Upload 1006 files to data/part_4

data/part_4/006135e9bf92d890cebb3ac20b97088e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"006135e9bf92d890cebb3ac20b97088e","source":"gardian_index","url":"https://digitalarchive.worldfishcenter.org/bitstream/handle/20.500.12348/778/WF-2013-66.pdf"},"pageCount":12,"title":"Weather Index Insurance: Lessons Learned and Best Practices for Bangladesh","keywords":[],"chapters":[{"head":"Adaptation to climate change meets disaster risk reduction","index":1,"paragraphs":[{"index":1,"size":44,"text":"All countries, whether rich or poor, have suffered from weatherrelated hazards and even disasters for centuries, including hurricanes, cyclones, typhoons, floods, droughts and landslides. All countries have developed some national mechanisms to prepare for such disasters and to respond to them after they occur."},{"index":2,"size":64,"text":"Human-induced climate change adds another dimension to this traditional arena of disaster risk reduction (DRR) by making the frequency and magnitude of weather-related disasters greater. In the climate change global policy arena under the United Nations Framework Convention on Climate Change (UNFCCC), this issue covers both adaptation to climate change (ACC) and the new, emerging topic of loss and damage (L+D) from climate change."},{"index":3,"size":64,"text":"Index-based insurance (IBI) is an emerging tool that cuts across these three arenas; namely, DRR, ACC and L+D. It is in this spirit that the International Centre for Climate Change and Development (ICCCAD) at the Independent University, Bangladesh (IUB), together with WorldFish, undertook an initial scoping study and then convened a workshop with relevant stakeholders in Bangladesh to explore the interest in this topic."},{"index":4,"size":69,"text":"We are very pleased with the results of the initial scoping and the workshop, where a new \"community of interest\" in IBI was set up. On behalf of ICCCAD, we are committed to supporting and facilitating this community of interest and transforming it into a \"community of practice\" over time. We hope that this workshop report will be the start of this community of interest and practice in IBI."}]},{"head":"Saleemul Huq Director","index":2,"paragraphs":[{"index":1,"size":10,"text":"International Centre for Climate Change and Development, Independent University, Bangladesh"}]},{"head":"Summary","index":3,"paragraphs":[{"index":1,"size":147,"text":"WorldFish and the International Centre for Climate Change and Development (ICCCAD) held a two-day workshop on the topic of Weather Index-Based Insurance: Lessons Learned and Best Practices for Bangladesh. Weather index insurance is based on a predefined weather event which when triggered ensures automatic payout to farmers who have taken out insurance. For example, the climatic trigger could be a predefined consecutive number of days where rainfall is below a set level or when the floodwater level reaches above a certain point. Index insurance has been operating for about 10 years in many countries but is still at an early stage in Bangladesh, where there are two schemes currently being piloted and three other projects being developed. Further information can be found in the scoping report: Current Status of Index-Based Insurance in Bangladesh (http://www. worldfishcenter.org/resources/publications/scoping-reportcurrent-status-index-based-insurance-bangladesh), which was conducted to inform the design and objectives of the workshop."},{"index":2,"size":85,"text":"The aim of the two-day workshop was twofold: to ascertain the present state of index insurance in Bangladesh and elsewhere, and to work together to identify ways forward. Day one was about learning and sharing information, and day two focused on group work, identifying opportunities, problem solving and ways to move the index insurance agenda forward. It was essential that the workshop was action oriented and that as a result of the workshop the ideas and connections made continued to advance index insurance in Bangladesh."},{"index":3,"size":23,"text":"The workshop was attended by around 30 participants who are experts and practitioners in index insurance related activities. They represent the following organizations: "}]},{"head":"CIMMYT's micro-saving insurance product","index":4,"paragraphs":[{"index":1,"size":91,"text":"The International Maize and Wheat Improvement Center (CIMMYT), along with Helmholtz Centre for Environmental Research and Crawford School of Public Policy, has recently started designing a weather index-based micro-saving insurance product for farmers in Southern Bangladesh. The project, which will be running until April 2014, was presented by Dr. Fred Rossi. Currently, CIMMYT is testing the financial viability of an insurance product that insures dry-season crops against flooding from January to May and also includes savings and credit components. The specifics of the model and contract are currently being worked out."}]},{"head":"Oxfam launches index-based flood insurance","index":5,"paragraphs":[{"index":1,"size":112,"text":"Oxfam is currently developing a meso-level index-based flood insurance program in collaboration with the Institute for Water Management (IWM), CIRM, Pragati Insurance Ltd., Swiss Re, and Manab Mukti Sangstha (MMS), a local NGO. Mr. Kazi Azam from Oxfam introduced the project at the workshop and gave an overview of its modalities. Payouts will be calculated based on the data from a flood model developed by IWM. Final contracts between the agency partners were signed in August 2013, and the product has been successfully launched. The premium is 10.3 percent of the sum insured, with the average insured sum per family being 8000 BDT (approximately 100 USD). The project currently has 1661 beneficiaries."}]},{"head":"It's about the good years","index":6,"paragraphs":[{"index":1,"size":112,"text":"Dr. Helen Greatrex from the International Research Institute for Climate and Society (IRI) gave a presentation on \"Index Insurance Design and Implementation. \" IRI has been instrumental in developing and introducing index-based insurance and has been undertaking schemes for 10 years in more than 15 countries in Africa and Latin America. Dr. Greatrex explained that climate risk is experienced at two levels-through direct impacts such as droughts or floods and through the threat of a bad harvest year. It is therefore paramount for farmers to increase productivity in normal years in order to cover losses in bad years. However, strategies that increase productivity, such as buying high-quality seeds, lead to increased risk."},{"index":2,"size":152,"text":"For IRI, \"it's about the good years\"-and their schemes focus on providing insurance to relax the risk of a bad year and to ensure that productivity options are unlocked. For a scheme to be successful, it has to have a solid science base, it must be integrated into a wider risk management program, it must ensure that farmers understand basis risk, and it should be designed as simply as possible so that it is easily understood by the wide variety of stakeholders involved (farmers, cooperatives, NGOs, insurers, banks, agronomists, scientists and re-insurers). IRI develops localized schemes in consultation with farmers. Successful schemes include the KIlimo Salama project in Kenya/Rwanda and the R4 project Ethiopia/Senegal, which insure a combined 50,000 farmers against a lack of rainfall and are part of holistic risk reduction projects. To date, IRI's index insurances have been purchased by tens of thousands of farmers, despite the premiums being unsubsidized."}]},{"head":"Should index insurance be used to address loss and damage?","index":7,"paragraphs":[{"index":1,"size":138,"text":"Loss and damage is a newly emerging topic in the global climate change debate that is rapidly gaining importance. The concern with loss and damage stems from the realization that currently neither mitigation (i.e., the prevention of greenhouse gases) nor adaptation (i.e., adapting to the negative impacts of climate change) efforts are enough to prevent current or future loss and damage due to climate change. Loss is generally thought of as the impacts of climate change that cannot be recovered, while damage is characterized as those impacts that can be recovered (Kreft et al., 2012). While a general definition of loss and damage has not yet been agreed upon, a working definition is the \"negative effects of climate variability and climate change that people have not been able to cope with or adapt to\" (Warner et al., 2012)."},{"index":2,"size":72,"text":"A range of approaches are required to address loss and damage, many of which originate in the climate change adaptation community, such as risk reduction, risk retention, risk transfer and approaches to slow-onset processes (UNFCCC, 2012). Index-based insurance, falling under the risk transfer category, is an important approach that, while not eliminating the risk of loss and damage, can reduce human suffering and development setbacks that result from climate change impacts (Ibid)."}]},{"head":"Key outcomes from the workshop","index":8,"paragraphs":[{"index":1,"size":142,"text":"• Mapping of the current status of index insurance in Bangladesh • Better understanding of the opportunities and challenges in implementing index insurance • Identification of stakeholders • First step in forming a community of practice • Demand for future meetings to share information Dr. Helen Greatrex sharing IRI's experience of index insurance from around the world A 'good' year Currently, insurance covers only around 3 percent of disaster losses in developing countries, compared to 40 percent in industrialized countries (Warner et al., 2009), which means there is significant potential for growth, with many new markets-such as Bangladesh-emerging. However, insurance as an approach to addressing loss and damage is controversial, as it is widely held that the climate vulnerable should not be paying premiums to insure themselves against impacts for which they are not responsible (Warner et al., 2010; see more below)."},{"index":2,"size":68,"text":"To effectively address loss and damage, any (index-based) insurance model should be linked with an ex ante climate risk management strategy. Such a risk-layering approach combines cost-effective risk reduction aimed at low-impact frequent events with insurance for high-impact, high-frequency events. Insurance can also create a space of certainty, thus enabling decision making and reliable provision of public services (Warner et al., 2012). However, already existing limitations to insurance"}]},{"head":"Who should pay?","index":9,"paragraphs":[{"index":1,"size":74,"text":"One topic that was continuously debated throughout the workshop was the question of who should pay for insurance premiums. Does the polluter-pay principle apply here or should farmers pay for themselves and become self-reliant? What about those farmers that do not have the ability to pay? It was stated several times that some of the money that donors have promised to put toward fighting climate change from 2020 on should go toward insurance schemes."},{"index":2,"size":335,"text":"Interestingly, IRI's very successful insurance schemes are not subsidized and target the poorest population groups; that is, those without mobile phones. While the cheapest premium option costs around 3 USD, on average farmers purchase premiums costing 19 USD. This is to some extent made possible by IRI's projects that allow farmers to pay partially for premiums with labor and by the fact that if the insurance is used to encourage people to invest in more productive technologies, the profits generated in good years will cover the premium and the losses of the bad years. are exacerbated by climate change and its impact on loss and damage. Insurance does not prevent or reduce direct losses and damages, for example, and is not always the most cost-effective tool for risk management. Moreover, climate change creates new challenges for insurance, such as potential un-insurability due to increased frequency and magnitude of extreme weather events, and traditional insurance not being suitable for slowonset processes such as sea level rise or salinization (Warner et al., 2009). Ultimately, underlying risk factors such as poverty, food insecurity, natural resource depletion, etc. will have to be addressed as part of a comprehensive disaster risk management approach. Insurance products need to be made accessible, affordable, desirable and understandable for low-income and rural households in the developing world. Consequently, enabling conditions such as good regulatory frameworks and data bases are needed; these enabling conditions require technical and financial assistance to assess loss and damage (Khan et al., 2013). This proactive approach gives people agency and often inspires them to take more risks. Dr. Greatrex mentioned that, for example, a recent Yale study found that out of farmers who were given a choice between insurance and a loan, those who chose insurance invested more into their farms. A study evaluating IRI's R4 scheme found that farmers who had at the beginning paid for their premiums through labor were moving more and more toward paying with cash as the insurance scheme allowed them to amass more capital."}]},{"head":"Group discussion during the workshop A flooded village","index":10,"paragraphs":[{"index":1,"size":11,"text":"Recommendation: Link index insurance with loss and damage and risk-transfer communities."},{"index":2,"size":42,"text":"of generating index-based flood data and information that is reliable and accurate. The model was produced using information on river geometry and real-time hydrological data. The flood model outputs are used for damage assessment and fixation of insurance premium and payout schemes."}]},{"head":"Challenges of weather system in Bangladesh","index":11,"paragraphs":[{"index":1,"size":113,"text":"Usually an area covered by weather index insurance is defined by the parameters of coverage of a specific weather station. In Bangladesh, agricultural production is affected by weather conditions not only in Bangladesh but also in neighboring countries. For example, the level of rainfall in parts of India affects the water released by Indian dams on the main rivers, and the resulting water flow into Bangladesh will affect the moisture in the soil or the risk of floods. This poses a challenge for index insurance in Bangladesh: Will data need to be collected from outside of Bangladesh, and if this is not viable, will weather index insurance not be applicable to these areas?"}]},{"head":"Stakeholders-who will champion index insurance in Bangladesh?","index":12,"paragraphs":[{"index":1,"size":19,"text":"During the workshop, an exercise was undertaken to map all the stakeholders required to implement index insurance in Bangladesh."},{"index":2,"size":59,"text":"The diagram of stakeholders demonstrates that one of the major challenges facing index insurance in Bangladesh is how to bring the different stakeholders together to work toward successful implementation. Workshop participants identified the need for a champion to promote index insurance and to coordinate the large number of stakeholders and activities. However, who the champion should be was undecided."},{"index":3,"size":106,"text":"The government and private insurance companies were identified as the two main stakeholders with leading roles. Without government approval and involvement in regulation, index insurance will not be viable in Bangladesh. In addition, private insurance companies need to offer index insurance coverage to farmers. Private insurance companies will only offer index insurance if there is profit to be made through a viable business model. Although index insurance needs to work as a business, it is important to note here that the primary purpose of index insurance is to protect farmers against the uncertainly of climate change, allowing them to transfer risk and avoid falling into poverty."}]},{"head":"Community fund to cover basis risk","index":13,"paragraphs":[{"index":1,"size":130,"text":"Basis risk is the potential mismatch between insurance payout and actual loss. To reduce the occurrence of basis risk, the insurance product has to be designed using detailed, good-quality data and tailored to cover different circumstances. However, insurance cannot cover every scenario; weather events may fall just below the insurance trigger point or crops may be affected by circumstances not covered by the insurance. Therefore, farmers must have alternative mechanisms to manage impacts not covered by index insurance. One option could be a community fund, where members of an area pay into a fund which is then used to assist farmers affected by events outside of the insurance contract. The community will need to decide who will manage this fund and set terms for when it will be paid out."}]},{"head":"Data and index model","index":14,"paragraphs":[]},{"head":"Meteorological data","index":15,"paragraphs":[{"index":1,"size":150,"text":"The index created to reflect the impact of the weather on crop yield will only be as reliable and accurate as the quality of the data input into the system. There are numerous weather conditions that can have an effect on agricultural production, including rain, temperature, humidity, wind, water salinity, flood water level, etc.; however, index insurance usually only focuses on one type of weather, most commonly the level of rainfall (too much or too little), temperature, or flood water level, and possibly only during a specific time or season of the year. The Bangladesh Meteorological Department (BMD) has 35 weather stations throughout Bangladesh and records daily weather information. It was announced at the workshop by the BMD that there are plans to install approximately 100 more automatic weather stations within the next two years. The increased coverage of weather stations will improve the accuracy of the data and index."}]},{"head":"Agronomic data","index":16,"paragraphs":[{"index":1,"size":66,"text":"Agricultural data is also required to understand what time of year different products require insurance coverage and when they are most at risk to weather variables. In addition, the production level for crops is vital to the assessment of the quantities to be insured. A major gap identified in agricultural data is that no data exists on the quantity of crops lost due to weather damage. "}]},{"head":"Flood modeling","index":17,"paragraphs":[]},{"head":"Community of practice","index":18,"paragraphs":[{"index":1,"size":107,"text":"One of the most important outcomes from the workshop is the formation of a community of practice for index insurance in Bangladesh. Workshop participants agreed that while index insurance is at an early stage in Bangladesh, it is beneficial for all involved to have a forum where progress can be shared, ideas can be discussed, and challenges can be worked out together. An online community forum has been created where members can share information and raise questions and discussions. A Web page with signposting to resources has also been created. The Web page contains all the presentations from the workshop as well as links to relevant reports."},{"index":2,"size":42,"text":"• Recommendation: Form a community of practice to continue discussions and keep updated on index insurance developments in Bangladesh. • Recommendation: Workshop participants and other stakeholders to reconvene in 2014 to discuss progress made within their organizations, including reporting on pilot projects."}]},{"head":"Conclusion","index":19,"paragraphs":[{"index":1,"size":57,"text":"The workshop highlighted that there is a great deal of interest around weather index insurance in Bangladesh. The challenge is now to cultivate that enthusiasm within the participants' organizations, to engage other stakeholders and to work together. Without collaborations between government, private insurance companies, technical experts, NGOs, farmers, and others, index insurance cannot progress to large-scale implementation."},{"index":2,"size":9,"text":"Many opportunities exist to apply index insurance in Bangladesh."},{"index":3,"size":97,"text":"There are plans to improve the collection of weather data, there is an existing network of NGOs with good rural reach, and Bangladesh already has a history of and familiarity with microfinance. However, there are challenges: the complex weather system, the fatalistic culture of farmers in accepting the impacts of weather events, and the need to develop a business model that will attract private insurance companies. All of these challenges will become manageable if there is dialogue and engagement with the relevant organizations and communities. This is something that the community of practice can begin to address."}]}],"figures":[{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Recommendation: ICCCAD and the community of practice to start dialogue with relevant government departments and with private insurance companies. Mr. Shah-Newaz from the Institute of Water Modelling (IWM) demonstrated the technical expertise required to produce a complex index model. The IWM developed a flood model capable Stakeholder mapping: index insurance key stakeholders in Bangladesh Stakeholder mapping   Stakeholder mapping Government  Private Insurance Companies GovernmentPrivate Insurance Companies To provide regulatory framework and policy Offer an index insurance product that is To provide regulatory framework and policyOffer an index insurance product that is • Ministry of Finance  beneficial to the insurance company and • Ministry of Financebeneficial to the insurance company and • Ministry of Agriculture  the farmer • Ministry of Agriculturethe farmer • CDMP   • CDMP Donors   NGOs and MFIs DonorsNGOs and MFIs To provide monetary support at pilot stage (and  Collect premiums and distribute payouts as well as To provide monetary support at pilot stage (andCollect premiums and distribute payouts as well as beyond), supporting development of infrastructure Banks communicating information about the insurance beyond), supporting development of infrastructureBankscommunicating information about the insurance and cost of premium  Provide reinsurance scheme to farmers and cost of premiumProvide reinsurancescheme to farmers  Data Collectors and Technical Experts Data Collectors and Technical Experts Champion To drive the agenda for index insurance and to coordinate stakeholders and activities Meteorological and agronomic data to be collected and monitored as inputs to the index model. Bangladesh Meteorological Department • Institute of Water Modeling • Bangladesh Water Development Board • Bangladesh Bureau of Statistics • Academic and research institutions Farmers Insurance policy holders. Consulted on development of insurance product Champion To drive the agenda for index insurance and to coordinate stakeholders and activitiesMeteorological and agronomic data to be collected and monitored as inputs to the index model. Bangladesh Meteorological Department • Institute of Water Modeling • Bangladesh Water Development Board • Bangladesh Bureau of Statistics • Academic and research institutionsFarmers Insurance policy holders. Consulted on development of insurance product  "}],"sieverID":"9036ea00-0bb9-47c1-9416-fdb0760528e5","abstract":"Adaptation to climate change meets disaster risk reduction."}

data/part_4/009b79445fc34b6b2a6bc533463ecb9b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"009b79445fc34b6b2a6bc533463ecb9b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/909c423c-84c7-4350-b022-244fa9f23601/retrieve"},"pageCount":32,"title":"~Nr!E~NO nm rorENTIAL OF Andropo¡on sayarws IWlth IN nm OXISOL AND ULTlSOL SAVANNAS OF TROPlOO-AMERICA","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":58,"text":"• geographical d~stributlon almost idEln~lcal tO,that ol'var. sguamulatus north 01' the equato.... It does not occur south 01' the !'Iguator. Varieties squamulatus and bisguamulatus have .invaded man:'made savanna areas, throughout the nol\"'thern part ef the fOl\"'est zona in Nigel\"'ia (Adejuwoo. 1974). Val\"'.'btsguamulatus has beén !ntl\"'oduced tnto Colombia, South Amel\"'ica and gr:-ovvs vigerouslywitli a blmodal rainfall distribut!on 01' C5."}]},{"head":"\"","index":2,"paragraphs":[{"index":1,"size":19,"text":",'1 ove,.. 1800.mm annually.,and wi,th, a single 5 menth dry seaSon and 2100 m in 8 annual rainfan. 9"},{"index":2,"size":11,"text":"Varo gayanus occurs en seasonally I'looded land in West Africa ,,'"},{"index":3,"size":23,"text":"10 where it forms aL-nost pur ', stands (13ogdan. 1977;Bowden. 19~).: ~~ , 11 .aJ.so occur's south 01' the eqt.:;atorial rainforeste in Za\"ire."},{"index":4,"size":27,"text":"12 Va .... trldentatus Is shorter than val\"'. bisguamulatus and occurs In 13 the sem!desert parte 01' the Sahel zona 01' West Afrlca (Sogdan, 1977; . t."},{"index":5,"size":4,"text":"~ 14 Fester, 1962)."},{"index":6,"size":1,"text":"15"},{"index":7,"size":21,"text":"The \\iarietles sguamulatus. blsquamulatus and gaya,nus occur lG naturally where the average mlnimj.Jl'Tl temperature 01' the coldest winter . . ."},{"index":8,"size":23,"text":". 11 month doss I!ot fan below 4.4 C (Sowden, 1964b). The species tole-18 rates lIght frastE¡ (Chatte ... jee and Slngh. 1966)."},{"index":9,"size":1,"text":"19"},{"index":10,"size":9,"text":"Varletles squamulatus and bisguamulatus can wlthstand up to 9"},{"index":11,"size":35,"text":"'20 mentbs 01' drought, but ,their,most favorable environment appears to be below 1000 m yvlth a dry season 01' 3 to 5 months and a 'total rainfaU el' , , over 750.mm (Bogdan, 1977;SowdÉln, 190080)."},{"index":12,"size":2,"text":"Flowering behavior."},{"index":13,"size":23,"text":". Andropogon gayanus. Hke most members 01' tlJe Andr-opogoneae, (Evans. ,1964). lB a shor-t-day p l8ont. Its oritica\" daylangth ,fol\". flowerkl, , ."},{"index":14,"size":11,"text":"lI!i between 12 and 14 hl'\" (Tompsett. '197'6). Flowering!s IntenslFied b~."},{"index":15,"size":32,"text":"21 shortenlng daytength fr-OI'n J2 to a:hr at\" by exposing older' plants to  the rainy season (Anon., 1942;Bogdan. 1977). The speclas ie weU adapted to burning. and' careful graztng management. periodic bUl\"ning."},{"index":16,"size":13,"text":"01\" cutting may be neeessary suppress the accumulatiO!\"\\ 01' old '''lb'r'OUs . \""},{"index":17,"size":1,"text":"."},{"index":18,"size":19,"text":"gayanus pastures Utter can\" ¡onstlli.lte more th&.n 50\"/0 01' the total ol\"gW'lic matter during the dry season (Egunjobt, 1974)."},{"index":19,"size":3,"text":", , '"},{"index":20,"size":34,"text":"In the eastel\"n savannas '01' Colombia the regl\"owth 01' nativa savanna is gl\"eatel\" than that ~ A. gayanus 1'01\" the.l'il\"st 4-5 days al'ter , bUl\"nlng; hoWever. within,.10 days ,~ regl\"ONth, of' A. gayanus greater."},{"index":21,"size":2,"text":", ,"},{"index":22,"size":16,"text":"Artel\" 6 weeks its I\"egrowth was 0'1191\" twlce that 01' natlve savanna (9'17 , , ."},{"index":23,"size":27,"text":"vs. 419 I<:g PM ha -1). Ligntl'lcation of' !;he I\"egrowth appeal\"S to ba mue\" stower In A. gayanus than in native savanna (M. Si!Ínchez. personal --, '"},{"index":24,"size":2,"text":", communtcation)."},{"index":25,"size":28,"text":"Varo bisquamulatus la known te aggresslvaly coloniza disturbe soU In both l'aUow flelds (P.N. de Leeuw. personal communicátion)and disturbed nativa savanna ( .. r.M. Spai\"'. personal communicatlon). In."},{"index":26,"size":80,"text":"northern Nigerla tt la aowri in'grass fal10w and lB known té, be useful in bunding sou rertillty (Bowden. 1963&.); Its benel'icial ert'ect en sub-:sequent cl\"'Oj:)s ,ls pr'obably due more te, tmprova soU rer.tntty,than toa .. : .; 11 less) 01' crown spllts appeal\"!, pra:nlslng. Evan when the land 'la pre-12 pared and spUts al\"'e planted late In the wet season, seed p~uctlon ma~ 13 be sufflcient to tnsure a good stand the'foUowingrainy ¡seaaon (.J. M. , 14 Spaln, personal communlca~lon)."}]},{"head":"'","index":3,"paragraphs":[{"index":1,"size":20,"text":"Seed.ma,y be aown I;lroaclc:ast.or In rows. Bowden (1963a)  12 Bowden (1963a) reviewed DM ylelds obtained in 5 Af'rlcan trials •.   "}]},{"head":"t4.","index":4,"paragraphs":[{"index":1,"size":36,"text":"ful\"ther de creases followed. The IVOMO of elongating stems was as hlgh as that of leave!!!. Voluntary feed Intake wás relatad to NOMO \" \"3 (r=0.40) and CP (ril:: 0.82). Percentage crude protein was related to,'."},{"index":2,"size":27,"text":"pereentage éllgestlbte crude prOtein (r=0.88). Perc:entage crude protein'was concluded to be:a useful'crlterlon for,predictlng nutrltive wtues. The Impol\"tance or selectiVa ~umPttÓn of iOllV quaUty of . .!!.    ,."},{"index":3,"size":3,"text":"... '.-:;: ."},{"index":4,"size":1,"text":")."},{"index":5,"size":6,"text":", , \" . \\ '."},{"index":6,"size":2,"text":"'. '"},{"index":7,"size":3,"text":".. . ,"},{"index":8,"size":2,"text":". \""}]}],"figures":[{"text":", . sqUamulatus ls a moderatet,Y vlgorous type not excee ling l.! m In height and Is the most widely dtstl\"'ibuted 01' the three val\"'ietlas. It, Is found on weU-drained soils throught tropical .Africa., NOl\"'th 01' the equator It extends In a wlde belt between the Sahara and the equatol\"'lal ralnforests fl\"Om Senegal on the west to too Sudan and northern Uganda on the eut. South 01' the equator It Is found In the savannas' to 'the east and I!!outh 01', the equatorlal ralnforests in Zaire and as far 'south as MOzambique ánd the Transvaal In South .Al'rlca. lt occurs up to' 2300, and occaslonalt,Y to 2600 m. . ~. ,Val\"'. blsquamutatus ,ls a lal\"ge vigorous type 'ol'tan exceeding 2 m• in he(ght. It (s I'cund on weH-dralned soU!!! to 2000 m aro has a I , . "},{"text":" . 1963a; Haggar. 1¡;¡70). In unburned ungrazed A. "},{"text":" long-lasting Improvement of soH phystcal properties(Wilklnson. 1975)    _ , Andropogon gayanus ts adaptad te a range ofs,ol1 typelS tnc.l.Alng. ... r---~:---:--~-_ _ --.--\"\"\"---:----:-:--~---::--:-'-~\"'\" ,1 rleh al1uvlal solls(8arrault. ,1973). serpentina solls(Wild. 1974a and   '2 1974b). Oxisots and, Ultisols (CIAT. 1977? and we1t dralned sandy clays ,3 011 medlum to hlgh fertility (8&den, H:)63a). opo9on gayanus may be establlshed ethr from crown spllts 6 or seed. Crown sptits areoften uSed In experimental work to quiekty .,7 estabUsh a unil'OI\"'m stand. Slnee the speciea ls altogarrious and plants '8 vary morphologleany spUts shoul~ be taken fl\"CJ!Tl a number 01' plants and '9 random~zed within a plot. Where seeifqualtty or other' factors prohlbtt 10 mechanized pianting 01' S~cI,lOW derúilly plantlng (1000 plants ha-1 01\" , "},{"text":"27 In hse trials~. gayanus was always among the three hlghest yieldlng specles. Ita yield was roughly ~parable to that 01' Panicum !: axlmulT • .. lt outyie\\ded 1:. maximum in two tt;'ials, ylelded less than.!:'.maximum in two tMals, ard proouced equlvalentyields In one trial.At 23\" North Latitute in India ~. gayanus and Brachlaria brizantha had aqual annuat Otvt yields (11 .6 tons ha-t ) and outylEollded the 10 other gl\"aeses In the trlal. Interestingly,~. gayanus had the highest DM yleld (1 .2 tona ha-1 ) during the 7-month dry season(Singh   and Chatterjee, 1965). On ,an annuat, basis U produced 9 to 10,kg DM ha-1 mm-1 ralnl'aU. 'In en analysls al' severat experimenta in Nigerta and Camel\"oon, , ~. gayanus 'grown at near optlm~fe,.ttHty yielded approximately 8• to .' '?! kg DM ha\"'~ mm-1 ralnfa11 ~n 4 to 5-month rainy s~alilons(Barrautb.   '1973;: Haggar¡ .1975). In BraZl1 EmrtCQ-(1972) reported fresh weight , / ' , ' yietds whlch, when calcutated on the basis 01' 25'Yo'to 30% DM (se., 6-montn ~tny seasons.. . \"In Colombia(CIAT, 1918; B.  G~f, personal ccmmunlcetton) ~. f gayanus grown in assoclatlon wlth legumes on an tnfertlle Ultlsol wtth 90 kg P20s ha-t yletdedap,,~xl~ately 11 kg DM he-t m\",,-f, r.alnfall.The cornpanton Ingumes ~Ietded an average of 3.4 kg DM: \"a-1 mm\"\".' ra tnfa n. ' . In cornpartson, Hyparrhenia ~ ani:! the same assoetated tegl:lmes yielded 9 ancl 4.5 kg DM ~a-1 mm-1 ralnfan, respectivaty.These hlgh vatues or water use efflciency uncler relativa 16w fertility may be the resutt or 10lI'l water loss due te deep drainage ancl runot'f beCause or the bimodal distribution of rainfall.Haggar (f970) ,reported maximum c~p growtn rates in Hghtty rertltlz'lId~. gayanus pAstures 01' sUghUy over 32 kg DM ha-1 day-1 rol\" at .1east a month prior te stem etongatlon.The abiUt:y of'~. gayanus te remaln green throughout muen of the ,16 11 dry soason then provlda an \"early blté\". at the beglnning.ol' ttie rainy season Is ene 01' its most important agronornic characterlstlcs(Bowden.   18 1963a; Bogdan, f977). Nevar~.ess, only onestudy has bean conducte< 11l on lts roet system(Bowden, 1963b•)., ¡Ilondropogon gayanus val\". 20 btsquamulatus was gr\"OWn as spaced. plants at Kampala. Uganda. Three 21 morphologlcal classes 01' roets were identlrled. dlstany~ u_Uy less then 0.5 mm dlameter. ancl. . Z3 extend lateraUy over a meter I'rom the planto Cord roots are about . . . ' 1M 2 mm in d,lameter. are sParse ly branched ~ make an angle or 30 a te 40~ 25 wtt/:l the sciU'surface, and a~ setdom mor,e than 0.5 m ln leng~. 2G Vertical roets resemble f'ibr,OÚ$ roots except thet they are sparsely , . ' . "},{"text":",' 1 Hagga,. (1970)  studied yleld, yleld components and quallty parameters In unferttliZed and lIg!1tly fertillzad~. gayarius varo bisquamulatus swards growing ,unlnterruptedly (ungrazed and uncut) durlng both we~ ánd dry seasons In Shika. NIgeria. Ourlng the 1964 'Wet season sta :\"Idlng c:rop OM on unfertl1ized plots increased SlgmoidaUy to 3.9 tons, ha -1. 'Durlng the followlng dry season thEi standing crop , nevel\" dropped batow 2.8 tens ha-ti however. CP dropped frcm over 6% \" at the beglnnlng ;)1' the wet sesson. to approxlmately 4% during the perlad of rapld growth in ,the middle of the wet seas,on, 'te less'l:I'lan 1.5% In the 'I'ourth month 01' the, dry season. During the 1967 w.et aeasor analysls of ylelc\".c:omponents showad that the pereentage 01' green teál'In the total dry rnatter ranged i'rcm about 60% before stem elongatlon te about 25% at ftowerlng. Thts was ac:compalned by a drop In the CP 21! content ol'!:he éntlre plant from about 4.5% durlng !:he ,rainy season te 21 3.0% In the sec:ond month 01' the dry season. During the same perlad 22 the CP 01' the gresn teat c:omponentl\")ever dropped be.low 5.5%. '23Bowden (t953a), cites reports that In a 2-year •. 12-varlety24 palatabtuty ,trlal lri Nlgerla.,e.. gayanUs ranked hlghest In pl1latabtllty 25 tollowed by Panlc:um colorntum. !!. maxlmum and 1:. eurpure\\n1 • . 26 In a 'prel'erenee tr:-Ial In Ghana ca~t~e •. sheep. and -goats grazed a 27 total 01' 12 major gress!'lpec:~es~ AU lI~stoc:k showedf)reference tor,-. 1:. maximum. Setaí-ia sphacelata and!!.: decumbens, (Tetteh. 1974). "},{"text":" ~------------~----~--~~--------~--~ .' , • "},{"text":": . . . . Socie!:y @atany); 58, 509-519 •. "},{"text":". 1 . outUne 01' Ita biolog,y.' ,Journal'of Ecology. 52, 255-2.71 •... Sowde!\", S.N. (1964~) Studies. on AndroPogon gayanus Kunth • IV. A note on the eXternal ligule and ligule or Andropogon gayanus var •. sqUamulatus (Hochst •. ) Stapr. Jouma! Qf the, Llnnean Society (Sotany), 59, 77-80. Sowden, S.N. (1971) Studles on Andropogon gayanus Kunth. VI. T~e leal' nactades 01' ..o.ndropogon gayanus val\". bisquamulatus (Hochsto) Hack. (Gramineae). Botanleal ,Journal or the Linnean Society. 64, 77-80. l Chattérjee. B.N. (1964) .At Sabour. Sadab,ahar ls firSt among fórage . Indlan ¡:::\"armlng. 14. 17-20. Chatter.jee. S.N.~ Singh, R.O. (1968) Gr6wth analysis 01' perannial , . grasses in thé troplcs in India. 4. Changes in tiller populatlon , In grass swards • .Al1ahabad Farmer. 42, 65-73. Egunjobt. ,J. K. (1974) Ory mattar. nitragen and mineral element .:Ilstributiol ,n an unburnt savanna during the year. Oecologla plantarum, 9. 1-10. Emrich, E.S. (1972) Competi~o entre Cinco gramineas fórragelras , , . para a I'ormac¡:!l'o de' pastagens em solo de cerrado. (Performance 01' flv EJ I'orage grásses used .,In ' pastura establishment In Cerrado , . SOiU. .A.r~IS lIa Reuniao Srasilelra de Cer~dos~ •1~67.• Sete Lagoas. MoG •• 2()9,-221. 34 Evans. L. T. (1964)' Reprc:iductlon o In Grasses and grass lands. 25 ~ \" London, UK¡ Maem,lIan; 1'26-153. i 26 Faster, W. H~ (1962) llÍ\\iestlgatlonS preU~inarY to the productlor.\"l 01'2'1L..._....:........:C:;:u:.;l.:,t:.;i v;,;:a:.:r..:s::,. ..:o¡;\"F..,¡.A¡¡¡¡,cn=d=r:!:!o:!:!:!!0'2=..,;¡¡o=nL.g¡!'i!ia!;!¡M.=:s='nu~S:..:.:-..:E;.:\" u:;:;o~h:.;,v¡.:.:tt i:;¡c~.?:.!J:\"':\".!'.L.: .4:::,' 7:..-::,:5::::2:::.:,. _ _ ......,-1•. . "},{"text":" ,2 gayarY..Is. Ory'ÍTlIltter yie\\ds In the flrst year are hlg~r when the gras.s Ory Matte,. Yield and Water Use Eff'\\clengt~6The reported dry matter ylelds 1'01\" /!lo. gayarY..IS ra,nge f'rom less,7 than 3 (Hagga,.. 19eá)t~ oval\" 1,7 tona OM ha-1 yr-1 (CrAT;> 1979). In 8 mature stands impo¡\"ta~t yield-detel\"'l'Tltnlng f'actors appe¡¡lr to be prevlO\\.i -: 3 ls sown broadcast. but establishment. in rows shows a stlght advaritage -: 3 ls sown broadcast. but establishment. in rows shows a stlght advaritage 4 af't:er the f'irst yaa,..  4 af't:er the f'irst yaa,..    recom- recom- 16 menda aowtng 1.2 to 2.5' cm dEiep on weU preparad seedbed. Sowlng 16 menda aowtng 1.2 to 2.5' cm dEiep on weU preparad seedbed. Sowlng 17 rates depend largetyon aeed 'f'ertttUy •. Bogdan (1977) recommends 17 rates depend largetyon aeed 'f'ertttUy •. Bogdan (1977) recommends 18 sowlng at least 45 kg ,uncleaned seed ha-1 Ir quaUIy la unknow~. A total 18 sowlng at least 45 kg ,uncleaned seed ha-1 Ir quaUIy la unknow~. A total 19 01' 2 kg puregermlnatlng aeed ha:- ' ls pi\"Obably sufflclent (.J.E~ Ferguscr. 19 01' 2 kg puregermlnatlng aeed ha:-'ls pi\"Obably sufflclent (.J.E~ Ferguscr. 20 personal communication).  20 personal communication). 2l Since~. gayanus. Hke many perennlat gr'asses. produces Uttle 2lSince~. gayanus. Hke many perennlat gr'asses. produces Uttle 22 :' forage during the wet season In whld1 It ,la s,own, ti: can be sown with 22 :' forage during the wet season In whld1 It ,la s,own, ti: can be sown with 23 annuat companlon crops té) lncrease th\\9 econcmlc yield durlng the 1'lr~t, 23 annuat companlon crops té) lncrease th\\9 econcmlc yield durlng the 1'lr~t, , ,  ,, 24 year. '[1\"'1 Nlgerla (Haggar, ,1969). malze and a~eans are more sutt- 24 year. '[1\"'1 Nlgerla (Haggar, ,1969). malze and a~eans are more sutt-  "},{"text":" 1 system conststed 01' 50%. fibrous roots. 40% cord roots. and .10% :8 ve'rUecal roots (by welght). Ourlng the dry seasqn on a deep Oxisol In Carlmagua. Colc:rnbta ..   .' .' , ' . 3 . . . , ' . 3. .. -4 ~. gayanus. tlke Brachiárla decumbelÍS. conttnued te extract water -4 ~. gayanus. tlke Brachiárla decumbelÍS. conttnued te extract water 6 I'rc:rn the deeper layers 01' thá soil prof11e leng~r than -,=. maxlmum 6 I'rc:rn the deeper layers 01' thá soil prof11e leng~r than -,=. maxlmum 6 (J.M. Spain. personal cc:rnmt.ntcation). Ouring the dry seasen It 6 (J.M. Spain. personal cc:rnmt.ntcation). Ouring the dry seasen It .7 produc:ed slighUy graater CM ylelds than!!. decumbens (P. Sánchez. .7 produc:ed slighUy graater CM ylelds than!!. decumbens (P. Sánchez. 8 personal communlcatiop). Two months into the dry seasen both lts 8 personal communlcatiop). Two months into the dry seasen both lts lB Sánchez, pereonal communlcatlon); hawever. with O.6-nleter r•QW lB Sánchez, pereonal communlcatlon); hawever. with O.6-nleter r•QW 19 spaclng and only three cuts per yea!\"'~. gayanus ylélded slightly more 19 spaclng and only three cuts per yea!\"'~. gayanus ylélded slightly more 200M tlÍan!!. decumbens or -,=. maxlmÚm (F. MC,Ue!\"'. personal 200M tlÍan!!. decumbens or -,=. maxlmÚm (F. MC,Ue!\"'. personal 21 communtcation). These data agree wUh those 01' Barrault (1973) whlch 21 communtcation). These data agree wUh those 01' Barrault (1973) whlch 22 Indicate thiat 10000ar rrequer:lCy 01'• C\\Jttlngfavors total OM ac~ulatlon 22 Indicate thiat 10000ar rrequer:lCy 01'• C\\Jttlngfavors total OM ac~ulatlon 23 ~n ~ gayarus. l.lght lnterceptlón \\s probaply timits crop grawth rata 23 ~n ~ gayarus. l.lght lnterceptlón \\s probaply timits crop grawth rata undar   undar  "},{"text":" , Andropogon gayar.lus ~nth Is a large tufted grass species i:hat 15 highly productive. moderately'nutritious In pure stand without N fertillzation. and highly palatable to aH classes of lvestock. It 'is easil,Y establlshed and Is easily eHminated by ploughing. It is very ',7 tolerant of p~oblem soils. including Oxisols ancj Ultisols which are low.: In P and have high levels of Al saturation. It is resistant to burning anc! drought stress arid is known for.-,its production of green forage throughout. the dry season and its r?pid recuperation after burning and uppn resumption oF the ra:,'Y season. . It appears to be best adapteé..••te , monsoonal cllmates at elevatlons below 2000 m with dr'y seasons of 3 13 to 5 (01\" more.) months and annual ralnfall above 750 mm. Urider 14 moderate to high ferttuty annual DM production ranges from 9 to 11 kg: • \" gayanus hay;to lntake aÍ\"ld dlgas.tlbtUty In sheep was demonstrated by . . . Haggar aOO Ahmed (1970) aOO !-/aggar (1972)': Restrictlng the amOunt of feed on ol'l'el\" reduced dl\"y matter digestlbUlty. presumably because . '1 the sheep were forced•to consume more 01' the uOOigestlbhi stem . . . : U productng cOntlnua1 yeung gr'DllVth •(Ratns. aOO Fester. 1958; Barrau1i:, 20 1973), ando Incluslon of a legumtnous assoctate 01\" supptement. (eIAT., 21 1978; Haggar. 1972). 22 Response to Ferttllty. 23 The response 01' cr.ops to l'erttuzer N ts dlff'icult to .compare . . 1 declines I'rom 80% te 50% In the I'lrst b'ear. to 30% in the third year .' 2 ard to zero in 4 to 6-year-old seed. .. ' '•8 In Colombia ylelds 01' grac!,ed seed 01' 40% purity has varled I'rom 30 to 300 kg ha-1 wlth a mean graded seed yield 01' 120 kg ha-1 • 4 5 Germination 01' untreated pure seed h~s been as high as 65% at 9 months 20 • 6 :7 8 9 : 10 11 12 13 14 15 16 .. 17 18 lE 20 21 .22 24 (J.E. Fergus~. personal communlcatlon). These yields are eonsiderably better than those reported elsewhere and ls probably Indicativa 01' tha Importan ce of' eli.mate ¡n'seed •production. Ylelds 01' 200 kg/ha of' graded seelng testing 40% international RUrity ard 50% '1ermination (I..e. 20% Pure Live Seed (PLS,) content). would allow seeding rates 01' 10'kg ha-1 of such seed (providing 2 kg ha-1 of PLS). Thus. a multiplication rate 01' approxl.mately 20 (20 ha seeded 1'01'\" each'h:t harvested) Is feaslble. . •. . . .. , 15 DM ha-1 mm-1 rainFaH •. It is reported te associate well wlth a 16 number of legumes. 'and the few avaitable data indicate that animal 17 gains on etther pure stands 01\" on mixtures with legumes are Far 18 ~uperior te those on' native pasture. 19 Seed production varies With location. but a ratio of 20 ha planted 20 per ha hal\"Vested seems ppssible to attain •. In addition, A. gayanus 21 adapts wett te companion crops, and 900d possibllities exlst For the 22 development oFvery low de~iI:Y. mlnimum Input planting techniques 24 belween sltes aOO'between .vea,.. ,\" 23 23 whl\"ch take advanlage of selF-sown seed. • \" gayanus hay;to lntake aÍ\"ld dlgas.tlbtUty In sheep was demonstrated by . . . Haggar aOO Ahmed (1970) aOO !-/aggar (1972)': Restrictlng the amOunt of feed on ol'l'el\" reduced dl\"y matter digestlbUlty. presumably because . '1 the sheep were forced•to consume more 01' the uOOigestlbhi stem . . . : U productng cOntlnua1 yeung gr'DllVth •(Ratns. aOO Fester. 1958; Barrau1i:, 20 1973), ando Incluslon of a legumtnous assoctate 01\" supptement. (eIAT., 21 1978; Haggar. 1972). 22 Response to Ferttllty. 23 The response 01' cr.ops to l'erttuzer N ts dlff'icult to .compare . . 1 declines I'rom 80% te 50% In the I'lrst b'ear. to 30% in the third year .' 2 ard to zero in 4 to 6-year-old seed. .. ' '•8 In Colombia ylelds 01' grac!,ed seed 01' 40% purity has varled I'rom 30 to 300 kg ha-1 wlth a mean graded seed yield 01' 120 kg ha-1 • 4 5 Germination 01' untreated pure seed h~s been as high as 65% at 9 months 20 • 6 :7 8 9 : 10 11 12 13 14 15 16 .. 17 18 lE 20 21 .22 24 (J.E. Fergus~. personal communlcatlon). These yields are eonsiderably better than those reported elsewhere and ls probably Indicativa 01' tha Importan ce of' eli.mate ¡n'seed •production. Ylelds 01' 200 kg/ha of' graded seelng testing 40% international RUrity ard 50% '1ermination (I..e. 20% Pure Live Seed (PLS,) content). would allow seeding rates 01' 10'kg ha-1 of such seed (providing 2 kg ha-1 of PLS). Thus. a multiplication rate 01' approxl.mately 20 (20 ha seeded 1'01'\" each'h:t harvested) Is feaslble. . •. . . .. , 15 DM ha-1 mm-1 rainFaH •. It is reported te associate well wlth a 16 number of legumes. 'and the few avaitable data indicate that animal 17 gains on etther pure stands 01\" on mixtures with legumes are Far 18 ~uperior te those on' native pasture. 19 Seed production varies With location. but a ratio of 20 ha planted 20 per ha hal\"Vested seems ppssible to attain •. In addition, A. gayanus 21 adapts wett te companion crops, and 900d possibllities exlst For the 22 development oFvery low de~iI:Y. mlnimum Input planting techniques 24 belween sltes aOO'between .vea,.. ,\" 23 23 whl\"ch take advanlage of selF-sown seed. 25 25 26 26 2'7 2'7  "},{"text":" S.N. (1964a) StuI;Iies on Andr\"opogpn gayanus Kunth. n. An outllne o: the mOl\"phology and anatomy ol' Andr\"Opogon gayanus  C'IAT (1978) Seel' Productton Program Annual Report 1977. Centro . . . Internacional de Agrlcultul\"'S. Tropical, Call, Colombia, i:a press. C'IAT (1978) Seel' Productton Program Annual Report 1977. Centro . . . Internacional de Agrlcultul\"'S. Tropical, Call, Colombia, i:a press.  Atkln, R.K.; Sartan, G.E.; RebIASon, O.K. (1973) 'Effect of root-• Atkln, R.K.; Sartan, G.E.; RebIASon, O.K. (1973) 'Effect of root-•  growing tempera.tures on growth substances in xylem exuda te ol' growing tempera.tures on growth substances in xylem exuda te ol'  Zea mays. 'Journa,l 0'-Experimental•Sotany. , 24, 475-487. Zea mays. 'Journa,l 0'-Experimental•Sotany. , 24, 475-487.  Sarrault. J. (1973) La recherche l'ourrag~re au Nol\"d-cameroun. Sarrault. J. (1973) La recherche l'ourrag~re au Nol\"d-cameroun. ,'1 Productlon ei: valeur aHmentai,re de quelques fourrages tocaux ,'1Productlon ei: valeur aHmentai,re de quelques fourrages tocaux  (Travaux menés par l'IRAT.de 1965 a 1971). (FOrage crop (Travaux menés par l'IRAT.de 1965 a 1971). (FOrage crop  researCh In Narth Cameroon. P¡\"'oduction and food value 01' some researCh In Narth Cameroon. P¡\"'oduction and food value 01' some 10 la«a1 l'orage (work ca¡:'~ied' out ~ IRA 1-I'~ 1965 to 1971») • 10la«a1 l'orage (work ca¡:'~ied' out ~ IRA 1-I'~ 1965 to 1971») • 11 L'Agronomle Tropicale\" Parls, 28, 173-188. 11L'Agronomle Tropicale\" Parls, 28, 173-188. 12  12 13  13 14  14 15 Al'rlca. Proceedlngs o, the ,11 th Internatlonal Grasslands 15Al'rlca. Proceedlngs o, the ,11 th Internatlonal Grasslands 16 CongreSs, Surfers Paradl.Se, p. 1-3. 16CongreSs, Surfers Paradl.Se, p. 1-3. 1'1 Bowden, S.N. (1963a) Studles onAndrópogon gayanus Kunth. 1'1Bowden, S.N. (1963a) Studles onAndrópogon gayanus Kunth. 18 l. The use of Andropogon gayanus' In agrlculture. E::mplre 18l. The use of Andropogon gayanus' In agrlculture. E::mplre ,19 Journal ol' Experimental Agr\"leulture. 31, 267-273. ,19Journal ol' Experimental Agr\"leulture. 31, 267-273. 20 Sowden S. N. (1963b) -r:he root distl\"lbutton 01' Andr\"opogon gayanus 20Sowden S. N. (1963b) -r:he root distl\"lbutton 01' Andr\"opogon gayanus 21 var,_ blsguamulatus • East Arrican Agricultural a,nd FOr\"estry 21var,_ blsguamulatus • East Arrican Agricultural a,nd FOr\"estry 22 ,Journal.¡ 29, ,157-159. 22,Journal.¡ 29, ,157-159.  : : 27  27  "}],"sieverID":"b873c362-9223-4ef1-999c-1da011f56bb0","abstract":"Beet' ls a staple roed In Latln Amel\"lea. About 70\",{. of Its beet' pl\"'oductlon.ls In tl\"opU::al reglone. Tropical America has á hlgher pel\" , , .caplta beef' cattle populatlon ttan Ner\"th Amerlca. Western Eul\"ope. ór• , ."}

data/part_4/00a916f32a92c663089a0eefb0ef87ba.json

@@ -0,0 +1 @@
+{"metadata":{"id":"00a916f32a92c663089a0eefb0ef87ba","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/095e6119-9afa-4bd6-bd15-6c857a1d80a4/retrieve"},"pageCount":9,"title":"","keywords":[],"chapters":[{"head":"I 1","index":1,"paragraphs":[{"index":1,"size":53,"text":"While the USA remains the world's largest cotton exporter, in 2012-13 Chinese cotton sector policies have come increasingly to overhang global cotton markets, with Chinese reserves accounting for 63% of global stocks. Chinese support policies, by making duty-paid cotton imports attractive to Chinese textile manufacturers, have supported the global cotton price in 2012-13."},{"index":2,"size":64,"text":"While the ACP accounts for only 5% of global cotton production, cotton remains of considerable social and economic importance in the main ACP cotton producers -Benin, Burkina Faso, Chad and Mali, known as the C4 group. Cotton production in West Africa is projected to show strong growth in marketing year 2012/13 (+41%), and these gains should continue in 2013-14, but at a slower rate."},{"index":3,"size":30,"text":"In Eastern and Southern Africa, a 21% decline in cotton production in 2012/13 is forecast, and this decline is due to continue into 2013/14, following reduced production across the region."},{"index":4,"size":95,"text":"While China now provides the highest overall level of cotton sector support, the EU continues to provide the highest level of support per tonne of production. The expansion of scope for the provision of coupled support, as part of the June 2013 political agreement on CAP reform, could see coupled payments in the cotton sector increased in the next 7 years. This does not bode well for early progress on cotton issues in the WTO, which remained stalled over 2012-13. The US, however, remains central to any substantive movement on cotton issues in the WTO."},{"index":5,"size":45,"text":"Given the influence of Chinese policies on the functioning of global cotton markets, drawing China more substantially into cotton reform discussions in the WTO can be seen potentially as an important priority for the ACP Group's efforts to move cotton issues forward in the WTO."}]},{"head":"Latest developments Developments in global cotton markets 2012-13","index":2,"paragraphs":[{"index":1,"size":19,"text":"In a continuation of the trend evident since 2010/11, global cotton production will again exceed consumption in 2012/13, ending"},{"index":2,"size":9,"text":"\"Cotton production has exceeded consumption for the last 3   "}]},{"head":"\"The cotton dossier in the WTO negotiations is at a standstill\"","index":3,"paragraphs":[{"index":1,"size":16,"text":"The stalemate over cotton is one aspect of the deadlocked negotiations over the wider Doha Round."},{"index":2,"size":11,"text":"Cotton sector subsidies in western countries are also under scrutiny, with"}]},{"head":"Outlook for cotton in 2022","index":4,"paragraphs":[{"index":1,"size":205,"text":"What will the cotton market look like in 10 years' time? In their 'Agricultural Outlook 2013-2022', the FAO and the OECD have for the first time included projections for cotton. While China and the United States are expected to maintain their status as leading consumer and producer respectively, the decade is likely to see significant changes. Consumption is projected to increase at an annual rate of 1.7%, below the longterm average, with a rate of 7% expected in India. It is not expected to reach the 2004 record of 26.7 million tonnes until 2022. Production is forecast to grow more slowly than demand, with a significant fall in China and growth in India and Pakistan. Trade is expected to fall. However the LDCs of sub-Saharan Africa are projected to increase their share of the global export market, overtaking India to become the world's second largest exporter behind the United States. Meanwhile China's share of the global import market will fall by half, with countries like Bangladesh and Vietnam taking up the slack. Finally, prices are projected to increase by 47% relative to the period 2000/09, reaching an average of some US$1395/t. However, they will not be as attractive as those offered by wheat and maize."},{"index":2,"size":23,"text":"discussions currently in progress over CAP reform and the new US Farm Bill (see section 'Developments in the European cotton sector, 2012-13' below)."},{"index":3,"size":144,"text":"In the United States, the two houses of Congress failed to agree a new Farm Bill for 2013/18. In response, the 2008/12 Farm Bill, with a budget in excess of US$288 billion, was extended until 30 September 2013, the deadline for the approval of its successor. Some elements of the new Farm Bill appear to be settled: the budget, at around US$939 billion over 10 years, substantial cuts to subsidies and an increase in crop insurance. However, as of early July, the Senate and the House were still divided, especially over the issue of food stamps. The Republicans in the House of Representatives suggested splitting the Farm Bill as a way forward, and on 11 July the House passed the Bill, shorn of its food stamp clauses. Will this be sufficient to gain a yes vote in the Senate and ultimately White House approval?"},{"index":4,"size":150,"text":"As far as cotton is concerned, the reform marks a change from direct payments to crop insurance programmes. Crop insurance will be complemented by the Stacked Income Protection Plan for Producers of Upland Cotton (STAX), proposed by the National Cotton Council (NCC) to cover smaller losses, and uncontested on 11 July. The NCC argues that STAX will benefit cotton growers while also providing a basis \"for a definitive resolution of the dispute with Brazil and the WTO\". In an interim agreement until the new Farm Bill comes into force, the US is making annual compensation payments of US$147.3 million to Brazil, which is still contemplating retaliatory measures if the new bill fails to meet its expectations. Studies conducted by the International Centre for Trade and Sustainable Development (ICTSD) show that in certain circumstances a crop insurance system combined with STAX could increase American spending on cotton when prices are low."},{"index":5,"size":50,"text":"While the steady increase in Chinese support for the domestic cotton sector has worked to keep the market stable and prices relatively high, especially during 2012/13, the past decade has also seen a negative correlation between levels of subsidy and the Cotlook A Index, particularly for the US and Europe."},{"index":6,"size":18,"text":"\"By including cotton in its duty-free, quota-free access for LDCs, China could increase the competitiveness of African cotton\""},{"index":7,"size":63,"text":"However, an ICAC/ICTSD Information Note suggests that by including cotton in its duty-free, quota-free access to markets programme for LDCs, China could increase the competitiveness of African cotton relative to other regions by making it duty free. Apart from the annual quota of 894,000 tonnes set as part of its WTO obligations, China's duties on imported cotton currently range from 5 to 40%."},{"index":8,"size":196,"text":"Despite the continuing stalemate at the WTO over the cotton issue, there has been an increase in the amount of aid received by African countries. A Cotton and Cashew Industry Management Council has been set up to reform the sector. Following the model adopted for the cocoa sector in Janu-ary 2012, it will focus its attention on growers. It aims to offer them higher returns on the sale of their crop and growers will thus receive 60% of the international price. The project will be accompanied by a special development fund designed to increase production to 600,000 tonnes in 2016, and a buffer fund, on the Burkina Faso model, is also envisaged. In Central Africa, Chad enjoyed marked growth in cotton production, driven by its cotton sector improvement programme for 2012-2016. Chad's cotton processing company, CotonTchad, took a number of measures at the beginning of 2012/13, collecting and paying for the previous year's seed cotton, ordering inputs, etc., and the result was a 50% increase in production to 120,000 tonnes. In Cameroon, production was affected by floods in 2012/13. However, it still grew by 19% to 220,000 tonnes and Sodecoton's target for 2013/14 is 260,000 tonnes."},{"index":9,"size":44,"text":"The company conducted its first trials of GM cotton in 2012 and a joint trade association for cotton is being planned. The association is in theory to start work in 2013, bringing together Sodecoton and the National Confederation of Cotton Producers of Cameroon (CNPCC)."}]},{"head":"East Africa and Southern Africa","index":5,"paragraphs":[{"index":1,"size":69,"text":"In contrast to West Africa and Central Africa, cotton production in East Africa and Southern Africa fell sharply in 2012/13, with no sign of an upturn for 2013/14. Between 2011/12 and 2012/13, production dropped by 22% and the planted area by 17% -the consequence of a 2011/12 season marked in several countries by tensions between growers and millers, as well as falling prices that turned growers away from cotton."},{"index":2,"size":114,"text":"In Tanzania, the system of contract farming central to its cotton sector reform seems mired in disputes. Problems were already apparent in 2012 (see Agritrade article 'Contract farming strengthens functioning of Tanzanian cotton supply chain', 4 June 2012), but during 2013 these became political. The Tanzania Cotton Association (TCA) accused some politicians and cotton buyers of conducting an anti-contract farming campaign that, by encouraging farmers not to sell their cotton below a certain price, has contributed to a potential 40% drop in this year's cotton harvest. With lower yields and a 26% reduction in the planted area from 2012, production is unlikely to exceed 240,000 tonnes in 2013, down from 354,000 tonnes in 2012."},{"index":3,"size":69,"text":"Unfavourable weather and a move to alternative crops, soybeans in particular, mean that Zambia is also expecting a fall in production -by some 30% to approx. 175,000 tonnes (275,000 tonnes in 2011/12) -as well a 27% reduction in the planted area. However, in 2012/13, the government for the first time included cotton in its Farmer Input Support Programme (FISP), a scheme which has already helped to increase maize production."}]},{"head":"\"There has been a fall in production in Eastern and Southern Africa\"","index":6,"paragraphs":[{"index":1,"size":16,"text":"The same trend is evident in Zimbabwe, with a fall of 25% to approx. 260,000 tonnes."},{"index":2,"size":43,"text":"Mozambique has experienced a sharper reduction, with a fall of approx. 46% to 110,000 tonnes, down from the 184,000 tonnes achieved in 2011/12, a year when annual production almost tripled, according to the Cotton Institute. However, the industry is continuing to attract investment. "}]},{"head":"ACP countries must keep up with Chinese policy developments","index":7,"paragraphs":[{"index":1,"size":27,"text":"Any change in China's current policy of supporting domestic cotton producers and building up its national reserve stocks could have a damaging effect on the ACP countries."}]},{"head":"\"Any change in Chinese policy will have an impact on the markets\"","index":8,"paragraphs":[{"index":1,"size":53,"text":"Chinese policy has undeniably worked to support international prices at an artificially high level and any rethink could provoke price falls. The first signs of such a change are now appearing, with the experimental payment in April of targeted subsidies direct to cotton growers in Xinjiang in an effort to halt falling production."},{"index":2,"size":89,"text":"This would have an immediate impact on the ACP countries, which are unprotected and export the majority of their production as raw cotton. However, China has maintained its policy of buying domestic cotton at a price of 20,400 yuan/tonne (€2,504/t), and although farm-gate prices in franc-zone Africa have fallen slightly, they are still relatively high. Chinese production, and global production in general, is projected to fall in 2013/14. With consumption rising, supply and demand are expected to be in equilibrium. However, stocks remain high and will grow further still."}]},{"head":"ACP countries must secure preferential thirdcountry access for their textiles","index":9,"paragraphs":[{"index":1,"size":27,"text":"Renewal of the third-country fabric provisions of the Africa Growth and Opportunity Act (AGOA), which expired on 30 September 2012, was only secured after a fierce struggle."}]},{"head":"\"AGOA's third-country fabric provisions are vital to Africa's textile industry\"","index":10,"paragraphs":[{"index":1,"size":115,"text":"The Act was eventually passed in August 2012 for a period of 3 years, although only after an intense lobbying campaign and more than a year of delays. The AGOA will remain in force until 2015, but any renegotiation of its terms would badly affect the African textile industry, especially in Kenya, Malawi, Lesotho and Tanzania. LDCs which benefit from the AGOA can buy thread and fabric on the global market and export finished garments manufactured from these raw materials to the American market duty free: 86% of African garment exports to the United States depend on these provisions, and the problematic renewal process has already had a negative impact on the Africa-US garment trade."},{"index":2,"size":53,"text":"The struggle will begin again when negotiations resume over the renewal of the AGOA and its third-country fabric provisions in 2015. President Obama confirmed his support for the AGOA when he visited Africa in June 2013 and indicated that he is interested in finding ways of ensuring that it is renewed and improved."}]},{"head":"Tackling the problem of sustainability criteria","index":11,"paragraphs":[{"index":1,"size":87,"text":"Organic cotton first took off in the 1990s. However, the mid 2000s brought new initiatives, such as Fairtrade International (FLO), Cotton Made in Africa (CMIA) and Better Cotton Initiative (BCI), which seemed to resonate with consumers and the big textile manufacturers, although certified cotton still represents only a fraction of the market (2.2% of global production in 2011/12). These certification initiatives vary by approach and geographical area, but all of them aim to make cotton more sustainable and socially responsible, and to increase the return to growers."},{"index":2,"size":77,"text":"The past 2 years have seen a fall in the global production of organic cotton, although India still dominates, with 75% of the market. Several countries are expressing their reservations about organic cotton, particularly Tanzania, the leading African producer (c.75% of Africa's organic crop), which experienced a fall in production (including conventional cotton) in 2012/13. Organic yields are smaller, and the price premium when paid (and this is not always the case) is not enough to compensate."}]},{"head":"\"Organic cotton is in turmoil\"","index":12,"paragraphs":[{"index":1,"size":127,"text":"Some growers are also finding it difficult to secure a market for their cotton. African countries, unlike India and Turkey, do not benefit from an integrated textile industry. They are price takers for organic cotton and conventional cotton alike. Without medium-term contracts to guarantee sales, growers will not stay in the market. Only Fairtrade cotton offers a minimum price and a price premium to the grower, but the brand seems to be marking time, since most of its cotton is also organic. Both certifications impose costs not applicable to the alternative CMIA and BCI marks, which consequently enjoyed considerable growth in 2010/11 and 2011/12. However, none of these initiatives guarantee a market to the producer. All imply additional costs, and they remain subject to supply and demand."},{"index":2,"size":72,"text":"Compliance with these sustainability criteria can offer African producers price premiums and attractive opportunities, but it seems these are by no means guaranteed. Any ACP producer wishing to go down this route must ensure that the price premiums offered for organic cotton provide effective compensation for lower yields and the costs of certification. The development of textile industries in cotton growing countries would also leave growers less vulnerable to external market trends."}]}],"figures":[{"text":"3 .Figure 1 : Figure 1: Cotton price trends on the New York futures market, 2009-13 (US $/lb) "},{"text":"Table 1 : Cotton fibre production trends in sub-Saharan Africa ('000 tonnes) 2011/12 2012/13* 2013/14* 2011/122012/13*2013/14* Francophone Africa 717 1011 912 Francophone Africa7171011912 -Benin 75 158 151 -Benin75158151 -Burkina Faso 174 260 92 -Burkina Faso17426092 -Cameroon 78 100 151 -Cameroon78100151 -Côte d'Ivoire 113 140 133 -Côte d'Ivoire113140133 -Mali 187 229 211 -Mali187229211 Anglophone Africa 633 503 461 Anglophone Africa633503461 -Mozambique 61 37 27 -Mozambique613727 -Nigeria 63 57 56 -Nigeria635756 -Tanzania 120 97 80 -Tanzania1209780 -Zambia 110 74 65 -Zambia1107465 -Zimbabwe 142 119 107 -Zimbabwe142119107 Note: *estimate    Note: *estimate Source: International Cotton Advisory Committee (ICAC), March 2013  Source: International Cotton Advisory Committee (ICAC), March 2013 Benin experienced considerable (Benin, Burkina Faso, Côte d'Ivoire, Benin experienced considerable(Benin, Burkina Faso, Côte d'Ivoire, uncertainty in 2012/13, with the gov- Mali, Senegal and Togo) as a whole, uncertainty in 2012/13, with the gov-Mali, Senegal and Togo) as a whole, ernment eventually resuming control production figures of approximately 1.8 ernment eventually resuming controlproduction figures of approximately 1.8 of the industry and sidelining Patrice million tonnes in 2012/13 are forecast of the industry and sidelining Patricemillion tonnes in 2012/13 are forecast Talon, a key figure in cotton, involved to grow by +20% to 2.1 million tonnes Talon, a key figure in cotton, involvedto grow by +20% to 2.1 million tonnes at every stage of the supply chain and in 2013/14.  at every stage of the supply chain andin 2013/14. particularly in the import of inputs. The    particularly in the import of inputs. The government was unable to turn things    government was unable to turn things round at such short notice and pro-    round at such short notice and pro- duction was limited to 250,000 tonnes    duction was limited to 250,000 tonnes instead of the anticipated 600,000    instead of the anticipated 600,000 tonnes. However, this still represented    tonnes. However, this still represented an increase over the 2011/12 figure of    an increase over the 2011/12 figure of 175,000 tonnes. Togo, too, was unable    175,000 tonnes. Togo, too, was unable to reach its target of 100,000 tonnes,    to reach its target of 100,000 tonnes, production remaining steady at 80,000    production remaining steady at 80,000 tonnes. In Mali, the CMDT consolidated    tonnes. In Mali, the CMDT consolidated its gains despite the conflict, with pro-    its gains despite the conflict, with pro- duction of 453,000 tonnes, almost    duction of 453,000 tonnes, almost identical to the previous year. The    identical to the previous year. The target for 2013/14 is 522,000 tonnes.    target for 2013/14 is 522,000 tonnes. For the six countries of West Africa    For the six countries of West Africa  "}],"sieverID":"633873f2-bf8c-4d86-a47d-39579a588d7e","abstract":""}

data/part_4/0126564e4eb8caa906da86c4c9bc6e3b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0126564e4eb8caa906da86c4c9bc6e3b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/11f83ea1-1df9-45fa-9b01-ee2c8001d1ae/retrieve"},"pageCount":18,"title":"Genetic Variability and Population Structure of Ethiopian Sesame (Sesamum indicum L.) Germplasm Assessed through Phenotypic Traits and Simple Sequence Repeats Markers","keywords":["Teklu, D.H.","Shimelis, H.","Tesfaye, A.","Mashilo, J.","Zhang, X.","Zhang, Y.","Dossa, K.","Shayanowako, A.I.T. Genetic Variability and Population Structure of Ethiopian Sesame (Sesamum indicum L.) Germplasm Assessed through Phenotypic Traits and Simple agronomic traits","Ethiopia","genetic diversity","microsatellites","population structure","principal component analysis","Sesamum indicum"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":128,"text":"Sesame (Sesamum indicum L.) is a multi-purpose high-value oilseed crop. It is a global commodity serving the food, feed, and cosmetic industries. The seed oil content of sesame is about 60%, the highest when compared with other oilseed crops such as sunflower (~45%), rapeseed (~40%), and soybean (~20%) [1][2][3][4]. Sesame oil comprises about 85% unsaturated and 15% saturated fatty acids. The fatty acid contains linoleic acid (~46%), oleic acid (~38%), palmitic acid (~12%), and stearic acid (~4%) [4][5][6][7]. Sesame seed is a rich source of protein (≈24%), carbohydrate (≈13.5%), vitamins (e.g., A and E), lignans (sesamin and sesamolin), γ tocopherol, phytosterols (β-sitosterol and Campesterol), policosanols (Docosanol, Tetracosanol, Hexacosanol, and Octacosanol) and lipids [4,[7][8][9]. These attributes make sesame a 'superfood' comprising all the essential human nutrients in desirable proportions."},{"index":2,"size":90,"text":"Sesame is the second most valuable export crop after coffee (Coffea arabica L.) and a major contributor to Ethiopia's gross domestic product [10]. In Ethiopia, the area allocated for sesame production in 2018 was 294,819.49 ha, approximately 39.4% of the total estimated area allocated for oil crops production [11]. Compared with global sesame production, Ethiopia ranks eight with a total annual output of 301,302 tons after Sudan (981,000 tons), Myanmar (768,858 tons), India (746,000 tons), Nigeria (572,761 tons), Tanzania (561,103 tons), China (433,386 tons), and China Mainland (431,500 tons) [12]."},{"index":3,"size":203,"text":"Ethiopia is the center of origin and diversity for the cultivated sesame and its allied species. The Ethiopian Biodiversity Institute (EBI) maintains one of the most extensive core collections of sesame genetic resources in Africa. About 5000 genetically diverse sesame germplasm resources are conserved by the EBI [13]. The germplasm pool can provide various unique economic traits and gene combinations for global sesame improvement. However, the genetic resources maintained at the EBI are yet to be explored for local, regional, and international sesame improvement programs to develop high-performing and marketpreferred varieties. Ethiopia's mean sesame yield is 0.68 tons ha −1 , which is relatively low compared with a mean yield of 1 ton ha −1 in sub-Saharan Africa and 1.29 ton ha −1 in Egypt [11,12]. The low productivity is attributable to a lack of improved and high-yielding varieties and traditional production technologies, among other constraints. Landrace varieties are the main sources of seed for cultivating the crop in Ethiopia. Landraces are inherently low yielders and prone to capsule shattering leading to reduced productivity. However, landraces are highly valued for possessing intrinsic farmer-preferred attributes such as unique taste and aroma, adaptation to marginal growing conditions that often characterize low input farming systems [8,14]."},{"index":4,"size":76,"text":"Sesame genetic resources maintained at the EBI can be explored to search for new sources of useful genetic variation for economic traits. This includes grain yield and yieldcomponents, resistance to diseases and insect pests, tolerance to abiotic stresses, capsule shattering tolerance, and nutritional quality. This will identify desirable and complementary parents and for gene discovery. Hence, rigorous phenotyping and genotyping can establish genetic polymorphism in the germplasm pool and classify the heterotic groups for ideotype breeding."},{"index":5,"size":76,"text":"Previous studies have reported considerable phenotypic variation for agronomic and quality traits in Ethiopia's sesame genetic resources [15][16][17][18]. However, these studies did not fully represent the landrace collections from various parts of Ethiopia. Hence there is a need for a comprehensive assessment of the genetic diversity present in the Ethiopian sesame using a relatively more significant number of accessions representing the diverse germplasm resources and sampled from various regions through phenotypic traits and effective molecular markers."},{"index":6,"size":214,"text":"Several molecular markers such as amplified fragment length polymorphism (AFLP), restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), microsatellites or simple sequence repeat (SSR), and single nucleotide polymorphisms (SNPs) markers are widely used in genetic diversity analysis of various crop genetic resources. SSR or microsatellites have been commonly used in genetic variation studies on sesame [19][20][21][22]. The SSRs are preferred for their ability to detect higher degrees of polymorphism, higher reproducibility, and abundant coverage of the genome [20,21]. Moreover, SSR markers can be used for loci with multiple co-dominant alleles [23]. Wei et al. [20] and Asekova et al. [21] assessed genetic diversity and population structure present in sesame genetic resources sampled from China and Korea using 44 and 23 SSRs, respectively. The authors reported two and three major heterotic groups among the Chinese and Korean collections, respectively. The level of genetic diversity varies among different germplasm populations and environmental conditions, suggesting that each set of populations must be assessed in a target production environment for selection and genetic grouping. Therefore, this study's objectives were to determine the extent of genetic variation among 100 diverse sesame germplasm collections of Ethiopia using phenotypic traits and simple sequence repeat markers to select and recommend distinct and complementary parents for direct production, breeding, and conservation."}]},{"head":"Materials and Methods","index":2,"paragraphs":[]},{"head":"Plant Materials","index":3,"paragraphs":[{"index":1,"size":246,"text":"The study used a mini-core collection of 100 sesame entries originally collected from the Amhara, Tigray, Afar, Oromia, and Gambela regions in Ethiopia. The test genotypes were obtained from the sesame and groundnut breeding program of Werer Agricultural Research Centre of the Ethiopian Institute of Agricultural Research (EIAR). The collection comprised of 95 accessions, one landrace (farmer variety), and four released varieties. The landrace variety \"Hirhir\" is widely cultivated by farmers in the study areas. The four released varieties (i.e., Setit-1, -2, -3, and Humera-1) were developed by the Humera Agricultural Research Center (HuARC) through mass selection amongst the local germplasm collections. The details of the germplasm collections used in the study are summarized in Table 1. The study was conducted in northwestern Ethiopia in two selected locations, namely, Humera (14 • 15 N, 36 • 37 E) and Kebabo (13 • 36 N, 36 • 41 E). Humera and Kebabo are agricultural research stations of the Humera Agricultural Research Centre of EIAR and the Tigray Agricultural Research Institute (TARI). The two sites represent the major sesame production environments in Ethiopia. Humera and Kebabo are situated at an altitude of 609 and 696 m above sea level and receive a total rainfall of 576.4 and 888.4 mm, respectively. The mean minimum and maximum temperatures at Humera site range from 20.3 to 36.5 • C. Kebabo has an average minimum and maximum temperatures of 16.9 and 31.7 • C. The two sites have predominantly clay soil [24]."}]},{"head":"Experimental Design and Trial Management","index":4,"paragraphs":[{"index":1,"size":63,"text":"The experiment was conducted under field conditions and laid out using a 10 × 10 simple lattice design, with two replications, at each site. Each entry was planted in four rows plots measuring four meters in length, with an inter-row and intra-row spacings of 0.4 m and 0.1 m, respectively. The trials were maintained following the standard agronomic practices of sesame production [24]."}]},{"head":"Phenotypic Data Collection","index":5,"paragraphs":[{"index":1,"size":183,"text":"Data were collected on quantitative and qualitative traits. Plant height, internode length, number of primary branches per plant, number of secondary branches per plant, number of capsules per plant, number of seeds per capsule, stem height to first branch, and distance from lowest branch to 1st capsule were recorded from 10 randomly selected and tagged plants during plant growth and at harvest. Plant height (PH) was measured from the base to the tip of the plant. Stem height from the base to the 1st branch (SHB) was measured from the base of the plant to first emerged primary branch. Internode length (INL) was measured between two consecutive nodes situated in the middle of the plant. The number of primary branches per plant (NPB) was counted from the plant's main stem, while the number of secondary branches per plant (NSB) was counted from the plant's main branch. Distance from the base of the lowest branch to the first capsule (DFLBC) was measured as the distance between the lowest situated primary branch to the 1st emerged capsule on the main stem and expressed in cm."},{"index":2,"size":113,"text":"The number of days to flowering (DF) was recorded by counting the number of days from planting to the date when 50% of the plants showed flowers, while days to maturing (DM) was recorded as the number of days from planting to the date when 75% of the plants reached physiological maturity. The number of capsules per plant (NCPP) and number of seeds per capsule (NSPP) were counted from a composite of three capsules per plant at harvest. Thousand seed weight (TSW) was measured from a random sample of 1000 seeds of each entry. Grain yield (GYH) was measured in grams per plot and converted into ton (t) per hectare (ha −1 )."},{"index":3,"size":40,"text":"Oil content was determined at Wuhan city, China using the Near-Infrared Spectroscopy (NIR) (FOSS, model DS2500, Hillerød, Denmark). Oil yield per hectare was calculated and expressed in tons per hectare as the product of grain yield and percent oil content."}]},{"head":"Phenotypic Data Analysis","index":6,"paragraphs":[{"index":1,"size":402,"text":"The phenotypic data were subjected to analysis of variance (ANOVA) using the alphalattice and general linear model (GLM) procedures of the SAS software version 9.4 [25]. A combined analysis of variance across the two locations was performed after Bartlett's homogeneity test of variance. Mean comparisons among accessions were performed using Tukey's Honestly Significant Difference (HSD) test procedure at 5% level of significance used to identify significant differences among means in Table 4. The correlation among traits was performed using R software version 4.0 [26] to determine the magnitude of associations among the studied traits. Multivariate analysis using the principal components was performed using R software version 4.0 [26]. The above 100 sesame entries (Table 1) were planted at the Oil Crops Research Institute (OCRI)-the Chinese Academy of Agricultural Sciences (OCRI-CAAS), China. Ten seeds per entry were sown in a plastic tray in a growth room. Three two-weeks old seedlings were randomly selected from each entry, and fresh young leaves were collected and ground in liquid nitrogen for DNA extraction. The DNA was extracted following the Cetyl-tetramethyl ammonium bromide (CTAB) method. Approximately 200 mg of ground plant tissue combined with 500 µL of CTAB buffer was incubated in a water bath at 65 • C, 4 times for 10 min, and subjected to centrifugation at 12,000 rpm for 10 min at 4 • C. The supernatant was then transferred into new 5 mL micro-tubes, and 400 µL chloroform: iso-amyl alcohol (24:1) was added into the tubes and mixed gently. After a minute of centrifugation (centrifuged at 12,000 rpm for 10 min at 4 • C), the supernatant was transferred into new 5 mL micro-tubes, and 400 µL isopropanol was added into the tubes, mixed gently and kept at −20 • C for 30 min and subjected to centrifugation at 12,000 rpm for 10 min at 4 • C. The precipitated DNA was washed by 75% ethanol three times. The resulting pellet was dried under vacuum and dissolved in 100 uL DD H 2 O. DNA concentrations were measured using the Quantus TM Fluorometer (Promega Corporation, Madison, USA). Microsatellites from 13 linkage groups were designed and used for the following experiments. The 27 primers were selected because of their suitability in discriminating sesame genotypes. The presently used primers were initially selected amongst 160 candidate primers based on their higher polymorphic information content and provided clear and informative amplicon profiles in sesame genetic analysis [27]."},{"index":2,"size":105,"text":"The polymerase chain reaction (PCR) conditions were maintained as follows; each PCR reaction was carried out in a 20 µL solution containing 25 ng of DNA, 4 µmol of forward primers, 4 µmol of reverse primers, 1 × buffer, 0.25 mmol of dNTPs, and 0.80 U Taq polymerase. The temperature profile used for PCR amplification comprised a denaturation step at 94 • C for 1 min, followed by primer annealing temperature at 45.2-53 • C for 1 min, and elongation at 72 • C for 1 min. After 34 cycles, the reaction was terminated with a 10 min final extension time at 72 • C."},{"index":3,"size":117,"text":"The PCR reaction conditions were the same for all the primers, except for the annealing temperatures. The PCR products were electrophoresed on 6% Acrylamide gel (=200 mL of 5 × T.B.E., 420 g of Urea [H2NCONH2], 75 g of Acrylamide, 3 g of Bis-Acrylamide, and 400 mL of distilled water) at a voltage value of 2000, current 300 A, power 80 W for 1:30 h. After silver staining, the bands on the gels were recorded, and a total of 27 markers (Table 2) with high polymorphism were used for capillary electrophoresis. The PCR products were separated by capillary electrophoresis on an ABI 3730 automatic sequencer. The marker data was presented as fragment sizes in an excel spreadsheet. "}]},{"head":"Genotypic Data Analysis","index":7,"paragraphs":[{"index":1,"size":117,"text":"The fragment sizes were determined using the ABI 3730 automatic sequencer. Data were analysed using the software GeneMarker V 2.2.0 to determine peak detection threshold levels that ranged from the minimum intensity of 500 and max intensity of 30,000. The 27 primers were used to detect the band sizes based on the peak detection thresholds, which were then scored using 1 to denote presence and 0 for absence. Genetic parameters, such as major allele frequency (M.A.F.), observed heterozygosity (Ho), expected heterozygosity (He), and the polymorphic information content (PIC) were calculated using Power Marker v3.2. Cluster analysis was carried out using a neighbor-joining (NJ) algorithm using the unweighted pair group method (UWPGM) in R software version 4.0 [26]."},{"index":2,"size":101,"text":"The population structure of the 100 sesame accessions was investigated using the Bayesian clustering method in STRUCTURE version 2.3.4 [28]. The length of the burn-in period and Markov Chain Monte Carlo (MCMC) were set at 20,000 iterations [29]. To obtain an accurate estimation of the number of populations, ten runs were performed for each K-value (assumed number of subpopulations), ranging from 1 to 10. Further, Delta K values were calculated, and the appropriate K value was estimated by implementing the [29] method using CLUMPK. The principal coordinate analysis was also used to deduce the genotypes' genetic structure using Darwin version 6."}]},{"head":"Results","index":8,"paragraphs":[]},{"head":"Genetic Variation and Mean Performance of Sesame Accessions","index":9,"paragraphs":[{"index":1,"size":353,"text":"Combined ANOVA revealed significant (p ≤ 0.05) entry x environment interaction for plant height, internode length, number of primary branches, number of secondary branches, distance from the base of the lowest branch to 1st capsule, and grain yield per hectare (Table 3). Entries showed significant (p ≤ 0.05) differences for days-to-50% flowering, days-to-75% maturity, plant height, internode length, number of secondary branches, number of seeds per capsule, distance from the base of the lowest branch to 1st capsule, and grain yield per hectare. Based on grain yield response, the top 10 best performing and the five bottom performing accessions are summarized in Table 4. The mean grain yield across locations was 0.48 ton ha −1, and the mean thousand-seed weight was 2.9 g. The highest grain yield was recorded for entries such as: Hirhir Kebabo Hairless-9 (1.01 ton ha −1 ), Setit-3 (0.84 ton ha −1 ), Orofalc ACC-2 (0.80 ton ha −1 ), Hirhir Humera Sel-6 (0.78 ton ha −1 ), ABX = 2-01-2 (0.74 ton ha −1 ), and Setit-1 (0.73 ton ha −1 ). These genotypes expressed high oil yields of 0.40, 0.40, 0.40, 0.39, 0.36, and 0.39 ton ha −1 than other test genotypes. The accessions Bawnji Fiyel Kolet, NN0056, Hirhir Humera Sel-8, NN-0068-1, and ACC-NS-010 had the highest oil content of 55.6, 55.2, 54.7, 54.6, and 54.10% than other genotypes, respectively. The five bottom performing accessions in terms of grain yield were NN-0183-3 (0.17 ton ha −1 ), NN-0020 (0.24 ton ha −1 ), NN-0108-2 (0.26 ton ha −1 ), NN00136-1 (0.26 ton ha −1 ), and NN-0143 (0.28 ton ha −1 ) with low oil yield of 0.07, 0.12, 0.04, 0.13, and 0.15 ton ha −1 , in that order. These accessions yielded below-average grain and oil yields. (cm), Distance from lowest branch to 1st capsule (DFLBC)(cm), Thousand-seed weight (TSW) (g/1000 seed), Grain yield per hectare (GYH) (ton ha −1 ), Oil yield per hectare (OYH) (ton ha −1 ), Oil content (OC) (%), Means in a column followed by the same letter are not significantly different at the 5% probability level of Tukey's Honestly Significant Difference."}]},{"head":"Correlations of Yield and Yield Components","index":10,"paragraphs":[{"index":1,"size":137,"text":"Phenotypic correlation coefficients for the studied traits are presented in Table 5. Grain yield was significantly and positively correlated with oil yield (r = 0.99; p < 0.01). Significant and positive correlations were also observed between grain yield and internode length (r = 0.35; p < 0.01), number of secondary branches (r = 0.21; p < 0.01), number of capsules per plant (r = 0.18; p < 0.01), number of seeds per capsule (r = 0.17; p < 0.01), stem height from base to 1st branch (r = 0.16; p < 0.01), and thousand-seed weight (r = 0.23; p < 0.01). , Distance from lowest branch to 1st capsule (DFLBC)(cm), Thousand-seed weight (TSW) (g/1000 seed), Oil content (OC) (%), Oil yield per hectare (OYH) (ton ha −1 ), Grain yield per hectare (GYH) (ton ha −1 )."}]},{"head":"Principal Component Analysis","index":11,"paragraphs":[{"index":1,"size":98,"text":"Principal component analysis (PCA) was computed to show each trait's contribution to the overall observed variation. A scree plot was generated to visualize the number of principal components. Overall, four principal components were identified with >1 Eigen values of which principal components 1 (PC1) and PC2 explained the highest proportion to the total variance (Figure 1). Principal component one (PC1) explained 19.9% to the total variation with OYH and GYH contributing the largest variation to PC1. Principal component two (PC2) accounted for 15.9% of the total variation, and DM, DF, DFLBC, and NPB were the most influential traits. "}]},{"head":"Principal Component Analysis","index":12,"paragraphs":[{"index":1,"size":98,"text":"Principal component analysis (PCA) was computed to show each trait's contribution to the overall observed variation. A scree plot was generated to visualize the number of principal components. Overall, four principal components were identified with >1 Eigen values of which principal components 1 (PC1) and PC2 explained the highest proportion to the total variance (Figure 1). Principal component one (PC1) explained 19.9% to the total variation with OYH and GYH contributing the largest variation to PC1. Principal component two (PC2) accounted for 15.9% of the total variation, and DM, DF, DFLBC, and NPB were the most influential traits.  "}]},{"head":"Genetic Polymorphism of the SSR Markers","index":13,"paragraphs":[{"index":1,"size":87,"text":"The summary statistics describing the SSR markers are presented in Table 6. The major alleles frequency per locus ranged from 0.52 to 0.96, with a mean of 0.78 alleles per locus. The observed heterozygosity varied from 0.08 to 0.96, with a mean of 0.43. The unbiased expected heterozygosity (gene diversity) of the markers ranged from 0.08 to 0.5, with a mean of 0.30. The PIC values ranged from 0.07 (for markers ID0041, ID0175, and ZMM2818) to 0.37 (ZMM3261 and ZMM1189) with a grand mean value of 0.25.  "}]},{"head":"Genetic Polymorphism of the SSR Markers","index":14,"paragraphs":[{"index":1,"size":87,"text":"The summary statistics describing the SSR markers are presented in Table 6. The major alleles frequency per locus ranged from 0.52 to 0.96, with a mean of 0.78 alleles per locus. The observed heterozygosity varied from 0.08 to 0.96, with a mean of 0.43. The unbiased expected heterozygosity (gene diversity) of the markers ranged from 0.08 to 0.5, with a mean of 0.30. The PIC values ranged from 0.07 (for markers ID0041, ID0175, and ZMM2818) to 0.37 (ZMM3261 and ZMM1189) with a grand mean value of 0.25. "}]},{"head":"Population Structure Analysis","index":15,"paragraphs":[{"index":1,"size":103,"text":"Structure analysis revealed four populations amongst the 100 sesame entries (Figure 2b, Table 7). Sixty-three accessions were allocated to the four populations, whereas 37 accessions were admixtures with no specific membership (Table 7). Population I consisted of 24 accessions collected from the following regions: Amhara (17 collections), Tigray (3), Afar (3), and Oromia (1). Population II had 13 accessions initially collected from the Amhara region (8), Afar (4), and Tigray (1). Population III comprised nine accessions, sourced from the Amhara (5 accessions) and Tigray (4) regions. Population IV consisted of 17 accessions sourced from Tigray (10 accessions), Amhara (6), and Afar (1) regions."},{"index":2,"size":67,"text":"Table 7. Genetic clusters and their member entries, the proportion of the membership, mean expected heterozygosity, and fixation index based on structure analysis of 63 sesame entries with 27 SSR markers.  Entries allocated in population I had good branching ability (NN-0052, NN-0029-1, and GXT = 85(28-2)), many seeds per capsule (Gojam Azene (Aleka), and ABXT-85-Sel-2-1), and significant oil yield (NN-0026), and seed oil content (NN0064-1 and NN0071)."}]},{"head":"Population","index":16,"paragraphs":[{"index":1,"size":93,"text":"Population II accessions were early maturing with tall plants. Some population II accessions had a significant number of seeds per capsule (NN0025 and ABX = 2-01-2), and grain yield(Orofalc ACC-2, and ABX = 2-01-2). In addition, population II comprises accessions such as NN0056, Hirhir Baeker-Sel-3, and Orofalc ACC-2 with good oil content. Genotypes allocated in population III were early maturing with taller plants. These accessions were outstanding in thousand-seed weight (e.g., Hirhir Filwha Large Seeded), grain yield (Hirhir Kebabo Hairless-9), oil yield (Hirhir Kebabo Hairless-9), and seed oil content ( Hirhir Kebabo Hairless-9)."},{"index":2,"size":114,"text":"Genotypes allocated in population IV were also early maturing with taller plants. Some accessions within this group also had remarkable seeds per capsule (Setit-3 and NN-0020), better thousand-seed weight (3.4 g), higher seed and oil yields (0.84 and 0.40 ton ha −1 ), and oil content (54.7%). To develop new breeding populations possessing desirable economic traits new crosses could be developed between the selected parents. Hence accessions Orofalc ACC-2 (from population II), Hirhir Filwha Large Seeded (population III), and Setit-3, Hirhir Humera Sel-6 (population IV) are ideal candidates with complementary traits for production and further breeding. However, the principal coordinate analysis assigned the 100 genotypes into admixture groups with an inconclusive structure (Figure 2c)."}]},{"head":"Cluster Analysis of 100 Sesame Accessions","index":17,"paragraphs":[{"index":1,"size":131,"text":"The cluster analysis involving 100 sesame genotypes resolved two clusters, and each cluster was further partitioned into two sub-clusters (Figure 3). Cluster I consisted of 49 accessions and one improved variety sourced from the following regions: Amhara (37 accessions), Tigray (5 accessions and one improved variety), Afar (6 accessions), and Oromia (1 accession). Cluster II contained 50 diverse genotypes, of which 28 accessions were from Amhara, while 13 accessions, one landrace and 3 improved varieties from Tigray, 2 accessions (from Afar), 2 accessions (Oromia), and 1 accession (Gambela). Likewise, as observed from the population structure analysis, all the two main clusters and their respective sub-branches had genotypes with the potential for optimum grain yield and high oil content. Note: see Table 1 for codes of entries.  1 for codes of entries."}]},{"head":"Discussion","index":18,"paragraphs":[]},{"head":"Genotypic Variation and Mean Performance for Seed and Oil Yields, and Yield-Component Traits","index":19,"paragraphs":[{"index":1,"size":55,"text":"Assessment of genetic diversity among crop genetic resources is essential to identify candidate accessions possessing desirable traits, including yield and quality attributes. The current study evaluated the genetic variation present among 100 accessions of sesame through rigorous field phenotyping and polymorphic SSR markers as a preliminary step to select genetically complementary parental accessions for breeding."},{"index":2,"size":179,"text":"The test genotypes showed significant (p ≤ 0.05) variation for grain yield and yield components (Table 3). This suggests that the germplasm pool contains vital phenotypic traits for sesame improvement through hybridization and selections. The test genotypes were sourced from five historically sesame-growing regions in Ethiopia. Given the long agricultural history and sesame production of the collection areas, it is expected that the test genotypes have adapted and evolved under local conditions through natural selection. This caused genetic differentiation of the studied sesame accessions for grain and oil yields and important yield-contributing agronomic traits. For example, the present study identified and selected sesame genotypes such as Hirhir Kebabo Hairless-9 and Setit-3 with high grain yields of >0.8 tons ha −1 and higher oil yields of 0.40 ton ha −1 . The selected genotypes, which are locally referred to as Humera types, are known for their unique quality associated with product aroma and taste [30]. The selected genotypes expressed higher grain yield which is above the mean yield of 0.68 tons ha −1 currently recorded in Ethiopia using traditional varieties."}]},{"head":"Traits Associations","index":20,"paragraphs":[{"index":1,"size":127,"text":"Sesame seed and oil yields are low in Ethiopia due to a lack of high-yielding varieties. These results in low financial returns for producers and processors across the sesame value chains. To improve selection response and genetic gains for economic traits, selection of highly heritable yield-contributing traits associated with seed and oil yields may be targeted in sesame improvement programs. The strong and positive correlation between seed and oil yield among the studied sesame genotypes implied both traits could be improved simultaneously in the present population. Weak correlations observed between grain yield with yield-related traits, including internode length, number of secondary branches, number of capsules per plant, stem height from base to first branch, and thousand seed weight would provide a low selection response for grain yield."},{"index":2,"size":168,"text":"Similarly, oil yield exhibited low correlations with internode length, the number of secondary branches per plant, and thousand-seed weight implying reduced selection response for grain yield via these traits. Oil content showed poor associations with agromorphological traits hindering direct selection. Despite the low and poor associations between seed and oil yields and oil content with yield-related agronomic traits, the present study revealed wide phenotypic variation among the studied sesame populations for several traits. These are valuable traits for future sesame phenotypic analysis, selection, and improvement in Ethiopia. Moreover, the assessed germplasm was diverse for seed and oil yields and oil content. This aided identification and selection of sesame genotypes such as Hirhir Kebabo Hairless-9, Setit-3, Orofalc, Hirhir Humera Sel-6, and Setit-1 with high seed and oil yields as useful germplasm to design and develop improved cultivars. Furthermore, sesame genotypes with relatively higher oil content, including Hirhir Humera Sel-6, Setit-1, ACC 205-180, and Orofalc ACC-2 are suitable candidates for developing new breeding populations with higher oil yield and content."},{"index":3,"size":67,"text":"The traits accounting for the significant variation observed in the first two PCs will be important for selection. Nevertheless, 53.4% of the total variation was not explained by the PCA, probably due to the limited number of test locations used in the study. Hence, there is a need to assess the test accessions across multiple test environments and using effective molecular markers to complement the phenotypic data."}]},{"head":"Genetic Diversity and Population Structure of Sesame Germplasm Based on SSR Markers","index":21,"paragraphs":[{"index":1,"size":204,"text":"SSR markers are amongst the useful genomic resources to complement phenotypic data for effective selection. The present study recorded a mean major alleles frequency per locus of 0.78 among the sesame population (Table 6), which was much higher than values of 0.41 and 0.17 reported by [21,31] using 23 and 21 SSR among 129 Korean and 25 Ghanaian sesame genotypes, respectively. Variation in alleles frequency is attributable to genotypic differences and the number of SSR markers used in the genetic analysis [32][33][34]. The mean observed heterozygosity of 0.43 reported in the present study is lower than the value of 0.56 reported by [31] when assessing 25 sesame genotypes using 21 SSR markers. This study's observed heterozygosity was higher than values of 0.23, 0.01, and 0.12 reported by [19,21,22] when assessing 50, 129, and 36 sesame genotypes using 10, 23, and 10 SSR markers, respectively. The mean expected heterozygosity (He = 0.30) recorded in the present study (Table 7) was lower than values of 0.72 and 0.34 reported by [21,22] when evaluating 129 and 36 sesame accessions using 23 and 10 SSR markers, respectively. The higher heterozygosity recorded in the present study suggested that the Ethiopian sesame populations have a high genetic variation for selection."},{"index":2,"size":161,"text":"The genetic variability was confirmed by population structure analysis, which revealed four distinct populations comprising genotypes collected from different regions in Ethiopia. Most released entries (Humera-1, Setit-1, and Setit-3) were grouped in subpopulation 4. Wei et al. [20] and Asekova et al. [21] reported two and three populations among 94 and 129 sesame accessions sampled from China and Korea collections using 44 and 23 SSR markers. The higher gene fixation index of 0.39 in population I comprising accessions collected from Amhara, Tigray, Afar, and Oromia regions suggest higher genetic differentiation attributable to high gene flow among these regions. Conversely, the low gene fixation index observed in population III, which comprises accessions sourced from the Amhara and Tigray regions, indicated low differentiation. This may be due to gene flow through germplasm exchange between sources of collections. The exchange of planting material regardless of geographical distances might be attributed to a low degree of differentiation in sesame populations observed in the current study."},{"index":3,"size":245,"text":"Cluster analysis identified two major clusters and four sub-clusters, revealing genetic variation among the assessed sesame entries (Figure 3). Asekova et al. [21] grouped 129 sesame genotypes into two clusters using 23 SSR markers. In the present study, the genotypes' clustering patterns did not correspond to the predefined population structure based on the collection regions. This may be because genotypes gathered from similar regions belong to the same gene pool or may have similar ancestral relationships [35]. Conversely, William et al. [36] reported that genetic dissimilarity among test genotypes could arise due to the diverse ancestral origin, high gene flow caused by cross-pollination and possible gene or chromosomal mutation. In this study, some sesame genotypes collected from different regions were grouped in the same cluster, such as Hirhir Kebabo Hairless Sel-6 (Tigray) and Gojam Azene (Yohans Sel-1) (Amhara), and ACC-NS-007(2) (Oromia) and GA-002(3) (Gambela) which were found in cluster I and II. In agreement with the current study, Zhang et al. [37] reported that geographical separation did not affect genetic distance among 24 sesame genotypes. Ganesamurthy et al. [38] reported that geographical separation does not affect the genetic differentiation of germplasm. Therefore, a key indicator of genetic diversity is not necessarily the geographical origin of germplasm collections. The exchange of genetic materials among farmers and traders in the regions contributes to high gene flow and a lack of genetic differentiation. Barnaud et al. [39], suggested that farmers' selections and management practices affect genetic diversity patterns."},{"index":4,"size":78,"text":"To develop new breeding populations possessing desirable agronomic traits, especially high grain and oil yields, crosses could be made between distantly related and complementary genotypes selected from different clusters. For instance, for improved grain and oil yields, the following entries were selected such as Setit-3, Orofalc ACC-2, Hirhir Humera Sel-6, ACC-NS-007(2), Hirhir Kebabo Hairless-9, and ACC 205-180. These genotypes are localized in sub-cluster II-a and sub-cluster II-b. The two clusters contained candidates with excellent grain and oil yields."},{"index":5,"size":177,"text":"In conclusion, the current study determined the extent of genetic variation among 100 diverse sesame germplasm collections of Ethiopia using phenotypic traits and simple sequence repeat (SSR) markers to select distinct and complementary parents for breeding. The test genotypes exhibited significant phenotypic variation for key agronomic traits including grain yield, oil content, and oil yield, which were underpinned by their genetic diversity. The sesame genotypes were differentiated into four major populations based on the model-based population structure analysis. The moderate heterozygosity and fixation index among the accessions suggests that the accessions have distinct heterotic groups desirable for breeding. Based on wide genetic divergence, the following genotypes were selected for use in future sesame breeding programs: Hirhir Humera Sel-6, Setit-3, Hirhir Kebabo Hairless Sel-4, Hirhir Nigara 1st Sel-1, Humera-1, Orofalc ACC-2, and Hirhir Kebabo Early Sel-1 (selected from subgroup II-a), Hirhir kebabo hairless-9, NN-0029(2), NN0068-2, Hirhir Filwha Large Seeded, and Bawnji Fiyel Kolet, (from subgroup II-b). Progeny development and field evaluation by combining ability analysis are recommended among the selected parents to establish heterotic groups for sesame pre-breeding."}]}],"figures":[{"text":"2. 3 . Genotyping 2.3.1. DNA Extraction, Primer Selection, Polymerase Chain Reaction, and Electrophoresis "},{"text":"Figure 1 . Figure 1. Cont. "},{"text":"Figure 1 . Figure 1. Principal component analysis based on agro-morphological traits, oil content and oil yield of 100 sesame germplasm collections. Note: Figure A is a scree plot indicating eigenvalues and percentage variation explained by principal components; while Figure B is a biplot that indicates sesame traits projection on the first two principal components. Days-to-50% flowering (DF), Days-to-75% maturity (DM), Plant height (PH) (cm), Inter node length (INL) (cm), Number of primary branches per plant (NPB), Number of secondary branches per plant (NSB), Number of capsules per plant (NCPP), Number of seeds per capsule (NSPC), Stem height to 1st branch (SHB) (cm), Distance from lowest branch to 1st capsule (DFLBC)(cm), Thousand-seed weight (TSW) (g/1000 seed), Oil content (OC) (%), Oil yield per hectare (OYH) (ton ha −1 ), Grain yield per hectare (GYH) (ton ha −1 ). "},{"text":"Figure 1 . Figure 1. Principal component analysis based on agro-morphological traits, oil content and oil yield of 100 sesame germplasm collections. Note: Figure (a) is a scree plot indicating eigenvalues and percentage variation explained by principal components; while Figure (b) is a biplot that indicates sesame traits projection on the first two principal components. Days-to-50% flowering (DF), Daysto-75% maturity (DM), Plant height (PH) (cm), Inter node length (INL) (cm), Number of primary branches per plant (NPB), Number of secondary branches per plant (NSB), Number of capsules per plant (NCPP), Number of seeds per capsule (NSPC), Stem height to 1st branch (SHB) (cm), Distance from lowest branch to 1st capsule (DFLBC)(cm), Thousand-seed weight (TSW) (g/1000 seed), Oil content (OC) (%), Oil yield per hectare (OYH) (ton ha −1 ), Grain yield per hectare (GYH) (ton ha −1 ). "},{"text":"Figure 2 . Figure 2. Subpopulation inference among100 sesame entries based on 27 SSR markers: (a) Delta K estimation based on the Evanno procedure, (b) Sub-populations for the best delta K value of four. Pop 1, 2, 3, and 4 denote Populations 1, 2, 3, and 4, respectively, and (c) principal coordinate clustering of genotypes. "},{"text":"Figure 2 . Figure 2. Subpopulation inference among100 sesame entries based on 27 SSR markers: (a) Delta K estimation based on the Evanno procedure, (b) Sub-populations for the best delta K value of four. Pop 1, 2, 3, and 4 denote Populations 1, 2, 3, and 4, respectively, and (c) principal coordinate clustering of genotypes. "},{"text":"Figure 3 . Figure 3. Dendrogram based on Unweighted Pair Group Method with Arithmetic Mean (UPGMA) showing the genetic relationship among 100 sesame entries using 27 SSR markers. Note: seeTable 1 for codes of entries. "},{"text":"Figure 3 . Figure 3. Dendrogram based on Unweighted Pair Group Method with Arithmetic Mean (UPGMA) showing the genetic relationship among 100 sesame entries using 27 SSR markers. Note: see Table1for codes of entries. "},{"text":"Table 1 . Names and sources of 100 sesame accessions included the study. Entry Number Entry Name or Designation Description Source (Regions or Research Center in Ethiopia) Entry Number Entry Name or Designation Description Source (Regions or Research Center in Ethiopia) Entry NumberEntry Name or DesignationDescriptionSource (Regions or Research Center in Ethiopia)Entry NumberEntry Name or DesignationDescriptionSource (Regions or Research Center in Ethiopia)  "},{"text":"Table 2 . Description of the SSR markers used in the study. No Primers Forward Primer Sequence Reverse Primer Sequence Product Size (bp) NoPrimersForward Primer SequenceReverse Primer SequenceProduct Size (bp) 1 ID0046 TCAACGTGATTGCTCCCATA CAGCTGCCTGAAAGAAGAGG 101 1ID0046TCAACGTGATTGCTCCCATACAGCTGCCTGAAAGAAGAGG101 2 ZMM1043 CCCGAAAATAGGATTTCTAACCA TTTTGGACTGCTATTGAGGGA 184 2ZMM1043CCCGAAAATAGGATTTCTAACCATTTTGGACTGCTATTGAGGGA184 3 ZMM3261 CGAAAGCATGAGACGAGTATG AACTAGTGCGCAATTCATTCAA 244 3ZMM3261CGAAAGCATGAGACGAGTATGAACTAGTGCGCAATTCATTCAA244 4 ID0041 AGGCTTTCACATCATCAAATG CATGTAGGATGCAACTCTTCAAA 280 4ID0041AGGCTTTCACATCATCAAATGCATGTAGGATGCAACTCTTCAAA280 5 ZMM5015 ATTTATTGGGTTGCTGGGAA TGAAAATTAAGTCACCAGTACCACC 151 5ZMM5015ATTTATTGGGTTGCTGGGAATGAAAATTAAGTCACCAGTACCACC151 6 ZMM4664 CCTTCACTTCAAATCCGTCAA TTTGGTTTGCATAGATGCTCTT 184 6ZMM4664CCTTCACTTCAAATCCGTCAATTTGGTTTGCATAGATGCTCTT184 7 ZMM1809 TTAAGCCTCGTTGACTCCAA ATTGTACGGCATGTTGTCCC 256 7ZMM1809TTAAGCCTCGTTGACTCCAAATTGTACGGCATGTTGTCCC256 8 ZMM2321 CAACACCACCAACGCATATC AGCAACGATTCACGACATTG 280 8ZMM2321CAACACCACCAACGCATATCAGCAACGATTCACGACATTG280 9 ZMM5358 TAGGATGCTTTGAATTGGGC AGGAACAAACATACGGCGTC 164 9ZMM5358TAGGATGCTTTGAATTGGGCAGGAACAAACATACGGCGTC164  ID0068 TCTTCGGAGTTAACACCCTCA TTGGATTTCCATGTATGCCA 199 ID0068TCTTCGGAGTTAACACCCTCATTGGATTTCCATGTATGCCA199  ZMM3312 GCAAAATCTTCTTTCCTCCG GCAGCAAGGGAATTGAATGT 264 ZMM3312GCAAAATCTTCTTTCCTCCGGCAGCAAGGGAATTGAATGT264  ZMM1033 CGTAGTGGTTCCCCTCACAT ATGCTTTCCCCCAAATAACC 179 ZMM1033CGTAGTGGTTCCCCTCACATATGCTTTCCCCCAAATAACC179  ZMM1189 TATCCAGGGGAAAACCAGAA TTGGATTTTCCTTCTCACGC 212 ZMM1189TATCCAGGGGAAAACCAGAATTGGATTTTCCTTCTCACGC212  ZMM2202 TCAGGAAGAAAGAATTGCTGC CAATTTAACCATCCTGACTC 276 ZMM2202TCAGGAAGAAAGAATTGCTGCCAATTTAACCATCCTGACTC276  ZMM1637 GCGGTGACATATTAAGGGCA ACCGGAATCCGAACATGTAA 265 ZMM1637GCGGTGACATATTAAGGGCAACCGGAATCCGAACATGTAA265  ZMM4645 TTGAGCGATTCATCGACTTG TTCTCCGGCCATTTTAATCA 179 ZMM4645TTGAGCGATTCATCGACTTGTTCTCCGGCCATTTTAATCA179  ZMM1700 CATTAACACCATTACGCAAACA TTTGGCAAAACTAGCAATGAA 258 ZMM1700CATTAACACCATTACGCAAACATTTGGCAAAACTAGCAATGAA258  ID0175 CAATTTTGATTTCTTTATCTATTTTCG TCGAGTGCCCGAATTTTAAG 271 ID0175CAATTTTGATTTCTTTATCTATTTTCGTCGAGTGCCCGAATTTTAAG271  ZMM1353 GCCAAAACAAAGGATTCAAGA TGAGCTTTGTGTGACCATGA 169 ZMM1353GCCAAAACAAAGGATTCAAGATGAGCTTTGTGTGACCATGA169  ID0145 ACCCTCCCTCCATGAATTTT CCTCCATCTCATCTCATCCC 196 ID0145ACCCTCCCTCCATGAATTTTCCTCCATCTCATCTCATCCC196  ZMM4803 TGCATGAGCTAAGGGAAAGG TGGTGGCAATTTGCAAGTAA 268 ZMM4803TGCATGAGCTAAGGGAAAGGTGGTGGCAATTTGCAAGTAA268  ZMM6141 AAAAAGCAAAATCCATAATTTGA TTGCCCCCTCAACTATTTG 167 ZMM6141AAAAAGCAAAATCCATAATTTGATTGCCCCCTCAACTATTTG167  ZMM3013 TGCCAGTTGGCATATACCATTA GAGCCGGTCTGAAATTTATCC 216 ZMM3013TGCCAGTTGGCATATACCATTAGAGCCGGTCTGAAATTTATCC216  ZMM2818 CGTGTGCCCAATATTTGAGTT TCAACCTCCTCCCTACACAA 279 ZMM2818CGTGTGCCCAATATTTGAGTTTCAACCTCCTCCCTACACAA279  ZMM3223 CGATGGTTATTAAATTAAGTATTCGG GACATTTGAAGCAAAGTGTATCG 279 ZMM3223CGATGGTTATTAAATTAAGTATTCGGGACATTTGAAGCAAAGTGTATCG279  ZMM1691 CTTGACCTGGAGTGTACGGC GGATCAAACAGACACGAGCA 220 ZMM1691CTTGACCTGGAGTGTACGGCGGATCAAACAGACACGAGCA220  ZMM1851 TGACTCTTTCGATTTGGGCT CGAAAAATACGGGCGTTACT 280 ZMM1851TGACTCTTTCGATTTGGGCTCGAAAAATACGGGCGTTACT280  "},{"text":"Table 3 . Analysis of variance showing mean square values and level of significance for the studied agro-morphological characters, and oil yield of 100 sesame collections evaluated in two locations in Ethiopia. Traits Traits  "},{"text":"Table 4 . Mean values for agronomic traits of 100 sesame genotypes of Ethiopia showing the top 10 and bottom 5 ranked entries based on grain yield (ton ha −1 ) across two sites. Traits Traits  "},{"text":"Table 5 . Phenotypic correlations coefficients for assessed agro-morphological traits, oil content, and oil yield of 100 sesame collections evaluated across two locations in Ethiopia. Traits DM PH INL NPB NSB NCPP NSPC SHB DFLBC TSW OC OYH GYH TraitsDMPHINLNPBNSBNCPPNSPCSHBDFLBCTSWOCOYHGYH DF 0.31 ** 0.05 ns 0.14 ** 0.09 ns 0.09 ns 0.16 ** −0.21 ** 0.05 ns −0.13 ** −0.02 ns −0.11 * 0.08 ns 0.09 ns DF0.31 **0.05 ns0.14 **0.09 ns0.09 ns0.16 **−0.21 **0.05 ns−0.13 **−0.02 ns−0.11 *0.08 ns0.09 ns DM 1.00 0.07 ns 0.08 ns −0.20 ns 0.07 ns −0.10 * −0.12 * 0.09 ns 0.00 ns −0.15 ** −0.06 ns −0.10 * −0.09 ns DM1.000.07 ns0.08 ns−0.20 ns0.07 ns−0.10 *−0.12 *0.09 ns0.00 ns−0.15 **−0.06 ns−0.10 *−0.09 ns PH  1.00 0.09 ns 0.06 ns 0.12 * 0.07 ns 0.05 ns 0.01 ns 0.07 ns 0.10 * −0.00 ns 0.05 ns 0.05 ns PH1.000.09 ns0.06 ns0.12 *0.07 ns0.05 ns0.01 ns0.07 ns0.10 *−0.00 ns0.05 ns0.05 ns INL   1.00 −0.17 ** 0.21 ** 0.08 ns −0.08 ns 0.38 ** −0.45 ** 0.00 ns 0.03 ns 0.35 ** 0.35 ** INL1.00−0.17 **0.21 **0.08 ns−0.08 ns0.38 **−0.45 **0.00 ns0.03 ns0.35 **0.35 ** NPB    1.00 0.06 ns 0.30 ** 0.08 ns −0.14 ** 0.25 ** 0.20 ** 0.05 ns −0.05 ns −0.06 ns NPB1.000.06 ns0.30 **0.08 ns−0.14 **0.25 **0.20 **0.05 ns−0.05 ns−0.06 ns NSB     1.00 −0.05 ns 0.04 ns 0.34 ** −0.166 ** −0.122 * 0.051 ns 0.214 ** 0.207 ** NSB1.00−0.05 ns0.04 ns0.34 **−0.166 **−0.122 *0.051 ns0.214 **0.207 ** NCPP      1.00 0.119 * −0.00 ns −0.01 ns 0.16 ** −0.01 ns 0.17 ** 0.18 ** NCPP1.000.119 *−0.00 ns−0.01 ns0.16 **−0.01 ns0.17 **0.18 ** NSPC       1.00 −0.07 ns 0.21 ** 0.04 ns −0.08 ns 0.15 ** 0.17 ** NSPC1.00−0.07 ns0.21 **0.04 ns−0.08 ns0.15 **0.17 ** SHB        1.00 −0.26 ** −0.13 ** 0.02 ns 0.16 ** 0.16 ** SHB1.00−0.26 **−0.13 **0.02 ns0.16 **0.16 ** DFLBC         1.00 −0.01 ns −0.02 ns −0.29 ** −0.29 ** DFLBC1.00−0.01 ns−0.02 ns−0.29 **−0.29 ** TSW          1.00 0.05 ns 0.23 ** 0.23 ** TSW1.000.05 ns0.23 **0.23 ** OC           1.00 0.16 ** 0.06 ns OC1.000.16 **0.06 ns OYH            1.00 0.99 ** OYH1.000.99 **  "},{"text":"Table 6 . Genetic parameters estimated for 100 sesame genotypes using 27 SSR markers. Locus Product Size (bp) MAF Genetic Parameter He Ho PIC LocusProduct Size (bp)MAFGenetic Parameter He HoPIC ID0046 101 0.72 0.40 0.56 0.32 ID00461010.720.400.560.32 ZMM1043 184 0.75 0.38 0.51 0.31 ZMM10431840.750.380.510.31 ZMM3261 244 0.59 0.48 0.82 0.37 ZMM32612440.590.480.820.37 ID0041 280 0.96 0.08 0.08 0.07 ID00412800.960.080.080.07 ZMM5015 151 0.79 0.34 0.43 0.28 ZMM50151510.790.340.430.28 ZMM4664 184 0.60 0.48 0.80 0.36 ZMM46641840.600.480.800.36 ZMM1809 256 0.86 0.24 0.28 0.21 ZMM18092560.860.240.280.21 ZMM2321 280 0.90 0.18 0.20 0.16 ZMM23212800.900.180.200.16 ZMM5358 164 0.62 0.47 0.77 0.36 ZMM53581640.620.470.770.36 ID0068 199 0.86 0.25 0.29 0.22 ID00681990.860.250.290.22 ZMM3312 264 0.56 0.49 0.89 0.37 ZMM33122640.560.490.890.37 ZMM1033 179 0.76 0.37 0.49 0.30 ZMM10331790.760.370.490.30 ZMM1189 212 0.52 0.50 0.96 0.37 ZMM11892120.520.500.960.37 ZMM2202 276 0.89 0.20 0.22 0.18 ZMM22022760.890.200.220.18 ZMM1637 265 0.68 0.44 0.65 0.34 ZMM16372650.680.440.650.34  "},{"text":"Table 6 . Genetic parameters estimated for 100 sesame genotypes using 27 SSR markers. Locus Product Size (bp) MAF Genetic Parameter He Ho PIC LocusProduct Size (bp)MAFGenetic Parameter He HoPIC ID0046 101 0.72 0.40 0.56 0.32 ID00461010.720.400.560.32 ZMM1043 184 0.75 0.38 0.51 0.31 ZMM10431840.750.380.510.31 ZMM3261 244 0.59 0.48 0.82 0.37 ZMM32612440.590.480.820.37 ID0041 280 0.96 0.08 0.08 0.07 ID00412800.960.080.080.07 ZMM5015 151 0.79 0.34 0.43 0.28 ZMM50151510.790.340.430.28 ZMM4664 184 0.60 0.48 0.80 0.36 ZMM46641840.600.480.800.36 ZMM1809 256 0.86 0.24 0.28 0.21 ZMM18092560.860.240.280.21 ZMM2321 280 0.90 0.18 0.20 0.16 ZMM23212800.900.180.200.16 ZMM5358 164 0.62 0.47 0.77 0.36 ZMM53581640.620.470.770.36 ID0068 199 0.86 0.25 0.29 0.22 ID00681990.860.250.290.22 ZMM3312 264 0.56 0.49 0.89 0.37 ZMM33122640.560.490.890.37 ZMM1033 179 0.76 0.37 0.49 0.30 ZMM10331790.760.370.490.30 ZMM1189 212 0.52 0.50 0.96 0.37 ZMM11892120.520.500.960.37 ZMM2202 276 0.89 0.20 0.22 0.18 ZMM22022760.890.200.220.18 ZMM1637 265 0.68 0.44 0.65 0.34 ZMM16372650.680.440.650.34  "},{"text":"Table 6 . Cont.     Locus Product Size (bp) MAF Genetic Parameter He Ho PIC LocusProduct Size (bp)MAFGenetic Parameter He HoPIC ZMM4645 179 0.81 0.31 0.39 0.26 ZMM46451790.810.310.390.26 ZMM1700 258 0.95 0.10 0.10 0.09 ZMM17002580.950.100.100.09 ID0175 271 0.96 0.08 0.08 0.07 ID01752710.960.080.080.07 ZMM1353 169 0.94 0.12 0.13 0.11 ZMM13531690.940.120.130.11 ID0145 196 0.77 0.36 0.47 0.29 ID01451960.770.360.470.29 ZMM4803 268 0.95 0.10 0.11 0.10 ZMM48032680.950.100.110.10 ZMM6141 167 0.75 0.38 0.51 0.31 ZMM61411670.750.380.510.31 ZMM3013 216 0.69 0.43 0.63 0.34 ZMM30132160.690.430.630.34 ZMM2818 279 0.96 0.08 0.08 0.07 ZMM28182790.960.080.080.07 ZMM3223 279 0.82 0.30 0.36 0.25 ZMM32232790.820.300.360.25 ZMM1691 220 0.73 0.39 0.54 0.32 ZMM16912200.730.390.540.32 ZMM1851 280 0.90 0.18 0.20 0.16 ZMM18512800.900.180.200.16 Mean 221 0.78 0.30 0.43 0.25 Mean2210.780.300.430.25  "}],"sieverID":"ddaf051b-76fd-4124-8191-f179b5826bdd","abstract":"Ethiopia is one of the centers of genetic diversity of sesame (Sesamum indicum L.). The sesame genetic resources present in the country should be explored for local, regional, and international genetic improvement programs to design high-performing and market-preferred varieties. This study's objective was to determine the extent of genetic variation among 100 diverse cultivated sesame germplasm collections of Ethiopia using phenotypic traits and simple sequence repeat (SSR) markers to select distinct and complementary genotypes for breeding. One hundred sesame entries were field evaluated at two locations in Ethiopia for agro-morphological traits and seed oil content using a 10 × 10 lattice design with two replications. Test genotypes were profiled using 27 polymorphic SSR markers at the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences. Analysis of variance revealed significant (p ≤ 0.05) entry by environment interaction for plant height, internode length, number of secondary branches, and grain yield. Genotypes such as Hirhir Kebabo Hairless-9, Setit-3, Orofalc ACC-2, Hirhir Humera Sel-6, ABX = 2-01-2, and Setit-1 recorded grain yield of >0.73 ton ha −1 with excellent performance in yield component such as oil yield per hectare. Grain yield had positive and significant (p < 0.01) associations with oil yield (r = 0.99), useful for simultaneous selection for yield improvement in sesame. The SSR markers revealed gene diversity and polymorphic information content values of 0.30 and 0.25, respectively, showing that the tested sesame accessions were genetically diverse. Cluster analysis resolved the accessions into two groups, while population structure analysis revealed four major heterotic groups, thus enabling selection and subsequent crossing to develop breeding populations for cultivar development. Based on phenotypic and genomic divergence, the following superior and complementary genotypes: Hirhir Humera Sel-6, Setit-3, Hirhir Kebabo Hairless Sel-4, Hirhir Nigara 1st Sel-1, Humera-1 and Hirhir Kebabo Early Sel-1 (from cluster II-a), Hirhir kebabo hairless-9, NN-0029(2), NN0068-2 and Bawnji Fiyel Kolet, (from cluster II-b). The selected genotypes will serve as parents in the local breeding program in Ethiopia."}

