abstract
stringlengths 73
3.51k
| description
stringlengths 1.1k
417k
| application_number
stringlengths 8
17
|
|---|---|---|
a helmet is disclosed with a detachable shield that completely envelopes or partially envelopes the helmet . this protective shield is replaceable and removable . when a helmet is scratched or worn , the protective shield may be replaced by a user . the protective shield may also be used to change the color or appearance of a helmet , as well as to alter the strength of the helmet . | reference throughout this specification to “ one embodiment ,” “ an embodiment ,” or similar language means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention . thus , appearances of the phrases “ in one embodiment ,” “ in an embodiment ,” and similar language throughout this specification may , but do not necessarily , all refer to the same embodiment . furthermore , the described features , structures , or characteristics of the invention may be combined in any suitable manner in one or more embodiments . in the following description , numerous specific details are provided to provide a thorough understanding of embodiments of the invention . one skilled in the relevant art will recognize , however , that the invention may be practiced without one or more of the specific details , or with other methods , components , materials , and so forth . in other instances , well - known structures , materials , or operations are not shown or described in detail to avoid obscuring aspects of the invention . fig1 a is a side elevational perspective view of a helmet 100 and detached protective shield in accordance with the present invention . the helmet 100 comprises a helmet 102 , a helmet shield 104 , a cantilevered lip 106 , and an inner surface 108 . the helmet is well - known to those of skill in the art , and generally comprises a bulbous polymeric shell which surrounds and protects a user &# 39 ; s head . the helmet 102 differs from traditional helmets in that , inter alia , it has a recessed outer surface for receiving the helmet shield 104 ( or protective shield 104 ), and may comprise means for detachably connecting , adhering , or fastening the helmet shield 104 to the helmet 102 . those means may include screws , velcro , adhesive , magnets , snaps , or the cantilevered lip 106 as shown . the cantilevered lip 106 comprises an alloy or polymeric ridge which juts roughly orthogonally inward from the inner surface of the helmet shield 104 . this cantilevered lip 106 engages a corresponding edge of the helmet 102 , thus securing the helmet shield 104 to the helmet 102 . in the shown embodiment , the helmet shield 104 comprises a rubber , polymeric or elastomeric shell which surrounds or partially surrounds or envelopes the helmet 102 . this helmet shield 104 may be translucent or colored . it may bear logos or distinctive identifiers for associating a wearer / user with a particular team or organization . it may bear aesthetic markings for color - coordinating the helmet 100 with a user &# 39 ; s outerwear . fig1 b is a upper elevational perspective view of a helmet 120 with attached protective shield in accordance with the present invention . the helmet 120 comprises a helmet 102 and a helmet shield 104 . the shown embodiment 120 represents the helmet 100 in its assembled , or attached , configuration , with the helmet shield 104 detachably affixed to the helmet 102 . fig2 a is a side perspective view of another embodiment of a helmet 200 in accordance with the present invention . the helmet 200 comprises a surface 108 , snaps 202 a - c , a screw 204 , a recessed groove 206 , a protrusion 208 , and an edge 210 . the exterior surface 108 of the helmet 102 in the shown embodiment comprises a groove running , or defines a recess , running laterally around the perimeter of the helmet 102 for receiving a corresponding lip , protrusion or contour on the inner surface of the protective shield 104 . the helmet 102 comprises snaps 202 a - c , which in the shown embodiment , comprise male snap members for engaging corresponding female snap members on the protective shield 104 . the screw 204 is insertably affixed into a bore hole in the helmet 102 . the helmet 102 may comprise a plurality of bore holes or screw holes and screws 204 for securing the protective shield 104 to the helmet 102 . the edge 210 of the helmet 102 is engaged by the cantilevered lip of the protective shield 104 . additionally or alternatively , the helmet 102 may comprise one or more protrusions 208 which jut outward from the convex surface of the helmet 102 and extrude into a recess on the inner surface of the protective shield , thus preventing forward , rear , and lateral slippage of the protective shield 104 in its affixed configuration . the helmet 102 may also comprise one or more magnets or iron plates for attracting corresponding magnets affixed to or within the protective shield 104 . the protrusion 208 may comprise a velcro pad , a magnet , or polymeric protrusion forming part of an integrated piece with the helmet 102 . the recessed groove 206 may also serve to secure and stabilize the stretched elastic band of ski goggles , lights , or other items with straps stretched over the helmet 102 . fig2 b is a rear perspective view of a protective shield 220 for a helmet in accordance with the present invention . the protective shield 220 comprises an aperture 222 , a snap 224 , a magnet 226 , and a recess 228 . the protective shield 220 may comprise one or more magnets 226 for engaging corresponding magnets , metals or alloys on the helmet 102 . the protective shield may also define or comprise holes for receiving a screw 204 traversing the protective shield 200 . the protective shield 104 may also comprise male or female snap members 224 , as well as one or more recesses for receiving corresponding protrusions 208 . fig3 a is a side perspective view of a helmet 300 in accordance with the present invention . the helmet 300 comprises a helmet 102 and snaps 202 a - c , and visor 304 . the helmet 300 may comprise a visor 304 which extending in cantilevered fashion forward of the helmet 102 . fig3 b is a side perspective view of a helmet 320 and detached protective shield in accordance with the present invention . the helmet 320 comprises a helmet 102 , a protective shield 104 , a visor 304 , and a liner 322 . as shown , the helmet shield 104 may vary in its shape , purpose and dimensions . it may also circumscribe , or envelope , only a portion of the helmet 102 . in the shown embodiment , the helmet shield 104 comprises the visor 304 , and the helmet 320 is a dirt - biking helmet . the helmet 320 may be a motorcycling helmet , a hardhat , a skiing helmet , riot gear helmet , football helmet , or the like . in the shown embodiment , the helmet shield 104 snaps to the helmet 102 . some embodiments of the present invention comprise a liner 322 , which comprises a thin film of elastomeric , silicone or polymeric material laid between the helmet shield 104 and the helmet 102 . the liner 322 may be affixed to the helmet 102 or the helmet shield 104 . the liner 322 protects the helmet 102 from wear imposed by the helmet shield 104 . in some embodiments , the liner 322 defines holes , apertures or passageways for accommodating screws 204 and the like . the liner 322 may be from 0 . 1 millimeters to 2 centimeters in thickness . in some embodiments , the liner 322 adds additional padding and impact protection to the helmet . fig4 is a forward elevational perspective view of a helmet 400 and detached protective shield in accordance with the present invention . the helmet 400 comprises a helmet 102 , a helmet shield 104 , a screw 204 , and a protrusion 208 . the helmet 400 comprises a ski helmet . the protective shield 104 affixes over the top of the helmet 102 , and is screwed in place . in some embodiments , the helmet 320 comprises a plurality of protective shields 104 which may be interchangeable affixed to the helmet 102 . in various embodiments , these protective shield ( s ) 104 differ in thickness , rigidity , and strength such that a user may customize the strength of the helmet 320 to suit particularized needs . in some embodiments , a plurality of protective shields 104 may be affixed on top of one another , in stackable fashion , to give a user even more control over strength and helmet 320 rigidity . fig5 is a side perspective view of a helmet 500 and detached protective shield in accordance with the present invention . the helmet 500 comprises a helmet 102 , a helmet shield 104 , and a goggle strap 502 . the helmet shield 104 may itself comprise a plurality of detachable implements , such a handle 502 . the goggle strap 502 in the shown embodiment is polymeric and flexible . the goggle strap 502 is detachably affixed to the helmet 102 using screws , snaps , buttons , buckles , or other fasteners known to those of skill in the art . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope . | US-201213530122-A |
wire , or other material , is wrapped around a shaft as the shaft turns , producing a coil . after being slid off the end of the shaft , the coil can be re - coiled by repeating the process . by shaping the twice - coiled material , a variety of pleasing jewelry beads may be formed . a variety of jigs useful for performing process are disclosed . one jig is easily and inexpensively manufactured from a unitary length of small rod , bent to provide a wrapping shaft , a feature for securing a free wire end ; and an actuator handle . the novel principles can be implemented in many different embodiments . | referring to fig1 a first embodiment of the present invention includes a chuck 10 , a hollow tube 12 , a stop collar 14 ( with associated set screw - not shown ), a nylon washer 16 , and a crank 18 . the jig is built around a main bar 20 , which in the illustrated example is fashioned from a 1 ″× 1 ″ aluminum block . the illustrated chuck 10 has a plurality of radially movable members 21 therein ( fig1 a , 1 b ), permitting gripping of a member inserted into the throat thereof . this chuck is of a type wherein the throat ( bore ) extends all the way through the chuck . female threads on the inside of this bore permit mounting of the chuck into threads cut onto the outside of the hollow tube 12 . the bar 20 is drilled to permit passage of the hollow tube 12 therethrough and rotation of the tube therein . the tube 12 is secured in place relative to the bar by the stop collar 14 on one side , and the crank ( which mounted on the outside of tube 12 ) on the other . an oil hole 22 permits lubrication of the tube 12 where it passes through the bar . by this arrangement , when the crank 18 is turned , the tube 12 turns and , with it , chuck 10 . the jig is secured in place by a c - clamp 24 or the like , which fastens the jig to a work surface ( not shown ). as summarized above , a first (“ inner ”) wire 17 ( fig5 ) is positioned in the throat of the chuck 10 , and the radially movable chuck members are tightened thereon . the distal end of a second (“ outer ”) wire 19 is secured to the chuck , e . g . by insertion into the small gap between two of the chuck &# 39 ; s radially movable members 21 . by this arrangement , the distal end of the outer wire turns with the chuck . with the wires thus arranged , the chuck is then rotated . as the inner wire is rotated , the operator trains the second wire othogonally thereagainst and ( slowly ) laterally therealong , thereby yielding a length of coiled stock 23 ( fig5 ) with the inner wire 17 extending therethrough . after a length of coil has thus been produced , the chuck is opened and the first wire , with the second wire now coiled thereabout , is inserted into the throat of the chuck ( and , therethrough , into the hollow tube 12 ), and the chuck is then tightened onto the coiled second wire . the operator then resumes training the second wire against the rotating first wire , extending the length of the coil earlier formed . by alternately coiling wire , and then moving and regripping the coil thus formed in the chuck ( so that the coil eventually extends through the chuck and into the hollow tube 12 ), coiled stock of arbitrary length is quickly and simply produced . such a coil is shown in fig5 . many crafts make direct use of the coil thus produced , without further use of the coiling jig . some crafts , however , do make further use of the jig . an example is a coiled bead 25 of the type shown in fig6 c . to make the coiled bead 25 of fig6 c , the user first produces about eight to ten inches of coiled stock , e . g . of the sort 23 illustrated in fig5 . this stock is then re - coiled — typically over a larger center member . fig6 a shows this process of recoiling over a metal rod 99 . ( other larger center members , including non - cylindrical shapes , can of course be used .) the shape of the bead is then adjusted , as necessary , by pliers to result in the bead shape shown in fig6 b . finally , the two ends of the center wire extending from the coiled stock are fashioned , by pliers , into coupling loops 97 ( fig6 c ). one way to effect the recoiling is shown in fig1 a . in this arrangement , a dowel 30 ( or metal rod or the like ) is secured in the jaws of the chuck 10 . the exposed end 32 of the dowel has a slot cut therein . the inner wire 17 protruding from the end of the 8 - 10 ″ coiled stock formed earlier is positioned in the slot . the chuck is then turned , and the coiled stock is wrapped back along the dowel , towards the chuck . after all of the stock is recoiled , it is slid off the exposed end of the dowel 30 and finished as described above . another way to effect the recoiling is shown in fig1 b . in this arrangement , a dowel 30 is again secured in the jaws of the chuck . in this arrangement , however , the inner wire 17 protruding from the end of the 8 - 10 ″ coiled stock 23 is inserted between the movable jaw members 21 of the chuck — off the axis of the dowel ( in the same manner as the outer wire was earlier secured to the chuck when the coiled stock was first formed ). again , the operation proceeds by turning the chuck , and recoiling the stock on the dowel — this time progressing away from the chuck . after the stock is recoiled , it is slid off the exposed end of the dowel and finished as described above . in other methods , instead of re - coiling the stock over a removable form ( such as a dowel ), the stock can be re - coiled over an article that is thereafter left in place to form part of the finished bead . in such an arrangement , this component article can be secured within the throat of the chuck , and the chuck ( and article ) rotated to permit the wrapping of the coiled stock therearound . the selection of wire size and type depends on artistic and structural considerations . an exemplary implementation uses 20 gauge copper wire for the inner wire 17 , and 22 gauge sterling silver wire for the outer wire 19 . wire sizes ranging from at least 16 to 26 gauge can be used , and others may be possible as well . usually a larger wire is used for the inner wire , but sometimes it is desirable to use the same sized wire for both , or use a larger wire on the outside . while the fig1 embodiment was described as employing a c - clamp to secure same to a work surface , a generally more desirable clamping arrangement is shown in fig2 . in this figure the apparatus includes the main bar 20 and a chuck 10 , as described above . ( additionally , this figure shows a take - up spool 62 , more particularly described in connection with the fig3 embodiment , below .) the clamping arrangement includes a clamp bar 42 , and first and second threaded bolts 44 , 46 — each with gripping handles 48 , 50 on the head thereof . the first bolt 44 first passes through an unthreaded bore 52 in the main bar 20 , and then threads into female threads 54 that pass through the clamp bar 42 . the second bolt 46 first passes through female threads 56 , and thence into an unthreaded seat 58 in the main bar 20 . in use , the work surface ( e . g . a table top ) is positioned in the gap 60 between the main bar 20 , the clamp bar 42 , and the first bolt 44 . the gripping handle 48 of the first bolt is then turned to bring the facing surfaces of the two bars 20 , 42 into engagement with opposing surfaces of the table top . next , the gripping handle 50 of the second bolt 46 is turned to urge the two bars apart in the vicinity of the second bolt . this has the effect of urging the two bars together on the opposite side of the first bolt 44 , snugging the bars into tighter engagement with the table top . this lever action of clamping bar 42 about bolt 44 affixes the coiling apparatus more securely to a table top than can be achieved with the c - clamp approach of fig1 . fig3 shows a second embodiment of a coiling apparatus . like the embodiment of fig1 the fig3 embodiment includes a chuck 10 , a hollow tube 12 , a stop collar 14 , a nylon washer , and a crank 18 , all built about a main bar 20 . additionally included in the fig3 embodiment are a take - up spool 62 , a brake assembly 64 , and a plurality of “ outriggers ”. the take - up spool 62 ( formed of circular metal spoked wheels 66 and 68 mounted on the outside of the hollow tube 12 ) is used to collect finished coiled stock that has extended 30 out of the hollow tube near the crank 18 , and which would otherwise droop down and possibly torque as rotation of the hollow tube continued . after the first six inches — or so — of coiled stock is produced , the stock protruding out the crank end of the hollow tube 12 is wrapped around the spool 62 each time more coiled stock is passed through the bore of the chuck 10 . the brake assembly 64 includes a movable member that prevents undesired rotation of the chuck 10 . in the illustrated embodiment , this movable member takes the form of a pin slidably mounted in a bore through main bar 20 . this pin can be selectively extended through the bar and into mechanical engagement with spokes 72 of wheel 66 of the takeup spool 62 . when the pin is thus extended , the disk 66 , and thus the chuck 10 , are prevented from rotating . locking the chuck in this fashion greatly facilitates the loosening and tightening of the chuck jaws , operations which are performed repeatedly in the above - described method of operation . for example , with the pin extended to its “ lock ” position , the chuck can be both loosened and tightened with a single hand , allowing the operator &# 39 ; s other hand to be dedicated to other tasks . the outriggers 66 provide support of the first , central wire at locations remote from the chuck 10 , facilitating use of this embodiment with long lengths of wire . each outrigger 66 comprises a hollow shaft 74 affixed to the end of a bar 76 , the opposite end of which is clamped to a work surface by , e . g ., a c clamp 78 . fig4 shows a third , “ loom ” embodiment of the coiling apparatus . like the foregoing embodiment , this embodiment includes a chuck 10 , a hollow shaft 12 , and a take - up spool 62 . ( in this embodiment , the take up spool is oriented with its axis transverse of the hollow shaft 12 — an arrangement that can likewise be employed in the fig3 embodiment .) new in fig4 is a second chuck 80 , a second hollow tube 82 , an inner wire supply reel 84 , a frame 86 , a drive shaft 88 , a crank 90 , and a pair of drive chains 92 , each with associated sprockets 94 , 96 . drive shaft 88 is journaled at its two ends in the frame 86 . the crank 90 is mounted to an end of the drive shaft that extends slightly beyond the frame . mounted on the drive shaft 88 are two sprockets 94 , through which drive power is applied to the first and second hollow tubes 12 , 82 through the chains 92 and hollow tube sprockets 96 . the first and second hollow tubes 12 , 82 , are also each journal led in the frame , and extend out therefrom to support the inner wire supply reel 84 and the take up spool 62 , respectively . in operation , an inner wire is first extended from reel 84 , through hollow tube 82 , through chuck 80 , across a reach and into chuck 10 . the two chucks are then tightened . a second , outer wire is secured to chuck 10 in the manner described above . crank 90 is then turned , causing the chucks ( 10 , 80 ), the hollow tubes ( 12 , 82 ), and the reel / spool ( 84 , 66 ) to rotate in tandem . as described above , the second wire is then trained around the inner wire , forming a coil that extends from chuck 10 towards chuck 80 . this coiling operation continues until the coil extends all the way across reach to chuck 80 . both chucks are then loosened , and the coiled stock just produced is moved to the right in the figure , through the throat of chuck 10 and into hollow tube 12 . any coiled stock extending out the right end of hollow tube 12 is wrapped around take up spool 62 . the chucks are then retightened ( chuck 80 is retightened on the inner wire alone ; chuck 10 is tightened on newly - coiled stock ), and the just - described wrapping operation is repeated . by use of this loom embodiment , arbitrarily long lengths of coiled stock can readily be formed at a fast pace . in all of the foregoing embodiments , the second wire is trained about the outside of the inner wire . the precise placement of this second wire during this training operation is accomplished — in the most rudimentary methods of the invention — by holding the second wire between the operator &# 39 ; s thumb and index finger , and letting it slip therethrough as it coils about the inner wire . this manual positioning of the second wire assures that the wraps of the second wire about the first are all adjacent ( assuming that this is what is desired ). another arrangement — still relying on manual positioning of the second wire as it wraps about the first — is to employ a ring clamp . ring clamps are well known to jewelers as simple lever - based devices for gripping a ring so that it may , e . g ., be securely held against a polishing wheel . in this method , the second wire is passed through the ring clamp , and the ring clamp is positioned as desired next to the inner wire to position the second wire as it coils therearound . ( the clamp is not fully tightened , so that the second wire can draw through the clamp to coil about the inner wire .) in more sophisticated embodiments ( e . g . a variant of the fig4 embodiment ), operator positioning of the second wire against the first can be obviated by a mechanism which automatically and continuously repositions the point along the inner wire at which the outer wire is trained thereagainst . in one such embodiment , the drive shaft 88 is threaded with a thread having the same pitch as the desired coil . a pinch clamp is then mounted on a nut that travels down the drive shaft as the shaft rotates , and the second wire is routed through the pinch clamp . as the clamp travels linearly down the threaded drive shaft , the point of application of the second wire against the first likewise progresses down the first wire , mechanically controlled by the geometry of the threads on the drive shaft . in most embodiments , a single outer wire is coiled about a single inner wire . but this need not be the case . interesting effects can be obtained by employing two or more wires for the “ inner ” wire . ( two wires will tend to lie side by side , creating coiled stock with a flat aspect . simple fixtures can be devised to hold plural wires flat within the jaws of the rotating chuck .) likewise it is sometimes desirable to coil two or more wires about an inner wire . a silver and a copper wire , side by side , for example , gives a pleasing visual effect . moreover , plural outer wires need not all be coiled in the same operation . for example , a relatively large wire can first be coiled about an inner wire . then , in a subsequent operation , a relatively smaller wire can be coiled thereon — between the wraps of the larger wire . having described and illustrated the features of my inventive work with reference to a variety of embodiments thereof , it should be apparent that these embodiments can be varied in arrangement and detail without departing from the general principles of my invention . for example , while i have described the fabrication of coiled stock useful in making articles of jewelry , it will be recognized that coiled materials have other craft uses as well . stock for baskets , ornaments , and sculpture are but a few examples . similarly , while i most commonly use wires of sterling silver and copper , it will be recognized that other types of wire , including gold , bronze , colored , etc ., can alternatively be used . likewise , while i have described the coiling of wire onto wire , it will be recognized that elongated component materials other than wire can alternatively be used . ( i sometimes find it desirable to coil wire onto string , for example . if string , or another limp medium , is used as the base onto which a material is coiled , it is helpful to provide means for holding the string taut . this is readily accomplished in the third embodiment by stretching the string taught between the two chucks . in other embodiments , the string may be kept taught between a single chuck and a fixed object to which the end of the string is attached through , e . g ., a swivel .) still further , it will be apparent to those skilled in the art that various of the mechanical components of the illustrated embodiments can be substituted with other components . the chuck , for example , may take the form of a clamp that holds the wire ( s ), etc ., in place with a set screw arrangement . similarly , the direct drive or chain drive systems can be replaced with ones employing gears ( including worm drive arrangements ). the stop collar 14 / washer 16 arrangement can be replaced with an oil - impregnated bushing that is press - fit into an oversize bore formed in the main bar 20 . myriad other arrangements can , of course , be employed — each providing its own advantages , in accordance with the particular application being addressed . to illustrate the range of embodiments according to the present invention , consider the winder arrangement 101 shown in fig7 . this embodiment includes a bracket frame 102 and a jig 104 . the bracket frame 102 has two vertical uprights 106 , 108 , connected by a base member 110 . as can be seen , the frame 102 can be formed simply by bending a strip of sheet metal with two right - angle bends . the jig has a main wire wrapping shaft 112 and a handle 114 intercoupled through members 116 and 118 . member 116 forms a receptacle , or eye 120 , through which wire can be passed , as detailed below . illustrated member 118 is perpendicular to shaft 112 . handle 114 is parallel to shaft 112 but offset therefrom . the illustrated jig is formed of round metal rod stock or stiff wire ( e . g ., 16 gauge ). in operation , the bracket frame 102 is screwed to a base ( e . g ., a board ) by a screw that passes through a hole in the base member 110 of the bracket . ( other known attachment means can naturally be used , including the illustrated c - clamp 122 , etc .) the user then takes the end of a wire and pushes it through the eye 120 of the jig and wraps it around a neck 124 of the eye or otherwise secures same . the shaft 112 is then inserted through holes 126 , 128 in the bracket uprights 106 , 108 , journalling the shaft for rotary motion . a right - handed user next holds the trailing portion of the wire against the shaft 112 — next to the eye 120 — with the thumb of the left hand , while operating the crank handle with the right hand in a circular motion to spin the shaft 112 around its own axis . as the shaft is rotated , the wire wraps around the shaft and is urged against the previous wrap ( s ) by the user &# 39 ; s left thumb . continued cranking yields a coil of wire around the shaft . when a coil of the desired length has been formed , the user cuts or otherwise frees the end of the wire from the eye , and slides the coil off the end 136 of the shaft . typically , the user then inserts a center wire through the axial bore of the just - removed coil to increase the structural integrity of the coil . by using a relatively small center wire , the coil is more pliable ; by using a relatively large center wire , the coil is more sturdy . while the coil so - produced is usable as — is in some applications , other applications re - coil the coil to yield , e . g ., the ornamental jewelry beads discussed above . to facilitate such re - coiling , the illustrated winder 101 has a second , larger jig ( e . g ., made of 8 gauge wire ), which passes through a second set of commensurately larger holes 126 a , 128 a in the bracket frame 102 . as before , the end of the coil ( or the wire extending from the bore thereof ) is passed through the eye 120 and secured in place . the free part of the coil ( or the protruding center wire , initially ) is urged against the ( larger ) shaft 112 by the user &# 39 ; s left thumb as the shaft is rotated by the user &# 39 ; s right hand . as the shaft is turned , the coil stock is wrapped there - around , yielding the re - coiled coil shown , e . g ., in fig6 a . again , when the re - coiling is completed , the end of the coil is freed from the eye 120 , and the re - coiled coil ( i . e ., bead ) is slid off the end of the shaft . it will be recognized that , as the shaft 112 spins around its axis , the eye 120 and the handle 114 similarly rotate about this axis . member 118 is rigidly coupled to the shaft 112 , and includes a first portion 140 extending in one direction away from the shaft , and a second portion 142 extending in a second , opposite direction away from the shaft . the handle 114 is affixed to the outermost - end of this second portion . while the illustrated eye 120 lies in the same plane as the shaft 112 ( with its eye defining an opening that faces in a direction orthogonal to the axis of the shaft ), it will be recognized that different arrangements can naturally be employed . for example , the same basic structure can be used , but with the eye rotated ninety degrees , so that the material defining the eye lies in a plane orthogonal to the shaft , and the eye &# 39 ; s opening faces in a direction parallel to the shaft &# 39 ; s axis . many entirely different arrangements for securing the wire &# 39 ; s free end can also be employed , as will be apparent to those skilled in the art . one such arrangement 144 is shown in fig8 and includes a wire attachment dimple 146 . while the just - described operation journalled the shaft in the bracket , this need not be the case . the jig 104 can instead be held in the user &# 39 ; s left hand , resting on the side of the user &# 39 ; s index finger , while the left thumb presses the wire against the shaft . the right hand , again , moves the handle in a circular motion to rotate the shaft and effect the wrapping . in view of the foregoing , it should be recognized that the arrangements described above illustrate but a few of the many forms my inventive work may take , and should not be understood as limiting the scope of my invention . rather , i claim as my invention all such embodiments as may fall within the scope and spirit of the following claims , and equivalents thereto . | US-30462099-A |
an exercise device is disclosed which is more effective and efficient than the traditional sit - up , but does not include the inherent negative side effects . moreover , the present invention is intuitive to use , will have increased efficiency , and can be used in a variety of ways . the exercise device is made of a plurality of components , including : a pair of tube housings , a plurality of compression mechanism , a plurality of height - adjustment mechanisms , a width - adjustment mechanism , and a plurality of grips . these components work in conjunction to form an abdominal exercise machine that is more safe and efficient than traditional abdominal exercises . | illustrative embodiments of the invention are described below . the following explanation provides specific details for a thorough understanding of and enabling description for these embodiments . one skilled in the art will understand that the invention may be practiced without such details . in other instances , well - known structures and functions have not been shown or described in detail to avoid unnecessarily obscuring the description of the embodiments . unless the context clearly requires otherwise , throughout the description and the claims , the words “ comprise ,” “ comprising ,” and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense ; that is to say , in the sense of “ including , but not limited to .” words using the singular or plural number also include the plural or singular number respectively . additionally , the words “ herein ,” “ above ,” “ below ” and words of similar import , when used in this application , shall refer to this application as a whole and not to any particular portions of this application . when the claims use the word “ or ” in reference to a list of two or more items , that word covers all of the following interpretations of the word : any of the items in the list , all of the items in the list and any combination of the items in the list . the present invention 10 comprises a pair of arcuate tube housings 20 releaseably connected with a width - adjustment mechanism 60 . the present invention 10 further comprises a plurality of compression mechanisms 30 , one at each end 21 of the tube housings 20 . the tube housings 20 are adapted to be placed between the chest and legs while the compression mechanisms 30 provide resistance during use . the compression mechanisms 30 are responsible for providing outward force during use . each compression mechanism 30 is mechanically attached at each tube housing end 21 , for a total of four compression mechanisms 30 . each compression mechanism 30 further comprises a compression spring 31 to provide the resistance needed for this outward force , and an end cap 32 to retain the spring 31 . more specifically , each spring 31 is contained within a recess 33 at each end 21 of the tube housings 20 , and an end cap 32 is mechanically attached each end 21 of the tube housings 20 to secure each spring 31 in place . in the preferred embodiment , the tube housing ends 21 are outwardly threaded , while the end caps 32 are inwardly threaded . each end cap 32 further comprises a plurality of protrusions to assist in gripping and rotating the end caps 32 . in the preferred embodiment , the spring 31 provides a fixed resistance . as such , the present invention 10 may be replaced with springs 31 of various resistances to provide a variety of workout intensities . springs 31 are replaced by completely removing the end caps 32 , releasing the springs 31 from the recesses 33 . for easily identifying resistance levels , each spring 31 will have a color for easily determining which spring provides which desired resistance . for example , a green spring may be used for a low resistance , a yellow spring for a medium resistance , and a red spring for a high resistance . in an alternative embodiment , a spring aperture is positioned on the compression mechanism 30 to easily identify the color of the spring 31 being used . in a further alternative embodiment , a gas spring is used as opposed to a compression spring 31 , wherein the gas spring is adapted to provide variable resistance when the gas pressure is increased or decreased . a plurality of height - adjustment mechanisms 40 are rotatably attached to each compression mechanism 30 . each height - adjustment mechanism 40 further comprises a plunger 41 that is mechanically attached to the end cap 32 through a plunger aperture . in the preferred embodiment , the plunger 41 is outwardly threaded , while the plunger aperture is inwardly threaded . the springs 31 will provide resistance directly against the plungers 41 . as such , the amount of resistance exerted by each height - adjustment mechanism 40 and plunger 41 will be determined by the resistance of the specific springs 31 within the compression mechanisms 30 in the device at the time of use . each height - adjustment mechanism 40 is adapted to adjust the overall height of the apparatus such that the plungers 41 rest on the body of the user comfortably . more specifically , the plungers 41 can be adjusted inward or outward from the compression mechanisms 30 to extend or contract the overall height of the device . this is accomplished by either unscrewing the plunger 41 from the end cap 32 , increasing its distance from the compression mechanism 30 , or screwing the plunger 41 into the end cap , decreasing its distance . furthermore , the plungers 41 can be completely removed upon fully unscrewing them from the end caps 32 . this permits the user to customize workouts by choosing to use less than all four of the compression mechanisms 30 at the same time . a plurality of height - adjustment apertures 43 are positioned along the plungers 41 , providing a visual aid when adjusting the height of the plungers 41 . here , the user will screw or unscrew each plunger 41 until the height - adjustment apertures 43 are consistent . in the preferred embodiment , the threading of the end cap 32 and plunger aperture operate such that an opposing direction is necessary to tighten or untighten each . in an alternative embodiment , tightening of the end caps 32 secures the plungers 41 in a fixed position , supporting the user &# 39 ; s weight during workouts . here , releasing the tension of the end caps 32 releases the plungers 41 for extending and contracting . the locking mechanism 50 comprises opposing release buttons 51 positioned on each compression mechanism 30 . the release buttons 51 are adapted to obstruct the movement of the compression mechanisms 30 , preventing any force from being exerted and consequently locking the plungers 41 in a fixed position . this is accomplished by engaging the release buttons 51 , which are mechanically attached to the compression mechanisms 30 , with a pair of opposing lock protrusions 52 fixedly attached to the tube housings 20 . when activated , the release buttons 51 will then prevent movement of the compression mechanisms 30 due to the attachment of the release buttons 51 to the opposing lock protrusions 52 . in an alternative embodiment , only a single release button 51 and lock protrusion 52 are used , while an aperture is provided in the absent release button 51 to view the spring 31 . in a further alternative embodiment , the locking mechanism 50 is also used to adjust the force exerted by the spring 31 . each plunger 41 is in mechanical communication with the springs 31 of the compression mechanisms 30 . as such , the user will apply bodily force against the plungers 41 in order to generate the resistance required during workouts . the plungers 41 further comprise pads 43 that provide support for the body parts in contact with the plungers 41 during use . furthermore , each pad 43 comprises a viscid texture which will add grip when forced upon the body of the user . in the preferred embodiment , the pads 43 are made of a soft material such as silicone , although foam or other suitable materials may be used . in an alternative embodiment , the pads 43 are adapted to freely rotate in 360 degrees in a single plane perpendicular to the direction of force exerted by the compression mechanisms 30 . in this embodiment , the present invention 10 is easily adjusted to the body of the user and provides additional safety and comfort due to the free - moving nature of the pads 43 . the width - adjustment mechanism 60 expands and contracts laterally to increase or decrease the distance between the tube housings 20 . this allows the user to customize the displacement between the tube housings 20 for better placement on the chest and legs . furthermore , the width - adjustment mechanism 60 can be contracted to minimize the size of the present invention 10 for storage purposes . the width - adjustment mechanism 60 comprises a pair of opposing cross braces 61 , a center support 62 , a pair of width - adjustment screws 63 , and a width - adjustment track 64 . the cross braces 61 are positioned around each tube housing 20 , and are secured together with the center support 62 . to activate the width - adjustment mechanism 60 , the width - adjustment screws 63 will be untightened , permitting the cross braces 61 and tube housings 20 to move along the width - adjustment track 64 and permitting expansion and contraction . the cross braces 61 are adapted to keep alignment within the width - adjustment tracks 64 so long as the width - adjustment screw 63 is not removed entirely . the width - adjustment mechanism 60 is further adapted to release the cross braces 61 from the center support 62 and the tube housings 20 from the width - adjustment mechanism 60 . this is accomplished by removing the width - adjustment screws 63 completely from the width - adjustment track 64 and opening the cross braces 61 in a jaw - like manner , thereby detaching the tube housings 20 from the width - adjustment mechanism 60 . as such , each tube housing 20 can be released and used individually for certain exercises that may require the use of only one the tube housing 20 at a time , or for storage purposes . the cross braces 61 are made of a durable material , while the center support 62 is made from a firm , yet flexible material adapted to provide a less - rigid structure . in other words , the center support 62 is adapted to be flexible and provide flexibility between the tube housings 20 for further adjustability between exercises and body types . each cross - brace 61 further comprises a protrusion at its hinge point , adapted to lock itself with the tube housings 20 , and a plurality of teeth adapted to grip the center support 62 when closed . therefore , the cross - members 61 will remain secure and in a perpendicular orientation at all times . in the preferred embodiment , the center support 62 can be adjusted in a 90 degree range (+ 45 °/− 45 °). a plurality of grips 70 are positioned at the center of the tube housings 20 . the grips 70 allow the user to grasp the tube housings 20 for positioning before use and to generate extra force during use . in the preferred embodiment , the grips 70 are positioned between the cross braces 61 and comprise a viscid material with a texturized surface for improved grip . alternatively , a gel - based substance , foam , or other comfortable , yet durable , material can be used . in an alternative embodiment , a pair of handles ( not shown ) are externally attached to the tube housings 20 and replace the grips 70 to allow the user to support the device and generate additional force . before use , the present invention 10 must be adjusted such that it will fit comfortably on the chest and legs of the user . first , the user must adjust the width of the tube housings 20 with the width - adjustment mechanism 60 . the user will adjust the width by unscrewing the width - adjustment screws 63 and extending or contracting the cross braces 61 and tube housings 20 along the width - adjustment track 64 . next , the user must adjust the height of the plungers 41 with the height - adjustment mechanism 40 . the user will adjust the plungers 41 by unscrewing or screwing them from the end cap 32 , thereby extending or contracting the plungers 41 until they rest comfortably on the chest and legs . lastly , the user must select the appropriate resistance level by replacing the springs 31 in the compression mechanisms 30 . resistance level is adjusted by removing the end caps 32 and exchanging the springs 31 within the recesses 33 with springs 31 having a desired resistance level . for advanced customization , the user may lock one or more plungers 41 by activating the locking mechanism 50 , preventing the corresponding plunger 41 from receiving outward force from the corresponding compression mechanism 30 . this can be advantageous for injured users who are only able to exercise specific parts of their body or for cross - body exercises . furthermore , the user may use a tube housing 20 individually by releasing the tube housing 20 from the width - adjustment mechanism 60 with the width - adjustment screw 63 . this is advantageous for isolating a muscle group during exercise . once the present invention 10 is adjusted to the specifications of the user , it is ready for use as an exercise aid . one example includes using the present invention 10 for abdominal exercises , performed while sitting in a chair , lying on a half - ball , or lying on a mat . first , the user will grasp the present invention 10 with the grips 70 and place the plungers 41 and pads 43 against their chest and legs . next , the user will bring their chest towards their legs , exerting force upon the compression mechanisms 30 . the compression mechanisms 30 will provide resistance to this motion by returning a force commensurate with the resistance level of the springs 31 . while this is an exemplary exercise , the adjustability and customization of the present invention 10 will provide many useful exercises and workouts for the user . the above detailed description of the embodiments of the invention is not intended to be exhaustive or to limit the invention to the precise form disclosed above or to the particular field of usage mentioned in this disclosure . while specific embodiments of , and examples for , the invention are described above for illustrative purposes , various equivalent modifications are possible within the scope of the invention , as those skilled in the relevant art will recognize . also , the teachings of the invention provided herein can be applied to other systems , not necessarily the system described above . the elements and acts of the various embodiments described above can be combined to provide further embodiments . changes can be made to the invention in light of the above “ detailed description .” while the above description details certain embodiments of the invention and describes the best mode contemplated , no matter how detailed the above appears in text , the invention can be practiced in many ways . therefore , implementation details may vary considerably while still being encompassed by the invention disclosed herein . as noted above , particular terminology used when describing certain features or aspects of the invention should not be taken to imply that the terminology is being redefined herein to be restricted to any specific characteristics , features , or aspects of the invention with which that terminology is associated . while certain aspects of the invention are presented below in certain claim forms , the inventor contemplates the various aspects of the invention in any number of claim forms . accordingly , the inventor reserves the right to add additional claims after filing the application to pursue such additional claim forms for other aspects of the invention . | US-201414183657-A |
a toy snake that reproduces the natural movement of a snake as it moves across surface is described . the toy snake comprises a head that is pivotally mounted to a tail and a motor unit located within the head . in a preferred embodiment a body is employed to pivotally mount the head to the tail . the motor unit comprises at least two independently driven wheels located towards opposite sides of the head and the motor unit is configured to introduce a periodic oscillation between the operation of the independently driven wheels . the motor unit may also be configured to operate a tongue that extends out from the head to further increase the realistic nature of the toy . embodiments of the snake may be adapted for use on land or water . | fig1 to 3 present a schematic top , side and bottom view , respectively , of a toy snake 1 in accordance with an embodiment of the present invention . the toy snake 1 can be seen to comprise a head 2 , a central body section 3 and a tail 4 . nine body sections 5 are longitudinally arranged between the head 2 and the central body section 3 , each body section 5 being pivotally attached to their adjacent segments . the first and ninth body sections 5 are also pivotally attached to the head 2 and central body section 3 , respectively . in a similar manner , a further nine body sections 5 are longitudinally arranged between the central body section 3 and the tail 4 , each body section 5 again being pivotally attached to their adjacent segments . the tenth and eighteenth body sections 5 are also pivotally attached to the central body section 3 and the tail 4 , respectively . the top surface of the head 2 , central body section 3 , body sections 5 and tail 4 preferably comprise a representation of snake skin so as to increase the authentic look of the snake 1 . this representation may be applied by engraving , embossing or printing on the top surface of these sections . in the presently described embodiment , a set of free spinning wheels 6 are located on the bottom surface of the fourth and fifteenth body sections 5 , the central body section 3 and the tail 4 . these wheels 6 assist the movement of the snake 1 across a surface , as described in further detail below . the tail 4 also comprises a plurality of beads which rattle during the movement of the snake 1 across a surface , thus further adding to the authenticity of the snake 1 . located within the head 2 is a power source 7 in the form of four battery cells , a printed circuit board ( pcb ) 8 upon which are mounted the control electronics for the snake 1 , and a motor unit 9 . it is preferable for the pcb to comprise a receiver 10 such that the snake 1 can be controlled via a remote control unit 11 . a tongue 12 is attached to the motor unit 9 and extends from the head 2 . on the bottom surface of the head 2 is located a switch 13 used to connect and disconnect the power source 7 and the motor unit 9 . detail of the motor unit 9 is provided within the exploded view of fig4 . the motor unit 9 comprises a housing 14 located external of which are two wheels 15 a and 15 b . the wheels 15 a and 15 b are provided with serrated grips so as to increase the friction between the wheels 15 a and 15 b and the surface over which the snake 1 is to move . two electric motors , 16 a and 16 b , are located within housing 14 , each connected via a gearing mechanism 17 to just one of the wheels 15 a and 15 b so as to provide a means for independently driving each of the wheels 15 a and 15 b . a tongue gearing mechanism 18 is employed to connect the electric motor 16 a to the tongue 12 . as a result , when the electric motor 16 a drives wheel 15 a it also acts to move the tongue 12 in and out of the head 2 . a circuit diagram of control electronics 19 employed within the motor unit 9 is provided within fig5 . a circuit diagram of the corresponding remote control unit 11 is provided in fig6 . with reference to fig7 there now follows an explanation of how the motor unit 9 acts to move the snake 1 across a surface . when the switch 13 is in the on position the power source 7 is connected to the motor unit 9 and the snake 1 is ready for use . on activating a forward button or joystick mechanism 20 on the remote control unit 11 the control electronics 19 act to provide power to electric motor 16 b so that wheel 15 b begins to rotate independently of wheel 15 a . as shown in fig7 ( a ) the effect of this is to cause the snake 1 to move forward while the head 2 turns to the left . the turning of the head 2 causes a ripple to flow down the body , as presented schematically in fig7 ( b ). after a short period of time , for example one second , the control electronics 19 act to power down electric motor 16 b and to power up electric motor 16 a . at this stage wheel 15 a begins to rotate independently of wheel 15 b which now stops rotating . as a result , the snake 1 continues to move forward with the head 2 now turning through its original central location towards the right , as presented schematically in fig7 ( c ). this oscillation of the powering up and powering down the electric motors 16 a and 16 a causes corresponding ripples to flow down through the body as the snake 1 moves over a surface in a substantially linear direction . it is the combined forward movement and the body rippling effect that allows the snake 1 to reproduce a highly realistic natural movement of a snake . the realistic nature of the snake 1 is further added to by the in and out movement of the tongue 12 as the snake 1 slithers across the surface and the rattling sound produced by the tail 4 . the control electronics 19 may also allow the toy snake to be temporarily deviated from the above described substantially linear propagation . when the joystick mechanism 20 of remote control unit 11 is pushed to one side the oscillatory driving of the wheels 15 a and 15 b is overridden such that only one of the wheels is powered at any one time e . g . if the joystick mechanism 20 is pushed left wheel 15 a is powered and the toy snake will turn to the left . in a similar manner , if the joystick mechanism 20 is pushed right wheel 15 b is powered and the toy snake will turn to the right . when the joystic mechanism 20 is returned to the forward direction the oscillatory powering of the wheels 15 a and 15 b is resumed . the above described snake may be adapted so as to provide a toy snake that moves across the surface of water . in order to achieve this water snake embodiment the wheels in the head are simply required to be adapted so as to function as water wheels . the wheels within the body sections and the tail may then be removed . it will be appreciated that a number of alternatives exists to the above described embodiments . for example , the length of the body of the snake may be varied so as to decrease or increase the overall length of the snake , as desired . indeed the head and tail could be pivotally connected directly to each other , although this would detract from the above described rippling effect . with larger snakes it may prove beneficial to increase the number of drive wheels on each side of the head . the rippling effect is still achieved as long as wheels on the same side of the head are powered up and down at the same time . in a similar manner , the number of body sections comprising free rotating wheels may wish to be increased or decreased in accordance with the length of the snake . the described rippling effect may also be changed by varying the period of oscillation of the powering up and down of the electric motors . in a further alternative embodiment , the snake may commence operation upon the switch being moved to the on position , thus removing the need for a receiver and the remote control unit . it is envisaged that a speaker may also be incorporated within the control electronics so that the snake may appear to make a hissing sound as it moves . as an alternative to battery cells , the snake may employ a solar panel to generate the required power . the foregoing description of the invention has been presented for purposes of illustration and description and is not intended to be exhaustive or to limit the invention to the precise form disclosed . the described embodiments were chosen and described in order to best explain the principles of the invention and its practical application to thereby enable others skilled in the art to best utilise the invention in various embodiments and with various modifications as are suited to the particular use contemplated . therefore , further modifications or improvements may be incorporated without departing from the scope of the invention as defined by the appended claims . | US-201013145971-A |
the present invention provides a method for bleaching or whitening a dairy product , comprising adding a lipoxygenase to the dairy product . the method of the invention may be used to whiten milk , cheese , butter oil , cream or whey products . the invention further provides the use of a lox to bleach a dairy product and a dairy product whitened by the methods of the invention . | the present invention is based on the surprising finding that only small amounts of lipoxygenases have a whitening effect on dairy products such as milk , cheese , butter oil , cream , whey products . dairy products are products that contain at least 10 w / w %, preferably at least 30 w / w %, more preferably at least 50 w / w %, still more preferably at least 70 w / w % or most preferably at least 80 w / w % on dry solid basis of components of milk , preferably cow &# 39 ; s milk . components of milk are , for example , fats , proteins etc . as discussed above milk , especially cow &# 39 ; s milk may naturally contain colouring compounds such as β - carotene . the mechanism of bleaching by lipoxygenase is based on the oxidative transition of double bonds in β - carotene ( or other carotenoides or other compounds having double bounds ) by radicals produced in the reaction of lipoxygenase and linole ( n ) ic acid . in contrast , the enzymatic whitening of the present invention may not result in off - flavours that might affect the taste of the treated dairy product . the whitening effect of lipoxygenase in dairy products is particularly surprising because the enzyme is present in the aqueous phase whereas the fatty acids are present in fat particles of the dairy product . also , the beta - carotene , which is present in cow &# 39 ; s milk , is present in the fat phase . commercially available lipoxygenase can be used . soy is a well - known source of lipoxygenase . other suitable sources include wheat varieties like durum , pea , faba beans , rice and lentils . lipoxygenase may also be produced by fermentation . b . knust ( 1990 ) proc . 15 th fermentively int . conf . yeast . gen mol . biol . p . s429 describes the use of baker &# 39 ; s yeast for producing legume lipoxygenase . also , wo 02 / 20730 describes the production of lipoxygenase by the fungus gaeumannomyces graminis , the identification of a lipoxygenase encoding gene from this organism and attempts to produce the functional protein in various microbial hosts . soy derived lipoxygenase has been used for bleaching purposes in wheat and maize flour or in such applications as noodles ( see e . g . jp1257158 , jp53024039 , jp5131358 , jp530294 ), but its use for cheese whitening has not been described . therefore , lipoxygenase originating from animals , preferably mammals , plant or micro organisms can be used . preferably plant or microbial lox is used in the process of the invention . most preferably lox from soy is used for example lox i - b . advantageously , the lipoxygenase is added to the milk before the cheese making process or any other milk conversion or separation process starts . the lipoxygenase can also be added at a later stage , for example during the cheese making such as at the same time as the addition of rennet . alternatively , the lipoxygenase can be added onto the cheese after cheese manufacturing . also , the lipoxygenase can be added to the whey or to the products obtained from whey , such as whey protein or whey hydrolysates . it will be appreciated that the skilled person in the art can easily determine the amount of lox necessary to whiten the dairy product . in general , from 10 to 1000 units of lox per gram of dairy product , preferably from 50 to 500 units lox per gram of dairy product , are used to bleach the dairy product . lipoxygenase from soy catalyzes the oxidation of lipids containing a cis , cis - 1 , 4 - pentadiene structure such a linoleic acid . the lox activity was determined at ph 9 . 0 at 25 ° c . using linoleic acid as the substrate . one unit caused an increase of 0 . 001 absorbance units at 234 nm ( 1 cm path length ) per minute . lipoxygenase was obtained from sigma . alternatively , lipoxygenase was prepared from soybean whey water , obtained from protein technology international ( leper , belgium ). a solid / liquid separation was performed over a z - 2000 filter plate , followed by a germ filtration over a z - 200 schenk filter plate . this resulted in a clear soy whey water preparation , which was subsequently ultra - filtrated at ph 8 . 2 on a 10 kd membrane . the final preparation contained at least • lipoxygenase units or more , the precise number varying between batches of soy whey . miniature cheeses were produced as described by shakeel - ur - rehman et al . ( protocol for the manufacture of miniature cheeses in lait , 78 ( 1998 ), 607 - 620 ). raw cows milk was pasteurised by heating for 30 minutes at 63 ° c . the pasteurised milk was transferred to wide mouth plastic centrifuge bottles ( 200 ml per bottle ) and cooled to 31 ° c . subsequently , 0 . 72 ml of starter culture ds 5lt1 ( dsm gist b . v ., delft , the netherlands ) was added to each of the 200 ml of pasteurised milk in the centrifuge bottles and the milk was ripened for 20 minutes . then , cacl 2 ( 132 μl of a 1 mol · l − 1 solution per 200 ml ripened milk ) was added , followed by addition of the coagulant ( 0 . 04 imcu per ml ). in some cases the lipoxygenase was added together with the coagulant . the milk solutions were held for 40 - 50 minutes at 31 ° c . until a coagulum was formed . the coagulum was cut manually by cutters of stretched wire , spaced 1 cm apart on a frame . healing was allowed for 2 minutes followed by gently stirring for 10 minutes . after that , the temperature was increased gradually to 39 ° c . over 30 minutes under continuous stirring of the curd / whey mixture . upon reaching a ph of 6 . 2 the curd / whey mixtures were centrifuged at room temperature for 60 minutes at 1 , 700 g . the whey was drained and the curds were held in a water bath at 36 ° c . the cheeses were inverted every 15 minutes until the ph had decreased to 5 . 2 - 5 . 3 and were then centrifuged at room temperature at 1 , 700 g for 20 minutes . after further whey drainage , the miniature cheeses were brine salted ( 20 % nacl , 0 . 05 % cacl 2 . 2h 2 o ) for 30 minutes and stored at 12 ° c . until such time that the cheese colour was determined either by visual inspection or as described in example 4 . mini cheeses were scanned on a colour scanner ( hewlett packard scanjet adf ) and analysed using the programme labsmart ( labsmart , llc , logan utah , usa ). colours were quantified with three parameters : l - factor ( black = 0 to white = 100 ), a - factor ( green =− to red =+ 60 ) and b - factor ( blue =− 60 to yellow =+ 60 ). bleaching or whitening is understood as an increse of 1 unit or more , preferably 2 units or more , in the l - component . in addition , cheeses were evaluated visually in comparison experiments ( control vs experimental ) for whiteness . mini cheeses were prepared as described in example 3 in which the cheese were spiked with a β - carotene casein emulsion ( 5 g β - carotene ( dsm ) was mixed with 25 g butterfat ( aveve ) at 50 - 60 ° c . ; 25 ml of this were added to 50 ml of 0 . 1 % sodium - caseinate solution followed by vigorous mixing using an ultraturrax blender . 10 ml of this β - carotene solution were added to 200 ml cheese milk ). lox ( 84 u / ml cheese milk ) was added ; in a control experiment heat - inactivated lox was added . the lox originated form sigma ( sigma lox i - b , coded lox sigma , almost colourless ). bleaching was assessed by visual inspection , and the results are given in the table 1 below : sigma lox ( 100 μl of a stock solution containing 168 u / μl ) was directly spotted onto slices ( approximately 2 mm thick ) of commercially available gouda cheese and incubated at 30 ° c . for 1 hour . in a control experiment , water was used instead of lox . after 1 hour , the color of the treated spots on the cheese slices was determined as described in example 4 . the l - value of the cheese treated with sigma - lox was slightly higher than the l - value of the cheese , treated with water ( l = 83 vs l = 82 ). both were higher than the l - value of the untreated cheese ( l = 81 ), indicating that both treatments resulted in bleaching , which was confirmed by visual inspection . the data indicated that the treatment with water causes bleaching of the cheese as result of extraction of the β - carotene and anatto ( a common colorant in gouda cheese ), which is a well known phenomenon . still , the treatment with lox gave a stronger discoloration , indicating that lox treatment results in bleaching of the yellow color . whey was obtained form the mini cheese experiments , and anatto ( dsm ) was added ( 2 μl / 100 ml whey ). a solution of sigma lox was added ( 84 u / ml whey ) and the samples were incubated at 30 ° c . for 20 hours . in a control experiment , either water or heat - inactivated sigma lox was added . the samples were than filtered over a 0 . 2 μm filter , after which the color intensity was determined at 460 nm . the lox - treated whey had a clearly lower absorbance ( a = 0 . 0045 ) compared to the whey to which either water or heat - inactivated lox was added ( which had absorbances of 0 . 090 and 0 . 092 respectively ). the lox treatment resulted in a clear reduction of the whey color . | US-55978705-A |
an improved system and method for positioning screws and rods to immobilize bones is provided . specifically , the system and method is optimal for performing transforaminal lumbar interbody fusion and other interbody fusions in the spine . the system involves pedicle screws detachably connected to wires that guide rods down to the screws . the wires are strong , narrow , flexible , adjustable in tension , and easily disconnected from the screws after rod placement via a process such as cutting , radiating , burning , dissolving , etc . the use of wires to place the rods avoids the conventional bulky tower apparatuses of the prior art while at the same time enhancing the accuracy of placement . one of the preferred methods involves relying upon the natural lordotic curvature of the spine and the narrow diameter of the wires to insert many elements through a single minimally invasive incision . | the invention involves at least a screw , a rod , and a locking assembly being wire - guided down to pedicles of the vertebrae and the rod secured to stabilize the vertebrae . the locking assembly may be built into the screw head or be a separate element . the locking assembly may be guided down to the screw before or after insertion of the rod depending upon the details of the locking mechanism used to secure the rod . in some cases , the locking assembly is already present on the screw head before the rod is received and in other cases the rod is inserted into the screw head first and the locking assembly follows . a preferred embodiment of the present inventive system and method is to use one wire 103 on each side of a screw head 102 such that there are two wires 103 per screw shaft 101 to securely trap a rod 104 over the screw shaft 101 within the screw head 102 . this embodiment is believed to provide the most rod 104 stability for the least volume of stabilizing elements ( thereby enabling a very small incision without stressing it ). the wire 103 can be attached to the screw head 102 through ( i ) the wire itself , ( ii ) an extension of the wire that is formed of a material that is the same as a material from which the wire itself is derived , ( iii ) a thread material thinner than the wire , ( iv ) a short tower , or ( v ) an intermediate element including an extensor / extended tab 112 , flexible sheet , flange 110 , or mechanical device / clamp 113 as discussed further herein , among other possibilities . a single wire 103 may be attached to a screw head 102 at a single location or in two or more locations 111 as illustrated in fig1 a - 1c . fig1 a - 1c shows a first configuration , in which a single guide wire 103 is attached to the screw head 102 ( fig1 a ), and a second configuration , in which one more shorter wires 111 are attached to the screw head 102 and also attached to a single elongated guide wire 103 at their other end ( fig1 b - 1c ). multiple short wires 111 attached directly to the screw head 102 may provide greater stability for an easier alignment . to accommodate this multiple wire configuration 111 , insertion instruments having side loops ( not shown ) through which the guide wire passes also have side loops to accommodate the larger area created by the fanning out configuration of the multiple short wires 111 close to the screw head 102 . thus , the side loop attached near the tip of the insertion tool will be as wide as the screw head to accommodate all the short wires at the screw head . above the transition zone ( from multiple wires 111 to a single wire 103 ) the insertion tool will have smaller side loops that only allow a single wire to pass . in an alternative embodiment there may be a single wire 103 on only one side of each screw 101 / 102 or screw head 102 . this embodiment further reduces the volume of stabilizing elements ( screw head wires ) that must fit through the minimal incision but also reduces rod stability . when only one screw head wire 103 is used per pedicle screw 101 / 102 it is recommended that at least one rod retention thread 105 also be used ( see fig7 and 8 for illustration of the rod retention threads 105 ). the screw head wire 103 should be inserted through the loop formed by the rod retention thread 105 along the lateral side of the rod body 104 . in another alternative embodiment , instead of one or more wires 103 , there may be one or more upwardly directed shafts that are not round ( not shown ) and are attached to a side of the screw head 102 . the unique shape of the shaft would prevent insertion tools from turning or rotating around the shaft ( i . e . during their descent to approach the screw head 102 ). thus any shaft that is not cylindrical would be capable of guiding tools that have a complementary non - cylindrical shaft holder attached to the tool . for example , a shaft that has a cross section of an oval , square , rectangle , triangle , cross , trapezoid , star , or any other shape besides a circle would be able to prevent an insertion tool from rotating around the shaft as long as the insertion tool is equipped with a complementary shaped holder through which the shaft fits precisely . a single shaft guidance mechanism that is thicker than a wire would also likely be more rigid than a wire . however , as long as the screw head 102 is multi - axial , there would be some flexibility in moving the shaft around in the incision . the screws 101 and screw heads 102 themselves may also have any one of several different vertical and horizontal cross - sections including both circular and non - circular , rectangular , square , hexagonal , etc . the screws 101 and screw heads 102 are preferably made of a titanium alloy or stainless steel . the rods 104 are preferably cylindrical but may alternatively have a non - circular cross - section ( triangular , square , hexagonal , etc .) so long as the seat of the screw head 102 is shaped correspondingly to accommodate . the rods 104 are preferably formed of polyetheretherketone ( peek ) but may also be made of any other biocompatible minimally flexible polymer or metal . in another alternative embodiment there may be more than two wires 103 per pedicle screw 101 / 102 . preferably , if more than two wires per screw are used , there is at least one wire on each side of the screw with more than one wire on at least one side . an equal number of wires on each side improves stability and prevents lopsidedness . however , every patient &# 39 ; s anatomy is slightly different and when curvature ( i . e . scoliosis ) and / or other aggravating conditions are present stability during rod 104 insertion may be best achieved by an asymmetric distribution of screw head wires 103 around the perimeter of a screw head 102 . in any case , the spinal surgeon is in the best position to make this decision about the appropriate screw head wire 103 and rod retention thread 105 set - up to use based on the individual needs of a particular patient . the wires 103 on any one screw 101 / 102 can be placed at various positions around the periphery of a screw ( rather than just on the sides ) for enhanced stability and control . screw 101 / 102 is used to refer to the entire screw including the screw shaft 101 and the screw head 102 collectively . the wires may be uniformly distributed and symmetrical around the periphery or they may be asymmetrical and staggered . for example , having four wires on a screw head ( i . e . one wire on each edge : north / top , east / right , south / bottom , west / left ) ensures that the screw head 102 is oriented along the axis of the rod 104 during transport of the rod through the incision and into a first screw head . limiting the open regions around the perimeter of a screw head 102 by effectively creating a wire cage can also force the rod 104 to turn in the right direction ( or force the screw head to turn to accommodate the rod ) when it moves from a vertical longitudinal to a transverse lateral orientation after placement of a first end in a first screw head while the other end is being directed for placement in a second screw head . the number of wires , their sizes ( i . e . diameters and lengths ), shapes , flexibility , and strength may be adjusted to suit a particular procedure in a particular patient based on the incision size to optimize screw stability and facilitate rod alignment while avoiding entanglement of too many wires . contemplated embodiments include those with from 1 to 10 wires per screw / screw head , especially those with 2 to 4 wires . instead of multiple long wires connected to the screw head 102 on each side , a single long wire 103 ( or thread ) is connected to several short wires 111 which in turn are connected to each side of the screw head . thus , multiple wires 111 are still connected to each screw head 102 but these multiple wires are also connected to one another in an area above the screw head to form single wire 103 extending through the incision . these multiple short wires 111 may still function to bound or limit the movement of a rod 104 at least at the base of the screw head 102 . the short wires 111 give the advantage of creating a wire cage by which the rod 104 is forced to sit down into the seat of the screw head 102 . the long single wire ( or thread ) 103 reduces clutter and confusion at the skin incision that occurs when too many wires are present . the multitude of short wires 111 distributed away from the longitudinal entry axis into approximately the same axis along which the rod 104 will ultimately lay also allows the long wire 103 and accompanying instruments to adjust the orientation and angle of the screw head 102 in this axis ( the rod axis , approximately perpendicular to the longitudinal entry axis used during rod insertion ). the screw head 102 is configured to form a concave channel in which the rod 104 will eventually come to sit / rest . the concave channel may be u - shaped when a vertical cross - section is taken but any substantially concave shape suited to retain a rod 104 and with dimensions corresponding to those of the rod 104 will work . the upper edges of the screw head 102 itself or those of another intermediate element 110 / 112 / 113 to which it is attached , are configured to receive an incoming rod at a wide range of angles and smoothly direct it into the proper angular configuration to fit into the screw seat . as an alternative to the screws 101 or the screw heads 102 being attached directly to upwardly directed guide wires 103 or guide shafts , there may be an intermediary flange , flanged leaflet , sheet 110 , extensor / extended tab 112 , a mechanical clamp / device 113 , or other element in between the two . the screw 101 / 102 or screw head 102 at its outer edges may transform into ( integral therewith ) or attach to a separate element that is directly attached to the guidance wire / shaft 103 such that the screw 101 / 102 or screw head 102 and the guidance element 103 are indirectly connected . the intermediate element is preferably specially adapted to readily detach from the screw 101 / 102 or screw head 102 when desirable , such as after securing the rod 104 in proper position and locking it in place . detachment may be through a snap - off / pop - off mechanical mechanism that might be activated through a push - button at the proximal end of a surgeon &# 39 ; s tool ; through tearing along a perforation ; through cutting , twisting , wagging , burning , heating , radiating , ultrasonically vibrating , electrifying / electrocuting , dissolving , unscrewing , or any other means . in this case with the guidance wires or upward shafts 103 attached directly to the intermediate and readily detachable element 110 / 112 / 113 the guidance wires 103 themselves may be more securely fastened to the intermediate element 110 / 112 / 113 . for example , the wires 103 might be soldered or welded to an extensor tab 112 that snaps into / onto and snaps out of / off of a groove or protrusion on the screw head 102 . at least a portion of the extensor tab 112 may be threaded to mate with a screw 101 / 102 or screw shaft 101 having corresponding threads or to align a rod 104 having some corresponding threads . the intermediate element may be in the form of a sheet 110 of a very thin material that is both flexible and can be tensed by pulling or tightening . when pulled tight the sheet 110 functions to guide the rod 104 into the seat of the screw head 102 . such material may be rubber . an intermediate element may be an inwardly tapered flange 110 attached to an inner top edge of the screw head 102 and placed symmetrically about the screw seat in which the rod 104 sits . such a flange 110 is configured to allow a malaligned rod 104 or screw head 102 to rotate and adjust relative to one another as the rod is inserted into the seat of the screw head until the two are acceptably aligned . the inwardly tapered sides of the flange 110 may take the form of convexly curved wings 110 that form a channel for the rod 104 between them . alternatively , the intermediate element may be an extensor tab 112 with straight rather than convex sides . preferably , the tab is triangular which may be formed by removing the corners of an otherwise rectangular tab . the wider base of the triangle may attach to the screw head 102 as shown in fig1 a - 18c . the function of the screw head 102 or intermediate element 110 / 112 / 113 is to create a channel into which a rod 104 can be easily guided by the upwardly directed guide wire 103 / guide shaft . the screw head or intermediate element is adapted to accept a large degree of malalignment of the rod and the screw seat relative to one another and then guide the rod into the screw seat until substantially perfect alignment is achieved . the advantage of this is that the system does not require starting over , pulling out , and reinserting the rod when it turns out the initial positioning is not ideal . the wires , threads , and intermediate elements described herein may be attached to the screw or screw head on the outside , on the inside , or through a cannulated portion of the downwardly directed screw shaft 101 . many attachment locations are possible so long as it does not interfere with the ability of the screw shaft 101 to be drilled into the pedicle and the ability of the rod 104 and locking assembly 106 to be received into the seat of the screw head 102 . the wire , thread , or upwardly directed shaft 103 may be attached to the downwardly directed screw shaft 101 , the screw head 102 , or an intermediate element ( i . e . flange , sheet 110 , extensor / extended tab 112 ) with glue , soldering , thread , sutures , string , a mechanical clamp 113 , etc . in embodiments in which a mechanical clamp 113 is used to connect the upwardly directed guidance element 103 to the screw head 102 , the clamp 113 preferably has 2 leaves that are connected under the head 102 or at least below where the rod 104 comes down so as not to impede the path of the rod . after closing the locking assemblies 106 to secure the rod 104 in place within the screw head 102 , the clamps 113 can be removed . removing the clamps 113 from the screw head 102 also removes the wires 103 attached to the clamps 113 . the clamps 113 may be removed by any means feasible in the limited space including ( but not limited to ): ( i ) by breaking the connection ( like detaching the extended tabs 112 ), ( ii ) by cutting a material that holds the 2 leaves together , ( iii ) unclamping or unbuckling , and ( iv ) unvelcro - ing . alternatively , in some embodiments the locking assembly may be part of the clamp 113 such that the clamp is not removed but remains to hold the rod 104 ( see fig1 a - 19c ). in such situations , the guidance wires 103 only are simply detached from the clamp - locking assembly combination unit . instead of a mechanical clamp with moving parts , the intermediate element ( between screw head 102 and wires 103 ) may also simply be a metal or plastic device that has no moving parts but traps the head 102 securely into it . the intermediate metal or plastic device can be removed by means including ( i ) snapping a thin center part connecting 2 halves of the device , or ( ii ) cutting a string that connects 2 parts of the device . if the locking assembly 106 for the rod 104 is distinct from the intermediate metal or plastic device , then the device can be removed along with the wires after the rod is placed . if the locking assembly is integrated with or dependent upon the intermediate metal / plastic device , then the device should stay in place after the wires 103 / 111 only are detached from it . in another embodiment illustrated in fig1 a - 11f , the wire 103 or an extension thread 107 thereon , can be attached to the area within the screw head 102 where the rod 104 would eventually sit , such as at the base of the screw head and / or to the upper end of the downwardly directed screw shaft 101 . for example , the wire 103 or its extension 107 may be attached within the cannulated portion of a cannulated screw . by using flexible wire or extension thread 107 , the wire / thread can wrap around the rod 104 as the rod is seated into the screw head 102 . the wire / thread can then be threaded through cannulated tools and a cannulated locking assembly 106 above the rod . optionally , color - coded wires 103 and / or screws 101 may be provided to assist doctors , technicians , and medical personnel in identifying elements , performing the procedure , and monitoring progress during follow - up visits . alternatively , some other form of visual coding , such as with particular materials and / or only visible under certain conditions may be used to distinguish wires , screws , and other elements ( i . e . fluorescent markers , radioactive isotopes , radioopaque markers visible on x - rays , magnetic nanoparticles , etc .). another alternative or complementary coding means can be sensed by touch ( different surface textures ) or sound ( tactile or auditory ) rather than or in addition to visually . the coding could be correlated with right and left sides of the body , medial vs . lateral elements , wire / screw sizes , wire / screw shapes , wire flexibility , and / or wire strengths , among other possibilities . this list of variables with which a coding or tagging system may correspond is intended to be illustrative rather than exhaustive . one preferred coding system provides markers or color coding for wires that are intended for the medial side of the rod versus those intended for the lateral side of the rod . this coding would allow for easy separation of the wires 103 when the rod 104 is inserted . this coding would also help the insertion of tools and the locking assembly 106 along the medial side and lateral side wires 103 . some elements ( wires 103 , screws 101 , screw heads 102 , rods 104 , retention threads 105 , locking assemblies 106 , etc .) with similar characteristics may be coded in groups such as all medial side wires being red while all lateral side wires are green . any locking assembly 106 can be used with the present invention . the precise design of the locking assembly 106 is not important so long as it is configured to retain the rod 104 within the screw head 102 for a secure and lasting stabilization . examples of locking assemblies 106 that might be employed include screw - on nuts , press - on caps , fast - drying glue , a tiny swinging gate or door with a latch , a series of elements that can be deployed to tighten around the periphery of the rod , etc . since a rod connects two or more separate vertebrae , the rod can first be secured into position ( locked or tightened ) though the locking assembly on a first vertebra and then subsequently on a second vertebra . in some cases after the rod is firmly secured to the screw on the first vertebra , the relative positioning of the vertebrae can be adjusted by the surgeon by moving the vertebrae closer together or farther apart before the rod is secured to the screw on the second vertebra . with only one side of the rod locked into place the other side of the rod can easily be adjusted in position . for example , the rod can vertically slide forward or backward through the locking assembly until the desired distance spanned by the rod between locking assemblies is obtained . the wires 103 can be attached to the screw heads 102 by a number of mechanisms . the retention threads 105 can be attached to the ends of the rods 104 by the same assortment of mechanisms . the simplest attachment mechanism is to solder or glue the wire / thread to the screw head / rod . the solder or glue can then be cut or broken off later . neither the lateral retention threads 105 on the rod 104 nor the upwardly directed guidance wires 103 on the screw 101 / 102 , or on the screw head 102 , are needed after the rod 104 has been securely placed within the screw head 102 . the retention threads 105 on the rod 104 that hold it close to the guide wires 103 as it is guided into position are preferably made of a flexible material including metal wire , nitinol , rubber , suture , plastic , polymer , and biodegradable material . the retention thread 105 should be easily removable after the rod 104 has been secured in an aligned position in the seat of the screw head 102 and locked in . alternatively , the wire / thread could be threaded into a threaded connector in the side of the screw head / rod so that the wire / thread is unscrewed at the end of the case . other embodiments include attaching the wire 103 / retention thread 105 by dissolvable sutures tied to the screw head 102 / rod 104 and to the end of the wire / retention thread with a small loop or grooves in the screw head / rod . suitable dissolvable suture materials include biocompatible synthetic absorbable materials such as those made primarily of polyglycolic acid ( pga ) or other proven compositions . specific brands of materials include vicryl ™ ( from ethicon ), biovek ™ ( from dynek ), visorb ™ ( from cp medical ), polysorb ™ ( from covidien &# 39 ; s syneture ), and dexon ™ ( also from covidien &# 39 ; s syneture ). the materials can be tailored to degrade or absorb in an amount of time that corresponds with sufficient internal healing to successfully hold the fusion . for example , standard vicryl ™ typically maintains tensile strength for three to four weeks . the materials may also be impregnated with drugs or biomolecules ( i . e . triclosan ) to accelerate the healing process and prevent infection . when the biodegradation ( i . e . bioabsorption , bioerosion , etc .) time for the suture material is too long and the sutures are unnecessary immediately following the procedure the sutures can instead be promptly cut or burned at the end to disconnect the wire / retention thread from the screw head / rod . yet another option for the “ wire to screw head ” or “ retention thread to rod ” attachment mechanism is to secure using a material that burns , breaks , or dissolves upon the application of current ( i . e . radiofrequency current ). this option permits the connection to be easily broken by simply passing current through the wire or thread . preferably , the wire / retention thread breaks down in response to current applied outside the skin . alternatively , an insulated guide wire can be used to apply current internally in a targeted and minimally invasive manner . an insulated guide wire would allow the current to pass directly from an external tip ( outside the body ) to the current - sensitive material at an interior tip near the pedicle screw . in still another preferred embodiment for attachment , the selected material ( i . e . elastic string or rubber ) is both flexible and can be tensed by pulling or tightening . the key is to use very thin material that can be both flexible and become tense . these dual properties allow the material to reliably guide the rod and tools down through the small incision without breaking while adapting to share the limited space . unless it is also biodegradable the flexible , tensile material of string / rubber will need to be cut / broken / burned off or untied from the screw head and wire ( or rod and retention thread ) at the end of the procedure . instead of using an intermediary material to connect the wire to the screw head and / or to connect the retention thread to the rod , another possibility is for the wire and / or retention thread to be formed of the same materials as the intermediary connectors described above . in this situation , it is the wire or retention thread that is itself burned or cut at the end of the procedure . the final result in all cases is a clean , successful pedicle screw fusion just like that which results from screws and rods used in an open procedure but with a smaller incision and fewer components . the material through which the rod - guiding wire is attached to the screw head may be the same material of which the wire itself is derived or a separate material . the wires themselves are preferably formed of a biocompatible metal having both strength and durability . in a preferred embodiment , the wires are formed of nitinol ( nickel titanium alloy ). the material through which the retention threads 105 of the rod 104 are attached to the ends of the rod may be the same material of which the retention threads themselves are derived or a separate material . the retention threads are preferably formed of a biocompatible metal having both strength and durability . in a preferred embodiment , the retention threads are formed of nitinol ( nickel titanium alloy ). alternatively , another preferred embodiment is for the retention threads of the rod to be made from a biodegradable thread so that it does not have to be removed after placement . another advantage of thread is that it would not interfere with the rod and cap locking mechanism 106 if it were caught in between the cap 106 and screw head 102 threads . to complement the wire guides 103 , the present invention also provides a special rod 104 , with its own retention threads 105 , that can fit between the wires . by attaching a small loop or ring at the ends of the rod , two threads can be tied though the loops with good tension along the sides of the rod . this way the wires 103 will pass in between the rod 104 and the thread 105 to prevent the rod from slipping out and around the most superior or inferior wires . ( see fig7 and 8 .) the retention thread 105 may also be attached to the rod by means other than loops or rings at its ends . the rod 104 may have holes or piercings therein for securing the thread to it . the rod may have grooves at its ends with which the thread engages . the thread 105 may be glued on near the ends of the rod . rod retention threads 105 restrain the rod 104 to riding the wires 103 and eliminate the risk of internal rod displacement away from the target screw site 102 . the retention threads 105 also expedite rod 104 placement into the screws 102 / 101 to decrease total procedure time . the retention thread 105 may take the form a strip or long sheet of material rather than an ordinary thread . the retention thread material should be flexible , strong , and biocompatible . the steps for the placement of the pedicle screws and rods for a “ micro open ” approach are as follows . first , using fluoroscopy or stereotactic guidance , a single small skin incision 1 - 4 cm lateral to a midline that will accommodate all pedicle screws is localized . next , using either a percutaneous jamshedi / kirschner - wire ( k - wire ) approach , a wiltse muscle splitting approach , or tube system , the pedicle screws are placed ( see fig2 ). the pedicle screw inserter has loop attachments that hold the side wires of the pedicle screw during placement . after each pedicle screw is placed , the side wires are pushed to the side of the incision to make room so that the other screws can be placed without entanglement . after all screws are placed , a screw head turner is inserted and guided down to the screw heads along each pair of guide wires to align the heads of the screws in preparation for receiving the rods ( see aligned screw heads in fig3 ). with the screw heads aligned , the side wires are split between the medial and lateral sides . then a rod is slid in between the medial and lateral wires into the screw heads . preferably , the rod should be bent before insertion . markers on the guide wires at predefined distances from the tip of the guide wires can help guide the surgeon in bending the rod to the correct curvature . guide wires coming out of a single incision are similar to light rays that have been focused by a convex lens . these light rays converge at a point and then create a mirror virtual image on the other side of the focal point . this same concept can be used to create a mirror image of the curvature of the rod to guide the bending of the rod to accurately fit into the screw heads . ( see fig4 and 15 a - 15 c ). after each end of the rod is properly positioned within a screw head , locking nuts or caps are screwed on the screw heads to secure it in place . alternatively , a compressor that is guided by the wires is used to compress pedicle screws on adjacent levels and then final tightening can be done during compression . the screw head guide wires are then removed by any means including cutting , twisting , wagging , burning , radiating , dissolving , unscrewing , etc . ( see fig5 and fig6 , left side ). once the screws and rods in all vertebrae to - be - fused along one side of the vertebral column are stabilized , their mirror - image counterparts should be placed along the opposite side of the same vertebrae using similar fluoroscopic localization or other imaging means ( see fig5 with one rod , preparing for the second , and fig6 with two rods placed ). the present invention can be used to dynamically stabilize or fuse vertebrae while at the same time removing a defective intervertebral disc and inserting a spacer in its place . the spacer may include bone graft material or bone inducing material incorporated therein to encourage healing . exemplary bone inducing materials include bone morphogenetic protein , tricalcium phosphate , hydroxyapatite , and collagen . the various elements ( wires , screws , screw heads , rods , retention threads , locking assemblies , etc .) of the present invention may be provided in a range of sizes , shapes , strengths , flexibilities , and other physical characteristics to best accommodate individual patients and particular applications . fig1 a - 13c shows how for a three level stabilization the rod can be guided down by the wires on a first screw head while the wires on a second and third screw head are splayed outward or bent to open the encatchment area for the rod to easily enter . in the conventional case of pedicle screw towers , the rod had to be precisely inserted through the small opening within each rigid tower . the present invention overcomes this difficulty . as shown in fig1 a - 14c a refined t - shape tool 108 / 109 may be used to separate the wires 103 . this gesture prevents them from becoming tangled ( or disentangles them ) and opens the space in between them such that a rod can be passed through it to enter the screw head . the horizontal arms 109 of the “ t ” extend outward perpendicular to the longitudinal insertion axis 108 . these arms 109 may be aligned parallel against the main longitudinal body during insertion and removal . they may also be inside the main body and deployed from within via telescopic extension or a spring - like mechanism . the end of each horizontal arm 109 may be u - shaped , v - shaped , or circular such that a wire 103 can be retained within it . if the ends are u - shaped or v - shaped the t - shaped tool 108 / 109 can be disconnected from the wire 103 easily after spacing by collapsing the arms to realign against the longitudinal insertion axis 108 or to collapse into the main body . if the ends are a closed loop shape such that the wires 103 are fed through them and trapped within them , the loops should be configured to open to release them ( like a jewelry clasp ) after the tool 108 / 109 has performed its function . the present invention is not limited to the embodiments described above . various changes and modifications can , of course , be made , without departing from the scope and spirit of the present invention . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents . | US-201113246432-A |
