine (V). The 64C>A mutation results in an amino acid substitution at position 22 from a glutamine (Q) to a lysine (K) in KRAS. All of these amino acid substitutions occurred along the GTP binding domain of KRAS (Fig. 3A“C). KRAS binds to GTP in the active state and possesses an intrinsic enzymatic activity which cleaves the terminal phosphate of the nucleotide converting it to GDP. Upon conversion of GTP to GDP KRAS is turned off [13]. The result of these mutations is constitutive activation of KRAS signaling pathways. Once it is turned on it recruits and activates proteins necessary for the propagation of growth factor and other receptors' signal such as c-Raf and PI3-kinase [13]. 7.7% of KRAS-associated lung cancers were adenocarcinomas () and 6.1% of KRAS mutations associated with ˜low differentiation™ cancers and 7.4% of KRAS mutations were ˜mid differentiation™ cancers (). In our sample set 6.3% of KRAS-associated lung cancers metastasized to local regions 9.1% to lymphs and 5.1% of cancers metastasized to distant ans in our sample set (). Missense mutation distribution in the exons and functional domains of TP53 Abnormality of the TP53 gene is one of the most significant events in lung cancers and plays an important role in the tumorigenesis of lung epithelial cells. The p53 tumor suppressor gene is located on 17p13 chromosome and spans 20 kb genomic DNA encompassing 11 exons that encodes for a 53KD phosphoprotein [14]. Most TP53 mutations cluster in the TP53 DNA-binding domain which encompasses exons 5 through 8 and spans approximately 180 codons or 540 nucleotides and is not limited to a few particular sequences or codons along this gene [15]. TP53 incurred several deleterious mutations in our sample set of 76 lung cancers mostly along the DNA-binding domain encoded from exon 5 (27.8%) 6 (16.7%) 7 (33.3%) 8 (16.7%) and along the oligomerization domain encoded from exon 10 (15.6%) (Fig. 4A“C). Most TP53 missense mutations lead to the synthesis of a stable protein which lacks its specific DNA-binding and transactivation function and accumulates in the nucleus of cells. Such mutant proteins become inactive and lack the ability to transactivate the downstream target genes that regulate cell cycle and apoptosis [16]. Apart from these mutations affecting the role of TP53 as a tumor-suppressor protein TP53 mutations also endow the mutant protein with ˜gain-of-function™ (GOF) activities which can contribute actively to various stages of tumor progression including distant metastases and to increased resistance to anticancer treatments [17]“[19]. 50.0% of TP53-associated lung cancers were squamous cell carcinoma () and 20.0% of TP53 mutations associated with ˜high differentiation™ cancers and 25.9% of TP53 mutations were ˜mid differentiation™ cancers (). In our sample set 25.0% of TP53-associated lung cancers metastasized to local regions 54.5% to lymphs and 12.8% of cancers metastasized to distant ans in our sample set (). .0095228.g004 Missense mutation distribution in the exons and function domains of TP53. A. Frequencies of detected mutations in different exons. B. Mutation distribution in exons. C. Mutation distribution in functional domains. Multiple mutations and mutation hot spots in human lung cancers Clinical success with individualized combination therapy relies on the identification of mutational combinations and patterns for co-administration of a single or combination of target agents against the detected mutational combinations. Some of the mutations detected in our tumor group through sequencing analysis were not only recurrent and frequent but also occurred in combination with other mutations. Lung cancers in our sample set contained the following: 64.5% of samples had at least one or more missense mutations 19.7% had at least two or more missense mutations 3.9% had at least three or more missense mutations 1.3% had at least four or more missense mutations and 35.5% of samples incurred no deleterious mutations in any of the screened 13500 loci of the potential tumor suppressor and oncogenes (). .0095228.t007 Single and multiple missense mutations (including coding silent/deletion/insertion) in genes of 76 human lung cancer samples. Mutations combination (including Missense point mutations/deletion/insertion) Number of samples with mutation combination Percentage in all sequenced samples Single and more 49 64.50% Double and more 15 19.70% Three and more 3 3.90% Four and more 1 1.30% Five and more 0 0.00% No missense deletion insert or substitution-nonsense 27 35.50% Discussion As lung cancer is the most prevalent cancer and leading cause of cancer deaths worldwide ongoing efforts are aimed to improve prevention diagnosis and effective treatment options for patients with lung cancer. Currently there are a range of treatment options for lung cancer patients with surgery being the most effective for treatment of NSCLCs and chemotherapy with or without radiation therapies as the standard treatment for SCLCs. Because most SCLCs metastasize early to distant ans surgery is often ineffective in curing this cancer. NSCLCs on the other hand are more likely to remain localized during development and are thus are more effectively treated with surgical intervention. Additionally SCLCs are typically much more sensitive to chemotherapy and/or radiation therapy than are NSCLCs [20] [21]. One challenge in proper classification and treatment of lung cancer is the extreme heterogeneity caused by differing genetic biological and clinical properties including response to treatment with over 50 histological variants recognized by the WHO typing system [22] [23]. Because of this correct classification of lung cancer cases is necessary to assure that patients receive optimum management [24]. Due to of these various levels of heterogeneity generalized treatments may be less effective. Alternatively targeted therapy which involves the usage of specially designed drugs to selectively target molecular pathways correlated with the malignant phenotype of lung cancer cells may be more useful [25]. Several genes commonly found to be mutated in various lung cancers have been reported including ALK/ELM4 fusion K-ras EGFR VEGF and p53 yet the entire genetic profile of each form is still not been fully defined [3]. This indicates the necessity of sequencing individual human lung cancers in order to match the use of a single targeted drug or two or more targeted drugs in combination against individual lung cancer-specific mutations. In this study we have used Ion Ampliseq Cancer Panel to sequence 13500 loci in 45 cancer-related genes mainly oncogenes and tumor suppressor genes of 76 human lung cancer samples. We identified frequent mutations in a group of genes including EGFR KRAS and TP53 (). Although most of these genes were already known to be associated with lung cancers the mutated points and the associated mutations in other genes were different in our sample set (Tables 7). As there is increasing awareness about the changes in lung cancer cells in recent times newer drugs that specifically target these changes have been developed. These targeted drugs either work synergistically with the chemotherapy drugs or by themselves with much lesser toxicity due to a selective effect as an alternative to a more systemic modulation of proteins associated with oncogenesis. EGFR inhibitors (Afatinib Erlotinib and Gefitinib) and VEGF inhibitors (Bevacizumab) are currently used for target therapies for NSCLC patients with mutations in the VEGF and EGFR [26]. Erlotinib is a drug that blocks EGFR from signaling the cell to grow. It prevents the progression of lung cancer specifically in non-smoking women and is mostly used in advanced NSCLC treatment that was not responsive to chemotherapy. It is also used as the first treatment in patients whose cancers have a mutation in the EGFR gene [27]. Cetuximab is a monoclonal antibody that targets EGFR which is also used in advanced NSCLC in combination with standard chemotherapy as part of first-line treatment [28]. Like erlotinib afatinib is a drug that blocks the growth signal from EGFR and used for advanced NSCLCs that have mutations in the EGFR gene [29]. Some younger non-smokers with adenocarcinomas are found to have an ALK/EML4 fusion oncogene which is currently a target for the drug Crizotinib [30]. Other drugs currently used to treat lung cancers are not gene-specific and instead target general molecular pathways like folate anitmetabolites (methotrexate and pemetrexed) mitotic inhibitors (docetaxel piclitaxel and vinorelbine) topoisomerase inhibitors (etopophos and topotecan) and nucleoside analogs which interfere with DNA synthesis (carboplatin cisplatin and gemciabine) [31] [32]. Inhibitors of EGFR-directed tyrosine kinase are established to be an effective treatment option for advanced NSCLC not responding to chemotherapy. However EGFR-directed monoclonal antibodies in combination with platinum-based first-line chemotherapy cetuximab combined with cisplatin/vinorelbine and bevacizumab in combination with platinum-based chemotherapy resulted in better survival compared to chemotherapy alone in patients with advanced EGFR-positive NSCLC [33]. Other targeted therapies including dual and multi-kinase inhibitors are in earlier stages of clinical development [34]. With the accumulation of knowledge and experience in next generation technologies it is necessary to expand our understanding in the sensitivity of specific mutations to individualized therapies. "
Lung_Cancer
"All the experiments were repeated three times. The data are presented as means ± SEM. Colony formation assay Cells were seeded in triplicate at 300 cells/well in a 6-well plate. After 7 days of culture the cells were washed twice with NaCl (0.9%) stained with 2% gentian violet for 20 min washed with water and air-dried. Foci were counted by microscopy. The experiments were repeated three times and data are presented as means ± SEM. Soft-agar assay Cells (1000) were seeded into 6-well plates in 2 mL of growth medium containing 0.3% agar and used to overlay 1.4-mL layers of growth medium containing 0.6% agar. After 21 days of culture the colonies were counted. All the experiments were repeated three times. The data are presented as means ± SEM. Cell cycle analysis Cells were harvested washed with cold PBS twice and fixed in 70% ethanol at “20°C overnight. The cells were then centrifuged (1500 rpm 10 min) and washed twice using phosphate-buffered saline (PBS). Next the cells were resuspended in 0.5 mL of PBS containing 50 µg/mL RNase A for 1 h at 37°C. The cells were then loaded with 65 ?g/mL PI for 30 min in the dark at 4°C. The percentage of cells in different phases of the cell cycle was measured by flow cytometry (Beijing Determination of Traditional Chinese Medicine Research Institute). The experiments were repeated three times. The data are presented as means ± SEM. Western blotting Cells were digested with trypsin and centrifuged. The cell pellet was washed twice with PBS. Next the cells were disrupted in lysis buffer (10 mM Tris-HCl pH 7.4 1 mM EDTA 0.1% Triton X-100 0.1% SDS and 1— protease inhibitor cocktail) on ice for 15 min and centrifuged at 12000 rpm for 20 min. Insoluble material was removed and protein concentrations were determined using a bicinchoninic acid kit. For Western blot analysis cell lysates (30 ?g/well) were subjected to SDS-PAGE and transferred to nitrocellulose filter membranes. The membranes were incubated with primary antibodies (anti-PAX6 -ERK1/2 p38 -pERK -pp38 -cyclin D1 -RB or -RB S780 phosphorylation) overnight at 4°C. Secondary antibodies conjugated with horseradish peroxidase were subsequently used. Signals were detected using ECL and exposed to Kodak X-OMAT film. The results were scanned and analyzed using Alpha View Analysis Tools. Statistical analysis All values are expressed as the mean ± SEM. Through real-time RT-PCR MTS assay colony formation soft-agar assays cell cycle analysis and western-blot assay for comparison between means of 2 groups statistical differences were tested with unpaired Student t-tests. Statistical significance was tested using SPSS Statistics version 13.0. P<0.05 (*) was considered different; P<0.01 (**) was considered significantly different. Results PAX6 mRNA expression was inhibited in cells infected with the PAX6 shRNA lentiviral vector PAX6 mRNA expression was determined in this study. As shown in A PAX6 was highly expressed in most lung cancer cell lines. In contrast MRC-5 a normal human fetal lung fibroblast cell line did not express PAX6 (A). .0085738.g001 PAX6 mRNA was highly expressed in lung cancer cells and its expression was suppressed by pax6-shRNA. A Real-time PCR analysis for the PAX6 mRNA expression level in H460 A2 95C 95D H1299 H446 801 D A549 and L lung cancer lines as well as in the normal human fetal lung fibroblast cell line MRC-5. B -C Confirmation of PAX6 mRNA knockdown by real-time RT-PCR assays performed on total RNA isolated from A549 (B) and H1299 (C) cells infected with pax6-shRNA or a random shRNA. The PAX6 mRNA expression levels in A549 and H1299 cells were measured by quantitative real-time RT-PCR. The y-axis represents the normalized PAX6 mRNA expression relative to A549 (B) or H1299 (C) cells. **P < <0.01. D The protein levels of PAX6 were determined by western-blot and GAPDH expression level was used as a control. Quantification was made by determining the gray level of PAX6 protein which was normalized against GAPDH levels. Data are expressed as mean ±SEM of independent experiments (times of the experiments are listed above the histograms). "
Lung_Cancer
"The overfitting characterizing AIC-selected models in scenarios of simple exposure“lag“response dependencies does not seriously affect its performance a result in line with previous findings 18. However AIC-selected models also suffer from bias and undercoverage of confidence intervals to some extent. Part of this seems to be related to the limited flexibility of the functions applied in the simulation study and may be described as a smoothing problem rather that an inherent limitation of the estimators. It should also be noted that the simulation study only evaluates a limited set of exposure“response and lag“response shapes simulated under the assumption of independency. Different functions such as cubic splines and more complex exposure“lag“response surfaces will be assessed in future simulation studies. Also an extension of DLNMs with penalized splines characterized by higher flexibility can be explored as well exploiting previous research on bivariate smoothing techniques 3031. A related problem is about the inferential procedures being conditional on a posteriori selection of the best-fitting model. Previous studies on unidimensional models have proposed a correction for the inflation of type I errors in tests on a constant effect along lags 1727. However this approach is not easily extended to the bidimensional setting of exposure“lag“response associations and the definition of a hypothesis testing procedure for DLNMs is left to future developments. Although a posteriori selection may also be a source of undercoverage of confidence intervals its impact seems to be limited if compared with that associated with lack of fit at least in the simple scenarios investigated in the simulation study. Another limitation is the lack of a formal testing procedure on the hypothesis of independency. As suggested in Section 3.4 a graphical assessment of the proportionality of exposure“response and lag“response curves such as those in can help investigating the issue. Further research is needed to provide more consistent inferential procedures in this setting. The analysis of the temporal evolution of the risk associated with protracted time-varying exposures has straightforward applications in different research fields. For example the DLNM methodology may be used to characterize the risk of chronic exposures to occupational or environmental factors to differentiate the role of exposures sustained at different ages in life course studies or to define the temporal frame of beneficial or adverse effects of drugs in clinical trials and pharmaco-epidemiology. The development of this methodology and software implementation provide a promising analytical tool for biomedical research. 6. Software and data All the analyses presented in this paper were performed using the R software version 3.0.1 32. The DLNM modeling framework is fully implemented in the package dlnm 25 by using the expressly extended version 2.0.0. The permutational algorithm for simulating time-to-event data in the presence of time-varying exposures is implemented in the package PermAlgo 29 version 1.0. Both packages are available through R from its central repository. The data of the Colorado Plateau uranium miners cohort in the form of a comma-separated values file is included in the supporting information¡ together with the R scripts for the analysis performed in the example and the simulation study of Sections 3“4 which are entirely reproducible. In particular the script example.R provides a short illustration of the modeling framework. Versions of the scripts updated to future versions of the dlnm package will be available at http://www.ag-myresearch.com. Distributed lag non-linear models were originally conceived and developed for describing temperature“health associations in time series data by Ben Armstrong. The data from the Colorado Plateau uranium miners cohort were collected by the researchers of National Institute for Occupational Safety and Health. I am grateful to Bryan Langholz for kindly making data and documentation available. The simulation study was performed using the high-processing computing system at the London School of Hygiene and Tropical Medicine. The final version of this has been substantially improved following the comments of an unknown reviewer. This research was supported by a Methodology Research fellowship by Medical Research Council-UK (grant ID G1002296). References 1 Goodman PG Dockery DW Clancy L Cause-specific mortality and the extended effects of particulate pollution and temperature exposure Environmental Health Perspectives 2004 112 2 179 185 14754572 2 Elliott P Shaddick G Wakefield JC de Hoogh C Briggs DJ Long-term associations of outdoor air pollution with mortality in Great Britain Thorax 2007 62 12 1088 1094 17666438 3 Collet JP Sharpe C Belzile E Boivin JF Hanley J Abenhaim L Colorectal cancer prevention by non-steroidal anti-inflammatory drugs: effects of dosage and timing British Journal of Cancer 1999 81 1 62 8 10487613 4 Abrahamowicz M Bartlett G Tamblyn R du Berger R Modeling cumulative dose and exposure duration provided insights regarding the associations between benzodiazepines and injuries Journal of Clinical Epidemiology 2006 59 4 393 403 16549262 5 Checkoway H Pearce N Hickey JL Dement JM Latency analysis in occupational epidemiology Archives of Environmental Health 1990 45 2 95 100 2334237 6 Thomas DC Models for exposure-time-response relationships with applications to cancer epidemiology Annual Review of Public Health 1988 9 451 482 7 Breslow NL Day NE Statistical Methods in Cancer Research 1987 II Lyon International Agency for Reasearch on Cancer (IARC) 232 271 The desing and analysis of cohort studies chap. 6: Modelling the relationship between risk dose and time 8 Thomas DC Brown CC Chu KC Goldsmith DF Saracci R Proceedings of a symposium on time-related factors in cancer epidemiology Journal of Chronic Diseases 1987 40 Suppl. 2 1S 211S 9 Thomas DC Statistical Methods in Environmental Epidemiology 2009 New York Oxford University Press 279 300 chap. 13: Mechanistic models 10 Thomas DC Statistical methods for analyzing effects of temporal patterns of exposure on cancer risks Scandinavian Journal of Work Environment & Health 1983 9 4 353 366 11 Vacek PM Assessing the effect of intensity when exposure varies over time Statistics in Medicine 1997 16 5 505 513 9089959 12 Langholz B Thomas D Xiang A Stram D Latency analysis in epidemiologic studies of occupational exposures: application to the Colorado Plateau uranium miners cohort American Journal of Industrial Medicine 1999 35 3 246 256 9987557 13 Richardson DB Latency models for analyses of protracted exposures Epidemiology 2009 20 3 395 399 19262389 14 Hauptmann M Wellmann J Lubin JH Rosenberg PS Kreienbrock L Analysis of exposure-time-response relationships using a spline weight function Biometrics 2000 56 4 1105 1108 11129467 15 Hauptmann M Berhane K Langholz B Lubin J Using splines to analyse latency in the Colorado Plateau uranium miners cohort Journal of Epidemiology and Biostatistics 2001 6 6 417 424 11831677 16 Hauptmann M Pohlabeln H Lubin JH Jockel KH Ahrens W Bruske-Hohlfeld I Wichmann HE The exposure-time-response relationship between occupational asbestos exposure and lung cancer in two German case-control studies American Journal of Industrial Medicine 2002 41 2 89 97 11813213 17 Sylvestre MP Abrahamowicz M Flexible modeling of the cumulative effects of time-dependent exposures on the hazard Statistics in Medicine 2009 28 27 3437 3453 19708037 18 Abrahamowicz M Beauchamp ME Sylvestre MP Comparison of alternative models for linking drug exposure with adverse effects Statistics in Medicine 2012 31 11-12 1014 1030 22095719 19 Abrahamowicz M MacKenzie TA Joint estimation of time-dependent and non-linear effects of continuous covariates on survival Statistics in Medicine 2007 26 2 392 408 16479552 20 Berhane K Hauptmann M Langholz B Using tensor product splines in modeling exposure-time-response relationships: Application to the Colorado Plateau Uranium Miners cohort Statistics in Medicine 2008 27 26 5484 5496 18613262 21 Almon S The distributed lag between capital appropriations and expenditures Econometrica 1965 33 178 196 22 Schwartz J The distributed lag between air pollution and daily deaths Epidemiology 2000 11 3 320 326 10784251 23 Armstrong B Models for the relationship between ambient temperature and daily mortality Epidemiology 2006 17 6 624 631 17028505 24 Gasparrini A Armstrong B Kenward MG Distributed lag non-linear models Statistics in Medicine 2010 29 21 2224 2234 20812303 25 Gasparrini A Distributed lag linear and non-linear models in R: the package dlnm Journal of Statistical Software 2011 43 8 1 20 22003319 26 Thomas DC Statistical Methods in Environmental Epidemiology 2009 New York Oxford University Press chap. 6: Modelling exposure-time-response relationships 27 Mahmud M Abrahamowicz M Leffondré K Chaubey Y Selecting the optimal transformation of a continuous covariate in Cox's regression: Implications for hypothesis testing Communications in Statistics: Simulation and Computation 2006 35 1 27 45 28 Breslow NL Day NE Statistical Methods in Cancer Research 1987 II Lyon International Agency for Reasearch on Cancer (IARC) 178 231 The desing and analysis of cohort studies chap. 5: Fitting models to continuous data 29 Sylvestre MP Abrahamowicz M Comparison of algorithms to generate event times conditional on time-dependent covariates Statistics in Medicine 2008 27 14 2618 2634 17918753 30 Wood SN Generalized Additive Models: an Introduction with R 2006 Chapman & Hall/CRC 31 Eilers PHC Currie ID Durban M Fast and compact smoothing on large multidimensional grids Computational Statistics and Data Analysis 2006 50 1 61 76 32 R Development Core Team R: A Language and Environment for Statistical Computing Lung_Cancer Background The development of a rash has been retrospectively associated with increased response and improved survival when treated with erlotinib at the standard dose of 150 mg per day. The objective of this trial was to evaluate the association of the activity of erlotinib in the first-line setting in patients with advanced non-small-cell lung cancer (NSCLC) with the development of a tolerable rash via dose escalation of erlotinib or tumor characteristics. Methods Patients with advanced NSCLC without prior systemic therapy were treated with erlotinib 150 mg orally per day. The dose was increased by 25 mg every two weeks until the development of grade 2/tolerable rash or other dose limiting toxicity. Tumor biopsy specimens were required for inclusion. Results The study enrolled 137 patients 135 were evaluable for safety and 124 were eligible and evaluable for response. Only 73 tumor samples were available for analysis. Erlotinib dose escalation occurred in 69/124 patients. Erlotinib was well tolerated with 70% of patients developing a grade 1/2 rash and 10% developing grade 3 rash. Response rate and disease control rate were 6.5% and 41.1% respectively. Median overall survival was 7.7 months. Toxicity and tumor markers were not associated with response. Grade 2 or greater skin rash and low pMAPK were associated with improved survival. Conclusions Overall survival was similar in this trial compared to first-line chemotherapy in this unselected patient population. Dose escalation to the development of grade 2 skin rash was associated with improved survival in this patient population. Bioinformatics Bioinformatics bioinformatics bioinfo Bioinformatics 1367-4803 1367-4811 Oxford University Press 25161229 4147902 10.1093/bioinformatics/btu449 btu449 Eccb 2014 Proceedings Papers Committee Original Papers Pathways and Molecular Networks Personalized identification of altered pathways in cancer using accumulated normal tissue data Ahn TaeJin 1 2 3 Lee Eunjin 1 2 Huh Nam 1 * Park Taesung 3 4 * 1Samsung Advanced Institute of Technology130 Suwon-si Gyeonggi-do 443-803 Korea 2Samsung Genome Institute Seoul 135-710 Korea 3Interdisciplinary Program in Bioinformatics and 4Department of Statistics Seoul National University Seoul South Korea *To whom correspondence should be addressed. 01 9 2014 22 8 2014 22 8 2014 30 17 i422 i429 © The Author 2014. Published by Oxford University Press. 2014 This is an Open Access distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial re-use distribution and reproduction in any medium provided the original work is properly cited. For commercial re-use please contact [email protected] Motivation: Identifying altered pathways in an individual is important for understanding disease mechanisms and for the future application of custom therapeutic decisions. Existing pathway analysis techniques are mainly focused on discovering altered pathways between normal and cancer groups and are not suitable for identifying the pathway aberrance that may occur in an individual sample. A simple way to identify individual™s pathway aberrance is to compare normal and tumor data from the same individual. However the matched normal data from the same individual are often unavailable in clinical situation. Therefore we suggest a new approach for the personalized identification of altered pathways making special use of accumulated normal data in cases when a patient™s matched normal data are unavailable. The philosophy behind our method is to quantify the aberrance of an individual sample's pathway by comparing it with accumulated normal samples. We propose and examine personalized extensions of pathway statistics overrepresentation analysis and functional class scoring to generate individualized pathway aberrance score. Results: Collected microarray data of normal tissue of lung and colon mucosa are served as reference to investigate a number of cancer individuals of lung adenocarcinoma (LUAD) and colon cancer respectively. Our method concurrently captures known facts of cancer survival pathways and identifies the pathway aberrances that represent cancer differentiation status and survival. It also provides more improved validation rate of survival-related pathways than when a single cancer sample is interpreted in the context of cancer-only cohort. In addition our method is useful in classifying unknown samples into cancer or normal groups. Particularly we identified ˜amino acid synthesis and interconversion™ pathway is a good indicator of LUAD (Area Under the Curve (AUC) 0.982 at independent validation). Clinical importance of the method is providing pathway interpretation of single cancer even though its matched normal data are unavailable. Availability and implementation: The method was implemented using the R software available at our Web site: http://bibs.snu.ac.kr/ipas. Contact: [email protected] or [email protected] Supplementary information: Supplementary data are available at Bioinformatics online. 1 INTRODUCTIONCancer arises from normal cells and can evolve to become malignant metastatic and/or resistant to therapy. The analysis of altered pathways in an individual cancer patient may help to understand the disease status and suggest customized anticancer therapies.It is straightforward to compare the molecular profile of an individual™s tumor and normal cells to discover molecular aberrances specific to his/her cancer. However it may not be feasible in the current clinical practice environment to perform a metastatic tumor biopsy at the time of treatment resistance in patients with advanced cancer (Dancey et al. 2012). A case study of custom-tailored medicine based on an individual™s genome and transcriptome highlights this limitation (Jones et al. 2010). A patient™s tumor had metastasized to the lung after surgery at the primary site. A biopsy from his lung tumor was analyzed by mutation and transcription profiling; however the patient™s normal lung tissue was not biopsied. Because there was no matched normal tissue messenger RNA (mRNA) expression in the patient™s own blood and information collected from various normal tissues were used to identify differentially expressed genes (DEGs). The results of pathway analysis based on DEGs integrated copy number variation and mutation information led the doctor to change the patient™s drug treatment and the disease was stabilized for 3 months.Although the personalized interpretation of pathways can be demanding most current pathway analyses have been developed to investigate deregulated pathways between two phenotype groups. Khatri et al. (2012) classified these methods into three types: overrepresentation analysis (ORA) functional class scoring (FCS) and a pathway topology (PT)-based approach.ORA approaches typically apply an arbitrary threshold value (e.g. fold change >2 or P < 0.05) on gene expression to assess whether the number of genes beyond threshold are significantly over- or underrepresented in the given pathway. There are two drawbacks to ORA. First it uses only the most significant genes and discards others thus resulting in information loss for marginally significant genes (Breitling et al. 2004). Second it considers only the number of genes and does not consider the magnitude of expression changes leading to information loss regarding the importance of genes (e.g. a gene with a fold change of 2.01 and a gene with a fold change of 4 are considered equally). Unlike ORA FCS methods do not discard genes with an arbitrary threshold but use all available genes which is an improvement over ORA (Tian et al. 2005). PT methods are essentially based on FCS methods with the addition that they consider network topology information. They compensate for the common limitation of ORA and FCS in reporting false-positive gene sets due to sets of overlapping genes. In our we focus on ORA and FCS methods extending and implementing each for personalized pathway analysis.There are two exceptional studies examining individualized pathway analysis (Drier et al. 2013; Vaske et al. 2010). PARADIGM is a tool that infers a pathway status by using known functional structures. The method models the functional structure of pathway as a set of interconnected variables where the variables are omic objects such as DNA mRNA and protein where the interaction between variables describes the functional status of a pathway. PARADIGM may perform better with multiple omics as it uses known functional relationships between a gene or inter-gene DNA and protein. Hence it might not perform well with single layer omic data such as from mRNA microarrays.Drier et al. (2013) proposed a personal pathway deregulation score (PDS) which represents the distance of a single cancer sample from the median of normal samples on the principal curve. To calculate PDS they reduced the dimensions by principal component analysis and found the best principal curve using entire cohort samples containing both normal and/or different stages of cancers. Drier™s method performs better than PARADIGM in the mRNA only datasets of brain and colon cancers. Calculating PDS requires data dependent preprocessing steps including selecting the number of principal components to be used and filtering out noisy gene data to obtain optimized principal curves. PDS fully uses whole cohort data to interpret an individual™s pathway which can be a drawback in that it requires a number of cohort data to extract principal curve to interpret a single patient data. It has a limitation to interpret a single sample such as a patient™s recurrent tumor that is not accompanied with cohort dataset to extract the principal curve.Our proposed method is based on the comparison of one cancer sample with many accumulated normal samples (we use ˜nRef™ to refer to the accumulated normal samples) that is different from the previous studies in following sense. The proposed method is suitable to adopt single-layer omics data and expendable to interpret a patient in the context of many published or user-defined pathway gene sets. PARADIGM has less freedom in terms of data and gene sets as it prefers multi-layered omics data and requires predefined functional structure among omics objects. Unlike PDS which extracts the principal curve from entire cohort data our method does not assume an individual sample belongs to a cohort. We introduce using accumulated normal tissue data as a reference. This is a simple and biologically intuitive guideline in such a case to interpret a single sample that lack cohort data.Our method provides a series of analysis steps which consists of four parts: data processing gene-level statistics individualized pathway aberrance score (iPAS) and a significance test. To discover the most feasible method for iPAS we extend existing pathway analysis techniques namely ORA and FCS to properly reflect the nature of testing one cancer to many normal samples.To demonstrate that iPAS captures biologically and clinically relevant information in a sensible valid and useful manner we apply it to samples of lung and colon adenocarcinoma. We show that our representation generates clinically relevant stratifications and outcome predictors which would not have been achieved when the same data are analyzed by the conventional method that does not use accumulated normal data.Our empirical study suggests two different strategies depending on the biological question that iPAS is focused on. In the case of cancer diagnosis a method that uses the inter-gene correlation structure of the accumulated normal samples performs best. In the case of cancer prognosis a simple averaging of all member genes™ standardized gene expression values performs best.2 METHODS AND MATERIALS2.1 Gene expression dataWe built nRef by the manual curation of data obtained from NCBI GEO (Barrett et al. 2012). Microarray data of adjacent normal tissues obtained from patients undergoing surgery were selected to serve as the nRef. Data from biopsied samples primary cultures of normal tissues and post-mortem donors were not included in the nRef. We collected 120 nRef for lung 60 from GSE19804 (Lu et al. 2011) 27 from GSE7670 (Su et al. 2007) and 33 from GSE10072 (Landi et al. 2008). Samples came from individuals with variable smoking histories and different ethnic backgrounds. We collected 101 nRef™ for colon concentrating on normal mucosa tissue samples from six datasets available at GEO. To evaluate the effectiveness of our method in survival analysis we used Beer™s data of 442 lung adenocarcinomas (LUADs) (Beer et al. 2002) to discover survival-related pathways and validated the associations of 61 LUAD samples of GSE8894 (Lee et al. 2008). The pathway based identification of LUAD were tested on 120 cancers and 120 normal samples of GSE19804 GSE7670 and GSE10071. Further validation was conducted with 48 cancers and 35 normal samples collected from GSE19188 (Hou et al. 2010) and GSE31547. For patient stratification by colon cancer differentiation status we used 566 microarrays of GSE39582 (Marisa et al. 2013) which provided in a separate manner 443 for discovery 123 for validation. GSE17536 (Smith et al. 2010) was also used for validation.2.2 Pathway dataInformation from gene sets representing biological pathways were obtained from REACTOME (Croft et al. 2011) which are also provided in the Molecular Signature Database (Subramanian et al. 2005). Pathways with small number of genes are more easily understood by human experts. We decided to filter out pathways of which gene set size is >97. The cutoff covers at least 80% of contents of each public pathway resources. Of 674 pathways in REACTOME 583 pathways (86.7%) remained after filtering by the gene set size.2.3 Individualized analysis using the nRefThe aim of our approach is to identify altered pathways in an individual by making use of the nRef. A schematic diagram of our method of individualized pathway analysis is described in Figure 1 and the following sections describe each step. Fig. 1.Schematic description of individualized pathway analysis using accumulated normal data (nRef). An individual™s tumor data are normalized with the nRef. Gene expression is standardized by mean and SD of the nRef. The iPAS is calculated from standardized gene expression values in the pathway. Null distribution calculated from the nRef provides significance2.3.1 Data preprocessing and gene-level statisticsExpression level was defined by using the robust multichip average (Irizarry et al. 2003). For datasets using different microarrays only those with probes in common from Affymetrix U133A to Affymetrix U133Plus 2.0 were used for further analysis. For individual tumor cases we performed quantile normalization (Bolstad et al. 2003) after combining the single tumor microarray with all nRef samples. In cases of genes with multiple probes gene expression level was summarized by averaging probe-level expression. Individual tumor sample gene expression was standardized using the mean and standard deviation of the reference.2.3.2 "
Lung_Cancer
"Urology 1471-2490 BioMed Central 24612599 3975282 1471-2490-14-26 10.1186/1471-2490-14-26 Research an-specific and tumor-size-dependent responses to sunitinib in clear cell renal cell carcinoma Tsuchiya Norihiko 1 tsuchiyamed.akita-u.ac.jp Yuasa Takeshi 2 takeshi.yuasajfcr.or.jp Maita Shinya 1 yamightyyahoo.co.jp Narita Shintaro 1 narishindoc.med.akita-u.ac.jp Inoue Takamitsu 1 takamitudoc.med.akita-u.ac.jp Numakura Kazuyuki 1 numakuradoc.med.akita-u.ac.jp Saito Mitsuru 1 mitsaitomed.akita-u.ac.jp Satoh Shigeru 1 shigerusdoc.med.akita-u.ac.jp Yonese Junji 2 jyonesejfcr.or.jp Habuchi Tomonori 1 thabuchidoc.med.akita-u.ac.jp 1Department of Urology Akita University Graduate School of Medicine Akita Japan 2Department of Urology Cancer Institute Hospital Japanese Foundation for Cancer Research Tokyo Japan 2014 11 3 2014 14 26 26 20 7 2013 28 2 2014 Copyright 2014 Tsuchiya et al.; licensee BioMed Central Ltd. 2014 Tsuchiya et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. Background Tyrosine kinase inhibitors (TKIs) have been used as standard therapy for patients with advanced renal cell carcinoma (RCC). However information on factors predicting response to treatment with TKIs is lacking. This study aimed to assess the association between initial tumor size involved ans pre-treatment C-reactive protein (CRP) levels and reduction in tumor size in patients with clear cell RCC (CCRCC) treated with sunitinib. Methods Patients with advanced CCRCC with target lesions with a maximum diameter???10 mm treated with sunitinib were evaluated. The tumor diameter representing the best overall response was designated as the post-treatment tumor diameter. Results A total of 179 lesions in 38 patients were analyzed. an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderate inverse association with percent reduction in post-treatment tumor diameter (R?=?0.341). Lung lesions showed significantly greater percent reductions in diameter than liver and kidney lesions (P?=?0.007 and 0.002 respectively). Furthermore based on a CRP cut-off level of 2.0 mg/dl mean tumor size reduction was significantly greater in patients with low CRP levels than in patients with high CRP levels in lesions with diameters?<?20 mm (P?=?0.002). CRP level had no effect on mean size reduction in lesions with a diameter???20 mm. Conclusions Patients with CCRCC with smaller lung metastatic lesions and lower CRP levels may achieve greater percent reductions in tumor size with sunitinib therapy than patients with extra-pulmonary lesions large lung lesions and/or higher CRP levels. Advanced renal cell carcinoma Sunitinib Tumor size Tumor response C-reactive protein Background In the era of cytokine therapy tumor response to treatment in advanced or metastatic renal cell carcinoma (RCC) has been reported to vary according to the ans involved [12]. Longer overall survival and a higher response rate to therapy with interferon-? or a combination of interleukin-2 and interferon-? were observed in patients with only lung metastasis compared with those with extra-pulmonary metastasis [12]. Complete remission (CR) after treatment with tyrosine kinase inhibitors (TKIs) which mainly target vascular endothelial growth factor receptors remains a rare event but most patients who do achieve CR have either lung metastasis alone or only lymph node involvement [34]. However most cancer clinical trials evaluate tumor response using the response evaluation criteria in solid tumors (RECIST) in which the longest diameters of target lesions in multiple ans are summed. Tumor response in individual metastatic lesions in specific ans has not been delineated. A reduction in tumor size >10% calculated as the sum of the longest diameter of the target lesions was significantly associated with both time to treatment failure and overall survival suggesting that size reduction of target lesions may predict the outcome of treatment with TKIs [5]. In addition Yuasa et al. recently demonstrated that a smaller initial tumor size predicted a good response to TKIs and that the maximum response was achieved in lung lesions [6]. TKIs have shown significant clinical benefit in advanced clear cell RCC (CCRCC) in large randomized trials [7-9]. However the reported objective responses vary according to the different types of TKIs and a recent phase II trial failed to demonstrate any clinical efficacy of sunitinib in non-CCRCC [10]. Tumor size reduction may thus be affected by many factors including initial tumor size involved ans tumor histology tumor aggressiveness or type of TKI used. In this study we evaluated the association between initial tumor size of individual lesions in specific ans and reduction in tumor size in patients with CCRCC treated with sunitinib. Methods Patients and tumor measurement A total of 38 patients with advanced CCRCC who received at least two cycles of sunitinib at Akita University Hospital and at the Cancer Institute Hospital of the Japanese Foundation for Cancer Research were enrolled in this institutional review-board-approved retrospective study. Pathological diagnosis was made by radical nephrectomy in 30 patients and by percutaneous biopsy in eight patients who were not indicated for surgical treatment because of a significantly higher total volume of metastatic lesions compared with the primary lesion. The initial dose of sunitinib was 50 mg/day which was reduced to 37.5 mg/day based on the patient™s physique age and performance status. Sunitinib was initiated on a 28 days on/14 days off schedule and a dose reduction to 25 mg/day or complete cessation was considered in the event of grade 3 or higher toxicity according to the Common Terminology Criteria for Adverse Events (CTC-AE). All lesions were evaluated using a multidetector computed tomography scanner and lesions???10 mm in diameter were considered target lesions. The maximum diameter of each target lesion was measured before treatment with sunitinib (pre-treatment tumor diameter) and every 2“3 months thereafter. The tumor diameter at the point when best overall response was achieved based on the RECIST version 1.0 was adopted as the post-treatment tumor diameter. In this study the most common metastatic ans including lung liver and lymph nodes as well as the kidney were subjected to analysis. Statistical analysis The association between pre-treatment tumor diameter and percent change between pre- and post-treatment tumor diameters for each lesion was assessed by Pearson™s correlation coefficient. The Kruskal Wallis test was used to compare differences in percent change in tumor diameter between the four different ans. The Mann“Whitney U test was used to compare differences between two groups. A receiver-operator curve (ROC) was constructed to find the pre-treatment tumor diameter predicting tumor response to sunitinib treatment. A value of P?<?0.05 was considered statistically significant. Results Patients and target lesions The patients included 30 men and eight women with a median age of 62 years (range 27“81 years). The patients™ characteristics are listed in . The best response to sunitinib treatment was CR in one patient (3%) partial response (PR) in 11 (29%) stable disease (SD) in 23 (61%) and progressive disease (PD) in three (8%). The objective response rate was 32% and the clinical benefit rate (CR?+?PR?+?SD for at least 3 months) was 92%. A total of 179 lesions ranging from 10 to 106 mm were measured and analyzed in 38 patients. These lesions were localized as follows: 124 in the lung 12 in the liver 24 in the lymph nodes and 19 in the kidney. Of the 15 patients with kidney tumors seven who underwent nephrectomy had target lesions in the contralateral kidney including two patients with multiple lesions. The remaining eight patients had primary kidney tumors that were diagnosed by percutaneous needle biopsy. Patients™ characteristics Characteristic No. of patients (%) Sex ??Male 30 (78.9) ??Female 8 (21.1) Age y ??Median [range] 62 [27“81] ECOG performance status ??0 25 (65.8) ??1 7 (18.4) ??> 1 6 (15.8) MSKCC risk category ??Favorable 8 (21.1) ??Intermediate 20 (52.6) ??Poor 10 (26.3) Target ans ??Lung 31 (81.6) ??Liver 6 (15.8) ??Lymph node 11 (28.9) ??Kidney 15 (39.5) Nephrectomy ??Yes 30 (78.9) ??No (biopsy) 8 (21.1) Prior treatments ??None 27 (71.1) ??Cytokines alone 4 (10.5) ??Sorafenib?±?cytokines 7 (18.4) Associations between pre-treatment tumor diameter and percent change in target lesion size in different ans The associations between pre-treatment tumor diameter and percent change in size of each target lesion in each of four ans were analyzed separately. an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderately positive association with percent change in post-treatment tumor diameter (R?=?0.341 Figure 1). There were fewer target lesions in the other three ans than in the lung and there was no association between liver lymph node or kidney lesion size and percent change in post-treatment tumor diameter (Figure 1). The percent changes in target lesion size differed significantly between the four individual ans (P?=?0.0007 by the Kruskal Wallis test). The mean (± SD) percent changes in target lesion size in the lung liver lymph nodes and kidney were ?27.1?±?33.5 0.5?±?29.4 ?16.7?±?19.6 and ?2.7?±?21.7 respectively. Target lesions in the lung showed the greatest change in size which was significantly greater than in the liver and kidney (P?=?0.007 and 0.002 respectively). There was no difference in the percent change in target lesion size between the lung and lymph nodes (P?=?0.114) (Figure 2). Figure 1 Association between pre-treatment tumor size and percent change in lesion size after sunitinib treatment. Association between pre-treatment tumor size and percent change in size was analyzed for lesions in the lung (a) liver (b) lymph nodes (c) and kidney (d). The pre-treatment size of lung lesions showed a moderately positive association with percent size change after treatment with sunitinib while no association was observed in the liver lymph nodes and kidney. Figure 2 Percent change in target lesion size in different ans. The reduction in lesion size was significantly greater in lung lesions compared with liver and kidney lesions. Lung lesions with an initial diameter?<?17.3 mm (median) showed a significant percent reduction in size compared with lesions???17.3 mm. No significant differences in relation to initial lesion size were observed in the liver lymph nodes and kidney. Lesions in each an were divided into two groups according to the median pre-treatment diameter and percent changes in tumor diameter were compared between the two groups. Lung lesions with a pre-treatment diameter less than the median value of 17.3 mm showed a significant percent reduction in diameter compared with tumors???17.3 mm (P?=?0.002). There were no differences in the percent change in relation to size above or below the median value in other ans (Figure 2). Cut-off value for pre-treatment tumor diameter predicting response to sunitinib in lung metastasis ROC curves were drawn to determine cut-off values predicting 30% and 50% reductions in the diameter of lung metastatic lesions (Figure 3). The cut-off predicting a 30% reduction in diameter was 16.5 mm with a sensitivity of 69.6% specificity of 58.2% and an area under the curve (AUC) of 0.662. The cut-off predicting a 50% reduction in diameter was also 16.5 mm with a sensitivity of 67.0% specificity of 77.8% and an AUC of 0.752. Using this cut-off value the percent change in lesion size for lesions?<?16.5 mm was ?41.7?±?35.5% while that for lesions???16.5 mm was ?16.2?±?26.9% (P?=?0.0005). Figure 3 Cut-off values of initial lung tumor size for predicting 30% and 50% reductions in diameter after sunitinib treatment. Based on ROC analysis the cut-off values of initial lung lesion size for predicting reductions in diameter of both 30% and 50% were 16.5 mm. Influence of pre-treatment CRP value cytoreductive nephrectomy and treatment line on percent change in target lesion size in the lung Metastatic lung lesions were categorized into two groups based on pre-treatment C-reactive protein (CRP) levels. The mean diameter and percent change in lesion size in patients with CRP?<?2.0 mg/ml were 19.0?±?9.3 mm and ?38.3?±?30.5% respectively while those in patients with CRP???2.0 mg/ml were 28.3?±?20.6 mm and ?9.6?±?33.9% respectively. The lesions were further divided into three subgroups according to pre-treatment diameter?<?20 mm ? 20 to?<?40 mm and???40 mm. Percent changes were compared between lesions in patients with CRP?<?2.0 mg/dl (low CRP) and those with CRP???2.0 mg/dl (high CRP) in each subgroup. For lesions?<?20 mm patients with low CRP had significantly greater reductions in tumor diameter than patients with high CRP (?43.8?±?33.4% vs. ?15.3?±?37.7% P?=?0.0019). In patients with lesions ?20 to?<?40 mm there was a tendency towards a greater reduction in patients with low CRP compared with high CRP though the difference was not significant (?29.0?±?17.3% vs. ?12.4?±?30.2% P?=?0.054) and similarly there was no significant association between tumor reduction and CRP level in patients with lesions???40 mm (?13.3?±?20.6 vs. 6.8?±?17.4 P?=?0.151) (Figure 4). Figure 4 Influence of CRP on percent change in lung lesion size. In patients with lung lesions?<?20 mm the percent reduction in size was significantly greater in patients with low compared with high CRP levels. Meanwhile CRP level had a marginal effect on size reduction in lesions???20 to?<?40 mm and no effect in lesions???40 mm. Percent changes in size were compared between lung lesions in patients in each diameter subgroup who did and did not undergo cytoreductive nephrectomy. There were no lung lesions???40 mm in patients who did not undergo cytoreductive nephrectomy. There was no significant difference between mean percent change in lesion size in patients with and without cytoreductive nephrectomy (?36.1?±?32.6 vs. ?28.2?±?41.9 P?=?0.421 and ?20.4?±?25.1 vs. ?32.0?±?21.9 P?=?0.307 in lesions?<?20 mm and???20 mm respectively). Similarly there was no significant difference in percent change in lesion size between lung lesions in patients treated as first-line therapy and those treated as second-line or later therapy in any diameter subgroup (?38.1?±?37.7 vs. ?32.1?±?33.9 P?=?0.280; ?23.5?±?21.6 vs. ?17.5?±?23.3 P?=?0.803; and 3.5?±?2.6 vs. 1.9?±?22.9 P?>?0.9 in lesions?<?20 mm ? 20 to?<?40 mm and???40 mm respectively)."
Lung_Cancer
" DLA and TTN contributed equally to this manuscript. # AJW and MVG share senior position authorship 15 7 2014 02 12 2013 1 2014 01 1 2015 12 1 111 118 Activated ALK and ROS1 tyrosine kinases through gene fusions has been found in lung adenocarcinomas and are highly sensitive to selective kinase inhibitors. This study aimed at identifying the presence of these rearrangements in human colorectal adenocarcinoma (CRC) specimens using a 4-target 4-color break-apart fluorescence in situ hybridization (FISH) assay to simultaneously determine the genomic status of ALK and ROS1. Among the clinical CRC specimens analyzed rearrangement-positive cases for both ALK and ROS1 were observed. The fusion partner for ALK was identified as EML4 and the fusion partner for one of the ROS1-positive cases was SLC34A2 the partner for the other ROS1-positive case remains to be identified. A small fraction of specimens presented duplicated or clustered copies of native ALK and ROS1. In addition rearrangements were detected in samples that also harbored KRAS and BRAF mutations in two of the three cases. Interestingly the ALK-positive specimen displayed marked intra-tumoral heterogeneity and rearrangement was also identified in regions of high-grade dysplasia. Despite the additional oncogenic events and tumor heterogeneity observed elucidation of the first cases of ROS1 rearrangements and confirmation of ALK rearrangements support further evaluation of these genomic fusions as potential therapeutic targets in CRC. Implications ROS1 and ALK fusions occur in colorectal cancer and may have substantial impact in therapy selection. J Vet Med Sci J. Vet. Med. Sci JVMS The Journal of Veterinary Medical Science 0916-7250 1347-7439 The Japanese Society of Veterinary Science 24389742 4064154 13-0434 10.1292/jvms.13-0434 Internal Medicine Note CT and PET-CT of a Dog with Multiple Pulmonary Adenocarcinoma KIM Jisun 1 KWON Seong Young 2 CENA Rohani 1 PARK Seungjo 1 OH Juyeon 1 OUI Heejin 1 CHO Kyoung-Oh 1 MIN Jung-Joon 2 CHOI Jihye 1 * 1)College of Veterinary Medicine Chonnam National University Gwangju 500“757 Korea 2)Department of Nuclear Medicine Chonnam National University Hwasun Hospital Jeonnam 519“763 Korea *Correspondence to: Choi J. College of Veterinary Medicine Chonnam National University Yongbong-ro Buk-gu Gwangju 500“757 South Korea. e-mail: imsonochonnam.ac.kr 31 12 2013 4 2014 76 4 615 620 28 8 2013 21 12 2013 2014 The Japanese Society of Veterinary Science 2014 This is an open-access distributed under the terms of the Creative Commons Attribution Non-Commercial No Derivatives (by-nc-nd) License. A 10-year-old intact female Yorkshire terrier had multiple pulmonary nodules on thoracic radiography and ultrasonography with no lesions elsewhere. Computed tomography (CT) and positron emission tomography and computed tomography (PET-CT) using 18F-fluorodeoxyglucose (FDG) were performed to identify metastasis and undetected primary tumors. On CT examination pulmonary nodules had a hypoattenuating center with thin peripheral enhancement suggesting ischemic or necrotizing lesion. In PET-CT at 47 min after intravenous injection of 11.1 MBq/kg of FDG the maximum standardized uptake value of each pulmonary nodule was about from 3.8 to 6.4. There were no abnormal lesions except for four pulmonary nodules on the CT and PET-CT. Primary lung tumor was tentatively diagnosed and palliative therapy using 2 mg/kg tramadol and 2.2 mg/kg carprofen twice per day was applied. After the dog™s euthanasia due to deteriorated clinical signs and poor prognosis undifferentiated pulmonary adenocarcinoma was diagnosed through histopathologic and immunochemistry examination. To the best of the authors™ knowledge this is the first study of CT and PET-CT features of canine pulmonary adenocarcinoma. In this case multiple pulmonary adenocarcinoma could be determined on the basis of FDG PET-CT through screening the obvious distant metastasis and/or lymph node invasions and excluding unknown primary tumors. computed tomography fluorodeoxyglucose multiple pulmonary nodules positron emission tomography pulmonary adenocarcinoma The etiology of lung masses including nodules (spots on the lung that are 3 cm in diameter or less) can be assumed on the basis of morphological characteristics and especially the number of masses can act as an important clue for differential diagnosis. Solitary masses may be primary lung tumor abscess granuloma or hematoma whereas multiple masses may be metastatic tumors septic emboli or parasitic granulomas [19]. However primary lung tumor can metastasize to lymph nodes distant ans or to other lung regions through hematogeneous or lymphatic routes or it can spread to adjacent lung tissues through local invasion [2 3]. Therefore primary lung tumor is not necessarily presented as a solitary mass but may also present itself as multiple masses or as in a disseminated form [414 15]. Surgical excision is the primary option for primary lung tumor regardless of whether solitary or multiple types are present and the goal of the surgery is to remove all the gross lesions. Therefore the primary lung tumor with multiple masses should be differentiated with metastatic lung tumors. When multiple masses are presented the largest one is usually considered to be the primary lesion. However if the masses™ sizes are equal it is impossible to determine which one is the origin [13]. Diagnostic imaging with high anatomic resolution such as computed tomography (CT) can be applied to evaluate the tumors in more detail to determine the treatment plan and prognostic factors through estimation of the tumor size lymph node involvement and pulmonary or distant metastasis [14]. Positron emission tomography (PET) a functional imaging modality can be used to determine the tumor or metastasis in equivocal situations in which enlarged lesions or those which have altered their shape due to metastasis are not identified with anatomic imaging during early stages or according to tumor type [18]. PET-CT provides the combined trans-sectional images which consist of functional information of PET superimposed on anatomic information obtained via CT scanning. PET-CT is considered to be one of the most sensitive diagnostic modalities for evaluating metastasis tumor staging and responses to therapy [9]. In veterinary medicine the physiologic values of 18F-fluorodeoxyglucose (FDG) uptake in normal dogs and a few cancer cases studied via PET-CT were reported in spite of the limited availability and cost of this modality [2710 11]. In this study we described the application of CT and PET-CT to distinguish primary lung tumor from metastatic lung tumor in a dog presenting multiple lung masses. A 10-year-old intact female Yorkshire terrier weighing 3.3 kg was presented at the Chonnam National University Veterinary Teaching Hospital for a general check-up without any specific clinical signs. Physical examination revealed small sized tumors (about 3 mm diameter) at the left 2nd and 4th mammary glands. Complete blood count revealed leukocytosis (40.14 K/?l; reference range 5.05“16.76 K/?l). There was no abnormal finding in serum chemistry. Thoracic radiographs revealed a total of four nodules on the left and right cranial and caudal lobes (Fig. 1Fig. 1.Canine thoracic radiographs (right lateral and ventrodorsal views) showing four nodules (long arrows) with uniform soft tissue density on the left and right cranial and caudal lobes. Enlarged teats (short arrows) were superimposed on the radiographs.). All nodules had soft tissue density with definite contour. The largest one located at the right caudal lobe was 4 cm in diameter and the others were about 2“3 cm. On ultrasonography all pulmonary nodules had slightly heterogeneous internal hypoechotexture confined by an echogenic border. The blood flow signal was not identified within all nodules on color Doppler mode. There was no remarkable finding on abdominal radiography and ultrasonography. Multiple pulmonary nodules were suspected as metastatic lesions however the primary tumor was not identified. Thus computed tomography (CT) and positron emission tomography-computed tomography (PET-CT) were performed under general anesthesia of a combination of 2.5 mg/kg zolazepam/tiletamine (Zoletil Virbac France) and 0.05 mg/kg medetomidine (Domitor Orion Corp. Espoo Finland) to identify the undetected primary tumor and additional metastasis which may have been present in other ans."