data/part_4/018f756f2930135abc44359d33db43fc.json

@@ -0,0 +1 @@
+{"metadata":{"id":"018f756f2930135abc44359d33db43fc","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/de00f72b-2b66-4b81-8b0d-13b6561b017c/retrieve"},"pageCount":28,"title":"20 | Value chains 21 | Publications 25 | Get on board with CTA Women from Abobo-Doume in Côte d'Ivoire cook and dry their fish in the dual-purpose FTT kiln","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":80,"text":"T he trend of foreign companies signing agreements with cash-hungry nations for rights over vast areas of land, leading to displacement of the land's traditional users, is all too familiar. Largescale land grabs have swept through developing regions in the last decade, driven by a speculative mania for food crops, biofuels and water reserves. But how should we pass judgement when the land deals are designed to support global public goods, such as the conservation of biodiversity and wild landscapes?"}]},{"head":"A return to fences","index":2,"paragraphs":[{"index":1,"size":115,"text":"Journalist John Vidal first coined the term 'green grabbing' in 2008, when writing about a new wave of land purchases in developing countries motivated by conservation goals. Further analysis of the trend, notably in a special 2012 issue of the Journal of Peasant Studies, widened the definition to include deals for carbon sequestration, forest protection and ecotourism, among others. Biofuel projects may also fall under the label of green grabs, and offer an important example to heed. By 2013, only 2% of land authorised for biofuels in Ethiopia, Mozambique, Tanzania and Zambia was actually cultivated. The sector's early promise left a legacy of lost access to land for communities, with none of the promised benefits."},{"index":2,"size":78,"text":"Green grabs are not only buyers purchasing land outright; they include any cases where rules of access to land and resources are changed to benefit green projects at the expense of existing users. However, instead of pitting small-scale local production against large-scale commodity production, green grabs complicate the land issue by setting production against protection of the environment. In doing so, green grabs are rekindling debates on the co-existence of people and nature that stretch back many decades."},{"index":3,"size":66,"text":"Since the colonial era, local farmers, herders and hunters have been perceived as environmental threats. Authorities have given apparently empty land over to conservation, heedless of its customary uses. However, over recent decades, conservationists have learned that most schemes fail without local participation, and that communities really can be stewards of the land as much as users of it. However, in an intensified atmosphere of crisis"}]},{"head":"GREEN GRABS","index":3,"paragraphs":[]},{"head":"Good intentions on other people's land","index":4,"paragraphs":[{"index":1,"size":22,"text":"Land grabs for green projects lock communities out of decisions about their future landscapes. Is this the cost of conserving the planet?"}]},{"head":"COVER STORY","index":5,"paragraphs":[{"index":1,"size":27,"text":"with unusual alliances of private capital, governments, international organisations and consumers taking on the defence of the planet, some of the lessons seem to have been forgotten."}]},{"head":"Adventures in carbon","index":6,"paragraphs":[{"index":1,"size":267,"text":"If there is one element that sums up the dilemma, it is carbon. One currently favoured solution for mitigating carbon emissions is biochar, charcoal made by burning biomass under low-oxygen conditions, which can be ploughed into soils as a long-lived form of carbon storage that also improves fertility. While some ventures are implementing biochar as a small-scale technology, others have sought to raise capital for biochar feedstock plantations on millions of hectares of \"under-used\" lands in Africa. In fact, farmers themselves regularly enrich their soils with waste organic carbon, including biochar, as recorded in rings of fertile black soil around many West African villages. Practices like these draw little appreciation as 'green technologies', however, and there is a lot of space to recognise and support the highly efficient carbon-mitigating potential of smallholder farmers without taking large chunks of the landscape out of their hands. The most land-grabbed country of the past decade is Papua New Guinea (PNG), where companies had acquired more than 5 million ha of former customary land by 2011. A big share of this was snapped up by carbon speculators following promising negotiations towards the Reducing Emissions from Deforestation and forest Degradation (REDD) standards in 2007. More than 90 carbon trading deals on customary land were under negotiation, but within two years almost all had stalled. In the end the great majority of the millions of hectares acquired in PNG have been used for short-term logging. Difficulties with securing community and legal consensus over long periods of time mean that potentially green projects with distant time horizons have lost out to quick extractive forestry."},{"index":2,"size":175,"text":"Plentiful examples of such failures feed scepticism of green grabs, highlighting the mismatch between longterm green goals and the turbulent world of land deals. In 2008, Liberia nearly signed an agreement with a British company to hand over 400,000 ha of forests to be conserved for carbon trading. The leaked draft contract specified that all forest resources in the area must be left intact, and defined forest resources as \"anything of practical, commercial, social, religious, spiritual, recreational, educational, scientific, subsistence, or other potential use to a human that exists in the forest environment, not limited to flora, fauna, or micro-organisms.\" This was an excellent catalogue of the comprehensive use local communities derived from their forests, albeit for the purposes of revoking their access. In fact, if local users had interfered with the carbon value of the scheme, the Liberian government could have been liable to the British company for billions of dollars in lost revenue. After the contract was leaked, and the lack of benefits for the country itself became obvious, Liberia stopped the deal."},{"index":3,"size":145,"text":"About one-third of Tanzania's land is currently under some form of protection for wildlife, a trend which proliferated in the 1990s during a hopeful phase of community-based conservation of grazing lands. However, poor implementation of this approach led international donors to withdraw funds and the government to favour more direct state management of wildlife. Subsequently, many villages that initially accepted conservation as a community-led use of their land are seeing the benefits go to the tourism industry, while the costs -including lost pasture and crops damaged by wild animals -impact on the village. Some communities have entered into beneficial ventures with ecotourism operators, most successfully in Maasai villages of Lolindo, where well-coordinated local authorities have negotiated and invested earnings in village infrastructure, social services and conservation. Others have lost their land altogether to companies that find it easier to sign private leases for tourism areas."},{"index":4,"size":57,"text":"Clearly, similar motivations -to conserve unique ecosystems, to make them available to ecotourists, to keep carbon out of the atmosphere -can lead to very different outcomes for local land users. What matters is how they are able to negotiate their own access to the land and its resources, and that means being there when the deal is"}]},{"head":"COVER STORY","index":7,"paragraphs":[{"index":1,"size":75,"text":"Conserving unique ecosystems -to make them available to ecotourists or to keep carbon out of the atmosphere -can have very different outcomes for local land users struck. Thus far, green land deals made without local participation have a poor track record for success, and that fact alone may be what puts the brakes on harmful green grabs. Respect for customary land users may, in the end, be better business, just as it is better conservation."}]},{"head":"Land beyond hectares","index":8,"paragraphs":[{"index":1,"size":103,"text":"FAO's recently compiled Voluntary Guidelines on the Responsible Governance of Tenure seem to be tailor-made for protecting communities from land grabs in countries with widespread customary forms of tenure -a system that still dominates 90% of African land. When it comes to green grabs, however, FAO's guidelines will run up against other international pressures felt by states: to increase protected areas, to save carbon stores, or to bring threatened species back from the brink. While supporting local claims to land can slow the land grabbing, the larger question remains the same as ever: how to balance local life and development with ecological needs?"},{"index":2,"size":153,"text":"Non-inclusive green grabs cut off very real synergies between development and environmental goals, leaving only tradeoffs and conflict. The most promising way forward is probably not in buying up huge areas for any exclusive function, but in finding the most benefits from the whole landscape. The emerging landscape approach is a more sophisticated attempt to answer some of the questions that green grabs ignore. For instance, the Reduced Emission from All Land Use project of the Alternatives to Slash and Burn Partnership for the Tropical Forest Margins has looked beyond forests to emission reduction possibilities throughout four different landscapes, working with users to find incentive strategies for carbon benefits everywhere. In Efoulan Municipality, southern Cameroon, these focus on both sustainable management of communal forests and intensification of neighbouring cocoa agro-forests mixed with other useful tree species. Projects like this suggest how communities can maintain higher-carbon landscapes while maintaining their livelihoods on the land."},{"index":3,"size":83,"text":"Climate change, deforestation, degradation and biodiversity loss are serious problems that are growing ever larger. It is easy to imagine that inclusive solutions will not be wide enough to face them, and that big solutions have to leave some people out. But the story of green grabs so far shows that greening landscapes is not as easy as just leasing land. Real progress will not be measured in thousands of hectares, but in the commitment of land users working together towards shared goals. "}]},{"head":"COCONUT","index":9,"paragraphs":[]},{"head":"Ex Exc cept eptio ion nal co al compost mpost","index":10,"paragraphs":[{"index":1,"size":67,"text":"The few hundred inhabitants of Agaléga, an The few hundred inhabitants of Agaléga, an archipelago located north of Mauritius, are archipelago located north of Mauritius, are using coconut fibre to improve vegetable using coconut fibre to improve vegetable cultivation on the coral ground of the island, cultivation on the coral ground of the island, which is not well-suited to farming. The which is not well-suited to farming. "}]},{"head":"MOBILE APP","index":11,"paragraphs":[{"index":1,"size":26,"text":"L Loc ocal l al lan angua guag ge e i inf nfo or rm mat atio ion s n se er rv vic ice e"},{"index":2,"size":83,"text":"In Ghana, F In Ghana, Farmerline have developed a local armerline have developed a local language, interactive voice-response mobile language, interactive voice-response mobile phone application to provide crop production phone application to provide crop production and aquaculture advice. One thousand and aquaculture advice. One thousand farmers have been using the service in farmers have been using the service in the last six months and have reported the last six months and have reported improvements in productivity and income. improvements in productivity and income."}]},{"head":"SOFTWARE","index":12,"paragraphs":[{"index":1,"size":98,"text":"In the Lake Alaotra region of Madagascar, a 'network of reference farms' is bringing together farmers cultivating under direct seeding mulch-based cropping systems to improve soil fertility. This type of network combines different kind of farms according to their cropping systems and breeding practices, for example. Once created, these farms are subject to technical monitoring to build postulated event sequences and assess their resilience to hazards (such as weather). To support this approach, three French research have developed the Olympe software package, a farm operating simulation tool that helps farmers optimising their crop management in a long-term perspective."}]},{"head":"Mamy Andriatiana","index":13,"paragraphs":[]},{"head":"SPRAY SERVICES protection for cocoa","index":14,"paragraphs":[{"index":1,"size":21,"text":"Fifty thousand cocoa farmers in West Africa are accessing crop protection advice and crop spraying services through the Africa Cocoa Initiative."},{"index":2,"size":92,"text":"A preliminary study by the World Cocoa Foundation (WCF), one year into its five-year Africa Cocoa Initiative, has found that the majority (70%) of participating farmers have been able to increase their cocoa yields by an average of 45%. Educating farmers about how best to tackle the threat of pests and diseases is a major focus of the WCF initiative, which aims to double productivity and income levels for 100,000 cocoa farmers in Cameroon, Côte d'Ivoire, Ghana and Nigeria. Currently, 30% of these countries' cocoa crop is lost to pests and disease."},{"index":3,"size":90,"text":"Access to authorised crop protection products has been identified as a major challenge to cocoa production in the region. The Initiative has therefore funded training for selected farmers as Spray Service Providers (SSPs), who help the wider farming community by identifying pests, providing advice on their management and, when needed, applying crop protection products. Working with plant science organisation CropLife Africa Middle East, the Initiative has trained more than 3000 SSPs since its launch in 2013, who in turn have used their knowledge and skills to support 50,000 cocoa producers."},{"index":4,"size":112,"text":"Scaling out the SSP approach to new cocoa growing regions now represents both a challenge and an opportunity for the West African initiative. Reasons for optimism, however, include the increasing number of certification projects being implemented by organisations such as UTZ, Rainforest Alliance and Fairtrade, and the high level of activity among NGOs in helping cocoa communities to take advantage of these. Certification schemes demand that the end product, chocolate, is produced to high environmental, social and agricultural standards, and the SSP scheme complements this work well. In Ghana, for example, the SSPs have helped farmers to meet their 'Good Agricultural Practice' standard, an essential component of achieving UTZ 'Sustainable Farm' accreditation."}]},{"head":"Mike Davison","index":15,"paragraphs":[]},{"head":"AGRICULTURE","index":16,"paragraphs":[{"index":1,"size":15,"text":"Sray Service Providers in Ghana have used their knowldege and skills to support cocoa producers"}]},{"head":"NUTRITION AND HEALTH","index":17,"paragraphs":[{"index":1,"size":2,"text":"DRYING TECHNOLOGY"}]},{"head":"An eco-friendly and healthy kiln","index":18,"paragraphs":[{"index":1,"size":31,"text":"The FTT kiln is more energy efficient, has a greater fish processing capacity, improves food quality and reduces health hazards. These qualities have contributed to its wide adoption by small-scale processors."},{"index":2,"size":121,"text":"T he FTT kiln is a mechanical cooking and drying unit -the result of 5 years collaboration between the Senegalese National Training Centre for Fish and Aquaculture Technicians and FAO -which significantly improves on traditional stove designs and reduces carcinogens produced by smoking. Traditional fish smoking techniques need a large amount of wood or coal, causing a heavy environmental impact. In contrast, the FTT kiln is adaptable to various fuels, such as coconut husks and shells and maize or millet stalks, which are as efficient at fish smoking while having less environmental impact. The kiln also needs less fuel and has a loading capacity five times larger than traditional barrel stoves and twice that of the widely distributed 'Chorkor' improved oven."},{"index":3,"size":107,"text":"The FTT kiln is made up of a furnace, a fat collection tray, an indirect smoke generator system -consisting of a barrel and a metal housing -and an air distributor; these accessories are locally available. The FTT kiln has been developed to help women small-scale fish processors to produce and sell safe, high quality food products. Operation of the kiln helps to meet food safety requirements and can be performed regardless of weather conditions. Consequently, postharvest losses, which may exceed 50% in some fisheries during the rainy season or cloudy days, are better controlled. A cover protects the kiln and the fish during smoking and drying operations."},{"index":4,"size":54,"text":"Smoked fish is a vital source of food and income for many coastal communities across the continent. In Côte d'Ivoire for instance, FAO estimates that 20-30% of local marine and freshwater fish catches are smoked for consumption. This new technique has been successfully rolled out to other African countries, including Ghana, Senegal and Tanzania."}]},{"head":"Mame Aly Konte","index":19,"paragraphs":[]},{"head":"WINNING FORMULA","index":20,"paragraphs":[{"index":1,"size":204,"text":"Impr Impro ov vi in ng c g child hildhood hood n nut utr rit itio ion n A joint study by the Government of Malawi, A joint study by the Government of Malawi, F FAO and the Justus Leibig University in AO and the Justus Leibig University in Germany Germany, has found that the nutritional , has found that the nutritional status of children aged between 6 and status of children aged between 6 and 24 months can be significantly enhanced 24 months can be significantly enhanced through a combination of food security through a combination of food security ) is a wild shrub found extensively in the Sahel that grows found extensively in the Sahel that grows in arid areas and is very drought-tolerant in arid areas and is very drought-tolerant. . Its bitter seeds are consumed in times of Its bitter seeds are consumed in times of famine. The Sahara Sahel Food NGO aims famine. The Sahara Sahel Food NGO aims to add value to hanza seeds, which are rich to add value to hanza seeds, which are rich in protein and carbohydrate, by processing in protein and carbohydrate, by processing them into flour and couscous. them into flour and couscous."}]},{"head":"BETTER BEANS","index":21,"paragraphs":[{"index":1,"size":22,"text":"Ir Iro on-r n-ric ich v h var arie iet tie ies s r reduc educe e an anae aemi mia a"},{"index":2,"size":118,"text":"In Rwanda, seven new varieties of iron-In Rwanda, seven new varieties of ironrich beans -now grown by nearly 800,000 rich beans -now grown by nearly 800,000 farmers -have contributed to a fall in farmers -have contributed to a fall in anaemia cases. Before the introduction of anaemia cases. Before the introduction of iron-rich beans in 2010 by HarvestPlus, iron-rich beans in 2010 by HarvestPlus, 56% of Rwandans were anaemic, with 56% of Rwandans were anaemic, with young children and women worst affected. young children and women worst affected. Since then, the rate has reduced to 38%, Since then, the rate has reduced to 38%, according to the Department of Health according to the Department of Health Services. Services."}]},{"head":"Vaccinating against East Coast Fever in northern Tanzania","index":22,"paragraphs":[{"index":1,"size":5,"text":"© ILRI/S Mann DRUG PROVISION"}]},{"head":"Saving Malawi's flood-hit livestock","index":23,"paragraphs":[{"index":1,"size":97,"text":"The Lilongwe Society for the Protection and Care of Animals (LSPCA) and the Ministry of Agriculture and Food Security have conducted a large scale programme to administer livestock drugs in three flood-hit districts of southern Malawi. Heavy rains in early 2015 contributed to numerous animal health problems, including pneumonia, lumpy skin disease, and foot rot, caused by water-logged soil. \"The type of drugs that were delivered by LSPCA were in line with those diseases that we expected to emerge after the flooding situation, such as bacterial and protozoan,\" said Taurayi Mlewa, chief animal health and livestock officer."}]},{"head":"Charles Mkoka","index":24,"paragraphs":[]},{"head":"FISHING","index":25,"paragraphs":[]},{"head":"Weather text alerts","index":26,"paragraphs":[{"index":1,"size":96,"text":"Over 1,000 Ugandan fishermen are receiving free SMS alerts to help them decide when and where to fish in Lake Victoria. Severe weather across the lake causes up to 5,000 fishermen deaths each year. The provision of text-based information is being facilitated by a partnership project between the World Meteorological Organisation and national meteorology departments in the Lake Victoria region. On a broader scale, the project aims to increase the livelihood security of both farmers and fishermen in the region, by strengthening climate observation, modelling and forecasting, and improving the sharing of information with local people."}]},{"head":"James Karuga","index":27,"paragraphs":[]},{"head":"LIVESTOCK AND FISHERIES","index":28,"paragraphs":[]},{"head":"VACCINATION AND ERADICATION","index":29,"paragraphs":[]},{"head":"Progress on East Coast Fever and PPR","index":30,"paragraphs":[{"index":1,"size":27,"text":"A less deadly parasite could offer cost-effective protection against East Coast Fever (ECF) in cattle, while global efforts are mounting to eradicate Peste des petits ruminants (PPR)."}]},{"head":"R","index":31,"paragraphs":[{"index":1,"size":164,"text":"esearchers have discovered a new and potentially more effective way of protecting livestock against ECF, a disease that kills over 1 million cattle in Africa every year. Scientists from the University of Edinburgh, UK, and the International Livestock Research Institute, have found that infecting healthy cattle with a Theileria mutans parasite -a close relative of the Theileria parva parasite that causes ECF -protects the majority of animals from the disease, while itself causing only a very mild infection. Out of 500 calves infected during the trials in western Kenya, an impressive eight out of nine were protected against ECF. Current vaccination practices for ECF typically involve infecting an animal and then treating it with antibiotics, to help the animal acquire immunity. Work is also being scaled up to combat PPR ruminants, a highly contagious viral disease affecting sheep and goats. Earlier in 2015, Côte d'Ivoire hosted the first global conference for the eradication of the disease, in order to endorse a global eradication strategy."}]},{"head":"Maina Waruru and","index":32,"paragraphs":[{"index":1,"size":2,"text":"Patrice Kouakou"}]},{"head":"COORDINATED ACTION","index":33,"paragraphs":[{"index":1,"size":26,"text":"S Sat ate ellit llite pr e proje ojec ct t t tac ack kle les s ille illeg gal fis al fishi hin ng g"},{"index":2,"size":3,"text":"In early 201"},{"index":3,"size":154,"text":"In early 2015, Palau participated in the 5, Palau participated in the launch of Project E launch of Project Eyes on the Seas, a yes on the Seas, a satellite technology-based system to satellite technology-based system to monitor monitor, detect , detect, and respond to suspected , and respond to suspected illegal fishing activity illegal fishing activity. Within 24 hours of . Within 24 hours of the launch, a suspected illegal fishing vessel, the launch, a suspected illegal fishing vessel, which had been monitored since December which had been monitored since December 2014 2014, was apprehended through a process , was apprehended through a process coordinated under the new system. coordinated under the new system. One recent success was strengthening the inspection team, made up of community members, which controls environmental pressure as a result of hunters and fishermen. The team also monitors and identifies incidents where the balance of the ecosystem is harmed."}]},{"head":"BIODIVERSITY","index":34,"paragraphs":[]},{"head":"Combining conservation and tradition for development","index":35,"paragraphs":[{"index":1,"size":47,"text":"According to Tiniguena, Urok Osheni, which began in 2010 on three Urok islands (Formosa, Nago and Chediã), \"is a pilot project for the rest of the archipelago of Bijagós.\" More than 30,000 inhabitants over 80 islands and islets make up the Community Protected Marine Area of Guinea-Bissau."}]},{"head":"Sílvia Norte","index":36,"paragraphs":[]},{"head":"ENVIRONMENT","index":37,"paragraphs":[]},{"head":"ENERGY","index":38,"paragraphs":[]},{"head":"L Li ig ght ht f fo or a r al ll l","index":39,"paragraphs":[{"index":1,"size":149,"text":"The town of Bambadinca, in eastern The town of Bambadinca, in eastern Guinea-Guinea-Bissau, is now being lit by the first Bissau, is now being lit by the first community-run renewable energy service in community-run renewable energy service in the country the country. Power is provided via a hybrid . Power is provided via a hybrid photovoltaic plant photovoltaic plant, which will supply the , which will supply the entire town at an affordable price. The entire town at an affordable price. The participatory and sustainable management participatory and sustainable management model was created by the Portuguese NGO model was created by the Portuguese NGO, , TESE, and its local partner TESE, and its local partner, , Associação Associação Comunitária para o Desenvolvimento do Comunitária para o Desenvolvimento do Sector de Bambadinca Sector de Bambadinca, the community , the community association for development in Bambadinca. association for development in Bambadinca."}]},{"head":"PLASTIC BAGS","index":40,"paragraphs":[{"index":1,"size":131,"text":"Hu Hur rr ra ay y f fo or r p pand andan anus us and v and ve et ti iv ve er r Mauritius has banned the manufacture Mauritius has banned the manufacture and use of plastic bags with effect from 1 and use of plastic bags with effect from 1 January 2016 in order to protect lagoons, January 2016 in order to protect lagoons, rivers and streams. Alternative bags are rivers and streams. Alternative bags are made of of pandanus leaves, vetiver and made of of pandanus leaves, vetiver and paper paper. At present . At present, about 300 million , about 300 million plastic bags are produced every year for plastic bags are produced every year for a population of 1 a population of 1.3 million people."},{"index":2,"size":3,"text":".3 million people."}]},{"head":"CLIMATE-SMART RESEARCH","index":41,"paragraphs":[{"index":1,"size":26,"text":"M Me ea asu sur ri in ng GHG g GHG e emissio missions f ns fr ro om f m far armi min ng g"},{"index":2,"size":86,"text":"The W The World Agroforestry Centre is working orld Agroforestry Centre is working with around 1 with around 1,200 households in K ,200 households in Kenya's enya's Rift V Rift Valley to quantify greenhouse alley to quantify greenhouse gas emissions from farming systems. gas emissions from farming systems. Scientists are sampling soils and Scientists are sampling soils and advising on appropriate climate-smart advising on appropriate climate-smart agriculture practices in order to reduce agriculture practices in order to reduce emissions while increasing yields. emissions while increasing yields."}]},{"head":"MIXED PLANTING","index":42,"paragraphs":[]},{"head":"B Bu ug ggi gin ng g pe pests wit sts with h biodi biodiv ve er rsit sity y","index":43,"paragraphs":[{"index":1,"size":88,"text":"Research by Bioversity International in Research by Bioversity International in Uganda has shown that mixed planting Uganda has shown that mixed planting of pest-and-disease-resistant and of pest-and-disease-resistant and susceptible varieties significantly reduces susceptible varieties significantly reduces pest or disease incidence. In trials of a pest or disease incidence. In trials of a common bean variety common bean variety, Kasirira, damage , Kasirira, damage decreased by 50% when a resistant decreased by 50% when a resistant variety was mixed into the plot variety was mixed into the plot. ."}]},{"head":"ENERGY","index":44,"paragraphs":[]},{"head":"Green coal is coming to","index":45,"paragraphs":[{"index":1,"size":23,"text":"Madagascar lost almost 21% of its mangroves (57,000 ha) between 1990 and 2010. Using green coal is a way to limit the destruction."}]},{"head":"C","index":46,"paragraphs":[{"index":1,"size":71,"text":"harcoal is the main source of energy in most developing countries, Madagascar included. Whether cooking, heating or even ironing, on average, Malagasies are burning 50-100 kg of charcoal per person, per year. This is the cause of severe damage to forests and an environmental threat. Some 150,000 ha of forests are destroyed each year for firewood, with additional losses to the country's mangroves, which initially covered an area of 325,000 ha."},{"index":2,"size":52,"text":"To reduce the pressure on forest resources, in 2005 Chan Huchoc, a Malagasy entrepreneur, developed 'green coal', a coal made from organic materials, such as compost, wood chips, stems and leaves, which are burned in a specially designed kiln. The use of this innovation has spread across the northern part of Madagascar."},{"index":3,"size":74,"text":"On the coastal island of Nosy Be in the Mozambique Channel, green coal is made from carbonised eucalyptus. Local people are being encouraged to use the green coal by a number of organisations, in particular the tourism industry association Groupement interprofessionnel de l'hôtellerie et du tourisme de Nosy Be (GIHTNB). Supported by the German cooperation agency GIZ, a huge reforestation programme has also been launched to plant eucalyptus in the northern region of Diana."},{"index":4,"size":67,"text":"Green coal has solved many of the energy problems faced by the local population, including fuel price and quality. The price of a 10 kg bag is stabilising at €2 while the cost of mangrove wood is increasing each year during the rainy season, up to €2.5. GIHTNB is now designing a year-round distribution network in order to provide Nosy Be with a convenient and continual supply."},{"index":5,"size":35,"text":"Green coal appears to be a way to limit mangrove destruction. For its part, the government has created a national integrated management commission to research ways to protect mangroves while sustainably exploiting their fishery resources."}]},{"head":"Mamy Andriatiana","index":47,"paragraphs":[]},{"head":"WATER RESOURCES","index":48,"paragraphs":[{"index":1,"size":99,"text":"The mapping of 53 km2 of river basins in Cabo Delgado, northern Mozambique, is now complete, providing an essential tool for drafting agricultural programmes and preventing natural disasters such as droughts and floods. The map, drawn with support from the EU and the Government of Galicia (Spain), will help define the irrigation infrastructure and the province's water supply. It will also greatly help in the prevention and management of natural disasters, providing information about the topography and geology of the region, its climate, demographic and socio-economic profile and an analysis of surface and as all the coastal river basins."}]},{"head":"Sílvia Norte","index":49,"paragraphs":[{"index":1,"size":10,"text":"'Green coal' will soon be distributed year-round in northwestern Madagascar "}]},{"head":"RESEARCH AND ICT","index":50,"paragraphs":[]},{"head":"INNOVATIVE TOOL","index":51,"paragraphs":[{"index":1,"size":141,"text":"Z Zambi ambian y an yout outh h's 's ne new w f fe er rt tilis ilise er r applic applicat ato or r Musenge Silwawa of the Zambia Centre Musenge Silwawa of the Zambia Centre for Horticulture T for Horticulture Training, Chapula, has raining, Chapula, has developed a simple fertiliser application developed a simple fertiliser application machine. The fertiliser flows from a machine. The fertiliser flows from a backpack into a hand-held pipe, which backpack into a hand-held pipe, which has a digging tool at the other end. By a has a digging tool at the other end. By a single depression and release into the soil, single depression and release into the soil, the applicator digs a hole and delivers a the applicator digs a hole and delivers a standard quality of fertiliser standard quality of fertiliser. ."}]},{"head":"REMOTE SENSING","index":52,"paragraphs":[]},{"head":"Sc Scr rut uti inisi nisin ng su g sug gar ar pr produc oduct tio ion n","index":53,"paragraphs":[{"index":1,"size":108,"text":"It is hard to estimate sugar production It is hard to estimate sugar production in small producing countries due to the in small producing countries due to the diversity of cultivation practices and the diversity of cultivation practices and the multitude of field plots. The solution lies multitude of field plots. The solution lies in remote sensing, a technology that uses in remote sensing, a technology that uses satellite sensors and images to provide satellite sensors and images to provide vegetative indices. These indices enable the vegetative indices. These indices enable the calculation of cane yield on a plot level. calculation of cane yield on a plot level."}]},{"head":"CLIMATE CHANGE beans","index":54,"paragraphs":[{"index":1,"size":35,"text":"In Colombia, scientists from the International Center for Tropical Agriculture (CIAT) are evaluating bean varieties resistant to high temperatures. This is an important discovery as bean is a staple for poor people in developing countries."},{"index":2,"size":65,"text":"C limate change will severely affect global agriculture. According to the Intergovernmental Panel on Climate Change, wheat, rice and maize yields could globally drop by more than 25% by 2030-2049. Climate-sensitive crops include bean, which is a staple for 400 million people across developing countries. Often known as 'the meat of the poor' in Latin America and Africa, bean is a major source of protein."},{"index":3,"size":69,"text":"Based on a study using 19 global climate models, panellists have concluded that with the actual varieties and their cultivation requirements, areas adapted to bean production could be cut in half by 2050, says CIAT. Rising temperatures could particularly affect this crop in Brazil, Haiti, Honduras and Nicaragua. In Africa, severe consequences could be seen in DRC and Malawi, and to a lesser extent in Kenya, Tanzania and Uganda."},{"index":4,"size":124,"text":"However, in the CIAT experimental station in Cali, south-western Colombia, scientists are evaluating new bean varieties resistant to high temperatures. These new varieties result from a cross between common beans widely cultivated and the very drought resistant 'tepary' bean, a species traditionally grown by Indians in the north of Mexico and in Arizona. Using these beans could limit the decrease in cultivated areas to 5% in case of a 3°C rise in temperature. This discovery shows the importance of protecting and using the genetic diversity of plants. \"Seeds from our gene bank are a vital asset to help farmers from developing countries to face climate change,\" says Ruben Echeverria, CIAT director. The new beans are going to be evaluated in Costa Rica and Mozambique."}]},{"head":"Anne Guillaume-Gentil","index":55,"paragraphs":[{"index":1,"size":10,"text":"Scientists are evaluating new bean varieties resistant to higher temperatures"}]},{"head":"WEATHER FORECASTING","index":56,"paragraphs":[]},{"head":"Combining old and new knowledge","index":57,"paragraphs":[{"index":1,"size":157,"text":"A collaboration between traditional rain-makers, meteorologists and community radio broadcasters in Kenya's Vihiga County has enabled farmers to receive accurate weather the Kenya Meteorological Service to serve climate change prone areas. It builds on a programme under which rain-makers (who observe plant and animal behaviour) and are provided with a wind-up radio and information is given in the local language. The every ten minutes. F Fairtrade International has revised its airtrade International has revised its trader standards in order to strengthen its trader standards in order to strengthen its core requirements, increase transparency core requirements, increase transparency and encourage importers, exporters and and encourage importers, exporters and businesses to deepen their commitment businesses to deepen their commitment to sustainable trading practices. A new to sustainable trading practices. A new set of voluntary best practices in sourcing, set of voluntary best practices in sourcing, capacity building and environmental capacity building and environmental performance are included. performance are included."}]},{"head":"Pius Sawa","index":58,"paragraphs":[]},{"head":"RICE RICE","index":59,"paragraphs":[]},{"head":"R Re est str ric ict ti in ng g i impo mpor rts ts","index":60,"paragraphs":[{"index":1,"size":111,"text":"In view of the increase in both quantity In view of the increase in both quantity and quality of rice production, Senegal and quality of rice production, Senegal has decided to restrict rice imports to has decided to restrict rice imports to 500,000 t in 201 500,000 t in 2015. With production 5. With production estimated at around 270,000 t estimated at around 270,000 t, this W , this West est African country is on track to reduce its African country is on track to reduce its dependency on imported rice, the primary dependency on imported rice, the primary cereal consumed by the Senegalese people. cereal consumed by the Senegalese people."}]},{"head":"T TAXES AXES","index":61,"paragraphs":[]},{"head":"B Boost oosti in ng o","index":62,"paragraphs":[{"index":1,"size":11,"text":"g or rg ganic anic pr produc oduct tio ion n"},{"index":2,"size":225,"text":"In Mauritius, in order to protect soils, the In Mauritius, in order to protect soils, the environment and consumer health, any environment and consumer health, any local or foreign firm that produces organic local or foreign firm that produces organic food in the island is eligible for exemption food in the island is eligible for exemption from taxes for 8 years. The government's from taxes for 8 years. The government's aim is that half of fruit and vegetable aim is that half of fruit and vegetable production will be organic by 2020. production will be organic by 2020. Initially, TASAI has been implemented in four pilot countries -Kenya, South Africa, Uganda and Zimbabwe -with highly differentiated results. In South Africa, the seed sector is competitive which enables farmers to get new seed varieties more rapidly than in Kenya (2 years), Uganda (3 years) and Zimbabwe (12 months). On the other hand, South Africa's results are not as good regarding the availability of seed in small packages, which are more adapted to smallholder farmers' needs and budget. Kenya's seed policy framework scores well, but its efforts to stamp out fake seed are poor. The index also shows that in the last three years, Kenya has released 35 maize varieties, South Africa 221, Uganda 12 and Zimbabwe 28. Within two years, the index should cover 20 countries."}]},{"head":"RICH REWARDS","index":63,"paragraphs":[]},{"head":"Commercialising indigenous plants in Zimbabwe","index":64,"paragraphs":[]},{"head":"Anne Guillaume-Gentil","index":65,"paragraphs":[{"index":1,"size":16,"text":"Smallholders in Africa face difficulties in accessing improved seeds of staple crops © Market Matters Inc."}]},{"head":"BUSINESS AND TRADE","index":66,"paragraphs":[]},{"head":"Strengthening ties","index":67,"paragraphs":[{"index":1,"size":88,"text":"Agriculture -in addition to generating produce -is a source of income for many people worldwide. Full inclusion of nutrition in specifically targeted agricultural policies would ensure a greater role for agriculture in combating malnutrition. T wenty-two years after the first International Conference on Nutrition (ICN1), some 2,200 participants at ICN2 underlined the progress that has been achieved since then, with the proportion of undernourished people having declined by around 20%. Major challenges remain, however, including the new paradox known as the 'double burden', whereby malnutrition and overnutrition coexist."},{"index":2,"size":67,"text":"The international community is increasingly mobilised in favour of nutrition. In 2013, the European Commission made nutrition a development objective and called for joint action, while pledging €3.1 billion in favour of nutritionsensitive agriculture. These funds are earmarked mainly for food security and agricultural interventions. At ICN2, the EU and three international institutions, including CTA, also announced a collaboration to promote agriculture geared towards ensuring better nutrition."}]},{"head":"Produce more by diversifying","index":68,"paragraphs":[{"index":1,"size":83,"text":"Increasing agricultural production and productivity to meet the needs of a growing population is essential, and the avowed aim of all governments. The agricultural sector has faced increased pressure in recent years to be nutrition sensitive; boosting production is no longer automatically synonymous with reducing malnutrition. For instance, in the Sikasso region of Mali, malnutrition is chronic among young children despite a high agricultural production rate. Carbohydrate-rich, micronutrient-poor cereals account for most of people's caloric intake. And this is not an isolated example."},{"index":2,"size":65,"text":"Increased production should contribute to the food and nutritional security of the population and one way to achieve this is to diversify agricultural production towards horticulture, legume crops, dairy products, fish, poultry and livestock. Crop diversification can also enhance the soil structure and fertility, while facilitating the introduction of new and more sustainable farming practices and reducing risks for farmers, thus potentially improving their income."}]},{"head":"DOSSIER","index":69,"paragraphs":[]},{"head":"Eggs against malnutrition","index":70,"paragraphs":[{"index":1,"size":172,"text":"For poor families in Mauritius, the Movement for Food Self-Sufficiency (MAA) runs egg production microprojects to combat malnutrition. Eggs are protein-rich and an excellent substitute for meat, which is too expensive for many families. They also help overcome the iron and protein deficiencies often affecting children. MAA provides poultry feed and poultry houses that can each host five to six laying hens, while training people on poultry rearing and egg marketing. The eggs are essentially for self-consumption, but families also sell surplus eggs to neighbours at less than the retail price. \"People who have been trained are often able to develop their project to the tune of around 50 laying hens, which enables them to collect around 50 eggs a day,\" says Eric Mangar, MAA Manager. All family members tend to be involved in these micro-projects, especially children, who maintain the poultry houses, collect eggs every morning and keep the accounts. These projects also represent an important economic activity, giving poor families an opportunity to start producing poultry on a small scale."}]},{"head":"Nasseem Ackbarally","index":71,"paragraphs":[{"index":1,"size":20,"text":"The biofortification of staple foods, such as rice, could provide a boost to nutrition and food security in ACP countries"}]},{"head":"Tapping biodiversity","index":72,"paragraphs":[{"index":1,"size":121,"text":"Species that are under-exploited, forgotten or even threatened by climate change, deforestation and bush fires abound in the natural environment. Around 400 species of traditional vegetables and leafy vegetables exist in Africa, some of which have a high yet often unrecognised nutritional value. These traditional vegetables could be tapped to help overcome nutrient deficiencies. Moringa leaves, for example, can be dried, ground and added to sauces to take advantage of their high vitamin, mineral and protein content. Other examples include African locust beans and baobab. New Zealand spinach, grown in the Pacific Islands, has a high nutrient content, while breadfruit, which has been domesticated in Pacific and Caribbean countries, is calorie-rich and contains vitamins A, B and C, phosphorus and iron."},{"index":2,"size":85,"text":"Promotion and awareness campaigns have led to a boom in the consumption of traditional vegetables in recent years. In Tanzania, it is estimated that traditional vegetables account for 70% of all vegetables cultivated and marketed in rural and peri-urban areas, while in Kenya there was a 135% market growth rate for these vegetables between 2002 and 2006. Focusing on vegetables, traditional or not, would help to curb obesity in the Pacific Islands and the West Indies, where high calorie/low nutrient processed foods are widely consumed."}]},{"head":"Biofortification soars","index":73,"paragraphs":[{"index":1,"size":123,"text":"The biofortification of staple foods could provide a way to overcome nutritional deficiencies. Substantial research is underway to increase the nutrient content of local cereal and legume varieties. HarvestPlus -a global alliance that aims to reduce micronutrient deficiencies -along with 60 partners worldwide, is developing biofortified crops. Some 10 million people in rural areas currently grow and eat biofortified foods, thus boosting their nutritional status, according to HarvestPlus. The case of beta-carotene-rich orange fleshed sweet potato is a prime example of this trend. Already cultivated in eight African countries, studies have confirmed its substantial nutritional value. High yielding iron-rich beans have been introduced in DRC, Nigeria, Rwanda and Uganda is promoting beta-carotene enriched cassava. Banana, wheat, maize and rice are also being biofortified."},{"index":2,"size":101,"text":"For smallholders, biofortification requires an initial investment in new seeds, which must be adapted to local conditions and profitable; ongoing costs must also remain reasonable. Farmers can then preserve the seeds and share them with other members of their community. Biofortification is focused on staple food crops that are used to prepare familiar foods, but problems of community acceptance of these varieties may arise. Nutrients supplemented via biofortification should also be preserved during processing and preparation. Finally, the technologies used to create new varieties may sometimes involve GMOs, raising the issue of seed ownership and capacity building for local research organisations."}]},{"head":"Developing the value chain","index":74,"paragraphs":[{"index":1,"size":143,"text":"Small and large farmers have to cope with dietary transitions that arise as a result of urbanisation and lifestyle changes. That may simply involve facilitating urban people's access to fresh fruit and vegetables, as proposed by the 'Green Collar Jobs' project in Nigeria (see field report in Spore N° 176), to ensure a more direct link between farmers and the market. Processing and packaging are other options. These are promoted by FasoPro, a company that has been marketing bags of fresh, protein, iron-and omega 3-rich shea caterpillars DOSSIER © CIAT/N Palmer since 2014 to help overcome malnutrition. Sterilised caterpillars are highly appreciated in Burkina Faso and may be consumed year round. Foods can also be enriched during processing. Many countries, especially in the ECOWAS region, now oblige manufacturers to fortify flour with folic acid or to enrich refined vegetable oil with vitamin A."},{"index":2,"size":42,"text":"The nutritional value of foods should also be preserved while limiting waste throughout the value chain. A lack of storage and refrigeration facilities, as well as transport infrastructure, is widely responsible for net losses of many foods, including vegetables, fruits and fish."}]},{"head":"Educating and targeting","index":75,"paragraphs":[{"index":1,"size":77,"text":"Food insecurity and nutrient deficiency mainly affect developing countries. Targeting the poorest and most vulnerable people is an integral part of the fight against malnutrition. Adopting a gender policy that fosters the empowerment of women in the agricultural sector is also beneficial. This has an impact on agricultural productivity but also on households, in terms of food, education and children's health. Awareness campaigns -via local radio programmes, fairs and schools, for example -are crucial in this regard."},{"index":2,"size":160,"text":"Many initiatives target the most vulnerable people at individual and community levels. In Rwanda, for example, the 'One Cow Per Poor Family' programme,  whereby a cow is given to poor or vulnerable families that live off less than 0.7 ha of land, has already benefitted over 100,000 households. At the community level, the increase in home gardens throughout Africa has enhanced the nutritional capacity of families through the harvesting of fruits and vegetables from these gardens. This produce is grown for self-consumption but can also be marketed, thus generating extra income for households (see our field report on Niger). School feeding programmes are another example. These are mainly implemented by the World Food Programme to ensure that school children get a meal every day, while also increasing awareness on nutrition, especially through the creation of vegetable gardens in schools. Whenever possible, these programmes are also based on local production, thus improving the economic situation for smallholders and the community overall."}]},{"head":"Nutrition-oriented agricultural policies","index":76,"paragraphs":[{"index":1,"size":125,"text":"Nutrition is still only barely (or not at all) taken into account in agricultural policies, which are focused more on production and productivity. This is one of the conclusions of an assessment by Save the Children of agricultural policies in 15 African countries and of the plans of 18 African countries under the Comprehensive Africa Agriculture Development Programme (CAADP). Nine of the latter 18 countries explicitly specified that improving nutrition was one of their goals, but few of them actually incorporate targeted objectives in their policies, accompanied by nutritional and food consumption indicators. Burundi and Ethiopia have nevertheless indicated that stunted growth in children should be reduced by 3%. Setting targeted objectives can help in developing monitoring indicators and assessing the results, while ensuring accountability."},{"index":2,"size":49,"text":"In addition, people working in the agricultural sector should be trained on nutrition issues. In Burkina Faso, nutrition courses are included in national agronomy training programmes, and in Kenya, a domestic economy section was created within the Ministry of Agriculture, which is responsible for implementing the ministry's nutrition mandate."},{"index":3,"size":60,"text":"The international community is increasingly aware of the importance of nutrition and agrees that it should be dealt with in a multi-sectoral manner, through a coordinated, long-term approach. Ministries of agriculture should play a full role in developing gateways with other ministries, while participating in inter-sectoral coordination structures, as well as developing and integrating nutritional indicators in their public policies."},{"index":4,"size":76,"text":"ICN2 endorsed the Rome Declaration on Nutrition, which includes 60 measures to combat all forms of malnutrition. Following on from the conference, FAO created a special trust fund in favour of nutrition and has incorporated nutrition as a cross-cutting theme in the organisation's revised strategic framework. Family farms seem to be the ideal intermediaries for disseminating the nutrition-sensitive agriculture concept, while sustainably taking full advantage of high biodiversity. Clearly, the family farming and nutrition agendas overlap."},{"index":5,"size":25,"text":"Anne Guillaume-Gentil DOSSIER V ie w p o in t is senior nutrition and partnership advisor and head, Food Security and Nutrition Programme, NEPAD Agency."}]},{"head":"the African Food Security Framework","index":77,"paragraphs":[{"index":1,"size":75,"text":"The Nutrition Capacity Development Initiative of the Comprehensive Africa Agriculture Development Programme (CAADP) was launched in 2011 following a review of the National Food Security Investment Plans (NAFISPS). This showed that nutrition had not been capacity development workshops were organised developed roadmaps to address this shortcoming. However, integrating nutrition in NAFISPS was not enough; adequate domestic capacity and financial states acknowledged the need to mobilise national resources. This is yet to be put into action."}]},{"head":"What are the most important indicators when","index":78,"paragraphs":[{"index":1,"size":43,"text":"track to meet the targets for reducing anaemia in women. This affects their health and productivity. Improvements in the nutritional status of women of reproductive age, adolescent girls and children under five, especially in households that depend on agriculture, need to be tracked."},{"index":2,"size":105,"text":"We need to focus more on the 'how to' and make resources available to bridge the gap. Phase 2 of the CAADP Nutrition Capacity Development Initiative will be developed and implemented through the regional economic communities. The Home Grown School Feeding Programme, a NEPAD flagship initiative, which benefits smallholder farmers especially women will become a continental programme. The Africa Day on Food and Nutrition Security will be our advocacy platform for promoting the agriculture and nutrition and the soon to be revised and rebranded CAADP Pillar III Framework for African Food Security and Nutrition will be launched and implemented with the support of our partners."},{"index":3,"size":26,"text":"A community garden run by a women's cooperative in Niger helps feed the community and diversify its diet while providing an opportunity to generate extra income."}]},{"head":"I","index":79,"paragraphs":[{"index":1,"size":135,"text":"n Guilladjé, a small village in Dosso region, southwestern Niger, the quality of the daily diet of many households has improved in recent years through a community vegetable garden. This roughly 5 ha garden is tended to by a village women's cooperative with the support of a local NGO specialising in water systems and food security, along with L'Organisation Nigérienne pour la Promotion de l'Hydraulique et du Développement à la Base, a Niger water and development organisation (ONPHDB), which promotes grassroots development, with a focus on water projects. Boureïma Garba of ONPHDB says that the idea of creating this vegetable garden for the benefit of women from the village emerged as a result of the cyclical food crises that have hit Niger, seriously affecting rural people who are exclusively dependent on rainfed crops for food."}]},{"head":"gardens","index":80,"paragraphs":[{"index":1,"size":27,"text":"The village chief allocated a field for the women's cooperative to grow vegetables and fruits on, ensuring a better diet for villagers DOSSIER FIELD REPORT FROM NIGER"}]},{"head":"Combatting malnutrition","index":81,"paragraphs":[{"index":1,"size":59,"text":"The aim of the community garden is twofold: to diversify the food production habits of Guilladjé residents in order to reduce their dependence on rainfed crops, which are vulnerable by nature, while simultaneously fighting malnutrition, a serious problem affecting children in a country where millet is the main staple food. The villagers have been readily involved in this initiative."},{"index":2,"size":73,"text":"\"The NGO approached the village chief regarding the project, who kindly offered a field to the women's cooperative,\" says Daouda Abdou, deputy mayor of Guilladjé. Once the land was obtained, ONPHDB created the conditions necessary to begin production activities by enclosing the site with wire fencing, building a modern well to facilitate access to water and supplying farming implements and inputs. An agricultural technician was provided to support and to help boost productivity."},{"index":3,"size":38,"text":"Around 30 women cultivate the community vegetable garden and produce various vegetables (cabbages, tomato, carrots, cucumbers, okra, peppers, green beans), tubers (potatoes, sweet potatoes, cassava), fruit (melon, watermelon) and moringa, etc., under the supervision of the extension agent."},{"index":4,"size":104,"text":"President of the cooperative, 50-year-old Oumou Seydou, cultivates a piece of land of around 300 m² at the site, with the help of her three daughters. \"Our food habits have dramatically changed in the village since we began cultivating this vegetable garden. Before, households that managed to get two meals a day invariably prepared a breakfast of millet porridge, often without curdled milk, and dough seasoned with a baobab leaf and soumbala sauce for dinner,\" she says. \"We have now diversified our diet with the vegetables, tubers and fruit we produce and also earn money by selling part of the harvested crops,\" she adds."},{"index":5,"size":27,"text":"\"Millet porridge is not the only food served daily. We sometimes also prepare a stew made with potatoes, sweet potatoes or cassava along with the necessary condiments."},{"index":6,"size":30,"text":"In addition, we make very nutritious meals with cabbages, green beans and moringa leaves,\" says Mariama Sambo. They also eat fruit, which offer a supplementary supply of calories and vitamins."}]},{"head":"Surplus and savings","index":82,"paragraphs":[{"index":1,"size":94,"text":"The surplus production is sold at local markets and the generated income has enabled some of these women farmers to launch into small livestock and poultry farming. \"I initially bought two goats, a chicken and guinea fowl eggs with my savings, as of the second year of cultivating my plot. I now have about 10 dairy goats and guinea fowl which produce eggs to tide us over through the rainy season,\" says Seydou, proud of her achievements. When sales are stagnant, the products are preserved by drying techniques that the women farmers have learnt."},{"index":2,"size":229,"text":"The success of this initiative in the fight against malnutrition has fostered its dissemination to many other parts of the country with the help of national and international NGOs such as CARE, Action Against Hunger and Save the Children, among others. Some of these vegetable gardens are equipped with a drip irrigation system developed by researchers at the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) in 2010. This system has generated real momentum in the development of so-called ' African vegetable gardens' in several Sahelian countries. Some 7,000 smallholdings located in around 100 communities in Benin, Burkina Faso, Niger and Senegal are now equipped with this innovative irrigation system, thus enabling them -according to ICRISAT -to produce better, have a balanced diet, and make money. W orldwide, around 65 million t of eggs are produced each year, with 65% coming from medium and large-scale commercial producers, according to the Worldwatch Institute. Backyard systems are also a valuable, low-risk farming enterprise for small-scale farmers. For those with little resources, a few hens can be kept, fed largely through their own foraging, to provide eggs and even meat for the household. But many developing countries are working to expand their commercial poultry sector, and develop cost-efficient systems which can compete with the lowcost eggs imported from developed nations (e.g. the EU to Africa and the US to the Caribbean)."},{"index":3,"size":116,"text":"Successful examples of poultry sector development can be found throughout the ACP regions. In northern Rwanda, where rates of chronic malnutrition are high (over 40%), poultry farms have been set up to provide sufficient eggs for all children under five to eat one boiled egg each day. As well as providing an income to those employed on the farms, the eggs are transforming the health of pre-school children, who would otherwise eat few, if any livestock products. In the Caribbean, poultry production is vital in ensuring food security within the region. Recent years have seen encouraging growth in the sector, although despite this, significant amounts of chicken meat, eggs and egg products continue to be imported."}]},{"head":"Beating the competition","index":83,"paragraphs":[{"index":1,"size":135,"text":"For egg production, Jamaica is the biggest contributor within the CARICOM region, providing over 80% of total regional output. With just over 2,000 small farms and 100 large facilities, the industry produced more than 130 million eggs in 2014; import of eggs is now only necessary if local production is impacted during the hurricane season. President of the Jamaica Egg Farmers Association, Roy Baker, attributes that success to the restructuring of the industry, which has included upgrading its production systems, ensuring compliance with standards and constructing a liquid egg plant. Established in 2007, the facility was built to meet the demands of the hospitality and commercial food sectors, which had previously preferred imported products. However, table egg production costs remains a challenge for many farmers due to the cost of feed, which is mainly imported."},{"index":2,"size":96,"text":"In northern Mozambique, to compete against low quality imported eggs from neighbouring countries, Mozambique Fresh Eggs (MFE) uses an out-layer model by which small-scale farmers look after 500-1,000 specialised layer chicks supplied by a local hatchery. Land around the hatchery is used to grow soya and maize feed for the chicks, and is fertilised using the chicken manure. Eggs are collected from the farmers and transported for marketing by a sister company. MFE is currently working to upscale its model with an aim that the majority of eggs consumed within the region will be produced locally."},{"index":3,"size":115,"text":"In the Pacific, Tonga is selfsufficient in eggs, although production is seasonal and dependent on the temperature. When supply is short, eggs are imported from New Zealand. The national market is dominated by Tonga's largest commercial egg and chicken producer, which contributes around 80% of production, selling to supermarkets and smaller retailers. Day old chicks and feed are currently imported from New Zealand by the company, with some being sold on to other poultry farms and small farmers. Whilst the company is interested in developing a more integrated value chain and establishing a hatchery for chicks, it recognises that this would involve significant costs and challenges, not least that half the chicks would be male."}]},{"head":"Susanna Thorp","index":84,"paragraphs":[{"index":1,"size":135,"text":"See also Spore 174 field report: Integrating poultry and poultry feed In drawing together lessons from the case studies, the editors conclude that value chain success is aided when the 'micro-participants', such as small-scale farmers, are engaged in familiar activities and require little or no training in order to participate in the chain. Also important is that many players in the chain have access to alternative markets of similar value, which minimizes the risk of monopoly and exploitation. Each chain assists many poor people to improve their livelihoods, often in a more sustainable way that other types of development projects, and at no cost to donors, NGOs or governments. In addition, chains led by small businesses can often achieve a better match with the smallest and weakest producers, entering into balanced business relations with them."},{"index":2,"size":61,"text":"The potential and limitations of value chains in the context of smallholder development are a hot topic at present, with some regarding them as a panacea for progress while others take a more cautious view. This excellent account of chains led by small business entrepreneurs makes a timely and well informed contribution to those discussions, and deserves to be widely read. "}]},{"head":"Gender, Assets and Agricultural Development: Lessons from Eight Projects","index":85,"paragraphs":[]},{"head":"Growth strategies","index":86,"paragraphs":[{"index":1,"size":60,"text":"Examining patterns of agricultural this study pays particular attention to the role played by fertiliser in supporting increased farm production. The findings show that in half the countries under study -those with relatively low population density -agricultural production has been largely increased through cultivation of new areas of land, combined with a reduction in fallow periods and increased double cropping. "}]},{"head":"Agricultural Intensification in Africa: A Regional Analysis","index":87,"paragraphs":[]},{"head":"Working with uncertainty","index":88,"paragraphs":[{"index":1,"size":81,"text":"■ Most agricultural development strategies operating in the drylands, says Kratli, attempt to control the uncertainties associated with rainfall, for example by introducing irrigation and high yielding crop varieties. But in areas where variability is a part of the environmental fabric, such attempts to control it are normally very costly, can undermine local economies and livelihoods and risk creating inequality, degradation and conflict. A more successful approach to dryland development is to work with climate variability, and take advantage of it."},{"index":2,"size":77,"text":"For dryland livestock herders, for example, scattered rainfall is an advantage, since different areas of grazing are reaching their nutritional peak at different times, allowing herders to find good fodder over a much longer period. In addition, the most nutritious fodder is produced when rainfall is only enough to allow limited growth. By drawing on examples such as these, this fascinating, clearly written and well-presented book provides much food for thought on ways forward for dryland development. "}]},{"head":"Valuing Variability: New Perspectives on Climate Resilient Drylands Development","index":89,"paragraphs":[]},{"head":"Conceptual questioning","index":90,"paragraphs":[{"index":1,"size":84,"text":"The term 'sustainable intensification' is frequently touted as the way to feed our expanding population. But, say the authors, there is a danger that it encourages too narrow a focus on crop production, and is being used to justify intensive, high-input models of production. They argue it should be considered as one element within a wider perspective on food systems, encompassing issues such as farmers' property rights and reduction of food waste, with sustainability understood to include social justice, economic viability and environmental soundness. "}]},{"head":"Food history","index":91,"paragraphs":[{"index":1,"size":87,"text":"■ There are an estimated 400,000 species of plant on Earth, of which over half are edible to humans. Yet even when considering diets from varying climates and cultures across the globe, our species routinely eats only around 200 plant species, and over half of our plant-derived calories come from just three: maize, wheat and rice. So are their good biological reasons for our conservative tastes, or is mankind just unadventurous and predictable? In attempting to answer that question, this book offers fascinating and highly entertaining reading."},{"index":2,"size":92,"text":"The process of domesticating crops from wild relatives without being poisoned is at the heart of the matter. Over millennia, human beings have adopted several strategies to do this, for example by selecting plants with lower levels of toxic chemicals and inventing processing methods that make them safer to eat. At the same time, our own biology has adapted to be better able to digest them. Using a series of crop biographies as case studies, The Nature of Crops combines science, history and humour in a way that will have wide appeal."},{"index":3,"size":63,"text":"■ Designed to conserve, restore, revitalise, strengthen and improve local seed systems, with an emphasis on local seed varieties, community seed banks have been around for some 30 years. Recent years have seen a rapid growth in their number, organisational diversity and geographical spread, but despite this, there has been relatively little recognition of their contribution to smallholder farming livelihoods or biodiversity conservation."},{"index":4,"size":96,"text":"This book offers a detailed analysis of various key aspects of the operation of community seed banks, including their origins and evolution, the wide variety of functions that different models support, the policy and legal environment they operate in, and the vital matter of sustainability. This analysis is complemented by 35 case studies from around the world, highlighting individual seed banks, and the organisations and policies that support them. ACP examples include initiatives in Burundi, Mali, Rwanda, South Africa, Trinidad and Tobago, and Zimbabwe. There are also many further valuable examples from Asia and Latin America. "}]},{"head":"Protecting local resources","index":92,"paragraphs":[]},{"head":"Bridging the divide","index":93,"paragraphs":[{"index":1,"size":78,"text":"How might digital technologies contribute to or damage development efforts over the next 15 years, and how should development practitioners and policymakers respond? In answering these questions, the authors argue that strategies to deliver universal access and inclusive knowledge will be needed if digital divides between the rich and poor are to be closed. Involving poor people in developing knowledge infrastructure, and encouraging research institutions and governments to pursue open knowledge, are other core principles to be followed. "}]},{"head":"TO OBTAIN PUBLICATIONS","index":94,"paragraphs":[{"index":1,"size":21,"text":"Publications marked @ may be downloaded from the following website: http://publications.cta.int Titles marked with the logo can be obtained as follows:"},{"index":2,"size":49,"text":"If you are a subscriber to CTA publications: Use one of these options. http://publications.cta.int, go on-line and select your books depending on the credit points you have, then click on 'Add to shopping cart' and 'Proceed to checkout'. access, you can continue using the order form supplied by CTA."}]},{"head":"If you are an ACP organisation involved in agriculture but","index":95,"paragraphs":[{"index":1,"size":10,"text":"are not yet a subscriber to CTA publications, you can:"},{"index":2,"size":24,"text":"Request a subscription online at http://publications.cta.int, by email to [email protected] or by mail to CTA -PDS, PO Box 173, 6700 AD Wageningen, the Netherlands."},{"index":3,"size":36,"text":"Organisations that subscribe in 2015 will receive 200 credit points. Those already subscribed will receive 200 credit points plus half of the amount of credit points spent in 2014, i.e. a maximum of 400 credit points."}]},{"head":"If you are not an ACP organisation involved in agriculture:","index":96,"paragraphs":[{"index":1,"size":24,"text":"You can either buy the publications from the publisher or in a book shop. Alternatively you can download certain titles on the website http://publications.cta.int."},{"index":2,"size":11,"text":"More than half of our publications are downloadable free of charge."},{"index":3,"size":15,"text":"Titles marked with the symbol can be purchased from the publishers cited or from bookstores."}]},{"head":"What does ICT4Ag involve at CTA?","index":97,"paragraphs":[{"index":1,"size":136,"text":"ICT4Ag at CTA is based on the principle that ICTs are useful tools and should be exploited, based on their function, within any given sector. CTA uses ICTs to achieve its mission to advance food and nutritional security in ACP countries. ICTs are used to champion practical, cost-effective and scalable solutions that impact lives. We keep our stakeholders up-to-date on emerging innovations in ICTs; support them to identify viable ICT4Ag solutions; strengthen their capacities in using these solutions; and provide platforms for deliberations with policymakers. CTA's ICT4Ag strategy is holistic and forward-looking, including all stakeholder groups both in its design and use. CTA is aware that the use of ICTs in agriculture is not new but we are convinced that its recent rise in popularity is here to stay; ICTs have high potential to transform agriculture."},{"index":2,"size":24,"text":"To what extent do ICT4Ag capacity building activities play a crucial role in enhancing access to agricultural and rural development information in ACP countries?"},{"index":3,"size":129,"text":"The question is, ICT capacity building for what? We emphasise capacity building in ICTs for agricultural and rural development: ICTs are the \"means\" rather than the \"end\". We also believe that capacity building goes beyond training to the provision of relevant resources. ICT4Ag capacity building has three levels of stakeholder: institutional, grassroots, and the individual. Institutionally, emphasis is placed on how partners use ICTs to improve collaborative production and sharing of content, for example Web 2.0 and social media training opportunities. At a grassroots level, we aim to empower communities through demanddriven, user-friendly and integrated applications, such as the Participatory Geographic Information System. At an individual level, we aim to build capacity of the individual user to adopt and use these applications for agriculture, for example Apps4Ag learning opportunities."},{"index":4,"size":74,"text":"What would be your three main recommendations to decisionmakers in order to create an enabling environment for adoption of ICT4Ag? i) Need for political buy-in: We need more high-level politicians in ACP countries to be actively involved. By this I mean digital champions and ambassadors who are passionate about those at the grassroots being able to take advantage of this revolution in ICTs for agriculture. Without political buy-in, we risk losing the current momentum."},{"index":5,"size":57,"text":"ii) Support sound e-agricultural strategy development and promotion: At the moment the field of ICT4Ag at a national level is at the mercy of the value-added services and mobile network operators. There is a lack of systematic dissemination of information using ICTs. We need our policymakers to step in and support sector strategies for better service provision."},{"index":6,"size":57,"text":"iii) Ensure a conducive atmosphere for private sector investment in ICTs: Hundreds of thousands of fibre optic cables have been installed. It is time for national governments to put in place appropriate policies and strategies for the strategic distribution of cables. Without this, cables will run along one profitable route, detrimental to agricultural stakeholders in rural areas."},{"index":7,"size":14,"text":"Are smallholder farmers and fisherfolk in ACP countries really benefiting from the digital revolution?"},{"index":8,"size":160,"text":"This is a challenging question. My answer is yes and no. Yes, because we have evidence of ICTs' impact on users. No, because we can literally count those success stories. The majority of target users are yet to join the revolution. We see and read anecdotal cases of impact here and there but we are also aware that uptake by millions of smallholders remains very low. Our experience tells us that the issue is about more than just access to technology, but the innovative use of these technologies. ICTs are more than single mobile applications; they involve the convergence of various channels. CTA has recently initiated Building Viable Delivery Models for ICT4Ag, within which, 'proof of concept' projects serving to demonstrate how ICTs can empower smallholder farmers economically through viable models, are being explored. We believe that, through collaboration and partnership, millions of smallholder farmers across the developing world can benefit from the potential of new ICTs for agricultural development."}]},{"head":"ICTs -a vital means for agricultural and rural development","index":98,"paragraphs":[{"index":1,"size":60,"text":"Information and communication technologies (ICTs) could transform agricultural activities in many parts of the world. In some countries, ICTs are helping farmers to increase their yields and income, but much more remains to be done. Benjamin Addom, CTA programme coordinator, ICT for development, tells us more about the importance of ICTs for improving rural livelihoods by enhancing access to information."}]},{"head":"n.178","index":99,"paragraphs":[{"index":1,"size":18,"text":"For all ACP regions, there is a challenge to develop more efficient agriculture markets and boost intra-regional trade."}]},{"head":"| Agricultural protectionism","index":100,"paragraphs":[]},{"head":"Promoting regional markets","index":101,"paragraphs":[{"index":1,"size":12,"text":"The rearing and processing of giant snails is thriving in West Africa."}]}],"figures":[{"text":"©F CIAT/N Palmer These 6 pages were produced with contributions from: : N Ackbarally (Mauritius), M Andriatiana (Madagascar), B H Carreon (Palau), O Issa (Niger), J Karuga (Kenya), M A Konte (Senegal), P Kouakou (Côte d'Ivoire), M Makoni (South Africa), S Mbuguah (Kenya), C Mkoka (Malawi), N Mutemweno (Zambia), S Norte (Mozambique), P Sawa (Kenya), Fai air r t tr rade ader r st stand andar ards ds r re evi vise sed d "},{"text":"A 3 year programme to support product and market development, farmer and wild collector training, and Fair Trade and organic certification in rural areas of Zimbabwe has helped more than 8,000 smallholder farmers to commercialise underutilised indigenous plants, including baobab, devil's claw, rosella, and chili peppers. Participating farmers' average income rose from €25 per month to €95 per month, with the proportion of farming households facing moderate or severe hunger decreasing from 23% in 2012 to 17% by May 2013. The programme M Makoni SEEDS state of the African seed sector The TASAI index maps out the strengths and weaknesses of the African seed sector. Presently implemented in four countries, it should cover 20 within two years. T he African Seed Access Index (TASAI) has been developed by the Cornell International Institute for Food, Agriculture and Development and the NGO Market Matters in response to the difficulties that smallholder farmers face in accessing improved seeds of staple crops, which continues to contribute to Africa's poor yields. TASAI maps out the strengths and weaknesses of the seed sector across African countries. It monitors 16 indicators that are grouped into five categories: research and development, industry competitiveness, service to smallholder farmers, seed policy and regulations, and institutional support. "},{"text":" for high-quality eggs for local markets is transforming domestic poultry sectorsPUBLICATIONSThis account of 15 profitable and inclusive value chains from Africa and Asia examines the factors behind value chain success and sustainability. Rather than focus on large scale chains led by international companies, the authors set out to document less well known chains led by small businesses. Examples include banana beer making in Tanzania, rice production in Malawi, green beans in Senegal and stove liners in Kenya. In each case, the driving force behind the chain have been profit-oriented entrepreneurs, in contrast with developmentoriented chains promoted by NGOs or state actors, which frequently collapse when external support comes to an end. "},{"text":" By N L Johnson, C Kovarik, R Meinzen-Dick, J Njuki & A Quisumbing IFPRI, 2015; 36 pp. IFPRI Discussion Paper 01436 Downloadable as a pdf file from: http://tinyurl.com/oqekfeg "},{"text":" pdf from: http://tinyurl.com/plcqcka "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":" Fi ig gh ht ti in ng g F Fus usar ariu ium m wil wilt t COVER STORY COVER STORY In December 2014 In December 2014, F , FAO launched in Africa AO launched in Africa In December 2014 In December 2014, F , FAO launched in Africa AO launched in Africa and in the W and in the West Indies a programme to est Indies a programme to and in the W and in the West Indies a programme to est Indies a programme to overcome the deadly Fusarium wilt disease overcome the deadly Fusarium wilt disease overcome the deadly Fusarium wilt disease overcome the deadly Fusarium wilt disease in bananas. This programme works on three in bananas. This programme works on three in bananas. This programme works on three in bananas. This programme works on three main fronts of action: preventing future main fronts of action: preventing future main fronts of action: preventing future main fronts of action: preventing future outbreaks, managing existing cases, and outbreaks, managing existing cases, and outbreaks, managing existing cases, and outbreaks, managing existing cases, and strengthening collaboration and coordination strengthening collaboration and coordination strengthening collaboration and coordination strengthening collaboration and coordination among institutions, researchers, among institutions, researchers, among institutions, researchers, among institutions, researchers, governments and producers. It also aims governments and producers. It also aims governments and producers. It also aims governments and producers. It also aims to develop new varieties resistant to to develop new varieties resistant to to develop new varieties resistant to to develop new varieties resistant to Fusarium oxysporum sp. Cubense Fusarium oxysporum sp. Cubense, the fungus , the fungus Fusarium oxysporum sp. Cubense Fusarium oxysporum sp. Cubense, the fungus , the fungus responsible for the disease. responsible for the disease. responsible for the disease. responsible for the disease. © ACON/ S Shaban © ACON/ S Shaban Biochar is ploughed Biochar is ploughed into soils as a into soils as a long-lived form of long-lived form of carbon storage, carbon storage, improving fertility improving fertility and carbon- and carbon- mitigating mitigating T Paul Cox T Paul Cox  "},{"text":"The Nature of Crops: How We Came to Eat the Plants We Do  PUBLICATIONS  PUBLICATIONS By J Warren  By J Warren CABI, 2015; 184 pp.  CABI, 2015; 184 pp. ISBN 978-1-78064-509-4  ISBN 978-1-78064-509-4 £19.95 . €28  £19.95 . €28 CABI, Nosworthy Way  CABI, Nosworthy Way Wallingford, Oxfordshire  Wallingford, Oxfordshire OX10 8DE, UK  OX10 8DE, UK www.cabi.org  www.cabi.org  Soil fertility Soil fertility  Lack of knowledge on crop nutrition Lack of knowledge on crop nutrition  and poor access to appropriate, high and poor access to appropriate, high  quality fertilisers are just two factors that quality fertilisers are just two factors that  undermine smallholder productivity, undermine smallholder productivity,  according to Kari Niedfeldt Thomas of according to Kari Niedfeldt Thomas of  the Mosaic Company Foundation. In the Mosaic Company Foundation. In  this online video talk, she explains how this online video talk, she explains how  properly-informed fertiliser usage can properly-informed fertiliser usage can  move farmers from a downward spiral move farmers from a downward spiral  of poverty and declining soil fertility to of poverty and declining soil fertility to  an upward, positive spiral of growing an upward, positive spiral of growing  productivity and wealth. One in a series productivity and wealth. One in a series  of IFAD AgTalks that aim to spur new of IFAD AgTalks that aim to spur new Sustainable Intensification Revisited By S Cook, L Silici, B Adolph & S Walker thinking on how to feed the world. Essential Elements, IFAD AgTalk Sustainable Intensification Revisited By S Cook, L Silici, B Adolph & S Walkerthinking on how to feed the world. Essential Elements, IFAD AgTalk IIED, 2015; 32 pp. By K N Thomas IIED, 2015; 32 pp.By K N Thomas ISBN: 978-1-78431-185-8 IFAD, 2015; 19 mins ISBN: 978-1-78431-185-8IFAD, 2015; 19 mins Downloadable as a pdf file Viewable at: Downloadable as a pdf fileViewable at: from: http://tinyurl.com/q7xbom4 http://tinyurl.com/pfwsd2b from: http://tinyurl.com/q7xbom4http://tinyurl.com/pfwsd2b  "},{"text":"Community Seed Banks: Origins, evolution and Prospects  R Vernoy, P Shrestha & B Sthapit R Vernoy, P Shrestha & B Sthapit Routledge, 2015; 294 pp. Routledge, 2015; 294 pp. ISBN 978-0-415-70806-7 ISBN 978-0-415-70806-7 £29.99 . €42 £29.99 . €42 For Routledge's address, see p. 23 For Routledge's address, see p. 23  "},{"text":"The Future of Knowledge Sharing in a Digital Age: Exploring Impacts and Policy Implications for Development  By J M Brownlee, R Playforth & N Bimbe By J M Brownlee, R Playforth & N Bimbe IDS, 2015; 76 pp. IDS, 2015; 76 pp. IDS Evidence Report 125 IDS Evidence Report 125 Downloadable as a pdf file Downloadable as a pdf file from: http://tinyurl.com/nb7g4hg from: http://tinyurl.com/nb7g4hg  "}],"sieverID":"828f6d0b-8a2c-4438-a9cc-1b7423ead53e","abstract":"2015 is a critical year for the future of sustainable development. Three major high-powered conferences are taking place during the year that will make major decisions and their impacts will reverberate for decades to come. These are: the Financing for Development (FfD) Conference in Addis Ababa, which took place in July, the UN Summit on the post-2015 development agenda in New York in September and the UN Climate Change Conference in Paris in December.The UN Summit in September will approve the Sustainable Development Goals (SDGs) that will kick in as the Millennium Development Goals come to an end in 2015. Among the 17 goals and 169 targets proposed for the SDGs, Goal 2 and its five targets focus on food and nutrition security and agriculture, which set specific, nutrition-related targets on reducing stunting and wasting among children. They also include targets on improving agricultural productivity and incomes for smallholders, increasing resilience, boosting investments in rural infrastructure, reducing trade restrictions and distortions and protecting biodiversity. Other SDGs address important aspects of food and agriculture, including post-harvest and food losses, access to land, and regulation of fishing.Achieving the SDGs will largely depend on the availability of financial resources, hence the importance of the FfD Conference in Addis Ababa. A key focus of this conference was on innovative ways to mobilise finance, including from the private sector. Given the high level of perceived risk associated with agriculture, smallholder farmers and small and mediumsized enterprises find it difficult to get credit from banks. Several organisations, including CTA, are exploring various ways to deliver inclusive value chain finance that could unlock capital for smallholders and SMEs. The Climate Summit is also expected to address financing issues.In all these discussions, the challenge will be how to translate what is decided in Addis Ababa, New York and Paris into real benefits for millions of farmers across the developing world."}

data/part_4/01c824bd773da87960fa097db9b49c40.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01c824bd773da87960fa097db9b49c40","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/db36a9bf-2eba-40c1-8f2c-d877f6d4b8a4/retrieve"},"pageCount":34,"title":"","keywords":["Indigenous knowledge","weather forecasts","climate risks","rainy season","agriculture"],"chapters":[{"head":"Table of Contents","index":1,"paragraphs":[]},{"head":"Introduction","index":2,"paragraphs":[{"index":1,"size":200,"text":"Smallholder farmers in many parts of East Africa face numerous challenges. These include declining soil fertility and crop yields, poor market access, declining land sizes and constrained access to land. Household food insecurity and poverty level are also increasing (Kristjanson et al. 2012, Thornton et al. 2011). These challenges are likely to worsen as climatic conditions change and become more variable, mainly due to the limited adaptive capacity and low levels of development. Moreover, limited access to available technological options and information further heighten vulnerability to climate stresses. Indeed, Africa's climate is warmer than it was 100 years ago and model-based projections of future greenhouse gas induced climate change for the continent project that this warming will continue and in most scenarios, accelerate (Hulme et al. 2001, Christensen et al. 2007). In Lushoto district in Tanzania, dry spells, floods and unpredictable rainfall have increased, negatively affecting agriculture and food security. These problems are compounded by high poverty rates (with about half of the population living below the poverty line) and low agricultural productivity (Lyamchai et al. 2011). While farming is the primary source of food and income in Lushoto, the farms are not diverse and show very few agricultural innovations."},{"index":2,"size":94,"text":"Use of improved agronomic practices can help increase on-farm productivity and contribute to reduction in land degradation. However, reliable climate information services and timely seasonal weather forecasts can offer great potential to inform farm-level decision making in the face of increasing climate variability. This can improve management of climate-related risks in agriculture, and therefore help farmers adapt to the changing climatic conditions. Despite significant progress in provision of scientific weather forecasts in East Africa, most of the seasonal forecasts are not specific to the localities and there are difficulties in accessing forecasts on time."},{"index":3,"size":188,"text":"Local communities in Africa have continued to rely on indigenous knowledge (IK) to conserve the environment and deal with natural disasters (Chang'a et al. 2010, Egeru 2012). They have generated a vast body of IK on disaster prevention through early warning and preparedness (Roncoli et al. 2002). The use of scientific and indigenous climate forecast information for farm level decision making has been reported in Kenya, Mozambique and Zimbabwe (Lucio 1999, Ngugi 1999). Also, Shumba (1999) documents the integration of contemporary and indigenous climate forecasting for coping with drought in Zimbabwe. Before the establishment of scientific weather forecasting, older generations especially in the rural areas in Tanzania have largely relied on IK to predict weather (Kadi et al. 2011) through observation and monitoring the behavior of animals, birds, plants and insects (Kihupi et al. 2002, Mhita 2006, Acharya 2011). In spite of all these benefits, weather forecasting using IK has challenges and these include lack of systematic documentation of the knowledge, lack of coordinated research to investigate its accuracy and reliability, and when old people who are the main custodians of the knowledge pass away, it is lost."},{"index":4,"size":53,"text":"Systematic documentation and subsequently integration of IK in seasonal rainfall forecasting is one of the promising initiatives that need to be explored. The aim of the study was to promote the integration and utilization of IK and scientific weather forecasting to improve farmer decisionmaking and management of climate risks. The specific objectives were:"},{"index":5,"size":34,"text":" To identify and document existing IK in weather forecasting practices;  To establish IK weather forecasting zones and teams; and  To operationalize the integration and dissemination of IK and scientific weather forecasts."}]},{"head":"Method","index":3,"paragraphs":[{"index":1,"size":138,"text":"The study was carried out in Lushoto District, Tanga Region in Tanzania (Figure 1). Lushoto is one of the six districts in Tanga Region, with an approximate land area of 3,500 km 2 . The altitude ranges from 200 m in the lowlands to 2000 m in the highland areas. Average annual rainfall ranges from 400 mm in the lowlands to 1800 mm in the highlands, with a mean annual temperature of 16°C and humidity of 70%. According to the 2002 national census, the total population in Lushoto district was 419,970. The Sambaa tribe is the dominant ethnic group in the district followed by Wapare and Wambugu and other smaller ethnic groups. The major economic activity in the district is subsistence farming of vegetables, fruits and maize with the majority of the population living within its rural areas."},{"index":2,"size":180,"text":"Data were collected from seven villages -Boheloi, Gare, Kwang'wenda, Masange, Mbuzii, Milungui, and Yamba, through household surveys. The study villages were spread in three administrative wards (Gari, Kwai, and Mbuzii). Respondents were randomly selected from each of the seven villages. The survey data were complimented with information from key informant interviews and focus group discussions (FGDs) that were carried out in three of the seven villages. The Lushoto district agricultural extension officers worked with village leaders to identify key informants who were knowledgeable on IK in the local community. They held meetings with the identified resource persons in their respective villages to discuss weather forecasting using IK. Following the interviews, the seven villages were grouped into three IK teams representing the upper, middle and lower zones. Each team consisted of seven people whose selection was based on gender and specific IK expertise such as plants, insects, animals, wind, moon and stars. The teams were trained on recording weather forecasts, and a schedule was agreed upon where they could meet regularly every two weeks to carry out the IK weather forecasting."}]},{"head":"Figure 1. Map of Lushoto site","index":4,"paragraphs":[{"index":1,"size":2,"text":"Source: CCAFS"},{"index":2,"size":51,"text":"In total, 77 respondents were interviewed across the seven villages of which 67.5% were male and 32.5% were female. Data collected through household survey were analysed using SPSS) version 21. Information collected from the key informants and FGDs was grouped together and synthesized according to the checklist of questions and interpreted."}]},{"head":"Results and discussion","index":5,"paragraphs":[]},{"head":"Annual and seasonal rainfall patterns","index":6,"paragraphs":[{"index":1,"size":76,"text":"The daily rainfall data for Lushoto for the period 1922 to 2012 obtained from TMA shows a decreasing trend though not significant (Figure 2). The mean annual total rainfall over this period was 1,079 mm with an average of 102 rainy days (Table 1). The highest rainfall amounts were recorded during the El-nino years of 1997 (1,862 mm) and 2006 (1,754 mm). The driest year was in 1974 with an annual mean rainfall of 619 mm."}]},{"head":"Figure 2. Lushoto long term annual rainfall trends","index":7,"paragraphs":[{"index":1,"size":2,"text":"Source TMA"},{"index":2,"size":146,"text":"The bimodal seasonal rainfall pattern in Figure 3 shows the long rainy season (masika) which occurs from March to mid-June, and the short rainy season (vuli), which occurs in the months of October to December.  The masika season records more rainfall than vuli season, with peaks in April (190 mm) and November (110 mm) respectively. The mean rainfall during masika is 527.8 mm, and vuli is 272.4 mm. Changes in the rainfall amounts received during both seasons is clearly evident with a slight shift toward late onset and early cessation of the rains. The masika seasons of 1931 to 1960, for example, experienced late onset (in May) as compared to the other periods where the peak is in April. Over the period 1981-2010, the seasonal trends show a decrease in rainfall amounts during masika season and increased amounts during vuli compared to the previous 30 years."},{"index":3,"size":51,"text":"The risk of having longer dry spells (greater than 10, 15 or 20 days) during rainfall season in Lushoto is not so high (Figure 4). The risk is below 50% at the peak of both vuli and masika seasons and increases gradually before and after the peak of the rainfall seasons. "}]},{"head":"Farmer awareness of climate change and variability","index":8,"paragraphs":[{"index":1,"size":117,"text":"Almost all the respondents (98.7%) were aware of the changes in climate, with 11.7% of the respondents much better informed on climate change and variability. These results were consistent with the responses from focus group discussions with the key informants. Findings from the key informant discussions show that the rains were reliable in the 1940s to early 1970s, with either few or no crop diseases and pests, and it was relatively cooler. Over 95% of the respondents perceived climate change as the main cause of the agricultural problems and unpredictable and unreliable rainfall. Climate change led to the drought and sometimes flood events, poor crop yield, loss of income and hunger, and damage to property and life."},{"index":2,"size":92,"text":"In the early periods (1940s-1970s) when rains were reliable, farmers in Lushoto used to grow many varieties of fruits and crops with high yields. However, with the changes in climate, most of the indigenous cultivars, for example, of bananas and pumpkins have gone into extinction and the few remaining cultivars have very low yields. In addition, coffee which was once the main cash crop has nearly become non-existent because of low yields. Increased temperatures are also associated with increased incidences of malaria in highland areas that were once free of the disease."},{"index":3,"size":44,"text":"-We used to grow cassava, coffee, tomatoes, bananas and pumpkins very successfully and without using fertilizers and pesticides. We had bumper harvests but that has changed today because even with heavy investment of inputs, you cannot get a good yield‖, farmer from Mbuzii village."}]},{"head":"Sources of and access to weather information","index":9,"paragraphs":[{"index":1,"size":160,"text":"While most of the respondents (67.5%) reported having observed the climatic changes on their own, the radio was the most commonly used media (61%) to access climate and weather information and forecasts (Table 2). Similarly, information on daily, weekly, monthly and seasonal weather forecasts, including climate change and variability were mainly from other sources. These sources included local development organizations and researchers from local institutions who work in the area. Climate and weather information dissemination methods widely used in Lushoto included village meetings (27%) and exchanges with other farmers (24.7%). Use of television, NGOs, researchers, TMA and input suppliers as sources of climate information was very limited. These findings are consistent with those of Lyamchai et al. (2011), who reported that almost 75% of respondents owned a radio in Lushoto, thus making it a useful media for accessing climate information. There is great potential to improve other sources such as NGOs and input suppliers in climate and weather information dissemination. "}]},{"head":"Severity and impact of climate related risks","index":10,"paragraphs":[{"index":1,"size":164,"text":"Several extreme events have occurred in Lushoto as summarized in Table 3 due to climate change. Perceived severity of extreme events underlies the ability of a farmer to cope with a hazard they are exposed to. Therefore, the pattern of perceived severity of extreme events is likely to change with increased ability of the farmer to cope with such climate hazards. Table 3 shows the farmers ranking of severity of extreme events. Overall, seasonal drought and crop pests were ranked to be most severe by farmers and had a significant effect on food production. Livestock pests are the least severe climate related risks. Most farmers associated crop failure, reduced income, and water scarcity with seasonal drought (Table 4) because their livelihoods depend on rainfed agriculture. The water scarcity was also associated with scarcity of pasture. Rainfall storms had the second greatest negative impact on crops and income. Similarly, the fluctuations in air temperature associated with the seasons had negative impacts on crops and income. "}]},{"head":"Impacts of climate change on various sectors","index":11,"paragraphs":[{"index":1,"size":54,"text":"The effects of climate change and variability differ across various sectors of the economy. A large proportion of farmers reported crop production as the most vulnerable sector to climate change and variability compared to other sectors such as livestock, health and infrastructure (Figure 5). Other sectors were also affected but to a lesser degree. "}]},{"head":"Constraints to crop and livestock production","index":12,"paragraphs":[{"index":1,"size":14,"text":"The reported constraints to crop and livestock production are summarized in Table 5 below."},{"index":2,"size":35,"text":"Limited availability of improved seeds and inorganic fertilizer affected crop production. Less than 40% of the respondents reported climate related constraints such as prolonged drought and floods compared to other constraints like weeds and salinization."},{"index":3,"size":43,"text":"Lack of improved breeds, adequate pastures, veterinary drugs and diseases were the core factors affecting livestock production (Table 5). Inadequate extension services cut across both crop and livestock production as most respondents (70%) said they had no contact with extension agents or services. "}]},{"head":"Community perception of scientific weather forecasts","index":13,"paragraphs":[{"index":1,"size":185,"text":"TMA issues various types of climate information, ranging from daily weather forecasts to seasonal forecasts. About 67% of the respondents had access to weather forecasts, with 56% indicating they were aware of the weather and climate forecasts issued by TMA. More than half (54.5%) of the respondents were using the forecasts in planning their agricultural activities, close to the percentage of those who reported to be aware of the weather and climate forecasts information issued by TMA. The information accessed by the respondents included onset of rainfall, cessation of rainfall, amount of rain, drought occurrence, duration of rainy season, occurrence of strong winds and floods (Figure 6). Seasonal forecasts was the most reliable source of information as reported by 53.2% of the respondents compared to daily forecast (6.5%) and monthly forecast (2.6%). Figure 7 shows the perceived reliability of the indigenous climate forecasts as compared to the scientific forecasts. Most of the farmers (56%) believed that the IK forecasts were reliable compared to 22% for scientific forecasting. Very few respondents (16%) thought indigenous forecasts were not reliable, as compared to 38% for the scientific forecasts. "}]},{"head":"Local knowledge based on birds","index":14,"paragraphs":[{"index":1,"size":98,"text":"The behaviour, appearance and movement of some birds in Lushoto is frequently used by the local people to predict weather in their communities. The monitoring of the behaviour of the birds is done informally and with time and experience, the local people have come to realize distinct and unique features of some of the birds. The occurrence of large flocks of swallows and swans roaming from the South to the North during the months of September to November, for example. is an indication of onset of short rains. Other birds used as indicators are shown in Table 6. "}]},{"head":"Local knowledge based on large animals","index":15,"paragraphs":[{"index":1,"size":75,"text":"The appearance of wild animals in the village and the behaviour of domestic animals are used by the local communities to predict weather and climate. For example, baboons coming into the village during the dry season indicate a good forthcoming rainy season. Goats, sheep and cattle flapping their ears repeatedly at any time during the dry season is an indication that the rain onset is near and also prospects of a good season (Table 7). "}]},{"head":"Indicators based on insects","index":16,"paragraphs":[{"index":1,"size":39,"text":"Results from the household interviews and focus group discussions show that various insects are used by the local communities to predict weather and climate. The most commonly used insects were army ants, Vidododo, odenteterms, butterflies and frogs (Table 8)."}]},{"head":"Indicators based on plant phenology","index":17,"paragraphs":[{"index":1,"size":25,"text":"Indigenous indicators based on plant phenology include the flowering of venonia, pears, albizia, and plums. Solanum incunum dropping leaves indicates onset of rains (Table 9).  "}]},{"head":"Indicators based on the moon, sun and wind","index":18,"paragraphs":[{"index":1,"size":56,"text":"The occurrence of halo moon (moon surrounded by a yellow ring) in Lushoto is an indication of onset of rains for both short and long rainy seasons. The North-South wind direction in September is taken as an indicator of onset of short rain season and a sign of heavy rainfall in the upcoming season (Table 10). "}]},{"head":"Indicators based on air temperature, clouds and wind","index":19,"paragraphs":[{"index":1,"size":33,"text":"Excessive heat and warming towards the end of the dry season is indicative of good rainfall season. High temperatures during the night are expected to be followed by a rainy day (Table 11)."}]},{"head":"Table 11. Air temperature and cloud indicators","index":20,"paragraphs":[{"index":1,"size":27,"text":"The sign used to relate to the rain Percent of respondents (n=77) High temperatures most of the time indicates that the onset of rains is near 74"},{"index":2,"size":28,"text":"High temperature during the night is an indication that it will rain the next day 57 Cold wind for about a week is usually followed by rain 1.3"},{"index":3,"size":11,"text":"High temperature and blowing wind is an indication of rain 1.3"}]},{"head":"Other indicators based on human beings","index":21,"paragraphs":[{"index":1,"size":43,"text":"Changes in the human body are at times used to predict weather and climate in Lushoto. Palpitation on top of the right eye and one sided headaches is an indication of onset of rains. Too much heat and humidity also indicate imminent rainfall."}]},{"head":"Local indicators of an unreliable rainfall season","index":22,"paragraphs":[{"index":1,"size":83,"text":"Indicators of a bad rainfall season include excessive flowering of mango trees and peaches. Birth trends are also used to predict weather or season, for example, a high birth rate of male children and animals in a particular season is usually taken as a sign of a likely bad season. Also, the moon orientation can be used to predict a bad season, when the moon is inclined towards the horizon, it is believed that there will be less rain on the inclined side."}]},{"head":"IK weather forecasting groups and establishment of weather information flow system at district level","index":23,"paragraphs":[{"index":1,"size":89,"text":"A major output of the study is the formation of three local IK forecasting groups consisting of seven people for each administrative ward. The IK groups meet twice a month to discuss and document the IK weather forecast observations. The groups are required to give two-week weather forecasts twice a month, describing the indicators that they use for forecasts. Apart from issuing new forecasts in their regular meetings, the previous forecast is also reviewed. An example of the forecasts for one of the villages-Yamba village-is presented in Table 12."},{"index":2,"size":114,"text":"Overall, the forecasts from the IK groups were fairly accurate as the review showed that most of the time the IK groups got it right. However, it is important to document the IK forecasts to make better conclusions. At the district level, a core team of weather forecasting experts constituting 29 people was launched at a meeting organized by the District Council. Members of the team included the District Agricultural and Livestock Development Officer (DALDO) as the chairperson, 21 members of IK forecasting teams (seven from each of the three zones), five extension officers from the zones and two members of the project team from SUA and TMA. Specific tasks for the team include:"},{"index":3,"size":51,"text":" Undertaking and recording IK weather forecasts on a 14 day basis, and reporting these to the DALDO and TMA;  Undertaking and recording scientific weather forecasts by TMA;  Producing a consensus seasonal weather forecast before and after the season; and  Disseminating the consensus weather reports to all stakeholders."}]},{"head":"Conclusion and recommendations","index":24,"paragraphs":[{"index":1,"size":153,"text":"Lack of documentation and reliability are among the key challenges in using IK forecasts. In most cases, IK is sustained from one generation to another through oral history and local expertise, and there is a widening intergenerational gap between the custodians of IK knowledge and the young. There is need for systematic documentation of IK in order to sustain and improve it for use by future generations. The results indicate that IK forecasts were more reliable in the long rainy season (March -May) compared to the short rainy season (October-December) in Lushoto. There is need to strengthen IK in weather forecasting, especially due to increasing changes in weather patterns and variability by integrating it with scientific weather information. One big challenge is that seasonal weather forecasts from the TMA sometimes come later in the season after the IK weather forecasts have already been released in the villages and farmers have already made decisions."},{"index":2,"size":221,"text":"The provision of climate information services in Lushoto will be improved through the district consensus weather forecasting team composed of a multistakeholder partnership that involves the local community, agricultural extension services and the TMA. In order to improve the accuracy of the weather forecasts, there is need for a systematic documentation of IK and establishing a framework for integrating IK and scientific weather forecasting from TMA. Equally important is the establishment of an information dissemination network that provides information to all farmers beyond the three administrative wards, as all the farmers in the district need to manage climate-related risks. This could be achieved by integrating systems for disseminating climate information within the local communities, e.g. through the local schools, community-based organisations, churches in highly religious communities, partnership with NGOs and agricultural input dealers and service providers. Similarly, integration of weather forecasting into the national agricultural policies and District Agricultural Development Programmes (DADPs) would greatly enhance food security, as it would lead to better-informed decisions at farm level. For easier understanding of the forecasts by majority of the farmers, there is need to translate the consensus weather forecasts into the native language. Therefore, there is need to integrate the IK and scientific weather forecasts by having local IK custodians work with TMA officers, in order to produce comprehensive and accurate weather forecasts."},{"index":3,"size":97,"text":"Towards the end of the season in December some areas received heavy rainfall that caused catastrophic disasters. The outlook for the March to May, 2012 rainfall season indicates that most parts of the bimodal areas (including Lushoto in Tanga Region) are expected to receive normal to above normal rainfall. These rains are expected to recede towards the end of April, 2012. The principal contributing factors to the observed and predicted weather include enhanced westerly wind flow, anomalous cooling of sea surface temperatures (SSTs) over the central and eastern Atlantic Ocean and slight warming over Southwestern Indian Ocean."}]},{"head":"B: RAINFALL PERFORMANCE","index":25,"paragraphs":[{"index":1,"size":113,"text":"The performance of the October to December (OND), 2011 short rains (vuli) was well over most parts of the country. However, both temporal and spatial distribution was not good as some parts of the country received more and heavy rains towards the end of the season. The recorded rainfall amounts in millimeters for some selected stations with their respective percentages of long term means in brackets are indicated below: It should be noted that: Rainfall amounts below 75% of long term averages are categorized as below normal while those ranging from 75 to 125% are categorized as near normal and those greater than 125% of long term averages are categorized as above normal."}]},{"head":"C: CLIMATE SYSTEMS OUTLOOK","index":26,"paragraphs":[{"index":1,"size":77,"text":"This outlook is based on a review of the current and expected state of global climate systems and its likely impacts on the upcoming March to May (MAM), 2012 rainfall seasons in the country. Currently, the Sea Surface Temperatures (SSTs) in the equatorial central Pacific Ocean have been anomalously cooler indicating persistence of weak La Niña conditions. However, slight warming leading to neutral Sea Surface Temperature condition is projected towards the end of MAM, 2012 rainfall season."},{"index":2,"size":173,"text":"The observed and projected cooling over Central equatorial and Eastern Atlantic Ocean coupled with slight warming over the South-western Indian Ocean is expected to contribute and enhance westerly wind towards Tanzania leading to increased rainfall particularly over the western parts. Westerly wave associated with phases of enhanced tropical convection is expected to move across the country during the early period of the season (i.e. March) and thus influencing early rainfall onset. The current weak temperature gradient between western and eastern parts of the Indian Ocean is projected to persist through March, 2012 leading to weak easterlies towards East African coast. The northern subtropical systems are projected to be relatively weaker than the southern systems that suggest the possibility of fast retreat of the Inter Tropical Convergence Zone (ITCZ) from south to north. Due to projected slight warming over South-western Indian Ocean and due to the likelihood of factors favoring the development of tropical storms, the number of tropical storms is projected to increase and this may have impact on the MAM seasonal rains."}]},{"head":"D: SEASONAL RAINFALL OUTLOOK","index":27,"paragraphs":[{"index":1,"size":5,"text":"(i) Long Rainfall Season (masika)"},{"index":2,"size":28,"text":"The long rainfall season in the northern sector (bimodal areas) of Tanzania is due to commence in the first week of March, 2012. The details are as follows:"},{"index":3,"size":69,"text":"Northern coast and hinterlands (Dar es Salaam, Tanga, Coast, northern Morogoro regions and isles of Unguja and Pemba): Rains are expected to start during the first week of March. However, some areas of this region had experienced pre-seasonal rains during the fourth week of February that was associated with tropical storm over the Indian Ocean. The seasonal rains over this region are likely to be normal to above normal."},{"index":4,"size":84,"text":"Northeastern highlands (Kilimanjaro, Arusha and Manyara regions): The onset of rainfall is expected during the first week of March, 2012 and the rains are likely to be Normal to Above Normal It should be noted that heavy rainfall events are common even in below normal rainfall conditions and periods of longer dry spells may occur even in areas with above normal rainfall. It should also be noted that the March to May rainfall season is more significant for the northern sector of the country."},{"index":5,"size":46,"text":"Tanzania Meteorological Agency will continue to monitor developments of weather systems including tropical cyclones over the southwestern Indian Ocean, which could influence the rainfall patterns in the country and issue updates as necessary. However, farmers are strongly advised to seek more advice from agricultural extension officers."},{"index":6,"size":5,"text":"Issued by Tanzania Meteorological Agency"}]}],"figures":[{"text":" 1. Introduction ...................................................................................................................... 2. Method .............................................................................................................................. 3. Results and discussion .................................................................................................... 3.1 Annual and seasonal rainfall patterns ........................................................................... 3.2 Farmer awareness of climate change and variability .................................................. 3.3 Sources of and access to weather information ............................................................. 3.4 Severity and impact of climate related risks ................................................................ 3.5 Impacts of climate change on various sectors .............................................................. "},{"text":"3. 6 Constraints to crop and livestock production ............................................................... 3.7 Community perception of scientific weather forecasts ............................................... 3.8 Indigenous weather forecasts using local indicators ................................................... 3.9 IK weather forecasting groups and establishment of weather information flow system at district level ..................................................................................................... 4. Conclusion and recommendations .................................................................................. Appendix ................................................................................................................................ References .............................................................................................................................. "},{"text":"Figure 3 . Figure 3. Comparison of 30-year period monthly rainfall patterns "},{"text":"Figure 4 . Figure 4. Probability of dry spell in Lushoto "},{"text":"Figure 5 . Figure 5. Farmers' perceptions regarding vulnerability of the different sectors to climate change and variability "},{"text":"Figure 6 . Figure 6. Type of climate information accessed by respondents "},{"text":"Figure 7 . Figure 7. Reliability of climate forecast information "},{"text":" roaming from South to North in the area are an indication of onset of the vuli rains, sometimes within "},{"text":" Strong winds and swirl winds indicate imminent rain onset 35.1 White clouds appearing in the evening indicates the prospect of rain the next day 15the evening during the dry season is an indication of onset of vuli rains 9.1 "},{"text":" Figure 1: Rainfall Outlook for March to May 2012 E: IMPACTS AND ADVISORY Agriculture and food Security: Sufficient soil moisture condition is likely over much of the country. The expected above normal rains in bimodal rainfall areas are likely to cause excessive soil moisture levels particularly over lowlands, thus causing water logging of crops. Over northern coast and north eastern highlands, farmers are advised to go for normal masika cropping season. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Table 1 . Lushoto mean monthly rainfall (mm) for the period of 1971-2000  Month Mean rainfall MonthMean rainfall January 87.0 January87.0 February 74.5 February74.5 March 136.1 March136.1 April 199.8 April199.8 May 192.9 May192.9 June 52.4 June52.4 July 34.9 July34.9 August 23.5 August23.5 September 17.6 September17.6 October 50.6 October50.6 November 111.5 November111.5 December 111.4 December111.4 Source: TMA  Source: TMA  "},{"text":"Table 2 . Sources of information on weather forecasts  Source of information on weather forecasts Percent of respondents Source of information on weather forecastsPercent of respondents Own observation 67.5 Own observation67.5 Radio 61 Radio61 Village meetings 27.8 Village meetings27.8 Neighbours and family 24.7 Neighbours and family24.7 Newspapers and television 14.3 Newspapers and television14.3 NGOs and researchers 7.7 NGOs and researchers7.7 Tanzania Meteorology Office 1.3 Tanzania Meteorology Office1.3 Input suppliers 1.3 Input suppliers1.3 N 77 N77  "},{"text":"Table 3 . Perception of severity of climate related risks  Risks   Percent of respondents (n=77)  RisksPercent of respondents (n=77)  More severe Severe Less severe Not severe No response More severeSevereLess severeNot severeNo response Seasonal drought 10.4 24.7 49.4 5.2 10.4 Seasonal drought10.424.749.45.210.4 Floods 3.9 16.9 6.5 18.2 54.5 Floods3.916.96.518.254.5 Stormy rainfall 7.8 13 31.2 16.9 31.2 Stormy rainfall7.81331.216.931.2 Strong wind 5.2 2.6 35.1 16.9 40.3 Strong wind5.22.635.116.940.3 High temperature 5.2 9.1 50.6 13.0 22.1 High temperature5.29.150.613.022.1 Extreme cold 3.9 3.9 23.4 23.4 45.5 Extreme cold3.93.923.423.445.5 Crop pests 14.3 8.2 40.3 11.7 15.6 Crop pests14.38.240.311.715.6 Livestock pests 0 3.9 29.9 14.3 51.9 Livestock pests03.929.914.351.9 Crop diseases 2.6 28.6 39.0 6.5 23.4 Crop diseases2.628.639.06.523.4 Livestock diseases 2.6 11.7 26.0 9.1 50.6 Livestock diseases2.611.726.09.150.6 Human disease 5.2 26.0 6.5 14.3 48.1 Human disease5.226.06.514.348.1  "},{"text":"Table 4 . Impacts of climate related risks  Impacts  Percent of respondents (n=77) ImpactsPercent of respondents (n=77)  Seasonal drought Rainfall storms Change in temperature Seasonal droughtRainfall stormsChange in temperature Crop failure 97.4 72.7 62.5 Crop failure97.472.762.5 Reduced income 93.5 51.9 55.8 Reduced income93.551.955.8 Water scarcity 77.9 9.1 32.5 Water scarcity77.99.132.5 Scarcity of pasture 40.3 11.7 24.7 Scarcity of pasture40.311.724.7 Outbreak of pests 29.9 13 32.5 Outbreak of pests29.91332.5 Plant diseases 19.5 9.1 14.3 Plant diseases19.59.114.3 Animal diseases 18.2 10.4 11.7 Animal diseases18.210.411.7 Destruction of infrastructure 15.6 50.6 5.2 Destruction of infrastructure15.650.65.2 Human diseases 11.7 13 46.8 Human diseases11.71346.8 Death of animals 7.8 2.6 3.9 Death of animals7.82.63.9 Land slides 1.3 10.4 1.3 Land slides1.310.41.3 Soil Erosion  48.1  Soil Erosion48.1  "},{"text":"Table 5 . Constraints to crop and livestock production  Constraints Percent of respondents ConstraintsPercent of respondents Lack of improved seeds 94.8 Lack of improved seeds94.8 Unavailability or lack of improved breeds 87 Unavailability or lack of improved breeds87 Lack of inorganic fertilizer 83.1 Lack of inorganic fertilizer83.1 Unavailability or lack of pastures 72.7 Unavailability or lack of pastures72.7 Inadequate extension services 67.5 Inadequate extension services67.5 Livestock diseases 66.2 Livestock diseases66.2 Lack of organic fertilizer 54.5 Lack of organic fertilizer54.5 Lack of pesticides 52 Lack of pesticides52 Unavailability or lack of veterinary drugs 52 Unavailability or lack of veterinary drugs52 Prolonged drought 37.6 Prolonged drought37.6 Water scarcity 36.4 Water scarcity36.4 Weeds 7.8 Weeds7.8 Salinization 7.8 Salinization7.8 Infertility in cattle 7.8 Infertility in cattle7.8 Floods 5.2 Floods5.2 N 77 N77  "},{"text":"Table 7 . Indigenous knowledge based on animals  Name * Scientific name Behaviors related to the Percent of Name *Scientific nameBehaviors related to thePercent of   rainy season respondents rainy seasonrespondents    (n=77) (n=77) Baboons (Ngedere), monkeys Alouatta caraya-black Appearance of these wild 52.0 Baboons (Ngedere), monkeysAlouatta caraya-blackAppearance of these wild52.0 (Nyani), leopards (Chui) and monkeys, Panthera padus- animals in the village is a  (Nyani), leopards (Chui) andmonkeys, Panthera padus-animals in the village is a antelopes (Pofu) Leopard, Antilope sign of a good rainfall season  antelopes (Pofu)Leopard, Antilopesign of a good rainfall season  Cervicapra-antelopes ahead  Cervicapra-antelopesahead Sheep (Kondoo) Ovis aries Ear flapping by the sheep is 48.1 Sheep (Kondoo)Ovis ariesEar flapping by the sheep is48.1   an indication of onset and  an indication of onset and   prospects of a good season  prospects of a good season Goat (Mbuzi) Capra aegagrus hircus When goats flap their ears, 48.1 Goat (Mbuzi)Capra aegagrus hircusWhen goats flap their ears,48.1   it is an indication of rainfall  it is an indication of rainfall   onset  onset Cattle (Ng'ombe) Bos taurus Cattle flapping their ears 48.1 Cattle (Ng'ombe)Bos taurusCattle flapping their ears48.1   repeatedly is also indicates  repeatedly is also indicates   rainfall onset  rainfall onset  "},{"text":"Table 8 . Indigenous knowledge based on insects  Name * Scientific name Behavior related to the rainy season Percent of Name *Scientific nameBehavior related to the rainy seasonPercent of    respondents respondents    (n=77) (n=77) Army ants (Siafu) Eciton When ants occur in large numbers almost 88.3 Army ants (Siafu)EcitonWhen ants occur in large numbers almost88.3  burchellii, but everywhere even inside the houses and appear  burchellii, buteverywhere even inside the houses and appear  there are many to be celebrating is an indication of onset of  there are manyto be celebrating is an indication of onset of  species rains and mostly heavy rains during vuli (only  speciesrains and mostly heavy rains during vuli (only   about a week before onset)  about a week before onset) Insects (Vidododo)  Their presence on Albizia trees with water 87 Insects (Vidododo)Their presence on Albizia trees with water87   dripping from them is an indication of a good  dripping from them is an indication of a good   season (almost one month before rains start  season (almost one month before rains start   (vuli)  (vuli) Butterflies (Vipepeo) Papilio spp. Occurrence and migration of butterflies from the 80.5 Butterflies (Vipepeo)Papilio spp.Occurrence and migration of butterflies from the80.5  There are a south to the north is an indication of early onset  There are asouth to the north is an indication of early onset  great number of rains and also gives a prospect of a good  great numberof rains and also gives a prospect of a good  of this insects season. Specifically, black butterflies indicate a  of this insectsseason. Specifically, black butterflies indicate a  species prospect of a good season.  speciesprospect of a good season. Odenteterms/flying Reticulitermes Occurrence after strong sunshine indicates 70 Odenteterms/flyingReticulitermesOccurrence after strong sunshine indicates70 ants (Kumbikumbi) spp proper rains have started, sufficient for planting  ants (Kumbikumbi)sppproper rains have started, sufficient for planting   for vuli and masika (i.e. the soil has adequate  for vuli and masika (i.e. the soil has adequate   moisture)  moisture) Grasshoppers (Panzi) Melanoplus Appearance of green grasshoppers in large 67.5 Grasshoppers (Panzi)MelanoplusAppearance of green grasshoppers in large67.5  differentialis numbers in the fields indicate the onset of  differentialisnumbers in the fields indicate the onset of   rainfall especially vuli  rainfall especially vuli Frogs/african clawed Xenopus laevis. Frogs starting to make a lot of noise is an 46.8 Frogs/african clawedXenopus laevis.Frogs starting to make a lot of noise is an46.8 frog (Vyura) Various spp indication of rainfall onset and the louder the  frog (Vyura)Various sppindication of rainfall onset and the louder the   noises become it signifies a good season  noises become it signifies a good season Shelled Helix aspera. Occurrence of shelled snails in large numbers 41.6 ShelledHelix aspera.Occurrence of shelled snails in large numbers41.6 snails/Garden snail  especially at the time when they are not  snails/Garden snailespecially at the time when they are not (Kozwe/Konokono)  expected is an indicator of onset of vuli season  (Kozwe/Konokono)expected is an indicator of onset of vuli season   and a prospect of a good season  and a prospect of a good season Bees (Nyuki) Apis mellifera Bees appearing in big groups indicates masika 29.9 Bees (Nyuki)Apis melliferaBees appearing in big groups indicates masika29.9   rains are about to start  rains are about to start (Kokoo)  Kokoo carrying eggs indicates vuli rains 9.1 (Kokoo)Kokoo carrying eggs indicates vuli rains9.1 Thrips (Vifizi) Thysanoptera Vifizi insects surrounding wetland areas indicates 6.5 Thrips (Vifizi)ThysanopteraVifizi insects surrounding wetland areas indicates6.5  spp good rainy season  sppgood rainy season Locusts (Nzige) Spodoptera Presence of many armyworms is an indicator of 2.6 Locusts (Nzige)SpodopteraPresence of many armyworms is an indicator of2.6  exigua/ the long rains  exigua/the long rains  Spodoptera spp   Spodoptera spp Colobus monkey  Presence of many Colobus Monkeys in the fields 2.6 Colobus monkeyPresence of many Colobus Monkeys in the fields2.6 (Ndega)    (Ndega)  "},{"text":"Table 9 . Local knowledge based on plants  Name * Scientific name Sign used to relate to the rain Percent of Name *Scientific nameSign used to relate to the rainPercent of    respondents respondents    (n=77) (n=77) Datura (Mitura) Solanumincunum Abundant fruit production and dropping leaves 89.6 Datura (Mitura)SolanumincunumAbundant fruit production and dropping leaves89.6   of the Datura is an indication of rainfall onset.  of the Datura is an indication of rainfall onset.   But when they turn upside down it is an  But when they turn upside down it is an   indication that the season is going to be too  indication that the season is going to be too   cold and even destructive to crops.  cold and even destructive to crops. Albizia (Mishai) Albizia Appearance of insects locally known as 74 Albizia (Mishai)AlbiziaAppearance of insects locally known as74  gummifera vidododo on Albizia tree with water dripping  gummiferavidododo on Albizia tree with water dripping   from the trees during a dry season is an  from the trees during a dry season is an   indication of the coming of vuli rains  indication of the coming of vuli rains Pears and Prunus serotina Heavy flowering of fruit trees like pears and 57.0 Pears andPrunus serotinaHeavy flowering of fruit trees like pears and57.0 plums (Mapea  plums are a good indicator of rainy season  plums (Mapeaplums are a good indicator of rainy season na Mapulamu)    na Mapulamu) Pigeon pea Cajanuscajan If a pigeon pea plant produces a lot of flowers 19.5 Pigeon peaCajanuscajanIf a pigeon pea plant produces a lot of flowers19.5 (Mbaazi)  than normal is an indication of a good season  (Mbaazi)than normal is an indication of a good season Venonia Vernonia When this tree starts to produce flowers it is an 15.6 VenoniaVernoniaWhen this tree starts to produce flowers it is an15.6 (Tugutu) myriantha indication of early onset of rains  (Tugutu)myrianthaindication of early onset of rains Baobab/Fig Ficus cycomorus Flowering and generation of new leaves 7.8 Baobab/FigFicus cycomorusFlowering and generation of new leaves7.8 tree (Mkuyu)  indicates rainfall onset; and prospects of long  tree (Mkuyu)indicates rainfall onset; and prospects of long   the rains  the rains Loquarts Eryobotrya Mafyoksi having many flowers is a sign of rain 2.6 LoquartsEryobotryaMafyoksi having many flowers is a sign of rain2.6 (Mafyoksi) japonica onset and a good season  (Mafyoksi)japonicaonset and a good season Coffee Coffea arabica Flowering of coffee trees is an indication of the 2.6 CoffeeCoffea arabicaFlowering of coffee trees is an indication of the2.6 (Kahawa)  vuli rains  (Kahawa)vuli rains Avocado Percea americana Avocado trees appearing to have many buds and 2.6 AvocadoPercea americanaAvocado trees appearing to have many buds and2.6 (Vokado)  flowers are an indication of rains  (Vokado)flowers are an indication of rains  "},{"text":"Table 10 . Moon, sun and wind as local indicators  Sign Characteristics related to the rainy season Percent of SignCharacteristics related to the rainy seasonPercent of   respondents (n=77) respondents (n=77) North-south wind direction in Indicates onset of vuli or masika season and in most cases 15.6 North-south wind direction inIndicates onset of vuli or masika season and in most cases15.6 September and in late a sign of heavy rainfall. Frequent and persistent winds  September and in latea sign of heavy rainfall. Frequent and persistent winds February indicate that it will rain within one week. Wind blowing  Februaryindicate that it will rain within one week. Wind blowing  without drying vegetation and soil is also an indication of  without drying vegetation and soil is also an indication of  rains  rains Moon surrounded with heavy A sign of a good rainfall season 14.3 Moon surrounded with heavyA sign of a good rainfall season14.3 clouds   clouds Halo moon (yellowish ring An indication of onset for both vuli and masika seasons 5.2 Halo moon (yellowish ringAn indication of onset for both vuli and masika seasons5.2 around the moon   around the moon Slanted position of the moon An indicator of a bad season especially towards the 5.2 Slanted position of the moonAn indicator of a bad season especially towards the5.2 crescent slanted side  crescentslanted side Moon Appearance of the moon in a circular shape (normal) is 3.9 MoonAppearance of the moon in a circular shape (normal) is3.9  an indication of onset rainfall, while moon with different  an indication of onset rainfall, while moon with different  colors like rainbow indicates onset of vuli and masika  colors like rainbow indicates onset of vuli and masika  rains  rains Wind Strong winds 2.6 WindStrong winds2.6 Red moon Indicates onset of vuli rains 2.6 Red moonIndicates onset of vuli rains2.6 Sun Sun hitting without wind indicating rains 2.6 SunSun hitting without wind indicating rains2.6 White moon Indicates the onset of rain of masika season 2.6 White moonIndicates the onset of rain of masika season2.6  "},{"text":"Table 12 . Example of forecast for Yamba village  Date Forecast Indicators Review DateForecastIndicatorsReview 20-12-2011 Enough rainfall ₋ Occurence of army ants - 20-12-2011Enough rainfall₋ Occurence of army ants-  was expected ₋ Shemkoko bird was singing all the time  was expected₋ Shemkoko bird was singing all the time   ₋ Ducks were stretching wings and bathing in  ₋ Ducks were stretching wings and bathing in   the dust  the dust   ₋ Nyange (insects) were making noises  ₋ Nyange (insects) were making noises 31-12-2011 Rainfall ₋ Strong winds without direction The area 31-12-2011Rainfall₋ Strong winds without directionThe area  expected to ₋ Cold nights received expected to₋ Cold nightsreceived  decrease ₋ Vidododo insects are few in trees (mishai) ₋ Army ants are few enough rainfall as forecasted decrease₋ Vidododo insects are few in trees (mishai) ₋ Army ants are fewenough rainfall as forecasted  "}],"sieverID":"7c5eb9c9-39df-42e6-b906-5ae97d598d50","abstract":"Improving food security needs appropriate climate related risk management strategies. These include using climate information to guide farm level decision-making. Progress has been made in providing climate services in Tanzania but there are significant gaps with regard to downscaled location specific forecasts, as well as generating timely, reliable and user friendly information. Majority of the farmers have been using indigenous knowledge (IK) forecasts to predict weather through observing the behavior of large animals, birds, plants, insects, and the solar system. IK is not often documented and is mainly sustained from one generation to another through oral history and local expertise, creating a wide inter-generational gap between its custodians and the young people. This study identifies and documents existing IK in weather forecasting in Lushoto district, northern Tanzania, and aims at promoting the integration of IK and scientific weather forecasting for climate risk management. Historical rainfall data was used in combination with data collected through household surveys, focus group discussions and key informant interviews. Majority of the farmers (56%) indicated that weather forecasts using IK were more reliable and specific to their location compared to scientific forecasts. Comparison was made of the seasonal March-April-May (MAM) forecasts in 2012 from IK and Tanzania Meteorological Agency (TMA), with both approaches predicting a normal rainy season. The IK forecasts were, however, more reliable in the long rainy MAM season compared to the short rainy October-November-December season. To improve accuracy, systematic documentation of IK and establishment of a framework for integrating IK and TMA weather forecasting is needed. There is also a need to establish an information dissemination network and entrench weather forecasting within the District Agricultural Development Programmes."}