a removable window covering for an arched window is formed of a reinforcing frame and fabric enveloping the frame . the frame has joints to allow for folding of sections of the window covering for ease in transporting and storing the covering . an attachment means is provided to allow for the window covering to be installed over an arched window and easily removed when it is desired to have the window exposed . the window covering may also have uv resistant and thermally insulative properties . | with reference initially to fig1 , a window covering 10 of the present invention is shown installed within an arched window casement 100 to cover an arched window ( window 200 , fig4 ) that is surrounded and framed by the casement . the window arrangement shown in fig1 , including a set of rectangular windows 300 located below the arched window 200 along a wall 400 , is one common window arrangement , but is meant to be exemplary . as can be seen in more detail in fig2 – 6 , the window covering 10 is formed of a generally planar semi - rigid or rigid frame 12 surrounded by fabric 14 . preferably , the window covering 10 is divided into four wedge shaped sections 50 , 60 , 70 and 80 each having a component of the frame 12 therein . in one embodiment , sections 50 and 60 , and sections 70 and 80 , are secured together along a joint 16 to form sections 50 and 60 into a first component 90 of the covering 10 and form sections 70 and 80 into a second component 92 of the covering 10 . each of the components 90 , 92 are independently removably mountable onto the window casement 100 or other structure by an attachment means 18 . also , the window covering 10 has a front side 20 configured to face away from the window and towards the interior of the building and a backside 22 configured to face towards the window and onto which the attachment means 18 is secured . the frame 12 can be formed of any lightweight material that is fairly rigid , such as cardboard , plastics or very thin plywood , and typically one frame portion is provided for each wedge shaped section 50 , 60 , 70 , 80 to define the overall shape of the respective section . the fabric 14 envelops each frame section and may be , for example , made of natural fibers , synthetics , or a combination of the two . in one arrangement , the fabric 14 may comprise a first general type of material overlaying the front side 20 of the window covering 10 , and a second uv resistant material ( e . g ., high - density polyethylene ) overlaying the backside 22 of the covering that may be exposed to direct sunlight through the window . alternatively , or in addition to having uv resistant characteristics , the second uv resistant material may be a thermally insulative fabric to aid in making the indoor environment less vulnerable to the influence of outdoor temperatures or to sunlight contacting the covering 10 . attachment means 18 may be in the form of a hook and loop system , such as that commonly referred to under the brand name velcro ®, where the hook component 24 is secured to one of the window covering 10 and the window casement 100 , and the loop component 26 is secured to the other of the covering and casement , as can be seen in fig3 and 4 . the hook and loop components 24 , 26 are strategically positioned generally near a perimeter edge 28 of each of the first and second components 90 , 92 of the window covering 10 — and in matching locations on the window casement 100 — to securely hold the covering 10 in place . one suitable configuration is for the attachment means 18 to be located on the window covering at “ pressure points ”, or near a lower outside corner 29 , lower inside corner 31 , upper inside corner 33 , and midpoint 35 of a curved portion 37 of the perimeter edge 28 near the joint 16 . one exemplary fabrication method for the window covering 10 will now be described with reference to fig2 – 6 . at a first step , the frame 12 is formed into the individual section pieces , one piece for each of the wedge shaped sections 50 , 60 , 70 and 80 of the window covering 10 . the size of the sections 50 , 60 , 70 and 80 will depend on the size of the arched window 200 and window casement 100 , so that preferably the finished window covering 10 will overlap onto the casement for attachment therewith at the locations shown in fig4 . for instance , when connected together , the section pieces of the frame can , in one embodiment , overlap one inch with the casement 100 . then , sections 50 and 60 may be connected together to form first component 90 , and sections 70 and 80 may be connected together to form second component 92 , of the covering 10 . each joint 16 ( between sections 50 and 60 , and between sections 70 and 80 ) is formed by a structure that allows one section ( e . g ., section 50 ) to be folded over the adjacent section ( e . g ., section 60 ) of the respective component ( e . g ., first component 90 ) of the covering 10 so that the first and second components 90 , 92 may be easily stored and transported when not in use . one partially folded component 90 or 92 is shown in fig5 , which upon unfolding to the position shown in fig3 is ready for installation over an arched window 200 . the structure of the joint 16 may include , in one embodiment , duct tape or a cloth - like tape that securely holds the sections together while allowing repeated folding of the sections with respect to one another at the joint . for example , the tape may be a light colored ( e . g ., white ) tape so that it is not seen through the fabric that will surround the frame pieces . the tape is preferably applied to the frame pieces on both the front and backsides 20 , 22 of the covering 10 . the sections 50 and 60 , 70 and 80 , to form each joint 16 , should be spaced slightly apart at their matching edges to allow sufficient clearance for the folding . one spacing dimension found to be suitable in forming the joints 16 is a ⅛ inch gap between sections 50 and 60 , and between sections 70 and 80 , where the sections are taped together while maintaining the gap to form the first and second components 90 , 92 . in an alternative arrangement , the joints 16 may be formed instead by mechanical hinges ( not shown ), one example of which would be a standard door hinge . such a mechanical hinge would couple the pieces of the frame 12 together that form the first and second components 90 , 92 ( e . g ., couple sections 50 and 60 , and sections 70 and 80 , together ). the frame 12 forming the foundation for the first and second components 90 , 92 of the window covering 10 is then enveloped by the fabric 14 . the fabric 14 is preferably sewn over the frame 12 as to surround both frame pieces forming the respective component 90 or 92 of the covering 10 . for instance , a first fabric piece 30 overlaying the covering front side 20 may be sewn to a second fabric piece 32 overlaying the covering backside 22 . the sewing takes place — for each of the components 90 and 92 — around the perimeter of the frame 12 forming the respective components 90 or 92 . other attachment means , such as adhesives or glues may be used instead of sewing to secure the first and second fabric pieces 30 , 32 together to envelop the frame pieces only if such adhesives or glues can withstand the elevated temperatures endured by the covering 10 when exposed repeatedly to radiation from incoming sunlight . optionally , at the time of sewing the first and second fabric pieces 30 , 32 together , or thereafter , a fabric ruffle 34 may be sewn around the edges of the sections 50 , 60 , 70 and 80 . fig6 shows how the frame 12 and fabric 14 may be secured together . finally , the hook and loop components 24 , 26 , as attachment means 18 , can be secured to the first and second components 90 , 92 of the window covering 10 on the backside 22 thereof as described above . in one arrangement , the hook components 24 are sewn ( e . g ., in 1 inch squares or circles ) onto the second fabric piece 32 on the backside 22 of the covering 10 , and the loop components 26 are glued or adhered onto the window casement 100 near where the arched window 200 interfaces therewith . however , the location of the hook components 24 and loop components 26 could be reversed , such that the loop components 26 are secured to the covering 10 and the hook components 24 are secured on the casement 100 . one suitable adhesive for attaching the loop components 26 is that sold under the name “ perfect glue 2 , liquid nails ” offered by ici paints of cleveland , ohio . other glues or epoxies may also be used . the window covering 10 may be easily installed over an arched window 200 by unfolding the particular component ( first component 90 or second component 92 ) to be flat , aligning the hook and loop components 24 , 26 between the component 90 or 92 and the window casement 100 , and pressing the component 90 or 92 against the window casement 100 . then , the other component 90 or 92 is aligned and pressed against the casement 100 over the uncovered part of the window 200 to complete the installation of the covering 10 over the window 200 . because of a degree of rigidity provided by the frame 12 , and the lightweight nature of the covering 10 , each component 90 , 92 can usually be lifted to a high location merely by holding onto a lower portion 36 of the particular component 90 , 92 . when it is desired to see through the window 200 towards the outdoor environment , or to merely clean the window from the inside , each component 90 , 92 may be independently pulled outward to overcome the gripping force of the hook and loop components 24 , 26 and remove the covering 10 from attachment with the casement 100 . then each component 90 , 92 may be folded at the respective joint 16 , as shown in fig5 , so that the components 90 , 92 may be transported and stored in a compact arrangement . it should be understood that the window covering 10 may , alternatively , be formed where all of sections 50 , 60 , 70 and 80 are attached together such that the first and second components 90 , 92 become just a single body with another joint 16 formed therebetween . however , this design would have more bulk and weight , which may be noticeable when attempting to mount the covering 10 over the arched window 200 . in still another arrangement , the first and second components 90 , 92 may be formed of more than four sections ( i . e ., more than sections 50 , 60 , 70 and 80 ). for instance , six sections may be selected such that each of the first and second components 90 , 92 may be divided into three sections , and an additional joint 16 would be required for each component 90 , 92 . from the forgoing , it can be seen that the window covering 10 of the present invention provides an effective solution for covering an arched shaped window that is also easy to install and remove as desired . furthermore , since certain changes may be made in the above invention without departing from the scope hereof , it is intended that all matter contained in the above description or shown in the accompanying drawing be interpreted as illustrative and not in a limiting sense . | US-94225604-A |
a detachable vertical cutter for insertion into a cylinder or tube is formed as a single unitary structure . the single blade has a pair of tool attachment end portions and a cutting blade extending in a loop between the attachment ends . the cutting blade is inclined vertically relative to a longitudinal axis of a cylinder or tube into which the attachment ends can slide into . the cutting blade has a cutting edge , a portion of which when extended free of the cylinder or tube will extend a distance greater than the tube outside diameter . the cutting edge when pushed inwardly and pulled outwardly between adjacent vertebrae scrapes and cuts disc material . when retracted the cutting blade deflects into the cylinder or tube for insertion or extraction into or from the disc space . | with reference to fig1 and 1a , the cutting tool device 100 of the present invention is illustrated . the device 100 includes a detachable vertical cutter 10 , a tool tube 102 , a rotatable retraction and protraction knob 120 and a push pull knob 130 to provide linear cutting capability as the tool 100 is pushed and pulled inward between two vertebral bodies to remove disc tissue and to scrape the bone exposed end plate surfaces . with reference to fig1 a , further illustrated internal to the tool tube 102 is a shaft 112 . the shaft 112 provides a way to attach the vertical cutter 10 . as further illustrated in fig2 a , the tube 102 has a “ t ” shaped end 104 that is adapted to fit in the rotatable knob 120 as illustrated in fig3 . the “ t ” shaped end 104 has a knob 120 mounted thereabout so that the knob 120 can rotate without rotating the tube 102 . the knob 120 has internal threads 122 adapted to engage the threads 110 of the shaft 112 as illustrated in fig2 b . the combination of threads 110 , 122 are designed so the shaft can be pulled or pushed axially along the longitudinal axis of the tool by the rotation of the knob 120 best illustrated in fig3 . a slot is provided in the tool in fig3 exposing the threads 110 of the shaft 112 . the threads 110 can be moved between positions 105 and 103 or further if so desired . this open window 106 provides a means for the surgeon to see the amount of travel that the vertical cutter 10 is making relative to the tool tube 102 when it is positioned inside the vertebral bodies . the shaft 112 has a flat end 116 to which the knob 130 is fixed . with particular reference to the detachable vertical cutter 10 , as illustrated in fig4 through 7 , the vertical cutter 10 has attachment ends 12 and 14 with an opening 11 that will conveniently fit on the attachment location 114 of the shaft 112 . the openings 11 are oriented at 90 degrees to attachment locations 114 . the attachment locations 114 are positioned on each side of the shaft 112 such that when the vertical cutter 10 is mounted on the attachment shaft 112 and pulled inside the tube 102 it securely holds the vertical cutter 10 in position so that it can be pulled internally within the tube 102 . as illustrated in fig4 a , the vertical cutter 10 was formed as a single piece , preferably of shaped memory alloy material such as nitinol wherein the material was cut from a blank sheet approximately 0 . 5 mm thick . the blank sheet is illustrated by dashed lines in fig4 a . as shown , the attachment ends 12 and 14 are at the extremes of this sheet where the cutting blade 20 is interposed between the attachment ends 12 , 14 . as shown , the width w b is approximately 2 mm in the exemplary embodiment . punched through the attachment ends 12 , 14 are the attachment holes 11 as illustrated . the cutting blade width w b is substantially uniform across the cutting blade 20 , however may be slightly narrower at a flat portion 25 . the flat portion 25 extends about 3 mm in length . when the shaped memory alloy material is formed into the desired cutting blade shape which is of a general oval nature as illustrated in the top view of fig4 b , the flat portion 25 will be at the very peak of the vertically inclined cutting blade 20 . as shown , the cutting blade sides 22 and 24 are inclined relative to the attachment ends 12 , 14 and are offset slightly lower than the center line of the attachment ends 12 , 14 . this enables the cutting blade 20 when bent in the configuration shown in fig4 b to take the shape as illustrated . the cutting blade sides 22 , 24 extend widthwise a distance w t of approximately 10 . 5 mm in this exemplary embodiment to form a large oval with a flat top . as illustrated in fig4 c , the blade side portion 22 on the attachment end 12 is shown , the other side of the cutting blade 20 has the end portion 24 and 14 ( not illustrated ) similarly inclined . an acute angle is shown of approximately 0 relative to a horizontal plane which can be varied dependent on the length and the amount of height required . however , it is believed important that the angle θ be less than 45 degrees preferably less than 30 degrees as illustrated . with reference to fig4 d , the cutting blade portion 20 has the sides 24 and 22 shown inclined to the flat portion 25 inclined and raised upward relative to the attachment ends 12 , 14 to the flat portion 25 . again , as previously mentioned , the width of the cutting blade 20 is of substantially uniform thickness w b of about 2 mm and has a cutting edge that is also generally uniform in thickness of 0 . 5 mm or less . this provides a substantially strong and yet flexible blade 20 such that it can be retracted and pulled inside the tube 102 . this attachment of the vertical cutter 10 is illustrated in fig5 where the thickness of the blade 20 is illustrated as dimension t . in the exemplary vertical cutter 10 , t was about 0 . 5 mm . with reference to fig6 , the vertical cutter 10 is also shown in the protracted position where it is free of the tool tube 102 . the tool tube 102 has an outside diameter od of approximately 8 mm in this exemplary embodiment with an inside diameter of 6 . 85 mm . the width of the attachment ends 12 , 14 is slightly less than the 6 . 85 mm such that they can slide inwardly to be attached to the shaft 112 at the attachment locations 114 . the vertical cutter 10 , when attached , has a vertical distance from the axis of rotation , this is called the cutting travel distance ct or cutting travel from the axis and it approximately 7 . 3 mm in the exemplary embodiment . this means that the cutting blade 20 extends above the outside diameter of the tool tube 102 by a distance of approximately 3 . 3 mm . it is important to note that this distance cv extending vertically above or below the tube 102 on an inclination , as shown , is achieved when the cutting blade 20 is free from the tube 102 . as shown , the cutting blade 20 will extend vertically upward relative to the axis in such a fashion that the flat end 25 cutting edge can reach a maximum level of 7 . 3 mm in height to the vertebrae surface above it . this allows the cutting blade 20 to cut not only into the disc material , both the nucleus pulposus and the annulus fibrosus , but also to be able to scrape along the interior surface of the vertebral plate . the vertebral plate must be remembered to be somewhat of a saucer shape turned upside down wherein the edges conform inwardly slightly while the inner portion of the vertebral plate is raised in a flattened elevated dome shape . this is important in that the cutting blade 20 is designed to be able to scrape not only the disc material , but also the thin layers of this end plate of the vertebral body . by scraping it , microfractures occur and improved bone surface preparation can be achieved for a fusion implant device . as shown , the flat portion 25 has a width of approximately 3 mm or greater . this enables the device to be pushed and pulled into and out of the disc space without any rotational cutting . all cutting is achieved by linear action and to widen this void space required for the implant it is important to remember that one simply can grab the outer tube 200 that has been inserted into a small incision at the direct location and tilt it laterally slightly left or slightly right on a very small inclination . this allows the cutting blade 20 to move slightly laterally and continued pushing and pulling can create a void space approximately 10 to 15 mm for an implant 9 mm wide if so desired . the cutting blade 20 can be held in a slightly retracted position if lowered cutting heights are need . so on initial cutting , the cutting blade 20 can be slightly retracted and pushed and pulled to cut some material away and then continue to be pushed and pulled in a fully retracted condition due to the flexibility of the cutting blade 20 , it will simply scrape along the bones outer edge removing a thin layer and also provide a good planar surface to receive the fusion implant device . fig7 is a similar view to that of fig6 only showing a side view and only one portion of the blade 20 . it is important to note that since the cutting blade 20 is made in a looped configuration , having a somewhat oval shape flattened at the peak , it provides a substantial amount of width for cutting as the entire cutting edge 21 is on a slight incline meaning that the side surface and the top of the blade 20 form an angulation such that only the edge 21 of the cutting surface is doing the primary cutting , therefore there is no need for a very sharp razor edged blade . this blade 20 will cut at the edge 21 of the width and thickness performing a scraping action to remove both the disc material and the layers of bone material needed to be removed in preparation of the void space . this cutting tool 100 , as illustrated , with the vertical cutter 10 provides a unique way of removing disc material and preparing two adjacent vertebrae for receiving any spinal fusion implant device . the surgeon will simply locate a position on the patient &# 39 ; s back to make an end incision . the surgeon cuts the tissue at the location by making a small incision and inserting a solid tapered dilator to allow insertion of an outer guide tube 200 that will hold the tool tube 102 portion of the tool 100 . this outer tube 200 is illustrated in fig7 . this tube 200 is then placed into the small incision in the desired location and inserted partially therein . this tube 200 will have an outside diameter of approximately 9 . 2 mm when using a tool tube 102 having an outside diameter of 8 mm . this means that the outer tube 200 has an inside diameter of approximately slightly greater than 8 mm so that the tool tube 102 can slide freely in and out of this outer sheathing or guide tube 200 . as illustrated , the surgeon will insert the cutting tool 100 with the retracted vertical cutter 10 inside the tool tube 102 which has been sized to pass through the inside diameter of the guide tube 200 while having the cutting blade 10 stowed internally . the surgeon will use the outer tube 200 to space the adjacent vertebral bodies wherein the disc material is intended to be removed . this spacing of the vertebrae allows the tool tube 102 to slide inward to the disc material and extending past the guide tube 200 directly towards or into the disc space . at this point the surgeon protracts the vertical cutter 10 by rotating the knob 120 . as the cutting blade 20 extends past the tool tube 102 it will be moved into a free position and the shaped memory alloy cutting blade 20 will return to its free and unrestrained condition . as such the blade 20 will then extend above the inner tube by approximately 3 . 3 mm as discussed . when this occurs , the surgeon can then push and pull on the cutting blade 10 creating a void surface by removing the disc tissue . this includes the nucleus pulposus and the annulus fibrosus of the disc . once this is removed the surgeon can continue to remove disc material by tilting on a slight lateral angulation , the entire guide tube 200 and tool 100 inside on a very slight angle using a lateral movement . this increases the width that can be cut such that the flat edge 25 can create a void space of at least 10 to 15 mm wide to receive the fusion implant device of 9 mm . once this has occurred , the surgeon can continue to scrape on the exposed end plate of the vertebral body . by doing this , he or she will create cracks and fissures that will improve the osteoinductivity of the bone material adjacent the implant . this will accelerate the fusion of the bone implant and accelerate the healing time . in order to cut the opposite adjacent vertebral body disc material , the surgeon can either retract if so desired or simply rotate the tool 100 such that it lines up with a vertical downward extension if he has previously cut in a vertical upward position . by extending the tool 100 in a downward direction he can now cut the lower vertebral body disc tissue above it and prepare that space by repeating the procedure in a push pull manner completing all the cutting without any requirement for rotational cutting of disc material . in this way , a chamber or void space that is basically rectilinear and ideally suited for receiving a spinal implant device is formed . once all the material has been cut away and the end plates have been scraped , the device can be retracted and pulled out of the guide tube 200 such that an implant device can be positioned through the guide tube 200 to complete the procedure . while various dimensions have been mentioned for the exemplary embodiment , these dimensions can be varied using the concepts taught herein and will still be within the scope of the present invention . variations in the present invention are possible in light of the description of it provided herein . while certain representative embodiments and details have been shown for the purpose of illustrating the subject invention , it will be apparent to those skilled in this art that various changes and modifications can be made therein without departing from the scope of the subject invention . it is , therefore , to be understood that changes can be made in the particular embodiments described , which will be within the full intended scope of the invention as defined by the following appended claims . | US-201715493783-A |
an electron beam tomography scanning system comprising an electron source generating an electron beam , a target ring that receives the electron beam and emits an x - ray fan beam upon impingement of the electron beam on the target ring , a pair of detector arrays arranged opposite the target ring , and a collimator arranged concentrically between the target ring and the pair of detector arrays . the collimator has interior and exterior walls concentrically arranged with one another and surrounding a patient examination area . the interior and exterior walls have a first set of apertures aligned to collimate the x - ray fan beam into a first collimated beam having a first width and a second collimated beam having a second width . each collimated beam may form a single or double tomographic slice . the collimated beams are detected by the pair of detector arrays . | [ 0017 ] fig1 is a transverse cross - sectional view of an electron beam tomography (“ ebt ”) system 10 , formed in accordance with an embodiment of the present invention . the ebt system 10 includes an electron beam scan tube 12 having a cylindrical portion 14 and a semi - circular conical portion 17 ; and x - ray detector arrays 20 and 21 . the scan tube 12 develops and projects an electron beam 26 towards a semi - circular ring - shaped target (“ target ring ”) 16 . the target ring 16 generates x - rays at portions thereof where the electron beam 26 impinges . the x - rays , after being collimated and subsequently passed through the patient 18 lying along a patient axis denoted by line x , are intercepted and detected by at least one of the detector arrays 20 and / or 21 . a data output of the detector array 20 and / or 21 is processed by a computer system ( not shown ) to form diagnostic images and other information of interest to a physician and the patient . scan tube 12 includes a vacuum envelope 22 , which houses an electron gun 24 in the cylindrical portion 14 . the electron gun 24 projects the axial electron beam 26 through the semi - circular conical portion 17 . focus coils 28 magnetically focus the electron beam 26 to a spot , which impinges on the target ring 16 . bending coils 30 provide a magnetic field to bend the electron beam 26 so that it is directed through the semi - circular conical portion 17 toward the target ring 16 . the bending coils 30 not only deflect the electron beam 26 , but also rapidly and repeatedly sweep the electron beam 26 arcuately along the target ring 16 so as to create a source of x - rays that rotates substantially within a single plane . a collimator assembly 36 ( shown in fig3 - 7 ) is disposed in the beam path between the target ring 16 and the detector arrays 20 and 21 so as to block the unwanted x - rays emitted by the target ring 16 and to define an x - ray beam projected as a one to ten millimeter thick planar fan beam . a sector of the x - ray fan beam is detected by a portion of the x - ray detector array 20 and / or 21 , which provide measured values to the computer in response thereto . [ 0020 ] fig2 is an axial cross - sectional view of an electron beam tomography (“ ebt ”) system 10 , formed in accordance with an embodiment of the present invention . by way of example , the collimator assembly 36 may be donut or circular shaped to surround the scan field 39 . the collimator assembly 36 collimates x - rays projecting from the target ring 16 and projecting onto the detector arrays 20 and 21 . as shown in fig2 only detector array 21 is visible , as detector array 20 is positioned behind and adjacent to detector array 21 . the x - ray fan beam 38 is shown emanating from beam spot 40 . that is , the electron beam 26 impinges on the target ring 16 at the beam spot 40 , which in turn generates the x - ray fan beam 38 . the target ring 16 and the detector arrays 20 and 21 overlap at an overlap region a . the source - only region of the ebt system 10 is denoted by the source - only region b ; while the detector - only region is denoted by the detector - only region c . [ 0021 ] fig3 is a cross - sectional view in a plane that contains axis line x of the collimator assembly 36 in the source - only region b , formed in accordance with an embodiment of the present invention . fig4 is a cross - sectional view in a plane that contains axis line x of the collimator assembly 36 in the detector - only region c , formed in accordance with an embodiment of the present invention . fig5 is a cross - sectional view in a plane that contains axis line x of the collimator assembly 36 in the overlap region a , formed in accordance with an embodiment of the present invention . turning now to fig3 the portion of the collimator assembly 36 in the source - only region b includes first and second rings 41 and 43 , a cover 42 over the first ring 41 , a first pre - patient x - ray surface 44 , a second pre - patient x - ray surface 46 and an inner cavity 48 therebetween . the first pre - patient x - ray surface 44 includes a first x - ray inlet aperture 50 and a second x - ray inlet aperture 52 . the second pre - patient x - ray surface 46 includes a first x - ray outlet aperture 51 and a second x - ray outlet aperture 53 . the first and second pre - patient x - ray surfaces 44 and 46 may be covered by lexan ®, or any other material that allows x - rays to pass through , while at the same time , maintaining the structural integrity of the collimator assembly 36 . the x - ray fan beam 38 is generated from the target ring ( not shown in fig3 ) toward the patient axis x , as shown by the arrows of beams e and f . the x - ray fan beam is collimated through the apertures formed between the blocking portions 54 . the blocking portions 54 may be formed of steel , lead , brass , or other materials that impede the progress of x - rays . the x - ray fan beam 38 may pass through the apertures 50 - 53 , but is blocked by the blocking portions 54 . also , the x - ray fan beam 38 is collimated through the source - only region b before the x - ray fan beam 38 passes through the patient . that is , as discussed below , the x - ray fan beam 38 passes through the collimator assembly 36 in the source - only region b before the x - ray fan beam 38 encounters the patient along the axis denoted by line x and the portion of the collimator assembly 36 in the detector - only region c . the collimator assembly 36 may be positioned such that the following tomographic slices (“ slices ”) may be used to image a patient : ( 1 .) one intermediate slice on one detector array 21 (“ one intermediate slice ”); ( 2 .) one thin slice on detector array 20 and one thin slice on detector array 21 (“ two thin slices ”); ( 3 .) one thick slice on both detector arrays 20 and 21 (“ one thick slice ”); or ( 4 .) one intermediate slice on detector array 20 and one intermediate slice on detector array 21 (“ two intermediate slices ”). the “ one thick slice ” is obtained by using the same collimator position as the “ two intermediate slices ,” but the outputs of the two detectors 20 and 21 are added either electrically or digitally . by way of example only , the thick , intermediate and thin slices may range in width from 10 mm to 1 mm . the slice widths depend on the widths of the apertures 51 and 53 . the apertures 50 - 53 may be sized differently to accommodate different sized slices . for example , if the collimator assembly 36 is set in a first position , the x - ray fan beam ( the center of which is represented by reference line e ) may pass through the first x - ray inlet aperture 50 , through the inner cavity 48 , and then through the first x - ray outlet aperture 51 . then , the x - ray fan beam 38 passes through the patient 18 lying along the axis denoted by line x , then through the collimator assembly 36 at the detector - only region a , until it impinges on one or both of the detector arrays 20 or 21 . because fig3 only shows the collimator assembly 36 in the source only region b , the x - ray fan beam 38 that passes through the collimator assembly 36 in the source - only region b has yet to pass through the patient 18 . if the collimator assembly 36 is positioned to obtain one intermediate slice the collimated x - ray fan beam 38 impinges on detector array 21 when the cone angle of the x - ray fan is minimized . if , however , the collimator assembly 36 is positioned to obtain two equal width slices , such as two thin slices , one half of the collimated x - ray fan beam 38 impinges on the first detector array 20 , while the second half of the collimated x - ray fan beam 38 impinges on the second detector array 21 . the collimator assembly 36 may also be mechanically shifted , either through an actuator , an operator , or the like , to a second position such that the x - ray fan beam 38 may pass through the second x - ray inlet aperture 52 to the second x - ray oulet aperture 53 ( with the center of the x - ray fan beam 38 being denoted by reference line f ). the second x - ray inlet aperture 52 may be a different size than the first x - ray inlet aperture 50 and the second x - ray outlet aperture 53 may be a different size than the first x - ray outlet aperture 51 . thus , different size slices may be obtained depending upon whether the first or second x - ray inlet and outlet apertures 50 and 51 or 52 and 53 are used , which is determined by the position of the collimator assembly 36 . that is , the collimator assembly 36 may be in a first position to obtain a first single slice ( such as the single intermediate slice if the x - ray fan beam 38 passes through the first x - ray inlet aperture 50 and first x - ray outlet aperture 51 ), a second position to obtain a first double slice ( such as two thin slices if the x - ray fan beam 38 passes through the first x - ray inlet and outlet apertures 50 and 51 , respectively ); a third position to obtain a second single slice ( such as the single thick slice if the x - ray fan beam 38 passes through the second x - ray inlet aperture 52 and the second x - ray outlet aperture 53 ); and the third position to obtain a second double slice ( such as two intermediate slices if the x - ray fan beam 38 passes through the second x - ray inlet and outlet apertures 52 and 53 , respectively ). thus , the collimator assembly 36 may be moved , actuated , or otherwise shifted through multiple positions to obtain different slice thicknesses and combinations . the detector assembly ( including detector arrays 20 and 21 ) is also positioned differently for each collimator assembly 36 position . the collimator assembly 36 may be shifted through three different positions , while the detector arrays 20 and 21 are shifted through two different positions to provide four different slice configurations . that is , the collimator assembly 36 may be in a first position , while the detector arrays are in a first position to provide a first slice configuration . the collimator assembly 36 may be in a second position , while the detector arrays 20 and 21 are in a second position to provide a second slice configuration . further , the collimator assembly 36 may be in a third position , while the detector arrays 20 and 21 are in the second position to provide a third and fourth slice configurations . with respect to fig4 the portion of the collimator assembly 36 in the detector - only region c includes the first ring 41 , the cover 42 and second ring 43 . additionally , the collimator assembly 36 in the detector - only region c includes a first post - patient x - ray surface 58 , a second post - patient x - ray surface 60 and an inner cavity 62 . the first post - patient x - ray surface 58 includes a first x - ray inlet aperture 64 and a second x - ray inlet aperture 66 . the second post - patient x - ray surface 60 includes a first x - ray outlet aperture 65 and a second x - ray outlet aperture 67 . the first and second post - patient x - ray surfaces 58 and 60 may be covered with lexan ®, or any other material that allows x - rays to pass through , while at the same time , maintaining the structural integrity of the collimator assembly 36 . the x - ray fan beam 38 passes through the collimator assembly 36 in the detector - only region c after the x - ray fan beam 38 passes through the source - only region b and the patient lying along the axis x . it is noted that e ′ and f ′ represent that the x - ray fan beam 38 has passed through the patient lying along the axis x ; whereas e and f , as shown in fig3 represent that the x - ray fan beam 38 has not yet passed through the patient . additionally , once the x - ray fan beam 38 has encountered the collimator assembly 36 in the source - only region b , the x - ray fan beam 38 is a collimated beam . that is , the collimator assembly 36 collimates the x - ray fan beam 38 into a collimated beam . the x - ray fan beam 38 passes through the patient lying along the axis x . after passing through the patient , the x - ray fan beam 38 passes through the first post - patient x - ray surface 58 , through the inner cavity 62 , and then through the second post - patient x - ray surface 60 . as mentioned above , the blocking portions 54 may be formed of steel , lead , brass , or other materials that impede the progress of x - rays . the collimated x - ray fan beam 38 may pass through the apertures 64 - 67 . the blocking portions 54 prevent scattered x - rays from reaching the detector arrays 20 and 21 . as discussed above , the collimator assembly 36 may be positioned such that the following tomographic slices may be used to image a patient : ( 1 .) one intermediate slice ; ( 2 .) two thin slices ; ( 3 .) one thick slice ; or ( 4 .) two intermediate slices . the slice thickness depends on the width of the apertures 51 and 53 . the apertures 64 - 67 may be sized differently to accommodate different size slices . for example , if the collimator is set in a first position , the x - ray fan beam ( the center of which is represented by reference line e ′) may pass through the first x - ray inlet aperture 64 , then through the inner cavity 62 , and through the x - ray outlet aperture 65 . then , the x - ray fan beam 38 impinges on one or both of the detector arrays 20 or 21 . because fig4 only shows the collimator assembly 36 in the detector - only region c , the x - ray fan beam 38 that passes through the collimator assembly 36 in the detector - only region c has already passed through the patient 18 . if the collimator assembly 36 is positioned to obtain one slice , such as a 3 mm slice , the collimated x - ray fan beam 38 impinges on one detector array 21 . if , however , the collimator assembly 36 is positioned to obtain two equal width slices , such as two thin slices , one half of the collimated x - ray fan beam 38 impinges on the first detector array 20 , while the second half of the collimated x - ray fan beam 38 impinges on the second detector array 21 . the collimator assembly 36 may also be shifted to a second position such that the x - ray fan beam 38 may pass from the second x - ray inlet aperture 66 to the second x - ray outlet aperture 67 ( with the center of the x - ray fan beam 38 being denoted by reference line f ′). the second x - ray inlet aperture 66 may be a different size than the first x - ray inlet aperture 64 ; while the second x - ray outlet aperture 67 may be a different size than the first x - ray outlet aperture 65 . thus , different sized slices may be accommodated depending on the position of the collimator assembly 36 . that is , the collimator assembly 36 may be in a first position to obtain one intermediate slice ( when the x - ray fan beam 38 passes through the first x - ray inlet aperture 64 and the first x - ray outlet aperture 65 ), a second position to obtain two thin slices ( when the x - ray fan beam 38 passes through the first x - ray inlet and outlet apertures 64 and 65 , respectively ); a third position to obtain one thick slice ( when the x - ray fan beam 38 passes through the second x - ray inlet aperture 66 and second x - ray outlet aperture 67 ); and the same third position to obtain two intermediate slices ( when the x - ray fan beam 38 passes through the second x - ray inlet and outlet apertures 66 and 67 , respectively ). additionally , the apertures 64 - 67 are wider than the apertures 50 - 53 to accommodate the width of the x - ray fan beam 38 . that is , the collimated x - ray fan beam 38 is wider near the detector arrays 20 and 21 than by the target ring 16 , which is the x - ray source . with respect to fig5 the portion of the collimator assembly 36 in the overlap region a includes the first ring 41 , the second ring 43 , and the cover 42 over the first ring 41 . additionally , the collimator assembly 36 in the overlap region a includes a first x - ray surface 70 , a second x - ray surface 72 and an inner cavity 73 . the x - ray surface 44 , 60 and 70 are physically the same cylindrical surface ; and x - ray surface 46 , 58 and 72 are physically a second cylindrical surface . cavities 48 , 62 and 73 are the same donut shaped cavity . each aperture pair 50 , 74 ; 51 , 75 ; 52 , 76 ; 53 , 77 ; 64 , 78 ; 65 , 79 ; 66 , 80 and 67 , 81 is physically a single continuous aperture . the first x - ray surface 70 includes a first pre - patient x - ray inlet aperture 74 , a second pre - patient x - ray inlet aperture 76 , a first post - patient x - ray outlet aperture 79 , and a second post - patient x - ray outlet aperture 81 . the second x - ray surface 72 includes a first pre - patient x - ray outlet aperture 75 , second pre - patient x - ray outlet aperture 77 , a first post - patient x - ray inlet aperture 78 and a second post - patient x - ray inlet aperture 80 . because the collimator assembly 36 is positioned within the overlap region a , the portion of the collimator within the overlap region a includes x - ray inlet and outlet apertures on both x - ray surfaces 70 and 72 to accommodate the sweeping of the x - ray fan beam 38 . that is , at a first radial angle , the x - ray fan beam 38 passes through the collimator assembly 36 in the overlap region a before it passes through the patient 18 lying along the axis x . however , when the x - ray fan beam 38 is radially rotated toward the other side of the collimator assembly 36 , the same portion of the collimator assembly 36 in the overlap region receives the x - ray fan beam 38 after the x - ray fan beam 38 passes through the patient 18 lying along the axis x . for example , as shown in fig2 the beam spot ( i . e ., the point from which the x - ray fan beam 38 emanates ) may be at the position marked by reference numeral 84 . the beam spot may then be swept to a position denoted by reference numeral 86 . thus , the collimator assembly 36 includes corresponding apertures to accommodate both pre and post patient x - ray fan beams . referring again to fig5 the first and second x - ray surfaces 70 and 72 may be covered with lexan ®, or any other material that allows x - rays to pass through , while at the same time , maintaining the structural integrity of the collimator assembly 36 . the x - ray fan beam 38 passes between the apertures as described above with respect to fig3 and 4 . for example , for one intermediate slice or two thin slices , the x - ray fan beam 38 ( the center of which is denoted by line e , for a pre - patient x - ray fan beam 38 ) passes from the first pre - patient x - ray inlet aperture 74 to the first pre - patient x - ray outlet aperture 75 . the x - ray fan beam 38 then passes through the patient and encounters the other side of the collimator assembly 36 in the overlap region , such that the x - ray fan beam passes between an analogous first post - patient x - ray inlet aperture 78 ′ to an analogous first post - patient x - ray outlet aperture 79 ′ ( the center of the post - patient beam is denoted by reference line e ′). for one thick slice or two intermediate slices , the collimator assembly 36 is shifted such that the x - ray fan beam 38 passes from the second pre - patient x - ray inlet aperture 76 to the second pre - patient x - ray outlet aperture 77 . the x - ray fan beam 38 then passes through the patient lying along the axis x . after passing through the patient , the x - ray fan beam 38 encounters the corresponding other side of the collimator assembly 36 in the overlap region a such that the post patient x - ray fan beam 38 passes from an analogous second post - patient x - ray inlet aperture 80 ′ to an analogous second post - patient x - ray outlet aperture 81 ′. in general , if a pre - patient x - ray fan beam 38 impinges on the collimator assembly 36 in the overlap region a , the resulting post - patient x - ray fan beam 38 impinges on the other side of the collimator assembly 36 in the overlap region a . [ 0035 ] fig6 is a cross - sectional view in a plane that contains axis line x of fig1 of both sides of the collimator assembly 36 in the overlap region a , formed in accordance with an embodiment of the present invention . as noted in fig6 the horizontal scale is approximately 4 : 1 , while the vertical scale is approximately 1 : 10 . fig6 represents the one intermediate slice and two thin slice portion of the ebt system 10 . the narrower the slice width , the better the axial resolution ( narrower slice widths also result in reduced dosage to the patient ). fig6 illustrates the ebt system 10 on the left side of reference line g , shown in fig5 . the patient 18 lies along the axis x . the x - ray fan beam 38 emanates from the beam spot 40 . the x - ray fan beam 38 has sides 138 and 238 . the x - ray fan beam 38 passes from the first pre - patient x - ray inlet aperture 74 through the first pre - patient x - ray outlet aperture 75 . the x - ray fan beam 38 then passes through the patient lying along the axis x . the x - ray fan beam 38 then passes through the first post - patient x - ray inlet aperture 78 ′ on through the first post - patient x - ray outlet aperture 79 ′. as shown in fig6 the apertures 74 , 75 , 78 , 79 ( and 74 ′, 75 ′, 78 ′ and 79 ′) are formed such that the x - ray fan beam 38 impinges on the detector array ( s ) at a first intermediate width . when the collimator assembly 36 is in a first position , as shown in fig6 one half of the x - ray fan beam 38 impinges on the first detector 20 , while the other half of the x - ray fan beam 38 impinges on the second detector 21 ( thus , two thin slices are detected ). however , the collimator assembly 36 and detector arrays 20 and 21 may be shifted to a second position such that x - ray fan beam 38 impinges only on the second detector 21 ( resulting in one intermediate slice ). for example , reference slot 222 shows where the first pre - patient x - ray outlet 75 shifts ( thus , the other apertures would also shift ), for the x - ray fan beam defined by sides 338 and 438 to impinge solely on the second detector 21 . additionally , the x - ray fan beam 38 may be swept through a 180 degree radial arc such that the x - ray fan beam 38 ′ emanates from beam spot 40 ′. in this case , the electron fan beam 38 ′ is defined by sides 138 ′ and 238 ′. [ 0037 ] fig7 is a cross - sectional view of both sides of the collimator assembly 36 in the overlap region a , formed in accordance with an embodiment of the present invention . as noted in fig6 the horizontal scale is approximately 4 : 1 , while the vertical scale is approximately 1 : 10 . fig7 represents the one thick slice and two intermediate slice portions of the ebt system 10 . that is , fig7 illustrates the ebt system 10 on the right side of reference line g , shown in fig5 . the patient 18 lies along the axis x . the x - ray fan beam 38 emanates from the beam spot 40 . the x - ray fan beam 38 has sides 138 and 238 . the x - ray fan beam 38 passes from the second pre - patient x - ray inlet aperture 76 through the first pre - patient x - ray outlet aperture 77 . the x - ray fan beam 38 then passes through the patient lying along the axis x . the x - ray fan beam 38 then passes through the second post - patient x - ray inlet aperture 80 ′ on through the second post - patient x - ray outlet aperture 81 ′. as shown in fig7 the apertures 76 , 77 , 80 and 81 ; ( and 76 ′, 77 ′, 80 ′ and 81 ′) are formed such that the x - ray fan beam 38 impinges on the detector array ( s ) at a thick width . when the collimator assembly 36 is in the position , as shown in fig7 one half of the x - ray fan beam 38 impinges on the first detector 20 , while the other half of the x - ray fan beam 38 impinges on the second detector 21 ( resulting in two intermediate slices ). however , data from the two detector arrays 20 and 21 may be added resulting in one thick slice . additionally , the x - ray fan beam 38 may be swept through a 180 degree arc such that the x - ray fan beam 38 ′ emanates from beam spot 40 ′. in this case , the electron fan beam 38 ′ is defined by sides 138 ′ and 238 ′. the collimator assembly 36 of the ebt system 10 is not limited to the slice configurations described above . a wide variety of slice configurations , in addition to the one thick , two intermediate , one intermediate , and two thin slice configurations , may be implemented within the system . additionally , the collimator may include more apertures that may allow for an increased number of slice configurations . for example , the collimator may include more than two sets of x - ray inlet and outlet apertures . that is , the collimator may include a set of apertures for one thick / two intermediate slices , another set of apertures for one intermediate / two thin slices , another set of apertures for one thin slice / two very thin slices , etc . also , additionally , more than two detector arrays may be used . for example , instead of having two detector arrays aligned with , and adjacent one another , three or more detector arrays may be utilized . also , multiple target rings may be used within the ebt system . thus , embodiments of the present invention provide a more efficient ( and less expensive ) dual - slice ebt scanner , because a single collimator may be used to collimate an x - ray fan beam at a plurality of slice widths . while the invention has been described with reference to certain embodiments , it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the scope of the invention . in addition , many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from its scope . therefore , it is intended that the invention not be limited to the particular embodiment disclosed , but that the invention will include all embodiments falling within the scope of the appended claims . | US-6418202-A |
a medical retrieval device for retrieving foreign objects from a patient and the method of constructing the device are disclosed . the device incorporates a wire cable composed of a precursor alloy to a superelastic material to improve durability of the device . because precursor alloys exhibit a linear stress - strain relationship and a yield point associated with a relatively high stress level , the device transfers greater stresses before experiencing deformation . thus , greater crushing forces can be achieved using a device of this type . these crushing forces may be needed when the foreign object is too large to remove intact . this property also facilitates the device in dilating ducts to retrieve foreign objects . using the precursor alloy additionally eliminates the need for heat treatment of the cables used in constructing the device . a retrieval device made of precursor alloy cable also is less susceptible to permanent deformation and unwinding during use . | the various aspects of this invention generally pertain to a device , and a method for manufacturing such a device , for retrieving foreign objects in a body from locations requiring traversal of narrow passages . in use , such a device must be able to collapse into a relatively narrow space for traversal purposes and to expand in that space for retrieval purposes . the device also must have strength characteristics so that the device can crush objects to facilitate capturing and removal . additionally , the device must reconfigure to it original shape when expanded and retain its ability to reconfigure to the original shape for repeated deployments without losing strength and without suffering permanent deformation . to accomplish these objectives and to overcome the problems associated with existing devices of this kind , a retrieval device of the present invention incorporates a precursor alloy into the stranded cable used for making the device . when subject to heat treatment , a precursor alloy results in the formation of a superelastic alloy . prior to heat treatment , such a precursor alloy exhibits high elongation and a linear stress - strain relationship with a yield point . because of these properties , the use of a precursor alloy in the manufacture of the device according to the present invention achieves greater strength , longer life , and ease in manufacture , as will be explained . unlike a superelastic alloy , a precursor alloy used in a medical retrieval device of the present invention exhibits a linear stress - strain relationship with a plastic yield point . for comparison purposes , schematics of the stress - strain curves for a superelastic alloy and a precursor alloy are shown in fig1 a and 1 b , respectively . as shown in fig1 a , as a superelastic alloy undergoes increased stress , strain increases to phase transformation point x . at x , the superelastic alloy transforms from an austenitic phase to a martensitic phase . thereafter , stress remains substantially constant as strain increases , forming a substantially constant stress plateau p . upon releasing the stress on the superelastic alloy , the reversibly deformable nature of the material allows it to return to its original length following curve y in the figure . the cycle shown often occurs repeatedly with no appreciable change in dimension or plastic deformation of the wire . therefore , the superelastic alloy withstands a relatively large strain prior to the phase transformation point , and additional strain during the phase transformation , without plastic deformation . furthermore , the phase transformation and reversible deformation of the superelastic alloy occurs at relatively low stress levels . during the superelastic alloy phase transformation , applied stress is absorbed by the alloy to facilitate the phase transformation , and is not available to be transferred to another object , such as a stone . a precursor alloy material exhibits the stress - strain characteristics shown in fig1 b . up to the plastic yield point z , strain increases in a reversible manner as stress increases . that is , the precursor alloy returns to its normal configuration upon release of stresses prior to reaching plastic yield point z . moreover , the precursor alloy does not pass through a substantially constant stress plateau as does the superelastic alloy . at stresses above yield point z , the precursor alloy becomes plastically and irreversibly deformed , unlike the superelastic alloy . as shown in fig1 a and 1 b , yield point z of the precursor alloy generally occurs at higher stress levels than does phase transformation point x of the superelastic material . this enables the device of the present invention to transfer greater stress to stones during lithotripsy , as well as facilitating dilation of ducts . accordingly , the inventive devices facilitate retrieval and removal , while maintaining shape and strength over repeated uses . in addition to requiring heat treatment of the precursor alloy to produce the superelastic material , a conventional retrieval device also requires heat treatment during the formation of the basket so that the superelastic wires maintain their shape . in contrast , a result of the plastic yield point associated with a precursor alloy , the basket of the present device forms easily by mechanically bending the precursor alloy wire beyond its yield point and into shape . sophisticated heat treatments are thus unnecessary in the manufacture of the inventive device . moreover , because of the superelastic nature of the heat - treated alloys used in conventional devices , a stranded cable made entirely of a superelastic material is ineffective due to phase transformation deformation and unwinding problems , as mentioned above . however , precursor alloys are highly elastic but also can be plastically deformed . thus , in a preferred embodiment of the present invention , a cable for a retrieval device is made entirely of a precursor alloy core and precursor alloy strands . it is contemplated that the strands and the core can be made of identical precursor alloy or different precursor alloys . if different precursor alloys are used , it is preferred to select wire dimensions and types such that the wires exhibit similar deformations when subjected to a given load . in either case , the cable will experience neither unwinding nor excessive deformation as would a cable that includes superelastic strands . furthermore , using a consistent material configuration for both the strands and the core would eliminate problems associated with elongation of the core relative to the surrounding strands leading to permanent damage to the basket . finally , a cable made entirely of wires of the same precursor alloy material facilitates the manufacturing process . reference will now be made in detail to the present exemplary embodiments of the invention , examples of which are illustrated in fig2 and 3 . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . in accordance with embodiments of the present invention , an endoscopic retrieval device 5 is formed from a stranded cable having the basic configuration shown in either fig2 a or fig2 b . fig2 a shows a cross - section of cable of a first embodiment of the device 5 . a cable 1 includes a core monofilament wire 2 made of precursor alloy . surrounding core wire 2 are strands 3 of stainless steel wire . due to the presence of the precursor alloy core wire 2 , device 5 suffers from less deformation problems than does a conventional device of this type that includes a superelastic core . this is because , as previously discussed , precursor alloys exhibit less elongation than do superelastic materials and therefore differences in the elongation between surrounding strands 3 and core wire 2 will be minimized . fig2 b shows a more preferred embodiment of a stranded cable for use in the endoscopic retrieval device 5 . in this embodiment , a cable 1 ′ includes a core wire 2 ′ made of a precursor alloy , as in fig2 a . however , surrounding strands 3 ′ in this embodiment also are formed of precursor alloy , either of identical or different precursor alloy material as core wire 2 ′. as discussed previously , this embodiment is preferred because the cables made entirely of precursor alloy wires ( core and strands ) will not unwind and are capable of transferring greater stress to objects without deforming . additionally , cables made of entirely of the same precursor alloy alleviate deformation problems associated with different rates of elongation between the core and strands . when selecting wires of different precursor alloys , it is preferable to impart consistent mechanical properties to the cable . a person having ordinary skill in the art would realize that such consistency can be achieved by varying such factors as , for example , the nature of the alloys of the surrounding strands and core wire , relative dimensions of the core wire and the surrounding strands , the winding pattern of the strands around the core wire , and the post processing of the cable . fig2 a and 2 b show six surrounding wire strands 3 and 3 ′, respectively . preferably , there are at least five surrounding wire strands 3 or 3 ′. however , it is contemplated that the number of surrounding strands can be varied in accordance with the particular use for the device or the desired characteristics of the cable . in both fig2 a and 2 b , the precursor alloy is in a martensitic phase at room temperature to body temperature . the precursor alloy can be a precursor nitinol or other material exhibiting like properties and known to those having ordinary skill in the art . such other precursor alloys that may be used include , for example , silver - cadmium , gold - cadmium , gold - copper - zinc , copper - zinc , copper - zinc - aluminum , copper - zinc - tin , copper - zinc - xenon , iron - beryllium , iron - platinum , indium - thallium , iron - manganese , nickel - titanium - vanadium , iron - nickel - titanium - cobalt , and copper - tin . in one preferred form of the invention , the overall diameter of the cable is approximately 0 . 017 inches . the materials used for the precursor alloy , the number of strands forming the cable , and the overall diameter of the cable can be modified according to the particular use or desired characteristics of the device . the selection of these parameters would be obvious to one having ordinary skill in the art . fig3 shows the overall construction of endoscopic retrieval device 5 . typically , four cables 1 or 1 ′ form basket 6 . however , any number of cables can be used and would be obvious to one having ordinary skill in the art depending on the use or desired characteristics of the basket . a bullet - shaped nosepiece 7 can be attached to a distal end of device 5 to improve guidance of device 5 during use , as well as to secure cables 1 or 1 ′ to each other . a coupling tube 8 , attached to a proximal end of basket 6 , also facilitates manipulation of device 5 during the retrieval process . coupling tube 8 also could take the form of a cannula , in which case basket 6 would retract into the cannula prior to retrieval . laser welding represents one preferred mode of attachment of bullet - shaped nosepiece 7 and coupling tube 8 to basket 6 . however , other suitable attachment methods known to those skilled in the art are within the scope of the present invention . device 5 is used to traverse narrow passages to retrieve , crush , and remove foreign objects within the body . device 5 can be deployed from a cannula or traverse independently through the body , collapsing and deploying as necessary . device 5 also may be used repeatedly to retrieve , crush , and remove foreign objects . the manufacture of device 5 first involves forming cables 1 , 1 ′. to form these cables , a precursor alloy wire is supplied as the core wire and surrounding strands of wire are placed approximately evenly - spaced around the perimeter of the core wire . surrounding strands wrap around the core in an essentially helical fashion along its length . the strands can be wrapped clockwise , counterclockwise , or any combination thereof , depending on the desired properties of the cable . a preferred embodiment has strands wrapping clockwise around the core wire , similar to threads of a right - hand screw . the cable can then be rotary swaged , which helps to straighten it and increase its column strength . as discussed with reference to fig2 a and 2 b , the surrounding strands can be made of stainless steel , or other like , suitable material , or most preferably precursor alloy . several cables , preferably approximately four cables 1 or 1 ′, are then bent past the yield point of either the precursor alloy or stainless steel to form basket 6 . after forming basket 6 , cables 1 or 1 ′ are joined together at one end , through welding or other suitable joining method known to those skilled in the art . laser welding cables 1 or 1 ′ to coupling tube 8 or , if desired , to the retractable portion of a retaining cannula , represents another method to connect and secure the cables to each other . as discussed with reference to fig3 a nosepiece can be laser welded , or otherwise attached in any suitable manner , to the end of basket 6 to guide device 5 through the body . it is important that during welding or other connecting operations involving heat , that temperature is controlled to prevent heat treating the cable such that the precursor alloys are converted to superelastic materials . the stranded cable configuration used in the retrieval device according to the present invention provides the durability necessary to perform lithotripsy and dilation and be repeatedly employed for retrieval processes . incorporating precursor alloy wire into the cable as opposed to a superelastic material such as nitinol enables the device to be manufactured without heat treatment processes . additionally , because precursor alloys do not exhibit the extreme elongation characteristic of superelastic materials , problems of permanent deformation are alleviated when surrounding stainless steel wire strands are used to form the cable . using precursor alloys also allows for the manufacture of a cable comprised entirely of precursor alloy wire , including the surrounding strands and the core . whether identical precursor alloy is used for both , or the precursor alloy used for the strands differs from that used for the core , the device will be capable of transferring greater stress to objects without deformation and will not unwind . additionally , using the same precursor alloy for both the strands and the core facilitates overall manufacture of the device and provides a device of consistent characteristics that will not deform due to disparate elongation properties within the cables . although the use of a basket type retrieval device has been discussed and shown in the figures , it is contemplated that the device can be of the snare type . a snare made of the precursor alloys discussed above would retain its shape better than conventional stainless steel snare devices . furthermore , although most of the above discussion pertains to using the inventive device to remove gallstones , it should be appreciated that the devices can be used for removing a variety of other foreign objects having various locations within the body . it will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein that various modifications and variations can be made in the endoscopic retrieval device formed of precursor alloy cable of the present invention . therefore , the invention in its broader aspects is not limited to the specific details and illustrative examples shown and described in the specification . it is intended that departures may be made from such details without departing from the true spirit or scope of the general inventive concept as defined by the following claims and their equivalents . | US-42755399-A |
a cover for a blood pressure cuff is disclosed . a base portion with tabs removably attaches to the blood pressure cuff . the base portion has attached to it a stack of sheets . the stack features multiple sheets of thin material where each sheet can be ripped off the stack after the blood pressure cuff has been used to take a patient &# 39 ; s blood pressure . sequential numbers on each sheet allow for tracking of use patterns . | many aspects of the invention can be better understood with the references made to the drawings below . the components in the drawings are not necessarily drawn to scale . instead , emphasis is placed upon clearly illustrating the components of the present invention . moreover , like reference numerals designate corresponding parts through the several views in the drawings . 20 . blood pressure cuff fitted with base portion with rip - away films . fig1 is a top view of one preferred embodiment of the invention , with a view of the base portion , generally referenced as 1 , of the invention as initially manufactured and before the bends or crimps are put in to create the tabs that removably secure the invention to the blood pressure cuff . the base portion is used to grip the blood pressure cuff through the tabs , and the center flat portion 4 is where the stack of thin , prophylactic sheets is attached . the tabs 2 , have a non - adhesive portion 3 that can be used to removably adhere the base 1 to a blood pressure cuff . fig2 is a perspective view of the invention removably attached to a blood pressure cuff . the bottom sheet 26 lies at the bottom of an entire stack of sheet ( illustrated in fig3 ) that lie on top of the blood pressure cuff , generally referenced as 20 , held in place by the tabs 2 , which in this figure have been wrapped completely over the blood pressure cuff to removably secure the invention to the blood pressure cuff . ( the only portion of the blood pressure cuff that is not covered by the bottom sheet 26 is the attachment portion 21 /) the bottom sheet 26 will cover the portion of the cuff from one end of the cuff up to the distal end of range marker . the bottom sheet 26 and the rest of the sheets are wrapped around a patient &# 39 ; s arm , and the blood pressure cuff secured by hook and loop or some other known means of attachment located on the backside of the blood pressure cuff . the range 25 indicates the size of a patient &# 39 ; s arm upon which the invention can be used . the targets 24 indicate location of arteries to allow the user of the invention to correctly place it . a tube 22 from the blood pressure cuff can be attached through a ( valve ) connector 23 to a source of air pressure . fig3 is a perspective , exploded view of the current invention showing both the base portion and the rip - away sheets attached to a blood pressure cuff . a stack 40 of rip - away sheets is attached to a base 1 . the base is removably fit over a blood pressure cuff 20 with tabs 2 , which have a non - adhesive section 3 for easy attachment and removal . the stack 40 has a plurality of thin sheets that are sufficient to cover the skin of a patient such that any germs or viruses from the blood pressure cuff 20 do not touch the patient , and so that any germs or viruses that the patient is carrying do not , in turn , rub off on the blood pressure cuff 20 and infect subsequent users . after the device is used on the first patient , the tube 22 is kept to the side and the uppermost sheet 42 is ripped off and disposed of , leaving the second sheet 43 in the stack 40 for protecting the skin of the next patient . this assembly line continues until all the sheets are used up , whereupon the clinician merely removes the base 1 from the blood pressure cuff 20 and puts on another full stack 40 . each sheet can be numbered 41 such that the number on the uppermost sheet 42 goes up ( or down ) by the count of one for every patient the clinician takes a blood pressure reading upon . this makes the clinicians more accountable for actually using the device as it was intended , and give a supervisor the ability to check up on clinicians to make sure they are providing the maximum protection to their patients from viruses , dirt and germs contained on the blood pressure cuff . the base 1 has a flat cover 4 that covers a portion of the blood pressure cuff , and two or more tabs 2 that can be folded down to allow the base 1 to removably attach to the blood pressure cuff 20 . several versions of the tabs are contemplated . first , the base could be manufactured from rigid cardboard , such that when the tabs were bent over and around the blood pressure cuff , they would grip it with merely physical pressure . second , the tab portions could have an adhesive substance 2 laid on them such that once the tab is folded over the blood pressure cuff it would stick . in either case , when the invention is in place , that portion of the blood pressure cuff that normally touches the skin , is covered by the stack of sheets and the patient is protected by the uppermost sheet 42 . the velcro ® or other hook and loop fastener or other means of attachment 21 at the end of the blood pressure cuff wraps the invention tightly around the arm of the user , thereby ensuring that the patient &# 39 ; s arm never touches the actual blood pressure cuff 20 . in this particular figure , the tab 2 has a rectangular section that has its inside surface covered with a tacky but not permanent adhesive , and a semi - circular region 3 that is not covered with any adhesive . thus , to remove the invention from a blood pressure cuff , the user need only grasp the non - adhesive portion 3 of the tab 2 and pull it off . the design of the rip - away film is important , as the film is strong enough to avoid ripping when being used to encircle the arm of the patient , and yet thin enough so that a substantial number of sheets can be pressed , laminated , or otherwise pressed together to present a small profile and yet have enough sheets to maximize the time between having to replace the base . a number of mechanisms are contemplated to allow a user to grasp and tear off individual sheets . there could be a weak adhesive applied in between the individual sheets except for a corner , end or some sort of tab . the sheets could also have perforations at their rear section to allow for a clean tear - away . the rip - away sheets or film are also thin enough to allow a clinician to take accurate blood pressure readings even with the stack of sheets in place . individual sheets can be numbered 41 , such that the number of sheets ripped off during a certain time period can be easily quantified . thus , if the hospital directs its clinicians to tear off a single sheet after each patient , and the clinician begins a day &# 39 ; s inventory on sheet # 55 , the supervisor could make periodic checks and after seeing ten patients , the uppermost sheet should be sheet # 45 . this would put the clinicians under pressure to use the invention , as opposed to the current art which allows a clinician to “ clean ” ( or at least say they “ cleaned ”) blood pressure cuffs through applying a wet antiseptic cloth for three minutes and leaving it to dry for two additional minutes ( which is why blood pressure cuffs are rarely cleaned at all , much less between each patient ). other embodiments of the base portion are contemplated , including using hook - and - loop fasteners on the back of the base portion , or on a portion of the base portion , to attach it directly to the blood pressure cuff . it is also contemplated that the tabs could grip the blood pressure cuff through hook - and - loop fasteners , snaps , magnets and other known means of removable attachment . the invention as described in this provisional patent application could be used for a blood pressure cuff that goes around the wrist , upper arm , or leg . while the upper arm version is by far the most popular , and therefore the one illustrated in the drawings , it should be understood that it is contemplated using this same technology on different types of blood pressure cuffs . it should be understood that while the preferred embodiments of the invention are described in some detail herein , the present disclosure is made by way of example only and that variations and changes thereto are possible without departing from the subject matter coming within the scope of the following claims , and a reasonable equivalency thereof , which claims i regard as my invention . all of the material in this patent document is subject to copyright protection under the copyright laws of the united states and other countries . the copyright owner has no objection to the facsimile reproduction by anyone of the patent document or the patent disclosure , as it appears in official governmental records but , otherwise , all other copyright rights whatsoever are reserved . | US-201615043523-A |