Lung_Cancer
"Acute phase reactants are plasma proteins that are synthesized by hepatocytes as a nonspesific response against tissue damage infection inflammation trauma or cancer. Acute phase reactants are frequently used in the evaluation of chronic inflammation in diseases such as inflammatory bowel disease or rheumatoid arthritis. Particularly C-reactive protein fibrinogen haptoglobin ferritin ceruloplasmin copper and ?1-antitrypsin can be mentioned among the proteins that show notable increases during acute phase response. On the other hand proteins such as albumin and transferrin demonstrate decreases during the response and are called as œnegative acute phase reactants. Different diseases associated with asbestos may present with different levels of oxidative stress or inflammation. The importance of oxidative stress and inflammation can be assessed by various markers and modalities targeting this system can be established in the treatment and follow-up. In this study we aim to evaluate oxidative markers including TOL TAC OSI and inflammatory indicators and compare their relationship with each other in patients with asbestos exposure having no disease and in patients with asbestos exposure and MM. 2. Material and Methods 2.1. Study Subjects and Area This cross-sectional study was conducted at the Pulmonology Department of Dicle University Diyarbakir Southeastern Turkey. Environmental asbestos exposure is common in the southeast region of Turkey. In this region asbestos-containing soil is used to purpose of thermal insulation and waterproofing on roof and wall (material of whitewash-wall plaster). Environmental exposure occurs through inhalation of asbestos-laden soil. Exposure with asbestos begins at birth in rural areas and the exposure is continuous. Thus patient's age was accepted exposure duration time in our study. We enrolled eighty villagers who have more than 20 years of environmental asbestos exposure were included in the study. Asbestos was detected in village in soil analysis. This village also was in an area that MM patients occure. There was not any finding for MM and other diseases in Chest X-ray in villagers. Forty-six patients with MM who were registered and followed up in our Department of Pulmonology were enrolled the study. The control group was created 50 healthy people with a mean of similar age and gender and who living in an area which not detected asbestos in soil analysis and without any disease. The patients with chronic kidney failure chronic heart failure liver failure and chronic obstructive pulmonary disease and those who have got active infection were excluded the study. The patients with malignancies other than MM were excluded from the study. The study protocol was carried out in accordance with the Helsinki Declaration as revised in 1998 and approved by the local research committee for ethics. All subjects were informed about the study protocol and written consents were obtained from all inhabitants. 2.2. MM Diagnosis Thoracentesis and closed pleural needle biopsy were performed in patients with pleural effusion for pathological and cytological examination. Ramel needle biopsy set was used in closed pleural biopsy. Surgical biopsy was performed when closed pleural biopsy is not appropriate The ultrasound-guided biopsy was performed in patients with small amount of pleural effusion. Tissue samples were immediately placed in 10% formol and sent for histopathological examination. Hematoxylin and eosin staining was used as standard in histopathological evaluation. Histochemical or immunohistochemical staining were used if necessary. The patients with confirmed MM diagnosis histopathologically were included in the study. Certain laboratory clinical and radiographic variables which measured at the time of diagnosis. were defined as potential prognostic factors. 2.3. Blood Sampling To measure TOL and TAC two 10?mL samples of blood were drawn from antecubital veins and were collected in empty tubes. Samples were separated from cells by centrifugation at 4000?rpm for 5?min and then serum was stored at ?80 C until analysis. 2.4. Measurement of TOL TOL of serum was determined using an automated measurement method (Rel assay diagnostics kits MegaTip Gaziantep Turkey) developed by Coussens and Werb [8]. Oxidants present in the sample oxidize the ferrous ion-o-dianisidine complex to ferric ion. The oxidation reaction is enhanced by glycerol molecules which are abundantly present in the reaction medium. The ferric ion makes a colored complex with xylenol orange in an acidic medium. The color intensity which can be measured spectrophotometrically is related to the total amount of oxidant molecules present in the sample. The assay was cali-brated with hydrogen peroxide and the results are expressed as micromoles of hydrogen peroxide equivalents per litre (mmol H2O2?equiv/L). 2.5. Measurement of TAC Serum TAC levels were determined using a novel automated measurement method (Rel assay diagnostics kits Mega Tip Gaziantep Turkey)"
Lung_Cancer
"A. Proliferation assay in Mero-14 cells. The graph shows the effect of the treatments with 5 µM cisplatin and 40 nM siMSLN-1 used as single agents or in combination. On day 6 MANOVA shows a statistically significant effect both for cisplatin (P?=?0.0168) and siMSLN-1 (P<10?4) in reducing proliferation. However the interaction term for the effect of both agents in combination is not statistically significant (P?=?0.145). Error bars represent SEM of three independent experiments each performed in quadruplicate. B. Flow cytometry analysis. The graph shows the percentage of cells in phase S+G2+M in Mero-14 cells treated with 40 nM of the siCtrl or siMSLN-1 in combination with imatinib (25 µM) or gemcitabine (1 µM) (alone) or imatinib+gemcitabine (10 µM and 1 µM respectively). The transfection with siMSLN-1 was accompanied with a marked decrease of cells in S+G2+M phase as compared with the respective cultures transfected with siCtrl irrespectively of the drugs employed (P?=? 0.00033). Error bars represent SEM of two independent experiments. C. Caspase activity measured on Mero-14 cells transfected with 40 nM of siCtrl or siMSLN-1 with or without cisplatin 5 µM. A marked increase in apoptosis is observed when siMSLN-1 and cisplatin are administered together compared to cultures treated with cisplatin and transfected with siCtrl (*P?=?0.018) suggesting a synergistic effect. Error bars represent SEM of three independent experiments each performed in triplicate. D. Western blotting analysis of MSLN p53 and PARP under different combinations of siRNAs and cisplatin (at 5 10 and 20 µM). ?-actin was used as reference. The protein levels were confirmed with three independent experiments. Legend to figure 5: Dark line: cells trated with siCtrl; gray line and triangles: cells treated with siCtrl plus cisplatin; gray line and dark spots: cells treated with siMSLN plus cisplatin; dark line and white spots: cells treated with siMSLN-1. Role of MSLN in cell cycle progression and apoptosis following treatments with chemotherapeutic drugs Following flow cytometry analysis Mero-14 cells treated with siMSLN-1 in combination with cisplatin or imatinib or gemcitabine (each as a single agent) or imatinib+gemcitabine showed a statistically significant decreased share of cells in S+G2+M phase as compared to their respective cultures where siMSLN-1 were replaced with siCtrl (B). This finding further confirmed the activity of siMSLN-1 in slowing the progression through cell cycle. In treatments where siRNA was combined with chemotherapeutic drugs activities of caspases-3 and -7 were measured as markers for apoptosis. The addition of siMSLN-1 in cultures treated with imatinib or gemcitabine (each as a single agent) or imatinib+gemcitabine was not associated with an increased rate of apoptosis as compared to cultures treated with the chemotherapeutic drugs together with siCtrl. Interestingly a synergistic effect was observed when cisplatin was used in combination with siMSLN-1. In fact siMSLN-1 or cisplatin alone did not induce apoptosis whereas they markedly (and in a statistically significant way) induced increased apoptosis rates when used together (C). This observation was further corroborated by the induction of p53 and by the cleavage of PARP both additional markers for apoptosis (D). The effect was dose-dependent and visible from 5 µM of cisplatin. Discussion The present work provides evidence on the importance of MSLN for cell growth and invasiveness in MPM. The transient MSLN-silencing caused a decrease in the proliferation rate of the MSLN-overexpressing cell line Mero-14. These data are in agreement with those observed on PC cells [24]. Similar findings were also reported by Wang et al. in the MSLN-overexpressing MPM cell lines H2373 [25]. As with the H2373 MPM cells the substantial arrest of the proliferation rate observed in the Mero-14 cells was underlined by the shift of the phosphorylation status of AKT and ERK (used as a marker of proliferation). The results on MPM cells were in agreement with the findings observed in PC and OC cells [25] suggesting that all the MSLN-expressing cancer cells show a significant loss of viability upon MSLN depletion. In addition to the reduced proliferation Mero-14 cells also showed a reduced capacity of sphere formation in a three-dimensional context. Concerning the cell cycle a significant increase (50%) of MPM H2373 cells in the S-phase was observed portraying a blockade in progression from S to G2 phase [25]. The results obtained in Mero-14 cells were different since a reduction of cells in S-phase was observed paralleling an increase of cells in G1 phase. The differences could be ascribed to the different methods of siRNA administration (electroporation in H2373 versus chemical transfection in Mero-14) involving different time of observation (48 versus 72 hours respectively). However the overall decrease of cells in G2/M was consistent in both cell lines. Moreover a significant reduction in invasiveness was observed in both Mero-14 and H2373 cells in the trans-well assay. With regard to apoptosis no assays were reported for H2373. In general MPM cell lines are quite refractory to undergo apoptosis and this was also observed in Mero-14 cells after MSLN depletion or a treatment with cisplatin. By contrast MSLN silencing was able to promote apoptosis in PC AsPC-1 Capan-1 and Capan-2 cells [24]. However MSLN depletion triggered a marked increase in apoptosis in Mero-14 cells when used in combination with cisplatin thereby suggesting a synergistic effect. In Mero-14 cells the activation of caspases-3 and 7 was associated with the induction of p53 and with the cleavage of PARP both markers of a pro-apoptotic activity. In summary paralleling previous studies our findings confirm that MSLN should not be regarded only as an interesting diagnostic marker for MPM or a promising target for immunotherapies. Despite the limited knowledge on the biological role of MSLN in normal and cancer cells MSLN should also be considered a key molecular target for novel gene-based targeted therapies of cancer. Supporting Information Table S1 Genes analysed for their mRNA expression in the present work. The table reports in the order the gene name the gene bank ID code the ID numbers of the TaqMan® assays the melting temperatures (in C°) and the lengths of the amplicons. (DOC) Click here for additional data file. Table S2 Silencing-RNAs tested in the present work. The table reports in the order the targeted gene the siRNAs codes and the targeted sequences. (DOC) Click here for additional data file. The authors thank Prof. Antonio Lucacchini and Prof. Maria Rosa Mazzoni (Department of Pharmacy University of Pisa) and Dr. Roberto Favoni (IRCCS A.O.U. San Martino-IST Laboratory of Gene Transfer) for the donation of the cell lines. The authors wish to thank Sandra Lindon for the proofreading of the . References 1 YamaguchiN HattoriK Oh-edaM KojimaT ImaiN et al (1994) A novel cytokine exhibiting megakaryocyte potentiating activity from a human pancreatic tumor cell line HPC-Y5. . J Biol Chem. 269(2): 805“88288629 2 ChangK PastanI (1996) Molecular cloning of mesothelin a differentiation antigen present on mesothelium mesotheliomas and ovarian cancers. . Proc Natl Acad Sci U S A. 93(1): 136“408552591 3 HassanR BeraT PastanI (2004) Mesothelin: a new target for immunotherapy. . Clin Cancer Res. 10(12 Pt 1): 3937“4215217923 4 HassanR HoM (2008) Mesothelin targeted cancer immunotherapy. . Eur J Cancer. 44(1): 46“5317945478 5 ArganiP Iacobuzio-DonahueC RyuB RostyC GogginsM et al (2001) Mesothelin is overexpressed in the vast majority of ductal adenocarcinomas of the pancreas: identification of a new pancreatic cancer marker by serial analysis of gene expression (SAGE). . Clin Cancer Res. 7(12): 3862“811751476 6 ChangK PastanI (1996) Molecular cloning of mesothelin a differentiation antigen present on mesothelium mesotheliomas and ovarian cancers. Proc Natl Acad Sci USA93: 136“408552591 7 SapedeC GauvritA BarbieuxI PadieuM CellerinL et al (2008) Aberrant splicing and protease involvement in mesothelin release from epithelioid mesothelioma cells. . Cancer Sci. 99(3): 590“418167128 8 RobinsonBW CreaneyJ LakeR NowakA MuskAW et al (2003) Mesothelin-family proteins and diagnosis of mesothelioma. Lancet362: 1612“1614630441 9 HassanR RemaleyAT SampsonML ZhangJ CoxDD et al (2006) Detection and quantitation of serum mesothelin a tumor marker for patients with mesothelioma and ovarian cancer. Clin Cancer Res12: 447“5316428485 10 GrigoriuBD ScherpereelA DevosP ChahineB LetourneuxM et al (2007) Utility of osteopontin and serum mesothelin in malignant pleural mesothelioma diagnosis and prognosis assessment. Clin Cancer Res13: 2928“3517504993 11 BeraTK PastanI (2000) Mesothelin is not required for normal mouse development or reproduction. . Mol Cell Biol. 20(8): 2902“610733593 12 RumpA MorikawaY TanakaM MinamiS UmesakiN et al (2004) Binding of ovarian cancer antigen CA125/MUC16 to mesothelin mediates cell adhesion. J Biol Chem279: 9190“919814676194 13 ChenSH HungWC WangP PaulC KonstantopoulosK (2013) Mesothelin binding to CA125/MUC16 promotes pancreatic cancer cell motility and invasion via MMP-7 activation. Sci Rep. 3: 187023694968 14 BharadwajU LiM ChenC YaoQ (2008) Mesothelin-induced pancreatic cancer cell proliferation involves alteration of cyclin E via activation of signal transducer and activator of transcription protein 3. Mol Cancer Res6: 1755“176519010822 15 TangZ QianM HoM (2013) The role of mesothelin in tumor progression and targeted therapy. . Anticancer Agents Med Chem. 13(2): 276“8022721387 16 HassanR VinerJL WangQC MarguliesI KreitmanRJ et al (2000) Anti-tumor activity of K1-LysPE38QQR an immunotoxin targeting mesothelin a cell-surface antigen overexpressed in ovarian cancer and malignant mesothelioma. . J Immunother. 23(4): 473“910916757 17 HungCF CalizoR TsaiYC HeL WuTC (2007) A DNA vaccine encoding a single-chain trimer of HLA-A2 linked to human mesothelin peptide generates anti-tumor effects against human mesothelin-expressing tumors. . Vaccine. 25(1): 127“3516930783 18 HungCF TsaiYC HeL WuTC (2007) Control of mesothelin-expressing ovarian cancer using adoptive transfer of mesothelin peptide-specific CD8+ T cells. . Gene Ther. 14(12): 921“917377599 19 BreidenbachM ReinDT EvertsM GlasgowJN WangM et al (2005) Mesothelin-mediated targeting of adenoviral vectors for ovarian cancer gene therapy. . Gene Ther. 12(2): 187“9315526007 20 YuL FengM KimH PhungY KleinerDE et al (2010) Mesothelin as a potential therapeutic target in human cholangiocarcinoma. . J Cancer. 1: 141“920922056 21 TangZ FengM GaoW PhungY ChenW et al (2013) A human single-domain antibody elicits potent antitumor activity by targeting an epitope in mesothelin close to the cancer cell surface. . Mol Cancer Ther. 12(4): 416“2623371858 22 HassanR EbelW RouthierEL PatelR KlineJB et al (2007) Preclinical evaluation of MORAb-009 a chimeric antibody targeting tumor-associated mesothelin. . Cancer Immun. 7: 2018088084 23 ImamuraO OkadaH TakashimaY ZhangD KobayashiT et al (2008) siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model. . Cancer Lett. 268(2): 278“8518490101 24 ZhengC JiaW TangY ZhaoH JiangY et al (2012) Mesothelin regulates growth and apoptosis in pancreatic cancer cells through p53-dependent and -independent signal pathway. . J Exp Clin Cancer Res. 31: 8423034174 25 WangK BodempudiV LiuZ Borrego-DiazE YamoutpoorF et al (2012) Inhibition of mesothelin as a novel strategy for targeting cancer cells. PLOS ONE7(4): e3321422485139 26 VersnelMA HoogstedenHC HagemeijerA BoutsMJ van der KwastTH et al (1989) Characterization of three human malignant mesothelioma cell lines. Cancer Genet Cytogenet. 42(1): 115“282790740 27 OrengoAM SpoletiniL ProcopioA FavoniRE De CupisA et al (1999) Establishment of four new mesothelioma cell lines: characterization by ultrastructural and immunophenotypic analysis. Eur Respir J. 13(3): 527“3410232421 28 VandesompeleJ De PreterK PattynF PoppeB Van RoyN et al (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol3(7): RESEARCH003412184808 29 VichaiV KirtikaraK (2006) Sulforhodamine B colorimetric assay for cytotoxicity screening. Nat Protoc1: 1112“111617406391 30 De LucaA MaielloMR D'AlessioA PergamenoM NormannoN (2012) The RAS/RAF/MEK/ERK and the PI3K/AKT signalling pathways: role in cancer pathogenesis and implications for therapeutic approaches. Expert Opin Ther Targets16 Suppl 2S17“2722443084 31 LiangCC ParkAY GuanJL (2007) In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. Nat Protoc2: 329“33317406593 32 MarshallJ (2011) Transwell(®) invasion assays. Methods Mol Biol769: 97“11021748672 Radiat Oncol Radiat Oncol Radiation Oncology (London England) 1748-717X BioMed Central 24479954 3922961 1748-717X-9-41 10.1186/1748-717X-9-41 Research Pretreatment SUVmax predicts progression-free survival in early-stage non-small cell lung cancer treated with stereotactic body radiation therapy Horne Zachary D 1 [email protected] Clump David A 1 [email protected] Vargo John A 1 [email protected] Shah Samir 1 [email protected] Beriwal Sushil 1 [email protected] Burton Steven A 1 [email protected] Quinn Annette E 1 [email protected] Schuchert Matthew J 2 [email protected] Landreneau Rodney J 2 [email protected] Christie Neil A 2 [email protected] Luketich James D 2 [email protected] Heron Dwight E 1 [email protected] 1Department of Radiation Oncology University of Pittsburgh Cancer Institute 5230 Centre Ave Pittsburgh PA 15232 USA 2Division of Thorcic and Foregut Surgery Department of Cardiothoracic Surgery University of Pittsburgh Medical Center 200 Lothrop St Suite C-816 Pittsburgh PA 15213 USA 2014 30 1 2014 9 41 41 24 9 2013 2 1 2014 Copyright © 2014 Horne et al.; licensee BioMed Central Ltd. 2014 Horne et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background This retrospective study aims to assess the usefulness of SUVmax from FDG-PET imaging as a prognosticator for primary biopsy-proven stage I NSCLC treated with SBRT. Methods This study includes 95 patients of median age 77 years with primary biopsy-confirmed peripheral stage IA/IB NSCLC. All patients were treated with 60Gy in 3 fractions with a median treatment time of six days. Local regional and distant failures were evaluated independently according to the terms of RTOG1021. Local regional and distant control overall- and progression-free survival were estimated by the Kaplan-Meier method. Cox proportional hazards regression was performed to determine whether SUVmax age KPS gender tumor size/T stage or smoking history influenced outcomes. SUVmax was evaluated as both a continuous and as a dichotomous variable using a cutoff of <5 and ?5. Results Median follow-up for the cohort was 16 months. Median OS and PFS were 25.3 and 40.3 months respectively. SUV with a cutoff value of 5 predicted for OS and PFS (p?=?.024 for each) but did not achieve significance for LC (p?=?.256). On Cox univariate regression analysis SUV as a dichotomous variable predicted for both OS and PFS (p?=?.027 and p?=?.030 respectively). Defined as a continuous variable SUVmax continued to predict for OS and PFS (p?=?.032 and p?=?.003) but also predicted LC (p?=?.045) and trended toward significance for DC (p?=?.059). SUVmax did not predict for OS as a dichotomous or continuous variable. It did however predict for PFS as a continuous variable (p?=?.008) neared significance for local control (p?=?.057) and trended towards significance for distant control (p?=?.092). Conclusions SUVmax appears to be a statistically and clinically significant independent prognostic marker for progression-free survival in patients with stage I NSCLC treated with SBRT. Prospective studies to more accurately define the role of tumor FDG uptake in the prognosis of NSCLC are warranted. Introduction [18?F]-Fluorodeoxyglucose positron emission tomography (FDG-PET) is an important tool in the initial staging and subsequent assessment of patients diagnosed and treated for non-small cell lung cancer (NSCLC) [12]. FDG-PET imaging relies on the functional properties that define malignancies including increased glucose metabolism. This uptake is linked to tumor proliferation and metastatic potential and recent investigations demonstrate the usefulness of PET imaging as a prognosticator for eventual outcomes. The International Association for the Study of Lung Cancer (IASLC) reviewed 21 studies that assessed the utility of the maximum standardized uptake value (SUVmax) in NSCLC and determined that tumors with higher SUVmax have poorer prognoses [3]. Other recent studies have attempted to determine the utility of SUVmax under a more narrow scope including that of early-stage NSCLC treated with stereotactic body radiation therapy (SBRT) an emerging technique typically reserved for patients who are medically-inoperable or who refuse surgery [45]. Multiple studies demonstrate that pretreatment SUVmax predicts for clinical outcomes in patients with early-stage NSCLC treated with SBRT [6-8]. To the contrary studies from Cleveland Clinic and Indiana University failed to find a correlation between pre-treatment SUVmax and survival [910]. As early-stage NSCLC is a potentially curable disease with SBRT here an SUVmax cutoff that predicts for more aggressive disease in patients with solitary peripheral primary stage I NSCLC is identified. Methods and materials Patients and workup This study includes 95 non-consecutive patients treated for biopsy-confirmed peripheral stage IA/IB between October 2005 and May 2011 [11]. This research was determined to have exemption status by our Institutional Review Board. All patients were staged according to the 7th edition of the AJCC criteria. No tumor was located within 2 cm of the proximal bronchial tree and no patient was previously treated for lung cancer. All patients had a pre-SBRT FDG-PET-CT scan with a documented SUVmax. Of these patients 14 were operable candidates but refused surgical therapy while the remaining 81 patients had significant pulmonary or cardiac comorbidity that precluded definitive surgical management (Table 1). As a part of the staging all patients underwent a PET-CT scan. The SUVmax was obtained from review of the formally dictated radiology report. Table 1 Patient characteristics n?=?95 Median Age 77 (48-91) years Sex Male 49 (51.6%) Female 46 (48.4%) Operable 14 (14.7%) Inoperable 81 (85.3%) KPS 80-100 63 (66.3%) <70 32 (32.7%) Clinical follow-up 16.33 (1.13-64.2) months Simulation and treatment Each patient was positioned supine with arms raised above the head for the CT simulation. A thin-slice 4-D high resolution CT (2.5 mm) and 1.25 mm helical CT with intravenous contrast was obtained while the patient was immobilized in a custom BodyFIX vacuum bag (Electa). For patients treated with CyberKnife„¢ Synchrony Respiratory Tracking System (Accuray Inc Sunnyvale CA) was utilized in conjunction with the 4D-CT to ensure fiducial movement in sync with the GTV. For Trilogy„¢ and Trubeam„¢ patients image-guided respiratory cycle motion was accounted for via Varian Real-Time Position Management System (Varian Medical Systems Palo Alto CA). Respiratory gating was incorporated for patients with tumor motion?>?0.5 cm. The acquired images were then transferred to the treatment planning workstation using either Accuray MulitPLAN„¢ (Accuray Inc Sunnyvale CA) or Varian Eclipse„¢ (Varian Medical Systems Palo Alto CA). The AAA planning algorithm was utilized for patients treated on Trilogy„¢ and Trubeam„¢ and the pencil beam algorithm for patients treated on CyberKnife„¢. The tumor volume and any surrounding critical structures including the spinal cord heart esophagus brachial plexus and normal lung were manually delineated by a radiosurgical team consisting of a radiation oncologist a medical physicist and a thoracic surgeon. The gross tumor volume (GTV) was defined as the tumor alone. To account for setup error and residual motion detected on end-exhalation 4D-CT a minimum expansion of 5 mm margin was added to create the planning target volume (PTV). An additional margin based on motion assessment was added to create an internal target volume (ITV) to be used with gating. Dose-volume histograms were calculated for the target volume and nearby critical structures to select the optimal treatment plan which provided at least 95% of the prescription dose to the PTV while sparing surrounding organs-at-risk. If surrounding organs-at-risk were deemed to be at excess risk for toxicity a plan with lower PTV coverage was accepted. SBRT was performed using CyberKnife„¢ Robotic Radiosurgery System (Accuray Inc Sunnyvale CA for 39 patients Trilogy„¢ Radiosurgery System (Varian Medical Systems Palo Alto CA) for 54 patients and Trubeam„¢ Radiosurgery System (Varian Medical Systems Palo Alto CA) for 2 patients. All lesions were treated with heterogeneity correction to 60 Gy in 3 fractions every other day with a median of 6 elapsed days from beginning of treatment to end (range 3-21 days). For patients treated on the Trilogy„¢ and Trubeam „¢ platforms cone-beam CT (CBCT) was performed daily to separate setup error from tumor reposition error. The treating physician checked and modified the alignment based on target relocalization in the fused imaging. Disease assessment and clinical follow-Up After treatment patients were scheduled to have either a CT or PET/CT scan every 3 months with a clinical evaluation. Response to treatment was evaluated by the RECIST v1.1 criteria and documented as a complete response partial response (greater than 30% decrease in the longest axis) progressive disease (greater than 20% increase in the longest axis) or stable disease (neither partial response nor progressive disease) [12]. Follow-up imaging was re-evaluated to classify local regional and distant failures similar to the definitions of RTOG 1021 [13]. Local failures were defined as recurrence within the originally involved lobe or within 2 cm of the initial primary but located outside the originally involved lobe. Regional failure included non-involved ipsilateral lobes as well as ipsilateral hilar mediastinal and subcarinal lymph nodes. Distant failures enveloped ipsilateral supraclavicular and contralateral lymph nodes and all other distant sites. Progression-free survival was defined as the time to a specified recurrence and was measured from the last day of treatment to that event. Death was not included as an endpoint for PFS. Local regional and distant control overall- and progression-free survival were estimated by the Kaplan-Meier method. The ANOVA test was utilized to determine correlations between SUVmax tumor histology and stage. Forward conditional Cox proportional hazards regression was performed to determine whether SUVmax (continuous/dichotomous) age (continuous) KPS (continuous) gender tumor T stage tumor histology or smoking pack years (continuous) influenced outcomes. SUVmax was evaluated in univariate and multivariate analyses as both a continuous and as a dichotomous variable using a cutoff of <5 and ?5 as described in previous reports [691415]. All statistics were completed using SPSS version 20 (IBM Corp Armonk NY). Significance was set at p???0.05. Results A total of 95 patients with a median age 77 years (range: 48-91 years) were identified between October 2005 and May 2011 (Table 1). All patients had biopsy-confirmed NSCLC with 38 (40%) having squamous cell carcinoma and 33 (34.7%) having adenocarcinoma. "
Lung_Cancer
"They are designed to determine which subjects have quit smoking or cut down and which subjects who have failed to quit still plan to do so. There is a section that asks about general motivators and components of the smoking cessation programme. The subjects will be asked to score these motivators and smoking cessation aids for their efficacy in helping them to quit. The questions in this section are almost identical to a validated questionnaire [24]. There are also further questions on whether the subject would recommend the Respiragene test to a relative or friend and an open ended question for subjects to add their own comments about the concept of a test that predicts susceptibility to lung cancer in a smoker. Data quality assurance The study has been designed and will be reported in accordance with CONSORT (Consolidated Statement of Reporting Trials) [25]. Data will be controlled in accordance with data protection legislation institutional protocols of Sussex NHS Research Consortium and NHS policies for research and information governance for ensuring patient confidentiality [26]. Data will be analysed in SPSS (Statistical Package for Social Sciences) version 15 using an intention to treat approach. Outcome measures Primary endpoint Comparison of smoking cessation rates (7 day point abstinence and continuous abstinence) in Clinic A and Clinic B at 8 weeks and six months. Secondary endpoints A. Personal data: 1. Number of smokers still smoking who state that they still plan to stop. 2. Daily cigarette consumption of those still smoking. 3. Mean scores for ranking of smoking cessation aids (gene-based test - Clinic A only salivary cotinine lung cancer facts - controls in Clinic B only and general counselling from NHS smoking counsellors). B. Analyse questions about whether subjects would recommend the test to a member of family or a friend. C. Analyse last (open ended) question using qualitative research methodology. Statistics Primary end point The difference between smoking cessation between Clinic A and Clinic B will be estimated from the four week and six month follow up for the primary endpoint (smoking status confirmed by carbon monoxide breathalyser and salivary cotinine tests). If there is the expected higher rate of smoking cessation for Clinic A compared with Clinic B statistical significance will be demonstrated by the ?2 test. Since there are as yet no case-control studies that compare quit rate following the gene-based test versus quit rate without the test the expected difference in quit rate between Clinic A and Clinic B is difficult to estimate. Two case-control studies showing only a 5-10% increase in smoking cessation involved just a single gene of small effect [1112]. In a randomised control trial patients were given either a full explanation of the results of spirometry testing including an estimation of lung age or just the FEV1 without explanation (control group). The group of patients who were given the full explanation had a 7.2% higher quit rate than the control group. However data from Auckland suggest a larger uplift of quit rate with Respiragene. This can be explained by the superior predictive power of a 20-gene test combined with clinical history (personal history of COPD and family history of lung cancer) to give a rather more impressive estimate of cancer risk than anything previously available. The adequacy of sample size was tested using data from smoking cessation trials that showed: ¢30-40% smoking cessation at 6-months with similar protocols [2728]. ¢A 48% quit rate at 2-4 weeks in subjects with high and very high lung cancer risk scores but this difference shrinks to 27% at 6 months. ¢Data from Young et al [1518] (independently verified by McBride et al [11]) that even being given an average score for lung cancer susceptibility increases smoking cessation by approximately 10%. Therefore with a minimum sample sizes of 30 per group the following calculations based on these estimated quit rates apply (). Statistical power of 87.1% is generally acceptable for publication (for alpha error of 5% - i.e. 5% probability of incorrectly rejecting the null hypothesis that there is no difference in the percentage values). For further detailed statistical analysis refer to Additional file 1. Summary of values from which the power of the study are estimated Control group expected quit rate as %ge Respiragene group expected quit rate as %ge ? 2 calculated from four-some table P value based on ? 2 Power calculations* 8 weeks Sample size 30/30* 70% 94% 5.9 <0.05 79.3% Sample size 60/60* 11.7 <0.01 96.9% 6 months Sample size 30/30** 35% 52% 1.7 NS 36.5% Sample size 60/60** 6.2 <0.05 87.1% *Telephone (alone) quit rate (see ) assumed to be 20%. **Telephone (alone) quit rate (see ) assumed to be 10-15%. Secondary outcome measures Similarly the significance of secondary endpoints on intention to stop smoking cigarette consumption uptake of invitation to cessation adherence to cessation course and self-reported smoking cessation will be calculated by the ?2 test but the p value for the ranking scores for information on lung cancer risk and other smoking cessation aids and motivators will be estimated from the unpaired student t-test. The open ended question: œHow do you feel now about having had a genetic test that estimates the probability that you will develop lung cancer at some future date? will have to be analysed by qualitative analysis to determine the main recurrent themes in responses. Discussion Overview Smoking cessation is one of the most cost effective interventions that can be achieved in primary care [29]. However many smokers are very reluctant to commit to a smoking cessation programme (precontemplative and contemplative) and about half of those that attend for smoking cessation intervention (action stage of change) are likely to drop out or give up trying. Therefore any methodology that increases motivation in both unmotivated and motivated smokers could be very valuable. The gene-based test we are offering has shown promise as a smoking cessation motivator in precontemplative-contemplative smokers in a hospital outpatient setting [1518] and now needs to be tested out as a motivator for improving adherence in a primary care smoking cessation clinic using a randomised controlled study. Strengths The main strengths of this study are that it is being carried out on subjects from a large primary care population and should therefore be more representative of the general population than previous studies recruited from hospital patients and other special groups. We also have the advantage of being able to carry out this research within the established framework of the local stop smoking service. Limitations and assumptions Although we have estimated based on previous smoking cessation work using this gene-based test that the primary endpoint will show that having the test improves quit rate by 20-25% this was based on a cohort of hospital outpatients in Auckland New Zealand and subjects recruited from primary care may respond differently. Although we plan to recruit a minimum of 60 subjects this may not be enough to balance unexpected and unknown confounding factors. What we might find We aim to recruit a minimum of 60 subjects to randomise 30 into group A (test group) and 30 into Group B (control group). The normal experience in NHS smoking cessation clinics is a drop-out rate of 40-50% [30-32]. We need therefore to attempt to recruit about 120 subjects in order to get a statistically significant result based on the assumptions in our power calculations. We may however have underestimated the 6-month quit rate using the NHS local stop smoking guidelines [22] which typically involves a multi-interventional programme which includes combinations of varenicline prescriptions Lung_Cancer breath carbon monoxide monitoring and intensive counselling giving a quit rate of 70-80% at 6-weeks.There are however no Surrey data for 6-month quit rate which we assume on the basis of similar smoking cessation data to be about half the 6-week figure [33] ? 35%. An unknown and unpredictable factor that could skew results significantly is the possibility that our multi-interventional approach could help to reinforce the health risk message equally for subjects in both groups. Also the Auckland study design involved recruitment of precontemplative-contemplative smokers from a hospital outpatient setting compared to this study that will involve primary care subjects who have volunteered to participate in a smoking cessation programme (ie smokers in the action stage of quitting). This population therefore could be sufficiently different to give unexpected results. However the results of this trial will inform as to the acceptability of this approach as well as its effectiveness. Abbreviations CONSORT: Consolidated statement of reporting trials; COPD: Chronic obstructive pulmonary disease; DNA: Deoxyribonucleic acid; NHS: National health service UK; SNP: Single nucleotide polymorphism; SAE: Stamped addresses envelope. Competing interests JN and PG are in receipt of research grants from Lab 21 Cambridge who are marketing the Respiragene test in the UK and Synergenz Bioscience Ltd. who financed the development of the test from its origins in New Zealand. We initially purchased SmokeScreen kits (for salivary cotinine estimation) from GFC Diagnostics Ltd. But they subsequently supplied 30 kits free of charge. Authors™ contributions JN and PG developed the idea of a control trial of the Respiragene test after discussions with Aino Telaranta-Keerie of Lab 21 Cambridge. WK was involved in helping to write the protocol and her experience in running smoking cessation clinics was very helpful. PW was our statistical adviser and SdeL helped us to write the protocol in accordance with CONSORT principles and in development of trial methodology. All authors read and approved the final manuscript. Authors™ information PG is a Visiting Professor of Primary Care at The University of Surrey. SdeL is Professor of Health Care and Clinical Informatics at The University of Surrey. JN is a primary care physician and visiting research fellow at The University of Surrey. WK is a visiting research fellow at The University of Surrey and an experienced smoking cessation nurse. PW is a Statistics Consultant in the Department of Mathematics at The University of Surrey. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2466/14/77/prepub Supplementary Material Additional file 1 Detailed statistical analysis. Click here for file Acknowledgements We are grateful for the help of Aino Telaranta-Keerie and the staff of Lab 21 for their support and for carrying out the Respiragene tests. We are also indebted to Kevin Murphy of Synergenz for his encouragement and support. Professor Robert Young and his team of Auckland New Zealand developed the Respiragene test and the risk score formula. His advice and guidance has been invaluable. Wetterstrand KA DNA Sequencing Costs Data from the NHGRI Large-Scale Genome Sequencing Program http://en.wikipedia.org/wiki/Personal_genomics#cite_note-18 Smerecnik C Grispen JEJ Quaak M Effectiveness of testing for genetic susceptibility to smoking-related diseases on smoking cessation outcomes: a systematic review and meta-analysis Tob Control 2012 21 3 347 354 10.1136/tc.2011.042739 21948804 Smith SM Campbell MC Macleod U Factors contributing to the time taken to consult with symptoms of lung cancer: a cross sectional study Thorax 2009 64 1953 531 Sanderson SC O™Neill SC White DB Bepler G Bastian L Lipkus IM McBride CM Responses to online GSTM1 genetic test results among smokers related to patients with lung cancer: a pilot study Cancer Epidemiol Biomarkers Prev 2009 18 7 1953 1961 10.1158/1055-9965.EPI-08-0620 19567511 Young RP Hopkins R Black PN Eddy C Wu L Gamble GD Mills GD Garrett JE Eaton TE Rees MI Functional variants of antioxidant genes in smokers with COPD and in those with normal lung function Thorax 2006 61 5 394 399 10.1136/thx.2005.048512 16467073 Young RP Hopkins RJ Christmas T Black PN Metcalf P Gamble GD COPD prevalence is increased in lung cancer independent of age sex and smoking history Eur Respir J 2009 34 2 380 386 10.1183/09031936.00144208 19196816 Young RP Hopkins RJ Hay BA Epton MJ Mills GD Black PN Gardner HD Sullivan R Gamble GD Lung cancer susceptibility model based on age family history and genetic variants PLoS ONE [Electronic Resource] 2009 4 4 e5302 10.1371/journal.pone.0005302 Young RP Hopkins RJ Hay BA Gamble GD GWAS And Candidate SNPs For COPD And Lung Cancer Combine To Identify Lung Cancer Susceptibility: Validation In A Prospective Study Am J Respir Crit Care Med 2010 181 A3738 Young RP Hopkins RJ Hay BA Epton MJ Mills GD Black PN Gardner HD Sullivan R Gamble GD A gene-based risk score for lung cancer susceptibility in smokers and ex-smokers Postgrad Med J 2009 85 515 524 10.1136/pgmj.2008.077107 19789190 Young RP Hopkins RJ Hay BA Epton MJ Black PN Gamble GD Lung cancer gene associated with COPD: triple whammy or possible confounding effect? Eur Respir J 2008 32 5 1158 1164 10.1183/09031936.00093908 18978134 McBride CM Bepler G Lipkus IM Lyna P Samsa G Albright J Datta S Rimer BK Incorporating genetic susceptibility feedback into a smoking cessation program for African-American smokers with low income Cancer Epidemiol Biomarkers Prev 2002 11 6 521 528 12050092 Sanderson SC Humphries SE Hubbart C Hughes E Jarvis MJ Wardle J Psychological and Behavioural Impact of Genetic Testing Smokers for Lung Cancer Risk: A Phase II Exploratory Trial J Health Psychol 2008 13 481 494 10.1177/1359105308088519 18420756 Wells S de Lusignan S Does screening for loss of lung function help smokers give up? Br J Nurs 2003 12 12 744 750 12829957 Parkes G Greenhalgh T Griffin M Dent R Effect on smoking quit rate of telling patients their lung age: The Step2quit randomised control trial BMJ 2008 336 598 600 10.1136/bmj.39503.582396.25 18326503 Hopkins RJ Young RP Hay B Gamble GD Lung cancer risk testing enhances NRT uptake and quit rates in randomly recruited smokers offered a gene based risk test Am J Respir Crit Care Med 2012 185 A2590 Hopkins RJ Young RP Hay B Gamble GD Gene-based lung cancer risk score triggers smoking cessation in randomly recruited smokers Am J Respir Crit Care Med 2011 183 A5441 West R Shiffman S McLean D Fast Facts: Smoking Cessation (Fast Facts series) “ Paperback 2007 London: Health Press Young RP Hopkins RJ Smith M Hogarth DK Smoking cessation: the potential role of risk assessment tools as motivational triggers [Review] Postgrad Med J 2010 86 1011 26 33 10.1136/pgmj.2009.084947 20065338 Cabebe E Recruitment details: REACT Clinical Trial Lung Cancer Detection Study http://www.elcaminohospital.org/Cancer_Center/Clinical_Trials/Lung_Cancer_Detection_Study McClure JB Ludman EJ Grothaus L Pabiniak C Richards J Impact of spirometry feedback and brief motivational counseling on long-term smoking outcomes: a comparison of smokers with and without lung impairment Patient Education & Counseling 2010 80 2 280 283 10.1016/j.pec.2009.11.002 20434863 Sanderson SK Humphries SE Hubbart C Psychological and behavioural impact of genetic testing smokers for lung cancer risk J Health Psychol 2010 13 4 481 494 18420756 Croghan E NHS Local stop smoking services services delivery and monitoring guidance 2011/12"
Lung_Cancer
" The blue nodes represent biomarkers identified in this work. The yellow nodes represent six genes which are not related with NSCLC on the NSCLC and normal specimens. The red nodes represent subtypes i.e. AC and SCC. Key gene pairs inferred by gene-subtype higher logic relationships We grouped together the gene-subtype higher logic relationships with the same logic function. Because the two logic functions AND (Type 1) and XOR (Type 8) have more intuitive biological interpretations than other logic functions we restricted our analysis to these two logic functions. The key gene pairs were defined as the gene pairs involved in the gene-subtype higher logic relationships with logic function AND or XOR. We obtained key gene pairs in total where and gene pairs were related with AC/SCC through the logic functions AND and XOR respectively (Table S6). This result may be explained by the strict parameters we chose. Gene Ontology analysis The Gene Ontology (GO) is a structured and controlled vocabularies and classifications about the annotations of genes gene products and sequences [40]. GO includes three categories of terms: biological processes molecular functions and cell components. We were focused on the biological processes enriching the genes involved in lower logic relationships. So in what follows when we say GO terms it means the GO terms in the ˜biological process™ category. According to probe-AC/SCC pairwise associations and their uncertainty coefficients we obtained a gene set containing genes without overlap and each gene attached a coefficient. A total of genes were ranked in descending order by coefficients and given as input to the Gorilla. The Gorilla gave significant GO terms like ˜tissue development™ (GO: 0009888) ˜epidermis development™ (GO: 0008544) and ˜epithelial cell differentiation™ (GO: 0030855) (Part A in Appendix S1). Given that the significant GO terms were retrieved based on the subtypes of NSCLC data it has to be checked whether the significant GO terms are also significant on NSCLC and normal specimens. The same procedure was applied to the ranked genes based on the NSCLC and normal data. The test revealed significant GO terms with significant value (Part B in Appendix S1). In total seven out of GO terms on the subtypes of NSCLC data were also significant on the NSCLC and normal specimens (). It indicates that the following seven biological processes are important for tumorigenesis of NSCLC: tissue development epidermis development epithelial cell differentiation anatomical structure development developmental process cell adhesion and biological adhesion. .0094644.t002 Significant GO terms. GO terms Description P-value1 P-value2 E1 E2 GO:0009888 tissue development GO:0008544 epidermis development GO:0030855 epithelial cell differentiation GO:0048856 anatomical structure development GO:0032502 developmental process GO:0007155 cell adhesion GO:0022610 biological adhesion ˜P-value1™ and ˜P-value2™ denote the p-value scores of GO terms based on the subtypes of NSCLC data and NSCLC and normal data respectively. ˜E1™ and ˜E2™ are the enrichment values of GO terms based on the subtypes of NSCLC data and NSCLC and normal data respectively. Further we grouped the genes closely related with the subtypes of NSCLC into two groups by the types of gene-SCC lower logic relationships. We mapped the genes which were related with SCC (AC) by Type () lower logic relationships to GO terms. Gene ontology analysis revealed GO terms with the p-value scores smaller than and the enrichment scores larger than . Among significant GO terms epithelial cell differentiation (GO: 0030855) and cell adhesion (GO: 0007155) were also involved in the seven significant GO terms which may be important for tumorigenesis of NSCLC. It indicates that dysfunction of epithelial cell differentiation and cell adhesion is important for both of the tumorigenesis of AC and SCC. In addition we mapped the identified biomarkers to GO terms. The resulted significant GO terms were cell adhesion (GO: 0007155) and epidermis development (GO: 0008544) with the p-value scores smaller than and the enrichment scores larger than . It indicates that genes annotated to epidermis development and cell adhesion may be differently regulated between AC and SCC. By mapping the higher logic relationships to GO terms we obtained pairs of GO terms with different GO terms. Among all pairs of GO terms pairs of GO terms involving GO terms were significant with the p-value scores smaller than enrichment score larger than one and the number of gene pairs larger than two. These combination of biological processes may be pivotal for differentiating AC and SCC including a combination of ˜transport™ (GO: 0006979) and ˜regulation of transcription DNA-dependent™ (GO: 0006355) a combination of ˜oxidation-reduction process™ (GO: 0055114) and ˜nervous system development™ (GO: 0007399) and a combination of ˜negative regulation of cell proliferation™ (GO: 0008285) and ˜muscle contraction™ (GO: 0006936). Discussion In this paper we improved the logic analysis method to infer sufficient and necessary conditions for the presence states (presence or absence) of a phenotype. The current method omits the integration of networks and identifies not only gene-phenotype pairwise combinations (i.e. lower logic relationships) but also triplets combinations (i.e. higher logic relationships). On one hand it avoids the incompleteness of data sources and the noise from the integration of data; on the other hand the triplets combinations reflect the combination effect of gene pairs on phenotypes other than an individual effect. Some examples of lower and higher logic relationships demonstrated the biological relevance of our results. However the accuracy of all discovered logic relationships cannot be verified because of the current limited knowledge of the relationships between genes and phenotypes. The statistics analysis strengthened the reliability of discovered logic relationships. In addition the current method was compared with the two earlier methods (the NMF method and the RA method). The current method was superior to the two earlier methods because of its ability of mining gene pairs which are closely related with phenotypes. Moreover the current method gained the higher recall rate and classification accuracy than the two earlier methods. Our results display the advantage of the current method in mining genes closely related with phenotypes. The discovered gene-subtypes logic relationships in this paper are equivalent relationships between the expression patterns (expression or no-expression) of genes and the presence states (presence or absence) of phenotypes. That is both a expression pattern of a gene and a presence state of a phenotype must be either simultaneously true or simultaneously false. For example DSC3 is expressed if and only if the specimen is SCC as DSC3 is related with SCC by the first type of lower logic relationship. If a gene is related with a phenotype by a logic relationship then either the expression pattern of a gene or the presence state of a phenotype may be determined by the underlying logic relationship. Concretely given a phenotype the expression pattern of genes in a phenotype could be determined by the logic relationship. For example the expression pattern of DSC3 in SCC depends on the type of DSC3-SCC lower logic relationship. Conversely given a expression pattern of a gene the presence state of a phenotype could also be determined by the underlying logic relationships. The type of a discovered gene-AC lower logic relationship was totally different from that of the gene-SCC lower logic relationship where the genes involved in two relationships are the same. It indicates that the totally different types of lower logic relationships between genes and phenotypes may be the intrinsic reason for the different expression patterns of genes in distinct phenotypes. A total of genes identified in our work were regarded as the biomarkers for distinguishing AC from SCC as well as novel molecular targets for targeted therapeutic agents. Besides the genes identified in the literature (DST CLCA2 KRT5 DSG3 GJB5 SERPINB13 TRIM29 PKP1 KRT6B DSC3 NKX2-1 TP63 and NTRK2) most of the rest genes (BNC1 FAT2 LASS3 and PVRL1) are likely to be the novel biomarkers to distinguish AC from SCC. The BNC1 gene is thought to play a regulatory role in ˜keratinocyte proliferation™ and the LASS3 gene is participated in ˜keratinocyte differentiation™. Both of the biological process ˜keratinocyte proliferation™ and ˜keratinocyte differentiation™ are children of ˜keratinization process™. Because the genes involved in ˜keratinization process™ are higher expressed in SCC as compared with AC [26] BNC1 and PVRL1 which are either a upstream regulatory factor or a member of these high expressed genes may be able to differentiate AC and SCC. FAT2 functions as a cell adhesion molecular and it controls cell proliferation. As ˜cell adhesion™ is one of the significantly important biological processes for tumorigenesis of NSCLC the cell adhesion molecular (FAT2) is deserved to be a biomarker to distinguish AC from SCC. Until recently the function of LOC642587 and GOLT1A has been unknown. Further experimental validation is needed to confirm the differentiating ability of these two genes. In addition the NKX2-1 gene has been considered as a novel oncogene [35] and it opens new windows for novel targeted therapies [41]. "
Lung_Cancer
"The occurrence of PLC is extremely rare in liver carcinoma. Herein we report the case of a patient with PLC after liver transplantation due to liver carcinoma. PLC was confirmed by clinical manifestations imaging studies and cytologic examination of exfoliated cells in the pleural effusion. Liver carcinoma Liver transplantation Metastasis Pulmonary lymphangitic carcinomatosis Background Primary liver carcinoma is a malignancy originating from hepatocytes and/or intrahepatic biliary epithelial cells. In China there are more than 90 million carriers of the hepatitis B virus (HBV) accounting for 40% to 45% of HBV carriers worldwide. The high prevalence of HBV in China is the underlying reason why liver carcinoma is the malignancy with the highest morbidity and mortality rates in China. Currently resection and liver transplantation are major strategies for the treatment of liver carcinoma. For patients with hepatic cirrhosis liver transplantation can cure both the cancer and liver cirrhosis. However liver carcinoma may recur or metastasize after resection or liver transplantation mainly via the hematogenous route. Although lymphatic metastasis can occur metastasis is usually found in the hepatic hilus upper abdomen and retroperitoneal lymph nodes [1]. Pulmonary lymphangitic carcinomatosis (PLC) is a special manifestation of metastatic cancer in the lymphatic vessels of the lung that is characterized by diffuse or focal growth. Most PLC cases originate from adenocarcinomas. PLC is rare in liver carcinoma patients. To the best of our knowledge no studies reported to date have described PLC after liver transplantation. Case presentation A 45-year-old man was admitted to our hospital with a complaint of repeated episodes of abdominal distension. He was diagnosed with HBV-induced hepatic cirrhosis and liver carcinoma (T3N0M0). He underwent liver transplantation without any metastasis before the operation. Pathological analysis identified a tumor (12 cm?—?8 cm?—?10 cm) in the right lobe of the liver within which the cancer cells were arranged in nests and pleomorphism was seen. These findings together with the results of immunohistochemistry demonstrated features of mixed liver carcinoma: ?-fetoprotein (+) hepatocytes (+) CD34 (+) CD19 (+) CD10 (focal +) synaptophysin (-) chromogranin A (-) and cytokeratin (pan +) (). The function of the graft liver was favorable. FK506 was used alone for antirejection therapy. Immunohistochemical staining of mixed liver carcinoma tissue specimens. (A) Cancer cells were arranged in nests and showed atypia. The interstitium was rich in sinusoids and invasive growth was noted. (B) Image showing cytokeratin 19 (CK19) (+). (C) Image showing CK7 (+). All three images are stained with hematoxylin and eosin and were scanned at 100— original magnification. Two months later the patient developed a dry cough of unknown etiology and his condition deteriorated 1 week later. Expectoration was occasionally present accompanied by chest tightness shortness of breath and hypoxemia (75 mmHg partial pressure of oxygen). Fever and chills were absent and the patient™s white blood cell count neutrophil count and inflammatory factors were normal. His sputum culture was negative. Lung computed tomography (CT) suggested infectious lesions in the lung which were characterized by interstitial changes. Right-sided pleural effusion and segmental atelectasis in the lower lobe of the right lung were noted. Several enlarged lymph nodes were identified in the mediastinum (A). Thoracentesis was immediately performed and approximately 2000 ml of light yellow fluid was collected. The patient™s chest tightness and shortness of breath improved significantly. Posttransplantation interstitial pneumonia was considered at first. FK506 was discontinued and methylprednisolone (40 mg every 12 hours) caspofungin sulfamethoxazole (SMZ) and aminophylline were administered. Computed tomography scans of the lungs. (A) Soon after the appearance of the patient™s respiratory symptoms a computed tomography (CT) scan revealed septal thickening of the peribronchovascular interstitium pleural effusion segmental atelectasis in the right lower lobe of the lung and several enlarged lymph nodes in the mediastinum. (B) Discontinuation of anti-infection therapy and 5 days after thoracentesis extensive involvement of the parenchyma with septal thickening was evident with reticulonodular densities in all lung fields. Five days later a lung CT scan showed reexpansion of the right lung and diffuse exudate in the interstitium. Multiple nodules were found in both lungs (B). Pulmonary function tests showed severe obstructive ventilatory dysfunction and moderate reduction in carbon monoxide diffusion capacity. Examination of exfoliated cells in the pleural effusion showed cancer cells (). Positron emission tomography (PET)-CT indicated multiple nodules and patchy or cloudy shadows with high density in both lungs (maximal standardized uptake value (SUV) approximately 6.27). Several enlarged lymph nodes were found in the mediastinum hepatic hilus and retroperitoneum (maximal SUV approximately 8.39). Moreover lesions with increased density were found in the left third rib the right upper femur and the left acetabulum which were accompanied by an increase in fluorodeoxyglucose. The patient was diagnosed with PLC after liver transplantation due to liver carcinoma. Cancer cells among the exfoliated cells in the pleural effusion are shown. All slides are stained with hematoxylin and eosin and were photographed under light microscope at 400 — original magnification. The treatment with steroid and aminophylline continued to improve the status of the patient™s interstitial lesions. Although antirejection therapy was stopped rejection did not occur and the function of the graft liver was stable. Oral capecitabine was administered but was not effective. The patient experienced increasing chest tightness and shortness of breath and he died as a result of respiratory failure 1 month later. Discussion PLC was first described by Troisier in 1873. About 30% to 40% of malignancies may present with metastasis to the lung and PLC accounts for approximately 6% to 8% of metastatic cancer in the lung. Most PLCs originate from adenocarcinomas and they are most often due to lung cancer followed by breast cancer and gastric cancer [23]. Patients with renal cancer cervical cancer thyroid cancer and melanoma rarely develop PLC [4-6]. The pathologic features of PLC include infiltration of cancer cells and interstitial edema in and around lymphatic vessels as well as infiltration of inflammatory cells caused by lymph node metastasis in the lung. The metastatic cancer in the mediastinal and pulmonary hilar lymph nodes may obstruct lymphatic drainage resulting in retrograde migration of cancer cells into terminal lung tissues via lymphatic vessels or anterograde migration of cancer cells in the pleura into the pulmonary hilar lymph nodes through intrapulmonary lymph vessels. In addition a cancer embolus may form in the terminal vessels of the lung due to hematogenous metastasis which can invade the surrounding lymphatic vessels. Thus hilar and mediastinal lymph node metastasis may be present or absent in PLC depending on the route of metastasis of the primary cancer. Extrahepatic metastasis of liver carcinoma is mostly found in the lung adrenal gland bone and central nervous system. Hematogenous spread is thought to be the most common extrahepatic metastatic route [78]. "
Lung_Cancer
"Overall survival (OS) curves were delineated by the Kaplan-Meier method and compared with log-rank test. For all tests p-values less than 0.05 were considered to be significant. All p-values given were results of two-sided tests. Results PDGF-BB and VEGF-C coexpression in primary human NSCLC In primary human NSCLC tissues PDGF-BB (Figure 1A B) and VEGF-C (Figure 1C D) expression were mainly present in the cytoplasm of cancer cells. PDGF-BB was also found on cancer cell membrane. Occasional and weak expression of PDGF-BB and VEGF-C were found in both cancer stroma and paracancerous normal tissues. Among 109 cases PDGF-BB and VEGF-C overexpression was 66.97% (73/109) and 65.14% (71/109) respectively. A cohort of patients was classified into 4 groups according to the expression of PDGF-BB and VEGF-C in the same patient. As shown in Table 1 47.7% (52/109) had overexpressions of both PDGF-BB and VEGF-C ( P?+?V+); 19.3% (21/109) had overexpression of PDGF-BB but low expression of VEGF-C (P?+?V-); 17.4% (19/109) patients had overexpression of VEGF-C but low expression of PDGF-BB (P-V+); 15.6% (17/109) patients had low expressions of both PDGF-BB and VEGF-C (P-V-). PDGF-BB expression had a positive correlation with that of VEGF-C (r?=?0.451 p?=?0.034) ( Figure 2). Immunohistochemical staining for PDGF-BB VEGF-C and D2-40 in primary NSCLC tissues (—200). A: PDGF-BB overexpression in adenocarcinoma. B: PDGF-BB overexpression in squamous cell carcinoma. C: VEGF-C expression in adenocarcinoma. D: VEGF-C expression in squamous cell carcinoma. E: D2-40 expression in the lymphatic endothelial cells in adenocarcinoma. F: D2-40 expression in the lymphatic endothelial cells in squamous cell adenocarcinoma. Relationship between the expression of PDGF-BB and VEGF-C in all adenocarcinoma and squamous cell carcinomas in NSCLC patients. Among 44 specimens from cases with lymph node metastasis 29 had P?+?V+ 5P?+?V- 7 P-V+ and 3 P-V-. There was a significant association between P?+?V?+?and lymph node metastasis (p?=?0.006). In addition compared with the P-V- cases the cases with P?+?V?+?were younger (p?=?0.047) and also had larger tumor size (p?=?0.037) and worse histological differentiation (p?=?0.017). While the cases with P-V?+?patients had worse histological differentiation (p?=?0.027) no other clinicopathological factores were found to be related to P?+?V- or P-V?+?. Relationship between lymphangiogenesis and coexpression of both PDGF-BB and VEGF-C in primary human NSCLC D2-40 expression was strictly present in the lymphatic endothelial cells. D2-40 positive lymphatic vessels were almost exclusively found at the tumor™s invasion front within the tumor stroma. The peri-tumoral lymphatic vessels were dilated and occasional invasion of the cancer cells into the dilated lymph vessels was observed (Figure 1E F). The amount of LMVD (25.970 ± 14.9347) in specimens from cases with lymph node metastsis was much higher than those without lymph node metastasis (17.860 ± 6.5640) p?=?0.015 (Figure 3A). Comparison of LMVD between the patients (A) who had lymph node metastasis and who didn™t and among the patients (B) who had P?+?V+ P?+?V- P-V?+?and P-V-. LMVD was also observed to be linked to P?+?V+. The amount of LMVD was 24.727 ± 13.772 in specimens with P?+?V+ 19.860 ± 6.663 in P?+?V- 20.395 ± 10.137 in P-V+ and 13.453 ± 4.503 in P-V-. Compared with other three groups LMVD in P?+?V?+?was significantly increased p?=?0.004 (Figure 3B). Prognostic significance of PDGF-BB and VEGF-C coexpression in primary human NSCLC P?+?V?+?was correlated with poor overall survival (OS). The univariate survival analysis showed that cases with P?+?V?+?had shorter survival time (38.7 m ) compared with those with P-V- (45.8 m) p?=?0.015. However no significant relationship was observed between OS and P?+?V- or P-V?+?( Figure 4). Relationship between coexpression of VEGF-C and PDGF-BB and overall survival in primary NSCLC patients. Disscussion Today accumulating evidences show that tumor may establish not only their own new blood vessels supply but might also induce lymphangiogenesis to promote its spread [29]. So possible inhibition of those processes might be of benefit for cancer patients especially as recent data suggest that the process of lymphangiogenesis is not only limited to primary tumor but is also present in lymph node metastases resulting in further cancer cell spread [30]. In this study we found the disordered and dilated lymphatic vessels were almost exclusively in peri-tumoral lesions but not in intra-tumoral lesions. And the amount of LMVD in cases with lymph node metastasis was significantly higher than those without lymph node metastasis. The results showed lymphangiogenesis existed in NSCLC tissues and was associated with lymphatic metastasis which is consistent with previous reports [11] and might be explained by a rising interstitial pressure caused by an increase in the size of lesion or by the lack of intratumoral lymphangiogenesis in NSCLC [31]. Indicating that peri-tumoral lymphatic vessels are important for the process of metastatic spread while intra-tumoral lymphatic vessels are non-functional [3233]. Lymphangiogenesis may require the interaction of several tumor-derived growth factors. It is demonstrated that VEGF-C and PDGF-BB are both important growth factors contributing to lymphangiogenesis [22]. VEGF-C can activate the VEGFR-3 signaling pathway to induce the lymphatic enlargement and lymphangiogenesis [14]. A study demonstrated that PDGF-BB can promote lymphangiogenesis and lymphatic metastasis by a VEGFR-3 independent mechanism in the mouse cornea in vivo [19]. "
Lung_Cancer
"This study was supported by grants from National Basic Research Program of China (973 Program No. 2012CB967003 to S. Shao) Natural Science Foundation of China (NO. 20935004 81071784 to S. Shao and 81172028 to Z. Hou). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Squamous cell carcinoma (SCC) is the second most common type of lung cancer accounting for about 30% of all lung cancers [1]. When diagnosed early lung SCC (LSCC) is well curable by surgical excision. However most of LSCC patients encounter high rate of recurrence for metastasis and resistance to existing chemotherapeutic agents after resection. Therefore in order to reduce mortality of LSCC it is necessary to identify molecular markers for early diagnosis and elucidate the biochemical mechanism governing the processes of recurrence and metastasis as well as therapeutic resistance. A proteomic approach using fluorescent dye-labeled proteins coupled with two-dimensional gel electrophoresis (2-DIGE) and mass spectrometric (MS) analysis has been widely applied to identify differentially expressed proteins between normal and tumor specimens [2]. These differentially expressed proteins could either serve as molecular markers for diagnosis or lead to understanding the molecular mechanisms of metastasis and therapeutic resistance. By employing the 2-DIGE and MS approaches we compared the protein profiles between clinical metastatic non-metastastic LSCC tissues and adjacent normal lung tissues and identified a number of differentially expressed proteins participating in many biological functions such as cell signaling regulation carbohydrate metabolism molecular chaperones and protein synthesis. Among these protein candidates we were particularly interested in fructose-bisphosphate aldolase A (ALDOA) an key enzyme in glycolysis responsible for catalyzing the reversible conversion of fructose-16-bisphosphate to glyceraldehydes-3-phosphate and dihydroxyacetone phosphate [3]. ALDOA is one of the three aldolase isozymes (A B and C) encoded by three different genes. These aldolases are differentially expressed during development. ALDOA is highly expressed in the developing embryo and in adult muscle [3]. ALDOA contributes to various cellular functions and biological process related to muscle maintenance regulation of cell shape and mobility striated muscle contraction actin filament anization and ATP biosynthetic process [4]“[13]. ALDOA deficiency is associated with myopathy and hemolytic anemia [14]“[16]. Notably ALDOA has been found highly expressed in a variety of malignant cancers including human lung squamous [17]“[18] renal cell [19] and hepatocellular carcinomas [20]. However none of these reports examined the involvement of ALDOA in LSCC progression and metastasis. In this study we reported that ALDOA is highly expressed in LSCC and its expression level is correlated with LSCC metastasis. Further we demonstrated that depletion of ALDOA in lung cancer cells reduces its tumorigenicity and capability of migration. These observations suggest that ALDOA is a potential biomarker of LSCC metastasis and play important role in LSCC progression and metastasis. Materials and Methods Samples Preparation and Proteomic Analysis Seven pairs of matched primary LSCC samples (6 male and 1 female aging from 36 to 67 years old with an average age of 55 years old) were obtained from the Department of Thoracic Surgery of the First Affiliated Hospital of Dalian Medical University China. Three pairs are non-metastatic and 4 pairs are metastatic. No patients received preoperative radiotherapy and chemotherapy. The study was approved by the Ethic and Research Committees of Dalian Medical University and was conducted in accordance with the Declaration of Helsinki Principles. The patients thoroughly understood the collecting process and purpose of using the specimens and signed œinformed consents-specimen collection. The fresh samples from tumor and normal tissues (>5 cm away from the lesion) were snap-frozen and stored at ?80°C. The pathological diagnosis was done to confirm that tumor specimens were real SCC tissues. Surgery follow-ups were conducted to each patient at an interval of 12 months for 3 years. To prepare protein extracts the tissues were homogenized in buffer containing 7 M urea 2 M thiourea 4% CHAPS 30 mM Tris and a cocktail of protease inhibitors (GE Healthcare) and the supernatants were collected by centrifugation at 12000 g for 15 min at 4°C. 50 ug of pooled protein extracts was labeled with Cy2 as the internal standard control Cy3 and Cy5 were used to label experimental samples. The resulting samples were resolved bi-dimensionally on 12.5% SDS-PAGE gels. Images were acquired using the fluorescence scanner (GE Healthcare) at excitation wavelengths of 488/520 nm 532/580 nm or 633/670 nm respectively. The image analysis was processed using DeCyder 6.5 (GE Healthcare). BVA software module was used for matching spots between gels and average abundance and statistics calculation. The protein abundance was represented by the volume ratio of samples versus standards and the proteins of interest with an average ratio more than 1.50 or less than ?1.50 were selected for mass spectrometry analysis. Western Blot immunofluorecence and LSCC tissue microarrays Protein extracts (50 µg) were resolved on 12% SDS-PAGE gels transferred to nitrocellulose membranes (0.45 µm) and immunoblotted with rabbit anti-human ALDOA antibody (HPA004177 Sigma; 1?1500) or mouse anti-human ?-actin monoclonal antibody (1?4000)."