data/part_4/01f7003f49a50aaaac38557d443c8cad.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01f7003f49a50aaaac38557d443c8cad","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/023d82ea-d7e8-48ac-bda8-2c6f1cedec20/retrieve"},"pageCount":15,"title":"Simulating cocoa production: A review of modelling approaches and gaps","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":82,"text":"Cocoa (Theobroma cacao L.) is one of the most important agricultural commodity crops globally, produced by five to six million mostly smallscale farmers (World Cocoa Foundation, 2014), contributing to the livelihood of millions. In 2018-2019 global production was approximately 4.8 million tons (ICCO, 2021) most of which is produced in the humid tropics across West and Central Africa, Latin America and South East Asia (ICCO, 2021) in a variety of cropping systems that range from monocultural systems to highly diverse agroforestry systems."},{"index":2,"size":180,"text":"Increases in cocoa production over the past decades were mostly driven by expansion of cropped land, often at the expense of natural ecosystems and other crops (Ajagun et al., 2022), rather than increases in yield per unit land area (van Vliet and Giller, 2017). Cocoa cultivation is predominantly extensive and rainfed (Lahive et al., 2019) with average yields per hectare around 440-550 kg ha -1 of fermented dry beans across production regions (FAOSTAT, 2021). However, highyielding farms in Ghana for example, may achieve yields up to 2125 kg ha − 1 depending on climatic conditions (Abdulai et al., 2020). Reducing this yield gap could help improving the livelihoods of cocoa small-holder farmers (van Vliet et al., 2021) though the effect of increased cocoa supply on prices would need to be considered. At the same time, projected shifts in climate suitability for cocoa producing regions (Bunn et al., 2018;Läderach et al., 2013;Schroth et al., 2016), increase land use for food production and growing attention for deforestation-free certified cocoa (Cocoa and Forest Iinitiative, 2021) call for substantial improvement in per hectare yields."},{"index":3,"size":125,"text":"Multiple factors contribute to high yield gaps such as erratic precipitation patterns (Abdulai et al., 2020); limited availability of improved planting material from national breeding programs (Edwin and Masters, 2005), untreated pests and diseases (Asante et al., 2022;Opoku et al., 2000), low soil fertility and fertilizer input (Ali et al., 2018), low plant density (Asante et al., 2022), inadequate shading levels (Asare et al., 2017) and plantation ageing (Lachenaud and Montagnon, 2002;Mahrizal Nalley et al., 2014). With changing climate, predicted higher maximum temperatures and reduced water availability in dry seasons are also expected to become limiting for cocoa production in West Africa (Schroth et al., 2016), and most areas will be able to sustain production only if adaptation strategies are implemented (Bunn et al., 2018)."},{"index":4,"size":41,"text":"Designing strategies to reduce the current yield gaps and designing effective adaptation strategies to sustain future production require a quantification of the relative contributions of yield-limiting factors and a solid understanding of how cocoa responds to environmental conditions and management practices."},{"index":5,"size":102,"text":"Several steps have been taken in the quantification of the contribution of yield limiting factors, using yield gap analysis (Abdulai et al., 2020;Asante et al., 2022) and regression analysis (Asante et al., 2021). Yet, how cocoa trees respond to management practices and how best practices should be adapted to different climatic conditions and different cropping systems, remains largely unknown. For instance, cocoa nutrient requirements are still unclear and fertilizer recommendations vary greatly among producing countries (van Vliet and Giller, 2017). Reported pruning effects on cocoa yield are inconsistent and pruning recommendations are not tailored to different cocoa systems (Tosto et al., 2022)."},{"index":6,"size":108,"text":"How cocoa responds to changing climatic conditions remains uncertain. Black et al. (2020) suggested that the negative impact of higher temperature is (partly) compensated by the positive effects of higher atmospheric carbon dioxide concentration ([CO 2 ]) on photosynthesis. However, the long-term impact of elevated atmospheric [CO 2 ] and temperature on cocoa photosynthesis, transpiration and respiration, are not well understood. Nor is much known about how assimilate allocation may change under adverse conditions and how cocoa responses to various changing environmental factors will interact (Lahive et al., 2019). Finally, the genotypic potential of cocoa adaptation to climate change conditions is still largely unexplored (Lahive et al., 2021)."},{"index":7,"size":119,"text":"Cocoa agroforestry is considered a promising adaptation strategy to changing climatic conditions and a means to reduce the negative socioenvironmental impact of cocoa production (Niether et al., 2020). However, contrasting effects of shade on cocoa yield are reported in literature (Abdulai et al., 2017;Asare et al., 2018;Asare et al., 2017) and these effects can also vary with agroclimatic conditions (Asare et al., 2017;Clough et al., 2011). Such complexities hamper the formulation of recommendations on cocoa production within agroforestry systems. For instance, recommendations on managing the shade canopy, both in terms of planting design and pruning, are lacking. Finally, it is still uncertain how cocoa viability and productivity is affected by climate extremes in agroforestry systems (Abdulai et al., 2017)."},{"index":8,"size":173,"text":"Addressing those knowledge gap in cocoa production is challenging, as cocoa is a woody perennial with a multi-decade production cycle which means experiments for agronomic improvement or breeding are slow and expensive. Addressing these gaps for cocoa agroforestry systems presents even bigger challenges, due to their structural heterogeneity and large number ecological interactions within the system. This calls for the use of cocoa simulation models to complement and inform experimental and on-farm research. Cocoa simulation models can combine agro-ecological, physiological, and farming system knowledge with experimental and observational data to estimate cocoa yields, resource-use efficiency and ecosystem services such as carbon sequestration. They can be used as a virtual breeding tool, to develop hypotheses, to predict yields under current and future climate scenarios, to investigate spatio-temporal patterns of production at landscape to global level, or as decision-support tools for advising agronomic practices and aid the design of cocoa cropping systems. Despite this potential, modelling of cocoa growth and production has received less attention than other crops, including similar tropical perennials such as coffee."},{"index":9,"size":55,"text":"With this review we aim to: 1) explore how simulation models can aid in addressing some of the most important problems in cocoa production.2) provide an overview of the state of the art of existing cocoa models; and 3) identify the main knowledge gaps and technical bottlenecks that limit the further development of cocoa models."},{"index":10,"size":63,"text":"The focus of the review is on abiotic stresses (present and future climate condition) and associated management practices (planting design, nutrient management, irrigation and pruning). We do not address issues related to pest and disease management, even though they play a crucial role in cocoa production (Wessel and Quist-wessel, 2015) as the topic is too broad to be included in the present review."}]},{"head":"Model approaches for key questions in cocoa production","index":2,"paragraphs":[{"index":1,"size":116,"text":"Open questions and issues in the cocoa sectors can be classified along various dimensional axes: (i) a \"fundamental vs applied\" axis that goes from more fundamental questions of cocoa tree functioning to problems connected to cocoa field management and investment choices; (ii) a spatial scale axis, that refers to the level at which a problem needs to be analyzed and that goes from single trees to regional/global level; and (iii) a prediction horizon axis, that takes into consideration the temporal scale at which predictions need to be made, from daily predictions to predictions encompassing the whole life cycle of a plantation, or even multiple generations, as in breeding programs or studies on climatechange effects (Fig. 1)."},{"index":2,"size":102,"text":"Along these axes, the best suited modelling approach to address a given problem will change with the level of detail, complexity, biological understanding and predictive power that the problem requires, and it can include both explanatory and descriptive components (see Box 1), depending on the model purpose and available knowledge (Fig. 2). In this section we link these axis to the suggested model approaches expanding on Jones et al. (2016) to include organ-level and plant models (Louarn and Song, 2020;Medlyn, 2004) in order to set the criteria to evaluate the existing cocoa models, for which the description is given in Section 3."}]},{"head":"The fundamental vs applied axis","index":3,"paragraphs":[{"index":1,"size":42,"text":"Fundamental questions (Fig. 1), are related to underlying processes driving cocoa phenology or responses of cocoa trees to management or climate. Addressing these questions requires an explanatory modelling approach, with an emphasis on the interpretability and understanding of the relevant physiological mechanisms."},{"index":2,"size":62,"text":"More applied problems regarding strategic decisions on investments or management options, spanning from the application of pruning, fertilizer use and irrigation to system design, require the development of decision support systems (DSS). Large networks of experiments are needed to build robust empirical relations that describe crop responses to management practices. Alternatively, simplified expressions can be derived using metamodels of well-validated explanatory models."}]},{"head":"The spatial scale axis","index":4,"paragraphs":[{"index":1,"size":110,"text":"At the lower end of the spatial scale axis (Fig. 1) are questions related to environmental conditions and resource availability that are heterogeneously distributed within plants and their environment. To simulate environmental heterogeneity, a 3D modelling approach of organs or plants is needed. Functional-structural plant (FSP) modelling can be used to address problems that require an explicit representation of tree structure at organ level and an accurate representation of the environment within the canopy (Vos et al., 2010) as is the case for questions related to microclimate or pruning. Those models though also require detailed architectural data that are time consuming to obtain and generally scarce (Louarn and Song, 2020)."},{"index":2,"size":92,"text":"When detailed architectural data is not available, simpler plant-level models may be more useful to address questions such as the interaction between shade and cocoa trees in agroforestry systems. However, modelling heterogeneous light availability for understory crops is challenging and typically leads to overestimating photosynthesis (Rosati et al., 2020). Furthermore, for both organ and plant level models, improper scaling of photosynthesis from the leaf to canopy level and improper diurnal integration, can lead to an overestimation of carbon assimilation and light-use efficiency, due to the non-linear relationship between photosynthesis and environmental factors."},{"index":3,"size":99,"text":"If horizontal uniformity of key resources such as light, water, or nutrient availability, can be assumed at the stand level and the dynamic structure of the stand can be described in simple terms, 1D classical crop growth models that focus on physiological processes could be used. When linked to spatial climate and soil data, such crop models can be employed to generate regional or national yield maps under present and future climate scenarios serving as a starting point for yield gap analysis (van Ittersum et al., 2013) and to inform decisions on investment and adaptation strategies to climate change."}]},{"head":"The prediction horizon axis","index":5,"paragraphs":[{"index":1,"size":103,"text":"At the lower end of the prediction horizontal axis in Fig. 1, management decisions taken at daily or seasonal time scales (e.g., irrigation, fertilization) are included. To support such decisions a DSS able to capture the intra-annual pattern of growth and production should be used. On the contrary, problems that require predictions at a coarser temporal scale such as yield responses to climate change scenarios in near and far future require less accurate short-term predictions and Fig. 1. Main questions in cocoa production along the fundamental vs applied axes and the spatial scale axis. Classification along the prediction horizon axis is color coded."},{"index":2,"size":7,"text":"Box 1 a glossary of modelling approaches."}]},{"head":"Explanatory (sub)models:","index":6,"paragraphs":[{"index":1,"size":59,"text":"An output of the model is calculated as a function of underlying processes, such that it becomes an emerging pattern of the simulation (van Ittersum et al., 2003). These models allow making predictions across a wide range of conditions, as long as they include the causal links between the different processes and the environment (Yin and van Laar, 2005)."},{"index":2,"size":53,"text":"Descriptive or empirical (sub)models: An output of the model is described as a function of environment and crop traits by data-driven functions or metamodels (van Ittersum et al., 2003). Their applicability is limited to the set of conditions used to calibrate the model given the lack of causal relationships (Jones et al., 2016)."},{"index":3,"size":41,"text":"Interpretability: Interpretability of a model output refers to the extent that models can be understood and their output explained. Parameter interpretability refers to the extent to which a parameter has a clear meaning in a certain domain (e.g., biology, physics, etc.)."}]},{"head":"Decision support system (DSS):","index":7,"paragraphs":[{"index":1,"size":84,"text":"A model of the system built with the purpose of supporting decision making at the tactical and strategic level by the different stakeholders. The model should include the outputs and management practices of interest and have well-calibrated predictions at a local level (Jones et al., 2016). Optimal decision making also requires the DSS to provide uncertainty of predictions (Keith and Ahner, 2021). The development of DSSs should be driven by user needs and the interface design should be user friendly (Antle et al., 2017)."},{"index":2,"size":21,"text":"Metamodels: Data-driven approximations to explanatory models consisting of multiple regressions or other algorithms linking input variables (e.g., climate) to model output."},{"index":3,"size":15,"text":"Models can be classified in terms of the level at which a system is represented:"},{"index":4,"size":78,"text":"Organ-level models: Models that simulate plant structure at a sub-plant level (i.e., organ, axis, growth unit) specifying how different organs are positioned and oriented in space (plant architecture), how they are connected (topology), and, when included, how their emergence and expansion is coordinated over time (development). This is typically done in functional-structural plant (FSP) models. Thus, processes at the plant and plot levels are emergent properties of the interactions among individual sub-plant level entities (Louarn and Song, 2020)."},{"index":5,"size":66,"text":"Plant-level models: Individual plants are simulated explicitly and represented by coarse geometries such as simplified crown shapes (e.g., ellipsoids, cones) or collections of voxels (le Roux et al., 2001). Within each crown, profiles of leaf area density, nitrogen concentration and leaf orientation are used to describe vertical pattern of within crown variability. Processes at the plot level are emergent properties of the interactions among individual plants."},{"index":6,"size":148,"text":"Crop-stand level models: These models do not represent individual plants or organs and most processes are either described at the stand level, or they are scaled from the organ to the stand-level using profiles and simplifying assumptions about structure (van Ittersum et al., 2003). These models are also known as process-based models or crop models and for simplicity we use the latter term hereafter. Fig. 2. Visualization of how existing cocoa models can be placed within the axes frameworks. Relevant example for other systems are given. The left vertical axes refer to the level at which the models make predictions, which coincides with the level at which questions can be addressed with those models. The right vertical axis refers instead to the level at which processes are described within the models. The prediction horizon axis is not added as model outcomes can be relevant at various time scale."},{"index":7,"size":89,"text":"allow for a higher level of abstraction. At the upper end of the prediction horizon axis, are decisions that need to be made during the establishment phase of a cocoa field (e.g., planting density and design, formation pruning). To assess the impact of those early decisions, it is necessary to simulate the system over multiple years. However, most models of perennial systems do not simulate early phases of tree development since it is difficult to accurately capture the rapid changes in tree characteristics that occur during the juvenile stage."}]},{"head":"An overview of existing cocoa models","index":8,"paragraphs":[{"index":1,"size":36,"text":"In this section we present the existing models of cocoa systems that comply with our selection criteria as described below, highlighting which questions those models can address and their main limitations. An overview is given in."},{"index":2,"size":152,"text":"Table 1. We gathered published cocoa models in the Web of Science by searching with the keyword combination ((cacao OR cocoa OR Theobroma) AND model*). Where the asterisk (*) extends the search to words derived from \"model\" (e.g. models or modelling). We then selected only models that focus on cocoa structure, biomass production and yield, thus excluding models that focus on ecosystem services (for example Middendorp et al., 2018). We also only focused on abiotic environmental factors such as climate, water and nutrients, while models focusing on the effects of pests and diseases were not taken into account. Finally, we did not take models into consideration that simulate only part of the crop (e.g., pod development models, ten Hoopen et al., 2012), and prediction models mostly used for economic analyses based on time series of national or regional average yield (Ajetomobi and Olaleye, 2019) that do not include any underlying biological processes."}]},{"head":"A rubber-cocoa bioeconomic model","index":9,"paragraphs":[{"index":1,"size":63,"text":"A first attempt to model a cocoa system was published by Wojtkowski et al. (1991) who developed a DSS for a rubber-cocoa intercropping system to support management decisions (planting density, thinning and fertilization) for a mature system (no early development), that would result in the highest profitability over the production cycle. Yield is estimated empirically as a function of shade, tree age, planting"}]},{"head":"Table 1","index":10,"paragraphs":[{"index":1,"size":5,"text":"Overview of existing cocoa models."}]},{"head":"Model description","index":11,"paragraphs":[{"index":1,"size":6,"text":"Output type Spatial scale Time scale"}]},{"head":"Main applications and limitations Reference","index":12,"paragraphs":[{"index":1,"size":3,"text":"Cocoa-rubber agroforestry system"},{"index":2,"size":24,"text":"Descriptive bioeconomic model of cocoa and rubber production, based on empirical equations that relate cocoa (and rubber) yield to fertilizer input and tree age."}]},{"head":"Attainable yield /profit Crop level Annual","index":13,"paragraphs":[{"index":1,"size":21,"text":"Applications: assess fertilizer application and thinning impact on system profitability. Limitations: rubber-cocoa system only, application to other locations require full recalibration."}]},{"head":"Wojtkowski et al. (1991)","index":14,"paragraphs":[]},{"head":"WaNuLCAS","index":15,"paragraphs":[{"index":1,"size":28,"text":"Stand-level model of tree-soil-crop interactions. It uses a radiation use efficiency approach and requires input from specific crop models. It allows for water, nitrogen and potassium stress simulation."}]},{"head":"Attainable yield Crop level Daily","index":16,"paragraphs":[{"index":1,"size":88,"text":"Applications: Explore design of agroforestry systems, investigate role of (belowground) interactions, estimate yield (for calibrated crops and trees). Limitation: Not fully calibrated for cocoa, so not suitable for quantitative estimation. Some parameters are difficult to estimate (RUE, lag time of recovery after disturbances). density and fertilizer availability, with calibration based on literature and expert knowledge. Due to its empirical nature, this model would need to be calibrated for each fertilizer and soil type, and for different water availability (Meyer et al., 2020) and varieties (Edwin and Masters, 2005)."}]},{"head":"WaNuLCAS","index":17,"paragraphs":[{"index":1,"size":89,"text":"WaNuLCAS is a generic stand-level model of tree-soil-crop interactions that allows for the simulation of multiple species of trees and annual crops in a range of spatial configurations (van Noordwijk et al., 2011;van Noordwijk and Lusiana, 1999). The model includes the effects of water and nitrogen availability, via the application of stress factors on potential daily growth. Management options such as tree pruning can also be simulated. Several model parameters, such as radiation-and water-use efficiency and lag time of recovery after disturbances are difficult to estimate for tree species."},{"index":2,"size":74,"text":"The model focuses mostly on below-ground interactions so it is less suitable to address detailed questions regarding light interception or canopy microclimate. WaNuLCAS has been applied to simulate an oil palm-cocoa-black pepper agroforestry system (Khasanah et al., 2020) but it focused on oil palm yield and cocoa trees were simulated using the generic routines for trees with minimal calibration. Using WaNuLCAS with cocoa as target species would therefore require further model development and calibration."}]},{"head":"A 3D model of a coconut-cocoa agroforestry system","index":18,"paragraphs":[{"index":1,"size":240,"text":"Mialet-Serra et al. ( 2001) developed an organ-level model of a coconut-cocoa agroforestry system with an emphasis on light distribution within the canopy. The individual trees are described based on detailed architectural descriptions of coconut and cocoa plants following the AMAP approach (de Reffye et al., 1995). The use of this model is limited by the fact that it only applies to juvenile cocoa trees, it does not include any physiological processes and it does not simulate growth. Also, as highlighted in Section 2.2, a plant-level model may be preferred if the intention is to simulate other shade tree species than coconut due to the general lack of detailed architectural data for tree species. Zuidema et al. (2005) developed CASE2, a crop model based on the SUCROS2 model (Laar et al., 1997). It simulates cocoa growth and yield from processes including light interception, evapotranspiration, water uptake, photosynthesis, respiration and allocation of assimilates, and it captures the effect of climatic conditions such as solar radiation, temperature, humidity and precipitation. A shade canopy layer can be simulated which competes with the cocoa canopy for light but not for below-ground resources nor does it influence microclimate conditions. The study by Zuidema et al. (2005) provides examples of model applications to address questions related to drivers of cocoa yield and their relative importance, to compute potential and water-limited potential yields for different pedo-climatic conditions and to investigate the effect of shade on cocoa production."}]},{"head":"CASE2: A crop model for cocoa production","index":19,"paragraphs":[{"index":1,"size":205,"text":"The model has several limitations: (1) nutrient dynamics and effects on yield are not included; (2) the assumption of a uniform canopy prevents its application to juvenile stages as well as sparse or heterogeneous shade canopies of present in e.g. agroforestry systems; (3) some physiological processes are not based on cocoa-specific knowledge (see Section 4.1.1). The model has been applied to estimate potential and waterlimited yields in Malaysia (Zabawi and Gerritsma, 2009) and Ghana (Asante et al., 2022) and to estimate yield responses to shade (Clough et al., 2011). It has been widely cited in cocoa literature as it provides the only available general estimate of potential yield for cocoa and broad indications of cocoa yield drivers. Wilson et al. (2019) developed a Delayed Differential Equation model (DDE) of cocoa production, linking flowering to interannual precipitation patterns and predicting pod production based on a fixed fruit-to-flower ratio, though this assumption may be too simplistic (see Section 4.1.4). The model is presented as a preliminary study providing a simple approach that could be expanded to add other environmental factors and management practices. The aim was to develop a tool that generates accurate inter-annual yield predictions and provides improved insights for on-farm management effects on annual yields."}]},{"head":"A delayed differential equation model of cocoa production","index":20,"paragraphs":[]},{"head":"Simulation of climate change on cocoa net primary productivity","index":21,"paragraphs":[{"index":1,"size":68,"text":"Black et al. ( 2020) investigated the potential effects of climate change on cocoa primary productivity (but not yield) in West Africa, using a process-based land-surface model (JULES) driven by a climate model. The model was calibrated with leaf-level photosynthesis measurements on young cocoa plants in a greenhouse experiment emulating climate change conditions, whereas other processes relied on generic values from tropical broadleaf plants (Harper et al., 2016)."}]},{"head":"Gaps in cocoa modelling","index":22,"paragraphs":[{"index":1,"size":94,"text":"Knowledge gaps in modelling cocoa systems are identified by comparing current published cocoa models (Section 3) against the framework of modelling concepts presented in Section 2. Gaps are presented according to whether they relate to physiological processes (Section 4.1), tree and stand structural characteristics (Section 4.2) or management (Section 4.3). When available, relevant modelling examples from similar systems such as coffee or mango that could potentially be adapted to cocoa are presented. We also provide indications of the availability of data for model development and calibration. A summary of our findings is presented in."},{"index":2,"size":2,"text":"Table 2."}]},{"head":"Gaps in modelling physiological processes","index":23,"paragraphs":[{"index":1,"size":94,"text":"In this section we present the main gaps in how physiological processes are represented in current cocoa models, with emphasis on water relations, maintenance respiration, and climate change responses. Capturing the response of these physiological processes to the abiotic environment is needed e.g., to understand the main drivers of cocoa production, perform yield gap analyses and to address questions regarding future production of cocoa under changing climatic conditions. We also discuss how the effect of nutrients on cocoa physiology could be incorporated, as well as phenological processes such as flushing, flowering and pod abortion."}]},{"head":"The effects of water stress","index":24,"paragraphs":[{"index":1,"size":104,"text":"Water availability has been shown to be an important driver of cocoa yield (Abdulai et al., 2020) and severity of water deficit stress may increase with climate change (Läderach et al., 2013). Thus, to predict cocoa yields under current and future climate (Fig. 1), there is a need to accurately capture the physiological effects of water availability in cocoa models. Currently, in CASE2 water availability influences photosynthesis, assimilate allocation, and leaf senescence while in the JULES model water availability has an influence on photosynthesis only. In both models, net daily assimilation is multiplied by a water stress factor that depends on soil water content."},{"index":2,"size":242,"text":"To capture the response of cocoa to simultaneous changes in temperature, evaporative demand and precipitation, a model should couple photosynthesis and stomatal conductance. In JULES, photosynthesis is coupled to a VPD-sensitive stomatal conductance model, but no coupling exists in CASE2. However, other factors are also known to influence stomatal conductance, such as radiation and CO 2 concentration  (Taylor, 1988) Reserve accumulationflushing cycle relation Machado and Hardwick (1988); Taylor (1988) Flowering mostly not included Data on fruit: flower ratio -  (Hikosaka et al., 2016). Soil-plant-atmosphere continuum (SPAC) models integrate all of these factors and use the concept of leaf water potential to also couple water supply from roots to leaves with evaporative demand (Tuzet et al., 2003). Developing a SPAC model for cocoa requires information on the relation between photosynthesis and stomatal conductance under a wide range of environmental conditions, as well as information on the relation between soil and leaf water potentials. Relationships between photosynthesis and stomatal conductance have been investigated under field and greenhouse conditions under different water availability levels (Araque et al., 2012;Ávila-Lovera et al., 2016;Rada et al., 2005;Tezara et al., 2020), shade levels ( Ávila-Lovera et al., 2021;Salazar et al., 2018;Suárez et al., 2021b), a combination of the two (Acheampong et al., 2015;Acheampong et al., 2013) and in response to air evaporative demand (Baligar et al., 2008;Della Sala et al., 2021), while the relation between leaf and soil water potential has received substantially less attention (Jiménez-Pérez et al., 2019)."},{"index":3,"size":168,"text":"Water availability may also affect allocation of assimilates. This is captured only by CASE2 that increases allocation to fine roots as water availability decreases, though using a generic relation. In general, the mechanisms behind assimilate partitioning to various organs are poorly understood, preventing the development of explanatory models for these processes (Poorter et al., 2012). Empirical rules may be used, but this requires quantifying the dynamics of assimilate allocation under stress, yet relevant studies are rare for cocoa (Moser et al., 2010;Schwendenmann et al., 2010). Measuring root turnover in response to water limitation could also provide insights on changes in allocation to the root system, but dedicated studies in cocoa systems are lacking. Alternatively, some models (e.g., GECROS, Yin and van Laar, 2005), currently mainly used for annual crops, have successfully made use of the functional-equilibrium theory, stating that plants tune the relative allocation to root and shoot to maximize relative carbon gain and these models therefore do not require species-specific calibration (Charlesedwards, 1976;Yin and van Laar, 2005)."},{"index":4,"size":64,"text":"Finally, CASE2 also assumes a reduction in leaf lifespan with decreasing water availability but it relies on an untested linear relationship between the two. However, studies on the effect of water availability on leaf lifespan in cocoa are missing. This relation could potentially be derived from the analysis of litterfall dynamics in cocoa systems (Mohammed et al., 2015;Moser et al., 2010;Schwendenmann et al., 2010)."}]},{"head":"Climate change responses in the JULES model","index":25,"paragraphs":[{"index":1,"size":117,"text":"Predicting future cocoa production (Fig. 1) requires a solid understanding of how cocoa physiological processes will be affected by changing climatic conditions. Cocoa responses to elevated atmospheric [CO 2 ] have been studied under greenhouse conditions in seedlings (Baligar et al., 2021;Black et al., 2020;Lahive et al., 2018) and juvenile plants (Lahive et al., 2021) but long-term free-air [CO 2 ] experiments on cocoa under field conditions are missing. Black et al. (2020) used the results from these greenhouse experiments to simulate cocoa biomass production under climate change. However, plants in free-air CO 2 enrichment (FACE) experiments have consistently shown lower photosynthetic stimulation under high CO 2 conditions than plants in greenhouse experiments (Long et al., 2006)."},{"index":2,"size":120,"text":"In the absence of long-term experiments some assumptions had to be made by Black et al. (2020). Long-term exposure to elevated [CO 2 ] was assumed not to result in photosynthetic down-regulation (i.e., the decline over time of the initial positive stimulation of photosynthetic activity, Dusenge et al., 2019) assuming the same response observed in coffee under a long-term FACE experiment (da Matta et al., 2019;Ghini et al., 2015). However, down-regulation of photosynthesis may increase with nutrient limitation (Dusenge et al., 2019), which is common in cocoa systems, especially in extensive small holder farms (van Vliet and Giller, 2017). More knowledge of the long-term effects of elevated [CO 2 ] on photosynthesis of cocoa under field conditions is thus needed."},{"index":3,"size":59,"text":"Additionally, while many crop models, including CASE2 and JULES, assume an exponential increase in respiration with temperature, more or less doubling every 10 • C, extensive evidence shows that plants acclimate to higher temperature by downregulating respiratory processes. The degree of acclimation varies between species (Slot and Kitajima, 2015) and no information on this is currently available for cocoa."},{"index":4,"size":106,"text":"Finally optimal temperature of photosynthesis under elevated atmospheric [CO 2 ] was predicted to increase in the Black et al. (2020) study, partially offsetting the negative effect of projected higher temperature. This is a common property of models that make use of a Farquhar type model for photosynthesis (Collatz et al., 1991;Farquhar et al., 1980) and a response observed in many species (Dusenge et al., 2019). However, since the temperature range that cocoa can tolerate is not well known, and since it seems to vary among different genotypes (Lahive et al., 2019) the mitigating effect of increased optimal temperature may vary depending on the cocoa variety."}]},{"head":"Modelling the effect of nutrient availability on cocoa functioning","index":26,"paragraphs":[{"index":1,"size":89,"text":"The integration of nutrient responses in a cocoa model would allow to address practical questions on fertilizer requirements as well as more fundamental questions on how nutrient availability mediates the responses to other stress factors (Fig. 1). Currently, cocoa responses to nutrient availability are included in the work of Wojtkowski et al. (1991), but as previously stated, the purely empirical nature of this model limits a more general use. WaNuLCAS allows for the simulation of the effect of nitrogen availability, but the relevant equations are not calibrated for cocoa."},{"index":2,"size":121,"text":"Modelling plant responses to nutrient availability is challenging due to the complex and simultaneous effects that nutrients have on several plant processes (Lambers et al., 2008). For this reason, crop models have relied on extensive experimental trials to determine empirical relations between nutrient availability, yield and plant functioning. The QUEFTS model, for example, simulates the simultaneous effect of the macronutrients nitrogen, phosphorus and potassium on crop yield (Sattari et al., 2014) and has been applied to assess nutrient demand for target yields of annual crops in tropical areas (e.g., Ezui et al., 2017;Shehu et al., 2019). Similar to WaNuLCAS, the CAF2007 model (van Oijen et al., 2010a) describes the effect of nitrogen limitation on coffee growth and production, using empirical relations."},{"index":3,"size":121,"text":"The effect of nitrogen limitation on plant processes is far better understood than the effect of phosphorus and potassium and a more explanatory approach to model nitrogen-related processes is presented in the GECROS model (Yin and van Laar, 2005). However this model includes the prioritization of nitrogen partitioning toward reproductive organs, typically observed in annual crops (Sinclair and de Wit, 1975) for which GECROS was designed. This mechanism may not directly apply to shade-tolerant woody perennials, such as cocoa, that have probably been naturally selected to favour survival over reproductive effort, especially under stress conditions (Anten et al., 2003). Hence, increasing N availability may not necessarily have the same short-term stimulatory effects on yields as it does in many annual crops."},{"index":4,"size":69,"text":"In cocoa, yield responses to fertilizer application are poorly understood and have been found to vary greatly between region, plots and even individual trees within a field (van Vliet and Giller, 2017). A promising development in this direction is the CocoaSoils project (report), a large-scale and long-term network of on-farm and on-station experiments of cocoa responses to fertilizer applications that have been set up in all major cocoa-producing regions."},{"index":5,"size":87,"text":"Mechanisms behind cocoa responses to nutrients are also poorly understood. The effect of N availability on cocoa has been investigated in terms of growth (Souza Júnior and Carmello, 2009), relative growth rate (Baligar and Fageria, 2017), nitrogen-use efficiency (Ribeiro et al., 2008) and gas exchange (Acheampong et al., 2015;Costa et al., 2001) exclusively in potted seedling or juvenile plants. Fewer studies have investigated the effect of potassium availability on cocoa (Anokye et al., 2021;Djan et al., 2017), while studies on the effect of phosphorous availability are lacking."}]},{"head":"Modelling cocoa phenology: Flushing, flowering and pod abortion","index":27,"paragraphs":[{"index":1,"size":50,"text":"In order to understand how seasonal variability in climatic condition ultimately influences cocoa production and to enable short term intraannual yield prediction (Fig. 1), processes related to cocoa phenology, such as flushing, flowering and pod abortion, need to be modeled. Those processes though are largely missing in existing cocoa models."},{"index":2,"size":160,"text":"As for flushing, all reviewed cocoa models assume a continuous production of vegetative biomass. However, in cocoa new leaves and branches are produced in rhythmic episodes, called flushes, followed by a dormant phase (Greathouse et al., 1971). Allocation to vegetative organs and internal competition for resources vary greatly between flushing and non-flushing periods. However, such fluctuations and their potential effect on pod abortion and development are not accounted for in current models. Including flushing in cocoa models would require an improved understanding of drivers of flushing activities. Several hypotheses have been proposed but no consensus has been reached so far, and the topic has attracted little to no attention in recent years. The proposed hypotheses span from endogenous hormonal regulation of flushing cycles (Orchard et al., 1980) also in combination with environmental cues (Greenwood and Posnette, 1950), to temperature and precipitation dependency (Almeida et al., 1987) and to cycles driven by accumulation of assimilate reserves (Machado and Hardwick, 1988;Taylor, 1988)."},{"index":3,"size":114,"text":"Whereas flowering is explicitly incorporated in the model by Wilson et al. (2019), estimating flower abundance is difficult and prone to have a large degree of uncertainty. Flowering in cocoa is in fact abundant (Niemenak et al., 2009), continuous (Waldburger et al., 2019) and flowers have a very short life span (Aneja et al., 1999). Some studies report on seasonal flower production on the trunk and on small sections of the canopy (Adjaloo et al., 2012;Omolaja et al., 2011;Tosto et al., 2022) but not for the entire tree. It is important to mention that the often-reported fruit:flower ratio of 0.5% to 5% (Aneja et al., 1999;Toxopeus, 1985) cannot be traced back to experimental results."},{"index":4,"size":92,"text":"Pod abortion in cocoa (also referred to as cherelle wilting) is considered an important determinant of yield and regulates the tree sink demand in response to available assimilates (Valle et al., 1990). Developing pods can be aborted up to the moment they reach 10-15 cm in length and the number of aborted pods can be high, especially during a period of intense vegetative activity (Waldburger et al., 2019). This may result in a loss of assimilates and nutrients allocated to pods, which is not included in any of the current cocoa models."},{"index":5,"size":31,"text":"Finally, it is worth mentioning that the CASE2 model simulates the seasonal fluctuation in pod production using a box cars approach. This part of the model, however, has not been validated."}]},{"head":"Modelling tree and stand structural characteristics","index":28,"paragraphs":[{"index":1,"size":164,"text":"Many questions regarding the design and management of a cocoa cropping systems (Fig. 1), especially in the case of systems with heterogenous shade canopy, like diverse agroforestry systems, require models at plant and organ levels (see Fig. 2 and Box 1). Those models in fact allow addressing questions at a higher spatial resolution, regarding the responses to environmental factors that may vary within a stand (e.g light, water availability, microclimate). Existing cocoa models are at present stage not sufficient. WaNuLCAS has the potential to address questions regarding belowground competition for resources, but it is less suitable to address issues on aboveground processes. The organ-level model of cocoa developed by Mialet-Serra et al. ( 2001) is very limited in its possible application and no plant-level model has been developed yet for cocoa. In this section we therefore explore how existing approaches to organ-level (FSP) and plant-level models could be applied to optimize cocoa architecture and improve the design and management of cocoa diverse cropping systems."}]},{"head":"Modelling tree architectural development","index":29,"paragraphs":[{"index":1,"size":78,"text":"There are at least two key issues FSP models of cocoa could address: 1) ideotyping cocoa architecture for different cropping systems to guide breeding programmes, and 2) understanding how tree structure and its management (e.g., pruning) influence tree performance and production (see also Section 4.3.3). No attempts have been done to develop and apply cocoa models in these directions, and to this end, the existing 3D cocoa model described earlier (Mialet-Serra et al., 2001) could be further extended."},{"index":2,"size":112,"text":"The work of Perez et al. (2018Perez et al. ( , 2020) ) is an interesting example of using FSP models for ideotyping in oil palm. Using a previouslydeveloped static FSP model of oil palm, a set of oil palm ideotypes were presented based on a sensitivity analysis on palm leaf traits. Plastic responses of leaf traits in relation to density were also added to improve the model applicability to different planting designs. Density-dependent allometric relations for leaf geometry and biomass were based on data extracted from LIDAR scans, an approach that could drastically reduce the need for time-consuming manual architectural measurements. However, examples of LIDAR technology applications to cocoa are missing."},{"index":3,"size":125,"text":"Understanding how tree structure and its management (e.g., pruning) influence tree performance and production requires a modelling approach that combines an explicit representation of cocoa architecture with the simulation of tree development and growth driven by environmental factors and resources. In contrast to annual crops (Gu et al., 2018), dynamic FSP models for tropical perennials are scarce. Recently, in mango trees, the complex interplay between the phenology of vegetative and reproductive branches was studied with V-Mango, a dynamic FSP model (Boudon et al., 2020). V-mango was based on extensive observations of mango organ sizes in well-defined developmental stages in vegetative and reproductive branches (Dambreville et al., 2015), and on time series of organ appearances (Dambreville et al., 2013). However, analogous studies on cocoa are missing."}]},{"head":"Example of modelling stand structure","index":30,"paragraphs":[{"index":1,"size":77,"text":"Plant-level models have been extensively used as a tool to investigate the contribution of stand structural characteristics (e.g., spacing, planting design, crown characteristics) on availability and utilization of resources such as light and water and on stand microclimate (le Roux et al., 2001;Medlyn, 2004;Pretzsch et al., 2015). We describe here the MAESTRA model, a widely used 3D plant model, and some of the models derived from it that have been applied in the context of coffee agroforestry."},{"index":2,"size":160,"text":"MAESTRA calculates the light interception of individual trees that are represented using geometric primitives (Medlyn, 2004) with speciesspecific values for the leaf area index (LAI), the leaf angle distribution and the leaf area density (LAD) profiles. Charbonnier et al. (2013) parameterized MAESTRA to represent a two-layer coffee agroforestry system able to analyze intra-plot light distribution. Duursma and Medlyn (2012) developed MAESPA by integrating MAESTRA with a soil-plant-atmosphere continuum model to simulate the effect of water availability on transpiration and photosynthesis. MAESPA was further extended to calculate evapotranspiration, air temperature and vapour pressure for different canopy layers (Vezy et al., 2018) and used to simulate coffee agroforestry systems. However, MAESPA is computationally demanding. To reduce simulation time, Vezy et al. (2020) developed DynACof, a crop-level explanatory model of coffee agroforestry systems, integrating two existing crop-level coffee models (Rodríguez et al., 2011;van Oijen et al., 2010a) with metamodels derived from the MAESPA model to account for the spatial heterogeneity of the systems."},{"index":3,"size":182,"text":"Similar approaches could be applied to model cocoa agroforestry systems. However there is limited data available to calibrate and validate MAESTRA or MAESPA for cocoa agroforests. For model calibration, we found various studies reporting LAIs of different cocoa systems (Daymond et al., 2002;Leiva-Rojas et al., 2019;Miyaji et al., 1997b;Moser et al., 2010), one study describing leaf area density profile (Miyaji et al., 1997a) but no studies assessing cocoa leaf angle distribution. Data on the characteristics of common shade trees in coffee agroforestry are reviewed by (van Oijen et al., 2010b) and several of those species are used also in cocoa agroforestry. However availability of shade tree data is overall scarce. For model validation we found a few studies reporting detailed measurement of light interception (Miyaji et al., 1997b;Tosto et al., 2022); several studies providing information on the effect of different shade levels and shade tree species on the microclimate of cocoa agroforestry systems (Abdulai et al., 2017;Acheampong et al., 2015;Jiménez-Pérez et al., 2019;Köhler et al., 2014;Suárez et al., 2021a) and one eddy-covariance study on a full-sun cocoa monoculture (Falk et al., 2005)."}]},{"head":"Gaps in modelling effects of crop agronomic practices","index":31,"paragraphs":[{"index":1,"size":137,"text":"Decision support systems (DSSs) to guide common management practices such as fertilization, irrigation and pruning are missing for cocoa (Fig. 1 and 2). DSSs need to be applicable at the farm level and thus require site-specific calibration and validation. DSSs therefore tend to follow a more descriptive approach, and management responses are often captured in the model as empirical functions modifying traits such as the radiation-use efficiency (RUE) or allocation to leaf area of the crop. In DSSs, the use of RUE is an important simplifying step but has so far mostly been used in annual crops. In this section, the main limitations to the use of RUE in cocoa systems are presented, followed by a discussion on the implementation of the main cocoa agronomic maintenance practices such as irrigation, fertilization and pruning in future cocoa models."}]},{"head":"Modelling radiation-use efficiency in tree crops","index":32,"paragraphs":[{"index":1,"size":147,"text":"Radiation-use efficiency (RUE) is a widely used empirical parameter in crop and forest modelling, that linearly relates solar radiation to biomass production (Monteith, 1977). Unlike annual crops where the production cycle is constrained to less than a year, estimating RUE for trees and tree crops, like cocoa, is less straightforward and different methodologies have been suggested. RUE can be calculated via destructive harvesting, as in annual crops, but requires sampling over multiple years and is time consuming (Villalobos et al., 2006). Nondestructive techniques have also been suggested such as tree allometry, remote sensing, eddy covariance and hemispherical photographs but these different methods appear to be inconsistent in regard to their estimates of RUE (Krupková et al., 2017). Also, the latter three techniques are difficult to apply in cocoa agroforestry systems as the scale at which they measure often does not allow distinction between cocoa and shade trees."},{"index":2,"size":49,"text":"RUE is known to vary with several factors, many of which are relevant to cocoa cultivation, such as proportion of diffuse light (Healey et al., 1998) and light intensity pattern (Rosati et al., 2020); water availability (Garbulsky et al., 2010); nutrient availability; and tree size (Collalti et al., 2020)."},{"index":3,"size":120,"text":"Only one estimate of RUE for cocoa has been published (Regazzoni et al., 2015) using destructive harvesting. As for non-destructive methods, some allometric models for aboveground and belowground biomass of cocoa have been developed (Borden et al., 2019) but their applicability may be limited only to systems with shade levels and management practices similar to the ones where the models have been developed. We are not aware of studies that have applied other nondestructive methods to follow cocoa biomass in the field over time. To develop a DSS for cocoa based on RUE with wide applicability, a network of on-farm experiments would be required encompassing a wide range of different tree sizes, levels and types of shade and climatic conditions."}]},{"head":"Modelling irrigation and fertilization practices","index":33,"paragraphs":[{"index":1,"size":44,"text":"To provide recommendations on irrigation and fertilization at farmlevel (Fig. 1), a cocoa DSS model needs to include cocoa responses to both water and nutrient availability as well as an accurate representation of the dynamics of the water and nutrient pools in the soil."},{"index":2,"size":109,"text":"The development of empirical functions to simulate the effect of water shortage on cocoa RUE would require data from irrigation experiments. In the review by (Carr and Lockwood, 2011) various irrigation experiments with often inconclusive outcomes were reported, due to problems of experimental design. More recently, other studies investigated the impact of irrigation (also in combination with fertilization) on seedling growth (Acheampong et al., 2019;da Silva Almeida et al., 2012;Posse et al., 2020) and yield (da Silva Almeida et al., 2014;Meneses-Buitrago et al., 2019), but studies relating water availability to RUE in adult plants are missing. The development of empirical relations for nutrient availability is discussed in Section 4.1.3."},{"index":3,"size":111,"text":"Regarding the soil component, a relevant and widely used example is given by the DAYCENT model (Parton et al., 1998) with a soil organic matter submodule that calculates the flow of C, N, P and S through plant litter and different inorganic and organic pools in the soils. Simulation of irrigation would require a soil module that allows for partial wetting of soil, especially in the case of drip irrigation, such as the model by Bonachela et al. (2001) that calculates soil evaporation on a partially wet soil, and the model by López-Bernal et al. (2018) that simulates a separate water balance for the irrigated and non-irrigated sections of the soil."}]},{"head":"Modelling pruning practice","index":34,"paragraphs":[{"index":1,"size":121,"text":"As discussed in Section 4.2.1, a dynamic FSP model could be used to analyze the effects of pruning on cocoa carbon dynamics and to optimize pruning practices (Fig. 1). FSP models have been applied to study the instantaneous effect that pruning has on plant functioning due to removal of leaf area, biomass and stored reserves in some horticultural crops. For example, Lescourret et al. (2011) developed QualiTree, a generic 3D fruit model that simulates the effect of branch removal and fruit thinning on fruit quality characteristics (fruit biomass, dry matter content, sugar concentration). A more recent example is given by the work of Bahr et al. (2021) that studied the effect of intensity and timing of leaf removal in grapevine cultivation."},{"index":2,"size":149,"text":"To understand the long-term effect of pruning practices on plant structure and function, pruning induced changes in branching patterns would need to be included in a FSP model, but no published examples were found. Such a model would require a detailed account of pruning responses as done in the work by Fumey et al. (2011aFumey et al. ( , 2011b) ) that described changes in branching patterns in response to pruning in apple trees, or the work by Persello et al. (2019) that described the structural and temporal responses to different levels of pruning intensity in mango trees. Those studies however did not take the effect of heterogeneous light availability (that varies vertically through the canopy, and between shaded systems) on pruning induced branching into account. To model pruning in cocoa, detailed descriptions of pruning induced branching, both in young plants and in fully developed tree crowns are needed."}]},{"head":"Considerations on availability of data","index":35,"paragraphs":[{"index":1,"size":136,"text":"Availability of yield data is limited and subject to large degree of uncertainty. Yield data from experiments under close-to-optimal management conditions are rare (Appiah et al., 2000;Waldburger et al., 2019). On the contrary, farm yield data are more widely available but often subject to a large degree of uncertainty, caused by incorrect selfreporting, differences in water content of reported fermented bean weight, variable tree density within a farm and/or uncertainty regarding exact farm size (Asare et al., 2018;de Groote and Traoré, 2005;Desiere and Jolliffe, 2018). The large tree-to-tree variation in bean production (Wibaux et al., 2018) may also introduce errors in yield estimation especially in the case where yield per hectare is extrapolated from measurements of sub-plots of small size and where tree size distribution is not represenative of the entire field (Tosto et al., 2022)."},{"index":2,"size":91,"text":"As we have shown throughout Section 4, availability of data on cocoa systems for model calibration and validation varies depending on the variables or processes considered. At present, calibrating and validating new model modules and new model types may require using data from several different sources. However, differences in environment, genotype and management between study sites may hamper the integration of data collected by different studies. Optimally all necessary measurements should be collected within the same plot, calling for experimental sites where a large number of measurements could be performed simultaneously."}]},{"head":"Conclusions","index":36,"paragraphs":[{"index":1,"size":186,"text":"Despite the importance of cocoa as a commodity crop and the advantages that modelling could bring to the understanding of cocoa systems, relatively few cocoa models have been developed. In addition, existing models have hardly been applied by the cocoa sector. We compared pertinent questions in the cocoa sector with existing cocoa models and their applications, therewith identifying various gaps in cocoa modelling. (i) Several physiological processes (e.g., water stress responses, respiration, climate changes responses) are simulated based on general plant physiological knowledge that is not cocoa-specific. (ii) Nutrient effects on cocoa functioning and production are missing in more explanatory models, while other models are either not calibrated for cocoa or too limited in scope. (iii) Phenological processes specific to cocoa, such as flushing and pod abortion are not represented in any of the existing models. (iv) Structural characteristics of the cocoa tree (3D organ-level models) are represented only in juvenile stages and models to simulate stand structural complexity especially in an agroforestry setting are missing (3D plant-level models). Finally (v) a decision support system including the main agronomical management practices in cocoa cultivation is missing."},{"index":2,"size":59,"text":"Given the state of the art of existing cocoa models and the necessary steps that we identified to address some of the most pressing issues in cocoa production, we propose to focus future modelling efforts on developing: (i) cocoa management decision support systems, (ii) a more comprehensive plant ecophysiological model of cocoa and (iii) a 3D structural-functional cocoa model."},{"index":3,"size":165,"text":"A cocoa management support system aims at supporting farmers in making decisions on management (e.g., irrigation and fertilization) as well as forecasting yields. Hence, the modelling strategy should focus on ease of calibration and high predictive power. This might require a significant simplification of process-based models such as CASE2 (Zuidema et al., 2005). A plant ecophysiological modelling approach of cocoa needs to focus on simulating the effects of climate, soil, water and nutrient availability on the growth and yield. Following the approach of MAESPA (Vezy et al., 2018), this model could also incorporate a simplified 3D structures of the system at plant level, thus allowing to address questions on the design of cocoa systems (including agroforestry systems) and evaluating the effect of heterogenous shade canopies on cocoa production. Lastly, the 3D structural-functional cocoa modelling approach needs to capture growth and development of cocoa trees at organ levels in order to address questions regarding the effect of microclimate on branching and pod production, pruning and shading."},{"index":4,"size":115,"text":"Data availability in many cases hampers further development of cocoa modelling. To develop management decision support systems for cocoa cultivation, we need to understand how radiation-use efficiency varies under different environmental conditions and how cocoa trees respond to management practices. Methods of effectively obtaining reliable on-farm or at least within-region data also need to be improved. Further development of an ecophysiological model requires knowledge on long-term cocoa responses to climate change and on nutrient effects on tree processes, currently available only at seedling stage. Hence, detailed field experiments exploring Finally new model types, such as 3D organ-level and plant level models, require data on architectural and structural tree and stand characteristics, which is currently missing."},{"index":5,"size":80,"text":"Obtaining knowledge of cocoa is challenging due to its perennial nature and the high variability of environmental conditions and cropping systems. Overcoming this challenge requires a concerted effort of the cocoa research community to develop networks of long-term experiments both under relatively controlled conditions at research stations (to develop and support explanatory models) and on-farm (to develop and support DSS). This requires collaboration across the sector, dedicated shared facilities (e.g. FACE experiment, well control experimental field) and long-term financial investments."}]}],"figures":[{"text":"  "},{"text":"  "},{"text":"Table 2 Overview of main gaps in modelling cocoa. Details of how gaps were identified and how they relate to questions in cocoa production are given in sections 4.1, 4.2 and 4.3. Gaps Possible modelling approaches Data required Data availability for cocoa GapsPossible modelling approachesData requiredData availability for cocoa  Physiological processes (Section 4.1)  Physiological processes (Section 4.1) Coupling of photosynthesis with stomatal conductance is missing in most models Soil-plant atmosphere continuum models (Tuzet et al., 2003) Stomatal conductance-photosynthesis relation Acheampong et al. (2015, 2013); Araque et al. (2012); Ávila-Lovera et al. (2021, 2016); Baligar et al. (2008); Rada et al. (2005); Salazar et al. (2018); Suárez et al. (2021b); Tezara et al. (2020) Coupling of photosynthesis with stomatal conductance is missing in most modelsSoil-plant atmosphere continuum models (Tuzet et al., 2003)Stomatal conductance-photosynthesis relationAcheampong et al. (2015, 2013); Araque et al. (2012); Ávila-Lovera et al. (2021, 2016); Baligar et al. (2008); Rada et al. (2005); Salazar et al. (2018); Suárez et al. (2021b); Tezara et al. (2020)   Leaf water potential-soil water potential Jiménez-Pérez et al. (2019) Leaf water potential-soil water potentialJiménez-Pérez et al. (2019) Assimilate allocation in response to water stress missing or based on generic knowledge Empirical allocation rules Organ biomass under different stress levels Moser et al. (2010); Schwendenmann et al. (2010) Assimilate allocation in response to water stress missing or based on generic knowledgeEmpirical allocation rulesOrgan biomass under different stress levelsMoser et al. (2010); Schwendenmann et al. (2010)  Allometric relation approach Destructive measurement of organ biomass Borden et al. (2019) and ref. within Allometric relation approachDestructive measurement of organ biomassBorden et al. (2019) and ref. within  Functional equilibrium approach (Yin Cocoa-specific data not  Functional equilibrium approach (YinCocoa-specific data not  and van Laar, 2005) needed  and van Laar, 2005)needed Leaf lifespan reduction under water stress based on hypothetical relation Empirical function Leaf lifespan under different water stress level - Leaf lifespan reduction under water stress based on hypothetical relationEmpirical functionLeaf lifespan under different water stress level-   Litterfall dynamics Mohammed et al. (2015); Moser et al. (2010); Schwendenmann et al. (2010) Litterfall dynamicsMohammed et al. (2015); Moser et al. (2010); Schwendenmann et al. (2010) Lack of knowledge of long-term cocoa    Lack of knowledge of long-term cocoa photosynthesis responses to elevated atmospheric [CO 2 ] and high  FACE and FACE-T experiments - photosynthesis responses to elevated atmospheric [CO 2 ] and highFACE and FACE-T experiments- temperature    temperature Acclimation of respiration to higher temperature not included Modification to respiration-temperature response curve (Slot and Kitajima, 2015) Temperature acclimation experimental data - Acclimation of respiration to higher temperature not includedModification to respiration-temperature response curve (Slot and Kitajima, 2015)Temperature acclimation experimental data- Nutrient responses are absent (CASE2 and JULES), too generic (WaNuLCAS), or too limited in scope (Wojtkowski et al., 1991) Empirical nutrient availability-yield response curves-QUEFTS (Sattari et al., 2014) Network of experiments with different levels of nutrient applications van Vliet and Giller (2017b) and refs within, Cocoa soil project (CocoaSoils Workplan and Annual Report, 2019) Nutrient responses are absent (CASE2 and JULES), too generic (WaNuLCAS), or too limited in scope (Wojtkowski et al., 1991)Empirical nutrient availability-yield response curves-QUEFTS (Sattari et al., 2014)Network of experiments with different levels of nutrient applicationsvan Vliet and Giller (2017b) and refs within, Cocoa soil project (CocoaSoils Workplan and Annual Report, 2019)  Application of stress factor to RUE, allocation, etc. LINTUL type models ( Adiele et al., 2022) -CAF002 (van Oijen et al., 2010a) nutrient-RUE responses, nutrient-allocation responses, etc. On seedlings only: Acheampong et al. (2015); Anokye et al. (2021); Baligar and Fageria (2017); Costa et al. (2001); Djan Application of stress factor to RUE, allocation, etc. LINTUL type models ( Adiele et al., 2022) -CAF002 (van Oijen et al., 2010a)nutrient-RUE responses, nutrient-allocation responses, etc.On seedlings only: Acheampong et al. (2015); Anokye et al. (2021); Baligar and Fageria (2017); Costa et al. (2001); Djan  Mechanistic approach of nitrogen dynamics GECROS (Yin and van Laar, 2005) Nitrogen effect on several plant processes et al. (2017); Ribeiro et al. (2008); Souza Júnior and Carmello (2009) Mechanistic approach of nitrogen dynamics GECROS (Yin and van Laar, 2005)Nitrogen effect on several plant processeset al. (2017); Ribeiro et al. (2008); Souza Júnior and Carmello (2009) Leaf flushing is missing Leaf production driven by external drivers Temperature/precipitation -flushing cycle relation Almeida et al. (1987); Greenwood and Posnette (1950); Sale (1968) Leaf flushing is missingLeaf production driven by external driversTemperature/precipitation -flushing cycle relationAlmeida et al. (1987); Greenwood and Posnette (1950); Sale (1968)  Leaf cycle linked to reserves   Leaf cycle linked to reserves  "},{"text":"Table 2 (continued )     Gaps Possible modelling approaches Data required Data availability for cocoa GapsPossible modelling approachesData requiredData availability for cocoa  Simulation nutrient soil pools and dynamics -DAYCENT (Parton et al., 1998) Cocoa-specific data not needed  Simulation nutrient soil pools and dynamics -DAYCENT (Parton et al., 1998)Cocoa-specific data not needed A decision support system that can simulate pruning practices is missing Static FSP models -QualiTree ( Lescourret et al., 2011) Dynamic FSP models Branching patterns Pruning responses (branching, leaf production)  A decision support system that can simulate pruning practices is missingStatic FSP models -QualiTree ( Lescourret et al., 2011) Dynamic FSP modelsBranching patterns Pruning responses (branching, leaf production)  "}],"sieverID":"fd0e26dd-77f2-4215-acf3-8ac882dbd91f","abstract":"Cocoa modelling can aid improving cocoa production but it has received little attention. • We reviewed existing cocoa models and highlighted the main knowledge gaps in cocoa modelling. • Substantial gaps remain in the representation of cocoa physiological processes, 3D structure and decision support systems. • Data availability is the main bottleneck for future model development. • A coordinated effort of the cocoa research community is needed to close those knowledge gaps."}

data/part_4/022194b44e4cf21c886066e761c0a7fd.json

@@ -0,0 +1 @@
+{"metadata":{"id":"022194b44e4cf21c886066e761c0a7fd","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/1a1de293-caad-42d0-9095-ee2d74105046/retrieve"},"pageCount":2,"title":"Maikona Index Reading for March 2011 (October -February insurance coverage period) This page provides the predicted livestock mortality index and the summary of the underlying data in Maikona for October 2010 -February 2011 insurance coverage period. For information on the definition and derivation of the index and underlying data, see","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[]}],"figures":[{"text":"  "}],"sieverID":"17a956a6-22a6-4fa4-969a-c1f7887f3362","abstract":""}

data/part_4/027efb887af3b07e97668f910cd63b25.json

@@ -0,0 +1 @@
+{"metadata":{"id":"027efb887af3b07e97668f910cd63b25","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7b89ce19-8cc3-452e-80b8-719579e5235a/retrieve"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"Description","index":1,"paragraphs":[{"index":1,"size":48,"text":" Urea treatment of low quality fibrous crop residues such as straws, sugarcane bagasse and hulls improves feed intake of these feeds. Ammonia, released from the urea, weakens the lignified outer wall and increases the digestibility of the straw. It also provides a source of supplementary non-protein nitrogen."},{"index":2,"size":85,"text":" For 100kg of dry straw, dilute 4kg of urea in 30-40 litres of water and sprinkle over the dry straw, compress the straw and then seal the straw with plastic. This is commonly done in a plastic-lined pit, a simple concrete box or in plastic bags. Leave the straw covered for 30-45 days (30 days for hot weather; 45 days for cold weather). Then remove the cover and leave straw for at least 7 days to get rid of the ammonia smell before feeding."}]},{"head":"Key benefits s","index":2,"paragraphs":[{"index":1,"size":23,"text":" Provides supplementary non-protein nitrogen and increases feed intake of low-quality fibrous feed by 10-15% and a similar improvement in growth or productivity."},{"index":2,"size":23,"text":" While the benefit of urea treatment is relatively small it can be significant in situations where feed quality is marginal for growth."}]},{"head":"Key limitations1","index":3,"paragraphs":[{"index":1,"size":37,"text":" Not easily adopted by smallholder farmers.  For smallholders the method must be simple and practical without expensive construction of silos. Also, supplies such as urea and plastic need to be available locally at reasonable prices."},{"index":2,"size":60,"text":" Danger of urea toxicity if too much urea is used.  Most suitable for areas where there is excess straw available on farms which would be wasted without urea treatment. Conversely, urea treatment may be less easily adopted in areas where straw availability is limited and animals will consume all of the available feed with or without urea treatment."}]},{"head":"Feed Intervention","index":4,"paragraphs":[{"index":1,"size":2,"text":"TechSheet 3"},{"index":2,"size":14,"text":"Treated straw (left) and untreated straw (right) Stored rice straw for cattle feeding, Cambodia."},{"index":3,"size":5,"text":"Where does this intervention fit? "}]}],"figures":[{"text":" TechFit is a tool to prioritize and select animal feed interventions. It was developed by ILRI under the leadership of Alan Duncan. It has been further refined and developed with inputs from many individuals in and beyond CGIAR. This is one of a series of feed intervention 'TechSheets' developed alongside the TechFit tool to provide summarized information on different interventions included in the tool. Werner Stür led the development of the TechSheets. This sheet was prepared by Jane Wamatu (ICARDA). TechFit is supported by the CGIAR Research Program on Livestock and Fish. ilri.org/techfit Feed intervention >> Improvements and feeding of crop residues and other basal feeds > Chemical treatment Urea treatment Pit lined with Enset leaves Packing treated straw in a pit lined with heavy plastic. Packing treated straw in a plastic bag. "},{"text":" Urea treatment: www.fao.org/docrep/003/w4988e/w4988e04.htm  Urea-ammonia treatment of low quality roughages in Ethiopia: www.esgpip.org/PDF/Technical%20bulletin%20No2.html "}],"sieverID":"a74f1763-f445-4463-9d69-e676409de8c6","abstract":""}

data/part_4/02ad4e8a98254a22fbbadc915d574c1d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"02ad4e8a98254a22fbbadc915d574c1d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7aafaefb-2314-46a8-9f56-b027b5e5659f/retrieve"},"pageCount":4,"title":"Outreach and Private Sector Partnerships Reduce Barriers to Female Market Participation and Financial Inclusion","keywords":["OICR: Outcome Impact Case Report","National Country(ies):","Uganda Comments: <Not Defined> Contributing CRPs/Platforms:","PIM -Policies, Institutions, and Markets Contributing Flagships:","F6: Cross-cutting Gender Research and Coordination Contributing Regional programs: <Not Defined> Contributing external partners:","Kakira Sugar Limited","The World Bank","Tropical Bank Limited"],"chapters":[{"head":"Elaboration of Outcome/Impact Statement:","index":1,"paragraphs":[{"index":1,"size":269,"text":"Women contribute to cash crop production but are often excluded from markets. Barriers include paperwork requirements, inability to leave home to visit company offices, lack of knowledge, and others. The main initiative in this project was to increase women's participation in the sugarcane value chain by encouraging the registration of sugar contracts in women's names. An RCT was designed in collaboration with a large, local sugar processing company (Kakira Sugar), which buys sugarcane from smallholder outgrowers. 2,370 outgrowers were enrolled in the study. The RCT had two interventions: • Intervention1: A workshop intervention that included a couples-based participatory training focused on recognizing contributions of each member and arriving at a balanced approach to household (or farm) management and access to resources. • Intervention2: A contract intervention, whereby households were visited and encouraged to transfer contracts to women and/or register new contracts in a woman's name. The RCT changed the composition of contracts of Kakira Sugar by encouraging households to put contracts in females' names; this increased the share of contracts registered to women from 18% to 30% (an increase of approximately 900 women) and gave the company more experience working with and engaging women. Encouraging contracts to be registered in women's names appears to be an effective method to include women in market-facing activities related to sugar cane: takeup of the contract intervention was 72%. Given the requirement of the sugar cane firm that clients have a bank account, a partner bank (Tropical Bank) adjusted their policies after recognizing the barriers for women to open bank accounts, increasing the number of women account holders by 66%. Policy outcomes include:"},{"index":2,"size":48,"text":"• Kakira Sugar has altered previously cumbersome procedures, to facilitate the registration of outgrower contracts in women's names. Requirement for a national ID can be waived, visits to company offices are not required, and the lengthy registration process was expedited. This was an explicit focus of the project."},{"index":3,"size":83,"text":"• Tropical Bank has adjusted their account-opening policies to facilitate account openings by women. This was not an explicit focus of the project, but a serendipitous outcome with real replicability/scale-up potential. Recognizing that women have greater barriers to traveling to the branch location, the bank sent staff to the villages to complete the required paperwork with women. The bank also adjusted their procedures to remove some redundant requirements, such as the requirement to have a local council letter in addition to other identification."}]},{"head":"Gender, Youth, Capacity Development and Climate Change:","index":2,"paragraphs":[{"index":1,"size":70,"text":"Gender relevance: 2 -Principal Main achievements with specific Gender relevance: The main focus of this project is gender. Although, final outcomes have not been measured, the project has resulted in approximately 900 women obtaining sugar contracts and bank accounts, a take-up rate of approximately 70%. Because female-held contracts in our sample were negligible at baseline and only 10% of women had bank accounts, this represents important increases for this population. "}]}],"figures":[{"text":" Youth relevance: 0 -Not Targeted CapDev relevance: 1 -Significant Main achievements with specific CapDev relevance: Although capacity development was not the main goal of the project, the research team has engaged in such development with KSL and Tropical Bank throughout the project interventions, in which we assist them in adjusting procedures to make them more accessible to women. This includes continual knowledge exchange over the course of the intervention. Climate Change relevance: <Not Defined> Other cross-cutting dimensions: <Not Defined> Other cross-cutting dimensions description: Policies and institutions: private sector Outcome Impact Case Report link: Study #2196 Contact person: Kate Ambler, Research Fellow, IFPRI MTID, [email protected] "}],"sieverID":"58a43621-31f4-4bee-9684-7f38318693b5","abstract":"This project involves an RCT designed to reduce barriers to women's participation in cash crop value chains. The RCT promoted female participation in cash crop value chains by encouraging households to register outgrower sugar cane contracts in women's names (which came with a requirement from the company that women have a bank account). By encouraging private sector processing companies and banks to interact with women, the project promotes women's empowerment and improved rural welfare."}

data/part_4/0323df3a6b70211b8b71922f931c52f5.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0323df3a6b70211b8b71922f931c52f5","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/39ba43b9-fb2c-4d44-86d3-fa2952d49260/retrieve"},"pageCount":10,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":101,"text":"Se ha demostrado que el establecimiento de leguminosas forrajeras mediante la l abranza reducida en sabana o en praderas de gramíneas preestablecidas, permite una evaluación confiable de la efectividad de las combinaciones leguminosa-rizobio (Sylvester-Bradley y Mosquera, 1985). La labranza reducida disminuye tanto la tasa de mineralización como la disponibilidad del nitrógeno mineral en el suelo, porque perturba menos el suelo y por la competencia con las gramíneas que crecen entre los surcos de las leguminosas (Figura 15.1). Este sistema de labranza asegura además un buen establecimiento de las leguminosas porque evita que las lluvias arrastren el suelo y las semillas ."},{"index":2,"size":50,"text":"En estos ensayos sólo se evalúa la simbiosis has ta el final de la fase de establecimiento. Por eso se facilita la consecución de lotes para ha cerlos, porque después del ensayo le queda al propietario de la tierra una pradera con leguminosas introducidas, lista para que inicie el pastoreo."},{"index":3,"size":78,"text":"En los ensayos correspondientes a l as Etapas 1 y 2, en que se requiere información sobre el potencial genético de la planta para fijar nitrógeno con las cepas nativas o inoculadas de rizobios, deben mantenerse las plantas en condiciones óptimas de crecimiento; se aplicarán, por tanto, niveles de fertilización adecuados para un buen desarrollo del germoplasma que se evalúa. La evaluación de la simbiosis bajo condiciones de estrés se estudia en l a Etapa 3 (Capítulo 20)."}]},{"head":"Epoca de siembra","index":2,"paragraphs":[{"index":1,"size":16,"text":"Se deb e sembrar en la época en que lo hacen los agricultores de la región."},{"index":2,"size":1,"text":"15-1 "}]},{"head":"Diseño experimental","index":3,"paragraphs":[{"index":1,"size":42,"text":"Las parcelas consisten en surcos hechos en una pradera de gramínea, a una distancia de 1.5 m entre uno y otro. Los surcos tienen de 10 a 40 cm de ancho, y quedan separados entre sí por áreas de gramínea sin perturbar."},{"index":2,"size":24,"text":"Se requieren, por lo menos, 12 m lineales de s urco por parcela, para hacer dos cortes; cada corte estará compuesto de 3 submuestras "}]},{"head":"15-4","index":4,"paragraphs":[{"index":1,"size":62,"text":"El croquis de la Figura 15.3 muestra un esquema de un ensayo típico de la Etapa 1, con un diseño de parcelas divididas. El diseño de bloques al azar es más preciso, pero r equiere un manejo muy cuidadoso de las aplicaciones de nitrógeno. El diseño de los ensayos que se utilizan en la Etapa 2 se describe en el Capítulo 19."}]},{"head":"Preparación del suelo","index":5,"paragraphs":[{"index":1,"size":57,"text":"Se recomienda, al empezar, quemar la sabana o guadañar (cortar) la gramínea para reducir la competencia de ésta con las plántulas de la leguminosa sembrada. Se pueden hacer los surcos con una profundidad de 10 a 15 cm usando un azadón, y asegurándose de que se eliminan las raíces de la gramínea en el área de siembra."},{"index":2,"size":168,"text":"También se pueden preparar los surcos con un cultivador, montando un par de escardillos para cada s urco, con 40 cm entre ellos, en la primera barra del cultivador, y una pala pequeña en la segunda barra, centrada entre los dos escardillos. Otro arreglo es colocar la pala en la primera b arra y los escardillos en la segunda. Puede ser necesar io cambiar el sis t ema de preparación de los surcos en cada sitio, según l a maqu i naria disponible, y según las características del suelo y de l a gr amínea as ociada; por esto se recomienda ensayar previamente pa r a elegir el mejor método de preparación de los s urco s . Obviamente, es importante cerca r el área del ensayo antes de la siembra para evi tar el ingreso e n ella de ganado u otros animales. Puesto que pueden surgir problemas con la preparación de la tierra , es aconsejable hacerla algunos días antes de la fecha de siembra ."}]},{"head":"15.5• Fertilización","index":6,"paragraphs":[{"index":1,"size":78,"text":"Aplicar el fertilizante en el s urco ca l culando, para cada metro lineal de s urco , la cantidad que se neces itaría para 1 m 2 de t e rreno. En ausencia de r ecomendac iones es pecíficas sobre e l sitio donde se realiza el ensayo, se recomienda aplicar, en g/m de surco, 12.0 de Ca, 2.2 de P, 4.0 de S, 3 .3 de K, 2 . 0 de Mg, 0.5 de Zn, 15-9"}]}],"figures":[{"text":"~ !:» EVALUACION DE LA SIMBIOSIS LEGUMINOSA FORRAJERA-RIZOBIO EN EL CAMPO (Etapas 1 y 2) "},{"text":" Figura 15.2 Tamaño y orientación de las parcelas en ensayos de campo con leguminosas forrajeras tropicales. (Ejemplo: 18 m lineales para 2 cortes; 40 m lineales para 3 o 4 cortes). "},{"text":"+N Figu ra 15.3. Croqu;s d e un e n sayo tlp ico d e l a Et a p a l. Par c e la p rin c i pal: f e rtil i zación c o n N; s ubpa r cel a : l e gumi no sa ~ "}],"sieverID":"3316d5e4-349a-4c0d-8f81-47cb98daeae7","abstract":""}

data/part_4/0333bc5e5ec7d3f680b55c594faa4c7d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0333bc5e5ec7d3f680b55c594faa4c7d","source":"gardian_index","url":"https://publications.iwmi.org/pdf/H021915_TOCOA.pdf"},"pageCount":3,"title":"","keywords":[],"chapters":[],"figures":[],"sieverID":"b8db777f-df5b-49c7-8f24-1a158eff3dfb","abstract":""}

data/part_4/03c01dbd03bb88d81eccfe577987475a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03c01dbd03bb88d81eccfe577987475a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/2a178549-9945-403e-9ba0-9cdfb473fc28/retrieve"},"pageCount":12,"title":"","keywords":[],"chapters":[{"head":"Biodiversidade agrícola e NUS","index":1,"paragraphs":[{"index":1,"size":48,"text":"Biodiversidade-ou diversidade biológica-é a variedade dentro e entre todas as espécies de plantas, animais e micro-organismos e os ecossistemas onde vivem e interagem. A biodiversidade agrícola, um subconjunto da biodiversidade, é o resultado da evolução e seleção naturais e melhoramento por parte de agricultores ao longo dos milénios."},{"index":2,"size":112,"text":"Muitos agricultores, especialmente em áreas não adequadas para variedades de alto rendimento, confiam numa vasta gama de NUS 1 para subsistirem. Espécies como o feijão-frade ou feijão-caupí e a quinoa evoluíram ao longo do tempo e estão adaptadas às condições particulares onde crescem, muitas vezes em sistemas agrícolas de sequeiro de baixa produtividade. Centenas de plantas, árvores, cogumelos e animais em ecossistemas naturais também fornecem alimento e rendimento. Mas a importância das NUS -também conhecidas como culturas menores ou órfãs -é frequentemente negligenciada. As políticas agrícolas e os mercados favorecem variedades geneticamente uniformes de poucas culturas de alta produção e culturas agrícolas de base tais como trigo, arroz, chá, café e cacau."},{"index":3,"size":130,"text":"NUS tais como os cereais dos Andes, painços menores e hortícolas de folha chamaram a atenção de cientistas e doadores durante, pelo menos, 20 anos. Porém, só recentemente é que a sua contribuição estratégica para acabar com a pobreza e com a insegurança alimentar e nutricional se tornou mais amplamente reconhecida. A Declaração de Córdoba de 2012 sobre Culturas Promissoras para o Século XXI, as celebrações do Ano Internacional da Quinoa, em 2013 e o recente lançamento da Academia Africana de Melhoramento Vegetal pelo Consórcio Africano de Culturas Órfãs são apenas alguns exemplos do crescente interesse nestas espécies. Uma série de organizações estão a reunir esforços para potenciar a conservação e a utilização de NUS, 2 mas são necessários mais investimentos para integrar estas espécies em sistemas alimentares e agrícolas."},{"index":4,"size":185,"text":"Recentemente, as organizações agrícolas e os decisores políticos reconheceram o papel atual e o potencial por explorar das NUS para a segurança alimentar e nutricional, gerando receitas em áreas rurais, reforço da resiliência, adaptando-se às alterações climáticas e atenuando os riscos climáticos, agronómicos e económicos. Em 2008, o primeiro simpósio internacional sobre este tema foi realizado em Arusha, na Tanzânia, seguido de um evento semelhante em Kuala Lumpur, Malásia, em 2011. Em Setembro de 2013, o Gana acolheu a 3 .a Conferência Internacional sobre Espécies Negligenciadas e Subutilizadas: Para a Segurança Alimentar em África. 3 Aprendendo com as lições obtidas pelas iniciativas mencionadas acima, esta nota de sensibilização realça papéis chave de NUS ao responder a cinco desafios críticos de desenvolvimento: a conservação da biodiversidade agrícola; o desenvolvimento agrícola e rural; as alterações climáticas; a segurança alimentar e nutricional; questões NUS: papéis chave relativas ao género, cultura e capacitação das mulheres. A necessidade de desenvolvimento de capacidades de intervenção em NUS também é realçada. As recomendações e ações chave indicam formas para integrar as NUS em políticas e programas a nível nacional, regional e internacional."}]},{"head":"Conservação da biodiversidade agrícola","index":2,"paragraphs":[{"index":1,"size":158,"text":"A humanidade depende de agroecossistemas saudáveis, e os agroecossistemas saudáveis dependem da biodiversidade ao nível do ecossistema, das espécies e dos genes. Globalmente, mais de 4000 espécies de plantas alimentares são presentemente consumidas (Proche et al., 2008). A diversidade genética de NUS, as variedades autóctones de culturas principais e os seus parentes silvestres constituem uma parte muito importante da biodiversidade agrícola mas estão em rápido declínio. Em todo o mundo, os agricultores estão a abandonar as NUS à medida que a globalização, o crescimento populacional e a urbanização levam a alterações em sistemas agrícolas e alimentares. De acordo com a Organização das Nações Unidas para a Alimentação e a Agricultura (FAO), desde os anos 1900, perdeu-se cerca de 75% da diversidade das culturas. Esta perda de biodiversidade agrícola é causada por um conjunto complexo de fatores económicos, sociais e demográficos, incluindo sistemas agrícolas e alimentares que se concentram na produção intensiva de um número muito limitado de culturas."},{"index":2,"size":66,"text":"O alarmante declínio dos recursos genéticos de NUS e o conhecimento tradicional associado aos mesmos têm implicações de longo alcance para a agricultura. Este declínio inibe a evolução natural e a adaptação de culturas, reduz opções futuras para o melhoramento de variedades e desenvolver cadeias de valor, e reduz a resiliência de agroecossistemas e a sua capacidade de se adaptar às alterações, incluindo as alterações climáticas."},{"index":3,"size":124,"text":"A Convenção sobre a Diversidade Biológica (CBD), o seu Plano Estratégico para a Biodiversidade, incluindo as Metas de Aichi para a Biodiversidade e a Década sobre Biodiversidade das Nações Unidas 2011-2020 claramente reconhecem a importância da biodiversidade agrícola. Mas ainda há muito por fazer para aumentar a consciencialização dos decisores políticos para a importância da conservação desta diversidade, incluindo a conservação de centenas de NUS ameaçadas pela grave erosão genética e cultural. Atualmente, o Anexo I do Tratado Internacional sobre os Recursos Fitogenéticos para a Alimentação e a Agricultura exclui a maioria das NUS. Esta omissão inibe a troca internacional de germoplasma para investigação e utilização na agricultura, e torna as NUS inelegíveis para financiamento através do fundo de partilha de benefícios do Tratado."},{"index":4,"size":234,"text":"O sistema global de bancos de germoplasma para conservar a biodiversidade agrícola ex situ inclui mais de 1740 bancos de germoplasma e mais de 7,4 milhões de acessos de culturas (FAO,  2010). Estas colecções focalizam-se principalmente em culturas de base e de culturas comerciaias, e nos seus parentes silvestres. Muitas NUS estão mal representadas; a sua conservação e evolução contínua dependem largamente do seu uso nos campos dos agricultores e a sua preservação em ecossistemas naturais saudáveis. Em muitas comunidades rurais, as NUS, incluindo os \"alimentos provenientes da floresta\", complementam as culturas de base principais em dietas e são uma opção de recursos se as culturas de base falharem. São frequentemente uma fonte significativa de rendimento, especialmente para as mulheres. Em ambientes marginais, onde a pobreza e a insegurança alimentar é mais predominante, as NUS são muitas vezes centrais para estratégias dos agricultores para reduzir os riscos climáticos e económicos. As NUS podem desempenhar um papel essencial no avanço do desenvolvimento agrícola e rural. Internacionalmente, o crescente interesse em substâncias naturais para produtos alimentares, cosméticos, farmacêuticos, nutricionais e de saúde apresenta grandes oportunidades para as NUS. As comunidades pobres que produzem NUS também podem potencialmente aproveitar a etiquetagem ecológica, a denominação de marca de origem, o comércio justo e iniciativas de Slow Food. O que é necessário é um apoio simultâneo e integrado ao longo das cadeias de valor desde a produção ao mercado."}]},{"head":"Promoção do desenvolvimento agrícola e rural","index":3,"paragraphs":[{"index":1,"size":71,"text":"Porém, atualmente, os agricultores africanos tem acesso limitado a sementes de qualidade de variedades de NUS com boas características. As comunidades rurais também têm poucos meios para aceder a mercados para NUS e produtos derivados de NUS. As cadeias de valor são frequentemente pouco desenvolvidas e inadequadamente apoiadas pela investigação, pelos serviços de extensão e pela agro-indústria. As restrições também incluem o processamento e embalagem não conforme com as normas, a "}]},{"head":"Plataformas de multi-intervenientes para desenvolver cadeias de valor para NUS","index":4,"paragraphs":[{"index":1,"size":50,"text":"A produção e o consumo de quinoa, um cereal dos Andes, está a passar por uma renovação. As plataformas de multi-intervenientes que envolvem comunidades pobres em toda a Bolívia, investigadores, professores universitários, organizações nãogovernamentais, especialistas de marketing e decisores políticos trouxe a quinoa para mercados nacionais e internacionais com êxito."},{"index":2,"size":177,"text":"A história de sucesso da quinoa baseia-se no trabalho persistente em muitas frentes para melhorar o cultivo, as práticas pós-colheita e de processamento, conservar a diversidade da quinoa, associar os agricultores a mercados e reforço de capacidades. Este trabalho foi fundamental para desenvolver as cadeias de valor nacionais e internacionais para esta cultura subutilizada. A maioria dos doadores, das agências de desenvolvimento e os intervenientes locais também contribui consideravelmente e merece crédito por estes êxitos. Apesar de a indústria alimentar preferir quinoa branca ou creme, a procura de quinoa colorida está a aumentar devido ao potencial gastronómico dessas variedades. Por isso, a diversificação de produtos -um fenómeno conhecido que tem sido observado para muitas outras culturas comerciais -ocorreu, com consumidores agora dispostos a comprar variedades de quinoa diferentes (preta, vermelha, as que têm ingredientes funcionais especiais, etc.). A tendência para uma alimentação saudável também dá uma oportunidade para promover variedades de quinoa atualmente não atrativas para o mercado de exportação de quinoa. Assim, a promoção e investigação para desenvolver mais as cadeias de valor da quinoa continua."}]},{"head":"Sistemas agrícolas à prova de alterações climáticas","index":5,"paragraphs":[{"index":1,"size":89,"text":"Os painços menores são geneticamente muito diversos. Nesta diversidade, existem variedades adaptadas a solos diferentes, ambientes áridos e montanhosos marginais, e áreas onde os principais cereais geralmente falham. Como os painços menores têm um ciclo de vida curto e um sistema de raiz eficiente, têm uma vantagem comparativa quando a água é escassa e a precipitação é baixa. Isto faz com que sejam bons candidatos para substituir trigo e arroz em países como a Índia onde estas culturas de base podem tornar-se gradualmente menos produtivas devido às alterações climáticas."}]},{"head":"NOTA INFORMATIVA 6 Adaptação às alterações climáticas e atenuação dos seus efeitos","index":6,"paragraphs":[{"index":1,"size":104,"text":"As alterações climáticas e a variabilidade têm impactos de longo alcance em sistemas agrícolas e na biodiversidade agrícola associada, tais como polinizadores e microorganismos de solo. Para garantir a segurança alimentar e nutricional a curto prazo, os agricultores terão de gerir secas, períodos de crescimento variáveis, eventos climáticos extremos mais frequentes e a disseminação de pragas e doenças. A longo prazo, os agricultores poderão experienciar uma incompatibilidade entre condições climáticas locais e as culturas e variedades a que têm acesso atualmente. Consequentemente, poderão ter que mudar para novas culturas e variedades, e os países terão de adaptar os seus sistemas de sementes em conformidade."},{"index":2,"size":63,"text":"As NUS cultivadas como complementos de culturas principais ajudam os agricultores a diminuírem os riscos. Tipicamente adaptados a condições locais, os agricultores consideram-nas frequentemente como tolerantes ao stress e mais resistentes à seca e a outros perigos relacionados com o clima. As NUS têm, assim, um papel importante no fortalecimento da resiliência de sistemas de produção agrícola à medida que alterações climáticas avançam."},{"index":3,"size":75,"text":"Mas, para que as NUS façam parte da \"agricultura climaticamente inteligente\", a investigação agronómica e as políticas de desenvolvimento têm de reconhecer e apoiar o seu papel. Perceber o potencial dessas espécies para se adaptarem às alterações climáticas requer, entre outras ações, investimento em investigação para desenvolver novas variedades com características adaptativas úteis, melhores mecanismos para permitir aos agricultores acederem a germoplasma e intervenções robustas para desenvolver mercados e cadeias de valor de NUS prioritárias."},{"index":4,"size":53,"text":"e introduzindo novas aptidões na produção, no processamento e na comercialização tanto vertical como horizontalmente ao longo das cadeias de valor. Os parceiros no setor privado são importantes para desenvolver tecnologias de processamento e comercializar produtos, enquanto os parceiros no setor não-governamental podem ajudar os agricultores a obter o reconhecimento dos seus direitos."},{"index":5,"size":23,"text":"Seleção participativa de variedades que envolvem agricultores e a colaboração extensiva com comunidades agrícolas em testes e avaliações de novo germoplasma, será importante."}]},{"head":"Melhoria da segurança alimentar e nutricional","index":7,"paragraphs":[{"index":1,"size":158,"text":"A proporção de pessoas subnutridas em países em desenvolvimento diminuiu significativamente desde os anos 1990. Mas a FAO (2013) estimou que entre 2011 e 2013, 842 milhões de pessoas -um oitavo da população mundial -sofriam de fome crónica. Na África subsaariana, 38% das crianças com menos de cinco anos atrofiaram como resultado de subnutrição crónica. A \"fome oculta\", uma deficiência de micronutrientes -vitaminas e mineraisafeta 3 biliões de pessoas globalmente. A falta de micronutrientes e a obesidade coexistem frequentemente, causando um \"duplo fardo\". De acordo com a Organização Mundial da Saúde (2013), em 2008, 1,4 bilião de adultos tanto em países desenvolvidos como em desenvolvimento tinham excesso de peso ou eram obesos, e corriam riscos crescentes de sofrer de doenças não transmissíveis incluindo, entre outras, doenças cardiovasculares, diabetes e alguns tipos de cancros. Em parte, a obesidade está associada a mudanças rápidas em sistemas alimentares para alimentos mais processados, supermercados, comidas rápidas convenientes e rejeição de alimentos tradicionais."},{"index":2,"size":81,"text":"Para enfrentar os desafios relacionados com a segurança alimentar, as políticas agrícolas, de um modo geral, concentraram-se em aumentar a produtividade, mas prestaram menos atenção ao valor nutricional de sistemas alimentares. As políticas negligenciam muitas vezes os benefícios para a saúde de uma dieta variada com base numa variedade de alimentos nutritivos. As NUS têm muito para oferecer neste aspeto. Muitas comparam-se favoravelmente com culturas de base em termos de vitaminas e teor micronutriente e podem ser usadas mais amplamente para"}]},{"head":"Integrar as NUS nas políticas alimentares e nutricionais","index":8,"paragraphs":[{"index":1,"size":67,"text":"Desde 1997, o governo peruano exigiu a inclusão de quinoa e outros cereais nativos no seu programa de pequenos-almoços escolares. O estado tornou-se um dos principais compradores de culturas nativas no Peru, levando a um aumento na área sob cultivo. Nos anos 80, a área semeada com quinoa anualmente era cerca de 15 000 hectares. Em 2000, a área tinha subido para cerca de 30 000 hectares."},{"index":2,"size":104,"text":"As políticas de nutrição no Nepal, na Zâmbia e na Papua Nova Guiné, apesar de não serem especificamente destinadas a aumentar a produção de NUS, incentivam ao cultivo de uma diversidade de culturas alimentares nutritivas e ao uso de alimentos nutritivos que estão disponíveis localmente. A Carta Nacional para a Segurança Alimentar da Índia, aprovada em Setembro de 2013, inclui painços menores no Sistema de Distribuição Pública bem como arroz e trigo. A carta estimulará um uso mais abrangente de painços na Índia, criando procura e dando um incentivo a agricultores. A Carta é um passo importante para fortalecer a segurança nutricional no país."}]},{"head":"Fortalecer a capacidade","index":9,"paragraphs":[{"index":1,"size":46,"text":"A maior parte das organizações de investigação agrícolas, de desenvolvimento e educação surgem para apoiar políticas agrícolas cujo enfoque principal assenta em produtos agrícolas de base. A capacidade humana e institucional para apoiar a investigação, conservação e utilização de NUS é fragmentada, irregular e insuficientemente financiada."},{"index":2,"size":107,"text":"Os problemas que limitam a exploração do potencial agronómico e de rendimento de NUS têm de ser resolvidos a partir de uma perspetiva de sistemas em vez de isoladamente. Restrições tais como uma baixa disponibilidade e qualidade de sementes, variabilidade de características agronómicos, processamento pós-colheita laborioso, falta de normas para embalagem e distribuição, e uma perceção de NUS como \"culturas de pobres\" podem ser resolvidas por sistemas de investigação e desenvolvimento, mas é essencial uma visão holística. É essencial fortalecer a capacidade -para uma investigação multidisciplinar participativa, para facilitar plataformas de intervenientes para aperfeiçoar as cadeias de valor e para a investigação e intervenções diferenciadas por género."}]},{"head":"\"Queremos ver cadeias de valor desenvolverem-se para estas culturas para o benefício máximo de agricultores e comunidades locais.\"","index":10,"paragraphs":[{"index":1,"size":55,"text":"Observações finais, 3 .a Conferência Internacional sobre Espécies Negligenciadas e Subutilizadas, Accra Ghana, Setembro de 2013 diversificar dietas. A fruta e os vegetais são particularmente importantes. Um novo enfoque na agricultura sensível à nutrição fortalece as ligações entre o setor agrícola e os setores da saúde e nutrição, e inclui objetivos nutricionais em programas agrícolas."},{"index":2,"size":81,"text":"Valorizar o género e a cultura, e capacitar as mulheres O contexto cultural, social e de género da maioria das NUS é fundamentalmente diferente do das culturas principais. É importante reconhecer as tradições culturais, as crenças religiosas e as motivações socioeconómicas dos \"guardiães\" destas culturas. Em muitos casos, são maioritariamente as mulheres que cuidam, cultivam e comercializam NUS, incluindo \"alimentos provenientes da floresta\". Isto significa que, em cadeias de valor em desenvolvimento para estas culturas, é essencial uma perspetiva de género."},{"index":3,"size":93,"text":"Processar NUS pode ser laborioso e geralmente faz parte do trabalho das mulheres. Na Bolívia e no Peru, a tecnologia de processamento melhorada ajudou a aumentar o consumo local e as vendas de cereais dos Andes. Aperfeiçoar as cadeias de valor melhorando a classificação, a embalagem e o desenvolvimento de produtos são igualmente formas de aumentar o rendimento das mulheres. Ajudar as comunidades rurais -e especialmente as mulheres -a tomarem consciência do potencial de culturas que foram ignoradas é uma forma poderosa de fortalecer a sua identidade, aumentando a sua visibilidade e capacitá-las."}]},{"head":"Recomendações e ações chave","index":11,"paragraphs":[{"index":1,"size":66,"text":"Ao longo dos últimos dez anos, vários encontros internacionais significativos -Chennai 2005, Arusha 2008, Suwon 2010, Kuala Lumpur 2011, Córdoba 2012 e Accra 2013 -reconheceram o potencial das NUS para travar a insegurança alimentar e nutricional, a pobreza, a degradação ambiental e adaptar-se às alterações climáticas. Os decisores políticos têm um papel essencial a desempenhar para a criação de condições favoráveis para a realização deste potencial."}]},{"head":"Incluir NUS em estratégias e âmbitos nacionais e internacionais que abordam questões globais","index":12,"paragraphs":[{"index":1,"size":60,"text":"Incluir NUS em estratégias para minimizar a pobreza, garantir a segurança alimentar, adaptar-se às alterações climáticas e alcançar uma agricultura sustentável. Direcionar os recursos financeiros para implementar a CDB para conservar e gerir NUS. Promover a investigação relacionada com os vários papéis que as NUS podem desempenhar para minimizar a pobreza, garantir a segurança alimentar e adaptar-se às alterações climáticas."}]},{"head":"Estabelecer listas nacionais e regionais de NUS prioritárias nas quais focalizar","index":13,"paragraphs":[{"index":1,"size":160,"text":"Realizar estudos nacionais e inventários de NUS cultivadas e silvestres, usando uma variedade de fontes de informação tanto científicas como tradicionais. Organizar processos de estabelecimento de prioridades nacionais que permitam aos intervenientes principais, incluindo organizações de agricultores e o setor privado, participar integralmente na decisão de espécies nas quais se focalizar. Fortalecer a colaboração subregional e regional e alinhar prioridades. NOTA INFORMATIVA 10 5. Fortalecer a colaboração e a partilha de informação entre investigação, extensão, agricultores e organizações de agricultores Envolver vários intervenientes e promover uma cultura de ação-investigação para garantir que a investigação está orientada para os problemas, direcionada para a procura e sensível ao género. Capitalizar sobre as tecnologias de informação e comunicação para envolver agricultores na investigação, melhorar informações de mercado e partilhar as melhores práticas. Fortalecer plataformas de partilha de conhecimento ao nível nacional, regional e global para facilitar o acesso a ferramentas, métodos, informações de bases de dados, e associar o conhecimento científico e tradicional."},{"index":2,"size":91,"text":"6. Promover o cultivo de NUS através de campanhas de consciencialização para as oportunidades comerciais que oferecem e os seus benefícios agronómicos e nutricionais Realizar campanhas em áreas urbanas para promover alimentos variados com base em culturas locais em parceria com chefes, supermercados, a indústria hoteleira e os meios de comunicação. Consciencializar os agricultores e as comunidades, e particularmente as mulheres, para os benefícios nutricionais de uma dieta variada que inclua NUS. Associar políticas e programas agrícolas, e de saúde e nutrição para promover uma abordagem à nutrição baseada nos alimentos."},{"index":3,"size":50,"text":"7. Aumentar o apoio à conservação de NUS no campo do agricultor, in situ e ex situ, e fortalecer os sistemas de sementes Desenvolver estratégias de conservação a longo prazo para NUS e os seus parentes silvestres que combinem a conservação ex situ, in situ e no campo do agricultor. "}]},{"head":"Recomendações","index":14,"paragraphs":[{"index":1,"size":181,"text":"Incluir NUS em políticas nacionais e internacionais que abordam questões globais tais como a redução da fome, a subnutrição e a pobreza, e a adaptação às alterações climáticas e alcançando uma agricultura sustentável. Estabelecer listas nacionais e regionais de NUS prioritárias nas quais focalizar os esforços de investigação e desenvolvimento. Apoiar a investigação interdisciplinar de NUS e promover ações com os vários intervenientes para fomentar a sua utilização. Apoiar o desenvolvimento de cadeias de valor e pequenos agronegócios para NUS prioritárias. Fortalecer a colaboração e a partilha de informações sobre NUS entre investigadores, extensionistas, agricultores, organizações de agricultores e comerciantes. Promover a utilização de NUS através de campanhas de conscienlização para as oportunidades comerciais que oferecem e os seus benefícios agronómicos e nutricionais. Aumentar o apoio à conservação de NUS nos campos dos agricultores, in situ e ex situ, e fortalecer os seus sistemas de sementes formais e informais. Apoiar agricultores guardiães e reconhecer os direitos dos agricultores de partilhar os benefícios resultantes de NUS. Fortalecer a capacidade de indivíduos e instituições nos domínios da investigação, educação e desenvolvimento de NUS."}]}],"figures":[{"text":" Este documento foi produzido com o apoio financeiro do CTA. As opiniões aqui expressas pertencem ao Bioversity International e, portanto, em caso algum refletem a opinião oficial do CTA. Todas as fotos são uma cortesia de Bioversity International. Capa: Y.Wachira; p.3 P.Rudebjer; p.5 P.Bordoni; p.6 Y.Wachira; p.7 in text: S.Padulosi, on the right: P.Rudebjer; p.8 S.Padulosi; p.11 B.Vinceti. "},{"text":" Avanço do desenvolvimento agrícola e rural através de cadeias de valor para NUS Adaptado dePadulosi et al., 2013  ausência de classificação, o fornecimento irregular, as normas de segurança alimentar, e outros. Mas, com o apoio certo, pode haver um progresso rápido. O apoio de políticas para investigação e desenvolvimento, juntamente com os investimentos recentes, levou ao desenvolvimento de cadeias de valor para produtos hortícolas de folha africanos no Quénia, a quinoa no Perú e na Bolívia, o baobá na África do Sul, o pimento-malagueta na América Latina e painços menores na Índia.    Remoção de uma barreira  Remoção de uma barreira    comercial para o fruto em  comercial para o fruto em    pó do baobá   pó do baobá    A PhytoTrade Africa, uma  A PhytoTrade Africa, uma    associação comercial sem fins  associação comercial sem fins    lucrativos baseada na afiliação, na  lucrativos baseada na afiliação, na    África do Sul, apoia o  África do Sul, apoia o    desenvolvimento de cadeias de  desenvolvimento de cadeias de    valor e mercados na indústria dos  valor e mercados na indústria dos    produtos naturais na região. Um  produtos naturais na região. Um    dos seus êxitos foi a aprovação em dos seus êxitos foi a aprovação em As parcerias e a ação coletiva ao longo das cadeias de valor são centrais para desenvolver mercados nacionais e internacionais para NUS. Uma abordagem com vários acionistas -envolvendo, por exemplo, cientistas, produtores, comerciantes e decisores políticos -funciona particularmente bem na análise de restrições e oportunidades, desenvolvendo capacidade segurança da exportação fruto em pó do baobá na União Europeia como ingrediente alimentar. O baobá, cultivado em áreas de planícies quentes e secas, produz frutos que são secados e moídos para fazer um pó nutritivo. Depois, já pode ser exportado para uso na indústria alimentar europeia.  As parcerias e a ação coletiva ao longo das cadeias de valor são centrais para desenvolver mercados nacionais e internacionais para NUS. Uma abordagem com vários acionistas -envolvendo, por exemplo, cientistas, produtores, comerciantes e decisores políticos -funciona particularmente bem na análise de restrições e oportunidades, desenvolvendo capacidadesegurança da exportação fruto em pó do baobá na União Europeia como ingrediente alimentar. O baobá, cultivado em áreas de planícies quentes e secas, produz frutos que são secados e moídos para fazer um pó nutritivo. Depois, já pode ser exportado para uso na indústria alimentar europeia.   Selecionar  Adicionar  SelecionarAdicionar   e cultivar  valor  e cultivarvalor Resgatar a  Selecionar as Melhorar o Reduzir custos de Desenvolver Resgatar aSelecionar asMelhorar oReduzir custos deDesenvolver diversidade  melhores processamento transação cadeias de valor diversidademelhoresprocessamentotransaçãocadeias de valor Mapear a  variedades Melhorar o tempo Aplicar normas de Comercializar Mapear avariedadesMelhorar o tempoAplicar normas deComercializar diversidade  Desenvolver as de prateleira qualidade Desenvolver marcas diversidadeDesenvolver asde prateleiraqualidadeDesenvolver marcas Preservar o  melhores práticas Melhorar o Desenvolver novos Desenvolver Preservar omelhores práticasMelhorar oDesenvolver novosDesenvolver conhecimento Melhorar os transporte e produtos: plataformas de conhecimentoMelhorar ostransporte eprodutos:plataformas de indígena  sistemas de distribuição saudáveis múltiplos indígenasistemas dedistribuiçãosaudáveismúltiplos Conservar a  sementes Desenvolver nutritivos, participantes Conservar asementesDesenvolvernutritivos,participantes diversidade in situ in situ e cooperativas orgânicos Criar ambientes diversidadein situ in situecooperativasorgânicosCriar ambientes ex situ ex situ    especiais favoráveis ex situ ex situespeciaisfavoráveis Caracterizar,    Caracterizar, utilizar e conservar a diversidade Melhorar tecnologias de pós-colheita  Desenvolver mercados utilizar e conservar a diversidadeMelhorar tecnologias de pós-colheitaDesenvolver mercados genética     genética  "}],"sieverID":"99ca367a-2620-4dc1-afc9-83b8867f073b","abstract":""}

data/part_4/03f4dfbe4acc9fd0c513cae67d4acf80.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03f4dfbe4acc9fd0c513cae67d4acf80","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/962478c2-16fe-417a-928f-d9b6f77f257d/retrieve"},"pageCount":58,"title":"Women's Empowerment in Agrifood Governance (WEAGov) Assessment Framework","keywords":[],"chapters":[{"head":"What is WEAGov?","index":1,"paragraphs":[{"index":1,"size":37,"text":"-WEAGov -the Women's Empowerment in Agrifood Governance -is an assessment framework and tool to measure women's voice and empowerment in the agrifood policy process At each stage of the policy process, WEAGov focused on 3 key questions"},{"index":2,"size":28,"text":"• How policies take into account different needs and priorities of men and women • Includes things like setting gender targets and collecting gender-disaggregated data Are women considered?"},{"index":3,"size":34,"text":"• Opportunities for women to meaningfully weigh in on how policies affect them • Includes things like input on policy design, feedback on policy implementation, and representation among organizations implementing policies Are women included?"},{"index":4,"size":11,"text":"• Ability to act with other women to shape policy choices "}]},{"head":"WEAGov Nigeria Pilot Study Processes","index":2,"paragraphs":[]},{"head":"Data collection activity #1 Policy Compilation and Content Analysis","index":3,"paragraphs":[{"index":1,"size":33,"text":"Checklist used in the policy content analysis ❑ Expert identification: (1) From the organization survey, we asked the organization heads to respond to the expert survey or recommend other key staff to respond;"},{"index":2,"size":36,"text":"(2) From a list of agrifood key stakeholders that APRNet have compiled and worked with in the past, we contacted these stakeholders to respond.  3. Does it make sense to aggregate measurements into single Indicator Score?"},{"index":3,"size":1,"text":"•"},{"index":4,"size":10,"text":"In most indicators, we apply simple average across the measurements"}]},{"head":"•","index":4,"paragraphs":[{"index":1,"size":11,"text":"In a few indicators, we apply different weights for each measurement"},{"index":2,"size":16,"text":"• Please comment on the weights and aggregation, and whether they make sense, and suggest improvements."}]},{"head":"4.","index":5,"paragraphs":[{"index":1,"size":30,"text":"Is there any indicator that you think is missing that would be important for understanding women's empowerment in this stage of the policy process?  Indicator 5: Gender-responsive budgeting (measurements 1-3)"},{"index":2,"size":9,"text":"No agrifood ministry conduct gender-responsive budgeting exercise (past administration)"},{"index":3,"size":11,"text":"17% of sample organizations reported allotting some budget for gender-related activities"},{"index":4,"size":19,"text":"• Affirmative action and gender quotas to ensure more opportunities for hiring women, especially in agrifood policy implementing agencies"},{"index":5,"size":14,"text":"• Gender sensitive and inclusive curriculum in agriculture at the elementary and high school"},{"index":6,"size":11,"text":"• Legislate policies to establish gender-responsive budgeting within agrifood government agencies."},{"index":7,"size":6,"text":"• Capacity building on gender-responsive budgeting"}]},{"head":"Policy Implications (3)","index":6,"paragraphs":[{"index":1,"size":58,"text":"• More research and evaluation on gender implications of agrifood policies o More gender-disaggregated data on women in the agri-food sector, especially on issues related to access and control of resources and women's empowerment o Capacity building for collecting these data • Policy review committees can be set up to periodically review progress toward these gender policy targets"},{"index":2,"size":41,"text":"• Although the National Gender Policy in Agriculture achieves high scores for its attention to gender goals and for bringing together strong inputs and influence of women into the policy process, it falls short on implementation, budgetary support, monitoring, and evaluation."},{"index":3,"size":29,"text":"→The FMAFS should ensure that this policy has a specific and dedicated budget line and is well-integrated into the country's agricultural development plan is essential to securing its implementation"}]},{"head":"Policy implications (4)","index":7,"paragraphs":[{"index":1,"size":33,"text":"• Given the existing strength of civil society organizations in women's leadership and representation, these organizations can provide policymakers with critical inputs on policy design and policy feedback and should be extensively consulted."},{"index":2,"size":42,"text":"• Despite the difficulty of taking concrete steps to increase women's representation in parliament and among cabinet ministers, both government ministries and civil society organizations can ensure women's ability to take on public and visible leadership roles in the agrifood policy process."},{"index":3,"size":45,"text":"• In the long term, changing attitudes and norms related to gender will require advocacy and providing more training on confidence building and leadership for girls and women at very young ages, as well as conducting gender-transformative campaigns that target girls, boys, women, and men."}]},{"head":"Meet our TEAM","index":8,"paragraphs":[]}],"figures":[{"text":" in-depth discussion per measurement per indicator and the corresponding survey question and data 10 experts from research team, ministries, academe, and policy experts For each indicator, participants discussed: 1. What do you think about the accuracy of the way in which we are measuring the indicator? • Please focus here on the way the survey question is phrased, the data sources, and the overall way the concept is being measured • Please make concrete suggestions for improvement when possible 2. What do you think about the validity of the results for Nigeria for this indicator based on your experience and expertise? • Please focus here on whether the results for Nigeria for this indicator seem accurate and valid to you based on your experience • Please make concrete suggestions for what you would have expected the results to be for this indicator and why. Does the result seem high or low to you? • What are the implications of the results/scores on policy and programming? "},{"text":" Women's policy design leadership (perception measures) "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"stages of the policy process  Policy evaluation & reform • How policies are assessed against their objectives to know if changes are needed Agenda setting, Policy design, and Policy adoption Agenda setting, Policy design, and Policy adoption: • Why certain social and economic problems emerge as topics for policy debate • How policy solutions are designed • Which policy solutions are ultimately adopted Policy evaluation & reform • How policies are assessed against their objectives to know if changes are neededAgenda setting, Policy design, and Policy adoptionAgenda setting, Policy design, and Policy adoption: • Why certain social and economic problems emerge as topics for policy debate • How policy solutions are designed • Which policy solutions are ultimately adopted Policy evaluation & reform  Policy implementation Policy implementation • How policies are implemented in practice, including budgetary outlays, organizational strategies, and delivery of services Policy evaluation & reformPolicy implementationPolicy implementation • How policies are implemented in practice, including budgetary outlays, organizational strategies, and delivery of services  "},{"text":"Our Approach Stage 1 - 2022 Stage 2 -2023 Stage 3 - 2024/25 WEAGov Theory Index review KII KII - Round 2 Piloting Expert feedback Scaling partners Peer review Piloting refined tool Nigeria Pilot  -  Niche Agrifood policy & stakeholder indicators (17 → 11)  Tractability -Scored content analysis of 4 primary AFS Scalability -Niche Agrifood policy & stakeholder indicators (17 → 11)Tractability -Scored content analysis of 4 primary AFS Scalability Challenges - -- Identify unique niche for new tool given existing indexes Many indexes already exist Need to locate niche where we can add mapping Refine and validate surveys in preparation for 2nd pilot (India) Desk review of objective, Deliberate with experts on measurement, scoring and quantitative indicators validity Positive feedback from greater process empowerment to more resources for Positive feedback from greater process empowerment to more resources for Indicators collected by APRNet research Women's voice, governance, and CC-AFS Find tractable ways of measuring complex concepts are each multidimensional concepts policies, 15 subsector policies Ensure that toolkit is replicable and scalable Measurement approach needs to be context-specific, yet allow for comparisons across countries -team Challenges ---Identify unique niche for new tool given existing indexes Many indexes already exist Need to locate niche where we can add mapping Refine and validate surveys in preparation for 2nd pilot (India) Desk review of objective, Deliberate with experts on measurement, scoring and quantitative indicators validityPositive feedback from greater process empowerment to more resources for Positive feedback from greater process empowerment to more resources for Indicators collected by APRNet research Women's voice, governance, and CC-AFS Find tractable ways of measuring complex concepts are each multidimensional concepts policies, 15 subsector policies Ensure that toolkit is replicable and scalable Measurement approach needs to be context-specific, yet allow for comparisons across countries -team value, and where there is demand Organization survey 2nd round of key information -  women women 141 unique organizations -including Need to conceptualize and measure each credibly, while creating something tractable Cannot be too expensive for partners - value, and where there is demand Organization survey 2nd round of key information -women women 141 unique organizations -including Need to conceptualize and measure each credibly, while creating something tractable Cannot be too expensive for partners - interviews & expert feedback helped us federal and state AFS ministries, interviews & expert feedback helped usfederal and state AFS ministries, influencing? Emphasis on national-level to start Expert survey • Are women • Landscape analysis of existing indexes and assessment frameworks • Located gap at nexus of agrifood, gender & governance further refine presentation, -communication, content, measurement, and scoring • Includes things like women playing leadership roles in organizations that play a role in the agrifood policy process tools & infographics to display complex ideas in intuitive ways down versions -241 AFS policy experts from within these allowing for scaled-up and scaled-• Create conceptual framework that is both theory-driven and informed by stakeholder consultations • Considerable effort on communication • Full measurement relatively inexpensive per country • Each indicator has measurements that derive from different data sources, parastatals, independent agencies, CSOs, Private sector, & universities influencing? Emphasis on national-level to start Expert survey • Are women • Landscape analysis of existing indexes and assessment frameworks • Located gap at nexus of agrifood, gender & governance further refine presentation, -communication, content, measurement, and scoring• Includes things like women playing leadership roles in organizations that play a role in the agrifood policy process tools & infographics to display complex ideas in intuitive ways down versions -241 AFS policy experts from within these allowing for scaled-up and scaled-• Create conceptual framework that is both theory-driven and informed by stakeholder consultations • Considerable effort on communication • Full measurement relatively inexpensive per country • Each indicator has measurements that derive from different data sources, parastatals, independent agencies, CSOs, Private sector, & universities     organizations organizations -  Technical workshop  - Held in Abuja, May 2023 -Technical workshop-Held in Abuja, May 2023  "},{"text":"WEAGov Scoring - 11 indicators → 44 measurement  WEAGov: Functionality and usability  WEAGov: Functionality and usability -Use #1: Tracking major agrifood policies to Every measurement receives a score: Use #2: Identify key organizational and institutional gaps in women's voice and identify where plans may be falling short -Use #1: Tracking major agrifood policies to Every measurement receives a score: Use #2: Identify key organizational and institutional gaps in women's voice and identify where plans may be falling short     agency in the national-level policy Scale Definition Implication Nigeria (of 44) process agency in the national-level policy Scale Definition Implication Nigeria (of 44) process Agricultural Development Plan Design Implementation Evaluation 1 2 3 Very weak Weak Moderate Advancing Low On the way Policy Evaluation 15 18 10 Policy Design Agricultural Development PlanDesignImplementationEvaluation1 2 3Very weak Weak Moderate Advancing Low On the way Policy Evaluation15 18 10 Policy Design Food &    4 Strong At goal 1 Food &4StrongAt goal1 Nutrition Policy   - Some scores are based on scored content analysis Nutrition Policy-Some scores are based on scored content analysis    - Some scores are based on objective levels (e.g., Policy share of women staff in agrifood ministries) Implementation -Some scores are based on objective levels (e.g., Policy share of women staff in agrifood ministries) Implementation Climate policy       Climate policy  "},{"text":"participation in the policy formulation process Important quotes and discussion of gender within the key policy objectives identified in the policy, strategy, or development plan o Evidence in the policy document (or drafts, media coverage, others) on the consultative processes o Evidence in the policy document (or drafts, media coverage, others) on the consultative processes undertaken? Included description here (with reference to women, different types of women, marginalized undertaken? Included description here (with reference to women, different types of women, marginalized groups, ethnic groups) groups, ethnic groups)  "},{"text":"on gender consideration in major AFS policies  Score 1 2 Name of policy 1. National Gender Policy in Agriculture Definition No or little mention of \"gender\" or \"women\" in the policy document some discussion of gender but lacks any specific gender-related goals or targets Year Gender Score (1-4) 2021-2026 4 2. National Food and Nutrition Policy in Nigeria 2016-2025 3 3. National Climate Change Policy for Nigeria (NCCP) 2021-2030 3 4. National Agricultural Technology and Innovation Policy (NATIP) 2022-2027 2 5. Agricultural Promotion Policy (APP) 2016-2020 2 Policy content analysis (19 major agrifood policies reviewed) Data collection activity #2 Organization survey Geopolitical zone Count Federal-level 43 State-level Bauchi (North East) 24 Goal: To understand national policy formulation, ❑ Sampling: 40 experts targeted in each of the 5 states which is at the federal level, and track policy and at federal-level (Abuja). Actual sample: 241 experts implementation and evaluation, which are at state and local levels. ❑ Target respondents: (1) Leaders, managers, or decision-Delta (South South) 22 Enugu (South East) 10 Kogi (North Central) 16 Ondo (South West) 26 Total 141 Sampling: diverse organizations involved (actually or potentially) in agrifood policy makers in the diverse agrifood organizations (identified in the organization survey), (2) experts in agrifood policy, Data collection #3 or (3) gender contacts for any gender-specific formulation, implementation, and evaluation at Expert survey federal-and state-level. programming in the AFS organizations. % 30% 17% 16% 7% 11% 18% 100% Score 1 2 Name of policy 1. National Gender Policy in Agriculture Definition No or little mention of \"gender\" or \"women\" in the policy document some discussion of gender but lacks any specific gender-related goals or targets Year Gender Score (1-4) 2021-2026 4 2. National Food and Nutrition Policy in Nigeria 2016-2025 3 3. National Climate Change Policy for Nigeria (NCCP) 2021-2030 3 4. National Agricultural Technology and Innovation Policy (NATIP) 2022-2027 2 5. Agricultural Promotion Policy (APP) 2016-2020 2 Policy content analysis (19 major agrifood policies reviewed) Data collection activity #2 Organization survey Geopolitical zone Count Federal-level 43 State-level Bauchi (North East) 24 Goal: To understand national policy formulation, ❑ Sampling: 40 experts targeted in each of the 5 states which is at the federal level, and track policy and at federal-level (Abuja). Actual sample: 241 experts implementation and evaluation, which are at state and local levels. ❑ Target respondents: (1) Leaders, managers, or decision-Delta (South South) 22 Enugu (South East) 10 Kogi (North Central) 16 Ondo (South West) 26 Total 141 Sampling: diverse organizations involved (actually or potentially) in agrifood policy makers in the diverse agrifood organizations (identified in the organization survey), (2) experts in agrifood policy, Data collection #3 or (3) gender contacts for any gender-specific formulation, implementation, and evaluation at Expert survey federal-and state-level. programming in the AFS organizations.% 30% 17% 16% 7% 11% 18% 100% 3 4 6. National Fisheries and Aquaculture Policy has gender-related goals but lacks specific measurable targets and details of how to track them has gender-specific goals with specific measurable targets in the results framework and implementation plan; exemplary in its focus on gender equality and women's empowerment. Early 2000s 1 7. National Forest Policy 2020-2030 1 8. Nigerian Vision 20: 2020 2009-2020 9. Feed Africa: Strategies for Agricultural Transformation in Africa 2022-2025 10. Trade Policy of Nigeria 2023-2027 11. Revised National Policy on the Environment 2016 12. Agricultural Manpower Development and Training policy 2005 13. Land Use Policy 2013 2013 14. National Water Policy 2016 15. Agricultural By-product Policy NA 16. National Policy on Rural Infrastructure NA 17. Agricultural Statistics and Databank Policy NA 18. Industrial Crop Production Policy NA 19. National Policy on Food Safety and its Implementation Strategy (NPFSIS) 2014 Respondent: head/representative of agrifood organizations Duration: 30-60 minutes Methods: Questionnaire programmed in CAPI; administered in (1) in-person interview; (2) phone interview; or (3) respondents filling out the questionnaire online Government/Ministry Private Sector NGOs/CSOs Multilateral Organizations Academia / Scientific Community Organization Type Count Federal ministry State ministry Federal parastatal Duration: 30-90 minutes State parastatal Independent governmental agency Civil society organization / Non-governmental organization Private sector Research institution /University Total sample Methods: Questionnaire programmed in CAPI; administered in (1) in-person interview; (2) phone interview; or (3) respondents filling out the questionnaire online % 6% 14% 4% 15% 1% 27% 21% 100% 12% 3 4 6. National Fisheries and Aquaculture Policy has gender-related goals but lacks specific measurable targets and details of how to track them has gender-specific goals with specific measurable targets in the results framework and implementation plan; exemplary in its focus on gender equality and women's empowerment. Early 2000s 1 7. National Forest Policy 2020-2030 1 8. Nigerian Vision 20: 2020 2009-2020 9. Feed Africa: Strategies for Agricultural Transformation in Africa 2022-2025 10. Trade Policy of Nigeria 2023-2027 11. Revised National Policy on the Environment 2016 12. Agricultural Manpower Development and Training policy 2005 13. Land Use Policy 2013 2013 14. National Water Policy 2016 15. Agricultural By-product Policy NA 16. National Policy on Rural Infrastructure NA 17. Agricultural Statistics and Databank Policy NA 18. Industrial Crop Production Policy NA 19. National Policy on Food Safety and its Implementation Strategy (NPFSIS) 2014 Respondent: head/representative of agrifood organizations Duration: 30-60 minutes Methods: Questionnaire programmed in CAPI; administered in (1) in-person interview; (2) phone interview; or (3) respondents filling out the questionnaire online Government/Ministry Private Sector NGOs/CSOs Multilateral Organizations Academia / Scientific Community Organization Type Count Federal ministry State ministry Federal parastatal Duration: 30-90 minutes State parastatal Independent governmental agency Civil society organization / Non-governmental organization Private sector Research institution /University Total sample Methods: Questionnaire programmed in CAPI; administered in (1) in-person interview; (2) phone interview; or (3) respondents filling out the questionnaire online% 6% 14% 4% 15% 1% 27% 21% 100% 12%  "},{"text":"Indicator 1: Gender Salience (Measurement 1) Indicator 1: Gender Salience (Measurement 2)  our society.\" Nigeria's 2023 budget presented by Study Results resources fairly and reach vulnerable groups of WEAGov Nigeria Nigeria's 2022 budget speech presented by President Buhari before a joint session of the National Assembly on October 7, 2021: \"The 2022 budget is also the first in our history, where MDAs were clearly advised on gender responsive budgeting. These are part of critical steps in our efforts to distribute *Most cited food policy issues are high fertilizer prices; 50% Within prioritized policy, gender is... fertilizer subsidy; high food prices; nutrition; agricultural credit and insurance, (e.g., Anchor Borrowers Programme); agricultural marketing and value chain development; trade policies (ban for rice importation and reduction of import duties on agrochemical and equipment); agricultural transformation agenda (ATA) and jobs creation our society.\" Nigeria's 2023 budget presented by Study Results resources fairly and reach vulnerable groups of WEAGov Nigeria Nigeria's 2022 budget speech presented by President Buhari before a joint session of the National Assembly on October 7, 2021: \"The 2022 budget is also the first in our history, where MDAs were clearly advised on gender responsive budgeting. These are part of critical steps in our efforts to distribute *Most cited food policy issues are high fertilizer prices; 50% Within prioritized policy, gender is... fertilizer subsidy; high food prices; nutrition; agricultural credit and insurance, (e.g., Anchor Borrowers Programme); agricultural marketing and value chain development; trade policies (ban for rice importation and reduction of import duties on agrochemical and equipment); agricultural transformation agenda (ATA) and jobs creation  40%     President Buhari at the joint session of the 40%President Buhari at the joint session of the       national assembly on October 7, 2022: national assembly on October 7, 2022: % of sample 20% 30%     CHECK OUT THE WORKSHOP REPORT HERE \"WOMEN'S EMPOWERMENT … To harness enable them to productively contribute to the the potentials of all Nigerian women and % of sample20% 30%CHECK OUT THE WORKSHOP REPORT HERE \"WOMEN'S EMPOWERMENT … To harness enable them to productively contribute to the the potentials of all Nigerian women and  10%     economy, we will continue to prioritise 10%economy, we will continue to prioritise  0% Don't know Not discussed at all Sometimes discussed Discussed often women's empowerment programmes across https://doi.org/10.2499/p15738coll2.136826 various MDAs in 2023.\" 0%Don't knowNot discussed at allSometimes discussedDiscussed oftenwomen's empowerment programmes across https://doi.org/10.2499/p15738coll2.136826 various MDAs in 2023.\"  "}],"sieverID":"30cb138b-2335-4432-9dfe-e38d92eb02d9","abstract":""}