water swellable absorbent articles , made from latexes having a copolymerized crosslinker , together with methods for their preparation , and a composition containing a copolymerized crosslinker useful to make said articles are disclosed . the articles are crosslinked by heating and / or removing substantially all of the water from the precursor composition . the absorbent articles are useful as surgical sponges , diapers , tampons , meat trays , bath mats and the like . | the mechanism through which the polyelectrolytes of this invention cure themselves ( i . e . without an added curing agent ) involves the condensation of a pendant carboxylic acid group on one polymer chain with a substituted amide group on another polymer chain with the resulting elimination of a molecule of water or alcohol . this reaction is thermodynamically possible at any temperature but for all practical purposes only proceeds at elevated temperatures . since the reaction is dependent on two separate species coming together in solution , the rate is concentration dependent and once the composition is applied to a substrate and evaporation of solvent begins , the rate of cross - linking accelerates . applying heat at this time increases the rate even more . if the crosslinking reaction is allowed to occur in the original solution as by heating or prolonged storage , the absorbent article of this invention cannot be fabricated . the solution will become progressively more viscous and stringy until it forms a continuous gel which cannot be spread , sprayed or spun . examples of useful alkyl acrylates are methyl acrylate , ethyl acrylate , propyl acrylate , hexyl acrylate and the like . examples of useful alkyl methacrylates are butyl methacrylates , hexyl methacrylates , octyl methacrylate , decyl methacrylate and the like . the foregoing polyacrylates are then dissolved in an aqueous alkali metal hydroxide solution . generally the equivalents of hydroxide solution used are from about 30 to about 70 percent based on the molar concentration of polymerized monomer and the preferred amount is from about 40 to about 55 percent . in any event , the amount of hydroxide solution added is sufficient to convert or saponify some of the acrylate esters to alkali metal carboxylates and to neutralize the carboxylic groups of the polyacrylate used into alkali metal carboxylates so that the converted polyacrylate has about 30 to about 70 weight percent of alkali metal carboxylates . the foregoing aqueous solution can be used per se to prepare the final products of this invention . however , it is sometimes advantageous to add various amounts of volatile monohydric alcohols to control the viscosity of the aqueous solutions and increase the rate of drying . examples of useful monohydric alcohols are lower alkanols such as methyl alcohol , ethyl alcohol and propyl alcohol . the n - substituted acrylamides that are useful in this invention have the following generic formula : wherein r is selected from hydrogen or methyl and r &# 39 ; is hydrogen or an alkyl group of 1 - 8 carbons . in the method of making water swellable films by the present invention , the above composition of the polyelectrolytes having a ph range from 7 to 9 is acidified by adding organic or inorganic acids to a ph range 3 to 6 and spread on a flat plate or roller of metal , plastic , or other impervious substrate and heated to a temperature greater than 30 ° c . to crosslink the polyelectrolyte and drive off the excess water and / or alcohol . the film is then peeled off the plate or roller by a scraper to recover the intact film for subsequent storage or use . it is sometimes desirable to add a small amount of a surfactant to the polyelectrolyte composition to aid in flowing on and removing the continuous film from the water impervious substrate . a secondary benefit of using a surfactant is to increase the wettability of the final dry absorbent film . either anionic or nonionic surfactants may be used . examples of the useful surfactants are the sodium alkyl sulfonates and ethylene oxide derivatives or alkylated phenols and the like . similarly , when an absorbent article is prepared , the article which is to be the substrate is coated with the acidified composition of the polyelectrolyte and then the coating is crosslinked . it is to be understood that for the purposes of this invention the coating step implies a complete coating or a discontinuous coating , thus when a fiberous substrate such as cellulose batting , paper , woven or non - woven cloth , and the like are used as the substrate , the composition can be applied in a discontinuous manner , i . e . in a pattern of large dots , squares , or grid lines to retain the inherent flexibility of the fiberous substrate and at the same time vastly improve its water absorbency . wood pulp can be coated by slurrying it in the polyelectrolyte composition followed by a fluffing operation . if desired , the water swellable film prepared as above can be used per se as the inner absorbent layer in baby diapers . it is sometimes advantageous that the film be disintegrated into flakes , strips or powders . this is accomplished by crushing or comminuting the film in a hammer mill , blenders , or the like . if long flat strips are desired , the film can be sliced widthwise with appropriate slicers . in some instances , water swellable fibers are desired . these can be prepared by extruding the above composition of the polyelectrolytes into a bath comprising lower alkyl ketones such as acetone , methyl ethyl ketone , diethyl ketone and the like . alcoholic compositions may be extruded into a non - aqueous coagulant such as chlorinated hydrocarbons , i . e . methylene chloride , perchloroethylene and the like . the soft extruded fibers are then removed from the bath by any convenient means such as a three or five roll cluster and carrier through a heated chamber at a temperature greater than about 30 ° c and preferably in the range from about 70 ° to about 150 ° c . to dry and to crosslink the polyelectrolyte fibers . the absorbency of the crosslinked polyelectrolytes ( grams solution gelled per gram of polyelectrolyte ) is determined in the following manner using synthetic urine ( 0 . 27 n sodium chloride solution ). a 0 . 5 gram sample of a crosslinked polyelectrolyte is weighed into a 250 ml . beaker , a 0 . 27 n sodium chloride solution ( 150 ml .) is poured into the beaker and allowed to soak for 2 hours at room temperature , with occasional stirring . the swelled polyelectrolyte is then collected by filtration and the gel capacity is reported as grams of solution gelled per gram of polymer salt . the following examples are presented solely to illustrate but not limit the invention . 2 . 0 g dowfax 2a - 1 surfactant ( disodium salt of dodecylated sulfonated phenyl ether ) 3 g n - isobutoxymethyl acrylamide ( 1 . 5 weight percent based on the monomer feed ) part a was heated to 40 ° c . in a stirred 1000 ml . flask . all of part c and 20 ml . of part b was added with the remainder of part b fed in over a period of 97 minutes while maintaining the temperature at 40 ° ± 1 ° c . the latex was digested for 30 minutes with heating to bring the final temperature to 80 ° c . due to some coagulum formation , the actual percent solids of the latex was 36 . 6 . a 20 percent solids solution of polyelectrolyte containing 52 mole percent unsaponified ethyl acrylate was prepared by treating 100 g of the latex of step 1 ( diluted with 40 g h 2 o ) with 14 . 3 g of 50 % naoh ( diluted with 29 . 5 g h 2 o ). the mixture was held at 55 ° c . for 18 hours to produce a viscous lightly colored solution . acetic acid ( 10 percent by weight dissolved polymer ) was added for the final ph near 5 . the acidified solution of step 2 was cast on a chrome plate , dried under heat lamps , and cured in a 150 ° c . oven for 60 minutes . the polymer absorbency ( gel capacity ) in 0 . 27 n nacl solution was 16 ( expressed as grams fluid imbibed per gram dry polymer ). as a control , example 1 was repeated using only 0 . 25 weight percent n - isobutoxymethacrylamide in the monomer feed . this level of built - in curing agent is too low as a soluble polymer rather than a swellable polymer resulted after following the procedure of example 1 . example 1 was repeated using 1 . 0 g n - isobutoxymethacrylamide , ( 0 . 5 percent by weight of monomer feed ) 169 g ethyl acrylate , and 30 g methacrylic acid as part b of the polymerization recipe . the resulting latex was digested at 40 ° c . for 1 hour , had practically no coagulum and was 39 percent solids . following the procedure of example 1 , an absorbent polymer with a 29 . 4 gel capacity was produced . example 2 was repeated using 2 . 0 g . n - isobutoxymethacrylamide ( 1 . 0 percent by weight of monomer feed ), 168 g ethyl acrylate , and 30 g methacrylic acid as part b of the polymerization recipe . the resulting latex had little coagulum ( 1 . 7 percent of monomer feed ) and was 39 . 26 percent solids . following the procedure of example 1 , an absorbent polymer with a 25 . 6 gel capacity was produced . | US-49445074-A |
the present invention relates to improvements in the dispensing of foodstuffs from piping bags . the use of piping bags to dispense decorative materials , such as icing , on to surfaces is well known and has been in use for many years . when used in conjunction with a nozzle , such piping bags allow for the dispensing of decorative materials to create messages or patterns . the nozzle can have a variety different shapes and sizes which allow for the ribbon of decorative material to have the desired appearance when expelled from the bag . existing piping bags are limited in that they typically only have a single compartment in which the decorative material can be placed . the present invention seeks to provide a piping bag and nozzle assembly which allows for the simultaneous and controllable dispensing of two or more decorative materials on to surfaces to create messages or patterns . | there will now be described , by way of example only , the best mode contemplated by the inventor for carrying out the present invention . in the following description , numerous specific details are set out in order to provide a complete understanding to the present invention . it will be apparent to those skilled in the art , that the present invention may be put into practice with variations of the specific . fig1 shows an embodiment of a nozzle insert 10 a . as shown the nozzle insert 10 a is tapered with a lower end having part of an external screw thread 11 on to which a securing means is fastened . the nozzle insert 10 a is hollow and thus forms a passage for the decorative material to pass through the dispensing aperture 12 from the piping bag compartment . in the embodiment shown here , one side of the nozzle insert 10 a has a tapered flat wall 12 so that it can sit in close proximity to a further nozzle insert with the walls abutting . in the embodiment shown here the wall includes two grooves 13 which engage with ridges ( not shown ) on the corresponding nozzle insert thus ensuring that the nozzle inserts sit in close proximity . the nozzle insert 10 a has downward tapered generally semi - circular cross section walls which curve around from the opposite edges of wall . the nozzle insert 10 a can be made of metal , though it is envisaged that the present invention will have most application with a nozzle insert 10 a made from a disposable plastic material . fig2 shows a further embodiment of a nozzle insert 10 b . the nozzle insert is largely the same dimensions and shape as nozzle insert 10 a , however here the insert includes a guide rail 14 which fits within a corresponding groove within the nozzle tip . this arrangement allows the correct alignment of the nozzle tip with the nozzle inserts . this ensures that the decorative materials are dispensed from the nozzle assembly is a precise , even alignment which greatly adds to the overall appearance of the desired messages or patterns . the nozzle insert 10 a and nozzle insert 10 b are each placed within a separate compartment of the piping bag 40 . the piping bag has an overall dimension and 30 shape of those known in the art . however the bag includes one or more internal partitions 41 which act to divide the piping bag 40 into two or more compartments , in this case two . each compartment has a narrow lower end dimensioned for use with a particular nozzle 10 a 10 b which is usually inserted through the wide upper end 43 before the contents of the tube are loaded and dispensed through the narrow end 42 . the piping bag 40 can be made of canvas , though it is envisaged that the present invention will have most application with a piping bag 40 made from a disposable plastic material . once inserted , a nozzle tip 20 is located over the nozzle insert 10 a and nozzle insert 10 b . the nozzle tip is a tube of a general shape as known in the art , having a downwardly tapering frusto - conical appearance . optionally a flange 21 may be formed surrounding the upper end 22 , with shoulder 23 in proximity which can aid locating the securing means on the assembly . an aperture 24 is located at the lower end of the nozzle tip 25 through which the contents of the piping bag compartments dispensed . nozzle tips with apertures 24 of various shapes and sizes can be used in the present invention , since the nozzle tips are interchangeable with the other components of the nozzle assembly . for example it will be understood that rectangular nozzles or those which are serrated or star shaped along the edges may be employed . nozzles of different widths may be used , all depending on the artistic effect which the user wishes to achieve . the nozzle tip 20 can be made of metal or a plastic material . the nozzle tip can include a groove ( not shown ) within the inner wall which can receive the guide rail 14 that extends from the nozzle insert 10 b . this arrangement allows the correct alignment of the nozzle tip with the nozzle inserts , ensuring that the decorative materials are dispensed from the nozzle assembly in a precise , even alignment . once the nozzle tip 20 is located over the nozzle inserts 10 a and 10 b the components are held in place using a securing means . a number of different mechanisms can be used to secure the components in place . as way of example in the present embodiment the securing means is shaped as a ring 30 which is slipped upwards from the bottom end of the nozzle tip . the ring 30 includes an internal screw thread 31 on to which the securing means is fastened . the securing means clamps the nozzle inserts together and also fixes the nozzle tip in place . the securing means 30 can also include outwardly facing 5 projections 32 placed radially around its upper end which allow the user to more easily grip and tighten the securing means . the securing means 30 can be made of metal or a plastic material . fig4 . 1 , 4 . 2 , 4 . 3 , 4 . 4 , 4 . 5 show the procedure for placing the nozzle pieces in each of the bags ( 4 . 1 , 4 . 2 ), inserting the nozzle insert within the guides ( 4 . 3 ), followed by placing the nozzle items together and fastening the items together with the coupler ring ( 4 . 5 ). fig5 shows a piping bag with a nozzle assembly for simultaneous dispensing two or more decorative materials of the present invention , assembled and ready to use . the user then places the desired decorative materials in to the compartments of the piping bag . typical examples of use decorative materials that can be dispensed using the piping bag with a nozzle assembly include icings for decorating cakes , or pureed vegetables e . g . carrots and potatoes . fig6 shows an example of the piping bag with a nozzle assembly of the present invention simultaneous dispensing two materials . the figure shows a ribbon of the two decorative materials in close proximity . referring now to fig7 a , there is shown a three - dimensional ( part - ghost ) representation of a nozzle insert with a nozzle tip insert extending therefrom . the insert corresponds with fig2 and comprises a semi - circular frusto - conic body with an aperture 71 to allow passage of material to be piped from a nozzle , with a tongue 14 depending therefrom . the inside face 12 is provided with grooves 15 which cooperate with similarly shaped projections associated with a corresponding nozzle insert 13 per fig8 a and 8 b and as shown in fig1 . additionally or alternatively , projection 72 cooperates with a corresponding notch 73 on a corresponding insert , per fig8 a . fig7 b shows the same nozzle insert from an external view of the semi - circular portion . fig9 shows a further variation wherein the tongue 14 has a central crease whereby to provide a “ v ” to the output flow , per fig9 b to enable a distinct output shape between the two materials . it will be appreciated that the pattern could be a continuous zig - zag pattern or an alternative , possibly more complex shape ; indeed , the output aperture of the nozzle tip need not be circular : it could be rectangular , elliptical or curved . fig9 a shows how the tongue is arranged at the proximal portion of the nozzle tip , where the tongue is planar ; fig9 b shows the tongue at the distal section of the nozzle , as discussed above . conveniently , the inside surface of the nozzle tip has a plurality of guiderails and the two edges of the tongue engage with such guiderails . by having a plurality of such guiderails , then the tongue can be positioned in a number of fashions with respect to a non - circular outlet aperture of a nozzle tip , whereby to enable a range of different colour effects with two materials of different colours . fig1 shows a still further embodiment wherein a two material piping set provides materials a and b at the outlets 17 a and 17 b from the piping bag output into a central aperture 14 derived from tongue 14 having an end that encompasses the output in a circular fashion , the tongue 14 lying within the nozzle tip 20 . fig1 a shows how the output from the device per fig1 will look like ; by changing the circular outputs to ellipses , then an output according to fig1 b could simply be provided . fig1 and 12 shows two alternative systems , wherein the use of three coloured materials could result in a tricolour arrangement . fig1 shows a central circular output bordered by a ring separated into two halves and 12 shows how consecutive colours could be arranged about a circular aperture ; it will be appreciated that the overall aperture of the nozzle tip could be rectangular , for example , or other shapes . fig1 shows an arrangement of nozzle tips . from left to right in the figure , the nozzles can provide large and small “ writer ” nozzles ; a star nozzle ; a rope nozzle ; a turnable border nozzle ; and a flower nozzle . in a still further embodiment , the nozzle tips may include a bridge - like element , wherein the bridge like element comprises part of the tip of the nozzle , so that a standard tongue - like element can be used for several nozzles , where the interior dimensions of the inside nozzle are the same , the tongue - like element abutting or overlapping the bridge element to ensure that the two or more materials do not mix as they are urged from their respective bags . referring to fig1 a , there is shown a view looking at the distal tip of a seven spike star 140 ; a bridge element 142 can clearly be seen . with reference to fig1 b , the channel guides 143 for receiving the tongue - like nozzle tip element 14 can also clearly be seen . fig1 a shows a small circular aperture with a small bridge 142 in plain view . fig1 b show the bridge from the side . the bridge is shaped so as not to impair flow of the material through the piping nozzle . with reference to fig1 a , the nozzle 150 is a small circular aperture . it has been found that by having the bridge in place , the division between two piping materials can be maintained until the mixtures exit from the nozzle . fig1 b , another cut - away view of a nozzle shows the inside surfaces , and clearly shows bridge 142 . again , fig1 a and 16 b show overhead and cut - away views of a further circular nozzle 160 . in fig1 b , 14 ′ indicates where a tongue like nozzle tip element 14 will be placed in use , whereby to ensure that two mixtures do not mix after being forced from the bags , whilst remaining in the nozzle . | US-201313801098-A |
a method for treating a disease comprising administering to a mammal in need thereof an effective dosage of an extract of a plant of the genus hoodia , wherein the disease is selected from the group consisting of immune - mediated disorders , immune - associated disorders , inflammatory diseases , coronary disease , insulin resistance and liver - related diseases . in a preferred embodiment , the hoodia is hoodia parviflora . also disclosed is a pharmaceutical composition for treating the above diseases comprising an effective dosage of an extract of a plant of the genus hoodia . | the hoodia parviflora extract used in the experiments described below was prepared as follows : fresh hoodia parviflora plants were washed in water and disinfectant . the washed plants were frozen and cut to size of 0 . 1 - 10 cm 2 , and 5 - 120 % ( v / v ) water was added to the cut hoodia plant tissue thereby obtaining suspended hoodia parviflora . the suspended hoodia parviflora plant tissue was further disintegrated and homogenized for 30 minutes in an ultrasonic bath filled with water at 0 - 10 ° c . liquid hoodia filtrate was separated from solid hoodia sediment by centrifuging or filtering , thereby obtaining a ‘ liquid hoodia extract ’ and a ‘ solid hoodia extract ’. all steps were carried out below 20 ° c . the administration of the plant lectin , concanavalin a ( cona ) to mice induces a severe immune - mediated hepatitis within 20 hours . when injected intravenously to mice , cona induces activation of t cells in the liver , nkt ( natural killer t ) cells being the most important . together with kupffer cells , nkt cells secrete large amounts of various hepatotoxic cytokines ( ifn - γ and tnf - α ) which cause severe hepatic inflammation . the cona ( mp biomedicals , usa ) was dissolved in 50 mm tris ( ph 7 ), 150 mm nacl , and 4 mm cacl 2 , and was intravenously injected into c57bl / 6 male mice , 10 - 12 weeks of age ( 500 μg per mouse ) in a total volume of 250 μl . cona was injected 20 h before sacrificing the mice . the administration of the hoodia liquid extracts was oral ( po ). the exact volumes are described in fig1 , 2 and 3 . 5 mice per group were used . the following groups were tested in this and in the following examples ( as indicated ): the mice were sacrificed and their liver enzymes were measured . evaluation of serum aspartyl transaminase ( ast ) and alanine aminotransferase ( alt ) activities were determined using an automatic analyzer . serum ifn - γ was measured using an elisa assay ( r & amp ; d , usa ). the results are summarized in fig1 , 2 and 3 . it can be seen that the groups fed with hoodia exhibited normal or near - normal serum levels of liver enzymes and ifn - γ . thus , the hoodia extracts reduced liver damage in mice suffering from autoimmune hepatitis as noted by a significant decrease in alt levels in mice . it also appears that the mice fed smaller amounts of hoodia extract exhibited a greater reduction in liver damage . fig3 shows that the anti inflammatory effect of the different extracts tested was mediated by a decrease in ifn - γ levels . the level of the compound p57 was measured in various hoodia liquid extracts . the results are provided in the table below . it can be seen that the level of p57 in hoodia gordonii is approximately 10 × higher than in hoodia parviflora . despite this significant difference , the effect on autoimmune hepatitis ( and on other diseases as described below ) was similar with the two plant varieties . this proves that the biological properties of the extract are not due to p57 . non - alcoholic fatty liver disease ( nafld ) is fatty inflammation of the liver when this is not due to excessive alcohol use . non - alcoholic steatohepatitis ( nash ) is the most extreme form of nafld , which is regarded as a major cause of cirrhosis of the liver of unknown cause . work with genetically obese , insulin - resistant ob / ob mice demonstrates that hepatocytes become steatotic and die at increased rates . thus , ob / ob mice develop nash spontaneously . insulin resistance , the inability of insulin to appropriately stimulate glucose uptake , is a hallmark of type 2 diabetes mellitus . hepatic steatosis results from lipid accumulation within hepatocytes due to variable combinations of excess lipid uptake and synthesis and altered lipid secretion . the effect of hoodia extracts on liver damage was assessed by the glucose tolerance test ( gtt ) and by determining hepatic triglyceride content . leptin deficient ob / ob mice ( 6 - 8 mice per group ) received daily po administrations ( 11 ml doses ) of water , p2 , sap or gt2 for 4 weeks . the mice were deprived of food for 12 hours and then given glucose . the serum glucose level was measured using bayer health care strips at pre - determined times after administration of the glucose , as indicated in fig4 . the results for each group were normalized to 1 , being the level of glucose at 0 minutes after administration . the results are summarized in fig4 . it can be seen that the hoodia parviflora extract improved glucose tolerance in these mice . the liver morphology of these mice is shown in fig5 and 6 . the liver tissue sections were stained with hematoxylin - eosin ( h & amp ; e ) stain . fig5 is from a control mouse while fig6 is from a p2 mouse . it can be seen that administration of hoodia parviflora significantly decreased hepatic fat content . in order to further determine hepatic fat levels , liver triglycerides ( tg ) were measured . the mice were sacrificed and a liver lysate was prepared . tg in the lysate ( sigma ) were measured . the results are shown in fig7 . it can be seen that all hoodia extracts significantly reduced hepatic tg content . in summary , it may be seen that oral administration of hoodia extracts to ob / ob mice : ( 1 ) decreases glucose levels ; ( 2 ) decreases liver enzymes ; ( 3 ) decreases triglyceride content in the liver ; ( 4 ) decreases fat accumulation in the liver . p57 was isolated from hoodia gordonii and found to have homologies to the steroidal core of cardiac glycosides . intracerebroventricular ( icy ) injections of the purified p57 demonstrated that the compound has a likely central nervous system ( cns ) mechanism of action . the studies demonstrated that the compound increases the content of atp by 50 - 150 % in hypothalamic neurons . liver atp content was also significantly reduced by about 60 %. a possible mechanism for the hypothalamic na / k - atpase activity is that hypothalamic regulation of food intake alters intracellular concentrations of atp . while atp may have direct effects on k + channel activity or na / k - atpase , many other phosphorylation - dependent transduction pathways may mediate the subsequent integrative response to energy sensing . the mechanisms that drive progression from fatty liver to steatohepatitis and cirrhosis are unknown . in animal models , obese mice with fatty livers are vulnerable to liver adenosine triphosphate ( atp ) depletion and necrosis , suggesting that altered hepatic energy homeostasis may be involved . it has been shown that recovery from hepatic atp depletion becomes progressively less efficient as body mass increases in healthy controls and is severely impaired in patients with obesity - related nonalcoholic steatohepatitis ( helena cortez - pinto , et al . alterations in liver atp homeostasis in human nonalcoholic steatohepatitis . jama . 1999 ; 282 : 1659 - 1664 ). in order to investigate the effect of hoodia extracts on liver metabolism , cells of a liver cell line ( hep3b ) were incubated with different volumes of hoodia extract , and atp production was followed as a function of time by measuring luminescence production . the results are shown in fig8 ( 0 . 1 ml extract ) and 9 ( 0 . 3 ml extract ). stat3 ( signal transducer and activator of transcription 3 ) has been proposed to be the main mediator of acute phase ( ap ) gene induction downstream of il - 6 and other gp130 cytokines phosphorylation of stat3 leads to its activation and is considered important for immune modulation of liver function . activation of stat3 plays a role in acute phase response , protection against liver injury , promotion of liver regeneration , glucose homeostasis , and hepatic lipid metabolism . in this experiment , the effect of hoodia extracts on the phosphorylation of stat3 was determined . psammomys obesus mice ( 4 mice per group ) received daily po administrations of water , p2 , sap and gt2 ( 11 μl doses ) for 4 weeks . the mice were sacrificed and the amount of phosphorylated stat3 in the liver as compared to unphosphorylated stat3 , normalized with reference to β - actin , was measured by a western blot . the results ( from 2 mice from each group ) are shown in fig1 . it may be seen that the mice which were fed hoodia parviflora showed a 29 % increase in phosphorylated stat3 as compared to the control . this shows that hoodia extract can have a positive immunomodulatory effect on the liver . safety and efficacy of oral administration of hoodia as a medical food for patients with nafld the clinical trial was an open labeled dose escalation , safety study . the primary endpoints were based on the effect of treatment at one of the time points . the following protocol involved 10 men and women above 18 years with biopsy - proven nash with a score of 4 or above , altered glucose metabolism , including diabetes ( non treated , or treated with up to 2 drugs ( not including insulin ) without any change in medication 2 months prior to enrolment ), impaired fasting glucose or impaired glucose tolerance . 1 . harvesting the upper part of hoodia parviflora plant 2 . washing the fresh hoodia plants with vibrating washing machine 3 . freezing the washed hoodia plants (− 200 c ) 4 . cutting the frozen hoodia plants to obtain cut hoodia plant tissue — automatic cutting machine which cuts cubes of 1 cm2 5 . blending the solids particles are less than 100 micro meter — 6 . first screening — 400 micrometer filter , solids are being removed and the liquid is now the initial basic extract which is 100 % pure blended plant tissue . from 1 kg of plant tissue we get 800 ml of initial basic extract . 7 . adding 30 % ( v / v ) water to the initial basic extract and blend the all mix under cold conditions ( refrigerated tank 40 c ) 8 . crushing the suspended hoodia plant tissue ( optionally further breaking and homogenizing the suspended hoodia plant tissue in an ultrasonic bath ) 9 . squeezing the solids via mechanical filter press ( filter opening size is 300 micron )— the solids are being removed 10 . clarification of the squeezed liquid by using the sweco vibration screener ( 200 and 100 micrometer ) 11 . fast freezing the liquid in 3 ml containers , divided into individual doses and stored at a temperature of 20 ° c . 12 . each ml of final clear extract contained 0 . 8 gr of plant tissue . oral administration was performed based on the dose currently used in medical foods containing hoodia in western world countries . hoodia was prepared in liquid form as described below and was divided into 30 doses per patient and stored at a temperature of − 20 ° c . all the drugs were stored at the study site . hoodia was administered in a dose of 0 . 043 ml / kg = 34 mg / kg . the patients were treated with this dose for 30 days . during the treatment period , subjects ingested the hoodia every day for 30 days , and were followed for clinical and laboratory effects ( table 1 ). hoodia was ingested in the morning before breakfast at the study site . the subjects were required to refrain from food for 2 hours after taking it . hba1c between 5 . 5 and 14 % blood was drawn for a complete blood count ( cbc ) and other laboratory analyses ( see attached study plan in table 1 ). serum was collected and archived for use in the development of surrogate markers . the subject visited the clinic on days 7 , 14 , 21 , and 30 . the hoodia was taken every day for 30 days . the subjects underwent a physical examination and blood samples were collected for all the disease parameters , as well as for t cell proliferation assay and facs analysis for cd3 , cd4 , cd8 , nkt , cd4cd25 , foxp3 , cd4ccd25lap . the results regarding the effect on immune function are summarized in table 2 . it may be concluded from the results that oral administration of hoodiya parviflora was shown to be safe . in a large proportion of treated patients it induced a significant immune modulatory effect and alleviated liver injury , improved insulin resistance and hyperlipidemia . | US-201314133968-A |
a magnetic resonance imaging apparatus includes a setting unit which sets a section position , a first image creating unit which creates a first image at the set section position by a multi planar reformat on the basis of a magnetic resonance signal collected from a subject by a first imaging sequence at a 3d region or multiple section positions different from the set section position , a determining unit which determines a section position of the first image , and a second image creating unit which creates a second image at the determined section position by the multi planar reformat on the basis of a magnetic resonance signal collected from the subject by a second imaging sequence different from the first imaging sequence at a 3d region or multiple section positions different from the determined section position . | hereinafter , an exemplary embodiment of the invention will be described with reference to the accompanying drawings . fig1 is a view illustrating a configuration of a magnetic resonance imaging apparatus ( mri apparatus ) 100 according to an exemplary embodiment of the invention . the mri apparatus 100 includes a static magnetic field magnet unit 1 , a gradient magnetic field coil 2 , a gradient magnetic field power source 3 , a bed 4 , a bed control unit 5 , a transmission rf coil 6 , a transmission unit 7 , a receiving rf coil 8 , and a receiving unit 9 , and a computer system 10 . the static magnetic field magnet unit 1 is formed in a hollow cylindrical shape , and generates a uniform static magnetic field in a space therein . the static magnetic field magnet unit 1 includes a static magnetic field magnet 11 and a correction coil 12 . as the static magnetic field magnet 11 , for example , a permanent magnet or a super conducting magnet is used . the correction coil 12 is configured in the manner that multiple coils are combined . the correction coil 12 generates a correction magnetic field for correcting a uniformity of the static magnetic field that is generated by the static magnetic field magnet 11 . the gradient magnetic field coil 2 is formed in a hollow cylindrical shape and is disposed inside the static magnetic field magnet unit 1 . in the gradient magnetic field coil 2 , three types of coils corresponding to x , y , and z axes which intersect each other are combined . the gradient magnetic field coil 2 generates a gradient magnetic field of which a magnetic - field magnitude changes along the x , y , and z axes when the gradient magnetic field power source 3 individually supplies current to each of the three types of coils . additionally , the direction in the z axis , for example , is set to the same direction as that of the static magnetic field . the gradient magnetic fields in the x , y , and z axes are arbitrarily used , for example , as a slice selection gradient magnetic field gs , a phase encoding gradient magnetic field ge , and a lead - out gradient magnetic field gr , respectively . the slice selection gradient magnetic field gs is used to arbitrarily decide an imaging section . the phase encoding gradient magnetic field ge is used to change a phase of a magnetic resonance signal in accordance with a spatial location . the lead - out gradient magnetic field gr is used to change a frequency of the magnetic resonance signal in accordance with the spatial location . a subject 200 is allowed to enter the hollow ( imaging space ) of the gradient magnetic field coil 2 while being placed on a top plate 41 of the bed 4 . the top plate 41 is driven by the bed control unit 5 so that the bed 4 moves in the longitudinal direction and the vertical direction . in general , the bed 4 is installed so that a central axis of the static magnetic field magnet 1 is in parallel to the longitudinal direction . the transmission rf coil 6 is disposed inside the gradient magnetic field coil 2 . the transmission rf coil 6 generates a high - frequency magnetic field upon receiving a high - frequency pulse from the transmission unit 7 . the transmission unit 7 transmits a high - frequency pulse corresponding to a larmor frequency to the transmission rf coil 6 . the receiving rf coil 8 is disposed inside the gradient magnetic field coil 2 . the receiving rf coil 8 receives a magnetic resonance signal that is radiated from the subject influenced by the high - frequency magnetic field . an output signal from the receiving rf coil 8 is input to the receiving unit 9 . the receiving unit 9 creates magnetic resonance signal data on the basis of the output signal from the receiving rf coil 8 . the computer system 10 includes an interface unit 10 a , a data collecting unit 10 b , a reconstruction unit 10 c , a memory unit 10 d , a display unit 10 e , an input unit 10 f , and a main control unit 10 g . the interface unit 10 a is connected to the gradient magnetic field power source 3 , the bed control unit 5 , the transmission unit 7 , the receiving rf coil 8 , the receiving unit 9 , etc . the interface unit 10 a inputs and outputs signals that are transmitted and received between the respective connected units and the computer system 10 . the data collecting unit 10 b collects digital signals output from the receiving unit 9 through the interface unit 10 a . the data collecting unit 10 b stores the collected digital signals , that is , magnetic resonance signal data in the memory unit 10 d . the data collecting unit 10 b collects magnetic resonance data inside roi under the control of the main control unit 10 g upon collecting data for calculating a correction amount of the static magnetic field . in this way , the data collecting unit 10 b configures a collector together with the main control unit 10 g . the reconstruction unit 10 c performs a reconstruction such as a post process , that is , a fourier transform on the magnetic resonance signal data stored in the memory unit 10 d , so that spectrum data or image data of a desired nuclear spin in the subject 200 are obtained . the memory unit 10 d stores the magnetic resonance signal data , and the spectrum data or the image data for each patient . additionally , the memory unit 10 d stores cutout section information on a cutout section of a section image that is generated by the past mpr . under a control of the main control unit 10 g , the display unit 10 e displays various information such as the spectrum data or the image data . as the display unit 10 e , a display device such as a liquid crystal display device may be used . the input unit 10 f inputs various instructions or information in accordance with an operator &# 39 ; s operation . as the input unit 10 f , a pointing device such as a mouse or a track ball , a selection device such as a mode switch , or an input device such as a keyboard may be appropriately used . the main control unit 10 g includes a cpu , a memory , and the like that are not shown in the drawing , and generally controls the respective units of the mri apparatus 100 . additionally , the main control unit 10 g has the following characteristic functions according to the embodiment , in addition to the functions for controlling the respective units to realize general operations that are provided in a known mri apparatus by using the mri apparatus 100 . specifically , the main control unit 10 g sets an imaging section in a 2d imaging technique in accordance with the operator &# 39 ; s instruction that is input from the input unit 10 f . the main control unit 10 g controls the gradient magnetic field power source 3 , the bed control unit 5 , the transmission unit 7 , the receiving unit 9 , and the data collecting unit 10 b to collect the magnetic resonance data for the imaging section . the main control unit 10 g controls the reconstruction unit 10 c to reconstruct a 2d image of the imaging section on the basis of the magnetic resonance data collected from the imaging section . the main control unit 10 g sets a 3d region in accordance with the operator &# 39 ; s instruction that is input from the input unit 10 f . the main control unit 10 g controls the gradient magnetic field power source 3 , the bed control unit 5 , the transmission unit 7 , the receiving unit 9 , and the data collecting unit 10 b to collect a magnetic resonance signal from the 3d region . the main control unit 10 g sets a region where the 3d region overlaps with the imaging section to the cutout section . the main control unit 10 g sets a region where the 3d region overlaps with the cutout section indicated by the cutout section information that is stored in the memory unit 10 d to a new cutout section . the main control unit 10 g sets a region where the 3d region overlaps with the imaging section or a region where the 3d region overlaps with the cutout section indicated by the cutout section information stored in the memory unit 10 d to a cutout section candidate . the main control unit 10 g displays an image showing the cutout section candidate on the display unit 10 e . the main control unit 10 g sets the cutout section in accordance with the operator &# 39 ; s instruction that is input from the input unit 10 f . the main control unit 10 g controls the reconstruction unit 10 c to create a section image of the cutout section by use of the mpr based on the magnetic resonance data collected from the 3d region . next , an operation of the mri apparatus 100 with such a configuration will be described . the main control unit 10 g performs the processes shown in fig2 in accordance with the operator &# 39 ; s instruction so that the 3d imaging technique is carried out and the 3d imaging result is displayed in the form of the section image obtained by the mpr process . in step sa 1 , the main control unit 10 g checks whether the 2d imaging technique is set to be carried out . additionally , the setting operation is carried out by the operator , in accordance with the above - described instruction . when the 2d imaging technique is set , the main control unit 10 g advances from step sa 1 to step sa 2 . in step sa 2 , the main control unit 10 g decides a position of the 2d sequence in accordance with the operator &# 39 ; s instruction input from the input unit 10 f , and sets a position of the imaging section ( a slice central position , a slice direction , a slice thickness , etc .). fig3 is a view illustrating an imaging section setting state in the 2d sequence . additionally , fig3 illustrates an imaging section for a 2d multi - angle imaging technique . in step sa 3 , the main control unit 10 g controls the respective units to collect the magnetic resonance data by the 2d sequence from the imaging section set in step sa 2 . in step sa 4 , the main control unit 10 g controls the reconstruction unit 10 c to perform a reconstruction process of the 2d sequence , and thus displays the reconstructed 2d image on the display unit 10 e . at this timer the reconstruction unit 10 c performs the reconstruction process on the basis of the magnetic resonance data collected by the data collecting unit 10 b in step sa 2 . in step sa 5 , the main control unit 10 g decides a position of the 3d sequence and sets a 3d region as a 3d imaging target and a section in which the magnetic resonance data is collected from the 3d region . fig4 is a view illustrating a state where the 3d region as the imaging target in the 3d sequence and the collection section are set . in step sa 6 , the main control unit 10 g controls the respective units to collect the magnetic resonance data by the 3d sequence . in step sa 7 , the main control unit 10 g controls the reconstruction unit 10 c to perform a reconstruction process of the 3d sequence , and thus displays the reconstructed 3d image on the display unit 10 e . at this time , the reconstruction unit 10 c performs the reconstruction process on the basis of the magnetic resonance data collected by the data collecting unit 10 b in step sa 6 . in step sa 8 , the main control unit 10 g sets the cutout section candidate on the basis of the 2d imaging section set in step sa 2 and the 3d region set in step sa 5 . specifically , the main control unit 10 g sets a region where the 3d region overlaps with the 2d imaging section to the cutout section candidate . accordingly , when the 2d imaging section set in step sa 2 and the 3d region set in step sa 5 are in the states shown in fig3 and 4 , respectively , the cutout section candidate can be set to a hatching region shown in fig5 . on the other hand , when the 2d imaging technique is not set , the main control unit 10 g advances from step sa 1 to step sa 9 . subsequently , in step sa 9 to step sa 11 , the main control unit 10 g performs the 3d imaging technique in the same manner shown in step sa 5 to step sa 7 . subsequently , in step sa 12 , the main control unit 10 g checks whether a past comparison is set to be carried out or a 3d comparison is set to be carried out . the setting operation is carried out by the operator , in accordance with the above - described instruction . additionally , the past comparison is to compare the mpr image based on the current 3d imaging technique with the mpr image for the past examination . further , the 3d comparison is to compare the mpr image based on the 3d imaging technique in step sa 9 to step sa 11 with the mpr image based on a 3d imaging technique described below . when the past comparison is set , the main control unit 10 g advances from step sa 12 to step sa 13 . in step sa 13 , the main control unit 10 g sets a region where the 3d region overlaps with the past cutout section to the cutout section candidate . at this time , the past cutout section corresponds to the cutout section that is indicated by the cutout section information stored in the memory unit 10 d . that is , the past cutout section corresponds to the cutout section to which the past mpr process is carried out . when the cutout section information on a plurality of mpr processes is stored in the memory unit 10 d , for example , the cutout section indicated by the cutout section information that is selected by the operator is set to the past cutout section . when the 3d comparison is set , the main control unit 10 g advances from step sa 12 to step sa 14 . in step sa 14 , the main control unit 10 g sets a first cutout section on the basis of the operator &# 39 ; s instruction . the first cutout section is set for the mpr processes based on the 3d imaging technique in step sa 9 to step sa 11 . additionally , in step sa 15 , the main control unit 10 g creates the mpr image of the cutout section set in sa 14 by the mpr process . subsequently , the main control unit 10 g performs the 3d imaging technique in step sa 16 to step sa 18 in the same manner shown in step sa 5 to sa 7 . in general , the 3d imaging technique is carried out by a sequence different from that of the 3d imaging technique in step sa 9 to step sa 11 . at this time , the sequence used for the 3d imaging technique is arbitrarily set by , for example , the operator . subsequently , in step sa 19 , the main control unit 10 g sets a region where the 3d region overlaps with the first cutout section to the cutout section candidate . in step sa 8 , step sa 13 , or step sa 19 , when the cutout section candidate has been set , the main control unit 10 g advances to step sa 20 . in step sa 20 , the main control unit 10 g checks whether an auto mode for setting the cutout section candidate is in an on state . subsequently , when the auto mode is in an on state , the main control unit 10 g advances from step sa 20 to step sa 21 . in step sa 21 , the main control unit 10 g sets the cutout section candidate in step sa 8 to sa 13 to the cutout section . on the other hand , when the auto mode is in an off state , the main control unit 10 g advances from step sa 20 to step sa 22 . in step sa 22 , the main control unit 10 g displays a planned screen showing the cutout section candidate on the display unit 10 e . the operator assigns a desired cutout section by referring to the cutout section candidate displayed on the display unit 10 e . subsequently , in step sa 23 , the main control unit 10 g assigns the cutout section in accordance with the operator &# 39 ; s instruction . additionally , the operator may assign a totally new cutout section by referring to the displayed cutout section candidate , or may modify the cutout section candidate if necessary . in step sa 21 or step sa 23 , when the cutout section has been set , the main control unit 10 g advances to step sa 24 . in step sa 24 , the main control unit 10 g creates the mpr image of the cutout section set in step sa 21 or step sa 23 by the mpr process , and thus displays the mpr image on the display unit 10 e . additionally , it is possible to develop the mpr image on a film by using a filming device ( not shown ) attached to the outside of the mri apparatus 100 . according to the above - described embodiment , when the 2d imaging technique is carried out and then the auto mode is set in an on state , a region where the 3d region as the 3d imaging target overlaps with the imaging section that is set for the 2d imaging technique is automatically set to the cutout section . accordingly , it is possible to set the cutout section for obtaining the mpr image that is the same section as that of the 2d image obtained by the 2d imaging technique without any determination or operation performed by the operator . according to the above - described embodiment , when the 2d imaging technique is not carried out , the past comparison is carried out , and then the auto mode is set in an on state , a region where the 3d region as the 3d imaging target overlaps with the cutout section that has been subjected to the past mpr process is automatically set to a new cutout section . accordingly , it is possible to set the cutout section for obtaining the mpr image that is the same section as that of the mpr image created in the past without any determination or operation performed by the operator . according to the above - described embodiment , when the 2d imaging technique is not carried out , the 3d comparison is carried out , and then the auto mode is set in an on state , a region among the 3d regions as the latter 3d imaging target and which overlaps with the cutout section that is set for the former 3d imaging technique is automatically set to the cutout section for the mpr process in the latter 3d imaging technique . accordingly , it is possible to set the cutout section for obtaining the mpr image that is the same section as that of the mpr image created in the former 3d imaging using a different sequence without any determination or operation performed by the operator . according to the above - described embodiment , when the 2d imaging technique is carried out and then the auto mode is set in an off state , a region where the 3d region as the 3d imaging target overlaps with the imaging section that is set for the 2d imaging technique is set to the cutout section candidate , and thus is provided for the operator . accordingly , it is possible for the operator to plan the mpr process by referring to the cutout section for obtaining the mpr image that is the same section as that of the 2d image obtained by the 2d imaging technique . according to the above - described embodiment , when the 2d imaging technique is not carried out , the past comparison is carried out , and then the auto mode is set in an off state , a region where the 3d region as the 3d imaging target overlaps with the cutout section that has been subjected to the past mpr process is set to a new cutout section candidate , and thus is provided for the operator . accordingly , it is possible for the operator to plan the mpr process by referring to the cutout section for obtaining the mpr image that is the same section as that of the mpr image created in the past . according to the above - described embodiment , when the 2d imaging technique is not carried out , the 3d comparison is carried out , and then the auto mode is set in an off state , a region where the 3d region as the latter 3d imaging target overlaps with the cutout section that is set for the former 3d imaging technique is set to the cutout section candidate for the mpr process in the latter 3d imaging technique . accordingly , it is possible for the operator to plan the mpr process in the latter 3d imaging technique by referring to the cutout section for obtaining the mpr image that is the same section as that of the mpr image created in the former 3d imaging technique . according to the above - described embodiment , since the mpr image is created for the cutout section that is automatically set in the aforementioned - manner or the cutout section that is set on the basis of a plan performed by the operator in the aforementioned - manner , it is possible to easily obtain the image that is the same section as that of the image obtained by the 2d imaging technique or other mpr images by use of the mpr process . the above - described embodiment may be modified into various forms as below . in the operation for automatically setting the cutout section based on the 2d imaging section , the operation for automatically setting the cutout section based on the past cutout section , the operation for suggesting the cutout section candidate based on the 2d imaging section , and the operation for suggesting the cutout section candidate based on the past cutout section , one or three of them may be carried out . in step sa 8 or step sa 13 , the 2d imaging section or the past cutout section may be directly set to the cutout section candidate . since a region where the 3d region overlaps with the 2d imaging section is set to the cutout section , the 2d imaging section outside the 3d region is not identical with the cutout section set based on the 2d section . accordingly , it is possible to inform the operator that the cutout section is not identical with the 2d section at the time of displaying the mpr image created from such a cutout section . the informing operation may be arbitrarily carried out by a non - identical region displayed in the mpr image , a mark , a text message , an alarming sounds or a voice message . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents . | US-3978708-A |
conventionally , polyether pendant dimethyl polysiloxane and linear polyether - polysiloxane - polyether block copolymer have been frequently proposed and dominantly used in cosmetic formulations . in this invention , non - hydrolyzing block copolymers comprising a linear polysiloxane - polyoxyalkylene block as a repeating unit are used as a main component of cosmetic formulations used in skin care products and hair care products . | the r and r &# 39 ; in the above - described formulas are selected from the group consisting of alkyl , e . g ., methyl , ethyl , propyl , isopropyl , butyl , pentyl , hexyl , octyl , decyl , dodecyl , octadecyl , eicocyl , etc ., aryl group , e . g ., phenyl , naphtyl , etc ., aralkyl , e . g ., benzyl , phenylethyl , etc ., tolyl , xylyl , and cyclohexyl , and can be the same or different . the divalent organic group represented by y in the above - described formula is exemplified by : where r &# 34 ; is a divalent alkylene group , e . g ., ethylene , propylene , butylene , and r &# 39 ;&# 34 ; is a divalent alkylene group , e . g ., r &# 34 ; or a divalent arylene group exemplified by : -- c 6 h 4 -- ch 2 -- c 6 h 4 --, -- c 6 h 4 -- ch ( ch 3 ) 2 -- c 6 h 4 -- --( ch 2 ) 3 nhconhc 6 h 4 nhco --, and most preferably , y is a divalent alkylene group , specifically -- ch 2 ch 2 ch 2 --. the non - hydrolyzing copolymer can be produced by reacting a polyoxyalkylene compound having reactive end groups with dihydrocarbyl siloxane liquid having end groups which are reactive with the end groups of the polyoxyalkylene compound . the nature of these reactive end groups determine the structure of the divalent organic group represented by y . generally the nature of the end groups of a reaction product depends on the end groups of reactive substances . such reactions are expressed by the following reaction formulas : ( a ) wch 2 ═ chch 2 o ( c n h 2n o ) b ch 2 ch ═ ch + whsime 2 o ( sime 2 o ) a sime 2 h →[( ch 2 ) 3 o ( c n h 2n o ) b ( ch 2 ) 3 -- sime 2 o ( sime 2 o ) a sime 2 ] c ( b ) wch 2 ═ cho ( c n h 2n o ) b ch ═ ch 2 + whsime 2 o ( sime 2 o ) a sime 2 h →[( ch 2 ) 2 o ( c n h 2n o ) b --( ch 2 ) 2 ( sime 2 o ) a sime 2 ] c ( c ) who ( c n h 2n o ) b h + wocn ( ch 2 ) 3 -- sime 2 o ( sime 2 o ) a sime 2 ( ch 2 ) 3 nco →[( c n h 2n o ) b conh ( ch 2 ) 3 sime 2 o --( sime 2 o ) a sime 2 ( ch 2 ) 3 nhcoo ] c ( d ) who ( c n h 2 no ) b h + wcloc ( ch 2 ) 2 -- sime 2 o ( sime 2 o ) a sime 2 ( ch 2 ) 2 -- cocl →[( c n h 2n o ) b co ( ch 2 ) 2 sime 2 o ( sime 2 o ) a -- sime 2 ( ch 2 ) 2 coo ] c + 2chcl ( e ) wocnc 6 h 4 nhcoo ( c n h 2n o ) b conhc 6 h 4 nco + wh 2 n ( ch 2 ) 3 sime 2 o ( sime 2 o ) a sime 2 ( ch 2 ) 3 nh 2 →[ conhc 6 h 4 nhcoo ( cnh 2 no ) b conhc 6 h 4 -- nhconh ( ch 2 ) 3 sime 2 o ( sime 2 o ) a sime 2 ( ch 2 ) 3 nh ] c ( f ) wocnc 6 h 4 nhcoo ( c n h 2n o ) b conhc 6 h 4 nco + who ( ch 2 ) 3 sime 2 o ( sime 2 o ) a sime 2 ( ch 2 ) 3 oh →[ conhc 6 h 4 nhcoo ( cnh 2 no ) b conhc 6 h 4 nhcoo ( ch 2 ) 3 -- sime 2 o ( sime 2 o ) a sime 2 ( ch 2 ) 3 o ] c in these formulas , the polyoxyalkylene block includes polyoxyethylene , polyoxypropylene , polyoxy - butylene , mixed polyoxyethylene / oxypropylene , etc . the most preferable example is the block copolymer which is produced by reacting a polyoxy - alkylene compound having ch 2 ═ c ( ch 3 )-- ch 2 -- groups on both ends with dimethylpolysiloxane having hsi ( ch 3 ) 2 o -- groups on both ends , and expressed by the formula ; ## str1 ## where ; me represents a methyl group ; n is an integer of 2 - 4 ; a is an integer of at least 4 ; b is an integer of at least 4 ; and c is an integer of at least 4 . the block copolymer used in the cosmetic formulations of this invention is used singly or solvated in various organic solvents , e . g ., ethanol , isopropyl alcohol , ethylene glycol , propylene glycol , pentane , hexane , octane , nonane , decane , etc . hair and skin care products can be prepared by blending the cosmetic formulations of this invention with known personal care ingredients , such as : an oil which is used as a component of the usual hair cosmetics , e . g ., camellia oil , rapeseed oil , sesame oil , safflower oil , cottonseed oil , castor oil , soybean oil , coconut oil , palm oil , beewax , montanic wax , lanolin , squalane or silicone oil ; a surface active agent , e . g ., alkyl benzene - sulfonate , polyozyalkylene alkylsulfate ester , alkyl - sulfate ester , alkanesulfonate , alkyl ethoxycarbozylate , succinic derivatives , alkylamine oxide , imidazoline compounds , polyoxyethylene alkyl or alkenyl ether , polyoxyethylene alkyl phenyl ether , higher fatty acid alkanolamide or its alkylene oxide addition products ; high - molecular compounds , e . g ., cellulosic compounds , such as , hydroyethyl cellulose , hydroxypropyl cellulose , hydroxypropyl methyl cellulose , methyl cellulose , cationic cellulose , cationic polymers , polyvinylpirrolidone , vinylpyrrolidone - vinyl acetate copolymer , vinylpyrrolidone - vinyl acetate - alkyl a aminoacrylate copolymer , lower alkyl half ester of methyl vinyl ether - maleic anhydride copolymer , vinyl acetatecrotonic acid copolymer , acrylic acid - acrylic ester - n - alkyl acrylamide copolymer ; a moisture retaining agent , e . g ., glycerol , ethylene glycols , propylene glycols , sorbitol , maltitol , pyrrolidone sodium carboxylate , polyoxyethylene methylglycoside , polyoxypropylene methylglycoside , glycol ; a powder , e . g ., ( sericite , silica - alumina , silica gel , kaolin , talc , red iron oxide , ultramarine , mica , mica titanium , magnesium oxide , chromium oxide , antimony oxide , zinc monoxide , zinc dioxide , magnesium carbonate , calcium carbonate , calcium phosphate , barium sulfate , aluminum hydroxide , chromium hydroxide , magnesium metasilicate aluminate , magnesium silicate aluminate , polyethylene powder ); and antioxidants , uv absorbers , perfumes , dyes , pigments , coloring matters , preservatives , vitamins , hormones , deodorants , binders , extinguishing agents etc . in the case the cosmetic formulations of this invention are used in aerosol - type sprays , a pressurizing agent , e . g ., propane , butane , trichloromonofluoromethane , dichloro - difluoromethane , dichlorotetrafluoroethane , carbon dioxide or nitrogen gas , may additionally be present in the formulation . typical examples of the use of the cosmetic formulations of this invention in the hair care products formulations include shampoo , rinse , hair lotion , hair oil , hair cream , pomade , hair spray , setting lotion , permanent wave liquid , mousse , dye , shaving foam , etc . the hair cosmetic formulations are suitable for use on the hair , beard , underarm hair , chest hair , artificial hair , as of wigs , etc ., hair and features of pets , e . g ., dogs , cats , monkeys , macaws , canaries , etc . when the cosmetic formulations are used in hair care products , these resultant cosmetics are superior to the conventional hair cosmetics in combing , smoothness , wetness , flexibility , brilliance , voluminousness ( bulkiness ), coating effect , durability , tackiness , texture , emulsification effect , hair fly , dust attraction , moisture retention , etc . typical examples of the use of these cosmetic formulations of this invention in skin care products include cleansing cream , cold cream , hand cream , powder , lotion , foundation , mascara , eye shadow , lipstick , manicure , anti - sunburn creams etc . when these cosmetic formulations are used in skin care products , the resultant cosmetics are superior to the conventional ones in smooth touch when applied to the skin , non - tackiness , wetness , brilliance , durability on the skin , retention of the beneficial effects of the other components , etc . the following examples are provided for illustrative purposes and are not intended to limit the scope of the claims that follow . one hundred ( 100 ) g of dimethacrylpolyether ( ch 2 ═ c ( ch 3 ) ch 2 o ( c 2 h 4 o ) 18 ( c 3 h 6 o ) 33 ch 2 c ( ch 3 ) ═ ch 2 ), 350 g of toluene , and 20 ppm of platinum as chloroplatinate were put in a 500 ml - three neck flask having a mechanical agitator , a condenser , a thermometer and a port for feeding nitrogen . one hundred nine ( 109 ) g of dihydropolydimethyl polysiloxane ( hme 2 sio ( mesio ) 40 sime 2 h ) was gradually added to the mixture at such a speed that the temperature is retained at 80 °- 100 ° c . the end of this reaction was judged when an agno 3 test on sih became minus . then the reacted mixture was neutralized by nahco 3 and filtered , and the solvent was removed at 50 ° c ./ 1 mmhg by a rotary evaporator . two hundred and three ( 203 ) g of the block copolymer having the following repeating unit and a molecular weight of 95 , 000 was prepared . [( me 2 sio ) 41 me 2 sich 2 ch ( ch 3 ) ch 2 -- o ( c 2 h 4 o ) 18 --( c 3 h 6 o ) 33 ch 2 ch ( ch 3 ) ch 2 ] 16 . 1 using the same conditions as in example 1 , 70 g of dimethacryl polyether ch 2 ═ c ( ch 3 ) ch 2 o ( c 2 h 4 o ) 20 ( c 3 h 6 o ) 29 ch 2 c ( ch 3 )═ ch 2 , 61 g of dihydropolydimethylsiloxane hme 2 sio ( mesio ) 30 sime 2 h , 350 g of toluene , and 20 ppm of platinum as an addition catalyst were reacted . one hundred and twenty - six ( 126 ) g , of the block copolymer having a molecular weight of 67 , 000 and having the following repeating unit was prepared . [( me 2 sio ) 31 me 2 sich 2 ch ( ch 3 ) ch 2 -- o ( c 2 h 4 o ) 20 --( c 3 h 6 o ) 29 ch 2 ch ( ch 3 ) ch 2 ] 13 . 3 using the same conditions as in example 1 , 150 g of dimethacryl polyether ch 2 ═ c ( ch 3 ) ch 2 o ( c 2 h 4 o ) 20 ( c 3 h 6 o ) 29 ch 2 c ( ch 3 )═ ch 2 , 43 g of dihydropolydimethyl siloxane hme 2 sio ( mesio ) 8 -- sime 2 h , 340 g of toluene , and 20 ppm of platinum as an addition catalyst were reacted . one hundred and eighty - six ( 186 ) g of the block copolymer having the following repeated unit and a molecular weight of 90 , 000 was prepared . [( me 2 sio ) 9 me 2 sich 2 ch ( ch 3 ) ch 2 -- o ( c 2 h 4 o ) 20 --( c 3 h 6 o ) 29 ch 2 ch ( ch 3 ) ch 2 ] 26 . 3 using the same conditions as in example 1 , 120 g of dihydropolydimethyl siloxane ch 2 ═ c ( ch 3 ) ch 2 o ( c 2 h 4 o ) 18 ( c 3 h 6 o ) 29 ch 2 c ( ch 3 )═ ch 2 , 72 g of dihydropolydimethyl siloxane hme 2 si ( mesio ) 15 sime 2 h , 330 g of toluene , and 20 ppm of platinum as an addition catalyst were reacted . one hundred and eight - four ( 184 ) g of the block copolymer having the following repeated unit and a molecular weight of 71 , 000 was prepared . [( me 2 sio ) 16 me 2 sich 2 ch ( ch 3 ) ch 2 -- o ( c 2 h 4 o ) 18 ( c 3 h 6 o ) 20 ch 2 c ( ch 3 ) ch 2 ] 21 . 5 using the same conditions as in example 1 , 180 g of dimethallyl polyether ch 2 ═ c ( ch 3 ) ch 2 o ( c 2 h 4 o ) 5 ch 2 o ( ch 3 )═ ch 2 , 95 g of dihydropolydimethyl siloxane hme 2 sio ( mesio ) 8 sime 2 h , 350 g of toluene , and 20 ppm of platinum as an addition catalyst . two hundred and sixty - one ( 261 ) g of the block copolymer having the following repeated unit and a molecular weight of 5 , 000 was prepared obtained . [( me 2 sio ) 9 me 2 sich 2 ch ( ch 3 ) ch 2 -- o ( c 2 h 4 o ) 5 ch 2 ch ( ch 3 ) ch 2 ] 4 . 8 using the same conditions as in example 1 , 27 g of dimethyl polysiloxane containing hydrosilyl groups me 3 sio [ sime 2 o ] 100 [ simeho ] 13 sime 3 , 94 g of allyl polyether ch 2 ═ chch 2 o ( c 2 h 4 o ) 18 ( c 3 h 6 o ) 20 ch 3 , 330 g of toluene , and 20 ppm of platinum as an addition catalyst were reacted . one hundred and twenty ( 120 ) g of the block copolymer having the following chemical structure and a molecular weight of 35 , 000 was prepared . ## str2 ## using the same conditions as in example 1 , 97 g of dihydropolydimethyl siloxane hme 2 si [ me 2 sio ] 200 sime 2 h , 43 g of allyl polyether ch 2 ═ chch 2 o ( c 2 h 4 o ) 27 ( c 3 h 6 o ) 30 ch 3 , 320 g of toluene , and 20 ppm of platinum as an addition catalyst were reacted . one hundred and thirty - three ( 133 ) g of the block copolymer having the following chemical structure and a molecular weight of 21 , 000 was prepared . ch 3 ( c 2 h 4 o ) 27 ( c 3 h 6 o ) 30 oc 3 h 6 ( sio ) 201 -- sime 2 c 3 h 6 o ( c 2 h 4 o ) 27 ( c 3 h 6 o ) 30 ch 3 ______________________________________alternating block copolymer 10 weight partsaccording to example 1cyclosiloxane 24squalane 5lanolin 3microcrystalline wax 3propyleneglycol 5citric acid 0 . 8preservative 0 . 2refined water 48perfume 1polyoxyethylene stearic ester 3______________________________________ the hand cream was applied to hands but did not feel sticky . the hands did not feel rough after 30 minutes of dish washing . a hand cream was prepared having the same composition as in example 8 except that the alternating block copolymer was replaced by polyether pendant dimethyl polysiloxane prepared in example 6 . compared with example 8 , the hand cream felt tacky on the hands . after 30 minutes of dish washing , the hand cream was completely removed , and the hands felt coarse and were defatted . ______________________________________alternating block copolymer 10 weight partsaccording to example 2cyclosiloxane 40squalane 3microcrystalline wax 1silica 5anti - uv agent 0 . 5citric acid 0 . 8uroganin acid 1 . 0preservative 0 . 4refined water 30 . 3polyoxyethylene stearic acid 3glycerol 5______________________________________ the anti - sunburn cream was applied to a back . the cream exhibited good flow and did not feel tacky sticky . after 10 minutes of swimming in sea water , 50 % of the application amount remained . ______________________________________alternating block copolymer 37 weight partsaccording to example 3microcrystalline wax 20citric acid 0 . 5titanium oxide fine powder 8siconin 0 . 01preservative 0 . 2refined water 34 . 29______________________________________ the lipstick was applied to the skin . the gloss was good . the skin with the lipstick applied to was rinsed with water for 3 minutes , but the purple of siconin remained . a lipstick was prepared having the same composition as in example 11 except that the alternating block copolymer was replaced by polyether pendant dimethylpolysiloxane prepared in example 6 . the lipstick was applied to the skin . the gloss was inferior to that of example 11 . after 3 minutes of water rinse shower , the siconin purple was substantially washed off . ______________________________________alternating block copolymer 3 weight partsaccording to example 4stearic acid 0 . 2cetanol 1 . 5vaseline 3 . 0lanolin alcohol 2 . 0fluid paraffin 7 . 0polyoxyethylene 2 . 0monooleic acid ( 10 e . o . ) perfume 0 . 5preservative 0 . 3glycerol 3 . 0propyleneglycol 5 . 0triethanolamine 1 . 0refined water 72 . 0______________________________________ the lotion could be very smoothly applied to the skin and prevented smearing of makeup due to sweating . the lotion did not undergo the phase separation . a lotion was prepared having the same composition as in example 13 except that the alternating block copolymer was replaced by polyether polysiloxane - polyether linear block copolymer prepared in example 7 . this lotion was slightly inferior to that according to example 13 in flow when applied to the skin and allowed smearing of makeup due to sweating . ______________________________________alternating block copolymer 3 . 0 weight partsaccording to example 5glycerol 2 . 0propyleneglycol 6 . 0dipropyleneglycol 1 . 0ethanol 20 . 0refined water 68 . 0______________________________________ this cosmetic liquid had good flow and feel when applied to the skin , made the skin brilliant ( glossy ) and was felt to tighten the skin . a cosmetic liquid was prepared having the same composition as in example 15 except that the alternating block copolymer was replaced by polyether pendant dimethyl polysiloxane according to example 6 . this cosmetic liquid lacked flow in application to the skin , and gave the skin less brilliance and less tightening feel . ______________________________________c14 -∝- olefin natorium 15 . 0 weight partssulfonateglycerin monostearate 1 . 0alternating block copolymer 1 . 0according to example 1polyethylene glycol ( mole - 0 . 5cular weight : 9 , 000 ) dis - tearatesodium benzoate ( germicide ) 1 . 0perfume 0 . 5yellow no . 203 ( coloring 0 . 01matter ) citric acid ph 5 . 8purified water balance______________________________________ a shampoo was prepared having the same composition as that according to example 17 except that the alternating block copolymer was replaced by the polyether pendant dimethyl polysiloxane in example 6 . foaming : the shampoo of example 17 was superior to example 18 in that the foam felt creamy and was more stable . squeaking during rinse : the shampoo of example 17 squeaked less than example 18 . dry condition after hair is dried : the shampoo of example 17 was less dry . ______________________________________alternating block copolymer 12 . 0 weight partsaccording to example 2ethanol 16 . 0perfume 0 . 5trichloromonofluoromethane 40 . 0dichlorodifluoromethane 40 . 0______________________________________ a hair spray having the same composition as that according to example 2 was prepared except that the alternating block copolymer was replaced by the polyether pendant dimethyl polysiloxane in example 6 . the spray was applied evenly to the hair of a woman ( 25 cm in length ), and the hair was brushed 100 times with a polyethylene brush . the composition according to example 19 was superior to the composition according to example 20 in brilliance , flexibility , smoothness , wetness , brushing , dust attraction and moisture - retention . ______________________________________alternating block copolymer 10 . 0 weightaccording to example 3lanolin 1 . 0 partsliquid paraffin 2 . 0self - emulsifiable glyceride 5 . 0monosterate , cetyl alcohol 0 . 5dimethy chloride benzyl - 3 . 0amoniumantiseptics 0 . 2perfume 0 . 1purified water 75 . 4______________________________________ a hair treatment having the same composition as that according to example 21 was prepared except that the alternating block copolymer was replaced by the polyetherpolysiloxane - polyether linear block copolymer in example 7 . example 21 was superior to example 22 in combing , smoothness , wetness , flexibility , brilliance , voluminousness ( bulkiness ), moisture - retaining ability and coating effect durability . ______________________________________alternating block copolymer 5 . 0 weight partsaccording to example 4polyoxypropylene ( 30 ) butyl 10 . 0etherpolyethylene glycol 6000 5 . 0ethanol 44 . 0water 36 . 0______________________________________ a hair liquid having the same composition as that according to example 23 was prepared except that the alternating block copolymer was replaced by the polyether pendant dimethyl polysiloxane in example 6 . example 24 is superior to example 23 in tackiness , combing , wetness , smoothness and voluminousness ( bulkiness ). | US-47947595-A |
a secure storage locker for temporarily storing golf bags having clubs . the locker includes a base having a recess for receiving the bottom end of a golf bag having the heads of the golf clubs extending above the top end of the bag . a bonnet is slidingly and / or hingedly connected to the base and has a cavity for covering the club heads . locking means are provided for locking the bonnet to the base . | referring now to fig1 - 5 , a first embodiment of a golf bag locker 10 is illustrated . the locker 10 is formed of a base 12 , vertical support member 20 and a bonnet 30 . the base 12 has vertical perimeter walls 14 forming a recessed cavity 16 for receiving the bottom portion 13 of a golf bag 11 as shown in fig2 . the base 12 can contain at least one bottom flange 17 having a mounting hole 18 for receiving screws or bolts ( not shown ) for securing locker 10 to a hardened surface ( not shown ). the vertical support member 20 is fixedly connected to a corner 19 of the base 20 and the moveable bonnet 30 can be rotatably connected to an inner post 31 slidingly received in the support member 20 . the bonnet 30 has a closed top wall 32 , side walls 34 and a hinge means 25 received in a corner extension 33 of the bonnet 30 for permitting the bonnet 30 to be rotatably connected to the post 31 slidingly received within the support member 20 . the hinge means 25 further permits bonnet 30 to rotate from a horizontal , closed position over the base 12 to an open position displaced from the base as shown in fig2 . as shown in fig4 and 5 , the hinge means 25 has two plates 35 , 38 joined by a pin 39 . the first plate 35 is secured to the inner wall 41 of the post 31 by means of fasteners such as rivets 37 . the second plate 38 is secured to the wall portion 44 of the extension 33 of the bonnet 30 by means of fasteners such as rivets 45 . when the bonnet 30 is rotated to the open position , the bonnet 30 will rotate 90 ° in a horizontal plane until the plates 35 , 38 are engaged . the bonnet 30 can also be moved vertically by pulling the telescoping post 31 out of the support member 20 . the pin 50 mounted through the slot 52 prevents the post 31 from being pulled out of the support member 20 . the pin 54 mounted on the post 31 acts as a lower stop for the post 31 and bonnet 30 . a coin operated locking mechanism 22 is mounted on support member 20 . the coin operated locking mechanism 22 includes a slot 24 for inserting a coin , and a keyhole 26 for inserting and removing a key 28 . as shown in fig5 when a coin is placed into the slot 26 , the tongue 60 is released from the groove 62 and the key 28 is released from the keyhole 26 . when the key 28 is removed from the keyhole 26 , the tongue 60 enters the groove 62 which prevents upward movement of the post 31 . a patron would utilize the locker 10 invention by initially inserting the required currency into coin slot 24 of mechanism 22 located on the support member 20 . the key 28 can now be removed from the keyhole 26 . the locking mechanism 22 releases the post 31 from its horizontal position allowing the patron to raise the bonnet 30 upward and rotate it sideways . the patron next lifts his golf bag 11 into the recess 16 in the base 12 . the patron then rotates and lowers the bonnet 30 back into the down position so that the club heads extending from the top of the golf bag are disposed within the recess of the bonnet 30 and are surrounded by top wall 32 and side walls 34 . once back in the position , the post 31 locks and can not be released until the key 28 is inserted back into the keyhole 26 to release the locking means . once the locking means is released , bonnet 30 can be raised and rotated to expose the club heads and the patron &# 39 ; s golf bag and clubs can be removed from the locker 10 . also , once the locking means is released , the key is not removable from the keyhole 26 until currency is again inserted into the coin slot 24 . referring now to fig6 and 7 , a second embodiment of a golf bag locker 100 is formed of a base 112 , bonnet 130 jointed together by a vertical support member 120 . the bottom end 121 of the support member 120 is fixedly mounted in a slot 113 in one of the perimeter walls 115 of the base 112 . the top end 123 of the support member 120 is secured to the back wall 117 of the bonnet by fasteners 118 . the bonnet 130 is split into 2 l - shaped sections , 132 , 134 . the first fixed section 132 comprises a side wall 136 and the back wall 117 . the second section 134 includes the other side wall 146 and the front wall 138 . the top wall can be connected to either of the sections 132 , 134 . it is preferably connected to the second movable section 134 . the sections 132 and 134 are joined along their mating edges 143 , 145 by a plate hinge 150 having plates 152 , 154 secured to the edges 143 , 145 by fasteners 147 such as rivets . the stationary section 132 has horizontal lips 149 , 151 across the top of the walls 136 , 117 . top wall 140 has vertical lips 153 , 155 which rest on the lips 149 , 151 when the bonnet 130 is closed . the front wall 138 has a flange 159 on which is mounted a hasp 161 . when the bonnet 130 is closed the aperture 163 in the hasp engages a spring mounted latch , not shown , projecting from the coin operated mechanism 170 mounted on the side wall 136 of the fixed section 132 of the bonnet 130 . as discussed above , the locking mechanism can be mechanical or electromechanical . the bonnet can be slidingly mounted on one or more posts and be raised and lowered vertically to accept and store clubs . the lockers would be used at golf courses near practice greens , restaurants , pro shop , etc . by patrons to increase the level of prevention of theft when the patron leaves his golf bag unattended . it is to be realized that only preferred embodiments of the invention have been described and that numerous substitutions , modifications and alterations are permissible without departing from the spirit and scope of the invention as defined in the following claims . | US-37744499-A |