Lung_Cancer
"developed by Coussens and Werb [8]. In this method hydroxyl radical which is the most potent radical is produced via Fenton Reaction. In the classical Fenton reaction the hydroxyl radical is produced by mixing ferrous ion solution and hydrogen peroxide solution. In the recently developed assay by Erel the same reaction is used. In this assay ferrous ion solution which is present in Reagent 1 is mixed with hydrogen peroxide which is present in Reagent 2. The sequentially produced radicals such as brown colored dianisidinyl radical cation produced by the hydroxyl radical are also potent radicals. In this assay antioxidative effect of the sample against the potent-free radical reactions which is initiated by the produced hydroxyl radical is measured. The assay has got excellent precision values which are lower than 3%. The results are expressed as mmol Trolox equiv./L. 2.6. Oxidative Stress Index (OSI) The percent ratio of the TOL to the TAC gave the OSI an indicator of the degree of oxidative stress. To perform the calculation the result unit of TAC was changed to mmol Trolox equiv./L and the OSI value was calculated as below formula; OSI = [(TOL mol/L)/(TAC mmol Trolox equiv./L)£100. C-reactive protein (CRP) transferrin ceruloplasmin???-1 antitripsin and ferritin levels were determined by immunonephelometric method with an autoanalyser (Image 800 Beckman Coulter Fullerton CA USA); ve copper was determined by atomic absorption/emission spectrometer (Shimadzu 6401S Shimadzu Biotech Kyoto Japan). 2.7. Statistical Analysis Data were stored in an Excel 2003 (Microsoft Redmond WA USA) worksheet and loaded by statistics software SPSS 18.0 (SPSS Inc. Chicago IL USA) was used for statistical analysis. One way ANOVA was used to compare the values of the biochemical parameters of MM asbestos exposure and control groups. Differences in mean values of the parameters between subgroups were assessed for statistical significance by Tukey test. Results were presented as n mean ± SD (standard deviation). Differences with a value of less than 0.05 were accepted as statistically significant. 3. Results Mean age of MM group is 58.9 ± 12.3 years (23 females 23 males) mean age asbestos group 61.7 ± 21.4 (44 women 36 men) and mean age of control group 58.3 ± 16.2 (26 female 24 male). summarizes serum TOL TAC and OSI activities CRP transferrin ceruloplasmin ?-1 antitrypsin ferritin and copper profiles in MPM group asbestos exposure group and control. As shown in the mesothelioma group exhibited higher TOL (P < 0.001) OSI (P = 0.007) ?1-antitrypsin (P < 0.001) ferritin (P < 0.001) and copper (P < 0.001) levels as compared to the other groups. The TAC level was lower in the mesothelioma group than in the asbestos group (P < 0.001) and it was similar in the mesothelioma and control groups (P = 0.074). Transferrin was lower in the mesothelioma group than in the other two groups (P < 0.001). The asbestos group had higher TOL (P < 0.001) TAC (P < 0.001) ?1-antitrypsin (P < 0.001) and transferrin (P < 0.001) levels as well as lower OSI (P < 0.001) and ferritin (P < 0.001) levels as compared to the control group. 4. Discussion TAC TOL and OSI have not been studied regarding their roles as oxidative stress markers in patients with environmental asbestos exposure. In our study the asbestos and mesothelioma groups showed significantly higher TOL values indicating that asbestos exposure leads to increased ROS levels. In the asbestos group increasing TOL was observed to be balanced with increasing TAC while oxidative stress was found to be at nonsignificant levels (low OSI). On the other hand MM group showed higher increases in TOL levels as compared to the asbestos group while also displaying inadequate balancing with antioxidants (low TAC) and a marked level of oxidative stress (high OSI). Numerous papers suggest that oxidative stress caused by free radicals and ROS plays a crucial role in the development of asbestos-induced lung disease [2 15]. Asbestos leads to excessive ROS synthesis in two ways: (1) direct chemical catalyzer impact generated by the free iron ion content (Fe+2) (Fenton reaction) and (2) induction by the activation of inflammatory cells to the site of asbestos fiber deposition [2“4]. Stress occurs when the oxidative/antioxidative balance is shifted towards the oxidative side in tissues and ans. The oxidant burden results in multiple genetic alterations such as facilitating mutations and/or inactivation of tumor suppression genes and activating oncogenes [16]. In oxidative stress can lead to cell injury by various pathways or possibly underbalanced conditions may initiate malignant transformation. Previous in vitro cell culture and animal trials have shown that asbestos causes oxidative stress in the lung epithelium and pleural cells. Decreased levels of antioxidant enzymes such as superoxide dismutase catalase glutathione peroxidase and heme oxygenase; and increased levels of oxidant markers such as MDA were reported [4“6 17]. In the present study elevated TOL in the asbestos and MM groups was a finding consistent with the previous studies [4“6 17]. In the MM group elevated TOL was observed to receive inadequate neutralization from TAC leading to the development of a marked oxidative stress. Our study supports the idea that oxidative stress markers (TOL TAC and OSI) can be useful in the assessment of predisposition to MM development and early diagnosis among cases of asbestos exposure. Moreover delivery of antioxidants in these individuals is believed to reduce the risk of MM development. However further prospective studies including long-term follow-up of patients with asbestos exposure is needed. Asbestos exposure is claimed to cause chronic inflammation thus leading to alteration of immunocompetent cells and later reduction of tumor immunity [15]. High levels of CRP in the blood and pleural fluid and its correlation with survival has been reported in patients with MM [18“20]. In our study CRP levels were comparable in the asbestos and control groups indicating that inflammation was not remarkable in the asbestos group. However CRP was significantly higher in the MM group than in the other groups. Elevated CRP level may be an indicator of development of asbestos-related diseases such as MM. ?1-antitrypsin is known to be active particularly in the protection of alveoli and liver while also having a remarkable antioxidant property [21]. In one study ?1-antitrypsin level was associated with asbestos-related immunologic stimulation and diffuse pulmonary fibrosis [22]. Increased ?1-antitrypsin level was found useful for diagnosis metastasis and recurrence evaluation in lung adenocarcinoma [23 24]. In the present study ?1-antitrypsin was higher in the asbestos group than in the control group whereas it was higher in the MM group than in the asbestos group. However when we consider that ?1-antitrypsin is both an inflammatory marker and an antioxidant and that CRP level was comparable in the asbestos and control groups in our study it is clear that the elevated ?1-antitrypsin level in the asbestos group was a response against the TOS not against the inflammation. Transferrin is a negative acute phase reactant with a mild antioxidant property. In one study serum transferrin level was found to be lower in the lung cancer group than in the control group and therefore it was noted as suitable for monitoring prognosis [25]. In our study transferrin level was significantly higher in the asbestos group than in the control group suggesting that the degree of inflammation was lower in the asbestos group. The transferrin level in the MM group was significantly lower as compared to the other two groups indicating that the degree of inflammation in MM was more remarkable. Ferritin is a protein in the body that binds to iron while also acting as a positive acute phase reactant. In the present study the ferritin level was significantly lower in the asbestos group than in the control group. Significantly elevated ferritin level in the MM group indicates a high-level inflammation. Studies have shown that serum ferritin is high in lung cancer patients and it has been noted as an important marker for the evaluation of performance status and prognosis [26]."
Lung_Cancer
"Lung cancer Background The complement system plays a critical role in the process of carcinogenesis. Despite of significant research controversial viewpoints remain on the exact relationship of complement system with cancer. Classically the complement system fights against cancer by exerting the effects of immunosurveillance in the immunologic microenvironment of tumors [1]. Recently it was found that complement may contribute to tumor growth by a wide variety of mechanisms including dysregulation of mitogenic signaling pathways sustained cellular proliferation angiogenesis insensitivity to apoptosis invasion and migration and escape from complement cytotoxicity [2]. This suggested complement just like a double-edged sword plays a dual role in carcinogenesis. In particular component C3 and its receptors have been demonstrated to be a key link between innate and adaptive immunity [3]. Complement receptor type 1 (CR1 CD35) is a multifunctional polymorphic glycoprotein which binds to C3b fragment of C3 and to C4b with lower affinity [45]. CR1 belongs to the regulators of complement activation (RCA) family of proteins and is expressed in a wide spectrum of cells and involved in T-cell and B-cell mediated immune regulation [67]. CR1 also modulates the complement cascade activation by preventing formation of classical and alternative pathway convertases and by acting as a cofactor for factor I mediated inactivation of C3b and C4b [89]. It has been demonstrated that chronic inflammation can predispose to cancer development and spread [10] as a fundamental component of innate immunity the complement cascade consists of potential proinflammatory molecules especially C3 and C5. Moreover complement activation and abnormal expression in tumor tissues has been demonstrated [11]. Considering the important role of CR1 in complement activation innate immunity and chronic inflammation CR1 has emerged as a molecule of immense interest in gaining insight into the susceptibility to cancer. CR1 gene is located on the Chromosome 1 at the locus 1q32 [12]. Various polymorphisms have been studied including the intronic and exonic density polymorphism for their ability to alter the density of erythrocyte CR1 on the cell membranes [13-15]. There are also the molecular weight variants due to insertion-deletion polymorphisms [16]. Up to now there have been very few studies on the association of genetic variants of CR1 with susceptibility to autoimmune and inflammatory diseases. It has been proposed that genetic variant at CR1 gene (rs6656401) might influence the susceptibility to late-onset Alzheimer™s disease [17]. CR1 expression in Peripheral Blood Mononuclear Cells (PBMCs) may be a new biomarker for prognosis of nasopharyngeal carcinoma and a potential therapeutic target [18]. Recently it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However the association of genetic variants of CR1 with risk of lung cancer remains unexplored. Worldwide lung cancer is the most common cancer in terms of both incidence and mortality [20]. NSCLC is the most common subtype of lung cancer and less aggressive and metastic than SCLC. Although cigarette smoking is the predominant risk factor for lung cancer inherited genetic characteristics are presumed to account in part for this interindividual variation in lung cancer susceptibility. Recently several genome-wide association studies have demonstrated the common genetic variations associated with susceptibility to lung cancer [21-24]. Given the involvement of the complement system in coordinating innate immunity and inflammatory response [25] further examination of the potential association between genetic variation of CR1 genes and lung cancer is warranted. In the current study we conducted a case-control study to investigate the association of tag SNPs in CR1 gene with the risk of NSCLC and effect of the interaction of gene-environment on the risk of NSCLC. Results Subject characteristics The frequency distributions of select characteristics in cases and control subjects were shown in . The mean age (±SD) was 59.6?±?10.5 years for the cancer patients and 57.2?±?13.3 years for the controls. No significant difference was found in the mean age between cases and controls (P?=?0.470). There was no significant difference in proportion of sex and smoking status between cases and controls (P?=?0.832 and P?=?0.321 respectively). However there was significant difference between cases and controls when compared by pack-year smoked (P = 0.001). The heavy smokers (?25 pack-year) accounted for 61.5% in cases but only 45.5% in controls which suggested that cigarette smoking was a prominent contributor to the risk of lung cancer. Of the 470 case patients 178 (37.9%) were diagnosed as adenocarcinoma 238 (50.6%) as squamous cell carcinoma and 100 (%) as other types including large cell carcinoma (n?=?49) and mixed cell carcinoma (n?=?5). Distributions of select characteristics in cases and control subjects Variables ???Cases (n?=?470) ???Controls (n?=?470) No (%) No (%) P a ???Sex 0.832 ???Male 324 68.9 328 69.8 ???Female 146 31.1 142 30.2 ???Age 0.470 ???<50 84 17.9 96 20.4 ???50-59 177 37.7 187 39.8 ???60-69 129 27.4 111 23.6 ????70 80 17.0 76 16.2 ???Smoking status 0.321 ???Non-smoker 265 56.4 281 59.8 ???Smoker 205 43.6 189 40.2 ???Pack-year smoked 0.001 ???<25 75 36.6 96 50.8 ????25 130 63.4 93 49.2 aTwo-sided ?2 test. Association of CR1 tag SNP with NSCLC risk Total 13 selected tag SNPs of CR1 in HapMap database among Chinese population were analyzed. Except for rs9429782 polymorphism the genotype distributions of other SNPs in controls were consistent to Hardy-Weinberg equilibrium. Therefore we excluded the rs9429782 from further analysis. In order to screen the genetic variants that confer the susceptibility to lung cancer 12 candidate tagSNPs were genotyped in a case-control study consisting of 470 lung cancer patients and 470 cancer-free controls as shown in . Importantly genotype frequency of one intronic SNP (rs7525160 G?>?C) in cases was found to be significantly different from those of controls (?2?=?6.339 P=0.042). Further multivariate regression model with adjustment for age gender and smoking status was used to assess the association between rs7525160 G?>?C polymorphism and the risk of NSCLC. The results indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC with OR (95% CI) of 1.52 (1.02-2.28) compared with the GG genotype. Other tagSNPs of CR1 were not significantly associated with the risk of NSCLC in our study population (P >0.05). Genotype frequencies of CRI among cases and controls and their association with non-small cell lung cancers CRI Genotypes ??Controls (n?=?470) ??Cases (n?=?470) OR (95% CI ) * P No (%) No (%) rs7525160 ??GG 176 37.5 139 29.6 1.00 (ref.) ??CG 228 48.5 256 54.5 1.38 (1.04-1.85) 0.041 ??CC 66 14.0 75 15.9 1.52 (1.02-2.28) 0.028 rs3886100 ??GG 117 24.9 105 22.4 1.00 (ref.) ??AG 223 47.4 253 53.8 1.33 (0.97-1.81) 0.078 ??AA 130 27.7 112 23.8 1.06 (0.73-1.54) 0.755 rs11118167 ??TT 348 74.1 353 75.1 1.00 (ref.) ??CT 111 23.6 102 21.7 0.89 (0.65-1.21) 0.457 ??CC 11 2.3 15 3.2 1.35 (0.61-3.01) 0.461 rs9429782 ??GG 250 53.2 261 55.5 1.00 (ref.) ??GT 220 46.8 209 44.5 0.89 (0.69-1.16) 0.388 rs10494885 ??CC 178 37.9 164 34.9 1.00 (ref.) ??CT 224 47.6 232 49.4 1.11 (0.83-1.47) 0.490 ??TT 68 14.5 74 15.7 1.20 (0.81-1.78) 0.365 rs7542544 ??CC 128 27.2 108 23.0 1.00 (ref.) ??AC 223 47.5 252 53.6 1.21 (0.88-1.67) 0.239 ??AA 119 25.3 110 23.4 0.90 (0.62-1.30) 0.897 rs6691117 ??AA 324 68.9 327 69.6 1.00 (ref.) ??AG 131 27.9 128 27.2 0.98 (0.73-1.31) 0.888 ??GG 15 3.2 15 3.2 0.96 (0.46-2.02) 0.923 rs6656401 ??GG 436 92.8 447 95.1 1.00 (ref.) ??AG 34 7.2 23 4.9 0.68 (0.39-1.18) 0.174 ??AA 0 0.0 0 0.0 NC§ rs2296160 ??CC 185 39.4 194 41.3 1.00 (ref.) ??CT 226 48.1 220 46.8 0.91 (0.69-1.21) 0.521 ??TT 59 12.5 56 11.9 0.90 (0.59-1.37) 0.606 rs9429942 ??TT 452 96.2 457 97.2 1.00 (ref.) ??CT 18 3.8 13 2.8 0.77 (0.37-1.61) 0.482 ??CC 0 0.0 0 0.0 NC§ rs4844600 ??GG 171 36.4 179 38.1 1.00 (ref.) ??AG 230 48.9 228 48.5 0.92 (0.70-1.22) 0.571 ??AA 69 14.7 63 13.4 0.87 (0.58-1.31) 0.513 rs3818361 ??CC 187 39.8 188 40.0 1.00 (ref.) ??CT 224 47.7 224 47.7 0.98 (0.74-1.29) 0.868 ??TT 59 12.5 58 12.3 0.96 (0.63-1.46) 0.848 rs17048010 ??TT 301 64.0 286 60.8 1.00 (ref.) ??CT 154 32.8 164 34.9 1.09 (0.82-1.43) 0.556 ??CC 15 3.2 20 4.3 1.40 (0.70-2.79) 0.343 *Adjusted by age sex and smoking status; §NC not calculated. Table 3 Summary of MDR gene-gene interaction results Models Training bal. acc. (%) Testing bal. acc. (%) P value Cross-validation consistency rs7525160 54.03 50.53 0.828 7/10 rs4844600 rs10494885 55.45 49.32 0.989 3/10 rs4844600 rs10494885 rs7525160 57.60 48.48 0.623 6/10 Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene interaction models is listed in Table 3. The SNP rs7525160 in CR1 had the highest testing balanced accuracy among 12 SNPs. The three-way interaction model among rs4844600 rs10494885 and rs7525160 showed high testing balance accuracy and cross validation consistency but the testing balanced accuracy was lower than the two-way gene-gene interaction in NSCLC. For each model the interaction was not significant (P?>?0.05). Table 4 Risk of CR1 genotypes with NSCLC by smoking status Smoking status CR1 genotype GG * OR (95% CI) § P value CG?+?CC * OR (95% CI) § P value Non-smoker 84/99 1.00 (reference) 181/182 1.15 (0.81-1.65) 0.440 Smoker 55/77 0.86 (0.54-1.38) 0.528 150/112 1.72 (1.15-2.59) 0.009 <25 pack-years 19/41 0.59 (0.31-1.10) 0.099 56/55 1.32 (0.81-2.61) 0.266 ?25 pack-years 36/36 1.18 (0.67-2.08) 0.562 94/57 2.01 (1.26-3.20) 0.003 *Number of cases/number of controls. §Data were calculated by logistic regression and adjusted for age and gender. Interaction of CR1 SNP with smoking Cigarette smoking is a well-known risk for lung cancer so stratification by smoking status was performed to investigate the association of rs7525160 G?>?C variant with the risk of NSCLC. As shown in Table 4 the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) suggesting that the CR1 rs7525160 G?>?C polymorphism is a smoking-modifying risk factor for susceptibility to NSCLC. When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year) consistently GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). The P value for heterogeneity of the stratification analysis by smoking status is 0.015. However the P value for interaction between rs7525160 polymorphism and smoking is 0.172 and the power for the interaction is 0.49. Discussion The chronic airway inflammation and dysfunctional immune system might promote pulmonary carcinogenesis. Implicated in the immune and inflammatory responses the complement cascade plays a pivotal role in the development of cancer. Thus it is likely that the genetic variants of CR1 in the complement system confer the susceptibility to lung cancer. In this study we have for the first time demonstrated that one intronic SNP (rs7525160 G?>?C) out of 13 tag SNPs of CR1 was associated with the risk of NSCLC in Chinese population. Notably the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. MDR analysis also showed that there was no gene-gene interaction among 12 tag SNPs in CR1 gene. Moreover the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) indicating this SNP is a smoking-modifying risk factor for susceptibility to NSCLC. To the best of our knowledge this study shed new insight into the interplay of genetic variation of CR1 with lung cancer risk. More importantly it highlights the potential gene-environmental interaction influences the susceptibility to lung cancer. The complement system has been proposed to get involved in innate immunity with the ability to œcomplement antibody-mediated elimination of immune complex and foreign pathogens [26]. Upon complement activation the biologically active peptides C5a and C3a elicit a lot of pro-inflammatory effects and could be closely associated with tumorigenesis [27]. Complement proteins play a dual role in the tumor microenvironment. On one hand they exert a defensive effect against tumor through complement or antibody-dependent cytotoxicity [128]. On the other hand they may escape from immunosurveillance and facilitate carcinogenesis [2]. Specifically a number of experimental evidence has suggested an association between complement activation and tumor growth [2930] which provides a strong biologically link between the abnormal expression and activity of complement cascade and carcinogenesis. Till now a few studies have been carried out to demonstrate the association of genetic variants in complement proteins with susceptibility to cancer. A significant association of CR2 SNP (rs3813946) with the development of nasopharyngeal carcinoma was indicated in Cantonese population [31] and the genetic variations of complement system genes C5 and C9 plays a potential role in susceptibility to non-Hodgkin lymphoma (NHL) [32]. Recently it has been shown that complement factor H Y402H polymorphism interact with cigarette smoking to confer the susceptibility to lung cancer [33]. Furthermore it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However whether the genetic variants of CR1 are related to the risk of lung cancer remains unknown. In this case-control study we found an intronic SNP (rs7525160 G?>?C) with CC genotype was significantly associated with an increased risk of NSCLC. Consistently our results were in accordance with the study that genetic polymorphisms in innate immunity genes may play a role in the carcinogenesis of lung cancer [34]. It is likely that some genetic variations in strong link disequilibrium with this intronic SNP (rs7525160 G?>?C) are functional which provides a new insight into the hallmarks in susceptibility to lung cancer and further functional experiments are warranted to address the proposal. Functionally human CR1 exists on the surface of almost all peripheral blood cells and plays a key role in immune complex clearance and complement inhibition at the cell surface by binding to activated products C3b and C4b [435]. CR1 also possesses cofactor activity for the serum protease factor I and is thus involved in the generation of further fragments of C3/4b with the activation of complement cascade and the cellular immune response [4]. In our study the association of CR1 polymorphism with lung cancer is biologically plausible in that the intronic polymorphism could affect the density of CR1 molecules on the cell surface thereby contributing to autoimmune disorders and neoplasm. Tobacco smoking is an established risk factor for susceptibility to lung cancer. However not all people who suffer from lung cancer are smokers. Lung cancer in non-smokers can be induced by second hand smoke air pollutants and diesel exhaust [36-39]. Our present data showed significant difference of pack-year smoked but not smoking status between NSCLC cases and controls which suggested the important role of other environmental factors in the development of NSCLC. Tobacco could induce chronic and sustained inflammation in lung microenvironment contributing to pulmonary carcinogenesis in smokers [40]. Support also comes from the epidemiologic data regarding inflammation and lung cancer [41]. CR1 an important molecule implicated in immunity and inflammation could protect the host from invasion of exogenous chemicals derived from cigarette smoking. Genetic variant of CR1 could alter gene function and result in deregulation of the inflammatory and immune responses thereby modulating the susceptibility to lung cancer. More importantly we observed a potential interaction of this SNP (rs7525160 G?>?C) with smoking status suggesting the gene-environmental interaction plays a prominent role in the susceptibility to lung cancer. Our present study has its limitation. Our patients may not be representative of total NSCLC patients at large because they were recruited from only one hospital. In addition due to the relatively small sample size further case-control studies are still needed to replicate and extend our findings. Conclusion We conducted a case-control study in Chinese subjects and found an intronic SNP (rs7525160 G?>?C) of CR1 was significantly associated with lung cancer risk. To the best of our knowledge this study provides the first evidence that genetic variant of CR1 (rs7525160 G?>?C) was a smoking-modifying contributor to the development of lung cancer. Methods Study subjects This case-control study consisted of 470 patients with histopathologically confirmed NSCLC and 470 cancer-free controls. All subjects were genetic unrelated ethnic Han Chinese. Patients were recruited between January 2008 and December 2012 at Tangshan Gongren Hospital (Tangshan China). There were no age gender or stage restrictions however patients with previous malignancy or metastasized cancer from other organs were excluded. The response rate for patients was 94%. The controls were randomly selected from a pool of a cancer-free population from a nutritional survey conducted in the same region. The selection criteria for control subjects included: i) no individual history of cancer; ii) frequency matched to cases according to gender age (±5 years); iii) the residential region; and iv) the time period for blood sample collection. At recruitment informed consent was obtained from each subject and each participant was then interviewed to collect detailed information on demographic characteristics. This study was approved by the institutional review board of Hebei United University. Tag SNPs selection and genotyping Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs with an r2 threshold of 0.80 and minor allele frequency (MAF) greater than 1%. Furthermore we also added two potential functional polymorphisms rs9429942 and rs6691117 [4243]. Therefore we included 13 SNPs in our study which represents common genetic variants in Chinese population. Genotyping was performed at Bomiao Tech (Beijing China) using iPlex Gold Genotyping Asssy and Sequenom MassArray (Sequenom San Diego CA USA). Sequenom™s MassArray Designer was used to design PCR and extension primers for each SNP. Primer information for selected tag SNPs was listed in Table 5. Table 5 Primers used in this study SNP_ID Alleles 1st-PCR primer sequences 2nd-PCR primer sequences UEP sequences rs7525160 G/C ACGTTGGATGCAAAATCAAGGTTTAAAGTC ACGTTGGATGTTCTGACATGTACTGCCTGC CCCTGTTGCCTGGGTTTTTCT rs3886100 G/A ACGTTGGATGGGCCTCAGATCCTCAAAATC ACGTTGGATGTGAGCTGTTTCAGCCAAGAG GAGCCAAGAGGACACTTAG rs11118167 T/C ACGTTGGATGATGTGTGTAGTCACTTAGCC ACGTTGGATGATAATGGCAGATTTAAGGGC CAATGATAAATGAATACTGTGTTCTATC rs9429782 G/T ACGTTGGATGACACGCGGGATCCATCGGAA ACGTTGGATGAACGAGTTTCGCTGGCAGAG GGTGCAGCAGCAGAG rs10494885 C/T ACGTTGGATGGTGTAATGCCACAGACATGC ACGTTGGATGCCAGCCAACTGACCTTTATG CTTCTGATTTTCTTTCCTGTTAC rs7542544 C/A ACGTTGGATGGCTAAGAGCCATTAGTGTGC ACGTTGGATGAACGTGGTGGTGCCCAAACA CCATGACCCCAAAGC rs6691117 A/G ACGTTGGATGAGAGTACCAGGAAACAGGAG ACGTTGGATGACCCTACCATGACAAACCCG CCGGGCTGACATCTAAATCTGA rs6656401 G/A ACGTTGGATGAAAGGACACACACAGAGGAG ACGTTGGATGCGTTGATGTTCCTTGGCTTG CTCTGTCTCCATCTTCTC rs2296160 C/T ACGTTGGATGCCAGAATTCCTCAGCAAAAC ACGTTGGATGCCAGAGTGATGTTTTGTGAC CGTGCCTTTTGTCTTCCTTTTAGGT rs9429942 T/C ACGTTGGATGTACATGTGCACAACGTGCAG ACGTTGGATGAAGGACGAGTTAATGGGTGC GGGAACGTCGCACATGTAT rs4844600 G/A ACGTTGGATGGAATGGCTTCCATTTGCCAG ACGTTGGATGGGGCGGCATTCATAGTTCAG CCCAATGGGAAACTCAAA rs3818361 C/T ACGTTGGATGTGGAAAGGACAGTTCCAGAG ACGTTGGATGTTTTAAGCCCTCTGGTAAGC TAATCCCTCTGGTAAGCATAAGATATA rs17048010 T/C ACGTTGGATGTTTCAAGGCTGCTCCTTGTT"
Lung_Cancer
"The protein encoded by DSC3 is a calcium-dependent glycoprotein (Desmocollin 3) that is required for cell adhesion and desmosome formation. The protein encoded by PKP1 may be involved in molecular recruitment and stabilization during desmosome formation. The protein encoded by CLCA2 belongs to the calcium sensitive chloride conductance protein family. It may serve as adhesion molecule for lung metastatic cancer cells. The above four genes (DSC3 DSG3 PKP1 and CLCA2) which are associated to desmosomes were found to be up-regulated in SCC compared to the AC subtype [26]. Concretely DSG3 showed high expression in SCC while low expression in AC [26]. DSC3 was also upregulated in SCC exclusively [27] [28]. In primary lung tumors DSC3 was a potential diagnostic marker for lung squamous cell carcinoma [29]. PKP1 showed a times greater level of expression in SCCs than in ACs and normal lung and thus may be useful in histopathological diagnosis [28]. CLCA2 has been inferred to be specifically overexpressed in SCC [30]. We found that subtype AC (SCC) was present (absent) if and only if NKX2-1 was expressed. It is inferred that the expression of NKX2-1 in the specimen of AC is much higher than that of SCC. NKX2-1 which is known as thyroid transcription factor 1 (TITF-1) is a homeodomain-containing transactivating factor and it expressed in the terminal lung bronchioles and lung periphery predominantly [31]. The presence of NKX2-1 protein was prevalent in AC while in SCC NKX2-1 was absent [13]. It is in accordance with our results. Examples of gene-subtype higher logic relationships The higher logic relationships between gene pairs and SCC were selected for further analysis. Gene pairs (GPX2 ITGB8) and (GPX2 SLC2A12) were related with SCC via an ˜AND™ logical relationship (higher logic relationship type ). It indicates that GPX2 ITGB8 and SLC2A12 were all expressed if the specimen was SCC. Moreover all of the genes GPX2 ITGB8 and SLC2A12 were not expressed if the specimen was AC. GPX2 was detected to have higher expression in SCC compared with AC and normal [32] [33]. We were unaware of evidence in the literature of the relationships between ITGB8 SLC2A12 and the subtypes of NSCLC. Our analysis generated several novel relationships. There are not enough evidences for higher logic relationships to distinguish the subtypes of NSCLC. Hence most of the relationships between gene pairs and the subtypes of NSCLC have not been confirmed. As the lack of knowledge about the regulation relationships between genes and subtypes the exact relationships between the common gene pairs and subtypes are deserved to be checked. Performance comparison We exacted the columns of binary probe data as well as those of phenotype profile data which correspond to the NSCLC specimens and normal specimens of GSE18842. The new binary probe data and phenotype profile data were formed by the exacted columns of binary probe data and phenotype profile data maintaining the relative positions of columns. The NSCLC and normal data comprised the new binary probe data and phenotype profile data. Application of the three methods We firstly applied the current method to the NSCLC and normal data. We set the and obtained probe-phenotype lower logic relationships. The significance and global significance of the discovered relationships were verified by statistic test. Next we applied the NMF method to the NSCLC and normal data. Rows with ˜s™ were filtered from the binary probe data to ensure the feasibility of the NMF method. The rest binary probe data contained rows and columns. Because two clusters of specimens (AC and SCC) were included in the binary probe data we chose as the dimensionality reduction parameter for the NMF method. Among the obtained two metagenes the second metagene had higher expression level in almost all (i.e. ) of the NSCLC specimens while lower expression level in almost all (i.e. ) of the normal specimens. The probes within the second metagene were sorted according to their activation levels (Table S4). The first probe represented the most closely related probe to the NSCLC phenotype while the last probe represented the least closely related probe. Finally we applied the RA method to the NSCLC and normal data. We sorted the probes by the mutual information between the probe profiles and NSCLC profiles. Note that the correlations between gene pairs and phenotypes could be measured by the current method but they could not be measured by the NMF and RA methods. Hence from this point of view the current method is superior to the two earlier methods. All of the three methods could find single genes closely related with phenotypes. Hence we just identified the gene-phenotype lower logic relationships by the current method and compared the results with those obtained by the two earlier methods. Performance comparison for the three methods We selected two datasets involved the genes which are related with NSCLC. One dataset contains high frequency genes on the mRNA level detected by Huang et al. (Table S5) [9]. It was showed that these genes belonged to the top dysfunctional gene sets with good discriminating ability. We chose the dataset because it was collected from GEO with the accession number GSE18842 which was also the source of the NSCLC and normal data in this work. The other dataset contains up-/down-regulated genes found by Urgard et al. where genes are down-regulated and genes are up-regulated in NSCLC compared to the normal tissue (Table S5) [34]. A total of genes were shared by the above two datasets. Because it is hard to validate the genes included in each dataset it is reasonable to consider these genes as the truth data to estimate the performance of different methods in this work. In order to estimate the performance of the current method and compare its performance with the two earlier methods (the NMF method and the RA method) we calculated a measure: the recall rate which was the ratio of the number of detected genes in the truth data to the total number of genes in the truth data. Note that the recall rate may be biased by the incomplete nature of the truth data. Further we evaluated the classification accuracy which evaluated the discriminating ability of resulted probes. Among all of the genes detected by probes obtained by the current method genes were in the truth data. Hence the recall rate of the current method was . To compare the recall rate of the current method with those of the two earlier methods we selected the top probes obtained by the NMF method and the RA method respectively. We found and zero of the genes in the truth data have been detected by the NMF method and the RA method respectively. Hence the recall rate of NMF and RA were and respectively. The current method had higher recall rate than NMF and RA. By Fig. 1 we found that the current method achieved higher classification accuracy than the NMF method and the RA method. Additionally the average classification accuracy of our method approached to (i.e. ) which means that the probes obtained by our method has a great classification ability. In the figure each curve was steady with little fluctuation. It indicates that the classification accuracy was little sensitive to the number of probes. .0094644.g001 The recall rate of genes obtained by three methods. According to each method we rank the genes in descending order by the coefficients of genes related with phenotypes. We selecte the top genes where . The classification accuracy is calculated based on the top genes. ˜RA™ ˜NMF™ and ˜U™ represent the relevance analysis method the non-negative matrix factorization method and the current method respectively. Biomarkers and key gene pairs Biomarkers inferred by gene-subtype lower logic relationships In previous research a total number of genes have been reported to be used to differentiate between AC and SCC and these genes are DSG3 [26] CLCA2 [30] DSC3 [27] PKP1 [28] NKX2-1 [35] GJB5 [26] KRT6B [36] SERPINB13 [36] TP63 [37] TRIM29 [38] KRT5 [28] NTRK2 [28] and DST [39]. We sorted the genes which were involved in the gene-AC/SCC lower logic relationships in descending order by their coefficients. Interestingly all of above genes were included in the top genes. It is suggested that a gene which has high uncertainty coefficient may clearly distinguish AC from SCC. To obtain a set of biomarkers we firstly selected the top ranked genes (Fig. 2). Because the molecular targets for targeted therapeutic agents play crucial roles for tumor the biomarkers for targeted therapy should have the distinct biological functions between NSCLC and normal. Next an intersection set was generated between top genes and the genes involved in gene-NSCLC lower logic relationships (the genes have been obtained in subsection ˜Performance comparison™). Finally intersect genes were regarded as the biomarkers for distinguishing "
Lung_Cancer
"The same procedures were repeated at a distance of 1 cm creating parallel lesions in order to analyse the lung tissue in between the lesions for thermal damage. In addition two implanted capsules in the lung tissue simulating a lung nodule were resected with either the laser or the monopolar cutter. The resection surfaces were then examined by magnetic resonance imaging and histology for tissue damage. Finally we created a 2-cm wide mark on the lung surface to test the resection capacity of both instruments within 1 min. RESULTS The laser created sharply delineated lesions with a vaporization and coagulation zone without thermal damage of the surrounding lung tissue. With lowering the working speed each zone was extended. At a working speed of 10 mm/s the mean vaporization depth using the laser was 1.74 ± 0.1 mm and the mean coagulation depth was 1.55 ± 0.09 mm. At the same working speed the monopolar cutter demonstrated a greater cutting effect (mean vaporization depth 2.7 ± 0.11 mm; P < 0.001) without leaving much coagulation on the resection surface (mean coagulation depth 1.25 ± 0.1 mm; P = 0.002). In contrast to the laser the monopolar cutter caused thermal damage of the adjacent lung tissue. The adjacent tissue injury was detected in histological examination as well as in the MRI findings. Adjacent lung tissue after lung metastasectomy using the monopolar cutter was hyper-intensive in T2-weighted MR imaging indicating a severe tissue damage. No significant changes in signal intensity were observed in T2-weighted imaging of the adjacent lung tissue after using the laser for lung resection. One minute of laser applied at a 100-watt output penetrated a lung surface area of 3.8 ± 0.4 cm2 compared with 4.8 ± 0.6 cm2 of surface after application of the monopolar cutter (P = 0.001). S The monopolar cutter possesses indeed a greater cutting capacity than the laser but it also causes more adjacent tissue injury. Thus laser resection might be preferred for lung metastasectomy. Electrosurgical scalpel Laser Lung metastases Lung resection Tissue damage BMC Urol BMC Urol BMC Urology 1471-2490 BioMed Central 24612599 3975282 1471-2490-14-26 10.1186/1471-2490-14-26 Research an-specific and tumor-size-dependent responses to sunitinib in clear cell renal cell carcinoma Tsuchiya Norihiko 1 tsuchiyamed.akita-u.ac.jp Yuasa Takeshi 2 takeshi.yuasajfcr.or.jp Maita Shinya 1 yamightyyahoo.co.jp Narita Shintaro 1 narishindoc.med.akita-u.ac.jp Inoue Takamitsu 1 takamitudoc.med.akita-u.ac.jp Numakura Kazuyuki 1 numakuradoc.med.akita-u.ac.jp Saito Mitsuru 1 mitsaitomed.akita-u.ac.jp Satoh Shigeru 1 shigerusdoc.med.akita-u.ac.jp Yonese Junji 2 jyonesejfcr.or.jp Habuchi Tomonori 1 thabuchidoc.med.akita-u.ac.jp 1Department of Urology Akita University Graduate School of Medicine Akita Japan 2Department of Urology Cancer Institute Hospital Japanese Foundation for Cancer Research Tokyo Japan 2014 11 3 2014 14 26 26 20 7 2013 28 2 2014 Copyright 2014 Tsuchiya et al.; licensee BioMed Central Ltd. 2014 Tsuchiya et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. Background Tyrosine kinase inhibitors (TKIs) have been used as standard therapy for patients with advanced renal cell carcinoma (RCC). However information on factors predicting response to treatment with TKIs is lacking. This study aimed to assess the association between initial tumor size involved ans pre-treatment C-reactive protein (CRP) levels and reduction in tumor size in patients with clear cell RCC (CCRCC) treated with sunitinib. Methods Patients with advanced CCRCC with target lesions with a maximum diameter???10 mm treated with sunitinib were evaluated. The tumor diameter representing the best overall response was designated as the post-treatment tumor diameter. Results A total of 179 lesions in 38 patients were analyzed. an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderate inverse association with percent reduction in post-treatment tumor diameter (R?=?0.341). Lung lesions showed significantly greater percent reductions in diameter than liver and kidney lesions (P?=?0.007 and 0.002 respectively). Furthermore based on a CRP cut-off level of 2.0 mg/dl mean tumor size reduction was significantly greater in patients with low CRP levels than in patients with high CRP levels in lesions with diameters?<?20 mm (P?=?0.002). CRP level had no effect on mean size reduction in lesions with a diameter???20 mm. Conclusions Patients with CCRCC with smaller lung metastatic lesions and lower CRP levels may achieve greater percent reductions in tumor size with sunitinib therapy than patients with extra-pulmonary lesions large lung lesions and/or higher CRP levels. Advanced renal cell carcinoma Sunitinib Tumor size Tumor response C-reactive protein Background In the era of cytokine therapy tumor response to treatment in advanced or metastatic renal cell carcinoma (RCC) has been reported to vary according to the ans involved [12]. Longer overall survival and a higher response rate to therapy with interferon-? or a combination of interleukin-2 and interferon-? were observed in patients with only lung metastasis compared with those with extra-pulmonary metastasis [12]. Complete remission (CR) after treatment with tyrosine kinase inhibitors (TKIs) which mainly target vascular endothelial growth factor receptors remains a rare event but most patients who do achieve CR have either lung metastasis alone or only lymph node involvement [34]. However most cancer clinical trials evaluate tumor response using the response evaluation criteria in solid tumors (RECIST) in which the longest diameters of target lesions in multiple ans are summed. Tumor response in individual metastatic lesions in specific ans has not been delineated. A reduction in tumor size >10% calculated as the sum of the longest diameter of the target lesions was significantly associated with both time to treatment failure and overall survival suggesting that size reduction of target lesions may predict the outcome of treatment with TKIs [5]. In addition Yuasa et al. recently demonstrated that a smaller initial tumor size predicted a good response to TKIs and that the maximum response was achieved in lung lesions [6]. TKIs have shown significant clinical benefit in advanced clear cell RCC (CCRCC) in large randomized trials [7-9]. However the reported objective responses vary according to the different types of TKIs and a recent phase II trial failed to demonstrate any clinical efficacy of sunitinib in non-CCRCC [10]. Tumor size reduction may thus be affected by many factors including initial tumor size involved ans tumor histology tumor aggressiveness or type of TKI used. In this study we evaluated the association between initial tumor size of individual lesions in specific ans and reduction in tumor size in patients with CCRCC treated with sunitinib. Methods Patients and tumor measurement A total of 38 patients with advanced CCRCC who received at least two cycles of sunitinib at Akita University Hospital and at the Cancer Institute Hospital of the Japanese Foundation for Cancer Research were enrolled in this institutional review-board-approved retrospective study. Pathological diagnosis was made by radical nephrectomy in 30 patients and by percutaneous biopsy in eight patients who were not indicated for surgical treatment because of a significantly higher total volume of metastatic lesions compared with the primary lesion. The initial dose of sunitinib was 50 mg/day which was reduced to 37.5 mg/day based on the patient™s physique age and performance status. Sunitinib was initiated on a 28 days on/14 days off schedule and a dose reduction to 25 mg/day or complete cessation was considered in the event of grade 3 or higher toxicity according to the Common Terminology Criteria for Adverse Events (CTC-AE). All lesions were evaluated using a multidetector computed tomography scanner and lesions???10 mm in diameter were considered target lesions. The maximum diameter of each target lesion was measured before treatment with sunitinib (pre-treatment tumor diameter) and every 2“3 months thereafter. The tumor diameter at the point when best overall response was achieved based on the RECIST version 1.0 was adopted as the post-treatment tumor diameter. In this study the most common metastatic ans including lung liver and lymph nodes as well as the kidney were subjected to analysis. Statistical analysis The association between pre-treatment tumor diameter and percent change between pre- and post-treatment tumor diameters for each lesion was assessed by Pearson™s correlation coefficient. The Kruskal Wallis test was used to compare differences in percent change in tumor diameter between the four different ans. The Mann“Whitney U test was used to compare differences between two groups. A receiver-operator curve (ROC) was constructed to find the pre-treatment tumor diameter predicting tumor response to sunitinib treatment. A value of P?<?0.05 was considered statistically significant. Results Patients and target lesions The patients included 30 men and eight women with a median age of 62 years (range 27“81 years). The patients™ characteristics are listed in Table 1. The best response to sunitinib treatment was CR in one patient (3%) partial response (PR) in 11 (29%) stable disease (SD) in 23 (61%) and progressive disease (PD) in three (8%). The objective response rate was 32% and the clinical benefit rate (CR?+?PR?+?SD for at least 3 months) was 92%. A total of 179 lesions ranging from 10 to 106 mm were measured and analyzed in 38 patients. These lesions were localized as follows: 124 in the lung 12 in the liver 24 in the lymph nodes and 19 in the kidney. Of the 15 patients with kidney tumors seven who underwent nephrectomy had target lesions in the contralateral kidney including two patients with multiple lesions. The remaining eight patients had primary kidney tumors that were diagnosed by percutaneous needle biopsy. Table 1 Patients™ characteristics Characteristic No. of patients (%) Sex ??Male 30 (78.9) ??Female 8 (21.1) Age y ??Median [range] 62 [27“81] ECOG performance status ??0 25 (65.8) ??1 7 (18.4) ??> 1 6 (15.8) MSKCC risk category ??Favorable 8 (21.1) ??Intermediate 20 (52.6) ??Poor 10 (26.3) Target ans ??Lung 31 (81.6) ??Liver 6 (15.8) ??Lymph node 11 (28.9) ??Kidney 15 (39.5) Nephrectomy ??Yes 30 (78.9) ??No (biopsy) 8 (21.1) Prior treatments ??None 27 (71.1) ??Cytokines alone 4 (10.5) ??Sorafenib?±?cytokines 7 (18.4) Associations between pre-treatment tumor diameter and percent change in target lesion size in different ans The associations between pre-treatment tumor diameter and percent change in size of each target lesion in each of four ans were analyzed separately."