data/part_4/041018e3d5789a8c3e8c2cc7add91465.json

@@ -0,0 +1 @@
+{"metadata":{"id":"041018e3d5789a8c3e8c2cc7add91465","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/0ba78405-d2eb-455c-be0b-2b4894d475af/retrieve"},"pageCount":28,"title":"A promising market for agricultural enterprises","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":65,"text":"How can agriculture produce more food for a rapidly growing population with an increasing appetite for meat and dairy products? How can it provide adequate and nutritious food to 1 billion undernourished people and another billion suffering from micronutrient deficiency or 'hidden hunger'? While addressing these questions, agriculture must also cope with the negative impacts of climate change and reduce its footprint on the environment."},{"index":2,"size":43,"text":"According to the recently released Montpellier Panel report, Sustainable Intensification: A New Paradigm for African Agriculture, the potential exists to produce greater output through sustainable, more efficient use of inputs, while also reducing environmental damage and strengthening resilience, natural capital and environmental services."},{"index":3,"size":104,"text":"In Africa, where food insecurity is most acute, agriculture faces a number of challenges. Firstly, agricultural productivity growth has been very low for many years compared to Asia and Latin America. Growth in Africa has largely come through cultivation of new land and greater use of fertilisers. As a recent IFPRI report noted, sub-Saharan Africa faces the biggest challenge in achieving long-term productivity growth in its agricultural sector. Secondly, some projections show that crop production could decrease by 10-20% in certain parts of Africa as a result of climate change. Thirdly, in many African countries, postharvest losses make a significant dent in food availability."},{"index":4,"size":54,"text":"The Montpellier Panel report notes that intensification could take a genetic, ecological or socio-economic dimension. From intercropping to agroforestry, integrated pest management and micro-dosing, smallholder farmers in Africa are using sustainable intensification techniques to address the continent's food and nutrition crisis. CTA co-hosted the report's launch in Brussels at the end of May 2013."}]},{"head":"Michael Hailu Director -CTA","index":2,"paragraphs":[]},{"head":"Sustainable intensification","index":3,"paragraphs":[{"index":1,"size":70,"text":"\"G reen business is the DNA of agricultural activities -everything is biodegradable,\" claims Thierry Téné, A2D Conseil director and cofounder of the Institut Afrique RSE which promotes green business and sustainable development in Africa. Three green economy sectors are promoted: environmental goods and services, such as waste treatment activities; low-carbon products, for instance agricultural projects designed to reduce reliance on chemical fertilisers or increase organic fertiliser use; and renewable energy."},{"index":2,"size":163,"text":"Waste management and use are advanced green agricultural business activities, with Mauritius being a model in this respect. The agricultural sector of this island is based on the sugar industry and nearly after milling sugarcane. The government instituted an incentive policy in 1985 to promote cogeneration development and ensured that income from electricity The energy production potential of agricultural waste, such as sisal residue, coffee and rice husks, banana leaves, wood and cotton industry waste, is growing. With rising energy costs and growing demand, the recovery of these wastes has become an economic boon. However, as Téné points out, an \"incentive-based legislative framework\" is required. Generating electricity over and above that needed to run a plant, for instance, is useless if the laws do not allow autonomous energy generation or if power transmission networks are lacking. Téné adds that the Cameroonian investment code has just been amended accordingly and that Côte d'Ivoire has created a Green Economy department within its Ministry of Environment."},{"index":3,"size":60,"text":"The situation is similar with regard to the dissemination of renewable energy in the agricultural community. A broad range of techniques involving windmills to power irrigation water pumps or generate electricity to supply processing plants, and small hydropower units to run tea smokehouses, have proven effective in many countries while reducing greenhouse gas emissions and enhancing energy reliability and availability."},{"index":4,"size":9,"text":"These projects are often supported by donors or NGOs."}]},{"head":"GREEN BUSINESS","index":4,"paragraphs":[]},{"head":"A promising market for agricultural enterprises","index":5,"paragraphs":[{"index":1,"size":16,"text":"A technician from Groupe Rougier measures tree diameter as part of FSC forestry certification in Gabon"},{"index":2,"size":60,"text":"Preserving forests, conserving water and recycling waste contribute to making agriculture more sustainable. These environment-friendly activities have created a promising market for agricultural enterprises, offering direct economic benefits for both smallholders and large multinational companies while giving them an opportunity to showcase their 'social responsibility'. But the green business is still in its infancy and a rocky road lies ahead."},{"index":3,"size":62,"text":"\"Funding issues arise when striving to boost the renewable energy supply because wind or solar equipment is more expensive than thermal equipment,\" says Philippe mechanisms must be developed for technology dissemination and, in this respect, Senegal has devised ways to promote them. Research and development is another key nanced under corporate social responsibility (CSR) programmes by public and private sectors,\" he adds."}]},{"head":"Deforestation -a growing concern","index":6,"paragraphs":[{"index":1,"size":129,"text":"Doing green business is also sometimes necessary in certain markets -a constraint that may turn into oil palm sectors. In the forestry sector, the French company Groupe Rougier, which logs over 2 million ha requirements to obtain Forest Stewardship Council (FSC) economically motivated. The FSC compliance process is presently voluntary, but also a response to pressure exerted for decades by civil society organisations, and NGOs, on operators involved in tropical timber harvesting and trade. \"Despite the high costs and betting on the future,\" says Paul-Emmanuel Huet, head of environmental and socially responsible development in Gabon represents an annual outlay of €1 million, excluding initial investments and direct costs associated with the decreased production. However, the group's label has also given it a competitive edge and opened up new markets."},{"index":2,"size":110,"text":"In the oil palm sector, pressure from environmental NGOs has prompted many global brands in the food industry to opt for sustainable Roundtable on Sustainable Besides these market obligations, African civil societyincreasingly mindful of environmental and social issues -is becoming mobilised, especially through the media, which is developing and becoming more professional. However, as is still the main motive for a company to get involved in green business. African consumers are increasingly aware of the environmental impact, but that does not necessarily result in sanctions.\" There is no real trend towards boycotting palm oil in Africa like there is in Europe, where many consumers prefer to buy 'palm oil-free' products."}]},{"head":"Opting for a green economy","index":7,"paragraphs":[{"index":1,"size":79,"text":"New companies may decide to be environmentally responsible, or 'green', right from the start, like the DPM Poultry Farm, a Senegalese start-up in the poultry sector. This company opted to comply with green and has set an example by promoting local chicken. Poultry chicks, purchased at a preset price, are sourced through a local network of women farmers. These women are trained and will be associated with the second phase of the project devoted to processing, conditioning and packaging."},{"index":2,"size":100,"text":"Overall, the company integrates sustainable development concepts in all farm activities, for instance by using a battery cage system to ensure sustainable water management; green aluminium sheeting rather power supply in buildings. \"Heavy investment is initially term,\" says Sene Pathe, the company's 'green man'. He adds, \"an aluminium roof is six times more expensive, but it improves productivity by providing an effective heat shield, therefore reducing the poultry mortality rate.\" The DPM Poultry Farm also manages its waste by collecting and bagging the methane-rich poultry droppings, and this material is then sold directly to local farmers as a natural fertiliser."},{"index":3,"size":32,"text":"Distinguishing between 'sustainable development', the 'green economy', 'CSR' and 'green business' may be confusing, but these different concepts all address the same challenge -to increase agricultural productivity while reducing the environmental footprint."},{"index":4,"size":15,"text":"A Senegalese women's enterprise and Aikaudi Labo explain their activities to promote local forest products"}]},{"head":"COVER STORY","index":8,"paragraphs":[]},{"head":"Editors note","index":9,"paragraphs":[{"index":1,"size":17,"text":"The \"to find out more\" box is available only on the online version of this issue. www.spore.cta.int"}]},{"head":"RICE","index":10,"paragraphs":[{"index":1,"size":63,"text":"A marriage of convenience de recherches agricoles, and the Africa Rice Centre have joined forces to boost rice production in 11 target countries. The partnership, which is being implemented under the Global Rice Science Partnership, aims to help efficient rice cropping technologies should be considerably enhanced. Remarkable progress has already been made on marker-assisted selection, disease and pest resistance and tolerance to salinity."},{"index":2,"size":98,"text":"By transferring two different genes from green pepper (Capsicum annuum) to bananas, researchers at the Kawanda Agricultural Research Institute in Uganda have developed new transgenic banana varieties that are resistant to banana bacterial wilt disease. Eastern Africa has paid a heavy price for this disease which causes gradual yellowing and wilting of leaves, early fruit ripening and pulp discolouration. Losses due to the disease can amount to several million dollars each year in the region. Africans' food security, income and health are at risk because of the rapid spread of Xanthomonas, the pathogen that causes this banana disease."},{"index":3,"size":75,"text":"Maize parental lines and hybrids with high levels of drought tolerance have been maturing maize genotypes developed and conserved by the International Institute for Tropical Agriculture (IITA). The study, maturing maize inbred lines and hybrids over 2 years across six agroecological zones of Nigeria, found that 48% were drought tolerant. To spot signs of drought tolerance, researchers also carried out assessment of hybrids under drought stress, molecular characterisation, and genetic analysis for drought tolerant genes."},{"index":4,"size":86,"text":"IITA's Muhyideen Oyekunle found that hybrids performed better than open-pollinated varieties under drought conditions. With the production of maize -one of Africa's key staples -impacted by the recurrence of drought, drought tolerant early and extraearly maturing cultivars could help farmers manage their risk of drought and consistently produce more food. In West Africa, early and extra-early maturing maize varieties and hybrids, made available to farmers by IITA, are being widely adopted to the extent that maize cultivation is largely replacing sorghum and millet in savanna ecologies."}]},{"head":"NEW VARIETIES","index":11,"paragraphs":[]},{"head":"Drought-tolerant beans","index":12,"paragraphs":[{"index":1,"size":55,"text":"Four new, drought-tolerant bean varieties developed by the Kenya Agricultural Research Institute require only residual moisture for germination and take just 65 days to mature, compared to 90-120 days for traditional varieties. The beans, which are fuel-e cient, taking less time to cook, are being grown by farmers in Burundi, Ethiopia, Kenya, Tanzania and Uganda."}]},{"head":"SOLAR POWER","index":13,"paragraphs":[]},{"head":"Fighting pests and pathogens","index":14,"paragraphs":[{"index":1,"size":52,"text":"practice called 'solarisation' to fight pests and pathogens in the soil. Solarisation involves covering weeks before crop sowing. The sun's radiant energy is trapped beneath borne pests and pathogens, including weeds, nematodes and insects. The practice, which can save on costs of pesticides and can protect the soil for up to five"}]},{"head":"FOOD SECURITY","index":15,"paragraphs":[]},{"head":"Stopping the crop stealers","index":16,"paragraphs":[{"index":1,"size":61,"text":"In St Lucia, the Ministry of Agriculture has stepped up the activity of its Praedial Larceny Unit. A campaign of town hall meetings is highlighting the consequences of praedial larceny (stealing crops from the field) and its impact on the St Lucian economy. So far 50% of the rural areas have been covered, with the campaign also addressing theft from fisheries."}]},{"head":"BANANA","index":17,"paragraphs":[]},{"head":"Resisting disease","index":18,"paragraphs":[]},{"head":"BREEDING","index":19,"paragraphs":[]},{"head":"Drought tolerant early maturing maize","index":20,"paragraphs":[{"index":1,"size":74,"text":"Members of the Koam cooperative in Vohibary, in the eastern coastal region of Madagascar, have been able to quickly increase their incomes by acquiring a rice husking machine and learning how the 12 cooperative members to buy rice their pig farming activities and purchase to boost their incomes, they also ran the machine and managed their activities concerning husking payments (in cash or in kind), and developed a true spirit of ownership and initiative."}]},{"head":"PERMACULTURE","index":21,"paragraphs":[]},{"head":"Grow your own","index":22,"paragraphs":[{"index":1,"size":94,"text":"An Australian permaculture expert, Rosemary Morrow, is encouraging Solomon Islanders to adopt a 'live local' approach by growing their own foods or buying local products. This ensures food security while supporting the islands' economy, which relies heavily on imports of rice, noodles and other processed products. Morrow says that a key aspect of permaculture is that communities are self reliant, especially in times of disaster. She recommends that people grow yams, taro, onions, sweet potatoes, chives, garlic and ginger in addition to perennial crops that make the soil less vulnerable to landslides and erosion."}]},{"head":"BIOTECHNOLOGY","index":23,"paragraphs":[]},{"head":"Micropropagated oil palm","index":24,"paragraphs":[{"index":1,"size":37,"text":"has developed so-called 'high-producing' or 'elite' hybrid oil palm plantlets through in vitro all virtually identical to the source plant. In practice, these micropropagated plants can non-micropropagated palms. Around 1,000 ha have been sown with these new"}]},{"head":"CREDIT","index":25,"paragraphs":[]},{"head":"Supplying seeds and skills","index":26,"paragraphs":[{"index":1,"size":53,"text":"The Lima Credit Scheme, run by Zambia's Zanaco Bank, provides maize, soybean, sunflower and groundnut seeds on credit to over 12,000 farmers. From loaning €90,000 4 years ago, the scheme loans €5.5 million today. The initiative also passes on skills in agronomy to improve small-scale farmers' productivity and profits and sustain their livelihoods."}]},{"head":"HORTICULTURE","index":27,"paragraphs":[]},{"head":"Mini-greenhouses multiply","index":28,"paragraphs":[{"index":1,"size":52,"text":"To boost production of quality vegetables, the Barbados Ministry of Agriculture has initiated a miniature greenhouse project. Vegetables grown using the greenhouses are healthier, mature faster and are also disease free, prompting a number of small producers to adopt the technology. Minigreenhouses may soon be commonplace in small-scale horticulture on the island."}]},{"head":"RICE","index":29,"paragraphs":[]},{"head":"A fertile plain","index":30,"paragraphs":[]},{"head":"MECHANISATION","index":31,"paragraphs":[]},{"head":"Proper use of a rice husker","index":32,"paragraphs":[{"index":1,"size":93,"text":"Rice is again being grown on the vast fertile Ruzizi plain south of Bukavu, the capital of South Kivu province in the Democratic Republic of Congo, with the support of NGOs and Bukavu's higher education institution, Institut supérieur de développement rural. The use of tractors and husking machines has helped farmers in agricultural cooperatives obtain better crop yields. Engineers also regularly instruct methods. These enhancements have enabled farmers to increase rice yields from a few now. Every tonne is currently being bought by Bralima Brewery in Bukavu, which produces beer and soft drinks. "}]},{"head":"SATELLITE TECHNOLOGY","index":33,"paragraphs":[{"index":1,"size":54,"text":"Marine maps for finding fish upgraded its satellite station to map potential fishing zones and monitor sea surface temperatures, chlorophyll and catching fish, particularly tuna, which migrate according to variations in ocean temperature. The new fishing zone maps, which also show sea temperatures and fisheries zone, mainly exploited by artisanal fishermen in non-motorised boats."}]},{"head":"GOATS","index":34,"paragraphs":[]},{"head":"Rising incomes","index":35,"paragraphs":[{"index":1,"size":81,"text":"According to the International Crops Research Institute rise when goat keepers, buyers and government agencies join forces to create an innovation platform. Such platforms promote discussion and information sharing between stakeholders. This is how goat keepers were persuaded that it is beneficial to sell their goats in December, just before arranged and pens were built to secure the herds. As a result of these innovations, the incomes of small-scale goat sellers -at least a third are women -have approximately © Gregrien"}]},{"head":"HYGIENE","index":36,"paragraphs":[]},{"head":"Marketing top quality fish","index":37,"paragraphs":[{"index":1,"size":90,"text":"Cleaning fishing boats and landing sites with clean water and disinfectant, washing hands and bandaging wounds before fish are handled, and putting fish in ice immediately after landing are all good hygiene and fish handling practices that could reduce post-harvest fish losses, which are estimated at 30-40% in small-scale fisheries in Africa. In Kenya, as part of the EU-funded SmartFish project, the Indian Ocean Commission and FAO have developed a multimedia package to boost the awareness of post-harvest practices among fishers, processors, sellers and consumers of Lake Victoria fisheries products."},{"index":2,"size":35,"text":"With public concerns over hygiene, Nigeria's nomadic Fulani herders struggle to sell their milk and cheese in urban areas, and may some Fulani have begun supplying fresh milk to a multinational beverage company -FrieslandCampina WAMCO."},{"index":3,"size":102,"text":"The company has been selling 'Peak' evaporated milk and milk powder in Nigeria for imported milk, it has built milk collection centres across the country and is providing training to help Fulani herders maximise production and improve hygiene. Herders are ing the traditional calabash, have also been provided, to protect the milk and keep it cool during transport to the collection centres. The milk is then cooled and taken to the company's factory in Lagos. As a result, Fulanis now have an alternative way to market their milk to city dwellers, who trust FrieslandCampina WAMCO to deliver a high quality, safe product."}]},{"head":"DAIRY","index":38,"paragraphs":[]},{"head":"Fulani find urban milk market","index":39,"paragraphs":[]},{"head":"BREEDING","index":40,"paragraphs":[]},{"head":"Hybrid livestock boost output","index":41,"paragraphs":[]},{"head":"FISHERIES AND LIVESTOCK","index":42,"paragraphs":[]},{"head":"YOUTH","index":43,"paragraphs":[{"index":1,"size":60,"text":"The future is organic A programme to build the capacity of youth in organic agriculture has been launched by the Pacific Organic and Ethical Trade Community, the Secretariat of the Pacific Community, UNDP, Oxfam New Zealand and the Tonga National Youth Congress. The objective is to enhance livelihood opportunities by providing mentoring, support and information on organic certification and markets."}]},{"head":"WILDLIFE","index":44,"paragraphs":[]},{"head":"Community land","index":45,"paragraphs":[{"index":1,"size":78,"text":"Maasai herders in northern Tanzania oppose a government 2 wildlife corridor in Loliondo district, between the Serengeti and Ngorongoro conservation areas. The herders argue that their animals cannot survive without access to rangelands. The government, on the other hand, is highlighting the need for conservation areas. So how can conservation, development and people's rights be reconciled? Tanzania could learn Access to these lands is granted to communities identified by their ethnic group, culture or common interest tenure rights."},{"index":2,"size":11,"text":"The worms produce organic fertiliser by feeding on decomposing organic waste"},{"index":3,"size":70,"text":"The Sun International hotel chain in to manage organic waste. Approximately imported from South Africa by FullCycle, a promoter of worm farming as a sustainable and environmentally friendly way of waste disposal. \"This is a very simple but innovative way of managing waste. We view waste as a resource that can be used to feed the soil and the people whilst protecting our lovely environment,\" says Mary Murphy from FullCycle."},{"index":4,"size":62,"text":"The worms feed on a variety of decomposing organic waste and harmful bacteria to pro-teria and hundreds of litres of concentrated liquid fertiliser, known as 'worm tea'. Per Hundreds of farmers from the Livingstone farm by applying the organic fertiliser to their gardens. Numerous hotels and lodges are also getting a steady supply of fresh organic farm produce through this innovative initiative."}]},{"head":"POACHING","index":46,"paragraphs":[]},{"head":"Markets and skills transform lives","index":47,"paragraphs":[{"index":1,"size":54,"text":"In eastern Zambia, the Community Market for Conservation is giving poor, food-insecure families access to markets, inputs and skills that negate the need to poach wildlife or degrade forest resources. Over 20,000 farmers have been trained, €300,000 worth of commodities has been purchased from farmers and 800 poachers have found new sources of livelihood."}]},{"head":"RADIO","index":48,"paragraphs":[]},{"head":"Ears of the environment","index":49,"paragraphs":[{"index":1,"size":61,"text":"WebRadio Fennec, known as the 'ears of the environment', is an educational tool developed by French research organisation, Institut de recherche pour le développement, and partners in Cameroon, the Central African Republic and Morocco. Around 300 students supervised by scientists and journalists investigate local environmental issues and share their findings with the general public through radio broadcasts and a blog (www.webradiofennec.fr)."}]},{"head":"BEEKEEPING","index":50,"paragraphs":[]},{"head":"Farmers abandon tobacco","index":51,"paragraphs":[{"index":1,"size":155,"text":"abandoned their long time cash crop -tobacco -in to cure 1 ha of tobacco, farmers believe the crop is responsible for environmental degradation in the area. \"This was a very green area 10 years ago. But now, the residents have cut down all the trees for tobacco curing,\" says beekeeper Isaiah Marwa. Those who still grow tobacco have to buy firewood from months, equivalent to what a farmer could earn from 3 ha of tobacco in one year. Researchers from the Southern African Development Community, in collaboration with a regional network of scientists, are producing locally adapted and high yielding tea cultivars in response to so far been produced, resulting in the widespread replacement of traditional populations with improved cultivars. \"Very good examples are the tea breeding programmes in Kenya and Malawi that have been on-going for many years,\" says Frank Ngonda, project manager at the Southern African Biochemistry and Informatics for Natural Products Network."},{"index":2,"size":68,"text":"\"Student research is also involved in tea breeding and selection programmes,\" says Ngonda.\" Traditional tea plantations were established using a narrow gene pool, making the crop vulnerable to diseases and adverse weather conditions. The researchers have found vegetatively propagated cultivars to be superior in terms of yield and black tea quality, compared to seedlings, which have been used for breeding by the Tea Research Foundation of Central Africa."}]},{"head":"DISEASES","index":52,"paragraphs":[]},{"head":"Resistant beans","index":53,"paragraphs":[{"index":1,"size":55,"text":"Seven new bean varieties with enhanced disease resistance, and particularly high protein, iron and zinc contents, are being distributed to Cameroonian farmers following tests carried out by the Cameroonian research institute, Institut de recherche agricole pour le développement. These bean varieties were selected from among hundreds distributed in Cameroon by the Pan-Africa Bean Research Alliance."}]},{"head":"FOOD SECURITY","index":54,"paragraphs":[]},{"head":"Digestible sorghum","index":55,"paragraphs":[{"index":1,"size":57,"text":"An international research team has identified the gene expression of an enzyme that naturally increases the energy content and digestibility of sorghum starch. The findings, published in Nature Communications, claim that this discovery could enhance food security. Sorghum is well adapted to growing in drylands, but this cereal has so far been hampered by its poor digestibility."}]},{"head":"FISH","index":56,"paragraphs":[]},{"head":"Express smoking unit","index":57,"paragraphs":[{"index":1,"size":72,"text":"It is no longer necessary to wait 3 days to obtain well smoked fish in Cameroon. The improved Hybrid Chorkor Banda smoking unit, invented by Cameroon's research institute, Institut de recherche the heat is maintained longer in the chamber since the walls are concrete or brick, and not sheet metal as in traditional smoke houses. The second advantage is that the south western Cameroon, the Women in Development group purchased this technology"}]},{"head":"TEA","index":58,"paragraphs":[]},{"head":"Drought tolerant cultivars","index":59,"paragraphs":[]},{"head":"LEGUME","index":60,"paragraphs":[]},{"head":"Certified seed","index":61,"paragraphs":[{"index":1,"size":63,"text":"A Senegalese NGO -Association sénégalaise pour la promotion du développement à la base -that was founded by farmers' organisations groundnut seed producers in arable regions (Thiès, Kaolack, Tambacounda, Diourbel, Ziguinchor and Kolda) to form cooperatives in order to pool their activities, including production management, marketing, collection groundnut seed production techniques are also organised in collaboration with research institutions and the State's technical services."}]},{"head":"COFFEE","index":62,"paragraphs":[]},{"head":"Leaf rust outbreak","index":63,"paragraphs":[{"index":1,"size":29,"text":"Industry Board, the Ministry is supplying farmers with copperalso had some success in tackling leaf rust, using an innovative, garlic-based natural spray, mixed with coconut, to treat infected plants."},{"index":2,"size":58,"text":"out prices for their produce at different markets, and selling them without involving middlemen, simply by sending M-Farm, developed by three young Kenyan collective crop selling; and collective input buying. Price information is collected daily through independent data collectors using a system known as 'geocoding'. This ensures that prices are genuinely collected from traders located in each market."},{"index":3,"size":61,"text":"\"I lacked information on market prices,\" says farmer Gerald Mokaya, recalling how from middlemen. Today he earns at least \"It saves me time and the hassle of going out to look for buyers,\" he adds. \"Our ultimate target is to have farmers all over the country using this service, so that they can get real-time price information without of M-Farm's co-founders."}]},{"head":"PARTNERSHIP","index":64,"paragraphs":[]},{"head":"Sustainable supply","index":65,"paragraphs":[{"index":1,"size":67,"text":"in the Solomon Islands. A public-private partnership was signed between the multinational firm, the Ministry of Agriculture and Livestock, cocoa producers and other cocoa sector stakeholders with the aim of improving the 30 million cocoa trees growing in the Solomon Islands are productive. Production could be increased to 10,000 t by replacing the unproductive trees with new high yielding varieties and implementing an integrated disease management programme."}]},{"head":"FOREST COMMODITIES","index":66,"paragraphs":[]},{"head":"Trade a click away","index":67,"paragraphs":[{"index":1,"size":29,"text":"A new e-learning programme -Trade in forest commodities and the role of phytosanitary measures -focuses on securing international trade in forest commodities while stressing the role of phytosanitary measures. "}]},{"head":"ORGANIC","index":68,"paragraphs":[]},{"head":"Maturing market","index":69,"paragraphs":[{"index":1,"size":55,"text":"Rising demand for organic produce in Trinidad and Tobago has led to the creation of the country's first weekly fresh market for organic food. Restaurants, high quality supermarkets and even fast food chains are targeting organic producers for fresh produce, which earns a premium price and costs 15-20% more than non-organic produce at high-end supermarkets."}]},{"head":"VERMICULTURE","index":70,"paragraphs":[{"index":1,"size":4,"text":"Profits should be shared"}]},{"head":"BUSINESS AND TRADE","index":71,"paragraphs":[{"index":1,"size":34,"text":"Rwanda has two policy priorities which can be drivers for growth: agricultural transformation and investment in information and communication technologies (ICTs). How do farmers and rural areas benefit from the investment in new ICTs?"},{"index":2,"size":95,"text":"include the Agricultural Management Information System (AMIS) that allow farmers to have access to extension materials and specialised agricultural experts and companies. Farmers gain agricultural knowledge through, for example, AMIS extension materials and videos, or links to experts. A useful tool for farmers is the online exchange platform, 'e-Soko', which gives farmers and consumers access to market information such as prices. Through their mobile phones, farmers can also have access to credit information and money transfers, as well as weather forecasts and early warning systems, helping them to mitigate agricultural risks and safeguard their incomes."},{"index":3,"size":32,"text":"Another example is the platform for service delivery and innovation, which provides vouchers for subsidised seed and fertilisers. On a more general level, the Ministry's website helps farmers obtain information and documents."},{"index":4,"size":37,"text":"Rwanda's Vision 2020 document has identified science and technology, including ICTs, as one of the 'cross-cutting' issues and has called for the creation of high and intermediate technology enterprises. What kind of technology enterprises does agriculture need?"},{"index":5,"size":75,"text":"Agriculture needs enterprises that specialise in modernisation, all the way from production and access to inputs. For example, seeds have a strong technological base that has been a major driver of the so-called green revolution. Value-adding technologies and the use of ICTs to reduce the cost of doing business, or to provide insurance systems and reliable information on weather shocks, are all key drivers that are extremely important to the sustainability of the agriculture sector."},{"index":6,"size":15,"text":"Youth often adopt new technologies. Does the Ministry develop specific ICT programmes targeting the youth?"},{"index":7,"size":74,"text":"Centers for Innovation and Smart Villages so that youth in the countryside can build their capacity in ICTs and have up-to-date information, mainly on agriculture. The Ministry also started two e-communication platforms: e-soko employs youth in data gathering; M-Visa targets youth in voucher distribution for fertiliser programmes and other programmes including plant and soil health clinics, livestock, input shops and surplus stock management, all creating jobs for the youth by the use of ICTs."},{"index":8,"size":20,"text":"What do you expect from the forthcoming ICT4Ag Conference that will be held in Kigali in November, co-organised by CTA?"},{"index":9,"size":83,"text":"Above all, we want to learn and I expect CTA to present experiences of what has been done elsewhere. The conference should also create awareness of the role of ICTs in agriculture with a special emphasis on youth. Ease of use of ICTs should be demonstrated, especially for women farmers who never have enough time for their dayto-day businesses. I hope the conference Rwanda. The conference should also create a networking platform for youth, the private sector and farmers from across the region."},{"index":10,"size":17,"text":"If you had to choose one topic to be discussed at the conference, what would it be?"},{"index":11,"size":16,"text":"Practical application of ICTs in agriculture and the business opportunity they present to the private sector."},{"index":12,"size":50,"text":"What policies have been put in place to ensure food security in Rwanda and what have been your major successes? that aims at transforming Rwanda into a middle income country (per capita achieve this, the country is focusing on the transformation of agriculture from subsistence farming to market-oriented modern farming."},{"index":13,"size":40,"text":"A major success for Rwanda has been productivity. CIP has a multi-pronged approach that includes facilitation of access to inputs (improved seeds and fertilisers), consolidation of land use, provision of extension services, and improvement of postharvest handling and storage mechanisms."},{"index":14,"size":60,"text":"There are six priority crops namely maize, wheat, rice, Irish potato, beans and cassava. New crops are added on a need basis. The general impact has been improved food security and increased income for farmers. Overall, a 12% reduction in poverty has of this can be attributed to the agricultural sector and CIP is a huge component of that improvement."}]},{"head":"AGNES KALIBATA","index":72,"paragraphs":[]},{"head":"Modernising agriculture through technology","index":73,"paragraphs":[{"index":1,"size":50,"text":"Minister of Agriculture and Animal Resources Dr Kalibata is an entomologist, with a Master's the International Institute of Tropical Agriculture in ICTs are being introduced in Rwanda through strong policies, to transform agriculture from subsistence farming to a market-oriented economic sector, as well as to create jobs for the youth."}]},{"head":"TREES ON THE FARM","index":74,"paragraphs":[]},{"head":"Agroforestry spreads fresh branches","index":75,"paragraphs":[{"index":1,"size":104,"text":"From providing fruit to fertiliser, farmers have many reasons to grow trees on their land. A growing alliance of governments, researchers and development organisations are recognising the importance of this, and carving out an agenda to bridge forestry and farming. However, these farmers might provide their own solution to deforestation if they are able to adopt trees into their homesteads alongside crops and livestock -a practice known as agroforestry. During Haiti's recovery from its 2010 earthquake, a number of organisations such as FAO and Trees for the Future began promoting agroforestry initiatives around the country as a key to a greener, less vulnerable future."},{"index":2,"size":57,"text":"FAO believes that the productive re-establishment of trees within smallholder farming systems can return some of the resilience that Haiti has lost, stabilising land against storms and regenerating soil fertility while providing more diverse income sources. To accomplish this, they are supplying local nurseries with seedlings, tools and equipment to provide farmers with young trees to plant."},{"index":3,"size":35,"text":"Agroforestry is far from a new concept, however. Trees have long been used in traditional farming systems worldwide, and farmers often know how best to integrate local land is under at least 10% tree cover."},{"index":4,"size":39,"text":"Tree crops provide fruit, fodder and medicines for local such as nuts and oils. The right species of trees provide growing under them, improving and protecting yields while preventing erosion and water loss. Trees also serve use or sale."}]},{"head":"Growing fertiliser","index":76,"paragraphs":[{"index":1,"size":69,"text":"In February 2013, FAO made a strong call to policymakers to work towards the greater adoption of agroforestry. The UN organisation's publication Advancing Agroforestry on the Policy Agenda: A Guide for Decision-makers acknowledges the promise of these methods in supporting harvests, food security and environmental sustainability for millions of farmers. With the guide, FAO demonstrates how agroforestry can be integrated into national strategies and adapted to countries' own conditions."},{"index":2,"size":151,"text":"The call comes as many African governments are undertaking ambitious programmes to bring hundreds of thousands more farms under the canopy of 'fertiliser trees' that naturally enrich soils. The World Agroforestry Center (ICRAF) has been evaluating the use of these trees around the continent since the 1980s, and has found that fertiliser trees used by farmers in the Sahel boost cereal yields by around 30%. Trials with maize plants under trees in of the crop's rain use of up to 380%. ICRAF is promoting the use of such trees in a system it calls 'EverGreen Agriculture'. of a native African fertiliser tree, Faidherbia albida. This recognised the seedlings as they emerged and let them grow. In the past fertiliser trees like Leucaena leucocephala and Gliricidia sepium have also been introduced to the continent from Central America and elsewhere, but ICRAF Faidherbia, whether it is planted or simply allowed to grow naturally."},{"index":3,"size":34,"text":"\"As an indigenous species, it's well adapted and widely acceptable,\" says ICRAF scientist Catherine Muthuri. \"Many farmers are already protecting the tree through farmer-managed natural regeneration. Farmers appreciate panying crops in their farming systems.\""},{"index":4,"size":65,"text":"Uniquely, Faidherbia drops its leaves in the rainy season when farmers are planting their crops, leaving the canopy open to sunlight as the crops grow beneath. The leaves phere, and other vital nutrients brought out of the deep soil by its long taproot. The tree then returns to life in the dry season, providing valuable fodder for livestock when other sources are in short supply."},{"index":5,"size":34,"text":"Faidherbia has been found to increase grain yield of crops such as maize, millet, sorghum, groundnut and cotton from 30-400%, depending on conditions in the Faidherbia averaged 4.1 t/ha, compared to 1.3 t/ha else-"}]},{"head":"Opportunity overhead","index":77,"paragraphs":[{"index":1,"size":23,"text":"However, no single tree, not even one as versatile as Faidherbia, is the answer to every farmer's needs. Farmers timber, fruit and fodder."},{"index":2,"size":59,"text":"Thus EverGreen Agriculture and other systems of agroforestry focus on a whole range of tree species. Some Gliricidia sepium and Tephrosia vogelli are managed as shrubs, with farmers a nutrient boost. There are also numerous useful fodder shrubs for livestock, such as Calliandra calothyrsus. Fruit and nut trees, meanwhile, can improve both nutrition and incomes (see Field Report p18)."},{"index":3,"size":72,"text":"Timber production is sometimes undervalued as an on-farm activity, especially when the clearing of trees is are planted. In a recent study in Cameroon, however, the Center for International Forestry Research and the Partnership for the Tropical Forest Margins found that farmers were unknowingly supplying a high-value market. The researchers observed smallholder farmers selling trees required. However, they did not see themselves as real timber producers and were not negotiating good prices."},{"index":4,"size":15,"text":"Nevertheless, 80% of timber traded in Cameroon's capital city comes from these farms, as booming"}]},{"head":"KEY FIGURES:","index":78,"paragraphs":[{"index":1,"size":96,"text":"of tree cover on agricultural land is defined as an agroforestry system tonnes of maize per ha increase in yield was achieved under the fertiliser trees Gliricidia and Tephrosia billion ha of land worldwide is under agroforestry years of growth are needed for a Faidherbia tree to reach full maturity 10% 1 9-10 demand far outstrips supply from the formal logging sector. The researchers propose that if this activity was managed sustainably, and farmers sought a greater share of the true market price for their product, on-farm timber could potentially constitute a valuable source of income."}]},{"head":"The long view","index":79,"paragraphs":[{"index":1,"size":84,"text":"The rallying call for on-farm trees from the likes of ICRAF and FAO has been answered by many African governments. In 2009, an African Union meeting brought Ministers of Agriculture, Land and Livestock together to make a declaration for the greater adoption of agroforestry. These governments have been joined by an alliance of donors, researchers and development partners who hope to establish EverGreen Agriculture and similar practices across the continent. National agroforestry programmes are presently operating or being established in at least 17 countries."},{"index":2,"size":70,"text":"The 're-greening of the Sahel' has been an ongoing, well documented project in Niger, where some 5 million with useful tree species including Faidherbia. According to one study by the International Food Policy Research Institute, this re-greening has increased yields in southern Niger enough to meet the grain needs of 2.5 million more people. In recent years, the initiative has spread to the plains of Burkina Faso, Mali and Senegal."},{"index":3,"size":143,"text":"In 2009 Kenya introduced a bold policy under its Greening Kenya Initiative, which aims to reach 10% tree coverage across the country by 2030. Through national legislation, tree cover of 10% has become compulsory on all agricultural land. Meanwhile, Ethiopia has committed to putting 15 million more ha under agroforestry systems by 2015, focusing especially On many Pacific islands, densely intercropped home gardens preserve the diversity of local trees and diets. A successful 'Go Local' campaign on the Micronesian island of Pohnpei has revitalised this tradition, while combating the effects of unhealthy imported foods. The campaign promotes the island's incredible food diversity, which includes more than 130 varieties of breadfruit. \"Breadfruit is an important crop in Pohnpei -it sustains existence in our culture, and supplies the basic food need of the household year round, from January to December,\" says 65-year-old grower Alwis Ioakihm."},{"index":4,"size":42,"text":"In one traditional agroforestry system, breadfruit is grown with climbing yam. The vines climb up trellises into the branches during the non-fruiting season. The yam plants then fall dormant before the breadfruit harvest, so the fruit can be picked without damaging them."},{"index":5,"size":63,"text":"The Island Food Community of Pohnpei, which created the 'Go Local' campaign, aims to sustain the island's knowledge of preserving breadfruit to be consumed throughout the year. Breadfruit may be eaten raw or cooked, and the large nut even ground and brewed to make a coffee-like beverage. The campaign is also introducing new products like breadfruit chips to be sold around the region."},{"index":6,"size":56,"text":"The results are clear to island resident Kermen Hadley. \"There's establishment of new breadfruit plantings and addition of missing cultivars in the traditional home gardens. And more cooked breadfruit and other fresh tree food crops like pandanus, citrus, mango, soursop and mountain apple are being served, especially in the traditional feast known as Kamadipw,\" he observes."}]},{"head":"V ie w p o in t","index":80,"paragraphs":[{"index":1,"size":22,"text":"Sairusi Bulai is the coordinator for the Forests and Trees Team at the Secretariat of the Pacific Community's (SPC) Land Resources Division."},{"index":2,"size":8,"text":"Faidherbia trees stand over more than 160,000 farms."},{"index":3,"size":65,"text":"Malawi is integrating the EverGreen system into its Agriculture Sector Wide Approach to propel a rapid upscaling within the country. More than 50,000 Malawian farmers have been piloting fertiliser trees with ICRAF and its partners since 2005. With clear evidence of the trees' scaled-up programme. The national programme provides tree seeds and nursery materials along with training in the planting and management of fertiliser trees."},{"index":4,"size":37,"text":"This broad national support is essential for newly thriving agroforestry, says Muthuri. \"Despite the numerous adverse policies, legal constraints and lack of coordination between the sectors to which it contributes: agriculture, forestry, rural development, environment and trade.\""},{"index":5,"size":184,"text":"Perhaps the biggest problem for farmers using trees has been this lack of a natural policy space for agroforestry, which hangs suspended between multiple government ministries. Some forest codes have the unintended consequence of restricting how farmers are allowed to manage trees on their own farms. And a lack of long-term land security makes agroforestry impossible, especially with a tree like Faidherbia that only produces its most Muthuri believes that the establishment of more national agroforestry programmes is a necessary step in one,\" she says. \"It's more to ensure that there are synergies between national, regional and local priorities. A top down approach should be avoided, as variation across scales is important to the success of agroforestry.\" With no single tree or approach offering a solution for everyone, the future of agroforestry is in the hands of farmers. Add in sea level rise and extreme weather events, and the situation becomes very precarious. Our approach at SPC is to intensify production systems and make them more resilient -more diverse and better adapted -to provide food and economic security in the face of climate change."}]},{"head":"What is SPC doing to build more resilient agroforestry systems?","index":81,"paragraphs":[{"index":1,"size":71,"text":"We're developing model agroforestry systems for the different Pacific agroecosystems, such as atolls, river deltas and uplands. We have a project across six Pacific countries (Fiji, Kiribati, Samoa, Solomon Islands, Tonga and Vanuatu) to increase the resilience of production systems, and we are building demonstration areas for the model systems. We are working with local communities to adapt the systems, and also developing community nurseries to supply climate-adapted crops and trees."}]},{"head":"What are the challenges to developing resilient agroforestry systems?","index":82,"paragraphs":[{"index":1,"size":104,"text":"There are many, but one major challenge is the availability of native tree species. We need much more effort on breeding and propagating these trees. The focus in the past has been on exotic high-value species like mahogany and teak, and our local species have fallen by the wayside, but we need to return to more diverse systems that mimic the natural ones that we have lost. Our local species provide a wealth of ecosystem services and also many high-value products such as nuts and oils. We are also helping to develop markets for these products, which also increases financial resilience for the communities."}]},{"head":"Is there any climate change financing available for agroforestry in the region?","index":83,"paragraphs":[{"index":1,"size":50,"text":"No, not at the moment. There has been a lot of talk about it, but it's hard to implement in practice, especially as these approaches are designed for larger land areas. We also lack data, for example on carbon budgets associated with different agroforestry systems and other land management options."}]},{"head":"DOSSIER","index":84,"paragraphs":[{"index":1,"size":35,"text":"At the heart of the world's second largest forest in Central Africa, Cameroonian farmers are learning to propagate native species and enhance their living conditions through the production of okok, a popular non-timber forest product."},{"index":2,"size":90,"text":"'O kok' or 'eru' are the names given to a wild vine of the Gnetaceae family (Gnetum spp.) that grows naturally in the Congo Basin rainforest in Central Africa, which is the second largest tropical forest after the Amazon forest. The leaves of this vine are very popular and eaten in many Central and West African countries. In Cameroonian restaurants, an okok dish costs about FCFA500 (€0.75), which is cheap enough for most people to afford. Okok is also used in concocting traditional medicines and making local whisky and vinegar."}]},{"head":"Overharvesting","index":85,"paragraphs":[{"index":1,"size":86,"text":"According to the statistics of the Cameroonian okok domestication programme PAPCO, funded by the Ministry of Agriculture, annual domestic okok consumption in Cameroon is estimated at over 350,000 t. The country The problem is that less than 5% of this market volume comes from cropped sources. Wild okok growing in forests is being overharvested, and the resource is gradually being depleted. \"The growing popularity of this NTFP has raised concerns on its sustainability. We've found that farmers why we've started to train them on okok domestication,\""}]},{"head":"REPORT FROM CAMEROON","index":86,"paragraphs":[]},{"head":"Taming okok in forest regions","index":87,"paragraphs":[]},{"head":"Domestication","index":88,"paragraphs":[{"index":1,"size":55,"text":"The greatest challenge was to get farmers interested in domesticating this plant. \"When I was told that we were going to be taught how to grow okok, I laughed. For me, it seemed crazy to waste time planting a vine that grows wild. But after several awareness sessions, I joined the an okok crop farmer."},{"index":2,"size":40,"text":"Like this farmer, 1,040 others have been trained by PAPCO in 4 years on plant production techniques and building prophave also been created. Okok has a 12 month production cycle. \"Research is under way to shorten this cycle to 3-4"}]},{"head":"Value chain","index":89,"paragraphs":[{"index":1,"size":125,"text":"10 \"For me, okok is green gold -I struck gold! In 4 years, I was able to save enough to pay my son's tuition fees in Canada. I've also started building a house,\" says Roger Noa proudly, a farmer who received training from PAPCO. \"I sell a 90 day old okok crop for FCFA300 (€0.45) and feel that I've gained because the crop costs nothing once I own \"We've encouraged farmers to form cooperatives to sell okok collectively, thus giving them more price negotiation Cameroonian farmers are focusing on processing okok, but this is still in the planning stage. They cut and then sun or oven dry the leaves to preserve their green colour and subsequently sell them on the local market and in Europe."},{"index":2,"size":102,"text":"Okok domestication has several advantages other than generating income. It promotes reforestation. Okok is a climbing plant that wraps itself around a tree or prop. Its leaves grow year round and do not require any control treatments as the plants are quite tough and therefore minimally vulnerable to insect pests. Okok requires little fertiliser since it grows in the shade. Finally, it does not have to be replanted because, after the leaves are cut, new buds emerge which in turn generate new leaves. Domestication of wild species like okok ensures a longterm supply of harvested crops, while also enhancing farmers' living conditions."}]},{"head":"S","index":90,"paragraphs":[{"index":1,"size":88,"text":"weet potato -often viewed as an 'unloved' crop or a 'poor man's food' -is grown mainly by women on small plots. Its popularity declines as consumer income rises, especially in urban centres. Less than 20% of all sweet potato produced in Africa is marketed, although Africa ranks second after China in sweet potato production, with 17 million t produced in 2011. This so-called 'subsistence crop' is consumed fresh (boiled, fried, baked under hot ashes), while the leaves are used as condiments, particularly by rural households during lean seasons."},{"index":2,"size":76,"text":"Sweet potato is a simple, short-cycle, lowinput crop that is adapted to a range of farming conditions, including drought and poor soils. Its production is, however, hampered by several problems that prevail in this sector: a lack of available seed at the right time (onset of varieties, low yield (4-5 t/ha on average, compared to 22 t/ha in China), as well as the use of rudimentary production, conservation and storage techniques, leading to high postharvest losses."}]},{"head":"The processing challenge","index":91,"paragraphs":[{"index":1,"size":143,"text":"The virtues of sweet potato abound, but added value must be created throughout its production cycle, while overcoming the transportation and conservation barriers, and gaining greater access to urban markets. The focus should now be placed on common, but other types of processing and uses could also be developed, such as the production of cossettes, or cooked tubers, to be used in making cakes, bread, and drinks. In late 2012, the Urwibutso agrifood company in Rwanda marketed biscuits through a collaboration between Sweet Potato Action for Security and Health in Africa (SASHA) and its partners, including the International Potato Center (CIP) and the Rwanda Agricultural Board (RAB). The entire value chain is involved in the biscuit production process: SASHA supplies the sweet potato varieties to RAB, which propagates and distributes them to cooperatives, and farmers then sell their produce to the biscuit manufacturer."},{"index":2,"size":97,"text":"The Caribbean Agricultural Research and Development Institute (CARDI) has also launched a programme in Trinidad and Tobago that aims to promote the consumption of sweet potato chips sold as a fast food. This tuber can also be used to produce animal feed -China devotes over 25% of its crop to this manufacturing sector. Papua New Guinea, meanwhile, has successfully introduced sweet potato in poultry feed, thus least 25%. Researchers from the International Livestock Research Institute and CIP, in collaboration with public and private partners, are also testing different sweet potato varieties and feed formulations in Eastern Africa."},{"index":3,"size":32,"text":"The marketing prospects to its nutritional qualities, particularly the high beta-carotene content. Over the last 5 years, sweet potatoes have been successfully disseminated in several Eastern and Southern African countries by HarvestPlus."},{"index":4,"size":45,"text":"especially in women and children. A study published in the British Journal of Nutrition sweet potatoes, which were distributed to more than 10,000 households in Zambezia province in Mozambique, was adopted by around 65% of the households, covering over 70% of their vitamin A needs."},{"index":5,"size":28,"text":"Sweet potato has a vast potential in ACP countries, provided that crop yields and quality are enhanced and that processing strategies are developed to meet urban consumer needs."},{"index":6,"size":40,"text":"Sweet potato is a major tuber crop throughout Africa and the Pacific region, yet it is one of the least marketed. This is a paradox since production of this food crop has been growing steadily over the last 40 years.  "}]},{"head":"SWEET POTATO","index":92,"paragraphs":[]},{"head":"An amazing tuber","index":93,"paragraphs":[]},{"head":"Technical guide","index":94,"paragraphs":[{"index":1,"size":144,"text":"This 'complete manual' achieves its stated aim to be a 'one-stop shop' for small-scale food processors and their advisers. Written by a leading authority in the sector, it is a comprehensive reference guide not only on the technical aspects of the subject, but also the practicalities of running a small-scale food processing business. While making use of photographs, diagrams and tables where necessary, the bulk of the information is carried in unbroken paragraphs of accessible, Helpfully, the author provides both higher and lower investment options for many of the technical aspects, such as construction as on processing technologies (from baking and bottling to centrifuging and pressing), customers, dealing with competitors, staff recruitment and training, and a summary of food quality and safety legislation. Other reviewers have described it as a 'must read' for the sector -a fair assessment of this important, highly practical guide. "}]},{"head":"The Complete Manual of Small-scale Food Processing","index":95,"paragraphs":[]},{"head":"Diversity","index":96,"paragraphs":[{"index":1,"size":173,"text":"While international policy frameworks make an explicit assumption that conserving biodiversity will help to tackle global poverty, is such an assumption justified? This volume explores a number of key questions, including which aspects of biodiversity are of value to the poor, and how conservation interventions can differ in their poverty impacts. A stimulating read for anyone interested in the potential, and limitations, of integrated approaches to biodiversity conservation and poverty alleviation.  The framework itself is based around a number of cross-cutting principles, two main objectives (to secure and protect the lives, livelihoods and rights of pastoral peoples, and to reinforce the contribution of pastoral livestock to national, regional and continentwide economies) and a detailed set of strategies to achieve them. Prior to that, the document offers a description of pastoralist systems across the continent, their economic, social and cultural contribution, and their political Positive policy trends are highlighted, such as laws in West Africa to protect pastoral land and enhance livestock mobility. Contemporary challenges to policy and development, such change, are also discussed."}]},{"head":"Biodiversity Conservation and Poverty Alleviation","index":97,"paragraphs":[]},{"head":"@","index":98,"paragraphs":[]},{"head":"PUBLICATIONS PUBLICATIONS","index":99,"paragraphs":[]},{"head":"Sustainable Cities: Local Solutions in the Global South","index":100,"paragraphs":[{"index":1,"size":19,"text":"Edited by M Robertson Practical Action Publishing, 2013;189 pp. ISBN 978-18-5339-723-3 For Practical Action's address, see page 21 www.practicalaction.org/publishing"}]},{"head":"Urban strategies","index":101,"paragraphs":[{"index":1,"size":63,"text":"Outlawed for years by municipalities across the developing world, urban agriculture is increasingly recognised as being part of the solution, not the problem, in building urban spaces that serve the diverse needs of their residents. When properly integrated in planning processes, urban agricultureincluding livestock rearing -offers numerous improving health, rehabilitating neglected neighbourhoods and promoting participatory local governance through its collective management of resources."},{"index":2,"size":63,"text":"In this volume of nine case studies from Africa, Latin America and South and East themes for developing sustainable cities. Other themes include good construction agricultural production into urban environments in ways that minimise health risks and public disturbance), housing and tenure policy, and water and waste insights for those conducting participatory research and practice in cities, in both the South and North."}]},{"head":"Environment","index":102,"paragraphs":[{"index":1,"size":82,"text":"With the term 'sustainable' used to describe nearly any product that is slightly 'greener' than the norm, has the word become redundant or is an accurate system for measuring sustainability possible? This latest State of the World report attempts to do the latter, highlighting issues in a range of sectors, including energy and agriculture, to show what sustainability would truly mean. A final section, 'Open in case of emergency', discusses the implications should climate-related conflict, migration and other crises define our world.  "}]},{"head":"Wetland Management and Sustainable Livelihoods in Africa","index":103,"paragraphs":[]},{"head":"Water resources","index":104,"paragraphs":[{"index":1,"size":50,"text":"Current wetland management policies and practices are frequently underpinned by the view that agriculture is a threat. However the editors of this book state: \"In rural areas where people are entrenched in poverty, wetlands (in particular wetland agriculture) have a critical role to play in supporting and developing peoples' livelihoods.\""},{"index":2,"size":118,"text":"With nine case studies from Ethiopia, Malawi, Nigeria, South Africa, Tanzania, Uganda and Zambia, the book outlines how wetlands have the potential to play a key role ensuring environmental sustainability, and providing a buffer and adaptive strategy for the challenges of population growth, climate change and increasing food production. The authors accept that for most wetlands, some change in their ecological character is inevitable and can be acceptable if managed carefully. \"In the coming decades, wetlands in Africa will be increasingly used by people editors write. \"It is essential that they are used sustainably so that they are maintained in a state where they can help address the challenges for human development and livelihood security facing Africa throughout"}]},{"head":"Mining","index":105,"paragraphs":[{"index":1,"size":126,"text":"While Africa has vast resources to improve the lives of its people, tax avoidance and evasion and weak governance are major challenges, with the continent annually losing twice as much in illegal financial outflows as it receives in international aid. This compelling report calls on African governments to put transparency and accountability at the heart of natural resources policy, and for an effective international response to tax avoidance and evasion. With the increasing demand for more food to be produced sustainably to feed a rapidly ual essays in this book highlight the importance of combining current biotechnology to improve agronomic practices. Highlights include the crucial role of high-quality seeds generation of African plant breeders, and inspiring African youth on the role of biosciences in African farming."},{"index":2,"size":81,"text":"Various initiatives using marker-assisted conventional breeding, vegetative propaga-gies are covered. With concerns over the use of GM technologies in Africa, several authors provide insights into whether they are safe, fair, natural, or needed in the face of climate change. \"As science, technology and innovation bring to society their successes and rewards, they demand to be handled wisely with structures of oversight and transparency of communication that ensure they are sustainable, safe and acceptable for consumers,\" conclude Brian Heap and David Bennett."}]},{"head":"Biotechnology","index":106,"paragraphs":[]},{"head":"Livestock","index":107,"paragraphs":[{"index":1,"size":169,"text":"In 1999, Livestock to 2020: The Next Food Revolution identified an accelerating demand for livestock products, dubbed the 'Livestock Revolution'. This work examined potential policy responses and foresaw that benefits for small-scale producers were not assured. Revolution Reconsidered reviews their analysis, noting that the strength of private sector involvement in the sector limits the effectiveness of policy-making in ensuring that livestock keeping fulfils its potential as a pathway out of poverty. As they say in Africa, 'You cannot shave a man's head in his absence.' You can do nothing for farmers without their involvement. CTA seeks to promote wellinformed agricultural policy processes and strategies that involve and empower everyone engaged in the sector, especially smallholder producers, women and youth. support to regional farmers' organisations raised in ARD policy processes, such as the Comprehensive African Agricultural Development Programme. This is achieved by building their institutional strength and their capacity to gather evidence for evaluating policy processes, take informed positions on emerging themes such as climate change, and articulate their views. "}]},{"head":"Developing the online policy debate","index":108,"paragraphs":[{"index":1,"size":43,"text":"CTA has been supporting the use of knowledge and learning platforms with selected partners across the ACP region. The aim is to bring policy debate out of the meeting room, and allow discussion to continue after an event, online (continued on page 26)."}]},{"head":"GET ON BOARD","index":109,"paragraphs":[]},{"head":"Developing the online policy debate","index":110,"paragraphs":[{"index":1,"size":84,"text":"In the CTA Strategic Plan 2011-2015, a clear need has been highlighted for the development of methodologies, tools and skills for information, communication and knowledge management among agricultural and rural development institutions. As a result, one of the key areas of focus at CTA is improving communication, creating access to information, discussion and knowledge, and sharing this within organisations and communities. This objective is being achieved through a variety of projects, including one which aims to improve participation in policy processes using online platforms."},{"index":2,"size":58,"text":"CTA is supporting the development of a number of knowledge and learning platforms with ACP partners. The platforms enable dialogue to continue during the periods between face-to-face policy meetings, ensuring that discussions and debates stay alive. According to Senior Programme Coordinator, Chris Addison, \"This is not just about teaching the tools but supporting organisations in managing the process.\""},{"index":3,"size":71,"text":"Over the last few months CTA has increased the number of projects with partners in this area. In April 2013, the Melanesian Spearhead Group, which includes Fiji, New Caledonia, Papua New Guinea, Solomon Islands and Vanuatu, began the process of establishing a virtual platform for the development of their Green Growth Framework, which was launched at the Leaders Summit (Heads of State), held in June 2013 in Noumea. This aims to"},{"index":4,"size":44,"text":"The Melanesian Spearhead Group project is part of a broader initiative to support dialogue on the issue of resilience in small month. In the Caribbean, the Blue Economy on a knowledge platform to support this is being developed with the Caribbean Regional Fisheries Mechanism."},{"index":5,"size":55,"text":"CTA is assisting the New Partnership for The content and development of a webpage (on NEPAD's website) for the inaugural session of the Africa Rural Development Forum was supported by CTA as part of the knowledge platform for the Rural Futures programme. Electronic discussions around key programme topics will be developed in the coming months."},{"index":6,"size":44,"text":"CTA is also supporting capacity building PanAfrican Farmers' Organization (PAFO) and regional farmers' organisations EAFF, PROPAC, ROPPA and SACAU*. A group of of these organisations joined the reporting and social media team for the 30th Brussels of crises and shocks', on 4 March 2013."},{"index":7,"size":106,"text":"Rasoanindrainy from Madagascar, together with Chris Addison of CTA, facilitated training for the group to report on the meeting through blogging, video interviews and social media. As part of this process they developed a blog to allow more dynamic updating of their web presence whilst the main site is under development. The group are continuing their work with regional farmers' organisations, EAFF and UMAGRI*, to develop a joint knowledge platform supporting PAFO and regional organisation websites, and to provide a redeveloped website and virtual discussion forum for their members. For more information on the projects above contact Chris Addison, Senior Programme Coordinator for knowledge management ([email protected]). "}]},{"head":"* Eastern African","index":111,"paragraphs":[]},{"head":"Inspiring technology adoption","index":112,"paragraphs":[{"index":1,"size":334,"text":"John Gushit of the University of Jos in Nigeria writes to tell us how Spore is useful to him. \"I write to notify and thank you for how your publication has shaped and guided me in my research, in which I have integrated relevant technologies in order to facilitate the optimal use of pesticides by farmers in my area. The work started with a field survey of the use of chemical inputs in normal farming practice. The outcome of the survey, which involved the use of a semi-structured questionnaire, showed that farmers within the study area are exposed to high risks as they handle and use various pesticides and other chemical inputs. This was observed in reported cases of death and injury arising from long and short term exposure to these chemicals, by both humans and animals. While lack of compliance with manufacturers' guidelines, due to illiteracy, was found to be a major cause of direct ingestion of these chemicals by farmers, the pesticides were also found to be ingested indirectly, in drinking water and other sources. This project is using mobile communications and related eLearning technology to educate, enlighten and provide a needed helpdesk for the rural farming population, in order to promote the effective and appropriate use of pesticides and chemical farm inputs. This involves using mobile telephones connected to major, global, mobile networks and private telephone operators, who provide the networks in Nigeria. This use of technology was motivated by related work on the iCow project, by Su Kahumbu from Kenya, which I read about in Spore (No 159, page 8). Her work made me integrate a similar concept in my research, as a way of assisting smallholder farmers in my area to make proper use of the pesticides and other chemical inputs that they use on an almost daily basis. I believe that this project, which is ongoing, will make a positive impact on the users of these chemicals, as it will enhance both good farming practices and farmers' health.\""}]},{"head":"The art of preservation","index":113,"paragraphs":[{"index":1,"size":97,"text":"Alexandre Rwidegembya, of the Farmers' Association of Ludaha/ Kabare (South Kivu, DRC), was interested in the palm wine bottling initiative carried out in Cameroon. \"This Cameroonian experience is astonishing and interests us. We would have liked Kasiksi, our local banana-based beer, to benefit from a suitable preservation system to make it competitive. Otherwise it becomes undrinkable within 2 days when not bottled. With a preservation method like that used for palm wine, our beer could be sold in a decent form, preserved for several days and even exported to other places in the Democratic Republic of Congo.\""}]},{"head":"Weather reports","index":114,"paragraphs":[{"index":1,"size":68,"text":"CTA launched a Spore distribution operation in South Kivu in the Democratic Republic of Congo (DRC) and regularly receives feedback from readers in this information-deprived region. The article on the dissemination of seasonal weather forecasts in various local languages impressed Landry Lungere, who thinks that rural communities in South Kivu should benefit from such radio programmes which, in Lungere's opinion, are much more important than political news programmes."}]}],"figures":[{"text":" Renewed efforts are under way to conserve coastline. According to a report by Coastal and Marine Resources Development (COMRED-Kenya coast are met by mangroves. COMRED-Africa and the Kenya Forest Service (KFS) are introducing income-earning activities to conserve mangrove plantations. Communities is paying them to guard the plantations to prevent them from being cut down. Tree nurseries have been established to replenish plantations that have been destroyed. Plan Vivo has also introduced a payments for ecosystem services scheme, in collaboration with Earth Watch International, the Kenya Marine and Fisheries Research Institute and the Gazi coastal community. These efforts are designed to enhance destroyedhave been established in the Solomon Islands, giving farmers better access to agriculture officers and plant specialists. The first clinics were set up in 2012 as part of Research. \"The number of extension officers around the country is very low,\" says Maria Gharuka from the Ministry of Agriculture and Livestock. \"We simply cannot attend to every farmer.\" According to Gharuka, outcomes from the clinics, which already very positive. "},{"text":" FAO designed the course in collaboration with the Secretariat of the International Plant Protection Convention and other partners (www.fao. org/forestry/foresthealthguide/82418/en). These 6 pages were produced with contributions from: M Aka Aka (Côte d'Ivoire), O Alawode (Nigeria), M Andriatiana (Madagascar), K Bascombe (Trinidad and Tobago), I Esipisu (Kenya), G Kamadi (Kenya), J Karuga (Kenya), J C Kijana (Democratic Republic of Congo), M A Konte (Senegal), P Kouakou (Côte d'Ivoire), C Mkoka (Malawi), A Moorhead (Fiji), A M Motsou (Cameroon), N Mutemweno (Zambia), C Nforgang (Cameroon), M Nzouankeu (Cameroon), P Pink (Jamaica), P Sawa (Kenya). In the eastern coastal region of Madagascar, hundreds of farmers growing pineapples, bananas, passion fruit, yams and grafted cassava have been using a new training method. So how does the solidarity trained on production techniques and given seeds. This farmer then produces seeds using the training, and the seeds are distributed to other group members, who in turn are trained on production techniques. These members subsequently train other farmers and give them their seeds. This training method was used to widely promote and disseminate vermicomposting techniques, whereby compost is produced This provided an opportunity for each of these farmers to set up a solidarity chain supported by the International Fund for Agricultural Development's Rural Income Promotion Programme. "},{"text":" | VIEWPOINT Agroforestry, a vital system for the Pacific | FIELD REPORT FROM CAMEROON Taming okok in forest regions © ICRAF/A Biloso DOSSIER I n Haiti, once-lush natural forest cover has long since for plantations and, as the nation's population grew, for subsistence farming and charcoal production. But farmers have found little promise in the degraded soils left "},{"text":" role of agroforestry in the Pacific, in view of climate change? Agroforestry has always been the mainstay of traditional farming in the Pacific islands, and with climate change it is even more vital. Most of the small island states in the Pacific have limited land available for food production, and severe land use competition from urban and tourism developments. "},{"text":" million (€9 million) in 2010, which means that okok is the third ranking marketed non-timber forest product (NFTP). "},{"text":" Having a properly thought-out strategy for the management of information, communication and knowledge within an organisation is vital for effective decision-making and problem solving, saving time and cost, creating value and supporting innovation. Yet a lack of Information and Communication Management (ICM) strategies in ACP organisations and institutions has been highlighted by a comprehensive needs assessment, conducted by CTA between 2003-2009. In response, the Centre undertook a collaborative process to develop and test a short training programme, based around a series of four modules. This was validated in different regions and has now been published in two volumes, targeting facilitators and users respectively. The facilitators' guide is intended to meet the needs of information and communication professionals with appropriate, university-level training and contain detailed information about ICM, including preparation and planning, strategy development, implementation, guide contains learning activities for groups and individuals and practical notes on how to present each module. The users' manual is more informal and practical, to help individuals collaborate to develop ICM strategies for their organisation. The training slides and other useful references are included on a CD-ROM in both the guide and the manual.Downloadable as PDF file from: http://tinyurl.com/a6mgs5g "},{"text":" economies, human development and food security indicators for many pastoral areas are amongst the lowest consultations since 2007, this accessibly written, carefully structured policy framework is intended to inform and guide the work of national steering committees in initiating and promoting new policies to achieve the goals set out in the title. "},{"text":" in ACP countries particularly in Africa where food production depends mainly on rainfed staple crops are already at their temperature have consequences for food security and nutrition. As new information on the opportunities and challenges of the linkage between climate change, agriculture and food security are made available to policymakers, their willingness to form conducive ARD policies to address this opportunity not to be missed.Who do you work with to address these issues?For the past 4 years, CTA has worked with the CGIAR Research Program on Climate Change, Agriculture and Food Security and the Food Agriculture, and Natural Resource Policy Analysis Network, among others, to organise ' Agriculture, Livelihood and Landscape' (ALL) days during the UN's annual climate change (CoP) meetings. The aim is to provide targeted information to participants, negotiators and the global audithemes. Earlier in 2013, CTA met with key partner organisations to plan joint activities focusing on agriculture and climate change policy processes. How many people were reached during the most recent ALL event at CoP18? The ALL event in December 2012 held in Doha was attended by over 400 delegates and around 700 also interacted online. Media were circulated, including live reports on Al Jazeera and articles in the Guardian. Five thousand Facebook connections were made, 600,000 people were reached via Twitter, and the various online video interviews received 500 views. With a PhD in Agricultural Economics from the University of Hannover, Olu joined CTA in 2012 bringing a wealth of experience on research for development from the World Agroforestry Centre, the Africa Rice Center and the International Institute of Tropical Agriculture. Olu is multilingual, has won several publishing awards and is a reviewer of international journals. "},{"text":" Africa's Development (NEPAD) with knowledge management around the Comprehensive Africa Agriculture Development Programme (CAADP) process. This is being carried out in collaboration with the European Centre for Development Policy Management and knowledge management company, Co-Capacity. The CAADP Partnership Platform meeting, held at the headquarters of the African Union in Addis Ababa in March 2013, provided a perfect opportunity to begin studying around the CAADP process, and in particular on this initial work, a number of regional consultations have been undertaken, leading to a workshop in August 2013. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"1.4-2      DOSSIER DOSSIER EverGreen Agriculture  © WRENmedia  EverGreen Agriculture© WRENmedia Above: Phylis 17 African Wambui Mungai harvests countries are     Above: Phylis 17 African Wambui Mungai harvests countries are branches of Calliandra -a useful fodder shrub -on her farm in Kenya Right: Maize implementing or developing programmes to scale-up EverGreen growing under Faidherbia Niger albida Agriculture  160,000 farmers introduced to Zambia Faidherbia trees conservation agriculture with  €150 per household generated in tree products such as fodder, timber, fuel, food and medicine by farmers practising EverGreen Agriculture in Mali and Niger branches of Calliandra -a useful fodder shrub -on her farm in Kenya Right: Maize implementing or developing programmes to scale-up EverGreen growing under Faidherbia Niger albida Agriculture160,000 farmers introduced to Zambia Faidherbia trees conservation agriculture with€150 per household generated in tree products such as fodder, timber, fuel, food and medicine by farmers practising EverGreen Agriculture in Mali and Niger 50,000 tonnes of additional cereal production per year under EverGreen Agricultural systems 4.8 million ha of landscapes have been re-greened, soil fertility which improve many with trees Malawi intercrop systems testing tree-maize 200,000 farmers have recently been © ICRAF 30 -200% increase in yields of crops grown in association with Faidherbia albida 50,000 tonnes of additional cereal production per year under EverGreen Agricultural systems4.8 million ha of landscapes have been re-greened, soil fertility which improve many with treesMalawi intercrop systems testing tree-maize 200,000 farmers have recently been© ICRAF30 -200% increase in yields of crops grown in association with Faidherbia albida    100% increase in soil nitrogen levels and a 200% increase in soil organic matter in a conservation agriculture maize system under 100% increase in soil nitrogen levels and a 200% increase in soil organic matter in a conservation agriculture maize system under     Faidherbia albida Faidherbia albida  "},{"text":"Mobile Phones for Nutrition Surveillance  ICM strategy ICM strategy By P Fellows By P Fellows Practical Action Publishing, Practical Action Publishing, 2013; 568 pp. 2013; 568 pp. ISBN 978-18-5339-766-0 ISBN 978-18-5339-766-0 Practical Action Publishing Practical Action Publishing The Schumacher Centre The Schumacher Centre Bourton on Dunsmore Bourton on Dunsmore Rugby Rugby CV23 9QZ, UK CV23 9QZ, UK www.practicalaction.org/ www.practicalaction.org/ publishing publishing ICT ICT Nutrition surveillance enables Nutrition surveillance enables governments and other agencies to governments and other agencies to track their progress towards reducing track their progress towards reducing undernutrition and respond quickly to undernutrition and respond quickly to changes in nutrition caused by food changes in nutrition caused by food price volatility and other shocks. But price volatility and other shocks. But nutrition surveillance is expensive and nutrition surveillance is expensive and laborious and is therefore often non- laborious and is therefore often non- existent in developing countries. This existent in developing countries. This report analyses the potential of mobile report analyses the potential of mobile phones to improve the effectiveness of phones to improve the effectiveness of surveillance with regards to timeliness, surveillance with regards to timeliness, cost, data quality and data analysis. cost, data quality and data analysis. By I Barnett & JV Gallegos By I Barnett & JV Gallegos Institute of Development Studies, 2013; 32 pp. Institute of Development Studies, 2013; 32 pp. Downloadable as PDF file from: Downloadable as PDF file from: http://tinyurl.com/l85hqf4 http://tinyurl.com/l85hqf4  "},{"text":"State of the World 2013: Is Sustainability Still Possible?  Edited by L Starke Edited by L Starke Worldwatch Institute, 2013; 464 pp. Worldwatch Institute, 2013; 464 pp. ISBN 978-16-1091-449-9 ISBN 978-16-1091-449-9  "},{"text":"Africa Progress Report 2013: Equity in Extractives  Africa Progress Panel, 2013; Africa Progress Panel, 2013; 120 pp. 120 pp. ISBN 978-29-7008-212-5 ISBN 978-29-7008-212-5 Downloadable as PDF file from: Downloadable as PDF file from: http://tinyurl.com/psdabzn http://tinyurl.com/psdabzn  "},{"text":"Africa's Future -Can Biosciences Contribute?  Compiled by B Heap & D Compiled by B Heap & D Bennett Bennett Banson, 2013; 136 pp. Banson, 2013; 136 pp. ISBN 978-09-5633-875-4 ISBN 978-09-5633-875-4 Earthprint Earthprint Unit 17/18 Gunnels Wood Park Unit 17/18 Gunnels Wood Park Stevenage Stevenage Hertfordshire Hertfordshire SG1 2BH, UK SG1 2BH, UK www.earthprint.com www.earthprint.com  "},{"text":"Revolution Reconsidered: Evolving Perspectives on Livestock Production and Consumption  PUBLICATIONS PUBLICATIONS PUBLICATIONS PUBLICATIONS 4 QUESTIONS FOR OLU AJAYI 4 QUESTIONS FOR OLU AJAYI How does CTA work to How does CTA work to strengthen farmers' strengthen farmers' organisations' involvement organisations' involvement in Agricultural and Rural in Agricultural and Rural Development (ARD) policy processes Development (ARD) policy processes and why is this important? and why is this important? By J Sumberg & J Thompson By J Sumberg & J Thompson STEPS Centre, 2013; 24 pp. STEPS Centre, 2013; 24 pp. ISBN 978-17-8118-097-6 ISBN 978-17-8118-097-6 Downloadable as PDF file from: Downloadable as PDF file from: http://tinyurl.com/q5cjcpt http://tinyurl.com/q5cjcpt  "},{"text":" Farmers Federation (EAFF); Plateforme Régionale des Organisations Paysannes d'Afrique Centrale (PROPAC); Réseau des Organisations Paysannes et de Producteurs de l'Afrique de l'Ouest (ROPPA); Southern African Confederation of Agricultural Unions (SACAU)  "}],"sieverID":"71cdfd24-65d5-471d-8b1c-95ff053ee5cc","abstract":"On farm multi-purpose trees support crop harvests, food security and environmental sustainability."}

data/part_4/0412046d176e742f85aca4a3db5957d3.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0412046d176e742f85aca4a3db5957d3","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/b3a1b770-c032-4783-b585-1442b7c8cb2a/retrieve"},"pageCount":4,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":32,"text":"• In the Lake Zone, Tanzania, between 2009-2012, 88 decentralized vine multipliers (DVMs) were established by the Marando Bora project. Five years later, the follow up study traced 81 of the DVMs."},{"index":2,"size":28,"text":"• 40% of the DVMs had sold planting material of Marando Bora varieties in the last year; a further 16% had maintained the improved varieties for own use."},{"index":3,"size":32,"text":"• The percentages of DVMs retaining different improved varieties were: Polista: 48%; Kabode: 34% Ukerewe: 23%; Ejumula: 12%; and Jewel: 11%. Depending on variety, between 9-21% of DVMs had obtained replacement materials. "}]},{"head":"What objectives did we set?","index":2,"paragraphs":[{"index":1,"size":52,"text":"We wanted to explore the motivations of individuals and groups to engage and disengage in specialized seed multiplication to inform future interventions. The study aimed to understand the drivers contributing to the continuity of sweetpotato vine multiplication enterprises producing and disseminating improved white and orangefleshed varieties in the Lake Zone of Tanzania."}]},{"head":"Where did we work?","index":3,"paragraphs":[{"index":1,"size":41,"text":"The follow-up study was carried out in the 13 implementation districts in Mwanza, Geita, Kagera, and Mara regions, Tanzania. The area has a bimodal rainfall pattern, with conservation and multiplication practices determined by proximity and access to water sources and lowlands."}]},{"head":"What did we achieve?","index":4,"paragraphs":[{"index":1,"size":73,"text":"Between October 2017 and December 2018, 81 DVMs were traced and interviewed by telephone to establish the current status of their vine multiplication activities. Sex-disaggregated Focus Group Discussions (FGDs) (Fig. 1), field interviews and plot visits were conducted with 46 continuing and non-continuing DVMs taking into consideration agro-ecology, market access, sex and individual or group organization management of the vine multiplication enterprise. Qualitative and quantitative data were analyzed using descriptive statistics in SPSS."},{"index":2,"size":98,"text":"The follow-up study found that 40% of the 81 traced DVMs had sold planting material of Marando Bora varieties in the year prior to the study, five years after the end of the project. This contrasts to 18% that had sold any variety of vines before the intervention. A further 16% had continued to maintain the improved varieties for own use. During the intervention 72% and 28% of the DVMs were operating as groups or individuals, respectively; five years later the proportion of DVMs operating as groups had reduced to 44% (of which 28% were continuing to sell)."},{"index":3,"size":8,"text":"Were there any key challenges or lessons learned?"}]},{"head":"Varieties","index":5,"paragraphs":[{"index":1,"size":68,"text":"During the Marando Bora project, five improved sweetpotato varieties were promoted and distributed through the DVMs: three were orange-fleshed (Jewel, Ejumula and Kabode) and the other two were cleaned up local cream/white-fleshed varieties (Polista and Ukerewe). The DVMs received 2-5 varieties for multiplication and distribution. Of the multipliers reporting receiving each variety 48% had retained Polista; 34% retained Kabode; 23% had retained Ukerewe; 12% Ejumula and 11% Jewel."},{"index":2,"size":95,"text":"Reasons for losing or retaining varieties related to susceptibility of the variety to drought and diseases, and market preferences. Individual DVMs were more likely to retain the varieties compared to groups. Male individuals had higher retention of Polista, Ejumula and Ukerewe than females. DVMs stated that Polista and Ukerewe were tolerant to diseases and drought, with Polista being marketable (both vines and roots), with large roots and high dry matter. Reasons for retaining Ejumula related to nutrition for their families and sale of vines when there is the opportunity. Kabode appears to be widely adaptable;"},{"index":3,"size":14,"text":"(Fig. 3) but Jewel was considered more susceptible to drought and diseases 1 ."},{"index":4,"size":96,"text":"If they lost a variety, some DVMs would find replacement material from within their network of other multipliers, neighbours and kin; or by contacting research stations. Depending on variety between 9% (for Ejumula, Ukerewe) and 21% (for Kabode) of DVMs who had received a variety, had replaced it. Of the 45 multipliers who were continuing for sale or own use 78% were also multiplying other varieties, with male DVMs having the highest number of other varieties. These included local land races and improved varieties distributed through subsequent projects (e.g. Mataya and NASPOT 1, 8, 12, 13)."},{"index":5,"size":85,"text":"There is increasing differentiation among varieties in terms of use; i.e. home consumption, marketing and to some extent processing (both traditional sweetpotato processed products such as \"mchembe\" and processing of OFSP types for chapati, mandazi). The persistence of varieties depends on how varietal characteristics fit into different agro-ecologies and degree of preference in the market. For the upland system -(with showers in August) -the variety needs to be longer maturity (5 months -e.g. Polista). Shifting between lowlands and uplands -suits the shorter maturity OFSP varieties."}]},{"head":"Seed production practices","index":6,"paragraphs":[{"index":1,"size":161,"text":"Observations were taken on 17 plots to capture the use of specialized seed practices. 94% were conserving vines during the dry season; 88% were weeding (Fig. 2); 47% used seed beds; 59% used short cuttings; 41% close spacing; 41% rouging; 71% rotation and 35% practiced isolation. 24% labelled their multiplication plot, with only 18% labelling planting materials. Access to a water 1 During the project, both Ejumula and Jewel were known to be virus susceptible, but the taste of Ejumula is highly preferred in East Africa, and Jewel, an important OFSP variety, met needs of a niche processing market. source ranged from 5 to 20 meters. Groups rented or used land belonging to a group member; the individual multipliers used their own land. FGDs on the changing division of labour, highlighted that men were joining their wives in their vine multiplication activities, ensuring that measurements for seed beds and spacing were done correctly, and supporting the irrigation effort during dry spells."}]},{"head":"Group and individual DVMs","index":7,"paragraphs":[{"index":1,"size":116,"text":"We found different scenarios as to why farmer groups who had been DVMs continued vine multiplication or not. 36 (57%) of the original group DVMs were traced of which 53% (19) had abandoned sweetpotato vine multiplication as an activity. Reasons for dropping including the start of another project with a different crop or activity focus; the lack of markets for vines in their area, or loss of varieties due to drought or disease. 19% (7) of the group DVMs had completely disbanded due to a variety of reasons relating to: group dynamics; technical challenges related to irrigation, pests and diseases; or the close of the project. 28% of the group DVMs were continuing to sell vines."},{"index":2,"size":93,"text":"However, in some cases although the group may have discontinued vine multiplication, members within the group started their own multiplication activities. This explains the increase in number of individual multipliers compared to the project period (from 28% to 56%) of which 69% were male and 31% were female. The number of female individual DVMs had doubled from seven during the intervention to 14 at the time of the follow-up. Among the individual DVMs, 49% were continuing to sell; with 39% of individual male DVMs continuing to sell; compared to 71% of female DVMs."}]},{"head":"Customers","index":8,"paragraphs":[{"index":1,"size":222,"text":"The main types of customers mentioned for all categories of DVMs (groups, individuals, male, female) were farmers from the surrounding community (up to 10 km distance) (Fig. 4). The second category were institutional customers. Individual male DVMs were the only ones to mention traders as customers; and group DVMs were the only ones to mention \"events\" (e.g. agricultural shows) as a source of customers. There was a mixture of one-off and repeat customers. The maximum number of customers reported was between 80-98; but the majority of DVMs reported between 5-10 customers over the last year, of which they could recall some details of the transactions. For groups: the predominant unit of sale was \"bundle\" (head-load/ bicycle load) which was not standardized but ranged in the equivalent of 100-300 30cm cuttings, with a price range per cutting of 7-20 TSH (US$0.003 -0.009). For individual DVMs, bags were more commonly used as the unit of sale, with each bag having 1,200 30 cm cuttings on average. Unit price per 30 cm cutting ranged from 4-40 TSH (US$0.002-0.018). Varieties requested, depended on what was available, but Kabode was most frequently mentioned and Polista. Key promotion strategies were: word of mouth through friends and neighbours; roadside signboards; village meetings and contacts through extension officers. Radio and use of demonstration plots were only mentioned by a few."}]},{"head":"Changing attitudes and behaviours","index":9,"paragraphs":[{"index":1,"size":111,"text":"In the past, sweetpotato was the responsibility of women because of its role in assuring food security in the home; and women's role in crop production, sourcing varieties and planting material. Attitudes and practices have changed towards sweetpotato as a crop and vine exchange. Sweetpotato is now considered as a cash crop by men, because production of other crops (e.g. maize, rice, coffee) is being affected by climatic variability, disease outbreaks, and marketing uncertainty. This is reflected in national and regional sweetpotato production figures and the increase in road side markets in Bukombe and Butiama on the major transportation routes to Dar es Salaam, Dodoma, Shinyanga and border towns with Kenya."},{"index":2,"size":47,"text":"As economic benefit is apparent, gender roles become more fluid, and ridicule overcome. In FGDs women noted how engagement in specialized vine multiplication, and the associated income -has led to increased respect in the household and community, leading to different social norms and practices emerging around sweetpotato."},{"index":3,"size":24,"text":"Managing access to appropriate land and water resources both within and outside the household are jointly negotiated by wife and husband for mutual benefit."},{"index":4,"size":173,"text":"Specialized seed production practices require additional investment and resources, so multipliers want to see some recognition/monetary compensation. Extra labour, manure and irrigation inputs are needed. Parallel pricing systems are emerging \"people know seed for sale is better quality than what they get for free. People are already accepting that\". \"There can be a price differentiation between local vines (TSH 1,000) and improved (TSH 5,000) (ID42)\". So, there is growing acceptance that vines can be sold.  However, commercialization and a business approach are still mediated by strong sentiments related to community obligations \"justness\". The DVMs balanced their social obligations with the development of their business. Some set the number of families they will assist or the quantity they will gift -planning to meet their social obligations; some only gift vines from their root production field, not their vine multiplication plot. Some will gift but only provide very small quantities. There are other motivations around gifting such as spreading risk if they lose a variety, and pragmatism when vines are plentiful or to avoid theft."},{"index":5,"size":57,"text":"While there are social norms and values that underpin transactions of sweetpotato vines, it appears that DVMs can navigate these to continue in their vine business. These social norms also contribute to the persistence of the orange-fleshed varieties as FGDs explained when people know the nutritional benefits, they want these to be shared widely in the community."}]},{"head":"What's next?","index":10,"paragraphs":[{"index":1,"size":90,"text":"The findings have increased our understanding of the motivations of different types of multipliers to continue to sell and maintain improved varieties, and the types of social norms underpinning vine transactions in cash or through gifting practices. This information can be used to ensure stronger linkages with the sources of improved varieties, clean seed and information about quality assurance practices. Using social media and identifying regular events where multipliers can access new varieties and clean seed is critical. In the context of commercialization of the root crop and availability of"}]}],"figures":[{"text":"Fig 1 . Fig 1. Sex disaggregated Focus Group Discussion, Chato, Tanzania (Credit: M. McEwan) "},{"text":"Fig 2 . Fig 2. Weeding time at Iligamba Village, Buchosa (Credit: M. Sila) "},{"text":"Fig 3 . Fig 3. Young child enjoying an orange-fleshed sweetpotato root "},{"text":"Fig 4 . Fig 4. Satisfied customers displaying their quality vines in Mwanza (Credit: J. Low) "}],"sieverID":"72cc7b41-bb84-44cd-bc70-2a4d00392d04","abstract":"improved varieties vine multiplication is increasingly a specialized activity, with changes in the gender division of labour. Women can negotiate and manage these changes to their own benefit and that of the household, if they have access to training and resources."}

data/part_4/043122db99b810cfaf34fd436967576b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"043122db99b810cfaf34fd436967576b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/cdd36c8b-d205-4fef-ad89-9fdcc3931341/retrieve"},"pageCount":11,"title":"The differential impact of four tropical species of root-knot nematodes (Meloidogyne spp.) on biofortified cassava","keywords":["food security","Meloidogyne arenaria","Meloidogyne enterolobii","Meloidogyne incognita","Meloidogyne javanica","nutritional insecurity"],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":366,"text":"Cassava is an important crop grown across sub-Saharan Africa, which is well adapted to diverse soil and environmental conditions, as well as to complex traditional farming systems. It is a major source of energy for over 600 million people on the continent (Afuape, 2009), even though it is generally low in nutritional value (Harvest-Plus, 2014). Cassava is grown principally for its swollen storage roots, while cassava leaves are also consumed in some areas, particularly in parts of Africa (Dahniya, 1983). Cassava leaves are an important vegetable in Congo, Sierra Leone and Tanzania (Okigbo, 1980) and have a nutritive value similar to other dark green leaves and are an extremely valuable source of vitamins A (carotene) and C, iron, calcium and protein (Latham, 1979). The consumption of cassava leaves helps many Africans compensate for the lack of protein and some vitamins and minerals in the roots. In some Africa countries, farmers plant tree cassava -mpiru -for the production of leaves and stems. Producers earn additional income by selling cassava leaves and stems. However, while cassava is renowned for its ability to thrive under marginal conditions and for its resilience, in Africa yields tend to be poor and way below potential (FAO, 2018). Numerous reasons underlie this, such as losses to pests and diseases. Although not well known, the damage caused by root-knot nematodes (RKN; Meloidogyne spp.) to cassava is becoming increasingly recognised (Coyne & Affokpon, 2018;Akinsanya & Coyne, 2021). Furthermore, in order to raise the nutritional value of cassava, substantial efforts have been made towards breeding biofortified cultivars, mostly with enhanced levels of provitamin A carotenoids (Montagnac et al., 2009). The specific enhancement of nutritional elements through genetic improvement is referred to as biofortification (Tanumihardjo et al., 2008). These cassava cultivars were developed by conventional plant breeding methods and released for use in Nigeria and DR Congo (Busani, 2011;Levitt, 2011). Micronutrients that are especially targeted for biofortification include vitamin A, iron and zinc, which are aimed at tackling vitamin A deficiency (Saltzman et al., 2013), an important public health problem in sub-Saharan Africa. It was recently highlighted how the yield and nutritional quality of biofortified cassava cultivars could be reduced by RKN (Akinsanya et al., 2020a, b)."},{"index":2,"size":228,"text":"Meloidogyne spp. mostly attack the feeder roots on cassava, although storage roots and stems can be affected, causing deformities and swellings, or galls, decay and root death (Gapasin, 1980;Caveness, 1982;Coyne et al., 2003). Damage to the root system disrupts translocation of water and nutrients, as well as facilitating entry of secondary root rot pathogens. Consequently, storage root number and yield can be affected, resulting in, at times, substantial losses from RKN infection (Coyne & Affokpon, 2018). In addition to storage root losses, even of up to 87%, reduced storability and post-harvest losses can be high, due to higher levels of rots and rapid deterioration under severe nematode attack (Caveness, 1982;Théberge, 1985). In Kenya, severe damage to a small number of cassava germplasm lines (ca 1%) was observed in a breeder's selection trial without the species involved being identified (Coyne et al., 2004). Similarly, in Nigeria RKN are becoming regarded as important pest constraints to cassava (Akinsanya & Afolami, 2019;Akinsanya et al., 2020a), but where the species involved have not been determined. The release of cassava cultivars into geographic situations where assessment has not been comprehensively conducted has also highlighted the damaging nature of Meloidogyne spp. on otherwise high yielding and promising cassava lines (Coyne et al., 2004(Coyne et al., , 2005)); knowledge on the species involved and their damage potential will be useful for deployment of new cultivars."},{"index":3,"size":254,"text":"The main species of Meloidogyne recorded infecting cassava are M. javanica and M. incognita, which can occur as single species infections or as multiple species infections, including in combination with M. arenaria and M. hapla (Coyne & Affokpon, 2018). Meloidogyne enterolobii has also been reported from cassava fields in Brazil (Rosa et al., 2014) but without any information on its pathogenicity or damage potential to cassava. In West Africa, M. enterolobii is among the most commonly occurring species of Meloidogyne, recovered from a range of crops (Pagan et al., 2015;dos Santos et al., 2019) and it has recently been confirmed infecting cassava and causing significant damage in Nigeria (Oyetunde et al., 2021). In light of the damage potential of M. enterolobii across a range of crops, as well as its prevalence in West Africa, the opportunity to gain an understanding of its interaction with cassava was taken in the current study. Akinsanya et al. (2020a, b) recently demonstrated that improved, biofortified cassava cultivars can be quite profoundly affected by M. incognita from studies in pots and in field plots in Nigeria. Both yield, post-harvest quality and nutritional quality were affected following nematode infection. However, how this damage may differ following infection by different species of RKN has not been well studied. The current study was therefore undertaken to determine the differential effects of M. incognita, M. javanica, M. arenaria and M. enterolobii individually and in combination on the growth and development of the same popular, biofortified cultivars that Akinsanya et al. (2020a, b) used."}]},{"head":"Materials and methods","index":2,"paragraphs":[]},{"head":"EXPERIMENTAL SITE AND DETAILS","index":3,"paragraphs":[{"index":1,"size":133,"text":"The study was conducted in the screenhouse at the International Institute of Tropical Agriculture (IITA), Ibadan, Nigeria (7°22 39 N 3°54 21 E; 181 m a.s.l.). Experiments were maintained for 4 months each, first in June 2018 and repeated in April 2019. The study consisted of two factors: RKN treatments (M. enterolobii, M. incognita, M. javanica, M. arenaria and combination of the four species) and cultivar (six biofortified cultivars plus a susceptible standard ('IITA-TMS-IBA 30572') as control; Table 1). Cassava cultivars were selected from among the most popular biofortified cultivars cultivated in Nigeria with a popularly grown RKN susceptible standard (Akinsanya & Afolami, 2018). Treatments were arranged in a completely randomised design with four replicates each   Total Density (TD) = root and soil densities combined from 10 g roots and 250 g soil."},{"index":2,"size":1,"text":"3"},{"index":3,"size":3,"text":"Gall Index (GI)"},{"index":4,"size":18,"text":"= (1 = 1-2 galls, 2 = 3-10 galls, 3 = 11-30 galls, 4 = 31-100 galls, 5"},{"index":5,"size":8,"text":"= >100 galls) (after Taylor & Sasser, 1978)."},{"index":6,"size":121,"text":"4 RF = Nematode Reproduction Factor (Oostenbrink, 1966). per cultivar per treatment. Cassava stems ca 15 cm long were planted at an angle into 10 l pots filled with steamsterilised sandy-loam topsoil, maintained for 3 weeks for roots to develop, before inoculating a suspension of approximately 1000 each of M. enterolobii, M. incognita, M. javanica or M. arenaria eggs, or a combination of all four species at 250 each, in 10 l pots. Inoculum was delivered into a furrow made with a trowel around each stem and then the soil replaced after inoculation. A noninoculated control received the same volume of water but no nematodes. All plants were then irrigated daily with 500 ml tap water. Mean daily temperatures were 26-32°C."}]},{"head":"NEMATODE INOCULUM","index":4,"paragraphs":[{"index":1,"size":134,"text":"A pure population each of M. enterolobii, M. incognita, M. javanica and M. arenaria, originally isolated from infected tomato (Solanum lycopersicum) plants (dos Santos et al., 2019), were maintained in the screenhouse at IITA on tomato plants. Galled, infected roots of tomato were gently removed from pots and rinsed under running water to remove soil debris, chopped into 2-3 cm pieces and nematode eggs extracted using the Hussey & Barker (1973) sodium hypochlorite method. The eggs were collected on a 25 μm sieve, which were rinsed into a beaker, reduced to 30 ml and the egg suspension density quantified using 3 × 1 ml aliquots in a Doncaster (1962) ringed counting dish under the stereomicroscope (×40). The nematodes were inoculated in suspension of tap water at the rate of 1000 eggs pot −1 ."}]},{"head":"NEMATODE EVALUATION","index":5,"paragraphs":[{"index":1,"size":314,"text":"At harvest, plants were carefully removed and roots tapped free of soil. Nematode eggs and second-stage infective juveniles (J2) were extracted and their density calculated from roots as above, using a 10 g sub-sample after weighing, chopping and thoroughly mixing all roots for each plant. The total number of nematodes per root system was then calculated. Nematodes were extracted from 250 g soil sub-samples using the Whitehead & Hemming (1965) tray method following thorough mixing of the soil from each pot, and using a double-ply extractor sandwiched between two plastic sieves with 250 ml water after spreading out the soil in the sieve. Nematode extracts were removed after 24 h, allowed to settle for 5 h and the volume adjusted to 30 ml by siphoning off the excess (Caveness, 1975). The nematode density was assessed under the microscope (3 × 1 ml aliquots) and the total number of soil nematodes per pot calculated. Total number of nematodes per pot from soil and feeder roots data was used to calculate the nematode reproduction factor (RF) (Oostenbrink, 1966): Four months after planting (MAP) at harvest, plant height, stem girth, aerial fresh weight and feeder root weight per plant were determined. The number of galls on 5 cm of feeder roots per plant, removed randomly at harvest, was counted and galling index (GI) per 5 cm plant root assessed using the 1-5 scale of Taylor & Sasser (1978) (1 = 1-2 galls, 2 = 3-10 galls, 3 = 11-30 galls, 4 = 31-100 galls, 5 = >100 galls). Cultivars were tested and categorised into resistance levels using nematode RF, GI and average crop yield (Afolami, 2000;Afolami et al., 2004). (Resistance: RF 1, GI 2, no significant growth/yield loss; Tolerance: RF > 1, GI 2, no significant growth/yield loss; Susceptible: RF > 1, GI > 2, significant growth/yield loss; Hypersusceptible: RF 1, GI > 2, significant growth/yield loss)."}]},{"head":"STATISTICAL ANALYSIS","index":6,"paragraphs":[{"index":1,"size":63,"text":"Data were subjected to a factorial analysis of variance (ANOVA) using SAS 9.4 (2012) statistical package and means were separated using least significant difference (LSD) at P 0.05. Analysis of data for plant growth data was separated for each experiment as ANOVA showed significant (P 0.05) differences (interaction) between the two experiments but not for the nematode density, damage and resistance rating data."}]},{"head":"Results","index":7,"paragraphs":[{"index":1,"size":153,"text":"All cultivars evaluated reacted to M. enterolobii, M. incognita, M. javanica and M. arenaria infection, with GI ranging from 2 to 5 (Table 1). Significant (P 0.05) differences in their abilities to support the reproduction of the four species were observed among most cultivars. All the cultivars were rated susceptible to M. enterolobii, M. incognita, M. javanica, M. arenaria and the combination of species, with the exception of 'IITA-TMS-IBA011368', 'IITA-TMS-IBA011371' and 'NR 07/0220', which were rated tolerant to M. arenaria with a GI less than or equal to 2 and a RF greater than 1, but their growth and plant weight were mostly not significantly reduced (Table 2). The highest number of root galls were observed in plants infected with the combination of the four species, while the lowest was recorded in plants infected with M. arenaria (Table 1). The highest number of galls in both trials was recorded in 'IITA-TMS-IBA070593' (Table 1)."},{"index":2,"size":106,"text":"Stunted aerial growth was observed on most plants infected with M. enterolobii, M. incognita, M. javanica, M. arenaria and the combined species at harvest (Table 3a, b). Crop growth was significantly (P 0.05) suppressed on inoculated plants for most cultivars, except for some cultivars infected with M. enterolobii and M. arenaria. Significant (P 0.05) reduction was also recorded in stem girth of most infected plants compared with the controls. Generally, plants infected with M. incognita or the combined species resulted in the most drastic suppression of plant growth and development, while M. arenaria-infected plants recorded the least suppression in both trials (Tables 3, 4; Fig. 1)."}]},{"head":"Discussion","index":8,"paragraphs":[{"index":1,"size":74,"text":"The current study demonstrates the high susceptibility of elite, biofortified cassava cultivars to four tropical species of Meloidogyne. Of particular note is the raised level of damage, following the combined inoculation with all four species, compared with single species infection. Furthermore, the study demonstrates the susceptibility of cassava to M. enterolobii, and this species additionally poses a threat to cassava production and has been recorded recently as occurring on cassava (Oyetunde et al., 2021)."},{"index":2,"size":274,"text":"The key four species of this tropical group are M. arenaria, M. enterolobii, M. incognita and M. javanica. These tropical RKN species are highly polyphagous and demonstrate substantial variation in virulence and aggression (Trudgill & Blok, 2001). Infection by these four species alone likely amounts to an insurmountable yet undetermined level of loss to agricultural productivity across crops, unparalleled by any other pest or pathogen group in terms of reduced yield and post-harvest losses in the tropics (Trudgill et al., 2000;Trudgill & Blok, 2001;Coyne et al., 2018;Sikora et al., 2018). Although not well recognised as pests of cassava, exceptionally high losses have been associated with RKN infection (Coyne & Affokpon, 2018), indicating the importance of these overlooked pests on an otherwise 'hardy' crop. Much damage probably goes unnoticed though, as cassava roots are naturally uneven meaning that low levels of galling damage could be readily overlooked. Infected roots can also deteriorate and decompose before harvest, leaving no observable symptoms to link RKN infection to reduced yields. Losses thus become attributed to other reasons, such as low soil fertility or rainfall (Coyne & Affokpon, 2018;Coyne et al., 2018). Despite relatively low initial inoculum levels (P i ) of Meloidogyne spp. in the field in Nigeria, the growth and yield of improved, elite cassava cultivars were significantly (P 0.05) reduced (Akinsanya & Afolami, 2019). Studies also demonstrated the potential damage of M. incognita to novel biofortified cultivars in pots (Akinsanya et al., 2020a) and to Meloidogyne spp. in the field (Akinsanya et al., 2020b). How these nutritionally improved and elite cultivars would react to other species of tropical RKN was unknown and therefore of much interest."},{"index":3,"size":238,"text":"Although our current study was conducted under controlled conditions in pots and for 4 months of growth only, significant (P 0.05) suppression in most growth parameters measured was observed, with the highest root galling and damage in plants following inoculation with a combination of the four species. While pot studies are not ideal to assess yield impact on cassava, the damage to roots and plant growth in the current study provides a suitable indication of potential field damage by the four species. The study also further demonstrates the susceptibility of cassava to M. enterolobii, which was only recently recorded infecting cassava in Africa (Oyetunde et al., 2021). The current study now clearly demonstrates its ability to infect and cause damage to cassava. Given that M. enterolobii is prevalent in Nigeria, at least on vegetable crops (dos Santos et al., 2019), it is highly likely that M. enterolobii is infecting cassava and other crops in the field, either in isolation or in combination, but being overlooked. As individual species inoculations, M. incognita and M. javanica were most damaging, with the least damage observed in plants inoculated with M. arenaria only. Three cultivars were rated as tolerant to M. arenaria, with a GI less than or equal to 2 and a RF greater than 1, but their growth and plant weight were mostly not significantly reduced, relative to the non-inoculated control (Afolami, = >100 galls) (after Taylor & Sasser, 1978)."},{"index":4,"size":8,"text":"3 RF = Nematode Reproduction Factor (Oostenbrink, 1966)."},{"index":5,"size":1,"text":"4"},{"index":6,"size":9,"text":"Yield difference between inoculated and control fresh plant weight."},{"index":7,"size":27,"text":"5 Degree of Resistance (DoR) based on Afolami (2000) and Afolami et al. (2004). (Susceptible (S): RF > 1, GI > 2, significant growth/yield loss; Tolerance (T):"},{"index":8,"size":120,"text":"RF > 1, GI 2, No significant growth/yield loss; Resistance (R): RF 1, GI 2, no significant growth/yield loss; Hypersusceptible (H): RF 1, GI > 2, significant growth/yield loss).  2000; Afolami et al., 2004). Tolerance in this context implied that M. arenaria reproduced with gall formation in the roots of these biofortified cultivars (RF > 1, GI 2) but did not cause significant (P 0.05) plant damage at harvest. Rather, the infected plants reacted with raised plant growth compared with non-inoculated control plants (Afolami, 2000;Afolami et al., 2004). The susceptible cultivars differed from the tolerant cultivars by the extent of the yield losses (P 0.05) experienced by M. incognita, M. javanica, M. enterolobii and a combination of the four species."},{"index":9,"size":148,"text":"Our study shows that all four prevalent tropical Meloidogyne species were able to infect and cause damage to cassava, especially in combination. The cassava cultivars used in this study have been developed to improve food security and reduce malnutrition, but, given their high sus- ceptibility to the prevalent RKN species, their potential to achieve this will be undermined. A previous study on the same cultivars also showed that infection with RKN can negatively affect the nutritional quality (Akinsanya et al., 2020b) in addition to yields. An effective nematode control strategy such as breeding for resistance to RKN is therefore necessary to safeguard these special cassava cultivars against these nematode pests. Cassava cultivars with resistance against RKN have been identified (Coyne et al., 2004;Udo et al., 2008;Abidemi, 2014) and so it should be possible to channel this resistance into new improved, biofortified cultivars to overcome the threat of RKN."}]}],"figures":[{"text":"5 Degree of Resistance (DoR) based onCanto-Saenz (1983) host suitability designation (Susceptible (S): RF > 1, GI > 2, significant growth/yield loss. Tolerance (T):RF > 1, GI 2, No significant growth/yield loss; Resistance (R): RF 1, GI 2, no significant growth/yield loss; Hypersusceptible (H): RF 1, GI > 2, significant growth/yield loss). "},{"text":" Final number of Meloidogyne eggs in 10 g feeder roots divided by 10 W rp = Total weight of fresh feeder roots in pot P f 250 g = Final number of Meloidogyne J2 and eggs in 250 g of soil divided by 250 M sp = Total mass of soil in pot P i = Inoculation density (initial number of Meloidogyne eggs) PLANT GROWTH AND NEMATODE DAMAGE EVALUATION "},{"text":"Table 2 . Resistance evaluation of biofortified cassava cultivars following inoculation with 1000 eggs of Meloidogyne enterolobii, M. incognita, M. javanica, M. arenaria and their combination (250 eggs of each species) in 10 l "},{"text":"Fig. 1 . Fig. 1. Growth of all cassava cultivars in 10 l pots at 3 months after inoculation with four species of Meloidogyne and their combination. A: All biofortified cassava cultivars + control cultivar + zero inoculation; B: All biofortified cassava cultivars + control cultivar + 1000 eggs of M. enterolobii; C: All biofortified cassava cultivars + control cultivar + 1000 eggs of M. incognita; D: All biofortified cassava cultivars + control cultivar + 1000 eggs of M. javanica; E: All biofortified cassava cultivars + control cultivar + 1000 eggs of M. arenaria; F: All biofortified cassava cultivars + control cultivar + 250 eggs each of M. enterolobii, M. incognita, M. javanica, and M. arenaria. "},{"text":"Table 1 . Root galling damage of biofortified cassava cultivars following inoculation with 1000 eggs of Meloidogyne enterolobii, M. incognita, M. javanica, M. arenaria  DoR 5  DoR 5  M. arenaria TD 2 M. arenariaTD 2  DoR 5  DoR 5  Meloidogyne spp. TD 2 GI 3 RF 4 Meloidogyne spp.TD 2 GI 3 RF 4   RF 4 RF 4  M. javanica TD 2 GI 3 M. javanicaTD 2 GI 3   RF 4 RF 4 and their combination (250 eggs of each species) in 10 l pots 1 . Cultivar M. enterolobii M. incognita TD 2 GI 3 RF 4 TD 2 GI 3 and their combination (250 eggs of each species) in 10 l pots 1 .Cultivar M. enterolobii M. incognitaTD 2 GI 3 RF 4 TD 2 GI 3  "},{"text":"Table 3 . Growth and development of six biofortified cassava cultivars in pots in the screenhouse following inoculation with four species of Meloidogyne and their combination: first trial 1 . Treatment with 1000 eggs of M. enterolobii, M. incognita, M. javanica, M. arenaria and 250 eggs of each species in the combined.  Control 3   Treatment 2   Control 3Treatment 2   M. M. M. M. Meloidogyne LSD M.M.M.M.MeloidogyneLSD   enterolobii incognita javanica arenaria spp. (P 0.05) enterolobiiincognitajavanicaarenariaspp.(P 0.05) 'IITA-TMS-IBA011368'        'IITA-TMS-IBA011368' Plant height (cm) 147.7 a 93.8 ab 58.3 b 84.5 ab 139.5 a 41.0 b 66.7 Plant height (cm)147.7 a93.8 ab58.3 b84.5 ab139.5 a41.0 b66.7 Stem girth (cm) 1.3 a 0.9 ab 0.5 bc 0.7 ab 1.1 ab 0.4 c 0.6 Stem girth (cm)1.3 a0.9 ab0.5 bc0.7 ab1.1 ab0.4 c0.6 Fresh shoot weight (g) 249.1 ab 141.6 ab 133.9 ab 180.3 ab 266.9 a 97.9 b 123.7 Fresh shoot weight (g)249.1 ab141.6 ab133.9 ab180.3 ab266.9 a97.9 b123.7 'IITA-TMS-IBA011412'        'IITA-TMS-IBA011412' Plant height (cm) 182.0 a 122.5 ab 83.8 b 163.0 ab 173.8 ab 90.5 b 92.6 Plant height (cm)182.0 a122.5 ab83.8 b163.0 ab173.8 ab90.5 b92.6 Stem girth (cm) 1.3 a 0.9 ab 0.7 b 1.3 a 1.1 ab 0.6 b 0.6 Stem girth (cm)1.3 a0.9 ab0.7 b1.3 a1.1 ab0.6 b0.6 Fresh shoot weight (g) 437.2 a 184.4 bc 119.8 c 273.0 ab 321.3 ab 137.1 bc 137.1 Fresh shoot weight (g)437.2 a184.4 bc119.8 c273.0 ab321.3 ab137.1 bc137.1 Fresh shoot weight (g) 249.1 ab 141.6 ab 133.9 ab 180.3 ab 266.9 a 97.9 b 123.7 Fresh shoot weight (g)249.1 ab141.6 ab133.9 ab180.3 ab266.9 a97.9 b123.7 'IITA-TMS-IBA01371'        'IITA-TMS-IBA01371' Plant height (cm) 160.5 a 119.5 ab 93.0 ab 100.5 ab 124.0 ab 71.0 b 60.6 Plant height (cm)160.5 a119.5 ab93.0 ab100.5 ab124.0 ab71.0 b60.6 Stem girth (cm) 1.1 a 0.7 b 0.8 b 1.1 a 1.2 a 0.7 b 0.5 Stem girth (cm)1.1 a0.7 b0.8 b1.1 a1.2 a0.7 b0.5 Fresh shoot weight (g) 248.8 a 199.7 bc 182.6 bc 234.0 ab 233.9 ab 163.3 c 48.2 Fresh shoot weight (g)248.8 a199.7 bc182.6 bc234.0 ab233.9 ab163.3 c48.2 Fresh shoot weight (g) 249.1 ab 141.6 ab 133.9 ab 180.3 ab 266.9 a 97.9 b 123.7 Fresh shoot weight (g)249.1 ab141.6 ab133.9 ab180.3 ab266.9 a97.9 b123.7 'IITA-TMS-IBA070593'        'IITA-TMS-IBA070593' Plant height (cm) 110.5 a 100.3 a 69.0 b 80.0 ab 74.5 b 85.0 ab 79.8 Plant height (cm)110.5 a100.3 a69.0 b80.0 ab74.5 b85.0 ab79.8 Stem girth (cm) 1.0 a 1.0 a 0.7 b 0.7 b 0.7 b 0.9 ab 0.5 Stem girth (cm)1.0 a1.0 a0.7 b0.7 b0.7 b0.9 ab0.5 Fresh shoot weight (g) 249.1 ab 141.6 ab 133.9 ab 180.3 ab 266.9 a 97.9 b 123.7 Fresh shoot weight (g)249.1 ab141.6 ab133.9 ab180.3 ab266.9 a97.9 b123.7 Fresh shoot weight (g) 317.6 a 198.5 bc 141.0 c 152.6 bc 232.1 b 131.6 c 131.6 Fresh shoot weight (g)317.6 a198.5 bc141.0 c152.6 bc232.1 b131.6 c131.6 Fresh shoot weight (g) 249.1 ab 141.6 ab 133.9 ab 180.3 ab 266.9 a 97.9 b 123.7 Fresh shoot weight (g)249.1 ab141.6 ab133.9 ab180.3 ab266.9 a97.9 b123.7 'IITA-TMS-IBA070539'        'IITA-TMS-IBA070539' Plant height (cm) 130.5 a 120.5 ab 72.0 b 88.5 ab 81.0 ab 71.5 b 61.6 Plant height (cm)130.5 a120.5 ab72.0 b88.5 ab81.0 ab71.5 b61.6 Stem girth (cm) 1.2 a 0.8 0.8 b 0.9 ab 0.9 ab 0.5 b 0.5 Stem girth (cm)1.2 a0.80.8 b0.9 ab0.9 ab0.5 b0.5 Fresh shoot weight (g) 261.1 a 105.6 bc 97.4 c 152.8 b 234.4 ab 135.3 b 48.4 Fresh shoot weight (g)261.1 a105.6 bc97.4 c152.8 b234.4 ab135.3 b48.4 Fresh shoot weight (g) 249.1 ab 141.6 ab 133.9 ab 180.3 ab 266.9 a 97.9 b 123.7 Fresh shoot weight (g)249.1 ab141.6 ab133.9 ab180.3 ab266.9 a97.9 b123.7 'NR 07/0220'        'NR 07/0220' Plant height (cm) 75.0 ab 43.0 c 64.3 bc 66.5 bc 90.5 a 37.5 c 82.0 Plant height (cm)75.0 ab43.0 c64.3 bc66.5 bc90.5 a37.5 c82.0 Stem girth (cm) 0.7 ab 0.6 ab 0.6 ab 0.9 a 0.8 ab 0.5 b 0.7 Stem girth (cm)0.7 ab0.6 ab0.6 ab0.9 a0.8 ab0.5 b0.7 Fresh shoot weight (g) 145.4 ab 108.4 b 99.3 b 108.3 b 160.7 a 119.5 b 122.3 Fresh shoot weight (g)145.4 ab108.4 b99.3 b108.3 b160.7 a119.5 b122.3 Fresh shoot weight (g) 249.1 ab 141.6 ab 133.9 ab 180.3 ab 266.9 a 97.9 b 123.7 Fresh shoot weight (g)249.1 ab141.6 ab133.9 ab180.3 ab266.9 a97.9 b123.7 'IITA-TMS-IBA30572' (control)        'IITA-TMS-IBA30572' (control) Plant height (cm) 213.3 a 163.5 b 116.8 c 136.0 bc 172.0 b 98.0 c 101.3 Plant height (cm)213.3 a163.5 b116.8 c136.0 bc172.0 b98.0 c101.3 Stem girth (cm) 1.3 a 0.9 ab 0.5 b 0.5 b 0.9 ab 0.5 b 0.5 Stem girth (cm)1.3 a0.9 ab0.5 b0.5 b0.9 ab0.5 b0.5 Fresh shoot weight (g) 321.5 a 162.7 bc 135.0 c 158.9 bc 231.5 b 141.3 c 94.8 Fresh shoot weight (g)321.5 a162.7 bc135.0 c158.9 bc231.5 b141.3 c94.8 1 n = 4: means of four replications; LSD: Least Significant Difference (P 0.05); for each treatment group values within a row 1 n = 4: means of four replications; LSD: Least Significant Difference (P0.05); for each treatment group values within a row followed by a different letter are significantly (P 0.05) different.     followed by a different letter are significantly (P 0.05) different.  "},{"text":"Table 4 . Growth and development of six biofortified cassava cultivars in pots in the screenhouse following inoculation with four species of Meloidogyne and their combination: second trial. Treatment with 1000 eggs of M. enterolobii, M. incognita, M. javanica, M. arenaria and 250 eggs of each species in the combination. 3 Control: No treatment applied.  Control 3   Treatment 2   Control 3Treatment 2   M. M. M. M. Meloidogyne LSD M.M.M.M.MeloidogyneLSD   enterolobii incognita javanica arenaria spp. (P 0.05) enterolobiiincognitajavanicaarenariaspp.(P 0.05) 'IITA-TMS-IBA011368'        'IITA-TMS-IBA011368' Plant height (cm) 132.5 a 108.0 ab 75.50 bc 100.5 ab 136.0 a 57.8 c 40.0 Plant height (cm)132.5 a108.0 ab75.50 bc100.5 ab136.0 a57.8 c40.0 Stem girth (cm) 1.4 a 1.2 ab 0.6 b 1.1 ab 1.1 ab 0.4 b 0.4 Stem girth (cm)1.4 a1.2 ab0.6 b1.1 ab1.1 ab0.4 b0.4 Fresh shoot weight (g) 251.2 a 175.3 bc 168.9 bc 195.0 b 258.5 a 101.2 c 62.0 Fresh shoot weight (g)251.2 a175.3 bc168.9 bc195.0 b258.5 a101.2 c62.0 'IITA-TMS-IBA011412'        'IITA-TMS-IBA011412' Plant height (cm) 200.8 ab 127.0 bc 92.5 c 178.5 b 231.8 a 81.5 c 52.4 Plant height (cm)200.8 ab127.0 bc92.5 c178.5 b231.8 a81.5 c52.4 Stem girth (cm) 1.4 a 0.8 b 0.6 b 1.2 ab 1.2 ab 0.6 b 0.3 Stem girth (cm)1.4 a0.8 b0.6 b1.2 ab1.2 ab0.6 b0.3 Fresh shoot weight (g) 390.0 a 174.8 bc 139.6 c 300.4 b 344.5 ab 122.1 c 58.0 Fresh shoot weight (g)390.0 a174.8 bc139.6 c300.4 b344.5 ab122.1 c58.0 'IITA-TMS-IBA01371'        'IITA-TMS-IBA01371' Plant height (cm) 185.0 a 94.0 110.8 c 101.5 c 153.8 b 97.5 c 64.8 Plant height (cm)185.0 a94.0110.8 c101.5 c153.8 b97.5 c64.8 Stem girth (cm) 1.3 a 0.6 b 0.7 b 0.9 ab 1.3 a 1.1 ab 0.4 Stem girth (cm)1.3 a0.6 b0.7 b0.9 ab1.3 a1.1 ab0.4 Fresh shoot weight (g) 271.70 a 199.5 b 190.0 b 181.4 b 249.3 ab 218.0 b 81.6 Fresh shoot weight (g)271.70 a199.5 b190.0 b181.4 b249.3 ab218.0 b81.6 'IITA-TMS-IBA070593'        'IITA-TMS-IBA070593' Plant height (cm) 133.5 a 110.5 ab 90.0 b 94.8 b 102.5 ab 95.0 b 62.5 Plant height (cm)133.5 a110.5 ab90.0 b94.8 b102.5 ab95.0 b62.5 Stem girth (cm) 1.1 a 0.7 b 0.7 b 0.7 b 0.9 ab 0.7 b 0.4 Stem girth (cm)1.1 a0.7 b0.7 b0.7 b0.9 ab0.7 b0.4 Fresh shoot weight (g) 331.0 a 155.0 bc 136.1 c 198.9 bc 277.9 b 162.3 bc 71.1 Fresh shoot weight (g)331.0 a155.0 bc136.1 c198.9 bc277.9 b162.3 bc71.1 'IITA-TMS-IBA070539'        'IITA-TMS-IBA070539' Plant height (cm) 149.8 a 125.2 ab 92.5 b 119.0 ab 141.9 a 92.5 b 36.4 Plant height (cm)149.8 a125.2 ab92.5 b119.0 ab141.9 a92.5 b36.4 Stem girth (cm) 1.1 a 0.9 ab 0.7 b 0.9 ab 1.0 a 0.7 b 0.4 Stem girth (cm)1.1 a0.9 ab0.7 b0.9 ab1.0 a0.7 b0.4 Fresh shoot weight (g) 245.1 a 132.6 b 126.0 b 190.9 ab 209.9 ab 144.0 b 71.2 Fresh shoot weight (g)245.1 a132.6 b126.0 b190.9 ab209.9 ab144.0 b71.2 'NR 07/0220'        'NR 07/0220' Plant height (cm) 83.0 ab 78.0 ab 72.3 ab 74.8 ab 103.8 a 55.3 b 38.4 Plant height (cm)83.0 ab78.0 ab72.3 ab74.8 ab103.8 a55.3 b38.4 Stem girth (cm) 0.8 a 0.7 ab 0.6 b 0.9 a 0.7 ab 0.7 ab 0.4 Stem girth (cm)0.8 a0.7 ab0.6 b0.9 a0.7 ab0.7 ab0.4 Fresh shoot weight (g) 169.4 a 125.0 ab 86.0 b 148.1 ab 167.6 a 133.5 ab 49.8 Fresh shoot weight (g)169.4 a125.0 ab86.0 b148.1 ab167.6 a133.5 ab49.8 'IITA-TMS-IBA30572' (control)        'IITA-TMS-IBA30572' (control) Plant height (cm) 245.3 a 207.5 ab 117.6 c 169.3 bc 233.1 a 126.9 c 90.6 Plant height (cm)245.3 a207.5 ab117.6 c169.3 bc233.1 a126.9 c90.6 Stem girth (cm) 1.5 a 0.8 ab 0.5 b 0.5 b 0.8 ab 0.5 b 0.6 Stem girth (cm)1.5 a0.8 ab0.5 b0.5 b0.8 ab0.5 b0.6 Fresh shoot weight (g) 312.6 a 226.1 b 122.1 c 175.8 bc 235.6 b 119.5 c 100.6 Fresh shoot weight (g)312.6 a226.1 b122.1 c175.8 bc235.6 b119.5 c100.6 1 n = 4: means of four replications; LSD: Least Significant Difference (P 0.05); for each treatment group values within a row 1 n = 4: means of four replications; LSD: Least Significant Difference (P0.05); for each treatment group values within a row followed by a different letter are significantly (P 0.05) different.     followed by a different letter are significantly (P 0.05) different.  "}],"sieverID":"52b9cf12-a64c-47a6-af04-2eb9a3845f56","abstract":"Cassava plays an important food security role in Africa. Although a hardy crop in general, average yields are low, while traditional cultivars tend to be low in nutrients and vitamins. Substantial efforts have therefore been made to improve the nutritional quality of cassava through the development of biofortified cultivars. Although root-knot nematodes (RKN) are among the various important constraints affecting production, details on the impact of different species of RKN on cassava productivity are scarce. In this study, six popular cultivars of biofortified cassava were evaluated for their response to M. arenaria, M. enterolobii, M. incognita, M. javanica and a combination of all four species, in pots. All tested cultivars were susceptible to the four Meloidogyne species, but some cultivars showed a tolerance to M. arenaria infection. Galling damage was observed on feeder roots of inoculated plants, with nematode reproduction factors ranging between 2.3 and 9.5. Plant height, stem girth and fresh plant mass were significantly lower for most cultivars by as much as 70% following RKN infection. The highest root galling and damage were observed in plants following inoculation with a combination of the four species. As individual species inoculations, M. incognita and M. javanica were the most damaging, with the least damage observed in plants inoculated with M. arenaria only. These results confirm the pathogenicity of M. arenaria, M. incognita and M. javanica and further illustrate the potential of M. enterolobii to impact cassava production, while combined species infections demonstrate the greater levels of damage that these may cause."}

data/part_4/04392bbf835a5bf2fd93bff6f970f5bc.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04392bbf835a5bf2fd93bff6f970f5bc","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/4edde1c4-2b07-43b5-bc22-33b46ec6f936/retrieve"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"Framework for cost-effectiveness analysis of aflatoxin reduction","index":1,"paragraphs":[{"index":1,"size":64,"text":"Project Title: P339 -Better evidence on foodborne disease in target regions Description of the innovation: Compared the impacts of two interventions: 1) subsidies for technologies that improve food safety and 2) price premiums for safer produce. We examine the case of on-farm control of aflatoxin, a carcinogenic toxin linked to child stunting that is produced by a fungus commonly found on maize and groundnut "}]}],"figures":[{"text":"Names of top five contributing organizations/entities to this stage: We tested the impact of subsidies for technologies that improve food safety and price premiums for safer produce in Kenya. Subsidization of aflatoxin control technologies is a cost-effective strategy for reducing liver cancer and possibly also for reducing stunting in children. New Innovation: No  New Innovation: No Stage of innovation: Stage 3: available/ ready for uptake (AV) Innovation type: Social Science Stage of innovation: Stage 3: available/ ready for uptake (AV)Innovation type: Social Science Geographic Scope: Regional Number of individual improved lines/varieties: <Not Applicable> Geographic Scope: RegionalNumber of individual improved lines/varieties: <Not Applicable> Region:  Region: • Sub-Saharan Africa  • Sub-Saharan Africa Description of Stage reached: Name of lead organization/entity to take innovation to this stage: IFPRI -International Food Description of Stage reached: Name of lead organization/entity to take innovation to this stage: IFPRI -International Food Policy Research Institute  Policy Research Institute • IFPRI -International Food Policy Research Institute • IFPRI -International Food Policy Research Institute • ACDI-VOCA  • ACDI-VOCA Milestones: No milestones associated  Milestones: No milestones associated Sub-IDOs:  Sub-IDOs: Contributing Centers/PPA partners:  Contributing Centers/PPA partners: Evidence link:  Evidence link: • https://tinyurl.com/yxpx3oen  • https://tinyurl.com/yxpx3oen  "}],"sieverID":"a260cd44-a91e-40ce-825a-29f4ece18fe3","abstract":""}

data/part_4/04896a31055e4995289795bdbce737b3.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04896a31055e4995289795bdbce737b3","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/901d60f3-ef55-40a8-8e70-4119f3bd5709/retrieve"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[]}],"figures":[{"text":"  "},{"text":"  "},{"text":"Table 1 . Summary For more information on the IBLI project, visit http://livestockinsurance.wordpress.com. Index Area North Horr Index AreaNorth Horr Year 2013 Year2013 Season LRLD SeasonLRLD Date of the most recent data 22 Mar 2013 -6 Apr 2013 Date of the most recent data22 Mar 2013 -6 Apr 2013 Predicted Livestock Mortality 0.05 Predicted Livestock Mortality0.05 Czndvi_pre -3.89 Czndvi_pre-3.89 Czndvi_pos -3.31 Czndvi_pos-3.31 CNzndvi 1.04 CNzndvi1.04 CPzndvi 0.90 CPzndvi0.90  "}],"sieverID":"d31d5743-6971-4cf2-8394-639c5054ad6b","abstract":""}

data/part_4/04c017f1f0f0feb156bf472cb71d475b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04c017f1f0f0feb156bf472cb71d475b","source":"gardian_index","url":"https://digitalarchive.worldfishcenter.org/bitstream/handle/20.500.12348/4862/ef331126916177769ebaa40efc37b952.pdf"},"pageCount":2,"title":"Collect bacteriological samples for AST from hatcheries, farms, wet markets, processing plants and environment (e.g. sh, shrimp, prawn, water, etc.). For live animals, follow standard operating protocol for euthanasia. For wet markets and processing plants, collect freshly killed animals kept on ice","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":15,"text":"Quick protocol for antimicrobial susceptibility testing (AST) in aquatic animal species from aquaculture and sheries"}]},{"head":"Disk di usion method (based on CLSI guideline Vet03 )","index":2,"paragraphs":[{"index":1,"size":8,"text":"Allow agar plates to dry for 3-5 min."},{"index":2,"size":8,"text":"Apply antibiotic disks with dispenser or sterile forceps."},{"index":3,"size":12,"text":"Gently press disks down (do not reposition  In partnership with Note: https://www.clsi.org/standards/products/veterinary-medicine/documents/vet03/"}]}],"figures":[{"text":" identity (e.g. gram staining, biochemical tests, molecular identi cation, etc.). Note: Follow standard protocol for those tests. swab in bacterial suspension.• Gram negative (-ve): Press swab against wall • Gram positive (+ve): Leave excess on 7 "},{"text":"* ECV, epidemiological cut-o value; NWT, non-wild type (resistant); WT, wild type (susceptible); mm, milimeter www.world shcenter.org This work was undertaken as part of the CGIAR Research Program on Fish Agri-Food Systems (FISH) led by WorldFish in close collaboration with Cefas researchers from the UK FAO Reference Centre for Antimicrobial Resistance. This quick protocol for AST in aquatic animal species from aquaculture and sheries is intended to support and benefit national partners and researchers in Asia and Africa working with WorldFish in the areas of aquatic food systems and One Health and bring harmonization of methodologies across ongoing initiatives in Bangladesh. FISH is supported by contributors to the CGIAR Trust Fund. "},{"text":"Table 1 . Streak x3 MHA plates from top to bottom. Rotate 60 and repeat. Then run the swab around rim of the plate. Example of zone of inhibition and ECV interpretation table. ). Incubate agar plates with Read plates at recommended time for the ).Incubate agar plates withRead plates at recommended time for the  disks at 22°C/28°C/35°C. speci c isolate (typically 22-24h and 44-48h). disks at 22°C/28°C/35°C.speci c isolate (typically 22-24h and 44-48h).  "}],"sieverID":"38681c63-49d3-412c-adfa-71e43182df21","abstract":"Bacterial isolation on appropriate media.Incubate fresh pure colony at appropriate time/temperature (e.g. 18-24h, 22°C/28°C/35°C).Inoculate 2 ml of Muller Hinton Broth (MHB)/ sterile saline with 3-5 single colonies and vortex.Adjust turbidity to 0.5 McFarland."}

data/part_4/052a20e017b4f0fed0b443c477eee48b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"052a20e017b4f0fed0b443c477eee48b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/082b2850-e93f-4944-9f28-6d026402b637/retrieve"},"pageCount":31,"title":"","keywords":[],"chapters":[{"head":"IPSR metrics -Innovation Readiness","index":1,"paragraphs":[]},{"head":"Innovation Readiness Levels","index":2,"paragraphs":[{"index":1,"size":25,"text":"Generic level label Generic level description Proven innovation The innovation is validated for its ability to achieve a specific impact under uncontrolled conditions Uncontrolled testing"},{"index":2,"size":17,"text":"The innovation is being tested for its ability to achieve a specific impact under uncontrolled conditions Prototype"},{"index":3,"size":17,"text":"The innovation is validated for its ability to achieve a specific impact under semicontrolled conditions Semi-controlled testing"},{"index":4,"size":71,"text":"The innovation is being tested for its ability to achieve a specific impact under semicontrolled conditions Model/ early prototype The innovation is validated for its ability to achieve a specific impact under fullycontrolled conditions Controlled testing The innovation is being tested for its ability to achieve a specific impact under fullycontrolled conditions Proof of concept The innovation's key concepts have been validated for their ability to achieve a specific impact Formulation"},{"index":5,"size":11,"text":"The innovation's key concepts are being formulated or designed Basic research"},{"index":6,"size":16,"text":"The innovation's basic principles are being researched for their ability to achieve a specific impact Idea"},{"index":7,"size":6,"text":"The innovation is at idea stage"}]},{"head":"Design context-specific Innovation","index":3,"paragraphs":[{"index":1,"size":12,"text":"Packages for innovations that have a specific readiness level (e.g. >5 readiness)"},{"index":2,"size":3,"text":"Context-specific meta data:"},{"index":3,"size":3,"text":"• Enabling conditions  "}]},{"head":"IPSR metrics -Innovation Use","index":4,"paragraphs":[{"index":1,"size":2,"text":"Innovation Use:"},{"index":2,"size":49,"text":"• Moves away from simplistic more=better thinking • Applies a network approach to measure diffusion of the innovation in the agricultural innovation system (who is using the innovation?)  The innovation is commonly used by end-users or beneficiaries who were not involved in the initial innovation development End-users/ beneficiaries (rare)"},{"index":3,"size":21,"text":"The innovation is used by some end-users or beneficiaries who were not involved in the initial innovation development Unconnected next-user (common)"},{"index":4,"size":20,"text":"The innovation is commonly used by organizations not connected to partners involved in the initial innovation development Unconnected next-user (rare)"},{"index":5,"size":19,"text":"The innovation is used by organizations not connected to partners involved in the initial innovation development Connected next-user (common)"},{"index":6,"size":19,"text":"The innovation is commonly used by organizations connected to partners involved in the initial innovation development Connected next-user (rare)"},{"index":7,"size":33,"text":"The innovation is used by some organizations connected to partners involved in the initial innovation development Partners (common) The innovation is commonly used by partners involved in the initial innovation development Partners (rare)"},{"index":8,"size":15,"text":"The innovation is used by some partners involved in the initial innovation development Project lead"},{"index":9,"size":13,"text":"The innovation is used by the organization(s) leading the innovation development No use"},{"index":10,"size":5,"text":"The innovation is not used"},{"index":11,"size":15,"text":"• Only for packages with (for example) scaling readiness of >36 or high scalability potential"},{"index":12,"size":15,"text":"• Prioritization at the Innovation Package level around the \"lowest staves in the barrel\" (bottlenecks)"},{"index":13,"size":18,"text":"• Fit-for-purpose partnerships and (co-)investment to overcome strategic bottlenecks  From data to decisions: What do portfolio managers want?"}]},{"head":"Key insights","index":5,"paragraphs":[{"index":1,"size":30,"text":"• Portfolio management activities are inconsistent across the organization. Each unit works its own way, either using generic tools like the initiatives list on the webpage or creating its own."},{"index":2,"size":18,"text":"• The lack of available systems translates into a lack of information about innovations created in the organization."},{"index":3,"size":38,"text":"The further away managers are from fieldwork, the harder it is to get this information directly from those involved. This translates into difficulty in making decisions and the inability to facilitate work at, for example, the country level."},{"index":4,"size":49,"text":"• One CGIAR is a chance to unify the approach to innovation in the organization and to have an overview of what is happening in individual initiatives for the first time. Managers are waiting for access to IPSR tools and have high hopes that they will facilitate portfolio management."},{"index":5,"size":40,"text":"• There is already discovered room for improvement in PPU/ IPSR innovation data. IPSR data currently fits better with product and technology innovations, but in the areas of Systems Transformation and Policies, there is a need for a different approach."},{"index":6,"size":18,"text":"• One CGIAR is just the beginning, the organization also needs an overview of innovations happening in bilateral"},{"index":7,"size":11,"text":"A healthy innovation portfolio has many attributes, but two stand out"}]},{"head":"Balanced","index":6,"paragraphs":[{"index":1,"size":7,"text":"(with innovations at different stages of development) "}]},{"head":"Responds to stakeholders' demands","index":7,"paragraphs":[]}],"figures":[{"text":" • 0-9 levels ranging from No use to Common use by beneficiary • Evidence-based assessment that is Quality Assured • Data updated annually Type 1 outcome reporting • Feeds dashboard, scaling strategy design and strategic decision-making Numbers are only part of the story… "},{"text":" Baseline for MEL and adaptive management• Monitor whether investments and partnerships have led to increased scaling readiness "},{"text":"IPSR metrics -Innovation Use Innovation Use Levels Generic level label Generic level description  I don't like the taste and there End-users/ beneficiaries is no market, but anyway… (common) then Alright I'll give you USD 10 if you adopt this new variety I don't like the taste and there End-users/ beneficiaries is no market, but anyway… (common)then AlrightI'll give you USD 10 if you adopt this new variety  "},{"text":"Building blocks: Implementation progress to date From data to decisions: What do portfolio managers want? Portfolio Manager study  2017-18 2019 2020 2021 2022 2017-182019202020212022 • Initial engagement with SMO • ILRI I@S + Livestock CRP pilot • CGIAR/ RTB Scaling • As a part of CGIAR Performance and Results Management • Stage-gating workshop • Scaling Readiness conceptual • An idea is born… we aim to help scientists and managers across CGIAR make • Performance and Results Management design, testing and proof of informed decisions on portfolio delivery through the provision of fit for purpose tools, analytics and support Framework (PRMF) • Capacity and concept by WUR and • First innovation portfolio overviews/ dashboards will be IITA under generated based on the Initiative 2022 reporting and • IPSR course launch • IPSR integration in PRMS/ reporting • IPSR CGIAR pilot • Mini-portfolio pilot • IPSR Innovation Profiling roll-out Aspired # Portfolio manager group • Conceptual alignment with CGIAR 2030 R&I Strategy interviews • IPSR in Initiative proposals System level 2/3 Action area level 1/3 • Living Lab with ILRI I@S Thematic level 1/3 • IPSR in Initiative PoRB Regional level 1/3 • Initial engagement with SMO • ILRI I@S + Livestock CRP pilot • CGIAR/ RTB Scaling • As a part of CGIAR Performance and Results Management • Stage-gating workshop • Scaling Readiness conceptual • An idea is born… we aim to help scientists and managers across CGIAR make • Performance and Results Management design, testing and proof of informed decisions on portfolio delivery through the provision of fit for purpose tools, analytics and support Framework (PRMF) • Capacity and concept by WUR and • First innovation portfolio overviews/ dashboards will be IITA under generated based on the Initiative 2022 reporting and• IPSR course launch • IPSR integration in PRMS/ reporting • IPSR CGIAR pilot • Mini-portfolio pilot • IPSR Innovation Profiling roll-out Aspired # Portfolio manager group • Conceptual alignment with CGIAR 2030 R&I Strategy interviews • IPSR in Initiative proposals System level 2/3 Action area level 1/3 • Living Lab with ILRI I@S Thematic level 1/3 • IPSR in Initiative PoRB Regional level 1/3 Acceleration Fund adopts Scaling Readiness • To ensure innovation portfolio management tools meet buy-in CGIAR available early next year Research Program RTB manager-specific needs we identified 8 groups of portfolio managers across CGIAR and asked them about their needs regarding Innovation Portfolio Management • IPSR capacity development Country level • FIA/ GIZ encourage CGIAR to report on Initiative level Work Package level innovation readiness & CG Centre level innovation use • Beyond CGIAR 0/3 interest 2/4 1/3 2/3 Total: 10/25 Acceleration Fund adopts Scaling Readiness • To ensure innovation portfolio management tools meet buy-in CGIAR available early next year Research Program RTB manager-specific needs we identified 8 groups of portfolio managers across CGIAR and asked them about their needs regarding Innovation Portfolio Management• IPSR capacity development Country level • FIA/ GIZ encourage CGIAR to report on Initiative level Work Package level innovation readiness & CG Centre level innovation use• Beyond CGIAR 0/3 interest 2/4 1/3 2/3 Total: 10/25  "}],"sieverID":"56e27165-42e9-49b1-9e53-d82f3bc8b4e9","abstract":"• Having timely access to essential knowledge, information and data, and developing metrics and criteria that are aligned to the organisational mission and that reflect diverse forms of innovation• Fit-for-purpose systems, procedures and governance mechanisms that include operations and senior management decision-making• Investing in organizational innovation culture growth, learning and capacity• Being clear on innovation portfolio intent and resource allocation strategy (what do we consider a healthy portfolio?)"}