the invention provides a biocompatible silicone implant that can be securely affixed to living tissue through interaction with integral membrane proteins . a silicone article containing a laser - activated surface is utilized to make the implant . one example is an implantable prosthesis to treat blindness caused by outer retinal degenerative diseases . the device bypasses damaged photoreceptors and electrically stimulates the undamaged neurons of the retina . electrical stimulation is achieved using a silicone microelectrode array . a safe , protein adhesive is used in attaching the mea to the retinal surface and assist in alleviating focal pressure effects . methods of making and attaching such implants are also provided . | in a first aspect of the invention , a silicone article treated with a biocompatible compound is provided , and comprises a silicone substrate having at least one activated surface formed by irradiation with laser light at a wavelength and power sufficient to eject organic species from the silicone substrate , and at least one compound capable of binding to one or more integrins , coupled to the activated surface . in one embodiment , the silicone article comprises or is part of an implantable medical device or prosthesis , as described below . nonlimiting examples of silicone articles include silicone films , substrates , bulk objects , and silicone coatings . the silicone may be present as substantially pure silicone polymers or , more typically , silicone polymers containing one or more additives to enhance the article &# 39 ; s mechanical , thermal , or other physical characteristics . nonlimiting examples of such additives include fillers , such as silica entities ( e . g ., foamed , granular , fibrous , etc ; optionally , the silicone polymers are coupled to these silica entities via grafting ), plasticizers , and crosslinkers , which can be admixed with the silicone - silica compounds to ensure lateral coupling between polymeric chains that are attached ( i . e . grafted ) to the same silica piece ; etc . the whole of a silicone / silica / crosslinker assembly constitutes a silicone rubber . varying any of the individual constituents in quality and quantity provides a nearly infinite range of silicone rubbers that can be activated according to the invention . integrins are integral membrane proteins used by cells to attach to their extracellular environment . treating an activated silicone surface with a compound capable of binding to one or more integrins makes it possible to attach a silicone article , such as an implant , directly to tissue , without resort to surgical tacks , toxic adhesives , or other potentially destructive means . one type of compound capable of binding to integrins is an arginine - glycine - aspartate ( rgi ) peptide , or a protein containing at least one rgd segment ( fig6 ). extracellular matrix ( ecm ) proteins can he used to bind integrins via rgd segments at the cellular interface ( fig7 ). nonlimiting examples include fibronectin , laminin , and collagen . non - ecm proteins that contain one or more rgd segments are another example of compounds capable of binding to integrins ; specific examples include contortrostatin ( cn ), a low molecular weight protein found in snake venom , and vicrostatin , the monomer of cn . both of these two proteins stick to integrins on tissue previously occupied by ecm proteins . cn works well ( i . e ., it is sticky ) as it is small and has two rgds per molecule . extracellular matrix proteins ( such as fibronectin , laminin and collagen ) do not adhere as well to the retina as they are large molecules with only one rgd ; however they do adhere well to the activated silicone . to prepare a silicone substrate having at least one activated surface , laser light of sufficient wavelength and power is directed at one or more surfaces of a silicone article , such as the top of a silicone film , a portion of a surface of a silicone prosthesis , etc ., which causes chemical bond breaking and formation of unpaired electrons , as described below . this “ activates ” the surface of the silicone article in and around the areas that have been irradiated , making that area more chemically reactive toward other compounds . the use of a monochromatic , intense uv light source can , under specific conditions , allow substantially instant light absorption and drive the silicone structure to destabilize its atom configuration . this can be achieved with a laser source working in the uv range and under a pulsed regime , such as an excimer laser . after investigating the actual optical absorption of a given silicone or silicone rubber , a uv light wavelength ( or photon energy ) is chosen that allows the material to absorb the uv photons selectively and exclusively on the si — c bond electrons . above a given power of the light source at that wavelength ( of the order of ioomw ), all si — c bond electrons that are present in the silicone volume that is traversed by the laser beam may be brought to absorb these uv photons quasi - simultaneously , over a very short period of time ( on the order of 1 - 2 ns ). that absorption produces the quasi - simultaneous breaking of these si — c bonds , thus separating the corresponding organic species , e . g ., organic radicals from the original silicone structure . while these radicals form a gas that disperses in the environment , the si — 0 backbones of the now partially decomposed polymer remain as the sole part of the silicone that has not absorbed the uv photons . meanwhile , each of the si atoms in the polymer backbones is no longer fully interlinked except to two adjacent o atoms . this leaves two unpaired electrons per si atom . each of these electrons remains coupled to a corresponding positron in the atom nucleus and occupies a so - called orbital that is attached to the atom site . after laser irradiation of the original surface , these “ dangling ” bond electron orbitals constitute a dense one - dimensional network along each backbone on the actual silicone surface . that network materializes the chemical “ activation ” of the processed silicone surface . in effect , and as a result of the laser - processing , the surface is no longer neutral , but is negatively charged . eventually , an electric field is established that stems from these orbitals and tends to attract ( i ) positively charged species to form covalent bonding , or even ( ii ) neutral species that come to settle on the silicone surface and adhere to the si — o backbones via electrostatic forces . the end product of the laser - processed silicone surface is partially ablated and , therefore , engraved ( i . e . recessed ) down to some 10 μm or more below the original surface plane , depending on the number of super - imposed irradiations . the activated surface is , therefore , originally localized in the recessed area but is not limited to it , as explained by the discussion . as noted above , c — h or other organic radicals are liberated during irradiation as free entities . the cloud of chemical species that is formed by these radicals tends to project outwards nanometer - scale particles ( or nano - particles ) of the silicone ( si — o ) backbones . these nano - particles land on and populate the silicone surface area that is adjacent to the recessed laser - irradiated parts . thus contributing to the formation of a laser - activated silicone surface . over that area , they form a dense layer of active species , since they contain those unpaired dangling bond electrons on each si atom as mentioned above . eventually , these species do react to the underlying virgin silicone surface , resulting in a strongly adherent , active cover . as a result , activation of the silicone surface is no longer restricted to the recessed laser - processed surface but extends eventually far beyond it . this extended activation is conformal to the un - recessed , original silicone surface . the geometry of the conformal activated surface that surrounds the laser - recessed parts may be tailored through the actual geometry and distribution of these laser - processed recessed areas . since the latter may be monitored by precisely positioning and / or scanning the laser beam onto the silicone surface , the entire conformal activated surface may be designed through computer - monitoring of the laser positioning on the silicone surface . all silicones ( including silicone rubbers ) are accessible to the above - described laser - induced selective decomposition and activation . such materials may differ by the type of organic - radicals that they contain . however , because each radical is connected to a single si atom by a normal si — c bond , different organic - radicals may be identically separated from their silicone backbone via identical irradiation conditions , irrespective of the individual identity of the organic - radicals and silicone formulation . three types of bonds are present in every silicone : si — o , si — c and c — h . the weakest of these bonds is si — c ; ( at 318 kj / mol ), the strongest is si — o ( at 452 kj / mol ), and c — h is intermediate in strength at 411 kj / mol . along with that bond hierarchy , optical absorption starts at 4 . 3 , 5 . 3 , and 5 . 5 ev , for si — c , c — h , and si — o bond ( valence ) electrons , respectively . choosing a monochromatic beam working at 5 ev photon energy ( i . e ., 248 nm wavelength ) restricts exclusively optical absorption to electrons belonging to si — c bonds . increasing the actual power of a laser beam working at 5 ev should therefore allow the selective decomposition of silicone that preserves the original si — o backbone and produces the formation of the dangling bond electrons that materialize the activation of the material . comparatively , such 5 ev photons are not absorbed by silica additive parts . in contrast , they may be absorbed by crosslinker molecules , whether these are a silicone polymer or siloxane . in that case , again c — h and other organic radicals are selectively separated from the backbone of these molecules , without affecting their inter - linking function . the preferred laser source that promotes this selective optical absorption to the most appropriate power is an excimer laser source working at 248 nm wavelength , i . e . 5 . 00 ev photon energy . its actual instant power ( i . e . beam energy / pulse duration ) may vary in the range of 50 to 200 mw . alternatively , another laser source is utilized , though not necessarily with the same effectiveness . for example , a pulsed , quadrupled - yag laser beam would likely operate less efficiently . in one embodiment , the irradiation is pulsed ( pulse duration being variable in the range 5 to 40 ns , full width , depending on manufacturer ). pulses are usually repeated several times along a train , at fixed time intervals . the processed material may be maintained fixed during irradiation , and the train of pulses processes the same area until a specific amount of ablated ( activated ) matter is produced . while being irradiated ( i . e . during laser - scanning ), the target polymeric material may also be displaced in front of the laser source on an x - y table , moving perpendicularly to the laser beam axis . an appropriate combination of pulse repetition rate and scan velocity would ensure the required ablation per unit area . material displacement is computer - controlled to any geometry and scan - speed velocity . the ablated species scatter around the laser - ablated area and establish the laser - activated silicone surface . optionally , the extent of the scatter may either be limited to a few μm or expanded to several hundred μm , using a gas jet ( e . g ., an inert gas , such as he ) that drifts the emitted species away from the irradiated area , and the scan geometry can be adapted to account for that scatter . in contrast , a monochromatic beam working at a photon energy exceeding 5 . 5 ev induces absorption from all valence electrons , irrespective of the bond type from which they originate . at and above an appropriate instant power level , this would eventually drive the full ablation of silicone with no activation of the remaining silicone surface , either of the irradiated part of it or of the surface area surrounding it . excimer lasers have been used to irradiate plastics to form metallized plastics . see u . s . pat . no . 5 , 599 , 592 to l . laude , entitled “ process for the metallization of plastic materials and products thereto obtained ,” the entire contents of which are hereby incorporated by reference . fig5 schematically depicts a conceptualization of a laser - activated silicone surface according to the invention . as shown , chemically reactive , dangling unpaired electrons bound to the si — o backbone are exposed at the surface . the surface is thus “ activated ,” and can react with other compounds of interest . in one embodiment , a silicone article having at least one activated surface formed by irradiation with laser light at a wavelength and power sufficient to eject organic species from the silicone article is prepared according to the method described above . in addition , the article further comprises one or more compounds capable of binding or adhering to one or more integrins , as described above . a convenient way to apply the compound ( s ) to the activated surface is to provide it as a gas or liquid , the latter being particularly suited for introducing large molecular structures , such as peptides and proteins that are otherwise difficult to manipulate . if these are contained in a liquid solution , coating may be done by hand ( e . g .,), disposing a drop of the solution on the irradiated surface ( s ) of the silicone article . advantageously , coupling of the compound ( s ) to the silicone surface is generally restricted to the laser - activated areas as described above . when these structures are contained in a liquid solution , a drop of that solution may be disposed ( e . g ., manually ) on the silicone surface . only the parts of the surface that have been activated would retain the incoming species and ensure substantial adhesion and bonding . on non - activated surface areas , foreign species do not adhere to the virgin silicone surface and may , therefore , be removed by washing in water , gentle scrubbing , or tapping out without affecting those species that are strongly fixed on the activated silicone surface . other means of disposing these foreign species may be practiced depending on the type and size of the species . for example , disposal may also be performed by evaporation in a vacuum chamber , and other physical or chemical means may be practiced as well without affecting the particular adhesion of these species to the laser - activated silicone surface alone . the type and extremely dense distribution of the laser - generated activated parts of the silicone polymer ( namely , the si — o backbones ) on a laser - processed silicone surface allow the surface to size , and keep at once , large molecules of varied formulation and shape . this is demonstrated , for example , in disposing protein molecular structures onto an activated silicone surface . one type of silicone article that can be prepared according to the invention is a silicone implant , i . e ., an implantable medical device made , in whole or in part , of silicone . ( in other words , silicone may constitute substantially the entire implant , or just a part of it , such as an outer coating , sleeve , jacket , or other protective barrier .) in one embodiment , the silicone implant is a silicone article treated with a biocompatible compound that facilitates bonding to living tissue , and comprises a silicone substrate having at least one activated surface formed by irradiation with laser light at a wavelength and power sufficient to eject organic species from the silicone substrate , and at least one compound capable of binding to one or more integrins , coupled to the activated surface , because retinal cells can bind to rgd peptides and proteins containing rgd segments , the present invention can be used to make an epiretinal visual prosthesis — a silicone - coated microelectrode array ( mea ) to be implanted in the eye . the internal limiting membrane of the retina ( the inner - most layer ) contains laminin , fibronectin , collagen type i and iv , protecglyeans and vitreous fibrils . biocompatibility of an epiretinal positioned electrode array is an important consideration when choosing the materials for the mea . additionally , the surgical techniques also play a role in the success of the implanted array . see long - term histological and electrophysiological results of an inactive epiretinal electrode array implantation in dogs . invest . ophthalmol . vis . sci ., vol . 40 , no . 9 , pp . 2073 - 2081 , august 1999 by a b . majji , the entire contents of which are hereby incorporated by reference . techniques for attaching arrays to ocular tissue using biological glues , retinal tacks , and magnets are known in the art . see bioadhesives for intraocular use , retina , vol . 20 pp . 469 - 477 , 2000 , by e . margalit et al ., the entire contents of which are hereby incorporated by reference . fabricating silicone microelectrode arrays is also known in the art , see retinal prosthesis for the blind , surv . ophthalmology , 47 ( 2002 ), pages 335 - 356 by e . margalit , et al ., the contents of which are hereby incorporated by reference . see also , u . s . department of energy document ucrl - lr - 153347 , entitled microfabrication of an implantable silicone microelectrode array for and epiretinal prosthesis by m . n . maghribi dated jun . 10 , 2003 ; batch - fabricated thin - film electrodes for stimulation of the central auditory system , ieee trans . biomed . eng ., vol . 36 , o . 7 , pp . 693 - 704 , july 1989 by d . j . anderson , et al . ; integrated - circuit approach to extracellular microelectrodes , ieee trans . biomed eng ., vol . bme - 17 , pp . 238 - 247 , 1970 by k . d . wise et al . ; implantable microsystems , polyimide - based neuroprostheses for interfacing nerves , med . device tech ., vol . 10 , no . 6 , pp . 28 - 30 , july 1999 , by t . stieglitz et al . ; the entire contents ( of all of the prior references ) of which are hereby incorporated by reference . in one embodiment , implanted components can include a multi - channel electrode array as well as bi - directional telemetry and hermetically packaged micro - electronics . these components can perform power recovery , management of data reception and transmission , digital processing , and analog output of stimulus current . in one embodiment , for a silicone implant comprising a microelectrode array ( mea ), and if an extracellular matrix ( ecm ) protein is selected as the compound coupled to the activated silicone surface , it is advantageous if the ecm protein has at least one of the following characteristics : ( i ) an rgd ( arginine - glycine - aspartate ) amino acid segment to enable it to interact with retinal integrins ( see fig6 and 7 ), ( ii ) disulfide bonds to allow covalent interaction with silicone ( iii ) enzyme - cleavable regions to facilitate removal of the mea . a non - limiting list of polymers useful for creating flexible , micro - electrode arrays are silicone , polyimide , polydimethylsiloxane , and parylenes , such as parylene n and c , and copolymer blends of silicone and non - silicone polymers . note that non - silicones like the polyimides and parylenes , without being combined with a silicone based polymer , may not have activated surfaces when subjected to the excimer laser process , but are still useful polymers for retinal implants . in one embodiment , the activated silicone may be used for long or short - term medical devices such as implants and drug delivery devices , and in a number of tissues , including brain ( e . g ., cortex ), heart , liver , and eye ( e . g ., retina ). a non - limiting list of medical devices includes cardiac pacemakers , cochlear implants , deep brain stimulators for parkinson &# 39 ; s disease , and epiretinal visual prostheses . for these devices , establishing good contact with the surrounding tissue is important and thus the attachment methods of the present invention may be used . the use and implanting of cochlear implants is known in the art . see cochlear prosthetics , ann . rev . neurosci ., vol 13 , pp . 357 - 371 , 1990 , by g . e . loeb , the entire contents of which are hereby incorporated by reference . using implants to treat parkinsonian tremors is also known in the art . see high - frequency unilateral thalmic stimulation in the treatment of essential and parkinsonian tremor , ann . neural ., vol . 42 , no . 3 , pp . 292 - 299 , september 1997 , the entire contents of which are hereby incorporated by reference . from the foregoing discussion it can be appreciated that the invention also provides a method of making a biocompatible , implantable prosthesis , comprising the steps of providing an implantable prosthesis ; partially or completely covering the prosthesis with a silicone having at least one activated surface ; and coupling at least one biocompatible compound capable of binding to one or more integrins to the activated surface . in addition , the invention provides a method of securing an implantable prosthesis to living tissue , the method comprising the steps of providing an implantable prosthesis partially or completely covered by a silicone having at least one activated surface , the activated surface being coupled to at least one biocompatible compound capable of binding to one or more integrins ; and allowing the at least one compound to interact with cellular membrane proteins in the tissue , thereby securing the implantable prosthesis to the tissue . if it becomes necessary to remove such an implant from tissue to which it has been attached , an enzyme such as plasmin can be used cleave rgd peptides , thereby breaking the bond between the implant and adjacent integrins . snake venom disintegrin ( contortrostatin ) is a homodimeric protein that contains an rgd amino acid segment and disulfide bonds that allow the protein to attach to activated silicone . an excimer laser was used to physically break the molecular bonds and produce dangling free bonds on the silicone surface . using a pipette , the contortrostatin was dropped onto the lased silicone surface and allowed to dry . postmortem porcine eyes were prepared by removing the vitreous humor with a vitreous cutter ( bausch and lomb ). the posterior segment of the eye was flattened by making four cuts in four different quadrants from the pars plana to the equator . the eye was pinned out onto a polystyrene surface and quadrants of the retina were delicately removed . each piece of retina was glued ( adhesive systems rp 1500 usp ) face up ( i . e . internal limiting membrane up ) to a piece of aluminum and allowed to dry for 10 minutes . during this time the retina was kept moist with drops of saline . the adherence forces between the contortrostatin - coated silicone and the retina were measured by dynamic mechanical analysis , using a bose electroforce 3100 . contortrostatin - coated silicone was glued ( adhesive systems rp 1500 usp ) to a piece of plastic and lowered onto the prepared retina . the silicone piece was raised 4 mm over 10 seconds and the adhesive forces resulting from the separation of retina and aluminum were recorded . after the excimer laser was used to physically break molecular bonds , photos were taken of the silicone surface during the attachment process . the contortrostatin drop can be seen absorbing into the lased areas ( fig8 ) and later extending over the silicone debris on the surface ( fig9 ). to test the adhesive strength of the protein to the silicone , a simple scotch tape test was performed . the scotch tape could not he removed from the activated surface . dynamic mechanical analysis of contortrostatin - coated silicone and non - laser processed silicone is graphically presented in fig1 and 12 . the silicone in each case was removed from the retina at 0 . 4 mm / second . fig7 shows the adhesive three of the contortrostatin - coated silicone is approximately 340 mn , at which point the retina was torn away from the aluminum surface ( see photo , fig1 ). fig1 shows the plain ( non - activated ) silicone is easily detached from retina after just 1omn . the green line represents a force of 1 omn , and the blue line is a displacement of 4 min . over 10 seconds . while this invention has been described in connection with reference to what are considered exemplary embodiments , the invention is not limited to the disclosed embodiments , dimensions , and configurations but , on the contrary , also extends to various modifications and equivalent arrangements . the invention is limited only by the appended claims and their equivalents . | US-201414499192-A |
a specialized article of clothing is configured to enhance speed and / or accuracy of a golf swing or baseball swing . the clothing employs tension and / or flexure members configured to enhance muscle function , thereby increasing muscular strength and / or speed for improving athletic performance . the tension and / or flexure members provide for storage and release of strain energy during a wearers movement . the article of clothing may be configured for alternative movements , including throwing , jumping , and running . the article of clothing may be adapted to reduce strain on fatigued or injured muscles , or it may be configured to limit the range of motion of a joint , such as to prevent injury . | while the invention is susceptible to various modifications and alternative forms , specific aspects thereof have been shown by way of example in the drawings and are herein described in detail . it should be understood , however , that it is not intended to limit the invention to the particular form disclosed , but rather , the invention is to cover all modifications , equivalents , and alternatives falling within the scope of the invention as defined by the claims . all muscles work in antagonistic pairs , since muscles can exert force only by contracting and lengthen only by relaxing . muscles cannot push or stretch themselves . for example , a pair of muscles ( the biceps and triceps ) bends and straightens the elbow , which is a simple hinge joint . when the biceps contracts , it flexes ( bends ) the elbow joint . at the same time , it pulls the triceps , making it longer . so the triceps stretches due to contraction of the biceps . when the triceps contracts , it extends ( straightens ) the elbow joint , and also pulls the biceps , making it longer . so these two muscles work together . neither muscle stretches itself . rather , it must be stretched by its antagonist ( partner ). complex joints , such as the shoulder ( which is a ball - and - socket joint ), have more than one antagonistic pair of muscles . the shoulder joint includes three pairs of muscle . in many athletic activities , such as sports that involve throwing a ball or swinging a club or bat , the muscles employed for throwing or swinging are first stretched by their corresponding opposing muscles . for example , the pre - launch mechanics of a baseball batter &# 39 ; s swing involve the batter &# 39 ; s hands pulling toward the back - shoulder — mainly by the top - hand pulling backward toward the catcher . when the muscles used to swing the bat are fully stretched , the batter is ready to initiate forward rotation . the lowering of the lead heel triggers the initiation of the swing . leg and torso muscles contract in unison to accelerate shoulder rotation . the hands remain back and allow rotation to fling them into a circular path . the back - elbow lowers toward the batter &# 39 ; s side as the batter pulls back with the top - hand , increasing the bat - head speed in an arc toward the catcher . at this point , shoulder rotation , the circular path of the hands , and the push - pull action of the arms accelerates the bat - head . while differences in style may exist , one key point proves true — all great power hitters in baseball use similar rotational mechanics , whereas weaker hitters do not . great hitters produce their tremendous bat speed by continuously supplying torque and rotational energies to the bat from initiation to contact . average hitters also generate their bat speed by applying these same forces , but over a more limited portion of the swing and therefore attain limited results . in accordance with one aspect of the invention , tension and / or flexure members fastened to opposite sides of a joint ( or fastened across multiple joints ) are configured to assist a batter &# 39 ; s swing by supplying continuous torque and rotational energy to the bat over a substantial portion of the swing . alternative aspects of the invention may be configured to assist a golfer &# 39 ; s swing . in yet another aspect , an article of clothing , such as a brace , includes tension and / or flexure members fastened to opposite sides of an elbow joint to assist a wearer &# 39 ; s throwing motion . other aspects may be provided wherein tension and / or flexure members integrated into an article of clothing may assist muscles in performing other movements , such as to enhance sports performance and / or reduce tension on injured or fatigued muscles . the tension and / or flexure members store energy when the first set of an antagonistic pair of muscles contracts and the second set of the antagonistic pair stretches . for example , the tension and / or flexure members are deformed as the first set of muscles contracts , and the resulting deformation may be in the direction that the second set of muscles is stretched . the tension and / or flexure members are configured to produce a restoring force in a direction that the second set of the antagonistic pair contracts . a restoring force , as used herein , is typically a variable force that gives rise to an equilibrium in a physical system . if the system is perturbed away from the equilibrium , the restoring force will tend to bring the system back toward equilibrium . an example is the action of a spring : an idealized spring exerts a force that is proportional to the amount of deformation of the spring . pulling the spring to a longer configuration causes it to exert a force that brings the spring back toward its equilibrium length . the amount of force can be determined by multiplying the spring constant of the spring by the amount of stretch . while a restoring force is typically a variable force , alternative aspects of the invention may be configured to produce a substantially constant restoring force . aspects of the invention may include an article of clothing , such as a brace , or some other wearable device that comprises at least a pair of fastening members and one or more tension and / or flexure members . the fastening members are configured for fastening the one or more tension and / or flexure members to opposite sides of at least one joint . in one aspect , a shirt comprises one or more tension and / or flexure members configured to store and release energy for enhancing a desired physical movement . the tension and / or flexure members may be positioned underneath the fabric of the shirt , outside the fabric of the shirt , encapsulated within the fabric of the shirt , or integrated into the fabric of the shirt . in one aspect , the fabric of the shirt may be designed to provide tension and / or flexure in one or more predetermined directions . for example , the shirt may comprise an elastic fabric configured for providing elasticity in at least one predetermined direction . fig1 shows the back of a shirt configured in accordance with an aspect of the invention . a plurality of tension members 101 - 105 have a first set of connectors 121 - 125 attached around the shoulder of the shirt . the plurality of tension members 101 - 105 have a second set of connectors 111 - 115 configurable for connecting to a belt , a brace , or some other separate article of clothing or any alternative wearable device configured to serve as an anchor point . in some aspects of the invention , each of the tension members 101 - 105 may comprise more than a pair of connectors . in all such aspects , tension members ( such as the tension members 101 - 105 ) and connectors ( such as the connectors 111 - 115 and 121 - 125 ) are positioned to enable the tension members to store energy when the wearer of the shirt moves in at least a first predetermined way and to release the energy when the wearer moves in at least a second predetermined way , thereby assisting at least one predetermined movement . in order to adjust the tension of the tension members ( 101 - 105 ) to a desired level , the connectors 121 - 125 ( and / or 111 - 115 ) and / or the anchor point ( such as the belt shown in fig3 ) to which the connectors 111 - 115 attach may be adjustable . the belt shown in fig3 includes a flexible member 300 configured to encircle a wearer &# 39 ; s waist , and a fastening member comprising a bracket 310 and a tightness - adjustment lever 322 configured for fastening the belt . alternative belt designs may be employed , such as those employing a standard buckle arrangement . the flexible member 300 further comprises one or more anchors ( such as anchors 301 - 304 ) for anchoring connectors ( such as the connectors 111 - 114 ). in this case , each connector ( such as connector 114 ) comprises a loop 314 configured to attach to its respective anchor 304 . the anchor 304 comprises a post 324 to which the loop 314 fits over , and a cap 334 for securing the loop to the post 324 . in other aspects , connectors and / or anchors may employ carabineers or other clip devices . the belt may be adjusted ( rotated ) around the waist to apply a desired level of pre - tension to the tension members . in other aspects , the connectors and / or the tension members may be adjusted to supply a predetermined amount of pre - tension . tension levels of zero pre - tension ( e . g ., fully slack tension members ) to many pounds of total pre - tension may be provided . pre - tension levels depend on various factors , such as the degree of deformation imposed upon the tension members , the number of tension members employed , and the amount of restoring force supplied by each tension member . a higher pre - tension level enables greater energy storage , which can increase swing speed for a batter or golfer . a pre - tension level greater than zero pounds results in a restoring force that the wearer must resist at the “ ready position ” ( e . g ., while standing over the golf ball , such as shown in fig6 a ). as the pre - tension level is increased ( i . e ., as the belt is adjusted to increase the tensile strain energy ), more potential energy is provided . in some aspects of the invention , the pre - tension may assist the wearer by relieving the load on fatigued or injured muscles . fig2 shows the front of a shirt configured in accordance with an aspect of the invention . the tension members 131 - 135 are positioned in a radial orientation with respect to each other , with a first set of connectors 151 - 155 located around the shoulder and a second set of connectors 141 - 145 configurable for connecting to an anchor ( such as the belt shown in fig3 ). fig4 shows the front of a shirt configured in accordance with an alternative aspect of the invention . in this case , the tension members 101 - 105 are disposed in a parallel orientation with respect to each other . fig5 shows the back of a shirt also comprising parallel tension members 101 - 105 . it should be appreciated that the tension members 101 - 105 may be oriented in different ways ( e . g ., radially in fig1 and 2 , and parallel in fig4 and 5 ), yet provide assistance for the same movement . for example , the shirt aspects shown in fig1 , 2 , 4 , and 5 may be employed by a wearer swinging a golf club . furthermore , a particular aspect of the invention may be employed for assisting different movements . for example , a shirt aspect , such as shown in any of the fig1 , 2 , 4 , and 5 may be employed for assisting both a golf swing and a baseball swing . alternative aspects may provide for the design of the tension and / or flexion members ( and their respective connectors ) to take into account fine aspects of the movement to be assisted . for example , one aspect may be designed specifically to enhance a golf club swing , whereas a different aspect may be designed specifically to enhance a baseball bat swing . tension and / or flexure members employed in aspects of the invention may have similar stiffness ( modulus ) or different stiffness values . the tension and / or flexure members may be embedded within the shirt material ( i . e ., encapsulated , or otherwise hidden ) or may be located externally ( e . g ., outside the shirt ). tension and / or flexure members may be applied to the back and / or front of the shirt and / or to the sides of the shirt . the tension and / or flexure members are attached at specific locations to allow stretching ( tensile strain ) and / or deflection ( flexural strain ) for energy storage and release . in some aspects of the invention , a tension member may comprise an elastic material ( such as a spring , a bungie , a rubber band , or any other type of elastic material ) configured to store strain energy when the tension member is stretched . alternative aspects of the invention may comprise one or more flexure members ( such as semi - rigid rods , beams , tubes , panels , or skins ) configured to store strain energy when the flexure member is bent or otherwise deformed . in some aspects , flexure members may comprise a semi - rigid material shaped as a circular tube , a curved panel , or an i - beam . furthermore , certain aspects ( such as an aspect configured to store energy when a hinge joint is bent , and to release energy when the joint is extended ) may be more effectively implemented with flexure members . thus , aspects of the invention that employ flexure members may provide a similar function as aspects employing tensile members . regardless of initial pre - tension ( or pre - flexure ), additional storage energy is provided during the backswing portion of a golf swing or baseball bat swing . for example , in a golf swing , a great amount of forward swing power can be facilitated in the backswing by rotating the shoulders further than the hips ( such as shown in fig6 b ). the shoulders rotate clockwise ( for a right - handed golfer ) by 90 degrees from the setup position shown in fig6 a to the full backswing position depicted in fig6 b , while the hips rotate only 45 degrees . aspects of the invention may provide for stretching one or more tension members or flexing one or more flexure members during the backswing . the coiling ( i . e ., twisting ) of the body ( and the resulting tension and or flexure of a shirt or brace configured in accordance with aspects of the invention ) during the backswing provide for potential - energy storage . this potential energy is released in the form of kinetic energy when the golfer &# 39 ; s body uncoils ( untwists ) during the downswing and follow - through ( fig6 b - 6f ), which accelerates the club head . thus , some aspects of the invention provide for coordinating the release of stored tension ( or flex ) in tension elements ( or flexure elements ) with the uncoiling ( i . e ., untwisting ) of the golfer &# 39 ; s body . since aspects of the invention enhance potential - energy storage in the backswing position ( fig6 b ), the speed of the downswing at impact with the golf ball ( fig6 d ) may be significantly increased . furthermore , aspects of the invention may employ an initial pre - tension and / or pre - flexure strain energy during setup ( fig6 a ), which provides for additional energy storage during the backswing ( fig6 b ). such pre - tension and / or pre - flexure assists the golfer in initiating the downswing from the top of the backswing , and increases the club head &# 39 ; s acceleration , thereby increasing club - head speed at the contact point ( fig6 d ), and thus driving distance . alternative aspects of the invention may be configured for enhancing a baseball player &# 39 ; s or softball player &# 39 ; s bat speed . other aspects may be configured for racket sports . still , other aspects may be configured for sports that employ throwing . in other aspects , an athlete &# 39 ; s running and / or jumping ability may be enhanced by the configuration of tension and / or flexure elements . another aspect may be configured for improving a swimmer &# 39 ; s performance . some aspects of the invention may be employed as a training tool for teaching proper movement . for example , an aspect of the invention may employ tension and / or flexure members configured to train someone to properly coordinate the movement of their hips , shoulders , and arms . in another aspect , the tension and / or flexure members may be further configured to resist a particular movement for physical conditioning to strengthen and train a predetermined muscle group used for batting , swinging , throwing , swimming , running , jumping , etc . fig7 a - 7d show a sequence of positions during a lifting movement performed by a wearer of an article of clothing configured in accordance with an aspect of the invention . the article of clothing comprises a flexure member 700 , a first connector 701 , and a second connector 702 . the flexure member 700 is secured to the wearer &# 39 ; s body by the connectors 701 and 702 . in this case , connector 701 may include a chest harness and connector 702 may include a leg harness . alternative connectors may be employed for securing the flexure member to the wearer &# 39 ; s body . the flexure member 700 may comprise a semi - rigid material , such as a flexible rod , panel , or membrane that is in a non - deformed state while the wearer &# 39 ; s back and buttocks are straight , such as shown in fig7 d . as the wearer bends or squats , the flexure member 700 deforms , storing energy . fig7 a illustrates a position in which the flexure member 700 stores the most energy during a lifting movement . at this point , the flexure member 700 is providing maximum restoring force , which relieves strain on the wearer &# 39 ; s back . as the wearer stands up , the flexure member assists the lifting movement . fig7 a - 7d show a sequence of positions during a lifting movement performed by a wearer of an article of clothing configured in accordance with another aspect of the invention . the article of clothing comprises flexure member 700 , first connector 701 , second connector 702 , and a flexure augmenter 710 . the flexure augmenter 710 is configured for providing a pre - flexion force to the wearer when the wearer is in a neutral position , such as the standing position shown in fig8 d . in this case , the pre - flexion force provided by the flexure augmenter 710 can assist the wearer when holding or carrying an object by reducing strain on the wearer &# 39 ; s back . the method and system aspects described herein merely illustrate particular aspects of the invention . it should be appreciated that those skilled in the art will be able to devise various arrangements , which , although not explicitly described or shown herein , embody the principles of the invention . furthermore , all examples and conditional language recited herein are intended to be only for pedagogical purposes to aid the reader in understanding the principles of the invention . this disclosure and its associated references are to be construed as being without limitation to such specifically recited examples and conditions . moreover , all statements herein reciting principles and aspects of the invention , as well as specific examples thereof , are intended to encompass both structural and functional equivalents thereof . additionally , it is intended that such equivalents include both currently known equivalents as well as equivalents developed in the future , i . e ., any elements developed that perform the same function , regardless of structure . | US-41615409-A |
the present invention includes a system and method of aggregating different flowers or plants in a single container . different plant types are grown in individual smaller pots having particular horizontal cross - sections . a plurality of the individual smaller pots are then closely fit into an outer plant pot to result in substantially no gaps between either the individual plant pots or between the individual plant pots and the outer plant pot . a method of retail marketing of the varieties of different types in the individual smaller pots includes permitting the consumer to mix and match the different types into outer plant pots . a cultivation method involves segregating the different types prior to becoming seedlings to facilitate their unique growing needs , and then providing the consumer access to the varieties at the retail level . | the present application provides a solution for consumers who wish to buy separate plant types and combined in a single pot . whereas previously a laborious chore of removing each types from separate smaller pots and putting them in a larger container was required , the present application enables the consumers to simply buy the separate smaller pots and combined them closely into a larger container without removing the plants from the pots . or , the consumer may purchase just the smaller pots for separate display or transplant . the term “ pot ” refers to any container which is typically used for growing plants , including perennials , annuals , fruits , vegetables , etc . the pot may be sized and configured to contain dirt , or another growing medium such as wood chips , clay beads , and the like . furthermore , the pot may not contain a growing medium such as for holding epiphytes . the materials for the separate smaller or larger pots may be plastic , ceramic , wood , or other typical pot materials . alternatively , the pots may be made of biodegradable materials . fig1 a shows three separate smaller segmented pots 20 being assembled into a larger cylindrical pot 22 . each of the segmented pots 20 has a horizontal cross - section configuration which is pie - shaped so that multiple segments can be combined and fit into the larger pot 22 which is circular in horizontal cross - section . the segmented pots 20 each contain dirt and , preferably , a separate plant species , as indicated by the different visual configuration of plants . fig1 b is the resulting close - fit assembly , which provides a pleasing assembly of the three different plant species in a single pot 22 . alternatively , three of the same species of flower with different colors could be combined for a pleasing appearance . the present application thus contemplates the mixing and matching of two or more different plant types ( species , colors , sizes , shapes , etc .) into a single pot . it should be noted that with three close - fit segmented pots 20 , each pot has a 120 ° pie - shaped horizontal cross - section . of course , two or more than three pots 20 can be combined , with the horizontal cross - section of varying accordingly . for example , the combination of five pots 20 means that each pot has a 72 ° pie - shaped horizontal cross - section . furthermore , the sizes of the larger pots 22 may vary , with the sizes of the smaller pots 20 changing proportionately . for example , the larger pots 22 may be provided in 4 , 6 , or 8 inch or larger diameters , with the three pie - shaped pots 20 having a radius from an inner apex to the outer curved wall of one half of the diameter of the larger pot . the depth of the smaller or larger pots are similar , and of course may vary , with the smaller pots typically being slightly shorter than the larger pots . fig2 a shows four separate smaller square pots 30 being assembled into a larger square pot 32 . again , each one of the smaller square pots 30 contains dirt and a separate plant species , such that when combined as in fig2 b the resulting assembly has the four separate plant species . again , the arrangement provides the ability to mix - and - match four different plant types ( species , colors , sizes , shapes , etc .) into a single pot . while in the past and a number of smaller pots which could fit within the volume of larger pot could be combined , the present application contemplates closely fitting a plurality of smaller pots into a larger pot . the term “ closely fitting ” or “ close - pack ” refers to the smaller pots fitting within the larger pot so that there are substantially no gaps or empty volume left between either the smaller pots or between the smaller pots and the outer larger pot . this maximizes the growing volume within the larger pot , and efficiently combines the different plant types . furthermore , the size of the larger pot is as small as possible , as the horizontal cross - section approximately equals the aggregate of the horizontal cross - sections of the smaller pots . of course , in order to fit smaller pots within larger pots a small amount of clearance is necessary between the respective pots , and thus there are by necessity nominal gaps between the pots . the permutations of combining separate smaller pots so as to fit closely into one larger pot are endless . for example , fig3 is a top plan view of the three smaller pie - shaped pots 20 from fig1 a fitted within the larger circular pot 22 . fig4 shows three smaller trapezoidal - shaped pots 40 fitted within a larger trapezoidal pot 42 . fig5 shows four smaller identical equilateral triangular - shaped pots 50 fitted within a larger equilateral triangular pot 52 . in fig6 , four smaller quarter - oval - shaped pots 60 fit closely within a larger oval pot 62 . fig7 is a top plan view of five smaller triangular - shaped pots 70 and an inner circular pot 72 fitted within a larger star - shaped pot 74 . the triangular - shaped pots 70 have partial circular inner walls 76 that conform to the inner circular pot 72 . fig7 is symbolic of any close - packed smaller pots within a larger pot , as described in the present application , where the smaller pots have more than one cross - sectional shape . the reader will therefore understand that the present application contemplates any combination of smaller pots that are close - packed into larger pots . one of the simplest variations is shown in fig9 a - 9c , described below , and includes two identically - shaped smaller pots fitted within a larger pot . fig7 illustrates a combination of a plurality of smaller pots with at least two that are different fitted within a larger pot . indeed , the present application discloses a number of “ regular ” shapes of pots , such as circular , square , etc . however irregular or random shapes are contemplated as long as the smaller pots are closely - packed into the larger pot . the present application also discloses a method of plant cultivation in which different types of plants are cultivated separately and then combined when ready to display in the retail space or at the time of purchase by the consumer . for instance , different plant species have different requirements in terms of watering , fertilizer requirements , sun exposure , etc ., and growers often segregate different species in their formative stages . once the plants have developed into seedlings , their particular requirements may not be so distinct , and therefore they can be combined with other varieties . a method of cultivation disclosed herein includes starting different plant species in separate containers until they reach a desired maturity , and then presenting them for combination with other plant species that have been similarly nurtured . more generally , the exemplary method provides the ability to separately cultivate different plant types ( species , colors , sizes , shapes , etc .) for later combination . indeed , one method could involve separately cultivating the same species but nurturing the plants differently so that the separate groups develop differently , such as by differently fertilizing or pruning one or more groups to be later combined for a pleasing arrangement . in an exemplary method , fig8 shows three separate long rectangular planter boxes 90 a , 90 b , 90 c each having a plurality of smaller segmented pots 92 a , 92 b , 92 c therein having the same plant types . that is , planter box 90 a has plant type a therein , planter box 90 b has plant type b therein , and planter box 90 c has plant type c therein . the different plant types are indicated by differently - shaped leaves and shapes . each separate planter box 90 a , 90 b , 90 c represents any number of segregated areas in which the different plant types may be separately cultivated . that is , the planter boxes 90 may be representative of separate areas or rooms within a cultivation facility , or simply separate containers within which the seeds are cultivated into seedlings . fig9 a - 9c show top plan views of three different combinations of the different plant types a , b , c from the previously segregated planter boxes of fig8 . that is , the smaller segmented pots 92 a , 92 b , 92 c are mixed and matched within larger pots 94 . in fig9 a , type a is combined with type b , in fig9 b , type a is combined with type c , and in fig9 c , type b is combined with type c . the smaller segmented pots 92 are semi - circular in horizontal cross - section , and closely fit within circular cross - sectional larger pots 94 . again , this is a relatively simple shape combination , and is representative of numerous other more complex arrangements . fig1 a - 10c show the combined plant types a , b , c corresponding to those schematically shown in fig9 a - 9c . it is thus apparent that numerous combinations of plants can be combined in this manner for a variety of results . for example , flowers having complementary colors , different varieties of herbs , striking arrangements of succulents ; all can be combined limited only by the imagination of the customer . in terms of the actual retail process , the combinations of different types may be made either by the seller or the buyer . for example , the plant store or nursery can cultivate the different types separately and then combine them in desirable ways for direct sale to the customer . alternatively , the retailer can provide multiple varieties of the plant types in the smaller pots for combination by the customer at the time of purchase . suggestions as to attractive or desirable combinations can be made by the retailer , verbally or on instruction sheets , or actual examples of such combinations can be displayed to assist the customer . throughout this description , the embodiments and examples shown should be considered as exemplars , rather than limitations on the apparatus and procedures disclosed or claimed . although many of the examples presented herein involve specific combinations of method acts or system elements , it should be understood that those acts and those elements may be combined in other ways to accomplish the same objectives . acts , elements and features discussed only in connection with one embodiment are not intended to be excluded from a similar role in other embodiments . as used herein , “ plurality ” means two or more . as used herein , a “ set ” of items may include one or more of such items . as used herein , whether in the written description or the claims , the terms “ comprising ”, “ including ”, “ carrying ”, “ having ”, “ containing ”, “ involving ”, and the like are to be understood to be open - ended , i . e ., to mean including but not limited to . only the transitional phrases “ consisting of ” and “ consisting essentially of ”, respectively , are closed or semi - closed transitional phrases with respect to claims . use of ordinal terms such as “ first ”, “ second ”, “ third ”, etc ., in the claims to modify a claim element does not by itself connote any priority , precedence , or order of one claim element over another or the temporal order in which acts of a method are performed , but are used merely as labels to distinguish one claim element having a certain name from another element having a same name ( but for use of the ordinal term ) to distinguish the claim elements . as used herein , “ and / or ” means that the listed items are alternatives , but the alternatives also include any combination of the listed items . | US-201314070290-A |
a portable game hoist and skinning aid which includes a support frame for supporting a deer carcass in a hoisted position off the ground and which may be attached to a tree , post or other vertical object by straps , chains or other means . the device includes a hand operated winch having a cable which may be passed over an upper pulley attached to the support frame to raise the deer carcass into position . the cable may also be run through a lower pulley and then attached to the skin of the animal so that operation of the winch provides assistance in skinning the suspended animal carcass . | with reference to fig6 a support frame 10 includes a horizontal support arm 11 which is rigidly affixed to a vertical backing member 12 . a diagonal brace 13 is rigidly affixed to the horizontal support arm 11 and the vertical backing member 12 so as to provide extra strength and rigidity for the entire support frame 10 . at the lower end of the vertical backing member 12 , a winch support 14 is attached in an essentially horizontal orientation . the winch support 14 supports a winch 15 such that its axis of rotation is horizontal and orthogonal to both the horizontal support arm 11 and the vertical backing member 12 . in the preferred embodiment , the winch 15 is manually operated , however , electrical or other winches operated by other than manual means would be acceptable . the support frame 10 is designed to be compact , lightweight and field portable . the support frame 10 may be set up for operation by attaching it to a tree 20 , vertical post or other substantial vertical object . it is desirable that the support frame 10 be attached to an object that is sufficiently strong and rigid to support both the weight of the support frame 10 , the carcass of the animal being skinned and is furthermore strong enough to resist bending forces induced by the operation of the apparatus . it is also desirable that the support frame 10 be supported at a height above ground sufficient to allow the animal carcass 30 to be freely supported above the ground . the support frame 10 is oriented for operations such that the vertical backing member 12 is essentially vertical . the support frame 10 is attached to the tree 20 or similar object by means of straps 21 . the straps 21 may be of various materials and construction . for example , nylon webbing materials having ratchet type locking mechanisms are commonly available and would be suitable for this application . in addition , metal chains looped about the tree 21 have been found to be suitable in practice . with reference to fig4 the support frame 10 is provided with an upper pulley 22 . the upper pulley 22 is held in a bracket 23 suspended from the outer extremity of the horizontal support arm 11 . the shaft 24 of the upper pulley 22 is suspended rotationally in the bracket 23 and in a movable pulley guard 25 . the action of the movable pulley guard 25 is described with reference to fig4 and 5 . the movable pulley guard 25 is pivotally attached to the horizontal support arm 11 by a pivot 26 . the movable pulley guard 25 is provided with a slot 26 which engages the shaft 24 of the upper pulley 22 . when the slot 26 is engaged , the upper pulley 22 is fully supported at each end of the shaft 24 . however , as will be described more fully below , the movable pulley guard 25 may be rotated so that the slot 26 disengages from the shaft 24 . in this position the upper pulley 22 is only supported by the support bracket 23 . however , the upper pulley 22 is in this position able to receive a cable 40 from the winch 15 . the use of the present invention as a hoist for hoisting a carcass of a deer or other game animal from the ground is illustrated with reference to fig1 and 5 . the deer carcass 30 is suspended from a gambrel 31 by means of hooks 32 which pass through the tendons of the hind legs 33 of the carcass 30 . a cable 40 is lead from the winch 15 over the upper pulley 22 with the movable pulley guard 25 disengaged from the shaft 24 . the movable pulley guard 25 is then re - engaged with the shaft 24 of the upper pulley 22 . the cable 40 terminates in a hook 41 which is attached to the gambrel 31 . operation of the winch 15 then acts to hoist the animal carcass 30 from the ground . when the animal carcass 30 has been hoisted to a sufficient height above the ground , a short length of chain 50 as shown in fig6 is employed to suspend the weight of the animal carcass 30 from the support frame 10 . the chain 50 may be permanently attached to the gambrel 31 or may be hooked to the gambrel 31 in the manner described for the hook 41 of the cable 40 . the chain 50 is suspended from the support frame 10 by means of a chain support 51 which vertically depends from the outer extremity of the horizontal support arm 11 . the chain support 51 contains a keyhole slot 52 . as is well known in the art , a chain 50 may be suspended by passing links of the chain 50 through a keyhole slot 52 after which the links of the chain 50 may be oriented so that the links of the chain 50 are locked into position in the keyhole slot 52 . after the chain 50 has been locked into the keyhole slot 52 , the winch 15 may be operated in a reverse direction to slacken the cable 40 so that the chain 50 takes the full weight of the animal carcass 30 . the hook 41 of the cable 40 may then be disengaged from the gambrel 31 . the movable pulley guard 25 may then be disengaged from the upper pulley 22 so that the cable 40 may be removed from the upper pulley 22 . at this point the apparatus may be set up to assist in the removal of the skin 60 of the animal carcass 30 as shown in fig6 . a lower pulley 70 is fastened to the tree 20 at a position below the animal carcass 30 by means of straps 21 . the cable 40 is lead from the winch 15 around the lower pulley 70 and thence to an upper portion of the animal carcass 30 . the process of removing the skin 60 from the animal carcass 30 is begun manually by making incisions in the animal carcass 30 to produce a flap of skin 61 to which the cable 40 may be attached . various means of attachment of the cable 40 to the flap of skin 61 as are well known in the art would be acceptable in the practice of the present invention . after attachment of the cable 40 to the flap of skin 61 , the winch 15 is operated so as to exert a downward pull on the skin 60 of the animal carcass 30 . while maintaining the downward force on the skin 60 , the operator may make such incisions and cuts as are necessary to assist in the removal of the skin 60 from the animal carcass 30 . the present invention is described with reference to certain preferred and alternative embodiments which are intended to be exemplary only and not by way of limitation to the full scope of the invention as set forth in the appended claims . | US-41287695-A |
a system for a dental superstructure to be attached to an implant using a digital model description of a shape of the superstructure , the superstructure including first and second elements . the system comprises a computing device arranged to analyze a recorded real clinical situation or shaped clinical situation of an implant axis and insertion axis , compute a shape of the dental superstructure based at least in part on the determined implant axis , generate digital data representing the shape of the superstructure , and separate the computed shape into first digital data representing a shape of the first element to be connected to the implant and second digital data representing a shape of the second element to be connected to the first element , the shape of the first element being optimized , at least in part , based on a tilt angle between the determined implant axis and insertion axis . | fig1 is a diagram of a two - element superstructure , composed of a crown 1 and an abutment 2 , on an implant 3 . the insertion direction of crown 1 is indicated by an axis 4 . the position of implant 3 in the jawbone is illustrated by an additional axis 5 . axes 4 and 5 only rarely coincide , because the insertion position of the implant in the clinical situation is dependent on the patient and must be defined on the one hand in relation to the bone material available and on the other hand in relation to the existing teeth . these parameters are critical for correct positioning and orientation of the implant to ensure future mechanical stability during the process of chewing . the position of the implant with its axis 5 may therefore differ from the position of the original root of the tooth . abutment 2 is joined to the end of implant 3 at the level of the jawbone by a form - fitting attachment geometry 6 . the ideal abutment shape expands from the geometry for attachment toward the implant in such a way that it forms with its abutment edge 7 a tooth cross section approx . 1 mm below the gum ( gingiva ). the abutment shape provides a shoulder 8 above and around abutment edge 7 , on which crown 1 rests . this shoulder 8 is wide enough to ensure that the wall thickness of the crown is not less than the minimum value specified for the material . shoulder 8 merges into a post 9 of smaller diameter . this post 9 points in the insertion direction indicated by axis 4 . ideally , abutment 2 , by its shape , compensates for the angle known as the tilt angle between implant axis 5 and the insertion direction in such a way that crown 1 can be mounted in the occlusal direction along axis 4 ( see fig3 ). instead of the occlusal direction , any other axis can be employed , such as a common insertion axis for the upper element of the two - element superstructure in a superstructure for multi - membered dental restorations . in fig2 a and 2 b , a clinical situation with two implants imbedded in a jaw is illustrated in longitudinal section , in which situation a frame 1 ′ instead of a crown is attached to two abutments 2 ′, 2 ″. implants 3 ′, 3 ″ exhibit axes 5 ′, 5 ″ that may be skew to each other ( as shown in fig2 b ). abutments 2 ′, 2 ″, however , exhibit insertion axes 4 ′, 4 ″, which are parallel to each other . implants 3 ′, 3 ″ are anchored in the jawbone 22 and extend to the gum 23 . an ideal abutment also has a cross section formed in such a way that it is twistproof , ie , it prevents the mounted crown from twisting on the abutment . the outer geometry of the abutment conforms to the minimum dimensions d 1 , d 2 , and d 3 , to be explained below . fig3 is a diagram of an abutment 12 to be produced from a blank 11 . blank 11 has an attachment geometry 14 for allowing form - fitting attachment to an implant 13 , and abutment 12 is positioned in blank 11 in such a way that said abutment will include the attachment geometry 14 . blank 11 has a bore 15 for the accommodation of a screw for mounting the abutment on the implant . in the present embodiment bore 15 is concentric with a center axis 16 of implant 13 . center axis 16 of implant 13 , however , mainly specifies the direction of attachment of attachment geometry 14 . blank 11 is cone - shaped in the region of the attachment geometry , so that it predefines the design of the abutment toward an abutment edge 17 . a shoulder 18 that merges into a post 19 adjoins abutment edge 17 . post 19 is disposed in blank 11 such that an axis 20 indicating the direction of attachment of crown 1 intersects the center axis 16 at an angle . in principle , axes 16 and 20 can be skew to each other . however , it has been demonstrated that the use of intersecting axes is sufficient . in this manner there is the assurance that the head 21 ( represented by dashed lines ) of an occlusal screw lies inside bore 15 , which is delimited by the wall of abutment 12 . the optimal abutment shape differs from the ideal abutment shape such that the limiting conditions described below , namely the clinical situation and the technical requirements relating to geometry , material , and fabrication , are fulfilled . the clinical situation defines the ideal shape of the abutment . the surrounding tooth situation is analyzed in addition to the position and orientation of the dental implant . such analysis reveals the occlusion direction along with the angle to be compensated by the abutment . the height of the occlusal table is also determined . the blanks , usually ceramic blocks , that are used to manufacture abutments exhibit certain geometric constraints . due to precision requirements , the size and shape of these blocks can only be varied to a very limited degree during fabrication . not just any ideal abutment shape can be produced from these blocks . among other things , it is important to ensure that head 21 of the occlusal screw disappears completely inside the contours of abutment 12 ( see fig3 ). the thicknesses of the material and in particular the ceramics used for abutment 2 and crown 1 mounted thereon may not fall below certain minimum values d 1 , d 2 , and d 3 . these wall thicknesses are greatly dependent on the properties of the material used and can therefore be considered separately for each material . if , when shaping the abutment , any engineering constraints arising from the method of fabricating the abutment and the crown are known , they , too , may influence the optimal shape of the abutment . if , for example , it is known that both ceramic shapes will be manufactured in a grinding machine having limited degrees of freedom for their tools , it can be confirmed , when generating the optimal shape , whether it is at all possible to shape the abutment by grinding . this applies not only to the positive shape of the abutment but also to its negative shape , that is , the inside of the crown forming an attachment surface . in order to automatically fabricate the ideal and optimal shape of an abutment , it is first necessary to have a model description of the shape available . in this manner , the abutment edge , for example , can be described as a line in the coordinate system of the implant attachment geometry , and the remaining shape as parameters . the line defines the transition from the abutment to the crown and is spatially closed . it exists , say , as a list of points or as a function . for esthetic reasons , this line ideally runs somewhat below the surrounding gum tissue . the shoulder width , the tilt angle , the angle of rotation of the abutment about the longitudinal axis in the blank , and the post height are considered as parameters . the blank can also be described in terms of the coordinate system of its attachment geometry , which perfectly matches the attachment geometry of the implant . the shape of the ideal abutment edge can then be adjusted little by little locally , so that this line lies completely within the outer contour of the blank 11 used . to describe the entire abutment , it is merely necessary to optimize all parameters to all constraints . the shoulder width d s has a minimum value of 1 mm for the standard ceramics used at the present time . the maximum post height h max is delimited by the tilt angle , the block geometry , and the height of occlusal table 22 , and lies at least 1 mm below this height . the minimum post height h min is delimited , below , by the position of head 21 of the occlusal screw . the minimum height h min and the maximum height h max are measured perpendicularly to axis 20 , which indicates the direction of attachment of crown 1 on post 19 . the minimum shoulder width d s will be measured parallel to axis 20 . the angle of rotation of the abutment about the longitudinal axis in the blank derives from the relative position of the implant in the clinical situation and , because of the rotational symmetry of the blank , it is not delimited further by said blank . by using this method , the optimal customized abutment shape is generated automatically and can be fabricated by machining as needed . at first the clinical situation or a shaped clinical situation of the implant is digitally recorded , for example by means of an intraoral scanning camera . this situation is then analyzed , taking into account the adjacent teeth and the position and orientation of the implant , and the implant axis is defined . this can be accomplished interactively , if desired . after this , all of the data are available for the automatic fabrication of an abutment shape . with the help of the constraints described above , first the ideal abutment shape is computed , and then the optimal abutment shape is computed from said ideal abutment shape . the separation into two steps is not absolutely necessary , and in particular the user does not have to see the standard abutment computed subsidiarily . for ease of programming , a standard abutment is first computed with reference to the constraining parameters such as the block geometry and the tilt angle , using construction rules , and this abutment is subsequently adjusted to fit the desired profile . since both elements of the superstructure for the implant are available in digital form , it is possible to ensure an optimum fit between them . the individual elements can be produced at any time with a machining tool from any material , particularly ceramics or metal , but also from plastics material . fig4 illustrates an implant 31 inserted in a jawbone ( not shown ) below the gingival margin 30 . on each side of the implant 31 there are adjacent teeth 32 , 33 , which delimit the boundaries of the lateral span of a superstructure to be constructed . the clinical situation illustrated in fig4 is set up so that the actual course of gingival margin 30 in the immediate vicinity of implant 31 is converted to a desired profile by means of an adjustment piece 34 , which profile , together with a measuring device 35 placed on implant 31 , is scanned by an intraoral camera 36 . the position and orientation of implant 31 can be determined by measuring device 35 , and the adjustment piece 34 establishes the gingival profile . a superstructure illustrated in fig5 can be computed on the basis of the scanned data . the size and orientation of the dental crown needed for the implant are defined from the known occlusal surfaces of the adjacent teeth . the cervical finish line of a tooth selected from a dental library is placed in a mesio - distal direction slightly below the level measured by the adjustment piece 34 . the cervical surface of the superstructure to be constructed is computed together with the known position of the implant head . the superstructure in its component two elements is shown diagrammatically in fig6 a , said elements consisting of an abutment and a crown , which can be interconnected via a mating surface , also designated as an interface . the design of this interface can be varied within limits by the user , as long as the other construction rules are observed . the essential factor is that the entire superstructure is computed in this example and that the interface is also automatically determined . this interface allows the user to fabricate the superstructure from more than one piece . this may be necessary for the reason that different restoration materials showing different characteristics may or must be employed , because a design of higher esthetic value is required , or because the geometric conditions permit no other solution . fig6 b illustrates a superstructure comprising a cap and an appropriate abutment as components , the cap being veneered with ceramics in conventional manner . fig6 c illustrates a superstructure comprising a reduced crown and an abutment as components of the final replacement . because of its reduced size , this crown is out of occlusion with the opposing tooth and thus experiences no transferred forces other than residual forces occurring during the process of chewing . in this manner it is possible for the user to design the functionally correct crown as is actually required . this crown is then computationally reduced in size to ensure that it is safely disoccluded . in this case , the element can be produced from , say , plastics material . during a second session , a crown can then be ground according to the original data set and the final crown can be mounted . fig6 d illustrates a superstructure comprising a partially veneered crown and an abutment as components . the interface between the abutment and the crown as well as that between the crown and the veneer can be computed automatically according to the construction rules . if one or more implants are to be equipped with telescopes or conical crowns , there are in principle two different ways of doing so . the implant , or a plurality of implants , is equipped with a normal abutment , and a telescope crown frame is attached to this abutment , onto which the prosthesis can be pushed . alternatively , the abutment itself can be designed as a conical crown , as illustrated in fig7 a and 7 b . in this case the abutment does not form the usual crown post , but a telescope crown . in this case its shape can be described by a different set of parameters . for example , a line might here again describe the outline shape , whilst additionally the height of the cone and the angle of taper will define the shape within the outline . implants 3 ′, 3 ″ exhibit axes 5 ′, 5 ″, which may be skewed to each other ( as illustrated in fig7 a ). the conical crowns 72 ′, 72 ″, however , exhibit insertion axes 4 ′, 4 ″ that are parallel to each other . implants 3 ′, 3 ″ are anchored in jawbone 22 and extend to gingiva 23 . the separation into abutment and crown or any other type of subdivision is then computed automatically . the rules to be observed when shaping the abutment are displayed in the computer and are implemented for automatic splitting to form the abutment and superstructure . according to ep 1 062 916 a2 either a wax build - up or recourse to a library is used for shaping the abutment as well as the frame and the veneer . if a wax build - up is used , a plurality of scans will have to be made in order to fabricate the abutment , frame , and veneer in succession . by contrast , the invention accelerates the entire procedure and contributes to making the technology available to the dentist . since presently available implants , when they are used to replace individual teeth , cannot be immediately subjected to chewing forces , as that would impair their internal attachment to the jawbone , so - called healing caps are used in the implant systems . after the implant has been inserted , the dentist closes the mechanical connector formed on the implant with a healing cap and sutures the gingiva together . in the course of a second operation approx . 8 weeks later , the dentist reopens the region around the healing cap and then introduces a prosthetic replacement comprising an abutment and a superstructure . in other systems , the healing cap is open and is situated at the level of the gingiva . the healing cap used here also serves to shape the gingiva such that it has a natural profile when compared with the adjacent teeth . superstructure 1 can have a plurality of abutments interconnected by a common frame construction ( see fig2 a ). | US-201113015646-A |
a mobile center - pivot irrigation unit capable of irrigating small and irregularly - shaped fields is disclosed . the unit has two wheel - mounted irrigation carriages which support a single irrigation pipeline which is suspended between the two carriages . the first carriage is a light - weight steerable tractor with a pivot attachment mounted on its frame . the second carriage has two pivoting wheels which lock into position , thereby allowing the carriage to be either towed by the tractor , or to move in a circle about the tractor and pivot point . the unit is capable of being driven from field to field by a single operator and may be connected to a variety of irrigation water sources . once connected to a water source , the second carriage wheels are repositioned and a water turbine powers the second carriage in a circular path about the first carriage as the unit sprays irrigation water onto the field . | it can be seen from fig1 that the self - driven mobile center pivot consists of a three - wheeled carriage with two undriven wheels 21 and a single drive wheel 22 mounted on a rigid metal frame . an upper pivot sleeve 11 is mounted within the frame and is supported by drive wheel connecting member 15 and upper elongate structural members 13 to which it is welded or otherwise rigidly attached by conventional means well known in the art . the upper pivot sleeve 11 is a metal pipe section with an internal radius slightly larger than that of l - shaped irrigation piping section 39 . as shown in fig1 and 3 , a lower pivot sleeve 12 is positioned a few feet below the upper pivot sleeve 11 and is supported by four lower elongate structural members 17 to which the lower pivot sleeve 12 is welded or otherwise rigidly attached . the lower pivot sleeve 12 has an internal radius identical to that of the upper pivot sleeve 11 ; thus holding the lower section of the l - shaped irrigation piping section in rotatabe sliding contact . a collar ( not shown ) located on the l - shaped irrigation piping section in sliding contact with the upper surface of the upper pivot sleeve 11 maintains the l - shaped piping section 39 in the proper vertical position . a cross member 14 is rigidly attached at either end to upper elongate structural members 13 and lower elongate structural members 17 as shown in fig1 . rear wheels 21 are rotatably mounted by conventional means well known in the art to either end of cross member 14 . the rear wheels 21 , as well as all other carriage wheels 41 and 22 discussed herein , are of a spoke and rim construction discussed in emrich patent application ser . no . 129 , 088 which is hereby incorporated as though fully set forth herein . the upper pivot sleeve 11 is structurally attached to front wheel fork sleeve 30 by means of the drive wheel connecting member 15 to which front wheel fork sleeve 30 is welded or otherwise rigidly attached . as shown by fig3 the branch section 23a of the front wheel fork 23 has a cylindrical shape and is rotatably mounted within front wheel fork sleeve 30 . a large sprocket 29 is mounted on the upper end of the branch section 23a of the front wheel fork 23 where it extends above the front wheel fork sleeve 30 . the large sprocket 29 meshes with a small sprocket 28 which is drivingly connected to a gear box 27 which is , in turn , connected to a hand crank 26 . a sufficient gearing ratio is thereby obtained to allow a manual operator to easily steer front wheel 22 which is rotatably mounted within the wheel fork 23 . the reduction gear box 27 is rigidly attached to front wheel fork sleeve 30 by structural housing 16 . as may be seen from fig1 and 3 , motor housing 25 is rigidly attached to the front wheel fork 23 by welding , bolting or other attachment means well known in the art . a drive motor 37 is conventionally attached within the motor housing 25 as shown in fig3 . a drive sprocket 38 which is rotatably connected to the motor gear train ( not shown ) drivingly engages the front wheel drive chain 24 which is positioned about the periphery of drive wheel 22 . a fuller description of the drive chain mechanism may be found in emrich application ser . no . 129 , 088 as discussed and incorporated above . as shown by fig1 and fig3 riding step structure 35 is attached to one side of the motor housing 25 by welding , bolting or other attachment means . folding step 36 is so hinged to the riding step structure 35 so as to allow the step 36 to be folded down into horizontal position to accommodate an operator during operation of the irrigation system in the mobile mode . the revolving irrigation carriage 40 is shown in fig2 . the carriage 40 supports the irrigation pipeline on a metal frame structure upon which the two carriage wheels 41 are mounted . the carriage frame , as shown by fig2 has two upper horizontal structural members 67 which support the irrigation pipeline . the upper horizontal structural members 67 are parallel and aligned in a direction perpendicular to the axis of the irrigation pipeline 62 . positioned immediately beneath each of the upper horizontal structural members is a lower horizontal structural member 66 . the upper and lower horizontal structural members 66 , 67 are connected at either end by a diagonal structural member 68 by welding , bolting or other attachment means well known in the art . the lower horizontal structural members 66 are attached to one another at either end by cross structural members 69 by welding , bolting or other attachment means . the irrigation pipeline 63 is attached to the upper horizontal structural members by means of brackets , welding or other attachment means well known in the art . the lower horizontal structural members 66 support the carriage drive motor which in the preferred embodiment shown in fig2 consists of a water - driven turbine 54 . the lower horizontal structural members 66 also support a reduction gear box 50 and irrigation drive gear housing 55 . each carriage wheel 41 is attached to the carriage frame structure by means of a pivot 42 which is bolted , welded or otherwise attached to a lower corner of the frame structure as shown in fig2 . each wheel is also connected to a u - shaped wheel brace 45 which consists of two wheel brace elongate members 46 welded to a wheel brace cross member 47 as shown in fig7 . the open ends of the u - shaped wheel brace 45 are welded or otherwise attached to the two axle plates 43 on each wheel as shown in fig2 . a drive chain pulley 49 is suspended between the wheel brace elongate members 46 of each u - shaped wheel brace 45 near the upper end of each u - shaped wheel brace 45 as shown in fig2 and 7 . the drive chain pulley 49 is mounted on a drive chain gear shaft 48 which is rotatably attached through the u - shaped wheel brace elongate members 46 . a first gear 51 is attached to the gear shaft 48 on the side near the carriage frame . a second gear 52 mounted on a second gear shaft 53 which is in turn drivingly connected to the reduction gear box 50 is operably mounted within the drive gear housing 55 . as shown in fig2 and 7 , the first gears 51 mesh with the second gear 52 when the irrigation system is in the irrigation mode . bolts or a simple locking mechanism ( not shown ) located on the u - shaped wheel brace cross member 47 hold the carriage wheels 41 and gears 51 , 52 in proper position during irrigation . rotational motion from the water - driven turbine is thus transmitted through the reduction gear box 50 and the first and second gears 51 , 52 , to the drive chain pulley 49 which in turn rotates the drive chain belt 61 to rotate the carriage wheels 41 . a more detailed explanation of the operation of the water driven turbine and associated gear mechanisms is found in emrich patent application ser . no . 129 , 088 , which has been incorporated by reference above . each wheel pivot 42 allows the associating carriage wheel to rotate within an arc of approximately 90 ° as shown in fig4 , 6 . during the irrigation mode , as shown in fig6 the carriage wheels may be locked into position by a locking mechanism in the wheel brace cross members 47 as discussed above . while in the mobile mode , as illustrated in fig4 the carriage wheels may be locked in a position perpendicular to the position of the irrigation mode by means of a detachable brace rod ( not shown ) operably connected to each u - shaped wheel brace and a lower horizontal structural member 66 or by means of a locking mechanism in the pivot 42 or by other conventional means which would be obvious to craftsmen familiar with the mechanical arts . an end gun boom 64 , as shown in fig4 and 6 , is attached to the irrigation pipe 62 at an irrigation pipe flange 63 by means of bolts , welding or other attachment means well known in the art . an end gun 65 operably attached at the end of the end gun boom may be operated to increase coverage of the field being irrigated , or to irrigate certain non - circular portions of the field being irrigated . the end gun 65 is actuated by means of a cable 19 and cam lever 18 and associated cam ring 20 . a second cam lever 18 and cam ring 20 may be used to automatically shut the system down after a preselected number of revolutions or partial revolutions . the operation of the cam system for the end gun and shut - off devices are more fully discussed in emrich patent application ser . no . 129 , 088 which has been incorporated by reference above . the center pivot carriage 10 and the revolving irrigation carriage 40 support the ends of the irrigation pipeline 62 as indicated in fig4 and 6 . it can be seen that in fig4 the wheels 41 of the revolving carriage 40 have been positioned in a direction parallel to the axis of the irrigation pipeline ; thus allowing the entire system to be towed by the self - driven center pivot carriage 10 . an operator standing on a folding step 36 , as shown in fig1 can steer the center pivot carriage 10 by means of hand crank 26 . once the desired point in the field is reached , the drive motor of the center pivot carriage 10 is turned off and the wheels 41 of the irrigation carriage 40 are rotated as shown in fig5 and locked into position as shown in fig6 . the water source ( not shown ) is then connected to the open end of the l - shaped irrigation pipe section 39 . although conventional drive motors could also be used , in the preferred embodiment , water from the irrigation water source would power the water driven turbine 54 , thereby turning the wheels 41 of the irrigation carriage 40 causing the irrigation carriage 40 to rotate about the center pivot carriage 10 while dispensing water on the field through the attached sprinklers 66 and end gun 65 , as shown in fig6 . water may be provided by any conventional irrigation water source . in a long narrow field , a single pipeline with multiple attachments might be placed down the center of the field allowing the irrigation system to be driven from one connection point on the pipe to another , thereby watering the entire field without using multiple branch piping . it might also be feasible to connect the mobile center pivot irrigation system to a flexible pipeline such as a fire hose which could trail behind the irrigation unit when the unit is moved from one irrigation position to another . | US-19117380-A |
an implant system including a substructure , a suprastructure , abutments and an implant . the suprastructure is preferably fabricated of a light polymerized resin material having reinforcements such as fibers or fillers . the suprastructure is fabricated before the substructure . the use of resin materials that exhibit less shrinkage and the fact that the process begins with the suprastructure fabrication prevents distortion of the prosthesis when the suprastructure is bonded to the substructure and placed in the patient &# 39 ; s mouth . additionally , the method involved in making this implant system provides a prosthesis that is available to the patient almost immediately after surgery . | as will be appreciated , the present invention provides an implant system that contains a substructure , a suprastructure , abutments and an implant . reference is made to fig1 which shows the finished implant system 10 placed in the patient &# 39 ; s mouth comprising prosthesis 11 and implant abutments 12 . prosthesis 11 contains a suprastructure 14 ( fig4 ) and a substructure 24 ( fig9 ) to be further described and discussed . fig2 and 3 show abutments 12 of the implant system placed into the implants located in the patient &# 39 ; s mouth . prior to the surgical placement of the implants , suprastructure 14 , shown in fig4 , is fabricated . the inventors herein describe this as the “ outside in ” approach , since this process differs from standard procedures used to manufacture implant prostheses . instead of inserting the abutments in the patient &# 39 ; s mouth , fabricating the substructure that attaches to the abutments , followed by fabricating the suprastructure that attaches to the substructure , this invention first begins with the step of suprastructure fabrication . suprastructure 14 is in the shape of a complete denture and includes teeth 16 and denture base material 18 . denture base material 18 and teeth 16 of suprastructure 14 may be fabricated of metal , plastic , ceramic , polymeric material or a mixture thereof , similar to those materials used to make standard denture base materials and those materials used to fabricate standard composite restorative materials . examples of these materials include thermoset and thermoplastic materials , which include but are not limited to , poly ( methyl methacrylate ), poly ( ethyl methacrylate ), poly ( butyl methacrylate ), polyamides , polyesters , polyolefins , polyimides , polyarylates , polyacrylates , polyurethanes , vinyl esters , epoxy - based materials , styrenes , stryrene acrylonitriles , abs polymers , polysulfones , polyacetals , polycarbonates , polyphenylene sulfides , and the like . preferred polymeric materials in the composite include those based on acrylic and methacrylic monomers , for example those disclosed in u . s . pat . nos . 3 , 066 , 112 , 3 , 179 , 623 , and 3 , 194 , 784 to bowen ; u . s . pat . nos . 3 , 751 , 399 and 3 , 926 , 906 to lee et al . ; u . s . pat . nos . 5 , 276 , 068 and 5 , 444 , 104 to waknine ; and u . s . pat . no . 5 , 684 , 103 to jia et al ., the pertinent portions of all which are herein incorporated by reference . an especially preferred methacrylate monomer is the condensation product of bisphenol a and glycidyl methacrylate , 2 , 2 ′- bis [ 4 -( 3 - methacryloxy - 2 - hydroxy propoxy )- phenyl ]- propane ( hereinafter abbreviated “ bis - gma ”). polyurethane dimethacrylates ( hereinafter abbreviated “ pudma ”), triethylene glycol dimethacrylate ( hereinafter abbreviated “ tegdma ”), polyethylene glycol dimethacrylate ( hereinafter abbreviated “ pegdma ”), urethane dimethacrylate ( hereinafter abbreviated “ udma ”), hexane diol dimethacrylate ( hereinafter abbreviated “ 1 , 6 hddma ”) and polycarbonate dimethacrylate ( hereinafter abbreviated “ pcdma ”) are also commonly - used principal polymers suitable for use in the present invention . it is preferable that denture base material 18 and teeth 16 are fabricated of a reinforced composite polymeric or resinous material and more preferably , a light polymerizable reinforced composite material reinforced with a small amount of reinforcing agent . the amount of reinforcing component present in the polymeric matrix may depend on the transition temperature ( tg ) of the resin . if the tg is above room temperature ( about 20 - 25 ° c . or about 68 - 77 ° f . ), the amount of filler added may be in an amount of about 5 % to about 40 % by weight , preferably about 3 % to 25 % by weight and most preferably up to about 10 % by weight . if the tg is below room temperature ( about 20 - 25 ° c . or about 68 - 77 ° f . ), the amount of filler added may be in an amount up to about 70 % by weight , preferably about 5 % to about 60 % by weight and most preferably about 10 % to about 20 % by weight . the reinforcing component includes , but is not limited to , fibers , fillers , powders , particulate and mixtures thereof . examples of the reinforcing component include , but are not limited to , fillers that are capable of being covalently bonded to the polymeric matrix itself or to a coupling agent that is covalently bonded to both . examples of suitable filling materials include but are not limited to those known in the art such as silica , silicate glass , quartz , barium silicate , barium sulfate , barium molybdate , barium methacrylate , barium yttrium alkoxy ( ba 2 y ( or ) x ), strontium silicate , barium borosilicate , strontium borosilicate , borosilicate , lithium silicate , amorphous silica , ammoniated or deammoniated calcium phosphate and alumina , zirconia , tin oxide , tantalum oxide , niobium oxide , and titania . particularly suitable fillers for dental filling - type materials prepared in accordance with this invention are those having a particle size ranging from about 0 . 1 - 5 . 0 microns with a silicate colloid of 0 . 001 to about 0 . 07 microns and prepared by a series of milling steps comprising wet milling in an aqueous medium , surface etch milling and silanizing milling in a silane solution . some of the aforementioned inorganic filling materials are disclosed in u . s . pat . nos . 4 , 544 , 359 and 4 , 547 , 531 to waknine , the pertinent portions of which are incorporated herein by reference . suitable organic filler materials are known in the art , including for example the poly ( methacrylate ) fillers described in u . s . pat . no . 3 , 715 , 331 to molnar . a mixture of organic and inorganic filler materials may also be used . the reinforcing fiber element of the composite preferably comprises glass , carbon , graphite , polyaramid , polyethylene , or other fibers known in the art , such as polyesters , polyamides , and other natural and synthetic materials compatible with the polymeric matrix . some of the aforementioned fibrous materials and fillers materials are disclosed in u . s . pat . nos . 6 , 013 , 694 , 4 , 717 , 341 and 4 , 894 , 012 all of which are incorporated herein by reference . the fibers may further be treated , for example , chemically or mechanically etched , silanized , or otherwise treated such as by grafting functional monomers to obtain proper coupling between the fibers and the resin matrix . silanization renders the fibers hydrophobic , reducing the water sorption and improving the hydrolytic stability of the composite material , renders the fibers organophilic , improving wetting and mixing , and bonds the fibers to the polymeric matrix . typical silane is a - 174 ( p - methacrylate propyl tri - methoxy silane ), produced by osi specialties , ny . the fibers preferably take the form of long , continuous filaments , although the filaments may be as short as 0 . 1 to 4 millimeters . shorter fibers of uniform or random length might also be employed . preferably , the fibers are at least partially aligned and oriented along the longitudinal dimensions of the strip . however , depending on the end use of the composite material , the fibers may also be otherwise oriented , including being normal or perpendicular to that dimension . the fibrous element may optionally take the form of a fabric . fabric may be of the woven or non - woven type and is preferably preimpregnated with a polymeric material as set forth above . the fibrous component may be present in the fiber reinforced composite material in the range from about 20 % to about 85 % of the composite , and more preferably between about 30 % to about 65 % by weight . the polymeric matrix in the reinforced composite may also include polymerization initiators , polymerization accelerators , ultraviolet light absorbers , anti - oxidants , and other additives well known in the art . the polymeric matrices may be visible light curable , self - curing , dual curing , and vacuum , heat , and pressure curable compositions as well as any combination thereof . the visible light curable compositions include the usual polymerization initiators , polymerization accelerators , ultraviolet absorbers , fluorescent whitening agents , and the like . preferred light curing initiators include camphorquinone ( cq ) and trimethyl benzoyl phosphine oxide ( tpo ). the heat curable compositions , which are generally filled compositions , include , in addition to the monomeric components , a heat cure initiator such as benzoyl peroxide , 1 , 1 ′- azobis ( cyclohexanecarbo - nitrile ), or other free radical initiators . the preferred polymeric matrix is a curable matrix , wherein light cure effects partial cure of the matrix , and final curing is by heat under controlled atmosphere or alternatively , the preferred matrix is a light curable matrix which is completely cured by light alone . use of light polymerizable resin materials makes it possible to fabricate denture base material 18 in segments as opposed to fabricating the entire base at one time , as when heat polymerized polymethylmethacrylate ( pmma ) materials are used . it is preferable that the denture base be fabricated of materials having some type of reinforcement material dispersed therein including but not limited to fillers , fibers or a combination thereof , to increase the strength and reliability of the components . base material 18 is easy to handle and bonds well to the substructure beneath it and to the denture teeth placed into it . using a light polymerized resin material reduces the polymerization shrinkage of the suprastructure due to the ability of the technician to place and polymerize the material in segments during the fabrication thereof . each segment compensates for the shrinkage of the previous segment . addition of light polymerized , low shrinkage resins to attach the substructure to the already polymerized suprastructure results in little or no prosthesis distortion prior to placement in the patient &# 39 ; s mouth . in order to strongly bond the denture teeth to the denture base material , the materials may be mechanically or chemically etched or abraded to provide good adhesive surfaces . the denture base material may include a low viscosity component that is able to wet the treated denture tooth surface resulting in optimal micromechanical retention . improved bonding between the denture teeth and the base material eliminates the need to place ( with a tool such as a bur ) macro mechanical retentive features , such as a hole , to the undersurface of the denture teeth . these retentive features have the potential to further weaken the denture tooth and exacerbate the denture tooth strength problem . after fabrication of suprastructure 14 , it is hollowed out as shown in fig5 . suprastructure 14 is then tried in the patient &# 39 ; s mouth to verify the occlusal relationship prior to implant surgery . a bite registration 20 , shown in fig6 , is made between suprastructure 14 and the opposing arch in the patient &# 39 ; s mouth . next , implants 12 are inserted into the patient &# 39 ; s mouth and suprastructure 14 is used as an impression tray to record the position of the newly placed implants . implant analogs 21 are placed in the impression to mimic the position of the implants in the mouth and a master cast 22 with analogs 21 positioned therein , shown in fig7 , is made from this impression . a substructure 24 , shown in fig8 , is fabricated on master cast 22 . a bottom plan view of substructure 24 is shown in fig9 , wherein substructure 24 is fabricated of fiber reinforced composite material 26 wrapped and built around cylinders 28 . examples of materials used for fabricating the fiber reinforced composite material framework 26 and cylinders 28 are described in copending application u . s . ser . no . 09 / 311 , 464 , filed may 13 , 1999 , which is hereby incorporated by reference . the substructure is the framework of the implant system and connects to the implant components that are implanted into a patient &# 39 ; s mouth . it also is bonded or connected to the suprastructure and supports the suprastructure . cylinders 28 connect to the implants and framework 26 that is formed on cylinders 28 provides a structure on which suprastructure 14 bonds . cylinders 28 may be fabricated of any known material such as metal , plastic , ceramic , polymeric material and mixtures thereof . one example of cylinders useful herein are machined titanium metal cylinders that are sprayed with a special titanium compatible ceramic , which via a resin / ceramic interface , are connected to and surrounded by pre - impregnated , unidirectional frc material . in fig1 , suprastructure 14 is shown repositioned over master cast 22 having fiber reinforced composite substructure 24 thereon . as shown in fig1 , an adhesive material 30 is placed between substructure 24 and suprastructure 14 in order to bond substructure 24 to suprastructure 14 resulting in prosthesis 11 . it is preferable that adhesive material 30 is the same material used to fabricate denture base material 18 or at least has the same or similar functional group as denture base material 18 to provide a covalent or chemical bond between the materials . it is further preferable that adhesive material 30 and the resins used to make substructure 24 and suprastructure 14 have the same or similar functional group to provide a covalent or chemical bond between the materials . it is further preferable that substructure 24 has an air - inhibited layer on its exterior and that suprastructure 14 has an air - inhibited layer on the inner surface so that adhesive material 30 easily bonds to both structures . the resulting prosthesis 11 having suprastructure 14 and substructure 24 bonded together with base material 30 is shown in fig1 . this almost immediate approach is feasible because the suprastructure is made prior to surgery and once the orientation of the implants can be recorded in the master cast , a substructure can be made and bonded to the already - made suprastructure . prosthesis 11 is now ready for attachment to the implant abutments 12 located in the patient &# 39 ; s mouth . while various descriptions of the present invention are described above , it should be understood that the various features can be used singly or in any combination thereof . therefore , this invention is not to be limited to only the specifically preferred embodiments depicted herein . further , it should be understood that variations and modifications within the spirit and scope of the invention may occur to those skilled in the art to which the invention pertains . accordingly , all expedient modifications readily attainable by one versed in the art from the disclosure set forth herein that are within the scope and spirit of the present invention are to be included as further embodiments of the present invention . the scope of the present invention is accordingly defined as set forth in the appended claims . | US-7860005-A |