Lung_Cancer
"TTP and 1-year survival were not different between the two dose groups indicating the dose-to-rash strategy failed to increase clinical benefit. Observed low incidence of toxicity and low erlotinib exposure suggest standardized and maximum allowable dosing may be suboptimal in African Americans. EGFR Erlotinib African American Pharmacokinetics Pharmacogenetics PLoS One one 1932-6203 Public Library of Science San Francisco USA 24647522 3960222 PONE-D-13-47730 .0092320 Research Biology and Life Sciences Biochemistry Biomarkers Cell Biology Molecular Cell Biology Genetics Gene Expression Medicine and Health Sciences Clinical Medicine Oncology Cancers and Neoplasms Lung and Intrathoracic Tumors Non-Small Cell Lung Cancer Cancer Treatment Research and Analysis Methods Research Design Clinical Research Design Retrospective Studies Response to First-Line Chemotherapy in Patients with Non-Small Cell Lung Cancer According to RRM1 Expression Chemotherapy According to RRM1 Expression Dong Xiaopeng 1 Hao Yingtao 1 Wei Yucheng 2 Yin Qiuwei 3 Du Jiajun 4 Zhao Xiaogang 1 * 1 Department of Thoracic Surgery Second Hospital of Shandong University Jinan China 2 Department of Thoracic Surgery Affiliated Hospital of Qingdao University Medical College Qingdao China 3 Department of Thoracic Surgery Qilu Hospital of Shandong University Jinan China 4 Department of Thoracic Surgery Shandong Provincial Hospital Jinan China de Mello Ramon Andrade Editor University of Algarve Portugal * E-mail: dxp3260sohu.com Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: XZ XD. Performed the experiments: YH YW QY JD. Analyzed the data: XZ XD. Contributed reagents/materials/analysis tools: YW QY JD. Wrote the paper: XD. 2014 19 3 2014 9 3 e92320 23 11 2013 7 2 2014 2014 Dong et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background The response to cytotoxic chemotherapy varies greatly in patients with advanced non-small cell lung cancer (NSCLC) and molecular markers may be useful in determining a preferable therapeutic approach for individual patients. This retrospective study was performed to evaluate the predictive value of ribonucleotide reductase regulatory subunit M1 (RRM1) on the therapeutic efficacy of platinum-based chemotherapy in patients with NSCLC. Methods Patients with advanced NSCLC who received platinum doublet chemotherapy (n?=?229) were included in this retrospective study and their clinical outcomes were analyzed according to RRM1 expression. Results In patients receiving gemcitabine-based therapy the disease control rate (DCR) and progression-free survival (PFS) of patients with RRM1-negative tumors were significantly higher than in patients with RRMI-positive tumors (P?=?0.041 and P?=?0.01 respectively) and multivariate analysis showed that RRM1 expression was an independent prognostic factor (P?=?0.013). No similar differences were found in patients receiving docetaxel- or vinorelbine-based therapy. In RRM1-positive patients the DCRs for docetaxel and vinorelbine were higher than for gemcitabine (P?=?0.047 and P?=?0.047 respectively) and docetaxel and vinorelbine showed a longer PFS than gemcitabine-based chemotherapy (P?=?0.012 and P?=?0.007). No similar differences were found among patients with RRM1-negative tumors. Conclusions Negative RRM1 expression in advanced NSCLC is associated with a higher response rate to gemcitabine-based chemotherapy. In patients with RRM1-positive tumors docetaxel and vinorelbine showed a higher therapeutic efficacy than gemcitabine-based therapy. Additional prospective studies are needed to investigate the predictive meaning of RRM1 in the response to chemotherapy. These authors have no support or funding to report. Introduction Platinum-based chemotherapy is considered the main therapeutic approach for advanced non-small cell lung cancer (NSCLC) [1] 2. However the selection of chemotherapeutic agents is primarily based on the clinician™s experience and preference and studies have shown a great deal of variability with respect to their therapeutic efficacy and toxicity. Even with newly developed chemotherapy regimens the prognosis of patients with advanced NSCLC remains dismal [3]“[5]. At present promising results on the utility of molecular markers in predicting efficacy of cytotoxic therapy in NSCLC have been reported. Excision repair cross-complementation group 1 (ERCC1) was shown to be associated with the response to platinum-based chemotherapy [6]“[8] and in another recent study taxane-based therapies showed a higher disease control rate (DCR) and longer progression-free survival (PFS) than gemcitabine in patients with epidermal growth factor receptor (EGFR) mutations [9]. These studies suggest that the tumor biology and the response to cytotoxic chemotherapy vary greatly among NSCLC patients and individualized therapies may help reduce the resistance to chemotherapeutic agents. Ribonucleotide reductase regulatory subunit M1 (RRM1) is a molecule involved in DNA synthesis and damage repair. Preclinical studies have shown that RRM1 is involved in sensitivity to gemcitabine in NSCLC [10] [11]. Lower RRM1 expression was associated with a high response rate to platinum agents and gemcitabine and patients with high expression of RRM1 showed a decreased response to gemcitabine therapy [12]“[15]. However in other reports RRM1 was either not associated or was inversely associated with the survival of NSCLC patients receiving gemcitabine-containing regimens [16] [17]. Therefore the correlation between RRM1 expression and the response to chemotherapy is still uncertain. In the present study we reviewed 229 patients with advanced NSCLC who had received platinum-based doublet chemotherapy as a first-line therapy and evaluated their clinical outcomes according to RRM1 expression. Patients and Methods Ethics Statement This retrospective study was approved by the ethics committee of second hospital of Shandong university. And all patient records were anonymized and de-identified prior to analysis. Patients In this retrospective analysis 680 patients diagnosed with advanced NSCLC between 2007 and 2010 were screened 325 of whom had received carboplatin-based doublet chemotherapy as a first-line treatment. A cohort of 229 patients for whom clinical records and computed tomography (CT) scans were complete and tumor specimens were available to screen for RRM1 expression was selected. Histological type was determined according to the World Health anization criteria. During the treatment period a chest CT scan was taken every 6“8 weeks and independent reviews of these CT scans were performed in this retrospective study to confirm the response to therapy and to assess disease progression. The treatment response was classified as progressive disease (PD) stable disease (SD) partial response (PR) or complete response (CR) according to RECIST (Response Evaluation Criteria in Solid Tumors). Patients showing a CR or PR were regarded as responders. The DCR included patients with CR PR and SD lasting longer than three months. PFS was the time between the first day of treatment and the first sign of disease progression or death. RRM1 Expression Analysis Immunohistochemistry was performed using 5 ?m-thick sections from paraffin-embedded tissue blocks and a Bond Polymer Intense Detection System (VisionBioSystems Vic Australia) according to the manufacturer™s instructions. As a negative control the same immunohistochemical staining protocol was used except the specific primary antibody (ProteinTech Group Chicago USA) was replaced with distilled water. Formalin-fixed paraffin-embedded human colonic adenocarcinoma tissue was used as a positive control. Five fields at 400— magnification were selected for each section to assess immunoreactivity. RRM1 immunoreactivity was evaluated semi-quantitatively based on the staining intensity and the proportion of positively staining cells by two independent observers blinded to patient status. The proportion of staining was scored from 0 to 3 as follows: diffuse ?50% positive (score 3); regional 10“49% positive (score 2); focal 1“9% positive (score 1); and negative <1% positive (score 0). The intensity of staining was also scored from 0 to 3 (0 absent; 1 weak; 2 moderate; 3 intense). The immunoreactive score for each sample was determined by multiplying the two individual scores. A score of ?9 was defined as a positive/high expression and a score of <9 was considered a negative/low expression. Statistical Analysis Statistical analyses of categorical variables including response rate (RR) and DCR were performed using Fisher™s exact test. Comparisons of the mean between different groups were calculated using the Student™s t-test. The median duration of PFS was calculated using the Kaplan-Meier method. Multivariate analyses were performed using Cox regression analysis for PFS to identify independent factors. Two-sided P-values of less than 0.05 were considered significant. All analyses were performed using SPSS 17.0 for Windows. Results Patient Characteristics and RRM1 Expression A total of 229 NSCLC patients were included in the study. The ages ranged from 39 to 75 years (median age 61 years) and 127 patients (55.5%) were male. The majority of the tumors were adenocarcinoma (112 patients 48.9%) and 123 patients had stage IV disease (53.7%). All patients received carboplatin-based doublet chemotherapy as a first-line treatment. Gemcitabine docetaxel and vinorelbine regimens were administered in 81 (35.4%) 77 (33.6%) and 71 (31.0%) cases respectively and the choice of regimen was made by the responsible clinician (Table 1). Of the 229 tumors 146 (63.8%) were negative for RRM1 expression and 83 (36.2%) were positive for RRM1 (Table 1). .0092320.t001 Table 1 Basic characteristics of NSCLC patients. Characteristics No % No. of patients 229 Age (median years) 61 Range 39“75 Gender Male 127 55.5 Female 102 44.5 History of smoking Never smoker 130 56.8 Smoker 99 43.2 Histology Adenocarcinoma 112 48.9 Squamous cell carcinoma 67 29.3 Others 50 21.8 Stage IIIB 106 46.3 IV 123 53.7 RRM1 Negative 146 63.8 Positive 83 36.2 Chemotherapeutic regimen Gemcitabine and carboplatin 81 35.4 Docetaxel and carboplatin 77 33.6 Vinorelbine and carboplatin 71 31.0 The relationship between patient characteristics and chemotherapy regimens according to RRM1 expression was analyzed. The patient characteristics were similar among patients receiving gemcitabine- docetaxel- and vinorelbine-based therapies (Table 2). .0092320.t002 Table 2 Characteristics of patients receiving chemotherapeutic regimens according to RRM1 expression. Characteristics RRM1-negative P-value RRM1-positive P-value Gemcitabine Docetaxel Vinorelbine Gemcitabine Docetaxel Vinorelbine No. of patients 52 50 44 29 27 27 Age (years) 58 62 61 >0.05# 60 58 63 >0.05# Gender Male 29 (55.8%) 28 (56.0%) 25 (56.8%) >0.05* 16 (55.2%) 15 (55.6%) 14 (51.2%) >0.05* Female 23 (44.2%) 22 (44.0%) 19 (43.2%) 13 (44.8%) 12 (44.4%) 13 (48.8%) Smoking history Never smoker 30 (57.7%) 31 (62.0%) 25 (56.8%) >0.05* 15 (51.7%) 15 (55.6%) 14 (51.9%) >0.05* Smoker 22 (42.3%) 19 (38.0%) 19 (43.2%) >0.05* 14 (48.3%) 12 (44.4%) 13 (48.1%) >0.05* Histology Adenocarcinoma 24 (46.2%) 25 (50.0%) 22 (50.0%) >0.05* 14 (48.3%) 14 (51.9%) 13 (48.2%) >0.05* Squamous cell carcinoma 17 (32.7%) 15 (30.0%) 12 (27.3%) 8 (27.6%) 8 (29.6%) 7 (25.9%) others 11 (21.1%) 10 (20.0%) 10 (22.7%) 7 (24.1%) 5 (18.5%) 7 (25.9%) Stage IIIB 24 (46.2%) 22 (44.0%) 20 (45.5%) >0.05* 14 (48.3%) 12 (44.4%) 14 (51.9%) >0.05* IV 28 (53.8%) 28 (56.0%) 24 (54.5%) 15 (51.7%) 15 (55.6%) 13 (48.1%) *Based on Fisher™s exact test. # Based on Student™s t-test. Tumor Response and PFS According to RRM1 Expression In the 229 patients 3 CRs 77 PRs 101 SDs and 48 PDs were observed for an overall RR and DCR of 34.9% and 79.0% respectively. There were no differences in the RR and DCR between patients with RRM1-negative tumors and those with RRM1-positive tumors. However in patients receiving gemcitabine-based therapy the DCR of RRM1-negative patients was significantly higher than that of RRM1-positive cases (78.8% vs. 55.2% P?=?0.041). No similar difference was found in patients receiving docetaxel- or vinorelbine-based therapy (Table 3). .0092320.t003 Table 3 Response to chemotherapy according to RRM1 expression. Gemcitabine and carboplatin Docetaxel and carboplatin Vinorelbine and carboplatin CR PR SD PD RR DCR CR PR SD PD RR DCR CR PR SD PD RR DCR RRM1 Negative 1 18 22 11 19 41* 1 17 26 6 18 44 1 14 21 8 15 36 Positive 0 7 9 13 7 16*# 0 10 12 5 10 22# 0 11 11 5 11 22# *Based on Fisher™s exact test. In patients receiving gemcitabine-based therapy the DCR of RRM1-negative patients was higher than RRM1-positive patients (P?=?0.041). # Based on Fisher™s exact test. In patients with RRM1-positive tumors the DCRs for docetaxel and vinorelbine were higher than for gemcitabine-based therapy (P?=?0.047 and P?=?0.047 respectively). The median PFS was 8.7 months (95% confidence interval (CI): 8.5“9.0 months) in all patients. No difference in PFS was found between patients with RRM1-negative tumors and those with RRM1-positive tumors (8.9 months vs. 8.5 months P?=?0.316) (Fig. 1A). However in patients receiving gemcitabine-based therapy the PFS of RRM1-negative patients was significantly higher than that of RRM1-positive patients (8.8 months vs. 7.6 months P?=?0.01) (Fig. 1B). No similar difference was observed in patients receiving docetaxel- or vinorelbine-based therapy (Figs. 1C and 1D). .0092320.g001 Figure 1 Kaplan-Meier curve of progression-free survival (PFS) according to ribonucleotide reductase M1 (RRM1) expression. (A) PFS for all patients with negative or positive RRM1 expression. (B) PFS for patients receiving gemcitabine-based therapy. (C) PFS for patients receiving docetaxel-based therapy. (D) PFS for patients receiving vinorelbine-based therapy. In multivariate analysis adjusted for gender smoking history and stage of disease RRM1 expression emerged as an independent predictive factor for PFS in patients receiving gemcitabine-based therapy (95% CI: 1.135“2.907 P?=?0.013). Tumor Response and PFS According to Chemotherapy Regimen In patients with RRM1-negative tumors no differences were observed in terms of RR DCR or PFS among patients that received gemcitabine- docetaxel- or vinorelbine-based therapies. However in patients with RRM1-positive tumors the DCR of patients receiving docetaxel or vinorelbine was higher than that of patients receiving gemcitabine (81.5% and 81.5% vs. 55.2% respectively; P?=?0.047 and P?=?0.047) (Table 3). In addition docetaxel and vinorelbine showed a longer PFS than gemcitabine-based chemotherapy (8.9 months and 9.1 months vs. 7.6 months respectively; P?=?0.012 and P?=?0.007) (Figs. 2A and 2B). .0092320.g002 Figure 2 Kaplan-Meier curve of progression-free survival (PFS) according to chemotherapy regimen. (A) PFS for patients with RRM1-negative tumors. (B) PFS for patients with RRM1-positive tumors. Discussion In the present study we analyzed 229 patients with NSCLC who had received carboplatin-based doublet chemotherapy. In patients receiving gemcitabine-based therapy the DCR and PFS in patients with RRM1-negative tumors was significantly higher than in RRM1-positive cases and multivariate analysis showed that RRM1 expression was an independent predictive factor for outcome. RRM1 overexpression in tumor tissue may induce resistance to gemcitabine-based therapy. Ribonucleotide reductase (RR) is an essential enzyme for DNA synthesis and is inhibited by the active metabolite of gemcitabine difluorideosycytidine 5-diphosphate. RRM1 depletes difluorideosycytidine 5-diphosphate and promotes DNA synthesis thereby enabling tumor survival. In studies with lung cancer cell lines RRM1 overexpression is associated with resistance to gemcitabine therapy [13] [18]. Consistently clinical studies have also suggested that overexpression of RRM1 correlates with resistance to gemcitabine-based therapy [19] [20]. Conversely low RRM1 mRNA expression was associated with a high response rate [21]"
Lung_Cancer
".0091811.g002 Heterogeneity of lymphatic vessel density (LVD) microvessel density (MVD) and amount of cancer-associated fibroblasts (CAFs) with respect to tumor location. The LVD (A) MVD (B) and CAF area (C) was significantly different according to each tumor location. .0091811.g003 LVD MVD and CAF area at different distant metastasis sites. The characteristics of cancer-associated stroma differed with respect to the metastatic site. LVD (A) and MVD (B) were greater in the metastatic tumor samples collected from the lung than in samples collected from other metastatic sites (p<0.001). However the amount of CAFs was not significant different between metastatic sites (C). Despite the heterogeneity of stromal characteristics CRC cases with higher LVD MVD and CAFs in center of the primary cancers had a tendency of higher LVD MVD and CAFs in periphery (p<0.05; Table S1). However LVD in center and periphery of primary cancer were not correlated with LVD in related distant metastasis (Table S1). In addition the amount of microvasculature was significantly correlated with the amount of CAFs (Table S2). 2. Clinical significance of cancer-associated stroma in advanced CRCs The MVD LVD and amount of CAFs present at each tumor location were compared according to their clinicopathologic features (). High grade CRCs were associated with lower CAFs in samples taken from the central cancer site (p?=?0.041). When compared with synchronous metastases the patients with metachronous metastases had higher LVD in center and periphery of the primary cancer and had higher MVD in lymph node metastases. Most patients with metachronous metastases were treated by adjuvant chemotherapy before metastasectomy. LVD and MVD in the distant metastases were significantly higher in the patients who had received chemotherapy before metastasectomy than those who did not (p?=?0.011 and 0.048 respectively). .0091811.t002 Clinicopathologic factor and LVD MVD and CAFs. Center (median) Periphery (median) LN metastasis (median) Distant metastasis (median) LVD MVD CAFs LVD MVD CAFs LVD MVD CAFs LVD MVD CAFs Total 39 717 1.13 5 740 1.22 3 888 1.42 3 648 0.91 Histologic grade Low grade 40 717 1.15* 5 741 1.23 3 895 1.43 3 665 0.92 High grade 34 683.5 0.94* 6 643.5 1.18 2 656 1.32 6 498 0.82 pT stage pT2 34 758 1.15 16 870 1.48 6 772 0.73 pT3 47 737 1.19 5 803 1.22 2.5 884 1.43 3 724 0.92 pT4 33 639 1.09 4 630 1.22 3 895 1.41 3 520 0.93 LN metastasis Absent 49 602 1.15 8 712 1.42 4 772 0.94 Present 39 737.5 1.12 4 740 1.21 3 884 1.41 3 617 0.91 Perineural invasion Absent 41 738 1.12 6 772 1.32 5.5 931.5 1.42 4 687 0.94 Present 39 672 1.13 4 702 1.2 2 796 1.39 3 548.5 0.86 Metastasis Synchronous 34* 717.5 1.11 3.0* 741 1.21 3 797* 1.39 3 617 0.93 Metachronous 55* 716 1.21 8.0* 712 1.23 2 1117* 1.63 5 698 0.91 Chemotherapy  Not done 2.0* 597.5* 0.93 Done 10.0* 684* 0.91 * p<0.05; ** p<0.01;   chemotherapy prior to metastatectomy of distant metastasis. 3. Expression loss of PTEN in CAFs PTEN was expressed in cytoplasm and sometimes the nucleus of both cancer and non-neoplastic cells when examined using immunohistochemistry. Expression of PTEN was lost in 8 cases in the center 2 cases in the periphery 4 cases in lymph node metastases and 11 cases in distant metastases (Table S3). In all 11 distant metastases with PTEN loss PTEN expression was intact in both the center and periphery of primary cancer (data not shown). PTEN loss in distant metastasis was correlated with synchronous metastasis (p?=?0.018). 4. Cancer-associated stroma and patient prognosis By using the obtained cut-offs lower LVD MVD and CAFs in the center LVD and CAFs in the periphery and MVD and CAFs in distant metastases were all significantly correlated with lower survival (p<0.05; Fig. S1). Among other clinicopathologic features synchronous metastasis old age larger size high histologic grade advanced pT and pN stage and presence of perineural invasion were associated with a worse prognosis (). By multivariate Cox regression analysis the hazard ratio of synchronous versus metachronous was the highest (4.029) with the lowest p value (p<0.001). CAFs in distant metastasis LVD and MVD in the center LVD in the periphery age and perineural invasion also independently predicted patient survival. In addition loss of PTEN expression in CAFs in distant metastases was associated with a worse prognosis (p?=?0.042; Fig S2) but not in primary cancer or lymph node metastasis. .0091811.t003 Univariate and multivariate survival analysis according to clinicopathologic features. Univariate survival analysis Multivariate survival analysis Factors HR (95% CI) P value HR (95% CI) P value Synchronous vs. Metachronous 4.617 (2.472“8.624) <0.001 3.762 (1.838“7.701) <0.001 Age 1.023 (1.004“1.044) 0.020 1.033 (1.011“1.056) 0.003 Sex (female vs. male) 1.428 (0.920“2.218) 0.113 ” ” Location (left vs. right) 0.503 (0.314“0.806) 0.004 0.700 (0.413“1.188) NS (0.186) Size 1.073 (1.005“1.146) 0.036 1.040 (0.903“1.198) NS (0.584) Histologic grade (high vs. low) 1.862 (1.061“3.269) 0.030 1.491 (0.763“2.912) NS (0.243) pT stage (pT4 vs. pT2/3) 2.341 (1.503“3.645) <0.001 1.137 (0.674“1.921) NS (0.630) pN stage (pN1/2 vs. pN0) 3.848 (1.760“8.411) 0.001 1.773 (0.758“4.146) NS (0.186) Perineural invasion 2.628 (1.640“4.211) <0.001 2.108 (1.265“3.513) 0.004 Venous invasion 1.217 (0.757“1.956) 0.418 ” Center LVD (high vs. low) 0.364 (0.158“0.836) 0.017 0.298 (0.118“0.753) 0.010 Center MVD (high vs. low) 0.391 (0.233“0.655) <0.001 0.437 (0.238“0.801) 0.007 Center CAFs (high vs. low) 0.579 (0.352“0.954) 0.032 1.038 (0.607“1.773) NS (0.892) Periphery LVD (high vs. low) 0.235 (0.086“0.644) 0.005 0.279 (0.096“0.809) 0.019 Periphery MVD (high vs. low) 1.456 (0.911“2.327) 0.117 ” Periphery CAFs (high vs. low) 0.524 (0.336“0.817) 0.004 0.813 (0.499“1.326) NS (0.406) LN LVD (high vs. low) 1.646 (0.874“3.100) 0.123 ” LN MVD (high vs. low) 0.597 (0.294“1.213) 0.154 ” LN CAFs (high vs. low) 0.717 (0.423“1.217) 0.218 ” Metastasis LVD (high vs. low) 0.569 (0.314“1.032) 0.063 ” Metastasis MVD (high vs. low) 0.579 (0.364“0.921) 0.021 1.262 (0.720“2.211) NS (0.417) Metastasis CAFs (high vs. low) 0.492 (0.271“0.894) 0.020 0.290 (0.144“0.582) 0.001 Metastasis PTEN (intact vs. loss) 0.454 (0.208“0.993) 0.048 0.575 (0.239“1.383) NS (0.217) Discussion Carcinoma cells in different tissue areas have distinct characteristics [32]. In central areas of the tumor carcinoma cells maintain an epithelial cell phenotype but carcinoma cells in the invasive front acquire a more malignant and mesenchymal phenotype and are thought to have an increased migratory capacity and contribute to metastatic diseases. These metastatic cells may restore the epithelial phenotype at metastatic sites [33]. In addition to carcinoma cells themselves microenvironment is suggested to be uneven within a given tumor because tumor formation and progression involve the co-evolution of cancer cells and microenvironments [34]. The present study demonstrated that the cancer-associated microenvironment also had distinct characteristics in different areas. Of the sites examined LVD was highest in the center of the primary cancer. MVD was slightly higher in center than at the periphery of the primary cancer but this difference was not statistically significant. Interestingly the amount of CAFs in distant metastases was significantly lower than in center and periphery of the primary cancer. We show that the stromal microenvironment has regional heterogeneity both within the primary tumor and between the primary site and its related metastases. Furthermore our data suggests that the stromal heterogeneity might be attributable to tumor heterogeneity. Therefore it would be beneficial to consider both stromal and tumor cell heterogeneity in order to manage CRC patients better. We evaluated the MVD LVD and amount of CAFs in metastatic tissues of various ans including the liver lung peritoneal seeding distant lymph nodes and ovary. Of the metastatic ans we examined both LVD and MVD were the highest in lung. In our previous study the KRAS discordance rate was also significantly higher in matched lung metastases than in other matched metastatic ans [35]. The underlying mechanism is not known. It could be that primary CRCs with high LVD and MVD have a tendency to produce lung metastases; however our results indicated that LVD and MVD in the center and at the periphery of the primary cancers were lower in the patients with lung metastases (data not shown). Alternatively it may be due to the physiological characteristics of metastatic ans interactions between cancer cells and microenvironment within the metastatic an or the characteristics of the cancer cell clones prone to lung metastasis. However technical or sampling errors also may be possible thus further large-scale studies are required. Although numerous studies have attempted to demonstrate an association between tumor microenvironment characteristics and survival the prognostic impacts of MVD and LVD are still controversial. Some studies have been presented that active angiogenesis and lymphangiogenesis represented by high MVD and LVD are associated with poor prognosis and aggressive clinicopathologic factors [36] [37]. Recent meta-analysis has demonstrated that LVD was significantly associated with disease-free survival but not overall survival [38]. Other studies have reported no statistical significance of MVD and LVD on survival [39]. Prall et al. has reported that high MVD and LVD are related with better survival in a consecutive series and liver metastases [40]. Our results were based on patients with advanced disease with distant metastasis and we showed that high MVD and LVD were related with improved survival. This might be because all the patients in this study had confirmed to have distant metastasis and microvasculatures could influence even delivery of the chemotherapeutic drug into the tumor. However our study had some limitations in terms of the survival analysis. We enrolled the CRC patients with available surgically resected cancer tissues from both primary tumors and corresponding metastatic tumors. Not all advanced CRC patients with metastatic diseases were included and far advanced cases were not enrolled because of their inoperability. Therefore unrecognized biases might have influenced our survival results. Some studies have demonstrated an anti-tumorigenic effect of fibroblasts [20] [21]. However it has become clear that CAFs contribute to the progression of cancer and their prognostic significance in various cancers also has been raised [41] and furthermore several studies have observed genetic alterations in CAFs [26] [27]. PTEN loss of CAFs has been observed in breast cancer and prognostic association of it has been suggested [27] [28]. We observed PTEN loss of CAFs in CRC patients and it was more frequently observed in the corresponding distant metastases. It is suggested that CAFs not only cancer cells have altered gene expression. Moreover loss of PTEN expression of CAFs in distant metastases was significantly correlated with the survival of patients. To our knowledge these are the first results showing PTEN loss in CAFs in CRC patients. Although more research is required we expect that it might be a prognostic factor in CRC patients. In our large cohort of advanced CRC patients with synchronous and metachronous distant metastasis we demonstrated the regional heterogeneity of stromal microenvironment factors according to the tumor location. "
Lung_Cancer
"Luciferase activity driven by the miR-182 promoter increased in H1299 cells overexpressing GFP-Sp1 (C) whereas luciferase activity decrease in cells treated with an Sp1 inhibitor mithramycin A (D). These results suggested that Sp1 is involved in miR-182 transcriptional activation. Using the TFSEARCH software we analyzed the miR-182 promoter and identified two putative Sp1 binding elements. Consequently recruitment of Sp1 to the miR-182 promoter was examined (E and 1F). Acetyl-histone3 was recruited to the Sp1 binding elements indicating that the region could recruit TFs (E panel b). Sp1 was also recruited to the miR-182 promoter (E panel c and panel d and 1F). When the Sp1 binding element at site 1 was mutated luciferase activity driven by the miR-182 promoter was abolished but no change was observed when the other Sp1 binding site was mutated indicating that the Sp1 binding element at site 1 is important for the Sp1-mediated expression of miR-182 (G). Sp1 regulates miR-182 expression (A) Scramble (shScr) and different doses of Sp1 shRNAs (shSp1) were transfected into A549 for 48 h. The miR-182 level was determined by stem-loop RT-PCR. U6 served as the internal control (panel a). Data were quantified after three independent experiments (panel b). (B) Different titer of adeno-GFP-Sp1 virus was infected IMR-90 cells for 48 h. The miR-182 level was determined by stem-loop RT-PCR (panel a). Data were quantified after three independent experiments (panel b). (C) Plasmids pGL2 or pGL2-miR-182 (-1000/+50) and GFP or GFP-Sp1 were co-transfected into H1299 cells for 24h. Cells were harvested to study the luciferase activity. Data were quantified after three independent experiments. (D) The plasmids pGL2 or pGL2-miR-182 were transfected into H1299 cells with mithramycin A treatment for 24 h. Cells were harvested for luciferase activity assays. (E) Schematic diagram indicates the location of putative Sp1 binding sites on miR-182 promoter region (panel a). ChIP assays were performed with anti-acetyl-H3 (panel b) and anti-Sp1 antibodies (panel c). DNA was extracted for PCR with miR-182 and p21 primers. Data were quantified after three independent experiments (panel d). (F) A549 cells were harvested for DAPA with a biotin-conjugated p21 and miR-182 promoter probes and samples were analyzed by Western blotting using anti-Sp1 antibodies (panel a). Data were quantified after three independent experiments (panel b). (G) Plasmids GFP or GFP-Sp1 were co-transfected with pGL2 pGL2-miR-182 WT or mutation plasmids into H1299 cells for 24 h and then cells were harvested for luciferase activity assays. Data are representative of three independent experiments each of which was performed in triplicate and presented as the mean ± SEM. The level of statistical significance determined by t-test (* p<0.05; ** p<0.01). Because Sp1 is highly expressed in lung cancer we studied the expression of Sp1 and miR-182 in various lung cancer cell lines and patient samples (). Compared with normal human lung cells (BEAS-2B) lung cancer cell lines expressed higher levels of miR-182 (A). We also assessed the correlation between the miR-182 and Sp1 expression patterns. Sp1 levels in clinical lung tissue samples were highly elevated in the tumorous sections of the lung accompanied by increased expression of miR-182 (B). To confirm this result Sp1 and miR-182 levels were measured in 32 lung cancer patients. Sp1 and miR-182 were upregulated by more than 1.3-fold in 59.4% of the lung adenocarcinoma specimens when compared to expression in normal tissue (C). These results indicate that Sp1 expression positively correlates with miR-182 expression (D). The miR-182 level correlates to Sp1 level Total RNA and cell lysates were prepared from indicated cell lines (A) or from clinical lung tissues of lung cancer patients (B). The miR-182 level was determined by stem-loop RT-PCR and Sp1 level was studied by Western blotting with anti-Sp1 antibodies. U6 and tubulin served as the internal control. (C) Total RNA and cell lysates were prepared from 32 paired normal lung tissues and lung adenocarcinoma samples. The miR-182 level was studied by stem-loop RT-PCR and Sp1 levels were studied by RT-PCR. (D) The relationship between Sp1 and the miR-182 level in the 32 lung cancer samples was statistically analyzed using Fisher's exact test. miR-182 increases lung tumor growth The data shown in indicated that Sp1 regulated miR-182 expression during lung tumorigenesis. To identify the specific gene targets of miR-182 we searched public miRNA target prediction databases (miRDB miRWalk and TargetScanHuman) for candidate target genes. By combining the data from these three databases we identified 161 genes potentially regulated by miR-182 (Supplementary Figure S1A). Moreover pathway analysis using Ingenuity software indicated that the cellular growth and proliferation pathway had the highest score when the association of these 161 genes with biological pathways was examined. This suggests that miR-182 may play a functional role in cancer-associated processes (Supplementary Figure S1B). Indeed when miR-182 was knocked down with miRZip-182 shRNA the percentage of cells in G2/M and sub-G1 phases increased suggesting that miR-182 positively regulated cell cycle progression in the lung cancer cells (A). To further elucidate miR-182's effect on the cell cycle cells were synchronized at prometaphase using nocodazole treatment. After removing nocodazole more miRZip-182 than miRZip cells remained in G2/M phase providing further evidence that miR-182 positively regulates cell cycle progression (B). Consistently knockdown of miR-182 expression inhibited cell growth (C). miR-182 increases cancer cell proliferation (A) The miRZip and miRZip-182 stably expressed H1299 cells were fixed with 70% ethanol and stained with propidium iodide for cell cycle analysis by FACS. (B) Mitotic cells were released into growth by removing nocodazole then fixed at indicated time points for cell cycle progression assay by FACS. (C) The growth rates of miRZip and miRZip-182 stably expressed H1299 cells were calculated by cell counting within 5 days. Data are representative of six independent experiments and presented as the mean ± SEM. (D) Bioluminescent imaging was performed on 10 severe combined immunodeficient (SCID) mice implanted with miRZip and miRZip-182 stable expression H1299 cells (106 cells/mouse) at day 14 (panel a) then image signal was analyzed using Living Image software and presented as total flux measurements in photons/second (panel b). (E) Tumors from SCID mice implanted with miRZip and miRZip-182 stable expression H1299 cells for 4 weeks are shown (panel a) and tumor weights were analyzed (panel b). Data are representative of ten independent experiments and are presented as the mean ± SEM. The level of statistical significance determined by t-test (* p<0.05; ** p<0.01; *** p<0.001). To confirm the effect of miR-182 on tumor formation cells stably expressing with miRZip or miRZip-182 were implanted into SCID mice and tumor growth was monitored in vivo (D). The miRZip lentivector contains a copGFP gene and the GFP signal in miRZip-182-expressing cells was lower than that in miRZip control cells (D). Furthermore tumor volume and tumor weight were also lower in miRZip-182-implanted mice than in miRZip-implanted mice (N = 10 per group) (E). These results suggest that miR-182 overexpression facilitates lung tumor growth in vivo. Sp1 inhibits FOXO3 expression by inducing miR-182 expression To investigate the molecular mechanism underlying miR-182-mediated cancer cell proliferation we studied an important miR-182 target gene FOXO3. FOXO3 expression was higher in cells stably expressing miRZip-182 than in control cells (A). Knockdown of miR-182 expression enhanced the luciferase activity of a pGL3 vector containing the 3?-UTR of FOXO3 (B) indicating that miR-182 downregulated FOXO3 expression. Further to determine whether Sp1 downregulated FOXO3 expression through miR-182 GFP-Sp1 was expressed in cells stably expressing miRZip-182 (C). Overexpression of GFP-Sp1 reduced FOXO3 protein expression in miRZip stable cells but increased FOXO3 levels in miRZip-182-expressing cells implying that different effect of Sp1 is existed on the regulation of FOXO3 expression. Regulation of FOXO3 by miR-182 and Sp1 (A) Lenti-miRZip and lenti-miRZip-182 viruses were infected into H1299 for 96 h individually. FOXO3 level was studied by Western blotting with anti-FOXO3 antibodies and miR-182 level was studied by stem-loop RT-PCR. (B) Plasmids pGL3 and pGL3-FOXO3-3'UTR were transfected into miRZip and miRZip-182 stably expressed H1299 cells for 24 h and then cells were harvested for luciferase activity assays. (C) Different doses of GFP-Sp1 adenovirus were infected into the miRZip and miRZip-182 stably expressed H1299 cells for 48 h. FOXO3 level was studied by Western blotting using anti-FOXO3 antibodies (panel a). Quantitative results from three independent experiments are shown (panel b). The level of statistical significance was determined by t-test (* p<0.05; *** p<0.001). Therefore we further investigated the relationship between Sp1 and miR-182 in the context of FOXO3 regulation. The expression of Sp1 and FOXO3 in patients with lung cancer was examined (Figure 5A). In normal tissue samples Sp1 levels were low and FOXO3 levels were high. In tumor tissue samples two Sp1 expression patterns i.e. high and low Sp1 expression were identified. Samples with higher Sp1 levels exhibited lower FOXO3 levels whereas samples with lower Sp1 levels exhibited higher FOXO3 levels suggesting that there is an inverse correlation between Sp1 and FOXO3 levels in lung specimen (Figure 5A). The levels of FOXO3 and Sp1 in the lung cancer cell lines A549 H1299 CL 1-0 and CL 1-5 were studied (Figure 5B). Higher levels of Sp1 expression were accompanied by lower levels of FOXO3 expression in A549 and CL 1-0 cells and lower levels of Sp1 expression were accompanied by higher levels of FOXO3 expression in H1299 and CL 1-5 cells suggesting that there is an inverse correlation between Sp1 and FOXO3 expression in lung tumorigenesis. Overexpression of GFP-Sp1 decreased FOXO3 mRNA and protein levels in a dose-dependent manner (Figure 5C panel a) whereas knockdown of Sp1 expression increased FOXO3 mRNA and protein levels (Figure 5C panel b). These results indicate that Sp1 negatively regulates FOXO3 expression. Figure 5 Sp1 negatively regulates FOXO3 expression through regulating miR-182 (A) The Sp1 and FOXO3 levels in clinical lung tissue samples were studied by IHC staining using antibodies against Sp1 and FOXO3 respectively. (B) Cell lysates were harvested from various cell lines for Western blotting using antibodies against FOXO3 and Sp1 and tubulin as an internal control. (C) Adeno-GFP-Sp1 viruses were infected into IMR-90 cells for 48 h and FOXO3 mRNA and protein were studied by RT-PCR and Western blotting respectively. GAPDH served as the internal control (panel a). Scramble and Sp1 shRNAs were transfected into H1299 for 48 h then FOXO3 mRNA and protein levels were studied by RT-PCR and Western blotting (panel b). (D) Scramble and Sp1 shRNAs were transfected into H1299 for 48 h and then cells were harvested at indicated time points following cycloheximide treatment for studying the Sp1 and FOXO3 levels with Western blotting. The levels of FOXO3 protein from three independent experiments were quantified using tubulin as an internal control. (E) Plasmids pGL2 or pGL2-FOXO3 (-1000/+50) were cotransfected with GFP or GFP-Sp1 into H1299 cells for 24 h then cell lysates were harvested for luciferase activity assays. (F) Adeno-GFP-Sp1 viruses were infected into H1299 cells for 24 h and cells were then transfected with pGL3 or pGL3-FOXO3-3'UTR plasmid for 24 h. Cells lysates were harvested for luciferase activity assays. (G) H1299 cells which were infected with GFP-Sp1 adenovirus for 24 h were then transfected with pGL3 or pGL3-FOXO3-3'UTR plasmid for 24 h. Total RNA was extracted at various time points following actinomycin D treatment. The mRNA levels of luciferase were determined by using quantitative RT-PCR and quantified using GAPDH as an internal control. Data are representative of three independent experiments each of which was performed in triplicate and presented as the mean ± SEM. The level of statistical significance determined by t-test (* p<0.05; ** p<0.01). Next we investigated the mechanism by which Sp1 regulates FOXO3 expression. FOXO3 protein half-life was studied after Sp1 knockdown. Knockdown of Sp1 expression did not affect FOXO3 protein stability (Figure 5D). We then constructed a luciferase reporter construct containing the FOXO3 promoter (-1000/+50) to study the effect of Sp1 on the promoter-mediated transcription of FOXO3 (Figure 5E). GFP-Sp1 overexpression significantly enhanced the luciferase activity indicating that Sp1 positively regulated FOXO3 transcription (Figure 5E). However FOXO3 mRNA and protein levels decreased as shown in Figure 5C. The data shown in indicated that Sp1 increased miR-182 expression which suggests that post-transcriptional processing contributes to the regulation of FOXO3 expression. Thus the 3'-UTR of FOXO3 might play an important role in stabilizing FOXO3 mRNA and in FOXO3 translation. Consequently a luciferase reporter construct containing the 3?-UTR of FOXO3 was generated. GFP-Sp1 overexpression reduced the luciferase activity (Figure 5F). Furthermore the stability of the luciferase mRNA containing the 3?-UTR sequence of FOXO3 decreased dramatically upon GFP-Sp1 overexpression (Figure 5G). These results indicate that Sp1 regulates FOXO3 expression through transcriptional and post-transcriptional regulation with a net negative effect on FOXO3 expression. miR-182 inhibits lung cancer metastasis activity The data shown in indicated that miR-182 positively regulated lung cancer cell growth. Therefore the role of miR-182 in lung cancer metastasis was studied (Figure 6). The morphology of miRZip-182 cells was markedly altered: circular structures of actin filaments were absence and pseudopodia were enriched suggesting that miR-182 decreased the cells' migratory ability (Figure 6A). Indeed knockdown of miR-182 expression increased the migration ability of lung cancer cells suggesting that miR-182 inhibits lung cancer migration (Figure 6B). Moreover transwell migration assays showed that knockdown of miR-182 expression enhanced cell's invasive capacity (Figure 6C). In mice injected with miRZip-182-treated cells the knockdown of miR-182 expression also increased the number of nodules in the lung suggesting that miR-182 represses metastatic ability in vivo (Figure 6D). The effects of miR-182 knockdown were partially reversed by knockdown of FOXO3 suggesting that miR-182 functions as a suppressor of lung cancer metastasis by repressing FOXO3 expression (Figure 6E panel a). The endothelial-mesenchymal transition (EMT) marker N-cadherin increased after miR-182 knockdown but this effect was abolished by FOXO3 knockdown. Thus miR-182 might repress lung cancer metastasis by decreasing the expression of N-cadherin (Figure 6E panel b). However the expression of other genes regulated by miR-182 might also play a role in metastasis (Figure 6F and Supplementary Figure S3). Therefore we generated gene expression profiles using microarray analysis. Functional grouping analysis using DAVID bioinformatics resources showed that 19 of the genes differentially regulated by miR-182 knockdown were related to cell migration. The expression of these genes was increased in miR-182-knockdown cells indicating that they are potential targets of miR-182 (Figure 6F). Many metastasis-related genes such as CD44 CDH9 and ADAM9 were upregulated after the knockdown of miR-182 expression (Figure 6F). Figure 6 miR-182 attenuates lung cancer cell metastasis (A) Immunofluorescent staining of Alexa Fluor 568-conjugated phalloidin that is a high-affinity probe for F-actin (red) in miRZip and miRZip-182 stably expressed H1299 cells. DNA was stained with DAPI (blue). Stained cells were photographed under a fluorescence microscope at x 600 magnification. (B) Confluent monolayers of miRZip or miRZip-182 stably expressed H1299 cells were wounded and incubated for an additional 16 h (panel a). Migratory area was calculated for quantification (panel b). (C) The migration activities of H1299 cells (2 x 104) expressing miRZip or miRZip-182 were studied by Transwell chambers. (D) The miRZip or miRZip-182 stably expressed H1299 cells (4 x 106) were suspended in 100 ?l of PBS and injected into the lateral tail vein of SCID mice. After 8 weeks all mice were killed and the number of pulmonary tumor nodules was calculated after fixation of lungs with 4% formaldehyde for 48 h (panel a) and the number of pulmonary metastatic tumor nodules was counted (panel b). (E) FOXO3 and miR-182 in H1299 cells were knockdown by shFOXO3 and miRZip-182 respectively and then migration of cells (3 x 104) was studies by Transwell chambers (panel a). In addition cell lysates were harvested from FOXO3 and miR-182 knockdown cells for Western blotting using antibodies against N-cadherin ?-catenin vimentin FOXO3 and tubulin (panel b) respectively. (F) Heat map of the 19 of genes from miRZip and miRZip-182 microarray data the red color represents genes that are upregulated and the green color represents genes that are downregulated. The level of statistical significance determined by t-test (* p<0.05; ** p<0.01; *** p<0.001). DISCUSSION Our recent studies showed that Sp1 increased the growth of lung cancer cells but inhibits metastatic activity [23 32]. In the present study we found that Sp1 which accumulated in the early stages of cancer positively regulated miR-182 gene expression to silence FOXO3 expression and thereby promote cancer cell growth. In addition decreased levels of Sp1 in the late stages of cancer increased the expression of FOXO3 and N-cadherin leading to cancer metastasis (Figure 7). Figure 7 (A) Clinical samples from lung cancer patients of stage I and IV were used to study the Sp1 level by IHC staining with anti-Sp1 antibodies (B) Schematic diagram illustrates Sp1 regulates miR-182 to silence FOXO3 expression in early and late stages of lung cancer progression. Sp1 functions as a transcriptional activator by recruiting p300 to its target genes and as a repressor by the recruiting HDACs. Because Sp1 accumulates in several types of cancer including lung cancer [33] understanding the Sp1 transcriptional regulatory network may provide novel insights into the molecular origins and treatment of lung cancer. In our previous studies of lung cancer we found that Sp1 was highly upregulated in the early stages of cancer progression but partially down regulated in the late stages. Our previous studies also showed that regulation of Sp1 protein stability by phosphorylation and sumoylation contributed to its expression in the early and late stages of cancer respectively [32]. Kras activation and the Notch pathway might activate ERK1/2 to phosphorylate Sp1 thus stabilizing Sp1 in the early stages of cancer [32 34]. In the late stages Sp1 could be sumoylated leading to recruitment of its E3-ligase RNF4 followed by polyubiquitination and degradation [32]. To clarify the molecular mechanism underlying gene regulation by Sp1 we used microarray analysis to assess gene expression in KrasG12D-induced lung tumor transgenic mice and identified thousands of genes potentially regulated by Sp1 [23]. However some of the genes do not harbor a conserved Sp1 binding motif within their promoter region suggesting that another regulatory mechanism is involved in Sp1-mediated gene regulation. In this study we identified a novel pathway for Sp1-mediated activation wherein miR-182 expression downregulated the expression of FOXO3 a known miR-182 target gene [35]. Sp1 activated miR-182 and FOXO3 at the transcriptional level; however FOXO3 protein expression decreased. These results suggest that post-transcriptional regulation by miRNAs is a powerful mechanism by which to control the final level of protein expression. Many coding genes with Sp1 binding element(s) in their promoters harbor conserved miRNA target sequences in their 3'-UTR. To our knowledge this is first study to demonstrate that Sp1 regulates the expression of a target gene by regulating promoter activity and post-transcriptional processing in parallel. Few studies have characterized the regulation of miRNA by Sp1. Herein using a bioinformatics approach we identified several miRNAs potentially regulated by Sp1 including miR-182. We then showed that Sp1 specifically targets the miR-182 promoter region and activates miR-182 expression. miR-182 reportedly forms a gene cluster with two adjacent miRNAs (miR-96 and miR-183) [35]. The expression of miR-96 and miR-183 also decreased following Sp1 knockdown (Supplementary Figure S2A). Moreover we also investigated the binding of Sp1 to the miR-212 promoter because the latter contains 13 putative Sp1 binding sites (Supplementary Table S1). We found that Sp1 bound to the miR-212 promoter sequence (Supplementary Figure S2B and S2C). Interestingly a recent study showed that FOXO3 is a direct target of miR-212 in the neurons of patients with Alzheimer's disease [36]. miR-182 and miR-212 might cooperate to downregulate FOXO3 expression upon Sp1 overexpression. We cannot rule out this possibility. However depletion of miR-182 was sufficient to impair the Sp1-mediated reduction of FOXO3 expression in our experiments (C) suggesting that miR-182 is the major regulator of FOXO3 in lung cancer cells. Several studies have shown that miR-182 is upregulated in lung cancer. This suggests that miR-182 plays a positive role in lung tumorigenesis. However in two studies of miR-182 function in lung cancer miR-182 inhibited the proliferation of human lung adenocarcinoma cells [37 38]. Our results in this study provide several pieces of evidence to support the notion that miRNA-182 is a positive regulator of lung cancer cell proliferation. Firstly miR-182 was upregulated in the majority of lung cancer clinical samples and lung cancer cell lines examined. Secondly miR-182 knockdown inhibited cell cycle progression and cell growth. Finally miR-182 knockdown reduced lung tumor growth in vivo. Discrepancies in the role of miRNA-182 in lung cancer cell proliferation might derive from the different experimental designs of the studies. For example because miR-182 expression is upregulated in lung cancer we knocked down its expression and examined the effects on cancer cell proliferation. However other studies that described a negative role of miR-182 in lung cancer used miR-182 overexpression to study miR-182's role in cancer cell proliferation. Overexpression conditions can alter the function of many genes [39]. For example Sp1 accumulates in most of cancers; knockdown of Sp1 expression decreases cell proliferation but Sp1 overexpression also attenuates cancer cell growth [40]. Because post-translational modifications affect protein function overexpressed proteins might not be completely processed which could affect their function. Previous studies in melanoma and hepatocellular carcinoma indicated that miR-182 enhanced tumor metastasis [35 41]. However our data as shown in Figure 6 indicated that miR-182 knockdown altered cell morphology and increased migration and invasion activities. In addition miR-182 knockdown increased N-cadherin levels suggesting that miR-182 promotes the mesenchymal to epithelial transition (MET) [42]. Previous studies have shown that TIMP-2 enhances the E-cadherin/?-catenin complex in A549 lung cancer cells [43]. Whether Sp1 or miR-182 regulates TIMP-1 in lung cancer needs to be addressed in future studies. Finally miR-182 levels were lower in CL1-5 cells then in CL1-0 cells resulting in increased metastatic activity in CL1-5. Collectively our data suggest that miR-182 inhibits lung cancer metastasis. Our previous study indicated that Sp1 is down regulated in the late stages of lung cancer progression [32]. Therefore in the late stages of lung tumorigenesis miR-182 expression was down regulated compared with expression in the early stages which led to tumor metastasis through at least in part an increase in FOXO3 expression. It is still not clear why miR-182 has different roles in different types of cancer; this awaits further study. Although we found that FOXO3 is involved in miR-182-mediated lung cancer progression FOXO3 knockdown did not completely abolish the effects of miR-182 knockdown suggesting that other genes regulated by miR-182 contribute to the inhibition of metastasis by miR-182. With this in mind we determined the expression profile of miR-182-regulated genes. Many metastasis-related genes were induced in miR-182-knockdown cells including CD44 ADAM9 and CDH9. CD44 which localizes to the cell membrane is reportedly involved in cell migration in various cancer types [44]. Recent studies also showed that tumor initiating cells with high CD44 expression maintained lung cancer tumorigenicity and drug resistance [45]. Another metastasis-related gene induced by miR-182 knockdown ADAM9 cleaves membrane proteins such as E-cadherin [46]. A previous study showed that combined Kras and Wnt pathway activation increased the incidence of lung cancer formation [47]. Given that ADAM9 is also involved in the activation of the Wnt pathway Sp1 and miR-182 might connect the Kras and the Wnt pathway. In addition CDH9 also involves in the cancer metastasis [48]. In conclusion we showed that miR-182 is an Sp1-activated miRNA whose expression increased in lung cancer. miR-182 functioned not only as an oncomiR for lung cancer growth but also as a suppressor of lung cancer metastasis. MATERIALS AND METHODS Cell culture and transfection Human lung cancer cell lines A549 H1299 CL 1-0 and 1-5 were cultured in Dulbecco's modified Eagle's medium (Invitrogen Carlsbad CA) human diploid fibroblasts IMR were cultured in Minimum Essential Media (Invitrogen) and human bronchial epithelial cells BEAS-2B was cultured in RPMI 1640 Medium (Thermo Scientific Rockford IL). All of culture mediums contained 10% fetal bovine serum 100 U/ml penicillin G sodium and 100 ?g/ml streptomycin sulfate (Invitrogen). Cells were cultured at 37? and 5% CO2. Transfection of all cells with expression vectors was done using Lipofectamine 2000 (Invitrogen) according to the manufacturer's directions. Reverse transcription-polymerase chain reaction (RT-PCR) and stem-loop RT-PCR Total RNA was isolated using the Trizol reagent (Invitrogen) and 3 ?g of RNA were reverse-transcribed using the Superscript III enzyme (Invitrogen). PCR was then performed on cDNA with gene-specific primers: Sp1 F 5'-TGC AGC AGA ATT GAG TCA CC-3' and R 5'-CAC AAC ATA CTG CCC ACC AG-3'; FOXO3 F 5'-GCA AGC ACA GAG TTG GAT GA-3' and R 5'-CAG GTC GTC CAT GAG GTT TT-3'; GAPDH F 5'-GAG TCA ACG GAT TTG GTC GT-3' and R 5'-TTG ATT TTG GAG GGA TCT CG-3'; and U6 F 5'-CGC TTC GGC AGC ACA TAT AC-3' and R 5'-AGG GGC CAT GCT AAT CTT CT-3'. The protocol for the detection of mature miRNAs using a stem-loop gene-specific reverse transcription primer was performed as described previously [49]. Stem-loop primers (miR-182 5'-GTC GTA TCC AGT GCA GGG TCC GAG GTA TTC GCA CTG GAT ACG ACA GTG TG-3'; miR-96 5'-GTC GTA TCC AGT GCA GGG TCC GAG GTA TTC GCA CTG GAT ACG ACA GCA AA-3'; and miR-183 5'-GTC GTA TCC AGT GCA GGG TCC GAG GTA TTC GCA CTG GAT ACG ACA GTG AA-3') were designed to specifically reverse transcribe the mature miRNA of interest. The primers for PCR were as follows: miR-182 F 5'-CGG CGG TTT GGC AAT GGT AGA ACT-3'; miR-96 F 5'-CGG CGG TTT GGC ACT AGC ACA TTT-3'; miR-183 F 5'-CGG CGG TAT GGC ACT GGT AGA ATT-3'; and R 5'-CCA GTG CAG GGT CCG AGG TAT-3'. PCR products were analyzed by ethidium bromide-containing agarose gel electrophoresis. Western blotting Cell lysates were prepared from the indicated cell lines for SDS-polyacrylamide gel electrophoresis (SDS-PAGE)"