data/part_4/05319570998fede971df1f3106262651.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05319570998fede971df1f3106262651","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c17cb928-77ee-47b1-8310-d98db8a6b2c3/retrieve"},"pageCount":66,"title":"Vui lòng trích dẫn như sau","keywords":[],"chapters":[{"head":"Lời nói đầu","index":1,"paragraphs":[{"index":1,"size":314,"text":"Để góp phần giải quyết các tác động tiêu cực của El Nino -ENSO đến sản xuất nông nghiệp vùng Đồng bằng sông Cửu Long, Cục trồng trọt (Bộ Nông nghiệp &Phát triển nông thôn) đã phối hợp với Nghiên cứu của CGIAR về Biến đổi Khí hậu, Nông nghiệp và An ninh Lương thực Đông Nam Á (CCAFS SEA) Chương trình CCAFS Đông Nam Á thuộc Viện nghiên cứu lúa gạo quốc tế (IRRI) để phát triển và thử nghiệm cách tiếp cận xây dựng bản đồ rủi ro thiên tai cho các khu vực có khả năng bị ảnh hưởng và xác định các giải pháp can thiệp thích ứng tương ứng, hay còn gọi là Bộ bản đồ rủi ro thiên tai và Kế hoạch thích ứng (Climate Smart-MAP). CS-MAP có sự tham gia của các chuyên gia đến từ các cơ quan cấp tỉnh và cấp quốc gia với các hoạt động: (1) xác định rủi ro thiên tai; (2) xác định phạm vi bị ảnh hưởng và mức độ rủi ro; (3) đề xuất kế hoạch thích ứng tương ứng; (4) tinh chỉnh và kiểm chứng các biện pháp được đề xuất; và (5) xây dựng các kế hoạch thích ứng tích hợp cho các tỉnh và cho toàn vùng. Các bản đồ rủi ro và các can thiệp thích ứng được xây dựng cho những năm trung bình và những năm cực đoan (năm có El Nino-ENSO) sử dụng các thông số kỹ thuật (địa hình và thủy văn), cơ sở hạ tầng (đê điều, đường xá, kênh rạch), và kiến thức hiểu biết về địa phương. CS-MAP đã được xây dựng và triển khai tại 13 tỉnh vùng ĐBSCL. Ứng dụng của CS-MAP trong vụ Đông-Xuân 2018-2019 đã cho thấy hiệu quả của nó trong việc điều chỉnh thời gian xuống giống để tránh xâm nhập mặn."},{"index":2,"size":275,"text":"Trong năm 2020, Cục Trồng trọt, Trung tâm Khuyến nông quốc gia, CCAFS Liên minh Đa dạng Sinh học Quốc tế và Trung tâm Nông nghiệp Nhiệt đới Quốc tế (CIAT) đã phối hợp triển khai thí điểm đề án Chuyển đổi hệ thống canh tác ứng phó với biến đổi khí hậu (TFCC) vùng đồng bằng Sông Cửu Long gồm hai hợp phần là xây dựng bản đồ CS-MAP cấp xã và xây dựng và phổ biến tư vấn nông vụ địa phương dựa trên thông tin thời tiết, khí hậu. Bản đồ CS-MAP đã được chuyển giao, phục vụ áp dụng tại các xã thí điểm. Phát triển kinh nghiệm này, CIAT và Cục Trồng trọt hợp tác thực hiện xây dựng và phổ biến tư vấn nông vụ địa phương dựa trên thông tin thời tiết, khí hậu thông qua dự án: \"Áp dụng dự báo khí hậu thời hạn mùa và các giải pháp bảo hiểm tiên tiến vào quản lý rủi ro khí hậu trong ngành nông nghiệp ở Đông Nam Á\", còn được gọi là \"DeRISK Đông Nam Á\". Thông tin dự báo thời tiết thời hạn mùa và khuyến cáo sản xuất nông nghiệp đã được xây dựng và phổ biến tới người nông dân trong vụ Đông Xuân 2020-2021 tại các xã thí điểm. Mặc dù thông tin trình bày trong tài liệu này dựa trên thí điểm tại ĐBSCL cho vụ Đông-Xuân, các nguyên tắc cùng xây dựng và phổ biến tư vấn nông vụ địa phương dựa trên thông tin thời tiết, khí hậu có thể áp dụng cho các vụ khác và vùng khác."},{"index":3,"size":132,"text":"Tài liệu hướng dẫn kĩ thuật này được xây dựng trong khuôn khổ đề án TFCC. Phần một của tài liệu hướng dẫn kĩ thuật này cung cấp các chỉ dẫn chi tiết để cán bộ cấp tỉnh, huyện, xã có thể triển khai phương pháp CS-MAP tại địa phương mình, với nền tảng cơ bản là phương pháp lập bản đồ có sự tham gia. Phần hai của cuốn tài liệu kỹ thuật này cung cấp một số khái niệm liên quan tới dịch vụ khí hậu trong nông nghiệp, các bước triển khai xây dựng và phổ biến tư vấn nông vụ địa phương dựa trên thông tin thời tiết, khí hậu và một số phản hồi sau khi thực hiện thí điểm trong vụ Đông Xuân 2020-2021 tại ĐBSCL. "}]},{"head":". Lập bản đồ có sự tham gia","index":2,"paragraphs":[{"index":1,"size":199,"text":"Lập bản đồ bằng phương pháp có sự tham gia (Participatory mapping) là quá trình thành lập bản đồ trong đó làm rõ mối quan hệ giữa đất đai và cộng đồng địa phương bằng cách sử dụng những hiểu biết chung và ngôn ngữ bản đồ được công nhận (IFAD, 2019). Bằng cách cung cấp một nền tảng để tích hợp các hiểu biết và ưu tiên của các bên liên quan, phương pháp lập bản đồ có sự tham gia đã được chứng minh là phù hợp trong việc thu hút các bên liên quan trong công tác quản lý tài nguyên và môi trường (Lynam và cộng sự 2007). Hơn nữa, nhu cầu sử dụng bản đồ để quản lý các tác động của biến đổi khí hậu ở quy mô địa phương ngày càng tăng (Preston và cộng sự 2011). Việc tích hợp kiến thức khoa học và hiểu biết về địa phương là quan trọng trong quản lý các thách thức khí hậu. Vì những lý do trên, phương pháp lập bản đồ có sự tham gia đã thể hiện được tính ưu việt của nó trong phạm vi chủ đề nghiên cứu này."}]},{"head":"Giới thiệu về bản đồ rủi ro thiên tai và kế hoạch thích ứng (CS-MAP) tại ĐBSCL","index":3,"paragraphs":[]},{"head":"Quá trình xây dựng","index":4,"paragraphs":[{"index":1,"size":121,"text":"Phương pháp Lập bản đồ có sự tham gia (LBĐCSTG) là phương pháp cốt lõi trong quá trình xây dựng bộ bản đồ CS-MAP cho Đồng bằng sông Cửu Long (ĐBSCL), được trình bày chi tiết trong B.T.Yen (2019) và Son NH et al (2018), trong đó coi hiểu biết địa phương là trụ cột của quá trình lập bản đồ. Trong phương pháp lập bản đồ có sự tham gia (Hình 1), các chuyên gia và cán bộ từ các viện nghiên cứu cấp quốc gia, tỉnh và các tổ chức quốc tế đã xác định các vấn đề, sau đó tìm hiểu các giải pháp cụ thể của địa phương thông qua đối thoại giữa các bên liên quan."}]},{"head":"Hình 1. Quy trình lập bản đồ rủi ro thiên tai và can thiệp thích ứng","index":5,"paragraphs":[{"index":1,"size":20,"text":"Nhìn chung, quy trình lập bản đồ có sự tham gia có thể được tóm tắt trong 5 bước sau:"}]},{"head":"Bước 1:","index":6,"paragraphs":[{"index":1,"size":131,"text":"Xác định rủi ro thiên tai: Để có hiểu biết chung về rủi ro thiên tai trong khu vực, một hội thảo được tổ chức với các bên liên quan tham dự là các đơn vị trực thuộc tỉnh (ví dụ: cán bộ Chi cục trồng trọt, Chi cục Thủy lợi và Trạm khí tượng thủy văn), các viện nghiên cứu, trường đại học và một tổ chức quản lý cấp cao (ví dụ: Bộ NN & PTNT). Các đại biểu được chia nhóm theo tỉnh. Bước đầu tiên bao gồm: báo cáo thiệt hại mùa màng và năng suất gần đây trong tỉnh do các tác động khí hậu, xác định các rủi ro tiềm ẩn trong tương lai và xác định các kịch bản và mức độ rủi ro."},{"index":2,"size":4,"text":"Kiến thức địa phương "}]},{"head":"Bước 2:","index":7,"paragraphs":[{"index":1,"size":198,"text":"Phân chia các cấp độ rủi ro: Hiểu biết chung về rủi ro thiên tai và mức độ rủi ro và kịch bản đã được sử dụng để xây dựng bản đồ rủi ro thiên tai. Các bản đồ giấy và giấy kính đã được sử dụng trong quá trình thảo luận và lập bản đồ. Các đại biểu đã xác định các khu vực chịu ảnh hưởng và nhạy cảm với các rủi ro đã biết trên địa bàn tỉnh. Các cán bộ tỉnh phân tích tình hình cơ sở hạ tầng hiện có như đê bao, kênh mương tưới tiêu, cửa cống, trạm bơm, độ cao tương đối của các ô ruộng…, và giả định mức độ thiệt hại của khu vực trồng lúa nếu rủi ro xảy ra. Phân tích được thực hiện theo hai kịch bản: năm trung bình và năm cực đoan. Các giai đoạn cực đoan mới nhất và các khu vực bị ảnh hưởng của chúng đã được xem xét để định vị diện tích và cường độ của các rủi ro. Kết quả của bước thứ hai là các lớp bản đồ riêng biệt với các ký hiệu chi tiết."}]},{"head":"Bước 3:","index":8,"paragraphs":[{"index":1,"size":105,"text":"Đề xuất các can thiệp thích ứng: Trong phần cuối cùng của lần đối thoại đầu tiên, các bản đồ rủi ro được xây dựng bởi các bên liên quan được sử dụng làm tài liệu cơ bản để phát triển các can thiệp thích ứng. Các bên liên quan được yêu cầu đề xuất các can thiệp phi cấu trúc có thể thực hiện cho tỉnh, tương ứng với từng kịch bản rủi ro. Các can thiệp được đề xuất đã được mô tả cho từng khu vực có khả năng bị ảnh hưởng và thể hiện trên các lớp bản đồ riêng biệt."}]},{"head":"Bước 4:","index":9,"paragraphs":[{"index":1,"size":223,"text":"Tinh chỉnh CS-MAP: Có một thực tế là các bản đồ rủi ro và can thiệp thích ứng được xây dựng tại các buổi thảo luận nhóm như trên có thể không mang tính đại diện do thiên kiến của những người tham gia. Các chuyên gia khác tại địa phương, những người không tham dự các cuộc đối thoại này có thể có ý kiến khác về có rủi ro thiên tai và các giải pháp. Do vậy, việc tinh chỉnh kết quả với các bên liên quan khác tại địa phương là cần thiết. Ở bước này, một cuộc đối thoại đa phương thứ hai giữa các các bên liên quan đã được tổ chức tại các tỉnh. Tại mỗi tỉnh, các đại biểu đã tham gia đối thoại lần 1 và các cán bộ của các cơ quan cấp tỉnh được mời đánh giá các bản đồ rủi ro và các can thiệp thích ứng. Thông qua cuộc họp này, các bản đồ rủi ro và các đề xuất can thiệp thích ứng tiếp tục được cải tiến và cập nhật. Các bản đồ sửa đổi đã được số hóa bằng Hệ thống thông tin địa lý (GIS).  -Căn cứ vào những tác động gần đây của ngập lụt, hạn hán, xâm ngập mặn đến sản xuất của từng huyện/xã."}]},{"head":"Đối tượng tham gia xây dựng bản đồ:","index":10,"paragraphs":[{"index":1,"size":26,"text":"-Đối với cấp tỉnh: Cán bộ Chi cục trồng trọt và Chi cục thủy lợi cấp tỉnh; cán bộ nông nghiệp và thủy lợi cấp huyên."},{"index":2,"size":15,"text":"-Đối với bản đồ cấp huyện: Cán bộ nông nghiệp và thủy lợi cấp xã"}]},{"head":"Nội dung cần thực hiện: a. Đối với bản đồ rủi ro thiên tai cấp tỉnh","index":11,"paragraphs":[{"index":1,"size":49,"text":"Các thành viên theo từng tỉnh thảo luận khoanh vùng trên bản đồ của từng tỉnh, phân rõ vùng có nguy cơ bị ảnh hưởng hạn, mặn, ngập của tỉnh, khái quát vùng và ranh giới chịu ảnh hưởng theo các cấp độ: nguy cơ cao, vừa và thấp. "}]},{"head":"Khái niệm:","index":12,"paragraphs":[{"index":1,"size":48,"text":"-Vùng an toàn: Không bao giờ bị ảnh hưởng bởi ngập lụt/hạn hán/ xâm nhập mặn -Vùng thường xuyên bị ảnh hưởng: năm nào cũng bị ngập lụt/hạn hán/xâm nhập mặn, địa phương đã có biện pháp thích ứng nên không được coi là vùng có nguy cơ."},{"index":2,"size":210,"text":"-Nguy cơ cao: những vùng hàng năm có thể không chịu ảnh hưởng của lũ lụt hay hạn hán hay xâm ngập mặn nhưng với sự biến động của BĐKH, có nguy cơ bị ảnh hưởng, gây thiệt hại nặng (thiệt hại >70%) -Nguy cơ trung bình: những vùng hàng năm có thể chịu ảnh hưởng của lũ lụt, hạn hán, xâm ngập mặn nhưng với một biến động của BĐKH, có nguy cơ bị ảnh hưởng, gây thiệt hại trung bình (thiệt hại 30-70%) -Nguy cơ thấp: những vùng hàng năm có thể chịu ảnh hưởng của lũ lụt, hạn hán, xâm ngập mặn nhưng với một biến động của BĐKH, có nguy cơ bị ảnh hưởng, gây thiệt hại ít (thiệt hại <30%). • Sử dụng bút màu sao chép bản đồ đã hoàn thiện trên phim ra bản đồ giấy • Ghép bản đồ, thảo luận chung, chỉnh lý các vùng giáp ranh Các nhóm tổng hợp và lắp ráp bản đồ của từng tỉnh theo vùng và thảo luận vùng có nguy cơ bị ảnh hưởng hạn, mặn, lũ nhóm, rà soát và thống nhất các vùng giáp ranh chịu ảnh hưởng theo các cấp độ: không bị ảnh hưởng, nguy cơ nặng, vừa và thấp."},{"index":3,"size":40,"text":"• Sử dụng bản đồ từng tỉnh đã hoàn thiện ở bước 1 -Dùng bút màu xanh để chỉnh lý các vùng nguy cơ ngập lụt, -Dùng bút màu đỏ để chỉnh lý các vùng nguy cơ xâm nhập mặn."},{"index":4,"size":13,"text":"-Sử dụng mã số cho các vùng nguy cơ như ở bước 1"},{"index":5,"size":17,"text":"• Sử dụng bút màu sao chép bản đồ đã chỉnh lý ra bản đồ giấy mới"}]},{"head":"b. Đối với bản đồ nguy cơ cấp huyện:","index":13,"paragraphs":[{"index":1,"size":16,"text":"• Các cán bộ nông nghiệp và thủy lợi cấp xã thảo luận theo bước 1."}]},{"head":"Kết quả mong muốn:","index":14,"paragraphs":[{"index":1,"size":28,"text":"Bản đồ thể hiện các vùng có nguy cơ bị lũ lụt, hạn hán và xâm ngập mặn theo các cấp độ của từng huyện hoặc toàn tỉnh."}]},{"head":"Thảo luận nhóm: Xây dựng bản đồ cơ cấu, thời vụ cây trồng thích ứng với biến đổi khí hậu.","index":15,"paragraphs":[]},{"head":"Căn cứ xây dựng bản đồ a. Sự cần thiết -cơ sở sắp xếp mùa vụ -thuận lợi, khó khăn","index":16,"paragraphs":[{"index":1,"size":75,"text":"• Thời vụ tập trung sẽ chủ động sử dụng và điều tiết nguồn nước cung cấp cho lúa, chủ động ứng phó với tình hình hạn, xâm nhập mặn và ngập úng cục bộ, hạn chế sự lây lan của dịch hại, chủ động trong chỉ đạo sản xuất lúa của địa phương và nông dân ít tốn các chi phí cả về phòng trừ dịch hại, làm đất, tưới tiêu như hiện nay"},{"index":2,"size":46,"text":"• Sắp xếp mùa vụ hợp lý, có thời gian dãn cách giữa các vụ, tăng cường cơ giới hóa khâu làm đất, vệ sinh và cải tạo đồng ruộng cần được áp dụng trong thời gian dài sẽ mang lại nhiều hiệu quả đáng kể."},{"index":3,"size":58,"text":"• Việc sắp xếp lại mùa vụ dựa vào điều kiện tự nhiên của các vùng sinh thái; mỗi vùng có cơ cấu mùa vụ và bố trí thời vụ thích hợp trên cơ sở hiện trạng thủy lợi và những định hướng cho sự phát triển trồng lúa thích ứng khó khăn, bền vững và hiệu quả."},{"index":4,"size":23,"text":"• Hạn chế những bất lợi của thời tiết, khí tượng thủy văn, dịch hại… khi bố trí thời vụ không phù hợp."}]},{"head":"b. Nguyên tắc","index":17,"paragraphs":[{"index":1,"size":20,"text":"• Thích ứng với BĐKH trong từng vùng sinh thái đối với hạn hán, xâm nhập mặn và ngập lũ."},{"index":2,"size":10,"text":"• Tập trung, đồng loạt từng vùng, từng cánh đồng."},{"index":3,"size":18,"text":"• Thời gian giãn cách giữa hai vụ lúa tối thiểu 3 tuần cho vùng 3 vụ lúa/năm. "}]},{"head":"Nội dung cần thực hiện","index":18,"paragraphs":[]},{"head":"Bước 1: Thảo luận theo từng huyện","index":19,"paragraphs":[{"index":1,"size":29,"text":"Có thể tiến hành theo cách thảo luận riêng từng huyện, hoặc chia nhóm thảo theo từng vùng có nguy cơ bị lũ lụt, hạn hán, xâm ngập mặn."}]},{"head":"Ví dụ cách chia nhóm như sau:","index":20,"paragraphs":[{"index":1,"size":21,"text":"• Nhóm 1: các huyện chịu ảnh hưởng của ngập lụt     -Bấm OK để chấp nhận tất cả các thay đổi."}]},{"head":"Hướng dẫn cài đặt phần mềm","index":21,"paragraphs":[]},{"head":"Chỉnh sửa bản đồ 4.3.1. Chỉnh sửa dữ liệu thuộc tính","index":22,"paragraphs":[]},{"head":"Bài toán 1: Giả sử một vùng trồng lúa hiện trạng nguy cơ cao (màu đỏ). Tuy nhiên sau khi nâng cấp hệ thống cống ngăn mặn và nạo vét kênh dẫn nước, khu vực này giảm nguy cơ xuống mức Trung bình. Vậy cần cập nhật lại trên bản đồ từ mã (1) xuống mã (2) tức là từ màu đỏ xuống màu cam.","index":23,"paragraphs":[{"index":1,"size":6,"text":"Các bước thực hiện như sau:"},{"index":2,"size":53,"text":"Bấm chuột phải tại lớp dữ liệu cần chỉnh sửa, ví dụ lớp CSMAP LongAn.shp, chọn mở bảng thuộc tính (open attribute table), bật chức năng chỉnh sửa (togge editing) Sau đó có thể điều chỉnh thông tin trực tiếp tại các ô dữ liệu, thêm trường (New Field), bớt trường (Delete Field)…"},{"index":3,"size":27,"text":"Tắt chức năng togge editing và chọn save nếu muốn lưu lại những thay đổi vừa thực hiện hoặc chọn discard trong trường hợp không muốn lưu."}]},{"head":"Chỉnh sửa dữ liệu không gian","index":24,"paragraphs":[]},{"head":"Bài toán 2: Ở bản đồ CSMAP cấp tỉnh, toàn bộ một huyện ở mức nguy cơ trung bình (Màu cam). Tuy nhiên khi sử dụng ở cấp huyện, mức nguy cơ này không hợp lý. Với nhiều vùng nhỏ ở xa các kênh dẫn nước cần phải đổi thành mức nguy cơ cao (Màu đỏ) do khó tiếp cận nguồn nước. Ngược lại, một số vùng không còn trồng lúa, cần phải bỏ đi.","index":25,"paragraphs":[{"index":1,"size":38,"text":"Đối với bài toán này, ngoài việc thay đổi mã số của một vùng như bài toán 1, thì một số vùng lớn phải chia nhỏ ra cho phùhợp với thực tế. Các bước thực hiện như sau:"}]},{"head":"X Trường hợp thêm, bớt đối tượng trong Layer thì thực hiện theo các bước sau:","index":26,"paragraphs":[{"index":1,"size":50,"text":"Bật chức năng chỉnh sửa/Toggle editing của Layer cần thực hiện (Ví dụ lớp \"CS-MAP\") Sau khi chức năng Toggle editing được bật thì các nút lệnh trên thanh công cụ edit cũng bật sáng. Bấm chuột phải lên thanh công cụ và bật bộ công cụ \"Advance digitizing feature\". "}]},{"head":"Sử dụng nút","index":27,"paragraphs":[]},{"head":"X Trường hợp cắt 1 đối tượng ban đầu thành các đối tượng khác","index":28,"paragraphs":[{"index":1,"size":56,"text":"Tiếp tục sử dụng nút Select feature để chọn đối tượng cần cắt. Vào Edit/Split Feature hoặc nút Split feature trên thanh công cụ. Vẽ ranh giới cần cắt trên vùng đã chọn, bắt đầu bằng một điểm ngoài vùng và kết thúc bằng một điểm khác ngoài vùng. Bấm chuột phải sau khi hoàn tất."},{"index":2,"size":22,"text":"Chọn vào các vùng mới được cắt, sau đó vào bảng thuộc tính để điều chỉnh lại thông tin của vùng mới."}]},{"head":"X Trường hợp điều chỉnh biên của đối tượng","index":29,"paragraphs":[{"index":1,"size":55,"text":"Chọn các chức năng phóng to, thu nhỏ, di chuyển bản đồ… đến đối tượng cần điều chỉnh Chọn chức năng vertex tool và di chuyển con trỏ đến đối tượng cần điều chỉnh. Sau đó bấm chuột tại các điểm cần điều chỉnh và kéo thả chuột đến vị trí mới theo yêu cầu."}]},{"head":"Lưu ý: có thể bật chức năng snaping option để việc điều chỉnh điểm được thuận lợi trong trường hợp muốn bắt điểm tự động (với các đối tượng đã có trước).","index":30,"paragraphs":[{"index":1,"size":33,"text":"Sau khi hoàn tất chỉnh sửa: Tắt chức năng togge editing và chọn save nếu muốn lưu lại những thay đổi vừa thực hiện hoặc chọn discard trong trường hợp không muốn lưu.  "}]},{"head":"Trình bày trang in","index":31,"paragraphs":[]},{"head":"Phụ lục 2 BẢNG CHÚ THÍCH CÁC TRƯỜNG DỮ LIỆU THUỘC TÍNH BỘ BẢN ĐỒ RỦI RO THIÊN TAI VÀ LẬP KẾ HOẠCH THÍCH ỨNG (CS-MAP)","index":32,"paragraphs":[]},{"head":"Mục tiêu/ Chức năng","index":33,"paragraphs":[]},{"head":"Mục tiêu của việc xây dựng và phổ biến tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu theo phương pháp có sự tham gia gồm 3 nội dung chính:","index":34,"paragraphs":[{"index":1,"size":1,"text":"9 "}]},{"head":"Khái niệm chính:","index":35,"paragraphs":[{"index":1,"size":70,"text":"Thời tiết và khí hậu: Thời tiết là trạng thái của khí quyển tại một địa điểm cụ thể trong một khoảng thời gian ngắn liên quan đến nhiệt độ, độ ẩm, loại và lượng mưa, áp suất không khí, gió và mây bao phủ. Khí hậu là điều kiện thời tiết trung bình cho một địa điểm cụ thể và trong khoảng thời gian dài đến vài thập kỷ."},{"index":2,"size":116,"text":"Thông tin thời tiết, khí hậu: bao gồm dự báo thời tiết, khí hậu, số liệu quan trắc và kiến thức về khí hậu.    • Mức độ tham gia: Đối với việc xây dựng và thực hiện các tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu, sự tham gia sâu hơn của cán bộ cấp huyện và cấp tỉnh là rất quan trọng, vì họ chịu trách nhiệm xây dựng các hướng dẫn được thực hiện ở cấp xã. Trong vụ Đông-Xuân 2020-2021, cán bộ các cấp này có tham gia nhiệt tình vào cùng xây dựng và chia sẻ bản tin nhưng CIAT mong muốn làm việc thường xuyên hơn nữa."}]},{"head":"Dự báo theo mùa/ thời hạn mùa","index":36,"paragraphs":[]},{"head":"Đối tượng","index":37,"paragraphs":[]},{"head":"Bước 3. Cùng phát triển khuyến nghị thời tiết nông nghiệp cấp xã và bản tin thời tiết nông vụ","index":38,"paragraphs":[]},{"head":"•","index":39,"paragraphs":[{"index":1,"size":59,"text":"Tần suất ra khuyến nghị: Nông dân và đối tác địa phương mong muốn nhận tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu dựa trên dự báo theo mùa, nhưng cũng muốn nhận thông tin cập nhật định kỳ hàng tháng và khuyến nghị cụ thể dựa trên dự báo thời tiết thời hạn vừa."}]},{"head":"•","index":40,"paragraphs":[{"index":1,"size":106,"text":"Nội dung/ bố cục của khuyến nghị: Thông tin dự báo thời tiết, xâm nhập mặn và khuyến nghị nông nghiệp cần được trình bày rõ ràng và dễ hiểu. Nội dung và bố cục bản tin vụ Đông Xuân 2020-2021 đạt tiêu chí này. Tuy nhiên, đối với vòng thí điểm tiếp theo vào vụ hè thu, chúng tôi dự định sử dụng nhiều hình ảnh minh họa hơn để làm cho bản tin hấp dẫn hơn về mặt hình ảnh và điều này cũng có thể có lợi hơn nữa cho sự hiểu biết của nông dân về các khuyến nghị được đề xuất."}]},{"head":"•","index":41,"paragraphs":[{"index":1,"size":63,"text":"Các kênh phổ biến: Các kênh phổ biến thông tin hiện tại (loa đài, áp phích, bản tin, zalo) là phù hợp. Nhóm Zalo mới chỉ được thử nghiệm tại An Mỹ nhưng cần cải thiện cách bố trí. Nếu cập nhật các bản tin theo mùa phát triển, phổ biến qua zalo group và loa đài sẽ là cách hiệu quả nhất."}]},{"head":"Bên cạnh các bài học kinh nghiệm liên quan đến thí điểm, một số yếu tố quyết định sự thành công trong quá trình phát triển, thực hiện và mở rộng quy mô dựa trên kinh nghiệm trước đó là:","index":42,"paragraphs":[{"index":1,"size":33,"text":"1. Sự quan tâm của các bên (chính phủ, các tác nhân địa phương, khối nghiên cứu) thể hiện ở sự hỗ trợ của lãnh đạo, hỗ trợ kỹ thuật và ngân sách."},{"index":2,"size":104,"text":"2. Cam kết của những người tham gia cung cấp hỗ trợ/ trợ giúp định kỳ và đóng góp thông tin liên quan 3. Sự tham gia của các tác nhân chính, chẳng hạn như các trung tâm/ đài khí tượng thủy văn (nguồn thông tin khí hậu chính thống). 4. Hỗ trợ thông qua chính sách công, các cam kết của quốc gia trong việc thể hiện tầm quan trọng đối với các đối tượng tại địa phương và người nông dân. 5. Tinh thần cầu thị, học hỏi liên tục, các bài học kinh nghiệm và củng cố phương pháp tiếp cận."}]},{"head":"Kế hoạch/ bước tiếp theo: mở rộng quy mô","index":43,"paragraphs":[{"index":1,"size":80,"text":"Thí điểm về phát triển tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu hiện đang được thực hiện trong giai đoạn hai. Thay vì mở rộng theo chiều ngang bằng cách tập trung làm cho nhiều xã hơn, chúng tôi quyết định mở rộng theo chiều dọc bằng cách tiếp cận đa cấp. Dựa trên những kinh nghiệm và bài học kinh nghiệm của giai đoạn đầu, các bước tiếp theo được thực hiện như sau:"},{"index":2,"size":95,"text":"-Mở rộng thí điểm đối với một trong các xã cho vụ lúa hè thu ở ĐBSCL với vai trò trung tâm hơn của cơ quan huyện; đồng thời, các bản tin dựa trên dự báo theo mùa được kết hợp với thông tin dự báo và khuyến nghị cập nhật hàng tháng được phổ biến qua nhóm Zalo và/ hoặc các phương tiện khác, và các khuyến nghị dựa trên dự báo thời tiết 10 ngày. Nội dung và bố cục của các bản tin và thông điệp cũng sẽ được điều chỉnh thêm."},{"index":3,"size":23,"text":"-Mô hình thí điểm tương tự đang được áp dụng ở Duyên hải Nam Trung bộ cho vụ lúa hè thu và nho."},{"index":4,"size":43,"text":"-Đồng thời, hợp tác với Cục Trồng trọt, Trung tâm Khuyến nông Quốc gia, Trung tâm Dự báo Khí tượng Thủy văn Quốc gia, chính quyền địa phương và các cơ quan chức năng, nông dân vùng thí điểm sẽ được tăng cường."},{"index":5,"size":73,"text":"-Là đầu vào quan trọng cho sự phát triển của thông tin khí hậu nông nghiệp phù hợp với địa phương, việc nhân rộng phương pháp CS-MAP ở ĐBSCL, duyên hải Nam Trung Bộ và Đồng bằng sông Hồng sẽ được hỗ trợ, kết hợp với nâng cao năng lực về phát triển thông tin khí hậu nông nghiệp phù hợp với địa phương, và sử dụng/ ứng dụng các kết quả CS-MAP."},{"index":6,"size":44,"text":"-Các kết quả từ giai đoạn thí điểm sẽ được tổng hợp thành các hướng dẫn cụ thể vào cuối năm 2021 để hỗ trợ nhân rộng hệ thống dịch vụ khí hậu nông nghiệp ở ĐBSCL và các vùng khác ở Việt Nam."}]}],"figures":[{"text":"Phần 1 . 5 1. 1 . Xây dựng bản đồ rủi ro thiên tai và kế hoạch thích ứng với biến đổi khí hậu (CS-MAP) vùngĐồng bằng Sông Cửu Long . . . . . . Phương pháp lập bản đồ rủi ro thiên tai và kế hoạch thích ứng . . . . . 8 1.1. Lập bản đồ có sự tham gia. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 1.2. Giới thiệu về bản đồ rủi ro thiên tai và kế hoạch thích ứng (CS-MAP) tại ĐBSCL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 1.2.1. Quá trình xây dựng . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 1.2.2. Cách đọc bản đồ CS-MAP. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11 1.2.3. Ứng dụng của bản đồ CSMAP. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13 2. Hướng dẫn thảo luận nhóm thành lập bản đồ CS-MAP . . . . . . . . . . . . . .14 2.1. Thảo luận nhóm thành lập bản đồ rủi ro thiên tai . . . . . . . . . . . . . . . . . . . . . . 14 2.1.1. Căn cứ xây dựng bản đồ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14 2.1.2. Đối tượng tham gia xây dựng bản đồ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14 2.1.3. Nội dung cần thực hiện . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14 2.1.4. Kết quả mong muốn . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16 2.2. Thảo luận nhóm: Xây dựng bản đồ cơ cấu, thời vụ cây trồng thích ứng với biến đổi khí hậu . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16 2.2.1. Căn cứ xây dựng bản đồ. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16 2.2.2. Cơ sở đề nghị khung thời vụ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17 2.2.3. Nội dung cần thực hiện . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18 2.2.4. Kết quả mong muốn . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 MỤC LỤC Phương pháp lập bản đồ rủi ro thiên tai và kế hoạch thích ứng 1.1 "},{"text":"Hình 2 . Bản đồ nguy cơ khí hạn mặn tỉnh Long An năm trung bình (a) và năm cực đoan (b) "},{"text":" Với cơ sở hạ tầng và cơ chế điều hành hiện nay, nếu xảy ra hạn hán hay xâm nhập mặn hay ngập lụt, xác định trên bản đồ: -Vùng thường xuyên an toàn (không bị ảnh hưởng) -Vùng thường xuyên bị ảnh hưởng -Vùng có nguy cơ cao -Vùng có nguy cơ vừa -Vùng có nguy cơ thấp "},{"text":"• Đặt lớp phim trong lên bản đồ hiện trạng sử dụng đất, cố định các lớp bản đồ. Bằng kiến thức chuyên gia của đại biểu và cơ sở hạ tầng, hiện trạng sử dụng đất hiện có của tỉnh: -Dùng bút màu xanh để vẽ các vùng nguy cơ ngập lụt, -Dùng bút màu đỏ để vẽ các vùng nguy cơ xâm nhập mặn. -Khoanh vẽ tách các vùng an toàn (Mã số 0) -Khoanh vẽ tách các vùng thường xuyên bị ảnh hưởng (Mã số 0) -Khoanh vẽ các vùng có nguy cơ cao (Mã số 1) -Khoanh vẽ các vùng có nguy cơ trung bình (Mã số 2) "},{"text":"Bước 1 : QGIS là phần mềm mã nguồn mở và miễn phí dùng cho việc trình bày, biên tập và xử lý các dữ liệu không gian (bản đồ số). Bản cài của QGIS có thể tải về miễn phí từ website. Một ưu thế khác của QGIS là có tích hợp giao diện tiếng Việt thân thiện hơn với người dùng. Kiểm tra hệ điều hành trên máy Bấm chuột phải biểu tượng My Computer hoặc This PC trên màn hình desktop hoặc trong cửa sổ File Explorer, chọn Properties; hoặc vào Control Panel -> System and Security -> System.Trong cửa sổ System, tìm dòng System type và ghi nhớ Hệ điều hành của máy là 32-bit hay 64-bit. "},{"text":"Bước 2 .Bước 3 : 4 . 1 . 2 . Tải phần mềm QGIS: Truy cập đường link: https://qgis.org/en/site/forusers/download.html. Kéo xuống phần Standalone installers from OSGeo4W packages và chọn tải bộ cài tương ứng với hệ điều hành của máy (Nên chọn bản \"Long term release repository\"). Cài đặt phần mềm: -Sau khi tải về, nhấp đúp vào file vừa tải và bấm Yes để bắt đầu cài đặt. Khung cửa sổ sau hiện lên, bấm Next. Tiếp theo bấm I agree để chấp nhận các điều khoản sử dụng. Tiếp tục bấm Next và Install Lớp dữ liệu chính CS-MAP Lớp dữ liệu chính CS-MAP là lớp dữ liệu chứa các thông tin về rủi ro thiên tai (hạn mặn, lũ lụt), và các biện pháp thích ứng (dịch chuyển lịch thời vụ) của các kịch bản cực đoan và trung bình. Các dữ liệu này là kết quả số hóa bản đồ giấy được các bên liên quan thảo luận và thống nhất ở các buổi hội thảo lập bản đồ có sự tham gia như hoướng dẫn ở Chương 2. Dữ liệu không gian là dữ liệu dạng vùng (polygon), dữ liệu thuộc tính đi kèm bao gồm 52 trường thuộc tính (chi tiết xin xem Phụ lục 2). Hình 7. Dữ liệu không gian (a) và dữ liệu thuộc tính (b) của lớp CS-MAP tỉnh Long An. "},{"text":"4. 2 . Mở và trình bày bản đồTừ giao diện khởi động của QGIS, chọn Lớp -> Thêm lớp -> Add vector layer… Tại khung hiện ra, Nhấp nút bên cạnh mục Vector database. Tìm đến thư mục Training_Data -> <Thư mục của tỉnh cần sử dụng> -> Shapefile. Tại khung góc dưới phải, chọn ESRI -Tập tin shape (.shp). Sau đó, chọn tất cả các file có trong tập tin và nhấp Open. Nhấp Thêm và sau đó Close để đưa các lớp vào bản đồ. Kéo và thả các lớp để sắp xếp lại thứ tự các lớp theo quy tắc: Lớp vùng nằm dưới cùng, lớp đường nằm giữa và lớp điểm nằm trên cùng. Kết quả như dưới đây. Để trình bày màu của đối tượng bản đồ, ta làm theo các bước sau: Nhấp chuột phải vào lớp CSMap_VinhLong_region và chọn Properties. Trong cửa sổ hiện lên, chọn Kiểu biểu tượng bên tay trái. Bấm vào khung chọn đang hiện \"Single symbol\" và chọn \"Phân theo loại\". Tại Khung Biểu tượng bên dưới, bấm Change…. Trong khung hiện lên chọn \"Tô màu đơn giản\". Đổi đường viền Stroke style thành \"Không vẽ\". Nhấp OK để chấp nhận thay đổi. Trở về khung Properties, trong khung Cột, chọn trường dữ liệu cần hiển thị. Ở đây ta chọn cột \"Salinity_e\" tức là nguy cơ hạn mặn năm cực đoan để làm ví dụ. Bấm \"Phân loại\" đê hiển thị tất cả các giá trị của trường lên. Nhấp đúp vào các giá trị 0, 1, 2, 3 ở cột \"Chú giải\" để đổi tên như dưới đây. Đối với lớp VinhLong_huyen1, giảm độ đục của lớp về 0%, chỉ để viền và tăng độ đậm của viền lên 0.4 Với các lớp đường giao thông GT_line và lớp kênh mương Thuyhe_line, bấm chuột phải vào lớp, chọn \"Kiểu\" và kéo về màu mong muốn. Đường giao thông màu nâu và thủy hệ màu xanh lơ. Đối với các lớp tên xã \"ten_xa\" và tên ấp \"tendancu\" làm như sau: -Tại thẻ Kiểu biểu tượng: Chọn No symbols. -Tại thẻ Nhãn, chọn Single labels. Trong mục Gắn nhãn theo, chọn trường Textstring. Chọn font chữ .VnArial và cỡ chữ 12 (với lớp xã) và cỡ chỡ 9 (với lớp dân cư). (Nếu không có font chữ này trong máy thì cài đặt theo Hướng dẫn cài đặt font ABC trong bộ tài liệu đi kèm). -Do đặc thù bản đồ nền sử dụng bảng mã UTF-8 cũ nên khi hiển thị trên bảng mãu UTF-16 có thể lỗi font. Khắc phục bằng cách sau: Chuyển sang thẻ Nguồn. Tại mục Mã hõa nguồn dữ liệu, chọn System. "},{"text":" Add feature để thêm đối tượng (lưu ý tùy từng kiểu dữ liệu điểm, đường, vùng mà nút Add feature có thể khác). Sau khi nhấp nút Add feature, con chuột sẽ có hình tròn với mũi tên bốn phía . Sử dụng con trỏ này để vẽ một hình polygon vào khu vực phù hợp. Vùng mới được vẽ sẽ có màu đỏ trong suốt. Sau khi vẽ xong bấm chuột phải để nhập dữ liệu thuộc tính. Nhập thông tin cho đối tượng vừa tạo vào bảng thuộc tính. Trường hợp muốn xóa các đối tượng thì thực hiện theo các bước sau: Chọn biểu tượng Select feature để đổi con trỏ. Chọn đối tượng cần xóa bằng cách bấm chuột. Xóa bằng cách bấm phím Delete trực tiếp trên bàn phím hoặc chọn biểu tượng Delete tại thanh công cụ edit X Trường hợp gộp 2 hay nhiều đối tượng Thay đổi con trỏ về biểu tượng \"Select feature\". Sau đó, chọn các đối tượng cần gộp. Giữ phím Shift để chọn được nhiều đối tượng một lúc. Chọn Edit/ Merge select feature hoặc biểu tượng Merge feature trên thanh công cụ ngang, sau đó điều chỉnh lại thông tin của đối tượng mới. "},{"text":" Zoom vào toàn màn hình bằng cách bấm nút Phóng to toàn bộ trên thanh công cụ. Từ màn hình chính, chọn menu Dự án góc trên bên trái -> chọn New Print layout hoặc phím tắt Ctrl+P Đặt tên cho trang in, ví dụ Han Man cuc doan. Tại cửa sổ layout, bấm chuột phải vào vùng trắng của trang giấy và chọn \"Thuộc tính trang\". Chọn kích thước giấy A0 (đối với bản đồ cấp tỉnh) và A2 hoặc A1 (đối với bản đồ cấp huyện). Chọn khổ giấy ngang hoặc dọc, tùy theo hình dáng bản đồ. Từ thanh công cụ bên trái màn hình, chọn công cụ New Map (Add new Bản đồ to layout). Vẽ một khung bản đồ theo ý muốn. Bản đồ đang thể hiện ở màn hình chính sẽ hiển thị trên khung này. Để di chuyển hoặc phóng to/thu nhỏ bản đồ trong khung, chọn nút . Khi không sử dụng nữa, chọn lại nút . Thêm chú thích vào bản đồ bằng nút . Vẽ khung của chú thích bên trong khung bản đồ như sau: Ở khung bên phải, chọn Legend để chỉnh sửa chú thích. Bỏ tick ở mục \"Cập nhật tự động\" để chỉ hiển thị các lớp cần thiết. Thêm tiêu đề cho bản đồ bằng nút . Thêm các đối tượng chỉ hướng Bắc và thước tọa độ bằng các nút và . Kết quả được bản đồ như sau: Xuất bản đồ ra file JPG để phục vụ in ấn: Chọn Menu \"Trình bày\" và chọn công cụ Export as Image… Phụ lục 1 Hướng dẫn cài đặt bộ font tiếng việt ABC Bộ font tiếng Việt ABC là một trong những bộ font tiếng Việt đầu tiên được sử dụng ở Việt Nam. Bộ font này sử dụng bảng mã 8-bit để mã hóa các kí tự, bao gồm cả các kí tự có dấu (hiện nay bảng mã này ít sử dụng, thay vào đó là bảng mã Unicode 16-bit có khả năng tương thích với các font chữ có sẵn trong Windows). Đa phần các bản đồ hành chính dạng số ở Việt Nam từ trước đến này sử dụng bảng mã 8-bit. Font ABC có đặc trưng là có dấu tiền tố .Vn đặt trước tên font, ví dụ: .VnArial, .VnTime, .VnAristote, v.v… Để hiển thị tên địa danh, tên đường phố trong bản đồ, máy tính cần có bộ font này. Cách cài đặt như sau: Mở thư mục font trong bộ dữ liệu tập huấn. Copy (Ctrl+C) toàn bộ các font có trong folder. "},{"text":" Cung cấp tư vấn dựa trên thông tin thời tiết, khí hậu phù hợp cho người sử dụng (nông dân và doanh nghiệp nông nghiệp) dựa trên các kịch bản khí hậu và bản đồ rủi ro, có tính đến thông tin dự báo thời tiết và xâm nhập mặn theo mùa, kiến thức và kinh nghiệm của cán bộ địa phương và người nông dân 9 Khởi đầu quá trình có sự tham gia và xây dựng năng lực cho người sử dụng gián tiếp về các định nghĩa chính về thời tiết, khí hậu và rủi ro khí hậu nông nghiệp; quá trình xây dựng thông tin khí hậu nông nghiệp dựa trên rủi ro khí hậu được xác định bởi các bên liên quan và những người tham gia; quá trình phổ biến, truyền thông và sản xuất các tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu 9 Nhấn mạnh thông tin cần thiết cho giám sát và đánh giá (M&E) quá trình xây dựng, phổ biến và sử dụng thông tin để nắm bắt những thay đổi đáng kể trong kiến thức, thái độ và áp dụng thực hiện khuyến cáo của nông dân, cũng như hiệu quả và cải tiến của các kênh phổ biến và truyền đạt. "},{"text":"Bước 1 . Sự tham gia của các bên liên quan và phát triển kế hoạch làm việc chungHai tháng trước khi mùa vụ bắt đầu, các bên liên quan chính được xác định, bao gồm Đài Khí tượng Thủy văn tỉnh, Sở NN & PTNT tỉnh, Chi cục Trồng trọt và Bảo vệ thực vật, Chi cục Thủy lợi, Phòng Nông nghiệp và Phát triển Nông thôn huyện, Phòng Trồng trọt và Bảo vệ thực vật / Trung tâm Dịch vụ Nông nghiệp; các bên liên quan khác bao gồm lãnh đạo xã, cán bộ nông nghiệp, cán bộ thủy lợi, Hội Liên hiệp Phụ nữ, Hội Nông dân xã, trưởng thôn và nông dân đại diện. Trong hội thảo đầu tiên đại diện các cơ quan, tổ chức, nông dân đại diện này thảo luận về mục tiêu của thí điểm và kế hoạch thực hiện chung. Đối với những người không thể tham dự hội thảo ban đầu, chúng tôi đã tổ chức các cuộc họp riêng để trao đổi. Bước đầu tiên này giúp các bên liên quan hiểu rõ ràng về ý tưởng thí điểm cũng như xác nhận và cam kết việc tham gia của họ. Hình 1. Đại diện Chi Cục Trồng trọt và Bảo vệ thực vật tỉnh Tiền Giang phát biểu tại cuộc họp "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Bước 5:  Tích hợp vùng: Cuộc đối thoại đa phương thứ ba được tổ chức để tích hợp các Tích hợp vùng: Cuộc đối thoại đa phương thứ ba được tổ chức để tích hợp các can thiệp thích ứng của từng tỉnh vào các kế hoạch sinh thái vùng và khu vực. can thiệp thích ứng của từng tỉnh vào các kế hoạch sinh thái vùng và khu vực. Tất cả các bên liên quan đã tham dự cuộc đối thoại đầu tiên được mời tham dự Tất cả các bên liên quan đã tham dự cuộc đối thoại đầu tiên được mời tham dự thội thảo vùng về các vấn đề tích hợp. Trong hội thảo này, các đại biểu được thội thảo vùng về các vấn đề tích hợp. Trong hội thảo này, các đại biểu được chia nhóm theo vùng sinh thái. Mỗi khu vực bao gồm các tỉnh lân cận có điều chia nhóm theo vùng sinh thái. Mỗi khu vực bao gồm các tỉnh l��n cận có điều kiện tự nhiên tương tự và chia sẻ các tài nguyên thiên nhiên (ví dụ như nước kiện tự nhiên tương tự và chia sẻ các tài nguyên thiên nhiên (ví dụ như nước tưới). Qua thảo luận nhóm, các vấn đề cấp tỉnh liên quan đến quản lý rủi ro biến tưới). Qua thảo luận nhóm, các vấn đề cấp tỉnh liên quan đến quản lý rủi ro biến đổi khí hậu và kế hoạch hành động để thực hiện can thiệp thích ứng đã được đổi khí hậu và kế hoạch hành động để thực hiện can thiệp thích ứng đã được báo cáo cho các nhà hoạch định chính sách, nhà nghiên cứu và các bên liên báo cáo cho các nhà hoạch định chính sách, nhà nghiên cứu và các bên liên quan khác. Kế hoạch tích hợp sau đó được phát triển cho từng tỉnh và cho cả quan khác. Kế hoạch tích hợp sau đó được phát triển cho từng tỉnh và cho cả khu vực, có tính đến các chính sách của khu vực và quốc gia. khu vực, có tính đến các chính sách của khu vực và quốc gia.  "},{"text":"1.2.2. Cách đọc bản đồ CS-MAP Bộ bản đồ CS-MAP vùng Đồng bằng sông Cửu Long bao gồm 2 loại bản đồ: (1) Bản đồ nguy cơ khí hậu, bao gồm nguy cơ hạn hán -xâm nhập mặn và nguy cơ ngập lũ; và (2) Bản đồ lịch thời vụ đề xuất. Mỗi loại bản đồ gồm 2 kịch bản là năm trung bình (hay năm thông thường) và năm cực đoan. Vì vậy, mỗi tỉnh sẽ từ 8-10 bản đồ, phụ thuộc vào điều kiện địa phương có canh tác lúa vụ 3 hay không. Hình 3. Màu của các Hình 3. Màu của các mức nguy cơ được thể mức nguy cơ được thể hiện trên bản đồ hiện trên bản đồ  "},{"text":"Các mức nguy cơ khí hậu được kí hiệu như sau: • Vùng an toàn (màu Xanh): Không  bao giờ bị ảnh hưởng bởi ngập lụt/hạn bao giờ bị ảnh hưởng bởi ngập lụt/hạn hán/xâm nhập mặn. Vùng này bao gồm hán/xâm nhập mặn. Vùng này bao gồm cả vùng thường xuyên bị ảnh hưởng, cả vùng thường xuyên bị ảnh hưởng, nghĩa là năm nào cũng bị ngập lụt/hạn nghĩa là năm nào cũng bị ngập lụt/hạn hán/xâm nhập mặn, địa phương đã có hán/xâm nhập mặn, địa phương đã có biện pháp thích ứng nên không được biện pháp thích ứng nên không được coi là vùng có nguy cơ. coi là vùng có nguy cơ.  "},{"text":"• Nguy cơ cao (màu Đỏ): những  vùng hàng năm có thể không chịu ảnh vùng hàng năm có thể không chịu ảnh hưởng của lũ lụt hay hạn hán hay xâm hưởng của lũ lụt hay hạn hán hay xâm ngập mặn nhưng với sự biến động của ngập mặn nhưng với sự biến động của BĐKH, có nguy cơ bị ảnh hưởng, gây BĐKH, có nguy cơ bị ảnh hưởng, gây thiệt hại nặng (thiệt hại >70%) thiệt hại nặng (thiệt hại >70%)  "},{"text":"• Nguy cơ trung bình (màu Cam):  những vùng hàng năm có thể chịu ảnh những vùng hàng năm có thể chịu ảnh hưởng của lũ lụt, hạn hán, xâm ngập hưởng của lũ lụt, hạn hán, xâm ngập mặn nhưng với một biến động của mặn nhưng với một biến động của BĐKH, có nguy cơ bị ảnh hưởng, gây BĐKH, có nguy cơ bị ảnh hưởng, gây thiệt hại trung bình (thiệt hại 30-70%) thiệt hại trung bình (thiệt hại 30-70%)  "},{"text":"• Nguy cơ thấp (màu Vàng): những vùng hàng năm có thể chịu ảnh hưởng của lũ lụt, hạn hán, xâm ngập mặn nhưng với một biến động của BĐKH, có nguy cơ bị ảnh hưởng, gây thiệt hại  lý cơ bản của lịch thời vụ đề xuất là ảnh hưởng của xâm nhập mặn và hạn lý cơ bản của lịch thời vụ đề xuất làảnh hưởng của xâm nhập mặn và hạn dựa vào các mức nguy cơ, thời điểm hán vào cuối vụ. Lịch thời vụ thường dựa vào các mức nguy cơ, thời điểmhán vào cuối vụ. Lịch thời vụ thường và thời gian của các hiện tượng thời đi kèm với việc thay đổi cơ cấu giống, và thời gian của các hiện tượng thờiđi kèm với việc thay đổi cơ cấu giống, tiết cực đoan mà bố trí thời vụ, sao cho sử dụng các giống lúa chịu hạn, chịu tiết cực đoan mà bố trí thời vụ, sao chosử dụng các giống lúa chịu hạn, chịu mức tác động đến cây lúa là thấp nhất mặn, ngắn ngày đối với các vùng canh mức tác động đến cây lúa là thấp nhấtmặn, ngắn ngày đối với các vùng canh (Hình 4). Ví dụ, vụ Đông Xuân được tác 3 vụ lúa, hoặc sử dụng các giống (Hình 4). Ví dụ, vụ Đông Xuân đượctác 3 vụ lúa, hoặc sử dụng các giống gieo sạ sớm, thay vì tháng 12 -tháng lúa chất lượng cao, dài ngày đối với gieo sạ sớm, thay vì tháng 12 -thánglúa chất lượng cao, dài ngày đối với 1 thì gieo sạ từ tháng 10 -11 để tránh các vùng cần cắt vụ v.v… 1 thì gieo sạ từ tháng 10 -11 để tránhcác vùng cần cắt vụ v.v… 1.2  1.2 ít  ít (thiệt hại <30%).  (thiệt hại <30%). Bản đồ lịch thời vụ đề xuất được xây  Bản đồ lịch thời vụ đề xuất được xây dựng dựa trên các vùng với các mức  dựng dựa trên các vùng với các mức nguy cơ tương ứng được xác định ở  nguy cơ tương ứng được xác định ở bản đồ nguy cơ ngập lũ và nguy cơ hạn  bản đồ nguy cơ ngập lũ và nguy cơ hạn mặn. Lịch thời vụ đề xuất thể hiện các Hình 4. Nguyên lý bố trí lịch mặn. Lịch thời vụ đề xuất thể hiện cácHình 4. Nguyên lý bố trí lịch biện pháp điều chỉnh lịch thời vụ, giãn vụ, chuyển đổi, dừng sản xuất v.v… cùng thời vụ thích ứng biện pháp điều chỉnh lịch thời vụ, giãn vụ, chuyển đổi, dừng sản xuất v.v… cùngthời vụ thích ứng với cơ cấu giống phù hợp cho các vùng  với cơ cấu giống phù hợp cho các vùng với các mức nguy cơ khác nhau, nhằm  với các mức nguy cơ khác nhau, nhằm giảm thiểu thiệt hại của các hiện tượng  giảm thiểu thiệt hại của các hiện tượng thời tiết cực đoan đến cây lúa. Nguyên  thời tiết cực đoan đến cây lúa. Nguyên  "},{"text":".3. Ứng dụng của bản đồ CS-MAP Bộ bản đồ CS-MAP tại Đồng bằng sông Cửu Long được sử dụng như một tài liệu tham khảo trong công tác chỉ đạo sản xuất lúa. Dựa vào dự báo về khí hậu hàng năm và dự báo đầu vụ, các cơ quan quản lý cấp Trung ương và cấp tỉnh xác định các khu vực có thể chịu ảnh hưởng của hạn hán, lũ lụt hay xâm nhập mặn ở các mức độ khác  "},{"text":"Hướng dẫn thảo luận nhóm thành lập bản đồ CS-MAP 2.1. Thảo luận nhóm thành lập bản đồ rủi ro thiên tai 2.1.1. Căn cứ xây dựng bản đồ - Căn cứ vào vùng có nguy cơ chịu ảnh hưởng của ngập lụt, hạn hán, xâm ngập mặn theo các tiểu vùng sinh thái.  "},{"text":"2.2.2. Cơ sở đề nghị khung thời vụ . Dựa vào tình hình phát sinh, phát triển của các loại dịch hại nhất là rầy nâu, bệnh vàng lùn, lùn xoắn lá. Cần thiết phải cách vụ, giãn vụ, gom vụ để cách ly vòng đời, giảm mật số rầy, hạn chế dịch bệnh. e. Tùy theo cơ cấu mùa vụ của từng vùng sản xuất. Ví dụ: cơ cấu 2 vụ lúa: ĐX -HT, cơ cấu 3 vụ lúa: ĐX -HT -TĐ hoặc cơ cấu ĐX -HT -Màu ... Xác định thời vụ của vụ trước sẽ liên quan đến thời vụ của vụ sau (cơ cấu 2 vụ lúa chủ động lịch thời vụ hơn cơ cấu 3 vụ). f. Dựa vào đặc điểm đất đai của từng vùng, đất phèn, đất nhiễm mặn, đất gò cao, triền, trũng… (đất gò cao xuống giống sớm hơn đất triền, trũng trong vụ Đông Xuân nhưng xuống giống muộn hơn trong vụ Hè Thu. Đất nhiễm phèn, mặn phải có thời gian rửa phèn mặn trước khi xuống giống). g. Dựa vào tập quán canh tác và mùa vụ truyền thống của từng vùng có sự điều chỉnh cho phù hợp (phương pháp làm đất: có làm đất hay không, phơi ải hay ngâm rũ... ảnh hưởng đến thời gian xuống giống). h. Vấn đề lao động theo mùa vụ, tính chất cơ giới hóa trong sản xuất là tiêu chí cần quan tâm trong việc bố trí thời vụ.  "},{"text":"Thảo luận của nhóm và các chuyên gia. 2.2.4. Kết quả mong muốn: Liên kết bố trí mùa vụ và thời vụ theo từng tiểu vùng sinh thái thích ứng với những tác động của BĐKH: + Mỗi tiểu vùng sinh thái có những tác động riêng của BĐKH, do vậy bố trí thời vụ sản xuất lúa sẽ khác nhau trong từng vùng sinh thái. Tuy nhiên mỗi vùng sinh thái sẽ liên quan đến sản xuất và hệ thống canh tác của nhiều tỉnh, do vậy cần có sự liên kết vùng trong bố trí mùa vụ và thời vụ sản xuất để khai thác tối đa các lợi thế trong việc sử dụng hệ thống công trình phục vụ sản xuất. + Liên kết trong bố trí mùa vụ đồng thời cũng khắc phục được việc sử dụng kém hiệu quả nguồn nước và chất lượng nước cho các mục tiêu sản xuất khác nhau như lúa + màu; lúa + thủy sản; Bước 2: Thảo luận chung Bước 2: Thảo luận chung • Các nhóm tổng hợp và lắp ráp bản đồ của các huyện với nhau và thảo luận • Các nhóm tổng hợp và lắp ráp bản đồ của các huyện với nhau và thảo luận bản đổ mùa vụ, thời vụ cho vùng có nguy cơ bị ảnh hưởng hạn, mặn, lũ nhóm, bản đổ mùa vụ, thời vụ cho vùng có nguy cơ bị ảnh hưởng hạn, mặn, lũ nhóm, rà soát và thống nhất các vùng giáp ranh chịu ảnh hưởng theo các cấp độ: nguy rà soát và thống nhất các vùng giáp ranh chịu ảnh hưởng theo các cấp độ: nguy cơ nặng, vừa và thấp. cơ nặng, vừa và thấp.  "},{"text":"Khung thời vụ chung chi tiết cho từng vùng  3.  3. a. Vùng 2 vụ lúa  a. Vùng 2 vụ lúa • Vụ Đông Xuân -Hè Thu • Vụ Đông Xuân -Hè Thu -Vụ Đông Xuân: từ 1/11 đến 30/12 -Vụ Đông Xuân: từ 1/11 đến 30/12 -Vụ Hè Thu: từ 1/5 đến 30/6 -Vụ Hè Thu:từ 1/5 đến 30/6 • Vụ Hè Thu -Mùa  • Vụ Hè Thu -Mùa -Vụ Hè Thu: từ 15/4 đến 15/5 -Vụ Hè Thu: từ 15/4 đến 15/5 -Vụ Mùa:  -Vụ Mùa: Mùa (Giống địa phương): mạ tháng 7, cấy tháng 8, 9 Mùa (Giống địa phương): mạ tháng 7, cấy tháng 8, 9 Mùa (Giống cao sản): xuống giống 15/8 đến 15/9 Mùa (Giống cao sản):xuống giống 15/8 đến 15/9 b. Vùng 3 vụ lúa: Đông Xuân -Hè Thu -Thu Đông b. Vùng 3 vụ lúa: Đông Xuân -Hè Thu -Thu Đông -Vụ Đông Xuân: từ 10/11 đến 30/12 -Vụ Đông Xuân:từ 10/11 đến 30/12 -Vụ Hè Thu: từ 15/4 đến 15/5 -Vụ Hè Thu:từ 15/4 đến 15/5 -Vụ Thu Đông: từ 20/7 đến 20/8 -Vụ Thu Đông:từ 20/7 đến 20/8  "},{"text":"Giới thiệu về phần mềm QGIS 3.1. QGIS là gì QGIS là phần mềm mã nguồn mở và miễn phí dùng cho việc trình bày, biên tập và xử lý các dữ liệu không gian (bản đồ số). Bản cài của QGIS có thể tải về miễn phí từ website. Một ưu thế khác của QGIS là có tích hợp giao diện tiếng Việt thân thiện hơn với người dùng.  "},{"text":".3 Lớp dữ liệu nền Lớp dữ liệu nền gồm các lớp ranh giới tỉnh, ranh giới huyện, ranh giới xã, tên địa danh, thủy hệ (kênh, rạch), sông, hồ. Ý nghĩa các cột (trường dữ liệu) trong bảng: 4.1  Ý nghĩa các cột (trường dữ liệu) trong bảng: 4.1 Ký hiệu Ý nghĩa Ký hiệu Ý nghĩa Ký hiệuÝ nghĩaKý hiệuÝ nghĩa Dx Đông Xuân T1….T12 Tháng xuống giống 1… 12 DxĐông XuânT1….T12Tháng xuống giống 1… 12 Ht Hè Thu Area-ha Diện tích (ha) HtHè ThuArea-haDiện tích (ha) Td Thu Đông Flood Ngập TdThu ĐôngFloodNgập Lm Lúa mùa Salinity Mặn LmLúa mùaSalinityMặn n hoặc norm Năm trung bình Landuse Kiểu sử dụng đất (ĐX.HT/ TĐ, màu…) n hoặc norm Năm trung bình LanduseKiểu sử dụng đất (ĐX.HT/ TĐ, màu…) e hoặc extr Năm cực đoan Maloaidat Loại sử dụng đất (ONT, CLN... ) e hoặc extrNăm cực đoanMaloaidatLoại sử dụng đất (ONT, CLN... ) Ví dụ:    Ví dụ: Flood_norm Nguy cơ ngập lụt -năm trung bình Flood_normNguy cơ ngập lụt -năm trung bình Flood_extr Nguy cơ ngập lụt -năm cực đoan Flood_extrNguy cơ ngập lụt -năm cực đoan Salinity_n Nguy cơ hạn mặn -năm trung bình Salinity_nNguy cơ hạn mặn -năm trung bình Salinity_e Nguy cơ hạn mặn -năm cực đoan Salinity_eNguy cơ hạn mặn -năm cực đoan Landuse_n Hình 7a Loại SDĐ năm trung bình  Landuse_nHình 7a Loại SDĐ năm trung bình Dx_n0 Thời điểm xuống giống vụ đông xuân, năm trung bình Dx_n0Thời điểm xuống giống vụ đông xuân, năm trung bình   Hình 7b  Hình 7b  "},{"text":"VÀ PHỔ BIẾN TƯ VẤN NÔNG VỤ ĐỊA PHƯƠNG DỰA TRÊN THÔNG TIN THỜI TIẾT KHÍ HẬU: KINH NGHIỆM THÍ ĐIỂM Ở VÙNG ĐỒNG BẰNG SÔNG CỬU LONG Nguyễn Duy Nhiệm Đàm Việt Bắc Angelica Barlis Kees Swaans 1. Bối cảnh chung Biến Biến đổi và biến thiên khí hậu làm gia tăng mức độ dễ bị tổn thương của các hộ nông dân sản xuất nhỏ lẻ và đe dọa sinh kế nông nghiệp của họ. Năm 2016, ảnh hưởng của hiện tượng El Nino -Dao động Nam (ENSO) đã được ghi nhận tại 11 trong số 13 tỉnh Đồng bằng sông Cửu Long (ĐBSCL) do hạn hán và xâm nhập mặn nghiêm trọng. Điều này đã gây thiệt hại trên 400.000 ha đất trồng trọt, dẫn đến thiệt hại kinh tế 200 triệu đô la Mỹ và an ninh lương thực không được đảm bảo cho nhiều nông dân. ENSO-2016 đã làm giảm 75% thu nhập của các hộ gia đình, đẩy những nông dân dễ bị tổn thương, những người có ít khoản tiết kiệm và không có bảo hiểm rơi vào tình trạng nghèo đói hơn.Cũng do biến đổi khí hậu, hiện tượng thời tiết cực đoan xảy ra ngày càng thường xuyên và nghiêm trọng hơn, và các thiên tai tự nhiên như ENSO có thể trở nên khốc liệt hơn. Do đó, các tư vấn nông vụ được xây dựng dựa trên thông tin thời tiết, khí hậu phù hợp với địa phương bao gồm thông tin về giống cây trồng và tập quán phù hợp, lịch thời vụ điều chỉnh, các biện pháp quản lý chăm sóc thích ứng với khí hậu, quản lý sâu bệnh, và dự báo lượng mưa và xâm nhập mặn đóng vai trò quan trọng trong việc cung cấp các lựa chọn giúp nông dân đương đầu với khó khăn.Dựa trên kinh nghiệm của CCAFS Đông Nam Á về xây dựng Bản đồ rủi ro khí hậu và kế hoạch thích ứng (CS-MAP) cho sản xuất lúa ở Đồng bằng sông Cửu Long (ĐBSCL), Liên minh Đa dạng Sinh học Quốc tế và CIAT đã phát triển kinh nghiệm này trong việc xây dựng và phổ biến tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu phù hợp với địa phương thông qua phương pháp có sự tham gia trong bối cảnh của Việt Nam. Thông qua Dự án: \"Áp dụng dự báo khí hậu mùa vụ và các giải pháp bảo hiểm tiên tiến vào quản lý rủi ro khí hậu trong ngành nông nghiệp ở Đông Nam Á\", còn được gọi là \"DeRISK Đông Nam Á\", thí điểm xây dựng tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu địa phương đã được thực hiện các xã trong vụ Đông Xuân 2020-2021 tại ĐBSCL trong sự phối hợp chặt chẽ với Bộ NN & PTNT, Cục Trồng trọt và Trung tâm Khuyến nông Quốc gia. Do đó, thông tin được trình bày trong tài liệu này là đặc thù cho việc xây dựng các tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu cho vụ đông xuân.Mục đích của cuốn sổ tay này là nhằm ghi lại những kinh nghiệm và bài học rút ra từ kết quả thí điểm. Đồng thời tài liệu cung cấp cụ thể thêm về khái niệm, điều kiện, các bước chính và thông tin quan trọng liên quan đến quá trình đồng Trường dữ liệu Trường dữ liệu Chú thích Chú thích Phân cấp Phân cấp Trường dữ liệu Trường dữ liệuChú thích Chú thíchPhân cấp Phân cấp Ht_e0 T8_e Thời điểm xuống Xuống giống tháng 8, theo giai đoạn tương tự: số chẵn -nửa đầu tháng; số Ht_e0 T8_eThời điểm xuống Xuống giống tháng 8,theo giai đoạn tương tự: số chẵn -nửa đầu tháng; số  giống vụ hè thu, năm năm cực đoan lẻ -nửa cuối tháng giống vụ hè thu, năm năm cực đoanlẻ -nửa cuối tháng Trường dữ liệu cực đoan Chú thích Td_e0 Thời điểm xuống T9_e Xuống giống tháng 9, năm cực đoan Phần 2 Phân cấp theo giai đoạn tương tự: số chẵn -nửa đầu tháng; số lẻ -nửa cuối tháng Trường dữ liệu cực đoan Chú thích Td_e0 Thời điểm xuống T9_e Xuống giống tháng 9, năm cực đoan Phần 2 Phân cấp theo giai đoạn tương tự: số chẵn -nửa đầu tháng; số lẻ -nửa cuối tháng Objectid T10_e Maloaidat Loại SDĐ theo bản đồ giống vụ thu đông, Xuống giống tháng tương tự: số chẵn -nửa đầu tháng; số ID năm cực đoan 10, năm cực đoan lẻ -nửa cuối tháng Lm_e0 Thời điểm xuống theo giai đoạn T11_e Xuống giống tháng tương tự: số chẵn -nửa đầu tháng; số SDĐ Province giống vụ mùa, năm 11, năm cực đoan lẻ -nửa cuối tháng Tên tỉnh Flood_ norm Nguy cơ ngập lụt -năm trung bình 0 -Không ảnh hưởng; 1:-Nguy cơ cao; Flood_extr Nguy cơ ngập lụt -năm cực đoan Salinity_n Nguy cơ hạn mặn -năm trung bình trung bình 2-Nguy cơ trung bình; 3-Nguy cơ thấp giống vụ hè thu, năm lẻ -nửa cuối tháng 0 -Không ảnh hưởng; 1:-Nguy cơ cao; Ht_n Thời điểm xuống tương tự: số chẵn -nửa đầu tháng; số SpatialID -2-Nguy cơ trung bình; 3-Nguy cơ thấp năm trung bình ngày 16 đến 31/10) 0 -Không ảnh hưởng; 1:-Nguy cơ cao; giống vụ đông xuân, tháng (ví dụ 10-ngày 1 đến 15/10; 10.5-Area_ha Diện tích 2-Nguy cơ trung bình; 3-Nguy cơ thấp cực đoan Dx_n Thời điểm xuống số chẵn -nửa đầu tháng; số lẻ -nửa cuối T12_e Xuống giống tháng 12, năm cực đoan tương tự: số chẵn -nửa đầu tháng; số lẻ -nửa cuối tháng CÙNG XÂY DỰNG Objectid T10_e Maloaidat Loại SDĐ theo bản đồ giống vụ thu đông, Xuống giống tháng tương tự: số chẵn -nửa đầu tháng; số ID năm cực đoan 10, năm cực đoan lẻ -nửa cuối tháng Lm_e0 Thời điểm xuống theo giai đoạn T11_e Xuống giống tháng tương tự: số chẵn -nửa đầu tháng; số SDĐ Province giống vụ mùa, năm 11, năm cực đoan lẻ -nửa cuối tháng Tên tỉnh Flood_ norm Nguy cơ ngập lụt -năm trung bình 0 -Không ảnh hưởng; 1:-Nguy cơ cao; Flood_extr Nguy cơ ngập lụt -năm cực đoan Salinity_n Nguy cơ hạn mặn -năm trung bình trung bình 2-Nguy cơ trung bình; 3-Nguy cơ thấp giống vụ hè thu, năm lẻ -nửa cuối tháng 0 -Không ảnh hưởng; 1:-Nguy cơ cao; Ht_n Thời điểm xuống tương tự: số chẵn -nửa đầu tháng; số SpatialID -2-Nguy cơ trung bình; 3-Nguy cơ thấp năm trung bình ngày 16 đến 31/10) 0 -Không ảnh hưởng; 1:-Nguy cơ cao; giống vụ đông xuân, tháng (ví dụ 10-ngày 1 đến 15/10; 10.5-Area_ha Diện tích 2-Nguy cơ trung bình; 3-Nguy cơ thấp cực đoan Dx_n Thời điểm xuống số chẵn -nửa đầu tháng; số lẻ -nửa cuối T12_e Xuống giống tháng 12, năm cực đoan tương tự: số chẵn -nửa đầu tháng; số lẻ -nửa cuối tháng CÙNG XÂY DỰNG Salinity_e Td_n Nguy cơ hạn mặn -năm cực đoan Thời điểm xuống tương tự: số chẵn -nửa đầu tháng; số 0 -Không ảnh hưởng; 1:-Nguy cơ cao; 2-Nguy cơ trung bình; 3-Nguy cơ thấp giống vụ thu đông, lẻ -nửa cuối tháng Salinity_e Td_nNguy cơ hạn mặn -năm cực đoan Thời điểm xuống tương tự: số chẵn -nửa đầu tháng; số 0 -Không ảnh hưởng; 1:-Nguy cơ cao; 2-Nguy cơ trung bình; 3-Nguy cơ thấp giống vụ thu đông, lẻ -nửa cuối tháng Landuse_n Loại SDĐ năm trung năm trung bình ĐX/HT/TD-(lúa đông xuân/hè thu/thu Landuse_n Loại SDĐ năm trung năm trung bìnhĐX/HT/TD-(lúa đông xuân/hè thu/thu Dx_n0 Lm_n bình Thời điểm xuống Thời điểm xuống tương tự: số chẵn -nửa đầu tháng; số đông); Mau: hoa màu theo giai đoạn giống vụ mùa, năm lẻ -nửa cuối tháng Dx_n0 Lm_nbình Thời điểm xuống Thời điểm xuống tương tự: số chẵn -nửa đầu tháng; số đông); Mau: hoa màu theo giai đoạn giống vụ mùa, năm lẻ -nửa cuối tháng  giống vụ đông xuân, trung bình giống vụ đông xuân, trung bình Ht_n0 Dx_e năm trung bình Thời điểm xuống Thời điểm xuống tương tự: số chẵn -nửa đầu tháng; số theo giai đoạn giống vụ đông xuân, lẻ -nửa cuối tháng Ht_n0 Dx_enăm trung bình Thời điểm xuống Thời điểm xuống tương tự: số chẵn -nửa đầu tháng; số theo giai đoạn giống vụ đông xuân, lẻ -nửa cuối tháng  giống vụ hè thu, năm năm cực đoan giống vụ hè thu, năm năm cực đoan Td_n0 Ht_e trung bình Thời điểm xuống Thời điểm xuống tương tự: số chẵn -nửa đầu tháng; số theo giai đoạn giống vụ hè thu, năm lẻ -nửa cuối tháng Td_n0 Ht_etrung bình Thời điểm xuống Thời điểm xuống tương tự: số chẵn -nửa đầu tháng; số theo giai đoạn giống vụ hè thu, năm lẻ -nửa cuối tháng  giống vụ thu đông, cực đoan giống vụ thu đông, cực đoan Lm_n0 Td_e năm trung bình Thời điểm xuống Thời điểm xuống tương tự: số chẵn -nửa đầu tháng; số theo giai đoạn giống vụ thu đông, lẻ -nửa cuối tháng Lm_n0 Td_enăm trung bình Thời điểm xuống Thời điểm xuống tương tự: số chẵn -nửa đầu tháng; số theo giai đoạn giống vụ thu đông, lẻ -nửa cuối tháng  giống vụ mùa, năm năm cực đoan giống vụ mùa, năm năm cực đoan trung bình Landuse_e Loại SDĐ năm cực Thời điểm xuống tương tự: số chẵn -nửa đầu tháng; số Lm_e ĐX/HT/TD-(lúa đông xuân/hè thu/thu giống vụ mùa, năm lẻ -nửa cuối tháng trung bình Landuse_e Loại SDĐ năm cực Thời điểm xuống tương tự: số chẵn -nửa đầu tháng; số Lm_e ĐX/HT/TD-(lúa đông xuân/hè thu/thu giống vụ mùa, năm lẻ -nửa cuối tháng  đoan cực đoan  đông); Mau: hoa màu đoan cực đoanđông); Mau: hoa màu Dx_e0 T1_n Thời điểm xuống Xuống giống tháng 1, tương tự: số chẵn -nửa đầu tháng; số theo giai đoạn giống vụ đông xuân, năm trung bình lẻ -nửa cuối tháng Dx_e0 T1_nThời điểm xuống Xuống giống tháng 1, tương tự: số chẵn -nửa đầu tháng; số theo giai đoạn giống vụ đông xuân, năm trung bình lẻ -nửa cuối tháng T2_n năm cực đoan Xuống giống tháng 2, tương tự: số chẵn -nửa đầu tháng; số T2_nnăm cực đoan Xuống giống tháng 2,tương tự: số chẵn -nửa đầu tháng; số  năm trung bình lẻ -nửa cuối tháng năm trung bìnhlẻ -nửa cuối tháng  "},{"text":": Cung cấp một khoảng các thay đổi có thể xảy ra trong mùa sắp tới. Tuy nhiên, không thể dự đoán trước các biến đổi thời tiết hàng ngày ở các khu vực cụ thể trước hàng tháng do tính chất hỗn loạn của hoàn lưu khí quyển. Do đó, dự báo thời hạn mùa chỉ hỗ trợ xây dựng kế hoạch sản xuất trước mỗi vụ sản xuất. Cung cấp nhu cầu theo thời gian thực của nông dân và đóng góp vào các chiến lược và hoạt động quản lý cây trồng/ vật nuôi dựa trên thời tiết nhằm tăng cường sản xuất cây trồng và an ninh lương thực. Các dịch vụ này hỗ trợ nông dân giảm thiểu tác động tiêu cực của điều kiện thời tiết khắc nghiệt. Dịch vụ ở đây không nhất thiết là dịch vụ có thu phí, nó tương tự như dịch vụ khuyến nông mà người nông dân vẫn tiếp cận thường xuyên.  "},{"text":"Dự án thí điểm đã được thực hiện như thế nào? Trước tiên, tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu phù hợp với địa phương được sản xuất để phục vụ nông dân và doanh nghiệp nông nghiệp với tư cách là người dùng cuối. Tuy nhiên, nhóm chủ chốt được hướng tới để sử dụng cuốn cẩm nang này là những người sử dụng gián tiếp, tức là cán bộ nông nghiệp và cán bộ khuyến nông cấp tỉnh, huyện và xã ở Việt Nam -những người chủ yếu làm việc với nông dân và các doanh nghiệp nông nghiệp, cung cấp hỗ trợ như đào tạo và xây dựng năng lực giúp họ đưa ra quyết định tốt hơn để cải thiện sản xuất nông nghiệp.Phát triển tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu phù hợp với địa phương được thực hiện thí điểm tại 3 xã: Tân Phước (Gò Công Đông, Tiền Giang), Hòa Chánh (U Minh Thượng, Kiên Giang) và An Mỹ (Kế Sách, Sóc Trăng). Thông qua hội thảo có sự tham gia, thông tin khuyến nghị khí hậu nông nghiệp phù hợp với địa phương cho vụ đông xuân 2020-2021 được xây dựng thành các bản tin, áp phích và bản đọc loa phát thanh, các tư vấn đã được phổ biến trực tiếp và gián tiếp đến với khoảng 5,000 nông dân.Bốn bước đầu tiên có thể được kết hợp triển khai thực hiện trong hai hội thảo có sự tham gia, với hội thảo đầu tiên được tổ chức khoảng hai tháng trước mùa vụ bắt đầu và hoạt động thứ 2 tổ chức từ 3 đến 4 tuần trước khi mùa vụ bắt đầu. Phương pháp này dựa trên việc triển khai thành công của xây dựng và phổ Phương pháp này dựa trên việc triển khai thành công của xây dựng và phổ biến tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu có sự tham gia ở châu biến tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu có sự tham gia ở châu Mỹ Latinh do CIAT tham gia xây dựng, nhưng đã được điều chỉnh cho phù hợp Mỹ Latinh do CIAT tham gia xây dựng, nhưng đã được điều chỉnh cho phù hợp với bối cảnh của Việt Nam dựa trên điều kiện địa phương và các môi trường. với bối cảnh của Việt Nam dựa trên điều kiện địa phương và các môi trường. Phương pháp thực hiện này gồm các bước sau: Phương pháp thực hiện này gồm các bước sau: 1. Sự tham gia của các bên liên quan và phát triển kế hoạch làm việc chung 1. Sự tham gia của các bên liên quan và phát triển kế hoạch làm việc chung 2. Hợp tác xây dựng các kịch bản thích ứng với khí hậu (bản đồ rủi ro và kế 2. Hợp tác xây dựng các kịch bản thích ứng với khí hậu (bản đồ rủi ro và kế hoạch thích ứng) hoạch thích ứng) 3. Hợp tác phát triển tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu cấp 3. Hợp tác phát triển tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu cấp xã và bản tin thời tiết nông vụ xã và bản tin thời tiết nông vụ 4. Phổ biến và chia sẻ các khuyến nghị thời tiết nông vụ 4. Phổ biến và chia sẻ các khuyến nghị thời tiết nông vụ 5. Giám sát và đánh giá việc thực hiện 5. Giám sát và đánh giá việc thực hiện  "},{"text":"Cùng xây dựng các kịch bản thích ứng với khí hậu (bản đồ rủi ro khí hậu và kế hoạch thích ứng) Trong hội thảo thứ hai được tổ chức 3 đến 4 tuần trước khi bắt đầu vụ Đông Xuân, các đại biểu họp để thống nhất kịch bản xâm nhập mặn có thể xảy ra đối với vụ Đông Xuân dựa trên tình hình dự báo thời tiết và xâm nhập mặn cập nhật. Bằng cách kết hợp thông tin từ kịch bản rủi ro xâm nhập mặn và kế hoạch thích ứng đã xác định và dự báo cập nhật v���i những thông tin về tình thu hoạch vụ trước đó và chất lượng nước (độ mặn của nước) trên sông/kênh, lịch gieo sạ, giống lúa phù hợp và các khuyến cáo sản xuất nông nghiệp khác cũng được cập nhật. Bản tin thời tiết nông vụđã được điều chỉnh và hoàn thiện cho phù hợp như dưới đây. Bước 2. Hoạt động 2 này có thể được kết dân hiệu chỉnh bản đồ rủi ro xâm Bước 2. Hoạt động 2 này có thể được kếtdân hiệu chỉnh bản đồ rủi ro xâm hợp với hoạt động 1 trong cùng một nhập mặn và kế hoạch thích ứng (lịch hợp với hoạt động 1 trong cùng mộtnhập mặn và kế hoạch thích ứng (lịch hội thảo. Cùng với sự phối hợp của gieo sạ và giống lúa phù hợp) cho hai hội thảo. Cùng với sự phối hợp củagieo sạ và giống lúa phù hợp) cho hai CCAFS-SEA và Cục Trồng trọt, chúng kịch bản rủi ro có thể xảy ra là xâm CCAFS-SEA và Cục Trồng trọt, chúngkịch bản rủi ro có thể xảy ra là xâm tôi đã tiến hành xây dựng các kịch nhập mặn trung bình và cực đoan do tôi đã tiến hành xây dựng các kịchnhập mặn trung bình và cực đoan do bản thích ứng với khí hậu (CS-MAP) CCAFS-SEA chuẩn bị. Cán bộ CCAFS- bản thích ứng với khí hậu (CS-MAP)CCAFS-SEA chuẩn bị. Cán bộ CCAFS- tập trung vào xâm nhập mặn -rủi SEA, CIAT và Cục Trồng trọt hướng dẫn tập trung vào xâm nhập mặn -rủiSEA, CIAT và Cục Trồng trọt hướng dẫn ro chính của khu vực trong vụ Đông thảo luận cho hoạt động này. Hướng ro chính của khu vực trong vụ Đôngthảo luận cho hoạt động này. Hướng Xuân. Các cơ quan từ các cấp khác dẫn chi tiết được trình bày trong cuốn Xuân. Các cơ quan từ các cấp khácdẫn chi tiết được trình bày trong cuốn nhau ở địa phương và người nông sổ tay này. nhau ở địa phương và người nôngsổ tay này. Cũng trong hội thảo đầu tiên, các đại ra, đại biểu cũng thảo luận và thống Cũng trong hội thảo đầu tiên, các đạira, đại biểu cũng thảo luận và thống biểu đã thực hành phân tích dự báo nhất cách trình bày những thông tin biểu đã thực hành phân tích dự báonhất cách trình bày những thông tin thời hạn mùa cho thời tiết và xâm này một cách dễ tiếp cận, dễ hiểu đối thời hạn mùa cho thời tiết và xâmnày một cách dễ tiếp cận, dễ hiểu đối nhập mặn do Trung tâm khí tượng với người nông dân. nhập mặn do Trung tâm khí tượngvới người nông dân. thủy văn tỉnh xây dựng. Họ đã thảo  thủy văn tỉnh xây dựng. Họ đã thảo luận về cách xác định khả năng xảy ra Với những nội dung chính của tư vấn luận về cách xác định khả năng xảy raVới những nội dung chính của tư vấn kịch bản xâm nhập mặn (trung bình nông vụ dựa trên thông tin thời tiết, kịch bản xâm nhập mặn (trung bìnhnông vụ dựa trên thông tin thời tiết, hoặc cực đoan) dựa trên các dự báo khí hậu (dự báo thời tiết và khuyến hoặc cực đoan) dựa trên các dự báokhí hậu (dự báo thời tiết và khuyến thời tiết và xâm nhập mặn. Hơn nữa, nghị nông nghiệp) đã được xây dựng, thời tiết và xâm nhập mặn. Hơn nữa,nghị nông nghiệp) đã được xây dựng, đối với mỗi kịch bản xâm nhập mặn, dựa trên mẫu bản tin thời tiết nông đối với mỗi kịch bản xâm nhập mặn,dựa trên mẫu bản tin thời tiết nông đại biểu hội thảo đã xây dựng lịch vụ, đại biểu hội thảo thảo luận về cấu đại biểu hội thảo đã xây dựng lịchvụ, đại biểu hội thảo thảo luận về cấu thời vụ và thảo luận về các phương trúc, các cấu phần (logo, tiêu đề, dự thời vụ và thảo luận về các phươngtrúc, các cấu phần (logo, tiêu đề, dự pháp quản lý cây trồng chung, các rủi báo thời tiết và xâm nhập mặn, các pháp quản lý cây trồng chung, các rủibáo thời tiết và xâm nhập mặn, các ro liên quan đến khí hậu ứng với các khuyến nghị nông nghiệp cụ thể, các ro liên quan đến khí hậu ứng với cáckhuyến nghị nông nghiệp cụ thể, các giai đoạn sinh trưởng của cây lúa cụ khuyến cáo sản xuất chung/ ghi chú, giai đoạn sinh trưởng của cây lúa cụkhuyến cáo sản xuất chung/ ghi chú, thể, các biện pháp thích ứng và giảm danh sách liên hệ, v.v.), phông chữ và thể, các biện pháp thích ứng và giảmdanh sách liên hệ, v.v.), phông chữ và thiểu, các loại dự báo thời tiết cần bố cục của bản tin. Kết quả là một thiểu, các loại dự báo thời tiết cầnbố cục của bản tin. Kết quả là một thiết. Sau đó, họ xác định và chắt lọc bản tin phác thảo hoàn chỉnh đã được thiết. Sau đó, họ xác định và chắt lọcbản tin phác thảo hoàn chỉnh đã được những dự báo và khuyến nghị nông phát triển theo cách phù hợp nhất và những dự báo và khuyến nghị nôngphát triển theo cách phù hợp nhất và nghiệp sẽ được đưa vào ấn phẩm dễ áp dụng cho nông dân. nghiệp sẽ được đưa vào ấn phẩmdễ áp dụng cho nông dân. thông tin khí hậu nông nghiệp. Ngoài  thông tin khí hậu nông nghiệp. Ngoài  "},{"text":"Phổ biến và chia sẻ các tư vấn nông vụ dựa trên thông tin thời tiết, khí hậu  Bước 5.  Bước 5. Cũng trong hội thảo đầu tiên được tổ  Cũng trong hội thảo đầu tiên được tổ chức, các đại biểu cũng thảo luận về  chức, các đại biểu cũng thảo luận về các kênh phổ biến thông tin khí hậu  các kênh phổ biến thông tin khí hậu nông nghiệp phù hợp nhất cùng với  nông nghiệp phù hợp nhất cùng với hình thức đi kèm (bản tin in, áp phích,  hình thức đi kèm (bản tin in, áp phích, bản đọc loa phát thanh) cho các xã.  bản đọc loa phát thanh) cho các xã. Họ có thể đánh giá, ưu tiên hóa các  Họ có thể đánh giá, ưu tiên hóa các kênh dựa trên tiêu chí về độ dễ dàng  kênh dựa trên tiêu chí về độ dễ dàng tiếp cận, số lượng người hưởng lợi  tiếp cận, số lượng người hưởng lợi và mức độ dễ hiểu. Đối với các kênh  và mức độ dễ hiểu. Đối với các kênh được chọn thông qua đánh giá trên,  được chọn thông qua đánh giá trên, đại biểu bàn về kế hoạch phổ biến cụ  đại biểu bàn về kế hoạch phổ biến cụ thể là trả lời các câu hỏi \"ai\", \"cái gì\",  thể là trả lời các câu hỏi \"ai\", \"cái gì\", \"khi nào\", \"ở đâu\" và \"như thế nào\".  \"khi nào\", \"ở đâu\" và \"như thế nào\". Cụ thể, các chủ đề thảo luận có thể  Cụ thể, các chủ đề thảo luận có thể bao gồm: những cán bộ hoặc các bên  bao gồm: những cán bộ hoặc các bên liên quan nào sẽ tham gia phổ biến  liên quan nào sẽ tham gia phổ biến thông tin và vai trò của họ (chẳng  thông tin và vai trò của họ (chẳng hạn như điều phối, in ấn và phân phối  hạn như điều phối, in ấn và phân phối bản tin và áp phích, phát loa truyền  bản tin và áp phích, phát loa truyền thanh, giám sát, v.v...), ngân sách, thời  thanh, giám sát, v.v...), ngân sách, thời điểm phổ biến và phát loa, nơi treo  điểm phổ biến và phát loa, nơi treo áp phích, bao nhiêu bản. Dựa trên kế  áp phích, bao nhiêu bản. Dựa trên kế hoạch phổ biến đã được thống nhất  hoạch phổ biến đã được thống nhất giữa các bên liên quan, thông tin khí  giữa các bên liên quan, thông tin khí hậu nông nghiệp được chia sẻ tới  hậu nông nghiệp được chia sẻ tới nông dân theo các hình thức khác  nông dân theo các hình thức khác nhau theo kế hoạch đã thống nhất. Thời điểm phổ biến thông tin thích hợp nhất là từ 2 đến 3 tuần trước khi Hình 4. Lãnh đạo ấp, nông dân xã Tân Phước đọc bản tin nông vụ nhau theo kế hoạch đã thống nhất. Thời điểm phổ biến thông tin thích hợp nhất là từ 2 đến 3 tuần trước khiHình 4. Lãnh đạo ấp, nông dân xã Tân Phước đọc bản tin nông vụ mùa vụ bắt đầu để nông dân có kế  mùa vụ bắt đầu để nông dân có kế hoạch chuẩn bị tốt cho mùa vụ. Lãnh  hoạch chuẩn bị tốt cho mùa vụ. Lãnh đạo xã, cán bộ nông nghiệp xã, cán  đạo xã, cán bộ nông nghiệp xã, cán bộ khuyến nông, trưởng thôn bản và  bộ khuyến nông, trưởng thôn bản và nông dân điển hình đóng vai trò quan  nông dân điển hình đóng vai trò quan trọng trong quá trình này.  trọng trong quá trình này.  "},{"text":"Giám sát và đánh giá. Để hiểu rõ hơn về hiệu quả của tư vấn nông vụ dựa trên dự báo thời hạn mùa , một trong những cơ quan liên quan chính (thường là cán bộ nông nghiệp/ xã) thực hiện nhiệm vụ giám sát việc phổ biến và sử dụng thông tin khí hậu nông nghiệp. Có thể thu thập thông tin phản hồi về độ chính xác của dự báo thời tiết/ xâm nhập mặn và khuyến nghị nông nghiệp, hình thức bản tin, kênh và tần suất phổ biến, v.v., để cải thiện thông tin (bản tin) khí hậu nông nghiệp và quá trình phổ biến thông tin.Tùy thuộc vào nguồn lực, có thể xem xét tiến hành khảo sát người nông dân sử dụng và cán bộ các cấp trước (khảo sát cơ sở) và sau (khảo sát tổng kết) khi phổ biến thông tin để đánh giá những thay đổi về kiến thức, thái độ và việc áp dụng  "},{"text":"Kết quả/ phản hồi ban đầu từ người dùng Đầu năm 2021, chúng tôi tổ chức đánh giá định tính để tìm hiểu mức độ phù hợp, nội dung và bố cục của các bản tin thời tiết nông vụ. Thông qua các cuộc họp, hội thảo và thảo luận nhóm tập trung, chúng tôi nắm được rằng các bên liên quan từ cấp tỉnh, cấp huyện và cấp xã, trưởng thôn và nông dân ở các xã thí điểm đánh giá cao thông tin khí hậu nông nghiệp mà chúng tôi đã phổ biến trong vụ đông xuân 2020-2021. Thông tin dự báo thời tiết và xâm nhập mặn rất hữu ích cho nông dân vì dựa vào đó họ có thể lập kế hoạch cho mùa vụ tốt hơn với thông tin khuyến nghị về ngày gieo và giống gieo phù hợp. Nhiều nông dân áp dụng các khuyến cáo về ngày gieo trồng và giống mà chúng tôi đã phổ biến trong bản tin hoặc phát trên loa truyền thanh. Dự báo thời tiết, xâm nhập mặn và khuyến nghị nông nghiệp được nông dân đánh giá là toàn diện, hữu ích, dễ hiểu và dễ áp dụng.Tuy nhiên, với những kinh nghiệm phổ quát hơn trong quá trình thực hiện thí điểm và kết hợp với các đối tác dự án là Cục Trồng trọg và Trung tâm Khuyến nông Quốc gia, một số điểm có thể được cải thiện bao gồm:  "}],"sieverID":"f0bcf3f8-bbd0-4266-81ce-78b8d0cd5a60","abstract":"Sản phẩm này là một phần của Chương trình nghiên cứu CGIAR về Biến đổi khí hậu, Nông nghiệp và An ninh lương thực (CCAFS) phối hợp với Cục Trồng trọt và Trung tâm Khuyến nông Quốc gia, được thực hiện dưới sự hỗ trợ từ các nhà tài trợ của CGIAR và thông qua các thỏa thuận tài trợ song phương. Chi tiết vui lòng truy cập: //ccafs.cgiar.org/donors. MIỄN TRỪ TRÁCH NHIỆM: Tài liệu này do biên soạn trong phạm vi Chương trình CCAFS và chưa được bình duyệt. Tất cả các quan điểm trình bày tại đây là quan điểm của (các) tác giả và không nhất thiết phản ánh chính sách hoặc quan điểm của CCAFS, các bên tài trợ hay đối tác. Tất cả hình ảnh vẫn là tài sản duy nhất của nguồn và không được sử dụng cho bất kỳ mục đích nào mà không có sự cho phép bằng văn bản của nguồn. Phần 2 Nguyễn Duy Nhiệm và nnk. 2021. Cùng xây dựng và phổ biến tư vấn nông vụ địa phương dựa trên thông tin thời tiết khí hậu: kinh nghiệm thí điểm ở vùng Đồng bằng sông Cửu Long. Hà Nội, Việt Nam: Liên minh Tổ chức Đa dạng Sinh học Quốc tế và Trung tâm Nông nghiệp Nhiệt đới Quốc tế (CIAT)."}

data/part_4/05347e4d1b096f7d31cfc2f7001c5c4e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05347e4d1b096f7d31cfc2f7001c5c4e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f9eb2268-87fd-440f-be15-75a668a13451/retrieve"},"pageCount":1,"title":"Drought Tolerance Mechanisms in CasSBva","keywords":["\"\"'\"","d Cuana Is torWdtn'd","food knlrUy crop In droutb'-pro\"\"","TM"],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":52,"text":"l\"dOlt tMl QIA\". Áoma\" rifIU In ~ 10 dllbl d~ In k , (WII!ft se.tUII .nd \",.Inla[, Inr ..... In' \"\",nlda. 1I n¡un nn, IhaK al wdl ..... ltred ('8111,.. .. Thb Is MlOdllllrcl.ttb ,.pld.1Id 'Irte ~l. ab$tkk kW tAllA). AIso,uÁrnI ('(1,\",\"-' • SU\",'''' f..ct.l ... 0(,\"-\", Ibtctit.  o., i~~~i-:\"'-':\"''''':':;:¡;::::::::-'''':':'''-  . ."}]}],"figures":[{"text":" rt'prt'HIIlI\", ... ~ sIuI .... ortb .. lotal_-slrvdunl nut • .,t.,.dntc In I pl'\"1 _ Ilw Inlll_ peried or aon,. ..-\"\"wth. Slomala are responsive lO small decreases in waler status ...... ww -.>-ws 0.7 ~----------~ "},{"text":" dwtdly dffnouIall',. ... lnUo ... ' hlrfln: Ira _ad rUNlM, C'OIIM'l\"IIlna ..... tn' darla, &C1'ft:Ii ¡wriDds. N ....... , pl'GdutlllNlllId ITpllIllIon il:nI .... h 1I .. 1$a ItIply ~h, lo ... I,r dtfk'II, d\", lo Inhlbltlon or IHr fttl dh1don, .nd fdl Iofll~, ~Iulrs lI;.of lu'-l.nll.lI,. IIImullted b,. JI ........ A ..... pI1lo~.nd ¡(mi nrhohydral .. nHI\"I'rs ..... &ndullll,. ullllud .... IraJIiIOC'led lo wnlu Ihroulthoollbt pllnl. Tbt l/IIOUru o( ,úorcb 5IOred In ~I'I'IIS 111 ~rab~. \" .. ndon. 1I .... ,\"\"r, Ir_lb r«1IY,,. raplell,. .nH r\\'Mwed \"'1\" $uppl,., \" .. ndon. 1I .... ,\"\"r, Ir_lb r«1IY,,. raplell,. .nH r\\'Mwed \"'1\" $uppl,., Ibn'dly ~.,.I.I .. lrapld T't'-ftUIbU5hm .. 1I1 o( lur,,,,,,,. C,rf:Ion UM 111 dowII ' Ibn'dly ~.,.I.I .. lrapld T't'-ftUIbU5hm .. 1I1 o( lur,,,,,,,. C,rf:Ion UM 111 dowII ' \"1tubltd b,.Untltlnllrowlb. A«umul. UOll o(,uprs.1Id oChtr OIUTIotk.lI,. \"1tubltd b,.Untltlnllrowlb. A«umul. UOll o(,uprs.1Id oChtr OIUTIotk.lI,.  "}],"sieverID":"e2acb73f-71cc-48d7-8a07-b6e2ed051b22","abstract":""}

data/part_4/0571d0152e18530603098e2581aa8f40.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0571d0152e18530603098e2581aa8f40","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/03324603-956c-496b-8989-0542a674e01a/retrieve"},"pageCount":24,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":11,"text":"Karl von Linnaeus described two bean species (out of 11) :"},{"index":2,"size":7,"text":"In Species Plantarum, 1 st edition (1753)"}]},{"head":"Phaseolus macrocarpus Moench","index":2,"paragraphs":[]},{"head":"Phaseolus maximus Roxburgh","index":3,"paragraphs":[]},{"head":"Phaseolus limensis Macfadyen","index":4,"paragraphs":[]},{"head":"Phaseolus rufus Jacquin","index":5,"paragraphs":[]},{"head":"Phaseolus saccharatus Stokes","index":6,"paragraphs":[]},{"head":"Phaseolus vexillatus Blanco","index":7,"paragraphs":[]},{"head":"Phaseolus achariensis Medikus","index":8,"paragraphs":[{"index":1,"size":3,"text":"Phaseolus puberulus H.B.K."},{"index":2,"size":27,"text":"The same species: Piper 1926, van Eseltine 1931, Verdcourt 1970, Westphal 1974 note the geographic origins = indicators of quick post-Columbus diffusions into the Old World !"}]},{"head":"Biological origin :","index":9,"paragraphs":[{"index":1,"size":14,"text":"What is (are) the plant (s) from which the crop originates (through domestication) ?"},{"index":2,"size":10,"text":"Understanding the domestication syndrome helps to visualize the wild ancestor(s)"},{"index":3,"size":17,"text":"At first : Later on : How to find out about the origin of a crop ?"}]},{"head":"Geographical origin :","index":10,"paragraphs":[{"index":1,"size":13,"text":"What is the distribution of the wild plant/ weed seen as 'ancestor' ?"},{"index":2,"size":8,"text":"Where did/ does the domestication take place ?  "}]},{"head":"RFLPs on cpDNA","index":11,"paragraphs":[{"index":1,"size":70,"text":"Fofana et al. 1999, 2001Maquet et al. 1994, 1997, 1999Fofana et al. 1997Lioi et al. 1998 RFLPs on rDNA Jacob et al. 1995Lioi et al. 1998 microsatellites on nDNA Lioi et al. 2001, 2002Lioi 1994, 1996Lioi et al. 1991, 1999 AFLPs on gDNA   The \"small-seeded\" wild Lima beans equally distant to the \"large-seeded\" ones !  two domestication events, one in W Mexico (M1) and one in NW Peru (A1)"},{"index":2,"size":12,"text":" but Brazil, so another event in the M2 gene pool !?"}]},{"head":"Conclusions (2)","index":12,"paragraphs":[{"index":1,"size":13,"text":"\" there would be little fascination in Science if it were static \""},{"index":2,"size":5,"text":"Prof. Jack R. Harlan, 1992"},{"index":3,"size":72,"text":" the differentiation of small-seeded 'Sieva' and 'Potato' has now little support  a very drastic founder effect occurs during the domestication  long-distance transportation of the benefits of domestication  further progress will come if (only if !) we go back to the field  erosion of landraces, potential of the wild forms/ species of the phylum  not back to \"square one\" however, because A1 and M1 domestications are clear"}]}],"figures":[{"text":" photo: Debouck 1987 photo: Debouck 1987 "},{"text":" three gene pools of wild Lima bean, with little overlap (but Colombia !)  possible Andean origin of the species, though the phylum came from the 'North' role of migrations in the formation of gene pools and of species  interference of geological events (Isthmus, Andean uplift, volcanism)  A1 gene pool restricted to the W Andes of S Ecuador and N Peru  MI gene pool concentrated in Mexico W of Tehuantepec, with few exceptions scattered over in Central America up to Colombia  MII gene pool widespread in Mexico E of Tehuantepec, Central America, and subhumid forests and savannahs of South America down to Argentina  do the wild gene pools reflect different ecological adaptations ? "},{"text":"  "},{"text":"  "},{"text":"An old crop known by the native peoples of the Americas An old crop known by the native peoples of the Americas  comba comba Guerrero Guerrero tabla tabla Cundinamarca Cundinamarca comba combaGuerrero Guerrerotabla tablaCundinamarca Cundinamarca pecta pecta Guerrero Guerrero calentano calentano Cauca Cauca pecta pectaGuerrero Guerrerocalentano calentanoCauca Cauca shiumin shiumin Veracruz Veracruz torta torta Nariño Nariño shiumin shiuminVeracruz Veracruztorta tortaNariño Nariño ishuet ishuet Chiapas Chiapas tapiramo tapiramo Guárico Guárico ishuet ishuetChiapas Chiapastapiramo tapiramoGuárico Guárico patashete patashete Chiapas Chiapas torta torta Imbabura Imbabura patashete patasheteChiapas Chiapastorta tortaImbabura Imbabura ib, ibes ib, ibes Campeche Campeche layo layo Cajamarca Cajamarca ib, ibes ib, ibesCampeche Campechelayo layoCajamarca Cajamarca ib, ibes ib, ibes Yucatán Yucatán pallar pallar Lambayeque Lambayeque ib, ibes ib, ibesYucatán Yucatánpallar pallarLambayeque Lambayeque chilipuca chilipuca El Salvador El Salvador pallar pallar La Libertad La Libertad chilipuca chilipucaEl Salvador El Salvadorpallar pallarLa Libertad La Libertad ixpanqué ixpanqué Suchitepéquez Suchitepéquez pallar pallar Ica Ica ixpanqué ixpanquéSuchitepéquez Suchitepéquezpallar pallarIca Ica furuna furuna Jalapa Jalapa palato palato Cochabamba Cochabamba furuna furunaJalapa Jalapapalato palatoCochabamba Cochabamba pois souche pois souche Haiti Haiti chorca chorca Chuquisaca Chuquisaca pois souche pois soucheHaiti Haitichorca chorcaChuquisaca Chuquisaca  "},{"text":"Neighbor-Joining (PAUP, Swofford 1998) topology based on cpDNA Caicedo et al. 1999 54kD  cp DNA: from 11 non coding regions to 2 intergenic spacers atpB-rbcL and trnL-trnF works by : Asmussen & Liston 1998, Bailey & Doyle1997, Bakker et al. 1999, Chacón et al. 1999   Demesure et al. 1995, Dutech et al. 2000, Motta-Aldana et al. 2008, Xu et al. 2000      nuclear ribosomal DNA : 5.8 S and flanking internal transcribed spacers works by : Delgado-Salinas et al. 2006, Dick et al. 2003, Schaal & Olsen 2000 to solve problems among closely related species and lineages to check the geographic distribution of allele genealogies (maternal inheritance, polymorphisms across regions, PCR amplification) In search of new markers . . . 0.001 W26468ECU W26721ECU D26659ECU D25910COL D27337BOL AI D26259ECU D26498COL D26656COL D25981BOL Gene pool AI D26480ECU W26609ECU W25913PER (wild+domesticated ) W26606ECU W26348PER W26459EC U W26608ECU W26751AEC D25983BOL D25987BOL D25420PER Chuquisaca, Salta D25540ARG D26029PER D25909PER W26629HND MII W26632HND W26515COL W25816MEX W25272GTM W25233BLZ Gene pool MII W25222GTM W26530COL W25912GTM (mostly wild) W25273ASLV W25584ACRI W25911GTM W25385ACRI W26527COL W26628HND W26685ARG W26547PER W26404ARG W26749ARG W26508GTM W25294CCU W26309COL D25108BRA Minas Gerais, Ceará D26002BRA W25819COL MI W25230MEX D25295CUB D26164MEX D25289MEX W26535MEX W25704MEX D26211BRA D26744COL D26290ARG D26706COL W25228MEX D26302GTM D25285GTM D26109BRA W26704COL W25713AMEX D26044BRA D25717MEX W26631HND D25236ARG W26518MEX D25577PER W25851MEX D27289CUB (wild+domesticated) D26745COL D25410ECU Gene pool MI W26360MEX D25367SLV D25971MEX Formosa, Mato Grosso, Espirito Santo  nuclear ribosomal DNA : 5.8 S and flanking internal transcribed spacers works by : Delgado-Salinas et al. 2006, Dick et al. 2003, Schaal & Olsen 2000 to solve problems among closely related species and lineages to check the geographic distribution of allele genealogies (maternal inheritance, polymorphisms across regions, PCR amplification) In search of new markers . . . 0.001 W26468ECU W26721ECU D26659ECU D25910COL D27337BOL AI D26259ECU D26498COL D26656COL D25981BOL Gene pool AI D26480ECU W26609ECU W25913PER (wild+domesticated ) W26606ECU W26348PER W26459EC U W26608ECU W26751AEC D25983BOL D25987BOL D25420PER Chuquisaca, Salta D25540ARG D26029PER D25909PER W26629HND MII W26632HND W26515COL W25816MEX W25272GTM W25233BLZ Gene pool MII W25222GTM W26530COL W25912GTM (mostly wild) W25273ASLV W25584ACRI W25911GTM W25385ACRI W26527COL W26628HND W26685ARG W26547PER W26404ARG W26749ARG W26508GTM W25294CCU W26309COL D25108BRA Minas Gerais, Ceará D26002BRA W25819COL MI W25230MEX D25295CUB D26164MEX D25289MEX W26535MEX W25704MEX D26211BRA D26744COL D26290ARG D26706COL W25228MEX D26302GTM D25285GTM D26109BRA W26704COL W25713AMEX D26044BRA D25717MEX W26631HND D25236ARG W26518MEX D25577PER W25851MEX D27289CUB (wild+domesticated) D26745COL D25410ECU Gene pool MI W26360MEX D25367SLV D25971MEX Formosa, Mato Grosso, Espirito Santo  "},{"text":"severe reduction of genetic diversity upon domestication :  few wild populations (one in W Mexico?) affected by the domestication process  potential of wild populations for future Lima bean breeding  Domestication event Andean (AI) Mesoamerican (MI) Average founder effect for cpDNA Population cpDNA Wild Domesticated Wild Domesticated ITS/5.8S Andean (AI) Wild Domesticated Mesoamerican (MI) Wild Domesticated Average founder effect for ITS/5.8S N = number of accessions analyzed; = nucleotide diversity; SD = standard deviation N  ±SD Founder effect (%) 7 0.00050±0.00011 48.00 14 0.00026±0.00022 11 0.00123±0.00037 91.87 19 0.00010±0.00008 69.94 6 0.00424±0.00119 75.00 13 0.00106±0.00034 7 0.00334±0.00098 75.75 24 0.00081±0.00031 75.34 Group configuration cpDNA ITS/5.8S AI vs. (MI+MII) Source of variation % Within groups 43.22 48.43 Between groups 56.78 51.57 Fixation indexes Φ ST 0.568** 0.516** G ST 0.141 0.090 N ST 0.643 0.549 Gene flow Nm 0.14 0.21 AI vs. MI vs. MII Source of variation % Within groups 35.37 29.70 Between groups 64.63 70.30 Fixation indexes Φ ST 0.646** 0.73** G ST 0.291 0.127 N ST 0.734 0.745 Gene flow Nm 0.09 0.09 MI vs. MII Source of variation % Within groups 40.39 23.72 Between groups 59.61 76.28 a Founder effect due to domestication Fixation indexes Φ ST 0.596** 0.763** Domestication event Andean (AI) Mesoamerican (MI) Average founder effect for cpDNA Population cpDNA Wild Domesticated Wild Domesticated ITS/5.8S Andean (AI) Wild Domesticated Mesoamerican (MI) Wild Domesticated Average founder effect for ITS/5.8S N = number of accessions analyzed; = nucleotide diversity; SD = standard deviation N  ±SD Founder effect (%) 7 0.00050±0.00011 48.00 14 0.00026±0.00022 11 0.00123±0.00037 91.87 19 0.00010±0.00008 69.94 6 0.00424±0.00119 75.00 13 0.00106±0.00034 7 0.00334±0.00098 75.75 24 0.00081±0.00031 75.34 Group configuration cpDNA ITS/5.8S AI vs. (MI+MII) Source of variation % Within groups 43.22 48.43 Between groups 56.78 51.57 Fixation indexes Φ ST 0.568** 0.516** G ST 0.141 0.090 N ST 0.643 0.549 Gene flow Nm 0.14 0.21 AI vs. MI vs. MII Source of variation % Within groups 35.37 29.70 Between groups 64.63 70.30 Fixation indexes Φ ST 0.646** 0.73** G ST 0.291 0.127 N ST 0.734 0.745 Gene flow Nm 0.09 0.09 MI vs. MII Source of variation % Within groups 40.39 23.72 Between groups 59.61 76.28 a Founder effect due to domestication Fixation indexes Φ ST 0.596** 0.763**  G ST 0.199 0.062 G ST0.1990.062  N ST 0.654 0.701 N ST0.6540.701 Gene flow Nm 0.13 0.11 Gene flowNm0.130.11  "}],"sieverID":"106b72e9-707d-4856-a96f-4b3c26c49142","abstract":"Archaeological remains of Phaseolus lunatus L. years before present Huacaloma,"}

data/part_4/0599f45bde52b44cc4d881c20698c677.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0599f45bde52b44cc4d881c20698c677","source":"gardian_index","url":"https://publications.iwmi.org/pdf/H042610.pdf"},"pageCount":19,"title":"Farm-Based Measures for Reducing Microbiological Health Risks for Consumers from Informal Wastewater-Irrigated Agriculture","keywords":[],"chapters":[{"head":"INTRODUCTION","index":1,"paragraphs":[{"index":1,"size":166,"text":"Wastewater-irrigated agriculture is increasingly becoming a common phenomenon, and more so with increasing global water scarcity. Wastewater irrigation creates both opportunities and problems. The opportunities of wastewater irrigation are that it provides convenient disposal of waste products and adds valuable plant nutrients and organic matter to soils and crops (van der Hoek et al., 2002). Wastewater also provides reliable irrigation water and supports urban food supply, especially with perishable crops, making it a source of livelihood for many farmers and produce traders. On the other hand, wastewater irrigation, especially with untreated wastewater, facilitates transmission of diseases from excreta-related pathogens and vectors, skin irritants and toxic chemicals like heavy metals and pesticides. Of most concern in developing countries are excreta-related pathogens and skin irritants (Blumenthal et al., 2000;van der Hoek et al., 2005). These risks affect the sustainability of wastewater irrigation and need to be addressed. This chapter focuses on risk reduction measures for excreta-related pathogens, i.e. microbiological health risks for consumers of increasingly popular salad greens."},{"index":2,"size":113,"text":"For many years, wastewater treatment was seen as the panacea for reducing health risks in wastewater-irrigated agriculture. The WHO, in its 2006 Guidelines for safe use of wastewater in agriculture, reviewed more than 20 studies on removal of various pathogens by different treatment processes (WHO, 2006). The studies show that biological processes, as they take place in pond systems, are especially effective in pathogen removal. Indeed, in many developed and middle-income countries, such as the USA, Tunisia, Spain, France, Israel and Jordan, wastewater is effectively treated before application to agricultural fields (Jiménez and Asano, 2008). In these countries, wastewater irrigation is formal, well regulated and controlled by well-established agencies (McCornick et al., 2004)."},{"index":3,"size":180,"text":"However, this is not the situation in most developing countries, which lack resources for effective wastewater treatment facilities; hence, large volumes of wastewater generated, especially in urban areas, remain untreated. Estimates show median levels of treated wastewater to be about 35 per cent in Asia, 14 per cent in Latin America and not even 1 per cent in sub-Saharan Africa (WHO, 2000). This treatment is often minimal or partial (primary level) and the effluent quality is poor. Therefore, in these countries, partially treated wastewater from the few existing treatment systems and large amounts of untreated wastewater are discharged into urban drainage systems and natural waterways, which farmers end up using on their farms. A recent survey suggests that wastewater without any significant treatment is used for irrigation purposes in and around four out of five cities in the developing world (Raschid-Sally and Jayakody, 2008). Hence, while source treatment of wastewater is important, implementing supplementary, or in the worst case alternative, on-farm measures appears, for the time being, to be a realistic approach to reduce health risks posed by wastewater irrigation."},{"index":4,"size":89,"text":"In the following sections some simple measures are described that have been tested on leafy vegetables such as lettuce and spring onions, which are commonly eaten raw as salad or part of urban fast food. Measures include the use of alternative sites for agricultural production, alternative water sources, different types of pond systems, low-cost filtration, improved ways of water fetching and application, and the choice of alternative crops. Examples refer in most cases to detailed studies in Ghana, supported by field studies in Burkina Faso, Senegal, Togo and India."}]},{"head":"ON-FARM WATER TREATMENT MEASURES","index":2,"paragraphs":[{"index":1,"size":71,"text":"The WHO (2006) describes measures for risk reduction outside conventional wastewater treatment facilities which might be called 'post-treatment' or 'nontreatment' options (see Chapter 2). The term 'non-treatment' suits measures such as drip irrigation but not those measures which transfer conventional treatment processes to the farm. Pond-based systems are an example as ponds alone or in combination can be of very different sizes (down to 2-4m 3 ), fitting even small farms."}]},{"head":"Pond-based systems","index":3,"paragraphs":[{"index":1,"size":109,"text":"Pond systems are widely used as simple biological wastewater treatment systems in many low-income countries as they are cheaper than most conventional systems. In ponds, helminth eggs and protozoa cysts are mainly removed by sedimentation (Sperling et al., 2004), while pathogenic bacteria and viruses are removed by a combination of various factors that create an unfavourable environment for their survival (Curtis et al., 1992). However, in drier climates evaporation can cause the salinity of the pond water to increase, which makes it less suitable for cultivation (Clemett and Ensink, 2006). In addition, pond systems can be important breeding sites for mosquitoes, which are vectors for a number of diseases."}]},{"head":"Waste storage and treatment reservoirs (WSTR)","index":4,"paragraphs":[{"index":1,"size":166,"text":"WSTR have traditionally been used as storage reservoirs for pre-treated wastewater from waste stabilization ponds (WSP) intended for irrigation use (Mara, 2004). During storage, further pathogen removal is achieved (Athyde-Junior et al., 2000;Cifuentes et al., 2000). Guidelines for designing WSTRs are detailed in Juanicó and Dor (1999) and Mara (2004). The use of a three batch-fed pond system (fill-restuse) has shown best results for pathogen removal (Mara et al., 1996). Sometimes called the 'Chinese three-tank' system, at any one time, one tank is being filled by the farmer, one is settling and the settled water from the third is being used for irrigation. It requires a one-day period of quiescent settling to remove almost all helminth eggs and achieve a 1-2 log reduction of other pathogens. In general, when WSTR are properly designed, operated and maintained, they can achieve a 2-4-log unit removal of viruses, a 3-6 log unit removal for bacteria pathogens and 100 per cent removal for helminth eggs (Juanicó and Milstein, 2004;WHO, 2006)."}]},{"head":"Simple on-farm sedimentation ponds","index":5,"paragraphs":[{"index":1,"size":95,"text":"In Ghana, as in many other countries in West Africa, shallow dugout ponds, which are usually about 1m deep and have a surface area between 2 and 6m 2 , are widely used at urban irrigated vegetable farming sites. In most cases, they are used as storage reservoirs that surface run-off and wastewater effluents are channelled into (Figure 10.1). Other variations include the use of mobile drums or concrete structures. Ponds are common in areas where irrigation water sources are far away. Farmers fill them manually or by pumping water from streams or tube wells."},{"index":2,"size":106,"text":"The key advantage of the ponds is the reduced walking distance, especially where watering cans are used. Depending on the size of the reservoir and irrigation frequency, refilling is done after one or several days. While the water is stored, sedimentation takes place and studies in Ghana showed that these ponds are very effective in removing helminths (reduced to less than one egg per litre) when sedimentation is allowed for two to three days. Removal of faecal coliforms in the same period was about 2 log units. In contrast to the reduction of worm eggs, the die-off of coliforms was only significant during the dry season."},{"index":3,"size":80,"text":"Digging a pond requires up to two man-days. With an additional plank to stand on (see below) the cost might be around US$20. The installation costs would be higher where concrete ponds are used as is common in other parts of West Africa (Figure 10.2). There are different measures possible that can enhance sedimentation in these ponds like using natural flocculants and means to optimize pathogen die-off. These measures could help further to lessen the pathogen load in these mini-ponds."}]},{"head":"Filtration techniques","index":6,"paragraphs":[{"index":1,"size":164,"text":"There is a wide range of filtration systems that can be used for treating irrigation water (Morel and Diener, 2006). For on-farm installation, sand-filters with slow application rates (slow sand-filters) are a possible option. However, sand should be of correct configuration i.e. effective size (ES) of 0.15-0.40mm and uniformity coefficient (UC) of 1.5-3.6 (Metcalf and Eddy, Inc., 1995). Sand-filters remove pathogenic micro-organisms from polluted water by first retaining them in the filtration media before they are eliminated (Stevic et al., 2004). Retention is achieved mainly through straining, in which larger micro-organisms (protozoans and helminths) are physically blocked as they move through the well-packed filter media, and adsorption, in which smaller ones like bacteria get attached to the filtration media. Elimination of pathogenic micro-organisms is achieved mainly by exposing them to unfavourable environmental conditions such as high temperature and also through predation by other organisms like protozoans. Similarly to manmade sand-filters, soils can act as natural bio-filters, especially if smaller textures (silt, clay) are dominant."},{"index":2,"size":343,"text":"The typical pathogen removal range reported by the WHO based on a review of several studies for slow sand-filters is 0-3 log units and 1-3 log units for bacteria and helminths respectively (WHO, 2006). Studies in Ghana using 0.5-1m deep columns filled with uniform sand of mean ES of 0.17mm and UC 3.6 achieved over 98 per cent of bacteria removal, equivalent to an average of 2 log units per 100ml, and 71-96 per cent of helminths were removed (Keraita et al., 2008b). This removal was significant but not adequate as irrigation water had very high initial levels of indicator organisms. For an urban vegetable farm of 0.1ha, a column sand-filter with a surface area of 0.4m 2 placed on a simple stand and with Farmers in West Africa also use other forms of infiltration systems. In Ouagadogou, Burkina Faso, wells are sunk next to wastewater canals, creating a hydraulic gradient which enables canal water to infiltrate the soil layer towards the well. In doing that, filtration takes place, leading to a reduction in micro-organisms and turbidity. Wastewater can also be allowed to pass through sand-filter trenches, sand embankments, column sand-filters and simple sandbags as farmers channel irrigation water to collection storage ponds. These types of filter will mostly affect protozoa and helminths. In Togo, Ghana and Senegal, farmers use different forms of sieves, but mostly folded mosquito nets on the watering-can intake hole to prevent particles like algae, waste and organic debris from entering the watering cans (Figure 10.3). In doing that, some pathogens adsorbed to organic matter are removed. Studies on this kind of simple filter system showed about 1 log unit removal for bacteria and 12-62 per cent for helminths when a normal nylon cloth material was used (Keraita et al., 2008b). Filtration materials can also be attached to irrigation equipment such as pumps. In all cases it is recommended to fine-tune the mesh size to find the best balance between easy water fetching and maximal debris filtration. As farmers are already used to these types of coarse filter systems "}]},{"head":"Use of irrigation infrastructure","index":7,"paragraphs":[{"index":1,"size":157,"text":"Irrigation infrastructure such as water reservoirs and weirs in irrigation canals can facilitate pathogen removal. Though not designed for this purpose, water-storage reservoirs can enhance sedimentation of helminths and bacterial die-off, especially in drier climates. Weirs, which are used for regulating irrigation water, act as traps for helminth eggs. A study done along the Musi river in Hyderabad, India, showed that irrigation infrastructure (mainly weirs, see Figure 10.4) can significantly improve water quality (Ensink et al., 2006). In the study, no helminth eggs were found 40km downstream from where 133 eggs/litre were reported at a point on the Musi river closest to the city. Corresponding E. coli levels showed a reduction by 5 log units from 7 log units per 100ml of water. Similar systems can be observed at micro-level where farmers block wastewater streams to create in-stream ponds (with overflow) for water fetching. In some instances, whole cascades of such barriers can be found (IWMI, 2008)."}]},{"head":"IMPROVED WATER FETCHING AND APPLICATION MEASURES","index":8,"paragraphs":[]},{"head":"Fetching of irrigation water","index":9,"paragraphs":[{"index":1,"size":207,"text":"In tests in Ghana, careful collection of irrigation water with a watering can, that did not disturb the sediment at the collection point in the stream or dugout, reduced helminth egg counts in irrigation water by 70 per cent. Most eggs settled on the first day of sedimentation. After three days without disturbance of the pond the average number of eggs in the pond water was less than one egg per litre (Keraita et al., 2008a). However, farmers in Ghana have to irrigate continuously due to high temperatures and use the dugouts regularly in the morning and afternoon on most sunny days without rain, thereby disturbing the water continuously. This could be avoided with a set of ('Chinese three-tank') dugouts as described above. Another option is the use of a wooden log across the pond to avoid entering the water (Figure 10.5). Water can also be fetched with a watering can connected to a rope, removing the need to step into the pond or stream (Figure 10.6). Deeper pond designs prevent the watering can from touching the sediment layer during water fetching (Drechsel et al., 2008). Investment costs are limited to labour (especially if a Chinese three-tank system is used) and the required behaviour-change during water fetching."},{"index":2,"size":73,"text":"Water from irrigation channels along the Musi River in India is pumped onto fields. The foot valve apparatus at the inlet pipe is usually heavy, which helps to keep the pipe in place under water. In many instances the pipe touches the sludge layer in the canal and sediments are sucked in, increasing the risk of metal and helminth egg contamination. U-shaped pump ends (Figure 10.7) could reduce this threat (Luque Ruiz, 2009). "}]},{"head":"Irrigation methods","index":10,"paragraphs":[{"index":1,"size":115,"text":"With regard to reducing crop contamination, good irrigation methods should minimize contact between the edible parts of the plant and contaminated irrigation water. Overhead irrigation methods such as sprinkler irrigation and watering cans have the highest potential to transfer pathogens to leafy vegetables as water is applied on edible parts and due to the wider movement of pathogens through aerosols (Pescod, 1992). Flood and furrow irrigation methods apply water on the surface and are less likely to contaminate high growing crops; but for low-lying crops and root crops contamination is still high. Localized techniques, such as drip irrigation, have minimal pathogen transfer to crop surfaces because water is directly applied to the roots (Pescod, 1992)."},{"index":2,"size":314,"text":"Several studies have been conducted on the effects of sprinkler, drip (both surface and subsurface) and furrow irrigation on crop contamination (Armon et al., 2002;Bastos and Mara, 1995;El Hamouri et al., 1996;Oron et al., 2001;Solomon et al., 2002). The studies show that drip irrigation results in comparatively lower contamination on crops than furrow and sprinkler irrigation. However, drip kits, as promoted in developed countries, are very expensive and prone to clogging as polluted water usually has high turbidity levels (Capra and Scicolone, 2007;Martijn and Redwood, 2005). Nevertheless, low-cost drip irrigation techniques like bucket drip kits (Figure 10.8) (sacks can also be used) have shown a high potential for use and adoption in low-income countries (Kay, 2001). Similar to more sophisticated kits, the low-cost types promoted, for example, by International Development Enterprises (IDE) in India can be tailored to local vegetable-bed sizes. Studies done in Ghana using bucket drip kits showed higher reduction in contamination (up to 6 log units) especially during the dry season (Keraita et al., 2007b) as compared to the often cited 2-4 log units (WHO, 2006). There are hardly any documented studies on traditional or modified traditional irrigation methods involving watering cans, buckets, subsurface clay pods or calabashes in relation to crop contamination. Studies in Ghana showed a great potential in reducing vegetable contamination by modifying the handling of watering cans to reduce splashing of contaminated soils on to the crops. Using a watering can with an outflow rose (a cap with holes in) and watering from a height <0.5m (Figure 10.9) reduced thermotolerant coliforms by 2.5 log units and helminths by 2.3 eggs per 100g of lettuce compared with using a watering can with no end cap, from a height >1m (Keraita et al., 2007a). The required changes are of very low cost, but further studies are needed to verify the effectiveness on different types of soil and crop cover."}]},{"head":"Scheduling of water application","index":11,"paragraphs":[{"index":1,"size":497,"text":"Timing of irrigation, including frequency, is not only important for pathogen reduction but also for reducing salinity. One of the most widely documented field water-management measures to reduce pathogens is cessation of irrigation, in which irrigation is stopped a few days before crops are harvested. This results in exposure to conditions that are unfavourable to pathogen growth including heat, desiccation and sunlight (Shuval et al., 1986). Studies have provided some ranges of potential survival times for pathogens on crops, soils and water in temperate and tropical climates (see Table 12.2, Chapter 12), along with identifying how environmental conditions influence pathogen survival (Feachem et al., 1983;Shuval et al., 1986;Yates et al., 1987). In short, pathogen inactivation on crops is more rapid in hot, sunny weather than in cool, cloudy or rainy conditions. WHO (2006) gives a pathogen die-off range of between 0.5 and 2 log units per day between final irrigation to consumption, while Fattal et al. ( 2004) use 3 log units in their risk-assessment models. In another study, it was revealed that when trickling filter effluent with 10 6 thermotolerant coliforms per 100ml was used to spray-irrigate lettuces, initial concentrations of indicator bacteria exceeded 10 5 thermotolerant coliforms per 100g fresh weight. Once irrigation ceased, no Salmonella could be detected after five days, and the levels of thermotolerant coliforms after 7-12 days were comparable to those detected on lettuces irrigated with freshwater (Vaz da Costa-Vargas et al., 1996). In Ghana, studies from field trials showed an average daily reduction of 0.65 log units of thermotolerant coliforms on lettuce (Keraita et al., 2007a). However, they also showed that cessation in hot climates has correspondingly high yield losses (1.4 tons/ha of fresh weight) that may make it harder for farmers to adopt the method. Indeed, in Accra or Kumasi, farmers irrigate lettuce preferably twice a day, while in the cooler Addis Ababa lettuce is irrigated thrice a week, which offers greater possibility for die-off. Enforcement of irrigation cessation in hot climates has raised reservations that some crops, especially leafy vegetables and salad crops, will lose their freshness and thereby their market value (Vaz da Costa-Vargas et al., 1996). It has been suggested that irrigation cessation should be used for fodder crops that do not have to be harvested at the peak of their freshness (Blumenthal et al., 2000). As much as 99 per cent elimination of detectable viruses has been reported after two days' exposure to sunlight, supporting regulations of a suitable time interval between irrigation and crop-handling or grazing time (Feigin et al., 1991). Enforcement can be difficult especially where vegetable farming is an informal activity and not regulated, as is the case in many low-income countries. In addition, in countries like Ghana, where farmers do not market the vegetables they produce but wait for vegetable traders to visit their fields and select the crops they like, special arrangements will have to be made with the traders for successful timing of the measure (Keraita et al., 2007a)."}]},{"head":"CROP SELECTION","index":12,"paragraphs":[{"index":1,"size":150,"text":"Some crops are more prone to contamination from pathogens than others. For example, crops with their edible parts more exposed to contaminated soils and irrigation water like low-growing leafy vegetables or root crops (e.g. carrots) will be more prone to pathogen contamination. The WHO, in its Guidelines for safe use of wastewater in agriculture, advises crop restrictions, especially for crops eaten raw (WHO, 2006). However, a shift in the type of crops planted is only feasible if the market value of the alternative crops is similar. Crop restrictions can be hard to implement if necessary conditions such as law enforcement, market pressure and demand for cleaner vegetables are not in place. So while there have been successful crop-restriction schemes in India, Mexico, Peru and Chile (Blumenthal et al., 2000;Buechler and Devi, 2003), this has not been possible in other countries where wastewater irrigation is informal, such as in sub-Saharan Africa."}]},{"head":"ALTERNATIVE FARMLAND AND/OR SAFER IRRIGATION WATER","index":13,"paragraphs":[{"index":1,"size":173,"text":"Wastewater use could be reduced if authorities have the possibility to provide farmers with safer irrigation water or an alternative location where water is not polluted. In Accra, Ghana, for example, groundwater was found at a convenient depth for treadle pumps, but the water was saline due to salt intrusion from the sea. In other cities, the groundwater level was in many sites too deep (more than 15m) to make borehole drilling an economic option for farmers. However, Ghana's Ministry of Food and Agriculture extended their national initiative to support small-scale irrigation and started borehole drilling on several urban farming sites. This risk-mitigation strategy was apparently successful in Benin where the city authorities of Cotonou and Seme-Kpodji and various national ministries agreed to allocate about 400ha of alternative farmland to urban farmers. The new site has shallow non-saline groundwater, which can easily be lifted by treadle pump for allseason irrigation. About 1000 farmers declared their interest to move to this periurban site despite its distance from the urban markets (Drechsel et al., 2006)."}]},{"head":"ENHANCING ADOPTION OF RISK-REDUCTION MEASURES","index":14,"paragraphs":[{"index":1,"size":89,"text":"Many initiatives to address wastewater irrigation-related health risks in lowincome countries remain at the risk-assessment level or pilot stage. To have the desired impact, recommended measures have to be integrated into routine farming practice. In this section, practical experience of some approaches is shared, drawing on several interlinked 'wastewater projects' conducted in Ghana between 2004 and 2009. The projects were supported by the Knowledge Sharing in Research project of the Consultative Group on International Agricultural Research (CGIAR). More details and lessons can be found in Chapters 16 and 17."}]},{"head":"Innovative knowledge sharing","index":15,"paragraphs":[{"index":1,"size":162,"text":"The project in Ghana encouraged and facilitated knowledge exchanges among farmers as well as between farmers and scientists. Research findings were synthesized according to the expressed wishes of the extension service to make them as userfriendly as possible. The materials illustrated safer irrigation practices and were translated into different regional languages. They included training media (radio and video) for extension offices and farmers as well as illustrated flip-charts/posters. In addition, the project prepared modules for farmer field schools, to actually demonstrate best practices. The module preparation was supported by the Food and Agriculture Organization (FAO) and involved farmers' representatives, extension officers from the Ministry of Food and Agriculture and communication experts. To enhance communication along the farm to fork pathway, all key stakeholders took part in so-called 'road shows', allowing them to follow the crops from the farm to the kitchen to observe and discuss sources of risks and options for risk reduction, and to understand the necessity of a multiple-barrier approach."}]},{"head":"Involving authorities","index":16,"paragraphs":[{"index":1,"size":142,"text":"Equally important is to involve local authorities and relevant government ministries from the initial stages. In Ghana, the project involved local authorities, the Ministry of Food and Agriculture, the private sector interested in food safety and other relevant agencies such as food-safety regulators. Some of them were involved as research partners, others coordinated training events which incorporated project results, and others were kept updated through policy briefs and participation in project meetings. The latter applies in particular to those agencies setting policies and regulations for wastewater reuse, and aids the institutionalization of safe practices. They also have a mandate to offer extension services to farmers. Dissemination of safe practices developed during the project will be done by the extension officials from the Ministry of Food and Agriculture. The target is to incorporate safer irrigation practices in the ministries' extension and training curricula."}]},{"head":"Linking with other projects","index":17,"paragraphs":[{"index":1,"size":121,"text":"Waste reuse projects should also be linked to other relevant projects or government projects with common goals. These could include government poverty-reduction programmes for the urban poor, initiatives for urban food security, nutritional programmes that emphasize consumption of green vegetables, health programmes and ongoing policy revisions. In Ghana, the project results influenced the Irrigation Policy launched in 2008 and the currently ongoing agricultural byelaw revision in the capital city, Accra. As wastewater use is just one of the routes by which excretarelated diseases are transmitted in poor communities, improved irrigation practices might not have much effect on the occurrence of intestinal infections when sanitation or hygiene remains unimproved. In such situations, linking vegetablewashing with a handwashing campaign might be very cost-effective."}]},{"head":"Incentives","index":18,"paragraphs":[{"index":1,"size":227,"text":"To enhance adoption of safer practices in waste reuse, farmers will need some form of incentive. This applies to most forms of behaviour-change, but in particular to situations where recommended practices involve increased inputs, such as personal labour. Studies have shown that people are more likely to adopt innovations if they get direct benefits for themselves rather than for the general population (Frewer et al., 1998). On this basis, incentives are even more important as the main beneficiaries are not the farmers but the consumers of their produce (exotic vegetables produced are for sale, not for farm household consumption). The most obvious incentive for farmers to adopt safe practices would be higher economic returns for safer vegetables. If a related market demand exists, producer groups could be encouraged to sell their products outside the existing marketing channels to avoid mixing-up safe and unsafe produce. This could be done by linking farmers directly to large unit consumers like hotels and designated selling-points of safe produce in markets and supermarkets or hotels. Other incentives could be institutional support from government institutions like the provision of extension services for training farmers, loans, awards and land-tenure security. Certification standards and labelling could be steps in the medium term. The media should be partners in these efforts to promote good practices and recognize progressive farmers. More details are presented in Chapter 16."}]},{"head":"CONCLUSIONS","index":19,"paragraphs":[{"index":1,"size":122,"text":"Farm-based measures can contribute to the reduction of health risks deriving for consumers from irrigated agriculture. These measures should play a complementary role to wastewater treatment and other post-harvest measures to comprehensively reduce risks associated with wastewater irrigation. Unfortunately, farm-based measures have not yet received the needed attention in research, perhaps due to the traditional focus on conventional wastewater treatment as the best solution for health protection. Although many principles of wastewater treatment could also be applied on farm, field-testing of these measures is scarce and their potential to reduce health risks is relatively unknown or not yet fully proven. There is an urgent need for scientists to work with farmers to adapt the technologies and improve their efficiency in pathogen removal."},{"index":2,"size":95,"text":"Assessments to provide evidence for health-risk reduction are also needed. These are particularly important and urgent in high-risk areas like urban vegetable farming in developing countries where farmers often have no other choice than using untreated wastewater for irrigation. A key challenge for the adoption of farm-based measures is that they require behaviour-change without obvious and direct benefit. This requires incentive systems which can range from supporting market demand to social marketing. It also requires that farmers are equipped with knowledge on health risks and can rely on institutional support, like from the extension service."},{"index":3,"size":85,"text":"The options of farm-based measures for health-risk reduction presented here are biased to experiences gained in West Africa. There, watering cans are extensively used in urban vegetable production while in other regions, such as Eastern Africa, topography favours gravity-flow and furrow or flood irrigation systems. Which measures fit (alone or in combination) a particular situation, will depend on local site characteristics and practices. Further studies are required to address other smallholder irrigation systems and crops to develop new measures or adapt the ones presented here."}]}],"figures":[{"text":"Figure 10 . 1 Figure 10.1 One of several dugout ponds farmers are using on informal urban vegetable farms in Kumasi, Ghana "},{"text":"Figure 10 . 2 Figure 10.2 Concrete reservoir used by smallholders in Lomé, Togo. Ponds are interconnected through tubes and filled with a pump from a tube well; at other locations, also from streams "},{"text":"Figure 10 . 3 Figure 10.3 Watering cans with mosquito mesh to avoid debris (Dakar, Senegal) "},{"text":"Figure 10 . 4 Figure 10.4 Weir in the Musi river, downstream of Hyderabad, Andhra Pradesh, India "},{"text":"Figure 10 . 7 Figure 10.7 Lifting pumps inflow valves out of the sediment of irrigation channels near Hyderabad, India "},{"text":"Figure 10 . 8 Figure 10.8 Simple drip irrigation kit made in India and tested in Ghana for lettuce. Adjustments are needed to increase the planting density "},{"text":"Figure 10 . 9 Figure 10.9 Holding the watering can at low height and using an outflow rose reduces splashing of already contaminated soil on the crop (Kumasi, Ghana) "},{"text":"  "}],"sieverID":"566f0f5e-ec90-4b00-94ec-bf8d563fd063","abstract":"This chapter presents farm-based measures that have been developed and tested in the informal irrigation sector to reduce microbiological health risks for consumers from wastewater irrigation of vegetables commonly eaten uncooked. The measures target poor smallholder farmers or farmer associations in developing countries as part of a multiple-barrier approach for health-risk reduction along the farm to fork pathway. Measures discussed include treatment of irrigation water using ponds, filters and wetland systems; water application techniques; irrigation scheduling; and crop selection. In addition, the chapter highlights some practical strategies to implement these measures, based largely on field experiences in Ghana. Although most measures discussed do not fully eliminate possible health risks, they can significantly complement other pathogen barriers. Which measures fit, either alone or in combination, will depend on local site characteristics and practices. Further studies are required to develop new measures or adapt them to other irrigation practices and systems in developing countries."}

data/part_4/05eddf0a63e2da1ea2ff17d2ebb3dce4.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05eddf0a63e2da1ea2ff17d2ebb3dce4","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/bb7f757c-a925-41c3-99e3-7986ed3c0dd7/retrieve"},"pageCount":1,"title":"Intercropping strategies under CA: Africa RISING science, innovations and technologies with scaling potential from ESA-Zambia","keywords":[],"chapters":[{"head":"Objectives and approach","index":1,"paragraphs":[{"index":1,"size":71,"text":"Farmers in eastern Zambia face production constraints due to declining soil fertility, degradation and the negative effects of climate variability and change. To sustainably increase productivity, a range of intercropping options were tested in maize-based conservation agriculture systems including grain legumes, green manures and agroforestry species. These were tested both on-farm and on-station in replicated trials across farms in Chipata and Lundazi and at the Msekera Research Station in Eastern Zambia."}]},{"head":"Key results","index":2,"paragraphs":[{"index":1,"size":55,"text":"Yield results across farms (n=264) with Gliricidia intercropping systems of different age (e.g. two and four years) on two contrasting soil types showed yield benefits of 66% between unfertilized Gliricidia-maize intercropping and an unfertilized control with sole maize (Figure 1, Picture 1). However, yield benefits were much greater between fertilized maize and the unfertilized control."},{"index":2,"size":39,"text":"Maize-lablab intercropping under no fertilization showed greater yield benefits than intercropping with pigeonpea (Figure 2). However this was only significant if the lablab planting was delayed by 3 weeks. Under fertilization there was no difference between treatments (Figure 2)"}]},{"head":"Significance and scaling potential","index":3,"paragraphs":[{"index":1,"size":41,"text":"Intercropping may provide cash constrained farmers an option to increase soil fertility without depending on mineral fertilizer only. In conservation agriculture systems, intercropping provides additional benefits (i.e. ground cover, weed control, additional income from intercrops, erosion control, increased nutrition amongst others)."},{"index":2,"size":33,"text":"Both COMACO and CRS have targeted large numbers of smallholder farmers with different intercropping strategies (>150,000 farmers) and the data generated by Africa RISING will provide the necessary evidence and support these attempts.  "}]}],"figures":[{"text":"Figure 2 :Figure 1 : Figure 2: Integration of green manure cover crops into farming systems, Eastern Zambia "}],"sieverID":"1f20e6b7-bc7c-4b00-b5ef-2dce984b15a8","abstract":"Thierfelder (CIMMYT), Geoff Heinrich (CRS), Dale Lewis (COMACO), Mulundu Mwila (ZARI) and Mateete Bekunda (IITA)"}

data/part_4/05f7c9d30e9725669b603d1153a64744.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05f7c9d30e9725669b603d1153a64744","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5fb3839f-ba18-422d-887c-705273375b68/retrieve"},"pageCount":1,"title":"EzyAgric app for the Uganda Pig Value Chain","keywords":[],"chapters":[{"head":"Partners","index":1,"paragraphs":[]},{"head":"Lessons and significance","index":2,"paragraphs":[{"index":1,"size":9,"text":"• Akorion now active in the pig value chain"},{"index":2,"size":16,"text":"• Farmers appreciate the value of proper record keeping that will also be enhanced through digitalization"},{"index":3,"size":16,"text":"• There is high demand of AI services amongst the farmers to improve on their breeds"},{"index":4,"size":13,"text":"• Through the App the farmers can easily access inputs and extension services."}]},{"head":"Paul Kawuki Tendo and Churchill Nokrach","index":3,"paragraphs":[{"index":1,"size":7,"text":"Akorion Company Ltd [email protected] [email protected] [email protected] [email protected]"}]},{"head":"UGANDA MORE PORK PROJECT","index":4,"paragraphs":[{"index":1,"size":16,"text":"This document is licensed for use under the Creative Commons Attribution 4.0 International Licence. October 2021"}]},{"head":"Project intervention: PigSmart Uganda platformC hallenge","index":5,"paragraphs":[{"index":1,"size":17,"text":"• Lack of access to quality, certified inputs and services by pig farmers exposing them to exploitation"},{"index":2,"size":22,"text":"• Lack of access to advisory messaging on piggery including on the right inputs and services, and best-bet practices to optimize production"},{"index":3,"size":12,"text":"• Lack of access to competitive market prices for their pigs due"}]},{"head":"Our approach","index":6,"paragraphs":[{"index":1,"size":29,"text":"• Training of Extension workers or Village Agent (VAs) to use the EzyAgric App to aggregate inputs making them affordable. Use of commission for sales makes the model sustainable"},{"index":2,"size":13,"text":"• Training of the farmers, and using digital advisory messaging on the App"},{"index":3,"size":26,"text":"• Through the agroshop, we provide genuine farm inputs such as drugs, equipment from authorized suppliers on both Ezyagricfarmer app or through our trained Village agents"},{"index":4,"size":53,"text":"• Through the digital upgrade on farming through the Ezyagric app we interlink farmers to market centers at all stages of production.ie breeders who sell 1month old piglets get customers and those that do fattening for pork production get linked buyers through our app system therefore market linkage is covered on both ends"}]}],"figures":[{"text":"• Digitalization of the Piggery value chain in the App • Selection and training of VAs on farmer profiling and monitoring • Digital messaging on the Eazy Agric App The CGIAR Research Program on Livestock thanks all donors & organizations which globally support its work through their contributions to the CGIAR Trust Fund. cgiar.org/funders "}],"sieverID":"d630f56d-0f04-458d-b649-05204dd78457","abstract":""}