a two - dimensional projection image of the nmr activity within a volume is obtained . the signals due to static material are cancelled and do not appear in the projection image . the signals due to moving blood in vessels produce an isolated image of the vessels with the superimposed structure removed . the excitation of a plane is accomplished using a single excitation pulse without requiring an a . c . gradient . the uniformity requirement of the inversion excitation is minimized . images are generated which distinguish the direction of flow . | an understanding of the broad aspects of the invention may best be had by reference to fig1 . here it is desired to provide an image of blood vessel 11 in a particular volume 10 of the human anatomy . vessel disease is by far the most prevalent cause of death in humans . what is greatly desired in a noninvasive method of visualizing the vessels so as to provide mass screening of the general population . a process of this type requires the production of projection images of the vessels . this is in sharp contrast to existing x - ray computerized tomography or nmr cross - sectional images . these slices are of little value in evaluating narrowing in vessels since it requires a large array of them to follow a vessel . clearly , the cross - sectional format is of little value in providing screening images for vessel disease . also , nmr cross - sectional images are particularly sensitive to artifacts caused by non - uniform magnetic fields . therefore , in this invention , projection images of the vessel are created . for example , a two - dimensional projection image is made of volume 10 containing vessel 11 . this projection can be represented by plane 28 in an xz plane . a pure projection image would fail to visualize vessel 11 due to all of the intervening anatomical structures . in x - ray studies the vessels are isolated by injecting a contrast material . in this invention , using nmr imaging , an isolated projection image is made of vessel 11 by making used of the flowing motion of blood 12 through the vessel . processor 29 , in conjunction with r . f . excitation signal 26 , operates to cancel the spin signals produced by the relatively static material in volume 10 and thus provide a signal solely due to vessel 11 . in this way , the desired projection image is created in a totally noninvasive manner without any injection of contrast agents or use of ionizing radiation . the description of the specifics of the nmr projection imaging will follow the description of the cancellation of the static material in volume 10 . in general , however , the principal axial magnetic field is produced using , for example , pole pieces 13 and 14 excited by coils 16 and 17 . these are driven by a d . c . source v 1 with the coils 16 and 17 producing fields in the same direction to create a substantially uniform field throughout the region of interest in volume 10 . this is by far the strongest field in the system with a strength of the order of one kilogauss . with both this coil and the remaining coils , the letter pairs a - d are simply convenient ways of indicating connections . specific regions are selected using the gradient coils . coils 18 and 19 form a gradient field in the z direction driven by 20 , source v 2 . similarly coils 23 and 24 are on opposite sides of object 10 and thus form a gradient field in the x direction driven by 25 , source v 3 . unlike coils 16 and 17 which create a uniform field , these gradient coils are bucking each other so as to produce a varying field in the respective direction . coils 21 and 22 are the radio frequency coils serving both the transmitter and receiver function . they produce fields in the same direction to create a substantially uniform field in volume 10 . when switch 27 is in the transmit position 26 , generator v 4 , is used to excite the magnetic spins in volume 10 . when switch 27 is connected to the receive position , signal 31 is received from magnetic spin signals in volume 10 . these are processed in processor 29 to provide a projection image of the moving blood 12 in vessel 11 . the resultant projection image 32 is displayed in display 30 . excitation signal 26 , and processor 29 combine to cancel or eliminate any magnetic spin signals due to structures in object 10 which are substantially static . one method of eliminating the signals due to the magnetic spins of static materials is illustrated in fig2 a and 2b . here the magnetic spins are excited , and signals are received at two different time intervals t a and t b . these correspond to time intervals where the blood velocity is different . the usual r . f . excitation signal 26 , v 4 , is supplied by burst generator 40 . the specifics of the pulse shape depend on the particular imaging arrangement used . in any case two bursts are generated at the two time intervals . moving blood , or other material , can result in a decrease in the received nmr signal since the excited spins move out of the sensitive region before they result in received signals . thus a high velocity region will produce a smaller signal than a low velocity region . by timing the excitation signal v 4 with the ekg of the patient under study , received signals 31 can be collected representing times of relatively high and low velocity of blood 12 in vessel 11 . the received signals 31 are demodulated using demodulator 41 and applied to switch 42 which is also activated at t a and t b by the ekg signal . thus the signal from excitation t a is stored in 43 , store a , and the signal from excitation t b is stored in 44 , store b . these are subtracted in subtractor 45 to provide the desired signal representing vessels only and cancelling all static material . the subtracted signal is applied to imaging computer 46 which , as will subsequently be described , reconstructs a two - dimensional projection image . signals due to any substantially static material will be cancelled since the component signals will be the same at t a and t b . the signals from vessel 11 , however , will be different since they are taken with the blood 12 at different velocities . although fig2 a and 2b illustrate a specific embodiment , this same principle can be applied in many ways . for example , a sequence of pulses 26 can be produced all representing the time t a in the heart cycle . this sequence of pulses may be required to generate a complete projection image corresponding to the t a time interval . this is followed by a sequence at t b in the heart cycle . the subtraction operation can then involve the complete image information rather than apply the subtraction at each heart cycle . in any case , it is desirable for the vessel to be at a similar position in t a and t b to avoid any loss of information . the description thusfar has been identified to that of the basic concept covered in u . s . application ser . no . 332 , 925 . however , in the description of the rapid projection imaging system , where each plane in sequence is decomposed into a set of integrals either an a . c . gradient or multiple excitations are used . although these are excellent methods of imaging , it is often desirable to use simpler systems . to accomplish this we use a projection imaging system similar to that employed in some cross - sectional imaging systems which requires only a single r . f . excitation without an a . c . gradient . first , in the presence of a z gradient a 90 ° r . f . burst , of a specific frequency is applied , exciting the spins in a specific xy plane . immediately following the burst , during the time the fid is received , the z gradient is turned off and a transverse gradient is applied . thus each line in the excited plane , normal to the transverse gradient , produces an fid signal of a different frequency . decomposing the composite received fid signals into their component frequencies provides the desired line integrals or projection of the plane in a direction normal to the transverse gradient . this process is repeated at each planar section , using a different excitation frequency , providing the desired two - dimensional projection image of the entire volume . this projection imaging approach is less complex than those described in u . s . application ser . no . 322 , 935 . the high power a . c . gradients or multiple excitations are not required . referring to fig1 and the waveform diagram in fig3 with the b terminal on gradient coil 18 connected to the b terminal on gradient coil 19 , a pulsed gradient signal 20 is applied using v 2 . simultaneously , with terminal d on r . f . coil 21 connected to terminal d on r . f . coil 22 and switch 27 in the receive position , connected to 26 , a high frequency burst v 4 is applied of appropriate amplitude and duration to provide the classic 90 ° excitation . following this burst signal the gradient signal v 2 is turned off , the transverse gradient signal 25 is turned on where terminal c on coil 23 is connected to terminal c on coil 24 and v 3 is pulsed on during the fid signal interval . during this same interval switch 27 is connected to terminal 31 so that the received fid signal can be processed by processor 29 . in this case processor 29 is a frequency decomposition system , such as a computerized fourier transform , where the fid signal is decomposed into its constituted frequencies , each representing a line integral in the y direction , of the selected xy plane . the entire process is repeated using different burst frequencies for v 4 , thus selecting xy planes at different z positions , each time determining the line integrals or projections of the xy plane onto projection plane 28 . this provides the entire two - dimensional projection 32 displayed on 30 . however , it is desired to use this efficient projection imaging system to display only the moving material in vessels and therefore to cancel all moving material . one approach is to use aforementioned temporal subtraction system illustrated in fig2 a and 2b . here the signals obtained from the excitations at different portions of the heart cycle are stored and subtracted . this can directly be applied to the projection system diagrammed in fig3 . the projection system of fig3 can also be applied to the inversion technique described in u . s . application ser . no . 332 , 935 . here , instead of a 90 ° excitation , v 4 becomes a 180 ° excitation by doubling either the signal amplitude or time or some appropriate combination . a 180 ° inversion produces no free induction decay signal , thus cancelling the signal from all moving material . the moving blood in vessels , however , does not experience a complete inversion , thus producing an fid signal . therefore the system of fig3 produces solely the desired projection image of moving blood and provides vessel image 32 on display 30 . this single excitation projection system does offer simplicity in that it minimizes the r . f . power and does not require an a . c . gradient signal . its snr performance , however , is poorer than the dual excitation approach described in u . s . ser . no . 332 , 925 . using the 90 °- 180 ° sequence produces a spin echo rather than an fid , thus doubling the duration of the signal and increasing the snr . for the inversion system the sequence becomes 180 °-- 180 ° as shown in u . s . ser . no . 332 , 925 where static material is cancelled and only moving blood provides an echo . one difficulty with the invention excitation system is the accuracy required to cancel all static material . if the r . f . fields produced by coils 21 and 22 are not uniform , portions of the object 10 will not experience an exact inversion and thus produce an fid signal which will appear in display 30 . if this signal is excessive it can obscure the desired image 32 of vessel 11 resulting from the movement of blood 12 . one approach to minimizing the uniformity requirements of the r . f . field is the use of a saturation or &# 34 ; burn &# 34 ; excitation followed by a 90 ° burst for the excitation signal as shown in fig4 . here a low level excitation , comparable in time to t 1 , is used to saturate the spins in the excited region so as to insensitize them . this procedure is described in the previously referenced paper by a . n . garroway , et al ., &# 34 ; image formation in nmr by a selective radiation process .&# 34 ; this saturation excitation , as shown in fig4 is immediately followed by a 90 ° burst . saturated regions , representing static material , will be unresponsive and produce no fid signal . moving blood , however , which has not been completely saturated , will produce an fid signal and an image . this signal v 4 , shown in fig4 simply replaces the 90 ° excitation in fig3 as did the 180 ° inversion signal . the use of a saturation signal followed by a 90 ° burst can replace a 180 ° inversion excitation in all of the projection imaging embodiments of u . s . application ser . no . 332 , 925 and provide the desired immunity to nonuniformity . this includes the spin warp , multiple plane and all other projection systems where an inversion excitation can be used to cancel static material and image only moving material . one difficulty with the saturation - 90 ° excitation is its increased time duration , since the saturation signal is comparable to t 1 . it may be helpful to time the repetitive signals in synchronism with the electrocardiogram to avoid the problem of moving vessels . the problem of long imaging time , however , can be overcome by the use of a adiabatic fast passage or afp excitation where an inversion is achieved by sweeping the r . f . signal v 4 through resonance . this excitation is also relatively immune to nonuniformity of the r . f . field . unfortunately , the previously described projection imaging system cannot be directly applied since the swept frequency , of itself , cannot be used for plane selection . the a . c . gradient system can , however , be used in combination with the afp excitation signal as shown in fig5 . here , while v 4 has the swept r . f . signal , an a . c . gradient signal is applied to v 2 . the null plane of this a . c . gradient signal will be the only plane receiving excitation . the null plane is readily varied by varying the relative excitation of coils 18 and 19 . by grounding b on coil 18 and connecting a signal kv 2 to terminal b on coil 19 , the null plane can be varied by varying k , where k = 1 provides a null plane between the two coils . following excitation of the desired plane with an inversion signal , the signals are read out as before in fig3 using a transverse gradient v 3 . this approach provides a stable method of inversion in a relatively short time interval . in many clinical situations it is desired to distinguish venous from arterial flow . one approach to this is the temporal subtraction method of fig2 a and 2b . since arterial blood has a stronger pulsatile component , using appropriate timing , an image can be made of solely the arteries , ignoring the veins , which have a weaker pulsatile component of velocity . another approach is to distinguish between venous and arterial flow by virtue of their directions . for example , in imaging the vessels in the neck , the carotid arteries carry blood upward into the brain while the jugular veins carry blood downward , back toward the heart . if an xy plane is excited and the received signals are gathered in a plane solely above or solely below the excited plane , the two directions can be distinguished . thus an excitation of an xy plane , using a 90 ° burst for v 4 in the presence of a z gradient , as shown in fig6 can be followed by an a . c . gradient whose null plane is either above or below the excited plane . again , the signal from this null plane is read out in the presence of a transverse gradient v 3 to decompose the lines of the plane into different frequencies . only moving material which has flowed from the excited plane to the null plane , above or below the excited plane , will produce signals contributing to vessel projection image 32 . this sequence is repeated for all planes in the volume to complete the image . the use of the a . c . gradient in direction - sensitive vessel imaging can be avoided using the dual excitation method of fig7 . here upward or downward flow is selected by utilizing spin echo excitation where the 180 ° excitation corresponds to planes above or below the initial excited plane . as shown a 90 ° excitation is first used on v 4 in the presence of a z gradient v 2 to excite the desired plane . the fid , shown in dotted lines , following this excitation is ignored since it represents signals from static material . with the z gradient v 2 turned on again , a 180 ° excitation is applied on v 4 following a relatively brief time interval . this 180 ° excitation is slightly lower or higher in frequency than the 90 ° excitation . moving material , such as blood , which has migrated from the 90 ° excited plane to the 180 ° excited plane will produce a spin echo signal in 27 . during this spin echo , as shown in fig7 the transverse gradient v 3 is turned on to decompose the selected plane into an array of lines to create the desired projection . this process is repeated using different frequencies for the v 4 bursts , where every 180 ° burst is correspondingly slightly higher or lower in frequency than the 90 ° burst , depending on whether an image of upward or downward flow is desired . both images can be obtained in sequence if desired . in fig7 either upward or downward flow was selected based on the frequency of the 180 ° burst with respect to the 90 ° burst . by using two 180 ° bursts , resulting in two spin echoes , as shown in fig8 the signals representing upward and downward flow can both be collected from the same 90 ° excitation . these are non - interacting since they represent different nuclei in each case . as shown in fig8 the 90 ° burst is followed by first a higher frequency 180 ° burst then a lower frequency 180 ° burst . these , depending on the direction of the z gradient , can for example represent the upper and lower planes respectively . they each produce separate spin echoes as shown . these are received in the presence of a transverse gradient v 3 to enable decomposition and the forming of the desired projection images . these each represent separate upward and downward flow images . as previously described in fig7 the dotted waveforms can be used to provide an image of static material which can be used to either combine with the flow images , or correct them for the residual signals due to overlap of the excited planes . this overlap can be minimized by shaping the excitation pulses into sinc waveforms which approximate planar sections , as has been extensively discussed in the nmr literature . the dotted fid following the 90 ° burst in fig7 and 8 can be used to enhance the images . if v 3 is also turned on during that first fid , as shown in the dotted line , the signal can again be decomposed to produce a projection image of the static material in the volume . this can be useful in producing a composite image where , for example , the static anatomic image is in one color and the moving blood in another . in addition , the planes selected by the 90 ° and 180 ° excitations may overlap somewhat . thus the spin echo will contain some signal representing static structures due to the overlap of the two planes . the signal from the first fid , representing static material only , can be processed as previously described and used to cancel that part of the image which is due to static material caused by overlap of the planes . each signal , the fid and the spin echo , are put through identical fourier transform processing to find the line integrals of each plane as has been previously described . this is illustrated in fig9 which illustrates a representative processor 29 . here the received signal 27 or 31 is applied to gating circuit 50 which gates out the fid representing the static material , and one or both of the spin echoes representing the directional flow signals . these are decomposed using fourier transformers 51 and 52 to create the projection images . these static and flow images are combined in combiner 53 to either create a composite image showing static anatomy plus the flowing blood , or to create an accurate flow image where the residual static image information is subjected . the methods described using fig7 and 8 for imaging directional flow can also be used for imaging flow independent of direction . referring to fig7 if the first burst v 4 is made a 180 ° narrow - band plane selection signal , and the second burst is a broadband 180 ° burst , the spin echo will then represent a flow image if processed as previously described . in essence , only moving material which experiences a partial excitation with the first burst , having a 90 ° component , will result in a spin echo . the broadband 180 ° second burst inverts the spins of all moving material , no matter where it has moved . the first 180 ° burst is shaped , based on anticipated flow . for example , assume blood is traveling in a large artery at about 50 cm / sec and the slice thickness of the excited plane is about 2 mm . it will therefore take about 4 millisec for a moving blood particle to traverse the excited plane . therefore , if the first 180 ° burst has a width of about 4 milliseconds , on the average the moving material will receive a 90 ° excitation due to blood in the center of the excited region receiving only half of the total 180 ° inversion . of course , some blood will receive less than 90 ° and some more . these will also produce partial spin echoes . the static material , however , will receive a complete inversion . as previously indicated , for reduced sensitivity to uniformity of the r . f . field , the first 180 ° pulse can be changed to a saturation excitation followed by a 90 ° pulse as in fig4 or an adiabatic fast passage in the presence of an a . c . gradient , as in fig5 . all of the many methods shown in the literature for enhancing the performance of nmr imaging systems can be applied to this blood vessel imaging system . for example , in the paper by p . a . bottomley , &# 34 ; nmr imaging techniques : a review &# 34 ; in the review of scientific instruments , vol . 53 , september 1982 , pp . 1319 - 1337 , a method is shown known as &# 34 ; time reversal &# 34 ; which involves reversing the sign of the gradient pulses for a short period in order to obtain optimum sensitivity . this can clearly be applied to the appropriate gradient signals used in this invention . | US-46696983-A |
a golf club which includes interconnected segments which can be added to extend the length thus providing an inexpensive alternative to buying new golf clubs . the segments are securely connected to achieve a rigid and sturdy golf club which can grow longer as a child grows taller . the segments preferably have a threaded male / female connection with epoxy applied to the threads followed by the added security of a roll pin inserted into the connection . | turning now to the drawings , fig1 shows a golf club 10 . broadly speaking , the golf club 10 includes a lower shaft 12 , a midsection 14 , and an upper shaft 16 . upper shaft 16 of golf club 10 has a lower end 18 fitted with a first collar 20 . first collar 20 terminates in a threaded male projection 22 ( shown in fig2 ) which has a pin hole 23 . fig1 illustrates an upper end 24 of upper shaft 16 covered with a handle 26 . lower shaft 12 has an upper end 28 which terminates in a second collar 30 . second collar 30 has a pin hole 31 and a threaded female opening 32 ( shown in fig2 ). fig1 illustrates the club head 34 which is attached to a lower end 36 of the lower shaft 12 . midsection 14 is composed of spacer segment 38 ( a ) in fig1 . in fig2 , midsection 14 contains spacer segment 38 ( a ) and spacer segment 38 ( b ). referring to fig4 , the midsection 14 has spacer segments 38 ( a ) through 38 ( h ). turning to fig2 , spacer segment 38 ( a ) has a threaded female opening 40 and a threaded male projection ( not shown ). spacer segment 38 ( b ) has a threaded female opening ( not shown ) and a threaded male projection 42 . each spacer segment added to the golf club 10 has a similar structure and further includes a pin hole 44 on its threaded male projection , a pin hole 46 on its barrel 48 , and a wrench flat 49 . referring to fig2 , spacer segment 38 ( a ) has a threaded female opening 40 which threadably receives threaded male projection 22 . a roll pin 50 is inserted through pin hole 46 of spacer segment 38 ( a ) and pin hole 23 of the threaded male projection 22 , thus reinforcing the connection . still referring to fig2 , second collar 30 has a threaded female opening 32 for threadably receiving the threaded male projection 42 of second spacer segment 38 ( b ). threaded male projection 42 has a pin hole 44 through its entire diameter , and second collar 30 has a pin hole 31 which is reflected across the threaded female opening 32 ( shown in breakaway ) thus permitting a removable roll pin 52 to be inserted when threaded male projection 42 is threadably received by threaded female opening 32 . this secures second spacer segment 38 ( b ) to second collar 30 of lower shaft 12 . in a preferred embodiment , each threaded male projection is about ¾ of an inch in length , and the barrel 48 has a length ( l ) of about 1 inch . the spacer segments can be of varying sizes and lengths , but preferably they are substantially similar to one another . fig2 also illustrates how the spacer segments look when connected to one another . spacer segment 38 ( b ) has a threaded female opening ( not shown ) which receives the threaded male projection ( not shown ) of spacer segment 38 ( a ). a roll pin 54 is inserted through spacer segment 38 ( b ) and the male projection ( not shown ) of spacer segment 38 ( a ) resulting in a secure connection between the two spacer segments . this connection can be repeated numerous times between many spacer segments . flat 49 is provides a gripping surface for tightening the connections . in a preferred embodiment of this invention , the golf club length can be potentially increased by up to eight spacer segments as shown in fig4 where spacer segments 38 ( a )- 38 ( h ) are interconnected by the same male / female and roll pin connection described above . spacer segment 38 ( a ) is secured to a first collar 20 by a roll pin 50 . eighth spacer segment 38 ( h ) is secured to a second collar 30 by a removable pin 52 . fig3 shows a sectional view of the connections when the golf club is lengthened by only one spacer segment . an upper shaft 16 is covered by a handle 14 . a lower end 18 of upper shaft 16 ends in a first collar 20 . an upper end 28 of lower shaft 12 is fitted with a second collar 30 . a spacer segment 38 ( a ) has a threaded female opening 40 which threadably receives a threaded male projection 22 of first collar 20 . this connection is secured by a roll pin 50 . second collar 30 has a threaded female opening 32 which threadably receives a threaded male projection 56 of spacer segment 38 ( a ). this connection is secured by a removable roll pin 52 . each time a user wishes to lengthen the golf club , he or she can withdraw removable roll pin 52 and add another spacer segment by putting the new spacer segment &# 39 ; s threaded female opening over the threaded male projection of the most recently attached spacer segments . the user then connects the new spacer segment &# 39 ; s threaded male projection to second collar 30 by way of the above described male / female connection followed by reinsertion of removable roll pin 52 . it will be appreciated that this unusual feature of adding segments permits a child to use the same golf club for quite some time . furthermore , club head 34 ( fig1 ) could be any golf head that the user desires , not just the one shown . placing an amount of epoxy on the male / female connection and inserting a roll pin through that connection provides the same strong , rigid shaft of a one piece golf club . these features save money for the families of children who play golf and give children from a wide range of economic backgrounds the ability to afford quality equipment . | US-93544404-A |
protector device for protecting the bottom edge of hockey sticks from wear when playing ball hockey on the road . the protector device can be in one or two protective pieces . the protective piece or pieces have a wearing surface that contacts the road when the piece or pieces are mounted on the hockey stick . a connector device provided on the protective piece or pieces for use in detachably mounting them on the blade of the hockey stick without damaging the blade so they can be readily removed when the stick is to be used for playing on an ice surface . | the hockey stick protector means 1 of the present invention as shown in fig1 to 5 is used with a regular hockey stick 3 , shown in fig6 having a shaft or handle 5 , and a blade 7 which has a front toe portion 9 with a toe 11 and a rear heel portion 13 with a heel 15 . the hockey stick protector means 1 , in the preferred embodiment of the invention , is made in two pieces , a toe piece 17 and a heel piece 19 . the toe and heel protector pieces 17 , 19 fit over the bottom edge 21 of the blade 7 onto the blade in its toe and heel regions 9 , 13 . the toe piece 17 has a u - shaped cross - section with a bottom wall 23 and upstanding side walls 25 , 27 . a slot 29 is defined between the side walls 25 , 27 and the bottom wall 23 for receiving the blade 7 of the stick . the front end of the toe piece 17 has a front wall 31 joining the side walls 25 , 27 and bottom wall 23 . a narrow slit 33 can extend down through the center of the front wall 31 and along the center of the bottom wall 23 for about two thirds of its length . the slit 33 allows for some adjustment between the front portion of the side walls 25 , 27 when mounted on the blade 7 . means are provided on the top piece 17 for use in connecting the toe piece to the blade 7 of the hockey stick . the connecting means preferably comprises two , spaced - apart , wide , shallow grooves 41 , 43 formed in the outer surface of the bottom wall 23 . the grooves 41 , 43 extend across the bottom wall 23 of the toe piece 17 and can extend up the side walls 25 , 27 as well if desired . the bottom surface 45 of each groove 41 , 43 is recessed from the outer surface 47 of the bottom wall 23 . one groove 41 is located near the front wall 31 and the other groove 43 is located near the rear end 49 of the toe piece . the grooves 41 , 43 have a width about twice the width of regular hockey tape . the toe piece 17 is normally straight . relief means are provided in the toe piece 17 to allow it to blend to generally follow the contour of the bottom edge 21 of the blade 7 in the toe region 9 if needed . the relief means can comprise at least one notch 53 , 55 in each side wall 25 , 27 of the toe piece 17 near the center of the toe piece between the grooves 41 , 43 . each notch 53 , 55 extends down from the top edge 57 , 59 of the side walls 25 , 27 to the bottom wall 23 and tapers inwardly from a wide mouth at the top edge of the side walls to a narrow bottom at the bottom wall 23 . more than one notch could be provided in each side wall 25 , 27 if more flexibility is required in the toe piece . the heel piece 19 is constructed similarly to the toe piece 17 and has a u - shaped cross - section with a bottom wall 71 and upstanding side walls 73 , 75 . a slot 77 is defined between the side walls 73 , 75 and the bottom wall 71 . a narrow slit 79 can extend , from the front end 81 of the heel piece , in the center of the bottom wall 71 to about the center of the heel piece to provide some degree of lateral adjustment for the forward portion of the side walls 73 , 75 . the bottom wall 71 also tapers very slightly from the back end 83 toward the front end 81 to accommodate normal hockey stick construction . means are also provided in the heel piece 19 for use in connecting it to the blade 7 and shaft 5 of the hockey stick . the connecting means again comprise spaced - apart , wide shallow grooves formed in the outer surface of the bottom wall 71 . the grooves extend across the bottom wall 71 and can continue up the side walls 73 , 75 as well if desired . at least two , and preferably three , grooves 87 , 89 and 91 are provided with two of the grooves 87 , 89 closer to the front end 81 and one of the grooves 91 closer to the back end 83 . the grooves 87 , 89 have a width about one and a half times the width of hockey tape and groove 91 can have a width about twice the width of hockey tape . the bottom surface 93 of each groove is recessed from the bottom surface 95 of the bottom wall 71 . the heel piece 19 is normally straight . relief means are provided allowing it to bend about the heel of the hockey stick . the relief means again can comprise notches formed in the side walls 73 , 75 , the notches extending down from the top edge 93 , 95 of the side walls 73 , 75 to the bottom wall 71 and tapering toward the bottom . three notches 97 , 99 and 101 can be provided in the central region of the heel piece 15 between the grooves 89 , 91 . in addition , a further notch 103 can be provided in the forward region of the heel piece between the forward grooves 87 , 89 . more notches can be provided if needed . the toe and heel pieces 17 , 19 are mounted on the bottom edge of the blade 7 of the hockey stick 3 as shown in fig6 and 7 . the toe piece 17 is mounted on the blade 7 in its toe region 9 with the blade sliding into the slot 29 and with the front wall 31 of the toe piece tight against the toe 11 of the blade . the bottom edge 21 of the blade is snug against the bottom wall 23 of the toe piece . the toe piece 17 is fastened to the blade 7 by wrapping a first strip 107 of hockey tape about the toe piece and blade in the forward groove 41 , and a second strip 109 of hockey tape about the toe piece and blade in the rearward groove 43 . the bottom slot 33 allows some adjustment of the forward portion of the side walls 25 , 27 to accommodate variations in the width of the blade in its forward toe region . the toe piece 17 can be bent in the area of notches 53 , 55 to generally follow the curvature of the bottom edge 21 after the first tape strip 107 is applied . the second tape strip 109 holds the toe piece in the bent position . the heel piece 19 is similarly mounted on the blade with the blade sliding into the slot 77 . the heel piece 19 is located to have its central notches 97 to 101 centered with respect to the heel 15 of the stick . the bottom edge 21 of the blade in the heel region 13 is snug against the bottom wall 71 of the heel piece 19 . first and second strips 111 , 113 of hockey tape are wrapped about both the heel piece 19 and the blade 7 in the two forward grooves 87 , 89 . the heel piece 19 can be slightly bent about the forward notch 103 between the grooves 87 , 89 to follow the contour of the bottom edge 21 if desired . after the forward portion of the heel piece 19 is fastened to the blade , the rear portion can be bent about the heel because of notches 97 to 101 to place the heel piece snug against the lower back portion of the shaft 5 and a tape strip 115 is wrapped about both the heel piece and the shaft in rear groove 91 to hold the heel piece to the shaft . the bottom slit 79 allows some adjustment of the side walls 73 , 75 in the heel portion of the blade to accommodate blade width variations . the bottom edge 21 of the blade 7 of the stick 3 is now protected against scraping damage when playing road hockey . while the central portion of the blade is unprotected , the bottom walls 23 , 71 of the heel and toe pieces are thick enough to prevent the central portion of the blade from contacting the road . the tape strips , which hold the protective pieces in place , are located in grooves and do not contact the road . the grooves are wide enough to allow several turns of tape to be wrapped about the hockey stick in each groove in overlapping fashion thus providing more adhesion to more securely hold the protective pieces on the stick . it will be seen that it is the flat bottom surfaces 47 and 95 respectively of the toe and heel protective pieces 17 , 19 that wear out during ball hockey play and not the bottom edge 21 of the blade . since the protective pieces are used primarily when playing ball hockey , they are made short enough so as not to interfere with the ball when it makes normal contact with the blade . with the smallest ball size used in ball hockey being about two inches , the protective pieces would have a height of no more than about five - eights of an inch . when it is desired to use the stick on ice the tape strips are removed by unwrapping them , or cutting them and peeling them off the stick and protective pieces . this allows the protective pieces to be slipped off , and the stick to be used normally . many modifications can be made to the protective pieces . in one embodiment , shown in fig8 both the toe and heel pieces 17a , 19a can have a central portion of the side walls 25a , 27a and 73a , 75a cut away as shown at 117 , 119 to provide the bending relief means . this leaves only the bottom wall 23a , 71a in the central region of the protective pieces 17a , 19a forming a strap section that can be easily bent to follow the curvature of the bottom edge of the blade . in another embodiment of the invention , shown in fig9 the protective toe and heel pieces 17b , 19b can be made already bent or curved to fit the curvature of the bottom edge of the blade . the relief means , in the form of the notches , can be eliminated or at least reduced . however hockey sticks are made with many types of curvatures in both the toe and heel regions and it is difficult to find one curvature for both the toe and heel pieces that will properly fit all the types of curvatures employed in hockey sticks . in another embodiment of the invention the protective toe and heel pieces can be produced in flat form , from a flat sheet , and provided with longitudinal hinges allowing the flat pieces to be bent into a u - shape . as shown in fig1 to 12 , the toe piece 17c is formed from a flat , generally rectangular , sheet member 121 having two parallel longitudinal grooves 123 , 125 formed in its inner surface . the grooves 123 , 125 divide the flat member 121 into a bottom wall section 127 and side wall sections 129 , 131 . cutouts 133 , 135 are made in the bottom wall section 127 near the front and rear ends 137 , 139 of the member 121 . the cutouts 133 , 135 extend slightly into the side wall sections 129 , 131 and provide the connecting means for use in connecting the toe piece to the blade of the stick . a flap 141 is provided at the front end 137 on one of the side wall sections 129 with a groove 143 delimiting the flap 141 from the section 129 . relief means in the form of notches 145 , 147 can be provided in the side wall sections 129 , 131 located between the cutouts 133 , 135 . the flat member 121 is formed into a u - shaped toe piece 17c by folding the side wall sections 129 , 131 about the grooves 123 , 125 which define hinges 149 , 151 . the flap 141 is also folded about groove 143 , which defines a hinge to abut the front end of the other side wall section 131 to form a front wall . a strip of tape 155 extending from side wall 129 to sidewall 131 across flap 141 holds flap 141 in place . the u - shaped toe piece 17c is now snugly mounted onto the hockey stick blade and held there by wrapping tape strips about both the blade and toe piece in the area of the cutouts 133 , 135 . the cutouts 133 , 135 locate the tape strips inwardly of the outer surface of the bottom wall section 127 so they don &# 39 ; t contact the road during use and wear out . the heel piece ( not shown ) can be made in a similar manner from a flat member . both the toe and heel pieces can also be made with cut away portions in the side walls , replacing the notches , to provide bending relief means if desired . the hockey stick protector means has been made in two pieces . this allows for variations in the length of the blade of the hockey stick , variations in the shape and curvature of the blade , and also allows the protector means to be used with left or right hand sticks . however it is contemplated that the protector means can also be made in one piece , moulded to fit both the curvature of the blade when viewed from the top and the curvature of the bottom edge of the blade when viewed from the side . as shown in fig1 , the one - piece protector 1d , having a u - shaped cross - section , has shallow , wide grooves 201 in its bottom wall 203 which can extend up in the side walls 205 . the protector 1d is slipped onto the blade over its bottom edge and tape strips 209 are wrapped about both the protector 1d and the blade , in the grooves 201 to fasten the protector to the blade . means other than tape strips could be used to fasten the one - piece moulded protector to the hockey stick . by way of example , and as shown in fig1 , the protector 1e , similar to protector 1d , could be made with an integral cap 221 at its front end which fits over the toe of the blade . a tail 225 extends from the rear end 227 of the protector up the back of shaft 5 of the stick . a fastening tape 229 is attached to the tail 225 to wrap about the shaft . the tape 229 can be a &# 34 ; velcro &# 34 ; ( registered trademark ) tape that fastens to itself . the tape 229 and cap 221 securely hold the protector 1e to the hockey stick eliminating the need for tape grooves in the protector , and tape strips . the protectors , whether in one or two pieces , can be moulded or otherwise formed from suitable plastic material such as nylon or polyurethane . the protectors shown in fig1 , 9 , 13 and 14 can be injection moulded for example . the materials are selected for their wear and flexibility . | US-91661292-A |
according to the present invention , an improved conveyor or roller pulley is provided . a preferred embodiment of the invention comprises a roll core , having a lagging material attached thereto , with a multiplicity of longitudinally spaced drive surfaces , with helical grooves , formed in said lagging , adjacent which are tapered shoulder regions . | referring to fig1 there is shown a conveyor pulley 2 for handling a plurality of belts 17 , a representative one of which is shown therein . thus , the pulley comprises a plurality of drive surfaces or faces 5 spaced along and extending around core 8 . the pulley is broken at two points to indicate the possible presence of still further pulley faces than those actually shown . referring to fig2 and fig3 the drive surfaces 5 are formed in a lagging material 6 , which is attached to the core 8 . as stated earlier , the lagging may be attached in a variety of ways , including vulcanizing , bonding , welding , cementing , or spraying . in a preferred embodiment , cured rubber or polyurethane lagging is vulcanized to an aluminum or steel roll core . the lagging is selected to improve the ability of the pulley and the belt to engage one another with reduced slippage , thereby increasing belt life . the overall thickness of the lagging material is a matter of environmental conditions , design choice and manufacturing ability . however , it is generally contemplated that the lagging thickness should normally range between 0 . 25 inches and approximately 2 inches . however , the aforementioned thicknesses should not be considered as limitations of the present invention , as it is readily apparent that the present invention will function properly regardless of the lagging thickness . in a preferred embodiment of the present invention , the overall thickness of the lagging is approximately 0 . 625 &# 34 ;, but this thickness is not considered to be a critical element of the invention . additionally , it should be understood that the present invention also encompasses pulleys that have helical grooving and tapered shoulder regions formed directly in the roll core , thereby avoiding the use of lagging altogether . by way of example only , this may be accomplished by using a roll core of solid rubber or urethane . opposed helical grooves 7 and 7 &# 39 ; are formed in each drive surface 5 and extend from tapered shoulders 9 and 9 &# 39 ; to a common apex 11 . as shown in fig4 a , 4b , 4c and 4d , the grooves , in cross section , have generally vertical sidewalls and a radius formed in the base of the groove and are separated by thread - like members or lands 13 and 13 &# 39 ;. for example , in a preferred embodiment , the conveyor pulley of the present invention , having an outer roll surface diameter of approximately 7 inches , the bottom radius is approximately 0 . 188 inches and the sidewalls of the grooves are approximately 0 . 188 inches in length , i . e ., nominally 3 / 8 &# 34 ; wide by 3 / 8 &# 34 ; deep . both the radius and length of the sidewalls vary in direct proportion to the diameter of the pulley . however , it should be understood that the present invention is not to be considered limited by this exact ratio of pulley diameter to groove depth / sidewall length . on the contrary , the specifies above disclosed represent a preferred embodiment of the invention . the relative sizes and shapes of the grooves and the lands may vary considerably , e . g ., &# 34 ; v &# 34 ; shaped , &# 34 ; u &# 34 ; shaped , or flat bottomed grooves , etc . however , it is generally contemplated that the lands will be at least as wide as the grooves and preferably wider . in a preferred embodiment of the invention , the grooves are approximately 3 / 8 &# 34 ; wide by 3 / 8 &# 34 ; deep and are on 11 / 8 &# 34 ; centers , which results in lands of approximately 3 / 4 &# 34 ; in width , i . e ., a 2 : 1 ratio of land width to groove width . however , this ratio may vary in range from 1 . 0 to 5 . 0 depending upon the particular requirements of the specific application , and should not be considered to be a specific limitation of the present invention . the pitch or rate of advance of the grooves may also vary considerably . in a preferred embodiment of the present invention , the pitch of the helical grooves is 5 °± 1 ° as measured from a line extending circumferentially around the pulley that passes through the apex 11 of the grooves . in general , it is desirable that the size and pitch of the grooves be such as to urge a belt toward the center of its drive surface and also provide a channel for helping to keep the pulley face and the belt clean and dry . tapered shoulder regions 9 and 9 &# 39 ; are preferably formed along each side of each drive surface 5 and extend toward the core 8 . as shown in fig4 a , the tapered shoulder regions are substantially linear in cross section . however , as shown in fig4 b , 4c , and 4d , the tapered shoulder regions may also be stepped , grooved or generally curvilinear in cross section . hereinafter , when the tapered shoulder region is referred to as being curvilinear in cross section it should be understood that the term curvilinear is meant to encompass the specific embodiments disclosed in fig4 b - 4d as well as any tapered shoulder region that is nonlinear in cross section . the lagging , if used , may be applied in such a manner as to either completely cover the roll core 8 between the tapered shoulder regions or , alternatively , applied in such a manner that the area of the roll core between the tapered shoulder regions is exposed to the environment , i . e ., not covered . the width of each drive surface 5 is preferably chosen to be less than that of its respective belt 17 , such that the edges of the belt overhang and conform to the shoulders 9 and 9 &# 39 ;. this arrangement not only further helps to center a belt on its pulley , it also improves belt - life by relieving stresses at the edges of a belt . as shown in fig2 each drive surface 5 is substantially flat . it will be recognized , however , that each of the individual drive surfaces may be crowned , cambered or tapered to have a generally higher central crown . furthermore , as shown in fig5 the plurality of drive surfaces may be collectively crowned to a common overall radius . as suggested earlier , the pulleys and their lagging components may be formed of a number of materials . thus , the core of a pulley may be made of a variety of materials , such as steel , plastic , bronze , aluminum , and wood . similarly , lagging materials may include elastomers such as natural rubber , synthetic rubber , polyurethane , neoprene , or other similar type materials . in general , it is desirable that a lagging material be wear - resistant but also resilient and elastic so as to possess a spring - like quality in engaging and disengaging from a belt . in operation , a grooved pulley of the present invention provides several attractive features . as stated earlier , the helical threads or lands formed between the helical grooves of the pulley act to help center a belt on the pulley . in addition , the grooves , being continuous from the center of a pulley to its edges , act as channels to convey fluid and particles away from the pulley and its belt . | US-77154591-A |
an adult or child life - size two dimensional human figure designed to simulate a man withdrawing a pistol or other firearms from a holster or the like . the figure is maintained in an upright position with its legs affixed within a rigid pace and includes a weighted set of arms with the pistol drawing arm held in a down position by means of a wire rod which is tripped by pulling on a string attached thereto to spring the arm into a simulated pistol draw to provide a contest to an individual attempting to outdraw the target device . | referring now to the drawings in detail , there is illustrated a preferred form of the pistol draw target constructed in accordance with the principles of the present invention and which is designated generally in its entirety by the reference numeral 10 and which is comprised of a frame 11 , an arm assembly 12 , an arm trigger mechanism 13 , the frame legs 14 , a base 15 , and associated hardware and interconnecting components as will be later described . the frame 11 is constructed of durable material , such as plywood , pressboard , or the like , and , as shown in fig1 is shaped with the configuration of a child or adult life - size figure having an opposed front surfce 16 and back surface 17 with the top portion of the front surface 16 being provided with facial features 18 and with a optional head covering or hat 19 . the arm assembly 12 consists of a length of durable rod or tubing which is bent to form a simulated arm 20 , a horizontal section 21 which is bent perpendicularly to the arm 20 , and the stub end 22 which is bent perpendicularly from the horizontal section 21 so as to also be perpendicular to the arm 20 and extending rearwardly from the back surface 17 of the frame 11 . a series of sleeves 23 are fitted losely over and along the length of the horizontal section 21 as shown in fig2 with the sleeves 23 being tightly secured to the back surface 17 by means of the u - shaped brackets 24 and the wood screw 25 so that the horizontal section 21 is positioned in the horizontal plane on the back surface 17 a short distance below the shoulder portion 26 of the frame 11 . two conventional washers 27 are positioned over the horizontal section 21 and securely affixed thereto , such as by welding , and are spaced apart by the width of the frame 11 so as to prevent side swaying of the horizontal section 21 in a horizontal direction . the stub end 22 is provided with external threads 28 a short distance from its end for assembly thereover , of a cylindrical weight 30 and which is tightened in place on the stub end 22 by means of the nuts 30 . a u - shaped spring clip 31 is provided with a series of round through holes 33 for assembly to a mounting plate 32 in a conventional way , such as with bolts and nuts , rivets , and the like , which is provided with round through holes ( not shown ). in axial alignment with the round through holes 33 , and with the mounting plate 32 being mounted to the back surface of 17 in the conventional way , such as with wood screws , through the round through holes 34 so as to line up the opening 35 of the u - shaped spring clip 31 with the weight 29 when stub end 22 in lowered into a vertical position . the arm trigger mechanism of 13 consists of a trigger rod 36 consisting pf a length of rigid wire which is straight in configuration but formed with a loop 37 on one end thereof , with the trigger rod 36 being loosely secured within two u - shaped brackets 38 to the back surface 17 by means of conventional screws or nails 39 so that the trigger rod 36 extends in a horizontal plane a distance laterally from the frame 11 so as to extend shortly beyond the arm 20 when the trigger rod 36 is in the fully extended position . a conventional string or cord 40 is knotted on one end to the loop 37 and , as shown in fig2 is dressed through two eye hooks 41 , which are screwed in a conventional manner into the back surface 17 to be in vertical alignment with each other with the upper eye hook being provided in the same horizontal plane and a short distance of the loop 37 when the trigger rod 36 is in a fully outwardly extended position , and with the cord 40 being of sufficient length to extend several feet in front of the pistol draw target for use by an individual in practicing withdrawal of the pistol from the holster . the frame legs 14 , as shown in fig4 are constructed of a single piece of durable tubing formed in a u - shaped configuration and is provided with a series of through holes ( not shown ) through which the frame legs 14 are secured to the back surface 17 near the bottom thereof by means of conventional wood screws 42 . the base 15 consists of a square or rectangular base plate 43 with a reinforcement block 44 being secured to the top surface of the base plate 43 in a conventional manner , such as by nails , screws , adhesive , or the like , so as to be centrally located on the top surface of the base plate 43 in one plane and to extend the length of the base plate 43 in the opposite plane . two cylindrical nipples 45 are securely affixed and centered on the top surface of the reinforcement block 44 with the spacing between the nipples 45 being equal to the spacing between the frame legs 14 , and with the nipples 45 being provided with the round openings 46 which are slightly larger than the outside diameter of the frame legs 14 for assembly of the frame legs 14 therein to stand the frame in an upright position . the top of the reinforcement block 44 is further provided with an eye hook 47 through which the cord 40 is dressed to extend to the front of the frame 11 and which is in vertical alignment with the eye hooks 41 . in operation , the user stands some distance away from and facing the front surface 16 of the pistol draw target 10 with a pistol or hand gun in the holster , tucked within one &# 39 ; s belt , or the like . the user &# 39 ; s pistol or hand gun can be provided with blank cartridges , wax bullets , or live ammunition as desired by the user , with live ammunition being the least desirable due to possible personal hazards and quicker deterioration of the pistol draw target 10 . the user or another individual pulls on the cord 40 to pull the cord through the eyelets 47 and 41 and , with the opposite end of the cord 40 attached to the loop 37 on the trigger rod 36 , the trigger rod 36 is rapidly pulled through the u - shaped brackets 38 to withdraw the trigger rod 36 inwardly of the back surface 17 of the frame 11 and away from the arm 20 . the weight 29 attached to the stub end 22 of the arm assembly 12 then falls from a horizontal position as shown in fig1 and 2 into a vertical position as shown in fig5 where the weight 29 rapidly falls into the opening 35 to snap into the u - shaped spring clip 31 , this in turn raising the arm 20 into a horizontal position , as shown in fig5 to simulate the drawing of a pistol or hand gun by a pistol draw target 10 . the user , of course , draws his pistol or hand gun upon the tug of the cord 40 trying to shoot at the pistol draw target 10 before the arm 20 is raised into the horizontal position , the rapidity of the user &# 39 ; s draw being judged visually by the user or other onlookers . the arm 20 is reset into the vertical position by manually lowering the arm 20 from the horizontal position and then by manually pulling the trigger rod 36 laterally from the back surface 17 of the frame 11 to hold the arm 20 in place as previously described . the pistol draw target 10 is portable and can readily be moved from one place to another by lifting the frame legs 14 out of the nipples 45 provided on the base 15 for setting up the pistol draw target 10 in another location . there is thus provided a novel pistol draw target for use in testing or practicing one &# 39 ; s skill in withdrawing a pistol or hand gun from a holster or the like , the invention being simple in construction and requiring a minimum number of moving parts to meet its stated objectives . it is to be understood that the form of this invention as shown and described is to be taken as a preferred example thereof , and that this invention is not to be limited to the exact arrangement of parts described in the description or illustrated in the drawings as changes thereto in the details thereof pertaining to size , shape and arrangement of parts thereof are envisioned within the scope of the invention without departing from the novel concepts of the invention . | US-67493476-A |
a method and apparatus for temporarily immobilizing a local area of tissue . in particular , the present invention provides a method and apparatus for temporarily immobilizing a local area of heart tissue to thereby permit surgery on a coronary vessel in that area without significant deterioration of the pumping function of the beating heart . the local area of heart tissue is immobilized to a degree sufficient to permit minimally invasive or micro - surgery on that area of the heart . the present invention features a suction device to accomplish the immobilization . the suction device is coupled to a source of negative pressure . the suction device has a series of suction ports on one surface . suction through the device causes suction to be maintained at the ports . the device further is shaped to conform to the surface of the heart . thus , when the device is placed on the surface of the heart and suction is created , the suction through the ports engages the surface of the heart . the suction device is further fixed or immobilized to a stationary object , such as an operating table or a sternal or rib retractor . thus , the local area of the heart near the suction device is temporarily fixed or immobilized relative to the stationary object while suction is maintained . in such a fashion , the coronary artery may be immobilized even though the heart itself is still beating so that a bypass graft may be performed . in addition the suction device may be used in either a conventional , open - chest environment or in a minimally - invasive environment , e . g . endoscopic . | fig1 is a view of the immobilizing device 11 being used to temporarily immobilize an area of heart tissue . in the preferred embodiment , surgical access to the local area of heart tissue is achieved through a mini - thoracotomy , preferably performed within either the fourth or fifth intercostal space . an incision 10 of approximately 10 centimeters is made into chest cavity between the ribs ( seen here in phantom .) the rib cartilage may be temporarily removed and the ribs surrounding the incision slightly spread apart using a retractor ( not shown ) to provide adequate surgical access to the mammary artery and the heart . as seen , a pair of suction devices 12 , 13 are introduced . the first suction device 12 is introduced through a small stab wound 8 in between the ribs approximately 10 cm . below incision 10 . this stab wound is made in any acceptable manner . incidentally , once the surgery has been completed , the stab wound may be used for the thorax drain after the closure of the chest . as discussed below with reference to fig1 , the suction device has a covering 180 , made from latex rubber , over the distal end when it penetrates the chest wall in order to avoid blood and tissue from entering the suction ports and block suction apertures . once suction device is introduced , covering 180 is removed and the distal end is positioned onto heart . the second suction device 13 is introduced through incision 10 onto the surface of the heart . as seen , the distal end of each suction device is ultimately positioned in the local area of heart tissue to be immobilized , i . e . on either side of a coronary artery upon which a graft is to be made . as seen , suction devices 12 , 13 are secured using securing devices 14 , 15 respectively to a stationary object , such as surgical table 16 . of course other objects besides the surgical table may be used as a stationary object , including the floor , ceiling or even the patient , such as a portion of the skeletal system of the patient , e . g . the sternum . in the preferred embodiment , each securing device 14 , 15 is a variable friction arm , model no . 244 available from manfrotto nord , inc . of zona industriale di villapaiera , l - 32032 feltre bl , italy . each securing device 14 , 15 has a series of elbow joints 17 which may be locked in position . thus the securing device permits the suction device to be locked into any position desired within three - dimensional space . although not show , each securing device ( or each suction device or both ) may also be interconnected such that a truss type structure is created and the entire stiffness or rigidity of the immobilizing device 11 is improved . suction devices 12 , 13 are coupled to a suction source 114 through lines 20 , 21 . suction source 114 is preferably the standard suction available in the operating room and coupled to the devices with a two liter buffer flask ( not shown ) for each device . suction is provided at a negative pressure of between 200 - 600 mm hg with 400 mm hg preferred . as seen , each suction device has essentially two portions , a paddle 22 and an arm 23 . fig2 and 3 detail suction devices 12 and 13 respectively . turning now to fig2 a and 2b , fig2 a is a side view of a suction device 12 showing its placement against the outline of a heart . as seen , the distal end of suction device comprises a paddle 22 and arm 23 coupled together by a continuous hinge or neck 71 . paddle 22 has a generally planar surface which conforms generally to the curvature of a heart 1 , shown here in outline . in the preferred embodiment , suction arm 23 is coupled to suction paddle 22 such that suction paddle 22 may be rotated or bent to achieve the desired orientation relative to arm 23 . this is accomplished by neck 71 . neck 71 is fashioned to be relatively bendable , that is to be bent by hand into the desired orientation , as opposed to paddle 22 and arm 23 , which are rigid . in the preferred embodiment suction paddle 22 and suction arm 23 are constructed of stainless steel 316 , while neck 71 is constructed of stainless steel 321 . of course other means may be provided to permit paddle 22 to move or rotate relative to arm 23 other than making neck 71 to be malleable by hand , such as a locking hinge as well as a remotely actuable joint , as is well known in the art . see for example , u . s . pat . no . 5 , 374 , 277 of hassler , incorporated herein by reference . a remotely actuable hinge is believed particularly advantageous for a suction device used endoscopically . in an alternate embodiment paddle may be fixed in a rigid orientation relative to arm . as seen , arm 23 has a suction lumen 30 therethrough which communicates with a suction conduit 31 in paddle 22 through neck lumen 72 . suction conduit 31 in paddle 22 further communicates through suction hole 32 ( best seen in fig2 b ) to suction port 33 . fig2 b is a view of the bottom of suction device 12 . as seen , in the preferred embodiment four suction ports 33 in a row are featured , although the specific or exact number and position used may vary . each suction port 33 has a suction aperture 32 , each of which are preferably located at a position off - center from suction port 33 . suction apertures 32 are positioned off center from suction ports 33 so that if a large upwelling of tissue is caused by the suction ( which may occur as a blister or bell - shaped curve ) the tissue will not immediately close off the suction by obstructing suction aperture 32 , as it would if the aperture were in the center of suction port 33 . in addition , each suction aperture 32 has a much smaller diameter as compared to the diameter of suction port 33 . this creates a high resistance pathway between suction port 33 and suction conduit 31 which permits the loss of a tissue - to - port seal in one suction port ( and thus loss of fixation of the suction port to the tissue ) to not also cause a precipitous pressure drop in the remainder of the suction ports . in the preferred embodiment suction aperture 32 has a diameter of 2 mm and suction port 33 has a diameter of 6 mm . turning now to fig3 a and 3b , fig3 a is a side view of a suction device 13 shown in fig1 . as seen , the distal end of suction device 13 comprises paddle 22 and arm 23 coupled together by a continuous hinge or neck 71 . paddle 22 has a generally planar surface which conforms generally to the curvature of a heart 1 . in the preferred embodiment , suction arm 23 is coupled to suction paddle 22 such that suction paddle 22 may be rotated or bent along any of the three axes to achieve the desired orientation relative to arm 23 . this is accomplished by neck 71 . neck 71 is substantially similar to that discussed in fig2 a but for the fact that suction device 13 has suction paddle 22 at an angled orientation to suction arm 23 . in the preferred embodiment suction paddle 22 of suction device 13 is perpendicular to suction arm 23 , although other angular orientations may be used . fig3 b is a view of the bottom of suction device 13 . as seen , in the preferred embodiment suction paddle 22 of suction device 13 is substantially similar to that described in fig2 b . in the preferred embodiment suction aperture 32 has a diameter of 2 mm and suction port 33 has a diameter of 6 mm . fig4 is a longitudinal cross - sectional view of suction paddle 22 used in immobilizing device 11 . as seen , paddle 22 has a series of suction ports 33 each of which is connected to suction conduit 31 through a suction aperture 32 . each suction port 33 has generally straight , cylindrical sides . of course other configurations may be used , such as cone - shaped suction ports , dome - shaped suction ports , etc . fig5 is a cross - sectional view of the suction paddle 22 taken along the line 5 -- 5 of fig4 . as seen , suction port 33 is connected to suction conduit 31 through suction aperture 32 . suction paddle 22 has a canted or slanted surface 36 at the top . through this type of surface , area 37 may be better accessed for performing surgical procedures . fig6 is a longitudinal cross - sectional view of suction arm 23 . distal end 71 of suction arm 23 has neck 71 ( not shown in this fig .) fixed thereto . as seen , arm 23 has a suction lumen 30 therethrough which communicates with suction conduit 31 in paddle 22 through neck lumen 72 of neck 71 ( shown in phantom in this fig .). as seen in fig7 which is a plan view of suction arm 23 , proximal end 75 has a series of knurled ridges 76 to facilitate coupling a suction line coming from suction source ( not shown in this fig .) to suction arm 23 . fig8 is a detailed view of a pair of suction devices 12 , 13 being positioned on a heart and spread apart . as seen , paddles 22 , 27 of each device generally are placed in the area 34 in which temporary immobilization of the heart tissue is desired . when used for a coronary bypass graft , area 34 typically will have a coronary artery 35 running therethrough . area 34 is between paddles 22 , 27 . once placed about area 34 , suction is then created in the suction ports ( not shown in this view .) through the suction , the device then is fixed to or grabs hold of the heart tissue . once the suction is created and the paddles are secured to the heart tissue , each of the suction devices are then spread slightly apart as shown by the arrows 40 , 41 to the positions shown as 42 , 43 . the effect of this spreading apart is to cause a tension to be created in the area 34 of the heart tissue between the paddles . the tension causes the area 34 to be further immobilized , and in particular in the z - direction , i . e . in the direction normal to the plane defined by the surface of the heart . this is represented in fig9 and 10 . as seen in fig9 the area of heart tissue between the paddles , even with the placement of the paddles , still has some vertical motion , shown here as arrow 50 . when paddles 22 , 27 are slightly spread apart to cause a tension in that area 34 of tissue between the paddles , as depicted in fig1 , then the amount of movement in the area 34 between the paddles 22 , 27 due to the tension is further decreased , especially in the z - direction , i . e . the direction perpendicular to the surface of the heart 1 . once the paddles 22 , 27 are thus positioned and secured and the area of the tissue is temporarily immobilized , the coronary artery in that area may be operated upon . in the preferred embodiment , the anastomosis of the coronary artery may be accomplished through any acceptable end - to - side or side - to - side technique . of course , other methods of performing the anastomosis may be used , such as those methods which may be performed endoscopically . fig1 is an example of the motion in the plane parallel to the surface of the heart of a point on heart tissue during one half respiratory cycle when the heart is unrestrained and also depicting the motion of the same point on heart tissue when the suction devices are used . line 60 is a tracing of the motion of a point of tissue on the cardiac surface . as seen by line 60 , a point on the cardiac surface moves approximately 15 mm in each direction . generally , each loop of movement depicts the motion of the beating heart within one cardiac cycle . thus , loop 61 occurs due to one cardiac cycle . loop 62 occurs due to the next cardiac cycle , but the entire heart has shifted in location somewhat due to the inflation or deflation of the lungs associated with respiration . line 63 shows the motion of the same point of heart tissue when the suction device is placed near the area and the heart wall is immobilized by the present invention . as seen , the present invention functions to minimize heart wall movement in that area to approximately 1 mm in each direction . this is best seen in fig1 which is an enlarged portion of fig1 and in particular line 63 . as seen , through the use of the present invention , heart wall movement has been decreased to only slightly more than 1 mm . decreased to an amount in the area of the suction devices such that the still - beating heart may be operated upon in that area using an endoscope or any other method of minimally invasive surgery . fig1 is an alternate embodiment of the present invention . as seen , the embodiment of fig1 comprises a suction sleeve 80 which is coupled to an annular suction head 81 via a ball bearing joint 84 . ball bearing joint 84 may be provided so as to permit remote actuation of the suction head 81 from a position outside the chest . the suction head 81 has a series of suction ports 82 located along a first planar surface . in the embodiment shown the planar surface upon which the suction ports 82 are located is conical in shape , although other types of planar surface may be used , such as frusto - conical for example . the suction head 81 may be constructed such that each half of the device is coupled to a separate suction source . through such a configuration , if one - half of the suction head 81 were to lose contact with the surface , the other one - half of the suction head 81 could maintain capture . the suction sleeve 80 is used as described above . that is the suction sleeve 80 itself is coupled to a suction source ( not shown but the same as suction source 114 ) and is fixed or immobilized to a stationary point , such as the operating table or a retractor ( also not shown .) suction through the suction source and the suction sleeve 80 then causes the suction ports 82 to suck upon the heart tissue . through this configuration , then , the heart tissue in the center of suction sleeve is immobilized . interruption or opening 83 permits suction head 81 to be fixed to heart tissue while permitting a blood vessel to be grafted . in particular , if a mammary artery has been grafted end - to - side to a coronary artery , then the opening 83 permits the suction head 81 to be removed from around the grafted artery . fig1 is a view of the device being used to temporarily immobilize a local area of heart tissue using an alternative access procedure to the preferred mini - thoracotomy . in particular heart 1 is exposed with an incision 2 through the patient &# 39 ; s sternum and the chest is spread apart by a retractor 3 to provide access to the heart 1 . access to the heart 1 is further effected by retraction of the pericardium 4 in the area of the heart 1 which is to be operated on . as shown pericardial retraction is accomplished through sutures 5 . as seen , the immobilizing device 11 comprises a pair of suction devices 12 , 13 and a suction source 114 . suction devices 12 , 13 are secured to patient be securing each to retractor 3 through a pair of clamps 19 . of course suction devices 12 , 13 may also be secured to the operating table ( not shown in this fig . but using a securing device as described above . ) suction devices are coupled to suction source 114 through lines 20 , 21 . suction source 114 is preferably the standard suction available in the operating room and coupled to the devices with a two liter buffer flask ( not shown ) for each device . suction is provided at a negative pressure of between 200 - 600 mm hg with 400 mm hg preferred . as seen , each suction device has essentially two portions , a paddle 22 and an arm 23 . turning now to fig1 which is a side view of an alternate embodiment of suction device 12 showing its placement against the outline of a heart . as seen , the distal end of suction device comprises a paddle 22 and arm 23 . paddle 22 has a generally planar surface which conforms generally to the curvature of a heart 1 , shown here in outline . the paddle 22 is coupled to arm 23 through a pin 24 . the pin 24 permits the paddle 22 to be swiveled to the preferred angle relative to arm 23 . as seen , arm 23 has a suction lumen 30 therethrough which communicates with a suction conduit 31 in paddle 22 . suction conduit 31 , in turn , communicates through suction aperture 32 ( best seen in fig4 ) to suction port 33 . fig1 is a view of the bottom of suction device 12 shown in fig1 . as seen , four suction ports 33 in a row are featured , although the specific or exact number and position used may vary . fig1 is a further alternate embodiment of a suction device 12 showing its placement against the outline of a heart . as seen , suction device 12 is substantially similar to that shown and described in fig2 but for the addition of suture coil 73 . suture coil 73 is a tightly wound spring fixed to the top surface of suction paddle 22 . further temporary stabilization of the coronary anastomosis site may be achieved , if desired , by catching epicardial flaps with light traction sutures . suture coil 73 permits these and any other sutures to be temporarily fixed in place by wedging the suture between within suture coil 73 , as is known in the art . fig1 is a bottom view of a further alternate embodiment of suction device 12 . as seen , suction device 12 is substantially similar to that shown and described in fig2 but for the addition of electrode 174 along a side of suction paddle 22 . electrode 174 is coupled by lead 175 to pulse generator 176 . electrode 174 , lead 175 and pulse generator 176 may be provided according to well know methods and materials so as to permit the heart to be paced , cardioverted or defibrillated while suction device 12 is fixed to the surface of the heart . fig1 is a cross - sectional view of a body showing an alternate method of achieving access to a surface of the heart and using the present invention to immobilize an area of tissue . as seen suction device 12 is introduced through a first stab wound . as discussed above , suction arm 23 of device 12 is secured by securing device 14 to a stationary object , such as operating table 16 . a second suction device may also be introduced through a second stab wound to securely immobilize a local area of tissue . each suction device has a covering 180 , made from latex rubber , over the distal end when it penetrates the chest wall in order to avoid blood and tissue from entering the suction ports and block suction apertures . two or more additional surgical trocars 78 may be introduced to permit endoscopy and surgical access to heart 1 . in addition the left lung 79 may also be partially collapsed so as to provide an unencumbered area in which to manipulate the surgical instruments . as disclosed , the present invention relates to a method and apparatus for immobilizing tissue . in the preferred embodiment , the invention is used to immobilize heart tissue for a coronary artery bypass graft procedure using either an open or closed chest approach , without the need for a cardiopulmonary bypass . other surgical techniques , however , which require immobilizing body tissue may also be performed using the present invention , such as surgery on other organs such as the stomach , gall bladder , etc ., as well as on other body tissues , such as the eye or the skin , for example . in addition , while the present invention has been described in detail with particular reference to a preferred embodiment and alternate embodiments , it should be understood variations and modifications can be effected within the scope of the following claims . such modifications may include substituting elements or components which perform substantially the same function in substantially the same way to achieve substantially the same result for those described herein . | US-53136395-A |
apparatus for performing an open wedge , low femoral osteotomy , the apparatus comprising an osteotomy guide , a hinge pin and an osteotomy implant , the osteotomy guide comprising : anterior and posterior tissue shields having openings for receiving the hinge pin and defining the hinge pin axis , and profiles configured to enable fluoroscopic alignment of the hinge pin axis parallel to the sagittal plane of the patient , a cutting guide comprising a cutting slot for defining a cutting plane extending parallel to , and through , the hinge pin axis , and a drill guide comprising a hole for forming a guide hole in the femur which extends substantially perpendicular to the cutting plane , the hinge pin comprising an elongated body , and the osteotomy implant for positioning in a wedge - shaped opening formed about the cutting plane and for receiving a screw extending through the guide hole . | looking first at fig1 and 2 , there is shown a knee joint 5 upon which an open wedge , low femoral osteotomy is to be performed . knee joint 5 generally comprises a tibia 10 and a femur 15 . in accordance with the present invention , the open wedge , low femoral osteotomy is preferably performed using the osteotomy guide 100 shown in fig3 . osteotomy guide 100 generally comprises an anterior tissue shield 105 a having a hole 110 a formed on one end thereof and a wishbone segment 115 a formed on the other end thereof ; a posterior tissue shield 105 p having a hole 110 p formed on one end thereof and a wishbone segment 115 p formed on the other end thereof ; a cutting guide 120 having a cutting slot 125 formed therein and a drill guide 130 having a pair of drill guide holes 135 a and 135 p formed therein , with cutting guide 120 and drill guide 130 being formed so as to mount to wishbone segments 115 a , 115 p of tissue shields 105 a , 105 p ; a guide bushing 137 for mounting to anterior tissue shield 105 a ; and a hinge pin 140 . looking next at fig4 - 24 , the open wedge , low femoral osteotomy is preferably performed as follows . ( 1 ) first , using a fluoroscope set up in anterior - posterior ( ap ) view , the desired location of the osteotomy hinge is marked on the skin ( not shown ). ( 2 ) next , a lateral incision ( also not shown ) is made in the skin and then anterior tissue shield 105 a and posterior tissue shield 105 p are inserted , anteriorly and posteriorly , respectively , alongside femur 15 . see fig4 and 5 . ( 3 ) next , cutting guide 120 and drill guide 130 are snapped into wishbone segments 115 a , 115 p of tissue shields 105 a , 105 p , so that tissue shields 105 a , 105 p , cutting guide 120 and drill guide 130 assume the configuration shown in fig3 . ( 4 ) then an incision is made at the boney hinge tissue mark and guide bushing 137 is mounted into hole 110 a in anterior tissue shield 105 a . see fig4 and 5 . ( 5 ) next , the desired location of the hinge pin boney entrance is marked by drilling approximately 5 mm into the bone with a hinge pin drill d . see fig6 and 7 . this forms a pivot point for hinge pin drill d in the following alignment step ( step 6 ) which will determine the orientation of the hinge pin hole . ( 6 ) during the alignment step , the surgeon holds hinge pin drill d and an alignment handle ( not shown ) connected to osteotomy guide 100 , pushing a reference edge on cutting guide 120 against the lateral aspect of the femur . the surgeon &# 39 ; s other hand holds hinge pin drill d in the boney pivot created in the preceding step ( step 5 ). looking in the lateral fluoroscope view , the hinge pin axis is made parallel with the patient &# 39 ; s sagittal plane by aligning the arms of the two wishbones 115 a , 115 p in the fluoroscope view . ( 7 ) when the aforementioned alignment is achieved , a hinge pin hole 143 ( fig9 and 14 ) is drilled into the femur , using hinge pin drill d . on account of the foregoing procedure , the hinge pin hole will extend anterior - to - posterior , parallel with the patient &# 39 ; s sagittal plane . ( 8 ) next , hinge pin 140 is inserted into hinge pin hole 143 , passing through guide bushing 137 , through anterior tissue shield 105 a and threading into hole 110 p in posterior tissue shield 105 p . see fig8 and 9 . a collet nut ( not shown ) may be used to lock guide bushing 137 and hinge pin 140 together . ( 9 ) a reference edge of drill guide 130 is pushed up against the lateral aspect of the femur ( see fig1 ) and then two guide holes 145 a , 145 p are drilled through drill guide holes 135 a , 135 p , respectively . guide holes 145 a , 145 p are drilled up to the osteotomy plane . see fig1 . note that only drill guide hole 135 a , and only guide hole 145 a , are shown in fig1 due to the angle of view . ( 10 ) next , two bolts 150 a , 150 p , equipped with self - cutting threads ( to form threads in the femur , to be used later by compression screws , as will hereinafter be discussed ) are inserted into the drill guide holes 135 a , 135 p and into guide holes 145 a , 145 p , respectively , tightening the instrumentation against the bone . see fig1 . ( 11 ) then an oscillating saw blade ( not shown ) is advanced through cutting slot 125 in cutting guide 120 and into the femur . cutting slot 125 guides the oscillating saw blade so as to restrict the osteotomy cut 155 ( fig1 ) to the zone within the “ safety cage ” formed by anterior and posterior tissue shields 105 a , 105 p and hinge pin 140 . as a result , the delicate vascular and neurological tissues surrounding the knee joint are fully protected during formation of osteotomy cut 155 . ( 12 ) at this point , bolts 150 a , 150 p are withdrawn from the femur , hinge pin 140 is withdrawn from the femur , and the remainder of osteotomy guide 5 is removed from the surgical site , leaving osteotomy cut 155 extending from the surface of the femur to hinge pin hole 143 , with guide holes 145 a , 145 p extending to osteotomy cut 155 . see fig1 . ( 13 ) next , the femur is opened along osteotomy cut 155 , so as to create a wedge - like opening 160 in the lower end of the femur . see fig1 and 16 . ( 14 ) then an appropriate wedge - shaped implant is disposed in wedge - like opening 160 so as to maintain the femur in its proper disposition during healing . preferably the wedge - shaped implant 200 shown in fig1 and 18 is used . wedge - shaped implant 200 generally comprises a wedge - shaped body 205 having a distal end 210 and a proximal end 215 , with an upper surface 220 and a lower surface 225 . a pair of holes 230 a , 230 p extend through body 205 , from lower surface 225 to upper surface 220 . as seen in fig1 and 20 , wedge - shaped implant 200 is positioned in wedge - shaped opening 160 so that the implant &# 39 ; s upper surface 220 engages the upper portion of the femur and the implant &# 39 ; s lower surface 225 engages the lower portion of the femur , and so that implant holes 230 a , 230 p are aligned with guide holes 145 a , 145 p , respectively . ( 15 ) next , a pair of extension holes 165 a , 165 p are drilled into the femur on the far side of the implant , with extension hole 165 a being aligned with implant hole 230 a and guide hole 145 a , and with extension hole 165 p being aligned with implant hole 230 p and guide hole 145 p . see fig2 and 22 . note that only extension hole 165 a , and only guide hole 154 a , are shown in fig2 due to the angle of view . ( 16 ) finally , wedge - shaped implant 200 is secured in position by passing a compression screw 235 a through guide hole 145 a , implant hole 230 a and extension hole 165 a , and by passing a compression screw 235 p through guide hole 145 p , implant hole 230 p and extension hole 165 p . see fig2 and 24 . note that only compression screw 235 a is shown in fig2 due to the angle of view . significantly , the compression screws engage bone on both sides of the osteotomy cut and , as the compression screws 235 a , 235 b are tightened , the compression screws draw the bone on both sides of the osteotomy closed , against the wedge - shaped implant . furthermore , the closely perpendicular relationship between the osteotomy plane and the compression screws allows for fixation to be maintained with screws in tension rather than in bending . the threads on either end of each compression screw also distribute shear load on the bone more evenly than a conventional locking plate - and - screw fixation that bears load on bone perpendicular to the axes of the screws . fixation may also be enhanced by incorporating a small washer or plate of metal or plastic between each compression screw head and bone . the washer or plate may be self aligning to accommodate the bone geometry . the controlled position and orientation of the compression screws help to locate the implant within the osteotomy . the compression screw axes are controlled through the use of osteotomy guide 100 , which interfaces with the instrumentation which is aligned to anatomical features of the distal femur . it will be understood that many changes in the details , materials , steps and arrangements of parts , which have been herein described and illustrated in order to explain the nature of the invention , may be made by those skilled in the art without departing from the principles and scope of the present invention . | US-99888207-A |