Lung_Cancer
"The amount of microvasculature measured by LVD and MVD was also heterogeneous in relation to the metastatic an examined. By Cox regression analysis center LVD and MVD periphery LVD and CAFs in distant metastasis were independently associated with patients' prognosis in addition to synchronous distant metastasis age and perineural invasion. Heterogeneity of microenvironment not only of cancer cells is suggested to contribute to tumor heterogeneity and biologic complexity thus it should be considered in managing CRC patients. In addition our results showed that PTEN expression was altered in CAFs of CRCs suggesting that CAFs might have altered gene expression and play an active role in cancer progression. Supporting Information Figure S1 The prognostic association of stromal characteristics as it relates to tumor location. The analysis was performed by using cut-off values obtained by maximal chi-squared methods. (TIF) Click here for additional data file. Figure S2 Representative PTEN antibody stainings of stromal cells and the prognostic association of PTEN expression. (A) Intact expression of PTEN in CAFs (—400) and (B) loss of PTEN expression in CAFs (—400). (C“F) Kaplan-Meier survival curves for the center (C) and periphery (D) of the primary tumor lymph node metastases (E) and distant metastases (F) according to CAF PTEN expression status. (TIF) Click here for additional data file. Table S1 Pearson's correlation coefficients among center periphery lymph node metastasis and distant metastasis. (DOCX) Click here for additional data file. Table S2 Correlation coefficients between CAFs and LVD or MVD. (DOCX) Click here for additional data file. Table S3 PTEN expression in CAFs and clinicopathologic factors. (DOCX) Click here for additional data file. References 1 JemalA SiegelR XuJ WardE (2010) Cancer statistics 2010. CA Cancer J Clin60: 277“30020610543 2 Edge SB American Joint Committee on C American Cancer S (2010) AJCC cancer staging handbook: from the AJCC cancer staging manual 7th ed. New York: Springer. 3 KnijnN TolJ PuntCJ (2010) Current issues in the targeted therapy of advanced colorectal cancer. Discov Med9: 328“33620423677 4 Van CutsemE (2007) Optimizing administration of epidermal growth factor receptor-targeted agents in the treatment of colorectal cancer. Clin Colorectal Cancer6 Suppl 2S60“6518021489 5 AlbaneseI ScibettaAG MigliavaccaM RussoA BazanV et al (2004) Heterogeneity within and between primary colorectal carcinomas and matched metastases as revealed by analysis of Ki-ras and p53 mutations. Biochem Biophys Res Commun325: 784“79115541358 6 ParkJH HanSW OhDY ImSA JeongSY et al (2011) Analysis of KRAS BRAF PTEN IGF1R EGFR intron 1 CA status in both primary tumors and paired metastases in determining benefit from cetuximab therapy in colon cancer. Cancer Chemother Pharmacol68: 1045“105521340604 7 BaldusSE SchaeferKL EngersR HartlebD StoeckleinNH et al (2010) Prevalence and heterogeneity of KRAS BRAF and PIK3CA mutations in primary colorectal adenocarcinomas and their corresponding metastases. Clin Cancer Res16: 790“79920103678 8 PagetS (1989) The distribution of secondary growths in cancer of the breast. 1889. Cancer Metastasis Rev8: 98“1012673568 9 CampbellI QiuW HavivI (2011) Genetic changes in tumour microenvironments. J Pathol223: 450“45821294119 10 LohelaM BryM TammelaT AlitaloK (2009) VEGFs and receptors involved in angiogenesis versus lymphangiogenesis. Curr Opin Cell Biol21: 154“16519230644 11 Muller-HubenthalB AzemarM LorenzenD HuberM FreudenbergMA et al (2009) Tumour Biology: tumour-associated inflammation versus antitumor immunity. Anticancer Res29: 4795“480520032438 12 RasanenK VaheriA (2010) Activation of fibroblasts in cancer stroma. Exp Cell Res316: 2713“272220451516 13 Des GuetzG UzzanB NicolasP CucheratM MorereJF et al (2006) Microvessel density and VEGF expression are prognostic factors in colorectal cancer. Meta-analysis of the literature. Br J Cancer94: 1823“183216773076 14 WeidnerN SempleJP WelchWR FolkmanJ (1991) Tumor angiogenesis and metastasis”correlation in invasive breast carcinoma. N Engl J Med324: 1“81701519 15 LindmarkG GerdinB SundbergC PahlmanL BergstromR et al (1996) Prognostic significance of the microvascular count in colorectal cancer. J Clin Oncol14: 461“4668636758 16 VermeulenPB VerhoevenD FierensH HubensG GoovaertsG et al (1995) Microvessel quantification in primary colorectal carcinoma: an immunohistochemical study. Br J Cancer71: 340“3437530985 17 GombosZ XuX ChuCS ZhangPJ AcsG (2005) Peritumoral lymphatic vessel density and vascular endothelial growth factor C expression in early-stage squamous cell carcinoma of the uterine cervix. Clin Cancer Res11: 8364“837116322297 18 KitadaiY KodamaM ChoS KurodaT OchiumiT et al (2005) Quantitative analysis of lymphangiogenic markers for predicting metastasis of human gastric carcinoma to lymph nodes. Int J Cancer115: 388“39215688374 19 JainRK FentonBT (2002) Intratumoral lymphatic vessels: a case of mistaken identity or malfunction?J Natl Cancer Inst94: 417“42111904313 20 TroskoJE RuchRJ (1998) Cell-cell communication in carcinogenesis. Front Biosci3: d208“2369458335 21 BarskySH GopalakrishnaR (1987) Increased invasion and spontaneous metastasis of BL6 melanoma with inhibition of the desmoplastic response in C57 BL/6 mice. Cancer Res47: 1663“16673815362 22 SkobeM FusenigNE (1998) Tumorigenic conversion of immortal human keratinocytes through stromal cell activation. Proc Natl Acad Sci U S A95: 1050“10559448283 23 OrimoA GuptaPB SgroiDC Arenzana-SeisdedosF DelaunayT et al (2005) Stromal fibroblasts present in invasive human breast carcinomas promote tumor growth and angiogenesis through elevated SDF-1/CXCL12 secretion. Cell121: 335“34815882617 24 OlumiAF GrossfeldGD HaywardSW CarrollPR TlstyTD et al (1999) Carcinoma-associated fibroblasts direct tumor progression of initiated human prostatic epithelium. Cancer Res59: 5002“501110519415 25 TsujinoT SeshimoI YamamotoH NganCY EzumiK et al (2007) Stromal myofibroblasts predict disease recurrence for colorectal cancer. Clin Cancer Res13: 2082“209017404090 26 MatsumotoN YoshidaT YamashitaK NumataY OkayasuI (2003) Possible alternative carcinogenesis pathway featuring microsatellite instability in colorectal cancer stroma. Br J Cancer89: 707“71212915883 27 KuroseK GilleyK MatsumotoS WatsonPH ZhouXP et al (2002) Frequent somatic mutations in PTEN and TP53 are mutually exclusive in the stroma of breast carcinomas. Nat Genet32: 355“35712379854 28 TrimboliAJ Cantemir-StoneCZ LiF WallaceJA MerchantA et al (2009) Pten in stromal fibroblasts suppresses mammary epithelial tumours. Nature461: 1084“109119847259 29 MekenkampLJ KoopmanM TeerenstraS van KriekenJH MolL et al (2010) Clinicopathological features and outcome in advanced colorectal cancer patients with synchronous vs metachronous metastases. Br J Cancer103: 159“16420551951 30 Bosman FT (2010) WHO classification of tumours of the digestive system/edited by Fred T. Bosman et al; anization WH Cancer IAfRo editors. France: Lyon: IARC Press. 31 LeeHS KimWH (2006) Tissue array methods for high-throughput clinicopathologic research. Cancer Res Treat38: 1“619771251 32 SpadernaS SchmalhoferO HlubekF BerxG EgerA et al (2006) A transient EMT-linked loss of basement membranes indicates metastasis and poor survival in colorectal cancer. Gastroenterology131: 830“84016952552 33 RyuHS Park doJ KimHH KimWH LeeHS (2012) Combination of epithelial-mesenchymal transition and cancer stem cell-like phenotypes has independent prognostic value in gastric cancer. Hum Pathol43: 520“52822018628 34 JunttilaMR de SauvageFJ (2013) Influence of tumour micro-environment heterogeneity on therapeutic response. Nature501: 346“35424048067 35 KimMJ LeeHS KimJH KimYJ KwonJH et al (2012) Different metastatic pattern according to the KRAS mutational status and site-specific discordance of KRAS status in patients with colorectal cancer. BMC Cancer12: 34722876814 36 BarresiV Di GregorioC Regiani-BonettiL Ponz-De LeonM BarresiG et al (2010) Stage I colorectal carcinoma: VEGF immunohistochemical expression microvessel density and their correlation with clinical outcome. Virchows Arch457: 11“1920532559 37 MoreiraLR SchenkaAA Latuf-FilhoP PennaAL LimaCS et al (2011) Immunohistochemical analysis of vascular density and area in colorectal carcinoma using different markers and comparison with clinicopathologic prognostic factors. Tumour Biol32: 527“53421222066 38 ChenY YanJ WangZ YuS YuanZ et al (2013) A meta-analysis of the relationship between lymphatic microvessel density and the survival of patient with colorectal cancer. Lymphology46: 42“5123930440 39 DuffSE JeziorskaM KumarS HaboubiN SherlockD et al (2007) Lymphatic vessel density microvessel density and lymphangiogenic growth factor expression in colorectal cancer. Colorectal Dis9: 793“80017931169 40 PrallF GringmuthU NizzeH BartenM (2003) Microvessel densities and microvascular architecture in colorectal carcinomas and their liver metastases: "
Lung_Cancer
"Accordingly the protease inhibitor E-64d partially suppressed TFP-induced cell death. Moreover we demonstrate that lysosomal targeting of TFP was critical for its cytotoxic activity because inhibition of vacuolar adenosine triphosphatase by BafA1 which dissipates the lysosomal pH gradient and prevents intra-lumenal entrapment of lysosomotropic compounds (e.g. phenothiazines) in their protonated forms18 largely abolished TFP-induced cell death. Overall these data demonstrate that phenothiazines can modulate lysosomal functions in human LC cells as the amount of endogenous LC3-II is correlated with autophagic vesicle formation and conversion of LC3-I into LC3-II is a hallmark of autophagic activity and changes in these processes were observed upon phenothiazine treatment especially in SCLC. The lysosome has recently emerged as a promising target for anticancer therapy because lysosome-initiated cell death can operate independently of p53 and downstream caspases19 20 pathways that are often functionally inactivated in a variety of human tumors.2122 23 Also in our studies lysosomal perturbation occurred despite mutation in p53 and was not influenced by intrinsic sensitivity/resistance toward conventional chemotherapeutic agents. From our data we cannot rule out that SCLC cells or tumors with wt p53 or p53 null status could potentially respond differently yet our opinion is that in this context p53 status is not the main factor that regulates phenothiazine monotherapy response of SCLC. However the disparate sensitivities that exist between but also within SCLC and NSCLC indicate intrinsic differences in lysosomal activity suggesting that not all SCLC cells will be equally susceptible to phenothiazine-based treatment. Hence we sought to reveal whether lysosome-associated parameters can be used to predict the sensitivity of human LC cells to phenothiazines. Indeed using a limited number of SCLC and NSCLC cell lines we found that sensitivity to phenothiazines inversely correlated with baseline LysoTracker Green retention which was generally higher in NSCLC. Meanwhile sensitivity to phenothiazines correlated positively with the magnitude by which LysoTracker retention was lost upon treatment which tends to be more pronounced in SCLC. This suggests that lysosomes in the tested panel of SCLC cells may be less abundant and/or have higher intra-lumenal pH and are therefore more prone to functional perturbations. These findings require however further validation in a wider panel of SCLC cell lines to make a final . Also as LysoTracker Green only stain lysosomes in live cells alternative methodologies need to be developed to assess definitively whether lysosomal mass and/or pH is altered in clinical SCLC specimens such as for example tissue microarray staining with LC3-II upon treatment. Nevertheless consistent with this idea a number of different SCLC cell lines (H69 H82 H592 and U-1285) exhibited increased sensitivity toward several well-known lysosome-disrupting agents such as TMX CQ quinacrine and ammonium chloride (NH4Cl) all of which elicited larger changes in LysoTracker retention in SCLC cells as compared with NSCLC counterparts. By contrast we found that the CaM antagonist W7 neither induced LC3-II accumulation nor was selectively cytotoxic in SCLC cells. In addition the expression of D2R was comparable in our cell lines panel. Therefore the enhanced cytotoxicity of phenothiazines in SCLC that we report here most likely derives from lysosomal dysregulation rather than preferential inhibition of CaM or neurotransmitter signaling two established activities of phenothiazines.5 In addition it is worth noting that NSCLC cell lines in general exhibited a higher basal autophagy than SCLC counterparts which may render them less sensitive to chemically induced lysosomal perturbation. Similar observations have been reported by other investigators implicating autophagy as a pro-survival mechanism in NSCLC.24 25 Multiple studies on human and mouse cell lines have demonstrated the cytotoxic potential of phenothiazines given as monotherapy.4 In addition a few case reports exist that described anecdotal evidence for the antitumor activity of phenothiazines in vivo.2627 28 While the clinical utility of phenothiazines for anticancer treatment needs to be further analyzed through in vivo using SCLC xenograft transgenic murine SCLC models and possibly also patient-derived xenografts we believe our data in SCLC cell lines provide an important rationale for such analysis. Indeed it has been shown that at advanced stages several types of human cancers rely on lysosomes/autophagy for survival and metastasis.29 This is not surprising given that tumors frequently experience metabolic and replication stress.30 31 Therefore it is conceivable that tumors with high stress load and relatively low lysosomal activity could be particularly sensitive to phenothiazines. Given that SCLC initially are typically sensitive to conventional CT but rapidly develop resistance our data support clinical trials where phenothiazines are administered as second-line treatment for tumors that become refractory to standard treatment. "
Lung_Cancer
"Nonetheless the tumor TS levels or its polymorphisms in each patient could explain these cases of severe toxicity as it has been suggested in other neoplasms treated with other antifolate drugs [9]. The potential association between different TS genotypes and the toxicity experienced by a European population of patients with NSCLC receiving pemetrexed is also to be studied. Three different types of polymorphisms have been described in the TS gene. In the gene promoter there is a variable number of tandem repeats (VNTR) of 28 pb in the 5?- region. Thus cases of two or three repetitions of this tandem TS gene promoter enhancer region (TSER) have been described [16]. A second type of polymorphism consists in a change in a single nucleotide (G >?C) in one of the sequences of the repetition comprising a single nucleotide polymorphism (SNP) [16]. A third modality of polymorphisms consists in the deletion or insertion of 6 pair of bases (bp) in the 3?-UTR region (untranslated region) [16]. In summary the potential usefulness of TS genotype as an independent prognostic factor or predictor of response to pemetrexed-based regimens in a European NSCLC population has not been studied. Similarly no clear evidence is available about the potential correlation between the different TS genotypes and the toxicity experienced by those patients. Therefore we decided to investigate the three known polymorphisms of TS gene and their correlation with objective response rate (ORR) progression-free survival (PFS) and overall survival (OS) as well as toxicity in European patients with advanced NSCLC treated with pemetrexed-based regimens. Methods Patients and samples Overall 25 consecutive stage III-IV NSCLC patients treated at a single institution from which peripheral blood samples were available were analyzed. All of them received pemetrexed-based regimens in the first second or third line settings according to our institutional therapeutic protocols. After the informed consent was obtained from all patients 10 ml of peripheral blood samples were collected before the administration of the first cycle of a pemetrexed-containing regimen. Blood samples were stored at the Biobank of the University of Navarra and were processed following standard operating procedures approved by the Ethical and Scientific Committees. Tumor ORR to the treatment was assessed using computerized tomography (CT) scans every two pemetrexed-based chemotherapy cycles and categorized according to the Response Evaluation Criteria In Solid Tumors (RECIST) v1.1 as per institutional protocol. The toxicities recorded during pemetrexed-based treatment were graded according to the Common Terminology Criteria for Adverse Events (CTCAE) version 4.0. TS enhancer region genotyping analysis The genomic DNA was extracted from the peripheral leucocytes. The genotypes of the TSER (VNTR) and SNP were determined by polymerase chain reaction (PCR). The variable number tandem repeat (VNTR) of 28 bp polymorphism and the G???C SNP in the first and second repeat were analyzed. A DNA fragment was amplified using previously described PCR conditions and primers [17] and directly sequenced using an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems Foster City CA USA). The forward primer 5?-CGTGGCTCCTGCGTTTCC-3? and the reverse primer 3?-GAGCCGGCCACAGGCAT-5? were used. A modification of conventional conditions was necessary. PCR was performed in a reaction mixture with dNTP: 0.35 ?l Buffer: 0.25 ?l MgCl2: 17.5 ?l Tap polymerase: 0.5 ?l H2O: 18 ?l primers 0.1?+?0.1 ?l DMSO: 1.25 ?l and DNA: 2 ?l. The cycling conditions were denaturation 95°C for 10 minutes and 30 cycles at 95°C for one minute then at 64°C for one minute and 72°C one minute and finally seven minutes at 72?ºC. Aliquots of amplified fragments were separated on a 3% agarose gel and the TS VNTR genotype was determined staining 2R (210 base pairs; bp) and 3R (238 bp) alleles. After that we performed a PCR-restriction fragment length polymorphisms (RFLP) by Hae III digestion. The mixture was PCR product: 10 ?l H2O: 7 ?l Buffer 2 ?l and Hae III: 1 ?l. After that we incubated the mixture at 37°C overnight. Aliquots of digested fragments were separated on 12% acrylamide gel and the SNP genotype was determined. The digestion of fragments showed the different genotypes 2RGC: 664746 44 and 7 bp 2RCC: 11346 44 and 7 bp 3RGGCC (3RG): 66474644 28 and 7 bp 3RGCC (3RC): 944746 44 and 7 bp. TS 3?UTR region genotyping analysis The 3?UTR polymorphisms were analyzed by Restriction Fragment Length Polymorphism (RFLP). A fragment containing the 6 bp deletion/insertion was amplified using the reverse primer 5?-CAGATAAGTGGCAGTACAGA-3?and the forward primer 3?-CAAATCTGAGGGAGCTGAGT-5? in 10 ul of reaction mixture with dNTP: 4 ?l Buffer: 5 ?l MgCl2: 4 ?l Tap polymerase: 0.5 ?l H2O: 26.5 ?l primers 4?+?4 ?l and DNA: 2 ?l. The cycling conditions were denaturation 95°C for 10 minutes and 35 cycles at 95°C for 30 minutes then at 57°C for 30 minutes and 72°C one minute and finally seven minutes at 72°C. The fragments were amplified on 2% agarose gel. Afterwards the products were digested with Dra I and the mixture of PCR product: 20 ?l BSA 10%: 0.5 ?l Buffer: 5 ?l H2O: 23.5 ?l and Dra I: 1 ?l. Posteriorly the product was incubated one hour at 37°C. The final digested product was separated in a 3% agarose gel. The different genotypes were deletion 6 bp/insertion 6 bp insertion 6 bp/insertion 6 bp and deletion 6 bp/deletion 6 bp. The expected fragment sizes by genotyping were deletion 6 bp/insertion 6 bp: 148142 88 and 60 bp insertion 6 bp/insertion 6 bp: 88 and 60 bp and deletion 6 bp/deletion 6 bp: 142 bp. We repeated the PCR three times to ensure final results. EGFR mutations analysis As per institutional protocol all patients with advanced NSCLC were tested for EGFR activating mutations before treatment initiation. In brief after having the samples fixed in alcohol and stained by Papanicolau stain DNA was extracted and amplified by PCR technique using EGFR gene exons 1819 20 and 21 specific primers. ABI PRISM® 310 Genetic Analyzer equipment was used for the analysis of the sequencing reactions with both forward and reverse primers. Statistical analysis Fisher™s exact test was used to investigate the correlation between each genotype and the response to the treatment and the toxicity presented. Kaplan-Meier curves and log-rank test or Tarone-Ware test when indicated were calculated to correlate each genotype with the survival outcomes (PFS and OS). For the subgroup analysis EGFR mutation status and smoking history were considered in order to analyze potential differences in clinical outcome measures (ORR PFS and OS). The SPSS 15.0 software (SPSS Inc. Chicago IL) was employed to perform the statistical analysis. Results Patients™ characteristics and treatment The clinical and pathological characteristics of the patients included are summarized in . In brief our cohort was mainly composed by males with a median age of 59 years and a past smoking history showing good performance status. Most of the patients showed adenocarcinoma histology (88%) and showed distant metastasis (M1) at onset (72%). Most of the patients received a pemetrexed-based regimen in first line (84%). After a median follow up of 21 months 80% of patients have already progressed and 52% of them have died due to disease progression (). Patients™ characteristics N pts % Gender ??Female 11 44 ??Male 14 56 Age ??<60 13 52 ??> r =60 12 48 ECOG ??0 9 36 ??1 15 60 ??2 1 4 Tobacco ??Current smoker 4 16 ??Never smoker 7 28 ??Former smoker 14 56 Histology ??Adenocarcinoma 22 88 ??Adenocarcinoma poorly differentiated 2 8 ??Adeno-squamous 1 4 T ??T1-2 12 48 ??T3-4 13 52 N ??N0 6 24 ??N+ 19 76 M ??M0 7 28 ??M1 18 72 Lung metastases ??Presence 7 28 ??Absence 18 72 Liver metastases ??Presence 2 8 ??Absence 23 92 Bone metastases ??Presence 10 40 ??Absence 15 60 Brain metastases ??Presence 8 32 ??Absence 17 68 EGFR ??Wild type 23 92 ??Mutant 1 4 ??Unknown 1 4 Line of treatment ??First/Induction (stage III) 2 8 ??First 21 84 ??Second 1 4 ??Third 1 4 Response ??Response 18 72 ??Progression?+?Stabilization 7 28 Maintenance ??No maintenance 18 72 ??Maintenance 7 28 Progression ??Not progressed 6 24 ??Progressed 19 76 Clinical status ??Alive 12 48 ??Dead 13 52 Eastern Cooperative Oncology Group (ECOG). Epidermal Growth Factor Receptor (EGFR). In addition in 8 out of the 18 subjects showing multiple brain metastases at onset conventional whole-brain radiotherapy (300 cGy) was administered between first and second chemotherapy cycles following our institutional treatment guidelines. Finally 4 out of the 7 patients showing no distant metastases at onset responded to the pemetrexed-based induction chemotherapy. As per institutional protocol all four subjects underwent a 3-D conformal radiotherapy program with concurrent chemotherapy as previously published [18]. Correlation between ORR to the treatment and polymorphisms We studied the potential correlation between the different polymorphisms observed and the response to the treatment obtained (Table 2). For this purpose any kind of radiological response (complete or partial response) was compared to no response to the treatment (disease stabilization or progression). The presence of 3R/3R polymorphism seemed to predict a higher ORR (100%) compared to the rest of the genotypes with a trend toward statistical significance (p =?0.055). In the subgroup analysis a significantly higher ORR to pemetrexed for wild-type EGFR patients showing a 3R/3R genotype (100%) compared to the 2R/2R (77.8%) 2R/3R (33.3%) and 3R/4R (0%) was observed (p =?0.017). Table 2 Overall response rate to the treatment and polymorphisms observed Global distribution of polymorphisms (Pol) Response N (%) Stabilization or progression N (%) p value VNTR 2R/2R 7 (77.8) 2 (22.2) 0.055 3R/3R 7 (100) 0 (0) 2R/3R 4 (50) 4 (50) 3R/4R 0 (0) 1 (100) Pol VNTR (Subanalysis by EGFR status; group of native EGFR-patients) 2R/2R 7 (77.8) 2 (22.2) 0.017 3R/3R 7 (100) 0 (0) 2R/3R 2 (33.3) 4 (66.7) 3R/4R 0 (0) 1 (100) Global distribution of SNP Absence 6 (85.7) 1 (14.3) 0.626 Presence 12 (66.7) 6 (33.3) Global distribution of polymorphisms in 3?-UTR +6/+6 10 (83.3) 2 (16.7) 0.234 +6/-6 6 (54.5) 5 (45.5) -6/-6 2 (100) 0 (0) Pol 3?-UTR (Subanalysis by smoking habit stratification; group of active and former smokers) +6/+6 8 (100) 0 (0) 0.085 +6/-6 4 (50) 4 (50) -6/-6 2 (100) 0 (0) No statistically significant differences were observed comparing the presence and the absence of a SNP G >?C as shown in Table 2. Overall a non-significant correlation between the different 3?-UTR polymorphisms and the ORR was observed. However the genotype +6/+6 seemed to predict a higher ORR among active/former smokers (A/FS) compared to +6/-6 (100% vs. 50%; p =?0.085). Correlation between PFS and polymorphisms Regarding TSER polymorphisms we found a trend toward statistical significance (p =?0.089) in the differences in PFS observed among the different genotypes in favor of the 3R/3R genotype (Figure 1A). Figure 1 Kaplan-Meier curves for progression-free survival (PFS) in months (mo) associated with the different TS polymorphisms. A: TSER genotypes. B: Presence or absence of SNP. C: 3´UTR genotypes. In the case of the absence or presence of a SNP at the third repetition (3R allele) we observed a non-significant increased PFS in the subgroup of patients showing an absence of SNP (Figure 1B). Finally no significant correlations regarding the 3?UTR genotypes and PFS were observed (Figure 1C). Correlation between OS and polymorphisms In this cohort we found a significant correlation between TSER polymorphisms and OS (Figure 2A). The median OS was not reached for 3R/3R genotype patients whereas 2R/3R genotype subjects showed a 70 m OS followed by 3R/4R and 2R/2R genotypes with a median OS of 15 m and 13 m respectively (p =?0.019) (Figure 2A). Figure 2 Kaplan-Meier curves for overall survival (OS) in months (mo) associated with the different TS polymorphisms. A: TSER genotypes. B: Presence or absence of SNP. C: 3´UTR genotypes. No significant differences in OS were observed with regards to the presence/absence of SNP (Figure 2B) or regarding the 3?-UTR polymorphisms (Figure 2C). Correlation between toxicity and polymorphisms The most frequent toxicity was grade (G)1 anemia (28%) and nausea (20%) and G2 leucopenia (40%). The most commom G3-4 toxicities were leucopenia (16%) asthenia (8%) anemia (4%) neutropenia (4%) and dyspnea (4%). Overall we found no significant correlations between the toxicity profiles experienced by the patients and the different TS genotypes (Table 3). Table 3 Correlation between grades of toxicity and different genotypes Global distribution polymorphisms (Pol) No toxicity Grade 1-2 Grade 3-4 p value VNTR polymorphisms 2R/2R 2 (22.2) 4 (44.2) 3 (33.4) 0.545 3R/3R 2 (25) 5 (75) 0 (0) 2R/3R 2 (25) 4 (50) 2 (25) 3R/4R 1 (100) 0 (0) 0 (0) SNP polymorphisms Absence 3 (42.9) 4 (57.1) 0 (0) 0.3 Presence 4 (22.2) 9 (50) 5 (27.8) 3?-UTR polymorphisms +6/+6 3 (25) 6 (50) 3 (25) > 0.05 +6/-6 3 (27.3) 6 (54.5) 2 (18.2) -6/-6 1 (50) 1 (50) 0 (0) Discussion Pemetrexed a multitargeted antifolate drug is essential for the first and second-line as well as maintenance treatment of NSCLC patients with non-squamous histology [6]. TS is the main biological target of pemetrexed. Some studies have suggested that TS expression could be a predictive factor of response in NSCLC [19]. Moreover some VNTR genotypes have been associated with TS expression and activity in other tumor types such as colorectal cancer [17]. In NSCLC patients a correlation between different genotypes and the TS protein expression has been shown [20]. Shintani et al. [20] also confirmed that the TS mRNA levels were significantly higher in lung cancer tissues with the 3R/3R genotype as compared to those with the 2R/2R genotype. Nonetheless definitive studies addressing the correlation of the different genotypes of TS in circulating genomic DNA with response to the treatment PFS or OS in pemetrexed-treated NSCLC European patients are lacking. The potential influence of the EGFR status on those polymorphisms and their correlation with clinical outcome after pemetrexed-based treatment is also unexplored. A recent study by Hu et al. [21] investigated the different TS polymorphisms in genomic DNA of 90 Asian NSCLC patients. In contrast with our findings no specific genotype regarding the TSER or 3?-UTR polymorphisms studied seemed to correlate with a significant difference in ORR PFS or OS. This could be explained by substantial clinical differences between both populations. Our cohort was constituted by Caucasian patients compared to the Asian population studied by Hu et al. In addition our patients were mostly current or former smokers (72%) compared to the Asian population that showed 62% of never smokers. Also in our cohort the subjects mainly received pemetrexed-based chemotherapy as a first line regimen (92%) whereas the cohort studied by Hu et al. [21] was treated with pemetrexed as a second or further line in 62.2% of the cases. These remarkable differences in basic clinical characteristics and in particular the ethnicity between both cohorts are probably also explaining the differences observed in the 3?-UTR genotype frequency between our population and the one studied by Hu et al. In our cohort +6 bp/+6 bp +6 bp/-6 bp and -6 bp/-6 bp genotypes were found in 48% 44% and 8% of the cases respectively. In contrast0.078 47.8% and 44.4% were respectively found in the population studied by Hu et al. [21]. In a previous analysis performed on another Caucasian NSCLC population evaluated at the M.D. Anderson Cancer Center [22] a similar proportion of 3?-UTR genotypes according to our findings was observed (49.2% of +6 bp/+6 bp 42.4% of +6 bp/-6 bp and 8.4% of -6 bp/-6 bp). Additionally the low prevalence of the +6 bp/+6 bp genotype in an Asian population compared to our cohort may be confirmed by a recent study in which from 106 Asian NSCLC patients investigated none of them showed a +6 bp/+6 bp genotype in genomic circulating DNA [23]. Nontheless in this latter study [23] a significantly higher ORR was observed among patients showing a -6 bp/-6 bp 3?-UTR genotype compared to the ORR reported for patients presenting a -6 bp/+6 bp polymorphism (32.2% vs 12.7%; p =?0.008). Accordingly in our cohort a higher ORR in patients showing a -6 bp/-6 bp genotype compared to those presenting a -6 bp/+6 bp polymorphism was also observed (100% vs. 54.5%). However the statistical significance was not reached probably due to the relatively low number of patients included in our analysis. Interestingly enough in the subgroup analysis of our data the +6 bp/+6 bp genotype seemed to predict a higher ORR only among active/former smokers compared to +6 bp/-6 bp (100% vs. 50%; p =?0.085). This novel observation if validated in future studies could be relevant for selecting specific drugs for each patient in a second or third line setting. With regards to the TSER polymorphisms the presence of a 3R/3R polymorphism seemed to predict a higher ORR with a clear trend toward statistical significance (p =?0.055). Moreover that difference was even greater and statistically significant benefiting the subpopulation of wild-type EGFR patients. To our knowledge this is the first time that such observation has been made. An interesting preclinical study by Giovannetti et al. [24] investigated the activity profile of a combination therapy against NSCLC cell lines with different genotypes with erlotinib and pemetrexed. Remarkably pemetrexed increased EGFR phosphorylation and reduced Akt phosphorylation. Additionally erlotinib significantly reduced TS expression and activity. Thus when erlotinib and pemetrexed were combined a strong synergism in all NSCLC cells regardless of their genetic signature was observed. This potential crosstalk between the EGFR signaling pathway and the TS expression and activity could in part explain our novel findings showing a significantly higher ORR to pemetrexed in those wild-type EGFR patients harboring a 3R/3R polymorphism. However none of the previous studies have described the EGFR status of the patients analyzed and how that status impacted on the ORR to pemetrexed for certain TS polymorphisms. In terms of survival in the present series after a median follow-up of 21 months PFS was superior for those patients showing a 3R/3R genotype with a trend toward statistical significance as expected considering the higher ORR observed for patients with the same TSER genotype. The relatively low statistical power of our clinical cohort may be accounting for the lack of a full statistical significance observed. Regarding OS the advantage in PFS observed in patients showing the 3R/3R genotype translated into a significantly higher median OS in patients with the same polymorphism compared to the rest. Conversely in the study by Hu et al. [21] no specific genotype was significantly correlated with a superior PFS or OS. As aforementioned the dramatic differences in the population™s characteristics between both series might possibly explain this discordance. In our study conversely to the observations made by Wang et al. [23] a significantly superior PFS and OS in patients with the -6 bp/-6 bp 3?-UTR genotype has not been confirmed. Most probably this is also due to the differences in the genotype distribution among populations with markedly different ethnicity and epidemiological characteristics. Finally in accordance with Wang et al. [23] the toxicity profile was not significantly correlated with any TS genotype in our series. As aforementioned this study has some limitations due to its retrospective nature and the low number of patients investigated. Both could be responsible for a low statistical power that may impair our ability to find significant differences between subgroups of patients. Conclusions For the first time in a European population of NSCLC patients receiving pemetrexed the presence of the TSER 3R/3R polymorphism significantly correlated with a superior OS. Moreover this same polymorphism when associated to wild-type EGFR was correlated with a higher ORR to pemetrexed. The presence of the +6/-6 bp 3?-UTR genotype among active or former smokers was correlated to a higher ORR showing a trend toward statistical significance. Finally pemetrexed-induced toxicity was not significantly correlated with a specific TS genotype. These novel data warrant further investigation in larger prospective series and may help to patient™s selection if finally validated. Abbreviations NSCLC: Non-small cell lung cancer; TS: Thymidylate synthase; EGFR: Epidermal Growth Factor Receptor; VNTR: Variable number of tandem repeats; TSER: Thymidylate Synthase gene promoter enhancer region; SNP: Single nucleotide polymorphism; ORR: Overall response rate; PFS: Progression-free survival; OS: Overall survival; CT: Computerized tomography; RECIST: Response Evaluation Criteria in Solid Tumors; CTCAE: Common Terminology Criteria for Adverse Events; PCR: Polymerase chain reaction; RFLP: Restriction fragment length polymorphism; A/FS: Active/former smokers. Competing interests The authors declare that they have no competing interests."
Lung_Cancer
"Non-Small-Cell Lung Cancer J Exp Clin Cancer Res 2012 31 77 22992338 PLoS One one 1932-6203 Public Library of Science San Francisco USA 24887068 4041776 PONE-D-14-02596 .0098621 Research Medicine and Health Sciences Oncology Cancer Treatment Radiation Therapy Feasibility of Proton Transmission-Beam Stereotactic Ablative Radiotherapy versus Photon Stereotactic Ablative Radiotherapy for Lung Tumors: A Dosimetric and Feasibility Study Lung SABR Using Transmission Proton Beams Mou Benjamin Beltran Chris J. * Park Sean S. Olivier Kenneth R. Furutani Keith M. Department of Radiation Oncology Mayo Clinic Rochester Minnesota United States of America Deutsch Eric Editor Institut Gustave Roussy France * E-mail: Beltran.Chrismayo.edu Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: BM KMF SSP KRO CJB. Analyzed the data: BM KMF SSP KRO CJB. Contributed reagents/materials/analysis tools: BM KMF SSP KRO CJB. Wrote the paper: BM KMF SSP KRO CJB. 2014 2 6 2014 9 6 e98621 21 1 2014 6 5 2014 2014 Mou et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Stereotactic ablative radiotherapy is being increasingly adopted in the treatment of lung tumors. The use of proton beam therapy can further reduce dose to normal structures. However uncertainty exists in proton-based treatment plans including range uncertainties large sensitivity to position uncertainty and calculation of dose deposition in heterogeneous areas. This study investigated the feasibility of proton transmission beams i.e. without the Bragg peak to treat lung tumors with stereotactic ablative radiotherapy. We compared three representative treatment plans using proton transmission beams versus conformal static-gantry photon beams. It was found that proton treatment plans using transmission beams passing through the patient were feasible and demonstrated lower dose to normal structures and markedly reduced treatment times than photon plans. This is the first study to demonstrate the feasibility of proton-based stereotactic ablative radiotherapy planning for lung tumors using proton transmission beams alone. Further research using this novel approach for proton-based planning is warranted. The authors have no support or funding to report. Introduction Stereotactic ablative radiotherapy (SABR) plays an essential role in the treatment of patients with medically inoperable early stage lung cancer and oligometastasis. The use of protons for lung SABR is emerging as an appealing treatment option because of its potential to deliver higher doses of conformal radiotherapy and spare normal tissues better than traditional photons [1] [2] [3] [4]. This can be achieved because of the natural characteristics of proton beams that deposit its dose at depth with no exit dose referred to as a Bragg peak. However conventional dosimetric models fail to accurately model how protons scatter and deposit dose in highly heterogeneous areas which leads to uncertainties in proton treatment plans [5]. In addition the uncertainties in the stopping power of the various tissues in the body and the interplay effect between spot scanning proton therapy and the target motion leads to large uncertainties in the treatment of lung tumors [5] [6]. In this study we report on the feasibility of proton transmission-beam SABR (PT-SABR) for lung tumors which uses the transmission portion of a spot scanning proton beam i.e. without the Bragg peak. This technique eliminates the major uncertainties of proton therapy mentioned above by having the proton beams pass through the patient. In addition the use of the transmission beam allows an entire field to be treated in one breath hold. This quick treatment and decreased uncertainties lead to smaller planning volumes. To the best of the authors™ knowledge this is the first report on the use of this novel approach to plan SABR with protons without using the Bragg peak which may have dosimetric advantages over photon treatments. Materials and Methods Ethics Statement Written informed consent was obtained from all patients registered in the SABR database. This study including the consent procedure was approved by the Mayo Clinic institutional review board. Patient Cohort Patients were identified from a prospectively collected institutional database of patients treated with SABR. Patients with lung tumors less than one centimetre in maximum dimension were included. The radiation treatment plans of three patients were extracted from the treatment planning system. All patients were treated using three-dimensional conformal multiple static-gantry photon beams. Plans were normalized so that 95% of the planning target volume (PTV) received at least 95% of the prescription dose. The prescription doses for these plans were adjusted to 34 Gy in one fraction based on the recently reported results of Radiation Therapy Oncology Group (RTOG) 0915 which established this dose fractionation regimen as a possible standard dose to be used in future trials [7]. Dose calculations for photon plans used the anisotropic analytical algorithm. Proton Treatment Planning A machine was commissioned in Eclipse v.10 (Varian Medical Systems Palo Alto CA) which allowed for planning and calculating transmission dose plans. The spot size (sigma) of the transmission beam which had an energy of 229 MeV was 2.2 mm. A proton plan that only used the transmission portion of the beam was created for each patient. Proton beam arrangements were selected so that no beams entered through the heart or spinal cord and allowed up to two non-coplanar beams. Four to five beams were used to keep the skin dose comparable to photon plans. The energy of the protons for each spot of a field was 229 MeV; this ensured the Bragg peak was not located within the patient. Dose calculations for the transmission portion of the proton beam were verified with Monte Carlo (Geant4). The proton plans were normalized so that the internal target volume (ITV) receives at least 95% of prescription dose including when range and position errors were included (3.5% and 2 mm) which is standard for spot scanning proton therapy. ITVs were created based on motion of the gross tumor volume in three dimensions using four-dimensional computed tomography image data. The dose constraints from RTOG 0915 were compared for the photon and proton plans as well as the total time that would be required to deliver the treatment. The radiotherapy delivery time per beam was estimated at 1 nC per second for proton therapy which is readily achievable by most spot scanning proton centers and 600 MU per minute for the photon plans. Differences in dosimetric and treatment planning parameters between photon and proton plans were analyzed with two-sided paired t-tests using SAS version 9.2 (SAS Institute Inc. Cary NC). Results The ITVs of the three tumors measured 0.220.42 and 0.99 cubic centimeters. All three proton plans had excellent coverage of the ITV. For all ITVs over 99.4% of the volume received at least 95% of the prescription dose including when uncertainties were examined. This was comparable with the photon plans where 100% of the ITVs received at least 95% of the prescription dose. For most normal tissues lower doses to these ans were achieved with the proton plans compared to the photon plans (). In fact (near) complete sparing of the spinal cord heart and esophagus was possible with protons through careful selection of beam angles (). .0098621.g001 Dose-volume histogram comparison of ans at risk. .0098621.t001 Dosimetric comparison of photon and proton plans. Parameter Photon Proton P-value Mean Range Mean Range Internal target volume (cc) 0.54 0.22“0.99 0.54 0.22“0.99 N/A Spinal cord Maximum dose (Gy) 5.66 2.39“8.07 1.97 0.00“3.06 0.04 Lungs (bilateral) Mean lung dose (Gy) 1.35 0.95“1.92 0.69 0.03“1.36 0.12 V20 (%) 0.66 0.39“1.20 0.49 0.16“1.01 0.06 V5 (%) 7.32 5.4“11.30 6.65 2.96“11.70 0.56 Heart Mean dose (Gy) 8.36 6.27“12.51 0.00 0.00“0.00 0.13 Skin Maximum dose (Gy) 11.75 9.86“13.28 11.40 7.37“16.23 0.89 Esophagus Maximum dose (Gy) 6.49 2.98“9.43 3.40 0.00“7.51 0.05 Homogeneity Index 1.25 1.21“1.29 1.07 1.03“1.11 0.06 Conformity Index 17.14 8.23“30.05 3.47 2.17“4.64 0.15 Proton plans used four to five non-coplanar beams compared to nine to ten beams for photon plans (Figure 2). The average number of monitor units per field was 818 (range 758“871) with photons and only 38 (range 31“59) with protons. This would translate to an average beam-on time per field of 82 seconds versus 6 seconds for photon and proton plans respectively. These differences in monitor units and beam-on time were statistically significant with P<0.01(Table 2). .0098621.g002 Figure 2 Comparison of isodose distributions. Proton (left) and photon (right) treatment plans. .0098621.t002 Table 2 Comparison of treatment time between photon and proton plans. Parameter Photon Proton P-value Mean Range Mean Range Total monitor units (MU) 7929 6820“8713 178 122“235 <0.01 Fields 9.7 9“10 4.7 4“5 N/A Average MU/field 818 758“871 38 30.5“46.9 <0.01 Beam on time per field (seconds) 81.8 75.6“87.1 5.8 4.7“7.2 <0.01 Discussion Exploiting the transmission beam in proton therapy planning has significant potentials for dose escalation and re-irradiation in lung tumors and eliminates the concern over the uncertainty of the stopping power and its impact on the Bragg peak location. PT-SABR planning requires fewer beams than photons and careful selection of optimal beam angles allows for minimal dose to adjacent normal tissues and tumor dose escalation which may translate to improved local control rates. RTOG 0915 showed that 34 Gy in a single fraction was comparable to 48 Gy in four fractions [7] and the dosimetric constraints from the protocol were easily achieved using both proton and photon plans for patients in this study. Further optimization with proton therapy can allow even higher doses to be delivered while still respecting established dosimetric constraints for normal tissues. This may translate to better tumor control but requires more investigation in a clinical setting. Patients planned with PT-SABR required fewer beams (5 vs. 10) which reduce the total treatment time and the low dose outside the tumor. The average monitor units per field for PT-SABR plans"
Lung_Cancer
"trial in patients with advanced non-small-cell lung cancer. J Clin Oncol 2010 28 3076 3083 20479403 29. Miller VA Hirsh V Cadranel J Afatinib versus placebo for patients with advanced metastatic non-small-cell lung cancer after failure of erlotinib gefitinib or both and one or two lines of chemotherapy (LUX-Lung 1): a phase 2b/3 randomised trial. Lancet Oncol 2012 13 528 538 22452896 Clin Orthop Relat Res Clin. Orthop. Relat. Res Clinical Orthopaedics and Related Research 0009-921X 1528-1132 Springer US Boston 24249538 3971232 3385 10.1007/s11999-013-3385-9 Clinical Research Does Intensity of Surveillance Affect Survival After Surgery for Sarcomas? Results of a Randomized Noninferiority Trial Puri Ajay MS docpurigmail.com Gulia Ashish MS Hawaldar Rohini PhD Ranganathan Priya MD Badwe Rajendra A. MS Orthopaedic Oncology Tata Memorial Hospital Room No. 45 E Bes Road Mumbai India Tata Memorial Hospital Mumbai India Anaesthesiology Critical Care and Pain Tata Memorial Hospital Mumbai India Surgical Oncology Tata Memorial Hospital Mumbai India 19 11 2013 5 2014 472 5 1568 1575 30 7 2013 8 11 2013 The Association of Bone and Joint Surgeons® 2013 Background Whether current postoperative surveillance regimes result in improved overall survival (OS) of patients with extremity sarcomas is unknown. Questions/purposes We hypothesized that a less intensive followup protocol would not be inferior to the conventional followup protocol in terms of OS. We (1) assessed OS of patients to determine if less intensive followup regimens led to worsened survival and asked (2) whether chest radiograph followup group was inferior to CT scan followup group in detecting pulmonary metastasis; and (3) whether less frequent (6-monthly) followup interval was inferior to more frequent (3-monthly) followup in detecting pulmonary metastasis and local recurrence. Methods A prospective randomized single-center noninferiority trial was conducted between January 2006 and June 2010. On the basis of 3-year survival of 60% with intensive more frequent followup 500 nonmetastatic patients were randomized to demonstrate noninferiority by a margin (delta) of 10% (hazard ratio [HR] 1.36). The primary end point was OS at 3 years. The secondary objective was to compare disease-free survival (DFS) (time to recurrence) at 3 years. At minimum followup of 30 months (median 42 months; range 30“81 months) 178 deaths were documented. Results Three-year OS and DFS for all patients was 67% and 52% respectively. Three-year OS was 67% and 66% in chest radiography and CT groups respectively (HR 0.9; upper 90% confidence interval [CI] 1.13). DFS rate was 54% and 49% in chest radiography and CT groups respectively (HR 0.82; upper 90% CI 0.97). Three-year OS was 64% and 69% in 6-monthly and 3-monthly groups respectively (HR 1.2; upper 90% CI 1.47). DFS was 51% and 52% in 6-monthly and 3-monthly groups respectively (HR 1.01; upper 90% CI 1.2). Almost 90% of local recurrences were identified by patients themselves. Conclusions Inexpensive imaging detects the vast majority of recurrent disease in patients with sarcoma without deleterious effects on eventual outcomes. Patient education regarding self-examination will detect most instances of local recurrence although this was not directly assessed in this study. Although less frequent visits adequately detected metastasis and local recurrence this trial could not conclusively demonstrate noninferiority in OS for a 6-monthly interval of followup visits against 3-monthly visits."