data/part_4/063688ed3706c4e8db35d30d86af196e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"063688ed3706c4e8db35d30d86af196e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/19a4d478-1b06-401a-a784-4e01f744172e/retrieve"},"pageCount":27,"title":"Eco Health -One Health","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":5,"text":"One Health Commission (http://www.onehealthcommission.org/ )"},{"index":2,"size":29,"text":"• The One Health concept is a worldwide strategy for expanding interdisciplinary collaborations and communications in all aspects of health care for humans and animals. One Health Initiative (http://onehealthinitiative.com/)"},{"index":3,"size":3,"text":"Broader thinking -OneHealth"},{"index":4,"size":4,"text":"Eco Health -One Health"},{"index":5,"size":33,"text":"• Ecosystem approaches to public health issues acknowledge the complex, systemic nature of public health and environmental issues, and the inadequacy of conventional methodologies for dealing with them. David Walter-Toews, University of Guelph"},{"index":6,"size":45,"text":"• The Ecohealth approach focuses above all on the place of human beings within their environment. It recognizes that there are inextricable links between humans and their biophysical, social, and economic environments, and that these links are reflected in a population's state of health.   Step-by-Step "}]}],"figures":[{"text":" at Chiang Mai University Other IDRC initiatives in SE Asia :APEIR; BECA; EcoEID; FBLI Ecosystem Approaches to the Better Management of Zoonotic Emerging Infectious Diseases in the Southeast Asia Region "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "}],"sieverID":"17846f0c-7988-4dce-8e6f-af47fda8c7a7","abstract":""}

data/part_4/063b2a2e6538b34a30c0ff0bb30c2c16.json

@@ -0,0 +1 @@
+{"metadata":{"id":"063b2a2e6538b34a30c0ff0bb30c2c16","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/dbb76a52-cada-4d5c-b8df-22d541361041/retrieve"},"pageCount":4,"title":"UFT UFT 74 75","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":160,"text":"generation bio-fuel technologies to upgrade lignocellulosic biomass for animal feeding by increasing the accessibility of sugars in plant cell walls. Key processes (see also Fig. 1) in 2 nd generation biofuel that matter for livestock feed resources are: 1) post harvest collection and mechanical pre-treatment of lignocellulosic biomass; 2) physical-chemical-biological pre-treatment to disrupt lignin-hemicelluloses-cellulose matrices, partially hydrolyze weaker linkages of pentoses in hemicelluloses structure and make hexoses in cellulose more susceptible to enzymatic hydrolysis; and 3) design and application of targeted and tailored enzyme cocktails. For animal nutritionist pre-treatment technologies up to the generation of glucose (or equivalents) are interesting, from here on rumen microbes and mammalian enzymes can take over (see also dotted line in Fig. 1). The current paper explores the impact of three 2 nd generation biofuel technologies on the fodder quality of a wide range of Indian cereal straws and stovers: 1) Steam treatment, 2) Ammonia Fiber Expansion (AFEX); and 3) NaOH-H 2 O 2 treatment."}]},{"head":"•","index":2,"paragraphs":[{"index":1,"size":80,"text":"Efficient harvest and collection of high volume-low density Steam explosion is a promising pre-treatment potentially effective without pH interventions if partially hydrolyzed hemicelluloses are recovered. In the case of steam treatments application to upgrading lignocellulosic biomass for feeding preceded use in 2 nd generation bio-fuel technologies for example treating wood to feed to ruminants (Bender et al., 1970). However, opportunities from steam explosion appear to increase with the exploration of its use as pre-treatments in 2 nd generation bio-fuel technologies,"}]},{"head":"Introduction","index":3,"paragraphs":[{"index":1,"size":206,"text":"Lignocellulosic biomass from forest, agricultural wastes and crop residues is the most abundant renewable biomass on earth with a total annual production of about 10 -50 billion metric tons (Sanchez and Cardena, 2008). Cellulose is the major constituent in lignocellulosic biomass ranging from about 300 to 550 g/kg followed by hemicelluloses which constitutes about 150 to 350 g/kg and lignin which constitutes about 60 to 300 g/kg (Ivetic and Antov, 2013). Cellulose is a linear polymer of cellobiose which itself is made up of a glucose to glucose dimer in the β 1-4 glucan configuration. This β 1-4 glucan configuration conveys molecular stability to cellulose when compared to starch, a glucose to glucose dimer in the α 1-4 glucan configuration (Van Soest, 1994). Thus lignocellulosic biomass is, in its essence, not that different from the primary products of cereals, the starch in grains, even though their respective accessibility to mammalian digestive enzymes is very different (Van Soest, 1994). Considering the huge quantities of lignocellulosic biomass available and the high nutritive quality of their hexose and pentose sugars, it comes as no surprise that attempts to upgrade lignocellulosic biomass for livestock fodder reach back to the beginning of the 20 th century (Fingerling and Schmidt, 1919;Beckmann, 1921)."},{"index":2,"size":446,"text":"The work on second generation bio-fuels (bio-fuels derived from lignocellulosic biomass) was motivated by reasons very similar to those of the early animal nutritionists: the abundance of lignocellulosic biomass and its content of basic sugars. The work on 2 nd generation bio-fuels (bio-fuels based on lignocellulosic biomass rather than on grains as in 1 st generation biofuel) has attracted US multi-billion dollars of investment during the last two decades (Blümmel et al., 2014a). It may be feasible to utilize spin-offs from 2 nd estimated based on in vitro gas production generally agreed with gravimetric estimates based on undigested residues, making it unlikely that the effect of AFEX treatment on digestibility was overestimated by unrecovered soluble but un-fermentable substrate. Details of this work have been reported by Blümmel et al. (2018). In a collaboration between ILRI, IICT and the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) 4 pearl millets stovers (Hybrid KH 16, ICMV 05555, ICMV 05777, ICMV 15111), three sorghum stover (ICSV 25333, ICSV 25335, IS 27246), two maize stover (9125, NK 6240) and two non-descript wheat straws (New Delhi fodder market, Uttrakhand farmer field) were treated. The treated stovers and straws had high water content ranging approximately fom 40 to 80%. Washing further increased the water content to consistently above 80%. Organic matter content was consistently lower in treated than in untreated material suggesting residual NaOH from treatment. Organic matter content was higher in treated and washed than in treated material suggesting that washing removed residual NaOH. Nitrogen content significantly decreased with treatment and washing becoming almost complexly removed in treated and washed material. The cell wall components NDF, ADF and ADL were differently affected by the treatments. Neutral detergent fiber recovery significantly decreased in treated material by 5.8 percent units but was increased by washing relative to untreated material by 11.5 percent units. Acid detergent fibre recovery was significantly increased by 6.2% units by washing and by 18.3% units by the washing of treated material. Acid detergent lignin recovery was approximately halved by the treatments. Treatment increased all in vitro fermentation, digestibility and ME measurements. In vitro gas volumes measured after 24 h and 48 h of incubations were more than 100 and 68%, respectively, higher in treated than in untreated material. In vitro apparent digestibility after 24 h and in vitro true digestibility after 48 h were 58 and 68%, respectively, higher in treated compared to untreated material. Metablizable energy was improved by 64% by the treatment. Washing of treated material had only a significant effect on gas volumes measured after 48 h of incubation otherwise there was no significant difference between treated and treated and washed material in invitro variables."}]},{"head":"(d) Comparison of effectiveness of steam, AFEX and NaOH-H 2 O 2 treatment on in vitro measurements and influence of baseline straw and stover quality","index":4,"paragraphs":[{"index":1,"size":202,"text":"Increases in in vitro GP and true IVOMD measured after 48 h of incubation were greatest upon NaOH-H 2 O 2 treatment followed by AFEX and finally steam treatment (Table 1). particularly when partially hydrolyzed hemicelluloses is not separated from the solid phase and no chemicals are used. In a collaboration between the International Livestock Research Institute (ILRI) and Nagarjuna R&D maize stover from a superior dual purpose hybrid, a superior dual purpose sorghum variety andtwo sorghum stovers purchased from fodder market were steam-treated using intermittent live steam injection to heat stovers to 160°C for 10 minutes. After 10 min the stovers were exploded into a receiver tank. After drying steam treated samples and untreated control samples were ground to pass a 1 mm mesh. Two hundred mg of substrate was weighted into glass syringesof the Hohenheim gas production test and gas volume and in vitro true degradability were determined after 48 h of incubation.After 48 h of incubation, steam treatment on average increased in vitro gas production significantly by 10% and in vitro trueorganic matter degradability by 14% or 8.9 percentage units (71.8 vs. 62.9%), respectively (see also Table 1).Details of this work have been reported by Dhanalakshmi et al. (2015)."}]},{"head":"(b) Ammonia Fiber Expansion (AFEX) technology developed by the Michigan Biotechnology Institute (MBI)","index":5,"paragraphs":[{"index":1,"size":324,"text":"This technique was developed by Dale and Weaver (2000). During AFEX treatment, ammonia vapor is added to the biomass under moderate pressure (100 to 400 psi) and temperature (70 to 200°C) before rapidly releasing the pressure and recovering more than 95% of the ammonia used in the process. About 2% of the ammonia that is not recovered in the process is chemically bound to the biomass, contributing to the crude protein content of the treated samples (Campbell et al., 2013). In a collaboration between ILRI and MBI 10 cereal straws and stovers from India consisting of two rice straws (cultivar names: Aditya and Vardhan), three sorghum stovers (cultivar names: CSV-22, ICGV 93046 and Zaheerabad), one wheat straw (nondescript purchased from a fodder market), two pearl millet stovers (cultivar names 86M88 and HHB-67) and two maize stovers (cultivar names: NK 6240 and 9125). Except for wheat, each crop straw and stover were chosen to include cultivars with higher and lower in vitro digestibility (IVOMD) and metabolizable energy (ME) content. AFEX treatment increased recovery of glucose between 60 and 85% and of xylose between 50 and 85% of their theoretical yields. AFEX treatment increased average crude protein (CP) by 260% (CP content: 62 vs. 161 g/kg). Cell wall content as estimated by NDF decreased on average by 47 g/kg (NDF: 656 vs 609 g/kg) while cellulose contents estimated as ADF apparently increased by 23 g/kg (ADF: 443vs 466 g/kg). Lignin contents estimated as ADL did not significantly differ between untreated and treated material. Measured after 24 h of incubation, AFEX treatment consistently and significantly increased in vitro gas production (39.8 vs 29.0 mL/200 mg), in vitro apparent digestibility (63.0 vs 49.3%) and true digestibility (77.0 vs. 60.2%) and in vitrometabolizable energy content (8.6 vs 6.9 MJ/kg). Measured after 48 h of incubation, AFEX treatment increased in vitro gas production from 42.9 to 51.5 mL and in vitrotrue digestibility from 65.1 to 84.4%). Treatment changes in digestibility"}]},{"head":"Cost-benefit estimates of 2 nd generation biofuel technologies for upgrading ligno cellulosic biomass as feed","index":6,"paragraphs":[{"index":1,"size":178,"text":"The kind of straws and stovers investigated for this work are widely traded for urban and peri-urban dairy production in India. An interesting feature of this fodder markets is that price premiums exist for quality differences between straws and stovers from the same crop traded at the same time and place for example because of perceived cultivar or management differences (Blϋmmel and Rao, 2006;Teufel et al., 2010). Fig. 3 and 4 summarize data from ILRI sorghum fodder market surveys over the past 5 years in Hyderabad in India focusing on the two sorghum stovers most widely traded: Andhra (a higher quality stover) and Telangana (a lower quality stover).The average cost of the higher and lower quality stover per kg (dry matter) were 9.8 (16 cents US) and 7.5 (12 cents US) Rs, respectively ( Fig. 3).The average (apparent) IVOMD was 44.7 and 40.3% in the higher and lower quality stover, respectively, see Figure 4. In other words and average difference in (apparent) IVOMD of 4.4 percentage units was associated with a price difference of Rs.2.3/kg (4 cents US)."},{"index":2,"size":113,"text":"The costs of AFEX treatment in India are estimated at 3 to 5 Rs./ kg of stover (Bringi, personal communication) which is currently equivalent to about 5 to 8 cents US. AFEX treatment increased the (apparent) IVOMD of sorghum stover on average by 14.5 percentage units (calculated from Blümmel et al., 2018) By extrapolation this would be equivalent to a value increase of 7.6 Rs/kg (14.5/4.4 times 2.3). Assuming the average cost of AFEX treatment to be 4 Rs/kg, the cross cost: benefit ratio from AFEX treatment of sorghum stover would be about 1: 2. Similar calculation are now under way to calculate cost-benefits from steam and NaOH -H 2 O 2 treatments."},{"index":3,"size":80,"text":"Considering the huge quantities of lignocellulosic biomass available and the high nutritive quality of their hexose and pentose sugars, it comes as no surprise that attempts to upgrade lignocellulosic biomass for livestock fodder reach back to the beginning of the 20 th century (Fingerling and Schmidt, 1919;Beckmann, 1921). These and later The average difference between true and apparent IVOMD is about 12.9 percentage units (van Soest, 1994). Increments in digestibility are similar independent of expression as apparent or true digestibility."},{"index":4,"size":629,"text":"NaOH-H 2 O 2 treatment on average increased true IVOMD by 38.2 percentage units from 55.9 in untreated straws and stovers to 94.1% after treatment. Such an increase is amazing and converts the straws and stovers in essence into concentrate feeds. The true IVOMD measurement is gravimetric in nature and calculated from the truly undegraded residue; all substrate not recovered is supposed to have been digested. This might not always be the case particularly in treated feed stuffs where some undigestible substrate might have been solubilized and so not recovered in the incubation residue (Blümmel et al., 2005). However, the increase in true IVOMD of 68% agrees with the average increase in vitro GP of 66% (66.7 vs 39.7 mL) and GP reflects generation of fermentation products and is so not gravimetric in nature. Put differently, the increases in straws and stover quality seem to be real. In AFEX and NaOH-H 2 O 2 treatments increments in true IVOMD were significantly inversely correlated to the true IVOMD of un-treated straws and stovers (Figure 2). In other words, higher quality straws and stover benefit less from treatment than lower quality ones. It is important to realize that upon AFEX and NaOH-H 2 O 2 treatments true IVOMD's approached 100%, an absolute ceiling that constraints increments in true IVOMD. A practical conclusion appears to be that baseline IVOMD does not really matter when very effective treatments are applied. Sundstol and Coxworth (1984) and Owen and Jayasuriya (1989). It is important to point out that these findings, as promising as they are, need to be corroborated and supported by animal experimentation to confirm that 1) voluntary feed intake is not negatively affected but corresponds to improved in vitro digestibility and 2) treatmentsare safe for the animal and the produced milk and meat are safe for human consumption. We also want to stress that the three pre-treatments explored are not exhaustive and other potentially useful spin-off technology from 2 nd generation biofuel are out there and need to be investigated. Animal nutritionist can and should leverage from these multi-billion investments into 2 nd generation biofuel in collaboration with the private sector. Small and medium enterprises using applying these spin-off technologies would: 1) very significantly increase fodder quality of crop residues thereby increasing livestock productivity at decrease feed costs; and 2) generate employment and income opportunities for rural population; and 3) decreasing environmental hazards from regional burning of crop residues (mainly rice straw) in parts of South and South East Asia. attempts included chemical, physical and biological treatments, but chemical treatments received maximum attention of researchers, particularly the use of hydrolytic agents such as NaOH and NH 4 for ensilaging (Jackson, 1977;Sundstol and Coxworth, 1984;Owen and Jayasuriya, 1989). However, comparative little uptake of these technologies was observed, even though considerable efforts were expanded by the international research community and development practitioners. For example, Owen and Jayasuriya (1989) listed and reviewed 12 major international conferences addressing the improved use of lignocellulosic biomass for livestock feed from 1981 to 1988 and concluded that large scale adoption of treatment interventions was very rare and did not continue once project activities ceased, despite the many efforts expended on simplifying treatment technologies and use of locally available materials and inputs. This is unfortunate since crop residues are the major feed resources for livestock in low and middle income countries (LMCs) and for example in India comprise about 70% of the feed resources (NIANP, 2012;Blümmel et al., 2014b). Even in specialized and commercialized urban and peri-urban dairy systems crop residues usually contribute more than 50% of the feed resources explaining their intensive trading. The work presented in this paper suggests that some spin-off technologies from 2 nd generation biofuel offer real possibilities for significantly upgrading ligno-cellulose biomass for livestock feed."},{"index":5,"size":297,"text":"As shown by Vogel and Sleper (1994), differences of 3 to 5 percentage units (30 to 50 g/kg) in forage digestibility were associated with 17 to 24% differences in livestock productivity. Surveying commercial sorghum stover fodder traders in India, Blϋmmel and Rao (2006) observed that a mean difference of 5% units (47 to 52% or 50 g/kg) in in vitro stover digestibility was associated with price premiums of 25% and higher. Anandan et al. (2010) collaborated with Miracle Feed andFodder Pvt Ltd (Shah, 2007) that commercially produced total mixed rations (TMR) consisting of about 50% of sorghum stover to assess differences 5 percentage units in digestibility in the basal sorghum stover. Milk potential was more than 5.5 and 7 kg/d higher in dairy buffalo and dairy cattle, respectively when offered TMR with higher quality sorghum compared to TMR with lower quality sorghum stover, this as a result of higher quality TMR and higher voluntary feed intake (Anandan et al., 2010). Thus intuitively small differences (i.e. 50 g/kg or 5 percentage units in digestibility) of basal diets can have significant effects on livestock productivity and also explain the price premiums paid at crop residue fodder markets (Fig. 3 and 4).The findings presented in Table 1 need to be seen in this light. Increments in true IVOMD upon steam, AFEX and NaOH-H 2 O 2 were 8.9, 19.3 and 38.2 percentage units, respectively (Table 1). Particularly AFEX and NaOH-H 2 O 2 treatment will have potentially very significant impact on fodder quality of cereal straws and stovers, in effect turning cereal crop residues into concentrates and feed resource boundaries between ruminants and monogastric animals could largely dissolve. These improvements are far superior to the ensilage methods based on pH change by NaOH and NH 4 reviewed by Jackson (1977);"}]}],"figures":[{"text":"Table 1 . Summary of effects of steam, ammonia fiber expansion and NaOH-H 2 O 2 treatment on in vitro gas production (GP) and true in vitro digestibility -1 after 48 h of incubation. U = untreated; T = Treated Spin-off technology n In vitro GP after 48 h (mL/200 mg) True IVOMD after 48 h (%)    U T U U UTUU Steam Treatment 4 48.6 53.6 62.9 71.8 Steam Treatment448.653.662.971.8 AFEX Treatment 10 42.9 51.5 65.1 84.4 AFEX Treatment1042.951.565.184.4 NaOH-H 2 O 2 Treatment 11 39.7 66.7 55.9 94.1 NaOH-H 2 O 2 Treatment1139.766.755.994.1 -1      -1  "}],"sieverID":"ae4ef7e7-7616-471d-b755-d0aba089e66a","abstract":""}

data/part_4/066db4ec88235fd7a5a7fdf2063153a8.json

@@ -0,0 +1 @@
+{"metadata":{"id":"066db4ec88235fd7a5a7fdf2063153a8","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/2098d14f-81c7-4984-87b1-9f7cf9816f13/retrieve"},"pageCount":15,"title":"Mapeo exploratorio de la red de actores trabajando en \"soluciones positivas para la naturaleza\" a nivel local en las regiones andinas y caribe de Colombia","keywords":[],"chapters":[{"head":"Figuras","index":1,"paragraphs":[]},{"head":"Resumen","index":2,"paragraphs":[{"index":1,"size":210,"text":"Conservar la biodiversidad de Colombia al tiempo que se producen los alimentos necesarios para la población es una tarea del desarrollo sostenible y que en los últimos años es promovida por los gobiernos e instituciones públicas y privadas. Sin embargo, la falta de información y comunicación entre los agricultores podría restringir la extensión de las innovaciones implementadas. En este estudio se usó el método de redes sociales para mapear los actores que trabajan en innovaciones y prácticas relacionadas con la iniciativa Soluciones positivas para la naturaleza del CGIAR. Se entrevistaron 38 actores en ocho departamentos en las regiones andina y caribe de Colombia. Se identificó como principales grupos de actores de la red a instituciones de enseñanza e investigación, organización de productores, agricultores individuales e instituciones gubernamentales. Las actividades de colaboración mencionadas fueron asistencia técnica, producción, educación e investigación. Se puede caracterizar esta red de actores como joven con pocas conexiones -91 relaciones-entre actores, debido a que la iniciativa es un movimiento reciente, lo que dificulta el flujo de información sobre las innovaciones. Se requiere desarrollar más acciones para favorecer la vinculación entre los actores para la implementación sostenible de soluciones positivas para la naturaleza.. Palabras clave: red de actores, regiones andina y caribe, vinculación, soluciones positivas y desarrollo sostenible."},{"index":2,"size":25,"text":"Mapeo exploratorio de la red de actores trabajando en \"soluciones positivas para la naturaleza\" a nivel local en las regiones andinas y caribe de Colombia"}]},{"head":"Introducción","index":3,"paragraphs":[{"index":1,"size":278,"text":"Colombia es un país megadiverso, ocupa el tercer lugar entre los países con mayor biodiversidad del planeta, con más de 75, 000 especies registradas (SiB Colombia, 2020). Además tiene un gran potencial agrícola por su riqueza en agrobiodiversidad cultivada -95 especies -y silvestre -185 especies -en 25 de los 32 departamentos, concentrada en los Andes y la región Pacífico (González-Orozco et al., 2021). Sin embargo, los ecosistemas de Colombia se encuentran amenazados por la deforestación, debido al desplazamiento de la zona forestal causada por el crecimiento demográfico -1.4% anual -, la agricultura -4.6 millones de hectáreas -y ganadería extensiva -con poco más de 39.0 millones de hectáreas que corresponden al 27% de la superficie de Colombia -(DANE, 2019). En este contexto agropecuario, Colombia produce alrededor de 28.5 millones de toneladas de alimento, pero se produce una gran cantidad de desechos, que incluye el desperdicio de más del 30% de los alimentos producidos (DNP, 2016), junto con los residuos de cultivos, animales y el agua, los cuales podrían reciclarse en lugar de desperdiciarse. Para resolver estos desafíos que enfrentan los sistemas agroalimentarios, se ha buscado implementar enfoques sistémicos que integren y sustenten los medios de vida y la producción de alimentos, pero también que conserven o rehabiliten ecosistemas naturales y mejorar los procesos naturales en ecosistemas modificados. La transformación del sistema agroalimentario implica conciliar la necesidad de satisfacer la demanda de producción de alimentos para una población creciente al tiempo que se conserva la biodiversidad, gestionando de manera sostenible los recursos naturales. Aprovechar de forma sostenible los recursos en la agricultura sin alterar los ecosistemas, permitirá contribuir de forma sostenible con la productividad y rentabilidad de los sistemas agrícolas."},{"index":2,"size":191,"text":"Durante la Cumbre de las Naciones Unidas sobre Sistemas Alimentarios de 2021, se ha reconocido la \"\"producción positiva para la naturaleza\" como uno de los cinco caminos críticos hacia sistemas alimentarios sostenibles. Este enfoque que fue introducido recientemente busca \"fomentar sistemas alimentarios positivos para la naturaleza y se identifica por un uso regenerativo, no agotador y no destructivo de los recursos naturales, basada en la gestión del medioambiente y biodiversidad como base de los servicios ecosistémicos. Además de cubrir la creciente demanda de alimentos de manera suficiente e incluyen una nutrición sostenible y saludable\" (Hodson et al., 2021). De acuerdo con estos autores, las soluciones positivas para la naturaleza consideran tres pilares. El primer pilar incluye la protección de los sistemas naturales y las áreas protegidas de nuevas conversiones para la producción de alimentos y ahorrar y reservar parte de la tierra y el agua para devolverla a la naturaleza. El segundo pilar trata del manejo sostenible de los sistemas de producción de alimentos existentes, mientras que el tercer pilar se enfoca en la restauración y la rehabilitación de los sistemas degradados para la producción sostenible de alimentos y servicios ecosistémicos."},{"index":3,"size":251,"text":"Aunque, el concepto de \"soluciones positivas para la naturaleza\" es reciente, muchos actores han trabajado en innovaciones y prácticas que permiten conservar la biodiversidad, el agua y el suelo, un manejo sostenibles de estos recursos y la restauración de ecosistemas degradados. Sin embargo, existe poca información sobre estos actores, cómo se interrelacionan e intercambian información. La innovación agrícola -conocimientos, prácticas y tecnologías aplicados en la cadena de valor de los sistemas agrícolases fundamental en el desarrollo sostenible (Pomareda, C., & Hartwich, 2006), pero la falta de información y comunicación entre los agricultores podría restringir la extensión de las innovaciones (FOLU, 2022). El mapeo y análisis de redes sociales es una herramienta de diagnóstico para realizar una línea base que ayude a entender los procesos de innovación en el territorio de impacto de forma que se establezcan intervenciones planificadas más estratégicas y eficientes en el uso de recursos (Clark, 2006). Una red se conforma por los actores -personas, empresas e instituciones-y las relaciones que existen entre ellos en cierto contexto social y territorial, sobre el intercambio de información y conocimientos con el fin de obtener un beneficio individual o colectivo a través de la innovación (Rendón et al., 2007). Entonces hacer un mapeo de redes también proporcionará elementos de acción para fortalecer los vínculos entre los actores clave, permitiendo un mayor empoderamiento de los agricultores para obtener información y contar con el conocimiento apropiado para adaptar las innovaciones tecnológicas asociadas a soluciones positivas con la naturaleza en los contextos locales de producción."},{"index":4,"size":103,"text":"En Colombia durante 2023 se colecto información para mapear la red de actores involucrados en actividades relacionadas con soluciones positivas para la naturaleza que mejoren la productividad y la resiliencia de los sistemas agrícolas salvaguardando el medio ambiente. El objetivo fue usar la herramienta de análisis de redes sociales para mapear e identificar los tipos de actores -personas, empresas e instituciones -, sus características y entender sus vínculos en el territorio para proporcionar elementos de acción que promuevan el desarrollo individual y colectivo a través de las innovaciones relacionadas con la conservación de las semillas nativas y soluciones agronómicas positivas con la naturaleza."}]},{"head":"Metodología","index":4,"paragraphs":[{"index":1,"size":63,"text":"El territorio de la colecta de información fueron los departamentos de Valle de Cauca, Nariño, Antioquia, Bolívar, Cauca, Cundinamarca, Quindío y Risaralda, correspondientes a las regiones Andinas y Caribe (DANE, 2012), las cuales son importantes por su alta diversidad en variedades nativas de maíz (Swissaid y Grupo Semillas, 2013), confiriéndoles ser centro de atención para el resguardo, manejo y conservación de estas poblaciones."},{"index":2,"size":138,"text":"Durante 2023 se hicieron entrevistas semiestructuradascon énfasis en organizaciones -para identificar alianzas que podrían tener influencia en los grupos de conservación de semillas nativas con base en soluciones positivas para la naturaleza que facilitara el entendimiento de la gestión de innovación en la red de actores. Para esto se implementó la metodología de redes de innovación de Clark, 2006y Rendón et. al, 2007. Primero se entrevistaron a 38 actores que identificamos trabajan en soluciones/innovaciones/prácticas positivas para la naturaleza (conservación de la biodiversidad -semillas, árboles, animales…-, conservación de agua, conservación de suelo -terrazas, camellones…-, manejo agroecológico de plagas, abonos orgánicos -composta, lixiviados y humus de lombriz, otros biofertilizantes-, economía circular, rotación de cultivos, cultivos intercalados, cultivos de cobertura, cero labranza, barreras naturales, variedades adecuadas, diversidad funcional, tecnologías herméticas para almacenamiento de granos, uso de plantas para almacenamiento de granos)."},{"index":3,"size":112,"text":"El método de muestreo que se uso fue bola de nieve para colectar la información de entrevistas (Wasserman and Faust, 1994). La información colectada se derivó de preguntas como: ¿Con quién te relacionas para actividades concernientes con soluciones positivas para la naturaleza?, ¿Qué actividades o prácticas relacionadas con soluciones positivas para la naturaleza realizan juntos?, ¿Desde qué año?, y ¿Cuáles son los tres principales retos de implementar prácticas relacionadas con soluciones positivas para la naturaleza? Con esta información se calcularon y graficaron los indicadores de la red -cobertura, centralización-y la identificación de los actores clave -articulador, colector y fuente-. Se analizaron los datos colectados usando los Software UCINET 6.288, Netdraw© y KeyPlayer2."},{"index":4,"size":142,"text":"Caracterizar los indicadores de la red como densidad y centralización dará una idea de cómo se concentra la información y/o toma de decisiones. Una red muy centralizada -la centralización se expresa en porcentaje; 100% es altamente concentrada -evidencia a pocos actores controlando de manera significativa la información, dependiendo de los objetivos o del estado de maduración de una innovación esto puede ser favorable o no. La densidad mostrará el porcentaje de relaciones existentes de las posibles en la red. Una alta densidad puede indicar un amplio acceso de los actores a la información disponible en la red -una densidad del 0% muestra que todos los actores se encuentran sueltos y por lo tanto sin acceso a información -Adicionalmente identificar la fortaleza de los vínculos puede reflejar el tiempo, intensidad emocional, confianza y reciprocidad que hay entre los actores (Rendón et al., 2007)."},{"index":5,"size":115,"text":"Por otra parte, el análisis estructural de la red se refiere a la posición, rol e influencia de los actores dentro de esta. En este estudio se analizan tres tipos de actores; articuladores, fuente y colectores. Los actores articuladores son el puente entre uno o varios grupos de actores y tienen la función de ordenar, enlazar y promover los flujos de información, su eliminación provocaría ruptura de la red. Los actores fuente o difusor son aquellos que transmiten información, a través de la validación y filtración por lo que también pueden suprimir información. Los actores colectores son sensibles a experimentar e innovar porque buscan información de la red para implementar (Rendón et al., 2007). \""},{"index":6,"size":87,"text":"Caracterizar los indicadores de la red como densidad y centralización dará una idea de cómo se concentra la información y/o toma de decisiones \" Resultados Actores de la red y actividades implementadas Los actores en la red se agruparon en instituciones de enseñanza e investigación (33.6%), organización de productores (29%), seguido de empresa rural (11.5%, agricultores), instituciones gubernamentales (10.7%), proveedores de servicios profesionales (6.1%), centros de acopio (4.6%), funciones múltiples (3.1%), empresa rural referida (0.8%, agricultores referidos por otro agricultor) y proveedor de insumos (0.8%) (Figura 1)."},{"index":7,"size":261,"text":"La red mapeada se compone de 131 actores -nodos de la red-y la cobertura territorial incluye los departamentos del Valle de Cauca (40.5%), Nariño (22.9%), Antioquia (9.2%), Cundinamarca (5.3%), Bolívar (4.6%), Cauca (4.6%), Quindío (3.1%), Risaralda (2.3%), Tolima (1.5%), y Huila, Meta, César, Córdoba, Sucre y Caldas (1% cada uno) (Figura 2). Se observa que el actor IE39 -Servicio Nacional de Aprendizaje (SENA) -es el nodo con mayor número de municipios articulados -Valle de Cauca, Nariño y Bolívar-, esto es porque SENA es una institución pública nacional, adscrita al ministerio de trabajo más cercana a los grupos de productores agrícolas a través de su estrategia de CampeSENA, por lo que fue el actor más referido por los miembros de la red entre municipios. SENA tiene la fuerza del vínculo -grosor de flecha-mayor en Bolívar (nueve años), seguido de Valle del Cauca (seis años) y Nariño (dos años) (Figura 2). La fuerza de los vínculos reflejada por el tiempo de relación entre los actores para trabajar con prácticas agrícolas asociadas con la conservación de los recursos naturales comienza desde los 80's (1% de la red) en Valle de Cauca, Antioquia y Cundinamarca con temas de conservación de bosques, siendo 2016 el año donde se gesta la mayor cantidad de vinculaciones (11.1%).  Las principales actividades de colaboración que mencionaron desarrollar en conjunto los actores de la red se clasifican en nueve grupos y se describen a continuación (Figura 3); 1. asistencia técnica (16%): no uso de químicos, practicas productivas agroecológicas, reconversión agroecológica, seguimiento a maíces, manejo de semillas, buenas prácticas pesqueras y reciclaje."},{"index":8,"size":51,"text":"2. producción (16%): agricultura regenerativa -la branza mínima, no quemas agrícolas, dejar cobertura de suelo y diversificación de cultivos-, abonos orgánicos, diversidad funcional, principios agroecológicos en el manejo del café, producción local de material de siembra yuca, producción orgánica, proyectos productivos de yuca, hortalizas, arroz y sistema silvopastoril y restauración ecológica."},{"index":9,"size":41,"text":"3. educación e investigación (15%): escuela de semillas, huerta escolar, implementación de herramientas de manejo del paisaje, prácticas profesionales de alumnos, plan de reconversión agroecológica, promoci��n de la biotecnología en el aula de clase, trabajo con polinizadores y transferencia de saberes."},{"index":10,"size":35,"text":"4. organización (15%): intercambio de semillas, intercambio de saberes, intercambio de mano de obra, gestión de proyectos con entidades (Fundocol, SENA, CVC, Asofrucol), planeación y ordenamiento territorial, plataforma colaborativa, transformación de productos locales y trueque."},{"index":11,"size":21,"text":"5. conservación (10%): áreas protegidas, conservación de bosques, conservación de semillas, conservación del medio ambiente, regeneración de semilla, rescate de semillas."},{"index":12,"size":12,"text":"6. comercialización (8%): ferias, mercados locales, fomento del comercio y negocios verdes."},{"index":13,"size":16,"text":"7. colaboración (5%): aliados colaborativos con fundaciones, instituciones públicas y de gobierno (Fundocol, SENA, CVC, Asofrucol)."},{"index":14,"size":16,"text":"8. trámites legales (2%): concesión de aguas y representación legal y 9) proveedurías (1%): distribuidores agropecuarios."},{"index":15,"size":25,"text":"Figure 3. Grupo de actividades desarrolladas por los actores de la red en soluciones positivas para la naturaleza en el área de estudio en Colombia."},{"index":16,"size":22,"text":"Tabla 1. Principales retos que los actores de la red entrevistados mencionaron enfrentar para realizar soluciones positivas con la naturaleza en Colombia."}]},{"head":"Aspectos sociales Aspectos técnicos Aspectos económicos Aspectos ambientales","index":5,"paragraphs":[{"index":1,"size":11,"text":"Inadecuados programas de fomento agrícola (fertilizantes y semilla transgénica e híbridos)."},{"index":2,"size":8,"text":"Falta de normativa de control hacia practicas dañinas."},{"index":3,"size":10,"text":"Falta de concientización, sobre las prácticas que afectan la naturaleza."},{"index":4,"size":10,"text":"Resistencia de los consumidores finales a comprar productos orgánicos locales."},{"index":5,"size":5,"text":"Falta de asociatividad con productores."},{"index":6,"size":21,"text":"Lograr la sostenibilidad en la producción de bioinsumos (falta de tiempo para preparar bioinsumos, no hay materiales o insumos para fabricar)."},{"index":7,"size":12,"text":"Asegurar la efectividad de los insecticidas biológicos para el control de plagas."},{"index":8,"size":7,"text":"Controlar de manera natural plagas y enfermedades."},{"index":9,"size":11,"text":"Falta de personal capacitado en el manejo de bancos de semilla."},{"index":10,"size":14,"text":"Incrementar la diversidad de productos que ofrecemos y avanzar en procesos de valor agregado."},{"index":11,"size":9,"text":"Falta de dinero para comprar variedades de semillas diferentes."},{"index":12,"size":7,"text":"Falta de dinero para comprar fungicidas ecológicos."},{"index":13,"size":6,"text":"Falta de dinero para comprar herramientas."},{"index":14,"size":12,"text":"Limitados recursos para llevar a cabo los procesos de regeneración de semilla."},{"index":15,"size":6,"text":"Limitaciones de espacios físicos e infraestructura."},{"index":16,"size":5,"text":"Difícil control de fauna invasora."},{"index":17,"size":18,"text":"Perdida de la agrobiodiversidad y formas tradicionales de producción de maíz y conocimiento sobre la cultura del maíz."},{"index":18,"size":2,"text":"Cambio climático."}]},{"head":"Reducción de agroquímicos.","index":6,"paragraphs":[{"index":1,"size":3,"text":"Variación del clima."},{"index":2,"size":40,"text":"Los principales retos que los actores de la red mencionaron enfrentar se relacionan con aspectos sociales (49.3%), técnicos (24.0%), económicos (18.7%) y ambientales (8.0%), de los cuales en la tabla 1 se mencionan los cinco más importantes de cada rubro."}]},{"head":"Caracterización de la red de actores","index":7,"paragraphs":[{"index":1,"size":137,"text":"Respecto a los atributos de la red, el porcentaje en el que los miembros de la red se relacionan es bajo (0.08% de densidad) -hay 91 relaciones -esto significa que las conexiones entre los miembros son cerca de ser nulas, probablemente debido a la dispersión geográfica de los actores por lo que la capacidad para acceder a la red de forma estratégica es baja (Figura 4). Cabe hacer énfasis que este estudio se hizo con base en la identificación de actores que tienen un trabajo previo a la iniciativa naturaleza positiva, lo que significa que hay movimientos antes de naturaleza positiva interesados en un cambio de paradigma sobre la forma de producción de alimentos y que pueden ser la base de oportunidad para comenzar a trabajar con el enfoque de la iniciativa y hacer madurar esta red."},{"index":2,"size":112,"text":"El porcentaje de intermediación -actores que vinculan los grupos de la red -también es casi nulo (0.05%) por lo que no hay actores puente en la red que intervengan en el flujo de la comunicación de la información sobre soluciones positivas para la naturaleza entre los nodos de la red. En una red poco densa, como ésta, será necesario considerar acciones de intervención con múltiples grupos o incluso nodos individuales para lograr un impacto en la difusión de tecnologías relacionadas a la iniciativa naturaleza positiva. Además, los actores dicen mantener más relaciones con otros actoresflechas hacia afuera-(4.7%) de lo que otros actores refieren mantener con un actor -flechas hacia adentro-(2.0%) (Figura 4)."},{"index":3,"size":34,"text":"Por lo que también será necesario emprender acciones que favorezcan la interacción como giras de intercambio, días de campo, reuniones de grupo, escuelas de campo, ferias e implementación de parcelas de campo experimentales participativas."},{"index":4,"size":105,"text":"La centralización de la red es baja (4.9%), esto significa que no hay un actor o grupo de actores que dominen la toma de decisiones o la información para influir en toda la red (Figura 4). La red de actores relacionada con actividades en soluciones positivas para la naturaleza es una red joven -poco densa, baja centralización y medianamente diversa -lo que dificulta la comunicación y el flujo de información sobre las innovación entre los actores, por ello es importante transitar a una red más equilibrada; incrementando la densidad y centralidad de la red, trabajando de forma estratégica con los actores articuladores, fuente y colectores."},{"index":5,"size":311,"text":"Se identificaron los actores clave de la red -estructurales, fuente y articuladores -con base a su posición, roles e influencia en los diferentes actores. El número de actores seleccionados depende de la capacidad de recursos del proyecto y la eficiencia de impacto sobre la redconsiderando el impacto en la red si se removieran-, por lo que el número de actores se estableció en cinco. Se identificó que los cinco actores articuladores -nodos puente que enlazan a dos o más grupos-son CA05 -la Red de mercados del Valle -, ER01 -productor -, FM04 -organización Ecofuturo y productor -, IE39 -SENA -y IG09 -Secretaría de Agricultura de Pasto -, remover estos 5 nodos causaría una fragmentación del 4% de la red (Figura 5). Identificar los nodos que proveen información a la red sobre soluciones positivas para la naturaleza es un papel importante para entender quién podría apoyar la difusión de la información. En este caso se seleccionó cinco actores fuente -nodos origen o proveedor de información que son altamente referenciados por los actores de la red -que resultaron en el máximo porcentaje de acceso a la red (12.8%) y son los actores IG02 -Alcaldía Municipal Toro Valle -, IE23 -institución de enseñanza Santa Elena -, IE27 -Granja Agroecológica Valeria -, OR10 -Huertas del mañana -y OR24 -Red Guardianes de semilla -(Figura 5). Los actores de la red con mayor número de fuentes de información sobre conservación de semillas y soluciones positivas con la naturaleza y que pueden llegar al 26.6% de la red son CA04 -Mercado Rozo -, IE01 -Agrosavia Costa Norte de Colombia -y IE14 -Agrosavia Nariño-. Se presentaron dos actores que mantienen doble función como articuladores y fuente ER01 -productor -, FM04organización Ecofuturo y productor-(Figura 5). Figure 5. Nodos articuladores, fuente y colectores de la red de actores en acciones positivas con la naturaleza en las zonas de estudio de Colombia."}]},{"head":"Conclusión","index":8,"paragraphs":[{"index":1,"size":189,"text":"El uso de la herramienta de redes de innovación para mapear a los actores relacionados con soluciones positivas para la naturaleza en las regiones andinas y caribe de Colombia permitió identificar de forma preliminar los tipos de actores fuente de información de las prácticas, que incluye principalmente: instituciones de enseñanza e investigación, organización de productores, agricultores individuales e instituciones gubernamentales. Aunque se identificaron varios actores en la red, se mostró que las relaciones entre estos actores son poco densas y centralizadas, lo que podría dificultar la comunicación y el flujo de información sobre las innovación entre los actores. Esto se explica por ser un concepto recién introducido, pero con base de otras movimientos similares, por lo que se requiere desarrollar estrategias que permitirían a estos actores que no se ubican por el momento, relacionarse. Se pudo identificar algunos actores articuladores, fuente y colectores, como SENA, que podrían ser nodos de intervención en el futuro para cerrar la brecha de interacción. Se requiere un estudio más profundo para identificar otras instituciones importantes a nivel nacional en Colombia, trabajando en soluciones positivas para la naturaleza, que podrían articular mejor la red."},{"index":2,"size":124,"text":"El propósito de las intervenciones del proyecto tendrá que estar asociado en mejorar los atributos de la red para desarrollar relaciones complejas de cooperación y asociación que favorezcan la comunicación y vinculación de los actores para la implementación de innovaciones agrícola asociada al desarrollo sostenible. Una de las acciones podría ser el desarrollo del modelo del hub implementado por CIMMYT en México y América Central -sistema de innovación basado sobre el pensamiento de diseño de investigación y extensión en conjunto con los productores como el centro de la estrategia y que busca fortalecer las relaciones entre actores y definir juntos una visión común -esto será un acercamiento para permitir fortalecer la red de actores trabajando en soluciones positivas para la naturaleza en Colombia. \""},{"index":3,"size":19,"text":"El propósito de las intervenciones del proyecto tendrá que estar asociado en mejorar los atributos de la red \""}]}],"figures":[{"text":"Figure 1 . Figure 1. Porcentaje de los principales tipos de actores de la red, relacionados con soluciones positivas para la naturaleza en el área de estudio en Colombia durante 2023. ........................ "},{"text":"Figure 2 . Figure 2. Red de actores realizando acciones positivas con la naturaleza en el área de estudio en Colombia y su fuerza de vínculos (el grosor de la línea indica más años de colaboración) en 2023. ..................................................................................... "},{"text":"Figure 3 . Figure 3. Grupo de actividades desarrolladas por los actores de la red en soluciones positivas para la naturaleza en el área de estudio en Colombia. ......................................................... "},{"text":"Figure 4 . Figure 4. Red de actores con baja densidad y centralidad en acciones positivas con la naturaleza en el área de estudio en Colombia durante 2023. ......................................................... "},{"text":"Figure 5 . Figure 5. Nodos articuladores, fuente y colectores de la red de actores en acciones positivas con la naturaleza en las zonas de estudio de Colombia. ............................................................. "},{"text":"Figure 1 . Figure 1. Porcentaje de los principales tipos de actores de la red, relacionados con soluciones positivas para la naturaleza en el área de estudio en Colombia durante 2023. "},{"text":"Figure 2 . Figure 2. Red de actores realizando acciones positivas con la naturaleza en el área de estudio en Colombia y su fuerza de vínculos (el grosor de la línea indica más años de colaboración) en 2023. "},{"text":"Figure 4 . Figure 4. Red de actores con baja densidad y centralidad en acciones positivas con la naturaleza en el área de estudio en Colombia durante 2023. "},{"text":"  "},{"text":"  "}],"sieverID":"e8b1e9b5-e81b-4259-b13e-cfc353fb5e6e","abstract":"Agradecemos a Myriam del Carmen Salazar Villarreal por recabar parte de las encuestas y a todos y cada una de las personas e instituciones que participaron respondiendo las preguntas de la encuestas por la información que nos han proporcionado para este estudio."}

data/part_4/06a7be5364eb8ad237eedda05053b80a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06a7be5364eb8ad237eedda05053b80a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/b736ad5d-15b0-4fd2-98bc-b549c6187c9c/retrieve"},"pageCount":18,"title":"Exchanging and managing in-vitro elite germplasm to combat Cassava Brown Streak Disease (CBSD) and Cassava Mosaic Disease (CMD) in Eastern and Southern Africa","keywords":["Exchange","In-vitro","Germplasm","CBSD and CMD"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":120,"text":"Cassava (Manihot esculenta Crantz) is one of the most important food staples in sub-Saharan Africa (SSA), ranked as the number one root crop followed by yam and sweetpotato (FAOSTAT 2017). With over 140 MT of annual root production (FAOSTAT 2017), cassava is the major source of carbohydrates in the diet of millions of people in SSA and is grown as a famine reserve crop owing to its tolerance of harsh environmental conditions (Jarvis et al. 2012;Nassar and Ortiz 2007). Moreover, the crop has enormous potential to graduate into an important economic driver within the agriculture sector in different SSA countries where entrepreneurs have started to exploit its industrial business potential to produce high quality flour, starch, beverages and animal feeds."},{"index":2,"size":257,"text":"However, the crop is threatened by two viral diseases: cassava brown streak disease (CBSD) and cassava mosaic disease (CMD), and these are currently the principal biotic factors affecting production in East and Southern Africa (ESA) (Alicai et al. 2007;Legg et al. 2011). While CMD is of economic importance across SSA, CBSD remains localized in ESA, although there is a high risk of the disease spreading to West Africa unless contained (Legg et al. 2011). CBSD is caused by two virus species, Cassava brown streak virus (CBSV) and Ugandan cassava brown streak virus (UCBSV) in the family Potyviridae, genus Ipomovirus (Mbanzibwa et al. 2009). Here, we refer to these collectively as cassava brown streak ipomoviruses (CBSIs). In addition to the two species groupings, several strains of each species have been reported (Mbanzibwa et al. 2009;Mohammed et al. 2012;Ogwok et al. 2015). These interact with the host differently (Mohammed et al. 2012;Kaweesi et al. 2014;Legg et al. 2015) and produce symptoms of varying severity that complicate the evaluation and selection processes in developing resistant varieties. A further important factor in the epidemiology of these viruses, causing CBSD and CMD, is the relative abundance of the whitefly vector, Bemisia tabaci (Maruthi et al. 2005). Whiteflies occur in greatly varying abundance in the regions where both diseases occur (Jeremiah et al. 2015), and this in turn results in significantly different levels of inoculum pressure for the two diseases. Consequently, it is essential to evaluate cassava germplasm that is potentially resistant to both CBSD and CMD in a wide range of agro-ecologies."},{"index":3,"size":86,"text":"Collaborative efforts with different national cassava breeding programs have identified germplasm resistant or tolerant to CBSD/CMD. However, these have been evaluated so far under a narrow range of conditions of environment, virus species/strains, and vector abundance (Legg et al. 2011). The exchange of germplasm between countries enhances the diversity of germplasm available to partner countries. It provides breeders with fresh opportunities to evaluate and release new varieties as well as to use them as parents in efforts to breed new genotypes resistant to CBSD and CMD."},{"index":4,"size":177,"text":"Past experiences of CMD pandemic management have underlined the significance of identifying and deploying host resistance as well as the importance of joint action among partners in the affected countries through elite germplasm exchange (Ntawuruhunga et al. 2013). Open quarantine was used effectively in efforts to manage the CMD pandemic (Mohamed 2002), but this is appropriate only under emergency conditions and where introduced germplasm is carried just a short distance over the border into the receiving country. The approach has risks of introducing other diseases/pests into new unaffected areas (Ntawuruhunga and Legg 2007). Sharing of botanical seeds is less risky, but the high level of genetic variability among individual seeds means that more time and funds are required at national level to develop promising varieties (Ntawuruhunga et al. 2013). Virus-indexed tissue culture (TC) plants are the form recognised by quarantine regulators for the exchange of elite germplasm among countries (Frison 1994;Lebot 2009;Ntawuruhunga et al. 2013). Their use also ensures that fair comparisons can be made among clones that are planted in evaluation trials without propagule-borne virus infection."},{"index":5,"size":141,"text":"Breeding for dual resistance is currently being pursued as the most cost-effective and sustainable way to manage the devastating effects of the viral diseases in ESA. Although high resistance for CMD has been found, only limited success has been documented for CBSD. The desired goal of the breeding efforts is stable genotypes with resistance to both viral diseases. Work described in this paper has helped partner countries to access clean in-vitro stocks of a diverse set of resistant germplasm as vital precursor to coordinated regional trials aimed at identifying new resistant variety options to mitigate threats of CMD and CBSD. The work was undertaken in the early stages of the project BNew Cassava varieties and Clean Seed to Combat CMD and CBSD^(5CP), and aimed at exchanging elite germplasm among the five countries most affected by CMD and CBSD for adaptability breeding."}]},{"head":"Target countries","index":2,"paragraphs":[{"index":1,"size":35,"text":"Kenya, Malawi, Mozambique, Tanzania and Uganda (Fig. 1) are the countries most severely affected by both CBSD and CMD and agreed to share their five best cassava clones with respect to resistance to both diseases."}]},{"head":"Target cassava germplasm","index":3,"paragraphs":[{"index":1,"size":92,"text":"The targeted germplasm (Table 1) included 25 elite clones contributed by partner countries, two standard regional susceptible check clones, i.e., Kibandameno, a CMD susceptible check from Kenya, and Albert, a CBSD susceptible check from Tanzania. The elite clones were selected for exchange based on resistance to CMD and CBSD, their root yield and dry matter content. Four other clones were included as national checks as follows: Tomo (susceptible to CBSD) from Mozambique, Mbundumali (susceptible to CBSD and CMD) from Malawi, and Kiroba (susceptible to CMD) and Mkombozi (susceptible to CBSD) from Tanzania. "}]},{"head":"Partner institutions","index":4,"paragraphs":[]},{"head":"Main steps for the exchange and management of elite cassava germplasm","index":5,"paragraphs":[{"index":1,"size":26,"text":"Four main steps (Fig. 2) were undertaken in the process of exchanging and managing the elite germplasm in the target countries. Figure 3 illustrates the timelines."}]},{"head":"Obtaining elite cassava clones from partner countries","index":6,"paragraphs":[{"index":1,"size":132,"text":"Between August and December 2012 each country freely agreed to submit to NRI and KEPHIS ca 25 stem cuttings obtained from asymptomatic plants of each of the best five clones (Table 1) for virus cleaning. The asymptomatic plants were used mainly to ease the task and cost of the cleaning process. To minimize chances of within-clone variation (mericlones), stem cuttings of a given clone were collected from one plant stand by breeders who had wide knowledge of the clones' agronomic performance as well as their reaction to the diseases. The two laboratories served as a backup to each other in the role of virus cleaning and indexing. Apart from short delays in the delivery of the elite clones by some countries, no major challenge was experienced during this step of the process."}]},{"head":"Virus cleaning and indexing","index":7,"paragraphs":[{"index":1,"size":229,"text":"At each laboratory, the stem cuttings were sprouted and grown in pots under quarantine for about 3 months while being observed for virus disease symptoms. At NRI, the asymptomatic plants were separated from the symptomatic (data not presented), and leaf samples from the former were subjected to virus diagnostics using PCR procedures (Aloyce et al. 2013) for cassava mosaic begomoviruses (CMBs) and real-time reverse transcription polymerase chain reaction (real-time RT PCR) procedures (Adams et al. 2013;Tomlinson et al. 2013) for CBSIs. The virus negative plants of each clone were initiated into TC and micro-propagated to raise over 50 plantlets. Meristems were used to initiate TC plants for those clones with only virus positive plants. These were incubated under thermotherapy conditions and left to grow for 8-10 weeks before being reintroduced to the quarantine glasshouse to confirm the absence of the viruses using the diagnostic methods indicated above. At KEPHIS, meristem tips of asymptomatic plants were initiated into TC and later diagnosed for viruses. As at NRI, the virus negative plants were micro-propagated to raise over 50 plantlets. Virus positive plants were incubated in the thermotherapy chamber at 38 °C for 21 days before meristems were chosen for TC initiation. Upon establishment, the plants were tested again for viruses, and the cycle was repeated for the positive plants until negative plants were obtained and micropropagated to produce over 50 plantlets."},{"index":2,"size":17,"text":"Fig. 1 A map showing partner countries that exchanged elite cassava germplasm and sites for regional trials"}]},{"head":"Preparation and dispatch of elite clones","index":8,"paragraphs":[{"index":1,"size":52,"text":"This step involved five activities: micro-propagation, verification of genotype purity and virus-free status, capacity building, mock shipment and shipment of TC plants to partner countries. a) Micro-propagation: This was done by GTIL a private TC laboratory in Nairobi, Kenya, to increase the number of clean plantlets per clone available to partner countries."},{"index":2,"size":37,"text":"From NRI, approximately 75 TC plants per clone were sent to GTIL and micro-propagated (Photo 1a) to produce more than 1500 plantlets per clone, which were sufficient to provide at least 300 plantlets per clone per country."},{"index":3,"size":301,"text":"Figure 4 shows the rates of progress of micropropagation at GTIL. While most clones responded positively to the protocols and yielded the required quantities by sub-culturing cycle 5 or 6, others such as Pwani, NASE 1, Tajirika, and Okhumelela were recalcitrant and required media improvement. The recalcitrant clones caused delays and held back the timelines for delivery of the plants to partner countries (Fig. 3) b) Verification of genotype purity and virus status of the clones: It was considered critical for independent parties to ascertain the genotype purity and virus-free status of the clones before shipment to partner countries. About ten sample plants were acclimatized at GTIL (for materials cleaned by NRI) and at KEPHIS from which later samples of different plant parts (leaves, stem and meristem) were taken and tested for CBSIs and CMBs by Mikocheni Agricultural Research Institute (MARI) in collaboration   the partners to receive the materials, as well as of identifying possible challenges during shipment. Two cuboid plastic containers (Photo 1a) each with a maximum of 150 plantlets of one clone were sent by courier to Uganda, Tanzania, and Malawi. Permits for both export and import accompanied the shipment as required by regulations. Two challenges were experienced during mock shipment and recommendations were made to GTIL for the actual shipment. Firstly, 150 plantlets per container were overcrowded with intertwined roots that resulted in both root and plant damage during removal from the media. A total of 75 TC plants per container was recommended for the actual shipment. Secondly, all countries reported plant damage resulting from the semi-solid media becoming loose and mixed with plants during shipment. GTIL was asked to use a more solidified medium to ensure that plants would be kept in position during shipment and to improve the placement of the containers in the big boxes."},{"index":4,"size":276,"text":"The mock shipment experience also led to GTIL being advised to ensure that consignments were projected to arrive in target countries early in the week for easy clearance and to avoid shipments being held up over weekends. Also, improvements were made to the system used to alert recipient countries about the expected timetable for dispatch of the TC shipments from GTIL and incountry arrival. This enabled national partners to make adequate preparations for receiving the material through liaising with authorities involved in the clearing process.  e) Shipment of TC plants: This is the activity that marked the exchange of the germplasm, between partner countries. The first and major shipment was undertaken by GTIL. Using cylindrical or cuboid plastic transparent containers, GTIL planted in the medium a maximum of 75 plantlets per container, labelled them, allowed two weeks for roots and shoots to develop, sealed, packaged, and sent the plantlets to the partner countries. The containers were placed in bigger boxes and surrounded with shockabsorbing materials. The boxes were also marked fragile and an 'up' arrow sign was used to ensure proper handling during transit. The plants were transported by road to Uganda and Tanzania or as cargo with international airlines to Malawi and Mozambique. Kenya, unlike other countries, received hardened plants from GTIL. To facilitate quarantine authority clearance at entry points, all the shipments were accompanied by copies of import permits that were obtained from plant protection offices in respective countries and phytosanitary certificates from KEPHIS. At the point of entry, the consignments were cleared by officials from the national plant protection organizations (NPPOs) of the respective countries and received by the national cassava research teams."},{"index":5,"size":47,"text":"The second shipment was made by KEPHIS, where 5 to 10 TC plantlets per clone in single glass test-tubes were shipped to partner countries. The purpose of these plantlets was to be conserved as back-ups for immediate post-flask management needs and also for future clean stock needs."}]},{"head":"Management of the exchanged elite clones in target countries","index":9,"paragraphs":[{"index":1,"size":208,"text":"a) Post-flask management: Upon arrival in each country, the TC plantlets were checked for contamination and physical damage, and registered. The plantlets were kept for two to seven days in TC laboratory growth rooms or under normal room temperature conditions to recover from transit stress. They were then carefully separated from the medium, introduced into individual small cups filled with vermiculite or forest soil/sand mixture, and placed in nutrient-enriched water baths. Each potted plant was covered with a transparent polythene bag to create micro-humid conditions. In Tanzania, the potted plants covered with polythene bags were additionally placed in a bigger humidity chamber. After one week, the polythene bags were cut open at one end and fully opened after two weeks (Photo 1b). The tender plants were sprayed with fungicide and insecticide and irrigated with nutrient-enriched water. After a month, the plants were transplanted into bigger polythene bag containers (also used in potting tree and flower seedlings) filled with sterilized soil. By the end of the second month the plants were ready for transplanting into the field for multiplication. Different rates of survival were registered by the different countries (Table 3). Uganda (79.4%) and Mozambique (80.9%) registered the highest survival rates with fewer losses than Malawi, Kenya. and Tanzania."},{"index":2,"size":610,"text":"There had been heavy losses in the first batch of delivered plants but survival improved with the second batch. b) Field multiplication: The fields used for multiplication were located in areas with very low CBSD and CMD pressure. Hardened plantlets were established in one multiplication field (Photo 1c) in all countries except Tanzania where two fields were used in different parts of the country. The management practices varied with countries. For example, irrigation was done during periods of drought in Kenya, Tanzania, and Mozambique. In Malawi, the severe cold period between June and October 2014 delayed further establishment of the multiplication field to avoid plant losses to frost. In Uganda, field multiplication was rain fed and no fertilizer application was made. To minimize any virus infection, the multiplication fields were isolated by being at least 200 m from any old cassava crop and continuously rogued. c) Macro-propagation: To mitigate the challenge of plant losses during post-flask management and ensure sufficient numbers of hardened plantlets for field multiplication, two-to three-node cuttings were taken from the few surviving plants and planted for further multiplication. In the screen houses, these were hardened plants between two and three months old and ready for transfer to the field. In the multiplication fields, these were plants at four to six months after establishment. In both cases, the cut plants sprouted with multiple shoots in addition to three or more plantlets from stem cuttings. Through this technique, the countries that suffered early plant deaths during acclimitization were able to increase the number of plants of the affected clones. The technique helped to save time and reduce costs of acquiring and acclimatizing new sets of TC plants from GTIL by the affected countries. It also ensured that there were sufficient stem cuttings of at least 20 elite clones for regional trials to be established by the end of 2015 in all countries. This technique can also be helpful in multiplication of hardened virus-indexed cassava plants under insect-proof screen houses for pre-basic seed production under cassava seed systems (IITA 2014). d) Regional multi-locational trials: The immediate purpose of exchanging the elite germplasm between countries as discussed in this paper was to test and validate the clones' adaptability and tolerance to CBSD and CMD across five partner countries all severely affected by CBSD and CMD. Using stem cuttings obtained from the multiplication field discussed above, field trials were established in a total of 33 sites across the partner countries (Fig. 1). The sites were characterized by varying levels of CBSD and CMD pressure, climatic and soil conditions. With the exception of Kenya, the countries successfully established trials with all the 25 elite clones and standard susceptible checks (Albert, a susceptible check for CBSD and Kibandamendo, a susceptible check for CMD). In Kenya, only 23 clones were established in the trials and four clones (N'ziva, Okhumelela, Shibe, and Albert) were omitted owing to plant losses during the post-flask management stage. Comprehensive data were collected for agronomic traits, viral disease incidence and severity at different stages of crop growth (including harvesting), whitefly abundance, and yield components. The data will be analysed in the near future and are expected to help in understanding the genotype by environment interactions for CBSD/CMD resistance. Also, the data will be helpful in identifying superior clone/varieties and environments for the evaluation of resistance to CBSD/CMD. e) In-vitro conservation: The clean plants received from KEPHIS in all countries were meant to be conserved as in-vitro back-ups to serve both immediate needs to replace plantlets of any clone lost during the acclimatization process and long-term needs for clean stocks for pre-basic seed production systems of identified varieties in each country."},{"index":3,"size":76,"text":"Apart from Uganda and Kenya, the countries reported the loss of all or the majority of the clones (Table 4). Erratic power supplies faced by most NARS in TC facilities and the lack of TC reagent supplies were reported as the main causes of plant losses for the clones. Additional investments in tissue culture facilities in the countries where these losses occurred will be required in future in order to allow for long-term TC-based germplasm conservation."}]},{"head":"Key achievements","index":10,"paragraphs":[{"index":1,"size":168,"text":"There were three major acheivements under the intiative reported here. Firstly, up to 30 clones (25 elite, two standard checks and four national checks) were successfully virus-cleaned and indexed, and 27 clones were exchanged among target countries. The other three were returned to their respective mother countries as national checks. The particularly unique aspect of this initiative was the sourcing and pooling of germplasm from five countries, the cleaning, and returning of the expanded pooled set. Additionally, the germplasm presented a unique opportunity to identify varieties with high levels of resistance to both CBSD and CMD under the diverse range of virus/virus vector/environmental conditions in these five countries of ESA. In addition to offering potential for use as parents to generate superior progeny with a background of high resistance, the clean stocks represented a great for initiating extension programs for the multiplication and dissemination of high quality pre-basic 'seeds'. Hitherto, most of the target countries have had no access to field-based stocks of high quality virus-tested planting material."},{"index":2,"size":183,"text":"The second achievement is the strong partnership built between breeders and virologists in national and international institutions (Fig. 2; Photo 1d) that has ensured the successful exchange of elite germplasm. It represents a joint action to reverse the devastating effects of the two deadly viral diseases. The partnership also allowed cross-learning between partners at all levels of the process. It has presented a unique opportunity for breeders and virologists to work together to combat these diseases through elite resistant germplasm and clean seeds. Legg et al. (2014) previously highlighed the importance of concerted multi-partner efforts to tackle the twin threats of CBSD and CMD to Africa's cassava production. The current initiative represented a significant achievement along the road map proposed for the 'War on Cassava Viruses' that was described in this publication. However, a key question is whether the partnership will continue after the project. Partner institutions will need to make concerted efforts to ensure that these linkages are sustained, and furthermore, that the lessons learned from the approach are shared with others who are faced with similar challenges affecting vegetatively propagated crops."},{"index":3,"size":109,"text":"The third achievement was the successful implementation of the trials across the countries. Following analysis, the collected data are anticipated to elucidate the magnitude of genotype by environment interactions for CBSD/CMD resistance, superior clones, and environments. Although these trials are still in progress, preliminary results are already helping to guide stakeholders on which varieties are likely to be most appropriate in which agro-ecologies and CBSD/CMD disease pressure conditions within the eastern and southern African region. Moreover, these preliminary data and the germplasm exchange approach described here are currently being used to inform the implementation of new CBSD mitigation programs in Burundi, Rwanda and the eastern Democratic Republic of Congo."}]},{"head":"Learning experiences","index":11,"paragraphs":[{"index":1,"size":154,"text":"& Cleaning from virus infection was relatively easy for about 85% of the cassava clones. These were cleaned in the 'first cycle' of the virus indexing program and were thereafter ready for micro-propagation. This success was possibly due to the selection and use of stem cuttings obtained from asymptomatic plants by the breeders. The remaining 15% of the clones took about three cycles, i.e., three treatments of chemotherapy, thermotherapy, and tissue culturing, before becoming clear of viruses. These clones were Tomo, F19-NL, NASE1 and Kibandameno; all were symptomatic after sprouting at NRI/KEPHIS. Only Tomo, a check clone from Mozambique, could not be cleaned at KEPHIS despite several repeated cycles. Starting a virus clean-up process such as this with visually clean plants directly influences how quickly the target clones can be cleaned of viruses. However, specificity in the response of cassava genotypes to the cleaning and indexing protocols has been reported (Sesay et al. 2016)."},{"index":2,"size":571,"text":"Future initiatives attempting similar work should recognize that a small proportion of plant genotypes are likely to be recalcitrant to virus eradication. & Responses of clones to micro-propagation protocols were varied at GTIL (Fig. 3). Although the majority responded positively to the protocols and yielded the required quantities by sub-culturing cycle 5 or 6, others such as Pwani, NASE1, Tajirika, and Okhumelela were recalcitrant and optimization of the medium was needed. The recalcitrant clones also caused delays and held up the timelines for delivery of the plants to countries (Fig. 2). TC recalcitrant behaviour among clones has previously been reported in cassava (Acedo and Corazon 2008). Further investigation is needed to establish the optimal protocol for micropropagation of most of the genotypes. & Extreme temperatures adversely affected the plants while being acclimatized. For example, extremely cold night temperatures in Nairobi either slowed growth or killed the plants in Kenya. On the other hand, hot screen house conditions scorched some of the plants to death at Kibaha and Maruku in Tanzania. These experiences suggest that temperature conditions are important in selecting a station where acclimatization of cassava plants should be conducted. Specifically, the choice is recommended of shaded cool or fresh environments with no extreme temperatures (FAO 2010). In Tanzania, the extremely hot conditions were overcome by introducing a shade net inside the screen house but this could also be overlaid on top of the white insect-proof net. & Bulk packaging of the TC plantlets (75 per container) at GTIL was cost-effective but presented several challenges. Firstly, the plantlets were exposed to contamination during shipment owing to ineffective sealing of large containers. Secondly, the plantlets were vulnerable to damage during removal for hardening. The roots of the plantlets grow and intertwine into a network, making it difficult to separate them without root or plantlet damage. Thirdly, for some clones (e.g., Tajirika) the plantlets in the middle of the container tended to be slow in developing roots resulting in plantlets with no roots or underdeveloped roots that had a high chance of early death during acclimatization. Single test-tube TC packaging is the commonly used method and is associated with limited contamination and damage during removal. However, testtubes can be expensive and bulky. & It was critical to have skilled and committed personnel to monitor the acclimatizing plants carefully and constantly, closely observing the progress of each plant. Therefore, training and supervision of personnel are vital. Best results were achieved in countries where the monitoring tasks were assigned to one committed technician. & We experienced variation across countries in capacities for in-vitro conservation of elite germplasm. During the course of the initiative, most partner countries except Uganda and Kenya (where plants were kept at KEPHIS) lost more than half of the in-vitro back-up plants from infrastructural difficulties such as the lack of reliable and stable electricity as well as of reagent supplies. Future initiatives should therefore pay particular attention to minimising the likelihood of infrastructural constraints having a negative impact on the work. & The coordination role played by IITA (Fig. 2) contributed greatly to the success of the entire exercise. The project leadership ensured effective communication, and the preparation of the different partners. Prior alerts of shipment schedules and departures to recipient countries were helpful in clearing the materials through plant health inspection offices at entry points and avoiding possible delays, as well as for country teams in making all the needed preparations."}]},{"head":"Conclusion","index":12,"paragraphs":[{"index":1,"size":315,"text":"This initiative is the first of its kind in successfully facilitating the exchange of a large number of clean virusindexed elite germplasm clones to combat CBSD and CMD. However, the success achieved was the result of extensive preparation of infrastructure and trained personnel to manage the different sub-processes in the framework of an effective partnership. This could have been achieved only within the context of a large project, which in this case was supported through a grant from the Bill and Melinda Gates Foundation. Even where such project support may not be available in future years, the approach has provided a valuable model for other national, regional, and international stakeholders in African agricultural development that may have an interest in supporting similar initiatives in future. Although the programme achieved its goals, some important challenges were identified. In particular, it was noted that a small proportion of cassava genotypes were recalcitrant either to virus cleaning or micro-propagation, and these slowed down the overall process. However, more than 80% of the genotypes used responded well to all stages of the process and by the end of the exercise, one of the most extensive cassava germplasm evaluation trials ever undertaken was underway at more than 30 locations in the five target countries of ESA. The trial will allow the region's cassava researchers to assess the performance of this elite set of varieties under a diverse set of agro-ecological conditions, and to characterize varietal responses to the viruses causing CBSD and CMD under each of these conditions. This in itself will be a unique undertaking, and should provide a lasting legacy for cassava development and efforts to combat these diseases in one of the most important cassava-growing regions of Africa. In view of the importance of cassava to Africa's food security given the threats posed by future climate change (Jarvis et al. 2012), this represents a very significant contribution."}]}],"figures":[{"text":" Fig. 3 Timelines for the process of cleaning, multiplication and exchange of the cassava elite germplasm "},{"text":"Fig. 2 Fig. 2 Schematic flow of the cleaning, multiplication and exchange process of the cassava elite germplasm "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":" IITA led the initiative through its Eastern Africa Hub in Dar es Salaam Tanzania. The five partner countries were represented as follows: Uganda by the National Agricultural Research Organization (NARO), Kenya by the Kenya Research Organization (NARO), Kenya by the Kenya Agricultural and Livestock Research Organisation (KALRO), Agricultural and Livestock Research Organisation (KALRO), Tanzania by the Department of Research and Development, Tanzania by the Department of Research and Development, (DRD), Mozambique by Instituto de Investigação Agrária de (DRD), Mozambique by Instituto de Investigação Agrária de Moçambique (Agricultural Research Institute of Mozambique - Moçambique (Agricultural Research Institute of Mozambique - IIAM), and Malawi by the Department for Agricultural IIAM), and Malawi by the Department for Agricultural Research Services (DARS). Other partner institutions were Research Services (DARS). Other partner institutions were the Natural Resources Research Institute (NRI) in the United the Natural Resources Research Institute (NRI) in the United Kingdom, Kenya Plant Health Inspectorate Services (KEPHIS) Kingdom, Kenya Plant Health Inspectorate Services (KEPHIS) and GTIL in Kenya. and GTIL in Kenya.  "},{"text":"Table 1 Elite germplasm cleaned, multiplied and exchanged among five countries in eastern and southern Africa from 2012 to 2014 Variety name Country of origin Fresh root yield (t/ha) DM content (%) Reaction to diseases  Release status Variety nameCountry of originFresh root yield (t/ha)DM content (%)Reaction to diseasesRelease status     CMD resistance CBSD resistance  CMD resistanceCBSD resistance KBH2002/066 Tanzania 34.1 28.0 Moderate Moderate Released KBH2002/066Tanzania34.128.0ModerateModerateReleased Pwani Tanzania 50.8 29.2 Moderate Moderate In pipeline PwaniTanzania50.829.2ModerateModerateIn pipeline Mkumba Tanzania 23.3 27 Weak Moderate In pipeline MkumbaTanzania23.327WeakModerateIn pipeline KBH2006/026 Tanzania 30.0 29.0 Moderate Moderate Released KBH2006/026Tanzania30.029.0ModerateModerateReleased Kizimbani Tanzania 28.6 28.0 Moderate Moderate Released KizimbaniTanzania28.628.0ModerateModerateReleased Kiroba* Tanzania 20.0 32.0 Weak Moderate Released Kiroba*Tanzania20.032.0WeakModerateReleased Mkombozi* Tanzania >20 30 Strong Weak Released Mkombozi*Tanzania>2030StrongWeakReleased Albert** Tanzania fair good Strong Susceptible Not released Albert**TanzaniafairgoodStrongSusceptibleNot released Sangoja Malawi 35 33 Moderate Moderate Released SangojaMalawi3533ModerateModerateReleased Sauti Malawi 30 34 Moderate Moderate Released SautiMalawi3034ModerateModerateReleased Yizaso Malawi 35 33 Moderate Moderate Released YizasoMalawi3533ModerateModerateReleased Kalawe Malawi 28 36 Moderate Moderate Released KalaweMalawi2836ModerateModerateReleased CH05/203 Malawi 33 34 Moderate Moderate In pipeline CH05/203Malawi3334ModerateModerateIn pipeline Mbundumali* Malawi 25 37 Susceptible Susceptible Recommended Mbundumali*Malawi2537SusceptibleSusceptibleRecommended Coliacanana Mozambique 20.0 33.0 Weak Moderate Released ColiacananaMozambique20.033.0WeakModerateReleased N'ziva Mozambique 22.0 35.1 Weak Moderate Released N'zivaMozambique22.035.1WeakModerateReleased Okhumelela Mozambique 20.0 32.8 Moderate Moderate Released OkhumelelaMozambique20.032.8ModerateModerateReleased Orera Mozambique 23.0 32.0 Weak Moderate Released OreraMozambique23.032.0WeakModerateReleased Eyope Mozambique 25.0 32.0 Moderate Moderate Released EyopeMozambique25.032.0ModerateModerateReleased LML/2008/363 Kenya 69 27 Moderate Moderate In pipeline LML/2008/363Kenya6927ModerateModerateIn pipeline F19-NL Kenya 39.4 25 Moderate Moderate In pipeline F19-NLKenya39.425ModerateModerateIn pipeline Tajirika Kenya 61 25.7 Moderate Moderate Released TajirikaKenya6125.7ModerateModerateReleased Shibe Kenya 68 26 Moderate Moderate Released ShibeKenya6826ModerateModerateReleased F10-30-R2 Kenya 58 40 Moderate Moderate Adv. yield trial F10-30-R2Kenya5840ModerateModerateAdv. yield trial Kibandameno** Kenya 26.1 40 Susceptible Susceptible Not released Kibandameno**Kenya26.140SusceptibleSusceptibleNot released TZ130 Uganda - - Strong Moderate Released TZ130Uganda--StrongModerateReleased NASE14 Uganda 31.2 35.0 Strong Moderate Released NASE14Uganda31.235.0StrongModerateReleased NASE18 Uganda 38.6 35.5 Strong Moderate Released NASE18Uganda38.635.5StrongModerateReleased NASE1 Uganda 14.9 32.5 Strong Moderate Released NASE1Uganda14.932.5StrongModerateReleased NASE3 Uganda <10 30.0 Moderate Moderate Released NASE3Uganda<1030.0ModerateModerateReleased  "},{"text":"Table 2  Virus clean status         Virus clean status verification results of TC-derived Clone Status of NRI sample plants  Status of KEPHIS sample plants verification results of TC-derivedCloneStatus of NRI sample plantsStatus of KEPHIS sample plants plants of different cassava clones         plants of different cassava clones targeted for regional exchange  No. of CBSV* UCBSV* CMBs No. of CBSV* UCBSV* CMBs targeted for regional exchangeNo. ofCBSV*UCBSV*CMBsNo. ofCBSV*UCBSV*CMBs among five countries in eastern  samples    samples   among five countries in easternsamplessamples and southern Africa         and southern Africa  CHO5/203 6       CHO5/2036  "},{"text":"Table 4 Survival rates (%) of in-vitro backup plantlets at different national tissue culture laboratories Country No. of clones received Tissue culture No. of clones in % clone survival Remarks CountryNo. of clones receivedTissue cultureNo. of clones in% clone survival Remarks  from KEPHIS lab location conservation at 31.12.2016   from KEPHISlab locationconservation at 31.12.2016 Malawi 27 DARS Vumbwe 0 0 Lost all clones due to power cuts Malawi27DARS Vumbwe 00Lost all clones due to power cuts      and lack of TC reagents for conservation and lack of TC reagents for conservation Mozambique 26 IIAM Maputo 10 38.5 Lost some clones due to power cuts Mozambique 26IIAM Maputo1038.5Lost some clones due to power cuts Kenya 31 KEPHIS 31 100 TC conservation part of their mandate Kenya31KEPHIS31100TC conservation part of their mandate      and have personnel and have personnel Uganda 27 NaCRRI 27 100 Have a functional TC lab with personnel Uganda27NaCRRI27100Have a functional TC lab with personnel Tanzania 24 MARI/CBS 14 25.6 MARI lost all clones due to power cuts. Tanzania24MARI/CBS1425.6MARI lost all clones due to power cuts.      The surviving clones are with CBS The surviving clones are with CBS  "}],"sieverID":"343ae95a-3360-45e8-be9f-d331dff380ae","abstract":"Cassava varieties resistant to cassava mosaic disease (CMD) and cassava brown streak disease (CBSD) are needed for the food and income security of the rural poor in eastern and southern Africa (ESA). The International Institute of Tropical Agriculture led five national cassava breeding programs (Malawi, Mozambique, Kenya, Tanzania and Uganda) in virus-cleaning and exchanging elite cassava germplasm resistant to both diseases. This paper documents the experiences and lessons learned from the process. Thirty-one clones (25 elite, two standard and four national) were submitted by the five breeding programs to the Natural Resources Institute and Kenya Plant Health Inspectorate Services for virus cleaning and indexing. Subsequently, ca 75 invitro virus-indexed plantlets per clone were sent to Genetic Technologies International Limited (GTIL), a private tissue culture (TC) lab in Kenya, and micro-propagated to produce ≥1500 plantlets. After fulfilling all the formal procedures of germplasm exchange between countries ≥300 plantlets per clone were sent to each partner country. National check clones susceptible to CMD/CBSD were sent only to their countries of origin. In each country, the in-vitro plantlets were acclimatized under screen house conditions and transferred to clean isolated sites for field multiplication. All the clones were cleaned of the viruses, except Tomo. The cleaning process was slow for F19-NL, NASE1, and Kibandameno and TC micro-propagation at GTIL was less efficient for Pwani, Tajirika, NASE1, and Okhumelela than for the other clones. Difficulties in cleaning recalcitrant clones affected the timeline for establishing the multi-site evaluation trials in target countries. The initiative is the one of the kind to successfully clean and exchange elite germplasm as a joint action to combat CBSD in ESA. Adequate preparation in terms of infrastructure and personnel are critical to successfully receiving and adapting the indexed in-vitro plants as new germplasm."}

data/part_4/06d22c5458e6e96e11fc2f3948adef22.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06d22c5458e6e96e11fc2f3948adef22","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7d426bcc-f2be-4d7b-a405-b80e45fc5b44/retrieve"},"pageCount":1,"title":"Study #4301 Contributing Projects: • P249 -Upscaling promising livestock options for mitigating greenhouse gas emissions in Asia","keywords":[],"chapters":[],"figures":[],"sieverID":"65ead4eb-1299-4ff5-b477-1c1ac4d181e0","abstract":""}

data/part_4/0767f55f695de0a3bc361992ccdcc40f.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0767f55f695de0a3bc361992ccdcc40f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/0aca6419-5db8-40d9-bbc1-a8df302442ec/retrieve"},"pageCount":5,"title":"","keywords":[],"chapters":[{"head":"Introducción","index":1,"paragraphs":[{"index":1,"size":46,"text":"Las plantas superiores desarrollan mecanismos físicos y químicos para su defensa contra las plagas. Según el caso, estas defensas pueden estar dentro del vegetal sano o ser inducidas en él por el ataque del artrópodo. Estas defensas son variables y pueden ser modificadas por factores ecológicos."},{"index":2,"size":66,"text":"Con más frecuencia, los mecanismos físicos están presentes en el vegetal sano, aunque en algunos casos, como en la formación de callo, pueden ser inducidos por la plaga. Estos mecanismos afectan mucho el establecimiento de un artrópodo en la planta, en especial, los aspectos del comportamiento de éste que prevalecen durante la elección que él hace de la planta hospedera y cuando se establece sobre ella."},{"index":3,"size":61,"text":"La defensa química es el mecanismo más eficaz y frecuente en especies vegetales (Bell, 1974), ya que las sustancias del metabolismo secundario son las que ejercen mayor acción ambiental. Según Fraenkel (1969), estas sustancias son, principalmente, compuestos con una función de defensa y tienden a dar a la planta características repulsivas o tóxicas, lo que afecta el crecimiento de los insectos."},{"index":4,"size":166,"text":"Se les atribuye a estas sustancias la calificación de secundarias porque cada familia está restringida a un grupo limitado de plantas y porque parece que éstas, generalmente, no intervienen en los procesos bioquímicos de base común en la mayoría de las plantas. Entre las sustancias secundarias se incluyen alcaloides, esteroides, terpenoides, compuestos fenólicos (flavonoides y taninos, entre otros), compuestos cianhídricos o algunos derivados azufrados (linamarina, glucosinolatos, etc.), y también otros compuestos orgánicos cuyas funciones metabólicas dentro de las plantas no están bien definidas (Robinson, 1974;Beck y Reese, 1976). Whittaker (1970) propone el término aleloquímico para algunas sustancias secundarias que se definen, en las interacciones planta-insecto, como sustancias producidas por la planta y que afectan marcadamente el crecimiento, la supervivencia y el comportamiento o la biología del insecto. La producción de fitoalexinas (sustancias químicas sintetizadas por la planta e inducidas por la presencia de un cuerpo extraño a la planta, generalmente un microorganismo), compuestos atractivos, repulsivos, fagorepulsivos, inhibidores y compuestos tóxicos son algunos ejemplos de interacciones aleloquímicas."},{"index":5,"size":20,"text":"En la literatura general se registra que Manihot esculenta Crantz (Euphorbiaceae) presenta mecanismos físicos y químicos contra plagas de artrópodos."}]},{"head":"Mecanismos Físicos","index":2,"paragraphs":[{"index":1,"size":63,"text":"En la resistencia de la yuca contra especies de trips se demostró claramente que la pilosidad de la hoja contribuye a la defensa de la planta contra estos insectos y que un aumento de la pubescencia foliar permite un incremento de la resistencia de la yuca a los trips, ya que molesta sus procesos de establecimiento sobre plantas (Schoonhoven, 1974;Bellotti y Schoonhoven, 1978)."},{"index":2,"size":71,"text":"En el estudio de las interacciones de la yuca y el piojo harinoso Phenacoccus manihoti Matile-Ferrer (Homoptera: Pseudococcidae), se evidenció una reacción muy rápida y común en muchas especies vegetales: se trata de la formación de callo (polímero de ß(1,3)-D-glucopiranosa, Figura 14-1) al contacto de los estiletes del piojo (Calatayud et al., 1996). Esta reacción constituye una cicatrización del floema y, por ende, perturba la alimentación sostenida de este insecto floemófago."},{"index":3,"size":95,"text":"Otro mecanismo físico de la planta, que molesta el comportamiento alimenticio de P. manihoti, es la pared vegetal. Un análisis de los compuestos secundarios presentes en los líquidos intercelulares de las hojas de yuca ha mostrado que los ácidos fenólicos están fuertemente implicados en el establecimiento del piojo harinoso sobre la planta (Calatayud et al., 1994a). Este resultado corrobora que los ácidos fenólicos, precursores de la síntesis de compuestos acoplados a pectinas de la pared vegetal, podrían constituir factores mayores de interacciones con las enzimas salivares del insecto y, por ende, molestar su comportamiento alimenticio."},{"index":4,"size":37,"text":"Además, el nivel de estos ácidos fenólicos disminuye fuertemente durante épocas secas, lo que explica, en parte, el aumento de la población natural de P. manihoti en el campo durante la sequía (Calatayud y Le Rü, 1995)."}]},{"head":"Mecanismos Químicos","index":3,"paragraphs":[{"index":1,"size":192,"text":"En las raíces, la cianogénesis puede constituir una defensa de la yuca contra la chinche de la viruela Cyrtomenus bergi Froeschner (Hemiptera: Cydnidae). En efecto, se demostró que el HCN liberado por el ataque de este insecto en las raíces juega un papel repulsivo y que variedades con bajos niveles de HCN sufren, generalmente, un ataque más severo del insecto que las variedades con altos niveles de HCN (Castaño et al., 1985;Bellotti y Riis, 1994;Riis, 1997;Bellotti et al., 1999). Figura 14-1. Microfotografía de un corte de tejido de hoja de yuca infestada por Phenacoccus manihoti. El corte (que muestra una célula del floema) fue tratado con el anticuerpo policlonal específico contra (anti-) la sustancia β(1,3)-D-glucopiranosa, constitutiva del callo (ca). Esta reacción hace visibles las partículas de oro (puntos negros en el callo) que contiene el anticuerpo. El callo es una respuesta de la célula a la perforación que hizo el insecto (flecha negra) en su pared celular primaria pw), con el fin de taponarla y evitar así el drenaje del plasmolema (pa) y la muerte de la célula. Estos elementos (callo, perforación, plasmolema) se encuentran en la zona de nutrición del insecto."},{"index":2,"size":11,"text":"FUENTE: Calatayud y Múnera, 2000 (adaptado de Calatayud et al., 1996)."}]},{"head":"(pa) (ca) (pw)","index":4,"paragraphs":[{"index":1,"size":44,"text":"Sin embargo, por varias razones la cianogénesis no constituye un mecanismo implicado dentro de la defensa de la yuca al piojo harinoso P. manihoti. La linamarina misma no es tóxica a P. manihoti y parece ser más un fagoestimulante (Calatayud et al., 1994a;1994b;Calatayud, 2000)."},{"index":2,"size":74,"text":"En condiciones naturales, el insecto posee un complejo enzimático capaz de hidrolizar la linamarina (Calatayud et al., 1995); sin embargo, la linamarasa de P. manihoti no parece provenir del insecto mismo, sino de bacterias contenidas en su tracto digestivo (Calatayud, 2000). Los niveles de HCN que se pueden encontrar dentro de su tracto digestivo no son tóxicos al insecto, ya que posee un sistema eficaz de excreción o de detoxificación (Calatayud et al., 1994b)."},{"index":3,"size":62,"text":"Además, la localización en los tejidos vegetales de la linamarasa difiere de la de su substrato; la linamarina (Pancoro y Hughes, 1992); esto, y el hecho de que los procesos de penetración de los estiletes de P. manihoti no inducen a casi ninguna herida (Calatayud et al., 1994a), hace poco probable la iniciación de la cianogénesis dentro de las interacciones yucapiojo harinoso."},{"index":4,"size":52,"text":"Aunque no se evidenciaron alcaloides en la yuca, algunos flavonoides glicosilados fueron detectados (Calatayud et al., 1994b); entre ellos, la rutina (Figura 14-3), cuya ausencia en plantas es más significativa que su presencia (Harborne y Williams, 1975), demostró que afecta el crecimiento y desarrollo de P. manihoti (Calatayud et al., 1994b;Calatayud, 2000)."},{"index":5,"size":128,"text":"Además, se determinó que una de las respuestas de defensa de la yuca contra P. manihoti se manifiesta por un incremento del nivel de rutina. Este incremento varía según la Hidroxinitrilo-liasa CH 3 CH 3 Figura 14-2. Fórmula química de la linamarina y esquema de la cianogénesis que permite la liberación de HCN por acción de la linamarasa (A) y de la hidroxinitrilo-liasa (B). estación y es menos fuerte durante épocas secas, lo que explica, en parte, el aumento de la población natural de P. manihoti en el campo durante la sequía (Calatayud et al., 1994c). Sin embargo, el efecto negativo de la rutina sobre el crecimiento y el desarrollo de P. manihoti no parece resultar de una acción tóxica al insecto sino más de una acción fagorepulsiva."}]},{"head":"Conclusiones","index":5,"paragraphs":[{"index":1,"size":44,"text":"En M. esculenta, las defensas naturales a las plagas de artrópodos, descritas en la literatura, parecen afectar particularmente el establecimiento o la alimentación sostenida (fagorepulsivas) de la plaga en la planta por mecanismos de defensa física (pilosidad, producción de callo) o química (HCN, rutina)."},{"index":2,"size":66,"text":"Ningún ejemplo de la literatura general ha mostrado claramente un efecto tóxico de una variedad de yuca contra sus plagas o ha indicado la presencia de una molécula tóxica contra el desarrollo y crecimiento de ellas; esto se explica, en parte porque no se ha desarrollado mucho la resistencia varietal para controlar varias plagas de artrópodos de la yuca (Bellotti y Schoonhoven, 1978;Bellotti et al., 1999)."},{"index":3,"size":38,"text":"La búsqueda de moléculas tóxicas a plagas de la yuca debe ser realizada a partir de especies silvestres o de otras especies vegetales y de organismos vivos (p. ej., bacterias), para utilizarlas en un programa de ingeniería genética."}]},{"head":"Agradecimientos","index":6,"paragraphs":[{"index":1,"size":18,"text":"Los autores expresan su agradecimiento a Ana Milena Caicedo por su lectura crítica y sus sugerencias al manuscrito."}]}],"figures":[{"text":"FUENTE FUENTE: Calatayud y Múnera (2000). "},{"text":"de la Yuca a las Plagas de Artrópodos 1 Paul-André Calatayud* y Diego Fernando Múnera**  "}],"sieverID":"65c2bf0d-3ad3-4028-bc37-5afc56bfe8e5","abstract":""}

data/part_4/0776f3510eccea352fbce2587d609b0a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0776f3510eccea352fbce2587d609b0a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d899b182-d92c-4853-b7f8-9e7849f2aa38/retrieve"},"pageCount":60,"title":"Eco Health -One Health • Ecosystem approaches to public health issues acknowledge the complex, systemic nature of public health and environmental issues, and the inadequacy of conventional methodologies for dealing with them. David","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":36,"text":"• One Health is the collaborative effort of multiple disciplines working locally, nationally, and globally, to address critical challenges and attain optimal health for people, domestic animals, wildlife, and our environment One Health Commission (http://www.onehealthcommission.org/ )"},{"index":2,"size":27,"text":"• The One Health concept is a worldwide strategy for expanding interdisciplinary collaborations and communications in all aspects of health care for humans and animals. One Health"}]},{"head":"Introduction: Ecohealth Theory","index":2,"paragraphs":[{"index":1,"size":5,"text":"• Based on 6 principles:"},{"index":2,"size":3,"text":"• Systems thinking"},{"index":3,"size":6,"text":"• 4 interacting subsystems influence health"}]},{"head":"Social","index":3,"paragraphs":[]},{"head":"Political","index":4,"paragraphs":[]},{"head":"Economic","index":5,"paragraphs":[]},{"head":"Ecological","index":6,"paragraphs":[{"index":1,"size":9,"text":"An approach to understand complex systems (socio-economic, socioecological ect)"}]},{"head":"Introduction: Ecohealth Practice","index":7,"paragraphs":[{"index":1,"size":97,"text":"• System thinking: System thinking suggests that the way to understand a system is to examining the linkages and interactions between the elements that make up the system. • Knowledge to action: Knowledge to action refers to the idea that knowledge generated by research is then used to improve health and well-being through an improved environment. The EcoHealth Resource Centre takes a transdisciplinary, EcoHealth/One Health approach to bring together health, social, economic, and ecological expertise to support efforts to achieve sustainable improvements in health, well-being, and social equity through research, capacity building, and communication in Southeast Asia. "}]},{"head":"Chiang Mai University","index":8,"paragraphs":[]},{"head":"EHRC -General information","index":9,"paragraphs":[]}],"figures":[{"text":" community, the nation, and the region.To employ a transdisciplinary, EcoHealth -One Health approach that brings together health, social,economic, and ecological expertise to support efforts to promote sustainable improvements in health, well-being, and social equity through research, capacity building, and communication in Southeast Asia. Manual: (Brainstorming, targeted group, content, assignment, lead)  Teaching material for faculty member to integrated with the existing undergraduate course  Key academic actors  Level o Executive level: dean meeting o Faculties: head of department  Media: e-office, brochure, agenda in meeting Academic community learning "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Policies Agroecosystem health Animal Health Vet Pub Health INTEGRATIVE APPROACH Wildlife health Plant health ILRI EcoZD project - Increase the knowledge, skills and capacity of research and infectious disease control personnel in SE Asia to understand the risks and impacts of Zoonotic Emerging Infectious Diseases (ZEIDs) and how feasible options can best be implemented and adapted. ILRI EcoZD: Overview ILRI EcoZD: Overview & key components ILRI EcoZD start-up issues -challenges Eco Health -One Health Resource Centre ILRI EcoZD: Overview ILRI EcoZD: Overview & key components ILRI EcoZD start-up issues -challenges Eco Health -One Health Resource Centre • Transdisciplinarity inclusive vision of health problems by scientists from multiple disciplines, community and policy actors • Participation aims to achieve consensus and cooperation within community and scientific and decision-making groups; • Equity involves analyzing the respective roles of men and women, and various social groups; • Sustainability: ecohealth research should aim to make ethical, and lasting changes which are environmentally sound & socially acceptable. Human health Societies, Behaviour, Cultures, Political situation, Crisis/Disasters Education. Poverty, Economies, Regulations, Institutions, Governance & Overview, opportunities, case studies  Regional: Cambodia, Laos, Thailand, Viet Nam, Indonesia, PR China (Yunnan) Human Resources  Appraisal & Consultative Process  Scoping Study: Questionnaire survey of representatives from 10-15 key institutions (PH, Vet, Social Science) countries • Establishment of two Eco Health Resource Centres at • Networking with other One Health, EcoHealth initiatives Technical (proposal writing/implementation/methodological/ analysis/paper) EHRC concept One World/One Medicine   Broad scope vs. H5N1 Universitas Gadja Mada Eco Health EcoHealth Resource center at  Two-dimensional capacity-building requirement  One Health Mada (UGM) in Indonesia Novel approaches v \"classical\" vet science Chiang Mai University (CMU) and Universitas Gadjah Scope of EcoZD 'Carte blanche' v flexible adaptive/consultative approach Priority zoonoses +/-ZEID (country perspective) Eco Health hub for the region Learning by doing  Medics & vets (clinical / lab / epi) Quantitative v Qualitative  Researchers, Decision Makers, Communities Capacity building on Eco Health  Objective: • Innovative Eco Health research underway in all 6 partner Biomedical v Social Sciences Level of counterparts (senior/junior) focussing on outcomes Identifying Champions (to implement & to mentor) -2 key universities in the region  Outcome Mapping: assists with formulating action plans Supply & Demand  Allocation of time  Language What language we are speaking…  Idea: EcoHealth-OneHealth Resource Eg Latin America/ Eco Salud  'Lost in translation' Establishment of two Eco Health Resource Centres center at Chiang Mai University • Transdisciplinarity inclusive vision of health problems by scientists from multiple disciplines, community and policy actors • Participation aims to achieve consensus and cooperation within community and scientific and decision-making groups; • Equity involves analyzing the respective roles of men and women, and various social groups; • Sustainability: ecohealth research should aim to make ethical, and lasting changes which are environmentally sound & socially acceptable. Human health Societies, Behaviour, Cultures, Political situation, Crisis/Disasters Education. Poverty, Economies, Regulations, Institutions, Governance & Overview, opportunities, case studies  Regional: Cambodia, Laos, Thailand, Viet Nam, Indonesia, PR China (Yunnan) Human Resources  Appraisal & Consultative Process  Scoping Study: Questionnaire survey of representatives from 10-15 key institutions (PH, Vet, Social Science) countries • Establishment of two Eco Health Resource Centres at • Networking with other One Health, EcoHealth initiatives Technical (proposal writing/implementation/methodological/ analysis/paper) EHRC concept One World/One Medicine   Broad scope vs. H5N1 Universitas Gadja Mada Eco Health EcoHealth Resource center at  Two-dimensional capacity-building requirement  One Health Mada (UGM) in Indonesia Novel approaches v \"classical\" vet science Chiang Mai University (CMU) and Universitas Gadjah Scope of EcoZD 'Carte blanche' v flexible adaptive/consultative approach Priority zoonoses +/-ZEID (country perspective) Eco Health hub for the region Learning by doing  Medics & vets (clinical / lab / epi) Quantitative v Qualitative  Researchers, Decision Makers, Communities Capacity building on Eco Health  Objective: • Innovative Eco Health research underway in all 6 partner Biomedical v Social Sciences Level of counterparts (senior/junior) focussing on outcomes Identifying Champions (to implement & to mentor) -2 key universities in the region  Outcome Mapping: assists with formulating action plans Supply & Demand  Allocation of time  Language What language we are speaking…  Idea: EcoHealth-OneHealth Resource Eg Latin America/ Eco Salud  'Lost in translation' Establishment of two Eco Health Resource Centres center at Chiang Mai University 18 18  "}],"sieverID":"bffd2f03-0812-4376-8ba9-5b0f577d1052","abstract":"The Ecohealth approach focuses above all on the place of human beings within their environment. It recognizes that there are inextricable links between humans and their biophysical, social, and economic environments, and that these links are reflected in a population's state of health. International Development Research Centre (IDRC)• EcoHealth is an emerging field of study researching how changes in the earth's ecoszstems affect human health. It has many prospects. EcoHealth examines changes in the biological, physical, social and economic environments and relates these changes to human health. Wikipedia."}

data/part_4/08095e10e4acd1c0bc761bb906134637.json

@@ -0,0 +1 @@
+{"metadata":{"id":"08095e10e4acd1c0bc761bb906134637","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/4eb2cf45-b18d-47a1-a103-fe36ca66d65d/retrieve"},"pageCount":24,"title":"","keywords":[],"chapters":[{"head":"TRANSFER OF TECHNOLOGY MODELS (TOTEMS)","index":1,"paragraphs":[{"index":1,"size":74,"text":"Transfer of Technology Models (TOTEMs) are focussed educational tools providing relevant information and distance training on one specific area of bamboo/rattan management, processing or utilization. They are a means of technology transfer between similar regions throughout the world, with the emphasis on South-South transfer for livelihood development. They enable those involved in the management and use of bamboo and rattan resources to more efficiently and effectively develop and use skills relating to these resources."},{"index":2,"size":101,"text":"TOTEMs are primarily intended as practical information resources and teaching aids for those at the local extension level in their communities, who can utilize them to assist local community development. Each TOTEM consists of a detailed written report of the technology, a PowerPoint presentation, a film, and, where relevant, a set of technical photographs. They also include information on target users, financial analyses of sample set-ups from the partner country preparing the report and information on where to source particular technologies (such as equipment). The TOTEM thus provides all the information required for establishing similar technologies within interested countries and regions."},{"index":3,"size":34,"text":"• The report contains all the technical details of the particular processes involved, as well as other relevant information for establishing the technology such as costs of business establishment, running costs and cash flows."},{"index":4,"size":28,"text":"• The PowerPoint presentation contains details of the relevant technologies and their applications, and is intended to provide an overview of the potential of the technology for development."},{"index":5,"size":23,"text":"• The film provides a visual guide to the processes involved and helps to bring them alive in the minds of the learners."},{"index":6,"size":200,"text":"The different parts of the TOTEM are targeted at slightly different audiences, via the local extension workers. The report and film are intended to be the main means of extension to the individuals and communities who will implement the technology and who will directly benefit from it. The PowerPoint presentation is primarily intended as a tool for the extension worker to sell the technology and its role in development to those who provide the infrastructural, policy and financial support for its implementation, such as government departments, donors and NGOs. There is considerable flexibility, however. Local extension workers will be able to incorporate the TOTEMs in their own work as they wish and adapt and develop the TOTEM to suit their particular requirements and conditions. This TOTEM on medium and large scale bamboo plantations has been produced by Xiao JiangHua and Yang XiaoSheng at the Research Institute of Tropical Forestry, Fuyang, China. The report part of this TOTEM describes the technology for producing and establishing medium or large scale bamboo plantations for rural development in regions where bamboo is available as a raw material. It is intended to be used in conjunction with the illustrative film included in this TOTEM package."},{"index":7,"size":57,"text":"The first part of the report introduces the technology, discusses its history, its development attributes, its benefits and it's applicability. The second part of the report provides detailed information on establishing and running a medium or large-scale bamboo plantation. Appendices I and II provide financial analysis for establishing and running a medium or large scale bamboo plantation."},{"index":8,"size":29,"text":"This TOTEM is one of the first to be produced by INBAR/ RISF and your feedback is most welcome -kindly contact INBAR or RISF with your comments or suggestions."}]},{"head":"© International Network for Bamboo and Rattan 2001","index":2,"paragraphs":[{"index":1,"size":23,"text":"Note 1: This TOTEM has been edited at INBAR and differs slightly from the form in which it was received from the authors. "}]},{"head":"Medium and Large Scale Bamboo Plantations","index":3,"paragraphs":[{"index":1,"size":69,"text":"Medium and large-scale bamboo plantations are plantations too large for an individual family to manage on their own. They are thus about 1 hectare or larger and may be up to many square kilometres. They may be managed for culm production, shoot production or both. Most of the commercially productive bamboo plantations in the world are medium or large scale and they benefit from the economies of their size."}]},{"head":"General development attributes and advantages","index":4,"paragraphs":[{"index":1,"size":10,"text":"The main development attributes of the technology are as follows:"},{"index":2,"size":59,"text":"• Income generation for poor rural people • Improves and broadens farmers plant cultivation skills base, making them more able to handle shocks and empowering them with new abilities • Increasing the area of managed bamboo resources • Brings degraded land back into productivity and reduces erosion • Promotes the sustainable increased use of bamboo as a wood substitute"},{"index":3,"size":7,"text":"The main advantages of the technology are:"},{"index":4,"size":34,"text":"• It builds upon rural farmers own inherent plant-cultivation abilities and hence is easily adopted • It is extremely environmentally friendly -organic inputs such as fertiliser are better for bamboo growth than inorganic ones."}]},{"head":"Suitable agro-ecological regions","index":5,"paragraphs":[{"index":1,"size":127,"text":"The medium or large-scale bamboo plantation may be established in any bamboogrowing region of the world. Additionally tropical, subtropical and temperate regions that presently do not have natural bamboos are also suitable. There are many species suitable for different climatic conditions and some are very frost-hardy. However bamboos are not suitable for very dry areas unless irrigation is provided. Consideration will need to be given to the market for the culms produced. Species with large culms often have a wide range of uses but those with small culms have limited uses. These small species are often the most resilient, as they grow at the fringes of the natural bamboo distribution areas. Thus one needs to define suitability as suitability for the particular species one wishes to grow."},{"index":2,"size":63,"text":"The plantation of bamboo improves the physical and chemical composition of soil considerably, prevents soil erosion in river and sea banks and preserves water in soil by creating a natural water reservoir. Land productivity per unit area increases, reducing the pressure on land due to high population density. Bamboo also produces more oxygen in comparison with the same quantity of many other trees"}]},{"head":"Requirement for success","index":6,"paragraphs":[{"index":1,"size":12,"text":"The essential requirements for a successful medium or large-scale bamboo plantation are:"},{"index":2,"size":14,"text":"• Interest of local communities to plant bamboo • Land availability, ideally degraded land."},{"index":3,"size":8,"text":"• Availability of raw materials -Propagules, fertilisers, tools."},{"index":4,"size":20,"text":"• Finance for the purchase of seedlings, fertilisers, tools and equipment charges of skilled and semi-skilled labour at various stages. "}]},{"head":"Concluding remarks","index":7,"paragraphs":[{"index":1,"size":109,"text":"The bamboo sector is not easily affected by climate and environment. Related activities are environmentally friendly and do not normally require a high level of mechanisation or financial input. A good plantation can be established with the help of local untrained manpower who can be taught the necessary skills. Due to the size of the plantation it may be established as part of a coordinated regional or local bamboo development venture including bamboo processing units that the plantation could supply. In this case it may be preferable to establish it with the assistance of NGOs or state agencies to ensure the proper infrastructural facilities and linkages are in place."}]},{"head":"PART TWO THE BAMBOO MEDIUM/LARGE SCALE BAMBOO PLANTATION","index":8,"paragraphs":[]},{"head":"Introduction","index":9,"paragraphs":[{"index":1,"size":14,"text":"The main activities involved in establishing a medium or large scale bamboo plantation are:"},{"index":2,"size":5,"text":"• Selection of suitable species,"},{"index":3,"size":3,"text":"• Land selection,"},{"index":4,"size":31,"text":"• Preparation of nursery and afforestation. This involves digging, clearing the ground, planting bamboo propagules, cutting bamboo culms and applying fertilisers, • Techniques for raising seedlings and plantlets, weeding and tending."}]},{"head":"Establishing a medium or large scale bamboo plantation Selection of suitable species","index":10,"paragraphs":[{"index":1,"size":34,"text":"There are many bamboo species and varieties and over 100 of them are commonly cultivated. Depending on the genetic characters, species vary in growth and development pattern and in their response to environmental conditions."}]},{"head":"Dos and Don'ts","index":11,"paragraphs":[{"index":1,"size":11,"text":"• Understand the basic biological characters of bamboo species before selecting."},{"index":2,"size":10,"text":"• Understand the climatic features of the chosen planting site."}]},{"head":"Nursery practice","index":12,"paragraphs":[]},{"head":"Nursery site selection and preparation","index":13,"paragraphs":[]},{"head":"Dos and Don'ts","index":14,"paragraphs":[{"index":1,"size":60,"text":"• Select land preferably on the lee side of a sunny site with a gentle slope and good drainage and with abundant water resources for easy irrigation. • The soil should be porous and fertile, sandy loam or loam with a pH neutral or slightly acidic. • The groundwater lever should not be high and usually should be under 1m."},{"index":2,"size":82,"text":"• The soil should be friable to increase the ability to preserve moisture, weeds should be cleared and soil pests and insects should be eliminated. Attention at this stage to the soil will go a long way in creating favourable conditions for growth of the bamboo. • The preferred time for preparing the soil is before freezing in winter or after defrosting in spring. • Plough the site thoroughly and deeply. The best time for ploughing is at the beginning of winter."},{"index":3,"size":12,"text":"• Dig out roots and rocks, rake and level the soil well."},{"index":4,"size":26,"text":"• After ploughing the seedbed and pace can be made. Add manure or plant ash as a basal fertilizer to improve seedling growth and root development."}]},{"head":"Methods of raising seedlings and plantlets","index":15,"paragraphs":[{"index":1,"size":48,"text":"There are two kinds of plant propagation: sexual and asexual propagation. As flowering is rare in bamboo species and produces very few matured seeds, plant propagation through seedling planting can only be used for a few bamboo species such as Dendrocalamus strictus which is regularly found in flower."},{"index":2,"size":60,"text":"The common and practical method of raising new plantlets is asexual propagation. This involves taking offsets, culm (or branch) cuttings, stumps with rhizomes, and rhizomes only for direct afforestation or for plantlet propagation. Culm or branch cuttings are the most commonly used of all methods for sympodial bamboos. Some asexual methods of raising plantlets of sympodial bamboos are listed below:"},{"index":3,"size":5,"text":"a. Propagation by branch cuttings."},{"index":4,"size":44,"text":"Raising plantlets by branch cutting is mostly suitable for relative large-sized species with dominant nodal branches, such as Dendrocalamus spp., Neosinocalamus spp. and Bambusa spp. Primary and secondary branches are used in most cases and around 90 percent of them will produce new stock."}]},{"head":"b. Propagation by single-node culm cuttings.","index":16,"paragraphs":[{"index":1,"size":45,"text":"Propagation of thin-walled bamboos by culm cuttings is usually less successful as it requires efficient handling that can often be tedious and hence it is difficult for largescale production. However, it is suitable for thick-walled and large-sized species, such as Dendrocalamus latiflorus and Dendrocalamopsis grandis."}]},{"head":"c. Propagation by two-node culm cuttings.","index":17,"paragraphs":[{"index":1,"size":20,"text":"Plantlet survival rate with two-node cuttings is higher than with single-node cuttings but slightly lower than with whole culm cuttings."},{"index":2,"size":24,"text":"Raising plantlets using single or two-noded cuttings may be unsuitable for the establishment of large scale plantations because of the tedious handling procedures involved."}]},{"head":"d. Propagation by culms with rhizomes attached.","index":18,"paragraphs":[{"index":1,"size":21,"text":"This method of propagation usually achieves good survival rate and has been the best approach of propagation for the following reasons:"},{"index":2,"size":1,"text":"Advantages:"},{"index":3,"size":73,"text":"• The holes made in the culm internodes enhance sprouting of nodal buds. Using the same method without holes most of the culm buds fail to develop. • Water and nutrients absorbed by the rhizome can be transported through the linkages of each node to meet the nutritional requirements of the plantlet before rooting. This avoids failure due to the exhaustion of nutrients, as may be the case when propagating by culm cuttings."},{"index":4,"size":6,"text":"e. Propagation by whole culm cuttings."}]},{"head":"Method:","index":19,"paragraphs":[{"index":1,"size":36,"text":"In comparison with the propagation using whole culms with rhizomes attached, the operation in this case is the same, except the parent culm is simply severed at ground level and does not have the rhizome attached."}]},{"head":"Advantages:","index":20,"paragraphs":[{"index":1,"size":70,"text":"Though it produces fewer plantlets compared to culm cuttings with rhizomes attached it is less expensive in terms of labour and costs. This method is more suitable for raising plantlets at a site near the stand from which the parent culm was collected. When longdistance transportation is essential, certain measures like watering and covering with thatch or plastic film should be taken to prevent the parent culm from drying out."}]},{"head":"f. Tissue culture","index":21,"paragraphs":[{"index":1,"size":27,"text":"This is the fastest and most economical way of raising plantlets for sympodial bamboo plantations on a large scale, if the species are suitable for tissue culture."}]},{"head":"Conclusion:","index":22,"paragraphs":[{"index":1,"size":44,"text":"Ideally, propagation using branch and culm cuttings needs experienced and efficient operation and is suitable for thick-walled species, while the culm-burying method may be the suitable choice for propagating mid-sized species at a site which it is less developed in technical and economic aspects."}]},{"head":"Nursery tending during vegetative propagation","index":23,"paragraphs":[{"index":1,"size":18,"text":"The propagation with opened culm can be divided into 6 stages. These are • planting of parent culm;"},{"index":2,"size":8,"text":"• growth of new roots on parent culm;"},{"index":3,"size":5,"text":"• growth of new culm;"},{"index":4,"size":2,"text":"• rooting;"},{"index":5,"size":2,"text":"• tillering;"}]},{"head":"Planting parent culms","index":24,"paragraphs":[{"index":1,"size":54,"text":"The parent culm dries out easily after digging from the soil, so it should be kept in a shady, moist and cool location. Adequate shading and regular watering are essential when the parent culm is in storage, during transportation and after planting in the nursery, so as to improve recovery of its root system."}]},{"head":"Rooting","index":25,"paragraphs":[{"index":1,"size":33,"text":"The recovery of the parent culm's root system usually takes place 1-2 weeks after planting. Sufficient watering at the base of parent culm after planting will significantly improve its recovery and survival rates."}]},{"head":"Shooting","index":26,"paragraphs":[{"index":1,"size":83,"text":"Shoots younger than one month old do not have their own root system. It is important to prevent them from being damaged by drought and sunshine. This can be achieved by regular irrigation and keeping the original cover for lowering the ground temperature. Fertilization during this stage, at the base part of the parent culm, can improve the quantity and quality of shoots. Complete weeding should be done in time, but carefully avoiding any injury to the parent culm and the young shoots."}]},{"head":"Rooting","index":27,"paragraphs":[{"index":1,"size":68,"text":"Rooting takes place about 30 days after shooting when the new culm has completed is extension growth and has shed its sheaths and produced branches and leaves. The young plantlets without developed root systems may die easily from drought and exhaustion of nutrients in the parent culm. They develop root systems from late May to mid June. Weeding, soil loosening and fertilizing at this time will stimulate tillering."}]},{"head":"Tillering","index":28,"paragraphs":[{"index":1,"size":60,"text":"The plantlets that have already established their well-developed root system can produce 2 to 3 generations of new culms from July to November provided they have sufficient water and nutrients. The first generation of new culms appears from mid July to mid August, the second from early September to early October and the third from late October to late November."}]},{"head":"Do and don'ts","index":29,"paragraphs":[{"index":1,"size":37,"text":"• Large amounts of water and nutrients are consumed by the plantlets during this stage and one should ensure adequate supply of water and nutrients. • Fertilizers must be applied at intervals of 2 to 3 weeks."},{"index":2,"size":15,"text":"• Weeds should be removed in time to avoid them competing for water and nutrients."},{"index":3,"size":16,"text":"• The rhizome should be earthed up to a depth of 5-6cm if it is exposed."},{"index":4,"size":13,"text":"• Pest control may be needed, which is discussed later in the text."}]},{"head":"Dormancy","index":30,"paragraphs":[{"index":1,"size":20,"text":"The plantlets will be in a dormant condition from December to February and no measures are adopted during this stage."}]},{"head":"Field -planting practices","index":31,"paragraphs":[]},{"head":"Planting site","index":32,"paragraphs":[{"index":1,"size":119,"text":"Plantations should be established at sites suitable for bamboo growth and survival. For example, sympodial species are susceptible to damage by cold weather conditions and such damage will occur on some species if the temperature falls below -4. Bamboo performs well in porous, deep and fertile soil with good drainage and relatively high moisture content. Sympodial bamboo species that have dense and concentrated root systems demand particularly high levels of soil moisture and nutrients. Therefore, plantations of these species are best established on sites such as valleys, mid and lower slopes, streams and areas along rivers, reservoirs or land around ponds and homes. Plantations established on dry and infertile soils will only produce small culms with limited economic profits."}]},{"head":"Soil Preparation","index":33,"paragraphs":[{"index":1,"size":30,"text":"If dense grasses and shrubs cover the afforestation site, burning will be necessary before soil preparation. There are three methods of soil preparation: Overall preparation, strip preparation and pit preparation."}]},{"head":"Planting Season","index":34,"paragraphs":[{"index":1,"size":75,"text":"There is a local saying that plant bamboos in Feb. but plant trees in March. This is because bamboo recovers from resting in winter earlier than trees do and the rise in temperature in February is favourable for the planting of bamboos. Sympodial bamboos are usually planted from February to April and the survival of new plantlets will improve if they are planted after rains when the moisture content of the soil is fairly high."}]},{"head":"Planting Density","index":35,"paragraphs":[{"index":1,"size":58,"text":"The initial planting density depends upon site conditions and the size of the species involved. Generally, higher densities are suitable for the establishment of small-sized bamboos. Plantations established with low density will suffer from canopy exposure, low soil moisture and strong competition from weeds. This may result in poor productivity and necessitate a lot of labor during tending."},{"index":2,"size":27,"text":"Overstocking at planting will also result in low productivity from smaller plants due to the intense competition among the plantlets for light, space, soil moisture and nutrients."}]},{"head":"Transplanting","index":36,"paragraphs":[{"index":1,"size":100,"text":"Plantlets propagated by seed or vegetative materials are ready for transplanting to the field at one year of age. Prior to field planting, the culms are cut back in the nursery to 2-3 basal nodes. The clumps are dug up and then divided into smaller clumps each containing 1 to 3 culms. After planting the root portion in thick mud or soil, they are ready for transporting and planting. Planting involves placing them upright in the planting hole, covering and firming the soil and finally earthing up the base part with loose soil to a depth of 3 to 4cm."}]},{"head":"3.","index":37,"paragraphs":[{"index":1,"size":8,"text":"Running a medium or large scale bamboo plantation"}]},{"head":"Tending bamboo shoot stands a. Inter-cropping","index":38,"paragraphs":[{"index":1,"size":110,"text":"It has been proven that inter-cropping in newly established bamboo stands increases the productivity and economic returns from the land. Crops suitable for inter-cropping in bamboo stands depend on the various local needs and conditions. These crops could be beans, watermelon, maize, cassava and green manure crops. Crops that are heavy consumers of soil nutrients, such as buckwheat and sesame seed, are not recommended. Crops should be planted not too close to the bamboo plants to avoid disturbing their growth, with taller crops being about 1 meter away. Inter-cropping with sun loving crops will not be possible when the stand canopy is dense, about 1 to 2 years after planting."}]},{"head":"b. Weeding and soil-loosening","index":39,"paragraphs":[{"index":1,"size":61,"text":"Weeds should be controlled effectively to prevent them competing with bamboos for soil moisture and nutrients. Soil-loosening in bamboo plantations is important, as maintaining a good soil structure in the stand will be beneficial to the growth of shoots and root system, as well as water conservation. Soil loosening should be done from November to February once or twice per year."}]},{"head":"c. Fertilizing and earthing-up.","index":40,"paragraphs":[{"index":1,"size":26,"text":"Results of soil chemical analysis shows that bamboo plants consume 500-700g N, 100-150g P and 200-250g K from the soil, per 100 kg fresh shoots produced."},{"index":2,"size":36,"text":"The chemical fertilizer available to bamboos quite soon after dressing, is usually applied during shooting stage. Alternatively, 37, 500 kg per hectare of organic fertilizers, such as barnyard manure or bean-cake and rape-cake, can be applied."},{"index":3,"size":104,"text":"Application of fertilizers, by placing in drills, is best done in combination with soil loosening in the winter months. The edible part of newly germinated bamboo shoots underground are very tender and delicate, with light yellowish sheath, but they become tough with green sheaths after they emerge from the soil. This can be delayed by earthing up the base of the clump at the beginning of shooting and thus increasing the size of the shoot. But in order to stimulate development of shoot buds, the soil cover should be removed to expose the bud to high temperature and light in March or early April."}]},{"head":"d. Shoot harvesting","index":41,"paragraphs":[{"index":1,"size":58,"text":"Sympodial bamboos produce shoots from May to October with peak production in July and August. Generally, the early shoots and most of those produced in the peak period are harvested, but those produced towards the end of shooting season are retained as mother culms. The operation of shoot harvesting varies with size of shoots for processing different products."}]},{"head":"Dos and don'ts","index":42,"paragraphs":[{"index":1,"size":102,"text":"• Edible shoot should be harvested before they become tough. Any delay will result in loss of quality and quantity. • Shoots produced in August and September should be retained as mother culms in order to maintain a reasonable culm-density in the clump. • Over-harvesting will result in a decline of both quality and quantity of shoots in future years and may even cause serious degeneration of the stand. • Three or four fairly distributed shoots are normally retained to develop for each clump annually. • In order to harvest high outputs, a reasonable age-structure and density of culms should be maintained."}]},{"head":"e. Pest control","index":43,"paragraphs":[{"index":1,"size":59,"text":"Insect pest problems are more significant on large-scale plantations.There are leaffeeders, sap-feeders, borers and timber pests. Many approaches to pest insect control have been developed, based on the end uses of the culms in the stands, the stands involved, the insect pest species and the extent of infestation. The general principles of pest insect control in bamboo stands are:"},{"index":2,"size":20,"text":"(1) to consider silvicultural measures as the basis, which involve appropriate tending, felling or thinning and regenerating in bamboo stands,"},{"index":3,"size":19,"text":"(2) to aim for unfavorable environment conditions for the pests and insects and make plants more resistant to them,"},{"index":4,"size":32,"text":"(3) to choose correct measures in time to prevent the population of the pest reaching epidemic levels. The main approaches to pest insect control include silvicultural measures, biological control, and behavior control."}]},{"head":"Tending bamboo timber stands a. Inter-cropping","index":44,"paragraphs":[{"index":1,"size":23,"text":"Inter-cropping is also an important procedure in tending bamboo timber stands and can be operated in the same way as for shoot-use stands."}]},{"head":"b. Fertilizing","index":45,"paragraphs":[{"index":1,"size":33,"text":"Balancing the nutritional supply by fertilization is one of the most important measures for ensuring high productivity of bamboo stands. The method of application is the same as that employed in shoot-use stands."}]},{"head":"c. Shoot retaining","index":46,"paragraphs":[{"index":1,"size":93,"text":"Retaining well-developed shoots is important in keeping the plantation at favourable culm densities and high productivity. Sympodial bamboos normally shoot from May to October. Shoots produced in the beginning and mid of the shooting season, which are strong and account for over 85% of the total in number, should be retained as much as possible to obtain quality plants. Shoots produced towards the end of the season are weaker and fewer in number and can mostly be harvested. Protective measures, if necessary, may be required to avoid damage by animals, pests and diseases."}]},{"head":"d. Reasonable felling","index":47,"paragraphs":[]},{"head":"Objectives:","index":48,"paragraphs":[{"index":1,"size":11,"text":"Felling is done with the aims of • harvesting bamboo timber,"},{"index":2,"size":5,"text":"• controlling pests and diseases,"},{"index":3,"size":12,"text":"• removing suppressed plants and • maintaining good culm age-structure and density."},{"index":4,"size":19,"text":"The time of felling significantly influences plant growth and timber quality. Suitable culm ages for felling vary with species."}]},{"head":"Dos and Don'ts","index":49,"paragraphs":[{"index":1,"size":40,"text":"• Felling should be done in late autumn and winter when the physiological processes in the plants are relative inactive • Avoid felling during the shooting season, or it will cause the death of new shoots or less developed culm."},{"index":2,"size":34,"text":"• Avoid felling during growing season. This will cause considerable loss of nutrients due to profuse exudation from the cut stumps, and the harvested timber is susceptible to infestation from fungi and boring insects."}]},{"head":"e. Pest control","index":50,"paragraphs":[{"index":1,"size":35,"text":"The conditions influencing pest and disease incidence in timber-use stands are similar to those in shoot use stands, and the control measures employed are also similar.  The total cash flow will be 1,3300,000 RMB Yuan"}]},{"head":"Explanation of assumptions used in calculating financial aspects","index":51,"paragraphs":[{"index":1,"size":22,"text":"Flow capital is calculated based on requirements of reserve, working capital, Bankroll for finished products, Balance of bankroll and Bankroll in currency."},{"index":2,"size":7,"text":"Reserve is calculated based on following equation: "}]}],"figures":[{"text":"Note 2 : All calculations are in Renminbi (RMB). At the time of writing RMB 8.25 = US$ 1. "},{"text":" working capital is calculated based on following equation: Bankroll for finished products is calculated based on following equation: Bankroll for finished products = quantity of products sold daily x unit cost x days Calculating Balances of bankroll and bankroll in currency are similar with bankroll for finished products.Cost of products = cost of raw materials + wages + management fee + selling fee + depreciation charge + other cost reserve "},{"text":"Table 4 The working capital requirements (×10 3 RMB Yuan)Outputs are mainly bamboo shoots, bamboo culms and by-products including branches, leaves etc. The annual output value in a re-afforestation circle is listed as follows (see table5). Years Annual output Fertilizer Seedlings transport land Salary YearsAnnual outputFertilizerSeedlingstransport landSalary     or   or     plantlets   plantlets  Shoots Culms     ShootsCulms First   180 1,200 50 750 4,000 First1801,200507504,000 Second   180  50 750 1,950 Second180507501,950 Third   180  50 750 1,060 Third180507501,060 Forth 6,000 3,000 180  50 750 1,060 Forth6,0003,000180507501,060 Fifth 6,600 3,400 180  50 750 1,060 Fifth6,6003,400180507501,060 Sixth 9,000 4,500 180  50 750 1,060 Sixth9,0004,500180507501,060 Seventh 9,000 4,500 180  50 750 1,060 Seventh 9,0004,500180507501,060 Eighth 9,000 4,500 180  50 750 1,060 Eighth9,0004,500180507501,060 Ninth 9,000 4,500 180  50 750 1,060 Ninth9,0004,500180507501,060 Tenth 9,000 4,500 180  50 750 1,060 Tenth9,0004,500180507501,060 Eleventh 9,000 4,500 180  50 750 1,060 Eleventh 9,0004,500180507501,060 Twelfth 9,000 4,500 180  50 750 1,060 Twelfth9,0004,500180507501,060 Thirteenth 9,000 4,500 180  50 750 1,060 Thirteenth 9,0004,500180507501,060 Fourteenth 9,000 4,500 180  50 750 1,060 Fourteenth 9,0004,500180507501,060 Fifteenth 9,000 4,500 180  50 750 1,060 Fifteenth 9,0004,500180507501,060 Years Management Equipment Others total  YearsManagementEquipmentOtherstotal    maintenance    maintenance First 400  20 30 6,630  First40020306,630 Second 400  20 30 3,380  Second40020303,380 Third 400  20 30 2,490  Third40020302,490 Forth 400  20 30 2,490  Forth40020302,490 Fifth 400  20 30 2,490  Fifth40020302,490 Sixth 400  20 30 2,490  Sixth40020302,490 Seventh 400  20 30 2,490  Seventh 40020302,490 Eighth 400  20 30 2,490  Eighth40020302,490 Ninth 400  20 30 2,490  Ninth40020302,490 Tenth 400  20 30 2,490  Tenth40020302,490 Eleventh 400  20 30 2,490  Eleventh 40020302,490 Twelfth 400  20 30 2,490  Twelfth40020302,490 Thirteenth 400  20 30 2,490  Thirteenth 40020302,490 Fourteenth 400  20 30 2,490  Fourteenth 40020302,490 Fifteenth 400  20 30 2,490  Fifteenth 40020302,490  "},{"text":"Table 5 The annual total output values in a re-afforestation cycle (×10 3 RMB Yuan) The total output value during a cycle of the sympodial bamboo plantation is 154 million RMB Yuan.CASH FLOWThe cash flow is mainly constituted of following table 6: Table6Cash flow requirement and component (×10 3 RMB Yuan) Year Yuan YearYuan First 0 First0 Second 0 Second0 Third 0 Third0 Fourth 9,000 Fourth9,000 Fifth 10,000 Fifth10,000 Sixth 13,500 Sixth13,500 Seventh 13,500 Seventh13,500 Eighth 13,500 Eighth13,500 Ninth 13,500 Ninth13,500 Tenth 13,500 Tenth13,500 Eleventh 13,500 Eleventh13,500 Twelfth 13,500 Twelfth13,500 Thirteenth 13,500 Thirteenth13,500 Fourteenth 13,500 Fourteenth13,500 Fifteenth 13,500 Fifteenth13,500 Total 1,54,000 Total1,54,000  "}],"sieverID":"f9e1dbad-0aad-43a5-b3df-32f6659802f5","abstract":""}