a multiple rf return pad contact detection system is provided which is adaptive to different physiological characteristics of patients without being susceptible to electrosurgical current interference . the detection system can measure or sense the contact resistance or impedance between the patient and pairs of rf return pads or return electrodes where multiple pairs of rf return pads are utilized due to the high current frequently needed during electrosurgery while eliminating or minimizing the risk of measurement interaction between the rf return pad pairs . the system allows for the independent and simultaneous measurement of the pad contact impedance for each pair of rf return pads . if the impedance of any pad pair is above a predetermined limit , the system turns off or reduces the electrosurgical output of the electrosurgical generator to prevent excess heating . the system eliminates or minimizes interference or measurement interaction between the pad pairs by providing a different signal source frequency for each pad contact pair , but a frequency which matches an associated series resonant network frequency . the current that flows in the series resonant network is a direct reflection or function of the pad impedance of the corresponding pad pair . | reference should be made to the drawings where like reference numerals refer to similar elements . referring to fig1 , there is shown a schematic diagram of the multiple rf return pad contact detection system 100 of the present invention wherein electrosurgical generator 10 includes known circuitry such as a radio frequency oscillator 12 and an output amplifier 14 which generate an electrosurgical current . this current is applied to a patient ( not shown ) via an active electrode 16 . the electrosurgical current is returned to the generator 10 via pad contact pairs or return electrode pairs 18 a , 18 b having pads or electrodes 20 a , 20 b and 22 a , 22 b and a corresponding two conductor patient cable 24 a , 24 b having leads 26 and 28 . two capacitors 32 and 34 are connected across each of the secondary windings 40 a , 40 b of transformer 38 a , 38 b . each primary winding 36 a , 36 b is connected to a corresponding a . c . signal source 42 a , 42 b and a series resonant network 44 a , 44 b . the purpose of each series resonant network 44 a , 44 b is to produce a current ( i . e ., left and right current senses ) which is a function of the impedance between pads or electrodes 20 a , 20 b and 22 a , 22 b . the system 100 eliminates or minimizes interference or measurement interaction between the pads 20 a , 20 b and 22 a , 22 b , while allowing for the independent and simultaneous measurement of the pad contact impedance for each pair of rf return pads by having each a . c . signal source 42 a , 42 b provide a different signal source frequency for its corresponding pad contact pair . the frequency of each series resonant network 44 a , 44 b is tuned to match the frequency of the current produced by its associated a . c . signal source 42 a , 42 b . accordingly , the frequency of one of the series resonant networks 44 a is different from the frequency of the other series resonant network 44 b . hence , there is minimal interaction , if any , between the left and right circuitry of the system 100 , especially the two contact pad pairs 18 a , 18 b . this essentially eliminates inaccurate or confusing measurements . additionally , the frequency of the electrosurgical current produced by the electrosurgical generator 10 is substantially different from that of the current produced by the a . c . signal sources 42 a , 42 b . the current that flows in each series resonant network 44 a , 44 b , i . e ., left and right current senses , is a direct reflection or function of the pad impedance of the corresponding pad contact pair 18 a , 18 b according to the physics of a series resonant network . each series resonant network 44 a , 44 b is an rcl network or a combination of r ( resistance ), l ( inductance ) and c ( capacitance ). in a preferred embodiment of the series resonant networks 44 a , 44 b , the inductive component for each network is integrated into the respective transformer 38 a , 38 b . the frequency response of a series resonant network has a maximum resonant frequency f r . at the resonant frequency , the series resonant network has the minimum impedance , as opposed to a parallel resonant network which has the maximum impedance at the resonant frequency , and the phase angle is equal to zero degrees . the total impedance of a series resonant network is z t + jx l − jx c = r + j ( x l − x c ). at resonance : x l = x c , f r = 1 /( 2 πsqrtlc ), z t = r , and v l = v c . the resonance of a series resonant network occurs when the inductive and capacitive reactances are equal in magnitude but cancel each other because they are 180 degrees apart in phase . the left and right current senses are applied to pad contact impedance measurement subsystem 46 which determines whether the impedance measurements between pads or return electrodes 20 a , 20 b and 22 a , 22 b are within a desired range . the range is preferably adaptable to the physiological characteristics of the patient . if at least one of the impedance measurements is not within a desired range , an inhibit signal is applied over a line 48 to internally disable the electrosurgical generator 10 ( or reduce the rf output therefrom ) to prevent excess heating . u . s . pat . nos . 4 , 416 , 276 and 4 , 416 , 277 describe a method for determining the desired range according to the physiological characteristics of the patient , the entire contents of these patents is incorporated herein by reference . preferably , the desired range for which the impedance must fall between return electrodes 20 a , 20 b and 22 a , 22 b is about 20 to about 144 ohms . if not , the electrosurgical generator 10 is disabled . thus , in one method of operation of the present invention , the lower limit is fixed at the nominal value of 20 ohms , thus reducing the onset of patient injury as a result of stray current paths which may surface if a contact pad or electrode is applied to a surface other than the patient . the upper limit is set to avoid such problems as those mentioned hereinbefore , i . e ., tenting , incorrect application site , gel drying , etc . in accordance with an important aspect of the invention , the upper limit is adjustable from the absolute maximum ( typically about 144 ohms ) downward to as low as typically 20 ohms to thereby provide for automatic adaptiveness to the physiological characteristics of the patient . this provides the multiple rf return pad contact detection system 100 of the present invention with significantly more control over the integrity of the rf pad contact or electrode connections without limiting the range of patient types with which the multiple rf return pad contact detection system 100 may be used or burdening the operator with additional concerns . that is , the physiological characteristics can vary significantly from patient to patient and from one location site for the pad pairs to another . thus , patients may vary in their respective amounts of adipose tissue ( which is one determining factor in the impedance measurement between the various pads ) without effecting the detection system . further , for a particular patient , one location site may be more fatty , hairy or scarred than another . again , this does not reduce the effectiveness of the system , i . e ., all of these factors typically affect the impedance measured between pads 20 a , 20 b and 22 a , 22 b and thus concern the operator as to which site is optimal for a particular patient . such concerns are eliminated in accordance with the present invention by providing for automatic adaptability to the physiological characteristics of the patient . reference should now be made to fig2 which is a graph illustrating the operation of pad contact impedance measurement subsystem 46 . during operation , the desired impedance range ( that is , the acceptable range of the impedance detected between pads 20 a , 20 b and 22 a , 22 b ) is preset when the power is turned on to an upper limit of , for example , 120 ohms and a lower limit of , for example , 20 ohms as can be seen at time t = 0 seconds in fig2 . if the monitored impedance for any pad contact pair is determined to be outside of this range ( t = a seconds ) by comparing the current sense signal ( or a signal derived there from ) with a reference signal ( e . g ., a signal equal to 120 ohms or 20 ohms ) using comparator circuitry ( e . g ., when a pad pair or any single contact pad is not affixed to the patient ) an alert will be asserted and the electrosurgical generator 10 will be disabled over line 48 . the impedance between two contact pads of a contact pad pair at any instant is designated the return rf electrode monitor ( rem ) instantaneous value ( riv ) in fig2 . when the rem impedance enters the range ( t = b seconds ) bounded by the upper limit ( ul ) and the lower limit ( ll ), a timing sequence begins . if after five seconds the riv is still within range ( t = c seconds ), the alert condition will cease and the rem impedance value is stored in memory . this is designated as rem nominal value ( rnv ). the upper limit is then reestablished as 120 % of this amount . the 80 ohm riv shown in fig2 causes the upper limit to be at 96 ohms . this feature of the invention is particularly important because it is at this time ( t = c seconds ) that adaptation is initially made to the physiological characteristics of the patient . note if the riv were to exceed 96 ohms at a time between t = c and t = f seconds ( while the upper limit is 96 ohms ), the alert will be asserted and the electrosurgical generator 10 disabled . however , if the upper limit had not been adjusted to 96 ohms , the alert would not have been asserted until after the riv exceeded the initial 120 ohms upper limit as determined by the comparator circuitry , thus possibly heating one or both of the pads 20 a , 20 b and 22 a , 22 b . this situation is of course exacerbated if the patient &# 39 ; s initial riv within the preset 20 to 120 ohm range is 30 ohms . an initial riv of 10 ohms within the preset range of 20 to 120 ohms sets an upper limit of 144 ohms . in accordance with another aspect of the invention , it has been observed that the impedance between contact pads of contact pad pairs decreases over a relatively long period , such as a number of hours . since many surgical procedures can extend a number of hours , this effect is also taken into consideration in the present invention . accordingly , riv is continuously monitored and any minima in rem impedance ( e . g ., a downward trend followed by a constant or upward trend in rem impedance ) initiates a new five second timing interval ( t = e seconds ) at the end of which the rnv is updated to the riv if the riv is lower ( t = f seconds ). the rem upper limit of 120 % of rnv is re - established at this time . the five second interval causes any temporary negative change in rem impedance ( t = d seconds ) to be disregarded . operation will continue in this manner provided riv does not exceed the upper limit of 120 % rnv or drop below the lower limit of 20 ohms . exceeding the upper limit ( t = g seconds ) causes an alert and the electrosurgical generator 10 is disabled . it will remain in alert until the riv drops to 115 % of rnv or less ( t = h seconds ) or until the system 100 is reinitialized . riv dropping to less than 20 ohms ( t = i seconds ) causes a similar alert which continues until either the riv exceeds 24 ohms ( t = j seconds ) or the system 100 is reinitialized . the hysteresis in the limits of the rem range ( that is , the changing of the upper limit to 115 % of rnv and the lower limit to 24 ohms in the previous examples ) prevents erratic alerting when riv is marginal . it should be noted in the example of fig2 that the alert actually does not turn off when riv returns to a value greater than 24 ohms because the pad pairs are removed before 5 seconds after t = j seconds elapse . thus , the alarm stays on due to the removal of the pad contact pairs 18 a , 18 b . removing the pad contact pairs 18 a , 18 b from the patient or unplugging the cables 26 , 28 from the electrosurgical generator 10 ( t = k seconds ) for more than one second causes the system 100 to be reinitialized to the original limits of 120 and 20 ohms . this permits a pad to be relocated or replaced ( t = l seconds ) without switching the electrosurgical generator 10 off . the riv at the new location is 110 ohms and 120 % rnv is 132 ohms . thus , as described above , this is the one time ( whenever riv enters the 20 to 120 ohms range ( either as preset during power on or as reinitialized as at t = k seconds ) for the first time ) that the upper limit can be raised during the normal rem cycle . otherwise , it is continually decreased to adapt to the decreasing riv impedance with the passage of time . the preferred implementation of the foregoing fig2 operation of the pad contact impedance measurement subsystem 46 is effected by a set of programmable instructions configured for execution by a microprocessor . the system 100 could be modified by providing a multiplexer to multiplex the measurements corresponding to each pad contact pair 18 a , 18 b to eliminate or minimize measurement interaction and also minimize hardware resources . other pad contact pair arrangements can be provided in the system 100 of the present invention besides the pad pair arrangements shown in fig1 . for example , ten pad contact pairs 18 can be provided and connected to electrosurgical generator 10 by cables 26 and 28 , where the corresponding a . c . signal source 42 and series resonant network 44 corresponding to each pad contact pair 18 are tuned to the same frequency which is different from the frequency of the other a . c . signal sources 42 and series resonant networks 44 . it is provided that the system 100 of the present invention allows for impedance comparisons to be performed between pad pairs . therefore , if the pad pairs are placed symmetrically on the patient , i . e ., left leg and right leg , comparison of the contact impedance can provide another degree of detection and safety . although the subject apparatus has been described with respect to preferred embodiments , it will be readily apparent to those having ordinary skill in the art to which it appertains that changes and modifications may be made thereto without departing from the spirit or scope of the subject apparatus . | US-91898404-A |
provided is image processing technology capable of avoiding image degradation even when a luminous body model is expanded on a three - dimensional virtual space . this image processing method generates a two - dimensional image obtained by performing perspective projection to an image model disposed in a virtual three - dimensional space on a perspective view plane 14 in a view coordinate system of a view point 12 set in the virtual three - dimensional space . the luminous body disposed in the virtual three - dimensional space is configured from a model 18 having a distance component z in the direction from the luminous source coordinate toward the view plane , and having a cone shape extending in a direction intersecting with the direction in the view plane side , and the center image of the luminous body and the diffused light image emitted therefrom are drawn on the object . | fig1 is a block diagram of the game device to which the present invention is applied . the game device 100 has a storage device or storage medium ( including optical disks and optical disk drives ) 101 storing game programs and data ( including visual and audio data ), a cpu 102 for executing the game program and controlling the overall system as well as performing coordinate calculation for displaying images , a system memory 103 storing programs and data required for the cpu 102 to perform processing , a bootrom 104 storing programs and data required for activating the game device 100 , and a bus arbiter 105 for controlling the programs and flow of data with the respective blocks of the game device 100 or the equipment to be connected externally , and these are respectively connected via a bus . a rendering processor 106 is connected to the bus , and the visual ( movie ) data read out from the program data storage device or storage medium 101 and images to be created according to the player &# 39 ; s operation or game progress are displayed on a display monitor 110 with the rendering processor 106 . graphic data and the like required for the rendering processor 106 to create images are stored in the graphic memory ( frame buffer ) 107 . a sound processor 108 is connected to the bus , and the audio data read out from the program data storage device or storage medium 101 and sound effects and audio to be created according to the player &# 39 ; s operation or game progress are output from a speaker 111 with the sound processor 108 . audio data and the like required for the sound processor 106 to generate sounds are stored in the sound memory 109 . the game device 100 is connected to a modem 112 , and is capable of communicating with other game devices 100 and network servers via a lan adapter or the like . further , a backup memory 113 ( including a disk storage medium and storage device ) for recording information on the progress of the game and program data to be input / output via a modem , and a controller 114 for inputting to the game device 100 information for controlling the game device 100 and equipment connected externally according to the player &# 39 ; s operation are also connected to the game device 100 . the cpu and rendering processor constitute the image arithmetic processing unit . the cpu executes the image processing described later based on a game program or game data . fig2 is a diagram showing a state where a luminous body model ( sun ) is defined in a virtual space created in a computer hardware resource with the cpu of the game device illustrated in fig1 , and formed from a polyhedral pyramid shaped model , whereby this model is represented from an oblique angle . this model 10 is configured from a polyhedral pyramid shape built from a plurality of polygons 11 . reference numeral 16 is the starting point ( tip ) of this model , and this is set to be the positional coordinate of the light source . reference numeral 18 is the ending point ( dead end , terminal ). reference numeral 12 is the camera viewpoint defined in a virtual space , and , as shown in fig3 , a two - dimensional image of the luminous body model is displayed by performing perspective projection on the perspective view plane in the view coordinate system of the view point . in fig2 , a flare image texture 19 as illustrated in fig6 is affixed to the rectangular model ( flare model ) represented with reference numeral 18 a . fig6 is a diagram showing the projected image of the flare model . in fig2 , reference numeral 14 is the view plane , and this view plane is positioned perpendicular to the view ( line ) direction 20 from the view point toward the light source coordinate . the luminous body model expresses a mode where the diameter is expanding in relation to the view direction 20 , and this diameter is radially expanding from the starting point toward the ending point . a picture ( texture ) of the luminous body is affixed to the inner peripheral face of the pyramid model illustrated in fig2 . this texture is configured from a center image and diffused light diffusing radially from such center image . fig4 is a diagram showing the configuration of this texture , and reference numeral 30 is the sun itself ; that is , the heat source , and reference numeral 32 is the diffused light . reference numeral 31 represents the flare image . as shown in fig5 , the texture 400 illustrated in fig5 is affixed to the inner peripheral face of the pyramid model 10 depicted in fig3 . with the two - dimensional projected image subject to perspective transformation with the starting point 12 facing the model 10 , a center image corresponding to the heat source is represented in the range shown with the arrow of reference numeral 402 , and diffused light is displayed in the range represented with reference numeral 404 . the luminous body model illustrated in fig2 has a distance component ( z component ) from the positional coordinate ( starting point ) 16 of the light source toward the view plane 14 ; that is , toward the view direction 20 , and the value of this z component can be changed to match the intended state of the luminous body model . fig7 is a diagram showing a state where the z value of the model 10 is expanded , and fig8 is a diagram showing the projected image thereof . as shown in fig8 , via perspective transformation , the area ( c . f . fig3 and fig5 ) to which the center image texture is displayed will be roughly the same size as the area 402 of fig3 before the expansion of the z value and will hardly be expanded , and , therefore , the resolution of such area will be maintained . contrarily , the peripheral area 404 to which the diffused light is represented will be rapidly expanded . here , since the diffused light will be drawn on the entire view plane , for instance , when reproducing the appearance of sudden and intense diffused light from the sun such as in a case where the view point 12 is moved and the sun is suddenly exposed from the shadows , the processing shown in fig7 and 8 is employed . meanwhile , for example , when reproducing a state where the exposure of the sun is small or the diffused light from the sun is light such as on a cloudy day , in comparison to fig7 , the z value of the model 10 is set small as shown in fig2 . in this state , as shown in fig3 , the ratio of the projected image of the sun on the view plane will be small in comparison to the case depicted in fig8 . the flare model 18 a ( fig2 ) constitutes a part of the luminous body model , and , in addition to the rectangular shape described above , this may also be a pyramid shape . incidentally , a flare is not formed across the enter periphery of the diffused light , and it will suffice so as long as it can be displayed in a prescribed direction . thus , the flare model has been formed in a rectangular shape as described above . the z value of the flare model can also be changed similar to the main model 10 of the luminous body . the purpose of placing this flare is to improve the presentation effect upon representing the flare image when the luminous body begins to expose itself from the obstacle or begins to hide behind the obstacle . the z value of the luminous body model 10 and flare model 18 a will be adjusted based on the degree of exposure of the luminous body . fig9 is a diagram showing a state where the sun 50 is hiding behind a mountain ( obstacle ) 52 , and fig1 is a diagram showing a state where the sun 50 is hiding behind a building 54 . the degree of hiding ( corresponds to the term “ phase of eclipse ” in the claims ”) ( r ) is determined by how many of the plurality of reference points 53 defined in relation to the sun 50 are hidden behind the obstacle . in the example of fig9 , since 4 among the 17 reference points are hiding behind the obstacle , r = 4 / 17 , and , in the example of fig1 , since 10 reference points are hidden , r = 10 / 17 . the position of the sun is determined as follows . since the direction of the sun in the three - dimensional coordinate space is nearly determined , the two - dimensional position of the sun on the view plane can be determined as a result thereof . simultaneously , the position of the obstacle on the view plane is also determined . as shown in fig9 and fig1 , the position of the reference points of the sun is determined , and the z buffer value of these reference points 53 and the z buffer value of the obstacle 52 are compared so as to count the number of reference points hiding behind the obstacle . the z value , which is the size of the cone shaped model of the luminous body in the view direction , and the degree of hiding are made to be a related parameter , and with the model illustrated in fig2 , the ratio of the x , y , z coordinate values are defined as [ 1 , 1 , ( 1 − r ) 2 ], and the relationship of the z value and r is defined with the characteristic ( z = a ·( 1 / r )) shown in fig1 . therefore , the higher the degree of hiding , the smaller the z value . when the z value becomes small , as shown in fig3 , the view ( drawing area of the diffused light ) of the sun on the screen will become small . contrarily , when the degree of hiding becomes low , the z value will increase , and the drawing area of the diffused light of the sun will become large . when the degree of hiding is high , since the diffused light from the light source must be represented lightly , a transparency parameter is used . in other words , the higher the degree of hiding , the greater the transparency of the luminous body . fig1 is a diagram showing that the relationship of the transparency a and r is a = r . the lower the degree of hiding , the transparency of the luminous body is lowered , and the luminous body is drawn densely . with the lens flare model ( 18 a of fig2 ) also , the z value or transparency is changed according to r , and , as shown in fig1 , the z value is changed within a range of roughly 4 to 5 times the standard size . pursuant to the increase of the degree of hiding r , as shown in fig1 , the flare model is extending in the z direction the transparency is gradually changed from r = 0 . 5 as shown in fig5 . what is important here is that when r increases , the transparency decreases ( does not have to become 0 ), and when r increases even more , the transparency increases . thus , this does not necessarily have to be 0 . 5 . a flare model is drawn the moment the sun enters or exits the obstacle . with the flare model , the ratio of coordinates x , y , z is defined with [ 1 , 1 , r + 4 ], a = 2 | 0 . 5 − r |. as shown in fig2 , the flare model 18 a is protruding from the luminous body model 10 , and is drawn with an emphasis in relation to the diffused light of the luminous body . fig1 is a block diagram showing the image processing operation to be realized by the cpu executing the game program . at step 16 a , as shown in fig9 and fig1 , the degree of hiding r is computed . at step 16 b , the z value and transparency are computed regarding the luminous body model . at step 16 c , the z value and transparency regarding the flare model are computed . at step 16 d , the luminous body model and flare model are drawn . here , as the view point moves and the luminous body is gradually exposed from the obstacle and the degree of exposure progresses , the change from fig3 to fig b ; that is , the size of the diffused light on the screen will increase . at the moment the sun is exposed 50 %, as shown in fig1 , a clear flare image is drawn . during the process of the sun becoming further exposed , although the size of the diffused light will increase , the flare image will gradually disappear . as described above , in the present embodiment , although a case has been explained where the foregoing cone shaped model is adapted as the luminous body , the present invention is not limited thereto , and the cone shaped model may also be applied to an object other than the luminous body in which the peripheral area thereof is to be expanded while the center portion thereof is not to be expanded , according to the present invention , a cone shaped object can be used to represent the sun ( luminous body ) and lens flare without having to calculate the position and light source of each and every lens flare . the moment the sun comes into view , the cone is reduced and displayed brightly , and then the cone is extended , made transparent , and the brightness is lowered . the cone shaped model may also be rotated around the axis in the z direction according to the movement of the view point . as a result , a more realistic lens flare can be represented . since the representation of a plurality of lens flares can be reproduced with a single object , the calculation load of the cpu can be reduced . | US-14224505-A |
a self - aligning , compactable , collapsible seating structure formed by sections of hollow tubing , each hollow tubing component has a first end having a first diameter and a second opposing region having a second , reduced diameter . reduced diameter regions are insertable into said tubing regions having a first diameter to form a self - aligning joint . a pair of rigid , u - shape frames are rotatively connected together to form an a - frame shaped support . dimensions of the chair in an operational , deployed configuration may be reduced along two dimensions into a compacted configuration for storage or transport . the novel chair may be compacted into a thin bundle that may be rolled up in and contained within fabric that forms a portion of the chair . in its compacted , rolled up state , the novel chair is suitable for transportation within a backpack or other such enclosure . | the present invention provides a self - aligning , compactable , collapsible chair structure having a seat - supporting portion and a back - supporting portion both rotatably connected to a common top member , the angle therebetween being adjustable . referring first to fig1 , there is shown an isometric schematic view of the self - aligning , compactable , collapsible chair of the present invention in an open , operational configuration , generally at reference number 100 . chair 100 has a seat / leg - supporting portion 102 consisting of a seat - supporting region 106 and a leg - protecting region 108 . a back supporting region 104 is provided by a first ridged , collapsible u - shaped frame 120 a that is hingedly connected to a second rigid , collapsible u - shaped frame 120 b that supports first rigid , collapsible u - shaped frame 120 a at a desired inclination by use of a flexible strap 182 interconnecting first rigid , collapsible u - shaped frame 120 a to second rigid , collapsible u - shaped frame 120 b . referring now also to fig2 a and 2b , there are shown side , cross - sectional , elevational , schematic views of two embodiments of seat / leg supporting region 102 of seat 100 . as seen in fig2 a , seat - supporting region 106 is typically a padded structure with a moisture barrier , 110 forming a lower , ground - engaging surface . a wear - resistant membrane 112 forms an upper surface of both leg - protecting region 108 and seat supporting region 106 . in a first embodiment , a back supporting region formed by first rigid , collapsible u - shaped frame 120 a and supporting region 106 have foam pads 114 a , 114 b disposed between water - resistant membrane 110 and wear - resistant membrane 112 . it will be recognized that foam pads 114 a , 114 b may be implemented as a continuous single foam pad . while foam pads 114 a , 114 b have been chosen for purposes of disclosure , it will be recognized by those of skill in the art that many alternate materials may be substituted therefor . consequently , the invention is not considered limited to the foam pad 114 a chosen for purposes of disclosure . rather , the invention comprehends any and all suitable padding materials . it will be further recognized that while a two - ply structure consisting of moisture resistant membrane 110 and wear - resistant membrane 112 has been shown , a single - ply structure may readily be substituted therefore . as seen in fig2 b , an inflatable bladder 116 and an inflation tube and valve 118 replace foam pad 114 of fig2 a . the use of an inflatable bladder 116 allows chair 100 to possibly be compacted to a smaller volume than in the embodiment of fig2 a having foam pad 114 . further , inflatable bladder 116 allows a user to adjust a degree of firmness or support of the “ padding ” provided thereby to a personal preference . inflatable bladders 116 and inflation tubes and valve structures 118 are considered to be well known to those of skill in the art and are not further described herein . a back - supporting portion 104 is attached to seat / leg supporting region 102 by a continuation of at least wear resistant membrane 110 or wear resistant member 112 . referring now to fig3 , there is shown an exploded , front elevational , schematic view of collapsible , u - shaped frames 120 a and 120 b . frame 120 a defines and supports back - supporting portion 104 of chair 100 . frames 120 a / 120 b each have a pair of upper frame braces 122 . upper frame brace 122 has a major axis , not specifically identified , and an upper flattened region 124 having a through hole 126 disposed in flattened region 124 perpendicularly the major axis . upper frame brace 122 has reduced diameter lower portion 132 . an elastic cord retaining member 128 is disposed within upper frame brace 122 and retained therein by the diameter reduction proximate reduced diameter lower portion 132 . elastic cord retaining member 128 has a central through hole 130 disposed parallel to the major axis and sized to accept an elastic cord 146 therethrough . an end , not specifically identified , of elastic cord 146 is retained above elastic core retaining member by a knot , a fastener , cement , or any other suitable manner , shown schematically at reference number 134 , that keeps the end of elastic cord 146 from passing through hole 130 once secured . rigid , collapsible , u - shaped frames 120 a , 120 b each typically have four hollow tubular frame members 140 . tubular member 140 has an upper end 142 having a first diameter , and a reduced diameter region 144 . the first diameter at upper end 142 being sized to receive and frictionally retain the reduced diameter portion 132 of upper frame brace 122 or a reduced diameter region 144 of another hollow tubular frame members 140 . a u - shape bottom member 148 has a pair of opposed ends 150 and 152 , each having a diameter sized to accommodate and frictionally retain a reduced diameter region 132 of upper frame brace 122 or reduced diameter region 144 of hollow tubular frame member 140 . frame members 122 , 140 , and 148 are formed from light - weight , ductile metal , typically aluminum . joints formed by inserting a reduced diameter region ( e . g ., 132 , and 140 ) into a larger diameter portion of tubing ( e . g ., 142 , 150 , 152 ) forms self - aligning joints . self - alignment in ensured by forming frame components so that the length of regions of reduced diameter is sufficient to cause the joint formed to be self - aligning . referring now also to fig4 a , there is shown a side elevational , schematic view of a top frame member 160 . top frame member 160 is a straight tubular structure having a pair of opposing ends , not specifically identified , each receiving and retaining a plastic insert 162 . referring now to fig4 b - 4d , there are shown a side elevational , a top plan , and a bottom plan , schematic view , respectively , of plastic insert 162 . plastic insert 162 has a flange 164 having a larger diameter that the diameter of top member 160 . a body 166 having a diameter 168 depends from a lower surface of flange 164 . body 166 is adapted for insertion in the ends of top member 160 . plastic insert 164 has a threaded bore 170 extending along the entire height thereof . protrusions 172 spaced circumferentially around body 166 are adapted to press against an inside surface of top frame member 160 as a screw 174 ( best seen in fig5 ) is inserted into threaded bore 170 and thereby slightly expanding the diameter 168 of body 166 and retaining plastic insert 162 within top frame member 160 . referring now also to fig5 , there is shown front elevational , schematic view of collapsible , u - shaped frames 120 a and 120 b connected to a top frame member 160 . in fig5 , the frame components shown in fig3 in an exploded view are joined to form frames 120 a , 120 b in their respective operational configurations . top frame member 160 is shown in its operational position between flattened regions 124 of upper frame braces 122 . plastic inserts 162 in each end of top frame member 160 , more specifically , threaded through hole 170 of plastic insert 162 is show positioned to receive screws 174 that will be inserted through holes 126 in the directions shown by respective arrows 176 adjacent each end of top frame member 160 . referring now also to fig6 , there is shown a front elevational , schematic view of u - shaped , collapsible support frames 120 a , 120 b in a partially collapsed state . the reduced diameter regions 132 of upper frame braces 122 and the reduced diameter regions 144 of frame hollow tubular pieces 140 have been withdrawn from respective upper ends 142 of hollow tubular pieces 140 and ends 150 , 152 of u - shaped bottom frame member 148 . referring now also to fig7 , the partially collapsed frames 120 a , 120 b of fig6 are now shown in a completely collapsed arrangement . the four hollow tubular frame pieces 140 all now lie substantially parallel to top frame member 160 in two rows , and bottom frame member 148 has moved inwardly toward top frame member 160 adjacent a bottom row of hollow frame tubular pieces 140 . once compacted , the frames 120 a , 120 b may be rolled up in the moisture proof barrier 110 ( fig2 a , 2 b ) into a configuration suitable for carrying in a backpack or other such container . referring now also to fig8 a and 8b , there are shown a perspective , schematic view of u - shaped collapsible support frames assembled into an a - frame structure , and a detailed perspective , schematic view of the frame connection region of the a - frame structure of fig8 a , respectively . the a - frame structure that results from rotatively interconnecting u - shaped , collapsible support frames 120 a , 120 b to one another forms the complete frame of the novel chair 100 . the pivotable ( i . e ., rotative ) interconnection of support frames 120 a , 120 b is shown schematically at reference numbers 180 . referring now to fig8 b , there is shown a perspective , schematic view of the region 180 of fig8 a . rotative interconnection of u - shaped , collapsible support framed 120 a , 120 b is accomplished by connecting corresponding flattened regions 124 of upper frame braces 122 of both frames 120 a , 120 b to respective ends of upper frame member 160 . to accomplish such interconnection , a machine screw 174 is placed into through hole 126 in flattened region of upper support brace associated with u - shaped , collapsible support frame 120 b . a nylon or polytetrafluoroethylene ( ptfe ) better known as teflon ® washer is placed onto the threads of machine screw 174 . it will be recognized that materials other than polytetrafluoroethylene ( ptfe ) exist and are believed to be known to those of skill in the art from which a “ slippery ” washer may be formed . consequently , the invention is not considered limited to the nylon or polytetrafluoroethylene ( ptfe ) materials chosen for purposes of disclosure . rather , the invention is intended to include washers formed from any suitable other material . machine screw 174 is then passed through hole 126 in a corresponding upper frame brace associated with u - shape , collapsible support frame 122 a . finally , machine screw 174 is secured in threads 170 of plastic insert 162 in the associated end of upper frame member 160 . this operation is performed on both sides of u - shaped , collapsible support frames 120 a , 120 b , thereby completely forming the a - frame structure shown in fig8 a . it will be recognized that numerous mechanisms are known to those of skill in the art for pivotably interconnecting frames 120 a and 120 b . such mechanisms include , but are not limited to , detented mechanisms capable of self - locking frames 120 a and 120 b in discrete , predetermined angular relationships to one another . such mechanisms are neither discussed nor described in further detail herein . flexible straps 182 , typically having one or more grommets 184 may be used to secure the angular relationship of frames 120 a and 120 b . flexible straps 182 have each a proximal end rotatively connected to u - shaped , collapsible frame 120 a and typically contain several grommets 184 . grommets 184 may be selectively placed over a screw or post 186 in one of the hollow tubular frame pieces 140 . by selecting the particular grommet 184 in flexible straps 182 , the angle formed between rotatively connected u - shaped , collapsible support frames 120 a , 120 b may be selected and maintained while chair 100 is in use . back supporting flexible straps 188 are attached to upper frame member 160 and lower frame member 148 of first u - shaped , collapsible frame 120 a . at their upper ends , back supporting flexible straps encircle upper fame member 160 and the stitched together with stitching shown schematically at reference number 190 . at their lower ends , back supporting flexible straps utilize a hook - and - loop fastening material with a hook portion 192 and loop portion disposed on a first major surface of back supporting flexible straps 188 and a mating loop portion disposed on an opposing major surface of back - supporting straps 188 . this arrangement allows back supporting flexible straps to be tightened once the angle , not specifically identified , between first u - shape rigid frame 120 a and second u - shaped rigid frame 120 b is established and maintained by straps 182 . refer now again also to fig3 , 6 , 7 , and 8 . in operation , compactable , collapsible chair 100 may be transformed from an operational configuration to a collapsed configuration by first unfastening straps 182 . if the chair 100 configuration includes an inflatable bladder 116 ( fig2 b ), it may be necessary to deflate inflatable bladder 116 prior to unfastening straps 182 . corresponding frame hollow members 140 of frames 120 a and 120 b may be pushed inwardly ( toward the center of respective frames 120 a and 120 b ) until the frames are totally collapsed . once collapsed , the compacted structure may be rolled up in the moisture proof barrier 110 ( fig2 a , 2 b ) into a configuration suitable for carrying in a backpack or other such container . since other modifications and changes varied to fit particular operating requirements and environments will be apparent to those skilled in the art , the invention is not considered limited to the example chosen for purposes of disclosure , and covers all changes and modifications which do not constitute departures from the true spirit and scope of this invention . having thus described the invention , what is desired to be protected by letters patent is presented in the subsequently appended claims . | US-201414562680-A |
a live insect dispensing cage to be used by fishermen enables one insect at a time to be selectively dispensed and encourages the insect to travel within the cage interior to a distal end portion of the cage housing that is less illuminated and that has a dispensing outlet . a trigger and pushrod linkage arrangement can be used to open and close a valve that registers in an outlet opening through which insects are to be dispensed . | fig1 - 4 show the preferred embodiment of the present invention designated generally by the numeral 10 . live insect dispensing cage apparatus 10 is comprised of a housing 11 that can have a handle 12 for enabling a user to grip and manipulate the housing 11 . housing 11 have end portions 13 and 14 . end portion 13 is a proximal end portion next to a users hand when the user grips the handle 12 during use . end portion 14 is a distal end portion that is next to a dispensing outlet opening 30 . housing 11 can be an elongated structure that includes a generally cylindrically shaped portion or a section 15 . housing 11 has an interior 16 for containing live insects 58 that are useful to a fisherman such as , for example , crickets , grasshoppers , grubs , or the like . proximal end portion 13 has a trigger support 17 that extends behind handle 12 as shown in the drawings . trigger support 17 has trigger 18 pivotally attached thereto at pivot 19 . trigger 18 can be used by an operator to move pushrod 20 or other suitable linkage . the pushrod 20 can be connected at one end portion to trigger 18 and at its other end portion to valve member 454 . the valve member 454 is moveable between open ( fig7 ) and closed ( fig2 ) positions for opening and closing the outlet opening 30 . during use , an operator holds handle 12 using primarily the fingers of one hand . the user also grips trigger 18 with - the thumb of the same hand . the user then squeezes the trigger 18 toward handle 12 in the direction of arrow 46 . this action of squeezing trigger 18 overcomes the return spring 29 that normally holds the valve 454 in a closed position as shown in fig2 . trigger support 17 can extend away from transverse plate 22 that is part of the cylindrical section 15 that is at the central part of the apparatus 10 . in order to fill the apparatus 10 with live insects 58 such as crickets , grasshoppers , grubs or the like , a fill opening 47 is provided that communicates with interior 16 . closure plate 21 can be fitted to opening 47 for closing it after a desired number of live insects 58 have been added to the interior 16 . once the live insects 58 are contained within interior 16 and the closure plate 21 has been fitted and sealed to fill opening 47 , the apparatus 10 can be carried using handle 23 . by placing fill opening 47 and plate 21 in the side wall of housing 11 , away from its end portions , live insects 58 will not congregate at opening 47 thereby enabling them an opportunity to escape when cover 21 is removed . the handle 23 can be pivotally attached to cylindrical section 15 of housing 11 at pivots 24 , 25 . once the insects 58 are contained within interior 16 , they tend to gravitate toward distal end portion 14 as will be described more fully herein after . the end portion 14 includes a cone - shaped portion 26 that is preferably a solid wall of material that does not have any openings . an outlet tube 27 is fitted to cone 26 . the outlet tube 27 can be beveled , providing beveled surface 28 . outlet opening 30 is provided in outlet tube 27 . the combination of the outlet opening 30 and the beveled surface 28 provides a structure that enables a user to very quickly dispense a cricket from the apparatus 10 into a user &# 39 ; s hand . when a live insect 58 enters the outlet tube 27 as shown in fig7 the live insect 58 can be easily discharged into a users hand by rapidly flipping the outlet tube 27 in the direction of arrow 59 as shown in fig7 . the outlet tube 27 communicates with interior 16 so that insects 58 contained within interior 16 can travel the length of the apparatus 10 and be dispensed through cone - shaped portion 26 , then outlet tube 27 , and through outlet opening 30 . in order to ensure that most of the live insects 58 contained within interior 16 gravitate or travel toward distal end portion 14 , the wall 48 of housing 11 provides a gradient of light transmission that provides a brighter illumination to the interior 16 at proximal end 13 and a lesser illumination at end portion 14 . this can be provided , for example , by means of a plurality of openings that include smaller diameter openings 31 next to distal end portion 14 and larger diameter openings 44 next to proximal end portion 13 . in the preferred embodiment , there are a plurality of openings 32 - 43 in between the smallest openings 31 and the largest openings 43 . the openings 31 - 44 can be , for example , sequentially of larger and larger diameter , beginning with the smallest diameter opening 31 and gradually increasing in diameter with openings 32 , 33 , 34 , 35 , etc . until the largest diameter 44 is reached . in the preferred embodiment , the valve 45 can simply be an enlarged diameter portion of pushrod 20 provided at the distal end portion of pushrod 20 . trigger 18 can provide an upper end portion 49 to which pushrod 20 is attached at connection 50 . pushrod 20 passes through channel 51 in transverse plate 22 of housing 11 . a flat washer or other retainer can be provided at channel 51 so that it retains one end of return spring 29 . the other end of return spring 29 presses against stop 52 mounted on pushrod 20 . the return spring 29 can thus be a coil spring that is mounted upon pushrod 20 as shown in the drawings . the housing 11 can be formed in halves , each half being injection molded for example . in fig6 mold sections 53 , 54 are shown , the section 54 having a plurality of projections 55 for forming the openings 31 - 44 . an overlapping joint 56 , for example , can be used at the interface between the half sections of the housing 11 . the housing half sections can be fastened together using screws 57 . the following is a list of parts and materials suitable for use in the present invention : all measurements disclosed herein are at standard temperature and pressure , at sea level on earth , unless indicated otherwise . all materials used or intended to be used in a human being are biocompatible , unless indicated otherwise . the foregoing embodiments are - presented by way of example only ; the scope of the present invention is to be limited only by the following claims . | US-96993301-A |
a protective carrying case for a handheld device having an anterior panel connected to a posterior panel and an integrated flap releasably attached to the anterior panel and connected to the posterior panel through a slit . the handheld device is inserted into the carrying case for protection and can be removed by unlatching integrated flap and manually moving the flap outwardly from the interior of the carrying case . | the invention will now be described with reference to fig1 , which is a perspective view of the handheld device carrying case 30 , comprising an anterior panel 32 a posterior panel 34 and an integrated flap 36 , the flap 36 is releasably attached to the anterior panel 32 at the flap attachment point 38 and the flap 36 is fitted to the posterior panel 34 at the flap retention point 40 . with continued reference to fig1 , the anterior panel 32 is designed to protect the face of the handheld device and at least a portion of the side of the handheld device . the posterior panel 34 is designed to protect the back of the handheld device and at least a portion of the side of the handheld device . the anterior panel 32 is attached to the posterior panel 34 producing a protective pocket 44 in which the handheld device is fitted . the flap 36 is designed to encompass the handheld device in the protective pocket 44 and latches to the anterior panel 32 at the flap latching point 46 . further to fig1 , the flap 36 is permanently attached to the anterior panel 32 at the flap attachment point 38 . the flap attachment point 38 is located on the interior of the anterior panel 32 . the posterior panel 34 has a flap sleeve 42 . in the preferred embodiment , the flap sleeve 42 is secured to the interior surface of the posterior panel 34 at approximately the top of the posterior panel 34 and configured to allow the flap 36 to pass through the sleeve 42 . the sleeve 42 is designed to allow the flap 36 to move in a planar direction . the flap 36 is latched to the anterior panel 32 at the flap latching point 46 , thus surrounding at least one surface of the handheld device in the protective carrying case 30 . the flap retracting device 50 is attached at one end to the inner surface posterior panel below the midsection , and is attached to the posterior surface of the flap above the midsection on the other end . the flap retraction device may be constructed of a suitable elastic material . fig1 discloses the carrying case 30 with the flap 36 fully inserted to store a handheld device . fig2 , is a perspective view of the handheld device carrying case 30 , as described in fig1 , depicting the flap 36 in the fully extracted position . the flap 36 is shown fully extracted to illustrate the degree to which the handheld device may be lifted from the carrying case 30 to allow for easy removal of the handheld device . the position of the flap attachment point 38 in conjunction with the position of the flap retention point 40 limits the extent to which the handheld device may be extracted from the carrying case 30 . in addition fig2 depicts the flap retracting device 50 in its expanded form . fig3 is perspective view of the carrying case 30 depicting the flap 36 in the fully inserted position . included in fig3 is a handheld device 48 depicted to aid in illustrating the functionality of the flap 36 . further to fig3 , the handheld device is fully inserted into the carrying case 30 , thus forcing the flap 36 into the fully inserted position . the flap 36 may be latched to the flap latching point 46 thus securing the handheld device 48 into the carrying case 30 . the flap retracting device 50 is attached at one end to the inner surface posterior panel below the midsection , and is attached to the posterior surface of the flap above the midsection on the other end . fig4 , shows a perspective view of the carrying case 30 depicting the flap 36 in the fully extracted position . included in fig4 is a handheld device 48 depicted to aid in illustrating the functionality of the flap 36 . the flap 36 has been unlatched from the flap latching point 46 and extracted forcing the handheld device 48 to be partially removed from the carrying case 30 . once again the flap retracting device 50 can be seen in its expanded form . fig5 is a cross sectional view of the carrying case 30 with the flap 36 in the fully inserted position , depicting the anterior panel 32 , the posterior panel 34 , the flap 36 , and the path of the flap 36 from the flap attachment point 38 , through the flap retention point 40 . the flap 36 is in the fully inserted position to store a handheld device . fig6 is a cross sectional view of the carrying case 30 with the flap 36 in the fully extracted position , depicting the anterior panel 32 , the posterior panel 34 , the flap 36 , and the path of the flap 36 from the flap attachment point 38 , through the flap retention point 40 . the flap 36 is in the fully extracted position to aid in the removal of a handheld device . in the operation of the invention , a handheld device 48 is inserted into the protective pocket 44 created by the assembly of the anterior panel 32 and posterior panel 34 . the flap 36 , which is attached at the flap attachment point 38 and retained by the flap retention point 40 , lays in the receiving position due to the retracting device 50 , ready to accept the handheld device into the carrying case . after the handheld device has been fully inserted , the remainder of the flap 36 is latched to the flap latching point 46 thereby encircling and securing the handheld device . upon the need to remove the handheld device 48 from the carrying case 30 , the flap 36 is unlatched the flap from the flap latching point 46 and pulled outwardly from the carrying case . the outward motion expands the flap retention device 50 and forces the handheld device 48 out of the protective pocket 44 to a predetermined limited point . the limited point is determined by the relationship between the flap attachment point 38 to the anterior panel 34 and the flap retention point 40 of the posterior panel 34 . the limited point of extraction is critical in ensuring that the handheld device 48 is partially held by the carrying case 30 , while increasing the ease of removal of the handheld device 48 . upon removal of the handheld device 48 from the carrying case 30 , the flap 36 withdrawn into the carrying case 30 by the retracting device 50 ready to accept insertion of the handheld device 48 . while the foregoing detailed description has described several embodiments of a carrying case 30 in accordance with the present invention , it is to be understood that the above description is illustrative only and not limiting of the disclosed invention . indeed , it will be appreciated that the embodiments discussed above and other embodiments that are not mentioned could easily be within the scope and spirit of the present invention . | US-46320606-A |
a tool for inserting a mesh prosthesis into the retroperitoneal space in the laparoscopic repair of inquinal and femoral herniae is set forth which includes a housing having an axially extending passageway therethrough and a carriage member slidingly and telescopically carried by the housing and extending into the passageway . the carriage member has a holding chamber adjacent its distal end for holding the mesh prosthesis in a radially overlapped wound position . an axially extending slot in the carriage member communicates with the holding chamber to permit radial unwinding and passage of the mesh prosthesis from the holding chamber into the retroperitoneal space . the carriage member is slidably and rotatably mounted to the housing to permit axial extension and retraction of the holding chamber from the passageway into and from the retroperitoneal space . | referring to fig1 the mesh introducer device 1 of this invention is shown in perspective . as can be seen a housing or sheath 2 has a radially projecting shoulder 3 which limits the distance that the sheath can extend when inserted into an abdominal trocar ( not shown ) in order to gain access to the operative region of the patient during laparoscopic hernia repair . carriage member 4 extends axially through the housing 2 and as illustrated in fig3 is slideably mounted to the housing 2 for axial extension and retraction relative to the housing . to permit relative movement between the housing 2 and the carriage member 4 , a silicon bearing 6 is carried by the housing in annular grove 9 near the distal end 7 of the housing ; the carriage member 4 has a bearing member 8 carried in fixed relationship to the carriage which radially encloses carriage shaft 11 and contains an annular grove 12 for holding silicon o - ring 13 which permits relative axial movement between o - ring 13 and the inner wall 14 of the housing 2 and also permits relative rotation between the carriage and the housing . to introduce the mesh prosthesis 16 , which is preferably made of a polypropylene material into the operative region of the patient &# 39 ; s body , the carriage member 4 has a tubularly configured distal end 17 which forms the radial boundary of a holding chamber 18 . the mesh prosthesis 16 is first inserted through an opening 15 located at the distal end 17 of the carriage member 4 which requires that the mesh be radially and overlappingly wound ; the mesh prosthesis 16 is then held in holding chamber 18 in its radially overlap configuration with the leading edge 19 of the mesh prosthesis 16 extending through axially extending slot 21 . fig2 is an illustration of the mesh prosthesis 16 after having been unwound from holding chamber 18 with the leading edge 19 of the mesh prosthesis fastened to the abdominal wall 23 of the patient &# 39 ; s body by appropriate fastening members 22 and 22 &# 39 ;. referring again to fig3 it can be seen that the housing or sheath 2 has a larger inner diameter than the outer diameter of the distal end 17 of the carriage member 4 ; this permits the retraction of the holding chamber 18 into cavity 24 of the housing or sheath 2 . thus , in the loading and operation of the mesh introducer device 1 , the mesh prosthesis 16 is first wound and then inserted through opening 15 into the holding chamber of the carriage member . the leading edge 19 of the mesh prosthesis during insertion into the holding member is positioned to project through axially extending slot 21 and the holding chamber 18 is thereafter retracted into cavity 24 and completely contained within the housing 2 . the leading edge of the mesh prosthesis is now bounded by inner wall 14 of the sheath and thereby the mesh prosthesis is retained in the holding chamber ; the housing 2 is then inserted into an abdominal trocar ( not shown ) and advanced therethrough until the advancement of housing 2 within the abdominal trocar is precluded by radially projecting shoulder 3 . to unwind the mesh prosthesis 16 the knurled cylinder 26 which is rigidly attached to carriage shaft 11 , and in fixed relationship with the carriage shaft , is axially displaced which causes the distal end 17 of the carriage member 4 to be extended from the cavity 24 of the housing 2 into the operataive region of the patient &# 39 ; s body ; the leading edge 19 of the mesh prosthesis may now be gripped by a laparoscopic gripping tool ( not shown ) and extended sufficiently through axial extending slot 21 to permit the leading edge of the mesh prosthesis to be positioned for the subsequent unwinding of the mesh prosthesis and positioning to overlay the pelvis . as shown in fig2 fasteners 22 and 22 &# 39 ; are utilized to fasten the leading edge portion 19 of the mesh prosthesis to body tissue . lateral movement of the carriage member will induce the mesh prosthesis to unwind through axial extending slot 21 until completely extended from the holding chamber after which the surgeon laparoscopically positions and fastens the mesh to body tissue to reinforce the abdominal wall thereby repairing the hernia . another embodiment of this invention is illustrated in fig4 . in this embodiment , a pair of axially extending tynes 27 and 28 are fixed to and axially extend from the distal end 29 of the carriage shaft 11 . a holding member 31 &# 39 ; contains an axially extending cavity which defines a holding chamber 18 &# 39 ; that communicates with a distal opening 15 &# 39 ;; the proximal end 32 of holding member 31 &# 39 ; has an axially extending bore 33 therethrough which communicates with the holding chamber 18 &# 39 ;. although not shown in fig4 the holding member 31 &# 39 ; also utilizes an axially extending slot through which the mesh prosthesis 16 may feed during the unwinding process of the mesh . to permit relative rotation of holding member 31 with respect to the carriage shaft 11 a pair of roller bearings 36 and 37 are utilized adjacent the distal end 29 of the carriage shaft 11 . thus , laparoscopic introduction of the mesh prosthesis into the operative region of the patient &# 39 ; s body is accomplished by first inserting thetrailing edge of the mesh prosthesis through the axially extending slot . tynes 27 and 28 have a gap 38 between them into which the trailing edge of the mesh prosthesis is captively held and the mesh then wound radially upon the tynes into an overlapping winding by rotating thecarriage shaft 11 . the leading edge 19 of the mesh prosthesis is permitted to project through the axially extending slot of holding member 31 &# 39 ; for subsequent grasping and positioning of the mesh prosthesis after the mesh has been introduced into the oprative region . by retracting carriage shaft 11 , the holding member is retracted into cavity 24 of the housing . the mesh introducer device is thereafter advanced through an abdominal trocar selectively placed in the patient &# 39 ; s abdomen and accessing the operative region . after the housing is advanced sufficiently through the trocar , as in the the embodiment above described , the radially projecting shoulder 3 of the housing which has a diameter greater than the diametric dimension of the trocar prohibits further advance of the housing relative to the abdominal trocar . by axially displacing knurled cylinder 26 , the surgeon causes the carriage shaft to extend from the housing cavity 24 thereby positioning the holding member outside the sheath . the leading edge of the mesh prosthesis 19 may now be grasped by a laparoscopic grasping tool , positioned , and fasteners inserted into the body tissue as shown in fig2 ; thereafter the mesh prosthesis is unrolled by rotating knurled cylinder 26 which rotates carriage shaft 11 . during rotation of the carriage shaft , the axially extending slot contained in holding member 31 &# 39 ; as the mesh unwinds remains nominally positioned because the unrolling and spreading of the mesh requires lateral movement of the holding member since the leading edge of the mesh has been fixed to body tissue and the mesh therefore will exert a force on the axially extending slot as it unwinds ; this force is transmitted to roller bearings 36 and 37 which permits relative rotation between carriage shaft 11 and holding member 31 &# 39 ;; thus the mesh prosthesis is allowed to feed freely through the axially extending slot as the tynes 27 and 28 are rotated and the holding member moved laterally to spread the mesh prosthesis . another embodiment of this invention is shown in fig5 . in this embodiment a housing or sheath 2 &# 39 ; is illustrated having a radially projecting shoulder 3 &# 39 ; which as in the previous embodiments acts as a barrier to prevent the further advance of the sheath 2 &# 39 ; into an abdominal trocar ( not shown ). the winding and unwinding of the mesh prosthesis is accomplished by utilizing a pair of tynes 27 &# 39 ; and 28 &# 39 ; which extend axially from the distal end of insertible member 41 . insertable member 41 is removably mounted to housing 2 &# 39 ; through an axially extending conduit or passageway 42 within the carriage shaft 11 &# 39 ;. the carriage shaft 11 &# 39 ;&# 39 ; is mounted in fixed relationship to holding member 31 &# 39 ; at its proximal end 43 . carriage shaft 11 &# 39 ; may be rotated or axially displaced by knurl cylinder 26 &# 39 ; which is fixed to carriage shaft 11 &# 39 ; at its proximal end 44 . to permit axial extension and retraction of carriage shaft 11 &# 39 ; and relative rotation of the carriage shaft with respect to the housing 2 &# 39 ;, the carriage shaft 11 &# 39 ; is mounted to the housing 2 &# 39 ; through the utilization of bearing members 8 &# 39 ; and 13 &# 39 ; in the same manner as in the previous embodiments . insertible shaft member 41 carries a silicon o - rings 46 and 47 ; this permits insertible shaft 41 to rotate relative to passageway 42 and to provide a seal . as can be seen in fig5 insertible member 41 has a radially extending flange 48 which bears against the distal end of carriage shaft 11 &# 39 ; to limit axial movement of insertible member 41 into passageway 42 of the carriage shaft 11 &# 39 ;. a hinged handle 51 is pivotally mounted at the proximal end 49 of insertible member 41 such that the handle 51 may be pivoted to permit rotation of the insertible member relative to the carriage shaft member 11 &# 39 ; for the unwinding of the mesh prosthesis 16 from the tynes 27 &# 39 ; and 28 &# 39 ; after the holding member 31 &# 39 ;&# 39 ; is extended from the housing cavity 24 &# 39 ;. thus , insertible member 41 is removeably carried by the housing 2 &# 39 ; and the carriage shaft 11 &# 39 ; to permit the mesh prosthesis to be first wound utilizing tynes 27 &# 39 ; and 28 &# 39 ; and thereafter inserting the proximal end 49 of the insertible member 41 through the holding chamber 18 &# 39 ;&# 39 ; and into the axially extending conduit or passageway 42 ; the advancement of insertible member 41 through passageway or conduit 42 is limited by radially extending flange 48 abutting against the proximal inner wall 52 of holding member 31 &# 39 ;&# 39 ; at the junction of inner wall 52 and the distal end of the carriage shaft 11 &# 39 ;&# 39 ;. in the above described embodiment , as in the previously described embodiments , when the mesh prosthesis is retracted into the holding chamber , the leading edge of the mesh prosthesis extends through the axially extending slot and is bounded by the holding chamber wall ; when the holding member is extended from the cavity of the housing by extension of the carriage shaft member , unlike the previous embodiments , the tynes 27 &# 39 ; and 28 &# 39 ; may be rotated by rotating the insertible member which thereby feeds the mesh prosthesis through the axially extending slot . while i have shown and described certain embodiments of the present mesh introducer device , it is to be understood that it is subject to many modifications without departing from the scope and spirit of the claims as recited herein . | US-86992892-A |
filament trimmer structure comprising a screw - free or unitary dual shank , balancing handle , housing and elongate handle portion , the handle portion having a lateral cover plate ; the dual shank both protecting in a first tubular part a contained electric lead and through a second tubular part venting air from a chaff - free location at a handle upper portion , downward into the housing . | fig1 shows the invention in embodiment 10 as comprising a unitary structure except for two elements . the heart of the structure is a low - cost , high - strength , low weight , one piece molding comprising integral balance handle 20 , shank 22 with integral conduit tube 24 and extension tube 26 , integral motor cover 28 and retainer 30 , and integral pistol - grip handle 32 with conventional , generally flat cover plate 34 on the pistol grip handle . the cover plate may be detachably secured as by screws 36 which do not penetrate the interior but instead secure through solid peripheral portions 38 . conventionally shaped guard 40 may be detachably secured to the retainer 30 by means disclosed in u . s . pat . no . 4 , 125 , 339 issued to c . b . pittinger , sr . and c . b . pittinger , jr . on nov . 14 , 1978 . the power cord 42 leads - in through the butt of the pistol grip handle , preferably through a fairlead of the type shown in u . s . pat . no . d255 , 640 issued to c . b . pittinger , sr . on july 1 , 1980 . the power cord then passes to conventional switching trigger 44 and down the shank conduit tube portion 24 to a conventional electric motor 46 conventionally secured , as to bottom bars 48 at the motor housing . this patent also shows a preferred type of balance handle . filament - holding and down - exhausting fan structure 50 may be of any conventional structure mounted on the motor shaft 52 . cooling air passing down through and around the motor and out the housing bottom is kept substantially chaff - free and dust - free according to this invention by being taken in at the highest location not interfering with handgrip . intake 54 is a full , unrestricted tubular opening at the top of the shank where the extension tube 26 ends , and is well above balance handle 20 and in position preferably permitting the extension tube to reinforce the pistol grip handle connection to the shank . the extension tube preferably continuous connection 56 to the conduit tube along the full length , and to the motor housing , reinforces and stiffens the whole assembly , permitting it to be made lighter in weight without sacrificing strength . the xyz aspect ratio ( length to cross - sectional size ) is compact and yet produces good airflow and adequate room for the electric wire , as further indicated by the proportions in the next figure . also evident from these two figures is the shank beam - stiffness and strength in the vertical or primary load direction , coupled with good strength and stiffness laterally , yielding efficient lightweight construction . fig2 shows a cross - sectional view through the balance handle 20 and adjacent shank portion 22 . the conduit tube 24 and extension tube 26 between them form a substantially uniformly - thick - wall figure - eight ; the loops becoming one at 56 . symmetrically joining the extension tube in the vertical plane is the flange 58 of the balancing handle 20 , the grip portion 60 of which is preferably a transverse &# 34 ; t &# 34 ;, each half of which has a coaxial bore 62 separated by the flange thickness . side buttresses 64 may be employed to stiffen the flange . in this view the upper part of the housing 28 is shown as a rounded truncated pyramid ; the guard retainer portion 30 is preferably circular with oval or rounded sides . fig3 is a diagrammatic detail of the junction of the pistol - grip handle 32 and the conduit tube 24 and extension tube 26 . it is evident that the lower part of the extension tube wall can contribute reinforcement to this junction without throttling airflow , as well as the full height of the conduit tube . elimination of need for a strainer or a perforate cap on the extension tube permits equal or greater airflow than customary , without increasing tube size . in a typical range the dimensions of the unit can be , in proportion : length from lower end of shank to balancing handle : 22 to 50 inches ( 0 . 55 to 1 . 2 m ) inside diameter of extension tube and conduit tube : 3 / 8 to 11 / 4 inches ( 0 . 9 to 3 cm ) outside diameter of extension tube and conduit : 1 / 2 to 11 / 2 inches ( 1 . 2 cm to 3 . 7 cm ) material for the unit can be abs , nylon or any other conventional thermoplastic of thermosetting plastic . from the above it will be appreciated that the unique construction of this invention cools the motor with clean air , cannot pull apart longitudinally , frees the assembly process from electric lead damage from screw punctures , provides efficient bending and torsional stiffness and strength through the double tubular , and unitary features , and is pleasing in appearance . although the preferred mode is set out above , it will also be evident that the dual tubes could be embodied side - by - side rather than over - and - under within the scope of the invention . further , the joining of the conduit tube and the extension tube could be discontinuous in part , but continuous joining is preferred for reduced stress concentration and greater protection . it will be evident that the dual tube construction could comprise other than the cylindrical tubes described and preferred for low stress concentration . this invention is not to be construed as limited to the particular forms disclosed herein , since these are to be regarded as illustrative rather than restrictive . it is , therefore , to be understood that the invention may be practiced within the scope of the claims otherwise than as specifically described . | US-18447980-A |
a trampoline game has a trampoline with a trampoline frame and a trampoline bed . the trampoline bed is connected to the trampoline frame by a plurality of springs . a gun has an infrared emitter emitting an infrared signal . a target has one or more infrared receivers capable of receiving a signal from the infrared emitter of the gun . a second gun also has an infrared emitter emitting an infrared signal , and the target is capable of receiving an infrared signal from the second gun . a bounce sensor can be used for sensing user bounces . the bounce sensor outputs data which could be sent to a microprocessor . defined game parameters may be stored in memory programmed into a microprocessor that receives data . | a target game can include a bounce sensor 21 which is preferably mounted on the bed of the trampoline or connected to the bed of the trampoline to detect vibrations . the bounce sensor can also be mounted on the springs or toward the edge of the bed . the standard trampoline bed 33 is connected to the trampoline frame 32 at trampoline springs 34 . the bounce sensor 21 can be housed within a lighting apparatus formed as a small flexible plastic disk encapsulating led elements and mounted under the bed . additional lighting elements can be formed below the small flexible plastic disk . the lighting elements and speaker may activate according to the theme of the target game . a control housing 148 may contain a microprocessor for controlling game lights 170 and one are more game speakers 240 . preferably , a power supply 220 provides power via household electric current from a plug 145 . a variety of different targets 22 can be connected to trampoline poles 31 at a top of a trampoline pole or at a bottom of a trampoline pole near the bounce surface . the trampoline poles 31 are mounted on trampoline frame members 32 . the trampoline frame supports a trampoline bed 33 . the targets could also be placed below the trampoline bed and shot through the openings of the mesh of the trampoline bed , however it is preferred to have the targets strapped or hung from the trampoline poles 31 . the targets could be attached to the net which is indirectly attached to the frame , if done so in a safe manner . the targets can be in the form of a creature such as a soldier having a helmet 23 , a pair of goggles 24 , a mouth 25 , and a pair of arms 26 . the target can also have a weapon 27 , a torso area 28 and a pair of legs 29 . the targets may also have clothing accessories such as shoes . the targets may have vulnerable areas that transmit an electrical signal when hit by an infrared beam from an infrared beam emitter 44 shaped as a spherical gun 41 . vulnerable areas are infrared receivers which can be placed on graphical aspects of the targets , such as an oval target mouth 25 , or a square torso area 28 . the vulnerable areas may be lighted by led lights so that a participant may see locations to hit . a gun is a game weapon with a trigger for activating a shot of a beam emitter 44 . the beam emitter can emit a shot of ultraviolet , visible or infrared light . the shot can have a predetermined time length , such as 500 ms or one second . the preferred frequency is infrared . the beam emitter 44 is preferably a gun which is a game weapon that has an ultraviolet , visible or infrared light emitting diode mounted to the gun that is intermittently activated when a user depresses a trigger . the user holds the gun in the palm of a hand and aims the gun , preferably while jumping . the user activates the trigger manually , preferably with a trigger finger . the gun is preferably shaped , formed or otherwise configured to conform to the user &# 39 ; s hand allowing easy grasp of the gun . the gun may further include a strap so that a user does not drop the gun and fall on the gun while jumping . the bounce surface may interact with the bounce sensor 21 so that a processor alternates or cycles between different areas of the target as vulnerable areas . when a vulnerable area is hit by the user , a light or a sound or both can indicate hit connection . alternatively , the vulnerable area can be lighted only after a certain number of hits or receive a sound only after certain number of hits . the bounce surface registers bounces from a user via the bounce sensor . a variety of different patterns of bounce may be required for activating the vulnerable areas on the targets . a user may begin with a limited character definition lacking in power . for example , the shot rate of the character may only be once per second at a first level and as a user accumulates more points but surely more targets , the user may attain higher levels and have equipment upgrade such that the user may fire more often and have longer bursts of fire . the user may also receive a wider hit dispersion or wider beam weapon angle . the game computer can also allow functionality of a first gun and then a second gun at a later level in the game . a particular set of characteristics such as fire rate , weapon cooldown and fire length may be associated with different levels . these level characteristics can be input in a microprocessor . the microprocessor can be a computer like system including memory and a power supply . the player could begin every game at a first level and increase from a first level to a second level , then a third level and then a fourth level until the character reaches a 10th level for example . the gun is preferably shaped as a ball like sphere having a strap 42 connected to the sphere . the sphere preferably has a loop to fit around a wrist . additionally , the gun has a bottom curvature 45 preferably formed as a bottom curvature of the sphere . the gun preferably also includes a top curvature 46 . the gun has a trigger 43 on a side of the ball and a beam emitter fitted at a tip of the gun . the trigger can be round at a front end and elongated as a button for depressing with a thumb at a thumb position . when a user does not wish to show that the targets on the top of the trampoline poles , the user may detach the target and hang the target on the netting at a hook 54 that can be located at a helmet portion of the target . the target may have feet on its legs extending horizontally to provide stability on the trampoline bed surface itself . typically , the user may attach the target at using a first target strap 51 or a second target strap 52 . in a simple embodiment of this invention , a game could be played with the following rules embedded into the microprocessor . the player begins at level 1 and has five bounces for each shot . the player must bounce five times to load the gun with one shot . the single shot allows for a 0 . 1 sec pulse of infrared beam from the gun . after firing , the player must bounce five times to reload the gun again with a second shot . each target requires one hit to complete such that the target has one hit point and the gun has a damage of one hit point . the target is assigned a certain number of hit points . the game level is level 1 and the player is also level 1 . once the player hits five targets , the player advances to level 2 . at level 2 , the player must bounce four bounces to recharge each shot , and the gun ammunition capacity is now increased to two shots with a 1 second cooldown between each shot requiring that the player wait one second before firing the second shot . the targets still require a single shot . the game level is now level 2 and the player is also level 2 . after hitting five targets , the player advances to level 3 . at level 3 , the player must bounce four bounces to recharge each shot , and the player has three shot capacity for ammunition with a 0 . 5 sec cooldown between each shot requiring that the player wait 0 . 5 seconds before firing again . the targets now require two shots to complete because the target now has two hit points and the gun does a damage of one hit point per hit . the game level is now level 3 and the player is also level 3 . after hitting six targets , the player advances to level 4 . at level 4 , the player must bounce three times to recharge each shot , and the player has a ammunition shot capacity of four . the player has a 0 . 4 cooldown between each shot requiring that the player wait 0 . 4 seconds before firing again . the target requires two shots to complete . the game level is now level four and the player is also level four . the targets now regenerate and heal over time by generating at the rate of one hit every three seconds . at level 5 , the player must bounce three times to recharge each shot , and the player has a ammunition shot capacity of five . the player has a 0 . 4 cooldown between each shot requiring that the player wait 0 . 4 seconds before firing again . the target requires three shots to complete . the targets now regenerate and heal over time by generating at the rate of one hit every two seconds . the game level is now level 5 and the player is also level 5 . at level 6 , the player must bounce three times to recharge each shot , and the player has a ammunition shot capacity of six . the player has a 0 . 4 cooldown between each shot requiring that the player wait 0 . 4 seconds before firing again . the target requires three shots to complete . the targets now regenerate and heal over time by generating at the rate of one hit every 1 . 2 seconds . in addition , a target is now designated as the boss target and the player must defeat the boss to advance to the next round . the boss has a total of six hit points and regenerates at the rate of one hit every second so that the boss regenerates one hit point if the boss is not hit within one second of being hit . thus , the boss only takes damage when hit on a vulnerable area in rapid succession and the boss is more than twice as difficult to defeat requiring at least six hits , in comparison to the other underling targets requiring only three hits . the boss can be identified by flashing lights in the eyes or by some other visual or audio indicator . the game level is now level 6 and the player is also level 6 . at level 7 , the boss acquires a special power of healing his underlings . the boss casts heal every five seconds and heals any random underling of one hit point , effectively undoing a hit made by the player . the underlings may have a chromatic , number display or other color led indicator to indicate hitpoints . once an underling is considered killed or defeated , the light on the vulnerable area or some other location on the target can be extinguished to show that the target is inactive and out of play . at level 7 , the player must bounce only twice to recharge each shot , and the player has a ammunition shot capacity of seven . the player has a 0 . 3 cooldown between each shot requiring that the player wait 0 . 3 seconds before firing again . each target now requires five shots to complete . after passing a level the player can receive a score calculated from a percentage of missed shots to completed shots and a time factor . the game level is now level 7 and the player is also level 7 . at level 8 , the rules are the same as level 7 except that the underlings and boss have a stealth feature . during stealth , the underlings and boss cannot be hit . only one or two underlings or boss at a time is illuminated at random from among the six targets mounted on the trampoline poles . the location of the revealed target is chosen at random and may switch with each bounce , or at irregular intervals or regular intervals such as once per second . the game level is now level 8 and the player is also level 8 . at level 9 , the rules are the same as level 8 except that the underlings and boss now shoot back . an infrared emitter located on the target illuminates at random . an infrared receiver on the gun near the infrared emitter can receive a shot . the user is assigned a certain number of hit points . the user &# 39 ; s game ends if the user is hit 10 times effectively giving the user 10 hit points and with each hit doing a damage of one hit point . the user may regenerate hits by bouncing on the trampoline mat with each five bounces healing or undoing one hit point of the user . the above game can be modified according to the theme of the game by modifying various parameters as defined . the game level is a round requiring a complete deactivation of every target including the underling targets and the boss target . the player level is defined to give the player a variety of different attributes . gun cooldown time is the time that the gun requires for regenerating . the gun ammunition capacity is the number of shots that the gun stores such that when the gun ammunition capacity is zero , the gun does not operate . target hit points are the number of hit points required to eliminate the target . player hit points are the number of hit points required to eliminate the player . charge per bounce is the number of bounces required to load a shot of ammunition . regeneration over time is the number of target hit points regenerated automatically per second . boss hit points on the number of hit points required to eliminate the boss . boss healing is the number of hit points healed each time the boss heals the underlings . boss heal cool down is the amount of time before the boss can heal again . stealth pattern is a random or regular pattern defined in the microprocessor for revealing less than all of the targets . a hit point visual indicator is an indication of the number of hit points that a target has . an activity indicator is a visual indication that a target is active and can be hit . the hit point visual indicator may appear in the vulnerable area of the target . for example , if the vulnerable area of the target is the torso , the visual indication can be activated in the torso area . a player level need not be the same as the game level , and could be less or more depending upon a player score . the game computer could advance the player on a set schedule after the player obtains a certain score from each successful shot , and also possibly from each successful target elimination . the bounce sensor is preferably a vibration sensor mounted within a housing . the best mode bounce sensor has a bounce sensor housing 80 in fig8 that includes a flexible resilient spring 82 that touches a post 83 when vibrated , or moved so that it closes a circuit sending a signal to lights connected on the circuit . there is optionally a sheath 81 mounted on a base 84 holding two sets of wiring . the spring wiring 85 connected to the post wiring 86 . other technical details may include that the microprocessor is stored in the gun . the microprocessor may be mounted in the gun and receive wireless signals from the bounce sensor , and receive and send wireless signals to and from the targets . therefore , while the presently preferred form of the system has been shown and described , and several modifications thereof discussed , persons skilled in this art will readily appreciate that various additional changes and modifications may be made without departing from the spirit of the invention , as defined and differentiated by the following claims . | US-201314052602-A |