Lung_Cancer
"Human FTSJ2 GCTGGTGTGTGTTTCCTTTCA CAGAATCTGGTGCCTCTCGT HSP70.2 GCACGTTCGACGTGTCCAT GCTTGTTCTGGCTGATGTCCTT ?-actin CCGTCTTCCCCTCCATCGTGGG CGCAGCTCATTGTAGAAGGTGTGG GAPDH GAGAAACCTGCCAAGTATGATG ACCTGGTCCTCAGTGTAGCC Pig Ftsj2 ACGAGTTCCCAGGAGAATCAGA TGCTTTGGCAACGACCTTTAA Hsp70.2 GCACGTTCGACGTGTCCAT GCTTGTTCTGGCTGATGTCCTT ?-actin CATCACCATCGGCAACGA TTCCTGATGTCCACGTCGC Wound Healing Assay The TE671 or TE671-hFTSJ2 cells were grown in 60-mm dishes to 90% confluence. Then a wound was produced by scraping the cell monolayer with a sterile P200 pipette tip. During the wound healing process time-lapse images were obtained every 10 min for 12 hours and the cell migration area was calculated ([healing area/wounding area]—100%) using the ImageJ program (http://rsbweb.nih.gov/ij/index.html). Invasion Assay The invasion assay was performed on the TE671 and TE671-hFTSJ2 cells using Trans-well chambers with an 8-µm pore size (Merck Millipore Darmstadt Germany). The upper chamber of the Trans-well was pre-coated with Geltrex matrix gel (30 µL/well) (Invitrogen Corp. Grand Island NY USA) and inserted into the lower chamber which contained DMEM with 10% FBS. The cells (1—104) were suspended in 200 µL of DMEM and added to the upper chamber. After 12 hours the cells on the upper surface of the membrane were removed with a cotton swab and the cells on the lower surface of the membrane were fixed with methanol for 10 min and subjected to Giemsa staining. The Giemsa-positive area of the membrane was calculated ([Giemsa positive area/total area]—100%) using the ImageJ program. Statistical Analysis All of the data are presented as the means±standard error (SE). The statistical comparisons were performed using Student™s t-test. The Duncan method of one-way ANOVA was used for multiple group comparisons. The P<0.05 or P<0.01 level was considered significant. Results FTSJ2 is Closely Related to E. coli RrmJ RrmJ is a 23S rRNA 2?-O-ribose MTase and is conserved in nearly all of the different species. To evaluate the relationship among the RrmJ homologs a phylogenic tree with 39 RrmJ homologs was constructed. The NCBI BLASTp program was used to identify the homologs of the E. coli RrmJ protein in M. jannaschii S. cerevisiae Caenorhabditis elegans Drosophila melanogaster and in vertebrates. Using the minimum evolution method the phylogenic tree showed the following three phylogenies: FTSJ1/Trm7p FTSJ2/Mrm2p and FTSJ3/Spb1p (). Using the JTT model to calculate the protein distances and comparing these distances within each phylogeny the protein distances within the FTSJ2/Mrm2p group were found to be larger than those within the FTSJ1/Trm7p and FTSJ3/Spb1p groups indicating that the RrmJ homologs FTSJ1 and FTSJ3 are more conserved between species than FTSJ2. However the distance between E. coli RrmJ and the root of the FTSJ2/Mrm2p group (distance: 0.84) was shorter than the roots of the FTSJ1/Trm7p and FTSJ3/Spb1p groups (distance: 1.25 and 1.28) suggesting that the FTSJ2/Mrm2p proteins are the most related to E. coli RrmJ and are presumed to be the orthologs of RrmJ. This assumption is supported by the known function of S. cerevisiae Mrm2p. Mrm2p catalyzes the methylation of 2?-O-ribose in the mitochondrial 21S rRNA [12] which has the same rRNA structure as the substrate of RrmJ. .0090818.g001 Phylogenetic tree of the E. coli RrmJ homologs from Eubacteria to Mammalia. This phylogenetic analysis represents the following three major homolog protein lineages: FTSJ1/Trm7p FTSJ2/Mrm2p and FTSJ3/Spb1p. The out-groups of the tree were catechol-O- methyltransferase VP39 and fibrillarin (PDB code 1VID 1AV6 and 1FBN respectively). These out-groups were chosen because of their similar functions and structures to E. coli RrmJ. The number at each branch node indicates the reliability of the splits (%) through the processing of 1000 bootstrap replicates. The GenBank accession numbers and species are shown for each protein. [F] and [S] denote proteins with known functions and protein structures respectively. The Protein Structures of the FTSJ2 Orthologs are Similar to that of E. coli RrmJ The protein sequence alignment of E. coli RrmJ M. jannaschii FtsJ S. cerevisiae Mrm2p and other FTSJ2 orthologs showed many similarities. The K50 D124 K164 and E199 residues which compose the catalytic center of RrmJ were present in all of the RrmJ orthologs. Furthermore the 19 residues involved in S-adenosylmethionine (S-AdoMet SAM) binding in RrmJ were also highly conserved in FTSJ2 (). A comparison of the similarity of the full-length amino acid sequences of human FTSJ2 with E. coli RrmJ S. cerevisiae Mrm2p and porcine FTSJ2 which represented the Eubacteria Eukaryota and Mammalia homologs respectively showed that the E-values (and amino acid identities) were 3e-43 (35%) 3e-33 (29%) and 7e-140 (76%) respectively. .0090818.g002 Protein sequence alignment of E. coli RrmJ with its FTSJ2 orthologs in 7 different species. The ?-helices and ?-strands were based on the RrmJ protein structure (PDB code: 1EIZ). The stars and triangles indicate the K-D-K-E catalytic center and the SAM binding residues in RrmJ respectively. The residues with identical and similar chemical properties are highlighted in black and gray respectively. In addition a comparison of the two published three-dimensional protein structures of E. coli RrmJ and human FTSJ2 and a predicted structure of porcine FTSJ2 showed that these structures contain five ?-helixes and seven ?-strands that compose an open-sheet structure. The positions of the SAM binding residues and the amino acids of the catalytic center showed similar arrangements in the protein structures. Notably the first residue of the catalytic center lysine (K50 in RrmJ) showed an approximately 120° rotation in human FTSJ2 (PDB code: 2NYU) [36] compared with E. coli RrmJ (Figure S1). This rotation may account for the different structures of the rRNA substrates of the E. coli and the human proteins. FTSJ2 is Localized in the Mitochondria of Human Cells Mrm2p the FTSJ2 ortholog in S. cerevisiae is located in the mitochondria and is responsible for the 2?-O-ribose methylation of the 21S rRNA. Thus we detected the subcellular localization of the FTSJ2 protein in the human cell lines. A vector for the overexpression of hFTSJ2 driven by the CMV promoter was constructed (pCMV-hFTSJ2-IRES2-DsRed2; A). The rhabdomyosarcoma (TE671) and hepatocarcinoma (HepG2) cell lines were transfected with the pCMV-hFTSJ2-IRES2-DsRed2 vector and the expression of the hFTSJ2 protein was detected by Western blot analysis. The results showed that the TE671-hFTSJ2 and HepG2-hFTSJ2 cells had higher expression levels of hFTSJ2 than the non-transfected cells (B). Immunofluorescence showed that most of the hFTSJ2 protein was located in the cytoplasm but not in the nuclei in both the TE671-hFTSJ2 and HepG2-hFTSJ2 cells and the mitochondria which were stained with MitoTracker Red showed the same localization as hFTSJ2 (C). In the analysis of the mitochondrial and cytosolic protein fractions hFTSJ2 was detected in the mitochondrial protein fraction but not in the cytosolic fraction (D). These results indicated that human FTSJ2 as its ortholog in S. cerevisiae is a mitochondrial protein. .0090818.g003 Subcellular localization of human FTSJ2 in TE671 and HepG2 cells. (A) Schematic of the hFTSJ2 over-expression vector. (B) Over-expression of the hFTSJ2 protein in the TE671-hFTSJ2 and HepG2-hFTSJ2 stable clones. (C) Immunofluorescence staining with anti-hFTSJ2 (green) MitoTracker for mitochondria (red) and DAPI for nuclei (blue) in the TE671-hFTSJ2 and HepG2-hFTSJ2 cells. (D) Mitochondrial localization of the hFTSJ2 protein in non-transfected TE671 cells. VDAC and MEK-1 were used as the mitochondrial and cytosolic fraction controls respectively in the Western blot analysis. Ftsj2 mRNA is Expressed in all of the Porcine Tissues but at Different Levels Because of the higher similarity between human and porcine FTSJ2 (amino acid identity?=?76% and RrmJ domain identity?=?81%; ) and the similar physiological responses of humans and pigs we further analyzed the expression of the porcine Ftsj2 gene and sequenced the coding region of the porcine Ftsj2 mRNA (GenBank accession number: EU694400). Then 13 tissues from a female piglet were analyzed for the expression of porcine Ftsj2 mRNA by RT-PCR. The results showed that all of the 13 tissues expressed Ftsj2 mRNA at different levels. The heart and kidney showed the highest expression; the large intestine muscle lung spleen and liver showed mid-level expression; and the small intestine ovary brain stomach mammary gland and bladder showed the lowest expression (Figure S2). The Level of Ftsj2 mRNA Expression Increases in Several Tissues after Heat Shock Stress Previous studies have shown that the mRNA of E. coli rrmJ increased nearly 20-folds under heat shock stress [3] and was involved in the thermal adaptation of E. coli [7]. Thus the heat shock protein characteristics of mammalian FTSJ2 were also evaluated in piglets which are known to be thermally sensitive in the livestock industry. Three-month-old female piglets were raised at room temperature (25°C) and to produce enough heat shock stress in the warm-blooded piglets temperatures of 30°C or 35°C were used to stimulate the heat shock response for at least 1 week. The porcine Ftsj2 mRNA expression in 11 tissues from these piglets was detected and Hsp70.2 mRNA expression was used as the heat shock response positive control (Figures 4A and 4B). The results showed that Ftsj2 mRNA expression was up-regulated in the large intestine stomach lung and bladder and down-regulated in the small intestine muscle heart mammary gland kidney spleen and liver in the 30°C and 35°C environments (Figure 4A). Notably the only tissue that showed an up-regulation of both Ftsj2 mRNA expression and Hsp70.2 mRNA expression which corresponds to a positive heat shock response was the lung (Figure 4B). "
Lung_Cancer
"As one of the DNA repair genes ataxia-telangiectasia mutated (ATM) gene which is responsible for the multisystem autoxomal recessive disorder ataxia-telangiectasia (A“T) plays a crucial role in the recognition signaling and repair of DNA damage especially DNA double-strand breaks (DSBs) [4] [5]. The ATM protein is a member of phosphoinositide 3-kinase (PI-3 kinases) and can be activated by DSBs caused by ionizing radiation or reactive oxygen intermediates [6] [7]. Once activated ATM can phosphorylate various downstream substates that function in cell cycle arrest apoptosis and DNA repair such as p53 NBS1 BRCA1 and Chk2 [8] [9]. Therefore genetic variants in ATM gene may lead to the structure and function change of the protein and act as important factors indicating individual susceptibility to cancer. ATM -111G>A (rs189037) resides in the promoter of ATM gene. Increasing studies have shown that variations in the DNA promoter sequence may potentially alter the affinities of multiple regulatory proteins-DNA interactions or the specificity of the transcriptional process [10]“[13]. Although this polymorphism makes no amino acid change the alleles may have different binding affinity to the transcription factor and exhibit different levels of mRNA expression [14] [15]. Zhang et al. [16]declared that ATM rs189037 AA genotype was associated with a lower ATM mRNA levels than GG genotype in lung tissue samples. Their results showed that the G-to-A change might create a transcriptional inhibitor-binding site for ATM rs189037 A allele promoter and subsequently reduce the ATM mRNA expression. Consequently lower expression of ATM might cause elevated sensitivity to ionizing radiation defects in the activation of cell cycle checkpoints a reduced capacity for DNA repair and abnormal apoptosis. All of these features would contribute to increased individual cancer susceptibility. In recent years a number of studies have evaluated the association between this polymorphism and cancer risk such as thyroid carcinoma [17] oral cancer [18] breast cancer [19] leukemia [20] nasopharyngeal carcinoma [21] glioma [22] and lung caner [23]“[25]. Previous studies of ATM rs189037 have included cigarette smokers as cases and controls that made it difficult to judge whether this polymorphism were associated with lung cancer or tobacco use. Considering the facts in China the incidence and death rate of lung cancer in women continues to increase and this phenomenon is frequently occurring in those who have never smoked. In order to have a better control of confounding of gender or smoking we performed a case-control study to identify the association between the polymorphism of ATM rs189037 and the risk of lung cancer in the non-smoking females in Chinese Han population. We also investigated the interaction between genetic polymorphism and environmental exposure in lung cancer. Methods Subjects This hospital-based case-control study included 487 lung cancer patients and 516 cancer-free hospital controls. All subjects were female non-smokers and they were from unrelated ethic Han Chinese. The cases were recruited during January 2002 to November 2012 at Liaoning Cancer Hospital & Institute. All patients were histologically confirmed to have lung cancer before any radiotherapy and chemotherapy. During the same time controls were selected from patients with other lung diseases but free of cancer history and symptom. Controls suffered mainly from bronchitis pneumonias fibrosis sarcoidosis chronic obstructive pulmonary disease and emphysema. Controls were all non-smoking females and frequency-matched to case subjects for age (±5 years). This study was approved by the institutional review board of China Medical University and written informed consent was obtained from each participant or each participant's representatives if direct consent could not be obtained. Data Collection A total of 10 ml of venous blood was collected from each patient. Patients were interviewed to collect information for demographics and environmental exposure at the time they were admitted to hospital. Information concerning demographic characteristics passive smoking cooking oil fume exposure fuel smoke exposure family history of cancer occupational exposure and dietary habit was obtained for each case and control by trained interviewers. An individual was defined as a smoker if she had consumed a total of 100 cigarettes in her lifetime; otherwise she was considered as a non-smoker. About fuel smoke exposure participants who used coal-fuel-burning stoves without chimneys were regarded as fuel smoke exposure. For exposure to cooking oil fumes participants were mainly asked about the method of cooking and eyes or throat irritation. For cooking methods participants were asked whether they cooked food in a stir-frying way and how many times a week; for eyes or throat irritation participants were asked how often they felt eyes or throat irritated by the oily smoke. There were four possible responses ranging from œnever œseldom œsometimes and œfrequently. Subjects were considered as cooking oil fume exposure if they met criteria as follows: (1) have cooked for over 15 years; (2) cooked food in a stir-frying way for more than twice a week; (3) felt eyes or throat irritated by oily smoke. Exposure for cooking oil fume was categorized as an indicator variable equal to 1 if participants reported frequently or sometimes and equal to 0 otherwise. Genotype Analysis Genomic DNA was extracted from peripheral blood samples by the conventional phenol-chloroform extraction method. SNP was genotyped by investigators blinded to case-control status in order to avoid any genotyping bias using TaqMan methodology and read with the Sequence Detection Software on an Applied Biosystems 7500 FAST Real-Time PCR System according to the manufacturer's instructions (Applied Biosystems Foster City CA). Amplification was done under the following conditions: 95°C for 10 min followed by 47 cycles of 92°C for 30 s and 60°C for 1 min. In this study 487 lung cancer patients and 516 controls were all genotyped successfully and 5% duplicated samples were randomly selected to assess the reproducibility for quality control with a concordance rate of 100%. Statistical Analysis The x2 test and t test were applied to estimate differences in demographic variables and distributions of genotypes between cases and controls. The association of genotypes of ATM rs189037 with risk of lung cancer was estimated by computing the odds ratios (ORs) and 95% confidence intervals (CIs) in unconditional logistic regression analysis. The Hardy-Weinberg equilibrium (HWE) was tested using goodness-fit x2 test to compare the genotype frequencies in the control subjects from those expected. A logistic regression model was used to evaluate gene-environment interactions. All data were analyzed with Statistical Product and Service Solutions (SPSS) v13.0 for Windows if not otherwise specified. All statistical analysis were two-sided and the significance level was set at P<0.05. Results Population characteristics A total of 487 lung cancer and 516 age-matched cancer-free controls were enrolled in this study. As shown in the mean ages of cases and controls (mean ±S.D.) were almost identical (56.5±11.7 and 56.3±12.5 respectively). All cases were female non-smoking lung cancer patients. No statistically significant difference was found between cases and controls in terms of age (P?=?0.248) and monthly income (P?=?0.084). Cases included 434 non-small cell lung cancer (NSCLC) patients and 53 small cell carcinoma patients. In the NSCLC cases there were 320 adenocarcinomas 73 squamous cell carcinomas and 41 other tumors with a variety of different pathologies (such as large cell carcinomas mixed cell carcinomas or undifferentiated carcinomas). .0096911.t001 Characteristics of lung cancer cases and controls. Variables Cases(%) Controls(%) P value Female 487 516 Mean age (years) 56.5±11.7 56.3±12.5 0.248a Income (yuan/month) 628.9±419.3 563.5±387.6 0.084a Never smoker 487 516 Histological type NSCLC 434(89.1) Adenocarcinoma 320(65.7) Squamous cell carcinoma 73(15.0) Small cell carcinoma 53(10.9) Other 41(8.4) a Student's t-test was used to compare the frequency distributions of demographic variables between the cases and controls. Association analysis The observed genotype frequencies among the control subjects was in agreement with that expected under the Hardy-Weinberg equilibrium (P?=?0.119). The distribution of ATM rs189037 genotypes among subjects were displayed in Table 2. Using subjects with the ATM rs189037 GG genotype as the reference group we calculated the ORs and 95%CIs for heterozygous carriers of GA genotype and homozygous carriers of AA genotype. No significant difference was observed between lung cancer cases and controls in each test (P>0.05). In order to increase the statistical power we combined the GA genotype with the AA genotype to compare with GG genotype as a dominant model and combined the GA genotype with the GG genotype to compare with AA genotype as a recessive model. The results indicated that individuals with AA genotype had a significantly elevated risk of lung adenocarcinoma compared with those carrying the GG or GA genotype (OR?=?1.44 95%CI 1.02“2.02 P?=?0.039). .0096911.t002 Table 2 Distribution of ATM rs189037 genotypes and ORs for lung cancer cases and controls. Genotype Cases(%) Controls(%) ORc 95%CI P overall (n?=?487) GG 148(30.4) 152(29.5) ref GA 240(49.3) 272(52.7) 0.91 0.68“1.20 0.494 AA 99(20.3) 92(17.8) 1.11 0.77“1.59 0.590 dominant modela 0.96 0.73“1.25 0.742 recessive modelb 1.18 0.86“1.61 0.313 NSCLC (n?=?434) GG 129(29.7) 152(29.5) ref GA 213(49.1) 272(52.7) 0.92 0.68“1.24 0.573 AA 92(21.2) 92(17.8) 1.18 0.81“1.71 0.397 dominant model 0.98 0.74“1.30 0.906 recessive model 1.24 0.90“1.71 0.192 Adenocarcinoma (n?=?320) GG 94(29.4) 152(29.5) ref GA 150(46.9) 272(52.7) 0.89 0.64“1.23 0.485 AA 76(23.7) 92(17.8) 1.33 0.90“1.99 0.156 dominant model 1.00 0.74“1.36 0.987 recessive model 1.44 1.02“2.02 0.039* Squamous cell carcinoma (n?=?73) GG 24(32.9) 152(29.5) ref GA 39(53.4) 272(52.7) 0.90 0.52“1.56 0.706 AA 10(13.7) 92(17.8) 0.69 0.32“1.51 0.355 dominant model 0.85 0.50“1.43 0.537 recessive model 0.74 0.37“1.50 0.400 *P<0.05. a GA+AA vs GG. b AA vs GA+GG. c adjusted for age and data were calculated by unconditional logistic regression. According to the results above we assumed that ATM rs189037 AA genotype might affect lung adenocarcinoma risk among non-smoking Chinese females. To test this hypothesis and explore the gene-environment interaction we adopted all the lung adenocarcinoma patients and cancer-free controls whose information about environmental risk factors were completely obtained such as fuel smoke exposure cooking oil fume exposure passive smoking and family history of cancer. Cases and controls were not included in the association analysis if any item of their environmental risk factors data was incomplete. After screening we had 242 lung adenocarcinoma cases and 277 cancer-free controls that were eligible. Selected demographic variables and environmental risk factors for the cases and controls were listed in Table 3."
Lung_Cancer
"IGFBP3 is known to block IGF-1 induced activation of IGF-1R1617. Overall these studies show that the IGF-1R signaling pathway is activated by multiple mechanisms in H3122 XR cells. We evaluated the effects of IGF-1R inhibition in ALK TKI resistant cells. The combination of X-376 with either MAb391 or OSI-906 (Fig. 4de) partially restored X-376 sensitivity in H3122 XR cells. Apoptosis was also enhanced in H3122 XR cells treated with X-376 and the IGF-1R TKI AEW-54118 (Fig. 4f). In accord with these data combination treatment with ALK and IGF-1R inhibitors in H3122 XR cells inhibited AKT phosphorylation to a greater extent than either inhibitor alone (Fig. 4g). The addition of OSI-906 also partially restored the sensitivity of H3122 CR cells to the growth inhibitory effects of crizotinib (Supplementary Fig. 4c). Since IRS-1 levels were increased in H3122 XR cells (Fig. 4c) we examined whether IRS-1 knock-down would also affect signaling and proliferation in the resistant cells (Fig. 4hi). We transfected H3122 XR cells with IRS-1 or control siRNAs and then treated cells with X-376. IRS-1 knockdown sensitized these cells to the anti-proliferative effects of ALK inhibition (Fig. 4h) and resulted in a further decline in phosphorylation of downstream targets compared to X-376 alone or IRS-1 knockdown alone (Fig. 4i). Previous studies have suggested that the IGF-1R pathway can drive EGFR inhibitor resistance1920. We tested the efficacy of combined EGFR/IGF-1R inhibition in 4 different isogenic pairs of EGFR TKI- sensitive and -resistant cell lines2122 (Supplementary ). The addition of the IGF-1R TKI OSI-906 was not synergistic with the EGFR TKI erlotinib in any of these cells (Supplementary Fig. 5a“d). Furthermore in contrast to the ALK TKI-resistant cells there was no increase in IGF-1R or IRS-1 in the EGFR TKI-resistant cell lines (Supplementary Fig. 5e). These data suggest that the effects seen with the ALK/IGF-1R inhibitor combinations in the ALK cell lines are true differences. Increased IGF-1R in tumor samples at the time of resistance To validate the clinical implications of our in vitro findings we evaluated phospho-IGF-1R (pIGF-1R) and IRS-1 levels in patient tumor biopsy samples. Three sets of paired pre-/post-crizotinib tumor samples as well as two post-crizotinib tumor samples from five different patients were examined by immunohistochemistry (IHC) for pIGF-1R and blindly evaluated by pathologists. As a control we also performed pIGF-1R IHC on lung cancer tissue microarrays (TMAs); representative examples are shown in Supplementary Fig. 6a“c. Four of five tumor biopsies taken at the time of acquired resistance displayed increased levels of pIGF-1R (Fig. 5a patients 1“4). For two of the paired tumor samples we had sufficient tissue to examine IRS-1 levels by IHC (Fig. 5b); one post-treatment sample (patient 2) had increased IRS-1 expression. These five samples were also assessed for ALK kinase domain mutations associated with crizotinib resistance (Supplementary ). Patient 4's post-crizotinib tumor harbored an ALK G1202R mutation. As an orthogonal approach we performed mRNA expression analysis for IGF-1R and IRS-1 using Nanostring23 on matched patient samples and on isogenic pairs of ALK TKI-sensitive and resistant cell lines. In the one case with enough pre- and post-treatment tissue for available for analysis IGF-1R and IRS-1 (Fig. 5cd) mRNA levels were increased in the post-crizotinib relative to the pre-crizotinib tumor sample. Similar results were obtained with the cell lines. In contrast Nanostring analysis of 11 matched pairs of EGFR mutant lung tumor biopsies revealed no significant change in IRS-1 levels post EGFR TKI therapy (Supplementary Fig. 6d“f) suggesting that the changes observed in IRS-1 were specific to ALK+ lung cancer. Overall these data validate our pre-clinical findings showing that levels of IGF-1R and IRS-1 can be increased post ALK TKI therapy in patient-derived samples. LDK-378 inhibits phosphorylation of ALK and IGF-1R in vitro The second-generation ALK TKI LDK-378 (ceritinib) has demonstrated a 56% ORR in patients with ALK+ lung cancer who have progressed on crizotinib24. Yet only a minority of patients had ALK alterations suggesting the possibility of alternative ˜bypass™ mechanisms which are sensitive to LDK-378. Interestingly LDK-378 and the structurally related ALK inhibitor TAE-684 can inhibit both ALK and IGF-1R in vitro25. We hypothesized that the efficacy of LDK-378 may be due to this drug's ability to simultaneously block both ALK and IGF-1R. LDK-378 was more potent than crizotinib in H3122 (Fig. 6a) STE-1 (Supplementary Fig. 7a) and H3122 XR cells (Supplementary Fig. 7b). LDK-378 was also more potent at inducing apoptosis in H3122 cells (Supplementary Fig. 7c). Furthermore LDK-378 was significantly more effective at delaying the growth of H3122 xenografts compared to the equivalent dose crizotinib (Fig. 6b). Next we tested LDK-378's ability to inhibit IGF-1R phosphorylation. H3122 (Fig. 6c) and H2228 (Fig. 6d) cells were treated with LDK-378 alone or in combination with IGF-1. Importantly LDK-378 treatment inhibited ALK phosphorylation and was also able to overcome the IGF-1 ligand induced increase in IGF-1R phosphorylation in both ALK+ cell lines (Figures 6cd compare lanes 4 and 6). These data suggest that LDK-378's potency in vivo may be due to this agent's combined ability to block both ALK and IGF-1R. Discussion We report that ALK and IGF-1R inhibitors have cooperative anti-proliferative effects. IGF-1R inhibitors sensitized tumor cells to the effects of ALK inhibition. The therapeutic synergism between ALK and IGF-1R inhibitors was observed in both the ALK TKI-sensitive and ALK TKI-resistant settings. Chronic ALK inhibition was associated with enhanced IGF-1R signaling. The ALK TKI resistant cells utilized numerous mechanisms to activate IGF-1R signaling. Importantly the addition of an IGF-1R inhibitor sensitized the resistant cells to the effects of ALK blockade. We propose drug combinations co-targeting ALK and IGF-1R as a novel therapeutic approach in patients with ALK+ lung cancer. This rationally selected combination of targeted therapies should be effective in both the ALK TKI-na¯ve and TKI-resistant setting. Our data may also in part explain the surprising 56% ORR for the ˜second generation™ ALK TKI LDK-378 in patients with ALK+ lung cancer who had progressed on crizotinib24. Since responses to LDK-378 were observed in both patients with and without ˜second-site™ ALK mutations the increased ˜on-target™ potency of LDK-378 towards ALK is alone not enough to explain all of the responses seen to this agent. We hypothesize that the potency of this agent is due to its ability to simultaneously inhibit both ALK and IGF-1R and our in vitro experiments confirm that LDK-378 does inhibit phosphorylation of both ALK and IGF-1R. Further studies will be necessary to validate this hypothesis in clinical samples. Mechanisms of acquired resistance to ALK inhibitors are just beginning to be understood. Target alterations have only been found in a minority of resistant tumors examined to date. ˜Bypass™ signaling has also been reported3-6. Interestingly target alterations and bypass signaling do not appear to be mutually exclusive."
Lung_Cancer
" In short EGFR activating mutations in exons 19 and 21 were initially identified by Sanger sequencing and confirmed by fragment length analysis for exon 19 deletions (FAM-labelled primer in an ABI prism 3130 DNA analyser (Applied Biosystems Foster City CA USA) and by Taqman assay for exon 21 (L858R) mutation. All tumor specimens were from the original biopsy taken prior to any treatment and before randomization. Testing was performed on ? 2mm2 of tissue obtained from one to three slides of 4-micron tissue sections which were subjected to laser capture microdissection to enrich for the presence of tumor cells. DNA was extracted using a standard laboratory protocol and tested at a single site in Spain in Laboratory of Oncology for EGFR activating mutations in exon 19 and 21 using a previously described method. The average turnaround time was approximately 5 days.[26] Bi-directional Sanger sequencing All samples tested by the EGFR PCR test were also tested by Sanger sequencing using DNA from FFPET specimens prepared by the cobas DNA Sample Preparation Kit and sequenced with 2— bidirectional Sanger sequencing by a CLIA-certified laboratory (SeqWright Houston TX USA) using a validated protocol. Repeat Sanger sequencing was performed to compare the detection of EGFR mutations from adjacent sections of tissue to minimize any impact of tissue heterogeneity used for the EGFR PCR test relative to the original LDT results. Also sequencing protocols vary by laboratory in terms of the percent tumor content/sample that requires macrodissection. DNA isolated with the cobas DNA Sample Preparation Kit and used for sequencing required ?10% tumor content. Average turnaround time to results was 7 days. The estimated limit of detection is approximately 20% mutant alleles.[30] Massively parallel pyrosequencing (MPP) Samples with valid EGFR PCR test results with adequate DNA remaining from the initial extraction were tested by a MPP method (454 GS Titanium 454 Life Sciences Branford CT USA) by a CLIA-certified laboratory (SeqWright Houston TX USA) using a validated protocol.[31] This method is a 5“7 day process that involves amplicon generation pooling ligation emulsion PCR amplification and massively parallel pyrosequencing with manual data analysis. The estimated limit of detection for the assay is 1.25% mutant alleles. [27] The MPP method was used to demonstrate performance of the EGFR PCR test to a more sensitive method and as an arbiter for discrepant cases observed between the LDT or the repeat Sanger sequencing. In order to preserve patient privacy associated with tested clinical samples raw MPP sequencing results were anonymized and presented in Table S1. Results Specimen demographics 487 (47%) of 1044 specimens screened for the EURTAC trial using LDTs were available for testing using the EGFR PCR test. The flow of samples through the study is shown in . Patient demographics and baseline tumor characteristics for all patients by LDT status are shown in . There were no significant differences between subsets of patients tested and patients not tested by the EGFR PCR test (p>0.05) for each LDT status (mutation detected mutation not detected) with the exception of country of the screening clinic. Clinical outcomes for patients based on the EGFR PCR test results Of the 174 patients enrolled in EURTAC trial specimens from 134 (77%) patients were available for testing using the EGFR PCR test. Excluding 11 patients with invalid EGFR PCR test results and 7 patients with a result of EGFR mutation not detected a total of 116 (67%) patients were mutation detected by the EGFR PCR test and evaluable for clinical outcome analysis (57 patients in the chemotherapy arm and 59 in the erlotinib arm). Clinical outcomes (PFS BORR and OS) are presented in . Among EGFR PCR test positive patients those treated with erlotinib had a significantly prolonged PFS when compared to patients treated with chemotherapy (p-value <0.0001 log-rank test); the median PFS was 10.4 months (95% CI: 8.0 to 13.8 months) and 5.4 months (95% CI: 4.4 to 6.8 months) for patients treated with erlotinib or chemotherapy respectively (). The HR based on the Cox proportional hazards model was reduced by 66% (HR 0.34; [95% CI: 0.21 to 0.54]) for patients in the erlotinib versus chemotherapy arm. One year after randomization a higher percentage of patients in the erlotinib compared with the chemotherapy arm were event-free (45% [95% CI: 32% to 59% versus 6% [95% CI: 0% to 15%] respectively). .0089518.g002 Kaplan-Meier curves of progression-free survival (PFS) for different treatments in treatment-na¯ve patients with non“small-cell lung cancer and EGFR mutation detected by the EGFR PCR test and LDT. .0089518.t002 Summary of Clinical Outcome Analysis among EGFR PCR test positive patients in the EURTAC trial. Chemotherapy (N?=?57) Erlotinib (N?=?59) PFS (Investigator) Patients with event 37 (64.9%) 47 (79.7%) Patients without eventa 20 (35.1%) 12 (20.3%) ?Time to event (months) ?Medianb (95%CI) 5.4 [4.4; 6.8] 10.4 [8.0; 13.8] ?p-Value (Log-Rank Test) <0.0001 ?Hazard Ratio (95% CI) 0.34 [0.21; 0.54] ?1 year estimate ?Patients remaining at risk 2 24 ?Event-free Rateb (95%CI) 6% [0%; 15%] 45% [32%; 59%] Best Overall Analysis Response rates (95% CI) 14.0% [ 6.3%; 25.8%] 59.3%[ 45.7%; 71.9%] Difference in Response Rates (%) 45.29% [ 28.8%; 61.7%] ?p-Value (Chi-squared Test) <.0001 Odds Ratio (95% CI) 8.93 [3.59; 22.19] OS Patients with event 35 (61.4%) 36 (61.0%) Patients without eventa 22 (38.6%) 23 (39.0%) ?Time to event (months) ?Medianb (95%CI) 20.8 [17.3; 29.4] 25.8 [16.1; 30.0] ?p-Value (Log-Rank Test) 0.5381 ?Hazard Ratio (95% CI) 0.86 [0.54; 1.38] ?2 - year estimate ?Patients remaining at risk 16 23 ?Event-free Rateb (95% CI) 43% [29%; 57%] 51% [38%; 64%] Note: All eligible patients enrolled in study ML20650 were determined as EGFR mutation detected by the LDT. Among those patients with EGFR mutation confirmed by the EGFR PCR test were included in this table. Event ?=? Death or progression free whichever comes first for PFS analysis and event?=?death for OS analysis. a censored. b Kaplan-Meier estimates. C including censored observations. BORR were higher in patients in the erlotinib arm (59.3% [95% CI: 45.7% to 71.9%]) compared to the chemotherapy arm (14.0% [95% CI: 6.3% to 25.8%]). Patients in the erlotinib arm were much more likely to respond to therapy than patients in the chemotherapy arm (odds ratio of 8.93 [95% CI: 3.59 to 22.19]). There was no significant difference in OS between the treatment arms (25.8 months in the erlotinib arm (95% CI: 16.1 to 30.0) and 20.8 months in the chemotherapy arm (95% CI: 17.3 to 29.4) (log-rank test p-value ?=?0.5381)). PFS BORR and OS results for EGFR PCR test positive patients did not differ significantly from those obtained in all patients enrolled in the EURTAC trial which suggests that the EGFR PCR test positive patients are representative of all EURTAC enrolled patients. For the 7 cases where the EGFR PCR test result was mutation not detected and discrepant with the LDT two cases resolved in favor of the LDT by MPP three cases resolved in favor of the EGFR PCR test and one sample was invalid for both Sanger and MPP and the other was in agreement between the EGFR PCR test and Sanger but not MPP (Table S2). Anecdotally 6 of the 7 patients were treated with erlotinib and only one patient achieved greater than or equal to median PFS based on the LDT or the EGFR PCR test. Comparison of EGFR PCR test and LDT results Among 432 specimens with valid results from both the EGFR PCR test and LDT the PPA NPA and OPA were 94.2% (146/155 CI: 89.3% 96.9%) 97.5% (270/277 CI: 94.9% 98.8%) and 96.3% (416/432 CI: 94.1% 97.7%) respectively (). Thus there was a high concordance between the original LDT and EGFR PCR test results. Among sixteen specimens with discordant results the EGFR PCR test result was confirmed by MPP in 68.8% (11/16) cases (Table S3). .0089518.t003 Agreement analysis between EGFR PCR test and LDT. SLCG LDT Total N?=?432 Mutation detected Mutation not detected EGFR PCR test Mutation detected 146 7 153 Mutation not detected 9 270 279 Total 155 277 432* ¢12 samples with inconclusive LDT results and 43 samples with invalid EGFR PCR test results were excluded. Positive percent agreement ?=?94.2% (95% CI [89.3“96.9%]). Negative percent agreement ?=?97.5% (95% CI [94.9“98.8%]). Overall percent agreement ?=?96.3% (95% CI [94.1“97.7%]). Comparison of the EGFR PCR test results with Sanger Sequencing Of 487 specimens tested using the EGFR PCR test and Sanger sequencing 406 gave valid results by both methods (38 were invalid by both methods five were invalid by EGFR PCR test and 38 were invalid by Sanger sequencing). The PPA NPA and OPA for EGFR PCR test compared with Sanger sequencing were 96.6% (112/116 CI: 91.7% 98.7%) 88.3% (256/290 CI: 84.1% 91.5%) and 90.6% (368/406 CI: 87.4% 93.1%; Table 4) respectively. Among 38 discordant results between the EGFR PCR test and Sanger sequencing MPP agreed with the EGFR PCR test result in 30 (78.9%) cases (Table S4). Sanger sequencing detected one L858R not detected by MPP and failed to detect 22 exon 19 deletions and 7 L858R mutations confirmed by MPP. Four MPP results were invalid and the remaining four results agreed with Sanger. The range of percent mutant alleles of the cases missed by Sanger was 3% to 60% with several specimens (n?=?16) under the estimated limit of detection for Sanger. .0089518.t004 Table 4 Agreement analysis between EGFR PCR test and Sanger sequencing. Sanger sequencing Total N?=?406 Mutation detected Mutation not detected EGFR PCR test Mutation detected 112 34 146 Mutation not detected 4 256 260 Total 116 290 406 *81 samples with invalid EGFR PCR test or Sanger sequencing results were excluded. Positive percent agreement ?=?96.6% (95% CI [91.5“98.7%]). Negative percent agreement ?=?88.3% (95% CI [84.1“91.5%]). Overall percent agreement ?=?90.6% (95% CI [87.4“93.1%]). Discussion This study supports the feasibility of performing a retrospective clinical validation of a companion diagnostic from prospective therapeutic clinical trials. The EGFR PCR test results were highly concordant (>96%) with the LDT results used to select patients for the EURTAC trial. As a consequence PFS and BORR of the subset of patients with EGFR mutations detected with the EGFR PCR test were comparable to the full cohort of patients enrolled in the EURTAC trial thus validating the use of the EGFR PCR test to select patients for treatment with anti-EGFR TKIs such as erlotinib. Median PFS survival was 9.7 versus 10.4 months for the erlotinib group and 5.2 versus 5.4 months for the LDTs and EGFR PCR test respectively. The BORR was 58% versus 59.3% months for the erlotinib group and 15% versus 14.0% for the LDTs and EGFR PCR test respectively. Among the 16 discordant specimens between the EGFR PCR test and LDTs a third mutation testing method agreed with the EGFR PCR test result in 11 cases. Of seven cases that were mutation detected by the EGFR PCR test and mutation not detected by the LDT 5 were confirmed by MPP. These patients could have potentially benefited from anti-EGFR TKI therapy. The EGFR PCR test had a number of technical advantages over the LDT used in the EURTAC trial. The LDT required laser capture microdissection of multiple tissue sections and involved 3 separate assays with a median turnaround time of 4.5 days. By comparison the EGFR PCR test required macrodissection only if the tumor content was <10% and can be performed in one day using a single 5 µm section. Furthermore the EGFR PCR test is a commercially available kit-based assay that provides an automated result rather than a manual process subject to interpretation and which can be performed by any qualified clinical laboratory. More than 80% of the specimens tested in this study were small biopsy specimens. The overall invalid rate for Sanger sequencing was 15.6% (76/487) compared to the EGFR PCR assay at 9% (43/487). However the invalid rate for the subset of specimens derived from resected specimens was 0% (0/109) likely because of sufficient tissue availability. Thus the assay is extremely robust when performed on resected tumor specimens and has an approximately 90% success rate on biopsy specimens which are often the only tumor sample available for testing in NSCLC. Sanger sequencing has been widely used to detect EGFR mutations.[30] [32] Similar to the overall invalid rates for the 134 EGFR mutation detected LDT samples enrolled in the EURTAC trial Sanger sequencing had a higher invalid rate (15.7%) compared to 8.2% for the EGFR PCR test. There were also 30 mutation not detected results for Sanger sequencing (22.4%) and 7 mutation not detected results for the EGFR PCR test (5.2%). With 21 invalid results and 30 mutation not detected results Sanger sequencing would have misclassified 38% of patients enrolled in the EURTAC trial. Similar invalid rates have been reported in three other studies suggesting that this methodology has limitations when applied to DNA from FFPET samples.[33] [34] [35] In addition Sanger sequencing has shown poor sensitivity in samples containing less than 20“25% mutant alleles.[35] [36] [37] When we compared the agreement between valid results for the EGFR PCR test with Sanger sequencing (n?=?406) there were 38 discordant cases of which 30 were confirmed by MPP. Twenty-nine of the 30 cases resulted in mutation detected status by the EGFR PCR test and would make these patients eligible for anti-EGFR therapy. Poor sensitivity of Sanger sequencing thus explains the relatively low NPA compared to EGFR PCR test observed in this study. Given the criticality of EGFR mutation testing in selecting specific therapies for life-threatening cancers such as advanced NSCLC robust and accurate assays with rapid turnaround time are preferred. Recent quality assurance studies to ascertain the mutation status of a standard panel of tumors have shown that different clinical laboratories do not correctly identify the mutation status of 100% of the panel members even when they are using the same or similar testing methodologies.[38] [39] For assays that involve mutation analysis of tumor samples important factors contributing to the assay performance include analytic standardization validation of reagents and methodology laboratory experience and the appropriate involvement of the pathologist. In conclusion results of the present study indicate that the cobas EGFR mutation test is a highly robust and highly accurate companion diagnostic assay to select patients for treatment with anti-EGFR therapies such as erlotinib. Supporting Information Table S1 Listing of MPP Result. (PDF) Click here for additional data file. Table S2 Outcome from samples discrepant between the cobas EGFR PCR test and LDT that were enrolled in the clinical trial (cobas MND/LDT MD). (PDF) Click here for additional data file. Table S3 Agreement results between discordant EGFR PCR and LDT tests. (PDF) Click here for additional data file. Table S4 MPP results from resolution analysis of discordant specimens between EGFR PCR test and Sanger sequencing. (PDF) Click here for additional data file. We would like to acknowledge Patrick O'Donnell and Karen Yu for their contributions to this study. References 1 ChapmanPB HauschildA RobertC HaanenJB AsciertoP et al (2011) Improved survival with vemurafenib in melanoma with BRAF V600E mutation. N Engl J Med364: 2507“251621639808 2 OuSH BartlettCH Mino-KenudsonM CuiJ IafrateAJ (2012) Crizotinib for the treatment of ALK-rearranged non-small cell lung cancer: a success story to usher in the second decade of molecular targeted therapy in oncology. Oncologist17: 1351“1375 3 O'BryantCL WengerSD KimM ThompsonLA (2013) Crizotinib: a new treatment option for ALK-positive non-small cell lung cancer. Annals Pharmacotherapy47: 189“197 4 SunJM ChoiYL WonJK HirschFR AhnJS et al (2012) A dramatic response to crizotinib in a non-small-cell lung cancer patient with IHC-positive and FISH-negative ALK. J Thorac Oncol7: e36“3823154564 5 Administration USFaD (2010) Class Labeling Changes to anti-EGFR monoclonal antibodies cetuximab (Erbitux) and panitumumab (Vectibix): KRAS Mutations. 6 HarbisonCT HorakCE LedeineJM MukhopadhyayP MaloneDP et al (2012) Validation of Companion Diagnostic for Detection of Mutations in Codons 12 and 13 of the KRAS Gene in Patients with Metastatic Colorectal Cancer: Analysis of the NCIC CTG CO.17 Trial. Arch Pathol Lab Med137: 820“82723030695 7 MaemondoM InoueA KobayashiK SugawaraS OizumiS et al (2010) Gefitinib or chemotherapy for non“small-cell lung cancer with mutated EGFR. N Engl J Med362: 2380“2388 8 MokTS WuYL ThongprasertS YangCH ChuDT et al (2009) Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. N Engl J Med361: 947“95719692680 9 ZhouC WuYL ChenG FengJ LiuXQ et al (2011) Erlotinib versus chemotherapy as first-line treatment for patients with advanced EGFR mutation-positive non-small-cell lung cancer (OPTIMAL CTONG-0802): a multicentre open-label randomised phase 3 study. Lancet Oncol12: 735“74221783417 10 HirschFR KabbinavarF EisenT MartinsR SchnellFM et al (2011) A randomized phase II biomarker-selected study comparing erlotinib to erlotinib intercalated with chemotherapy in first-line therapy for advanced non-small-cell lung cancer. J Clin Oncol29: 3567“3573 11 RosellR CarcerenyE GervaisR VergnenegreA MassutiB et al (2012) Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre open-label randomised phase 3 trial. Lancet Oncol13: 239“24622285168 12 SequistLV MartinsRG SpigelD GrunbergSM SpiraA et al (2008) First-line gefitinib in patients with advanced non-small-cell lung cancer harboring somatic EGFR mutations. J Clin Oncol26: 2442“244918458038 13 MitsudomiT MoritaS YatabeY NegoroS OkamotoI et al (2010) Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label randomised phase 3 trial. Lancet Oncol11: 121“12820022809 14 KosakaT YatabeY EndohH YoshidaK HidaT et al (2006) Analysis of epidermal growth factor receptor gene mutation in patients with non-small cell lung cancer and acquired resistance to gefitinib. Clin Cancer Res12: 5764“576917020982 15 LynchTJ BellDW SordellaR GurubhagavatulaS OkimotoRA et al (2004) Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med350: 2129“213915118073 16 PaezJG JannePA LeeJC TracyS GreulichH et al (2004) EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science304: 1497“1500 17 PaoW MillerV ZakowskiM DohertyJ PolitiK et al (2004) EGF receptor gene mutations are common in lung cancers from œnever smokers and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A101: 13306“1331115329413 18 PaoW MillerVA PolitiKA RielyGJ SomwarR et al (2005) Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is associated with a second mutation in the EGFR kinase domain. PLoS2: 225“235 19 RielyGJ PolitiKA MillerVA PaoW (2006) Update on epidermal growth factor receptor mutations in non-small cell lung cancer. Clin Cancer Res12: 7232“7241 20 SharmaSV BellDW SettlemanJ HaberDA (2007) Epidermal growth factor receptor mutations in lung cancer. Nat Rev Cancer7: 169“18117318210 21 GarridoP de CastroJ ConchaA FelipE IslaD et al (2012) Guidelines for biomarker testing in advanced non-small-cell lung cancer. A national consensus of the Spanish Society of Medical Oncology (SEOM) and the Spanish Society of Pathology (SEAP). Clin & Transl Oncol14: 338“349 22 KeedyVL TeminS SomerfieldMR BeasleyMB JohnsonDH et al (2011) American Society of Clinical Oncology provisional clinical opinion: epidermal growth factor receptor (EGFR) Mutation testing for patients with advanced non-small-cell lung cancer considering first-line EGFR tyrosine kinase inhibitor therapy. J Clin Oncol29: 2121“212721482992 23 EttingerDS AkerleyW BeplerG BlumMG ChangA et al (2010) Non-small cell lung cancer. J Natl Compr Canc Netw8: 740“801 24 LindemanNI CaglePT BeasleyMB ChitaleDA DacicS et al (2013) Molecular Testing Guideline for Selection of Lung Cancer Patients for EGFR and ALK Tyrosine Kinase Inhibitors: Guideline from the College of American Pathologists International Association for the Study of Lung Cancer and Association for Molecular Pathology. J Mol Diagn15: 415“45323562183 25 Administration USFaD (2013) FDA approves first companion diagnostic to detect gene mutation associated with a type of lung cancer. 26 RosellR MoranT QueraltC PortaR CardenalF et al (2009) Screening for epidermal growth factor receptor mutations in lung cancer. N Engl J Med361: 958“96919692684 27 O'Donnell PF Jane; Shyu Johnny; Current Robert; Rehage Taraneh; Tsai Julie; Christensen Mari; Tran Ha Bich; Chien Sean; Wei Wen; Lawrence H. Jeffrey; Soviero Steven; Wu Lin. A real-time PCR assay for detecting EGFR mutations in formalin-fixed paraffin-embedded tissue (FFPET) specimens of non-small cell lung cancer (NSCLC). 2012; Chicago IL. 28 O'Donnell PFJ ShyuJ CurrentR RehageT TsaiJ Christensen M. Bich TranH Shih-ChangC WeiW LawrenceHJ WuL SovieroS (2013) A Real-Time PCR Assay for Detecting EGFR Mutations in Formalin-Fixed Paraffin-Embedded Tissue Specimens of Non-Small Cell Lung Cancer. BMC Cancer13: 21023621958 29 (2011) cobas EGFR Mutation Test CE-IVD Package Insert Roche Molecular Systems Inc. USA. 30 CondeE AnguloB TangM MorenteM Torres-LanzasJ et al (2006) Molecular context of the EGFR mutations: evidence for the activation of mTOR/S6K signaling. Clin Cancer Res12: 710“71716467080 31 MarguliesM EgholmM AltmanWE AttiyaS BaderJS et al (2005) Genome sequencing in microfabricated high-density picolitre reactors. Nature437: 376“38016056220 32 AnguloB Garcia-GarciaE MartinezR Suarez-GauthierA CondeE et al (2010) A commercial real-time PCR kit provides greater sensitivity than direct sequencing to detect KRAS mutations: a morphology-based approach in colorectal carcinoma. J Mol Diagn12: 292“299 33 Gallegos RuizMI FloorK RijmenF GrunbergK RodriguezJA et al (2007) EGFR and K-ras mutation analysis in non-small cell lung cancer: comparison of paraffin embedded versus frozen specimens. Cell Oncol29: 257“26417452778 34 OginoS KawasakiT BrahmandamM YanL CantorM et al (2005) Sensitive sequencing method for KRAS mutation detection by Pyrosequencing. J Mol Diag7: 413“421 35 AndersonS BloomKJ ValleraDU RueschoffJ MeldrumC et al (2012) Multisite Analytic Performance Studies of a Real-Time Polymerase Chain Reaction Assay for the Detection of BRAF V600E Mutations in Formalin-Fixed Paraffin-Embedded Tissue Specimens of Malignant Melanoma. Arch Pathol Lab Med136: 1385“139122332713 36 TanYH LiuY EuKW AngPW LiWQ et al (2008) Detection of BRAF V600E mutation by pyrosequencing. Pathology40: 295“29818428050 37 KotoulaV CharalambousE BiesmansB MalousiA VrettouE et al (2009) Targeted KRAS mutation assessment on patient tumor histologic material in real time diagnostics. PLoS One4: e774619888477 38 Beau-FallerM DegeorgesA RollandE MounawarM AntoineM et al (2011) Cross-Validation "
Lung_Cancer