data/part_4/0839bd06499529108e3b5593bb68f1c8.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0839bd06499529108e3b5593bb68f1c8","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/e373fc42-2ce2-4e23-b9bf-90e53690d7ad/retrieve"},"pageCount":16,"title":"Assessing Small-holder Participation in Value Chains: the case of vegetables in Honduras and El Salvador 1 Authors","keywords":[],"chapters":[{"head":"Background","index":1,"paragraphs":[{"index":1,"size":138,"text":"The retail sector throughout the world has seen rapid changes over the past decade. These changes are evidenced by the growing participation of what can be considered modern marketing channels for the delivery of food products to increasingly urban populations (Reardon Food Policy). Hallmarks of this rapid change include a shift from traditional supply chains and markets (e.g. wholesale or wet markets) towards increasingly close systems of supply through which final retailers exercise a much greater degree of control not only over the quality and quantity of product but also over the governance of the entire supply chain. The Central American region is no exception to the rule as is evidenced by previous work carried out in the region on this topic by Balsevich, Berdegué and Reardon (2006), Reardon and Berdegué (2002), Jano et. al (2004) among others."},{"index":2,"size":113,"text":"1 . This work was financed by a grant from the ESAE Division of the Food and Agriculture Organization of the United Nations (FAO) and carried out within the context of a regional learning alliance on rural enterprise development (www.alianzasdeaprendizaje.org). 2 . Senior Research Fellow, Rural Agroenterprise Development Project, CIAT ([email protected]) 3 . Consultant, Agropyme Program, Swisscontact Honduras 4 . Technician, Agriculture and Environment Program, Catholic Relief Services El Salvador. 5 . Advisor, Agropyme Program, Swisscontact Honduras 6 . Technician, Agriculture and Environment Program, Catholic Relief Services El Salvador. 7 . Technician, Agriculture and Environment Program, Catholic Relief Services El Salvador. 8 . Manager, Agriculture and Environment Program, Catholic Relief Services El Salvador."},{"index":3,"size":180,"text":"Work carried out by the research teams in Honduras and El Salvador supports the trends highlighted by existing literature. In the case of El Salvador, supermarkets have grown 14.7% during the last 10 years to a total of 132 retail outlets at a national level that manage approximately 39% of the overall market for food (CRS, 2005). Additional characteristics in El Salvador include the fact that nearly 65% of the products currently sold in supermarkets are imported, principally from the United States or from other Central American countries with total agricultural imports totaling approximately 33.1 million US dollars in 2002 (ibid). Recent studies carried out by USDA estimate a total value for supermarket sales in El Salvador between 276 and $375 million yearly. Across the border in Honduras the situation is similar. During the period at of 1999 to 2003, USDA reports that supermarkets expanded from 41 to 51 outlets, with total sales moving from 142 million to 267 million US dollars and the overall participation of supermarkets in the food sector reaching 43% (USDA, 2003 cited in Agropyme, 2005)."},{"index":4,"size":338,"text":"In both countries one of the major supermarket players is the Central American Retail Holding Corporation (CARHCO) composed by two national supermarket chains in Costa Rica and Guatemala and an international firm. According to the CARHCO web site, the holding company currently possesses 354 supermarkets across the isthmus making it by far and away the dominant player in this market. During the period of study, the previous international supermarket chain --Ahold from the Netherlands --sold its 33% share in CARHCO to Wal-Mart from the United States. Under its initial configuration, CARHCO initiated processes focused on modernizing and centralizing their procurement activities. Among the initiatives undertaken were the expansion of specialized wholesalers into both Honduras and El Salvador, the identification of suppliers willing and able to meet CARHCO standards and some activities focused on building of those players capacities. As this process has evolved, the number of overall suppliers selling into the CARHCO network has declined while, at the same time, focusing on producers and producer organizations with the capacity to make increasingly important investments in technology, organization and logistics sufficient to meet increasing quality and consistency standards. This process is not unique Central America and has been described by Berdegué and others in diverse contexts throughout Latin America, Africa, Asia and Eastern Europe (Berdegué, 2005 andRegoverning Markets, 2004). The process of market modernization is characterized by a shift to centralized distribution systems, specialized wholesalers, selected producers, increasingly stringent private standards and labels and increasing use of international suppliers (see Graphic 1 below). This process implies important technological, organizational, logistical and financial hurdles for producers who wish to maintain their participation in this channel. In much of the developed world, this process has taken place over a span of 30 to 50 years. In the developing world, this process is taking place in anywhere from eight to 12 years. The default result of this collision between producer skills and capabilities and rapid changes in the market dynamic tends to be exclusion especially of the smaller or less organized producers."},{"index":5,"size":207,"text":"The results of the desk study in both Honduras and El Salvador clearly show how this process is moving in both countries. The active participation of the general manager for Hortifruti in Honduras during the research process allowed a glimpse of how this process is playing out as part of a business strategy being employed by CARHCO through the identification and development of specialized producer organizations. In this case it is important to highlight that the implementation of a modernization strategy by supermarket actors is not driven by a desire to exclude small producers but rather by economic logic that favors the development of a relatively small number of highly qualified suppliers able to meet supermarket demands on a consistent basis. The remainder of the paper is structured as follows: (a) a section on the objectives of the research; (b) a brief overview of the methods employed at the field level, and; (c) a review of relevant results from the field. The paper concludes with section focusing on the critical points of the supply chain, possible strategic options to improve the participation of smallholder farmers in dynamic markets as well as reflections on the use of participatory methods and links between natural resource management and dynamic markets."}]},{"head":"Graphic 1 -Evolution of supermarket supply systems","index":2,"paragraphs":[]},{"head":"Traditional wholesalers supply indivdual stores","index":3,"paragraphs":[]},{"head":"Specialized wholesalers","index":4,"paragraphs":[]},{"head":"Time","index":5,"paragraphs":[]},{"head":"Preferred suppliers","index":6,"paragraphs":[]},{"head":"Distribution centers","index":7,"paragraphs":[]},{"head":"Private","index":8,"paragraphs":[]},{"head":"Objectives","index":9,"paragraphs":[{"index":1,"size":13,"text":"The research carried out in El Salvador and Honduras had the following objectives."},{"index":2,"size":104,"text":"Firstly, a desk study on the relative rate of expansion of supermarkets in both countries and the effects that their purchase practices are having on markets for specific vegetable crops, and, in particular key entry barriers that limit smallholder participation in these markets. Secondly, a participatory review of the supply chain for cucumber, bell pepper, tomato, broccoli, potato and lettuce focusing on price term and ends, margins, transaction costs, logistical and storage needs and quality standards. Thirdly, the identification of possible strategies to facilitate the participation of smallholder producers in vegetable supply chains linked to supermarkets bearing in mind the previously mentioned entry barriers."},{"index":3,"size":89,"text":"It is also important to mention that this work was carried out in a participatory fashion through the existing Learning Alliance network in Central America with the intention of providing development partners with access and the needed skills to carry out supply chain analysis in both Honduras and El Salvador. FAO also requested that the research team assess the usefulness of the participatory chain analysis method chosen for use (please see the methods section of this paper for more details) and provide input on how it might be improved."}]},{"head":"Methodology","index":10,"paragraphs":[{"index":1,"size":233,"text":"At the request of FAO, the method used for the participatory analysis of vegetable supply chains was adapted from work carried out previously by the Netherlands Development Organisation (SNV) as published in Van der Heyden and Camacho (2004). This method consists of three phases of analysis. In the preliminary phase of analysis, the research team defines the objectives of the study, selects the product or products to focus on and it defines the reach or scope of the analysis. In the central phase of the method, the research team analyzes the history of the supply chain, the context in which the supply chain operates, the participating direct and indirect actors, the relationships between actors and their organizations, current and projected marke conditions and, finally, the economic and financial data along the chain. The final phase of the method focuses on analysis of the resulting data, the identification of critical points and competitive advantages and the development of action strategies improve the functioning of the supply chain. A key difference in this regard, was the relative level of participation among the diverse chain actors. In Honduras, given existing links between the Agropyme program and several of the participating supermarkets, it was feasible to develop a steering committee in which there was significant participation from the leading superm chain as well as relevant government actors. In the case of El Salvador, this was not feasible."}]},{"head":"O H","index":11,"paragraphs":[{"index":1,"size":129,"text":"The product scale can be traced back to approximately the decade of the 1970s. Increasing urbanization and resulting demand for vegetable crops is the main driver for the expansion of these crops throughout the isthmus. Recently this process has been accelerated through an increasing focus on the use of fresh or healthy ingredients b urban populations which, in many cases, has been actively promoted by the supermarkets themselves through the use of various promotional strategies fo increasing overall vegetable consumption. Despite the increasing importance of these crops for the retail sector, large-scale commercial cultivation is principally confined to Guatemala and to a lesser extent Costa Rica. As mentioned previously, the lack of consistent availability of high-quality vegetable crops leads to imports by supermarke at a regional scale and beyond."},{"index":2,"size":84,"text":"A has also grown. It would be remiss, however, not to mention the important role of international development organizations in this process. Development agencies and projects have, in many cases, actively promoted the expansion or establishment of wh they consider \"higher value\" crops to complement existing food security options such as maize and beans. This focus has increased in importance as national governments and international donor agencies have turned their attention to a poverty reduction agenda particularly in countries such as Honduras and Nicaragua."},{"index":3,"size":185,"text":"A hands of small producers is the existence of sufficient technical knowledge at a nat level. In this area, work carried out by the Honduran Foundation for Agricultural Research (FHIA), the National Center for Agricultural and Forestry Technology of E Salvador (CENTA), the Pan American Agricultural School Zamorano and, to a lesser extent, national extension programs has been important. In addition to the adaptati research carried out by the aforementioned organizations, Central America also possesses a relatively well-developed network of private technology providers who facilitate farmer access to seed varieties, fertilizers, pesticides, irrigation systems a some cases, greenhouse supplies. based on land tenure patterns and existing natural advantages presented by hillside environments. Smallholder vegetable production in hillside environments benefits fro a slightly lower incidence of pest and disease problems, slightly improved access to year-round water supplies and, as a result, is less expensive in these environments. is important to note, however, that need to large-scale visual production also occurs in lower line valleys in both countries. These regions were not included in the current study principally because producers there tend to be large-scale commercial operatio"}]},{"head":"C","index":12,"paragraphs":[{"index":1,"size":66,"text":"The veget defined by public policies, access and control of infrastructure and environmental considerations. Of relevance to the present study are existing public policies in bot Honduras and El Salvador focusing on the agricultural sector. In El Salvador, the Ministry of Agriculture and Ranching (MAG) has two specific policy areas that shou kept in mind: a focus on producer association and a focus on technological innovation."},{"index":2,"size":51,"text":"In the first area, the Ministry seeks to promote associations of producers who are both profitable and competitive while, with the second, it hopes to increase the access of these associations and other producers to innovative production and post harvest technologies. Both policies are supported by activities carried out by CENTA."},{"index":3,"size":83,"text":"In Environment Strategy of Honduras for the period of 2003 to 2021. Within thi framework to improve the competitiveness of the horticultural agri-food chain was sanctioned in December of 2004. As part of this framework, the horticultural agri-f chain of Honduras was assigned a coordinator paid for by the Ministry of Agriculture and Ranching. Other laws exist on the books --such as that focused on food safety -but the implementation on a day-to-day basis in activities concerning the horticultural agri-food chain is limited."},{"index":4,"size":99,"text":"In horticultural agri-food chain in particular, both Honduras and El Salvador are signatories of the recently approved Central American Free Trade Agreement (CA with the United States. Initially actors from the horticultural agri-food chains in both countries felt that the approval of CAFTA was a step forward in terms of competitiveness. However, CAFTA also opens the door for potential agric --including vegetables --from Mexico and even the United States itself. While the full impact of CAFTA remains to be seen, this treaty more than any national level policy will define the future for many horticultural producers in the region."},{"index":5,"size":51,"text":"In well as a larger number of functioning warehouse and distribution centers. While Honduras is behind in all these areas, the majority of the show for producing areas reasonably well connected to markets. A major limitation for higher-quality products in Honduras is the relative lack of warehouse and specialized transportation available."},{"index":6,"size":68,"text":"Traditionally both countries suffered from limited communications facilities linking rural communities with major markets, however, this has changed rapidly in the las five years with the expansion of cellular phone service to many rural communities. A strong local value added or processing industry for vegetable crops exists in neither country. Farmer organizations or the supermarkets themselves carry out what little value adding does occur in the horticultural supply-chain."},{"index":7,"size":157,"text":"Finally, the production of high-quality vegetables year-round has significant ustaining ntinue to hain actors orticultural agri-food chain can be divided between direct participants banks roducer in the chain were subdivided into three categories for this study. These r ent irect fieldwork was carried out to assess the cost structures and benefits achieved by tal of five t n important caveat to this work is the relative scope of farm organization in that care ar implications for the environment. Producers need access to soils capable of s intensive production systems as well as a year-round supply of water for irrigation. In many cases, the achievement of adequate production conditions in existing environmental niches is far from easy. As a result significant investments co be made not only in small-scale drip irrigation systems but also in more appropriate soil and crop management approaches. The paper will return to the nexus between smallholders, vegetables and dynamic markets in the conclusion."}]},{"head":"C","index":13,"paragraphs":[{"index":1,"size":57,"text":"Actors in the h and indirect participants. Direct participants include producers, producer organizations, marketing and retail actors and the final consumers. In direct participants include technical and business assistance providers, researchers, and micro finance institutions, transportation providers and input suppliers. The principal focus of this research was on the direct actors in the chain and their relationships."},{"index":2,"size":71,"text":"P categories are unorganized small producers, small producers organized in produce associations and independent producers with a secure market. The discovery of a distinct business model promoted by the CARHCO group --focused on the developm of business networks around the lead farmer --led to the inclusion of the third category. The principal characteristics of each type of small vegetable producer in Honduras and El Salvador are shown below in Table 1."},{"index":3,"size":104,"text":"D the types of small holders by selling to supermarkets. Relatively more time and effort was dedicated to studying the second type of smallholder producers, those that are organized in formal producer associations (e.g. cooperatives, associations or farmer owned businesses) given in the predominance of this model within the rural development community in both Honduras and El Salvador. As a result, a to formal producer associations --three in El Salvador and two in Honduras --were reviewed in detail. Initial work was carried on the third typology of smallholder, bu given the relatively late appearance of this category there remain significant questions to be answered."},{"index":4,"size":117,"text":"A horticultural agri-food chain in both Honduras and El Salvador. In both countries was exercised to identify and study the most relevant and/or representative group of formal farmer associations active in this chain. However, when the total number of participating farmers in these organizations is compared to existing data on the total number of farmers who participate in the horticultural agri-food chain, it becomes cle that the default condition for smallholder vegetable production is no organization. These results are summarized in Table 2. The use of seedbeds in greenhouses is not necessary for carrots and potatoes. A low score implies that the seedbed is prepared next to the final plot with minimum control exercised over plant development."},{"index":5,"size":229,"text":"The farmer organizations covered by this study are presented in Table 3. Other direct actors in the horticultural agri-food chain include traders and retailers. In both Honduras and El Salvador a wide range of individuals as well as formal business are active in the chain. Several different channels for product can be identified. The more traditional market channel is comprised principally of networks of informal traders that link areas of production with regional and national markets. This market channel is characterized by cash payments, limited quality demands, important levels of social capital between actors and usually sells the final product in urban wholesale markets (e.g. wet markets) although some product is sold to smaller supermarkets as well. Some traditional traders have developed at the necessary skills and knowledge to sell a portion of their produce to specialized wholesalers and, in some cases, to supermarkets and restaurants directly. This channel represents a midpoint between the traditional system and the modern retail system. The modern retail system is comprised of diverse types of former organization --ranging from formal associations to the lead farmer model --linked into specialized wholesalers and/or directly into supermarkets, restaurants and hotels. A certain degree of competition exists between formal farmer organizations and some of the more progressive traders as both seek to sort, pack and, in some cases, add value to the horticultural products that they sell."},{"index":6,"size":50,"text":"The final direct actor in the chain is the consumer. While both countries boast a wide range of consumer types, the present study focused on consumers who purchase horticultural products from supermarkets. Table 4 provides an idea of the characteristics of this kind of consumer in the case of Honduras."},{"index":7,"size":2,"text":"Table 4."}]},{"head":"Consumer characteristics for Honduras","index":14,"paragraphs":[{"index":1,"size":2,"text":"Variable Results"}]},{"head":"Location","index":15,"paragraphs":[{"index":1,"size":33,"text":"Tegucigalpa and the Valle de Sula (the San Pedro Sula metropolitan area) concentrate more than 2 million inhabitants who demand quality fresh vegetables. Approximately 30% of the total population purchase vegetables in supermarkets."}]},{"head":"Criteria of purchase location","index":16,"paragraphs":[{"index":1,"size":4,"text":"Security, location and hygiene."},{"index":2,"size":46,"text":"Income level (Lps / month) >22,000=22%, 12,000-20,000=19%, , 8,000-12,000=23%, 5,000-8,000=6%, <5,000=30% Demographics 50% older than 40, 28% between 31 and 40, 15% beween 21 and 30, 7% under 20 years of age Market segments Low, middle and upper class with income above 3,000 Lps / month."},{"index":3,"size":30,"text":"Reasons for purchases Physiological needs and life style focused on healthy living. Recognize that the consumption of fresh produce contributes the family diet and reduces overall budget expenditures on food."}]},{"head":"Frequency of purchases Every 15 days or weekly in the afternoons","index":17,"paragraphs":[{"index":1,"size":10,"text":"Factors that influence purchases Price, quality (fresh and unblemished), hygiene."}]},{"head":"Types of products demanded","index":18,"paragraphs":[{"index":1,"size":205,"text":"The majority of demand is concentrated on fresh produce sold loose but there is demand for different presentations (tomatoes in foam trays, mini potatoes in mesh, various heads of lettuce in bags, bagged carrots, baby carrots in foam trays, peeled carrots, etc.). Source: Agropyme, 2005: 28. In addition to direct actors, there are indirect actors who provide support services necessary for the functioning of the agri-food chain. These actors include technical and business assistance providers --NGOs, development projects and producer organization themselves. In the majority of cases the technical assistance provided is focused on recommendations for crop management, post harvest processing and social and organizational aspects as well. The coverage and quality of these services is often less than optimal. In addition to these subsidized service providers, some marketing actors also provide technical assistance to farmers who supply them. This is the case when supermarkets focus on supplier development as a key factor to increase the competitiveness of their supply chains. Other indirect actors in the chain include specialized research organizations such as FHIA and Zamorano in Honduras and CENTA in El Salvador. The relatively low level of research investment in the horticulture agri-food chain is focused principally on adaptive research linked to development activities."},{"index":2,"size":143,"text":"Finally, additional indirect service providers include micro finance and formal banks, transport services and input suppliers. The provision of credit to the horticultural agrifood chain in both Honduras and El Salvador is deficient as is the case for many, if not all, rural enterprise activities. Transportation services exist in the majority of vegetable producing areas, however the quality of these services varies as is their cost. It is important to note that only farmers involved in producer organizations can count on access to specialized --e.g. refrigerated --transportation that helps guarantee the quality of their product. In both countries, there is widespread access to basic production inputs such as seeds, fertilizers and pesticides. Some more specific technologies such as drip irrigation and simple greenhouses are more difficult or costly to come by and us tend to reach the small holders only through producer organizations."},{"index":3,"size":59,"text":"An important differentiating factor between services provided by development actors and those provided by chain actors themselves is the relative importance of external subsidies to cover costs. Normally the provision of services by development actors requires significant and ongoing subsidies. Services provided by chain actors directly (e.g. embedded services) are paid for directly or indirectly by the chain itself."}]},{"head":"Markets","index":19,"paragraphs":[{"index":1,"size":81,"text":"The vegetable crops included in the study are highly dynamic. Comparisons can be made between markets for tomatoes and bell peppers and Honduras and El Salvador while, and Honduras, additional work was carried out on other horticultural crops such as carrots, broccoli, lettuce, and potatoes. The divergence between crop study in the two countries is based principally on the importance of these crops in the supermarket supply chain. A brief review of tomatoes and bell peppers shows the following market information."},{"index":2,"size":157,"text":"For tomatoes the apparent consumption in El Salvador is nearly 80,000 metric tons per year. Of this total, 66.7% are sold through informal market channels, 11.3% through supermarkets and the remainder consumed by the institutional and processed food markets. Approximately 65% of all tomato consumed in El Salvador is imported from neighboring countries such as Guatemala and Honduras. Imports of increased at an annual rate of 37% over the last three years indicating the insufficiency of local supply (CRS, 2005). In Honduras, the members of the supply chain analysis steering committee considered tomato to be a high risk crop for small holders. According to the general manager of COHORSIL, one of the formal farm associations included in the study, only medium to large producers with significant access to capital can produce this crop successfully. Demand for tomato and Honduras is approximately 114 metric tons per week. Supermarkets account for 28.5 metric tons of that total (Agropyme, 2005)."},{"index":3,"size":101,"text":"In the case of bell pepper, the Salvadoran market consumes 16,000 metric tons yearly. A total of 78.9% of this product is sold through informal market channels while 9% is sold through supermarkets. The remaining percentage is sold through prepared food. The dominant actor in this supply chain is the wholesaler who manages approximately 96% of all national consumption. Approximately 59% of all bell pepper consumed in El Salvador is produced nationally while 41% is imported from neighboring countries (CRS, 2005). In Honduras, 95 metric tons of bell peppers are consumed weekly with 23.5 tons being sold by supermarkets (Agropyme, 2005)."},{"index":4,"size":102,"text":"In both countries in the majority of tomatoes and bell peppers are sold individually but there is an increasing tendency for specialized wholesalers and producer organizations to explore the possibility of selling prepackaged trays of both products. In addition there are attempts at branding these products in both countries. The grades and standards that are applied to these products by supermarkets vary depending on, among other factors, the availability of the product in the market, the relationship with the supplier and the going price. Interviews with producer organizations support the idea that supermarkets actively adjust their grades and standards to their benefit."}]},{"head":"Economic analysis","index":20,"paragraphs":[{"index":1,"size":92,"text":"The economic analysis focused on the distribution of returns on investment among actors along the supply chain and the relative differences between diverse marketing channels. Tables 5 and 6 (see below) some of the returns on investment in El Salvador and Honduras. One of the producer organizations in El Salvador --ACOPO --is not included in this analysis because the products they sell the supermarkets are different --baby carrots, lettuce and radishes --as well as being marketed as organic. The data in both tables is presented in US dollars per kilo of product."},{"index":2,"size":304,"text":"In general terms, the chain dynamics during the period of study showed the relative proximity of prices among different chain actors acted in diverse market channels. The local trader who buys at the field level is competing with the producer organization while the specialized wholesaler/supermarket channel competes with the traditional wholesaler in urban centers. Despite the apparent competition, each commercial channel has varying demands in terms of quality and consistency. Specialized wholesalers are able to demand a higher price from supermarkets for similar product principally due to investments in refrigeration, grades and standards and consistent supply. While there is not a clear shift to only use specialized wholesalers, the data indicates that the tendency in both Honduras and El Salvador is for supermarkets to move in this direction.    The preceding data should be treated carefully as it was not possible during the study to identify the net margins for supermarkets and specialized wholesalers. As a result the apparent lion's share of the final consumer prize that they receive may not be entirely accurate due to product perishability and other factors. During workshops with supermarket buyers in Honduras, spoilage of between 8 to 10% for tomato and peppers was considered average (Agropyme, 2005: 104-5) What is interesting to highlight in these tables, is the relatively low level of participation in the final consumer price of producer organizations: in Honduras, 4% of the final price and in El Salvador 6%. Reflecting on these results with members of the supply chains themselves, the question of the economic viability of existing producer organization models was raised. The combination of relatively low volumes of product plus low margins means that many of the farmer organizations included in the study require ongoing subsidies to cover operational costs despite significant support from donor and development agencies over long periods of time."}]},{"head":"Critical points in the supply chain","index":21,"paragraphs":[{"index":1,"size":82,"text":"At the end of the preceding analysis critical points in the supply chain were identified by participating actors. For each apparent critical point, a problem tree was developed to analyze the causes and effects that this issue had on supply chain competitiveness and sustainability. After much discussion, three major critical points were identified: (a) low levels of producer organization in the chain; (b) limited spaces for coordination and consultation among chain actors, and; (c) public policies out of step with market realities."},{"index":2,"size":52,"text":"The identification of the low level of producer organization apparent in the chain as a critical point was motivated by the fact that, despite significant investments of time and financial resources, existing producer organizations in both Honduras and El Salvador encompass significantly less than 5% of total horticultural producers in each country."},{"index":3,"size":53,"text":"Possible causes identified for the situation include limited business skills within existing producer organizations, nonreplicable organizational models (e.g. too costly in terms of time and financial resources with limited benefits) for linking small holders to dynamic markets and a general uncertainty about the benefits that small holders can expect from the supermarket channel."},{"index":4,"size":130,"text":"A second critical point was the general lack of coordination among chain actors. This generates a skewed governance structure in which the rules of the game are developed and imposed by the stronger members of the supply chain (e.g. the retailers) while other members have little or no choice but to accept. In many cases, even the more powerful actors poorly understand the effects of these rules on the long-term sustainability of the chain in the system. In addition, the low-level of coordination along the chain results in the provision of less than adequate business and enterprise development services to the chain actors themselves. A key issue in this area is the dearth of adequate financial services (e.g. credit, leasing, rapid payment, etc.) to meet the demands of the chain."},{"index":5,"size":139,"text":"A final critical point focuses on public-sector policies. As mentioned earlier in this article, both Honduras and El Salvador possess policies focused on rural and agricultural development. However, through the analysis of the supply chain it became clear that these policies are not adapting to the rapidly changing market conditions seen in both countries. Public decision-makers have little or no access to consistent and up-to-date data regarding the economic, social and environmental effects that these changes are having on rural development in their nations. As a result, policies change slowly, if at all, in a rapidly changing market environment. The key issue identified here was the need for public policy interventions focused on generating and maintaining not only food safety standards to protect consumers but also fair marketing practice standards to protect weaker members of an increasingly concentrated supply-chain."},{"index":6,"size":41,"text":"Based on these critical points, possible strategies for supply chain upgrading were developed. Table 9 below sums up the causes for each of these critical points based on data gathered during the supply chain analysis as well as the proposed strategies."},{"index":7,"size":145,"text":"A principal focus of chain upgrading in both countries is development of more effective organizational models to link small holders to dynamic markets. The producer organizations included this study are an important starting point for this analysis, however, these development driven approaches should be mixed with private-sector activities focused on supplier development. A key element here is the CARHCO model of lead farmer networks. The objective of this work should be to involve both developments and retail actors in the design of organizational models that lead to specialization among chain actors, increased transparent links between these actors, processes of horizontal and vertical strengthening between enterprises, the development of minimum administrative capacities capable of meeting chain demands and, finally, the development of a clear set of incentives to promote smallholder involvement in these agri-food chains. This work should be carried out with the participation of producer"}]}],"figures":[{"text":"Table 1 . Principal characteristics of small-scale vegetable producers in Honduras and El Salvador  Variables  Unorganized small producers Small producers in formal organisations Independent producers with a secure markets VariablesUnorganized small producersSmall producers in formal organisationsIndependent producers with a secure markets Access to technology   Access to technology Inputs 9  Low Medium Medium Inputs 9LowMediumMedium Use of seed beds or greenhouses 10 Low Medium Low Use of seed beds or greenhouses 10LowMediumLow Irrigation  Low Appropriate Appropriate IrrigationLowAppropriateAppropriate Market access    Market access conditions    conditions Packing houses No Yes No Packing housesNoYesNo Transport from the field to the packing house Can not pay costs Can pay local transportation Owns vehicle Transport from the field to the packing houseCan not pay costsCan pay local transportationOwns vehicle Market information No access Limited access, limited knowledge Good access, good knowledge Market informationNo accessLimited access, limited knowledgeGood access, good knowledge Price conditions Low and instable prices Good and stable prices Good and stable prices Price conditionsLow and instable pricesGood and stable pricesGood and stable prices Use of quality standards No Yes Yes Use of quality standardsNoYesYes Type of packaging Sacks Plastic trays Plastic trays Type of packagingSacksPlastic traysPlastic trays Technical assistance   Technical assistance Production  No access, limited knowledge Access, good knowledge No access but good knowledge based on experience. ProductionNo access, limited knowledgeAccess, good knowledgeNo access but good knowledge based on experience. Business organization No access, limited knowledge Access, good knowledge No access but good knowledge based on experience. Business organizationNo access, limited knowledgeAccess, good knowledgeNo access but good knowledge based on experience. Resources used   Resources used     Own and rented, Own and rented, Land  Own land, small parcels Own and rented production in partnership LandOwn land, small parcelsOwn and rentedproduction in partnership     with others with others Labor  Family Mostly family with some outside help. Some family but principally hired labors. LaborFamilyMostly family with some outside help.Some family but principally hired labors. Capital, inputs Informal lenders Personal capital and credit Personal capital and credit Capital, inputsInformal lendersPersonal capital and creditPersonal capital and credit Source: Agropyme,   Source:Agropyme,  "},{"text":"2005: 25 y CRS, 2005: 25 Table 2. Total number of horticultural producers in Honduras and El Salvador compared to total membership of farm organizations studied. Country Total number of horticultural producers Total number of member in producer organisations Percentage of total farmers in producer organizations  Honduras 15.000 a 395 2,6% Honduras15.000 a3952,6% El Salvador 8.000 b 236 3,0% El Salvador8.000 b2363,0% Source: Authors calculations based on Agropyme, 2005 y CRS, 2005.  Source: Authors calculations based on Agropyme, 2005 y CRS, 2005. (a) Number of vegetable producers according to the National Agricultural Census of Honduras, 1993. (a) Number of vegetable producers according to the National Agricultural Census of Honduras, 1993. (b) Number of producers in the horticultural agri-food chain according to BMI/Technoserve, 2004 (cited (b) Number of producers in the horticultural agri-food chain according to BMI/Technoserve, 2004 (cited in CRS, 2005: 25)   in CRS, 2005: 25) (c) Total number of producers involved in producer organizations focused on vegetable production in (c) Total number of producers involved in producer organizations focused on vegetable production in Honduras and El Salvador, Agropyme, 2005 y CRS, 2005.  Honduras and El Salvador, Agropyme, 2005 y CRS, 2005.  "},{"text":"Table 3 . Producer organizations included in the study.  Organization Country Number of farmers Annual USD) sales (thousands Products Market channels OrganizationCountryNumber of farmersAnnual USD) sales (thousandsProductsMarket channels ACOPO El Salvador 23 140 a Lettuce, baby carrots, radishes Supermarkets, hotels and restaurants ACOPOEl Salvador23140 aLettuce, baby carrots, radishesSupermarkets, hotels and restaurants     Tomato, bell Supermarkets, Tomato, bellSupermarkets, AGROLEMPA El Salvador 70 177 b pepper, hospitals, processors AGROLEMPAEl Salvador70177 bpepper,hospitals, processors     cucumber and restaurants cucumberand restaurants APRHOFI Honduras 110 184 c Carrots, lettuce, broccoli, potatoes Suplidores especializados, supermercados, restaurantes, mercados mayoristas APRHOFIHonduras110184 cCarrots, lettuce, broccoli, potatoesSuplidores especializados, supermercados, restaurantes, mercados mayoristas      Specialized wholesalers, Specialized wholesalers, COHORSIL Honduras 285 89 c Tomato, bell pepper supermarkets, wholesale markets and COHORSILHonduras28589 cTomato, bell peppersupermarkets, wholesale markets and      local markets local markets PHOC El Salvador 143 96 c Tomato, bell pepper, cucumber Supermarkets and farmers markets PHOCEl Salvador14396 cTomato, bell pepper, cucumberSupermarkets and farmers markets  "},{"text":"Table 5 . Return on investment for producer organizations in El Salvador (year 2004) . Data for tomatoes sold by Agrolempa are not included in this table because this organization did not sell this product to supermarkets during the period of the study.   Products (prices in USD/Kg.)  Products (prices in USD/Kg.)  Agrolempa 11  PHOC  Agrolempa 11PHOC Variable Bell pepper Cucumber Tomato Bell pepper Cucumber VariableBell pepperCucumberTomatoBell pepperCucumber Production costs 0.064 0.088 0.24 0.055 0.068 Production costs0.0640.0880.240.0550.068 Sales price to producer organization 0.108 0.115 0.29 0.066 0.084 Sales price to producer organization0.1080.1150.290.0660.084 Net profit for farmer 0.044 0.027 0.04 0.011 0.015 Net profit for farmer0.0440.0270.040.0110.015 Marketing costs 0.022 0.022 0.04 0.011 0.015 Marketing costs0.0220.0220.040.0110.015 Sales price to supermarket 0.154 0.154 0.35 0.139 0.112 Sales price to supermarket0.1540.1540.350.1390.112 Net profit for producer organization 0.024 0.018 0.02 0.061 0.013 Net profit for producer organization0.0240.0180.020.0610.013 Supermarket retail price 0.40 0.17 1.12 0.40 0.17 Supermarket retail price0.400.171.120.400.17 Gross profit for supermarket 0.246 0.216 0.77 0.261 0.258 Gross profit for supermarket0.2460.2160.770.2610.258 Source: CRS, 2005: 30, 33      Source: CRS, 2005: 30, 33  "},{"text":"Table 6 . Return on investment for producer organizations in Honduras (year 2005) Products (prices in USD/Kg.)  Variable Tomate Bell pepper Potato Broccoli Lettuce Carrots VariableTomateBell pepperPotatoBroccoliLettuceCarrots Production costs 12 0.19 0.26 0.17 0.12 0.11 0.13 Production costs 120.190.260.170.120.110.13 Purchase price paid by local traders 0.45 0.40 0.17 0.20 0.20 0.23 Purchase price paid by local traders0.450.400.170.200.200.23 Net farmer income for sale to local trader 0.26 0.14 (0.00) 0.08 0.09 0.10 Net farmer income for sale to local trader0.260.14(0.00)0.080.090.10 Transportation costs from farm local market 13 0.05 0.14 0.01 0.03 0.04 0.01 Transportation costs from farm local market 130.050.140.010.030.040.01 Local market sale price 0.40 0.34 0.11 0.17 0.17 0.17 Local market sale price0.400.340.110.170.170.17 Net farmer income for sale at local market 14 0.16 (0.06) (0.07) 0.02 0.02 0.03 Net farmer income for sale at local market 140.16(0.06)(0.07)0.020.020.03 Transportation costs from       Transportation costs from farm to producer organization packing 0.05 0.14 0.01 0.03 0.04 0.01 farm to producer organization packing0.050.140.010.030.040.01 house       house Sales price to producer organization 0.47 0.40 0.35 0.27 0.26 0.24 Sales price to producer organization0.470.400.350.270.260.24 Net farmer income for sale to producer organization 0.23 0.00 0.17 0.12 0.11 0.10 Net farmer income for sale to producer organization0.230.000.170.120.110.10 Transportation costs to       Transportation costs to Tegucigalpa or San Pedro 0.02 0.02 0.01 0.03 0.03 0.01 Tegucigalpa or San Pedro0.020.020.010.030.030.01 Sula       Sula Wholesaler purchase price 0.40 0.34 0.34 0.28 0.28 0.28 Wholesaler purchase price0.400.340.340.280.280.28 Net income for sale to       Net income for sale to wholesaler in Tegucigalpa 0.14 (0.08) 0.15 0.10 0.10 0.13 wholesaler in Tegucigalpa0.14(0.08)0.150.100.100.13 or San Pedro Sula       or San Pedro Sula Wholesaler sales prices 0.59 0.80 0.34 0.35 0.38 0.52 Wholesaler sales prices0.590.800.340.350.380.52 Gross income for wholesaler 0.19 0.46 - 0.07 0.10 0.24 Gross income for wholesaler0.190.46-0.070.100.24 Specialized wholesaler purchase price 0.54 0.46 0.38 0.31 0.30 0.29 Specialized wholesaler purchase price0.540.460.380.310.300.29 Net income from sale to specialized wholesaler 0.28 0.04 0.19 0.13 0.12 0.14 Net income from sale to specialized wholesaler0.280.040.190.130.120.14 Specialized wholesaler       Specialized wholesaler sales price to 0.84 0.85 0.50 0.57 0.44 0.55 sales price to0.840.850.500.570.440.55 supermarket       supermarket Gross income specialized       Gross income specialized wholesaler for sale to 0.30 0.39 0.12 0.26 0.14 0.26 wholesaler for sale to0.300.390.120.260.140.26 supermarket       supermarket Supermarket retail price 1.20 1.21 0.71 0.81 0.63 0.79 Supermarket retail price1.201.210.710.810.630.79 Gross income for supermarket 0.36 0.36 0.21 0.24 0.19 0.24 Gross income for supermarket0.360.360.210.240.190.24 Producción (Kg./ha) 40,492 20,408 21,379 21,056 20,732 29,024 Producción (Kg./ha)40,49220,40821,37921,05620,73229,024 Source: Agropyme, 2005: 68.       Source: Agropyme, 2005: 68. Working back from the final price paid by consumers for products in supermarkets in Working back from the final price paid by consumers for products in supermarkets in both Honduras and El Salvador, we can identify the following division among supply both Honduras and El Salvador, we can identify the following division among supply chain actors.       chain actors.  "},{"text":"Table 7 . Distribution of final consumer price among supply chain actors in Honduras. Products Variables Tomate Bell pepper Potato Broccoli Lettuce Carrots Average  Production costs. 15% 22% 24% 15% 17% 17% 18% Production costs.15%22%24%15%17%17%18% Farm to packing shed transportation costs 4% 12% 1% 4% 6% 1% 5% Farm to packing shed transportation costs4%12%1%4%6%1%5% Net farmer income for sale to producers organization 20% 0% 24% 14% 18% 12% 14% Net farmer income for sale to producers organization20%0%24%14%18%12%14% Transportation costs to Tegucigalpa or San Pedro Sula 2% 2% 1% 4% 5% 1% 2% Transportation costs to Tegucigalpa or San Pedro Sula2%2%1%4%5%1%2% Net producer organization income        Net producer organization income for sale to specialized wholesaler in 4% 3% 3% 1% 2% 5% 3% for sale to specialized wholesaler in4%3%3%1%2%5%3% Tegucigalpa or San Pedro Sula        Tegucigalpa or San Pedro Sula Gross profit for specialized wholesaler for sale to supermarket 25% 32% 16% 32% 22% 33% 27% Gross profit for specialized wholesaler for sale to supermarket25%32%16%32%22%33%27% Gross profit for supermarket 30% 30% 30% 30% 30% 30% 30% Gross profit for supermarket30%30%30%30%30%30%30% Retail price paid by final consumer 100% 100% 100% 100% 100% 100% 100% Retail price paid by final consumer100%100%100%100%100%100%100% Source: Agropyme, 2005: 75        Source: Agropyme, 2005: 75  "},{"text":"Table 8 . Distribution of final consumer price among supply chain actors in El Salvador.   Agrolempa  PHOC   AgrolempaPHOC Variable Bell peppers Cucumber Tomato Bell peppers Cucumber Average VariableBell peppersCucumberTomatoBell peppersCucumberAverage Production costs 16% 24% 21% 14% 18% 19% Production costs16%24%21%14%18%19% Net farmer income for sale to producers organization 11% 7% 4% 3% 4% 6% Net farmer income for sale to producers organization11%7%4%3%4%6% Market costs (transportation and sales) 6% 6% 4% 3% 4% 4% Market costs (transportation and sales)6%6%4%3%4%4% Net producer organization income for sale to supermarket 6% 5% 2% 16% 4% 6% Net producer organization income for sale to supermarket6%5%2%16%4%6% Gross profit for supermarket 62% 58% 69% 65% 70% 65% Gross profit for supermarket62%58%69%65%70%65% Retail price paid by final consumer 100% 100% 100% 100% 100% 100% Retail price paid by final consumer100%100%100%100%100%100%  "}],"sieverID":"5cdbd325-bb1a-4d99-a2d6-6c1643cc8fce","abstract":"The growth of supermarkets in the developing world has attracted the attention of social science researchers over the last few years. Of major concern is the role that rapid changes in supermarket and other procurement systems are having on smallholder livelihoods. Evidences suggests that while some smallholders are able to organize themselves and access the relatively more lucrative supermarket channels, the majority of smallholder farmers in the developing world faced significant barriers in this regard. This paper examines the case of vegetable chains in Honduras and El Salvador in an attempt to gain further insight into this dynamic. Fieldwork was carried out with a total of five smallholder organizations and a range of supermarket buyers. Results indicate that the existing supply chain suffers from several limitations including: (a) relatively low levels of collective action and organization among smallholders; (b) a paucity of collaborative fora linking actors along the chain, and; (c) public policies that fail to keep pace with the rapid change occurring in the retail sector. Based on these findings, the paper suggests strategies for chain development focused on collaborative actions between chain actors. Key areas of intervention include the development and testing of more widely replicable and sustainable organizational models for smallholders; development and trialing of diverse methods of chain governance and coordination, and; the institutionalization of public-sector policies based on more complete monitoring of the social, environmental and economic impacts all the rapid changes occurring in the food retail sector in Central America."}

data/part_4/0841bb4d38e012f7a7caeb69ad3dbf8e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0841bb4d38e012f7a7caeb69ad3dbf8e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/6d1815b8-81e4-4c95-85cc-5723bbee614b/retrieve"},"pageCount":1,"title":"Sero-epidemiological investigation of foot and mouth disease (FMD) in cattle at the livestock-wildlife interface in Maasai Mara, Kenya","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":16,"text":"▪ Land use changes affect the transmission dynamics of many infectious diseases that constraint livestock production."},{"index":2,"size":32,"text":"▪ Using FMD as a case study disease, we investigated the effects of varied land use types and different levels of livestockwildlife interactions on its transmission patterns in Maasai Mara ecosystem, Kenya."},{"index":3,"size":29,"text":"▪ The study used a cross sectional study design and multi-stage cluster sampling framework to estimated FMD seroprevalence and the associated risk factors for exposure in pastoral cattle herds."}]},{"head":"Results","index":2,"paragraphs":[]},{"head":"▪","index":3,"paragraphs":[{"index":1,"size":12,"text":"The overall individual-level seroprevalence of FMD was 81.2% (95% CI: 79.1 -83.5)."},{"index":2,"size":37,"text":"▪ FMD Seroprevalence was inversely related to the ecological distance from Mara Reserve; Zone 1 (92.0, 95% CI: 89.9 -94.5) than in zone 2 (79.8, 95% CI: 76.3 -83.5) and zone 3 (62.9, 95% CI: 57.1 -69.5)."},{"index":3,"size":46,"text":"▪ Cattle herds grazed in zones 1 and 2, respectively, had higher odds of FMD exposure (OR = 8.8, 95% CI: 5.1 -15.4, p < 0.001) and (OR = 2.7, 95% CI: 1.7 -4.3, p < 0.001), than those grazed in zone 3 (low interface area)."},{"index":4,"size":66,"text":"▪ Other significant predictors of animal-level FMD seroprevalence included; sharing of watering points within villages (OR = 4.8, 95% CI: 1.8-13.2, P = 0.002), mixing of cattle with other herds during grazing (OR = 3.3, 95% CI: 1.9 -5.6, P< 0.001), pastoral herd management practices (OR =5. ▪ The increasing distance from the reserve correspond to different levels of wildlife-livestock interactions and varied land use types."},{"index":5,"size":19,"text":"ILRI thanks all donors and organizations which globally support its work through their contributions to the CGIAR Trust Fund."},{"index":6,"size":30,"text":"▪ A total of 1170 cattle were randomly sampled from 390 herds and screened for FMD non-structural antibodies (NSP) using a 3ABC blocking Elisa (Priocheck® FMDV NS, Prionics AG, Netherlands)."},{"index":7,"size":19,"text":"▪ Seropositive sera was further screened for serotypes A, O, SAT 1 and SAT 2, all endemic in Kenya."},{"index":8,"size":33,"text":"▪ A generalized linear mixed effect model (GLMM) was used to analyze seroprevalence data and identify risk factors for exposure; herd ID was fitted as a random effect to account for herd-level clustering."}]}],"figures":[{"text":"▪▪ 3, 95 CI: 3.3 -8.4, P<0.001), grazing cattle in wildlife reserves (OR = 4.5, 95% CI: 2.8 -7.1, P< 0.001) and large herd size >50 animals (OR = 1.6, 95% CI: 1.0 -2.4, P = 0.035). ▪ Serotypes O, A, SAT 1 and SAT 2 were all prevalent in the target zones. The Intracluster Correlation Coefficient, ICC (i.e., the level of dependence among seropositive cattle individuals within herds) was estimated at 0.34. Pictures Conclusion ▪ This study highlights important risk factors for FMD transmission and will help in the establishment of mitigative strategies. Further research should characterize circulating FMD viruses for the development of effective vaccines and build communities' capacity for sustained control . Partners logo Partners logo This document is licensed for use under the Creative Commons Attribution 4.0 International Licence. November 2018 June 2012 Methods ▪ Three ecological zones were identified along a distance gradient from Mara National reserve (Fig 1). "}],"sieverID":"70f50e2e-48a4-478f-a7b8-974532d43755","abstract":""}

data/part_4/08971b1cf92b4ccaa5b3e4fb108f5ca6.json

@@ -0,0 +1 @@
+{"metadata":{"id":"08971b1cf92b4ccaa5b3e4fb108f5ca6","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c89e6186-123a-45ad-a084-223672ef9e7c/retrieve"},"pageCount":21,"title":"Organización y resultados de la plataforma de diálogo","keywords":[],"chapters":[{"head":"INTRODUCCIÓN","index":1,"paragraphs":[{"index":1,"size":46,"text":"\"Cali Come Mejor\" es un proyecto dirigido a promover políticas locales y/o regionales que contribuyan eficazmente a reducir las desigualdades, a mejorar el acceso y la disponibilidad a una alimentación saludable para la población vulnerable de Cali y fortalecer los vínculos con pequeños productores del Valle."},{"index":2,"size":93,"text":"El desarrollo del proyecto se encuentra estructurado en dos etapas fundamentales, la primera etapa (marzo-diciembre 2015) buscó analizar el sistema alimentario de Cali a través una revisión y recolección de los datos disponibles (canales de distribución, consumo de alimentos, mercados formales e informales, actores etc.); el proceso de finalización de esta primera fase consistió en la realización de una plataforma de diálogo donde participaron actores del sector público, privado y de la sociedad civil identificados a lo largo del estudio (ver anexo 1 y 2, lista de invitados y lista de participantes) ."},{"index":3,"size":82,"text":"Este dialogo tuvo como objetivo compartir y socializar ideas y propuestas a favor de un sistema alimentario sostenible para Cali, tanto para la zona urbana como la rural. Su realización busco llegar a un consenso sobre los resultados del estudio y a generar algunas propuestas para optimizar el funcionamiento del sistema alimentario de Cali. Esta primera fase del proyecto, llevada a cabo desde marzo 2015, es condicional al desarrollo y toma de decisiones en la segunda etapa, a realizarse en el 2016."},{"index":4,"size":30,"text":"De esta manera, en el presente documento se encontraran los resultados del primer taller de la Plataforma de diálogo \"Cali Come Mejor\", así como la descripción del proceso de desarrollo."}]},{"head":"METODOLOGÍA DE LA PLATAFORMA DE DIALOGO \"CALI COME MEJOR\"","index":2,"paragraphs":[{"index":1,"size":74,"text":"La jornada se desarrolló el jueves 10 de Diciembre 2015, en dos sesiones. La Sesión 1 direccionada a la presentación de los resultados del análisis del sistema alimentario de Cali y las dinámicas de consumo y de abastecimiento de la población. La Sesión 2 sobre los aportes para fortalecer el sistema alimentario sostenible en Cali (ver anexo 4, agenda). Cada sesión contenía presentaciones que fueron insumo para el desarrollo de la plataforma de diálogo."},{"index":2,"size":15,"text":"En la Sesión 1 se socializaron los resultados de la investigación sobre las temáticas siguientes:"},{"index":3,"size":45,"text":"1. Nutrición y consumo de alimentos 2. Abastecimiento y producción de alimentos 3. Políticas y programas de Seguridad Alimentaria y nutricional En la sesión 2 se presentó el concepto de un sistema alimentario sostenible en Cali y el pacto de Milán (ver en anexo 3)."},{"index":4,"size":26,"text":"A continuación de las presentaciones en cada sesión, se desarrollaron talleres según la metodología de trabajo \"café mundo\" que se explica brevemente en el anexo 5."}]},{"head":"RESULTADOS TEXTUALES DE LOS APORTES DURANTE LOS TALLERES","index":3,"paragraphs":[{"index":1,"size":31,"text":"Los aportes relacionados con las limitaciones y las recomendaciones principales del análisis rápido del sistema alimenticio de Cali, identificadas para cada tema en la plataforma de dialogo, se describen a continuación:"},{"index":2,"size":161,"text":"3.1 Limitaciones principales identificadas en el tema abastecimiento y producción  No hay políticas ni programas adecuados de desarrollo rural incluyente para pequeños productores  Los jóvenes deciden abandonar el campo y llegando a la ciudad se ubican en las zonas de mayor vulnerabilidad  Falta de infraestructura adecuada para productores para mercadear sus productos  Inadecuadas normas para mejorar las condiciones locales a los pequeños productores  Problema de legalidad/protección al campesino productor  Falta de articulación de los actores en pro de una política publica  Débil organización y articulación de los productores  Uso de los recursos (agua y tierra) por la caña  Barreras a los productores para la sana comercialización de sus productos  Baja educación para campesinos adultos  Falta de compromiso entre producción y protección en la zona rural de Cali  Falta de programas de asesorías técnicas continúas (no fue considerada en la priorización, sin embargo, en la discusión se convierte en prioridad)"},{"index":3,"size":345,"text":"3.2 Limitaciones mayores identificadas en el tema: Nutrición y consumo de alimentos  Población (consumidores) con poca educación nutricional; no hay concientización de lo que es adecuada alimentación  Poca aplicación y seguimiento a la política pública de Seguridad Alimentaria y Nutricional SAN  Reducida coordinación y/o articulación entre las intervenciones públicas y las privadas  Débil regulación de la publicidad respecto a alimentos poco nutritivos y ausencia de medios de comunicación institucionales  Falta de empoderamiento de las organizaciones y de la sociedad civil en los temas de seguridad alimentaria y nutricional  Poco apoyo social a la lactancia materna y a la alimentación propia  No hay organizaciones de consumidores para hacer compras en volúmenes que permita reducir costos en alimentación  Adopción de hábitos de compra, preparación y consumo de alimentos de otras culturas  Falta articulación de entes públicos y privados en las acciones direccionadas a mejorar el acceso de los alimentos  Poca creatividad para la promoción de alimentación saludable agroecológica y fuerte influencia de los medios de comunicación que promueven productos industriales  Decisiones inadecuadas de compra de alimentos: alimentos con muchas calorías pero con bajo aporte nutricional  Hábitos poco saludables: mucha grasa y azúcar  Abastecimiento de programas escolares de alimentación con productos poco nutritivos  Recomendaciones nutricionales inadecuadas 3.3 Recomendaciones de los actores y propuestas direccionadas a los problemas priorizados 3.3.1 Primera temática: Abastecimiento y producción de alimentos Para el problema 1: No hay políticas ni programas adecuados de desarrollo rural incluyente para pequeños productores:  Difícil encontrar soluciones porque el problema económico no lo permite  Fortalecer los espacios de participación de la sociedad civil, Consejos municipales de desarrollo rural (CMDR) y Consejos Territoriales de Planeación (CTP)  Fortalecer la economía solidaria (ejemplo: sistemas financieros adecuados)  Crear y/o fortalecer las compras institucionales (modelo de negocio inclusivo)  Los productos pasan por intermediarios (mafias), falta de mercados directos del productor al consumidor Para el problema 2: Los jóvenes deciden abandonar el campo y llegando a la ciudad se ubican en las zonas de mayor vulnerabilidad:"},{"index":4,"size":620,"text":" Educación permanentes para el campo  Toma de decisiones gubernamentales incluyentes en lo agrario y el mercado emergente  Apoyo para la formación y la fortaleza de las asociaciones de productores: aumentar el poder de los productores, auto-organización de transporte y crédito  Cambios que incentiven la permanencia de los campesinos en el campo, \"buen vivir\"  Fortalecer la relación campo -ciudad, productor -consumidor  Compras a pequeños productores agroecológicos existentes Para el problema 3: Falta de infraestructura adecuada e inaccesible para los productores para mercadear sus productos  Proponer \"centros de atención integral urbanos\"  Inclusión en el Plan de Ordenamiento Territorial (POT) de infraestructura de mercados alternativos agroecológicos y la infraestructura adecuada para la producción  Crear centros de acopio para productores del campo y laboratorios para procesados 3.3.2 Segunda temática: Nutrición y consumo de alimentos Para el problema 1: Población (consumidores) con poca educación nutricional; no hay concientización de lo que es adecuada alimentación  Realizar eventos con las comunidades sobre alimentación sana, nutrición y salud  Promover el consumo responsable de alimentos, resaltando la importancia de alimentarse saludablemente desde los colegios. Debe ser política de educación  Lograr con las instituciones de salud un concepto unificado sobre nutrición  Capacitar en preparación de alimentos saludables  Generar en las instituciones educativas Proyectos Educativos Institucionales (como PRAE) para trabajar en temas de alimentación  Generar programas de formación al consumidor vinculado a los programas de tiendas escolares saludables, que vincule a estudiantes y a padres  Crear en cada comuna un comité asesor en alimentación (tema nutricional y agroecológico)  Identificación de alimentos de \"patrimonio alimentario\"  Apoyo y/o acompañamiento nutricional desde una perspectiva holística Para el problema 2: Poca aplicación y seguimiento a la política pública  Continuidad y voluntad en los Planes de Desarrollo Municipal (PDM) y en los Planes Operativos Anuales de Inversiones (POAI)  Delegar responsables de continuidad y ejecución de políticas de seguridad alimentaria y nutricional; así como la realización del plan SAN incluyéndolo en el Plan de Desarrollo Municipal  Retomar y hacer ajustes a la política de seguridad alimentaria y nutricional para hacerles ajustes y presentar al consejo  Presentar propuestas al gobierno municipal y presionar para que se implementen las propuestas de política pública ya elaboradas  Establecer un sistema de control y seguimiento de disponibilidad, acceso y calidad, de manera continua por parte del gobierno y ONG's Para el problema 3: Reducida coordinación y/o articulación entre las intervenciones públicas y las privadas  Convenios públicos y privados que favorezcan la seguridad alimentaria y nutricional de Cali  Diseño y aplicación de un modelo efectivo de articulación entre instituciones públicas y privadas, y de acuerdo a la apuesta de ciudad planteada  Articulación del estado con centrales de abasto para establecer medidas que garanticen comercio justo y transporte; también para el mejoramiento del sistema de información de precios y mercados Para el problema 4: Débil regulación de la publicidad respecto a alimentos poco nutritivos y ausencia de medios de comunicación institucionales  Diseñar estrategias de comunicación que promuevan alimentación saludable  Conocer el proceso de regulación de publicidad Para el problema 5: Falta de empoderamiento de las organizaciones y de la sociedad civil en los temas de seguridad alimentaria y nutricional  Promocionar en la sociedad civil la participación en las mesas de seguridad alimentaria y nutricional, veedurías y el Consejo Asesor de Seguridad Alimentaria y Nutricional del Valle del Cauca (CASAN)  Realizar base de datos de actores relacionados con SAN en la ciudad  Ganar un lugar en los comités de planeación de cada comuna (para abordar los temas de política SAN)  Apoyar con recursos las experiencias ya existentes como la red de mercados -CROAC"}]},{"head":"IDENTIFICACIÓN DE VACÍOS DE INFORMACIONES, CONOCIMIENTOS Y NECESIDADES DE ESTUDIOS ADICIONALES PARA LA SEGUNDA ETAPA DEL PROYECTO","index":4,"paragraphs":[{"index":1,"size":17,"text":"A continuación se presenta los vacíos de información identificados durante los talleres de la plataforma de diálogo"}]},{"head":"Caracterización del sistema de abastecimiento y de la oferta: donde se compra, que alimentos, precios, calidad y cantidad","index":5,"paragraphs":[{"index":1,"size":47,"text":" Caracterización de la oferta de alimentos, precio, calidad y cantidad en los distintos lugares de abastecimiento  Cuál es la calidad de los alimentos en los puntos de abastecimiento?  Por qué la población vulnerable preferiría comprar en una tienda de barrio que en otro lugar?"}]},{"head":"Acceso de los (pequeños) productores a mercados","index":6,"paragraphs":[{"index":1,"size":91,"text":" Cuáles son las limitaciones de los productores para acceder a los mercados formales?  Cuales son los problemas para que lleguen los productos al mercado? (transporte, violencia, relaciones de poder)  Los pequeños productores acceden o no a los mercados institucionalizados (formales)? si es el caso, como lo hacen y sino cuales son las limitaciones?  Cuales son los canales de comercialización directa?  Cuáles son las formas alternativas de abastecimiento?  Identificar cuáles son las razones (causas) principales por las que el campesino no se queda en el campo?"}]},{"head":"Producción","index":7,"paragraphs":[{"index":1,"size":26,"text":" Donde se producen los alimentos y cuales son los canales de distribución?  Cuáles y cuantos son los desperdicios de alimentos en toda la cadena?"}]},{"head":"Inocuidad de los alimentos, aspectos ambientales","index":8,"paragraphs":[{"index":1,"size":23,"text":" Cuáles son las normas de calidad de los alimentos y sus aplicaciones?  Integrar parámetros ambientales en el estudio (agua, químicos, ….)!!!"}]},{"head":"Hábitos de consumo de alimentos","index":9,"paragraphs":[{"index":1,"size":206,"text":" Caracterización de hábitos alimentarios de Cali en zonas de afinidad cultural (afrodescendiente, indígenas…). Análisis con enfoque diferencial.  Zonificación de comunidades de acuerdo a su lugar de origen, costumbres y tradiciones alimentarias  Cual es la frecuencia en el consumo de productos industriales transformados procesados y productos frescos?  Investigar en temas de patrimonio alimentario  Aclarar el concepto de adecuado estado nutricional, respecto al equilibrio en una ración de alimentos (ejemplo: engordar es estar bien nutrido)  Desarrollar encuestas a profundidad, enfocadas en conocer la percepción de una buena alimentación. Además indagar acerca de lo que consumirían en el caso de tener mayores ingresos  Cuál es la percepción de alimentación saludable de acuerdo a los recursos económicos disponibles?  Reconocer las prácticas culturales alimentarias con el fin de recuperar identidades  Formas de preparación de los alimentos Acceso económico a los alimentos  Caracterización de costos de la canasta básica y de la canasta básica de los alimentos Nutrición  Cuál es la percepción de las comunidades de las alteraciones nutricionales?  Cuáles son los efectos de una adecuada e inadecuada nutrición en la salud?  Cuáles son los beneficios nutricionales de alimentos que se han dejado de consumir en Cali (ejemplo: Quinua)?"}]},{"head":"Inocuidad de los alimentos","index":10,"paragraphs":[{"index":1,"size":31,"text":" La calidad de los alimentos que la gente consume: son productos sanos? Son productos contaminados con agroquímicos? Son alimentos transgénicos? �� De donde son importados los alimentos? Que calidad tienen?"}]},{"head":"Influencia de los medios de comunicación y programas","index":11,"paragraphs":[{"index":1,"size":22,"text":" Cuál es la influencia de la publicidad en hábitos alimentarios?  Cuál es la normatividad para la regulación de la publicidad?"},{"index":2,"size":56,"text":" Cuál es el impacto de los programas de asistencia alimentaria con relación a la creación de hábitos alimentarios?  Cuáles son las iniciativas de economía solidaria existentes?  Se presenta asistencialismo en Cali y en el país? Impacto de los programas de asistencia alimentaria?  Existen iniciativas de etiquetado de alimentos para conocer su origen?"}]},{"head":"Contexto socioeconómico","index":12,"paragraphs":[{"index":1,"size":33,"text":" Actualmente la población en Cali es itinerante? (relacionado con que tiene poco tiempo para la preparación de alimentos)  Cual es el nivel educativo de las madres de los niños con desnutrición?"}]},{"head":"PROPUESTAS DE LOS TEMAS ADICIONALES DE INVESTIGACIÓN","index":13,"paragraphs":[{"index":1,"size":41,"text":"A continuación se presentan algunos temas de investigación que requieren ser abordados. Estas propuestas se derivan del análisis de los resultados de la primera fase de la investigación y de los aportes realizados por los participantes de la plataforma de dialogo."}]},{"head":"Investigación sobre la competencia y competitividad en las cadenas de alimentación","index":14,"paragraphs":[{"index":1,"size":74,"text":"La identificación de una situación de oligopolios (mercado dominado por un pequeño número de proveedores) explicando los problemas en el proceso de formación de los precios de los alimentos para los consumidores, implica realizar un estudio de competencia para caracterizar los determinantes, profundizar el análisis de los impactos sobre la competitividad de las cadenas de abastecimiento de proximidad y las orientaciones de políticas públicas necesarias para manejar un proceso de apertura de la competencia:"},{"index":2,"size":134,"text":" La claridad del poder de los supermercados en el proceso de formación de los precios directos debe ser objetivo central;  La existencia de un grupo de personas implicadas en el proceso de formación de los precios debe ser también un objetivo de análisis sobre algunos productos importantes (se menciona por ejemplo esta situación en la comercialización de la cebolla);  Este estudio de competencias puede estar ligado en su metodología con un análisis de la competitividad de las principales cadenas de abastecimiento de alimentos de la ciudad, los cuales tienen actualmente precios demasiado altos. Un elemento importante es el de obtener más transparencia sobre la formación de los precios en el sistema. En esa dirección la reducción de la heterogeneidad de los estándares de calidad utilizados por los supermercados podría ser analizada."}]},{"head":"Investigación sobre las condiciones de acceso a mercados para pequeños productores","index":15,"paragraphs":[{"index":1,"size":21,"text":"El sistema de abastecimiento actual de la ciudad tiene características que no son favorables para la integración de los pequeños productores:"},{"index":2,"size":50,"text":" Número de mercados físicos insuficientes y difícil acceso logístico;  Informalidad y riesgo sobre el mercado mayorista de Santa Elena;  Normas de calidad en los supermercados o normas sanitarias que no son acordes con una producción agroecológica;  Inadecuada organización de productores para la comercialización de los alimentos."},{"index":3,"size":48,"text":"Las síntesis de los diferentes diagnósticos identifica la necesidad de encontrar alternativas para generar circuitos cortos y que también podrían, en el futuro, mejorar el acceso de los pequeños productores al mercado, mercado agroecológico, actividad colectiva de productores para venta en plazas de mercados: Cavasa, Santa Elena, otros."},{"index":4,"size":114,"text":"Un estudio dedicado a identificar y aclarar las dinámicas de las cadenas de comercialización es necesario. Adicionalmente, se requiere centrarse en los siguientes temas:  La oferta de alimentos, precio, calidad y cantidad en los distintos lugares de abastecimiento;  Los procesos de formación de los precios de los alimentos por parte de los productores en los diferentes modelos identificados;  Los márgenes de comercialización entre los diferentes actores y las estructuras de los costos de comercialización;  La posibilidad de generar estrategias para lograr conexiones entre los pequeños productores y el abastecimiento de las tiendas de barrio, con el fin de disminuir los intermediarios en los canales de abastecimiento de la población vulnerable."}]},{"head":"Investigación con la municipalidad sobre las infraestructuras de mercado","index":16,"paragraphs":[{"index":1,"size":49,"text":"El problema del acceso a los mercados físicos fue mencionado varias veces como una limitación en el mejoramiento del abastecimiento alimentario de la población vulnerable y probablemente de toda la población. Un estudio sobre un plan estratégico de integración de las plazas de mercado que podría estar enfocado en:"},{"index":2,"size":97,"text":" Cómo planificar la ubicación de terrenos para plazas de mercado y organización de los mercados móviles;  Cómo imaginar modelos económicos de manejo (mecanismos de regulación y gobernanza de esos mercados) que involucre los actores (intermediarios, comerciantes, empresas) para que los impuestos futuros (disminución de la informalidad) ligados a las actividades de comercialización sean directamente utilizados en la financiación de las infraestructuras;  Cómo encontrar una solución al problema jurídico y/o legal de los predios de Santa Elena;  Cómo mejorar el papel de Cavasa en la creación de los precios directos del sistema de abastecimiento."},{"index":3,"size":33,"text":"5.4 Investigación sobre el componente ambiental en el sistema alimentario La dimensión ambiental no fue integrada en la primera etapa del proyecto, sin embargo diversos actores indicaron la necesidad de integrar ese punto."},{"index":4,"size":69,"text":"Uno de los elementos identificados es el relacionado con el impacto del uso de los productos químicos en la agricultura intensiva que abastece a la población de Cali. No se conoce actualmente la calidad ni cantidad de productos químicos (se mencionó productos usando mucho glifosato, reconocido por la OMS como peligroso para la salud). Este estudio permitiría clarificar los costos públicos (salud, calidad del agua) ligados a esos usos."},{"index":5,"size":98,"text":"De esta manera se pueden fortalecer estrategias de promoción de la producción agroecológica que implementan más los pequeños productores. De hecho, actualmente los pequeños productores son en su mayoría productores familiares que usan pocos productos químicos. El reconocimiento de la calidad sanitaria de la producción agroecológica desde un punto de vista de la seguridad sanitaria es un elemento que podría mejorar la contribución de esos pequeños productores al abastecimiento alimentario de la ciudad. El impacto indirecto es el de mejorar las condiciones económicas de viviendas en zonas rurales y disminuir, a largo plazo, las migraciones hacia la ciudad."}]},{"head":"Investigación sobre el desarrollo y las oportunidades de la agricultura urbana y periurbana","index":17,"paragraphs":[{"index":1,"size":32,"text":"Se hace necesario considerar que un estudio sobre las condiciones de desarrollo de una agricultura urbana de proximidad a las comunas vulnerables podría ser muy útil al mejoramiento del sistema de alimentación."},{"index":2,"size":35,"text":"Uno de los elementos centrales de este estudio es el de clarificar la manera para mejorar las condiciones de acceso a las tierras en las zonas de proximidad que abastecen actualmente la ciudad de Cali."},{"index":3,"size":141,"text":"De otro lado, un elemento identificado en la jornada se refiere al impacto que tiene la política de protección del medio ambiente en las restricciones legales al acceso de los parques naturales y reservas, lo que se percibe como un freno al desarrollo de una agricultura de proximidad. La posibilidad de compromisos entre producción y protección en la zona rural de Cali permitiría integrar una agricultura limpia (agroforestal) como componente reconocido de los parques y reservas. Esta agricultura integrada en los parques podría contribuir a una función de aumento de la biodiversidad y de atracción ecoturística de estas zonas. Otro elemento potencial es el análisis del impacto ambiental de la producción de caña de azúcar, el cual permitiría mejorar el conocimiento de los costos ocultos de la situación actual del monocultivo, la cual también bloquea el acceso a tierras de proximidad."}]},{"head":"Investigación sobre el abastecimiento del mercado institucional","index":18,"paragraphs":[{"index":1,"size":49,"text":"El mercado institucional (comedores escolares, comunitarios, cárcel, hospital...) es un medio central del mejoramiento del sistema de alimentación de la población vulnerable poco utilizado. Efectivamente, este mercado aparece más bien como un medio de asistencia alimentaria para corregir una situación de acceso a la alimentación para la población vulnerable."},{"index":2,"size":40,"text":"En relación con ello, el mercado institucional se abastece más con empresas de productos preparados que con productos frescos. El estudio sobre las condiciones de acceso de este mercado institucional podría focalizarse en tres puntos complementarios identificados en la jornada:"},{"index":3,"size":28,"text":" Analizar los mecanismos de abastecimiento de este mercado en productos frescos y los medios de regulación o de incentivos que podrían aumentar la importancia de estos productos;"},{"index":4,"size":31,"text":" Analizar con las empresas involucradas en los platos preparados, la manera para mejorar el componente nutricional de dichos platos teniendo en cuenta las normas nutricionales de las diferentes instituciones públicas;"},{"index":5,"size":20,"text":" Analizar cómo se puede usar este mercado para una política de educación nutricional de la población joven y adulta."}]},{"head":"Investigación sobre los conocimientos alimentarios de la ciudad de Cali","index":19,"paragraphs":[{"index":1,"size":49,"text":"Los resultados del análisis revelan elementos un tanto contradictorios entre la observación de una tendencia a un aumento de consumo de productos no saludables, en la insuficiencia de acceso a productos frescos (frutas verduras), que tienden a aumentar muy rápidamente el riesgo de malnutrición (sobrepeso) en la población vulnerable."},{"index":2,"size":89,"text":"Un estudio dedicado a la caracterización de las dinámicas de consumo de alimentos nos parece necesario para analizar que, según las diferentes comunidades (según su lugar de origen, costumbre, tradición alimentaria) existen elementos patrimoniales de hábitos nutricionales con impactos positivos sobre la seguridad alimentaria. El conocimiento de esos elementos permitiría construir una estrategia de protección. Así, por ejemplo, el bajo consumo de frutas y verduras no está ligado, en algunos casos, a la falta de acceso sino a la falta de conocimiento en la manera de preparar esos elementos."},{"index":3,"size":67,"text":"Esos conocimientos existen potencialmente en algunas comunidades pero se olvidaron (se menciona un ejemplo sobre la quinua). Por otra parte, también permitiría contribuir a la orientación de las recomendaciones nutricionales públicas para que se apoyen en las buenas prácticas de la población actual (adecuada a los medios de la población) y no en recomendaciones que las poblaciones no pueden seguir debido a los bajos ingresos, educación, etc."},{"index":4,"size":129,"text":"5.8 Investigación sobre la relación entre ingresos-alimentación y malnutrición Los diferentes estudios anteriores sobre nutrición y alimentación, las entrevistas efectuadas a los diferentes actores económicos e institucionales y a cinco consumidores residentes en el barrio Agua Blanca, en el marco de este proyecto y los debates llevados a cabo durante la jornada dedicada a la plataforma, evidencian que se desconoce el consumo alimentario de los habitantes más vulnerables de Cali, tanto en zona urbana como en zona rural. Una encuesta más profunda acerca de las poblaciones vulnerables y un análisis de los datos de las encuestas sobre el consumo, suministradas por el Departamento Administrativo Nacional de Estadística (DANE) permitirían resolver, al menos en parte, algunos de los puntos que aparecen como contradictorios acerca de los problemas nutricionales y alimentarios."},{"index":5,"size":101,"text":"Los actores reconocen que las dificultades económicas son las causas principales de los problemas alimentarios de las poblaciones vulnerables aunque se trate de problemas poco conocidos. En este sentido, faltan datos específicos sobre el estado nutricional y alimentario de las poblaciones vulnerables de la ciudad de Cali, particularmente. Sabemos que la población de Cali se ve más afectada por el sobrepeso y la obesidad que las otras poblaciones urbanas de Colombia, pero no sabemos si son los más vulnerables los que más sufren de ello o si, más bien, afecta a las poblaciones con ingresos medios, o incluso a otras poblaciones."},{"index":6,"size":75,"text":"Sin embargo, sí sabemos que la prevalencia de sobrepeso y la obesidad de las mujeres de Cali (urbano y rural) ha aumentado mucho desde hace unos veinte años y que los índices son muy preocupantes (del orden de más de 45 %) incluido en las mujeres muy pobres. No obstante, es difícil decir si ese aumento de la malnutrición está vinculado a un problema de alimentación o a otro problema (sedentarismo, falta de actividad física)."},{"index":7,"size":60,"text":"Algunos indicadores parecen mostrarnos que las costumbres alimentarias de las poblaciones de la ciudad de Cali son más saludables que las de las otras ciudades (consumo más importante de frutas y de verduras) pero se debería profundizar más en el tema. También se debería analizar si la población vulnerable consume más productos azucarados y grasos que los otros estratos socioeconómicos."},{"index":8,"size":81,"text":"Una encuesta de tipo sociológico, permitiría aclarar esos puntos de manera cualitativa, en primer lugar, y de manera cuantitativa en segundo lugar, si fuera necesario. El tema de la comunicación también ha sido a menudo abordado durante la plataforma de diálogo así como el tema de la educación nutricional de las poblaciones vulnerables. Una parte de la encuesta sociológica permitiría entender el nivel de conocimiento y las percepciones reales de las poblaciones vulnerables con el fin de determinar intervenciones más eficaces."}]},{"head":"CONCLUSIÓN","index":20,"paragraphs":[{"index":1,"size":95,"text":"La modelización de los sistemas de alimentación de la población vulnerable produce una matriz de lectura y de organización de las informaciones que salieron de las encuestas y de la literatura en la primera fase del proyecto. Posteriormente en la presentación de esos resultados con los actores de la jornada, se mejoró esa matriz. Nos ayudó a traducir los resultados de la jornada sobre la validación de las limitaciones y conocimientos de las dos temáticas distintas pero complementarias que son: el sistema de abastecimiento y de producción, y el sistema de consumo y de nutrición."},{"index":2,"size":43,"text":"En relación con la identificación de vacíos de información, el proceso dio paso a la formulación de las recomendaciones en la estructura y el contenido de las investigaciones que nos parecen las más relevantes para la segunda fase del proyecto Cali Come Mejor."},{"index":3,"size":104,"text":"Un elemento importante que fue abordado en las entrevistas y en la jornada hace referencia a la falta de articulación de los actores en la política pública. Este elemento está relacionado con la necesidad política de implicar a las instituciones públicas en un objetivo colectivo de construcción de una alimentación sostenible. Desde 2011, los diferentes documentos de política de seguridad alimentaria han sido poco aplicados y casi virtuales. En esta orientación, una mejor integración de las organizaciones de la sociedad civil (organizaciones de productores por ejemplo, ONG) en los diferentes espacios de toma de decisiones podría ser un elemento global de mejoramiento del proceso."},{"index":4,"size":130,"text":"Un segundo elemento complementario es el hecho de analizar cómo se puede llegar a tener más coordinación y articulación entre los diferentes servicios de programas y proyectos de los diferentes entes de la ciudad. Es necesario considerar que los informes que proponemos en el proyecto Cali Come Mejor tienen como objetivo producir conocimientos que sirvan como herramienta para la toma de decisiones y generar estrategias para mejorar el sistema alimentario. El diseño de la actividad está previsto para que se den rondas de conversación alrededor de una mesa y al mismo tiempo que exista una interconexión con el resto de mesas al ir intercambiando. De este modo, conforme la gente se mueve de una mesa a la otra, se van enlazando sus conversaciones y construyendo sobre cada una de ellas."},{"index":5,"size":117,"text":"En cada una de las mesas estará la figura del moderador/a, el cual dinamizará la mesa en la que está presente a lo largo de toda la sesión. Esta persona es la única que no varía de mesa en toda la dinámica. Son los encargados de mantener un ambiente cordial y agradable en la mesa que moderan; para este caso, son algunos de los miembros de la organización de la jornada y el motivo de esta elección es principalmente, que son personas que dominan la temática que se aborda y pueden realizar un buen papel de construcción conjunta. Este hecho permite que puedan mediar más fácilmente ante discusiones que se creen entorno a aspectos de la temática."},{"index":6,"size":10,"text":"Café mundo en este caso, se desarrolla en tres fases: "}]}],"figures":[{"text":"Anexo 2 . Lista de participantes Anexo 3. Información pacto de Milano Disponible en:  http://www.foodpolicymilano.org/wp-content/uploads/2015/10/Milan-Urban-Food-Policy-Pact-_SPA.pdf 14:00 -14:10 El concepto de un sistema alimentario sostenible en Cali (LT) 14:10 -14:25 Plenaria, discusión Café del mundo con las mismas dos mesas (14:20-15:45) Recomendaciones para resolver los problemas identificados en la mañana (Trabajo grupal) -¿Que necesitamos para superar estos problemas? -¿Cuáles son las limitaciones para que se resuelvan estos problemas? 15:45 -16:00 Conclusiones y cierre Anexo 5. Metodología \"café mundo\" mesas de pensamiento colectivo "},{"text":"Fase 1 .Fase 2 . Preparación para el ejercicio (5 minutos) 1. Dividir a los participantes en dos grupos; Nutrición/Alimentación y Trabajo en las mesas (60 minutos) "}],"sieverID":"9abbc1a7-8dfc-41d8-bf79-5f078e4426e0","abstract":"Investigación sobre la competencia y competitividad en las cadenas de alimentación ... 5.2 Investigación sobre las condiciones de acceso a mercados para pequeños productores 5.3 Investigación con la municipalidad sobre las infraestructuras de mercado ."}

data/part_4/08a577dc2ee7a448c64937773bc55c5d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"08a577dc2ee7a448c64937773bc55c5d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/9a582f10-3a14-4541-805e-e2ef26cd6fe8/retrieve"},"pageCount":8,"title":"DESCRIPCiÓN MORFOLÓGICA 03:5' f/6","keywords":[],"chapters":[{"head":"ADAPTACiÓN Y PRODUCCiÓN DE FORRAJE","index":1,"paragraphs":[{"index":1,"size":100,"text":"Resultados de evaluaciones agronómicas en Comayagua, Yorito, Sulaco y el litoral atlántico, muestran que este cultivar se adapta a una diversidad de climas y suelos; al trópico sub húmedo con períodos secos de 5 a 7 meses y precipitaciones anuales de 800 a 1,600 mm y al trópico húmedo con más de 3,500 mm . Crece muy bien en suelos ácidos de baja fertilidad y da excelentes resultados en los de mediana y buena fertilidad. Tolera suelos arenosos y persiste en suelos mal drenados, hasta un máximo de 30 días, después de este período detiene su crecimiento y puede morir."},{"index":2,"size":125,"text":"Durante la época seca mantiene más hojas verdes que otros cultivares de la misma especie como el marandú y la libertad. Se adapta muy bien a la sombra , con temperaturas de 18 a 27° C, y crece desde el nivel del mar hasta los 1500 metros. Datos de producción de forraje en diferentes zonas, mostraron un promedio de 4 toneladas de materia seca (ms) por corte, con un 32% de (ms) y de 9 a 11 % de proteína cruda. Durante la época lluviosa y seca, en cuatro sitios diferentes, los resultados fueron de 20 a 30/ Tn/ha/ms por año, en cortes practícados cada 40 días. Resultados en Costa Rica , Panamá y Colombia reportan 32 Tn/ha/ms por año. iembra de semilla de pastos."},{"index":3,"size":72,"text":"PASIO 10 LEDO BRACHIARlA BRI%ANIHA \"CIAI 26110\" Los pastos tropicales constituyen el alimento mas barato y abundante para la alimentación de la ganadería bovina . Es por ello que a través de los años el ganadero hondureño los ha utilizado, pero por su condición de especies naturalizadas, adolecen de buena calidad, lo que impide la explotación de una ganadería intensiva y la liberación de áreas frágiles no aptas para este rubro ."},{"index":4,"size":75,"text":"En base a lo anterior la Dirección de Ciencia y Tecnología Agropecuaria, DICTA, a través del \"Proyecto Investigación Participativa con el Productor en Acción \" -DICTA -CIAT-BMZ-GTZ, han hecho esfuerzos conjuntos logrando identificar y seleccionar una nueva alternativa forrajera, la Brachiaria brizanfha \"CIAT 26110\", conocida como cultivar Toledo y Victoria , con características productivas y de persistencia adaptable a las diferentes condiclones agro ecológicas del país para una ganadería mas productiva y ver.daderamente competitiva ."},{"index":5,"size":32,"text":". , . Dirección de Ciencia y Tecnología Agropecuaria DICTA Boulevard Centro América Ave. La FAO, Col. Loma Linda Norte Apdo. Postal 5550 Tegucigalpa, Honduras, C. A. 232•2451,232-6652,235-6025 Fax: 235-6112 E-mail: [email protected]"}]},{"head":"SIEMBRA, ESTABLECIMIENTO Y MANEJO","index":2,"paragraphs":[{"index":1,"size":55,"text":"Se debe sembrar al inicio de las lluvias con semilla gámica; al voleo utilizando de 3 a 5 Kg/ha , en surcos o hileras de 2 a 3 Kg/ha y con espeque (labranza mínima y cero labranza) de 1.5 a 2.5 Kg/ha . También puede sembrarse por semilla vegetativa o plántulas producidas en almácigos ."},{"index":2,"size":62,"text":"La cantidad de semilla a utilizar depende de su calidad , (valor cultural , pureza y germinación) y del método de siembra . Suelos bien preparados requieren menor cantidad de semilla que con cero o mínima labranza . La cantidad final varía entre 3 a 4 Kg/ha para semilla con valor cultural de 60 a 80% de pureza y 75% de germinación."},{"index":3,"size":33,"text":"La emergencia de plántulas es mayor en siembras por chuzo (espeque) que al voleo, esto se asocia al contacto de la semilla con la humedad del suelo y al daño de plagas (hormigas)."},{"index":4,"size":31,"text":"El sistema de almácigos, en áreas pequeñas, baja la cantidad de semilla por unidad de superficie y disminuye todos los riesgos asociados al establecimiento por semilla (arrastre por lluvias, depredadores, etc.)."},{"index":5,"size":43,"text":"Esta Brachiaria se utiliza bajo pastoreo en bovinos , los caballos y mulas se comen las hojas tiernas (R. Bradley). Su crecimiento varía dependiendo del clima y del suelo, por lo que se recomienda un período de descanso de 20 a 30 días."},{"index":6,"size":8,"text":"Compite con las malezas durante la fase de"}]},{"head":"ATRIBUTOS DEL PASTO TOLEDO Y OTROS CULTIVARES DE BRACHIARIA BRIZANTHA","index":3,"paragraphs":[{"index":1,"size":44,"text":"En América Latina existen dos cultivares muy conocidos y disponibles de Brachiaria brizantha: La libertad y marandú, con características forrajeras deseables . Con el objeto de compararlos y hacer una mejor utilización de ellos, se ilustran esas características en el cuadro a continuación.  ."}]},{"head":"Ca ract:r~tres","index":4,"paragraphs":[{"index":1,"size":30,"text":"establecimiento, siendo posible el primer pastoreo a los 3 ó 4 meses. Su alta producción de biomasa le permite cargas mayores a 2 Ua/ha/año, especialmente en el período de lluvias."},{"index":2,"size":35,"text":"Se asocia bien con leguminosas forrajeras como: Arachis pintoi, Centrosema , Kudsu y con leguminosas tipo arbustivas como la Cratylia y Leucaena, éstas últimas sembradas en bandas de 2 a 3 hileras cada 10 metros."},{"index":3,"size":26,"text":"Por su gran vigor de crecimiento, puede utilizarse bajo corte, aunque los rendimientos no son iguales a los pastos tradicionales como el King-grass, caña, sorgo, etc."}]},{"head":"TOLERANCIA A PLAGAS Y ENFERMEDADES","index":5,"paragraphs":[{"index":1,"size":39,"text":"Tolera ataques de Rhizoctonia Sp y hongos del suelo como Fusarium Sp, existentes en zonas húmedas en donde el marandú es altamente susceptible.Tolera además el ataque de hongos foliares y es resistente al salivazo o baba de culebra ."}]},{"head":"CALIDAD Y PRODUCCION ANIMAL PRODUCCiÓN Y CALIDAD DE SEMILLA","index":6,"paragraphs":[{"index":1,"size":41,"text":"En Honduras en condiciones de trópico sub-húmedo, como en el valle de Comayagua, inicia su floración a inicios de octubre al final del período lluvioso. En este período, tiene una mejor sincronización de la floraci ón que la decumbens y marandú."},{"index":2,"size":29,"text":"La producción de semilla es más tardía que las Brachiarias dictyoneura y decumbens, que florecen al inicio de la época lluviosa, permitiendo su utilización bajo pastoreo durante el invierno."},{"index":3,"size":67,"text":"Para una producción de semilla uniforme se deben estandarizar los lotes (cortes de uniformación) en la segu nda quincena de septiembre, así se obtendrá buena calidad de semill a y un mayor número de tallos generativos. Se re comie nda hacer el corte de uniformación a 50 cms de alto, después ferti lizar con 50 kg de nitrógeno, para mejorar el porcentaje de pureza en la semilla."},{"index":4,"size":53,"text":"La semilla de este pasto tiene un período de latencia muy corto. Su germinación es de un 40% dos meses después de la cosecha, almacenada a 20°C, 50% de humedad relativa y escarificada con ácido sulfúrico. Seis meses más tarde, la germinación se incrementa significativamente y puede llegar a un 80% de germinación."}]}],"figures":[{"text":" cultivares de Brachiaria . C ... . . dc. Pasto Toledo Pasto M .... dú Pasto La Libenad C ... . . dc.Pasto ToledoPasto M .... dúPasto La Libenad Tolerancia a la sequía Muy buena Bueoa Buena Tolerancia a la sequíaMuy buenaBueoaBuena Tolerancia a la humedad Buena Mala Regular Tolerancia a la humedadBuenaMalaRegular Tolerancia a hongos foliares )' Muy buena Mala Regular Tolerancia a hongos foliares )'Muy buenaMalaRegular de la raíz    de la raíz Tolerancia a salivazo Susceptible Resistente Susceptible Tolerancia a salivazoSusceptibleResistenteSusceptible Recuperación bajo pastoreo Muy rápida Lenta Rápida Recuperación bajo pastoreoMuy rápidaLentaRápida Calidad forrajera Buena Buena Buena Calidad forrajeraBuenaBuenaBuena Sincronización de la noración Regular Pobre Pobre Sincronización de la noraciónRegularPobrePobre C aUdad de semto. Muy buena Buena Buena C aUdad de semto.Muy buenaBuenaBuena ES'ablKimiento por semilla Muy fácil Fácil Fácil ES'ablKimiento por semillaMuy fácilFácilFácil Vigor de plántula Alto Medio Medio Vigor de plántulaAltoMedioMedio Compatibilidad con leguminosas Buena Buena Buena Compatibilidad con leguminosasBuenaBuenaBuena forrajeras    forrajeras Requerimientos de suelos Fertilidad media FertiUdad Fertilidad Requerimientos de suelosFertilidad media FertiUdadFertilidad  alla media alt. media allamedia alt.media   Flllntt: Boletín Tknlco 2000 Costa Riel. Flllntt: Boletín Tknlco 2000 Costa Riel. BIBLIOGRAFíA    BIBLIOGRAFíA Argel P.S., Ard6n C. H., Di Palma M. l. , 2000. Pasto Toledo (Brachiaria brizanlha Argel P.S., Ard6n C. H., Di Palma M. l. , 2000. Pasto Toledo (Brachiaria brizanlha CIAT 26110) Boletfn Técnico. Consorcio TropiJeche Costa Rica , San José, CIAT 26110) Boletfn Técnico. Consorcio TropiJeche Costa Rica , San José, Costa Rica, 15 p.    Costa Rica, 15 p. Burgos C., Cruz H. 1998. Resultados de Investigaciones Agronómicas en Pastos y Burgos C., Cruz H. 1998. Resultados de Investigaciones Agronómicas en Pastos y Forrajes. Proyecto de Investigación Pecuaria . DICTA -SAG , Comayagua, Forrajes. Proyecto de Investigación Pecuaria . DICTA -SAG , Comayagua, Comayagua y Proyecto DICTA I CIAT, Yorito , Yoro.   Comayagua y Proyecto DICTA I CIAT, Yorito , Yoro.  "}],"sieverID":"e0c9cbde-6ef1-4e49-8b5e-7b08e8b7f844","abstract":"La Brachiaria brizantha \"CIAT 26110\" ( cv Toledo) es -foriginaria de Burundi , Africa . Fue evaluada por el Centro Internacional de Agricultura Tropical, CIAT, Introducida a -Honduras por la DICTA, para ser evaluada con otras gramíneas en la estación experimental El Guanacaste, Comayagua y en varias localidades de Yoro a través del proyecto DICTA-CIAT.Es una gramínea perenne, crece formando macollas de 1.60 metros de altu ra. Produce tallos vigorosos capa ces de enraizar en los nudos que entran en contacto con el suelo, por lo que puede sembrarse en forma vegetativa . Las hojas son lanceoladas con poca pubescencia , alcanzan hasta 60 cms de longitud y 2 cms de ancho. La inflorescencia es una panícula de 40 a 50 cms de longitud , con cuatro racimos de 8 a 12 cms con una sola hilera de espiguillas. Florece entre octubre y noviembre lo que permite utilizarla bajo pastoreo todo el invierno."}

data/part_4/08a6f21a565b24880376047fae9c2ad3.json

@@ -0,0 +1 @@
+{"metadata":{"id":"08a6f21a565b24880376047fae9c2ad3","source":"gardian_index","url":"https://dataverse.harvard.edu/api/access/datafile/:persistentId/?persistentId=doi:10.7910/DVN/28531/3UHCMK"},"pageCount":20,"title":"A 2007 Social Accounting Matrix (SAM) for Namibia","keywords":["First draft","February 2014","not for circulation"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":139,"text":"This section outlines the construction of a 2007 social accounting matrix (SAM) for Namibia. A SAM is a consistent data framework that captures the information contained in the national income and product accounts and the supply-use table (SUT), as well as the monetary flows between institutions. A SAM is an ex-post accounting framework since, within its square matrix, total receipts must equal total payments for each account contained within the SAM. Since the required data is not drawn from a single source, information from various sources must be compiled and made consistent. This process is valuable since it helps identify inconsistencies among statistical sources. For example, there are invariably differences between the incomes and expenditures reported in national household surveys. SAMs are economy-wide databases which are used in conjunction with analytical techniques to strengthen the evidence underlying policy decisions."},{"index":2,"size":111,"text":"Section 2 reviews the general structure of SAMs and Section 3 presents the key features of the Namibia SAM. The first step in constructing the SAM is compiling national accounts and other official data sources into a consistent SAM framework. The second step then draws on other data (including a previous SAM for the year 2004 by Lange & Schade, 2007) to disaggregate activity, commodity, labor and household accounts. Given the diversity and inaccuracy of survey data sources, the prior SAM is invariably inconsistent (i.e., there are inequalities between household receipts and payments) which need to be resolved. Section 4 briefly describes the Namibian economy through the lens created by SAM."}]},{"head":"General Structure of SAMs","index":2,"paragraphs":[{"index":1,"size":103,"text":"A SAM is an economywide data framework that usually represents the real economy of a single country. 1 More technically, a SAM is a square matrix in which each account is represented by a row and column. Each cell shows the payment from the account of its column to the account of its rowthe incomes of an account appear along its row, its expenditures along its column. The underlying principle of double-entry accounting requires that, for each account in the SAM, total revenue (row total) equals total expenditure (column total). Table 1 shows an aggregate SAM (with verbal explanations in place of numbers)."},{"index":2,"size":123,"text":"The SAM distinguishes between 'activities' (the entities that carry out production) and 'commodities' (representing markets for goods and non-factor services). SAM flows are valued at producers' prices in the activity accounts and at market prices (including indirect commodity taxes and transactions costs) in the commodity accounts. The commodities are activity outputs, either exported or sold domestically, and imports. In the activity columns, payments are made to commodities (intermediate demand), and factors of production (valueadded comprising of operating surplus and compensation of employees). In the commodity columns, payments are made to domestic activities, the rest of the world, and various tax accounts (for domestic and import taxes). This treatment provides the data needed to model imports as perfect or imperfect substitutes vis-à-vis domestic production."},{"index":3,"size":90,"text":"The government is disaggregated into a core government account and different tax collection accounts, one for each tax type. This disaggregation is necessary since otherwise the economic interpretation of some payments is often ambiguous. In the SAM, direct payments between the government and households are reserved for transfers. Finally, payments from the government to factors (for the labor services provided by public sector employees) are captured in the government services activity. Government consumption demand is a purchase of the output from the government services activity, which in turn, pays labor."},{"index":4,"size":82,"text":"The SAM contains a number of factors of production, which earn incomes from their use in the production process, and then pay their incomes to enterprises, households, government and the rest of the world. Indirect capital earnings or enterprise profits are taxed according to average corporate tax rates and some profits may be repatriated abroad. The remaining capital earnings, together with labor earnings are paid to households. Households use their incomes to pay taxes, save, and consume domestically produced and imported commodities."}]},{"head":"Structure of a 2007 SAM for Namibia","index":3,"paragraphs":[]},{"head":"Macro SAM","index":4,"paragraphs":[{"index":1,"size":207,"text":"The Central Bureau of Statistics in Namibia publishes a comprehensive set of national accounts which allows us to compile a Macro SAM for the year 2007. In particular, we have at our disposal, not only a breakdown of domestic expenditures by households and the public sector, it is also possible to identify investment demand and changes in stocks. GDP can be broken down functionally by labour, capital and taxes on products. Primary income and current transfer flows in both directions can be broken down by labour and capital and by households and government respectively. Government transfers paid and received are available as well at government savings, while direct taxes are broken down by households and enterprises. The transfer of functional incomes to households and enterprises can be derived as a residual. Domestic private savings is available but not its breakdown across enterprises and households. Here, we make the assumption that enterprises retain 40% of their revenues for savings. With this assumption we can derive enterprise income distributed to households as a residual. With enterprise savings and total domestic savings now known, we can derive household savings as a residual. This yields a savings rate of 12%. With this final piece of information the Macro SAM will balance."},{"index":2,"size":17,"text":"However, there are some small imbalances that are dealt with. This is achieved in the following way:"},{"index":3,"size":20,"text":"1. GDP accounting from the income and expenditure side yields a published discrepancy. We load this into changes in inventories."},{"index":4,"size":87,"text":"2. Government income identifies taxes on production which are not factored into GDP at market prices as is the case for example in South Africa. Thus, if we add taxes on production in, our estimate of GDP is higher that the official estimate. We could (but didn't) balance this on the expenditure side by raising changes in inventories. If we leave taxes on production out altogether (we didn't do this either), our GDP estimate remains consistent with the official data but public sector accounting will not balance."},{"index":5,"size":72,"text":"An alternative is to treat taxes on production as a factor tax. In that way, it is kept outside the GDP accounting and the Macro SAM maintains consistency with headline variables while government accounting remains internally consistent. We have followed the latter approach 3. Another imbalance refers to government transfers paid to the Rest of the World. The Balance of Payment reports a slightly lower total here than the public sector account."},{"index":6,"size":57,"text":"We maintain the totals of the former so as to keep the Current Account balance in the Micro SAM consistent with published data. The upshot of all this is that there is a difference between the government balance on their current account in our Micro SAM compared to the national accounts to the amount of N$40 million."},{"index":7,"size":147,"text":"4. Finally, indirect taxes on products are broken down by sales tax and import tax. While the sum of the two is available for the national accounts, the latter can be extracted from OECD/ADB data on Namibia's fiscal performance (http://www.africaneconomicoutlook.org/en/menu-miscellaneous/database-onafrican-fiscal-performance/). Another source would have the IMF/IFS data. In both cases the customs duties collected are two times the value that is reported in the Nation Accounts for total indirect taxes, i.e., including sales taxes. This makes us believe that the SACU customs pool transfers are loaded in to these estimates. When we back the SACU customs pool transfers out of the OECD/ADB or IMF/IFS data, we end up with an estimate of Namibia's own collections of customs duties or just over N$1 billion. We subtract this from the national accounts value for total indirect taxes on products to arrive at sales tax of just over N$3.5 billion."},{"index":8,"size":69,"text":"In the next table, the resulting Macro SAM is shown. The rest of this section broadly explains the source of each macro SAM entry and how it is disaggregated to arrive at the micro SAM. The notation for SAM entries is (row, column) and the values are in millions of 2007 Namibian Dollars. The final disaggregated SAM is quite large and is therefore included in an accompanying workbook file."}]},{"head":"i. 2 Commodities, 1 Activities: 44,930","index":5,"paragraphs":[{"index":1,"size":85,"text":"This is the value of intermediate inputs used in the production process (i.e., the \"use\" matrix) and is taken from UN National Accounts Official Country Data series. The technical coefficients are based on the 2004 SAM and are defined as the share of input costs used per unit of output. Biproportional scaling has been used to make the \"use\" matrix consistent with the rest of the SAM. More detail is provided in the next section with \"Additional Notes on the Compilation of the Micro SAM\"."}]},{"head":"ii. 3 Factors, 1 Activities: 57,424","index":6,"paragraphs":[{"index":1,"size":44,"text":"This is the value of gross domestic product (GDP) at factor cost or alternatively, total value-added generated by labor and capital. 2007 National Accounts GDP data for 23 sectors is used for further disaggregation and the 2004 SAM for further disaggregation to 24 sectors."},{"index":2,"size":1,"text":"iii."},{"index":3,"size":98,"text":"1 Activities,2 Commodities: 102,354 This is the value of total marketed output (i.e., the \"supply\" matrix). Since all output is assumed to be supplied to markets, this value is equivalent to gross output, where the latter is the sum of intermediate inputs and GDP at basic prices (which is equal to factor costs in our case since there are no indirect taxes on production). The 2004 SAM distinguishes between 25 commodities (see Table A 3 in the appendix). Note that some industries produce more than one commodity. This results in a few offdiagonal entries in the supply matrix."}]},{"head":"iv. 6 Government, 2 Commodities: 4,678","index":7,"paragraphs":[{"index":1,"size":112,"text":"While the macro SAM shows only a single row and column for the government account, this cell entry actually consists of a number of distinct tax accounts. These include value-added tax (VAT), subsidies on products, other excise taxes, and import tariffs. The final commodity tax entries in the 2007 SAM for Namibia consist of two indirect taxes: (1) import tariffs and (2) sales taxes. These taxes are derived by applying tax rates from the 2004 SAM and scaled to the Macro SAM control totals. This implies that the same distribution across commodities for the total indirect tax is used for sales tax and import duties respectively while ignoring the latter for services."}]},{"head":"v. 8 Rest of world, 2 Commodities: 32,310","index":8,"paragraphs":[{"index":1,"size":34,"text":"Total imports is available from the 2007 National Accounts. Disaggregation across the 24 commodities uses UN ComTrade data that has been mapped from HS codes. Services trade is based on World Bank Development Indicators."}]},{"head":"vi. 4 Enterprises, 3 Factors: 30,528","index":9,"paragraphs":[{"index":1,"size":68,"text":"These are the capital returns (i.e., property incomes) that enterprises earn after they have been generated during the production process. The total capital returns were taken from the 2007 National accounts together with what is transferred to the RoW Accounts (external transaction of property income) and a factor tax (see discussion in viii below) The residual is what is shown in this entry and represents payments to enterprises."}]},{"head":"vii. 5 Households, 3 Factors: 24,787","index":10,"paragraphs":[{"index":1,"size":53,"text":"Households receive factor incomes directly from labour (not from capital as that is all transferred to enterprises). The total value of these receipts is taken from the 2007 National Accounts. A small share is allocated to the RoW for non-resident workers. This share is based on data taken from the 2007 National Accounts."},{"index":2,"size":48,"text":"Disaggregation of labour (skilled and unskilled) and of household categories [urban/rural as well as the categories wage earner, self-employed (broadly) and other income] is achieved by using shares from the 2004 SAM. Inconsistencies are eliminated by means by biproportional scaling, see below for further discussion on this issue."}]},{"head":"viii. 6 Government, 3Factors: 865","index":11,"paragraphs":[{"index":1,"size":36,"text":"This is the factor tax mentioned earlier. It should be considered as a tax on production that appears in the government accounts but not in the national accounts such that the SAM is consistent with both."}]},{"head":"ix. 8 Rest of world, 3 Factors: 2,693","index":12,"paragraphs":[{"index":1,"size":67,"text":"This entry represents the gross outflow to the RoW of the rewards for the factors of production. Total income and expenditure of all factors of production was taken from the 2007 National Accounts. The breakdown between capital and labour and the components of the latter was discussed in ii above. The proportion that flows to the RoW is based on data taken from the 2007 National Accounts."},{"index":2,"size":6,"text":"x. 5 Household, 4 Enterprises: 15,538"},{"index":3,"size":30,"text":"These are transfers from enterprises to households and they are derived as a residual. The disaggregation of these transfers amongst household categories is based on shares from the 2004 SAM."}]},{"head":"xi. 6 Government, 4 Enterprises: 3,565","index":13,"paragraphs":[{"index":1,"size":81,"text":"Since this is a Macro SAM we do not at this stage make a distinction between government income received from enterprise surpluses in which they may have a stake and corporate tax income. We assume it is the latter and a breakdown is available from the 2007 National Accounts The first services category is split between communications and other services using 2004 SAM shares. Travel services are allocated to the hotels and restaurants SAM (cacco) commodity while the rest is self-explanatory."},{"index":2,"size":73,"text":"Indirect taxes are derived by applying tax rates from the 2004 SAM and scaled to the Macro SAM control totals. The same distribution across commodities for the total is applied to sales tax and import duties respectively while ignoring the latter for services. A similar approach is followed with regard to trade and transport margins. A further disaggregation of margins into those that apply to domestic, import and export will be discussed later."},{"index":3,"size":79,"text":"Detailed intermediate demand for goods and services can initially be derived from the 2004 SAM Use Matrix after which is then proportionally scaled to be consistent the Macro SAM. The 2004 SAM Use Matrix is also used to derive intermediate inputs by activities. The latter is added to GDP to arrive at gross value of production for activities. Combined with the 2004 SAM Supply Matrix it is then possible to construct an initial estimate of domestic supply for commodities."},{"index":4,"size":66,"text":"Bringing demand and supply together reveals inconsistencies. In addition, for a number of commodities domestic supply is less than what is exported. Since we have more confidence in UNComTrade exports estimates we resolve the second inconsistency (of domestic supply being larger than exports) by way of manual ad-hoc adjustment to the former. Commodity demand and supply are then equalised by making demand for intermediates the residual."},{"index":5,"size":90,"text":"With a new estimate of domestic supply of goods and services we can derive a new estimate of gross value of production for activities using the 2004 SAM Supply Matrix. The new estimate of gross value of production can be reduced with value added to arrive at a final estimate of intermediate inputs by activities. The latter, together with the estimates of demand for intermediates are then imposed as lower level control totals to the 2004 SAM Use Matrix. A new Use Matrix is derived by means of biproportional scaling."},{"index":6,"size":149,"text":"A further set of adjustments is made so as to incorporate a disaggregation of household demand by income category and labour remuneration by skill category. The schedule of disaggregated accounts can be found in Table A 6 of the Appendix. We do this by initially using the relevant shares from the 2004 SAM. Sources of household income other than wage earnings such as income from enterprises and transfers are also disaggregated using shares from the 2004 SAM. A manual adjustment to the distribution of unearned income from enterprises to households was necessary as the combination of Macro SAM entries and 2004 SAM shares resulted in negative flows of earned wage income. In order to bring household wage earnings by income category in line with wage earnings by skill we use the income distribution shares from the 2004 SAM as a starting point for a final round of biproportional scaling."},{"index":7,"size":92,"text":"Trade margins are derived from the 2004 SAM and applied to the absorption data described earlier. The 2004 SAM also offers shares to disaggregate margins across trade and transport but no distinction was made between margins on domestic trade, exports and imports. The last two represent margins to move goods to and from the border. The final adjustment that is made to the 2007 SAM for Namibia is disaggregates trade and transport margins into those on domestic trade, exports and imports using the values of trade (less taxes) for the respective components."}]},{"head":"Namibia's Economic Structure through the Lens of a 2007 Micro SAM","index":14,"paragraphs":[{"index":1,"size":26,"text":"We examine the economic structure of the Namibia economy through the lens of the newly estimated 2007 Micro SAM by compiling the following set of tables."},{"index":2,"size":140,"text":"Table 3 reports macro variables of the 2007 SAM for Namibia. GDP is estimated to be N$62.1 billion. The stand-out features are that trade in either direction represents about 50% of GDP while investment is about 23%. The distribution of the components of value added at basic prices across activities is shown in the next table. Government services, mining and trade are the 3 largest activities in terms of their contribution to GDP at basic prices. Fishing and fish processing is also substantial with close to 6%, followed by heavy and light manufacturing. Accommodation services' share is estimated to be just over 3% of GDP. Government and other private services employ most of Namibia's skilled labour. These activities are also the largest employer of unskilled labour followed by fishing and mining. Most capital is employed by mining and trade services."},{"index":3,"size":14,"text":"Table 5 reports on the distribution of activities' costs across primary and intermediate inputs."},{"index":4,"size":104,"text":"Agriculture requires relatively less intermediate inputs than manufacturing. Construction has a relatively high linkage to the rest of the economy, although some of that may still be imported. Moving on to household income, the next table reports sources. As expected, urban households with business interest obtain most (95%) of their income from enterprises. In the rural areas there is a more even distribution in this regard amongst wage earners and business households. If the latter type households do earn wage income, it is mostly high skilled. Rural 'other' households receive more than half of their income from government transfers, higher than their urban counterparts.    "}]}],"figures":[{"text":"Table 1  : A Macro SAM for Namibia, 2007, N$ million      : A Macro SAM for Namibia, 2007, N$ million  1 Activities 2 Commodities 3 Factors 4 Enterprises 5 Households 6 Government 7 Investment 8 Rest of world Total 1 Activities2 Commodities3 Factors4 Enterprises5 Households6 Government7 Investment8 Rest of worldTotal 1 Activities  102,354       102,354 1 Activities102,354102,354 2 Commodities 44,930    35,664 12,840 14,412 31,496 139,342 2 Commodities44,93035,66412,84014,41231,496139,342 3 Factors 57,424       1,449 58,873 3 Factors57,4241,44958,873 4 Enterprises   30,528   1,311   31,839 4 Enterprises30,5281,31131,839 5 Households   24,787 15,538  3,805  161 44,291 5 Households24,78715,5383,80516144,291 6 Government  4,678 865 3,565 3,724   7,260 20,092 6 Government4,6788653,5653,7247,26020,092 7 Savings    12,736 4,876 1,793  -4,993 14,412 7 Savings12,7364,8761,793-4,99314,412 8 Rest of world  32,310 2,693  27 343   35,373 8 Rest of world32,3102,6932734335,373 Total 102,354 139,342 58,873 31,839 44,291 20,092 14,412 35,373 Total102,354139,34258,87331,83944,29120,09214,41235,373  "},{"text":" This entry represents personal income tax and is taken from the 2007 National Account. The breakdown into household categories is available from the 2004 SAM.Household transfers to the RoW are taken from the 2007 National Accounts and broken down by income group according to the 2004 SAM.Transfers by government to households are also derived from the 2007 National Accounts. Further disaggregation into income and geographic groups is based on shares from the 2004 SAM. The only household categories that receive these transfers are marked as rural and urban \"other\" in the 2004 SAM.Investment demand for goods and services available from the 2007 National Accounts and can be broken down by commodity using the 2004 SAM where necessary.Demand for goods and services by the RoW is available from the 2007 National Accounts and disaggregated across commodities according to UNComTrade data and data on services trade according to the World Bank Development Indicators.Receipts by Namibian resident workers and Namibian capital outside the country is available from the 2007 National Accounts data. The breakdown between capital and labour is based on the 2004 SAM but is manually adjusted in order to avoid negative entries elsewhere in the SAM. The breakdown in labour groups is based on the 2004 SAM.Household transfers received from the RoW are based on the 2007 National Accounts. The breakdown between households and government is based on shares from the 2004 SAM.The current account surplus balances out the external and the savingsinvestment accountsMicro SAM2007 National Accounts GDP data for 23 sectors is used to construct value added for the 24 sectors identified in the 2007 SAM for Namibia. The Mapping is shown in Table A 2 of the Appendix. Where necessary, 2004 SAM industry shares were used. Further breakdown into labour (by two skill levels) and Gross Operating Surplus is initially based on shares from the 2004 SAM. We add mixed income with Gross Operating Surplus. Overall consistency of the initial estimates for the two types of labour and gross operating surplus with the economywide functional distribution in the Macro SAM was maintained by way of a biproportional scaling routine.Household expenditure is distributed across SAM commodities as shown in Table A 3 of the Appendix. 2004 SAM shares are used to disaggregate beyond the household expenditure commodities identified in the national accounts. An adjustment is made for local expenditures by non-residents and foreign expenditures by residents by taking the net of these two as reported in the National Accounts and applying expenditure shares that are available from the 2004 SAM. Government expenditure on goods and services is limited to the government services commodity and can be taken from the Macro SAM. Investment demand is allocated to SAM commodities according to the schedule shown in TableA 4 and matched.The distribution of transport equipment and machinery across heavy and light manufacturing is based on 2004 SAM shares.Merchandise trade (in both directions) is based on UNComTrade data and is disaggregated to the relevant commodities according to Table A 5. The trade data identifies exports of petroleum products but this is considered re-exports and therefore removed from both directions of trade. Since, according to the 2004 SAM, there is some fish processing taking place on board of fishing ships, the exports of fish products is split between fish and fish processing products according to the export shares as reported in the 2004 SAM. Trade in services is derived from the World Bank Development Indicators (downloaded from Quantec). The following table shows the services trade categories identified by the World Bank Development Indicators: xxii. Commodities, 7 Savings-investment: 14,412 xxii.Commodities, 7 Savings-investment: 14,412 xv. 7 Savings-investment, 5 Households: 4,876 xv.7 Savings-investment, 5 Households: 4,876 xxiii. Household savings are derived as a residual and broken down by income groups 2 Commodities, 8 Rest of world: 31,496 xxiii.Household savings are derived as a residual and broken down by income groups 2 Commodities, 8 Rest of world: 31,496  according to the 2004 SAM. according to the 2004 SAM. xvi. 8 Rest of world, 5 Households: 27 xvi.8 Rest of world, 5 Households: 27 xxiv. 3 Factors, 8 Rest of world: 1,449 xxiv.3 Factors, 8 Rest of world: 1,449 xvii. 2 Commodities, 6 Government: 12,840 xvii.2 Commodities, 6 Government: 12,840  Government expenditure on goods and services is based on the 2007 National Government expenditure on goods and services is based on the 2007 National  Accounts data and broken down into types of goods and services using the 2004 Accounts data and broken down into types of goods and services using the 2004  SAM. SAM. xviii. xxv. 4 Enterprises, 6 Government: 1,311 5 Households, 8 Rest of world: 161 xviii. xxv.4 Enterprises, 6 Government: 1,311 5 Households, 8 Rest of world: 161  Transfers by government to enterprises represent government interest payments as Transfers by government to enterprises represent government interest payments as  shown in the 2007 National Accounts. shown in the 2007 National Accounts. xix. 5 Households, 6 Government: 3,805 xix.5 Households, 6 Government: 3,805 xxvi. 6 Government, 8 Rest of world: 7,260 xxvi.6 Government, 8 Rest of world: 7,260 Table 2: Services Trade Categories Identified by the World Bank Development Indicators Table 2: Services Trade Categories Identified by the World Bank Development Indicators Government transfers received from the rest of the world are available from the 2007 1 Computer, communications and other Government transfers received from the rest of the world are available from the 2007 1 Computer, communications and other  National accounts and comprise of: services National accounts and comprise of: services xii. xx. 2 Insurance and financial services 7 Savings-investment, 4 Enterprises: 12,736 7 Savings-investment, 6 Government: 1,793 -Current taxes on income, wealth, etc. -3 Transport services Receivable due to SACU membership -Other current transfers receivable by Government 4 Travel services xii. xx. 2 Insurance and financial services 7 Savings-investment, 4 Enterprises: 12,736 7 Savings-investment, 6 Government: 1,793 -Current taxes on income, wealth, etc. -3 Transport services Receivable due to SACU membership -Other current transfers receivable by Government 4 Travel services  Enterprise savings in the Macro SAM are calculated as a residual Enterprise savings in the Macro SAM are calculated as a residual xxvii. Government savings is calculated as the difference between current income and 7 Savings-investment, 8 Rest of world: -4,993 xxvii.Government savings is calculated as the difference between current income and 7 Savings-investment, 8 Rest of world: -4,993 xiii. 2 Commodities, 5 Households: 35,664 expenditures. xiii.2 Commodities, 5 Households: 35,664 expenditures. xxi. Household expenditure on goods and services is available from the 2007 National 8 Rest of world, 6 Government: 343 xxi.Household expenditure on goods and services is available from the 2007 National 8 Rest of world, 6 Government: 343  Accounts and broken down into urban/rural as well as the categories wage earner, Accounts and broken down into urban/rural as well as the categories wage earner,  self-employed (broadly) and other income and types of goods and services using Government transfers to the RoW are taken from the 2007 National Accounts and self-employed (broadly) and other income and types of goods and services using Government transfers to the RoW are taken from the 2007 National Accounts and  shares from the 2004 SAM. comprises: shares from the 2004 SAM. comprises:  - Current taxes on income, wealth, etc. -Current taxes on income, wealth, etc. xiv. 6 Government, 5 Households: 3,724 -Payable due to SACU membership xiv.6 Government, 5 Households: 3,724 -Payable due to SACU membership  - Other current transfers payable by Government. -Other current transfers payable by Government.  "},{"text":"Table 2 : Macro Structure, 2007     Value  Share of GDP ValueShare of GDP (mil. N$) (%) (mil. N$)(%) Household consumption 35.7 57.4 Household consumption35.757.4 Gross fixed capital formation 14.4 23.2 Gross fixed capital formation14.423.2 Change in inventories 12.8 20.7 Change in inventories12.820.7 Government expenditure 31.5 50.7 Government expenditure31.550.7 Exports 32.3 52.0 Exports32.352.0 Imports 62.1 100.0 Imports62.1100.0 GDP at market prices 4.7 7.5 GDP at market prices4.77.5 Net indirect taxes 57.4 92.5 Net indirect taxes57.492.5 GDP at factor cost 35.7 57.4 GDP at factor cost35.757.4 Source: 2007 Namibia SAM.   Source: 2007 Namibia SAM.  "},{"text":"Table 4 : Value Added Shares by Industry, 2007  Labor catego ries Capital Total Labor catego riesCapitalTotal  Skilled Unskilled   SkilledUnskilled acrps 0.2 0.6 2.0 1.3 acrps0.20.62.01.3 alvst 0.2 0.6 3.0 1.8 alvst0.20.63.01.8 atagr 0.0 0.0 3.7 2.1 atagr0.00.03.72.1 afish 2.1 6.5 3.7 4.1 afish2.16.53.74.1 amine 15.0 6.0 13.3 11.9 amine15.06.013.311.9 ameat 0.3 0.3 0.4 0.4 ameat0.30.30.40.4 afprc 1.1 1.2 1.9 1.6 afprc1.11.21.91.6 agram 0.4 0.5 1.8 1.2 agram0.40.51.81.2 aothf 1.8 1.9 5.4 3.9 aothf1.81.95.43.9 atclf 1.1 1.3 5.2 3.5 atclf1.11.35.23.5 almnf 2.9 1.8 1.4 1.8 almnf2.91.81.41.8 ahmnf 4.5 2.8 5.6 4.7 ahmnf4.52.85.64.7 aelct 2.2 0.9 2.3 1.9 aelct2.20.92.31.9 awate 0.6 0.5 1.0 0.8 awate0.60.51.00.8 acnst 3.1 1.3 5.4 4.0 acnst3.11.35.44.0 atrad 11.4 10.8 12.3 11.8 atrad11.410.812.311.8 aacco 0.5 2.1 2.4 1.9 aacco0.52.12.41.9 atrnp 1.7 2.3 2.0 2.0 atrnp1.72.32.02.0 acomm 2.3 1.9 4.0 3.2 acomm2.31.94.03.2 afini 1.9 1.4 4.3 3.1 afini1.91.44.33.1 areal 0.0 0.0 4.5 2.5 areal0.00.04.52.5 abuss 1.5 1.0 5.5 3.7 abuss1.51.05.53.7 aopsv 13.2 12.2 2.3 6.8 aopsv13.212.22.36.8 agovt 32.0 42.2 6.7 20.1 agovt32.042.26.720.1 Total 100.0 100.0 100.0 100.0 Total100.0100.0100.0100.0 Source: 2007 Namibia SAM.   Source: 2007 Namibia SAM.  "},{"text":"Table 5 : Primary and Intermediate Input Shares by Industry, 2007  Value- Inter- Gross Value-Inter-Gross  added mediates output addedmediatesoutput acrps 75.5 24.5 100.0 acrps75.524.5100.0 alvst 78.1 21.9 100.0 alvst78.121.9100.0 atagr 70.9 29.1 100.0 atagr70.929.1100.0 afish 69.2 30.8 100.0 afish69.230.8100.0 amine 55.0 45.0 100.0 amine55.045.0100.0 ameat 16.0 84.0 100.0 ameat16.084.0100.0 afprc 59.7 40.3 100.0 afprc59.740.3100.0 agram 82.2 17.8 100.0 agram82.217.8100.0 aothf 36.8 63.2 100.0 aothf36.863.2100.0 atclf 67.1 32.9 100.0 atclf67.132.9100.0 almnf 31.8 68.2 100.0 almnf31.868.2100.0 ahmnf 32.4 67.6 100.0 ahmnf32.467.6100.0 aelct 47.3 52.7 100.0 aelct47.352.7100.0 awate 65.6 34.4 100.0 awate65.634.4100.0 acnst 37.4 62.6 100.0 acnst37.462.6100.0 atrad 71.7 28.3 100.0 atrad71.728.3100.0 aacco 34.7 65.3 100.0 aacco34.765.3100.0 atrnp 49.2 50.8 100.0 atrnp49.250.8100.0 acomm 63.5 36.5 100.0 acomm63.536.5100.0 afini 36.8 63.2 100.0 afini36.863.2100.0 areal 100.0 0.0 100.0 areal100.00.0100.0 abuss 67.6 32.4 100.0 abuss67.632.4100.0 aopsv 56.1 43.9 100.0 aopsv56.143.9100.0 agovt 77.7 22.3 100.0 agovt77.722.3100.0 Source: 2007 Namibia SAM.  Source: 2007 Namibia SAM.  "},{"text":"Table 6 : Sources of Household Income, 2007      Labor categories Enterprises Government Rest of Total Labor categoriesEnterprisesGovernmentRest ofTotal  Skilled Unskilled   world  SkilledUnskilledworld hhuws 32.6 51.8 14.9 0.0 0.7 100.0 hhuws32.651.814.90.00.7100.0 hhubs 4.1 0.0 95.9 0.0 0.0 100.0 hhubs4.10.095.90.00.0100.0 hhuot 0.0 0.0 54.2 45.8 0.0 100.0 hhuot0.00.054.245.80.0100.0 hhrws 17.5 27.7 54.8 0.0 0.0 100.0 hhrws17.527.754.80.00.0100.0 hhrbs 60.7 0.0 39.3 0.0 0.0 100.0 hhrbs60.70.039.30.00.0100.0 hhrot 0.0 0.0 42.9 57.1 0.0 100.0 hhrot0.00.042.957.10.0100.0 total 25.0 31.0 35.1 8.6 0.4 100.0 total25.031.035.18.60.4100.0 Source: 2007 Namibia SAM.      Source: 2007 Namibia SAM.  "},{"text":"Table A2 : Mapping of SAM Commodities to Household Expenditure from the National Accounts, 2007  SAM Commodity Description Nat Acc Control SAM Commodity DescriptionNat Acc Control ccrps Commercial crops Food, beverages and tobacco ccrpsCommercial cropsFood, beverages and tobacco clvst Commercial animal products Food, beverages and tobacco clvstCommercial animal productsFood, beverages and tobacco ctagr TradAgr-FoodForOwnCon Food, beverages and tobacco ctagrTradAgr-FoodForOwnConFood, beverages and tobacco cfish Fishing Food, beverages and tobacco cfishFishingFood, beverages and tobacco cmine Mining cmineMining cmeat Meat processing Food, beverages and tobacco cmeatMeat processingFood, beverages and tobacco cfprc Fish processing Food, beverages and tobacco cfprcFish processingFood, beverages and tobacco cgram Grain milling Food, beverages and tobacco cgramGrain millingFood, beverages and tobacco cothf Beverages and other food processing Food, beverages and tobacco cothfBeverages and other food processingFood, beverages and tobacco ctclf Textiles Clothing and footwear ctclfTextilesClothing and footwear clmnf Light manufacturing Other goods clmnfLight manufacturingOther goods cpetr Petroleum products Housing, water, electricity and fuels cpetrPetroleum productsHousing, water, electricity and fuels chmnf Heavy manufacturing Other goods chmnfHeavy manufacturingOther goods celct Electricity Housing, water, electricity and fuels celctElectricityHousing, water, electricity and fuels cwate Water Housing, water, electricity and fuels cwateWaterHousing, water, electricity and fuels ccnst Construction Housing, water, electricity and fuels ccnstConstructionHousing, water, electricity and fuels ctrad Trade; repairs (margins +) Other services ctradTrade; repairs (margins +)Other services cacco Hotels and restaurants Other services caccoHotels and restaurantsOther services ctrnp Transport Transport ctrnpTransportTransport ccomm Communication Other services ccommCommunicationOther services cfini Finance and insurance Other services cfiniFinance and insuranceOther services creal Real estate, own Housing, water, electricity and fuels crealReal estate, ownHousing, water, electricity and fuels cbuss MktRealEst + Business services Other services cbussMktRealEst + Business servicesOther services copsv Other private services Health + Education copsvOther private servicesHealth + Education cgovt Government services cgovtGovernment services Table A4: Mapping of SAM Commodities to Household Expenditure from the National Table A4: Mapping of SAM Commodities to Household Expenditure from the National Accounts, 2007  Accounts, 2007   SAM Commodity Description Nat Acc Control SAM Commodity DescriptionNat Acc Control chmnf & clmnf Heavy manufacturing & Light manufacturing Food, beverages and tobacco chmnf & clmnfHeavy manufacturing & Light manufacturingFood, beverages and tobacco ccnst  Construction Food, beverages and tobacco ccnstConstructionFood, beverages and tobacco cbuss  MktRealEst + Business services Food, beverages and tobacco cbussMktRealEst + Business servicesFood, beverages and tobacco  "},{"text":"Table A5 : Matching HS2 Trade Data from UNComTrade to SAM Commodities  HS2 UNComTrade Commodity Description SAM Commodity HS2 UNComTrade Commodity DescriptionSAM Commodity clvst Live animals Commercial animal products clvstLive animalsCommercial animal products cmeat Meat and edible meat offal Meat processing cmeatMeat and edible meat offalMeat processing cfish Fish, crustaceans, molluscs, aquatic invertebrates nes Fishing cfishFish, crustaceans, molluscs, aquatic invertebrates nesFishing cothf Dairy products, eggs, honey, edible animal product nes Beverages and other food processing cothfDairy products, eggs, honey, edible animal product nesBeverages and other food processing cothf Products of animal origin, nes Beverages and other food processing cothfProducts of animal origin, nesBeverages and other food processing ccrps Live trees, plants, bulbs, roots, cut flowers etc Commercial crops ccrpsLive trees, plants, bulbs, roots, cut flowers etcCommercial crops ccrps Edible vegetables and certain roots and tubers Commercial crops ccrpsEdible vegetables and certain roots and tubersCommercial crops ccrps Edible fruit, nuts, peel of citrus fruit, melons Commercial crops ccrpsEdible fruit, nuts, peel of citrus fruit, melonsCommercial crops cothf Coffee, tea, mate and spices Beverages and other food processing cothfCoffee, tea, mate and spicesBeverages and other food processing cgram Cereals Grain milling cgramCerealsGrain milling cgram Milling products, malt, starches, inulin, wheat gluten Grain milling cgramMilling products, malt, starches, inulin, wheat glutenGrain milling cothf Oil seed, oleagic fruits, grain, seed, fruit, etc, nes Beverages and other food processing cothfOil seed, oleagic fruits, grain, seed, fruit, etc, nesBeverages and other food processing cothf Lac, gums, resins, vegetable saps and extracts nes Beverages and other food processing cothfLac, gums, resins, vegetable saps and extracts nesBeverages and other food processing cothf Vegetable plaiting materials, vegetable products nes Beverages and other food processing cothfVegetable plaiting materials, vegetable products nesBeverages and other food processing cothf Animal,vegetable fats and oils, cleavage products, etc Beverages and other food processing cothfAnimal,vegetable fats and oils, cleavage products, etcBeverages and other food processing cothf Meat, fish and seafood food preparations nes Beverages and other food processing cothfMeat, fish and seafood food preparations nesBeverages and other food processing cothf Sugars and sugar confectionery Beverages and other food processing cothfSugars and sugar confectioneryBeverages and other food processing cothf Cocoa and cocoa preparations Beverages and other food processing cothfCocoa and cocoa preparationsBeverages and other food processing cothf Cereal, flour, starch, milk preparations and products Beverages and other food processing cothfCereal, flour, starch, milk preparations and productsBeverages and other food processing cothf Vegetable, fruit, nut, etc food preparations Beverages and other food processing cothfVegetable, fruit, nut, etc food preparationsBeverages and other food processing cothf Miscellaneous edible preparations Beverages and other food processing cothfMiscellaneous edible preparationsBeverages and other food processing cothf Beverages, spirits and vinegar Beverages and other food processing cothfBeverages, spirits and vinegarBeverages and other food processing cothf Residues, wastes of food industry, animal fodder Beverages and other food processing cothfResidues, wastes of food industry, animal fodderBeverages and other food processing cothf Tobacco and manufactured tobacco substitutes Beverages and other food processing cothfTobacco and manufactured tobacco substitutesBeverages and other food processing cmine Salt, sulphur, earth, stone, plaster, lime and cement Mining cmineSalt, sulphur, earth, stone, plaster, lime and cementMining cmine Ores, slag and ash Mining cmineOres, slag and ashMining cpetr Mineral fuels, oils, distillation products, etc Petroleum products cpetrMineral fuels, oils, distillation products, etcPetroleum products chmnf Inorganic chemicals, precious metal compound, isotopes Heavy manufacturing chmnfInorganic chemicals, precious metal compound, isotopesHeavy manufacturing chmnf Organic chemicals Heavy manufacturing chmnfOrganic chemicalsHeavy manufacturing clmnf Pharmaceutical products Light manufacturing clmnfPharmaceutical productsLight manufacturing chmnf Fertilizers Heavy manufacturing chmnfFertilizersHeavy manufacturing chmnf Tanning, dyeing extracts, tannins, derivs,pigments etc Heavy manufacturing chmnfTanning, dyeing extracts, tannins, derivs,pigments etcHeavy manufacturing clmnf Essential oils, perfumes, cosmetics, toileteries Light manufacturing clmnfEssential oils, perfumes, cosmetics, toileteriesLight manufacturing chmnf Soaps, lubricants, waxes, candles, modelling pastes Heavy manufacturing chmnfSoaps, lubricants, waxes, candles, modelling pastesHeavy manufacturing chmnf Albuminoids, modified starches, glues, enzymes Heavy manufacturing chmnfAlbuminoids, modified starches, glues, enzymesHeavy manufacturing chmnf Explosives, pyrotechnics, matches, pyrophorics, etc Heavy manufacturing chmnfExplosives, pyrotechnics, matches, pyrophorics, etcHeavy manufacturing clmnf Photographic or cinematographic goods Light manufacturing clmnfPhotographic or cinematographic goodsLight manufacturing chmnf Miscellaneous chemical products Heavy manufacturing chmnfMiscellaneous chemical productsHeavy manufacturing clmnf Plastics and articles thereof Light manufacturing clmnfPlastics and articles thereofLight manufacturing chmnf Rubber and articles thereof Heavy manufacturing chmnfRubber and articles thereofHeavy manufacturing clmnf Raw hides and skins (other than furskins) and leather Light manufacturing clmnfRaw hides and skins (other than furskins) and leatherLight manufacturing clmnf Articles of leather, animal gut, harness, travel goods Light manufacturing clmnfArticles of leather, animal gut, harness, travel goodsLight manufacturing clmnf Furskins and artificial fur, manufactures thereof Light manufacturing clmnfFurskins and artificial fur, manufactures thereofLight manufacturing chmnf Wood and articles of wood, wood charcoal Heavy manufacturing chmnfWood and articles of wood, wood charcoalHeavy manufacturing chmnf Cork and articles of cork Heavy manufacturing chmnfCork and articles of corkHeavy manufacturing clmnf Manufactures of plaiting material, basketwork, etc. Light manufacturing clmnfManufactures of plaiting material, basketwork, etc.Light manufacturing chmnf Pulp of wood, fibrous cellulosic material, waste etc Heavy manufacturing chmnfPulp of wood, fibrous cellulosic material, waste etcHeavy manufacturing chmnf Paper & paperboard, articles of pulp, paper and board Heavy manufacturing chmnfPaper & paperboard, articles of pulp, paper and boardHeavy manufacturing clmnf Printed books, newspapers, pictures etc Light manufacturing clmnfPrinted books, newspapers, pictures etcLight manufacturing clmnf Silk Light manufacturing clmnfSilkLight manufacturing clmnf Wool, animal hair, horsehair yarn and fabric thereof Light manufacturing clmnfWool, animal hair, horsehair yarn and fabric thereofLight manufacturing clmnf Cotton Light manufacturing clmnfCottonLight manufacturing clmnf Vegetable textile fibres nes, paper yarn, woven fabric Light manufacturing clmnfVegetable textile fibres nes, paper yarn, woven fabricLight manufacturing clmnf Manmade filaments Light manufacturing clmnfManmade filamentsLight manufacturing clmnf Manmade staple fibres Light manufacturing clmnfManmade staple fibresLight manufacturing  "},{"text":"Table A5   continued: Matching HS2 Trade Data from UNComTrade to SAM Commodities continued: Matching HS2 Trade Data from UNComTrade to SAM Commodities clmnf Wadding, felt, nonwovens, yarns, twine, cordage, etc Light manufacturing clmnfWadding, felt, nonwovens, yarns, twine, cordage, etcLight manufacturing clmnf Carpets and other textile floor coverings Light manufacturing clmnfCarpets and other textile floor coveringsLight manufacturing clmnf Special woven or tufted fabric, lace, tapestry etc Light manufacturing clmnfSpecial woven or tufted fabric, lace, tapestry etcLight manufacturing clmnf Impregnated, coated or laminated textile fabric Light manufacturing clmnfImpregnated, coated or laminated textile fabricLight manufacturing clmnf Knitted or crocheted fabric Light manufacturing clmnfKnitted or crocheted fabricLight manufacturing clmnf Articles of apparel, accessories, knit or crochet Light manufacturing clmnfArticles of apparel, accessories, knit or crochetLight manufacturing clmnf Articles of apparel, accessories, not knit or crochet Light manufacturing clmnfArticles of apparel, accessories, not knit or crochetLight manufacturing clmnf Other made textile articles, sets, worn clothing etc Light manufacturing clmnfOther made textile articles, sets, worn clothing etcLight manufacturing clmnf Footwear, gaiters and the like, parts thereof Light manufacturing clmnfFootwear, gaiters and the like, parts thereofLight manufacturing clmnf Headgear and parts thereof Light manufacturing clmnfHeadgear and parts thereofLight manufacturing clmnf Umbrellas, walking-sticks, seat-sticks, whips, etc Light manufacturing clmnfUmbrellas, walking-sticks, seat-sticks, whips, etcLight manufacturing clmnf Bird skin, feathers, artificial flowers, human hair Light manufacturing clmnfBird skin, feathers, artificial flowers, human hairLight manufacturing chmnf Stone, plaster, cement, asbestos, mica, etc articles Heavy manufacturing chmnfStone, plaster, cement, asbestos, mica, etc articlesHeavy manufacturing clmnf Ceramic products Light manufacturing clmnfCeramic productsLight manufacturing clmnf Glass and glassware Light manufacturing clmnfGlass and glasswareLight manufacturing chmnf Pearls, precious stones, metals, coins, etc Heavy manufacturing chmnfPearls, precious stones, metals, coins, etcHeavy manufacturing chmnf Iron and steel Heavy manufacturing chmnfIron and steelHeavy manufacturing chmnf Articles of iron or steel Heavy manufacturing chmnfArticles of iron or steelHeavy manufacturing chmnf Copper and articles thereof Heavy manufacturing chmnfCopper and articles thereofHeavy manufacturing chmnf Nickel and articles thereof Heavy manufacturing chmnfNickel and articles thereofHeavy manufacturing chmnf Aluminium and articles thereof Heavy manufacturing chmnfAluminium and articles thereofHeavy manufacturing chmnf Lead and articles thereof Heavy manufacturing chmnfLead and articles thereofHeavy manufacturing chmnf Zinc and articles thereof Heavy manufacturing chmnfZinc and articles thereofHeavy manufacturing chmnf Tin and articles thereof Heavy manufacturing chmnfTin and articles thereofHeavy manufacturing chmnf Other base metals, cermets, articles thereof Heavy manufacturing chmnfOther base metals, cermets, articles thereofHeavy manufacturing chmnf Tools, implements, cutlery, etc of base metal Heavy manufacturing chmnfTools, implements, cutlery, etc of base metalHeavy manufacturing chmnf Miscellaneous articles of base metal Heavy manufacturing chmnfMiscellaneous articles of base metalHeavy manufacturing chmnf Nuclear reactors, boilers, machinery, etc Heavy manufacturing chmnfNuclear reactors, boilers, machinery, etcHeavy manufacturing clmnf Electrical, electronic equipment Light manufacturing clmnfElectrical, electronic equipmentLight manufacturing chmnf Railway, tramway locomotives, rolling stock, equipment Heavy manufacturing chmnfRailway, tramway locomotives, rolling stock, equipmentHeavy manufacturing chmnf Vehicles other than railway, tramway Heavy manufacturing chmnfVehicles other than railway, tramwayHeavy manufacturing chmnf Aircraft, spacecraft, and parts thereof Heavy manufacturing chmnfAircraft, spacecraft, and parts thereofHeavy manufacturing chmnf Ships, boats and other floating structures Heavy manufacturing chmnfShips, boats and other floating structuresHeavy manufacturing clmnf Optical, photo, technical, medical, etc apparatus Light manufacturing clmnfOptical, photo, technical, medical, etc apparatusLight manufacturing clmnf Clocks and watches and parts thereof Light manufacturing clmnfClocks and watches and parts thereofLight manufacturing clmnf Musical instruments, parts and accessories Light manufacturing clmnfMusical instruments, parts and accessoriesLight manufacturing chmnf Arms and ammunition, parts and accessories thereof Heavy manufacturing chmnfArms and ammunition, parts and accessories thereofHeavy manufacturing clmnf Furniture, lighting, signs, prefabricated buildings Light manufacturing clmnfFurniture, lighting, signs, prefabricated buildingsLight manufacturing clmnf Toys, games, sports requisites Light manufacturing clmnfToys, games, sports requisitesLight manufacturing clmnf Miscellaneous manufactured articles Light manufacturing clmnfMiscellaneous manufactured articlesLight manufacturing clmnf Works of art, collectors pieces and antiques Light manufacturing clmnfWorks of art, collectors pieces and antiquesLight manufacturing chmnf Commodities not elsewhere specified Heavy manufacturing chmnfCommodities not elsewhere specifiedHeavy manufacturing  "},{"text":"Table A6 : Disaggregation of Production Factors and Households in a 2007 SAM for Namibia flskl Skilled labour flsklSkilled labour flusk Unskilled labour fluskUnskilled labour fcap Gross operating surplus (net operating surplus fcapGross operating surplus (net operating surplus hhuws Urban: wage & salaries in cash hhuwsUrban: wage & salaries in cash hhubs Urban: business activities including farming hhubsUrban: business activities including farming hhuot Urban: pensions, cash remittances and other sources of income hhuotUrban: pensions, cash remittances and other sources of income hhrws Rural: wage & salaries in cash hhrwsRural: wage & salaries in cash hhrbs Rural: business activities & commercial farming hhrbsRural: business activities & commercial farming hhrot Rural: subsistence farming, pensions, cash remittances and other sources of income hhrotRural: subsistence farming, pensions, cash remittances and other sources of income  "}],"sieverID":"e5348d53-fdf6-47a6-b727-705bce4a4dec","abstract":"It separates 24 activities and 25 commodities; labor is disaggregated by 3 skill groups; and households into 6 groups based on the rural/urban and income status of the household head. The SAM is a useful database for conducting economy-wide impact assessments, including SAM-based multiplier analysis and computable general equilibrium (CGE) modeling."}