the present invention relates to a method of providing an antihistaminic effect in a hepatically impaired patient in need thereof comprising administering to said patient an effective antihistaminic amount of a compound of the formula wherein r 1 is hydrogen or hydroxy ; r 2 is hydrogen ; or r 1 and r 2 taken together form a second bond between the carbon atoms bearing r 1 and r 2 ; n is an integer of from 1 to 5 ; r 3 is — cooh or — cooalkyl wherein the alkyl moiety has from 1 to 6 carbon atoms and is straight or branched ; each of a and b is hydrogen or hydroxy with the proviso that at least one of a or b is hydrogen ; or a pharmaceutically acceptable salt and individual isomers thereof . | compounds of formula ( 1 ), and , in particular , 4 -[ 1 - hydroxy - 4 -[ 4 -( hydroxydiphenylmethyl )- 1 - piperidinyl ] butyl ]- α , α - dimethyl - benzeneacetic acid , are prepared and used as described in carr et al . [ u . s . pat . no . 4 , 254 , 129 , issued mar . 3 , 1981 ] which is hereby incorporated herein by reference in its entirety . the present invention relates to a method of providing an antihistaminic effect in a hepatically impaired patient in need thereof comprising administering to said patient an effective antihistaminic amount of a compound of formula ( 1 ). the compounds of formula ( 1 ) are known histamine h 1 - receptor antagonists and as such provide relief of symptoms associated with histamine - mediated diseases and conditions such as seasonal allergic rhinitis , urticaria and the like . as used herein , the term “ patient ” refers to a warm - blooded animal , such as a mammal , which is afflicted with a histamine - mediated disease or condition . it is understood that dogs , cats , rats , mice , and humans are examples of animals within the scope of the meaning of the term . a hepatically impaired patient is a patient having impaired liver function due to disease , such as alcoholic cirrhosis or hepatitis , or due to administration of a drug , such as ketokonazole , erythromycin or troleandomycin , which inhibits normal liver metabolic function . in the hepatically impaired patient , terfenadine is not metabolized at the normal rate to the terfenadine acid metabolite . when administered terfenadine at the recommended dosage , a hepatically impaired patient will experience increased levels of terfenadine in the blood and decreased levels of the acid metabolite over that expected with the non - hepatically impaired patient . increased blood levels of terfenadine in turn may cause decreases in the action potential and in various membrane currents of cardiac cells which may trigger cardiac events of qt prolongation and / or ventricular tachycardia . surprisingly , similar blood levels of the terfenadine acid metabolite do not cause these decreases in the action potential and in various membrane currents of cardiac cells . therefore , at the same blood levels where terfenadine may trigger cardiac events of qt prolongation and / or ventricular tachycardia , the terfenadine acid metabolite will not trigger these cardiac events . the identification of those patients who may benefit from the present invention is well within the ability and knowledge of one skilled in the art . a clinician skilled in the art can readily identify , by the use of clinical tests , physical examination and medical / family history , those patients who are hepatically impaired and who are in need of treatment with an antihistamine . an effective antihistaminic amount of a compound of formula ( i ) is an amount which is effective in antagonizing the histamine h 1 - receptor in a patient in need thereof which results in an antihistaminic effect . an effective dose can be readily determined by the use of conventional techniques and by observing results obtained under analogous circumstances . in determining the effective dose , a number of factors are considered including , but not limited to : the species of patient ; its size , age , and general health ; the specific disease involved ; the degree of or involvement or the severity of the disease ; the response of the individual patient ; the particular compound administered ; the mode of administration ; the bioavailability characteristics of the preparation administered ; the dose regimen selected ; and the use of concomitant medication . an effective antihistaminic amount of a compound of formula ( i ) will generally vary from about 0 . 01 milligram per kilogram of body weight per day ( mg / kg / day ) to about 20 mg / kg / day , and will preferably be in the range of about 0 . 1 to about 6 mg / kg / day . a dose of about 10 mg to about 200 mg two to four times per day is preferred . a dose of about 20 mg to about 180 mg twice per day , or a single daily dose of about 40 mg to about 360 mg , are most preferred . a compound of formula ( 1 ) can be administered to a patient in any form or mode which makes the compound bioavailable in effective amounts , including oral and parenteral routes . for example , compounds of formula ( 1 ) can be administered orally , subcutaneously , intramuscularly , intravenously , transdermally , intranasally , rectally , and the like . oral administration is generally preferred . one skilled in the art of preparing formulations can readily select the proper form and mode of administration depending upon the particular characteristics of the compound selected the disease state to be treated , the stage of the disease , and other relevant circumstances . the compounds can be administered alone or in the form of a pharmaceutical composition in combination with pharmaceutically acceptable carriers or excipients , the proportion and nature of which are determined by the solubility and chemical properties of the compound selected , the chosen route of administration , and standard pharmaceutical practice . the compounds of the invention , while effective themselves , may be formulated and administered in the form of their pharmaceutically acceptable acid addition salts for purposes of stability , convenience of crystallization , increased solubility and the like . the present invention contemplates compositions comprising a compound of formula ( 1 ) in admixture or otherwise in association with one or more inert carriers . these compositions are useful , for example , as assay standards , as convenient means of making bulk shipments , or as pharmaceutical compositions . an assayable amount of a compound of formula ( 1 ) is an amount which is readily measurable by standard assay procedures and techniques as are well known and appreciated by those skilled in the art . assayable amounts of a compound of formula ( 1 ) will generally vary from about 0 . 001 % to about 75 % of the composition by weight . inert carriers can be any material which does not degrade or otherwise covalently react with a compound of formula ( 1 ). examples of suitable inert carriers are water ; aqueous buffers , such as those which are generally useful in high performance liquid chromatography ( hplc ) analysis ; organic solvents , such as acetonitrile , ethyl acetate , hexane and the like ; and pharmaceutically acceptable carriers or excipients . more particularly , the present invention contemplates pharmaceutical compositions comprising a therapeutically effective amount of a compound of formula ( 1 ) in admixture or otherwise in association with one or more pharmaceutically acceptable carriers or excipients . the pharmaceutical compositions are prepared in a manner well known in the pharmaceutical art . the carrier or excipient may be a solid , semi - solid , or liquid material which can serve as a vehicle or medium for the active ingredient . suitable carriers or excipients are well known in the art . the pharmaceutical composition may be adapted for oral or parenteral use and may be administered to the patient in the form of tablets , capsules , suppositories , solution , suspensions , or the like . the compounds of the present invention may be administered orally , for example , with an inert diluent or with an edible carrier . they may be enclosed in gelatin capsules or compressed into tablets . for the purpose of oral therapeutic administration , the compounds may be incorporated with excipients and used in the form of tablets , troches , capsules , elixirs , suspensions , syrups , wafers , chewing gums and the like . these preparations should contain at least 4 % of the compound of the invention , the active ingredient , but may be varied depending upon the particular form and may conveniently be between 4 % to about 70 % of the weight of the unit . the amount of the compound present in compositions is such that a suitable dosage will be obtained . preferred compositions and preparations according to the present invention are prepared so that an oral dosage unit form contains between 5 . 0 - 300 milligrams of a compound of the invention . the tablets , pills , capsules , troches and the like may also contain one or more of the following adjuvants : binders such as microcrystalline cellulose , gum tragacanth or gelatin ; excipients such as starch or lactose , disintegrating agents such as alginic acid , primogel ™, corn starch and the like ; lubricants such as magnesium stearate or sterotex ™; glidants such as colloidal silicon dioxide ; and sweetening agents such as sucrose or saccharin may be added or a flavoring agent such as peppermint , methyl salicylate or orange flavoring . when the dosage unit form is a capsule , it may contain , in addition to materials of the above type , a liquid carrier such as polyethylene glycol or a fatty oil . other dosage unit forms may contain other various materials which modify the physical form of the dosage unit , for example , as coatings . thus , tablets or pills may be coated with sugar , shellac , or other enteric coating agents . a syrup may contain , in addition to the present compounds , sucrose as a sweetening agent and certain preservatives , dyes and colorings and flavors . materials used in preparing these various compositions should be pharmaceutically pure and non - toxic in the amounts used . for the purpose of parenteral therapeutic administration , the compounds of the present invention may be incorporated into a solution or suspension . these preparations should contain at least 0 . 1 % of a compound of the invention , but may be varied to be between 0 . 1 and about 50 % of the weight thereof . the amount of the inventive compound present in such compositions is such that a suitable dosage will be obtained . preferred compositions and preparations according to the present invention are prepared so that a parenteral dosage unit contains between 5 . 0 to 300 milligrams of the compound of the invention . the solutions or suspensions may also include the one or more of the following adjuvants : sterile diluents such as water for injection , saline solution , fixed oils , polyethylene glycols , glycerine , propylene glycol or other synthetic solvents ; antibacterial agents such as benzyl alcohol or methyl paraben ; antioxidants such as ascorbic acid or sodium bisulfite ; chelating agents such as ethylene diaminetetraacetic acid ; buffers such as acetates , citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose . the parenteral preparation can be enclosed in ampules , disposable syringes or multiple dose vials made of glass or plastic . | US-48140400-A |
a porous weave of bioabsorbable filaments having an open mesh configuration is formed into an oblate shape having dimensions greater than the esophageal opening and gastric outlet of a stomach . the resulting prosthesis is deployed in the stomach and is of a size to be retained in the proximate portion thereof for exerting pressure on the upper fundus . the prosthesis limits the amount of food that may be held within the stomach , and exerts pressure on the fundus to create a sensation of being full , resulting in weight loss . | the present invention provides a volume - filling prosthesis insertable into the stomach for treatment of morbid obesity by taking up space in the stomach to reduce its capacity and by exerting pressure to create a sensation of being full , particularly on the upper fundus . fig1 illustrates a central portion of the alimentary canal including the distal segment of the esophagus 10 , the stomach 12 , and the duodenum 14 ( proximate segment of the small intestine ). the esophagus 10 opens into the stomach 12 toward the top of the lesser curvature 16 adjacent to the fundus 18 . the pyloric part 20 of the stomach leads to the duodenum by way of the gastric outlet or pylorus 22 which forms the distal aperture of the stomach and has an enclosing circular layer of muscle which is normally contracted to close the aperture but which relaxes to provide an open but restricted passage . although subject to substantial variation in different individuals , representative dimensions for the stomach are approximately 8 cm long ( fundus to pylorus ) by 5 cm wide ( greatest distance between lesser and greater curvatures ), with the esophageal opening being approximately 2 cm in diameter and the pylorus having a maximum open diameter of about 2 cm . in accordance with the present invention , an oblate , volume - filling prosthesis 24 is held within the stomach , sized for reception in the proximate portion adjacent to the opening of the esophagus and fundus . such prosthesis preferably is a porous body formed of a loose weave of thin polymer filaments 26 , having large spaces between filaments for an open area of at least about 80 %, preferably more than 90 %, so as not to impede the flow of gastric juices or other functioning in the stomach . the filaments 26 have substantial memory characteristics for maintaining the desired oblate shape and size . however , the filaments preferably are sufficiently soft and flexible to avoid abrasion of the mucus coat forming the inner lining of the stomach and to enable normal flexing and shape changes . the size of the prosthesis 24 is substantially greater than the opening of the esophagus , at least about 3 cm in the narrowest dimension , preferably at least about 4 cm . the longer dimension of the oblate prosthesis is greater than 4 cm , preferably at least about 5 cm to prevent the prosthesis from free movement within the stomach . the size and shape of the prosthesis tend to maintain it in the position indicated in fig1 , adjacent to the fundus 18 and remote from the pyloric part 20 . thus , while the prosthesis occupies a substantial portion of the volume of the stomach , preferably approximately one - half the volume , the prosthesis does not interfere with normal digestion of food , such as by gastric juices ( hydrochloric acid and digestive enzymes ) nor with passage of food through the pyloric part 20 and its opening 22 to the duodenum 14 . with reference to fig2 , the prosthesis can be formed from a substantially cylindrical stent 28 having the desired porous weave and large open area . the filaments 26 and weave pattern are selected to achieve memory characteristics biasing the prosthesis to the cylindrical condition shown . in the preferred embodiment , the opposite ends 30 of the stent are reverted , the end portions are rolled inward , and the ends are secured together such as by suturing . alternatively , a disk of the same pattern and material can be used in securing the reverted ends together . the resiliency of the filaments tends to bulge the resulting prosthesis 26 outward to the desired oblate shape . prior to reversion of the ends , stent 28 in the condition shown in fig2 can be approximately 2 - 3 cm in diameter and approximately 8 - 10 cm long , in a representative embodiment . the filaments can have a diameter of about 0 . 010 inch to about 0 . 25 inch . the filaments may be coated or impregnated with other treating agents , such as appetite suppressants , or agents to decrease the likelihood of gastric problems , such as ulcers , due to the presence of a foreign object . however , such problems are unlikely due to the biocompatible nature and the resilient flexibility of the prosthesis . it is preferred that the filaments 26 be formed of a bioabsorbable polymer such as a polyglycolic acid polymer or polylactic acid polymer . similar materials are used for some bioabsorbable sutures having “ forgiving ” memory characteristics and sufficient “ softness ” that tissue abrasion is inhibited . the absorption characteristics of the filaments 26 can be selected to achieve disintegration of the prosthesis 26 within the range of three months to two years , depending on the severity of obesity . in the preferred embodiment , the prosthesis will absorb and pass naturally from the stomach approximately 6 months after deployment . nonbioabsorbable materials may be used , such as nitinol , which exhibit the desired springiness but which would require that the prosthesis be retrieved . an advantage of the preferred , bioabsorbable embodiment of the invention is that delivery can be through the esophagus , with no additional intervention being required . with reference to fig4 , preferably from the condition shown in fig3 , the prosthesis 26 can be compressed to a generally cylindrical shape having a diameter of no more than about 2 cm such that the compressed prosthesis can be carried in a short ( approximately 5 cm to 6 cm long ) loading tube 32 . the loading tube can be advanced along the esophagus by a central tube 34 of smaller diameter , under the visualization allowed by a conventional endoscope 36 . the tube 34 can enclose a core wire 38 to actuate a pusher mechanism 40 for ejecting the prosthesis 26 when the opening of the esophagus into the stomach has been reached . the endoscope and deployment mechanism can then be retracted . while the preferred embodiment of the invention has been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention . for example , while it is preferred that the prosthesis be sized for self - retention in the desired position in the stomach , it also may be secured in position by a few sutures applied endoscopically , preferably in or adjacent to the fundus area of the stomach . | US-50353806-A |
the invention provides a device for dispensing medication in the respiratory system , with provision for breath - activation ; open and closed - mouth technique ; recording and control of dosage ; and enhanced atomization of liquid medication . this is accomplished with a device that uses a medication canister with an integral battery and circuitry , the battery providing power for electro - mechanical activation , counting medication dosage used or remaining , and controlling device activation . the invention has capability for use with dry and wet medication , and is easily cocked with a simple manual action . | the present invention is a breath - activated inhaler intended to address the disadvantages of the previously described mdi &# 39 ; s , spacers , and breath - activated devices . in a preferred embodiment , the device is constructed primarily of plastic , and includes various electrical components that are battery powered . preferably , the invention is electronically activated , and employs a microprocessor chip , which is integral with each medication canister . the microprocessor chip controls activation based on flow rate and time interval from start of inspiration . this allows the same device to be used with different medications but allows each medication to be optimally delivered . the invention may also be electro - mechanically activated , using an electrical solenoid to release a spring mechanism . the invention may also incorporate an electronic digital counter . the counter is part of a replaceable medication canister that has an attached chip and battery power supply to store information on remaining medication doses . the counter thus provides valuable information to both patient and physician , reducing the incidence of patients running out of medication . placing the battery on the replaceable canister also ensures that a fresh battery will always be available . the microprocessor employed in the invention may incorporate a time delay to prevent rapid successive actuations and thus preventing over medication . a time delay also serves to discourage patients from “ mock - activating ” the device with rapid successive actuations . the invention may also incorporate a bleed hole in the nozzle . this feature , in conjunction with a venturi design , allows more complete atomization of the medication . smaller droplets (& lt ; 5 micrometers ) can be carried further along a current of air and thus will minimize oropharynx deposition . the invention may also incorporate a tube within a tube design in the mouthpiece . this two position mouthpiece simulates an open - mouth technique using conventional closed - mouth technique . oropharynx deposition is decreased with this open - mouth technique . with convention mdi &# 39 ; s , closed - mouth technique requires far less motor skill than open - mouth technique . with the present invention , the same technique is used for both closed and open - mouth features . for patients unable to generate sufficient inspiration flow to trigger the device using this open - mouth technique , the patient can put his / her lips around the proximal most part of the mouthpiece to use ordinary closed - mouth inhalation . the features described above will now be described above in greater detail . referring first to fig1 the invention is illustrated in the cocked , or primed configuration . to operate the device , a cap 101 is removed and a metered - dose inhaler canister 103 is inserted into an opening . the canister has a nozzle 105 that is directed toward a mouthpiece 107 . the nozzle of the metered - dose canister is preferably sealed against the bottom of the compartment by a ring gasket 109 . once the canister is properly oriented , cap 101 is replaced . preferably , the canister has electrical circuitry or microprocessor chip and a battery 111 that are constructed so as to form an integral element of the canister . this has an advantage of providing a fresh battery when the canister is changed . one function of the circuitry and battery is to operate the electro - mechanical components of the inhaler when breath - activated . this function can be considered to be a medication dosage regulator in that a dose of medication is only dispensed when the electro - mechanical components operate . another function of the circuitry and battery is to collect and record information on how many times the device has been used and thereby also determine how many inhalations or doses remain in the canister . this function can be considered a usage recorder , as the use information is collected and recorded as the device is used or activated . the circuitry that is used to collect and record information on how many time the device has been used can also function to determine or indicate the remaining medication dosage in the canister . canisters are manufactured with a known quantity of medication and the quantity that is dispensed during each use is also known . therefore , it is a simple matter to calculate the remaining medication dosage . it is preferred , but not necessary that these functions described above be performed . to place the device in the primed position , as illustrated in the embodiment of fig1 the mouthpiece 107 is extended from the main body of the device 112 by holding fingergrips 113 and 115 and pulling them apart until a cantilever latch 117 engages a retainer 119 on the mouthpiece . by extending the mouthpiece from the main body and latching it into that position , a spring 121 is placed in compression . the cantilever latch 117 is held in the cocked position by another spring 123 , which also keeps the latch 117 and the retainer 119 properly oriented . in the figure , the retainer 119 has been illustrated as engaging a v - shaped notch , but other shapes or arrangements that provide a positive engagement with an ability to release would be suitable . in the cocked position , a set of electrical contracts 125 are in contact with each other , forming an electrically conducting contact , or switch . in this orientation , current may flow through from one contact to the other contact , completing a circuit . in a preferred embodiment , this circuit forms part the electro - mechanical circuitry of the device . in particular , the contacts 125 may be connected to a flow sensor 127 that serves to detect inhalation by the patient . flow sensor 127 is located in an opening 128 that serves to connect the mouthpiece to ambient air . in the cocked position opening 128 is the only opening between the mouthpiece and ambient air . thus , when a patient places his or her mouth around the mouthpiece , at position 129 , and inhales , all air must flow through the opening 128 and past the flow sensor 127 . when the patient uses the open - mouth position 139 which is described in greater detail below , less than all the air must flow through the opening 128 and past the flow sensor 127 . this is not a problem as the flow sensor has sufficient sensitivity to detect the inhalation flow and actuate the device even when less that all the air flow passes the flow sensor . in the preferred embodiment , the flow senor 127 is a flow - sensing resistor . in an alternative embodiment , the flow sensor may be a crystal whose resistance is thermally sensitive . other alternative embodiments for the flow sensor , including but not limited to a mechanical vane and switch , are also possible and suitable . after the device is cocked , as described above , the patient holds the device by fingergrips 113 in preparation for activation . he then places the end of the mouthpiece 107 in his mouth and wraps his lips around the opening at position 129 . the patient then simply inhales . as previously described , when the patient inhales , he draws air through the mouthpiece across the flow - sensor 127 . when the flow sensor is a resistor , the air flow causes the resistor to cool . the reduced temperature causes resistance across the resistor to drop , causing more current to flow across it according to ohm &# 39 ; s law . appropriate circuitry senses this change in current , acting as a switch . referring now to fig2 this switching action activates a solenoid 131 which moves the cantilever latch 117 , releasing the retainer 119 , and thereby allowing spring 121 to move mouthpiece 107 relative to the main body 112 of the device . when it moves , the end of mouthpiece 107 pushes or depresses the nozzle 105 of the metered - dose inhaler canister 103 , releasing aerosolized medication through an opening into the mouthpiece 107 where it is then inhaled by the patient , eventually coming to rest in the lungs . in a preferred embodiment , when the solenoid 131 is activated and the mouthpiece 107 moves relative to the main body 112 of the device , a gated air channel 133 is opened , providing less restriction of inhalation air flow and allowing a greater quantity of air to be mixed with the aerosol . the device has been described thus far with reference to a closed - mouth technique . in another embodiment , the device may be used to achieve the beneficial results of an open - mouth technique . referring to fig1 a second mouth position 139 is available . using this second mouth position , the patient places his or her lips around an outer tube and inhales . in this second mouth position , an additional air channel 141 is available . open - mouth technique has been prescribed and used with conventional mdi . open - mouth technique with a conventional mdi requires the patient to hold the inhaler a few inches from the mouth , and activate the mdi in coordination with inhalation . using this conventional open - mouth technique , the patient inhales additional air , but the amount of medication that is deposited in the mouth and oropharynx is less . when open - mouth technique is correctly performed , more medication is carried to and deposited in the lungs and less medication is deposited in the mouth and back of the throat . the mechanism for this improvement in medication administration is unclear . one possible explanation is that with open - mouth technique , the air column that is inhaled is not uniform and the medication is more concentrated in the center of the column . in this manner , the medication in the center of the column may be somewhat shielded and therefore less likely to contact the mouth or back of the throat before being fully inhaled . it is also possible that the additional air inhaled with open - mouth technique simply alters the medication - to - air ratio and thereby reduces the incidence of medication deposit in the mouth or throat . regardless of the reason , properly performed open - mouth technique provides a significant treatment advantage . to provide ease of description within this specification , the open - mouth technique is presumed to result in a different medication - to - air ratio than closed - mouth technique . with a traditional breath - activated device , the use of open - mouth technique , where the patient holds the device away from the lips , might not provide sufficient flow to actuate the device . however , the present invention is more sensitive to flow by using the gated channel . thus , a patient with poor inspiration flow rate is still able to breath activate the device using the open - mouth position of the present invention . it should be noted that while the terms “ open - mouth ” and “ closed - mouth ” are used in this description , in both cases , the patient will make lip contact with the device . this difference is that for the open - mouth technique , the patient uses the outer opening 139 and for the closed - mouth technique , the patient uses the inner opening 129 . with a conventional mdi , the only way to perform open - mouth technique is to keep the lips from contacting the mdi . with the present invention , a patient is able to achieve the beneficial result of an open - mouth technique using a device that is operated with the lips contacting the mouthpiece as in a closed - mouth device . referring again to fig1 in a preferred embodiment , there is also a bleed hole 143 in the nozzles 135 . the placement of this bleed hole and an accompanying venturi effect provided by a constriction of the air passage 145 , allows air to mix with the medication while in the nozzle , emulsifying the medication before it is ejected from the nozzle 135 . this additional air mixing of the medication , while in the nozzle , further ensures that the medication is aerosolized into fine droplets . in a preferred embodiment , a short time after the device has been discharged by breath - activation ( preferably about 10 seconds ), the device makes an audible tone , using the circuitry and battery power , signaling to the patient that he can release his breath . as illustrated in fig2 once the device has been discharged or breath - activated , the contacts 125 no longer make electrical contact . in this “ open ” position , the contacts can serve to prevent battery drain . once discharged , no further medicine can be accidentally released until the device is cocked or primed again . this “ open ” or uncocked position is a storage position for the device . after each activation , a digital counter shows the number of inhalations remaining in the canister 103 . in a preferred embodiment , the device also has a timer delay to prevent a second activation before one minute ( or another preset period of time ) has elapsed . this time delay allows the canister to deliver a full dose in a second activation . as previously described , it takes only a few seconds to cock the device . release of the medication into the lungs after breath activation takes milliseconds . the device of the present invention is preferably much more sensitive to inhalation than conventional breath - activated devices . this increased sensitivity is achieved by using the gated channel ( 133 in fig1 and 2 ) that opens only after activation . this arrangement allows all airflow to pass over the air flow sensor when in the cocked position and will provide activation with a flow rate as low as 2 liters / minute . this capability for low flow rate activation can be critical for a patient with minimal inspiratory flow during an asthma attack . to prevent the loud click on activation that is heard in the use of some breath - activated devices , the invention may also include a dashpot 137 to dampen the initial motion of the mouthpiece 107 relative to the main body 112 . the dashpot thus serves as a sound - dampening device to deaden the sound and reduces noise made during activation . this device can be manually activated in an emergency in the unlikely case the batteries on the canister runs out of power or there is an electronic malfunction . a cover ( not illustrated ) over the canister is easily removable to allow manual actuation but a tear sensitive tape will alert the health professional that the device has been tampered with . this , along with the timer delay described above , also discourages the practice known as dumping , where the patient repeatedly and rapidly discharges the mdi , usually just prior to an appointment , in an attempt to hide his or her failure to follow the prescribed medication schedule . as described above , the device is easy to use , requiring minimal hand strength to cock and only inhalation for activation . this can be very important to persons with arthritis , or to the individual with poor physical conditioning . the device is also intuitive to use , so that patient needs minimal instruction . a simple three - step operation is needed to use the inhaler : shake , pull out the ends of the inhaler by holding the fingergrips , and then inhale . electronics allows additional optional enhancements such as voice prompts to remind the patient to shake the canister , pull it apart , inhale and when to exhale . referring to fig3 an embodiment of an electrical circuit for electro - mechanical activation is illustrated . the circuit includes a flow sensor 301 , and an op - amp 303 to drive a solenoid 305 . the contacts 125 that are illustrated in fig1 & amp ; 2 are also illustrated . a battery 307 , to power the device is also illustrated . parts of the circuit illustrated in fig3 including the battery and op - amp , may be the same chip and battery that is illustrated at 111 in fig1 & amp ; 2 . though not illustrated , conventional electronic circuitry , as would be known to one of ordinary skill in the art , are included in the embodiment described above that regulates the medication dosage by monitoring flow rate and time between start of inspiration . similarly , circuitry to detect and record usage is included in another embodiment . this circuitry may record each use , subtracting it from a pre - set value associated with a full canister and testing the value to see if it has reached zero . alternatively , the circuitry may record each use and add it to an initial value then test the value to see if it has reached as pre - set value , representing the total number of doses in the canister . in this manner the circuitry may indicate doses used , or doses remaining . though not illustrated , the conventional electronic circuitry may also record secondary information relating to use , such as date and time of use , or time since last use , or any other type of information relating to use that would help the patient or physician in treatment of the disease . as illustrated in fig1 and 3 the present invention combines a number of advantages into a single device . however , there are aspects of the invention that are adaptable to conventional mdi . for example , fig4 illustrates an embodiment of the invention that incorporates the open - mouth technique with a conventional mdi . in fig4 a conventional mdi mouthpiece 129 is surrounded by a second mouthpiece 139 , which enables the open - mouth technique . in this embodiment , the patient is only able to place their lips on the outer mouthpiece and must therefore use the device in the open - mouth configuration . by providing an mdi of this design , the patent achieves the advantages of open - mouth technique with only a slight modification of the conventional mdi . in another example of the invention , fig5 illustrates a two - position mouthpiece allowing open - mouth and closed - mouth technique with an otherwise conventional mdi . in this embodiment , a first closed - mouth position , similar to the mouth position of a conventional mdi , is illustrated at 129 . in addition to the closed - mouth position , the invention also provides an open - mouth position 139 . with this combination of mouth positions , the invention provides the advantages of open - mouth and closed - mouth technique in an mdi that is only slightly modified . from the previous examples , it is understood that a two - position mouthpiece , providing the benefits of open - mouth and closed - mouth technique , are accomplished in a number of different embodiments . in another example of the invention , fig6 illustrates a bleed hole 143 that provides enhanced emulsification . this is accomplished with a slightly modified mdi . the combination of bleed hole 143 and venturi 145 , illustrated in fig6 is readily adaptable to otherwise conventional mdi and provides better emulsification of the aerosol medication than is available with conventional mdi . the venturi 145 provides an area of low pressure that , in conjunction with the bleed hole 143 , ensures greater mixing and emulsification of the medication than is available with convention mdi . fig7 illustrates another embodiment of the present invention where the bleed hole 143 is not closely associated with a structure that is specifically designed as a venturi , but the relationship between the structure of the mdi and the bleed hole otherwise provides for pressure differentials and thereby allows enhanced emulsification and mixing compared to that which is available without the bleed hole . the invention has been described with reference to a number of preferred embodiments with accompanying figures as examples . however , it will be apparent to those of ordinary skill in the art that different aspects or embodiments of the invention may be accomplished independently of each other and that other embodiments , not expressly described in the specification , will achieve the objectives of the invention . as such , embodiments that accomplish the objectives of the invention are equally suitable and are understood to be disclosed by this specification even if not expressly described in the specification . | US-41148799-A |
normal or genetically modified cell having magnetic nanoparticle bound to their surfaces and methods of delivery to target tissues , e . g . for treatment of disease and or injury . | cells for magnetization and use in the method can be obtained according to known protocols . for examples below , rgcs were purified to homogeneity (& gt ; 99 . 5 %), separating them from all other retinal neurons as well as all other cns glial cells ( meyer - franke et al ., 1995 ; goldberg et al ., 2002b ; goldberg et al ., 2002a ). purification of rgcs will allow more rapid identification of nanoparticle binding and endocytosis , and will allow us to better characterize the force versus axon growth rate . in other examples , cns glia , both astrocytes and oligodendrocytes ( goldberg et al ., 2002b ; goldberg et al ., 2002a ) can be purified for testing ( goldberg et al ., 2002b ; goldberg et al ., 2002a ). magnetic nanoparticles in various forms are already in use clinically and in research applications without any demonstrated toxicity . for example , superparamagnetic particles containing monociystalline iron oxide nanoparticles ( mion ) of diameters & lt ; 50 nm have been used as mri contrast agents . these particles have demonstrated neurologic non - toxicity and axonal transport of ferrous - based agents ( neuwelt et al ., 1994 ). published studies supporting the use of the mri contrast agent ferridex ( advanced magnetics and berlex laboratories ) have found no deleterious effects . furthermore , magnetically directed drug delivery , using tagged pharmaceuticals in the form of magnetic microspheres and magnetic polymer carriers , has shown success in delivering anti - neoplastic drugs and radio - isotopes to magnetically targeted areas in vivo ( schutt et al ., 1997 ; lubbe et al ., 2001 ). means for applying the contemplated coatings to magnetic nanoparticles are well known to those of skill in the art . commercial kits are available having the necessary agents and instructions , for example , as detailed in the description above and examples below ( see , e . g ., example 1 ). magnets for use in the medical arts and in particular for localizing magnetic particles in tissue are familiar to those of skill in the art . suitable magnets are described , for example in consigny ( u . s . pat . no . 6 , 203 , 487 ). the clinical device will include either a superconducting magnet or fixed / rare earth magnet with sufficient field density uniformity and magnetic field gradient to direct the cells and hold them in place . specifics of magnetic field strength will vary by need , such that stronger fields / gradients will be used when the magnet is required to act at greater distances , and weaker fields / gradients may be used when the magnet can be localized closer to the implanted particles and / or target tissues . we anticipate directing the cells to the target tissue and then modulating the underlying field to further refine their movement and shape the tissue . for coating various magnetic nanoparticles for surface attachment to neurons , a procedure analogous to that effective for coating 1 μm particles activated with carboxylic acid ( dynal biotech , oslo , norway ) or for coating 50 nm particles ( e . g . miltenyi biotech ) with anti - trkb ( bd bioscience , san jose , calif ., usa ) can be used . the coating procedure is performed according to the manufacturer &# 39 ; s standard protocols . briefly , particles are washed twice with 25 mm mes at approximate ph6 buffer for approximately 10 min each time . approximately 150 μg of anti trkb in mes buffer is used for functionalizing particles , and slow tilt rotated for approximately 30 min . then , 0 . 3 mg of edc in mes buffer is added , and incubated overnight at 4 ° c . with tilt rotation . finally , particles are washed in pbs for four times and pbs is added to a final 1 mg / ml . we found that 1 μm magnetic particles coated in this manner can strongly bind to rgcs ( fig1 ). it is expected that this and similar protocols can be used to coat magnetic nanoparticles down to 25 nm diameter and smaller . optimal functionalization ( surface coating ) of commercially available superparamagnetic nanoparticles to maximize binding to retinal ganglion cells commercially available surface activated superparamagnetic nanoparticles as small as 25 nm ( micromod partikeltechnologie gmbh , germany ) can be coated according to manufacturers &# 39 ; protocols with functional molecules selected for their ability to strongly and specifically bind neurons . briefly , tosyl - activated or carboxyl - activated magnetic nanoparticles can be used for attaching antibodies , proteins and other biomolecules that contain primary amino or sulphydryl groups . we will use manufacturers &# 39 ; suggested protocols for nanoparticle and protein / antibody concentrations as a starting point to covalently attach the following proteins : antibodies to the trkb receptor , antibodies to the surface adhesion molecule l1 , antibodies to surface integrin receptors , and cholera toxin subunit b , which binds to the gm1 ganglioside on the surfaces of rgcs and other neurons . we have already successfully shown that we can functionalize magnetic nanoparticles using these techniques ( see above ). the coupling of the functional group will be verified by staining the nanoparticles with fluorescently tagged secondary antibodies directed against the primary antibody / protein . non - functionalized magnetic nanoparticles will be used as controls . we will confirm that the coating process did not disrupt the ability of these antibodies / molecules to bind their targets . measurement of binding specificity of magnetic nanoparticles in purified and mixed cultures to assay for nanoparticle binding by neurons , retinal ganglion cells ( rgcs ) can be cultured according to standard protocols ( meyer - franke et al ., 1995 ; goldberg et al ., 2002b ). we will add functionalized nanoparticles generated as described above to the rgcs 2 hours after plating , leave them for an additional 1 hour at 37 ° c ., and then exchange the media to remove excess unbound nanoparticles . we will leave the neurons in culture for 1 hour to 3 days , to examine whether the nanoparticles remain attached with time . at the end of the culture period we will use three techniques to confirm nanoparticle binding : ( 1 ) direct visualization using high - magnification microscopy available in the lab ; ( 2 ) commercially available iron staining kits ( sigma ) in the case of nanoparticles with exposed iron surfaces ; and ( 3 ) standard immunohistochemistry with fluorescent secondary antibodies directed against the antibodies / proteins coating the nanoparticles . using these 3 techniques we will estimate at a gross level the amount of nanoparticle binding by counting nanoparticles or comparing stained cells . to assay for neuron - specific binding , we will use mixed retinal and cortical cell cultures , both of which we are currently using in the lab . although most of the studies for initial simplicity will focus on the use of rgcs , we wish to generate at a minimum some indication that the data generated for rgcs will be testable more broadly on other cns neurons . approximately 2 hours after plating we will add functionalized magnetic nanoparticles , as above , and exchange the media after 1 hour at 37 ° c . to remove excess unbound nanoparticles . after 1 hour to 3 days , we will do double immunohistochemistry to determining binding specificity , using antibodies against the neuron - specific surface molecule thy - 1 to identify rgcs or cortical neurons . the magnet will first be calibrated to the magnetic nanoparticles to be used , as nanoparticles in different regions in the dish will experience different forces . we will initially calibrate two different magnets : ( 1 ) a calibrated permanent magnet , and ( 2 ) a sharpened magnetized tip . we will use uncoated magnetic nanoparticles for calibration by suspending them in a high viscosity polydimethylsiloxane solution ( pdms , sigma ). we will use 12 , 000 centistoke pdms for 1 μm nanoparticles , and 1 , 000 centistoke pdms solution for nanoparticles smaller than 1 μm . we will place the permanent magnet in the middle of a 35 mm petri dish with glass bottom containing magnetic nanoparticles and pdms solution . the movement of the nanoparticles towards the magnet will be digitally recorded using videomicroscopy , from which we will calculate position versus time ( velocity ) of the nanoparticles . we will then plot velocity versus position from magnet to fit a curve , which can then be used to estimate the force versus position ( distance ) curves based on stokes &# 39 ; law : wherein f is the force due to friction , η is the fluid viscosity , r is the nanoparticle radius , and ν is the nanoparticle velocity . this will give us the force - distance relationship for the specific magnet / nanoparticle in use ( see , e . g . fig2 ). to measure binding strength of magnetic nanoparticles to neurons , we will add functionalized nanoparticles to the rgc cultures as described above . we will use a calibrated permanent magnet to apply a known force to rgc - nanoparticle pairs . we will note whether the nanoparticle was attached to an axon or the cell body , as binding strength may vary according to the cellular site of attachment . by varying the distance between the nanoparticle and the magnet , we can vary the applied force , for example to increase the force until the nanoparticles detach from the neurons . we will record the time , t , since application of force and the force at which the nanoparticle detaches from the cell / axon . we will use this data for statistical analysis of the binding force of the nanoparticle to a cell for a variety of nanoparticle sizes coated with one of the above mentioned molecules . using this technique , we have demonstrated that surface activated nanoparticles can be strongly and specifically attached to neurons and other cells . optimal nanoparticle size should be able to be determined through routine experimentation . likewise , antibody and protein coatings can be optimized for individual applications . magnetic particle - comprising cells as described above can be administered to the subject by any suitable means known in the art , for example , by injection ( local or systemic ), topical application , infusion , etc . it is expected that for applications involving the eye , topical application or local injection will be preferred . following administration of the cells , one or more magnets will be positioned so as to cause the cells to migrate to or remain in or at the desired target tissue . the required strength of the magnet and time period necessary for the magnetic force to be applied in order to effect the desired outcome ( in most instances , cells being fixed in or attached to the target tissue ) can be determined by routine experimentation . ( a ) delivery of donor or autologous corneal endothelial cells to the corneal endothelial surface of the patient with inadequately functioning endothelium , as in fuch &# 39 ; s endothelial dystrophy or pseudophakic bullous keratopathy . corneal endothelial cells would be isolated from human donor corneas ( joyce et al ., 1990 ; joyce et al ., 1996 ; chen et al ., 2001 ; joyce , 2003 ; joyce and zhu , 2004 ; zhu and joyce , 2004 ) or derived from human stem cells in cultures by other technologies ( yokoo et al ., 2005 ; yamagami et al ., 2006 ). such corneal endothelial cells would be bound with magnetic nanoparticles , for example 50 nm or 360 nm magnetic nanoparticles bought commercially or constructed using published methods ( schroder et al ., 1986 ; douglas et al ., 1987 ; sestier et al ., 1998 ; perrin et al ., 1999 ; mccloskey et al ., 2000 ; tibbe et al ., 2001 ). binding of cells to coated nanoparticles would be based on specific antibody - antigen nanoparticle coatings , for example using antibodies against cadherin - 11 , integrin - beta - 1 , platelet - derived growth factor 1 - alpha receptor , or neuropilin - 1 , all of which are expressed by corneal endothelial cells [ our unpublished data ]. such magnetic nanoparticle - coated endothelial cells would be injected into the anterior chamber of the eye in a manner that can be done in a clinic , for example with a 30 gauge needle , without a requirement for incisional surgery . 10 3 - 10 6 cells will be delivered by injection in a volume of 3 - 300 μl , but more typically around 10 4 - 10 5 cells in a volume of 50 - 100 μl . a suitable magnet , for example a rare earth magnet of suitable strength , would be affixed in a patch to the surface of the eye external to the eyelid centered over the cornea . over the course of a 1 hour to 7 days but more typically 16 hours to 3 days , the magnetic field would help affix the donor , nanoparticle - bound endothelial cells to the surface of the host / patient endothelial surface , after which time natural endothelial cell adhesion would take place , removing the need for additional magnetic field application . the external magnet would be removed . with time , the nanoparticles on the surface of the donor cells would degrade from the surfaces by natural proteolytic mechanisms , and be washed away in the fluid of the anterior chamber . their small size would allow outflow through the trabecular meshwork and other natural outflow pathways without clogging these pathways or elevating intraocular pressure . the delivery of the magnetic endothelial cells to the internal corneal surface would allow improved pump function of the corneal endothelium and removal of fluid ( edema ) from the cornea . the cornea would subsequently become more clear , improving vision , and less edematous , decreasing the pain typically associated with this condition . ( b ) delivery of donor or autologous stem cells , photoreceptors , or retinal pigment epithelial ( rpe ) cells to the subretinal space in patients with photoreceptor / rpe dysfunction , as in age - related macular degeneration or retinitis pigmentosa . as in ( a ), such cells would be bound with magnetic nanoparticles , and injected subretinally , or perhaps through the bloodstream intravenously . surgical implantation of a magnet or magnetic coil ( electromagnet ) would precede such injection , for example by affixing a rare - earth magnet by means of a sutured plate to the sclera behind the macula using a surgical technique in current use for the attachment of radioactive plaques in the treatment of ocular melanoma ( giblin et al ., 1989 ; shields et al ., 1993 ; shields et al ., 1996 ; shields et al ., 1997 ). the magnetic field will cause localization and retention of the implanted cells at the site of degeneration , typically the macula . after healing and integration processes took hold , the magnet might be surgically removed . alternatively the magnet could be left in place for future , additional cell treatments . the small , nano - scale , surface bound particles would as above degrade from the surfaces by natural proteolytic mechanisms allowing excretion from the eye . in this treatment paradigm , the delivery of magnetic cells to the posterior aspect of the retina would allow the improved function of the photoreceptors , enhancing visual acuity and visual field in these patients . ( c ) delivery of donor or autologous stem cells or retinal ganglion cells to the retinal surface , for such diseases as glaucoma or ischemic optic neuropathy , or other optic neuropathies . as in ( b ), such cells would be bound with magnetic nanoparticles , and injected intravitreally . rather than simply floating around in the vitreous or sinking to the base of the eye , a posteriorly place magnet would pull the cells to the surface of the retina , perhaps over the macula , or in the retinal region of an acquired visual field deficit . magnet and placement can be , for example as described in ( b ), above . sequential localization of the magnetic field towards the head of the optic nerve could pull axons along their normal wiring pathways to the brain . as above , the small , nano - scale , surface bound particles would as above degrade from the surfaces by natural proteolytic mechanisms allowing excretion from the eye . in the treatment of glaucoma or other optic neuropathies with this version of the invention , the improved number of retinal ganglion cells , and the improved integration of these magnetic cells into the proper location of the eye , will allow for improved vision , and will contribute to the neuroprotection of the remaining retinal neurons preventing their cell death . references , patents and other publications cited herein are hereby incorporated by reference . chen k h , azar d , joyce n c ( 2001 ) transplantation of adult human corneal endothelium ex vivo : a morphologic study . cornea 20 : 731 - 737 . douglas s j , davis s s , illium l ( 1987 ) nanoparticles in drug delivery . crit rev ther drug carrier syst 3 : 233 - 261 . giblin m e , shields j a , augsburger j j , brady l w ( 1989 ) episcleral plaque radiotherapy for uveal melanoma . aust n z j opthalmol 17 : 153 - 156 . goldberg j l , klassen m p , hua y , barres b a ( 2002a ) amacrine - signaled loss of intrinsic axon growth ability by retinal ganglion cells . science 296 : 1860 - 1864 . goldberg j l , espinosa j s , xu y , davidson n , kovacs g t , barres b a ( 2002b ) retinal ganglion cells do not extend axons by default : promotion by neurotrophic signaling and electrical activity . neuron 33 : 689 - 702 . joyce n c ( 2003 ) proliferative capacity of the corneal endothelium . prog retin eye res 22 : 359 - 389 . joyce n c , zhu cc ( 2004 ) human corneal endothelial cell proliferation : potential for use in regenerative medicine . cornea 23 : s8 - s19 . joyce n c , meklir b , neufeld a h ( 1990 ) in vitro pharmacologic separation of corneal endothelial migration and spreading responses . invest opthalmol vis sci 31 : 1816 - 1826 . joyce n c , meklir b , joyce s j , zieske j d ( 1996 ) cell cycle protein expression and proliferative status in human corneal cells . invest opthalmol vis sci 37 : 645 - 655 . lubbe a s , alexiou c , bergemann c ( 2001 ) clinical applications of magnetic drug targeting . j surg res 95 : 200 - 206 . mccloskey k e , chalmers j j , zborowski m ( 2000 ) magnetophoretic mobilities correlate to antibody binding capacities . cytometry 40 : 307 - 315 . meyer - franke a , kaplan m r , pfrieger f w , barres b a ( 1995 ) characterization of the signaling interactions that promote the survival and growth of developing retinal ganglion cells in culture . neuron 15 : 805 - 819 . neuwelt e a , weissleder r , nilaver g , kroll r a , roman - goldstein s , szumowski j , pagel m a , jones r s , remsen l g , mccormick c i , et al . ( 1994 ) delivery of virus - sized iron oxide particles to rodent cns neurons . neurosurgery 34 : 777 - 784 . perrin a , theretz a , lanet v , vialle s , mandrand b ( 1999 ) immunomagnetic concentration of antigens and detection based on a scanning force microscopic immunoassay . j immunol methods 224 : 77 - 87 . schroder u , segren s , gemmefors c , hedlund g , jansson b , sjogren h o , borrebaeck c a ( 1986 ) magnetic carbohydrate nanoparticles for affinity cell separation . j immunol methods 93 : 45 - 53 . schutt w , gruttner c , hafeli u , zborowski m , teller j , putzar h , schumichen c ( 1997 ) applications of magnetic targeting in diagnosis and therapy — possibilities and limitations : a mini - review . hybridoma 16 : 109 - 117 . sestier c , da - silva m f , sabolovic d , roger j , pons j n ( 1998 ) surface modification of superparamagnetic nanoparticles ( ferrofluid ) studied with particle electrophoresis : application to the specific targeting of cells . electrophoresis 19 : 1220 - 1226 . shields c l , shields j a , de potter p , quaranta m , freire j , brady l w , barrett j ( 1997 ) plaque radiotherapy for the management of uveal metastasis . arch opthalmol 115 : 203 - 209 . shields j a , shields c l , de potter p , singh ad ( 1996 ) diagnosis and treatment of uveal melanoma . semin oncol 23 : 763 - 767 . shields j a , shields c l , de potter p , cu - unjieng a , hernandez c , brady l w ( 1993 ) plaque radiotherapy for uveal melanoma . int opthalmol clin 33 : 129 - 135 . tibbe a g , de grooth b g , greve j , liberti p a , dolan g j , terstappen l w ( 2001 ) cell analysis system based on immunomagnetic cell selection and alignment followed by immunofluorescent analysis using compact disk technologies . cytometry 43 : 31 - 37 . yamagami s , mimura t , yokoo s , takato t , amano s ( 2006 ) isolation of human corneal endothelial cell precursors and construction of cell sheets by precursors . cornea 25 : s90 - 92 . yokoo s , yamagami s , yanagi y , uchida s , mimura t , usui t , amano s ( 2005 ) human corneal endothelial cell precursors isolated by sphere - forming assay . invest opthalmol vis sci 46 : 1626 - 1631 . zhu c , joyce n c ( 2004 ) proliferative response of corneal endothelial cells from young and older donors . invest opthalmol vis sci 45 : 1743 - 1751 . | US-86600409-A |
the present invention relates to an antibacterial peptide having from the amino to the carboxylic terminal an amino acid sequences selected from the group of : kkirvrlsa , seq id no . 1 , rrirvrlsa , seq id no . 2 , krirvrlsa , seq id no . 3 , rkirvrlsa , seq id no . 4 or a derivative thereof and uses thereof . | monomeric peptide was synthesized as peptide amide by an automated synthesizer ( multisyntech , witten , germany ) on a rink amide mbha resin ( nova biochem ) using 9 - fluorenylmethoxycarbonyl ( fmoc ) chemistry and o -( benzotriazol - 1 - yl )- n , n , n ′, n ′- tetramethyluronium hexafluorophosphate / 1 , 3 - diisopropylethylamine activation . branched peptide molecules ( maps ) were synthesized on fmoc 4 - lys - lys - βala wang resin . side chain protecting groups were trityl for gln , tert - butoxycarbonyl for lys , 2 , 2 , 4 , 6 , 7 - pentamethyldihydrobenzofuran - 5 - sulfonyl for arg , and tert - butyl ether for ser . peptides were then cleaved from the resin and deprotected with trifluoroacetic acid containing water and triisopropylsilane ( 95 / 2 . 5 / 2 . 5 ). crude peptides were purified by reversed - phase chromatography on a vydac c18 column . identity and purity of final products was confirmed by ettan ™ maldi - tof mass spectrometry ( ms ) ( amersham biosciences ). a total of 10 μl of a 10 mm solution of peptide was incubated at 37 ° c . with 10 μl human serum . samples were collected after 24 h of incubation , precipitated with 150 μl methanol , and centrifuged for 2 min at 10 , 000 × g . the crude solution was then analyzed by high - performance liquid chromatography ( hplc ) and ms . hplc was performed with a vydac c18 column , and the crude solution was diluted five times with 0 . 1 % trifluoroacetic acid before injection and monitored at 280 nm . a single colony of e . coli tg1 strain was cultured in 2 × ty medium to 0 . 2 od 600 . 25 μl of peptides diluted as depicted in fig1 and 25 μl of e . coli derived from the previous culture were incubated in 96 well plate for 75 minutes at 37 ° c . in mild agitation . as control we used one well incubated with 25 μl of e . coli and 25 μl of medium only ( 100 % viability ). after incubation the solution of every well was diluted 1 : 1000 and plated on a agar 2 × ty plate . plates were incubated over night at 30 ° c . the following day colonies ( cfu / ml ) grown on plates were counted . different batches of tetra - branched peptide m6 ( qkkirvrlsa , seq id no . 5 ) provided dissimilar results against e . coli when analyzed in parallel in the same experiment ( m6 batch 1 , 2 and 3 of fig1 a ). tetra - branched m6 was therefore analyzed by mass spectrometry , which revealed two main peaks , one corresponding to the regular molecular mass of m6 and the other to the molecular mass of a tetra - branched peptide containing pyroglu as first residue ( fig1 b ). different preparations of m6 obtained by identical procedures gave ms profiles with the two peaks always in different proportions , confirming that conversion of the first gln into pyroglu occurred in an unpredictable percentage . the presence of pyroglu instead of gln impaired the antimicrobial activity of m6 as demonstrated by a tetra - branched peptide in which the first aminoacid was 100 % pyroglu ( pyro - m6 of fig1 a ). therefore , peptide m6 can not be considered a real candidate for the development of a new drug . the elimination of the first aminoacid from peptide m6 sequence ( qkkirvrlsa , seq id no . 5 ), and the possible substitution of first two lys with arg , or alternating these two aminoacids , produced 4 new sequences ( kkirvrlsa , seq id no . 1 , rrirvrlsa , seq id no . 2 , krirvrlsa , seq id no . 3 , rkirvrlsa , seq id no . 4 ) with a highly stable activity of peptides derived from synthesis carried out in different periods . in particular , the peptide called m33 : kkirvrlsa , seq id no . 1 , was synthesized in many different batches , all of which gave the same ms profile with a single peak corresponding to the molecular mass of the tetra - branched m33 ( fig1 c ). as expected , tetra - branched m33 was also very stable to proteolytic degradation when incubated in serum for 24 h ( fig1 c ). indeed , elimination of the first residue from the sequence of m6 not only stabilized batch - to - batch homogeneity but also improved peptide antibacterial activity ( m33 in fig1 a ). many different syntheses of m33 , m34 , m35 and m36 gave perfectly overlapping results without any fluctuations in outcome . the above demonstrated stability renders peptides m33 , m34 , m35 and m36 very appealing candidates for the creation of a new antibacterial medicine . minimum inhibitory concentration ( mic ) was determined by a standard microdilution assay as recommended by the national committee for clinical laboratory standards ( nccls ) using cation - supplemented mueller - hinton ( mh ) broth ( oxoid ltd . basingstoke , uk ) and a bacterial inoculum of 5 × 10 4 cfu per well , in a final volume of 100 results were recorded by visual inspection after 24 h of incubation at 37 ° c . m33 , m4 , m35 and m36 mics were determined against strains of several bacterial species , including gram - negative pathogens and also staphylococcus aureus ( table 1 ). mics in the micromolar range were observed against several gram - negatives including pseudomonas aeruginosa , acinetobacter baumannii and most enterobacteriaceae , with the exception of proteus mirabilis , serratia marcescens and burkholderia cepacia . activity of peptides was retained against mdr strains with various resistance mechanisms ( such as extended - spectrum beta - lactamases and carbapenemases ), including mdr p . aeruginosa strains from cf patients . antimicrobial profile of m33 , m4 , m5 and m6 and potency were overall similar to those of polymyxin b , although m33 , m34 , m35 and m36 also appeared to have some activity against s . aureus ( table 1 ). a tested strains included either reference strains ( indicated ) or clinical isolates ( mostly showing an mdr phenotype ); relevant resistance traits and resistance mechanisms are indicated : _fq r , resistant to fluoroquinolones ; ag r , resistant to aminoglycosides ( gentamicin , amikacin , and / or tobramycin ); esc r , resistant to expanded - spectrum cephalosporins ; nem r , resistance to carbapenems ( imipenem and / or meropenem ), ert r resistance to ertapenem ; col ns , nonsusceptible to colistin ; esbl , extended spectrum β - lactamase ; mbl , metallo - β - lactamase ; oxa , oxacillinase ; mr methicillin - resistant ; van i , vancomycin - intermediate peptides described in the present invention appeared particularly selective for gram negative bacteria , probably because they bind strongly to lps , which is constitutively present in gram negative bacteria only . the amphypatic profile , and the large excess of positive charges of the peptides , suggests also that they might interact with bacterial membranes entering the cells by one of the mechanisms of action described for antimicrobial peptides with similar structure . haemolysis of fresh human erythrocytes was determined using the method of parpart , summarized as follows . a calibration curve was constructed by suspending fresh human erythrocytes in phosphate buffer ( ph 7 . 4 , 110 mm sodium phosphate ) with various concentrations of nacl and incubated for 30 min at room temperature . samples were centrifuged at 500 × g for 5 minutes , and haemoglobin release was monitored by measuring the absorbance of supernatants at 540 nm . the absorbance obtained with 0 . 1 % nacl corresponded to 100 % lysis and that with 1 % nacl , to 0 % lysis . peptides dissolved in pbs were added to human erythrocyte solution at several concentrations . the resulting suspension was incubated separately at 37 ° c . for 2 h and 24 h . release of hemoglobin was monitored by measuring the absorbance of the suspernatant at 540 nm after centrifuging and haemolysis percentage was calculated using the calibration curve . a very important feature is that , contrary to most antimicrobial peptides described so far , m33 , m34 , m35 and m36 peptides show a practically negligible haemolysis grade ( fig2 ), suggesting their possible use also through systemic administrations . in gram - negative bacterial infections , release of lps is known to be involved in the pathophysiology of sepsis and septic shock . antimicrobial peptides that also effectively neutralize lps are of considerable importance in combating sepsis . initially , tetra - branched m33 was analysed in a limulus amebocyte lysate test ( e - toxate ) demonstrating its ability to neutralize sample gelification due to lps ( not shown ). then it was examined for inhibiting lps - induced tnf - α , secretion by raw 264 . 7 macrophages . m33 resulted able to block tnf - α , secretion in a dose - dependent manner when macrophages were stimulated with lps from p . aeruginosa serotype 10 atcc27316 ( fig3 a ), and k . pneumoniae atcc15380 ( fig3 b ) with an ec50 of 4e - 8 m and 2 . 6e - 7 m , respectively . notably , at a concentration corresponding to mic ( between 1 . 5 and 3 μm for p . aeruginosa and k . pneumoniae ), m33 decreased tnf - α , production by more than 90 % when macrophages were stimulated with lps from p . aeruginosa and by more than 80 % when stimulated with lps from k . pneumoniae . m33 only stimulated a quantifiable amount of tnf - α when incubated with macrophages at three time mic concentration . tetra - branched m33 peptide was analysed for its antibacterial activity in mice infected with lethal amounts of bacteria . two different bacterial species were used , escherichia coli and pseudomonas aeruginosa . the smallest number of bacteria causing 100 % lethal infection ( ld100 ) after intra - peritoneal ( ip ) injection was 1 . 5 × 10 9 , 1 × 10 7 and 1 . 5 × 10 7 for e . coli tg1 , p . aeruginosa atcc 27853 and the mdr clinical isolate p . aeruginosa vr143 / 97 , respectively . bacterial ld100 killed mice in 20 - 24 hours . balb - c mice were infected with the ld100 of bacteria and treated 30 minutes later with the peptide by ip administration . following infection with e . coli tg1 , m33 protected 100 % of animals from signs of sepsis and death ( seven - day survival ) when administered in a single dose at a concentration of 10 mg / kg ( fig4 a ). after the mice were challenged with p . aeruginosa atcc 27853 , m33 administered in a single dose at the concentrations of 25 mg / kg and 12 . 5 mg / kg protected 75 % and 25 % of animals , while at 6 . 5 mg / kg it did not protect them from death , although death was delayed in comparison with untreated controls ( fig4 b ). finally , p . aeruginosa vr - 143 / 97 , an mdr strain susceptible only to polymyxin b ( 19 ) and representative of a clone currently spreading in italy ( cornaglia et al ., 2000 ), was used to challenge mice . m33 administered in a single dose at the concentrations of 25 mg / kg protected 100 % of animals ( fig4 c ). m33 was then analyzed for its activity when administered in multiple doses following infection with p . aeruginosa atcc 27853 . when mice were treated with two doses of 5 mg / kg m33 every twelve hours ( 30 min and 12 h after infection ) death was delayed . when mice were treated with three doses of 5 mg / kg m33 every twelve hours ( 30 min , 12 h and 24 h after infection ) full protection from signs of sepsis was obtained and 100 % survived beyond seven days after infection ( fig4 d ). m33 did not produce apparent toxicity signs in animals treated ip with a peptide dose of 100 mg / kg ( not shown ), 4 time the dose reported in this article . antimicrobial activity of m33 in vivo was also evaluated by counting bacteria at different times in blood , peritoneal fluid , spleen and liver after infection with ld100 of p . aeruginosa atcc 27853 and treatment with a single dose of m33 at 25 mg / kg . 18 h after infection , blood was apparently clear of bacteria and bacterial counts in peritoneal fluid , spleen and liver were significantly lower than in controls . after 40 hours , all sampled body sites were apparently clear of bacteria ( table 2 ). | US-200913122426-A |
a medical endoscope with a sealed housing that defines a shaft . a working passage , which is open at its ends , extends through the shaft in a sealed manner in the longitudinal direction . the passage projects proximally beyond the housing and has a lateral branch passage for connection of a flow line . the branch passage is arranged on the housing so as to pass through the housing wall and a wall defining the working passage . | as shown highly schematically in the figures , the endoscope has a housing which comprises a tubular shaft 1 , which is to be introduced into the body of the patient , and a main body 2 adjoining the shaft 1 . the main body 2 is secured to the proximal end of the shaft 1 , and the shaft extends away from the main body 2 . these two components are connected together , for instance by adhesive , soldering or the like , in a sealed manner which will not be described in more detail . a working tube 4 , which surrounds and defines a working passage 3 , extends through the housing 1 , 2 . the tube 4 passes , in a sealed manner , through the end wall of the main body 2 in order to project beyond the main body 2 with a proximal end region . the tube 4 essentially extends from the main body 2 in a direction opposite to , and aligned with , the shaft 1 . secured in a connecting socket 5 on the main body 2 , which serves to connect a light guiding fiber cable , is the proximal end of a light guiding fiber bundle 6 . the fiber bundle 6 extends through the interior of the housing 1 , 2 in the longitudinal direction toward the distal end of the shaft 1 . an ocular socket 7 also extends away from the main body 2 . an optical system extends through the ocular socket 7 and through the shaft 1 to the distal end of the endoscope . an ocular 9 is provided at the proximal end of the optical system 8 on the ocular socket 7 . the housing 1 , 2 is closed in a sealed manner at the distal end ( not shown ) of the shaft 1 in a suitable manner . for instance , the shaft may be sealed or closed by a window for the optical system 8 and with a sufficiently sealed adhesion of the fibers of the light guiding fiber bundle 6 , which fill the area within the shaft 1 and outside the working tube 4 and the optical system 8 . the well - sealed housing 1 , 2 ensures that the optical system 8 disposed therein and the light guiding fiber bundle 6 , which can be freely disposed therein , are not impaired by water or vapor which penetrates while working with the endoscope or during sterilization . on the other hand , the working passage 3 , provided by the tube , is open at both ends . preferably , a proximal end of the passage tube 4 has a valve 10 with which the passage 3 may be blocked . the endoscope described above is known from the prior art . such known endoscopes have , at the end region of the working passage 3 projecting proximately beyond the housing 1 , 2 , a branch passage 11 with a valve 12 connected laterally to the working tube 4 , as is illustrated in broken lines in fig1 for the purpose of explanation . connected to the branch passage 1 , there can be a flow line which extends away in the form of a hose . after closing the valve 10 and opening the valve 12 the working passage 3 can be used for introducing or draining flushing liquids , gases and the like . as shown in fig1 the hose extending away from the branch passage 11 is then , however , situated too far in the proximal direction , that is to say proximally of the ocular 9 and of a light guiding cable extending away from the connecting socket 5 . the result of this is an unfavorable location of the center of gravity and an impairment of the working field of the operator by the hose . the inventive construction illustrated in fig1 on the other hand , provides an inner branch passage 13 that passes through the wall of the main body 2 . the inner branch passage 13 surrounds the shaft 1 at that point , and the shaft 1 itself and the wall , of the working tube 4 . provided between the working tube 4 and the shaft 1 is a sealing body 14 , which , constructed in a suitable shape , sealingly engages around the edge of the inner branch passage 13 between the wall of the working tube 4 and the shaft 1 and which is sealingly secured in a suitable manner , for instance by adhesive , soldering or the like . the sealing body 14 ensures a good seal of the inner branch passage 13 with respect to the interior of the housing 1 , 2 . it can also be constructed , for instance , in the form of a short tubular member extending transverse to the axis of the working tube 4 . an outer branch passage 15 with a valve 16 is secured directly to the outer opening 17 of the inner branch passage 13 . in the event that the shaft 1 is not surrounded by the main body 2 at that point , the outer branch passage 15 should be secured directly to the shaft 1 . in the illustrated exemplary embodiment the outer branch passage 15 is , however , arranged to be pivotable about the axis of the shaft 1 . the outer branch passage 15 is secured to a ring or collar 19 that extends over the outer mouth 17 of the inner branch passage 13 with an inner peripheral passage 19 . the ring 18 is , as shown , mounted rotatably on the main body 2 , retained in the axial direction , and rotationally seated with means which are not shown . with this construction , a flow passage is ensured from the working passage 3 to a hose ( not shown ) connected to the outer branch passage 15 in all angular positions of the outer branch passage 15 about the axis of the shaft 1 . the ring 18 may be removed from the main body 2 for cleaning purposes . the branch passage 15 can also be provided in a different axial position on the illustrated endoscope , for instance in the axial position of the connecting socket 5 . it can be provided there , for instance , diametrically opposite thereto , whereby a rotatable construction with ring 18 is then not possible . such a rotatable construction would , however , be possible on the main body 2 between the connecting socket 5 and the ocular socket 7 . an outer shaft surrounding the shaft 1 can be provided in the conventional manner . the outer shaft can be secured , for instance , to the ring 18 and proximately sealed to it . the additionally provided outer shaft can be rotatably mounted with the ring 18 and be constructed to be decoupled with it . a further branch passage with a valve can be provided on the additional outer shaft which results in a further hose connection to the space between the shaft 1 and the additional outer shaft . | US-59673500-A |