"e commonest cause of cancer death in England and Wales with around 38?000 cases diagnosed each year and ?35?000 deaths. Data from the National Lung Cancer Audit (NLCA) demonstrate significant variation in process and outcome measures across England. In 2009 there was a three-fold difference in survival and active treatment rates which persisted following case mix adjustment (Beckett et al 2012). Furthermore reported lung cancer outcomes in the UK are worse than other comparable European countries (Walters et al 2013) and have improved little in recent years (Khakwani et al 2013). It has been estimated that if survival rates were increased to that of the best in Europe around 1300 lives could be saved each year in the United Kingdom (Abdel-Rahman et al 2009). Variation in health care is not unique to lung cancer and addressing unwarranted variation is challenging (Wise 2010). Although external regulation may have a role in some areas this approach is more difficult to apply to the complex pathways involved in lung cancer diagnosis and treatment. Peer review with supported quality improvement offers a promising alternative but the evidence for its effectiveness is limited. The Washington State's Surgical Care and Outcomes Assessment Program utilised a peer support programme to share the best practice which led to a significant reduction in post-operative complications (Kwon et al 2012). Within the United Kingdom the national COPD resources and outcomes project demonstrated that reciprocal peer-to-peer review led to only limited quantitative differences in the quality of services offered (Roberts et al 2012). A qualitative analysis of this study identified a number of barriers to improvement including difficulties in establishing effective working relationships funding changes and service re-design. In 2003 the Institute for Healthcare Improvement described the collaborative model to achieve a breakthrough improvement (Institute for Healthcare Improvement 2003). Collaboratives allow teams working on the same issue to share good practice and innovation permitting others to take these ideas and implement them in the context of their own anisation resources and case mix. Pronovost et al (2006) successfully employed this collaborative approach together with supported quality improvement to implement five evidence-based interventions on the intensive care unit resulting in the reduction in catheter-related bloodstream infections to zero. These studies offer a persuasive proof of concept but the absence of a control group or of patient-specific outcomes measures limits their implementation in other disease areas such as cancer. The aim of the current study is to determine whether a programme of reciprocal peer-to-peer review visits with supported quality improvement and collaborative working can significantly improve lung cancer process and outcome measures and thus reduce unwarranted variation in outcomes. Materials and methods Study design We conducted a prospective randomised controlled trial. Study population One hundred and sixty-two English NHS trusts were identified from the 2008 NLCA annual report. Centres only providing treatment (not diagnostics) orthopaedic hospitals and ambulance trusts were excluded. Invitations to participate were sent to the remaining 152 trusts. Trusts who agreed to participate and who had 2008 NLCA case ascertainment rates of > 50% expected were paired before randomisation on the basis of contrasting results for four key indicators from the NLCA. The indicators were active treatment rates surgical resection rates median survival and the proportion of patients assessed by a clinical nurse specialist. Each trust was colour coded for each indicator red if below the national average and green if above. By placing each trust with its colour-coded indicators on a map we were able to pair trusts on the basis of a contrasting mixture of red and green indicators and a travel time between centres of around 2?h. On the basis of data from the national COPD resources and outcomes project we determined that we would be able to complete 30 peer review visits during the lifetime of the project thus allowing 30 lung cancer multidisciplinary teams (15 pairs) to be randomised into the intervention arm. Randomisation was performed in a blinded fashion by assigning a random number to each pair of trusts and then allocating pairs numbered 1“15 to the intervention group. The remaining trusts formed either the control group (if they had agreed to participate) or the non-participant group and had no further contact with the study team but continued to submit data to the NLCA as usual. Intervention The study timeline is shown in . Following introductory workshops the multidisciplinary teams within each pair undertook facilitated reciprocal site visits. The visits consisted of observation of the host team's multidisciplinary team meeting three discussion sessions focusing on the functioning of the mulitdisciplinary team meeting the host team's NLCA data and patient experience questionnaire results. The final session aimed to identify the focus of improvement work to be undertaken by the host team. The quality improvement facilitator introduced a structured template for the quality improvement plans and provided a short introduction to using the model of improvement to guide implementation of the plans. Over the next 12 months the quality improvement facilitator provided support via electronic mail telephone and follow-up visits where required. Teams within the intervention group supported each other via mini-collaboratives in the form of web-based teleconferences and two face-to-face workshops. Outcomes Changes in process and outcome were assessed using data from local quality-improving plans and the following indicators from the NLCA: the proportion of patients discussed at a multidisciplinary team meeting histological confirmation rate active treatment rate surgical resection rate the proportion of patients with small-cell lung cancer receiving chemotherapy and the proportion of patients seen by a lung cancer nurse specialist. Patient experience was assessed in the intervention group using a new lung cancer-specific patient experience questionnaire designed in collaboration with the Roy Castle Lung Cancer Foundation. The questionnaire included 11 questions selected with permission from the previously validated 2004 national cancer patient survey. The questions covered the following domains: communication privacy respect and dignity and three free text questions (see Appendix I). Participating teams were asked to distribute 30 questionnaires to patients recently seen in their services. The clinical nurse specialists distributed the questionnaires to patients who anonymously returned them to the Royal College of Physicians. An independent qualitative ethnographic evaluation of the study was undertaken by the Social Science Applied to Healthcare Improvement Research Group at the University of Leicester. Statistical methods Data were tested for normality using the Shapiro“Wilk test. Baseline NLCA indicators were taken from the 2009 NLCA report and the intervention control and non-participant groups were compared using a ?2- test. The changes in NLCA indicators from 2009 to 2011 were compared using an independent t-test. Patient experience questionnaire responses for each question were labelled and re-coded to separate them into the worst patient experience category (score 1) vs all other responses (score 0). These scores were then summated to create a domain and a total patient experience score with a possible range of 0“11 whereby a higher score indicates a worse patient experience. Analyses were performed using the statistical software package SPSS (International Business Machines Corp. Armonk NY USA). Funding and ethics The study was funded by a ˜Closing the Gap' grant from the Health Foundation. The National Research Ethics Service confirmed that the study was service evaluation and quality improvement and did not require ethical review. Results One hundred trusts (66%) replied to the invitation to participate and 91 (61%) agreed to participate in the study. Eighty-one trusts had 2008 NLCA data of sufficient quality to allow pairing. Two trusts provided a joint multidisciplinary team allowing 40 pairs of multidisciplinary teams to be created. One pair agreed to act as a pilot and was excluded from further analysis. Of the remaining 39 pairs 15 pairs (31 trusts) were randomised to the intervention group. The remaining 24 pairs formed the control group. During the study two trusts in the control group amalgamated to form one trust so the total number of trusts in the control group was 47 (Figure 2). Quality improvement plans Two hundred and thirty medical professionals from 31 trusts participated in the review visits. Twenty-nine teams submitted a total of 67 quality improvement plans. The issues identified in the quality improvement plans are shown in Table 1. Eighteen teams collected local data to measure impact. An example of such data is shown in Figure 3. This trust identified small-cell lung cancer chemotherapy as an area for improvement. They introduced a number of changes to their diagnostic and treatment pathways including prioritisation of small-cell pathology reporting faxing of the results to the multidisciplinary team coordinator and lung nurse specialist to allow early booking of oncology appointments. These changes were monitored using a run chart that demonstrated a reduction in the time from multidisciplinary team meeting to chemotherapy treatment and an increase in the proportion of small-cell lung cancer patients receiving chemotherapy from 60% in 2009 to 71% in 2011. National lung cancer audit indicators Baseline (2009) NLCA indicators for the intervention control and non-participant groups were similar (Table 2). The mean change for each NLCA indicator from baseline to 2011 in the intervention and control group is shown in Figure 4. The proportion of patients receiving active anti-cancer treatment in the intervention group increased by 5.2% compared with 1.2% in the controls (mean difference 4.1% 95% CI ?0.1 to 8.2% P=0.055). The remaining NLCA indicators improved similarly both in the intervention and control groups. Patient experience In the intervention group patient experience questionnaires were returned by 438 patients from 30 multidisciplinary teams at baseline (return rate 49%) and 372 patients from 27 trusts following the intervention (return rate 41%). Baseline total scores were low (0“1.31) indicating high levels of patient satisfaction with the care received although there was a statistically significant (P<0.001) variation in results by the multidisciplinary team (Figure 5). In particular the proportion of patients responding yes to the question ˜did you find that the person who told you about your diagnosis did so with sufficient sensitivity/care?' varied significantly by 57%“100% (P<0.001). The total questionnaire scores did not change significantly during the study (0.22“0.17 P=0.377) however the variation by the multidisciplinary team reduced (Figure 5). Given that the study aimed to bring the standard of the lower performing trusts to that of the best we performed a post hoc analysis for the five trusts with the worst baseline patient experience scores. This demonstrated that the mean total score improved significantly for these trusts from 0.86 to 0.22 P<0.001. The biggest improvement in this group was seen in the proportion of patients responding yes to the question ˜did you find that the person who told you about your diagnosis did so with sufficient sensitivity/care?' which increased from 75% to 90% (P=0.05). One multidisciplinary team in this group achieved this improvement by using their baseline questionnaire results as a lever to encourage attendance at an advanced communications skills course. The questionnaire domain-specific scores did not change significantly during the study. Of the individual questions a significant improvement was seen in the rating of the quality of information provided as excellent which rose from 53%“59% P<0.05. Qualitative evaluation Participants' experiences were overwhelmingly positive. The reciprocal peer-to-peer visits with supported quality improvement were seen as a strong driver to change. The method of pairing multidisciplinary teams was important. In particular pairing teams with different results not just ˜good' with ˜bad' and allowing teams to visit each other's sites to ensure a two-way sharing of best practice. The independent quality improvement facilitator role was seen as crucial to ensure the visits remained focussed and that the engagement with quality improvement plans was maintained. Finally the involvement of senior managers was crucial to the successful implementation of the quality improvement plans. The detailed findings from the independent evaluation of this project have been reported elsewhere (Aveling et al 2012). Discussion Lung cancer outcomes remain relatively poor and reducing unexplained variation is an attractive proposition to promote improvement. There are a number of ways that clinical teams may share best practice and innovative service delivery models however studies formally evaluating their impact are limited. To our knowledge this is the first study to formally test a national quality improvement strategy which aimed to bring the standard of all lung cancer teams to that of the best. We have demonstrated that reciprocal peer-to-peer review with supported quality improvement is both feasible and effective at stimulating local quality improvement activity but had a relatively modest and somewhat disappointing impact on process and outcome measures as measured by NLCA indicators and a new lung cancer patient experience questionnaire. The facilitated reciprocal visits represented a new and unique opportunity for all members of a lung cancer team to exchange ideas in a supported environment and to formally design then implement quality improvement plans. Nearly two-thirds of lung cancer multidisciplinary teams in England agreed to take part in the study and reassuringly baseline NLCA indicators did not differ significantly between participants and non-participants suggesting that the willingness to participate in quality improvement activity is not related to baseline performance. There were a wide range of areas identified for improvement but nearly half of the teams identified multidisciplinary team meeting effectiveness as a key issue. This is not surprising given that these meetings are pivotal in the lung cancer pathway. Live observation of each multidisciplinary team meeting followed by facilitated feedback proved to be a strong driver to improve on problems such as ensuring weekly presence of all the treatment specialists as well as more simple issues such as room layout. The need to streamline diagnostic and treatment pathways was also identified as a common problem. Recent NICE guidance on the management of lung cancer (National Institute for Health and Care Excellence 2011) recommended a paradigm shift in the diagnostic algorithm from performing multiple diagnostic and staging investigations to performing a single test that will provide both diagnostic and staging information. A number of teams within our study were able to introduce such pathways and demonstrate impressive reductions in diagnostic times and more prompt treatment. This together with more effective multidisciplinary team working may have led to the small increase in the active anti-cancer treatment rates seen within the intervention group. However an alternative explanation for the improvement is regression to the mean given that treatment rates in the intervention group were lower at baseline and overall the lack of significant improvement across the range of NLCA indicators in the intervention group was disappointing. One possible explanation for this is the challenge that some participating teams encountered converting enthusiastic quality improvement plans into tangible improvements for patients over a relatively short time period. The qualitative evaluation confirmed that participants often underestimated the time and energy required to implement and sustain change and highlighted the importance of early engagement with hospital managers to maintain momentum (Aveling et al 2012). Alternatively other national lung cancer initiatives implemented at the time of the study may have driven coexistent improvements in the control group. For example the drive to encourage all lung cancer patients to be referred for clinical nurse specialist support has subsequently been shown to increase the probability that a lung cancer patient receives active treatment. Although even small improvements in lung cancer treatment rates are very welcome it is recognised that undergoing investigation for suspected lung cancer generates high levels of patient anxiety and many patients will remain too unwell to benefit from currently available drugs. The assessment of patient experience is therefore of particular importance in lung cancer. This has proved challenging in detailed national cancer surveys owing to the advance in age poor health and short median survival of lung cancer patients. The response rate to our short questionnaire was relatively high at 41“49% compared with the 2011 national survey in which only 7% of lung cancer patients responded (Department of Health 2012) but still represents the views of less than half of lung cancer patients and is a relative limitation in terms of generalisability of the results. It was reassuring to note that at entry to the study patients in the intervention group generally rated their experience as highly satisfactory. This may explain the low number of teams who specifically identified patient experience as an area for quality improvement. In terms of assessing the impact of the reciprocal peer-to-peer review visits and supported quality improvement on patient experience it is likely that this high-baseline satisfaction and the lack of patient experience data for the control group limited our ability to detect a significant change. However our results suggest that those teams with poor scores may be able to use patient experience data to promote significant improvements particularly in areas such as communication skills. Further work is required to develop a lung cancer patient experience measure that is both acceptable to patients and able to detect small but clinically important changes in experience. Although similar in name to the national cancer peer review process there are a number of important differences between the reciprocal peer-to-peer review and supported quality improvement process employed in the current study and national cancer peer review. The latter predominantly performs a quality assurance role ensuring that cancer teams meet a minimum standard via compliance with a number of process measures. Support with quality improvement is not provided and site visits are now rarely performed. The qualitative evaluation of our study highlighted the importance of an independent quality improvement facilitator to the success of the peer review visits and the subsequent implementation of the quality improvement plans. Integration of facilitated reciprocal peer-to-peer review and supported quality improvement into national cancer peer review both for lung cancer and other tumour sites is an attractive proposition and requires further study. However our results suggest that this strategy alone is unlikely to have a major impact on lung cancer treatment rates. This phenomenon is not new in lung cancer for example the introduction and NICE approval of gefitinib treatment for the first-line treatment of lung cancer in 2010 was associated with only a 1% increase in active anti-cancer treatment rates over the following year (Health and Social Care Information Centre 2012). Achieving a stepwise increase in lung cancer treatment rates and survival is likely to require a multi-targeted approach including earlier diagnosis streamlined lung cancer pathways new treatments and a reduction in unexplained variation via supported quality improvement programmes. This project was funded by a Health Foundation Closing the Gap award. (grant number: 7797/5557). Appendix I Improving lung cancer outcomes project: patient experience questionnaireWhat is this survey about? This questionnaire asks about your experience of lung cancer treatment and care at the hospital. It was developed in 2010 and it has been used by Lung Cancer Nurse Specialists in 30 hospital across participating in the ˜Improving Lung Cancer Outcomes Project' led by the Royal College of Physicians and several other anisations. The project aims to improve the quality of services and care for people affected by lung cancer. Why should I complete the survey? We need to know your opinion of the current services and care to help improve these for people affected by lung cancer. Your participation in this survey is voluntary and your answers will be treated in confidence. If you choose not to take part in this survey it will not affect the care you receive from the NHS in any way. Please do not write your name and address anywhere on the questionnaire as this information is not required. No information you give in this questionnaire will be shared in a way that allows you to be identified. How to complete the survey and how long it will take. The questionnaire is short and will take 5“10?min to complete. Please try to answer every question. Please return your questionnaire even if you have not answered every question. If English is not your first language or if you if you have difficulty understanding the questions then please ask a relative or carer to help you complete the questionnaire. Questions or help? If you have any questions please contact your local lung clinical nurse specialist team. Please select one answer to each question by placing a in the appropriate box. There is space at the end of the survey for you to write any comments. This work is published under the standard license to publish agreement. After 12 months the work will become freely available and the license terms will switch to a Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. Abdel-Rahman M Stockton D Rachet B Hakulinen T Coleman MP 2009 What if cancer survival in Britain were the same as in Europe: how many deaths are avoidable Br J Cancer 101 (Suppl 2 S115 S124 19956155 Aveling EL Martin G Jiménez García S Martin L Herbert G Armstrong N Dixon-Woods M Woolhouse I 2012 Reciprocal peer review for quality improvement: an ethnographic case study of the Improving Lung Cancer Outcomes Project BMJ Qual Saf 21 1034 1041 Beckett P Woolhouse I Stanley R Peake MD 2012 Exploring variations in lung cancer care across the UK-the ˜story so far' for the National Lung Cancer Audit Clin Med 12 14 18 22372213 Department of Health2012National Cancer Patients' Experience Survey Programme 2012/13. England. Health And Social Care Information Centre2012National Lung Cancer Audit Report. Institute for Healthcare Improvement2003The Breakthrough Series: IHI's Collaborative Model for Achieving Breakthrough Improvement. Boston. Khakwani A Rich AL Powell HA Tata LJ Stanley RA Baldwin DR Duffy JP Hubbard RB 2013 Lung cancer survival in England: trends in non-small-cell lung cancer survival over the duration of the National Lung Cancer Audit Br J Cancer 109 (8 2058 2065 24052044 Kwon S Florence M Grigas P Horton M Horvath K Johnson M Jurkovich G Klamp W Peterson K Quigley T Raum W Rogers T Thirlby R Farrokhi E Flum D 2012 Creating a learning healthcare system in surgery: Washington State's Surgical Care and Outcomes Assessment Program (SCOAP) at 5 years Surgery 151 146 152 22129638 National Institute for Health and Care Excellence 2011 The Diagnosis And Treatment Of Lung Cancer (Update Of Nice Clinical Guideline 24) Clinical guidelines CG121 London UK Pronovost P Needham D Berenholtz S Sinopoli D Chu H Cosgrove S Sexton B Hyzy R Welsh R Roth G Bander J Kepros J Goeschel C 2006 An intervention to decrease catheter-related bloodstream infections in the ICU N Engl J Med 355 2725 2732 17192537 Roberts CM Stone RA Buckingham RJ Pursey NA Lowe D Potter JM 2012 A randomized trial of peer review: the UK National Chronic Obstructive Pulmonary Disease Resources and Outcomes Project: three-year evaluation J Eval Clin Pract 18 (3 599 605 21332611 Walters S Maringe C Coleman MP Peake MD Butler J Young N Bergström S Hanna L Jakobsen E Kölbeck K Sundstrøm S Engholm G Gavin A Gjerstorff ML Hatcher J Johannesen TB Linklater KM McGahan CE Steward J Tracey E Turner D Richards MA Rachet B ICBP Module 1 Working Group 2013 Lung cancer survival and stage at diagnosis in Australia Canada Denmark Norway Sweden and the UK: a population-based study 2004-2007 Thorax 68 551 564 23399908 Wise J 2010 Health atlas shows large variations in care in England BMJ 341 c6809 c6809 Study timelines. Figure 2 Consort diagram disposal of eligible trusts including screening randomisation and follow-up. Figure 3 Run chart showing the waiting times from the multidisciplinary team meeting to the first treatment for 10 consecutive small-cell lung cancer patients following the implementation of the quality improvement plan at one trust in the intervention group. Figure 4 Mean change in national lung cancer audit metrics from baseline (2009) to 2011. P=0.055 active treatment”intervention vs controls. Intervention n=31 trusts control n=47 trusts and non-intervention (control and non-participants combined) n=66 trusts. Abbreviations: CNS clinical nurse specialist; MDT multidisciplinary team; SCLC small-cell lung cancer. Figure 5 Total patient questionnaire scores by the multidisciplinary team in the intervention group at baseline (pre) and at the end of the study (post). A low score indicates better experience. Each symbol represents the mean score for each trust in the intervention group. The maximum possible score for the questionnaire is 11. Table 1 Quality improvement plan themes Quality improvement plan theme Number of plans Multidisciplinary team effectiveness 31 Diagnostic pathways 13 Treatment pathways 9 Access to clinical nurse specialists 8 Clinical trial recruitment 4 Patient experience 2 Table 2 Baseline (2009) national lung cancer audit indicators Control ( n =47) Intervention ( n =31) Excluded ( n =67) P -value Mean (%) s.e.m. Mean (%) s.e.m. Mean (%) s.e.m. Control vs intervention vs non-participant control vs intervention Case ascertainment 158.1 38.6 122.0 7.2 107.4 3.6 0.220 0.455 Discussed at the MDT meeting 95.2 0.7 93.7 1.7 90.9 1.9 0.155 0.370 Histological confirmation rate 75.7 1.2 76.4 1.8 78.4 1.6 0.409 0.739 Active treatment 59.5 1.2 55.9 2.2 59.5 1.5 0.305 0.131 Surgery (all cases) 13.4 0.6 13.0 0.8 14.2 0.7 0.469 0.648 SCLC (chemo) 65.1 2.2 66.5 3.9 63.3 2.7 0.746 0.733 Seen by CNS 70.3 3.8 76.6 3.2 58.3 4.2 0.007 0.243 CNS present diagnosis 44.0 3.8 49.4 5.4 38.7 3.8 0.237 0.403 Abbreviations: CNS=clinical nurse specialist; MDT=mulitdisciplinary team; SCLC=small-cell lung cancer. Data are shown as mean and s.e. proportion of patients. BMC Cancer BMC Cancer BMC Cancer 1471-2407 BioMed Central 24386906 3893473 1471-2407-14-3 10.1186/1471-2407-14-3 Study Protocol Study protocol of a randomized controlled trial comparing Mindfulness-Based Stress Reduction with treatment as usual in reducing psychological distress in patients with lung cancer and their partners: the MILON study Schellekens Melanie PJ 1 [email protected] van den Hurk Desiree GM 2 [email protected] Prins Judith B 3 [email protected] Molema Johan 2 [email protected] Donders A Rogier T 4 [email protected] Woertman Willem H 4 [email protected] van der Drift Miep A 2 [email protected] Speckens Anne EM 1 [email protected] 1Department of Psychiatry Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 2Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 3Department of Medical Psychology Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 4Department of Epidemiology Biostatistics and Health Technology Assessment Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 2014 3 1 2014 14 3 3 28 6 2013 19 12 2013 Copyright © 2014 Schellekens et al.; licensee BioMed Central Ltd. 2014 Schellekens et al.; lic"
Lung_Cancer
" 3 further treatments at 4-day intervals. In the mesothelioma model C57BL/6 mice were treated 5 days after 40L tumor cell inoculation and injected i.p. with scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. Three subsequent doses were administered at 3-day intervals thereafter. For survival studies we observed the mice daily 3 weeks after inoculation of BR5FVB1 cells or 1 week after inoculation of 40L cells. Tumor generations were consistently first evident via abdominal distension secondary to malignant ascites and tumor-bearing mice were euthanized at the endpoint when there were signs of distress including fur ruffling rapid respiratory rate hunched posture reduced activity and progressive ascites formation as previously described [25]. For the investigation of anti-tumor T-cell responses all ovarian tumor-bearing mice were sacrificed 7 days after the final scheduled treatment. All studies were performed in a manner that was blinded to the observer under protocols that were approved by the Massachusetts General Hospital Subcommittee on Research Animal Care (SRAC). Treatment of na¯ve mice with experimental or control protein 6-week-old male C57BL/6 mice were injected i.p. with scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. Three subsequent doses were administered at 3-day intervals thereafter. Seven days post the administration of the final treatment mice were sacrificed and abdominal wall and intestine were retrieved for histopathological studies of mesothelial tissues. Ex vivo assessment of tumor specific T-cell functions Single cell suspensions were prepared from spleens. Cells were plated in round-bottomed 96-well plates pulsed with a validated CD8+ T-cell Her2/neu peptide (PDSLRDLSVF 1 ?g/ml; EZBiolab) [2543] an in-house designed H2d-restricted MSLN Ld1 peptide (IPLSYLCDF 1 ?g/ml; EZBiolab) that did not induce ovarian cancer specific T-cell response in H-2q FVB mice or medium alone for 72 hours when Golgi Plug (BD Bioscience) was added for the last 5 hours as previously described [44] and then stained with fluorophore-conjugated anti-CD3 anti-CD4 anti-CD8 anti-IFN? (BD Pharmingen) and anti-Granzyme B (eBioscience) antibodies. Cells were then analyzed on a LSRII 4 laser (BD Biosciences). Depletion of CD8+ T cells in vivo FVB/NJ mice were injected i.p. with 200 ?g of anti-CD8 monoclonal antibody (mAb)(53“6.72 Bio X Cell) or an isotype-matched irrelevant rat IgG2a (2A3 Bio X Cell) 2 days before 1 day before and 1 day after i.p. inoculation with BR5FVB1 ovarian tumor cells. Depletion was continued once every week until 29 days after tumor inoculation. The mice were treated with scFvMTBHsp70 or saline as described above. All the mice were bled from the tail vein and the depletion of CD8+ cells was examined by flow cytometry analysis of peripheral blood cells stained with fluorophore-conjugated anti-CD8 on days 7 and 28 after tumor inoculation. Generation and purification of bone marrow-derived DCs (BMDCs) CD11c+ DCs were generated from bone marrow cells of FVB/NJ mice as described [45-47] with minor modifications. Briefly erythrocyte-depleted mouse bone marrow cells from flushed marrow cavities were cultured in complete RPMI 1640 with 10 ng/ml GM-CSF and 1 ng/ml IL-4 at 1 — 106 cells/ml. Medium was changed on day 3. On day 7 DCs were harvested by gentle pipetting and purified with magnetic microbeads conjugated to a monoclonal antibody against CD11c (MiltenyiBiotec) as described [4648] according to the manufacturer™s recommended protocol. In vitro activation of BMDCs CD11c+ BMDCs were plated in a 24-well plate at a density of 2?—?106 cells/ml and incubated with 2 ?g/ml scFvMTBHsp70 (105 kDa) 1.3 ?g/ml MTBHsp70 (70 kDa) 1 ?g/ml LPS equivalent to 103 EU/ml endotoxin (InvivoGen San Diego CA) or 0.1 ng/ml (0.1 EU/ml) LPS equivalent to endotoxin found in 2 ?g/ml of proteins (since LPS level is less than 50 EU per mg of protein) for 24 h at 37°C in humidified atmosphere with 5% CO2. Cells were then placed on ice collected by vigorous pipetting washed and stained with the following fluorophore-conjugated antibodies: anti-CD11c and anti-CD40 (eBioscience) anti-CD80 (BD Horizon) anti-CD86 and anti-MHC class II (I-Aq) (BD Pharmingen). Afterwards the cells were analyzed on an LSRII 4 laser (BD Biosciences). In vitro tumor antigen presentation assay BR5FVB1 cells were harvested and treated with mitomycin C and plated in a 96-well round-bottomed plate with 20 ?g/ml scFvMTBHsp70 or 13 ?g/ml MTBHsp70. After pre-incubation at 4°C for 1 h CD11c+ BMDCs (ratio of tumor cells: DCs = 3: 1) were added to the wells and the plate was incubated at 37°C for 24 h. For generation of BR5FVB1 cell-primed T cells we inoculated FVB/NJ mice by i.p. injection with 107mitomycin C-treated BR5FVB1 cells and sacrificed the mice 60 days after the immunization according to the approved animal protocol. Splenocytes were then harvested and T cells were isolated using the Pan T-Cell Isolation Kit II (MiltenyiBiotec). BR5FVB1 cell-primed T cells were then added to the wells at a DC/T-cell ratio of 1:20. After a 24-hour co-culture of BR5FVB1 cell-pulsed DCs with BR5FVB1 cell-primed T cells the cells were harvested washed and resuspended in PBS with 5% FBS stained for CD3 CD4 CD8 and IFN? and analyzed on a LSRII 4 laser (BD Biosciences). In vivo immunization with mitomycin C-treated ovarian tumor cells BR5FVB1 ovarian tumor cells were harvested with enzyme-free cell-dissociation buffer and treated with mitomycin C as described above. Cells were then pre-incubated with scFvMTBHsp70 (10 ?g/106 cells) MTBHsp70 (6.5 ?g/106 cells) or PBS alone at 4°C for 1 h. 6-week-old FVB mice were shaved and depilated on both left and right flanks and then injected i.d. with 50 ?l of PBS or 1?—?106 tumor cells in 50 ?l of PBS with or without a pre-incubation with scFvMTBHsp70 or MTBHsp70 at both flanks. Histopathology Abdominal walls and intestines from mice were fixed for at least 24 h in PBS-buffered 10% formalin. Tissues were routinely embedded in paraffin. 5 ?m thick sections were stained routinely with H&E. For staining tumor-infiltrating T cells mice were perfused with 4% paraformaldehyde (PFA) in PBS and tumor nodules were fixed in 4% PFA/PBS for additional 2 hours washed and infiltrated with 30% sucrose/PBS at 4°C. 6 ?m thick frozen sections were stained with rat anti-mouse CD8 (BD Biosciences 1:100 dilution) or rat anti-mouse Foxp3 (eBioscience 1:12 dilution) followed by polyclonal rabbit anti-rat immunoglobulin/HRP (Dako 1:750 dilution). Signal was developed with diaminobenzidine (DAB Dako). Images were acquired on a Zeiss Axio A1 microscope. All histopathological and immunohistochemical samples were reviewed and the quantitation of the cellular infiltrate was performed in a blinded manner to the observer. Statistical analysis Statistical differences between three or more experimental groups were analyzed using One-Way ANOVA followed by Turkey™s multiple comparison tests when mean of each group is compared with that of every other group or followed by Dunnett™s multiple comparison tests when mean of each group is compared with that of a control group. Statistical differences between two experimental groups were analyzed using Student™s t-test. Survival was analyzed with the Log-rank test. Prism 6.0 software (GraphPad Software) was used for all the statistical analysis. Abbreviations DC: Dendritic cell; scFv: Single-chain antibody variable fragment; MSLN: Mesothelin; MTB: Mycobacterium tuberculosis; Hsp: Heat shock protein; i.p.: Intraperitoneal; i.d.: Intradermal; BMDCs: Bone marrow-derived dendritic cells; APCs: Antigen-presenting cells; PBMCs: Peripheral blood mononuclear cells; PBLs: Peripheral blood leukocytes; LPS: Lipopolysaccharide; H&E: Haematoxylin and eosin; PFA: Paraformaldehyde; DAB: Diaminobenzidine; mAb: monoclonal antibody. Competing interests The authors declare that they have no competing interests. Authors™ contributions JY played a role in the design of the experiments acquisition analysis and interpretation of the data and writing the manuscript. PR JN YY NHA MN GJ-M XT SK HC PU BF TC and PL participated in the performance of experiments. SK and TB were involved in design of the experiments. RB was involved in data analysis. ER was involved in setting up murine ovarian cancer model. SO provided the murine ovarian cancer model. NS provided the plasmid that encodes an scFv fragment specific to MSLN and the recombinant P4 scFv protein. GD NS and SO gave constructive input on experimental design and data analysis. JG played a role in conception and design of the fusion protein. MP and JG were involved in the conceptualization and design of the study analysis and interpretation of datasets and in writing the manuscript. All authors read and approved the final manuscript. Supplementary Material Additional file 1: Figure S1 scFvMTBHsp70 binds to 40L mesothelioma cells. 40L cells were stained with scFvMTBHsp70 or MTBHsp70 followed by mouse anti-MTBHsp70 and Donkey anti-mouse Alexa Fluor 594. Cells were observed using a Nikon Eclipse TiE fluorescence microscope. A Representative pictures from three independent experiments. Scale bar 10 ?m. B Images were analyzed using the NIS-Elements AR Microscope Imaging Software. Mean Fluorescence Intensity was analyzed using ImageJ. P values were determined using One-Way ANOVA followed by Turkey™s multiple comparison tests. ****p?<?0.0001. Click here for file Additional file 2: Figure S2 scFvMTBHsp70 or MTBHsp70 plus P4 scFv treatment does not lead to infiltration of inflammatory cells into abdominal or intestinal mesothelial tissues. Samples of abdominal wall and intestine were prepared from C57BL/6 mice that had previously received multiple i.p. injections of scFvMTBHsp70 MTBHsp70 plus P4 scFv or saline as described in the Methods section. Sections of these tissues were stained with H&E and images were acquired on a Zeiss Axio A1 microscope. Representative images from 3 animals per treatment group are shown. No detectable level of mononuclear cell or granulocyte infiltrate within mesothelial tissues was seen in any sampled tissues. Scale bar 20 ?m. Click here for file Additional file 3: Figure S3 scFvMTBHsp70 treatment does not affect numbers of tumor-infiltrating CD8+ or Foxp3+ T cells. (A) Representative images of intratumoral CD8+ and Foxp3+ T cells from saline (n?=?3) scFvMTBHsp70 (n?=?3) or MTBHsp70 plus P4 scFv (n?=?3) -treated mice. Mouse spleen sections were used as positive controls: CD8+ and Foxp3+ T cells are clearly evident in the sections. Scale bar 20 ?m. (B) Numbers of CD8+ and Foxp3+ cells were quantified from 3“5 randomized fields. Click here for file Additional file 4: Figure S4 Validation of in vivo depletion of CD8+ cells in FVB/NJ mice. Mice were injected i.p. with 200 ?g of anti-CD8 mAb or an isotype-matched irrelevant rat IgG2a as described in Methods. All the mice were bled from the tail vein and the depletion of CD8+ cells was examined by flow cytometry analysis of peripheral blood cells stained with fluorophore-conjugated anti-CD8 on days 7 and 28 after tumor inoculation. (A) Representative results of flow analyses on 10 mice per group and reported as the percentage of CD8+ cells in lymphocytes. (B) CD8+ cells in the mice treated with isotype IgG2a or anti-CD8 mAb were compared. ***p< 0.001. Click here for file Acknowledgments This manuscript is dedicated to the memory of Janet Gelfand a victim of ovarian cancer."
Lung_Cancer
"followed by intravenous tail vein injection of 1 — 106 MX-1 cells. Thirteen days after injection lungs were harvested and stained with Bouin's solution to visualise metastatic colonies. For survival analysis mice were monitored daily for signs of morbidity including body weight hydration level coat appearance mobility and behaviour. Mice that showed cumulative signs meeting the criteria of a moribund state were euthanised. All procedures using laboratory animals were done in accordance with all applicable institutional and government regulatory guidelines and policies were performed in an animal facility accredited by the Center for Accreditation of Laboratory Animal Care of the Japan Health Sciences Foundation. Statistical analysis Eribulin-treated vs control groups were analysed by the Dunnett multiple comparisons test using two-sided approaches. Values of P<0.05 were considered as statistically significant. Statistical analyses were performed using GraphPad Prism version 5.04 (GraphPad Software La Jolla CA USA) or R (v2.15.2 http://www.r-project./index.html) and SAS (v9.2 2M2 Cary NC USA) programs. Analyses of lung metastatic nodules and survival data were done using Kaplan“Meier and log-rank test methods and the Mann“Whitney U-test (GraphPad Prism version 6 La Jolla CA USA). Results Eribulin reverses EMT and induces MET in TNBC cells in vitro To investigate the effects of eribulin on EMT/MET balance three TNBC cell lines were treated with eribulin for 7 days (A). The doses of eribulin for MX-1 and Hs578T were IC50 and three times IC50 decided by 3 days proliferation assay result (Supplementary Figure S1A). For MDA-MB-157 half IC50 and IC50 of eribulin were selected because almost all cells died after 7 days treatment with three times IC50. Although eribulin strongly inhibited proliferation of these cells surviving cells were no longer spindle shaped like control cultures but instead had flat more epithelial-like morphologies (B). This conversion from mesenchymal to epithelial-like morphologies prompted us to examine alterations in EMT/MET-related genes. RNA from surviving TNBC cells treated with eribulin for 7 days was assayed by qPCR analysis. As shown in C (MX-1) D (MDA-MB-157) and E (Hs578T) eribulin treatment consistently upregulated mRNA expression levels of epithelial markers CDH1 and KRT18 while it downregulated mesenchymal markers CDH2 VIM TWIST1 SNAI2 ZEB1 and ZEB2 even though the pattern and degree of these alterations was somewhat different among the three TNBC cell lines (C D and E). Of the three eribulin effects on EMT/MET markers were most robust in MX-1 cells so this line was selected for further more detailed analyses. Thus using MX-1 cells western blotting analysis confirmed that protein levels of key EMT/MET markers behaved similarly to mRNA expression patterns: eribulin increased levels of E-cadherin protein while decreasing levels of N-cadherin and vimentin proteins (F and G). Taken together results of morphological observations and gene and protein expression patterns strongly point to eribulin-induced reversion of EMT and induction of MET in TNBC cells. Eribulin reverses EMT and induces MET in MX-1 TNBC tumour xenografts in mice Next eribulin's ability to induce a shift from EMT to MET phenotypes was tested in MX-1 tumour xenografts in vivo. MX-1 cells were transplanted into athymic mice to establish MX-1 xenografts followed by treatment of animals with eribulin using the schedule shown in A. Under these conditions eribulin showed a significant antitumour activity as determined by measurement of tumour weights on days 4 and 8 of the study (Supplementary ). Nevertheless even in tumours in the 3?mg?kg?1 eribulin group residual tumour tissues remained intact and showed evidence of tumour vasculature remodelling (Matsui et al 2013; Funahashi et al manuscript in preparation). Therefore an IHC analysis of EMT/MET-related proteins in the resected tumours was performed. B showed representative images of IHC staining for E-cadherin N-cadherin and ZEB1 protein in tumours from animals receiving each of the three eribulin treatment dose levels. As shown in all eribulin-treated groups the epithelial E-cadherin signal was increased whereas the mesenchymal N-cadherin and ZEB1 signals were decreased. Quantification of these IHC results for all animals in each group revealed that these alterations were significant at all doses tested when compared with the corresponding vehicle controls (C). Together with results from cell-based studies analysis of protein expression levels in in vivo MX-1 tumour xenografts provides strong evidence for eribulin-induced reversion of EMT and induction of MET in breast cancer cells. Eribulin regulates TGF-? signalling pathway via downregulation of Smad phosphorylation To examine the mechanism by which eribulin induces MET in cells the effect of eribulin on TGF-?/Smad signalling a key signalling pathway for induction of EMT was investigated. It is known that TGF-? enhances phosphorylation of receptor-regulated Smad2 and Smad3 proteins resulting in enhanced complexing with Smad4. Translocation of the resulting complex into the nucleus activates transcription of essential EMT-related genes including TWIST1 SNAI1 SNAI2 ZEB1 and others (Takano et al 2007; Gregory et al 2011). To evaluate the effect of eribulin on this pathway MCF10A normal mammary epithelial cells were utilised. These cells represent a non-cancerous triple negative basal cell type and as such are often used as an EMT model since they quickly undergo EMT in response to TGF-?. A shows the treatment scheme of the experiment. The EMT phenotype of MCF10A cells treated with TGF-? for 7 days was confirmed by cell morphology (B) as well as gene expression profiles of epithelial and mesenchymal markers (C). Next effects of eribulin on MCF10A cells already induced to the EMT phenotype by TGF-? treatment were examined. For this analysis eribulin treatment was begun after cells had been induced to the EMT phenotype by 7 days of TGF-? pretreatment and 7 days later cellular morphology and gene expression profiles were examined. The concentration of eribulin used in this experiment was ?0.5 — IC50 0.25?nM (see Supplementary Figure S1B). As shown in D on day 15 eribulin treatment reversed the observed phenotype from the previously induced spindle-like EMT morphology seen at day 8 to the original cuboidal morphology typical of TGF-?-untreated cells (compare D right with B left). Furthermore eribulin treatment also significantly upregulated mRNA expression levels of epithelial marker CDH1 while downregulating several mesenchymal markers (E). Finally phosphorylation levels of Smad2 and Smad3 were investigated. MCF10A cells were pretreated with eribulin for 1 day and the phosphorylation status of Smad2 and Smad3 was analysed 1?h after subsequent TGF-? stimulation. As shown in F eribulin pretreatment significantly decreased TGF-?-induced phosphorylation of Smad2 and Smad3 suggesting that the MET induced by eribulin was at least in part due to of downregulation of the TGF-?/Smad pathway. Eribulin decreases migration and invasion capacity of MX-1 TNBC cell in vitro One of the functional changes associated with EMT is an increase in migration and invasion capacities traits typically associated with mesenchymal phenotypes. To investigate whether decreases in cell migration and invasion capacities accompany the eribulin-induced shift from EMT to MET phenotypes seen above in vitro migration and invasion assays were conducted. For these studies MX-1 cells were treated for 7 days with 1 or 3?nM eribulin or 10??M 5-FU (active metabolite of capecitabine the comparator used in a recent phase III clinical trial of eribulin; see Kaufman et al 2012) followed by drug washout and evaluation of in vitro migration and invasion in the absence of drugs (A). The concentration of 5-FU used 10??M was approximately a 2 — IC50 growth inhibitory concentration (Supplementary Figure S1C). Treatment with eribulin significantly decreased both the migration (B and C) and invasiveness (D and E) capacities of MX-1 cells in vitro. In contrast although treatment with 5-FU also decreased both migration and invasiveness of MX-1 cells such effects were smaller than those seen with eribulin (B“E). Eribulin treatment decreases lung metastases and prolongs survival in MX-1 in vivo experimental metastasis model Finally we utilised an in vivo experimental metastasis model to investigate whether MX-1 cells pretreated with eribulin have a reduced capacity to generate metastatic lung nodules and whether the host mice would survive longer. Equivalent numbers of MX-1 cells pretreated in vitro with DMSO 1?nM eribulin or 3??M 5-FU for 7 days were injected into tail veins of mice followed 13 days later by assessment of the number of metastatic lung nodules. To exclude the possibility that pretreated cells had lost their viability at the time of injection proliferation rates of samples of pretreated cells (i.e. cells identical to those injected into mice) were measured after washout of the drugs. Results indicated that the post-washout proliferation rates of both eribulin- and 5-FU-pretreated cells were slightly slower at 2 days but had recovered to virtually identical rates as DMSO control cells by day 4 indicating that all post-washout cells injected into tail veins retained full viability and proliferative capacity (Supplementary Figure S2). Thirteen days after tail vein injection numbers of metastatic lung nodules were assessed. As shown in Figure 5A and B animals injected with MX-1 cells pretreated with eribulin showed dramatic reductions in the number of metastatic lung nodules compared with controls. Pretreatment of MX-1 cells with 5-FU also led to a reduction in numbers of metastatic lung nodules compared with controls (Figure 5A and B) albeit to a considerably lesser degree than seen with eribulin. Next we examined whether the observed reductions in lung metastases were associated with prolonged survival. As shown in Figure 5C control mice started to die around 13 days after DMSO-treated MX-1 cell injection with mice in the 5-FU group starting to die only a few days later. By day 21 all mice in both the DMSO and 5-FU groups had died. In marked contrast the first deaths in the eribulin-treated group were not seen until day 39 with the final survival rate at the conclusion of the study on day 80 being 60% (Figure 5C) linking the reduction in metastases to functional prolongation of survival. Discussion Recent advances in novel drug development strategies have improved treatment paradigms for hormone-sensitive and HER2 overexpressing breast cancers; however the most malignant and heterogeneous subtype TNBC remains largely intractable due to an aggressive metastatic character and rapid recurrence after treatment. Emerging results from many groups suggest that TNBC's resistance to chemotherapy may be explained in part by the EMT hypothesis. Epithelial“mesenchymal transition progression is characterised by a transition from epithelial to mesenchymal phenotype loss of proteins involved in cell junctions such as E-cadherin and increased expression of mesenchymal markers such as N-cadherin and vimentin. Moreover circulating tumour cells (CTCs) involved in breast cancer metastasis are reported to harbour mesenchymal characteristics (Yu et al 2013) and gene signatures of mesenchymal type cells induced by EMT are highly correlated with those of cancer stem cells (Shipitsin et al 2007; Mani et al 2008; Taube et al 2010). Thus the processes of tumour aggressiveness chemoresistance metastasis and invasion appear to be inextricably linked to EMT. The current preclinical studies represent an attempt to identify the scientific basis behind clinical observations of eribulin's enhancement of OS without corresponding increases in PFS. The studies described here have uncovered a potential new biology associated with eribulin treatment regulation of tumour EMT/MET balance which may add a new dimension to eribulin's known antimitotic antiproliferative effects on cancer cells. Results in support of this conclusion are several-fold. First in TNBC cells in vitro eribulin promoted a shift from EMT to MET states as shown by phenotypic shifts from mesenchymal to epithelial morphologies as well as changes in EMT/MET-related markers strongly favouring MET. Second eribulin treatment of mice bearing TNBC xenografts led to increased tumour expression of epithelial markers concurrent with decreased levels of mesenchymal markers. Third eribulin treatment of TNBC cells in vitro led to decreased cellular migration and invasiveness capacities an observation consistent with the known functional phenotype of MET. Finally eribulin pretreated TNBC cells had a significantly decreased capacity to colonise the lung in an in vivo experimental metastasis model findings that also correlated with significant prolongation of survival. It has been shown in several reports that the primary target of eribulin is tubulin and microtubules (Towle et al 2001; Kuznetsov et al 2004; Jordan et al 2005; Okouneva et al 2008; Smith et al 2010). However the relationship between microtubule regulation and EMT has received little attention. Smad proteins which are essential mediators of TGF-? signalling pathway normally bind microtubules in the absence of TGF-? but dissociate from them upon TGF-? stimulation (Dong et al 2000). Dissociated Smad2 and Smad3 become phosphorylated and then associate with Smad4 followed by translocation of the entire complex to the nucleus where it activates transcription. Eribulin inhibits the growth phase of microtubule dynamics (Jordan et al 2005) by binding to high affinity sites on microtubule plus ends (Smith et al 2010) possibly resulting in maintenance of the association between Smad proteins and microtubules with consequent inhibition of Smad phosphorylation. In fact the microtubule stabiliser paclitaxel even with a distinct mode of action from eribulin decreased Smad2 phosphorylation in gastric cancer (Tsukada et al 2013). On the other hand the microtubule destabiliser nocodazole enhances the release of Smad proteins from microtubules and thus increases their phosphorylation (Dong et al 2000). Although it cannot be excluded that eribulin may have other unique targets to evoke MET the precedents set by paclitaxel and nocodazole in altering Smad-related signalling suggests that eribulin binding to microtubules may at least partially explain its induction of MET in TNBC cells as observed in our studies. Involvement of EMT in drug resistance has been reported in several cancer types. For instance positive staining for the mesenchymal marker Vimentin appears in specimens from non-small cell lung cancer (NSCLC) patients who develop resistance to EGFR inhibitors suggesting that EMT has been triggered in such tumours (Uramoto et al 2010; Chung et al 2011; Sequist et al 2011). It will be interesting to determine whether eribulin reverses the EMT phenotype of lung cancer cells preclinically to reduce resistance to EGFR inhibitors. An important caveat to the studies presented here is that it is not currently known whether other tubulin-targeting agents such as the taxanes vinca alkaloids or epothilones have effects on EMT/MET balance similar to those described here for eribulin. Studies are currently ongoing to investigate this important question. In conclusion the preclinical studies presented here reveal that in addition to having a primary anticancer mechanism associated with classical antimitotic effects eribulin may also render residual tumours less aggressive and less likely to metastasise by triggering a shift from mesenchymal to epithelial phenotypes via reversal of the EMT state to the MET state. We thank Makoto Asano Naoko H Sugi Hajime Shimizu Taisuke Uehara and Hideki Watanabe for preparation of materials used in this study. We also thank Kentaro Matsuura and Kentaro Takahashi for statistical analysis Kishan Agarwala for helpful discussions and Bruce Littlefield for critical reading of the manuscript. Supplementary Information accompanies this paper on British Journal of Cancer website (http://www.nature.com/bjc) All authors are employees of Eisai Co. Ltd or Eisai Inc. Arteaga CL Sliwkowski MX Osborne CK Perez EA Puglisi F Gianni L 2012 Treatment of HER2-positive breast cancer: current status and future perspectives Nat Rev Clin Oncol 9 (1 16 32 22124364 Bonnomet A Syne L Brysse A Feyereisen E Thompson EW Noel A Foidart JM Birembaut P Polette M Gilles C 2012 A dynamic in vivo model of epithelial-to-mesenchymal transitions in circulating tumor cells and metastases of breast cancer Oncogene"
Lung_Cancer
"These point mutations occur in the tyrosine kinase domain which plays an important role in oncogenesis. Our peptide array was selected from EML4 which has no correlation with these point mutations. It is possible that this treatment is effective for tumor cells resistant to ALK inhibitors. In this study we identified a new epitope peptide derived from the EML4-ALK fusion gene. We successfully induced an HLA-A*02:01-restricted peptide-specific CTL clone that demonstrated cytotoxicity for EML4-ALK-positive tumor cells. This is a new epitope-based vaccine therapy design for EML4-ALK-positive cancer cells. In order to obtain a stronger effect further analysis is needed. Acknowledgements We thank Professor S. Yano for providing the H2228 cell line which possesses the EML4-ALK fusion gene Professor H. Mano for providing the EML4-ALK fusion DNA and Professor N. Hirano for providing artificial APCs. This study was supported in part by Health and Labor Science Research Grants for Clinical Research and Third Term Comprehensive Control Research for Cancer from the Ministry of Health Labor and Welfare Japan and the National Cancer Center Research and Development Fund (25-A-7). References 1 Silvestri GA Tanoue LT Margolis ML The noninvasive staging of non-small cell lung cancer: the guidelines Chest 123 147S 156S 2003 12527574 2 Reck M What future opportunities may immuno-oncology provide for improving the treatment of patients with lung cancer? Ann Oncol 23 Suppl 8 viii28 viii34 2012 22918925 3 Chang SC Chang CY Shih JY The role of epidermal growth factor receptor mutations and epidermal growth factor receptor-tyrosine kinase inhibitors in the treatment of lung cancer Cancers 3 2667 2678 2011 24212826 4 Gridelli C Peters S Sgambato A Casaluce F Adjei AA Ciardiello F ALK inhibitors in the treatment of advanced NSCLC Cancer Treat Rev 40 300 306 2014 23931927 5 Hall RD Gray JE Chiappori AA Beyond the standard of care: a review of novel immunotherapy trials for the treatment of lung cancer Cancer Control 20 22 31 2013 23302904 6 Jackman DM Miller VA Cioffredi LA Impact of epidermal growth factor receptor and KRAS mutations on clinical outcomes in previously untreated non-small cell lung cancer patients: results of an online tumor registry of clinical trials Clin Cancer Res 15 5267 5273 2009 19671843 7 West H Oxnard GR Doebele RC Acquired resistance to targeted therapies in advanced non-small cell lung cancer: new strategies and new agents Am Soc Clin Oncol Educ Book 2013 10.1200/EdBook_AM.2013.33.e272 http://meetinglibrary.asco./content/198-132 8 Wu YL Park K Soo RA INSPIRE: a phase III study of the BLP25 liposome vaccine (L-BLP25) in Asian patients with unresectable stage III non-small cell lung cancer BMC Cancer 11 430 2011 21982342 9 Tyagi P Mirakhur B MAGRIT: the largest-ever phase III lung cancer trial aims to establish a novel tumor-specific approach to therapy Clin Lung Cancer 10 371 374 2009 19808198 10 Quoix E Ramlau R Westeel V Therapeutic vaccination with TG4010 and first-line chemotherapy in advanced non-small-cell lung cancer: a controlled phase 2B trial Lancet Oncol 12 1125 1133 2011 22019520 11 Brahmer JR Tykodi SS Chow LQ Safety and activity of anti-PD-L1 antibody in patients with advanced cancer N Engl J Med 366 2455 2465 2012 22658128 12 Lynch TJ Bondarenko I Luft A Ipilimumab in combination with paclitaxel and carboplatin as first-line treatment in stage IIIB/IV non-small-cell lung cancer: results from a randomized double-blind multicenter phase II study J Clin Oncol 30 2046 2054 2012 22547592 13 Topalian SL Hodi FS Brahmer JR Safety activity and immune correlates of anti-PD-1 antibody in cancer N Engl J Med 366 2443 2454 2012 22658127 14 Soda M Choi YL Mano H Identification of the transforming EML4-ALK fusion gene in non-small-cell lung cancer Nature 448 561 566 2007 17625570 15 Bonanno L Favaretto A Rugge M Role of genotyping in non-small cell lung cancer treatment: current status Drugs 71 2231 2246 2011 22085382 16 Fukui T Yatabe Y Mitsudomi T Clinicoradiologic characteristics of patients with lung adenocarcinoma harboring EML4-ALK fusion oncogene Lung Cancer 77 319 325 2012 22483782 17 Lin E Li L Guan Y Exon array profiling detects EML4-ALK fusion in breast colorectal and non-small cell lung cancers Mol Cancer Res 7 1466 1476 2009 19737969 18 Robertson FM Petricoin EF III Cristofanilli M Presence of anaplastic lymphoma kinase in inflammatory breast cancer Springerplus 2 497 2013 24102046 19 Sasaki T Rodig SJ Jnne PA The biology and treatment of EML4-ALK non-small cell lung cancer Eur J Cancer 46 1773 1780 2010 20418096 20 Kwak EL Bang YJ Iafrate AJ Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer New Engl J Med 363 1693 1703 2010 20979469 21 Katayama R Shaw AT Engelman JA Mechanisms of acquired crizotinib resistance in ALK-rearranged lung cancers Sci Transl Med 4 120ra17 2012 22 Doebele RC Pilling AB Camidge DR Mechanisms of resistance to crizotinib in patients with ALK gene rearranged non-small cell lung cancer Clin Cancer Res 18 1472 1482 2012 22235099 23 Shaw AT Engelman JA ALK in lung cancer: past present and future J Clin Oncol 31 1105 1111 2013 23401436 24 Sasaki T Koivunen J Jnne PA A novel ALK secondary mutation and EGFR signaling cause resistance to ALK kinase inhibitors Cancer Res 71 6051 6060 2011 21791641 25 Latif M Saeed A Kim SH Journey of the ALK-inhibitor CH5424802 to phase II clinical trial Arch Pharm Res 36 1051 1054 2013 23700294 26 Passoni L Scardino A Gambacorti-Passerini C ALK as a novel lymphoma-associated tumor antigen: identification of 2 HLA-A2.1-restricted CD8+T-cell epitopes Blood 99 2100 2106 2002 11877285 27 Hirohashi Y Torigoe T Maeda A An HLA-A24-restricted cytotoxic T lymphocyte epitope of a tumor-associated protein survivin Clin Cancer Res 8 1731 1739 2002 12060610 28 Hirano N Butler MO Xia Z Engagement of CD83 ligand induces prolonged expansion of CD8+T cells and preferential enrichment for antigen specificity Blood 107 1528 1536 2006 16239433 29 Yoshikawa T Nakatsugawa M Sakemura N HLA-A2- restricted glypican-3 peptide-specific CTL clones induced by peptide vaccine show high avidity and antigen-specific killing activity against tumor cells Cancer Sci 102 918 925 2011 21281401 30 Robinson KW Sandler AB EGFR tyrosine kinase inhibitors: difference in efficacy and resistance Curr Oncol Rep 15 396 404 2013 23674236 31 Lesniak D Sabri S Abdulkarim B Spontaneous epithelial- mesenchymal transition and resistance to HER-2-targeted therapies in HER-2-positive luminal breast cancer PLoS One 8 e71987 2013 23991019 32 Sawada Y Yoshikawa T Nakatsura T Phase I trial of a glypican-3-derived peptide vaccine for advanced hepatocellular carcinoma: immunologic evidence and potential for improving overall survival Clin Cancer Res 18 3686 3696 2012 22577059 33 Nakatsura T Yoshitake Y Nishimura Y Glypican-3 overexpressed specifically in human hepatocellular carcinoma is a novel tumor marker Biochem Biophys Res Commun 306 16 25 2003 12788060 34 Okabe H Satoh S Nakamura Y Genome-wide analysis of gene expression in human hepatocellular carcinomas using cDNA microarray: identification of genes involved in viral carcinogenesis and tumor progression Cancer Res 61 2129 2137 2001 11280777 35 Saito-Hisaminato A Katagiri T Nakamura Y Genome-wide profiling of gene expression in 29 normal human tissues with a cDNA microarray DNA Res 9 35 45 2002 12056413 36 Weir GM Liwski RS Mansour M Immune modulation by chemotherapy or immunotherapy to enhance cancer vaccines Cancers 3 3114 3142 2011 24212948 37 Hodge JW Ardiani A Gameiro SR The tipping point for combination therapy: cancer vaccines with radiation chemotherapy or targeted small molecule inhibitors Semin Oncol 39 323 339 2012 22595055 38 Garnett CT Palena C Hodge JW Sublethal irradiation of human tumor cells modulates phenotype resulting in enhanced killing by cytotoxic T lymphocytes Cancer Res 64 7985 7994 2004 15520206 39 Gelbard A Garnett CT Hodge JW Combination chemotherapy and radiation of human squamous cell carcinoma of the head and neck augments CTL-mediated lysis Clin Cancer Res 12 1897 1905 2006 16551875 40 Kaneno R Shurin GV Shurin MR Chemotherapeutic agents in low noncytotoxic concentrations increase immunogenicity of human colon cancer cells Cell Oncol 34 97 106 2011 41 Ramakrishnan R Assudani D Gabrilovich DI Chemotherapy enhances tumor cell susceptibility to CTL-mediated killing during cancer immunotherapy in mice J Clin Invest 120 1111 1124 2010 20234093 42 Choi YL Soda M Yamashita Y EML4-ALK mutations in lung cancer that confer resistance to ALK inhibitors N Engl J Med 363 1734 1739 2010 20979473 43 Katayama R Khan TM Benes C Therapeutic strategies to overcome crizotinib resistance in non-small cell lung cancers harboring the fusion oncogene EML4-ALK Proc Natl Acad Sci USA 108 7535 7540 2011 21502504 44 Lovly CM Pao W Escaping ALK inhibition: mechanisms of and strategies to overcome resistance Sci Transl Med 4 120ps2 2012 Figure 1 EML4-ALK-derived peptides bound to HLA-A2 or HLA-A24 molecules. In vitro cellular peptide binding assays for HLA-A*02:01 (A) or HLA-A*24:02 (B) were performed using a FACS system. Figure 2 IFN-? release by in vitro-induced anti-EML4-ALK CTLs. CD8+ T cells from four healthy donors were stimulated with EML4-ALK-derived peptide-pulsed autologous DCs and aAPCs. CTLs induced by EML4-ALK-derived peptides (1—105) were stimulated with T2 cells pulsed with or without 1 ?M EML4-ALK-derived peptides. IFN-?-producing CTLs were detected by IFN-? ELISPOT assay. DCs dendritic cells; aAPCs artificial antigen presenting cells; CTLs cytotoxic T cells. Figure 3 Peptide A-specific CTL clone established from anti-EML4-ALK CTL. (A) Peptide A-specific CTL clones established using CD107a single cell sorting. Peptide A-specific CTLs (1—105) were incubated with peptide-pulsed T2 cells (5—104) with CD107a-specific antibodies for 3.5 h at 37°C. CD8+CD107a+ cells were sorted using a FACSAria II cell sorter. Square CD8+CD107a+ cells that are peptide A-specific CTL clones. (B) Recognition of peptide-pulsed T2 cells by peptide A-specific CTL clones. A peptide A-specific CTL clone (1—104 cells) was incubated with stimulator cells that had been pulsed with 1 ?M peptide A or HIV-gag peptide. IFN-?-producing CTLs were detected by IFN-? ELISPOT assay. CTLs cytotoxic T cells. Figure 4 Recognition of lung carcinoma cells expressing HLA-A*02:01 and the EML4-ALK fusion gene by the peptide A-specific CTL clone. The peptide A-specific CTL clone recognized H2228 cells pretreated with IFN-? 48 h prior to the assay. (A) The peptide A-specific CTL clone (1—104 cells) was incubated with H2228 cells with or without IFN-?. IFN-? production was detected by IFN-? ELISPOT assay. (B) IFN-? increased expression of HLA-A2 presented on H2228 cells. Incubation of H2228 cells with 100 U/ml IFN-? for 48 h increased HLA-A2 presentation on the cells. Dotted line HLA-A2 on H2228 cells without IFN-?. Black line HLA-A2 on H2228 cells incubated with IFN-? (higher than on H2228 cells without IFN-?). Dashed line and shaded region: no staining of H2228 cells with/without IFN-?. (C) Inhibition of IFN-? production by an anti-HLA-class I mAb. Blocking experiments were performed using an HLA-A -B -C-specific mAb (W6/32) or an isotype control mAb (mIgG2a?). The peptide A-specific CTL clone was incubated with H2228 cells (HLA-A*02:01+/EML4-ALK+) pretreated with IFN-? 48 h prior to examination. IFN-?-producing CTL clones were detected by IFN-? ELISPOT assay. The bar graph shows the percentage of inhibition. CTL cytotoxic T cell. Figure 5 Cytotoxic activity of the peptide A-specific CTL clone against H2228 cells. The peptide A-specific CTL clone was incubated with H2228 cells pretreated with IFN-? 48 h prior to the assay at various E/T ratios and specific lysis was assessed. Blocking experiments were performed using the HLA-A -B -C-specific mAb (W6/32) or the isotype control mAb (mIgG2a?). CTL cytotoxic T cell. Table I HLA-A2 peptide binding predictions of the BIMAS program. Peptide name Peptide sequence Binding scorea A RLSALESRV 69.552 B AISEDHVASV 90.183 C TVLKAALADV 51.79 D"