data/part_4/0900cda20a426105ae58c1eaebb69a5c.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0900cda20a426105ae58c1eaebb69a5c","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f7749a2e-b5e0-4004-8950-38263c851c1f/retrieve"},"pageCount":10,"title":"Transhumance in the Tigray Highlands (Ethiopia)","keywords":["Home range herding","grazing grounds","grazing rights","livestock","oxen","rangeland","Ethiopia"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":141,"text":"As in many other parts of eastern Africa, livestock are an important component of the agricultural system in the Tigray highlands (North Ethiopia). In the crop-growing season, transhumance is practiced on a broad scale in the open-field areas of Tigray, as farmland and stubble can no longer be accessed by livestock (Figure 1). By transhumance we mean the practice of ''herd movements that are seasonal, occurring between two points, following very precise routes and repeated each year'' (DGCID 2001). Studies of transhumance generally show that this practice is an adaptation to spatial and temporal variability in climatic conditions, for instance, in most European mountains (Dodgshon and Olsson 2007), in central parts of North America by indigenous populations and by settlers (White 1926;Stoffle and Evans 1976), in southern Africa (Rohde and Hoffman 2008), and in the Sahel (Zonneveld 1984;Banoin and Jouve 2000)."},{"index":2,"size":206,"text":"Whereas some researchers make an explicit or implicit link between pastoralism and transhumance (Fark-Gru ¨ninger 1995;Cour 2003;Hoffman and Rohde 2007), the latter is commonly practiced by sedentary populations. As such, transhumance should not be confused with pastoralism, as it is part of a system that combines the seasonal movement of livestock with permanent arable agriculture (Evans-Pritchard 1940;Johnson 1969;Zonneveld 1984;Jones 2005). This distinction is important, because the majority of studies concerning transhumance in Ethiopia relate to peripheral pastoral areas (Coppock 1994;Kamara et al 2004), and the terminology often seems improperly used. In Ethiopia (Tigray) and Eritrea, transhumance has been associated with human and livestock disease hazards (Roundy 1976;Gebretsadik et al 2007), threats to riverine forests (Connelly and Wilson 1996), and collective action in community management of grazing lands (Benin and Pender 2006). Here we first characterize transhumance practices in the Tigray highlands in terms of organization, importance, composition of the herds, transhumance destination zones (TDZs), routes, rights of use, and conflict management. We also analyze whether the scope of the practice is induced by regional variations in climatic conditions and whether recent developments (schooling, exclosure over large parts of the villages' territories, construction of reservoirs and agricultural intensification) have led to changes in the practice of transhumance."}]},{"head":"Study area","index":2,"paragraphs":[{"index":1,"size":147,"text":"The varied lithologies of the Tigray Mountains (volcanic, sandstone, limestone, and metamorphic rock) and surrounding areas (10 5 km 2 in extent and from 1000 to 3000 m), and the subhorizontal structural relief that they induce, are the basis for zonation of the soils in the study area. Lithology and position on the slope largely determine the soils' spatial distribution and their utilization (Nyssen et al 2008a). Average annual rainfall ranges between 500 and 900 mm yr 21 , mostly concentrated in the summer rainy season (end of June to FIGURE 1 Location map with schematic representation (arrows) of transhumance and home range herding movements. Numbers in clear circles correspond to villages that do not engage in these practices. Names of villages: 1: Adi Geza'eti, 2: Kokolo, 3: Megab, 4: Korkor, 5: Da Tsimbia, 6: Agewo, 7: Hidmo, 8: Antshel, 9: Gobo Dogu'at, 10: Gabien, 11: Akeza."}]},{"head":"MountainResearch","index":3,"paragraphs":[{"index":1,"size":62,"text":"Mountain Research and Development http://dx.doi.org/doi:10.1659/mrd.00033 end of August). Young soils are dominant owing to active erosion processes. The permanent mountain agricultural system of Tigray may be characterized as a ''grain-plough complex'' (Westphal 1975) with a cropping pattern that is adjusted to the various soils present in each catena. Cereals are the dominant crops, and the farming system is geared to maximize yields."},{"index":2,"size":147,"text":"Agriculture in the Tigray highlands consists exclusively of small-scale family farms. A land tenure regime was introduced in the 1980s and has led to broad equality in the size of landholdings (Hendrie 1999). On average, the families in the study area farm two or three parcels of cropland, with a combined area of 0.5 to 2 ha. Grassland, rangeland, and exclosures are communally owned. Cultivated crops include common cereals such as barley (Hordeum vulgare) and wheat (Triticum sp.), as well as tef (Eragrostis tef), a cereal with very fine grains endemic to Ethiopia. Leguminous crops are also important. With a rotation intensity of 0.91-that is, the ratio of cropped area to cropped plus fallow-and the existence of clearly demarcated fields (Nyssen et al 2008a), the agricultural system in the Tigray highlands can be characterized as a permanent upland farming system (Ruthenberg 1980) practiced by a sedentary population."},{"index":3,"size":173,"text":"Livestock are predominantly cattle (especially oxen) and also include sheep, goats, donkeys, and mules. An average family owns 1 or 2 oxen, 5 to 6 goats or sheep, and sometimes a donkey. An exceptionally rich farmer may possess 6 or 8 oxen, 20 or 30 goats and sheep, and 3 to 4 mules or donkeys (Naudts 2002). Livestock-keeping is part of the permanent upland system (Ruthenberg 1980). It is very important for farmers, especially as a source of energy: oxen are essential for the production system, being used for plowing and threshing (Solomon et al 2006), and donkeys are used to transport heavy loads. Manure commonly substitutes for firewood. Livestock, especially sheep and goats, are also considered as insurance for difficult periods. The production of meat and milk are only of secondary importance for most farmers. Yet it must be considered that 475,321 smallholder farmers in Tigray manage approximately 844,845 oxen (CSA 2006). Overall, livestock productivity is low in Ethiopia due to the shortage and poor quality of fodder (Benin et al 2006)."},{"index":4,"size":99,"text":"Since no forage crops are grown, livestock are allowed on all land where grazing is not forbidden. Fallow land and harvested cropland are also used for grazing (''stubble grazing,'' Figure S1; http://dx.doi.org/doi:10.1659/mrd. 00033.S1). Increasingly, as part of a bold effort to protect the most endangered areas, notably on steep slopes and in eroded areas, such lands are being converted into exclosures, that is, lands under strict management and often policed by the community, where grazing is prohibited, where woodcutting is allowed only in certain cases and under strict regulations, and where annual grass-cutting is organized (Descheemaeker et al 2006)."}]},{"head":"Study methods","index":4,"paragraphs":[{"index":1,"size":109,"text":"During 10 years of fieldwork and multidisciplinary research, we became acquainted with the study area, its inhabitants, and the agricultural system, including transhumance practices. For this particular survey, villages were selected where other research has also been conducted (Nyssen et al 2006(Nyssen et al , 2008b;;Munro et al 2008;Segers et al 2008;Fredu et al 2009) and where we had good relations with the communities (Tables 1 and 2). This allowed semistructured interviews to be conducted confidently with village dwellers and shepherds. Issues addressed during these interviews for the purposes of understanding and characterizing transhumance concerned herd composition, organization, routes and TDZs, use rights, and occurrence and management of conflicts."},{"index":2,"size":176,"text":"A systematic inventory included field observations and secondary data collection. In the field, the general environmental setting, lithology, topography, and water availability were assessed and geographical coordinates were recorded using a global positioning system. Topographic maps at a scale of 1:50,000 and 1:250,000 (EMA 1979(EMA , 1996) ) were analyzed for elevation and distances. Data on landholding size, population, and oxen density were obtained from the Ethiopian Central Statistical Agency (CSA 2006). Such data are available at the level of woredas (districts in the study area ranging from 700 to 2000 km 2 ), but not at the level of municipalities or villages. Detailed data on densities of sheep and goats are not available at all. Average yearly rainfall, average August rainfall (month with greatest rainfall and climax of transhumance activities), and average yearly temperature were interpolated using NewLocClim (FAO 2008). Temperature was estimated along a vertical gradient with neighboring stations, and rainfall was exclusively interpolated along a lateral gradient, as no correlation exists in the study area between elevation and rainfall (Nyssen et al 2005)."},{"index":3,"size":67,"text":"We used Landsat ETM+ satellite imagery (especially Bands 3 and 4) taken in January 2000 (middle of the dry season) and the derived Normalized Difference Vegetation Index (NDVI) to assess biomass availability around the villages and in TDZs. NDVI is used universally as a measure of greenness (Lillesand and Kiefer 2000). The NDVI values were obtained using Idrisi32 Release Two software. This vegetation index takes the form"},{"index":4,"size":68,"text":"where NDVI value ranges from 21 (no vegetation) to 1 (dense vegetation), NIR 5 near-infrared reflectance, and R 5 red reflectance. Average NDVI values were calculated for 500 m 3 500 m squares in every village and TDZ. Recent changes MountainResearch (schooling, catchment management activities, and agricultural intensification) were also assessed, especially in relation to routes used for transhumance, as well as to the magnitude of the practice."}]},{"head":"Results","index":5,"paragraphs":[{"index":1,"size":193,"text":"Unlike transhumance in the Mediterranean region (Aitken 1945;Puigdefabregas and Fillat 1986), transhumant livestock movements in Tigray generally involve distances not greater than 20 km, and daily contact is maintained with the village. Villages that do not have access to sufficiently wide nearby pasture grounds organize seasonal transhumance to a distant zone during the crop-growing period in the summer rainy season. The presence of livestock near crops is thus avoided, and grass on nearby pastures is allowed to grow and is saved for use later in the season. Transhumance of cattle is the first concern; sheep and goats may be added to the flock. Young boys remain with the herds day and night. Their work includes bringing the herd to the best grazing grounds and watering it every day or every two days. In the evening some adult men, each one in his turn, join the herd to supervise nighttime protection of livestock and the shepherds; they also bring food to the children. The TDZ is typically called bereha, or ''desert.'' Table 1 summarizes some characteristics of villages and their TDZs, while detailed inventories are presented in Tables S1 and S2 (Supporting Information; http://dx.doi.org/doi:10.1659/mrd.00033.S1)."},{"index":2,"size":18,"text":"Transhumance and other livestock-keeping practices Some typical practices related to transhumance in Tigray are described in this section."},{"index":3,"size":116,"text":"Herds in the village of Adi Geza'eti (2580 m) are brought each summer to the gorge of the River Tsaliet (1930 m), where riparian vegetation exists (Figure 1, village 1). The young shepherds establish enclosures and places to sleep, if possible in rock shelters, but if not, in the open air. The first to arrive choose the best places. The shepherds remain there until after the harvest, when the oxen are needed for threshing operations and when the herds are fed by stubble grazing. As this takes place during summer school holidays, young boys who are in school join with those who are not. This is the most frequent method of practicing transhumance in the area."},{"index":4,"size":177,"text":"In Kokolo village (2060 m), the herds are taken to the Geba River valley (1680 m) (Figure 1, village 2). This case is very similar to the previous one, with the exception that one of the village families has chosen to dwell in the valley and has occupied the best rock shelters and transformed them into permanent cattle sheds.  a) As interpolated using NewLocClim software (FAO 2008)-polynomial interpolation along a horizontal gradient (extrapolation not allowed) from data of maximum 10 nearest stations, maximum 100 km away. b) As the transhumance from Hidmo village to Chow'eh TDZ takes place in the dry season, the average February rainfall was incorporated in the comparison. c) As interpolated using NewLocClim software (FAO 2008)-linear inter-and extrapolation along a vertical gradient from data of maximum 10 nearest stations, maximum 100 km away. d) Derived from Landsat ETM+ satellite imagery. e) Calculated at district level, using data from CSA (2006). f) Calculated at district level, using data from CSA (2006). g) Full details in Table S1 (http://dx.doi.org/doi:10.1659/mrd.00033.S1). h) Full details in Table S2 (http://dx.doi.org/doi:10.1659/mrd.00033.S1)."}]},{"head":"MountainResearch","index":6,"paragraphs":[{"index":1,"size":197,"text":"The villages around Mount Kemer (2440 m) in the Gueralta plain have different livestock migration patterns, depending on accessibility to the mountain, which is composed of a foot slope, a very high cliff, and an undulating top plateau (Figure 2). From Korkor and Da Tsimbia (2000 m) (Figure 1, villages 4 and 5), the herds are led toward the upper slopes of Mount Kemer (2200-2300 m), where the land is too rugged to be occupied by farmland. During the rainy season, there are many water holes and there is much lush vegetation. Whereas the herds from Da Tsimbia usually return to the homesteads for the night, those from Korkor have to be taken through a difficult mountain pass and hence are kept overnight on the grazing lands. The flocks belonging to the slightly urbanized Megab (2050 m) (Figure 1, village 3) are only taken to the foot slopes of Mount Kemer, reportedly because many farmers have off-farm income activities that do not allow for careful follow-up of livestock in transhumance. People from this area do not bring the livestock to the lowland areas more to the west, as they maintain that ''that land belongs to other villages.''"},{"index":2,"size":93,"text":"The herds of Agewo (2840 m) descend the western escarpment of the Rift Valley (Figure 1, village 6), which is a day's walk. This is a region with seasonal springs, and it is much less populated, ''a shared territory in which Afars and Tigrayans are involved in both intensive and extensive interaction'' (Kelemework 2006). Livestock are kept there throughout the rainy season by adult men: conflicts with the Afar are not frequent, but memories of past fighting and cattle raiding, such as those described by McCann (1985) and Kelemework (2006), are still recalled."},{"index":3,"size":285,"text":"Hidmo (1450 m), a village in the lowlands with high temperatures and water shortages, is located some 9 km from Tekezze River, one of the major tributaries of the Nile (Figure 1, village 7; Figure S2; http://dx.doi.org/doi:10. 1659/mrd.00033.S1). The river flows in a deep gorge, the slopes and shoulders of which are used as a TDZ. Rangelands are much wider across the river on its west bank, and the inhabitants have developed a bimodular transhumance system. Throughout the dry season livestock are herded across the river to Chow'eh, an area in the Amhara region, a day's walk from the village. The flocks are herded by adult men on a rotational basis, but not by children, as Chow'eh is far from home and both the river crossing and the livestock watering are unsafe owing to the presence of crocodiles. In addition, many children have started to go to school in recent years and dry season transhumance here takes place in the middle of the school year. The magnitude of transhumance in the dry season depends on the previous year's harvest: when there is little straw, most people will bring their livestock there. Otherwise, only half of the households participate in transhumance. Conflicts with the Amhara cultivators on the other side of the river are rare. Villagers stated: ''They quarrel only when too many livestock are brought. It is especially the youngsters who quarrel. We generally communicate in Amharic, though most elder people also know Tigrinya. There are many cross-marriages, girls from Hidmo who marry at the other side of the river.'' Quarrels over land use rights do not seem to have an ethnic flavor-they are rather similar to what may occur between neighboring villages within Tigray."},{"index":4,"size":74,"text":"In the summer rainy season, livestock are herded on the eastern, nearby banks of Tekezze River, which at that time is impossible to cross. The shepherds are young boys, and the practice is very similar to the one described for Kokolo and Adi Geza'eti. On the left bank of the Tekezze, the Amhara also bring their livestock down to the river. They never need to cross, as there is more grass on that side."},{"index":5,"size":104,"text":"As far as can be remembered, people from Antshel (Figure 1, village 8) have never practiced transhumance. Until some 12 years ago, livestock were taken daily for grazing to Bereha Antshel, the 250-m high escarpment that overlooks the village, and brought home in the evening. In recent years, these slopes have become exclosures and the area has changed dramatically (Figure 3). Vegetation has grown, infiltration is enhanced, and springs have developed. As every potential rangeland area has become an exclosure, livestock are kept in and near the homesteads; grass is cut from the closed areas and pure water is available in newly arisen rivulets."},{"index":6,"size":98,"text":"In Gobo Dogu'at (2690 m) and Gabien (Figure 1, villages 9 and 10), separated by a 200-m high cliff, livestock are not subject to transhumance. The herds of Gabien village are kept there, feeding year-round on edaphic grasslands on the wetlands in the center of the village. Gobo Dogu'at's livestock are taken down daily to the valley in the lower part of the village near Gabien. Despite the fact that an ancient, man-made foot tunnel provides access to bushy areas in the west, livestock are not sent there because, it was reported, ''those areas belong to another village.'' "}]},{"head":"MountainResearch","index":7,"paragraphs":[{"index":1,"size":114,"text":"Though located in a situation on the Rift shoulder similar to Agewo, the farmers of Akeza (Figure 1, village 11) do not take their livestock down the Rift Valley escarpment, simply because there are no areas with sufficient availability of water. Previously, a few springs and some pond water in the rainy season allowed livestock to be kept in the village. Transhumance started only in recent years, after the Hashenge earth dam and reservoir were built in 1997 within the plateau, some 5 km from the village (Tadesse et al 2008). Presently, around half of the village stock is brought there during the rainy season and remains there the whole season, herded by children."}]},{"head":"Comparison of village surroundings and TDZs","index":8,"paragraphs":[{"index":1,"size":164,"text":"Unsurprisingly, the TDZs are found to be better endowed with water and fodder resources. Mostly they have springs or a river. NDVI values measured during the dry season when farmlands bear no crops (Table 1) are 20.20 (6 0.05) for the immediate village surroundings and 20.19 (6 0.05) for the TDZ; there is no significant difference. The availability of fodder is instead related to the extensiveness of the TDZ. As they are usually located downslope from the villages, TDZs are on average 1.5uC warmer; yearly and summer rainfall are very similar in the villages and their respective TDZ, except for Agewo, where livestock are brought to a remote and less rainy area at the margins of the Danakil Desert (Table S1; http://dx.doi.org/doi:10.1659/ mrd.00033.S1). Furthermore, there is an additional good reason to go to the TDZ during the rainy season: overall, soils are sandy and shallow there (Table 2) and temperatures are higher, so that herbaceous vegetation is at its most plentiful during the rains."},{"index":2,"size":209,"text":"Resident human and livestock population densities are lower in the TDZs. When the routes stay within the same woreda, such differences can only be observed anecdotally, as high-resolution census data are not available. In a few   a) In every village it is the norm to participate in the mentioned practice-nonparticipation may be due to socioeconomic problems (no children available, disease, lack of money to hire somebody); full details in Table S3. b) All distances are Cartesian distances-real walking distance is 1.5 to 2 times the Cartesian distance. c) Positive difference indicates that the value of this parameter is higher in the TDZ than in the village. d) As interpolated using NewLocClim software (FAO 2008)-polynomial interpolation along a horizontal gradient (extrapolation not allowed) from data of maximum 10 nearest stations, maximum 100 km away. e) February data were used for transhumance from Hidmo to Chow'eh. f) As interpolated using NewLocClim software (FAO 2008)-linear inter-and extrapolation along a vertical gradient from data of maximum 10 nearest stations, maximum 100 km away. g) Water availability in villages and pastures was evaluated as (A) sufficient water available throughout the year for humans and livestock; (B) water available throughout the year but sometimes long waiting times, especially for livestock; (C) water availability is critical."}]},{"head":"MountainResearch","index":9,"paragraphs":[{"index":1,"size":45,"text":"cases, transhumance leads to remote boundary areas between woredas, with low population densities. In the case of Hidmo, livestock are brought to another woreda in the dry season, which has less land suitable for agriculture and hence small landholdings, less population, and lower oxen densities."}]},{"head":"Discussion","index":10,"paragraphs":[]},{"head":"Typologies of transhumance","index":11,"paragraphs":[{"index":1,"size":247,"text":"With respect to transhumance practices, the villages studied can be classified into three groups: those where transhumance is practiced; those where daily movements with livestock are back and forth to the grazing grounds, the ''home range herders'' of Baker and Hoffman (2006); and those where livestock are kept near homesteads (Table 2; Figure 4). In all villages that practice transhumance, a proportion of the farmers do not participate in the seasonal livestock movements but rather bring their livestock daily to nearby grazing grounds. Home range herders daily travel an average distance of 2.2 km, whereas transhumance takes place over an average distance of 8.1 km. Furthermore, average difference in elevation (Dz) is much greater in the case of transhumance. Based on the distance and difficulty of the terrain (and its proxy, Dz), farmers decide to keep livestock on the grazing grounds during the whole cropping season. Both distance from the village and the difficulty of the terrain are very straightforward parameters that explain whether a village practices home range herding or transhumance and, in the latter case, whether the flocks are herded by children or adults (Figure 4). Yet transhumance practices in Tigray may be characterized as ''low amplitude transhumance'' (Banoin and Jouve 2000): in contrast to situations in the Mediterranean (Aitken 1945;Cleary 1987;Puigdefabregas and Fillat 1986) or in the Sahel (Banoin and Jouve 2000; Green and Tchinle ´2004), transhumance movements in the Tigray highlands follow relatively short routes, particular for every village, rather than lengthy trails."},{"index":2,"size":187,"text":"Water availability is generally better in the more distant TDZs (which are often close to deeply entrenched rivers) than in the nearby areas where the home range herders go. TDZs are located on lithology (often sandstone) that generally produces less fertile soils, which is a major reason, besides topography, why farmland was not established there. The average NDVI values tend to indicate that there is no significant difference in vegetation cover between the village surroundings and the TDZ. However, high NDVI values in the villages are induced by the presence around homesteads of plantations growing (unpalatable) eucalyptus. Furthermore, the attraction of a TDZ is not related to good vegetation cover in the first place, but to its wide extent and free access. This is in contrast to the village surroundings, where the few rangelands in the rainy season are highly fragmented by farmlands out of bounds for livestock. Methodologically, the use of a vegetation index such as NDVI in satellite image interpretation has proven not to be a good tool to locate a potential TDZ, as its attractiveness is governed by relative remoteness, wideness, and water availability."},{"index":3,"size":129,"text":"Livestock are typically kept in the village if no TDZs with water are within reasonable distance. This may be the case owing to water scarcity on the available grazing grounds (eg Akeza before reservoir construction), or because grazing lands have become exclosures, in which case livestock are kept near the house and fed on harvested grass (for instance, in Antshel). Transhumance in Tigray is thus basically related to availability of water and especially range space during the cropping season, and not by significantly  different temperature or rainfall conditions, which is the case for transhumance in other areas of Africa (Zonneveld 1984;Banoin and Jouve 2000;Rohde and Hoffman 2008), or in mountain areas of Europe (Aitken 1945;Puigdefabregas and Fillat 1986;Dodgshon and Olsson 2007) or North America (White 1926;Stoffle and Evans 1976)."}]},{"head":"Transhumance and conflicts","index":12,"paragraphs":[{"index":1,"size":154,"text":"It is striking that villages around Megab and Gobo Dogu'at do not bring their livestock to nearby areas inhabited by Tigray kinsmen, because, they say, ''the land belongs to another village,'' whereas Hidmo and Agewo do not hesitate to enter Amhara or Afar territory (Table 3) while generally avoiding conflicts. This suggests that conflicts are related to the availability of grass and grazing space, rather than being purely ethnic in character. Official proposals to demarcate grazing grounds between Tigray and Afar have been rejected by both groups as they ''preferred joint use of available resources in harmony'' (Kelemework 2006). Important here, besides the carrying capacity (Zonneveld 1984), is that both groups have partially different seasonal grazing patterns, the Tigrayans going down from the highlands during the summer rainy season and the Afar nomads coming up from the lowlands following a less rigid temporal pattern related to extremely erratic rainfall in the Danakil Desert margins."},{"index":2,"size":50,"text":"Table 3 shows, for instance, that potential TDZs for Da Tsimbia and Gobo Dogu'at are better endowed with vegetation than are the villages. However, around each of these TDZs are several other villages, the inhabitants of which would not be happy to see additional livestock arrive in search of pasture."}]},{"head":"Changes in practice","index":13,"paragraphs":[{"index":1,"size":106,"text":"Transhumance reacts in a highly adaptive way to social and technological changes in society. The construction of an earth dam some 5 km from Akeza encouraged some farmers to start transhumance activities. On the other hand, reservoir building inside the village of Agewo did not stop transhumance to its traditional, distant TDZ, essentially because rangeland is limited around the reservoir. In Antshel, the exclosure of previous rangelands has led to abandonment of home range herding, and villagers claim that grass harvested nowadays from that area and the improved availability of water are largely sufficient for their herds, which are now smaller in number and also healthier."},{"index":2,"size":95,"text":"Total net enrollment ratio in primary education in Ethiopia increased from 26% in 1991 to 75% in 2007 for boys and from 19% to 69% for girls (UNSTATS 2009). As most transhumance activities take place during summer school holidays, increased schooling does not affect the practice of transhumance. It is not uncommon to see young herders studying textbooks for the upcoming school year. Football, which has been introduced in schools, was also seen to have increasingly supplanted the traditional game of qarsa in the TDZs. In the case of Tigray, transhumance seems compatible with schooling."},{"index":3,"size":63,"text":"The fact that the Ethiopian government has generally resisted any pressure for large-scale land privatization and has tried to strengthen tenure rights for individual smallholders (Hennebert 2006;Kanji et al 2006) has led to a near-absence of large, private range grounds that could pose obstacles to transhumance routes as, for instance, in South Africa (Baker and Hoffman 2006;Hoffman and Rohde 2007;Rohde and Hoffman, 2008). "}]},{"head":"MountainResearch Conclusions","index":14,"paragraphs":[{"index":1,"size":244,"text":"To allow sowing of crops on farmland during the rainy season, stubble grazing is stopped and the herds on the Tigray highlands are sent to remote areas (valley bottoms or upper slopes of mountains) where grass and water are available. Such altitudinal movements are basically induced by the fact that there is little to no space for livestock near the villages. As such, transhumance in the North Ethiopian highlands fully accords with Johnson's (1969) definition: ''Although pastoral activities are one of the concerns of a transhumant community, agriculture nearly always remains the dominant interest. In other words, pastoral movements are limited in scale, usually take place in one valley system, and are undertaken by only a small proportion of the total population. None of these features are shared by pastoral nomads.'' Faced with social (schooling) and technological (reservoir construction and establishment of exclosures) change, transhumance in Tigray has adjusted itself in a highly adaptive way, with new routes being developed and others abandoned. In several villages, there is an increasing trend toward feeding livestock at home using grass harvested from exclosures. Interestingly, in the study area, transhumance seems not to lead to major conflicts (unlike in the past- McCann [1985]) even if livestock are brought to areas belonging to other ethnic groups. Conflicts are avoided by not bringing livestock to particular areas if there is a lack of biomass. Ethnicity does not play a role here, whereas environmental and socioeconomic processes and changes do."},{"index":2,"size":62,"text":"Because this study, a first of its kind in Ethiopia, is mainly limited to characterizing the practice of transhumance and analyzing its determinants, future geographical research could include, for example, spatial modeling of the practice. This may lead to the prediction of areas that could be affected by transhumance in the near future under various assumptions of oxen density and agronomic practices."}]}],"figures":[{"text":"FIGURE 2 FIGURE 2 Partial view of Mount Kemer, from Da Tsimbia. The TDZ is located behind the ridge. Note the presence of small remnant forests on inaccessible flats. (Photo by Jan Nyssen) "},{"text":"FIGURE 4 FIGURE 4 Livestock herd movements as a function of distance from the village (d) and accessibility (represented by its proxy, difference in elevation [Dz] between the village and its [summer] TDZ). "},{"text":"FIGURE 3 FIGURE 3 An area where livestock movements have been abandoned has undergone important changes between 1975 and 2007. The former grazing lands (lower part of the photographs) have been closed and livestock are fed on grass harvested from these exclosures. (A) Antshel in 1975. (Photo by Neil Munro); (B) Antshel in 2007. (Photo by Jan Nyssen) "},{"text":"TABLE 1 Characteristics of the 11 villages, and their TDZs, used in the study (averages 61 SD). Characteristics Characteristics  "},{"text":"TABLE 2 Typology of transhumance practices a) in the study area (averages 61 SD).(Table extended below.)         Difference c) in rainfall (mm) d) Difference c) in rainfall (mm) d)   Distance to Dz, Difference   Distance toDz, Difference Type of practice Villages TDZ (km) b) in elevation (m) Annual August e) Type of practiceVillagesTDZ (km) b)in elevation (m)AnnualAugust e) Transhumance Adi Geza'eti, Kokolo, Korkor, 8.1 6 4.0 491 6 332 -6 6 48 + 4 6 6 TranshumanceAdi Geza'eti, Kokolo, Korkor,8.1 6 4.0491 6 332-6 6 48+ 4 6 6 to TDZ Agewo, Hidmo, Akeza (seasonally)    to TDZAgewo, Hidmo, Akeza(seasonally) Home range Megab, Da Tsimbia, Gobo 2.2 6 0.8 183 6 115 22 6 3 0 6 2 Home rangeMegab, Da Tsimbia, Gobo2.2 6 0.8183 6 11522 6 30 6 2 herders Dogu'at (daily)    herdersDogu'at(daily) Livestock kept Antshel, Gabien ,0.0 ,0.0   Livestock keptAntshel, Gabien,0.0,0.0 in the village      in the village  "},{"text":"TABLE 2 Extended. Difference in yearly  Typical difference in water availability Most common pattern with Difference in yearlyTypical difference in water availabilityMost common pattern with temperature (uC) c),f) Difference in NDVI c) between village and pasture g) respect to lithology temperature (uC) c),f)Difference in NDVI c)between village and pasture g)respect to lithology +3 6 3 0.01 (B or C) to (A) Same lithology, or +3 6 30.01(B or C) to (A)Same lithology, or    transhumance to ''less fertile'' transhumance to ''less fertile''    lithology; often to sandstone lithology; often to sandstone 0 6 1 0.04 (C) to (A or B) Generally to ''less fertile'' 0 6 10.04(C) to (A or B)Generally to ''less fertile''    lithology, sandstone lithology, sandstone   (A) to (A) Within same lithology (A) to (A)Within same lithology  "},{"text":"TABLE 3 Contrast in NDVI values between village grazing areas and distant TDZs where transhumance occurs (Agewo and Hidmo) or does not occur (Da Tsimbia and Gobo Dogu'at).    NDVI value a) NDVI value a) Difference NDVI value a)NDVI value a)Difference Village Type of practice (Potential) TDZ in village of TDZ in NDVI VillageType of practice(Potential) TDZin villageof TDZin NDVI Agewo Transhumance to TDZ Awi Fiso, 9 km away, -0.20 0.03 0.23 AgewoTranshumance to TDZAwi Fiso, 9 km away,-0.200.030.23   boundary to Afar region    boundary to Afar region Hidmo Transhumance to TDZ Chow'eh, 16 km away, -0.24 -0.30 -0.06 HidmoTranshumance to TDZChow'eh, 16 km away,-0.24-0.30-0.06   across Tekezze River,    across Tekezze River,   in Amhara region    in Amhara region Da Tsimbia Home range herders May Negad, potential -0.26 -0.23 0.03 Da TsimbiaHome range herdersMay Negad, potential-0.26-0.230.03   TDZ, 6 km away, in    TDZ, 6 km away, in   neighboring Tigray    neighboring Tigray   village    village Gobo Home range herders Shelewa, potential -0.24 -0.19 0.05 GoboHome range herdersShelewa, potential-0.24-0.190.05 Dogu'at  TDZ, 4 km away, in    Dogu'atTDZ, 4 km away, in   neighboring Tigray    neighboring Tigray   village    village  "}],"sieverID":"6e762d1d-56cf-4679-a129-6ec7b9f7c0ce","abstract":"Transhumance, the seasonal movement of herds occurring between two points and following precise routes repeated each year, is practiced on a broad scale in the open field areas of Tigray (North Ethiopia). This article presents a characterization of the practice, factors that explain its magnitude, and recent changes. Eleven villages were selected randomly, semistructured interviews were conducted, and data on the sites were collected both in the field and from secondary sources. The transhumance destination zones are characterized as better endowed with water and fodder resources, essentially due to their great extent. The sample villages can be classified into three groups: annual transhumance (average one-way traveling distance 8.1 km), home range herding (average traveling distance 2.2 km), and keeping livestock near homesteads. Movements are basically induced by the fact that there is little to no space for livestock near the villages during the crop-growing period-not by the significantly different temperature or rainfall conditions in the grazing lands. Adults will only herd the flocks when the distance for transhumance is great or considered unsafe; otherwise, young boys tend the livestock for the entire summer rainy season. Faced with social (schooling) and technological (reservoir construction and establishment of exclosures) changes, transhumance in Tigray has adjusted in a highly adaptive way, with new routes being developed and others abandoned. Transhumance does not lead to major conflicts in the study area even when livestock are brought to areas that belong to other ethnic groups (Afar, Amhara)."}

data/part_4/09308ac04d256447a85a5745ab1ce7ca.json

@@ -0,0 +1 @@
+{"metadata":{"id":"09308ac04d256447a85a5745ab1ce7ca","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/58153f5d-4dcd-4ede-85a4-2eb7964df7ce/retrieve"},"pageCount":4,"title":"Soluciones de sistemas alimentarios en el nexo entre agricultura, medio ambiente y nutrición","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":43,"text":"Nuestro planeta enfrenta cuatro crisis mundiales interconectadas: cambio climático, pérdida de la biodiversidad, degradación ambiental y malnutrición. Los sistemas alimentarios son a la vez un determinante importante de estas crisis y una víctima. Estos sistemas pueden, y deben, ser parte de la solución."},{"index":2,"size":67,"text":"La agricultura es además un factor importante de degradación de tierras y pérdida de la biodiversidad, se le atribuye el 70% del uso de agua dulce, el 80% de la deforestación y afecta negativamente la vida sobre el planeta. La pérdida de biodiversidad y la falta de acción frente al clima están dentro de los tres primeros riesgos que enfrenta la Tierra en los próximos diez años."},{"index":3,"size":48,"text":"Al mismo tiempo, nuestros sistemas alimentarios no están satisfaciendo las necesidades nutricionales. Una de cada nueve personas padece de hambre. La obesidad mundial se ha casi que triplicado desde 1975. Más de 2 mil millones de personas carecen de las vitaminas y minerales esenciales para un adecuado crecimiento."},{"index":4,"size":37,"text":"El cambio climático está afectando negativamente la productividad agrícola mundial, en tanto que el 23% de las emisiones antropogénicas de gases de efecto invernadero se derivan de la agricultura, la forestería y otro uso de la tierra."},{"index":5,"size":60,"text":"La Alianza de Bioversity International y el Centro Internacional de Agricultura Tropical (CIAT) aporta un enfoque dinámico, nuevo e integrador a la investigación para el desarrollo, abordando el sistema alimentario en su conjunto -no tan solo sus partes componentes y síntomas individuales. Esto lo logramos trabajando en el nexo entre agricultura, medio ambiente y nutrición para generar impacto a escala."},{"index":6,"size":70,"text":"Nuestro trabajo combinado suma más de 100 años de experiencia aplicando ciencia para abordar retos mundiales, mucho antes de que llegaran a los encabezados de las noticias. Nuestra experticia cubre toda la gama desde la restauración y el mejoramiento ambiental a nivel paisajístico, hasta sistemas de mercado, salud y nutrición, y caracterización, conservación y uso de la biodiversidad agrícola. La Alianza cuenta con una capacidad única para marcar la diferencia."},{"index":7,"size":38,"text":"Las soluciones de la Alianza apoyan el logro de la Agenda 2030 para el Desarrollo Sostenible, las Metas Mundiales de Biodiversidad, el Acuerdo de París sobre el Clima 2016 y el Reto de Bonn, entre otras iniciativas internacionales."}]},{"head":"Objetivos de Desarrollo Sostenible","index":2,"paragraphs":[{"index":1,"size":50,"text":"Las soluciones de la Alianza contribuirán para avanzar en los ODG, en especial: La Alianza es parte de CGIAR, el mayor consorcio mundial en investigación e innovación agrícola para un futuro sin hambre, dedicado a reducir la pobreza, contribuir a la seguridad alimentaria y nutricional y mejorar los recursos naturales."}]},{"head":"Objetivos estratégicos","index":3,"paragraphs":[]},{"head":"Visión Misión","index":4,"paragraphs":[{"index":1,"size":57,"text":"Para lograr su visión de sistemas alimentarios y paisajes que sostienen el planeta, impulsan la prosperidad y nutren a las personas, la Alianza de Bioversity International y el CIAT brinda soluciones científicas que aprovechan la biodiversidad agrícola y transforman los sistemas de manera sostenible para mejorar la vida de las personas a través de cuatro objetivos estratégicos."}]},{"head":"Las personas consumen alimentos diversos, nutritivos e inocuos","index":5,"paragraphs":[{"index":1,"size":15,"text":"Las personas participan en mercados agroalimentarios incluyentes, innovadores y diversificados, y se benefician de ellos"}]},{"head":"Las personas manejan sosteniblemente fincas, bosques y paisajes que son productivos y resilientes al cambio climático","index":6,"paragraphs":[]},{"head":"Las comunidades y las instituciones usan y salvaguardan la biodiversidad agrícola de manera sostenible","index":7,"paragraphs":[{"index":1,"size":16,"text":"Sistemas alimentarios y paisajes que sostienen el planeta, impulsan la prosperidad y nutren a las personas."},{"index":2,"size":29,"text":"Brindamos soluciones científicas que aprovechen la biodiversidad agrícola y transformen los sistemas alimentarios de manera sostenible para mejorar la vida de las personas en medio de una crisis climática."}]},{"head":"Enfoques novedosos para transformar los sistemas alimentarios","index":8,"paragraphs":[{"index":1,"size":63,"text":"La manera como hacemos las cosas es tan importante como lo que hacemos. Nuestro enfoque expande nuestro rol más allá de la investigación, y asegura que las soluciones que generamos conduzcan a marcos de desarrollo más generales. Somos ágiles en responder a las exigencias, retos y oportunidades pero siempre guiados por nuestros principios centrales, visión, misión y objetivos, a los que permanecemos fieles."},{"index":2,"size":26,"text":"Nuestra estrategia, centrada en torno a palancas para lograr un cambio sistémico, está diseñada para generar impacto a escala. Desde un principio, tenemos presentes los resultados."},{"index":3,"size":52,"text":"La complejidad y dimensión de los retos globales significan que nadie puede enfrentarlos a título individual. Nuestro éxito depende de las colaboraciones, que incluyen gobiernos, agencias de la ONU, empresas sociales, sector privado, instituciones financieras, sociedad civil, universidades y CGIAR. Trabajando juntos estrechamente, cocreamos soluciones que satisfacen las necesidades de nuestros socios."},{"index":4,"size":33,"text":"Luchamos por generar un cambio sistémico. Para lograrlo, trabajamos con comunidades locales, institutos nacionales de investigación agrícola, universidades y el sector privado para compartir conocimiento, fortalecer capacidades y desarrollar herramientas y productos innovadores."},{"index":5,"size":35,"text":"Entablamos relaciones con actores en todo el espectro del desarrollo creando nuevos modelos de negocio con instituciones financieras, gobiernos locales y programas nacionales, bancos de desarrollo, compañías, fondos ambientalistas y universidades. PENSAR GLOBAL, ACTUAR LOCAL"}]},{"head":"NEXO NEXO","index":9,"paragraphs":[]},{"head":"Potenciando el cambio en los sistemas alimentarios","index":10,"paragraphs":[{"index":1,"size":15,"text":"Seis palancas para lograr el cambio en el nexo entre agricultura, medio ambiente y nutrición"}]},{"head":"Entorno alimentario y comportamiento del consumidor","index":11,"paragraphs":[{"index":1,"size":14,"text":"Remodelar el entorno alimentario y el comportamiento del consumidor hacia dietas saludables y sostenibles"}]},{"head":"Biodiversidad para la alimentación y la agricultura","index":12,"paragraphs":[{"index":1,"size":21,"text":"Poner la diversidad agrícola y arbórea a disposición y salvaguardarla para las diversas necesidades de los actores de los sistemas alimentarios"}]},{"head":"Inclusión digital","index":13,"paragraphs":[{"index":1,"size":14,"text":"Promover la inclusión en la revolución de la agricultura digital para lograr beneficios equitativos"}]},{"head":"Cultivos para la nutrición y la salud","index":14,"paragraphs":[{"index":1,"size":19,"text":"Poner la nutrición y la salud en el centro del fitomejoramiento para enfrentar la triple carga de la malnutrición"}]},{"head":"Paisajes multifuncionales","index":15,"paragraphs":[{"index":1,"size":16,"text":"Fomentar la innovación para lograr salud ambiental y paisajes productivos para mejorar los medios de vida"}]},{"head":"Acción frente al clima","index":16,"paragraphs":[{"index":1,"size":89,"text":"Integrar la acción frente al clima en el sistema alimentario para reducir riesgos La Alianza ha identificado seis 'palancas para el cambio' que, aplicadas juiciosamente, transformarán los sistemas alimentarios y los paisajes para enfrentar los retos de la creciente demanda de alimentos más nutritivos, manteniendo y mejorando a su vez nuestro medio ambiente y haciendo frente al cambio climático. Estos son puntos apremiantes en donde la investigación de la Alianza puede asumir un rol catalítico, donde nuestra intervención puede desencadenar efectos multiplicadores para lograr un cambio positivo y donde:"},{"index":2,"size":42,"text":"» la Alianza cuenta con una ventaja comparativa » un punto de partida genera efectos indirectos benéficos en el sistema » nuestro rol catalítico es reconocido por los socios » trabajamos en el nexo entre los sectores agricultura, medio ambiente y nutrición."}]}],"figures":[{"text":" A nivel mundial, nos enfocamos en entender y anticipar las tendencias globales que tienen repercusiones a nivel local. A nivel local, buscamos soluciones que anticipan o reaccionan a tendencias globales pero consideramos la dinámica local. "},{"text":"  "}],"sieverID":"bfed2eb9-0df0-4e55-a8f1-d136029bddd3","abstract":""}

data/part_4/0a7c36614cf4e3014e0f646bb2ba2adb.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0a7c36614cf4e3014e0f646bb2ba2adb","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/08699b6d-6634-44f6-bbc2-85c4bb59af4f/retrieve"},"pageCount":4,"title":"ILRI extension brief","keywords":[],"chapters":[{"head":"Principles of haymaking using tropical grasses and legumes","index":1,"paragraphs":[{"index":1,"size":9,"text":"Irenie Chakoma, Godfrey Manyawu, Kasirayi Gwezuva and Lovemore Gwiriri"},{"index":2,"size":2,"text":"Why hay?"},{"index":3,"size":83,"text":"Hay is a very popular form of forage preservation that provides an important source of animal feed in smallholder farming systems where veld (natural rangeland) is increasingly limited. Commonly made from fresh grass, forage legumes-such as cowpeas (Vigna anguiculata), velvet bean (Mucuna pruriens) and lablab (Lablab purpureus)-can also be turned into hay. During haymaking, forage is harvested by cutting and is left to dry in the sun until the moisture content reaches about 20% dry matter, at which stage it is stored safely."}]},{"head":"Steps in haymaking","index":2,"paragraphs":[]},{"head":"Harvesting","index":3,"paragraphs":[{"index":1,"size":54,"text":"Plants should be harvested by cutting at the appropriate stage of growth. As the plant matures, its herbage yield increases and nutritive value decreases. Therefore, hay should be harvested at a stage of growth when both the nutritive value (chiefly forage digestibility and protein content) and the herbage yield are optimized-usually at flowering time."}]},{"head":"Timing","index":4,"paragraphs":[{"index":1,"size":23,"text":"Forage intended for making hay should be harvested when the farmer is confident there will be three or more days of sunny weather."},{"index":2,"size":47,"text":"Harvesting is best done in the morning, to allow the cut forage to start drying during the remaining part of the day when the stomata (tiny breathing holes on leaf surface) are still open. When the stomata close-which occurs a few hours after cutting-the drying rate decreases."},{"index":3,"size":58,"text":"Herbage does not die immediately after cutting. It continues to live (or respire) until its normal metabolic processes are halted by lack of moisture. While it is alive, the herbage continues to lose nutrients from within the plant cells. Therefore, it is important that the herbage is dried as quickly as possible to preserve the herbage's nutritive quality."}]},{"head":"Cutting","index":5,"paragraphs":[{"index":1,"size":28,"text":"Resource-constrained farmers can use hand-held sickles (or slashers) to cut grass and legume crops. Where resources permit, tractor mounted mowers can also be used to harvest the pastures."}]},{"head":"Conditioning","index":6,"paragraphs":[{"index":1,"size":23,"text":"Leaf and stem material is normally covered with wax-like material (cuticle) on its skin (epidermis), to protect the plant from unwanted water loss."},{"index":2,"size":79,"text":"Water lost as by transpiration occurs through the stomatal apertures. To hasten drying, forage can be physically treated at the moment of cutting or immediately afterwards. The objective of such treatment is to bruise or press the herbage so as to break the skin and its cuticle and, thus, avoid stomatal resistance during drying. This can be achieved by putting the forage on a hard surface and rolling a 200 litre steel drum, covered in mesh wire, over it."}]},{"head":"Turning","index":7,"paragraphs":[{"index":1,"size":70,"text":"Cut and conditioned herbage must then be turned several times to speed up the rate of drying. The process of turning the hay soften it up and allows the air and sunshine to penetrate the herbage, hastening drying. Turning must be done once or twice a day. However, if the hay is turned too frequently, particularly when it almost dry, will cause the leaves to shatter (and break into pieces)."},{"index":2,"size":8,"text":"Legume hay is especially prone to leaf shatter."}]},{"head":"Baling","index":8,"paragraphs":[{"index":1,"size":97,"text":"Bailing hay too early (when moisture levels are greater than 23%) will trap moisture inside the bale and promote the growth of thermophilic bacteria, causing spoilage from heating and even burning of the haystack. Late baling (when moisture levels are around 15-16%) will cause the leaves to shatter, due to extreme dryness. The ideal moisture content for baling varies from 18-22%, depending on forage species. In the absence of a baling machine, using their feet smallholder farmers can compress the hay in portable wooden crates or pits-90cm long x 60cm wide x 60cm deep-dug into the ground."}]},{"head":"Storage","index":9,"paragraphs":[{"index":1,"size":89,"text":"Proper storage is a critical step in making high-quality hay. Hay bales should be stored in well-ventilated farm sheds that also provide sufficient cover from the rain. It is important to ensure that the sheds or barns do not expose the hay to very moist conditions causing spoilage from mould. Hay sheds can be built using simple materials, such as wooden poles and grass thatching. Wooden pallets or a raised platform can be used to avoid placing the hay directly on the shed floor, as shown in the picture."}]},{"head":"Field losses and quality changes","index":10,"paragraphs":[{"index":1,"size":20,"text":"Serious losses in dry matter quantities and nutritive value can occur during haymaking. These should be minimized to ensure profitability."},{"index":2,"size":11,"text":"Losses in the haymaking process can occur in the following ways:"}]},{"head":"Respiration losses","index":11,"paragraphs":[{"index":1,"size":45,"text":"As already indicated, harvested forage will continue to breathe after cutting, causing loss of dry matter as nutrients are expended. Therefore, drying should be done as quickly as possible to minimize losses. Under normal conditions, losses may amount to 1-5% of total dry matter yield."}]},{"head":"Leaching of nutrients","index":12,"paragraphs":[{"index":1,"size":70,"text":"The leaching of nutrients occurs when rain falls on cut herbage before it can be dried or stored away. For best results, the hay crop should be dried in dry and sunny conditions. Farmers should use their experience of weather condition or information from weather forecasts to determine the best time to cut hay as losses caused by rainfall damage can be as high as 15% of total dry matter."}]},{"head":"Mechanical losses","index":13,"paragraphs":[{"index":1,"size":99,"text":"In smallholder farms mechanical losses are minimal because farmers use simple equipment, such as sickles, to cut herbage and the area covered per day is relatively small, such that most of the cut forage is picked-up by hand. In mechanized operations, losses can occur as crops are not picked up by the machinery-either at harvesting or baling. This usually happens when chop length (the average length of the cut hay) is too small, making it difficult for the machine to pick it up. This can also occur when the mower, rake or baler is not in good working order."},{"index":2,"size":20,"text":"Irenie Chakoma, Kasirayi Gwezuva and Lovemore Gwiriri work for the International Livestock Research Institute. Godfrey Manyawu is an independent consultant."},{"index":3,"size":18,"text":"ILRI thanks all donors and organizations which globally supported its work through their contributions to the CGIAR system "}]}],"figures":[{"text":" Peter C Doherty AC, FAA, FRS Animal scientist, Nobel Prize Laureate for Physiology or Medicine-1996 Box 30709, Nairobi 00100 Kenya Phone +254 20 422 3000 Fax +254 20 422 3001 Email [email protected] ilri.org better lives through livestock ILRI is a CGIAR research centre Box 5689, Addis Ababa, Ethiopia Phone +251 11 617 2000 Fax +251 11 667 6923 Email [email protected] ILRI has offices in East Africa • South Asia • Southeast and East Asia • Southern Africa • West Africa "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "}],"sieverID":"454ad067-d518-43cb-a187-08b6b98a2840","abstract":""}

data/part_4/0a98aaf84c3258b52bdd8d2998c44361.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0a98aaf84c3258b52bdd8d2998c44361","source":"gardian_index","url":"https://www.iwmi.cgiar.org/Publications/Water_Issue_Briefs/PDF/water_issue_brief_18.pdf"},"pageCount":4,"title":"Maintain or restore diversity in water-related systems to provide redundancy and fail-safes. Use diversity and connectivity for flexibility in responding to unexpected events and changes","keywords":[],"chapters":[{"head":"Transformation of water systems for climate change adaptation and resilience","index":1,"paragraphs":[]},{"head":"Climate change is water change","index":2,"paragraphs":[{"index":1,"size":47,"text":"It has never been clearer -human-induced climate change is here, and we are seeing the impacts all over the world, day by day. Floods, fires, tropical cyclones, heat waves, droughts -these disasters are becoming more frequent and severe. Water runs like a thread through all these extremes."},{"index":2,"size":54,"text":"The Intergovernmental Panel on Climate Change (IPCC) warns us in the starkest terms that what we have seen so far is just a warning of what is to come. Under every emissions scenario it has considered, global average temperatures will continue to rise, and water extremes and risks will continue to become more dangerous."}]},{"head":"Water Issue Brief -18","index":3,"paragraphs":[{"index":1,"size":5,"text":"Putting research knowledge into action"}]},{"head":"The context","index":4,"paragraphs":[{"index":1,"size":82,"text":"Global warming is only the start. As climate change warms the atmosphere, the water cycle is intensifying dangerously. More severe, frequent and less predictable floods and droughts, extreme rainfall and changes in soil moisture, along with the melting of ice, reduced snow cover and rising sea levels are dislocating water systems worldwide. The consequences are plain to see. Without action to transform water systems, disruption of the ecological web of life that sustains us will deepen, and development gains will be lost. "}]},{"head":"Key messages","index":5,"paragraphs":[]},{"head":"GOVERNANCE AND PARTICIPATION","index":6,"paragraphs":[{"index":1,"size":29,"text":"Ensure data and information is accessible at all levels and that people have the skills to apply it to managing dynamically changing risks. Foster systems thinking and knowledge sharing."}]},{"head":"SYSTEM DIVERSITY AND CONNECTIVITY","index":7,"paragraphs":[{"index":1,"size":22,"text":"Reduce vulnerabilities using infrastructure, technologies and water management that will be robust for high-confidence threats but flexible in response to emerging futures."}]},{"head":"INFRASTRUCTURE, TECHNOLOGY AND MANAGEMENT","index":8,"paragraphs":[{"index":1,"size":55,"text":"Water security is becoming harder to achieve because of climate change, yet is more urgent than ever. Climate change adaptation and resilience in agriculture, the energy sector, industry and cities -as well as global ambition for food systems, biodiversity and sustainable development -all depend, as a result, on transforming water systems as the climate changes."}]},{"head":"Water: Too much and not enough","index":9,"paragraphs":[{"index":1,"size":96,"text":"To tackle climate change, we need to let go of our old assumptions: firstly, the notion that we can plan for the future solely by looking to the past. The age-old concept of 'stationarity' -viewed in terms of a stable climate with a predictable frequency of disruptions -has long governed human affairs and decisionmaking. Climate change makes no such promises: we must now plan in a state of 'deep uncertainty'. This means making robust water management strategies suited to multiple scenarios, and flexible enough to adapt to unexpected events and an emerging understanding of new realities."},{"index":2,"size":68,"text":"The second assumption to discard is the idea that water is a single sector. Water is intrinsic to the climate; it is everywhere, and climate change impacts on water are felt in every sectorfrom agriculture to sanitation, to energy and to manufacturing and commerce -by all social groups. Climate-resilient water management needs to take into account the cascading impacts of climate change across sectors and at all levels."}]},{"head":"An Action Framework for Climate-Resilient Water Management","index":10,"paragraphs":[{"index":1,"size":29,"text":"The International Water Management Institute (IWMI) has developed an Action Framework for Climate-Resilient Water Management that builds resilience into decision-making at all levels, across four linked domains for action."}]},{"head":"Governance and participation","index":11,"paragraphs":[{"index":1,"size":53,"text":"Governance is central to climate-resilient water management -but this has to be characterized by participation at all levels, including by vulnerable communities. Multi-level water governance where higher-level institutions empower robust and flexible decisions at lower levels is more likely to account for rights and bring stakeholders together in a collaborative cocreation of solutions."},{"index":2,"size":150,"text":"The warming of the atmosphere is intensifying the water cycle (IPCC 2021;Smith et al. 2019): ■ The frequency and intensity of heavy precipitation events have increased since the 1950s; and patterns of tropical monsoon rainfall are changing. ■ For each 1°C of global warming, extreme daily precipitation events are projected to intensify by about 7%. ■ Flood risks will expand, with three times as many people exposed to the equivalent of a 100-year flood event by the end of this century. ■ Surface water flows and availability will become more variable within seasons and from year to year. ■ Soil moisture levels will decline in some critical farming areas, challenging rainfed agriculture and increasing irrigation needs. ■ Drought has increased over the last five decades and the area of land under drought conditions will double by 2050, with between 0.5 and 3.1 billion more people experiencing conditions of water scarcity."},{"index":3,"size":1,"text":"The "}]},{"head":"Resilience for whom?","index":12,"paragraphs":[{"index":1,"size":132,"text":"Climate change is affecting all of us. But it is already having a disproportionate impact on those least responsible for global emissions, who are also much less able to withstand the shocks of extreme weather events. Any action on mitigation and adaptation must listen to the voices of the marginalizedfarmers, women, young people and indigenous peoples -and guarantee their rights. Scientific and local knowledge need to be put on an equal footing if sustainable outcomes are to be achieved; locals need to be heard at the highest levels of decision-making. If well-intentioned, scientifically grounded initiatives for mitigation and adaptation neglect inclusion at the local level, they will be rejected, with their efforts condemned to failure. Grassroots participation within a framework of multilevel governance is fundamental to the success of sustainable water management."}]},{"head":"Financing for water systems transformation","index":13,"paragraphs":[{"index":1,"size":89,"text":"Finance for climate mitigation and adaptation needs to work today, tomorrow and the day after tomorrow. Finance must tackle intensifying water risks under climate change. An 'economics of resilience' will help open up minds (and wallets) to the scale of finance that needs to be mobilized to transform water systems for climate resilience. There are crucial opportunities to be seized not only to include water management in climate finance, but also to ensure that the much larger pool of more general water-related finance is used to build climate resilience."}]},{"head":"Recommendations","index":14,"paragraphs":[{"index":1,"size":69,"text":"Climate change is dislocating water systems and dangerously intensifying the water cycle. The old, static ways we relied on to manage our water resources are no longer enough. Governments, businesses, cities, rural communities and farmers alike need new levers and tools, backed by new evidence and data, to transform water systems for a dynamically changing future. Building on the Action Framework for Climate-Resilient Water Management, IWMI recommends that we:"},{"index":2,"size":70,"text":"Prioritize system-wide action Support governments and communities to realize their commitments in nationally determined contributions (NDCs) and national adaptation plans (NAPs), where water and agriculture are frequently identified as key areas of risk. This requires water governance developments that operate at multiple levels, a strong evidence base to support analysis of trade-offs and decision-making, technology and infrastructure adapted to non-stationarity, and joined up solutions across food, land and water systems."}]},{"head":"Information and learning","index":15,"paragraphs":[{"index":1,"size":63,"text":"Information is power -if it is available to those who most need it, and if they have the skills to use it. Furthermore, this has to be achieved within the dynamic contexts of climate change, where stationarity is breaking down and uncertainty is expanding. This requires more than simply replacing statistical analyses of past weather and climate with the outputs of climate models."},{"index":2,"size":127,"text":"For a number of countries in Asia, Africa and the Middle East, IWMI has developed capabilities across technology, data and policy to respond to droughts and floods. Mapbased monitoring systems are being operationalized through country-specific early warning systems, to track drought or flood impacts on irrigated and rainfed agricultural systems. These are linked to risk management and transfer activities to help mitigate and recover from often devastating impacts. For example, bundled insurance solutions that provide climate information services, seeds and fertilizers, as well as cash payouts, have been developed for India and Bangladesh. While in the MENAdrought project, vulnerability and impact assessments alongside monitoring have been used in the participatory drafting of action plans that help Jordan, Lebanon and Morocco mitigate climate change and adapt to it."},{"index":3,"size":71,"text":"Wetlands provide an excellent example: long undervalued, particularly around urban settlements, they may provide flood defense for cities at risk from severe weather events, supporting urban municipalities maladapted to such shocks. Colombo's designation as a Ramsar Wetland City, supported by IWMI, recognizes the value of the city's 'natural infrastructure', which helps to reduce flood risks, is ecologically rich, and offers livelihoods to farmers and fishing communities in and around the city."}]},{"head":"Infrastructure, technology and management","index":16,"paragraphs":[{"index":1,"size":53,"text":"Climate-resilient infrastructure and technology for water needs to fit a wide range of credible futures, and should incorporate assessments of suitability for particular vulnerabilities and contexts. A new generation of uncertainty-tolerant approaches helps decision-makers identify options that have a satisfactory performance across scenarios while also retaining the flexibility to adapt according to need."},{"index":2,"size":23,"text":"The Innovation Lab for Small Scale Irrigation works in Ghana, Ethiopia and Tanzania to improve access to irrigation technologies, accounting for combinations of"}]},{"head":"System diversity and connectivity","index":17,"paragraphs":[{"index":1,"size":46,"text":"A reluctance to view the Earth as a whole, interconnected system is a fundamental barrier to addressing climate change. But it is water that allows us to maintain a balance across the ecological, economic and social spheres, enabling flexibility in responding to unexpected events and changes."},{"index":2,"size":35,"text":"water sources, water extraction technologies, application methods and allocation tools. These are set against biophysical and socioeconomic data so the limits of both the environment and the market can be aligned to benefit smallholder farmers."},{"index":3,"size":4,"text":"For more information, contact: "}]},{"head":"Prepare for high-confidence impacts and deep uncertainty","index":18,"paragraphs":[{"index":1,"size":53,"text":"Respond decisively to anticipated impacts in which we have high confidence, but avoid actions that are difficult to undo, modify or adjust over time. This calls for designs of technologies and infrastructure that perform well across a range of climate scenarios, and a decision-making approach that internalizes the principles of robustness and flexibility."},{"index":2,"size":39,"text":"Invest in water and climate information systems Advance and invest in the best water and climate information systems available, so decision-makers can prioritize climateresilient interventions. Ensure this is accompanied by inclusive learning across water users, institutions and wider society."}]},{"head":"Align water and climate finance to accelerate resilience","index":19,"paragraphs":[{"index":1,"size":35,"text":"Financing should be used to accelerate action to build resilience to climate change. Innovative mechanisms such as green bonds, sustainable finance and index-insurance products can help broaden the pool of investors interested in climate resilience."}]},{"head":"Use water as an enabler of adaptation","index":20,"paragraphs":[{"index":1,"size":33,"text":"Leverage action on water to enable adaptation across sectors, and harness the synergies generated to propagate change across water systems. Focus on policy coherence to reconcile the water needs of mitigation and adaptation."}]}],"figures":[{"text":"  "},{"text":" Put the needs of the most vulnerable people first Enact policies and take actions for climate-resilient water management that are inclusive and advance gender equality, and reduce displacement/migration. Ensure that the development gains of marginalized and climate-vulnerable people are protected and that future pathways out of poverty are privileged. Mark Smith, Director General, IWMI and Senior Director -Water Systems, CGIAR ([email protected]) Mark Smith, Director General, IWMI and Senior Director -Water Systems, CGIAR ([email protected]) Rachael McDonnell, Deputy Director General -Research for Development, IWMI ([email protected]) Rachael McDonnell, Deputy Director General -Research for Development, IWMI ([email protected])  "}],"sieverID":"93847cf4-6db5-462c-8003-70b6aa61286a","abstract":""}

data/part_4/0b034f8f266ee588d5a882a4ab6fe23b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b034f8f266ee588d5a882a4ab6fe23b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/b8565129-28f3-4d17-aca9-c3faa9e63fb7/retrieve"},"pageCount":30,"title":"Efficient and client oriented bean breeding in WECABREN","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":35,"text":"2b. PABRA and FARA facilitated the coming together of some West and Central African countries to the FARA head quarter in ACCRA for a meeting that lead to the creation of WECABREN in October 2006."}]},{"head":"WECABREN OPTED FOR INTRODUCTION SELECTION OF BEAN VARIETIES FROM ECABREN AND VARIETIES FROM ECABREN AND SABRN TO ACHIEVE FAST IMPACT Phase1: 2009-2014","index":2,"paragraphs":[{"index":1,"size":4,"text":"From Kenya to Cameroon "}]}],"figures":[{"text":"  "},{"text":"2006: 45 bean varieties From DRC to • Jan 2006: 45 bean varieties • Nov 2006: 46  • Jan 2006: 60 bean varieties • Jan 2006: 60 bean varieties • Nov 2006: 135 bean • Nov 2006: 135 bean varieties(Biofort, BILFA, MAC) varieties(Biofort, BILFA, MAC) • January 2010: 114 snap bean • January 2010: 114 snap bean lines lines • Jan varieties (MAC, • Jan varieties (MAC, MCR) MCR) • April 2011: 52 micronutrient • April 2011: 52 micronutrient rich bean varieties (NUA & rich bean varieties (NUA & NUV) NUV)  "},{"text":"From DRC to Cameroon From Uganda to Cameroon:  June 2013: -117 navy s/climber and 25 large grains lines -84 navy and 84 large grains lines -116 navy and 24 large grains lines lines -35 navy S/climber lines -In 2008: 68 best varieties (bush, semi-climbers, climbers) -In 2009: 68 best varieties Republic of Congo To Guinea c.: To Mali: From Univ. Michigan To Cameroon: From Cameroon From From Guinea Cameroon Conakry • Dec 2012: 26 kg • Three varieties released in October 23, 2013: To Togo and Guinea C. To Sierra Leone (bush, s/climber, climber) -In 2009: 110 best varieties of BILFA, MAC, Biofort, MCR -In 2010: 96 best lines of BILFA, MAC, Biofort, MCR Burkina, Senegal, CAR, Congo Brazza. Ghana To: Mali and -TY 3396-12: 100 kg • Sept 2013: 83 kg of GLP190 To Senegal -G16157(NITU): 300 kg program. To Togo, Guinea, -GLP 190: 16 kg -ECAPAN 021, -In 2013: 700 kg of bean certified seeds: To: Congo certified seeds: -ECAPAN 021: 300 kg To: Congo Brazzaville -Babessi 1: 7 kg -Bodhe: 3 kg -G16157(NITU), To Mali -Bodhe: 3 kg -TY 3396-12 -TY 3396-12 June 2013: -117 navy s/climber and 25 large grains lines -84 navy and 84 large grains lines -116 navy and 24 large grains lines lines -35 navy S/climber lines -In 2008: 68 best varieties (bush, semi-climbers, climbers) -In 2009: 68 best varieties Republic of Congo To Guinea c.: To Mali: From Univ. Michigan To Cameroon: From Cameroon From From Guinea Cameroon Conakry • Dec 2012: 26 kg • Three varieties released in October 23, 2013: To Togo and Guinea C. To Sierra Leone (bush, s/climber, climber) -In 2009: 110 best varieties of BILFA, MAC, Biofort, MCR -In 2010: 96 best lines of BILFA, MAC, Biofort, MCR Burkina, Senegal, CAR, Congo Brazza. Ghana To: Mali and -TY 3396-12: 100 kg • Sept 2013: 83 kg of GLP190 To Senegal -G16157(NITU): 300 kg program. To Togo, Guinea, -GLP 190: 16 kg -ECAPAN 021, -In 2013: 700 kg of bean certified seeds: To: Congo certified seeds: -ECAPAN 021: 300 kg To: Congo Brazzaville -Babessi 1: 7 kg -Bodhe: 3 kg -G16157(NITU), To Mali -Bodhe: 3 kg -TY 3396-12 -TY 3396-12  "},{"text":". 2050 kg of released varieties produced . 239 kg distributed to 740 household (494 women and 246 men) GUINEA CONAKRY • One variety released in December 2012: GLP 190 (1241 kg/ha) • Number of people reached: 62 730 -39 520 women -39 520 women -23 210 men • Three varieties potential for release: MCM 5001 (900 kg/ha), RWR 719 (800 kg/ha) and Babessi 1 Guinea: Presentation of the released variety to the public: GLP 190 IT is estimated that 1400000 households have been • IT is estimated that 1400000 households have been reached with seed and technics of bean production: 800000 women and 600000 men. • Seed distribution and training continue and the tracking is ongoing.  Guinea Conakry: Samples of the Non varietal technology development 4. REACHING END USERS Guinea Conakry: Samples of the Non varietal technology development 4. REACHING END USERS released variety GLP 190 Development of cultural practices (ICM) to increase • About 600 tons of bean seeds have be produced so released variety GLP 190 Development of cultural practices (ICM) to increase • About 600 tons of bean seeds have be produced so  bean yield was done in many countries. It far by both research station, the national seed bean yield was done in many countries. It far by both research station, the national seed  concerned the : program, the bean program and partners in the concerned the : program, the bean program and partners in the  WECABREN countries. WECABREN countries. • -Planting date -Planting date -Organic and inorganic and foliar fertilization •-Planting date -Planting date -Organic and inorganic and foliar fertilization  -Disease control -Disease control  -Insect control -Insect control  -Staking -Staking  -Natural substances for bean conservation in -Natural substances for bean conservation in  storage storage  "}],"sieverID":"bc824c3d-5fc9-40a0-a039-3258cc2baa40","abstract":"To show that WECABREN is achieving quick impact by capitalizing the know how and the existing of the PABRA's ECABREN and SABRN networks • PABRA collaboration started with Cameroon in 2005. 2005. • Backstopping by PABRA/ECABREN scientists helped Cameroon lay ground work and strategy for bean germplasm introduction and selection and to play a leading role in the West and Central Africa Region."}

data/part_4/0bce5785d5257c791ecc22024ce4ba5e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0bce5785d5257c791ecc22024ce4ba5e","source":"gardian_index","url":"https://digitalarchive.worldfishcenter.org/bitstream/handle/20.500.12348/36/3725_2015-34.pdf"},"pageCount":2,"title":"WorldFish Incubator brings scientific research and innovative technologies to scale by preparing early-stage aquaculture SMEs for investment. By fostering the growth of aquaculture SMEs, the Incubator will deliver positive economic, social and environmental impacts","keywords":[],"chapters":[{"head":"WOrk With us","index":1,"paragraphs":[{"index":1,"size":24,"text":"WorldFish Incubator works with many partners to create change. Through our relationships with social impact investors and private-sector partners, we will have greater impact."},{"index":2,"size":49,"text":"To learn more about the Incubator, please contact us at: [email protected] production comes from small and medium enterprises. In developing countries, these SMEs strengthen the communities in which they are based by producing affordable, nutritious food and promoting better livelihoods for the many poor people who rely on fish."},{"index":3,"size":26,"text":"Unfortunately, many SMEs often lack access to markets, financing, and the technical and business management skills that would help them to succeed in a global market."}]},{"head":"the challenge","index":2,"paragraphs":[{"index":1,"size":16,"text":"Today, fish provides more than 1 billion poor people with most of their daily animal protein."},{"index":2,"size":51,"text":"Fish is an affordable animal-source food that provides nutrients and micronutrients that are essential for cognitive and physical development, especially in children, and are an important part of a healthy diet. In some of the poorest countries, fish is the primary source of animal protein and a key source of nutrition."},{"index":3,"size":77,"text":"There is increasing global demand for fish, especially in poor countries. By 2020, it is estimated that 18 million more tons of fish will be needed. Aquaculture will be the key to increasing our fish supply. While production from capture fisheries is expected to remain stable due to overfishing, supply from aquaculture will need to grow by 30 percent. Today, approximately half of our fish comes from aquaculture, and it is the world's fastest-growing food production system."},{"index":4,"size":65,"text":"Farmed fish from aquaculture have a smaller environmental footprint than other animal-sourced foods. Pound for pound, aquaculture contributes less to global emissions of nitrogen and phosphorus than beef and pork production. While aquaculture growth can impact ecosystems if not managed responsibly, the aquaculture industry is relatively new and has the potential to further decrease its environmental impact through the use of improved feeds and technologies."},{"index":5,"size":28,"text":"the WOrldFish incubatOr WorldFish Incubator bridges the gap between scientific research and business by supporting investment in sustainable small-and medium-sized aquaculture enterprises in Africa, Asia and the Pacific."},{"index":6,"size":26,"text":"By building opportunities for growth, WorldFish Incubator connects small-scale aquaculture enterprises in Africa, Asia and the Pacific with investors seeking scalable, high-impact, bottom-line investments in aquaculture."}]},{"head":"abOut WOrldFish","index":3,"paragraphs":[{"index":1,"size":55,"text":"WorldFish, an international nonprofit research organization, harnesses the potential of fisheries and aquaculture to reduce global poverty and hunger. Utilizing its scientific expertise, its networks and partnerships, and a unique \"research in development\" approach, WorldFish increases the productivity and sustainability of fisheries and aquaculture and improves the lives of poor people who rely on them."},{"index":2,"size":41,"text":"WorldFish is deeply committed to creating a more food-secure and prosperous future for the more than 1 billion poor people who rely on fish for food and nutrition and the 250 million who depend on fishing and aquaculture for their livelihoods."},{"index":3,"size":11,"text":"Fish is an important animal-source food, particularly in Asia and Africa. "}]}],"figures":[{"text":" the early-stage development of scalable aquaculture SMEs that adopt sustainable technologies. The Incubator identifies earlystage entities with growth potential, provides technical and business capacity development training, and facilitates access to financing. By fostering the growth of SMEs that use sustainable practices and technologies, the Incubator promotes positive economic, social and environmental impacts. "}],"sieverID":"3d2deec3-0e23-431b-80ff-dcafcad3faa4","abstract":""}

data/part_4/0bd183a1b5e0e0c4bedc36bd2de755aa.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0bd183a1b5e0e0c4bedc36bd2de755aa","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c16e9e86-bd3d-4166-96de-2ab55e122354/retrieve"},"pageCount":10,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":22,"text":"same or similar disease strains. This acquired resistance to reinfection suggests that prospects are promising for the development of an effective vaccine."},{"index":2,"size":159,"text":"A concerted effort to develop an ECF vaccine was initiated in 1967 at the former East African Veterinary Research Organization (EAVRO), supported by the Food and Agriculture Organization (F.AO) of the United Nations and the United Nations Development Program (UNDP). Scientists demonstrated that it is possible to vaccinate cattle experimentally by infecting them with Theileria parasites and treating them at the same time with a longlasting formulation of the antibiotic oxytetracycline (Terramycin LAPfizer). However, this 'infection and treatment' approach has a number of drawbacks. Originally concern centred on the fact that animals immunized in this way might retain live parasites in their blood stream and thus act as disease carriers. Also, it became clear that a number of different ECF strains occur in the field, and animals immune to one strain may be partly or fully susceptible to another. In addition, not all strains can be contained by oxytetracycline, so the initial infection with live parasites may be fatal."},{"index":3,"size":23,"text":"Dr Subash Morzaria (on right) takes a blood sample from a steer exposed to ECF at a field site in Kenya's Coast Province."},{"index":4,"size":64,"text":"Research on ECF declined in the mid1970s with the termination of the FAO/UNDP project and the dissolution of the East African Community which supported EAVRO. This work has been taken up again in recent years by a group of scientists at ILRAD led by Dr Tony Irvin, in cooperation with EAVRO's successor, the Kenya Agricultural Research Institute (KARI), and the Ministry of Livestock Development."},{"index":5,"size":100,"text":"It has now been shown that cattle which recover naturally from ECF commonly retain parasites in their bloodstream. Thus, the occasional retention of parasites in the blood of immunized animals may be acceptable since such animals will not add significantly to the preexisting population of carriers. Dr Irvin and his team are tackling the other two problems encountered in the 'infection and treatment' approach -the identification and classification of different ECF strains and the development of safe and effective methods of infecting animals and treating them to confer immunity. Other promising immunization methods are also being investigated by ILRAD scientists."}]},{"head":"Characterizing ECF strains","index":2,"paragraphs":[{"index":1,"size":39,"text":"Different strains of Theileria parasites probably possess strainspecific antigens. These antigens are difficult to study directly, but scientists at ILRAD have produced antibodies which can be used to identify parasite strains in the laboratory according to their specific antigens."},{"index":2,"size":72,"text":"First Theileria parasite material is injected into mice to stimulate antibody production Then antibodyproducing spleen cells are taken from these mice and fused with myeloma (bone marrow) cells which can grow and multiply in culture. The resulting hybrid cells are cloned and appropriate clones are selected which produce monoclonal antibodies. In this wavy, 16 monoclonal antibodies have been raised at ILRAD which respond to the parasite antigens associated with different ECF strains."},{"index":3,"size":86,"text":"Following an agreement with the Kenya Government in 1979, ILRAD scientists launched a field program in collaboration with the Ministry of Livestock Development to isolate and characterize strains of ECF which could be used as the basis for experimental vaccines. This work was initiated in Kenya's Coast Province. Parasites isolated from infected cattle and ticks at the coast have been compared with strains identified earlier by scientists at EAVRO, and with isolates collected more recently in other parts of Kenya and in Uganda, Malawi and Zambia."},{"index":4,"size":78,"text":"Twentytwo stocks of T p parva have been isolated from widely separated areas and screened using the battery of 16 monoclonal antibodies. The responses of the different antibodies are measured using the indirect fluorescent antibody (IFA) test. Based on comparisons of these responses, all the stocks tested so far fall into one of three groups, A, B or C, as shown in the figure. These groupings are not related to the areas from which the stocks were obtained."},{"index":5,"size":76,"text":"Cattle have been immunized by infection and treatment using Theileria stocks identified by the antibody responses. These cattle were then challenged with different stocks from the same group as their original infection or with stocks from different groups. Animals challenged with a stock from the same group as their first infection showed very mild disease symptoms or none at all. Animals challenged with a stock from a different group often showed severe symptoms, and some died."},{"index":6,"size":57,"text":"These results suggest that the characterization of stocks by monoclonal antibodies can provide information which predicts crossprotective patterns in cattle. Thus, it may be possible to produce vaccines for specific areas based on the isolation of local ECF strains. Eventually it may also be possible to develop hybrid strains which will protect animals over much wider regions."},{"index":7,"size":51,"text":"Simplified diagram of the reactions of 15 monoclonal antibodies with macroschizonts of 22 T p parva stocks, measured by the IFA test. Stocks from Kenya, Uganda, Malawi and Zambia have been screened. They all appear to fall into one of three profile groups (A, B and C), irrespective of geographic origin."},{"index":8,"size":79,"text":"Immunization trials at the Kenya coast ILRAD scientists are now carrying out vaccination trials in Coast Province in cooperation with the Ministry of Livestock Development and the Agricultural Development Corporation. Two T p parva stocks were selected as the basis for these experiments, T p parva Kilifi from group A and T p parva Marikebuni from group C. Crossimmunity trials had suggested that cattle immunized with these stocks are protected against the other ECF stocks isolated at the coast."},{"index":9,"size":73,"text":"Eleven Jersey calves between 3 and 12 months old were used for one field trial. This breed is highly susceptible to ECF. Eight calves were immunized by infection with Kilifi and Marikebuni parasites followed by two doses of oxytetracycline. After 25 days, four of these were infected and treated again and four were injected with parasites only, to boost their immunity. One of the second group reacted severely and was treated with parvaquone."},{"index":10,"size":88,"text":"Fiftyfour days after the booster immunization, the eight immunized calves and three non immunized controls were taken to graze for 3 months in an endemic ECF area. Ticks were counted every second day; an average of over 50 ticks was found on each calf throughout the period. ECF parasites were observed in the lymph nodes of all the calves but the non immunized calves showed much higher levels of parasitaemia and they all died of acute ECF. The immunized calves showed mild or inapparent symptoms and all survived."},{"index":11,"size":110,"text":"At another site, 16 Sahiwal/Red Poll calves were immunized against ECF by inoculation with Kilifi and Marikebuni parasites and treatment with oxytetracycline. Two controls were inoculated with the Kilifi parasites only and two with Marikebuni; five other controls were treated with oxytetracycline only. The two calves which were only inoculated with Marikebuni parasites developed severe parasitaemia and were treated with parvaquone. The two which were only inoculated with the Kilifi strain did not develop infection. This suggested that the Kilifi stabilate used may not have been viable, so these two calves were grouped with the five controls. The treated calves were thus probably only immunized against T p parva Marikebuni."},{"index":12,"size":64,"text":"Fortynine days after the initial immunization, all 25 calves were taken to graze for 3 months in fields infested with ticks. Parasites were observed in the lymph nodes of 8 out of the 18 immunized calves and all 7 controls. None of the immunized calves became seriously ill, while five of the controls suffered acute ECF and four died. Other approaches to vaccine development"},{"index":13,"size":98,"text":"While field trials are being conducted in Coast Province, work is also in progress at ILRAD to develop new immunization techniques. Two possible starting points are being investigated as the basis for a vaccine which would stimulate effective immunity but would not require the level of veterinary supervision needed when animals are infected with live parasites. The two immunogens which are being purified and tested are antigens from Theileria sporozoites, the stage of the parasite which is transmitted to cattle from infected ticks, and antigens from Theileria schizonts, the stage which develops in the cells of infected cattle."},{"index":14,"size":18,"text":"Dr Toru Fujinaga and Mr Reeves Njamunggeh check antigen preparations from ECF isolates before screening with monoclonal antibodies."},{"index":15,"size":88,"text":"Another research effort concentrates on Theileria parva lawrencei, a subspecies of the parasite closely related to T p parva. T p lawrencei is normally carried by wild buffalo, but it can cause severe infections in cattle. The ECF situation appears much more complex in areas where cattle come into contact with infected buffalo. Scientists at ILRAD are working with colleagues at KARI and the Kenya Government's Veterinary Research Laboratories who are studying Theileria in buffalo and its transmission to domestic cattle. This project is supported by The Netherlands."},{"index":16,"size":59,"text":"Using electron microscopy and other techniques, ILRAD scientists are also carrying out detailed studies of the lifecycle of ECF parasites to identify stages, which may be particularly vulnerable to control. The longterm goal of all ECF research at ILRAD is to produce safe and effective vaccines, which will protect cattle throughout the region where the disease is now endemic."}]},{"head":"Recent articles by ILRAD scientists","index":3,"paragraphs":[{"index":1,"size":102,"text":"The research conducted at ILRAD is described every year in the annual report. Scientists on the ILRAD staff publish detailed accounts of their research results in books and in articles written for international scientific journals. Graduate students work at ILRAD for periods of 1 to 3 years to fulfil requirements for a higher degree. Most of these students are from Africa. Postdoctoral fellowships are also offered to young scientists who work within ILRAD's research program, normally for a period of 2 years. Candidates for postdoctoral positions are selected on an international basis, but preference is given to wellqualified scientists from African countries. "}]},{"head":"Current individual training activities","index":4,"paragraphs":[]}],"figures":[{"text":" of calves immunized experimentally against ECF and exposed to field challenge at two locations in Kenya's Coast Province.The results of these two trials are summarized in the table. Two other field trials are now in progress at different sites. Boran cattle have been immunized by infection with the Marikebuni and Kilifi strains or the Marikebuni strain only and treatment with oxytetracycline. They are now being exposed to infected ticks in two different field locations.Dr Evans Taracha and Dr Tony Irvin monitor cattle which have been immunized experimentally against ECF. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":" Copies of annual reports, publications lists and brochures describing ILRAD's research and training activities can also be obtained from Information Services. Single copies are sent without charge.Black, S.J., Jack, R.M. and Morrison. W.I.(1983). Hostparasite interactions, which influence the virulence of Trypanosoma (Trypanozoon) brucei brucei organisms. Acta Tropica. 40: 11-18.Gibson, W.C., Wilson, A.J. and Moloo, S.K.(1983). Characterisation of Trypanosoma (Trypanozoon) evansi from camels in Kenya using isoenzyme electrophoresis. Research in Veterinary. laboratories or field programs in developing countries, most often in Africa, and the specific training they receive depends on the needs of their home institutions. The goal is to identify individuals who are working in appropriate areas and to give them exactly the additional experience they need to do a better job. Laurent, M., Pays, E., Magnus, E., van Meirvenne, N., Matthyssens, G., Williams, R.O. and Laurent, M., Pays, E., Magnus, E., van Meirvenne, N., Matthyssens, G., Williams, R.O. and Steinert, M. (1983). DNA rearrangements linked to expression of a predominant surface Steinert, M. (1983). DNA rearrangements linked to expression of a predominant surface antigen gene of trypanosomes. Nature. 302: 263-66. antigen gene of trypanosomes. Nature. 302: 263-66. Moloo, S.K. (1983). Feeding behaviour of Glossina morsitans morsitans infected with Moloo, S.K. (1983). Feeding behaviour of Glossina morsitans morsitans infected with Trypanosoma vivax, T. congolense or T. brucei. Parasitology. 86: 51-56. Trypanosoma vivax, T. congolense or T. brucei. Parasitology. 86: 51-56. Morrison, W.I., Murray, Max, Whitelaw, D.D. and Sayer, P.D. (1983). Pathology of infection Morrison, W.I., Murray, Max, Whitelaw, D.D. and Sayer, P.D. (1983). Pathology of infection Training opportunities at ILRAD-Steady advances since Training opportunities at ILRAD-Steady advances since 1976 1976 What is the role of training in an institute with a mandate to carry out basic scientific What is the role of training in an institute with a mandate to carry out basic scientific research? 'An important one', according to Dr Jim Lenahan, the Training Officer at ILRAD. research? 'An important one', according to Dr Jim Lenahan, the Training Officer at ILRAD. 'But training activities must be carefully planned to complement, rather than compete with, 'But training activities must be carefully planned to complement, rather than compete with, the research program.' the research program.'  "},{"text":" During the first 6 months of 1983, 11 postdoctoral fellows were conducting research at ILRAD and 17 graduate students were working in pursuit of higher degrees or completing their studies at universities overseas with ILRAD support. Nine scientists and senior technicians were receiving specialized training.But numbers do not tell the whole story. Who are these people and what are they learning during their stay at ILRAD? The nine scientists and senior technicians who participated in the training program during the first half of 1983 are good examples. They came from 9 different African countries: Burundi, Kenya, Mali, Rwanda, Sudan, Tanzania, The Gambia, Zambia and Zimbabwe. Four are on the staff of national veterinary laboratories and one is in his country's national veterinary service. Two work for FAO animal disease projects, one is on the staff of a pest research institute and one works for a national livestock marketing board.Each trainee is assigned to a member of ILRAD's scientific staff who has the primary responsibility for providing an appropriate training program. The nine trainees who were working at ILRAD during the first 6 months of 1983 stayed for periods ranging from 10 days to 7 months, depending on their specific training needs. Three learnt parasitological and immunological techniques related to trypanosomiasis. Three learnt advanced laboratory techniques required for East Coast fever research. Two learnt serological and diagnostic methods used in animal disease research in Africa, and one learnt improved methods of maintaining tsetse fly colonies. All are returning to their home institutions to put this training into practice. Course on the Diagnosis of Haemotropic Cattle Diseases, with Emphasis on East Coast Fever, which was held from 14 February to 11 March. General sessions covered the pathology and epidemiology of ECF and the lifecycle of the Theileria parasite. Scientists then explained how to diagnose ECF and other haemotropic diseases of cattle and discussed current control methods and recent advances in the study of natural and induced immunity.The 13 participants came from Kenya, Indonesia, Malawi, Mozambique, Somalia. Sudan, Tanzania, Uganda, Zambia and Zimbabwe. Four were veterinarians, eight were laboratory technicians and one was a veterinary assistant. Ten were staff members in national veterinary laboratories or livestock ministries and three were working in FAO projects. One participant from Zambia reported back to his laboratory director, 'The course included both theory and practical classes. It was set in such a way as to enable us to put into practice what we acquired when we go back to our respective countries.'The third Training Course on Trypanosomiasis and other Parasitic Diseases was held at ILRAD from 31 May to 8 July. This series of courses is cosponsored by ILRAD and the International Livestock Centre for Africa (ILCA) to train field staff who are working in the ILCA/ILRAD livestock productivity and trypanotolerance research network. Eleven scientists have participated in training courses associated with the network.A full schedule of courses and conferences is planned for the months and years ahead. Activities for the second half of 1983 are listed in this newsletter. Increasing numbers of scientists and technicians will also be coming to ILRAD for individual training, always preserving the balance between opportunities for relevant training and basic research priorities.ILRAD appoints research directorIn December 1982, the Board of Directors appointed Dr Jack Doyle as ILRAD's first Director of Research. Dr Doyle took up this position at the beginning of 1983. Specialists in the field of ruminant immunology will meet participants from developing countries who are engaged in research on the immunological aspects of ruminant diseases. The murine, human and bovine immune systems will be reviewed and papers will be presented on current immunological research, with particular emphasis on bovine diseases occurring in Africa. The conference will be conducted in English and French.An Interregional Training Course on the Use of Nuclear Techniques in AnimalParasitology will be held at ILRAD from 17 October to 11 November 1983. FAO and the International Atomic Energy Agency (IAEA) are cosponsors. The course, which is open to 20 participants, will be conducted in English. For more information on conferences and training activities at ILRAD, write to Dr Jim Lenahan, Training Officer, ILRAD, P O Box 30709, Nairobi, Kenya. The International Centre of Insect Physiology and Ecology (ICIPE) is organizing an International Study Workshop on Tsetse Behaviour and Population Ecology, to be held in Nairobi from 23 to 29 October 1983. Topics proposed for discussion include: sensory physiology and reproductive aspects of tsetse behaviour, population ecology and sampling techniques, parasitevectorhost interactions and the impact of recent advances in the study of insect ecology and behaviour on tsetse control strategies. For further information on ICIPE courses and conferences, contact the Senior Communication and Information Officer, ICIPE, P O Box 30772, Nairobi, Kenya. The 10th Executive Committee :Meeting of the International Scientific Council for Trypanosomiasis Research and Control (ISCTRC) will take place in Brazzaville, Congo, from 18 to 19 November 1983. The Committee will review research and training activities concerned with tsetse and trypanosomiasis control.A Training Seminar on Tsetse and Trypanasomiasis Control will be held in Brazzaville from 21 to 30 November 1983, organized jointly by FAO, WHO and the Organization of African Unity (OAU). The seminar will cover environmental aspects of integrated tsetsecontrol programs, diagnosis and chemotherapy of animal trypanosomiasis, management of trypanosomiasis control campaigns, training, the role of trypanotolerant livestock and the economics of tsetse and trypanosomiasis control. The progress of the FAO trypanosomiasis control program will also be reviewed. More information on the Brazzaville meeting and training seminar can be obtained from the Director, OAU/IBAR, P O Box 30786. Nairobi, Kenya. Training Courses ________________________________________________________________________________________ Training Courses ________________________________________________________________________________________ ILRAD Reports ILRAD Reports Seventeen scientists and technicians participated in ILRAD training courses during the first 6 International Laboratory for Research on Animal Diseases Seventeen scientists and technicians participated in ILRAD training courses during the first 6 International Laboratory for Research on Animal Diseases P O Box 30709, Nairobi, Kenya telephone: Nairobi 592311 telex: 22040 'ILRAD' months of 1983. Thirteen participated in a In addition to these discussions, the course participants learnt a number of laboratory cable: ILRAD/Nairobi/Kenya P O Box 30709, Nairobi, Kenya telephone: Nairobi 592311 telex: 22040 'ILRAD' months of 1983. Thirteen participated in a In addition to these discussions, the course participants learnt a number of laboratory cable: ILRAD/Nairobi/Kenya techniques used in the study of ECF. These included: techniques used in the study of ECF. These included: collection and examination of blood and lymph node biopsy smears from cattle collection and examination of blood and lymph node biopsy smears from cattle recognition of ECF macrochizonts, microschizonts and piroplasms and differentiation recognition of ECF macrochizonts, microschizonts and piroplasms and differentiation of Theileria species of Theileria species recognition of Rhipicephalus appendiculatus and other important tick species recognition of Rhipicephalus appendiculatus and other important tick species dissection and preparation of tick salivary glands: recognition of different types of acini dissection and preparation of tick salivary glands: recognition of different types of acini and different parasite forms and different parasite forms indirect fluorescent antibody (IFA) test and other tests used for the diagnostic serology indirect fluorescent antibody (IFA) test and other tests used for the diagnostic serology of ECF. of ECF.  "}],"sieverID":"0a09120a-25a6-49a4-bc4b-4d11c7682eb3","abstract":"Towards the development of an ECF vaccine Early research on ECF Characterizing ECF strains Immunization trials at the Kenya coast Other approaches to vaccine development Recent articles by ILRAD scientists Training opportunities at ILRAD-Steady advances since 1976 Current individual training activities Training Courses ILRAD appoints research director Calendar notes for the second half of 1983 Towards the development of an ECF vaccine East Coast fever (ECF) is a particularly virulent form of theileriosis, a complex of diseases caused by singlecelled Theileria parasites. ECF is caused by the parasite T parva parva. It is an important constraint on livestock development in Kenya,"}

data/part_4/0c45f5b6a2a550358196bb779befe600.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0c45f5b6a2a550358196bb779befe600","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7eb9ef32-eb88-47a3-b6c2-d33f77fc21e3/retrieve"},"pageCount":11,"title":"Impact of irrigation works systems on livelihoods of fishing community in Ca Mau Peninsula, Viet Nam","keywords":["impact","irrigation works systems","livelihoods community","Ca Mau Peninsula"],"chapters":[{"head":"I. INTRODUCTION","index":1,"paragraphs":[{"index":1,"size":357,"text":"a Mau Peninsula (CMP) is located in the South-West of the Mekong River Delta (MRD), Vietnam with a natural area of 1.6 mil ha, accounting for 43% MRD land area. It is classified into 7 eco-regions and 51 irrigation destinations including 6 provinces: Bac Lieu, Soc Trang and Ca Mau, Hau Giang, Can Tho and a part of Kien Giang province. CMP was the wide area in the MRD where fisheries activities take place in both freshwater and brackish water ecosystems. Over the past decade, the rice production with limited fresh water sources presented low economical efficiency, resulted in switching gradually to integration production models of agriculture, forestry and fisheries. The pattern of production has changed on the demand for water resources as well as integrated water resource management (Thang, 2011). The irrigation works systems (IWS) in CMP were planned and constructed quite well. However, similar to other areas formerly, these irrigation systems were mainly used for agricultural production. This region was a key area for aquaculture development of the MRD, but no any specialized irrigation system to serve this purpose (Son, 2010). The problems arose, so far remain unresolved, especially issue of initiative water supply to the sub-regions on the needs of each object produced. Diversified agriculture production in combination with inadequate irrigation system has limited social-economic development in the region (Thang, 2011). IWS in medium flooded areas in the Mekong River Delta negatively influenced on aquatic resources (Sinh et al., 2007). Serious depletion of aquatic resources has a strong and negative impact on productivity of the inland fisheries as well as aquaculture activities relied on natural seed sources, and subsequently caused huge socio-economic impact on the community (Sinh, 2006). However, study on the impact of IWS on livelihoods of fishing community in CMP has not been in-depth investigated. This research aims to provide scientific data on rationalization the inlands fisheries and aquatic resources protection as well as the livelihoods of people in the area. The study will focus on impact of IWS in CMP on natural resources, human resources, social, financial and physical capitals in the sustainable livelihoods framework of freshwater and brackish water ecosystems."}]},{"head":"II. METHODS","index":2,"paragraphs":[]},{"head":"A. Sample design and data collection","index":3,"paragraphs":[{"index":1,"size":111,"text":"The study was conducted from January to December, 2015 in CMP with two representative ecosystems including Can Tho City (fresh water ecosystem affected by the O Mon-Xa No C ISSN 2250-3153 www.ijsrp.org irrigation system) and Bac Lieu province (brackish water ecosystem affected by the Quan Lo-Phung Hiep irrigation system) (Figure 1). Respondents were households who participated in fishing natural aquatic resources, aquaculture households using fingerlings from natural resources, the poor households (agricultural production landless and minority households who have participated in fishing natural aquatic resources), managers and representatives of local organizations. Interviewed households were randomly selected from a list of respondents provided by Can Tho and Bac Lieu Provincial Agriculture Department."},{"index":2,"size":104,"text":"Secondary data were collected from relevant documents, previous studies have been published domestically and internationally, some final reports of the specialized agencies of the province in the study area. Primary data was collected following the method of Participatory Rural Appraisal (PRA) (Lammerink and Wolffers, 1996) and household face-to-face interview by a structure prepared questionnaires. Accordingly, the study was conducted in six communes in five districts in the two provinces, corresponding to six PRA meetings, four meeting located in the affected area of IWS with 120 households and another 120 households in two adjacent areas which were not affected by IWS (Figure 1; Table 1)."},{"index":3,"size":119,"text":"Data on fish species compositions distributed in the study area were collected throughout the year with three sampling phases in dry season (Phase 1: 3/2015, Phase 2: 05/2015 and Phase 5: 11/2015) and two sampling phases in rainy season (Phase 3: 07/2015, Phase 4: 09/2015). The fish sampling was done inside and outside water bodies of the IWS areas in both freshwater and brackish water ecosystems. Fish identification and classification was done following Eschmeyer (1998) using grade class, order, family, and species. Also, specific species identification was based on documents described by Khoa and Huong (1993), Khang (1958), Rainboth (1996) and Dinh et al. (2013). To update the fish scientific names, document of Fröese and Pauly (2015) was used."}]},{"head":"B. Data analysis","index":4,"paragraphs":[{"index":1,"size":89,"text":"The collected data from the local reports, data of PRA meeting and household survey were cross-checking input, encrypted and analysed. Descriptive statistics method (SPSS 13.0) was used to present indicators of incidence (percentage, mean, standard deviation) to describe the current status. Analysis the impact of the IWS on livelihoods of natural fisheries community based on methods of Neefjes (2000) and DFID's Sustainable Livelihood Framework (2001). In the following section this paper will focus on analyzing impacts of IWS on five different capitals in the sustainable livelihoods framework (DFID, 2001)"}]},{"head":"III. RESULTS AND DISCUSSION","index":5,"paragraphs":[]},{"head":"Impact of IWS on the natural resources capital","index":6,"paragraphs":[{"index":1,"size":285,"text":"The highly construction inside the IWS area caused lower fish species composition. The systems of canals, dikes and flood control canals in both freshwater and brackish water ecosystems were important factors affecting livelihoods of fishing communities (Table 2). In the freshwater ecosystem, the number of canals level 2 and level 3 inside the IWS area was nearly three times higher than that of outside area, and the total length of the canals level 2 and level 3 inside the IWS area was nearly two times longer than that of outside area (77.6 and 40.84 km, respectively). Similarly, in brackish water ecosystem, the number and total length of canals level 2 and level 3 inside IWS area was nearly three times higher than that of outside area. Moreover, inside IWS area of brackish water ecosystem, there was three canals level 1 with the total length of 183 km (Table 2). Results from fish species composition distribution showed that number of fish species outside IWS area was much richer than that of inside area in both two ecosystems. In freshwater ecosystem, there were 52 species distributed inside IWS area and 79 species distributed outside. Similarly, in brackish water ecosystem, 79 species were found inside IWS area and 83 species outside. This showed that IWS negatively affected aquatic species population though water surface area inside the IWS was significantly higher than that of outside area. In addition, farmer (78.7%) reported that the systems of dykes, embankments and flood control drains themselves caused water pollution. The water quality inside the IWS area was heavily affected through agricultural activities. Chemical pollution from agriculture (reported by 65.2% farmers, n=120) is the main reason causing lower fish species composition inside IWS area."},{"index":2,"size":227,"text":"Survey results show that in freshwater ecosystem, the fishing production outside IWS area was four times higher than that of inside area. For brackish water ecosystem, the fishing production outside IWS area was almost two times higher than that of inside area. The study results also in agreement with Sinh et al. (2007) stated that the O Mon-Xa No irrigation system (in freshwater ecosystem) caused a decrease in yields of fishing at a rate of 9-10% annually. According to research results of Phu (2013) in An Giang province, the system of flood prevention dykes of the province was one of the reasons of natural fishery resources decline (80-90% reduction) compared to area without embankment. The decline of aquatic resources inside the IWS itself has affected income of fishing households, as they had to move further to catch fish. Households stated that natural aquatic resources reduced 50-60% in comparison to five years ago. The decline of aquatic resources directly affected the livelihood of fishing households, especially poor households. According to Sinh et al. (2007) when the fishing production dropped, the fishermen (especially poor households mainly living by fishing activity) would prolong fishing period, or buy more different fishing gears, or use destructive fishing gears (electromagnetic pulse, chemical, smaller mesh size catching nets) in order to increase the fishing quantity. This has caused great pressure on natural aquatic resources."},{"index":3,"size":161,"text":"Weather is also an important element toward natural aquatic resources which directly affects the livelihood of fishing households. Results show that 75.8% of fishing households in freshwater ecosystem and 86.7% of households in brackish water ecosystem believed that the weather in recent years was not favorable for fishing activities in the area. For example, farmers reported that more frequent storms, higher periods of saline intrusion, and unexpected drought and floods. Natural disasters caused negative effects on agricultural production and ISSN 2250-3153 www.ijsrp.org rural livelihoods (Birkmann et al., 2012;Dung et al., 2012;Tuan, 2014). Prediction on climate change were reported as sea level would rise by 1 meter in the next 50 years, while 43% MKD area would be submerged in seawater (Carew-Reid, 2007) and the MKD has been become one of the hardest affected areas due to the climate change (Wassmann et al., 2004;Dagupta et al., 2007). These changes and predictions of natural hazards potentially affected development policy on aquatic resource management."}]},{"head":"Impact of IWS on human capital","index":7,"paragraphs":[{"index":1,"size":298,"text":"In the freshwater ecosystem, the number of male employees participating in fishing inside IWS area was more than that of outside IWS area (1.3 versus 1.2 persons, respectively), while the number of female workers engaged in fishing was the same both inside and outside of the IWS area. For brackish water ecosystem, both the number of male workers and female workers participating in fishing activities were the same both inside and outside IWS area (Table 3). Average age of fishermen in both ecosystems was above 40. With this average age, most of them have to work to support their families. So the employment selection to stabilize livelihoods becomes important. Most of the fishermen in both ecosystems had education level of primary and secondary school, while few fishermen had high school and higher education level (college and bachelor degree). Illiteracy rate in brackish ecosystem (14.2%) was higher than that of the freshwater ecosystem (5.9%). In particular, the illiteracy rate in the surveyed households outside IWS area was higher than that of inside in both ecosystems. The main reason was that the majority of fishermen (above 40 years old) went through the war and did not have opportunity to go to school. When socio-economic conditions of the province began to improve (especially areas inside the IWS was invested well in terms of infrastructure, electricity, roads, and schools), many rural families have invested in education for their children. Education level of young workers has been raised. However, the majority of young workers preferred non-agricultural careers or worked in industrial zones in urban, peri-urban areas and big cities. This circumstance led to the present situation in rural areas that only permanent labor force beyond age of 40 and illiteracy rate outside IWS area was higher than that of the inside IWS area."},{"index":2,"size":68,"text":"Survey result also shows that the majority of fishermen understood rules relating to activities of aquatic resources protection and management of the provinces. However, there were 25-30% of households still did not know anything about these regulations (Table 4). Therefore, there are urgent needs on training on the fishery regulations for fishermen in the regions focused on appropriate fishing gear, mesh size net, fishing ground and fishing seasons."},{"index":3,"size":215,"text":"Currently, the many types of fishing gears are used for fishing in different water bodies that enhanced fishing production. Fishing gears were very diverse and plentiful; many fishing gears with smaller mesh sizes can catch most fish species. However, some of the water bodies such as canals and fields have been closed by dikes in both ecosystems, thus, fishermen need to move to another place for fishing. The survey shows that the production of natural aquatic resources in the study area has diminished substantially compared to previous years (described bove). In brackish water ecosystem, 64% of households said that depletion of aquatic resources caused by the use of destructive fishing gears; following by fishing of juveniles or broodstocks in spawning season (50%); the increase in number of fishermen (42%); and about 13-25% of households said that IWS prevented migratory routes of fish and shrimp, polluted water environment that affected life of aquatic species (Table 5). In freshwater ecosystem, 36.9% of households reported that fish production declined due to low floodwater level; followed by using destructive fishing gears (35.1%); fishing for aquaculture (snakehead); especially 28.8% of households said that the reason of aquatic resources decline was prevention of fish migration by IWS, and the increased fishing of juveniles and broodstocks in their breeding season (Table 5)."},{"index":4,"size":88,"text":"Under the impact of IWS on declined production of natural aquatic resources, to adapt to those situations, fishermen stated that changing job and effective rearrangement family labor would be a better choice for stabilizing their livelihood. However, results showed that the majority of fishing households only arranged family labors into specific tasks in fishing activities rather than participate into other livelihood activities. Most of fishermen were in charge of activities related to natural fishing (above 90%). All decisions in consumption of fishing products were agreed mainly by women."},{"index":5,"size":142,"text":"Analytical results on adaptability of community under the depletion of aquatic resources showed that fishing households (31.7%) will choose to become paid workers as they don't have land for farming and currently live in poverty. Other households (22.0%) would like to change to aquaculture to increase income due to owning less land for production. In addition, fishermen would like to choose some other occupations such as small business (19.0%), livestock and poultry (12.2%), crop cultivation (paddy and vegetables) (12.2%), workers in the industrial zone (4.9%) (Table 6). Overall, the majority of fishing households have expected to earn more when changing current job. In short, human capital becomes an important factor in selection of household livelihoods. The impact of IWS on aquatic resources may directly affect the fishermen labor force, leads to changes in human capital to adapt to the new economic circumstances."}]},{"head":"Impact of IWS on social capital","index":8,"paragraphs":[{"index":1,"size":173,"text":"Survey results shows that fishing community in freshwater ecosystem was mainly Kinh people (92.5%). Khmer people shared low percentage (7.5%), living primarily outside IWS. In the brackish ecosystem, most of respondents (99.2%) were Kinh people living both inside and outside IWS and the remaining was Khmer who live inside IWS area. According to De and Be (2005) Khmer people in the Mekong Delta heavily relied on agriculture activities following their own experience and it was difficult for them to adapt to the new technique application. Regarding to religion, the fishing community living in freshwater ecosystems had no religious affiliation accounted for the highest proportion (69.7%). Others followed Buddhism (24.4%), Catholics (3.4%) and Hoa Hao (2.5%). In brackish water ecosystem, the rate of fishing community ISSN 2250-3153 www.ijsrp.org without following religion up to 95%, the remaining was Buddhists (5%). There were no major differences regarding to religion between the communities living inside and outside IWS in both ecosystems. This means that following religions did not effect on livelihoods of fishing communities in both ecosystems."},{"index":2,"size":78,"text":"The results of PRA survey and interviews fishermen show that in freshwater ecosystem, only 9.3% of households inside IWS area and 17.8% households outside IWS area involved in local associations (association of Women, Farmer's organization, Veterans Association, Red Cross, etc.) whereas in brackish water ecosystem, the corresponding rates were 10.4% (inside) and 7.2% (outside). This suggested that fishing community was limited in accessing information through the mass local organizations to apply scientific and technological achievements into households' production."},{"index":3,"size":257,"text":"Results of PRA analysis on the relationship between fishing community and organizations and local unions in freshwater ecosystem show that scientists, the ward's people committee and the farmers' organization and agricultural extension service are most common organizations closed to economic activities of households. Other organizations such as agricultural enterprise, Bank, Youth Union and Veterans have not involved and associated to livelihood communities. In brackish water ecosystem, the scientists, veterans, retired people living in the local area have became pioneers in implementation and dissemination activities and new regulations to the community. They acted as transmission of indigenous knowledge, encourage people abide the law and integrate into society. Currently, the fishermen in the research area lacked the information on commodity prices and markets. This led to obstacles in selling products with the appropriate price, normally lower price by private traders. Therefore, it is essential to establish fishing association in order to access easily the scientific and technical information, access to capital for production as well as recommend solutions in the operation and regulation of water through IWS in order to enhance production and to stablize livelihoods. Tuan and Dung (2015) reported that local associations played an important role in sharing knowledge between agriculture communities. The changes in the natural conditions and socio-economic characteristics such as dikes construction in flood-prone areas, freshening projects in coastal areas, depletion of natural resources, policies of agricultural and rural development, agricultural product price volatility have caused both positive and negative effects on farmers in developing and implementing livelihood strategies to achieve livelihood outcomes expected."}]},{"head":"Impacts on financial capital","index":9,"paragraphs":[{"index":1,"size":255,"text":"In the freshwater ecosystem, the investment costs for annual fishing was very low (1.4 million VND/year) with an average income of 13.3 million VND/year and profit of 11.8 million VND/year. Therefore, after deducting living expenses, the annual saving amount of fishermen was very low. In brackish water ecosystem, the investment costs for natural fishing activities was 1.4 million VND/year, with an average income of 17.7 million VND/year and profit of 16.3 million VND/year (Table 7). With this profit, fishing communities in both ecosystems had a very low annual accumulate income. This issue shows that the fishing community in both ecosystems in the studied areas faced many difficulties about capital for reinvestment in fishing or for investment into other activities to diversify livelihoods or for investment to expand production scale toward efficiently productive activities. Therefore, the fishermen should be supported in capital access to maintain fishing operations and there is a need for training on how to use capital efficiently for fishing community. The survey results show that the majority of fishermen in the community had no demand for loans, although the poverty rate in the study area was relative high. Phu (2013) suggested increasing capital access to fishermen who like to convert their fishing activities into other business. In the context of the impact of IWS on community livelihoods, the ability of investment into activities aimed to diversify income sources served their livelihoods was essential. Therefore, the investment in production equipment of the community currently needed financial support from the Government and non governmental organizations."}]},{"head":"Impact of IWS on physical capital","index":10,"paragraphs":[{"index":1,"size":190,"text":"Physical capital in this study was divided into two groups consisting of household's assets and infrastructure in the community (outside of the household). Survey results show that the most important physical capital of fishermen was fishing gears to serve household livelihoods. Fishing gears were different between professional fishing households (with income from fishing occupied higher than 50% of total income per year of the household income) and the seasonal fishing households. Net, trap, mud chain, trawl and fishing rods (gill net, tube trap for eels, mud chain, trawl net, and hook and line) were five main types of fishing gears of the professional fishing households. Meanwhile, besides net, trap and mud chain, fishermen also used long fence trap net and trap net as two other kinds of fishing gears which were used by many seasonal fishing households. Some fishing gears (tree branches or lift net) tended to decrease in number due to ineffective fishing and regulations on aquatic resource protection and regulations in river transportation. Particularly, snail's trawl net should be recommended for use to reduce the damage of yellow snails and increase the amount of natural food for aquaculture."},{"index":2,"size":439,"text":"For freshwater ecosystem, 69.2% of fishing households used only one fishing gear. Households used two fishing gears shared only 27.5% of total surveyed households and only 3.3% of households owned three gears. In the brackish ecosystem, there was 89.2% of fishing households used one type of fishing gear, 10.8% of households owning two fishing gears and no households owning three or more gears. Comparision between the inside and outside of IWS area, the percentages of households owning one fishing gears in outside area were higher than that of inside IWS area at both ecosystems (71.7% and 66.7 % in freshwater ecosystem and 90% and 88.3%, respectively in brackish water ecosystem). However, the proportions of households using two or three fishing gears in freshwater ecosystem were higher than that of in brackish water ecosystem. It means that fishing effort on freshwater ecosystem was higher than in brackish water ecosystem. ISSN 2250-3153 www.ijsrp.org According to the People's Committee of Can Tho city (2013), land resources in freshwater ecosystem included two main groups: alluvial soil (84%) and alkaline soil (16%). Land composed rich humus and nitrogen, medium of phosphorus and potassium level, with little or no toxicity, was favorable for rice and fruit cultivation. However, some limitations are found in the study area: (i) area affected by annual flood in which 25% of land was deeply flooded, especially at the end of the flood season that directly impacts on agricultural production, infrastructure, residents and urban areas; (ii) the degree of separation by infield rivers and canals was rather large, poor geological characteristics of works, negative impact on building the infrastructure and roadways; (iii) biological resources were declined, surface water in rural areas and urban areas tended to be polluted. In brackish water ecosystem, most agricultural land inside the IWS was saline, especially in the dry season; saline water season was more predominant than freshwater season. The rainy season was flooded partly by rainwater so that it was suitable for farming model of riceshrimp or rice-fish integration. However, during cultivation, there is a need to complete works of saline-fresh water zoning, activeness in preventing and providing saline water and freshwater to minimize damage caused by shortage of saline or freshwater in different farming time. Meanwhile, outside the IWS area, it was mostly salinization alluvial soil, unsuitable for growing rice and orchards. It was only suitable for aquaculture (Vietnamese Ministry of Agriculture and Rural Development, 2006). The biggest difficulty of the research area was the lack of freshwater for agriculture production. Main water source from the Bac Lieu-Ca Mau canal was severely polluted (Department of Agriculture and Rural Development of Bac Lieu province, 2012)."}]},{"head":"Livelihood strategies for fishing community","index":11,"paragraphs":[{"index":1,"size":89,"text":"Based on the results of the analysis on the livelihood capitals of fishermen above, livelihood strategies of fishing households in freshwater ecosystem and brackish water ecosystem were presented in Table 8 and Table 9. To adapt to the depletion of natural aquatic resources caused by IWS, fishing households have to use livelihood assets themselves to build or adjust adapted livelihood strategies. Fishermen would implement that process in the context of impacts of vulnerable context in accompany to affect by formal regulations and informal social ties (Chambers and Conway, 1992)."},{"index":2,"size":114,"text":"Adaptation strategies of farmers in developing countries with extremist phenomena of climate and fluctuations of socioeconomic included intensive and diversified livelihoods or immigrant the labors (Paavola, 2008). Diversification of agricultural livelihoods is a process that the households increase activities which generate the income and capabilities to support the society in order to maintain their lives (Carswell, 2007). Livelihood strategies of households in each ecological sub-area were not only affected by ability to access to livelihood capitals of households but also due to factors related to pedology, access to water resources, markets, production experience. During implementing livelihood strategies, farmers would face with different influential factors; the livelihood results of each household would have certain differences."},{"index":3,"size":37,"text":"Therefore, the identification of factors affecting to fishermen' livelihoods was essential because it would be intervention points in terms of technique and policies to increase appropriate livelihood strategies and to minimize the failure in developing household livelihoods."}]},{"head":"IV. CONCLUSION AND RECOMMENDATIONS","index":12,"paragraphs":[]},{"head":"Conclusion","index":13,"paragraphs":[{"index":1,"size":235,"text":"The highly construction inside the IWS area caused lower fish species composition and fishing production in both ecosystems. Within five types of capitals in livelihood framework of the community, the human resources, natural resources and physical capital played very important roles in fishing community. Human capital was the most important factor in livelihood strategies of fishing community in the study area. In particular, investment in education and career training to improve opportunities to access employment for the community become necessary. The situation of uneven distribution among livelihood capitals in the framework was factor affecting to economic development and social justice of the community in the research area IWS has brought positive effects on the development of socio-economic and improvement of rural landscape of the study area. However, there are some limitations due to many objective and subjective reasons. For examples, operational process of IWS to regulate water for production has been unsuitable, has caused partly flooding in the rainy season in some areas. In addition, lack of water for agriculture in the dry season, increase the cost for pumping water for production are mainly caused by IWS. IWS for salinization prevention in some areas have not yet been completed, causing saltwater leaking into the freshening areas, while saline preventing schedule and freshwater keeping has not really suitable for actual demand of rice production, fruits and aquaculture in each period and different locations throughout the year."}]},{"head":"Recommendations","index":14,"paragraphs":[{"index":1,"size":82,"text":"To address the problem of water supply for production, there should have a common plan of water regulation for the province or the entire region in each specific month (Establishing water regulation committee of the province/interprovince) to comprehensive coordinate in taking water and drainage. Synchronous arrangement should be made on schedule of cultivation and water regulation in each area and ample notice to the public through the mass media and government at all levels (15 day cycle with a water regulation schedule)."},{"index":2,"size":30,"text":"Policy on water resource use should be based on specific purpose of use such as agriculture or aquaculture in the region which is regulated in the proper way under IWS."},{"index":3,"size":24,"text":"Construction of IWS serve for aquaculture and fisheries should be taken into account with detailed appropriated research plan for brackish water ecosystem in CMP."},{"index":4,"size":37,"text":"Also, there is a need on improving all livelihood capitals of household and community, building up modeling on water resource and fisheries management following ecopath approach and sustainability development. It is encouraging for artificial ISSN 2250-3153 www.ijsrp.org  "}]}],"figures":[{"text":"Table 3 : Some indicators of human capital of fishing households  Unit: people/household Unit: people/household  "},{"text":"Table 4 : Knowledge on aquatic resources protection regulations  Unit: % Unit: %  "},{"text":"Table 5 : The causes of the natural aquatic resources depletion reported by fishermen  Unit: % Unit: %  "},{"text":"Table 6 : Occupation adaptability by genders when aquatic resources decline  Unit: % Unit: %  "}],"sieverID":"84560177-b49d-485f-ae72-453748ca2a33","abstract":"Ca Mau Peninsula (CMP) locates in Mekong Delta, Vietnam is a conflict area in the use of freshwater and brackish water due to existing of both types of ecosystems. The irrigation works systems (IWS) in CMP were planned and constructed to serve local communities' economic development. The aims of this study are to investigate the impact of irrigation works on livelihoods of fishing community in Ca Mau Peninsula, Viet Nam. The study was conducted in six communes in five districts in the two provinces, Can Tho City (freshwater ecosystem) and Bac Lieu province (brackish water ecosystem). Six Rapid Rural Appraisal (PRA) meetings were held, four meetings located in the affected area of IWS (120 households) and two adjacent areas, which were not affected by IWS (120 households). Data on fish species compositions were collected three times a year. This paper argues that the highly construction inside IWS area caused lower fish species composition and lower fish production inside IWS area compared to outside IWS area in both freshwater and brackish water ecosystems. Limited households inside IWS area (9.3%) and outside IWS area (17.8%) involved in local associations fishing community in both ecosystems and they mostly had a very low annual accumulate income. Net, trap, mud chain, trawl and fishing rods were five main types of fishing gears of the professional fishing households. Survey result also shows that the majority of fishermen understood rules relating to activities of aquatic resources protection and management of the provinces though 25-30% of households still did not know anything about these regulations. Overall results revealed an impact of IWS on livelihoods of fishing community such as human resources, natural resources and physical capital. Therefore, there are urgent needs on training on the fishery regulations for fishermen in the regions focused on appropriate fishing gear, mesh size net, fishing ground and fishing seasons. In particular, investment in education and career training to improve opportunities to access employment for the community become necessary."}