Lung_Cancer
"This may be the reason why this pathway is universally aberrant in all the LUAD samples we assessed. Our analysis of this pathway in other cancer types demonstrated less of a role for this pathway suggesting that it is more LUAD specific. We believe that the common disruption of this pathway is a novel discovery as this pathway consisting of 17 genes has not been reported as an indicator of LUAD in any of the studies we acquired datasets from (GSE10082 GSE7670 GSE10072) nor in a literature search with key words.4 SWe have proposed personalized extensions to ORA- and FCS-based pathway analysis by introducing the concept of comparing an individual tumor with many normal samples. Exploratory analyses of our methods with previously published survival pathway signatures reproduced the correct survival outcomes. We have also demonstrated that using nRef improves the validation rate. Unbiased clustering with iPASs revealed sample clustering which is indicative of the cancer differentiation status of LUAD and of different survival outcomes. Clustering also identifies pathway characteristics from patients displaying common up- or downregulations and subgroup-specific deregulations.Pathways that are commonly deregulated across all cancer patients may be useful in identifying cancer from unknown samples. We explored the pathway-based identification of cancer with ˜amino acid synthesis and interconversion and transamination™ pathway which is commonly upregulated in LUAD patients. Validation using independent datasets demonstrated that this pathway is useful in classifying LUAD and normal lung samples.Based on our results we conclude that individualized pathway scores using nRef can provide a sensitive measure of a patient™s clinical features and can be useful for identifying cancer.In our empirical study Average Z performed best in highlighting pathway aberrance and in further revealing clinical importance. It had the best statistical power when identifying a previously known survival-related pathway and the best averaged validation rate for LUAD and colon cancer. In the pathway-based identification of cancer the Mahalanobis method performed best.An important clinical aspect of our methods is that it enables the interpretation of a cancer case in a single patient even if matched normal tissue data from the same individual are unavailable. Accumulated information of normal tissues from a data repository will take the place of data unavailable for a specific individual. As the data repository is growing rapidly it is expected that more ˜nRef™ data will be available for many diseases in the near future. We hope that our proposed approach can help in the personalized interpretation of tumor data and can be a useful tool in the upcoming era of data-based personalized medicine.Although we have shown our results in microarray platform our method is applicable to different RNA expression platforms including next-generation sequencer. Our method is also supportive of various pathway resources such as KEGG NCI cancer pathway and Biocarta provided in the gmt format. The R code for our methods along with nRefs of LUAD and colon cancer used in our study is available at http://bibs.snu.ac.kr/ipas. Supplementary Material Supplementary Data ACKNOWLEDGEMENT The authors thank Jaehoon Lee and Sungyoung Lee for discussion. Funding: This work was supported by the National Research Foundation of Korea (NRF) grant (2012R1A3A2026438) and by the Bio & Medical Technology Development Program of the NRF grant (2013M3A9C4078158). Conflict of interest: none declared. REFERENCES Bandres E A gene signature of 8 genes could identify the risk of recurrence and progression in Dukes' B colon cancer patients Oncol. Rep. 2007 17 1089 1094 17390049 Barletta JA Prognostic significance of grading in lung adenocarcinoma Cancer 2010 116 659 669 20014400 Barrett T NCBI GEO: archive for functional genomics data sets”update Nucleic Acids Res. 2012 41 D991 D995 23193258 Barrier A Stage II colon cancer prognosis prediction by tumor gene expression profiling J. Clin. Oncol. 2006 24 4685 4691 16966692 Barrier A Prognosis of stage II colon cancer by non-neoplastic mucosa gene expression profiling Oncogene 2007 26 2642 2648 17043639 Beer DG Gene-expression profiles predict survival of patients with lung adenocarcinoma Nat. Med. 2002 8 816 824 12118244 Bolstad BM A comparison of normalization methods for high density oligonucleotide array data based on variance and bias Bioinformatics 2003 19 185 193 12538238 Breitling R Iterative Group Analysis (iGA): a simple tool to enhance sensitivity and facilitate interpretation of microarray experiments BMC Bioinformatics 2004 5 34 15050037 Bryant CM Clinically relevant characterization of lung adenocarcinoma subtypes based on cellular pathways: an international validation study PLoS One 2010 5 e11712 20661423 Croft D Reactome: a database of reactions pathways and biological processes Nucleic Acids Res. 2011 39 D691 D697 21067998 Dancey JE The genetic basis for cancer treatment decisions Cell 2012 148 409 420 22304912 Drier Y Pathway-based personalized analysis of cancer Proc. Natl Acad. Sci. USA 2013 110 6388 6393 23547110 Eschrich S Molecular staging for survival prediction of colorectal cancer patients J. Clin. Oncol. 2005 23 3526 3535 15908663 Hou J Gene expression-based classification of non-small cell lung carcinomas and survival prediction PLoS One 2010 5 e10312 20421987 Irizarry RA Exploration normalization and summaries of high density oligonucleotide array probe level data Biostatistics 2003 4 249 264 12925520 Jones SJ Evolution of an adenocarcinoma in response to selection by targeted kinase inhibitors Genome Biol. 2010 11 R82 20696054 Khatri P Ten years of pathway analysis: current approaches and outstanding challenges PLoS Comput. Biol. 2012 8 e1002375 22383865 Kopetz S Abbruzzese JL Barriers to integrating gene profiling for stage ii colon cancer Clin. Cancer Res. 2009 15 7451 7452 19996205 Landi MT Gene expression signature of cigarette smoking and its role in lung adenocarcinoma development and survival PLoS One 2008 3 e1651 18297132 Lee ES Prediction of recurrence-free survival in postoperative non-small cell lung cancer patients by using an integrated model of clinical information and gene expression Clin. Cancer Res. 2008 14 7397 7404 19010856 Lin YH Multiple gene expression classifiers from different array platforms predict poor prognosis of colorectal cancer Clin. Cancer Res. 2007 13 498 507 17255271 Lu TP Integrated analyses of copy number variations and gene expression in lung adenocarcinoma PLoS One 2011 6 e24829 21935476 Marisa L Gene expression classification of colon cancer into molecular subtypes: characterization validation and prognostic value PLoS Med. 2013 10 e1001453 23700391 Munoz-Pinedo C Cancer metabolism: current perspectives and future directions Cell Death Dis. 2012 3 e248 22237205 Smith JJ Experimentally derived metastasis gene expression profile predicts recurrence and death in patients with colon cancer Gastroenterology 2010 138 958 968 19914252 Su LJ Selection of DDX5 as a novel internal control for Q-RT-PCR from microarray data using a block bootstrap re-sampling scheme BMC Genomics 2007 8 140 17540040 Subramanian A Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles Proc. Natl Acad. Sci. USA 2005 102 15545 15550 16199517 Tian L Discovering statistically significant pathways in expression profiling studies Proc. Natl Acad. Sci. USA 2005 102 13544 13549 16174746 Vaske CJ Inference of patient-specific pathway activities from multi-dimensional cancer genomics data using PARADIGM Bioinformatics 2010 26 i237 i245 20529912 Wang Y Gene expression profiles and molecular markers to predict recurrence of Dukes' B colon cancer J. Clin. Oncol. 2004 22 1564 1571 15051756 Am J Respir Cell Mol Biol Am. J. Respir. Cell Mol. Biol ajrcmb American Journal of Respiratory Cell and Molecular Biology 1044-1549 1535-4989 American Thoracic Society 23980547 3930939 2013-0314TR 10.1165/rcmb.2013-0314TR Translational Review The Role of Vimentin Intermediate Filaments in the Progression of Lung Cancer Kidd Martha E. 1 2 Shumaker Dale K. 2 Ridge Karen M. 2 1Department of Biomedical Engineering Northwestern University Evanston Illinois; and 2Division of Pulmonary and Critical Care Medicine Northwestern University Feinberg School of Medicine Chicago Illinois Correspondence and requests for reprints should be addressed to Karen M. Ridge Ph.D. Division of Pulmonary and Critical Care Medicine Northwestern University Feinberg School of Medicine 240 East Huron Street McGaw M328 Chicago IL 60611. E-mail: [email protected] 1 2014 1 2014 50 1 1 6 08 7 2013 30 7 2013 Copyright © 2014 by the American Thoracic Society 2014 There is an accumulation of evidence in the literature demonstrating the integral role of vimentin intermediate filaments (IFs) in the progression of lung cancers. Vimentin IF proteins have been implicated in many aspects of cancer initiation and progression including tumorigenesis epithelial-to-mesenchymal transition (EMT) and the metastatic spread of cancer. Specifically vimentin IFs have been recognized as an essential component regulating EMT major signal transduction pathways involved in EMT and tumor progression cell migration and invasion the positioning and anchorage of organelles such as mitochondria and cell“cell and cell“substrate adhesion. In tumorgenesis vimentin forms a complex with 14-3-3 and beclin 1 to inhibit autophagy via an AKT-dependent mechanism. Vimentin is a canonical marker of EMT and recent evidence has shown it to be an important regulator of cellular motility. Transcriptional regulation of vimentin through hypoxia-inducible factor-1 may be a potential driver of EMT. Finally vimentin regulates 14-3-3 complexes and controls various intracellular signaling and cell cycle control pathways by depleting the availability of free 14-3-3. There are many exciting advances in our understanding of the complex role of vimentin IFs in cancer pointing to the key role vimentin IFs may play in tumor progression. Keywords epithelial-to-mesenchymal transition invadopodia lung cancer metastatic cascade vimentin 8711562 6325 Oncogene Oncogene Oncogene 0950-9232 1476-5594 23752194 3839253 10.1038/onc.2013.208 NIHMS490151 Article ARF Inhibits the Growth and Malignant Progression of Non-Small Cell Lung Carcinoma Busch Stephanie E 1 2 Moser Russell D 1 Gurley Kay E 1 Kelly-Spratt Karen S 1 Liggitt H Denny 3 Kemp Christopher J 1 1Division of Human Biology Fred Hutchinson Cancer Research Center Seattle Washington 98109 2Molecular and Cellular Biology Graduate Program University of Washington Seattle Washington 98195 3Department of Comparative Medicine University of Washington Seattle Washington 98195 Corresponding author: Christopher J. Kemp Ph.D. Fred Hutchinson Cancer Research Center 1100 Fairview Ave N Mail Stop C1-015 Seattle WA 98109. [email protected]. Phone: (206) 667-4252. Fax: (206) 667-5815 11 7 2013 10 6 2013 15 5 2014 15 5 2015 33 20 2665 2673 Non-small cell lung carcinoma (NSCLC) is among the deadliest of human cancers. The CDKN2A locus which houses the INK4a and ARF tumor suppressor genes is frequently altered in NSCLC. However the specific role of ARF in pulmonary tumorigenesis remains unclear. KRAS and other oncogenes induce the expression of ARF thus stabilizing p53 activity and arresting cell proliferation. To address the role of ARF in Kras-driven NSCLC we compared the susceptibility of NIH/Ola strain wild-type and Arf knockout mice to urethane-induced lung carcinogenesis. Lung tumor size malignancy and associated morbidity were significantly increased in Arf?/? compared to Arf+/+ animals at 25 weeks post-induction. Pulmonary tumors from Arf knockout mice exhibited increased cell proliferation and DNA damage compared to wild-type. A subgroup of tumors in Arf?/? animals presented as dedifferentiated and metastatic with many characteristics of pulmonary sarcomatoid carcinoma a neoplasm previously undocumented in mouse models. Our finding of a role for ARF in NSCLC is consistent with the observation that benign adenomas from Arf+/+ mice robustly expressed ARF while ARF expression was markedly reduced in malignant adenocarcinomas. ARF expression also frequently co-localized with expression of p21CIP1 a transcriptional target of p53 arguing that ARF induces the p53 checkpoint to arrest cell proliferation in vivo. Together these findings demonstrate that induction of ARF is an early response in lung tumorigenesis that mounts a strong barrier against tumor growth and malignant progression. p19Arf p14ARF ethyl carbamate metastasis J Transl Med J Transl Med Journal of Translational Medicine 1479-5876 BioMed Central 24726028 3996904 1479-5876-12-98 10.1186/1479-5876-12-98 Research Thymidylate synthase polymorphisms in genomic DNA as clinical outcome predictors in a European population of advanced non-small cell lung cancer patients receiving pemetrexed Arévalo Estefanía 1 [email protected] Castañón Eduardo 1 [email protected] López Inés 2 [email protected] Salgado Josefa 3 [email protected] Collado Víctor 2 [email protected] Santisteban Marta 1 [email protected] Rodríguez-Ruiz María 4 [email protected] Martín Patricia 1 [email protected] Zubiri Leire 4 [email protected] Patiño-García Ana 3 [email protected] Rolfo Christian 5 [email protected] Gil-Bazo Ignacio 1 2 [email protected] 1Department of Oncology Clínica Universidad de Navarra 31008 Pamplona Spain 2Division of Oncology Center for Applied Medical Research (CIMA) 31008 Pamplona Spain 3Laboratory of Clinical Genetics Clínica Universidad de Navarra 31008 Pamplona Spain 4Department of Radiation Oncology Clínica Universidad de Navarra 31008 Pamplona Spain 5Oncology Department Antwerp University Hospital UZA 2650 Edegem Belgium 2014 14 4 2014 12 98 98 3 11 2013 7 4 2014 Copyright © 2014 Arévalo et al.; licensee BioMed Central Ltd. 2014 Arévalo et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article unless otherwise stated. Background We studied whether thymidylate synthase (TS) genotype has an independent prognostic/predictive impact on a European population of advanced non-small cell lung cancer (NSCLC) patients receiving pemetrexed. Methods Twenty-five patients treated with pemetrexed-based regimens were included. Genomic DNA was isolated prior to treatment. The variable number of tandem repeat (VNTR) polymorphisms the G >?C single nucleotide polymorphisms (SNP) and the TS 6-bp insertion/deletion (6/6) in the 3? untranslated region (UTR) polymorphisms were analyzed and correlated with overall response rate (ORR) progression-free survival (PFS) overall-survival (OS) and toxicity. Results The genotype +6/+6 predicted a higher ORR among active/former smokers compared to +6/-6 genotype (100% vs. 50%; p =?0.085). Overall the 3R/3R genotype predicted a higher ORR (100%) over the rest VNTR polymorphisms (p =?0.055). The presence of 3R/3R genotype significantly correlated with a superior ORR in patients without EGFR activating mutations (100%) compared to 2R/2R 2R/3R and 3R/4R genotype (77.8% 33.3% and 0% respectively; p =?0.017). After a median follow-up of 21 months a trend towards a better PFS although not significant was found among subjects showing 3R/3R polymorphisms (p =?0.089). A significantly superior OS was found in patients showing 3R/3R genotype rather than other VNTR polymorphisms (p =?0.019). No significant correlation with the toxicity was observed. Conclusion In our series 3R/3R polymorphism correlated with a superior OS. Also this polymorphism when associated to wild type EGFR was related to a higher ORR to pemetrexed. Toxicity was not significantly correlated with a specific TS genotype. Thymidylate synthase Polymorphisms Epidermal growth factor receptor Predictive factors Prognostic factors Non-small cell lung cancer Background Lung cancer represents the most frequent cause of cancer deaths. More than 225000 new cases were diagnosed during 2012 only in the United States of America accounting for approximately 160000 annual deaths [12]. More than 50% of the patients diagnosed with non-small cell lung cancer (NSCLC) present advanced disease (stage III and IV) at onset. The most common histology is adenocarcinoma representing approximately 80% of all cases [3]. Pemetrexed is a multitargeted antifolate drug and one of the latest active drugs against NSCLC [4] approved for the first-line [5] (in combination with cisplatin) [6] and second-line treatment (monotherapy) of patients with non-squamous histology [7]. More recently pemetrexed gained approval for its use as a single-agent maintenance therapy [8] after response/stabilization to four cycles of a platinum doublet with or without pemetrexed. Thymidylate synthase (TS) is the main biological target of antifolate drugs such as pemetrexed or 5-fluorouracil. Different studies have evaluated the correlation between tumor TS expression and TS genotype and the prognosis of patients with different cancer types treated with antifolates [9-11]. In NSCLC constitutive expression of TS is lower in tumors with adenocarcinoma histology than among those with squamous differentiation [12]. This finding could possibly explain the higher efficacy of the drug among non-squamous histology patients. The potential predictive role of TS polymorphisms in NSCLC has never been studied in a European population. In addition how differential TS genotypes may impact on the outcome of patients depending on their smoking status or with Epidermal Growth Factor Receptor (EGFR) activating mutations tumors is to be determined. Finally although the toxicity profile described in most patients receiving pemetrexed in combination or as a single agent is usually favorable there are several reported cases of fundamentally dermatological hematological and potentially serious renal toxicities even when the recommended vitamin prophylaxis guidelines have been followed [13-15]. "
Lung_Cancer
"Background Complement receptor 1 (CR1) the receptor for C3b/C4b complement peptides plays a crucial role in carcinogenesis. However the association of genetic variants of CR1 with susceptibility to lung cancer remains unexplored. Methods This case-control study included 470 non-small cell lung cancer (NSCLC) patients and 470 cancer-free controls. Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs. Odds ratios (ORs) and 95% confidence intervals (CIs) were computed by logistic regression to evaluate the association of each tag SNP with NSCLC. Results Multivariate regression analysis indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. When stratified by smoking status the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.79) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65). When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year). Similarly GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). Conclusion CR1 rs7525160 G?>?C polymorphism was associated with an increased risk of developing NSCLC in Chinese population. The association displays a manner of gene-environmental interaction between CR1 rs7525160 tagSNP and smoking status. CR1 Polymorphism Tag SNPs Lung cancer Background The complement system plays a critical role in the process of carcinogenesis. Despite of significant research controversial viewpoints remain on the exact relationship of complement system with cancer. Classically the complement system fights against cancer by exerting the effects of immunosurveillance in the immunologic microenvironment of tumors [1]. Recently it was found that complement may contribute to tumor growth by a wide variety of mechanisms including dysregulation of mitogenic signaling pathways sustained cellular proliferation angiogenesis insensitivity to apoptosis invasion and migration and escape from complement cytotoxicity [2]. This suggested complement just like a double-edged sword plays a dual role in carcinogenesis. In particular component C3 and its receptors have been demonstrated to be a key link between innate and adaptive immunity [3]. Complement receptor type 1 (CR1 CD35) is a multifunctional polymorphic glycoprotein which binds to C3b fragment of C3 and to C4b with lower affinity [45]. CR1 belongs to the regulators of complement activation (RCA) family of proteins and is expressed in a wide spectrum of cells and involved in T-cell and B-cell mediated immune regulation [67]. CR1 also modulates the complement cascade activation by preventing formation of classical and alternative pathway convertases and by acting as a cofactor for factor I mediated inactivation of C3b and C4b [89]. It has been demonstrated that chronic inflammation can predispose to cancer development and spread [10] as a fundamental component of innate immunity the complement cascade consists of potential proinflammatory molecules especially C3 and C5. Moreover complement activation and abnormal expression in tumor tissues has been demonstrated [11]. Considering the important role of CR1 in complement activation innate immunity and chronic inflammation CR1 has emerged as a molecule of immense interest in gaining insight into the susceptibility to cancer. CR1 gene is located on the Chromosome 1 at the locus 1q32 [12]. Various polymorphisms have been studied including the intronic and exonic density polymorphism for their ability to alter the density of erythrocyte CR1 on the cell membranes [13-15]. There are also the molecular weight variants due to insertion-deletion polymorphisms [16]. Up to now there have been very few studies on the association of genetic variants of CR1 with susceptibility to autoimmune and inflammatory diseases. It has been proposed that genetic variant at CR1 gene (rs6656401) might influence the susceptibility to late-onset Alzheimer™s disease [17]. CR1 expression in Peripheral Blood Mononuclear Cells (PBMCs) may be a new biomarker for prognosis of nasopharyngeal carcinoma and a potential therapeutic target [18]. Recently it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However the association of genetic variants of CR1 with risk of lung cancer remains unexplored. Worldwide lung cancer is the most common cancer in terms of both incidence and mortality [20]. NSCLC is the most common subtype of lung cancer and less aggressive and metastic than SCLC. Although cigarette smoking is the predominant risk factor for lung cancer inherited genetic characteristics are presumed to account in part for this interindividual variation in lung cancer susceptibility. Recently several genome-wide association studies have demonstrated the common genetic variations associated with susceptibility to lung cancer [21-24]. Given the involvement of the complement system in coordinating innate immunity and inflammatory response [25] further examination of the potential association between genetic variation of CR1 genes and lung cancer is warranted. In the current study we conducted a case-control study to investigate the association of tag SNPs in CR1 gene with the risk of NSCLC and effect of the interaction of gene-environment on the risk of NSCLC. Results Subject characteristics The frequency distributions of select characteristics in cases and control subjects were shown in . The mean age (±SD) was 59.6?±?10.5 years for the cancer patients and 57.2?±?13.3 years for the controls. No significant difference was found in the mean age between cases and controls (P?=?0.470). There was no significant difference in proportion of sex and smoking status between cases and controls (P?=?0.832 and P?=?0.321 respectively). However there was significant difference between cases and controls when compared by pack-year smoked (P = 0.001). The heavy smokers (?25 pack-year) accounted for 61.5% in cases but only 45.5% in controls which suggested that cigarette smoking was a prominent contributor to the risk of lung cancer. Of the 470 case patients 178 (37.9%) were diagnosed as adenocarcinoma 238 (50.6%) as squamous cell carcinoma and 100 (%) as other types including large cell carcinoma (n?=?49) and mixed cell carcinoma (n?=?5). Distributions of select characteristics in cases and control subjects Variables ???Cases (n?=?470) ???Controls (n?=?470) No (%) No (%) P a ???Sex 0.832 ???Male 324 68.9 328 69.8 ???Female 146 31.1 142 30.2 ???Age 0.470 ???<50 84 17.9 96 20.4 ???50-59 177 37.7 187 39.8 ???60-69 129 27.4 111 23.6 ????70 80 17.0 76 16.2 ???Smoking status 0.321 ???Non-smoker 265 56.4 281 59.8 ???Smoker 205 43.6 189 40.2 ???Pack-year smoked 0.001 ???<25 75 36.6 96 50.8 ????25 130 63.4 93 49.2 aTwo-sided ?2 test. Association of CR1 tag SNP with NSCLC risk Total 13 selected tag SNPs of CR1 in HapMap database among Chinese population were analyzed. Except for rs9429782 polymorphism the genotype distributions of other SNPs in controls were consistent to Hardy-Weinberg equilibrium. Therefore we excluded the rs9429782 from further analysis. In order to screen the genetic variants that confer the susceptibility to lung cancer 12 candidate tagSNPs were genotyped in a case-control study consisting of 470 lung cancer patients and 470 cancer-free controls as shown in . Importantly genotype frequency of one intronic SNP (rs7525160 G?>?C) in cases was found to be significantly different from those of controls (?2?=?6.339 P=0.042). Further multivariate regression model with adjustment for age gender and smoking status was used to assess the association between rs7525160 G?>?C polymorphism and the risk of NSCLC. The results indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC with OR (95% CI) of 1.52 (1.02-2.28) compared with the GG genotype. Other tagSNPs of CR1 were not significantly associated with the risk of NSCLC in our study population (P >0.05). Genotype frequencies of CRI among cases and controls and their association with non-small cell lung cancers CRI Genotypes ??Controls (n?=?470) ??Cases (n?=?470) OR (95% CI ) * P No (%) No (%) rs7525160 ??GG 176 37.5 139 29.6 1.00 (ref.) ??CG 228 48.5 256 54.5 1.38 (1.04-1.85) 0.041 ??CC 66 14.0 75 15.9 1.52 (1.02-2.28) 0.028 rs3886100 ??GG 117 24.9 105 22.4 1.00 (ref.) ??AG 223 47.4 253 53.8 1.33 (0.97-1.81) 0.078 ??AA 130 27.7 112 23.8 1.06 (0.73-1.54) 0.755 rs11118167 ??TT 348 74.1 353 75.1 1.00 (ref.) ??CT 111 23.6 102 21.7 0.89 (0.65-1.21) 0.457 ??CC 11 2.3 15 3.2 1.35 (0.61-3.01) 0.461 rs9429782 ??GG 250 53.2 261 55.5 1.00 (ref.) ??GT 220 46.8 209 44.5 0.89 (0.69-1.16) 0.388 rs10494885 ??CC 178 37.9 164 34.9 1.00 (ref.) ??CT 224 47.6 232 49.4 1.11 (0.83-1.47) 0.490 ??TT 68 14.5 74 15.7 1.20 (0.81-1.78) 0.365 rs7542544 ??CC 128 27.2 108 23.0 1.00 (ref.) ??AC 223 47.5 252 53.6 1.21 (0.88-1.67) 0.239 ??AA 119 25.3 110 23.4 0.90 (0.62-1.30) 0.897 rs6691117 ??AA 324 68.9 327 69.6 1.00 (ref.) ??AG 131 27.9 128 27.2 0.98 (0.73-1.31) 0.888 ??GG 15 3.2 15 3.2 0.96 (0.46-2.02) 0.923 rs6656401 ??GG 436 92.8 447 95.1 1.00 (ref.) ??AG 34 7.2 23 4.9 0.68 (0.39-1.18) 0.174 ??AA 0 0.0 0 0.0 NC§ rs2296160 ??CC 185 39.4 194 41.3 1.00 (ref.) ??CT 226 48.1 220 46.8 0.91 (0.69-1.21) 0.521 ??TT 59 12.5 56 11.9 0.90 (0.59-1.37) 0.606 rs9429942 ??TT 452 96.2 457 97.2 1.00 (ref.) ??CT 18 3.8 13 2.8 0.77 (0.37-1.61) 0.482 ??CC 0 0.0 0 0.0 NC§ rs4844600 ??GG 171 36.4 179 38.1 1.00 (ref.) ??AG 230 48.9 228 48.5 0.92 (0.70-1.22) 0.571 ??AA 69 14.7 63 13.4 0.87 (0.58-1.31) 0.513 rs3818361 ??CC 187 39.8 188 40.0 1.00 (ref.) ??CT 224 47.7 224 47.7 0.98 (0.74-1.29) 0.868 ??TT 59 12.5 58 12.3 0.96 (0.63-1.46) 0.848 rs17048010 ??TT 301 64.0 286 60.8 1.00 (ref.) ??CT 154 32.8 164 34.9 1.09 (0.82-1.43) 0.556 ??CC 15 3.2 20 4.3 1.40 (0.70-2.79) 0.343 *Adjusted by age sex and smoking status; §NC not calculated. Table 3 Summary of MDR gene-gene interaction results Models Training bal. acc. (%) Testing bal. acc. (%) P value Cross-validation consistency rs7525160 54.03 50.53 0.828 7/10 rs4844600 rs10494885 55.45 49.32 0.989 3/10 rs4844600 rs10494885 rs7525160 57.60 48.48 0.623 6/10 Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene interaction models is listed in Table 3. The SNP rs7525160 in CR1 had the highest testing balanced accuracy among 12 SNPs. The three-way interaction model among rs4844600 rs10494885 and rs7525160 showed high testing balance accuracy and cross validation consistency but the testing balanced accuracy was lower than the two-way gene-gene interaction in NSCLC. For each model the interaction was not significant (P?>?0.05). Table 4 Risk of CR1 genotypes with NSCLC by smoking status Smoking status CR1 genotype GG * OR (95% CI) § P value CG?+?CC * OR (95% CI) § P value Non-smoker 84/99 1.00 (reference) 181/182 1.15 (0.81-1.65) 0.440 Smoker 55/77 0.86 (0.54-1.38) 0.528 150/112 1.72 (1.15-2.59) 0.009 <25 pack-years 19/41 0.59 (0.31-1.10) 0.099 56/55 1.32 (0.81-2.61) 0.266 ?25 pack-years 36/36 1.18 (0.67-2.08) 0.562 94/57 2.01 (1.26-3.20) 0.003 *Number of cases/number of controls. §Data were calculated by logistic regression and adjusted for age and gender. Interaction of CR1 SNP with smoking Cigarette smoking is a well-known risk for lung cancer so stratification by smoking status was performed to investigate the association of rs7525160 G?>?C variant with the risk of NSCLC. As shown in Table 4 the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) suggesting that the CR1 rs7525160 G?>?C polymorphism is a smoking-modifying risk factor for susceptibility to NSCLC. When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year) consistently GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). The P value for heterogeneity of the stratification analysis by smoking status is 0.015. However the P value for interaction between rs7525160 polymorphism and smoking is 0.172 and the power for the interaction is 0.49. Discussion The chronic airway inflammation and dysfunctional immune system might promote pulmonary carcinogenesis. Implicated in the immune and inflammatory responses the complement cascade plays a pivotal role in the development of cancer. Thus it is likely that the genetic variants of CR1 in the complement system confer the susceptibility to lung cancer. In this study we have for the first time demonstrated that one intronic SNP (rs7525160 G?>?C) out of 13 tag SNPs of CR1 was associated with the risk of NSCLC in Chinese population. Notably the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. MDR analysis also showed that there was no gene-gene interaction among 12 tag SNPs in CR1 gene. Moreover the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) indicating this SNP is a smoking-modifying risk factor for susceptibility to NSCLC. To the best of our knowledge this study shed new insight into the interplay of genetic variation of CR1 with lung cancer risk. More importantly it highlights the potential gene-environmental interaction influences the susceptibility to lung cancer. The complement system has been proposed to get involved in innate immunity with the ability to œcomplement antibody-mediated elimination of immune complex and foreign pathogens [26]. Upon complement activation the biologically active peptides C5a and C3a elicit a lot of pro-inflammatory effects and could be closely associated with tumorigenesis [27]. Complement proteins play a dual role in the tumor microenvironment. On one hand they exert a defensive effect against tumor through complement or antibody-dependent cytotoxicity [128]. On the other hand they may escape from immunosurveillance and facilitate carcinogenesis [2]. Specifically a number of experimental evidence has suggested an association between complement activation and tumor growth [2930] which provides a strong biologically link between the abnormal expression and activity of complement cascade and carcinogenesis. Till now a few studies have been carried out to demonstrate the association of genetic variants in complement proteins with susceptibility to cancer. A significant association of CR2 SNP (rs3813946) with the development of nasopharyngeal carcinoma was indicated in Cantonese population [31] and the genetic variations of complement system genes C5 and C9 plays a potential role in susceptibility to non-Hodgkin lymphoma (NHL) [32]. Recently it has been shown that complement factor H Y402H polymorphism interact with cigarette smoking to confer the susceptibility to lung cancer [33]. Furthermore it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However whether the genetic variants of CR1 are related to the risk of lung cancer remains unknown. In this case-control study we found an intronic SNP (rs7525160 G?>?C) with CC genotype was significantly associated with an increased risk of NSCLC. Consistently our results were in accordance with the study that genetic polymorphisms in innate immunity genes may play a role in the carcinogenesis of lung cancer [34]. It is likely that some genetic variations in strong link disequilibrium with this intronic SNP (rs7525160 G?>?C) are functional which provides a new insight into the hallmarks in susceptibility to lung cancer and further functional experiments are warranted to address the proposal. Functionally human CR1 exists on the surface of almost all peripheral blood cells and plays a key role in immune complex clearance and complement inhibition at the cell surface by binding to activated products C3b and C4b [435]. CR1 also possesses cofactor activity for the serum protease factor I and is thus involved in the generation of further fragments of C3/4b with the activation of complement cascade and the cellular immune response [4]. In our study the association of CR1 polymorphism with lung cancer is biologically plausible in that the intronic polymorphism could affect the density of CR1 molecules on the cell surface thereby contributing to autoimmune disorders and neoplasm. Tobacco smoking is an established risk factor for susceptibility to lung cancer. However not all people who suffer from lung cancer are smokers. Lung cancer in non-smokers can be induced by second hand smoke air pollutants and diesel exhaust [36-39]. Our present data showed significant difference of pack-year smoked but not smoking status between NSCLC cases and controls which suggested the important role of other environmental factors in the development of NSCLC. Tobacco could induce chronic and sustained inflammation in lung microenvironment contributing to pulmonary carcinogenesis in smokers [40]. Support also comes from the epidemiologic data regarding inflammation and lung cancer [41]. CR1 an important molecule implicated in immunity and inflammation could protect the host from invasion of exogenous chemicals derived from cigarette smoking. Genetic variant of CR1 could alter gene function and result in deregulation of the inflammatory and immune responses thereby modulating the susceptibility to lung cancer. More importantly we observed a potential interaction of this SNP (rs7525160 G?>?C) with smoking status suggesting the gene-environmental interaction plays a prominent role in the susceptibility to lung cancer. Our present study has its limitation. Our patients may not be representative of total NSCLC patients at large because they were recruited from only one hospital. In addition due to the relatively small sample size further case-control studies are still needed to replicate and extend our findings. Conclusion We conducted a case-control study in Chinese subjects and found an intronic SNP (rs7525160 G?>?C) of CR1 was significantly associated with lung cancer risk. To the best of our knowledge this study provides the first evidence that genetic variant of CR1 (rs7525160 G?>?C) was a smoking-modifying contributor to the development of lung cancer. Methods Study subjects This case-control study consisted of 470 patients with histopathologically confirmed NSCLC and 470 cancer-free controls. All subjects were genetic unrelated ethnic Han Chinese. Patients were recruited between January 2008 and December 2012 at Tangshan Gongren Hospital (Tangshan China). There were no age gender or stage restrictions however patients with previous malignancy or metastasized cancer from other organs were excluded. The response rate for patients was 94%. The controls were randomly selected from a pool of a cancer-free population from a nutritional survey conducted in the same region. The selection criteria for control subjects included: i) no individual history of cancer; ii) frequency matched to cases according to gender age (±5 years); iii) the residential region; and iv) the time period for blood sample collection. At recruitment informed consent was obtained from each subject and each participant was then interviewed to collect detailed information on demographic characteristics. This study was approved by the institutional review board of Hebei United University. Tag SNPs selection and genotyping Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs with an r2 threshold of 0.80 and minor allele frequency (MAF) greater than 1%. Furthermore we also added two potential functional polymorphisms rs9429942 and rs6691117 [4243]. Therefore we included 13 SNPs in our study which represents common genetic variants in Chinese population. Genotyping was performed at Bomiao Tech (Beijing China) using iPlex Gold Genotyping Asssy and Sequenom MassArray (Sequenom San Diego CA USA). Sequenom™s MassArray Designer was used to design PCR and extension primers for each SNP. Primer information for selected tag SNPs was listed in Table 5. Table 5 Primers used in this study SNP_ID Alleles 1st-PCR primer sequences 2nd-PCR primer sequences UEP sequences rs7525160 G/C ACGTTGGATGCAAAATCAAGGTTTAAAGTC ACGTTGGATGTTCTGACATGTACTGCCTGC CCCTGTTGCCTGGGTTTTTCT rs3886100 G/A ACGTTGGATGGGCCTCAGATCCTCAAAATC ACGTTGGATGTGAGCTGTTTCAGCCAAGAG GAGCCAAGAGGACACTTAG rs11118167 T/C ACGTTGGATGATGTGTGTAGTCACTTAGCC ACGTTGGATGATAATGGCAGATTTAAGGGC CAATGATAAATGAATACTGTGTTCTATC rs9429782 G/T ACGTTGGATGACACGCGGGATCCATCGGAA ACGTTGGATGAACGAGTTTCGCTGGCAGAG GGTGCAGCAGCAGAG rs10494885 C/T ACGTTGGATGGTGTAATGCCACAGACATGC ACGTTGGATGCCAGCCAACTGACCTTTATG CTTCTGATTTTCTTTCCTGTTAC rs7542544 C/A ACGTTGGATGGCTAAGAGCCATTAGTGTGC ACGTTGGATGAACGTGGTGGTGCCCAAACA CCATGACCCCAAAGC rs6691117 A/G ACGTTGGATGAGAGTACCAGGAAACAGGAG ACGTTGGATGACCCTACCATGACAAACCCG CCGGGCTGACATCTAAATCTGA rs6656401 G/A ACGTTGGATGAAAGGACACACACAGAGGAG ACGTTGGATGCGTTGATGTTCCTTGGCTTG CTCTGTCTCCATCTTCTC rs2296160 C/T ACGTTGGATGCCAGAATTCCTCAGCAAAAC ACGTTGGATGCCAGAGTGATGTTTTGTGAC CGTGCCTTTTGTCTTCCTTTTAGGT rs9429942 T/C ACGTTGGATGTACATGTGCACAACGTGCAG ACGTTGGATGAAGGACGAGTTAATGGGTGC GGGAACGTCGCACATGTAT rs4844600 G/A ACGTTGGATGGAATGGCTTCCATTTGCCAG ACGTTGGATGGGGCGGCATTCATAGTTCAG CCCAATGGGAAACTCAAA rs3818361 C/T ACGTTGGATGTGGAAAGGACAGTTCCAGAG ACGTTGGATGTTTTAAGCCCTCTGGTAAGC TAATCCCTCTGGTAAGCATAAGATATA rs17048010 T/C ACGTTGGATGTTTCAAGGCTGCTCCTTGTT ACGTTGGATGCCCAGTCTATGGAGTTTCTG AGACTGAGACAGTTGGT Statistical analysis We used Chi-square test to examine the differences in the distributions of demographic characteristics and genotype frequencies between cases and controls. The NSCLC risk associated with CR1 tag SNPs was estimated as odds ratios (OR) and 95% confidence intervals (CI) computed by logistic regression model adjusted for age gender and smoking status where it was appropriate. Smokers were considered current smokers if they smoked up to 1 year before the date of cancer diagnosis for NSCLC patients or before the date of the interview for controls. The number of pack-years smoked was determined as an indication of cumulative cigarette-dose level [pack-year?=?(cigarettes per day/20) × (years smoked)]. Light and heavy smokers were categorized by using the 50th percentile pack-year value of the controls as the cut points (i.e. ?25 and >25 pack-years). All statistical tests were 2 sided with P<?0.05 as the significant level. Statistical analyses were done using SPSS (version 16.0 SPSS Inc Chicago IL). Gene-gene and gene-smoking interactions were analyzed by open-resource GMDR software package (version 0.9) and Quanto (http://www.hydra.usc.edu/gxe) [4445]. Abbreviations CR1: Complement receptor 1; OR: Odds ratio; CI: Confidence interval; SNP: Single nucleotide polymorphism. Competing interests The authors declare no competing financial interest. Authors™ contributions XY drafted the article. XY and JR conducted genotyping of CR1. JL ZZ and LC collected clinical data and analyzed the data. XZ contributed the research plan and approved the data. All authors read and approved the final manuscript. Acknowledgements This work was supported by the National Natural Sciences Foundation of China to XZ (no. 81101483) Program for New Century Excellent Talents in University to XZ (NCET-11-0933) Science Fund for Distinguished Young Scholars of Hebei Scientific Committee to XZ (H2012401022) and Foundation for the Author of National Excellent Doctoral Dissertation of PR China (FANEDD) (no. 201274). Gelderman KA Tomlinson S Ross GD Gorter A Complement function in mAb-mediated cancer immunotherapy Trends Immunol 2004 25 158 164 10.1016/j.it.2004.01.008 15036044 Rutkowski MJ Sughrue ME Kane AJ Mills SA Parsa AT Cancer and the complement cascade Mol Cancer Res 2010 8 1453 1465 10.1158/1541-7786.MCR-10-0225 20870736 Liu D Niu ZX The structure genetic polymorphisms expression and biological functions of complement receptor type 1 (CR1/CD35) Immunopharmacol Immunotoxicol 2009 31 524 535 10.3109/08923970902845768 19874218 Ahearn JM Fearon DT Structure and function of the complement receptors CR1 (CD35) and CR2 (CD21) Adv Immunol 1989 46 183 219 2551147 Tas SW Klickstein LB Barbashov SF Nicholson-Weller A C1q and C4b bind simultaneously to CR1 and additively support erythrocyte adhesion J Immunol 1999 163 5056 5063 10528211 Wagner C Ochmann C Schoels M Giese T Stegmaier S Richter R Hug F Hansch GM The complement receptor 1 CR1 (CD35) mediates inhibitory signals in human T-lymphocytes Mol Immunol 2006 43 643 651 10.1016/j.molimm.2005.04.006 16360013 Jozsi M Prechl J Bajtay Z Erdei A Complement receptor type 1 (CD35) mediates inhibitory signals in human B lymphocytes J Immunol 2002 168 2782 2788 11884446 Rochowiak A Niemir ZI The structure and role of CR1 complement receptor in physiology Pol Merkur Lekarski 2010 28 79 83 20369732 Ross GD Lambris JD Cain JA Newman SL Generation of three different fragments of bound C3 with purified factor I or serum. I. Requirements for factor H vs CR1 cofactor activity J Immunol 1982 129 2051 2060 6214588 Coussens LM Werb Z Inflammation and cancer Nature 2002 420 860 867 10.1038/nature01322 12490959 Jurianz K Ziegler S Garcia-Schuler H Kraus S Bohana-Kashtan O Fishelson Z Kirschfink M Complement resistance of tumor cells: basal and induced mechanisms Mol Immunol 1999 36 929 939 10.1016/S0161-5890(99)00115-7 10698347 Weis JH Morton CC Bruns GA Weis JJ Klickstein LB Wong WW Fearon DT A complement receptor locus: genes encoding C3b/C4b receptor and C3d/Epstein-Barr virus receptor map to 1q32 J Immunol 1987 138 312 315 3782802 Wilson JG Wong WW Murphy EE 3rd Schur PH Fearon DT Deficiency of the C3b/C4b receptor (CR1)"
Lung_Cancer
"are associated with erythrocyte sedimentation rate Am J Hum Genet 2011 89 131 138 10.1016/j.ajhg.2011.05.019 21700265 Teeranaipong P Ohashi J Patarapotikul J Kimura R Nuchnoi P Hananantachai H Naka I Putaporntip C Jongwutiwes S Tokunaga K A functional single-nucleotide polymorphism in the CR1 promoter region contributes to protection against cerebral malaria J Infect Dis 2008 198 1880 1891 10.1086/593338 18954261 Chen GB Xu Y Xu HM Li MD Zhu J Lou XY Practical and theoretical considerations in study design for detecting gene-gene interactions using MDR and GMDR approaches PLoS One 2011 6 e16981 .0016981 21386969 Lou XY Chen GB Yan L Ma JZ Zhu J Elston RC Li MD A generalized combinatorial approach for detecting gene-by-gene and gene-by-environment interactions with application to nicotine dependence Am J Hum Genet 2007 80 1125 1137 10.1086/518312 17503330 PLoS One one 1932-6203 Public Library of Science San Francisco USA 24416392 3887046 PONE-D-13-33822 .0085329 Research Mathematics Statistics Biostatistics Statistical Methods Medicine Clinical Research Design Meta-Analyses Oncology Basic Cancer Research Metastasis Cancers and Neoplasms Lung and Intrathoracic Tumors Pulmonology Surgery Thoracic Surgery Evaluation of Video-Assisted Thoracoscopic Surgery for Pulmonary Metastases: A Meta-Analysis VATS for Pulmonary Metastases Dong Siyuan Zhang Lin * Li Wenya Du Jiang Liu Xiangli Chen Xitao Department of Thoracic Surgery First Hospital of China Medical University Shenyang Liaoning Province People's Republic of China Arnold Paul Editor University of Kansas United States of America * E-mail: zhanglincmu163.com Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: SYD LZ. Performed the experiments: SYD LZ WYL JD XLL XTC. Analyzed the data: SYD LZ WYL JD XLL XTC. Contributed reagents/materials/analysis tools: SYD LZ WYL JD XLL XTC. Wrote the paper: SYD LZ. 2014 9 1 2014 9 1 e85329 16 8 2013 25 11 2013 2014 Dong et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background To evaluate the evidence comparing video-assisted thoracic surgery (VATS) and open thoracotomy in the treatment of metastatic lung cancer using meta-analytical techniques. Methods A literature search was undertaken until July 2013 to identify the comparative studies evaluating disease-free survival rates and survival rates. The pooled odds ratios (OR) and the 95% confidence intervals (95% CI) were calculated with the fixed or random effect models. Results Six retrospective studies were included in our meta-analysis. These studies included a total of 546 patients: 235 patients were treated with VATS and 311 patients were treated with open thoracotomy. The VATS and the thoracotomy did not demonstrate a significant difference in the 1-3-5-year survival rates and the 1-year disease-free survival rate. There were significant statistical differences between the 3-year disease free survival rate (p?=?0.04) which favored open thoracotomy. Conclusions The VATS approach is a safe and feasible treatment in terms of the survival rate for metastatic lung cancer compared with the thoracotomy. The 3-year disease-free survival rate in the VATS group is inferior to that of open thoracotomy. The VATS approach could not completely replace open thoracotomy. The authors have no support or funding to report. Introduction Metastasectomy is considered a beneficial treatment for a patient with metastatic lung cancer whose primary tumor has been well controlled[1].After surgery 5-year survival rates of 30% to 50% could be achieved depending on the underlying primary cancer[2]“[4].In practice the surgical approaches to pulmonary metastases are variable. Video-assisted thoracoscopic surgery (VATS) is an emerging technique; many procedures that had previously required a thoracotomy have been performed with the minimally invasive VATS. VATS has been used for the treatment of pulmonary metastases. The routine use of VATS for the treatment of respectable metastatic lung cancer remains controversial. Critics of the VATS approach have argued that it might not be an equivalent oncological operation[5] [6]. A prospective study by Cerfolio[7]found that 22% of the nodules that could be detected by thoracotomy were missing by VATS.Whether the VATS approach can provide a satisfactory outcome is unknown. An evidenced-based investigation of the VATS approach is needed we undertook this meta-analysis to achieve a more objective assessment of the published studies and to provide a more accurate comparison between VATS and thoracotomy for metastatic lung cancer. Methods Search Strategy Electronic searches were of the MEDLINECochrane Controlled Trial Register (CENTRAL) Ovid MEDILINE PubMed and Embase databases were performed until July 2013.The following MeSH search headings were used: œmetastatic lung cancer œpulmonary metastases œvideo-assisted thoracic surgery œthoracotomy and œcomparative study.We searched the reference lists of relevant studies reviews editorials lettersand meeting s. We used the Science Citation Index to cross-reference for further studies that met our criteria. Study Selection The studies included in this meta-analysis were based on our predetermined criteria as follows: (1) clinical trials that include the full text of the paper published in peer-reviewed English journals or reports of presentations at major thoracic surgery meetings; (2) comparison of the efficacy of VATS to that of thoracotomy in patients with metastatic lung cancer; and (3) similarity in the patients' baseline characteristics. Data extraction and quality assessment Two independent reviewers (Siyuan and Wenya) assessed the quality and the risk of bias of the included trials as follows: (1) the studies that did not include a comparative group with surgery as a form of intervention were excluded; (2) the trials focusing on patients undergoing surgery for primary lung cancer were excluded; (3) the studies on robotic video-assisted thoracic surgery were excluded; (4) if there was an overlap between authors centers or patient cohorts evaluated in the published literature only the most recent report was included; (5) studies published more than 20 years ago were excluded because of the significant technological changes that has occurred. The s were evaluated with the Downs and Black quality assessment method[8]. Discrepancies between the two investigators were resolved by discussion and consensus with a senior investigator. The final results were reviewed by two senior investigators (Lin and Jiang).The disease-free survival was defined as the date of the initial metastasectomy until the date of a recurrence. Statistical and sensitivity analyses The meta-analysis was performed using the RevMan 5.1.0. software package. The odds ratio (OR) or the mean difference with 95% confidence intervals (95% CI) was calculated for the dichotomous outcomes and the continuous outcomes respectively. A P value<0.05 was considered a significant difference in the value between the two groups. We used the I2 statistic to investigate the heterogeneity among the studies.The heterogeneity was explored by X2 and I2; I2<25% and I2>50% reflect a small and large inconsistency respectively. P<0.05 was considered significant. If there were a statistical difference in terms of the heterogeneity (P?0.05) a random-effect model was selected to pool the data. Otherwise a fixed-effect model was used. Taking into account the presence of different sample sizes of the included studies a sensitivity analysis was performed to compare the of 1-year survival rate and the 3-year disease free survival rate between VATS and open thoracotomy. Publication bias A funnel plot was used to explore bias. Asymmetry in the funnel plot of trial size against treatment effect was used to assess the risk of bias. Results Description of the studies Six retrospective cohort studies the met our criteria were included in this meta-analysis. A total of 546 patients were included in the six studies;235 patients were allocated to the VATS group whereas 311 were allocated to the open thoracotomy group to evaluate their survival rate.The search algorithm results of the search strategies and selection criteria are shown in Fig 1. The patient characteristics and evaluation index are shown in Table 1. .0085329.g001 Figure 1 Identification of studies for inclusion. .0085329.t001 Table 1 Study Design Country NO(V/O) Gender (M/F) Mean age (years) Assessment score Nakajima2001[28] OC Japan 45/55 V59/41 O34/21 V55±15 O55±14 13 Mutsaerts2002[29] OC Netherlands 8/12 NR NR 19 Nakas2009[30] OC UK 25/27 V16/9 O 19/8 V69 O66 16 Carballo2009[31] OC USA 36/135 V18/18 O82/53 V58.5 O49 15 Gossot2009[32] OC France 31/29 V21/10 O13/16 V43 O40 18 Chao2012[33] OC Taiwan 90/53 V49/41 O35/18 NR 13 V VATS; O Open thoracotomy; NR Not reported; OC observational cohort. Assessment of Recurrence and Survival Six studies documented the 1-year survival rateand there was no significant heterogeneity among the six studies (x2?=?3.79 P?=?0.58I2?=?0%).A fixed effect model was used.The combined result is shown in Fig 2(OR?=?1.15; 95%CI 0.72“1.84; p?=?0.58). Because of the heterogeneity in sample size the sensitivity analyses were conducted using larger sample sizes. There was no difference between the two surgical methods with an OR of 1.00(95%CI 0.55“1.79) and with heterogeneity(?2?=?3.23P?=?0.07 I2?=?69%). Five studies reported the 3-year survival rate and heterogeneity was identified through the five studies (x2?=?11.32P?=?0.02I2?=?65%); and a random effect model was adopted (OR?=?1.07; 95%CI 0.50“2.27; p?=?0.86) (Fig 3). Three studies compared the 5-year survival rate (OR?=?0.96; 95%CI 0.34“2.71; p?=?0.93) with certain heterogeneity(x2?=?8.86P?=?0.01I2?=?77%) (Fig 4). .0085329.g002 Figure 2 1-year survival rate. Forest plot of the Odds Ratio(OR) of the 1-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g003 Figure 3 3-year survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g004 Figure 4 5-year survival rate. Forest plot of the Odds Ratio(OR) of the 5-year survival rate following VATS versus open thoracotomy for metastatic lung cancer."
Lung_Cancer
"Phenothiazines elicit caspase-mediated and caspase-independent cell death To gain insight into the mechanistic basis of phenothiazine-associated cytotoxicity we analyzed in detail the mode by which these compounds induce cell death in human SCLC cells. While some studies have implicated apoptosis as a major cell death mode in phenothiazine-treated cells34 9 we found that the percentage of SCLC exhibiting nuclear morphologic changes typical of apoptosis such as chromatin condensation and fragmentation remained low (10%) even at the highest TFP concentrations where >98% of all cells lost the ability to exclude propidium iodide (PI; data not shown). Instead TFP-treated SCLC cells exhibited profoundly shrunken nuclei without concomitant chromatin condensation. TFP elicited poly (ADP-ribose) polymerase (PARP) cleavage in some but not all LC cell lines (Figures 3a and b). Importantly although the SCLC cells are sensitive to 10??M TFP treatment and respond with an approximately 60% decrease in cell viability this concentration of TFP only resulted in no or minor cleavage of PARP. Consistent with a non-essential requirement of caspase-mediated apoptotic response the pan-caspase inhibitor benzyloxycarbonyl-Val-Ala-Asp fluoromethylketone (z-VAD-fmk) did not significantly protect either SCLC (H82) or NSCLC (U-1810) cells from TFP-induced cell death (c) emphasizing the involvement of non-caspase-mediated cell death in response to phenothiazines in SCLC. Phenothiazines induce lysosomal dysfunction in LC cells Phenothiazines are known to be lysosomotropic and accumulate within intracellular acidic compartments.12 13 We therefore examined whether phenothiazines may affect lysosomal functions in LC cells. We found that treatment with TFP and related phenothiazines (cis-flupenthixol dihydrochloride (cis-FPX) PZ chlorpromazine hydrochloride (CPZ) TFPZ and FPZ) caused a rapid increase in appearance of light chain 3 (LC3)-II a marker of autophagy in a dose- and time-dependent manner in both SCLC and NSCLC cells (Figures 4a“c). By contrast the level of p62/SQSTM1 a scaffold protein that target ubiquitinated polypeptide cargo for autophagic degradation did not show any consistent change in response to TFP in the examined SCLC and NSCLC cells (a). As accumulation of LC3-II can result from either increased autophagic flux or impaired autophagic degradation we used chemical probes to manipulate these two processes separately and then investigated the effect of phenothiazines on LC3 conversion. Notably blocking autophagic degradation with the lysosomal protease inhibitor E-64d in cells treated with survivable concentrations of TFP (5??M in H82 and 10??M in U-1810) caused further accumulation of LC3-II indicative of enhanced autophagic flux (d). Similar results were obtained at cytotoxic concentrations of TFP or when autophagosome maturation was suppressed by bafilomycin A1 (BafA1; data not shown). Under conditions where de novo protein synthesis was shut down by cycloheximide (CHX) LC3-II induced by TFP pre-treatment (0“24?h) was rapidly cleared upon removal of TFP (e compare lanes 2 and 4). This process became significantly slower if TFP was present during the recovery period (24“48?h) especially in H82 cells (e compare lanes 5 and 6) suggesting that phenothiazines may additionally antagonize autophagic degradation. These data show that TFP both induces LC3-II and prevents its clearance especially in the SCLC cells which is consistent with the notion that phenothiazines perturb lysosome homeostasis more severely and persistently in SCLC than in NSCLC. Overall these data demonstrate that phenothiazines can modulate lysosomal functions in human LC cells. Basal lysosomal mass and pH buffer capacity can predict sensitivity to phenothiazines The response to chemotherapy (CT) in human tumors is highly heterogenous and therefore there is an urgent need for the identification of biomarkers for prediction of treatment efficacy. As our data suggest that the lysosome is a potentially critical site of action for phenothiazines when used as single treatment of LC cells we therefore sought to determine whether lysosome-associated parameters could be used to predict sensitivity of human LC cells to phenothiazines. Indeed we found a statistically significant inverse correlation between the mean cytotoxicity index calculated from the average cytotoxicity of six phenothiazines at 10??M (a ) and cellular retention of LysoTracker at baseline (a). On the other hand neither basal lysosomal ?-galactosidase (?-gal) activity nor the baseline expression levels of the lysosomal markers LC3-II and lysosomal-associated membrane protein 1 (LAMP-1) correlated well with cellular phenothiazine sensitivity (Supplementary Figures S2A“C). "
Lung_Cancer