a mat surface cleaner of the walk - behind type , comprising a wheeled housing having a forward roller brush cleaner , a rear squeegee device , user hand controls and an internal cavity for housing the device power means and cleaning elements . the cavity is accessed through flip - open hatch along the housing upper surface , which provides access to a cleaning solution reservoir attached thereto . along the base of the cavity is a gel cell battery , electric motor and a pulley system for powering the device . rear hand controls provide the user control over the cleaning spray application and vehicle speed , while a rearward a / c power plug is provided for recharging the battery . the forward roller brush is adapted to provide soft - contact bristles for the particular goal of sanitizing and cleaning athletic and wrestling mats after their use without causing damage thereto , while the lightweight design of the device allows improved handling and everyday use . | reference is made herein to the attached drawings . like reference numerals are used throughout the drawings to depict like or similar elements of the athletic mat cleaner device . for the purposes of presenting a brief and clear description of the present invention , the preferred embodiment will be discussed as used for cleaning and sanitizing athletic and wrestling mat surfaces . the figures are intended for representative purposes only and should not be considered to be limiting in any respect . referring now to fig1 , there is shown a side view of the mat surface cleaning device of the present invention , wherein the sidewall of the device is removed for visualization of its internal elements . the device comprises a housing 12 having a pair of front and rear wheels 15 , a hollow interior volume forming an enclosure for moving components and a volume of cleaning solution , and support for a rotating cleaning assembly along the front of the device . the housing 12 has a back wall , sidewalls and a hingeable lid 22 that allows access to the housing interior for maintenance and cleaning solution replenishment . along the back of the housing are user hand controls within a handle 13 for which the user can direct the motion of the device during operation , while a squeegee element 13 is provided at the user &# 39 ; s feet to absorb any residual cleaning solution on the mat surface . the device is driven forward by internal motive power in a walk - behind configuration , while the user guides the direction of the device along a mat surface . a cleaning roller 20 and spray nozzle means 21 are positioned along the front of the housing to dispense a mist of cleaning solution onto a mat surface therebelow while the roller 20 lathers the solution and disrupts and removes dirt therefrom . the nozzles 21 provide a means to distribute the solution along the entire length of the roller 20 , directed in front of the roller . the solution is housed within a reservoir 11 attached to the hingedly attached lid 22 , while a hose at the base of the reservoir and an inline pump distribute solution to the spray nozzles 21 during operation . the hose is adapted to form a flexible connection between the reservoir 11 and the spray nozzles 21 , allowing the lid to open freely and the reservoir to move therewith throughout its travel . once opened , the cleaning solution fill level can be checked and replenished if necessary . similarly , if internal maintenance is required , the lid can be rotated 31 into an open position for access to components within the housing 12 . the device is powered by an electric motor 28 and onboard battery supply 16 . the motor 28 spins a shaft connected to a double pulley device 19 , further connected to a pair of belts that travel fore and aft through the device interior . the first belt drives a rear wheel 15 , while the second belt spins the cleaning roller 20 at a higher rotational velocity . the double pulley provides two distinct speeds for the rear wheel and the roller brush , as the brush is required to spin at a faster rate than the rear wheel in order to achieve an effective means of dirt and contaminant removal from a mat surface . the speed of the motor 28 is controlled by the user through hand controls in the handle , wherein the speed can be varied depending on input to allow the device to travel at a faster or slow speed , and correspondingly a greater or slower roller brush rotational velocity . the faster the linear travel of the device , the faster the roller brush needs to spin in order to adequately clean the given floor mat surface area being rushed thereunder . the battery comprises a glass mat , lithium ion or similarly lightweight battery supply so as to reduce overall vehicle weight , while an nc power plug 14 allows the battery to be charged after extended usage . it may be desired to provide a low battery indicating lamp for the user to monitor the power level within the battery during usage , so as not to drain the battery and disrupt operations . overall , the device utilized lightweight materials and components to allow the cleaning to operate on athletic mats and wrestling mats without damaging the mats or causing damage thereto . in place of a cleaning solution recirculation or recovery system , a squeegee along the rear of the device absorbs or wipes residual solution from the mat surface . this element may comprise of a rubber squeegee or alternatively a cloth or microfiber towel for wiping the mat after being wetted . in this way , the device employs a passive drying capability that reduces its overall mass and allows improved functionality , wherein larger and heavier device may be ill - suited . referring now to fig2 , there is shown a view of the user handle 13 and associated hand control elements of the present invention . the handle 13 attaches to the rear of the device housing and provides a means for the user to control the direction and speed of the device during operation . two adjuster handles are provided along the handle : a vehicle speed controller 23 for the motor input on the rear wheel ( wheel speed ) and a spray controller 24 for the forward nozzles . the controllers are movable handles that translate a physical input to a change in electrical output sent to the electric motor and spray pump . preferably , the controller handles actuate a linear potentiometer 25 or similar electro / mechanical device that can be utilized to control both the speed of the electric motor and the cleaning solution spray pump while the device is being utilized to clean a floor mat . input travels from first and second wire 26 , 27 to the motor controller and spray pump , respectively . the vehicle speed can be increased or decreased , as well as the volume and intensity of fluid spray from the nozzles can be adjusted . this allows certain areas of a floor mat to be intensely or lightly cleaned as necessary , and the speed of the operation to be controlled by the user . referring now to fig3 , there is shown an overhead perspective view of the present floor mat cleaner . the near - side surface of the device housing is hidden to visualize the internal components that comprise the cleaning elements and means for operating the device . within the internal volume of the device housing is a cleaning solution reservoir 11 , a fluid pump 29 for communicating solution therefrom and a plurality of spray nozzles 21 that project a mist of solution onto a mat surface in front of the rotating roller brush 20 and the direction of travel of the housing . the roller brush 20 is a soft bristle cleaning implement that is particularly suited for athletic mats and softer materials , as opposed to hardwood , tile and laminate floor cleaning implements . the rotation of the brush 20 is controlled by a belt 18 that attaches to an electric motor 28 by way of a double - pulley 19 . a second belt 17 extends from the double - pulley 19 to drive the rear wheel 15 of the device , allowing forward or rearward travel of the housing . power for the electric motor 28 is provided by a battery power supply 16 , which is wired to the electric motor and controlled by a motor controller and the user input 23 . wires 26 , 27 route from the handle 13 to the motor 28 and the pump 29 within the housing , while a majority of the internal cavity is left unoccupied . the goal is to provide a lightweight device that is easily maneuvered onto and over a floor mat surface , wherein a larger device would not be ideally suited . a rear a / c plug is provided for charging the battery pack 16 , allowing the device to operate without a cord for extended periods of time , whereafter the power supply can be recharged using a wall outlet and extension cord . the lid of the device allows access within the internal cavity of the housing , which allows the reservoir 11 to be replenished and the internal components to be maintained as necessary . it is preferred that the roller brush 20 be mounted on the exterior of the housing , wherein its bristles cannot spray solution , dirt and floor contaminants into the interior of the housing . this ensures components within the housing are not damaged or sprayed with solution , which could otherwise affect their operation and longevity . a shroud that is built into the housing around the roller brush 20 deflects any ejected dirt or solution therefrom . solution is sprayed onto the mat surface directly in front of the roller brush 20 , which is then brushed over using the rotating motion of the brush , liberating dirt and grime , and primarily sanitizing the mat between uses . once passed over , the sprayed area is whipped dry using the squeegee 13 mounted on the rear of the housing . the squeegee 13 is preferably a replaceable cloth or microfiber material that absorbs moisture as is passes over the thin film cleaning solution sprayed onto the mat surface . it is not desired to recollection the cleaning solution or to provide a device that sprays large volumes of fluid onto the mat surface . rather , the nozzles are adapted to spray a mist of sanitizing solution that is brushed into the mat surface , while the squeegee wipes the moistened area dry . the mat will remain moist for a short period of time prior to completely drying , but no pooling of solution will occur and only a thin film that rapidly evaporates will be left behind the squeegee . the primary function of the present invention is to provide a means to sanitize athletic floor mats and wrestling mats , which generally develop dirt , sweat and fungus after prolonged use . the cleaning solution is ideally one that can destroy any germs or fungus from the mat surface , which would otherwise transfer between users of the mat . the solution is applied in a thin film by the nozzles and whipped dry using the rearward squeegee assembly . the elements of the device , including the housing , battery , electric motor and roller brush are adapted to be lightweight and specifically designed for mat surfaces , including those with foam interiors or those that are of uniform material . using a lightweight assembly allows the device to be lifted or rolled onto the mat and operate thereon without damaging the mat surface . additionally , the roller brush bristles are adapted to be a soft material to prevent tearing or removal of material from the mat surface . the primary application is to treat the mat surface with an antiseptic or sanitary solution to remove sweat , germs and fungus , while allowing the user to easily manipulate and rapidly deploy the device during athletic events or between sessions requiring an athletic mat . with regard to the present disclosure , it is therefore submitted that the instant invention has been shown and described in what is considered to be the most practical and preferred embodiments . it is recognized , however , that departures may be made within the scope of the invention and that obvious modifications will occur to a person skilled in the art . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention . | US-201113326748-A |
provided are a method of producing a porous chitosan scaffold , the method including : providing an aqueous acidic solution having chitosan and a solvent which does not dissolve the chitosan ; and freeze - drying the aqueous acidic solution , wherein the solvent is selected from the group consisting of a c3 - c8 aliphatic alcohol having one hydroxy group , ethylene glycol monoethylether , ethylene glycol monobutylether , dioxane , tetrahydrofuran , dimethylcarbonate , acetone and acetonitrile , and a chitosan scaffold produced using the method . | hereinafter , the present invention will now be described more fully with reference to the accompanying drawings , in which exemplary embodiments of the invention are shown . the invention may , however , be embodied in many different forms and should not be construed as being limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the concept of the invention to those skilled in the art . preparation of a chitosan scaffold by freeze - drying an aqueous acidic chitosan solution chitosan ( molecular weight : 760 , 000 , degree of deacetylation : 80 %) was added to 1 % ( v / v ) of aqueous acetic acid solution to a concentration of 1 % ( w / v ), and the mixture was stirred at room temperature for 24 hours to obtain a homogeneous aqueous acidic chitosan solution . 4 g of the aqueous acidic chitosan solution were placed in each of three sheet - shaped molds , then frozen at − 70 ° c . for 24 hours , and freeze - dried in a refrigerator at − 70 ° c . for 24 hours . as a result , a sheet - shaped scaffold was obtained . the scaffold was immersed in 100 % ethanol and washed for 2 hours or longer to remove remaining acidic solution . then , the resultant was sequentially washed with 90 %, 80 %, 70 %, 60 %, and 50 % ( v / v ) ethanol solutions and distilled water respectively for longer than 1 hour . then , the resultant was freeze - dried at − 70 ° c . to obtain a final scaffold . fig1 is sem photographs showing the surface a and a cross section b of a chitosan scaffold produced by freeze - drying an aqueous acidic chitosan solution (× 100 ). as illustrated in fig1 , each of pores in the chitosan scaffold is not linked to each other . preparation of a chitosan scaffold by freeze - drying an aqueous acidic chitosan solution including n - butanol chitosan ( molecular weight : 760 , 000 , degree of deacetylation : 80 %) was added to 0 . 5 %, 1 %, and 2 % ( v / v ) of aqueous acetic acid solutions to a concentration of 2 % ( w / v ), and the mixtures were stirred at room temperature for 24 hours to obtain homogeneous aqueous acidic chitosan solutions ( reagent a ). then , n - butanol was added to 0 . 5 %, 1 %, and 2 % aqueous acetic acid solutions to concentrations of 10 %, 20 %, and 40 % ( v / v ) respectively ( reagent b ). 2 g of reagent a having different concentrations of acetic acid were placed in each of three sheet - shaped molds , and 2 ml of reagent b having different concentrations of n - butanol were respectively added thereto . the mixtures were reacted at room temperature for 1 hour , then frozen at − 70 ° c . for 24 hours , and freeze - dried again at − 70 ° c . for longer than 24 hours to respectively prepare porous chitosan scaffolds . the prepared porous chitosan scaffolds were washed in the same manner as in comparative example 1 , and freeze - dried . the porous chitosan scaffold was gold - coated using a sputter - coater ( eiko ib3 , tokyo , japan ) for 5 minutes , and the surface changes and changes in the pore structure of the porous chitosan scaffold were observed using an electron microscope ( hitachi , tokyo , japan ) at 20 kv according to the amount of acetic acid and butanol . further , micropore formation and size distribution of pores were measured using mercury impregnation method . fig2 a , 2 b and 2 c are sem photographs showing the surfaces and cross sections of chitosan scaffolds produced by freeze - drying aqueous acidic chitosan solutions including n - butanol . a and b in fig2 a denote the surface and a cross section of a chitosan scaffold produced using a solution of acetic acid and butanol ( acetic acid / butanol = 1 %/ 10 %) (× 400 ). c and d in fig2 b and e and f in fig2 c denote the surfaces and cross sections of a chitosan scaffold respectively produced using solutions of acetic acid and butanol ( acetic acid / butanol = 0 . 5 %/ 5 %, 0 . 5 %/ 10 %, 2 %/ 5 % and 2 %/ 10 %) (× 300 ). as illustrated in fig2 a , 2 b and 2 c , the size of pores can be controlled to be from 30 to 100 μm according to the concentration of acetic acid and butanol . further , when the concentration of butanol was varied from 5 to 10 % in each of the acetic acid having 0 . 5 % and 2 %, the quantity of micropores increased to obtain an improved multi - space connecting structure . in particular , the tubal porous inner wall having the pore size of 80 μm or greater had micropores having the size of about 3 to 4 μm , and thus improved interconnectivity between the pores was identified . fig3 is a graph illustrating measuring results of the size distribution of pores of a chitosan scaffold produced by freeze - drying an aqueous acidic chitosan solution including n - butanol using a porosimeter using mercury impregnation method . as shown in fig3 , as the amount of n - butanol , which is a nonsolvent , increased , the quantity of micropores having the size of 4 μm and pores having the size of 10 to 17 μm increased compared to the chitosan scaffold produced by freeze - drying the aqueous acidic chitosan solution . on the other hand , the quantity of pores having the size of 30 to 45 μm decreased . that is , the size distribution of pores in the porous scaffold can be controlled by adjusting the concentration of n - butanol , and interconnectivity between the pores can be improved by controlling the distribution of micropores . in fig3 , the expressions of 0 %, 5 %, 10 % and 20 % indicate solutions having 1 % of acetic acid , and 1 % of chitosan , in which 0 %, 5 %, 10 % and 20 % of butanol were respectively added . preparation of a chitosan scaffold by freeze - drying an aqueous acidic chitosan solution chitosan ( molecular weight : 760 , 000 , degree of deacetylation : 85 %) was added to 0 . 1 % ( v / v ) of aqueous acetic acid solution to a concentration of 1 % ( w / v ), and the mixture was stirred at room temperature for 24 hours to obtain a homogeneous aqueous acidic chitosan solution . the aqueous acidic chitosan solution was added drop wise to liquid nitrogen at − 196 ° c . using an injector to give chitosan beads . the beads were freeze - dried at − 70 ° c . for 48 hours . as a result , a porous chitosan bead - type scaffold was obtained . the scaffold was immersed in 100 % ethanol and washed for 2 hours to remove excess of the solvent . then , the resultant was sequentially washed twice with 90 %, 80 %, 70 %, 60 %, and 50 % ( v / v ) ethanol solutions and distilled water respectively for 1 hour . then , the resultant was frozen at − 70 ° c . for 48 hours , and freeze - dried at − 70 ° c . for 48 hours to obtain a final scaffold . the chitosan bead - type scaffold were gold - coated using a sputter - coater ( eiko ib3 , tokyo , japan ), and the surface and pores in the chitosan bead - type scaffold were observed using a scanning electron microscope ( hitachi , tokyo , japan ) at 20 kv . fig4 is sem photographs showing the surface a and a cross section b of a chitosan bead - type scaffold produced by freeze - drying an aqueous acidic chitosan solution (× 200 ). as illustrated in fig4 , a porous structure of the surface is partially blocked , and a bead - type scaffold having multi - space connecting structure cannot be obtained since the inner walls do not have interconnectivity although the cross section has porosity . preparation of a chitosan scaffold by freeze - drying an aqueous acidic chitosan solution including n - butanol chitosan ( molecular weight : 760 , 000 , degree of deacetylation : 85 %) was added to 0 . 1 % ( v / v ) of aqueous acetic acid solution to a concentration of 2 % ( v / v ), and the mixture was stirred at room temperature for 24 hours to obtain a homogeneous aqueous acidic chitosan solution ( reagent a ). then , n - butanol was added to 0 . 1 % ( v / v ) of aqueous acetic acid solution to a concentration of 30 % ( v / v ) ( reagent b ). 2 g of reagent a were placed in each of three beakers , and 2 ml of reagent b were respectively added to the beakers . the mixtures were reacted at room temperature for 10 hours , and added drop wise to liquid nitrogen at − 196 ° c . using an injector to obtain chitosan beads . the beads were freeze - dried at − 70 ° c . for 48 hours . as a result , a porous chitosan bead - type scaffold was obtained . the scaffold was immersed in 100 % ethanol and washed for 2 hours to remove excess of the solvent . then , the resultant was sequentially washed twice with 90 %, 80 %, 70 %, 60 %, and 50 % ( v / v ) ethanol solutions and distilled water respectively for 1 hour . then , the resultant was freeze - dried at − 70 ° c . for 48 hours to obtain a final scaffold . the chitosan bead - type scaffold were gold - coated using a sputter - coater ( eiko ib3 , tokyo , japan ), and the surface and pores in the chitosan bead - type scaffold were observed using a scanning electron microscope ( hitachi , tokyo , japan ) at 20 kv . fig5 is sem photographs showing the surface a and a cross section b of a chitosan bead - type scaffold produced by freeze - drying an aqueous acidic chitosan solution including n - butanol (× 200 ). as illustrated in fig5 , it was observed that pores were completely open on the surface due to n - butanol addition and improved multi - space connecting structure was obtained in the cross section of the beads since the inner walls in the pores include micropores , which is distinguished from the results observed in fig4 preparation of a chitosan scaffold by freeze - drying an aqueous acidic chitosan solution including acetone acetone was added to 5 % ( v / v ) sulfuric acid solution to a concentration of 8 % ( v / v ) to prepare an 8 % ( v / v ) acidic acetone solution . chitosan ( molecular weight : 70 , 000 , degree of deacetylation : 76 %) was added to the acidic acetone solution to a concentration of 1 % ( v / v ), and the mixture was stirred at room temperature for 24 hours to obtain a homogeneous aqueous acidic chitosan solution . then , 4 g of the aqueous acidic chitosan solution were placed in each of three cylindrical molds , and placed in a refrigerator at − 100 ° c . for 48 hours , and the resultant was freeze - dried at − 70 ° c . for 24 hours . as a result , a cylindrical porous chitosan scaffold was obtained . the scaffold was washed three times with 100 % ethanol to remove excess of the solvent . then , the resultant was sequentially washed twice with 90 %, 80 %, 70 %, 60 %, and 50 % ( v / v ) ethanol solutions and distilled water respectively for 1 hour or longer . then , the resultant was freeze - dried at − 70 ° c . to obtain a final scaffold . as a result , it was observed that pores were completely open on the surface due to acetone addition and improved multi - space connecting structure was obtained in the cylindrical porous chitosan scaffold since the inner walls in the pores include micropores ( not shown ). preparation of a chitosan scaffold by freeze - drying an aqueous acidic chitosan solution including iso - hexanol chitosan ( molecular weight : 70 , 000 , degree of deacetylation : 76 %) was added to 1 % ( v / v ) of aqueous acetic acid solution to a concentration of 2 % ( w / v ), and the mixture was stirred at room temperature for 24 hours to obtain a homogeneous aqueous acidic chitosan solution . 0 . 1 % ( w / v ) of collagen ( type ip collagen , cellmatrix , gelatin corp ., osaka ) was gradually added thereto while stirring to obtain a homogeneous aqueous chitosan solution ( reagent a ). then , iso - hexanol was added to 1 % aqueous acetic acid solution to a concentration of 20 % ( w / v ) ( reagent b ). 2 g of reagent a were placed in each of three molds , and 2 ml of reagent b were respectively added to the molds . the mixtures were placed at 5 ° c . for 5 hours , placed in a refrigerator at − 60 ° c . for 72 hours , and freeze - dried at − 70 ° c . for 24 hours . as a result , a porous chitosan scaffold was obtained . the porous chitosan scaffold was neutralized in 0 . 1 n sodium hydroxide solution for 3 hours to remove excess of the solvent , and sufficiently washed with excess of distilled water until the remaining solution became the neutral . then , the resultant was freeze - dried at − 70 ° c . to obtain a final scaffold . then , the scaffold was prepared into slices having the thickness of 5 μm using paraffin blocks , and the slices were dyed with eosin . fig6 is sem photographs showing the surface a and a cross section b of a chitosan - collagen scaffold produced by freeze - drying a solution including 2 % ( v / v ) of an acidic chitosan containing iso - hexanol and 0 . 1 % ( w / v ) of collagen (× 400 ). as illustrated in fig6 , the size and size distribution of pores were uniform regardless of collagen addition , micropores were observed in pores , and the pores are well connected to each other in the cross section . the size of pore was proper for tissue engineering application . fig7 is photographs showing the porous surface a and a cross section b of a slice of a chitosan - collagen scaffold produced by freeze - drying a solution including 2 % ( w / v ) of an acidic chitosan containing iso - hexanol and 0 . 1 % ( w / v ) of collagen , and dyed with eosin that selectively dyes collagen showing effects of collagen (× 50 ). as illustrated in fig7 , regions colored brown indicate dyed collagen , the size and size distribution of pores were uniform regardless of collagen addition as illustrated in sem photographs of fig6 . the size of pores was proper for tissue engineering application . preparation of a chitosan scaffold by freeze - drying an aqueous acidic chitosan solution including ethylene glycol monoethylether chitosan ( molecular weight : 50 , 000 , degree of deacetylation : 76 %) was added to 0 . 1 n hydrochloric acid solution to a concentration of 1 . 5 %, and the mixture was occasionally stirred at 5 ° c . for 24 hours to obtain a homogeneous aqueous acidic chitosan solution . 1 % hydroxyapatite and 1 % beta - tricalcium phosphate were added thereto to obtain uniform chitosan solutions ( reagent a ). then , ethylene glycol monoethylether was added to 0 . 1 n hydrochloric acid solution to a concentration of 10 % ( w / v ) ( reagent b ). 2 g of reagent a were placed in each of three molds , and 2 ml of reagent b were respectively added thereto . the mixtures were reacted at 5 ° c . for 5 hours , placed in a refrigerator at − 60 ° c . for 72 hours , and freeze - dried again at − 70 ° c . for 24 hours . as a result , a porous chitosan scaffold was obtained . the porous chitosan scaffold was neutralized in 0 . 1 n sodium hydroxide solution for 3 hours to remove excess of the solvent , and sufficiently washed with excess of distilled water until the remaining solution became the neutral . then , the resultant was freeze - dried at − 70 ° c . to obtain a final scaffold , and the obtained final scaffold was used in cytocompatibility tests . cytocompatibility of chitosan scaffolds produced according to comparative examples 1 and 3 , and examples 1 , 4 and 5 for human fibroblasts and rabbit cartilage cells were examined . ( 1 ) cytocompatibility of chitosan scaffolds produced according to comparative examples 1 and 3 , and examples 1 and 4 for human fibroblasts fibroblasts were separated from dermis of foreskin in a human infant and cultured in an f - medium ( dmem : f - 12 = 3 : 1 , 10 % fbs , 1 % penicillin - streptomycin ). the chitosan scaffolds produced according to comparative examples 1 and 3 , and examples 1 and 4 were sterilized with 70 % ethanol for 48 hours before fibroblast inoculation , washed twice with a phosphate buffer solution and once with a culture medium , and placed in 48 well plates . the cultured human fibroblasts ( p = 3 ) were inoculated into the chitosan scaffolds at a concentration of 50 , 000 cell / ml / well . the inoculated fibroblast cells were cultured in a medium ( dmem : f12 = 3 : 1 , gibco brl . dmem - catalog no . 12800 - 058 , f12 - catalog no . 21700 - 026 ) including 10 % fetal bovine serum ( jrh biosciences catalog no . 12103 - 78p ) in an incubator under 95 % humidity at 37 ° c ., with 5 % co 2 for 4 hours for cell attachment . then , they were cultured for one day while the culture medium was added to the extent that the chitosan scaffold is not dried . the next day , the culture medium was added to the extent that the chitosan scaffold is completely immersed , and then the chitosan scaffold to which the fibroblasts were attached was continuously cultured . after they were cultured for 6 hours , 2 days , 4 days , and 7 days while the culture medium was changed once every 2 days , the culture medium was removed . 500 μl of a mixture of cell counting kit − 8 dye (( 2 -( 2 - methoxy - 4 - nitrophenyl )- 3 -( 4 - nitrophenyl )- 5 -( 2 , 4 - disulfophenyl )- 2h - tetrazolium , monosodium salt ), dojindo , japan ) and culture medium ( 1 : 9 v / v ) was added to each of the wells and they were cultured in an incubator at 37 ° c . with 5 % co 2 for 3 hours . a chitosan scaffold in which fibroblasts were not inoculated was used as the control group . each of 100 μl of orange culture mixture colored by the cell counting kit - 8 was placed in a 96 well plate . absorbance was measured at 405 nm using a microplate elisa reader ( molecular devices , usa ) to identify the degree of proliferation of cells . the results are shown in fig8 . fig8 is a graph illustrating cytocompatibility of chitosan scaffolds produced according to comparative example 1 , examples 1 and 4 and comparative example 3 for fibroblasts . as illustrated in fig8 , fibroblast growth increased in the chitosan scaffold produced according to example 1 in which interconnectivity is improved between pores and micropores compared to the chitosan scaffold produced according to comparative example 1 , and fibroblast growth increased by more than 82 % after 3 days . in particular , the chitosan scaffold produced according to example 1 had the same effect on fibroblasts in the beginning compared to the chitosan scaffold produced according to comparative example 3 in which collagen that is known to have excellent biocompatibility was added . however , after 3 days , fibroblasts in the chitosan scaffold of example 1 grew 13 . 6 % higher compared to those in the chitosan scaffold to which collagen was added . further , fibroblast growth in the chitosan scaffold produced according to example 4 increased by greater than 73 % and 104 % respectively after 2 days and 3 days compared to fibroblast growth in the chitosan scaffold produced according to comparative example 3 to which collagen was simply added . thus , when collagen is added to the porous chitosan scaffold produced according to the present invention , biocompatibility of the porous chitosan scaffold is improved . ( 2 ) cytocompatibility of chitosan scaffolds produced according to comparative example 1 and example 5 for rabbit cartilage cells cartilage cells were separated from rabbit costal cartilage . the separated cartilage cells were treated with trypsin after being cultured to about 80 % confluency at p = 1 and cultured in a medium ( mscgm catalog no . 12800 - 058 , f12 - catalog no . 21700 - 026 ) including 10 % fetal bovine serum ( jrh biosciences catalog no . 12103 - 78p ) and 1 ng / ml b - fgf . the chitosan scaffolds produced according to comparative example 1 and example 5 were sterilized with 70 % ethanol for 48 hours before cartilage cell inoculation , washed twice with a phosphate buffer solution and once with a culture medium , and placed in 48 well plates . the cultured cartilage cells were inoculated into the chitosan scaffolds at a concentration of 5 , 000 cell / scaffold . the inoculated cartilage cells were cultured in a medium ( mscgm catalog no . 12800 - 058 , f12 - catalog no . 21700 - 026 ) including 10 % fetal bovine serum ( jrh biosciences catalog no . 12103 - 78p ) and 1 ng / ml b - fgf in an incubator under 95 % humidity at 37 ° c ., with 5 % co 2 for 4 hours for cell attachment . then , they were cultured for one day while the culture medium was added to the extent that the chitosan scaffold is not dried . the next day , the culture medium was added to the extent that the chitosan scaffold is completely immersed , and then the chitosan scaffold were attached was continuously cultured . after they were cultured for 6 hours , 2 days , 4 days , and 7 days while the culture medium was changed once every 2 days , the culture medium was removed . 500 μl of a mixture of cell counting kit − 8 dye (( 2 -( 2 - methoxy - 4 - nitrophenyl )- 3 -( 4 - nitrophenyl )- 5 -( 2 , 4 - disulfophenyl )- 2h - tetrazolium , monosodium salt ), dojindo , japan ) and culture medium ( 1 : 9 v / v ) was added to each of the wells and they were cultured in an incubator at 37 ° c . with 5 % co 2 for 3 hours . a chitosan scaffold in which cartilage cells were not inoculated was used as the control group . 100 μl of orange culture mixture colored by the cell counting kit - 8 were placed in a 96 well plate . absorbance was measured at 405 nm using a microplate elisa reader ( molecular devices , usa ) to identify the degree of proliferation of cells . the results are shown in fig9 . fig9 is a graph illustrating cytocompatibility of chitosan scaffolds produced according to comparative example 1 and example 5 for cartilage cells . as illustrated in fig9 , the cartilage cell growth in the chitosan scaffold produced according to example 5 was almost the same in the beginning , but increased by greater than 11 % after 2 days , and further by greater than 58 % and 60 % respectively after 4 days and 7 days compared to the cartilage cell growth in the chitosan scaffold produced according to comparative example 1 . therefore , the chitosan scaffold produced according to the present invention has micropores , and excellent interconnectivity between pores , and thus have excellent properties facilitating cell growth as a cell support . according to the method of the present invention , a chitosan scaffold having high tensile strength in which size and size distribution of pores are uniform and the pores are linked to each other can be obtained . the chitosan scaffold of the present invention can be effectively used in proliferating cells for tissue regeneration , and used as a support for culturing cells . while the present invention has been particularly shown and described with reference to exemplary embodiments thereof , it will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the following claims . | US-15712007-A |
a purified ig - e binding immunogenic polypeptide the amino acid sequence of which consists of seq id no : 1 is disclosed . the purified amino acid sequence is a major allergen of the walnut juglans regia . also described are a diagnostic test kit and use of the purified polypeptide in tests for identifying patients having an allergy to walnuts . mutations of the disclosed polypeptide , as well as nucleic acid sequences encoding therefor are claimed as part of the invention . | the present invention will now be described more fully hereinafter with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . unless otherwise defined , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains . although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention , suitable methods and materials are described below . all publications , patent applications , patents , and other references mentioned herein are incorporated by reference in their entirety . in case of conflict , the present specification , including any definitions , will control . in addition , the materials , methods and examples given are illustrative in nature only and not intended to be limiting . amino acids are referred to by their standard single or three letter abbreviation . similarly , nucleic acids are identified by their single letter code , as known in the art . accordingly , this invention may , however , be embodied in many different forms and should not be construed as limited to the illustrated embodiments set forth herein . rather , these illustrated embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . other features and advantages of the invention will be apparent from the following detailed description , and from the claims . the study was approved by the human subjects review committee at the university of california , davis . sera from 20 walnut - allergic patients with a convincing history of life - threatening systemic allergic reactions to walnuts , positive immunocap assays ( pharmacia , inc ., diagnostics , columbus , ohio ), and evidence of ige against rjug r 1 ( see below ) were used in this study . control sera were obtained from atopic patients with no history of walnut sensitivity , and one patient with life - threatening reactions to walnuts , positive immunocap assay , positive serum ige immunoblot to walnut proteins , but negative for binding to the 2s albumin . two protocols for isolation of rjug r 1 were used . in the first , used to produce rjug r 1 for screening patient sera by western blotting , the jug r 1 insert was subcloned into the pproexht expression vector ( gibco brl , invitrogen life technologies , carlsbad , calif . ), and transformed into e . coli bl21 - codonplus ( stratagene inc ., la jolla , calif .). cells were grown overnight ( o / n ) at 37 ° c . in 5 ml 2 × yt broth with 50 μg / ml ampicillin and chloramphenicol . this was then added to 500 ml 2 × yt broth and grown to an a 600 of 1 . 0 . isopropyl thiogalactose was added to 0 . 5 mm , and the culture was grown at 37 ° c . for 4 hrs . cells were pelleted , washed with 0 . 02 m phosphate buffered saline ( pbs ; ph 7 . 3 ), and resuspended in brl lysis buffer ( gibco brl ). lysozyme was added to 500 μg / ml on ice for 15 min , followed by the addition of sarkosyl to 1 % w / v . the cells were sonicated and the insoluble matter pelleted by centrifugation at 12 , 000 g for 20 min at 4 ° c . ni - nta resin ( gibco brl ) was added in brl buffer a ( gibco brl ) to the supernatant and allowed to incubate o / n at 4 ° c . the resin was washed 4 × with brl buffer a and the his - tagged fusion protein then eluted with brl buffer c ( gibco brl ) containing 0 . 25 % sarkosyl . in the second protocol , rjug r 1 was expressed in fusion with glutathione - s - transferase ( gst ) and purified following the frangioni and neel protocol with slight modifications as previously described by teuber et al 6 , 30 . this gst - rjug r 1 fusion protein was used in all dot - blot assays , as described below . rjug r 1 samples were either subjected to sodium dodecylsulfate - polyacrylamide gel electrophoresis ( sds - page ) and electrophoretically transferred to nitrocellulose ( nc ), or blotted directly onto the membrane . for sds - page analysis of rjug r 1 , samples were boiled for five min in sample buffer ( 60 mm tris - hcl , ph 6 . 8 , 2 % sds , 10 % ( v / v ) glycerol , 0 . 01 % ( w / v ) bromophenol blue ) and electrophoresis was carried out at 8 ma constant current using a se600 vertical slab gel unit ( pharmacia biotech , piscataway , n . j .). an sds - page gel , 13 % monomer acrylamide concentration , with 1 μg protein / 4 mm was used for immunoblotting as previously described . 6 protein was transferred to a 0 . 22 mm nc membrane ( msi , westborough , mass .) o / n at 30v using a te 42 transphor electro - transfer unit ( pharmacia biotech , piscataway , n . j .). the blot was cut into 4 mm wide strips and blocked for 1 hr at room temperature ( rt ) in pbs / 3 % nonfat dry milk / 0 . 2 % triton x - 100 ( tx - 100 ). diluted sera , 1 : 5 v : v in the blocking buffer , were added to the strips and incubated o / n at rt . the strips were then washed for 20 min 3 × in pbs / 0 . 01 % tx - 100 and incubated o / n at rt with equine polyclonal 125 i - anti - human ige ( hycor biomedical inc ., garden grove , calif .) diluted 1 : 5 in the nonfat milk buffer . the strips were washed for 20 min 3 × and exposed to kodak biomax x - ray film ( kodak , rochester , n . y .) at − 70 ° c . for 48 hours . all incubations were carried out with rocking . for dot - blot assays , a graphite pencil was used to circumscribe 4 mm × 8 mm elipses on a dry 0 . 4 μm nc membrane ( shleicher & amp ; schuell ; keen , n . h .). the nc was incubated in distilled - deionized water ( ddh 2 o ) on a rocking table for 5 min and allowed to air dry before each dot was loaded with 0 . 11 μg of rjug r 1 in 2 μl of ddh 2 o . the antigen - loaded nc was then rinsed in ddh 2 o as described above , placed protein side up on 3mm paper ( whatman intl . ltd ., maidstone , england ), and dried under a 60 - watt light until all moisture was removed . once dry , dots were rinsed for 2 min in tris - buffered saline ( tbs : 20 mm tris , 137 mm nacl , ph 7 . 6 ) containing 0 . 2 % tween - 20 , blocked for 1 hr at rt in tbs - t containing 2 % bovine - serum albumin ( bsa , sigma , st . louis , mo . ), and then incubated o / n at 4 ° c . with sera diluted 1 : 40 in tbs - t . membranes were then washed once for 15 min , and 3 × for 5 min in tbs - t prior to being incubated for 1 hr at rt with horseradish peroxidase - labeled goat - anti - human ige ( biosource international , camarillo , calif .) diluted 1 : 2000 in tbs - t . washing in tbs - t was repeated as above and the reactive dots were identified after a 5 - min incubation in enhanced chemiluminescence plus ( ecl +, amersham pharmacia , piscataway , n . j . ), prepared following manufacturer &# 39 ; s instructions , and subsequent exposure to kodak x - omat x - ray film . based on the published amino acid sequence of jug r 1 and our unpublished data determining the subunit cleavage sites , 6 twenty - five 13 - amino acid peptides , offset by three amino acids , were synthesized which corresponded to the entire 64 - amino acid length of the large subunit ( fig1 a ) and 26 - amino acid length of the small subunit ( fig1 b ). additional peptides bearing the target epitope ( qglrgeemeemv ), seq id no : 1 , mutated forms of this peptide , and a non - ige binding peptide ( lsqrglqsssv ), seq id no : 2 , were also synthesized . thirteen versions of the target peptide were created via a single site alanine substitution at each position along the amino acid sequence , and six mutated peptides were synthesized using multiple alanine substitutions , as shown in table i . peptides were synthesized on derivatized cellulose sheets using 9 - fluorenlymethoxy carbonyl - derived ( fmoc ) amino acids as described by the manufacturer ( genosys biotechnologies , inc ., the woodlands , tex .). briefly , cellulose membranes containing free hydroxy groups were esterfied with an fmoc - amino acid dissolved in 1 - methyl - 2 pyrrolidione . the coupling reaction was followed by washing in n , n - dimethylformamide ( dmf ) and the amino acids were acetylated with acetic anhydride . the membranes were deprotected by washing in dmf and incubation with a solution of 20 % piperidine in dmf followed by another wash in dmf . coupling , acetylation , and deprotection steps were repeated for each cycle . during the final cycle , a mixture of dichloromethane , trifluoroacetic acid , and triisobutylsilane ( 1 : 1 : 0 . 05 ) was used to deprotect the acid - labile amino acid side chains . the peptide - containing membranes were washed in tbs and incubated o / n at rt in blocking solution as directed by the manufacturer ( genosys biotechnologies , inc ., the woodlands , tex .). membranes were then washed in tbs - t for 10 min and incubated o / n at 4 ° c . with individual patient &# 39 ; s serum or pooled patients &# 39 ; sera diluted 1 : 5 in blocking buffer ( total sera : blocking buffer ). this incubation was followed by three 5 - min washes in tbs - t and an o / n ( 4 ° c .) incubation with 125 i - anti - human ige ( hycor biomedical inc ., garden grove , calif .) diluted 1 : 10 in a mixture of pbs , 5 % nonfat dry milk , and 0 . 05 % tween - 20 . three final 10 min washes in pbs / 0 . 05 % tween - 20 were performed and ige - peptide reactivity identified after a 48 hr exposure at − 70 ° c . to kodak biomax x - ray film . a soluble form of an identified ige - reactive peptide is ( qglrgeemeemv ) was synthesized by fmoc protocols on an automated peptide synthesizer ( model 433a , applied biosystems , foster city , calif .). the epitope - reactive ige was isolated from patients &# 39 ; sera by affinity chromatography . a 0 . 5 ml pool of patients &# 39 ; sera , known to be reactive to the reactive synthetic solid - phase epitope peptide , was slowly added to a 5 ml disposable polypropylene column ( pierce chemical company , rockford , ill .) containing cyanogen - bromide - activated beads ( sigma , st . louis , mo .) ( to which 5 mg of the reactive peptide had been covalently coupled , as described by the manufacturer ) and the effluent collected . bound ige was eluted with the addition of 0 . 2 m glycine sulfate , ph 2 . 3 , collected in a beaker containing 10 μl of 1 % bsa in buffered saline borate ( bsb ), and subsequently neutralized with 1 . 0 m tris . the column was then rinsed with bsb and the initial effluent re - passed over the column . the process was repeated for a total of 3 ×, yielding three eluates and the column effluent . to test the specificity and reactivity of the epitope - specific ige , control , pooled and fractionated patients &# 39 ; sera were pre - incubated o / n at 4 ° c . with different amounts ( 70 , 7 . 0 , and 0 . 7 μg ) of the soluble epitope peptide , or a soluble non - specific peptide . the pre - incubated sera were used to probe either solid phase ige - reactive and non - ige - reactive peptides or rjug r 1 . detection of ige binding to the solid - phase synthetic peptides and dot - blotted rjug r 1 was detected using 125 i - anti - human ige and ecl +, respectively , as described earlier . ige from 20 individual walnut - sensitive patients was shown to bind the 20 - kda his - tagged rjug r 1 ( fig2 ). three showed only faint binding , while 17 sera gave moderate or strong signals . recombinant jug r 1 was previously shown to completely inhibit binding to the native 2s albumin and substantially inhibit binding of patient sera ige to english walnut in walnut immunocap assays ( up to 84 % of measurable anti - walnut ige ), 6 thus the folding appears to preserve most of the presumed conformational epitopes present on the native mature protein . identification and recognition of ige - reactive linear epitopes on rjug r 1 the entire lengths of both the large and small subunits of jug r 1 were studied by probing overlapping solid phase synthetic peptides with sera from 20 patients randomly assigned to four pools . each pool recognized three adjacent peptides from the large subunit ; two peptides were recognized very strongly (#&# 39 ; s 11 and 12 ) and one less so (# 10 ); no peptides were identified from the small subunit ( fig3 a ). a common sequence , glrgeem , was observed in all three large subunit peptides ( fig3 b ). a fourth partially overlapping sequence (# 9 , fig3 a ) showed a slight positive reaction . some other peptides showed slight positive signals in some assays ( i . e . # 7 , fig3 a ) but were not reproducible , leading us to examine only the identified dominant linear epitope - bearing peptides . additional peptides were tested in which alanine was substituted at each of the 12 amino residues of the ige - reactive peptide , qglrgeemeemv . in addition , peptides were tested with varying numbers of alanines substituted at the n - and c - termini . together , these data demonstrated that the core amino acids rgee , at positions 36 to 39 , and an additional glutamic acid residue at position 42 , were necessary for maximum ige binding to occur ( table i ). spots containing a 12 - amino acid peptide ( qglrgeemeemv ), bearing the immunodominant epitope , designated e1 , and spots containing a negative control (−) peptide ( lsqrsqqqcrq ), selected from the large subunit of jug r 1 were used to test the degree of individual reactivity and specificity of allergic and control sera . of the 20 patients tested , five exhibited strong recognition of the epitope peptide , six moderate , four weak , and five showed no recognition ; none reacted with the (−) peptide ( fig4 ). to determine if the identified epitope , designated e1 , is the major epitope recognized by patients &# 39 ; sera , we separated e1 - specific ige from the total antiserum and tested both fractions for reactivity with rjugr 1 . epitope - specific ige was isolated from patient serum by passage over an e1 - affinity column . to assure removal of anti - e1 abs , the three sequential eluate and the serum effluent fractions were first assayed against our solid - phase ige binding (+) and non - ige binding (−) peptides . fig5 a shows binding of ige to the positive ( e1 ) peptide in unfractionated patient serum , progressively less binding in the first two eluate fractions , and no binding in the third , indicating complete removal of the e1 - reactive ab by the column . significantly , the e1 - adsorbed serum ( effluent ) also showed no reactivity to the e1 peptide , confirming removal of e1 - specific ige from the serum . the eluate and effluent fractions were then used in dot - blot assays to determine if ige abs to the e1 epitope represent the bulk of the rjug r 1 - reactive ige . as expected , binding of ige to rjug r 1 , from total sera and the first two eluate ( anti - e1 ) fractions , but not the third ( anti - e1 - depleted ), was demonstrated ( fig5 b ). however , there was considerable rjug r 1 - specific ige remaining in the effluent ( anti - e1 depleted fraction ), demonstrating the presence of additional ige ab specific for one or more conformational epitopes . to further examine the specificity of both our peptide - reactive fractions and unfractionated jug r 1 - reactive ige , a soluble form of the epitope peptide was pre - incubated with whole patient serum as well as the e1 - specific ige abs in an attempt to inhibit their reaction with both our solid - phase peptides and rjugr 1 . varying amounts ( 70 , 7 . 0 , 0 . 7 μg ) of the peptide were incubated with whole patients &# 39 ; sera prior to probing the e1 epitope ( positive ) and negative solid - phase peptides . partial to complete inhibition was achieved ( fig5 c ), demonstrating that the solid and fluid phase versions of the peptide are similarly recognized . the amount of soluble peptide ( 70 μg ) needed to completely inhibit binding of e1 - specific ige to the solid phase version of this epitope was similarly used for inhibition studies involving unfractionated patient serum ige and affinity column purified ige fractions against the rjug r 1 . inhibition was again observed in the eluate ( e1 epitope - specific ) ige fractions . these data demonstrate that the epitope is similarly recognized in both the peptide and the recombinant protein . however , ige reactivity in both whole patient serum and the e1 - adsorbed effluent fraction reacted with rjug r 1 ( fig5 d ), again demonstrating the existence of additional ( presumably conformational ) ige - reactive epitopes on rjug r 1 . on a global basis walnuts rank second in tree nut production . 31 in children , anaphylactic reactions to peanut and tree nuts are responsible for most fatal and near - fatal food allergic reactions . 3 , 32 in a recent study , 32 fatal cases of anaphylactic reactions to foods reported to a national registry were analyzed and it was determined that up to 31 % were due to tree nuts . 33 the severity and prevalence of some food induced allergic reactions has prompted investigation to identify and characterize offending allergens . jug r 1 , a major allergen in the english walnut , has previously been characterized as a 2s albumin seed storage protein . 6 2s albumins are found in almost all edible seeds . in view of the importance of this class of protein as food allergens and the possibility of cross - reactivity among class - related proteins , 34 a detailed knowledge of these proteins would be valuable . in particular , given the important role allergen - specific ige plays in the allergic reaction , determination of allergen - specific ige binding epitopes , be they linear or conformational , appears to be of great importance for gaining a better understanding of the allergenic nature of foods and for possible therapeutic intervention . we have found a single linear ige - reactive epitope and have defined its core amino acid residues . to date , no common structural character of linear - ige epitopes has been identified ( reviewed in 35 ), but this could change as more epitope mapping studies are completed . a key step in the allergic reaction is the binding of at least two ige abs to a multivalent allergen . the fact that we have found only one linear epitope on jug r 1 is unique in that all previously analyzed allergens have contained multiple linear ige - binding sites ( reviewed in 35 ). although we cannot rule out the existence of weakly binding peptides that are undetected by our methods , the affinity of such peptides would be much lower as judged by the high intensity of the signal on the epitope e1 . our findings , in combination with the knowledge that allergens must be multivalent to elicit an allergic response , point towards the existence of conformational epitopes on jug r 1 as well . although it is qualitative data , it is noteworthy that all 20 patients &# 39 ; sera bound rjug r 1 ( in fig2 ), whereas only 15 bound the linear epitope , with many of these exhibiting disproportionately faint binding . this too , is evidence that conformational epitopes are relevant and key in ige binding for some patient sera . in fact , it has been estimated that most protein epitopes are conformational . 36 it is worthwhile to note that the labeling of an epitope as “ linear ”, based on the use of synthetic epitopes , is imprecise because the identified epitope may be a fragmented part of a larger discontinuous epitope ( reviewed in 35 ). clinically , insight into the ige - binding epitopes of allergens , linear or conformational , is extremely useful . identifying the immunodominant linear ige - binding epitope of jug r 1 may lead to better designs for walnut - allergy therapy . currently there is no generally agreed upon treatment for ige - mediated food allergy and , therefore , complete avoidance of the food is recommended . 37 however , with tree nuts , such as walnuts , avoidance is often difficult since equipment used for food processing is often shared and the implicated allergen may , therefore , be present in trace amounts or may be added to foods where its presence was not expected by the consumer . because tree nut allergies are rarely resolved , reactions can be severe , and accidental ingestion is almost inevitable , life for afflicted patients can be fraught with anxiety ( reviewed in 38 ). some new approaches to allergen immunotherapy and diagnosis include : the use of blocking peptides to inhibit the triggering of ige - mediated hypersensitivity reactions , immunization with specific peptides to alter the type of immune response elicited , allergen reengineering to enhance protective responses , and the use of defined peptides in diagnostic assays . 9 , 10 , 11 , 12 a common factor for the application of these approaches is a required knowledge of the amino acids in the ige - reactive sites of the allergen . we have mapped the major linear ige epitope of jug r 1 and identified the principal core amino acid residues within the epitope . additional studies are planned to identify the conformational epitopes on this allergen . accordingly , the invention disclosed herein includes a purified ig - e binding immunogenic polypeptide of walnuts , the amino acid sequence of which consists of seq id no : 1 . the immunogenic polypeptide of the invention may also include at least one mutation in said amino acid sequence , wherein said at least one mutation is selected from a deletion , a substitution , and an addition . the polypeptide may also comprise at least one mutation in said amino acid sequence which reduces the polypeptide &# 39 ; s ige - binding capacity while maintaining at least minimal immunogenicity . the skilled will recognize that the inventive polypeptide may also comprise at least two seq id no : 1 . the invention additionally includes a test for detecting a walnut allergy in a patient , said test comprising contacting the patient with an effective amount of a purified polypeptide consisting of seq id no : 1 for detecting the allergy . in one embodiment of the test contacting comprises injecting the purified polypeptide below the skin of the patient . for use in this test , the purified polypeptide may comprise at least one mutation in said sequence , and the mutation is selected from a deletion , a substitution , and an addition . a further embodiment of the invention includes a diagnostic test for detecting anti - walnut ige in a patient to thereby indicate an allergy to walnuts . the diagnostic comprises reacting patient &# 39 ; s serum with a purified polypeptide the amino acid sequence of which consists of at least one seq id no : 1 ; separating the polypeptide from unreacted patient serum ; reacting the polypeptide with a labeled human ige - reactive agent after separating from unreacted patient serum ; separating the polypeptide from unreacted labeled human ige - reactive agent ; and directly or indirectly detecting the labeled human ige - reactive agent bound to the polypeptide after separating from unreacted agent to thereby indicate presence in the patient &# 39 ; s serum of anti - walnut ige . for use in this diagnostic test , as also noted previously , the amino acid sequence may further comprise at least one mutation selected from a deletion , a substitution , and an addition . yet another embodiment of the invention includes a test kit for screening patients for allergy to walnuts . the kit comprises a first reagent containing at least one purified polypeptide whose amino acid sequence consists of seq id no : 1 . the kit also contains a second reagent containing at least one labeled human ige - reactive agent , for example , anti human ige , or others known or to be developed . in the test kit , the first reagent preferably comprises a solid phase carrying the purified polypeptide . those skilled in the art will readily recognize that from a known amino acid sequence such as seq id no : 1 , we may readily prepare an isolated nucleic acid sequence and degenerate variants thereof which encode a polypeptide consisting of seq id no : 1 , as shown in table ii . such a nucleic acid may further comprise a sequence which encodes at least one mutation of seq id no : 1 , wherein said mutation is selected from a deletion , a substitution , and an addition . the nucleic acid may be an isolated cdna and degenerate variants thereof which encode a polypeptide consisting of seq id no : 1 , or at least one mutation thereof wherein said mutation is selected from a deletion , a substitution , and an addition . in the drawings and specification , there have been disclosed a typical preferred embodiment of the invention , and although specific terms are employed , the terms are used in a descriptive sense only and not for purposes of limitation . the invention has been described in considerable detail with specific reference to these illustrated embodiments . it will be apparent , however , that various modifications and changes can be made within the spirit and scope of the invention as described in the foregoing specification and as defined in the appended claims . table i mutational analysis of the jug r 1 ige binding epitope , e1 amino acid sequence * substitution ige binding ** a gl rgee me e mv q1a ++ q a l rgee me e mv g2a ++ qg a rgee me e mv l3a + qgl a gee me e mv r4a − qgl r a ee me e mv g5a − qgl rg a e me e mv e6a − qgl rge a me e mv e7a − qgl rgee a e e mv m8a ++ qgl rgee m a e mv e9a ++ qgl rgee me a mv e10a + qgl rgee me e a v m11a ++ qgl rgee me e m a v12a ++ q aa rgee me e mv g2a , l3a + q aaa gee me e mv g2a , l3a , r4a − q aaaa ee me e mv g2a , l3a , r4a , g5a − qgl rgee me aa v e10a , m11a + qgl rgee m aaa v e9a , e10a , m11a − qgl rgee aaaa v m8a , e9a , e10a , m11a − [ 0108 ] table ii amino acid sequence for immunogenic walnut polypeptide and corresponding codons q gln glutamine caa , cag g gly glycine gga , ggg , ggu , ggc l leu leucine uua , uug , cuu , cuc , cua , cug r arg arginine cgu , cgc , cga , cgg , aga , agg g gly glycine gga , ggg , ggu , ggc e glu glutamic acid gaa , gag e glu glutamic acid gaa , gag m met methionine aug e glu glutamic acid gaa , gag e glu glutamic acid gaa , gag m met methionine aug v val valine guu , guc , gua , gug | US-25191802-A |
a new and distinct variety of persian walnut tree having an abundance of fruit particularly when young . the nuts are of an oblate shape and have a high percentage of sweet mild kernels . | the walnut tree is of a medium height and breadth . it produces a moderate to dense foliage . it grows vigorously producing spreading branches and a liberal number of buds and laterals . it is about as broad as it is high . the leaves are ovate to eliptic in shape , and they number about 7 to 9 to a leaflet . they are abundant , producing a shady tree , but one that at the same time is relatively light and airy as contrasted to those having a density of the nature of a tree such as a beech , for example . the tree is attractive and makes an excellent shade tree or ornamental tree . its most recent growing produced nuts which in competition type inspection were described as follows : shell : yellowish brown covered with a network of shallow veins converging at the apex , very thin , translucent where diaphragm tears away from shell midway between sutures . base : smooth except for longitudinal lines . sutures slightly ribbed at equator with variable pits . kernel : full , plump , convolutions moderate and even . pellicle light golden brown , semi - glossy to glossy , slightly astringent , veins absent or inconspicuous , flesh oily and rich . flavor mild and sweet . quality good . the production of fruit on the laterals is a distinct advantage particularly in the early years of the tree . the quantity is much greater than if nuts occurred only on the terminals as is customary with its parents . the terminals have up to five nuts per cluster further enhancing the out - put . in addition , the nuts are of high quality . the fruit also ripens early . in romulus , mich . the fruit ripens in the last week of august and the first week of september . the foliage and blossoms do not show until early may , but the harvest begins well within the growing period in southern michigan . the tree is self - pollenating . due to the smaller size , the nuts are not competitive with the walnuts of the larger presently available commercial sizes in california . the tree , is however , advantageously hardy and not only suitable for an ornamental , but in addition produces a nut well worth harvesting and using for local purposes . it is very suitable for decoration of cakes , etc . it has a desirable flavor . the nuts are easily recovered from the ground . yet the shells are relatively thin and easy to open without damage to the kernel . in addition , the tree produces a bountiful harvest . the tree appears to be as resistant as it forebears to disease and insects . it can be grafted or budded onto black walnut seedlings . it will be understood that the tree and its fruit can vary somewhat due to differences in climate , topography , and soil conditions , under which it is grown . | US-24403688-V |
an improved satchel - style tackle box wherein access to the storage compartments can be had through the upper end or through the front wall of the box . hence with the box of the present invention , there is no need to turn the box over in order to obtain access to all its storage compartments . the elimination of the need to turn the box over is accomplished by adding a pull out drawer to the lower part of the box . one or more storage compartments are then developed in the box above the drawer storage compartment . the projecting edge around the drawer opening in the box cooperate to prevent the rain water and other casual water from getting into the box , between the drawer and the opening , when the drawer is closed . novel latches secure the drawer in its closed position and assist in preventing the ingress of water into the drawer . the latches are readily moved out of the way when the drawer is to be opened . a handle is mounted on the front wall of the box to facilitate carrying the box . a novel keeper is used to retain the handle away from the drawer when the handle is not being used . | referring now to fig1 - 4 , a satchel - style box of the present invention is shown generally at 10 and comprises a one piece body 12 that may be molded from a plastic material such as polypropylene . the advantages of such a one piece construction is in economy of manufacture and also in preventing water from leaking into the box 10 . the body 12 includes a front wall 14 , a rear wall 16 , a left side wall 18 , a right side wall 20 , and a bottom wall 22 . the upper end of the body 12 , generally designated at 24 , is open . additionally , the body 12 includes integral , internal walls 26 and 28 ; the wall 26 being horizontally disposed and the wall 28 being vertically disposed . the vertical wall 28 extends between the side walls 18 and 20 and projects upwardly from the bottom wall 22 so that its upper end is generally the same height as the upper ends of the front , rear and side walls 14 - 20 . wall 28 is positioned approximately two - thirds to three - quarters of the way , from the front to back , between the front and rear walls 14 and 16 . horizontal wall 26 extends between the side walls 18 and 20 and from the front wall 14 back to the wall 28 . it is disposed approximately one - third of the way up , from the bottom to the top , between the bottom wall 22 and the upper open end 24 . the walls of the body 12 define three separate storage compartments . a first compartment 30 is defined by the horizontal wall 26 , the portion of the vertical wall 28 below the intersection between the horizontal and vertical walls 26 and 28 , the portions of the side walls 18 and 20 below the wall 26 , and the portion of the bottom wall 22 forward of the vertical wall 28 . a second compartment 32 is defined by the horizontal wall 26 , the portion of the vertical wall 28 above the horizontal wall 26 , and the portions of the side walls 18 and 20 and front wall 14 above the horizontal wall 26 . a third compartment 34 is defined by portions of the vertical wall 28 , side walls 18 and 20 to the rear of the vertical wall 28 , the portion of the bottom wall 22 to the rear of the vertical wall 28 , and the rear wall 16 . the front wall 14 includes an opening 36 that extends from between the side walls 18 and 20 and between the forward edge of the bottom wall 16 and the horizontal wall 26 . the opening 36 provides access to the first storage compartment 30 from without the box 10 . access to the second and third storage compartments 32 and 34 is through the open upper end 24 of the box 10 . a clear , molded plastic lid 38 is pivotally connected with the body 12 by a pair of conventional hinges 40 and 42 . as best seen in fig3 and 4 , parts of the hinges 40 and 42 are integrally molded on the rear wall 16 , adjacent to its upper end . the other cooperating parts of the hinges are molded on the lid 38 . hinge pins 43 interconnect the parts of the hinges . the hinges 40 and 42 permit the lid 38 to be pivoted about the aligned axes of the hinge pins 43 between a closed position , as shown in fig1 , and 4 , and an opened position , as shown in fig3 wherein access can be had to the storage compartments 32 and 34 . a dependent , integral lip 44 is molded about the peripheral edge of the lid 38 , which edge is congruent with the upper end 24 of the body 12 . when the lid is in its closed position , the peripheral edge of the lid 38 overlies and the lip 44 is disposed closely adjacent to the upper edges of the walls 14 - 20 defining the upper end 24 . two , over - center toggle - style latch assemblies 46 and 48 are mounted on the front wall 14 of the body 12 adjacent to the upper end 24 . these latch assemblies are of conventional design and construction , and accordingly are not described further herein . suffice it to say that they are used to secure the lid 38 in its closed position by cooperating with depressions or notches 50 and 52 , as best shown in fig3 molded in the front edge of the lid 38 . the upper end of the front wall 14 is cut away at 54 and 56 to accommodate the lid notches 50 and 52 . the latch assemblies 46 and 48 serve to hold the lid 38 tightly against the upper end 24 . generally speaking , when the lid 38 is so held , the lid 38 and the lip 44 form a relatively tight seal about the upper end 24 of the box 12 . there are , however , a series of small ports ( not shown ) in the upper end 24 which allow any warm air and gases , that may be formed when the box 12 sits in the sun , to escape from the interior of the box . the bottom surface of the bottom wall 22 includes several integral projections or feet 58 . similarly , the rear wall 16 includes integral projections or feet 60 . these feet 58 and 60 serve to support the box when it is rested on its bottom or rear walls , respectively . the central portion of the front wall 14 is slightly , rearwardly recessed at 62 . the remaining end portions of the front wall 14 are generally flat and lie in a common vertical plane . a plastic handle assembly 64 is positioned within the recess 62 . this handle assembly includes a generally rectangular support housing 66 and a u - shaped handle 68 . the housing 66 is secured to the front wall 14 by rivets and has an integral , rounded , upwardly projected tab 70 at the center of its upper edge . the ends of the handle 68 are connected with the sides of the housing 66 . the handle may be pivoted from a handle rest position , as shown in fig1 - 4 where the bight portion 72 of the handle is disposed above the housing 66 and adjacent to the front wall 14 , to a handle gripping portion , where its bight portion 72 overlies the front of the housing 66 and can be gripped by a person who wishes to carry the box 10 . the handle assembly 64 is made so that the handle has a little play in it . this enables the bight portion 72 of the handle to be snapped over the tab 70 when the handle is moved to its handle rest position . the tab then retains the handle 68 in its handle rest position until someone snaps the handle back over the tab 70 . thereafter the handle 68 may be used to carry the box 12 . the use of tab 70 to retain the handle 68 in its rest position prevents the handle from overlying or blocking the opening 36 in the front wall 14 when the box 12 is in use . as previously noted , this opening 36 permits access to the first storage compartment 30 . a storage drawer 74 is slidingly received within the storage compartment 30 . the drawer includes molded plastic , one piece body and a front plate 76 . a plurality of integral divider walls 78 subdivide the drawer into a variety different size storage areas . a pair of forwardly projecting pads 80 and 82 are molded on the front face of the front plate 76 , with each pad being spaced about one - half way between the centerand a side edge of the plate 76 . the sides of the pads are curved and provide a smooth , inclined ramp - like surface . a round recess 84 is molded in the center of each ofthe pads 80 and 82 is used in retaining the drawer 74 in its closed position as hereinafter described . the front plate 78 is secured to the body of the drawer 74 by rivets 86 that are disposed within the recesses 84 . the lower , central portion of the front plate 78 is cut away , as shown at 87 . this cut away portion serves as a finger hold or handle for the drawer . as best seen in fig4 and 6 , a rearwardly extending flange 88 is molded about the periphery of the front plate 76 . the front wall 14 of the body 12 , adjacent to the opening 36 , has a groove - like structure 90 molded along the upper edge of the opening 36 and a forwardly projecting flange 92 molded about the remaining threesides of the opening 36 . when the drawer 74 is disposed within the first or drawer compartment 30 , the flange 88 overlies and is closely adjacent to the flange 92 and fits within the groove 90 thereby forming a tongue and groove type seal between the body 12 and drawer 74 about the entire periphery of the opening 36 . this seal prevents the ingress of rain water and other casual water into the drawer or first compartment when the drawer is in its closed position . as illustrated in fig4 and 6 , the front plate 76 lies in substantially the same plane as the end portions of the front wall 14 when the drawer 74 is in its closed position within the first compartment 30 . the drawer 74 is held in its closed position by novel , pivot style latches 94 and 96 that are mounted on the front wall 14 immediately above the opening 36 . in addition to securing the drawer 74 in its closed position , there latches also urge the drawer inwardly , with respect to the first compartment 30 , so that the flanges 88 and 92 and groove 90 are urged into a sealing relationship . each of the latches 94 and 96 are identical in construction and operation . for that reason , only one , latch 96 , will be specifically described . that latch is best illustrated in fig5 - 8 . the latch 96 includes a molded plastic , generally rectangular body 98 . a first end 100 of the body 98 is connected with the front wall 14 by a rivet 102 . the connection between the first end 100 and the front wall 14 permits the body 98 to be pivoted about the axis of the rivet 102 between a closed drawer position , as shown in fig5 and 6 , and a open drawer position , as shown in fig7 and 8 . the body 98 has a second end 104 . a ball or ball bearing 106 , made of a plastic material , is mounted in a recess 108 in the second end 104 . the ball 106 is carried by the second end 104 as the body member 98 is pivoted about the axis of the rivet 102 . when the latch 96 is in its drawer closed position , the ball 106 is partially disposed within the recess 84 in the pad 82 . this cooperation between the ball 106 and recess 84 assists in retaining or &# 34 ; locking &# 34 ; the latch in its drawer closed position . a lug 110 is molded on the front wall 14 above the opening 36 . the distance between the rivet 102 and the ball 106 is the same as that between the rivet 102 and the lug 110 . the ball 106 is adapted to rest on and above the lug when it is desired to hold the latch 96 in its drawer open position , that is , the position shown in fig7 and 8 . as noted , the body 98 is molded from a plastic material . normally the body 98 , including the ends 100 and 104 , lies in a common plane . the plastic material , however , has sufficient internal resiliency so that the second end 104 may be slightly bent or flexed and as a result , may be moved out of this common plane . this enables the end 104 , including the ball 106 , to pass over the lug 110 as the latch 96 is moved from its drawer closed position to its drawer open position and to pass up the side ramp surface of the pad 82 as the latch is moved from its drawer closed position to its drawer open position . the internal resiliency of the body 98 is such that when the second end 104 is moved out of the common plane , the end 104 tends to try to return to the common plane . accordingly , when the end 104 is out of the common plane , as for example when the end 104 overlies the pad 82 , the end 104 exerts a biasing force on the pad . this in turn urges the drawer 74 inwardly and also urges the tongue and groove structure , that is associated with the drawer and opening 36 , into close , sealing cooperation . the body 98 also includes a central , inwardly directed flange 112 which extends from its first end 100 toward its second end 102 . stops 114 and 116 are molded on the front wall 14 near the rivet 102 . the flange 112 cooperates with these stops . this cooperation limits the pivotal movement of the latch 96 to approximately 90 degrees . referring now to fig3 and 4 , the second storage compartment 32 includes a number of internal dividing walls 118 which serve to divide the compartment into a plurality of separate storage areas . these walls 118 extend upwardly from the horizontal wall 26 and for the most part , are molded as an integral part of the body 12 . however , one of these walls , wall 120 , may be removed from the box 10 by lifting the wall 120 out of grooves 122 that are molded in the dividing walls 118 and the adjacent facing parts of the vertical wall 28 and the front wall 14 . by removing the wall 120 , the user of the box may change the size of some of the storage areas in the compartment 32 . this movable wall 120 includes slots 124 that permit the wall to fit down within the grooves 122 in the dividing walls 118 . the upper ends of the dividing wall 120 have a plurality of notches 128 that permits bait and similar objects to be hung therefrom . the upper ends of the walls 118 and 120 do not extend to the top of the second compartment , that is , to the upper end 24 of the body 12 . rather , they terminated at a uniform , predetermined distance below the upper end 24 to define a sub - compartment above the upper ends of the walls and below the upper end 24 of the body 12 . this sub - compartment is adapted to receive and retain a removable , lift - out , one - piece molded plastic storage tray 130 . the outer peripheral shape of the tray 130 is congruent with but slightly smaller than the internal , peripheral shape of the second compartment . consequently , this tray 130 stays in place in the second compartment when the box 10 is being carried . the storage tray 130 includes a number of internal , integral dividing walls 132 that serve to divide the interior of the tray into separate storage areas . the tray also includes two removable walls 134 and 136 that are similar in construction to the wall 120 , except that they do not have notches at their upper ends . grooves 138 are molded in the walls 132 to receive and secure the walls 134 and 136 . by removing the walls 134 and 136 , the user of the box 10 may change the size of some of the storage areas in the tray 130 . the third storage compartment 34 is deeper than the second compartment 32 . internal , removable dividing walls 140 and 142 extend upwardly from the bottom wall 22 toward the upper end 24 of the body 12 and serve to divide the compartment 34 into separate storage areas . the dividing walls 140 extend from front to rear , and their ends are adapted to be disposed within sets of vertical aligned grooves 144 molded on the facing surfaces of the rear and vertical walls 16 and 28 . the walls 140 themselves include sets of grooves 146 at their mid - points . additional grooves 148 are molded on the facing surfaces of the side walls 18 and 20 and are aligned with the grooves 146 . the wall 142 extends between the side walls 18 and 20 . like the wall 120 , the wall 142 includes slots 150 that permit the wall to fit within the grooves 146 and down over the walls 140 . the ends of the wall 142 are also adapted to be disposed within the grooves 148 . the upper ends of the walls 140 and 142 include notches 152 , similar to the notches 128 , which are useful for hanging baits and other equipment . the user of the box 10 may remove all or any of the walls 140 and 142 to change the size of the storage areas in compartment 34 . in conclusion , the invention described herein may be embodied in other specific forms without departing from the spirit or central characteristics thereof . the preferred embodiment described hereinabove is to be considered in all respects as illustrative and not restrictive . the scope of the invention is indicated by the appended claims , rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein . | US-89083786-A |
the present invention describes a combined vaccine that offers broad protection against meningococcal disease caused by the pathogenic bacteria neisseria meningitidis . the vaccine is comprised of four distinct polysaccharide - protein conjugates that are formulated as a single dose of vaccine . purified capsular polysaccharides from neisseria meningitidis serogroups a , c , w - 135 , and y are chemically activated and selectively attached to a carrier protein by means of a covalent chemical bond , forming polysaccharide - protein conjugates capable of eliciting long - lasting immunity to a variety of n . meningitidis strains in children as well as adults . | the present invention comprises an immunological composition of two or more distinct protein - polysaccharide conjugates , wherein each of the conjugates comprises a capsular polysaccharide conjugated to a carrier protein . thus , the present invention includes compositions that comprise two or more different capsular polysaccharides conjugated to one or more carrier protein ( s ). capsular polysaccharides can be prepared by standard techniques known to those of skill in the art ( ref ). in the present invention capsular polysaccharides prepared from serogroups a , c , w - 135 and y of n . meningitidis are preferred . in a preferred embodiment , these meningococcal serogroup conjugates are prepared by separate processes and formulated into a single dosage formulation . for example , capsular polysaccharides from serogroups a , c , w - 135 and y of n . meningitidis are separately purified . in a preferred embodiment of the present invention the purified polysaccharide is depolymerized and activated prior to conjugation to a carrier protein . in a preferred embodiment of the present invention capsular polysaccharides of serogroups a , c , w - 135 , and y from n . meningitidis are partially depolymerized using mild oxidative conditions . the depolymerization or partial depolymerization of the polysaccharides may then be followed by an activation step . by “ activation ” is meant chemical treatment of the polysaccharide to provide chemical groups capable of reacting with the carrier protein . a preferred activation method involves treatment with adipic acid dihydrazide in physiological saline at ph 5 . 0 ± 0 . 1 for approximately two hours at 15 to 30 ° c . one process for activation is described in u . s . pat . no . 5 , 965 , 714 . once activated , the capsular polysaccharides may then be conjugated to one or more carrier proteins . in a preferred embodiment of the present invention each capsular polysaccharide is separately conjugated to a single carrier protein species . in a preferred embodiment the capsular polysaccharides from serogroups a , c , w - 135 and y of n . meningitidis are each separately conjugated to the same carrier protein species . carrier proteins may include inactivated bacterial toxins such as diphtheria toxoid , crm197 , tetanus toxoid , pertussis toxoid , e . coli lt , e . coli st , and exotoxin a from pseudomonas aeruginosa . bacterial outer membrane proteins such as , outer membrane complex c ( ompc ), porins , transferrin binding proteins , pneumolysis , pneumococcal surface protein a ( pspa ), or pneumococcal adhesin protein ( psaa ), could also be used . other proteins , such as ovalbumin , keyhole limpit hemocyanin ( klh ), bovine serum albumin ( bsa ) or purified protein derivative of tuberculin ( ppd ) may also be used as carrier proteins . carrier proteins are preferably proteins that are non - toxic and non - reactogenic and obtainable in sufficient amount and purity . carrier proteins should be amenable to standard conjugation procedures . in a preferred embodiment of the present invention diphtheria toxin purified from cultures of corynebacteria diphtheriae and chemically detoxified using formaldehyde is used as the carrier protein . after conjugation of the capsular polysaccharide to the carrier protein , the polysaccharide - protein conjugates may be purified ( enriched with respect to the amount of polysaccharide - protein conjugate ) by a variety of techniques . one goal of the purification step is to remove the unbound polysaccharide from the polysaccharide - protein conjugate . one method for purification , involving ultrafiltration in the presence of ammonium sulfate , is described in u . s . pat . no . 6 , 146 , 902 . alternatively , conjugates can be purified away from unreacted protein and polysaccharide by any number of standard techniques including , inter alia , size exclusion chromatography , density gradient centrifugation , hydrophobic interaction chromatography or ammonium sulfate fractionation . see , e . g ., p . w . anderson , et . al . ( 1986 ). j . immunol . 137 : 1181 - 1186 . see also h . j . jennings and c . lugowski ( 1981 ) j . immunol . 127 : 1011 - 1018 . after conjugation of the polysaccharide and carrier protein the immunological compositions of the present invention are made by combining the various polysaccharide - protein conjugates . the immunological compositions of the present invention comprise two or more different capsular polysaccharides conjugated to one or more carrier protein ( s ). a preferred embodiment of the present invention is a bivalent immunological composition comprising capsular polysaccharides from serogroups a and c of n . meningitidis separately conjugated to diphtheria toxoid . more preferably the present invention is a tetravalent immunological composition comprising capsular polysaccharides from serogroups a , c , w - 135 and y of n . meningitidis separately conjugated to diphtheria toxoid . preparation and use of carrier proteins , and a variety of potential conjugation procedures , are well known to those skilled in the art . conjugates of the present invention can be prepared by such skilled persons using the teachings contained in the present invention as well as information readily available in the general literature . guidance can also be obtained from any one or all of the following u . s . patents , the teachings of which are hereby incorporated in their entirety by reference : u . s . pat . nos . 4 , 356 , 170 ; 4 , 619 , 828 ; 5 , 153 , 312 ; 5 , 422 , 427 and 5 , 445 , 817 . the immunological compositions of the present invention are made by separately preparing polysaccharide - protein conjugates from different meningococcal serogroups and then combining the conjugates . the immunological compositions of the present invention can be used as vaccines . formulation of the vaccines of the present invention can be accomplished using art recognized methods . the vaccine compositions of the present invention may also contain one or more adjuvants . adjuvants include , by way of example and not limitation , aluminum adjuvants , freund &# 39 ; s adjuvant , bay , dc - chol , pcpp , monophoshoryl lipid a , cpg , qs - 21 , cholera toxin and formyl methionyl peptide . see , e . g ., vaccine design , the subunit and adjuvant approach , 1995 ( m . f . powell and m . j . newman , eds ., plenum press , ny ). the adjuvant is preferably an aluminum adjuvant , such as aluminum hydroxide or aluminum phosphate . as demonstrated below , the vaccines and immunological compositions according to the invention elicit a t - dependent - like immune response in various animal models , whereas the polysaccharide vaccine elicits a t - independent - like immune response . thus , the compositions of the invention are also useful research tools for studying the biological pathways and processes involved in t - dependent - like immune responses to n . meningitidis antigens . the amount of vaccine of the invention to be administered a human or animal and the regime of administration can be determined in accordance with standard techniques well known to those of ordinary skill in the pharmaceutical and veterinary arts taking into consideration such factors as the particular antigen , the adjuvant ( if present ), the age , sex , weight , species and condition of the particular animal or patient , and the route of administration . in the present invention , the amount of polysaccharide - protein carrier to provide an efficacious dose for vaccination against n . meningitidis can be from between about 0 . 02 μg to about 5 μg per kg body weight . in a preferred composition and method of the present invention the dosage is between about 0 . 1 μg to 3 μg per kg of body weight . for example , an efficacious dosage will require less antibody if the post - infection time elapsed is less since there is less time for the bacteria to proliferate . in like manner an efficacious dosage will depend on the bacterial load at the time of diagnosis . multiple injections administered over a period of days could be considered for therapeutic usage . the multivalent conjugates of the present invention can be administered as a single dose or in a series ( i . e ., with a “ booster ” or “ boosters ”). for example , a child could receive a single dose early in life , then be administered a booster dose up to ten years later , as is currently recommended for other vaccines to prevent childhood diseases . the booster dose will generate antibodies from primed b - cells , i . e ., an anamnestic response . that is , the multivalent conjugate vaccine elicits a high primary ( i . e ., following a single administration of vaccine ) functional antibody response in younger populations when compared to the licensed polysaccharide vaccine , and is capable of eliciting an anamnestic response ( i . e ., following a booster administration ), demonstrating that the protective immune response elicited by the multivalent conjugate vaccine of the present invention is long - lived . compositions of the invention can include liquid preparations for orifice , e . g ., oral , nasal , anal , vaginal , peroral , intragastric , mucosal ( e . g ., perlinqual , alveolar , gingival , olfactory or respiratory mucosa ) etc ., administration such as suspensions , syrups or elixirs ; and , preparations for parenteral , subcutaneous , intradermal , intramuscular , intraperitoneal or intravenous administration ( e . g ., injectable administration ), such as sterile suspensions or emulsions . intravenous and parenteral administration are preferred . such compositions may be in admixture with a suitable carrier , diluent , or excipient such as sterile water , physiological saline , glucose or the like . the compositions can also be lyophilized . the compositions can contain auxiliary substances such as wetting or emulsifying agents , ph buffering agents , gelling or viscosity enhancing additives , preservatives , flavoring agents , colors , and the like , depending upon the route of administration and the preparation desired . standard texts , such as “ remington &# 39 ; s pharmaceutical science ”, 17 th edition , 1985 , incorporated herein by reference , may be consulted to prepare suitable preparations , without undue experimentation . compositions of the invention are conveniently provided as liquid preparations , e . g ., isotonic aqueous solutions , suspensions , emulsions or viscous compositions that may be buffered to a selected ph . if digestive tract absorption is preferred , compositions of the invention can be in the “ solid ” form of pills , tablets , capsules , caplets and the like , including “ solid ” preparations which are time - released or which have a liquid tilling , e . g ., gelatin covered liquid , whereby the gelatin is dissolved in the stomach for delivery to the gut . if nasal or respiratory ( mucosal ) administration is desired , compositions may be in a form and dispensed by a squeeze spray dispenser , pump dispenser or aerosol dispenser . aerosols are usually under pressure by means of a hydrocarbon . pump dispensers can preferably dispense a metered dose or a dose having a particular particle size . liquid preparations are normally easier to prepare than gels , other viscous compositions , and solid compositions . additionally , liquid compositions are somewhat more convenient to administer , especially by injection or orally , to animals , children , particularly small children , and others who may have difficulty swallowing a pill , tablet , capsule or the like , or in multi - dose situations . viscous compositions , on the other hand , can be formulated within the appropriate viscosity range to provide longer contact periods with mucosa , such as the lining of the stomach or nasal mucosa . obviously , the choice of suitable carriers and other additives will depend on the exact route of administration and the nature of the particular dosage form , e . g ., liquid dosage for ( e . g ., whether the composition is to be formulated into a solution , a suspension , gel or another liquid form ), or solid dosage form ( e . g ., whether the composition is to be formulated into a pill , tablet , capsule , caplet , time release form or liquid - filled form ). solutions , suspensions and gels , normally contain a major amount of water ( preferably purified water ) in addition to the active ingredient . minor amounts of other ingredients such as ph adjusters ( e . g ., a base such as naoh ), emulsifiers or dispersing agents , buffering agents , preservatives , wetting agents , jelling agents , ( e . g ., methylcellulose ), colors and / or flavors may also be present . the compositions can be isotonic , i . e ., it can have the same osmotic pressure as blood and lacrimal fluid . the desired isotonicity of the compositions of this invention may be accomplished using sodium tartrate , propylene glycol or other inorganic or organic solutes . sodium chloride is preferred particularly for buffers containing sodium ions . viscosity of the compositions may be maintained at the selected level using a pharmaceutically acceptable thickening agent . methylcellulose is preferred because it is readily and economically available and is easy to work with . other suitable thickening agents include , for example , xanthan gum , carboxymethyl cellulose , hydroxypropyl cellulose , carbomer , and the like . the preferred concentration of the thickener will depend upon the agent selected . the important point is to use an amount that will achieve the selected viscosity . viscous compositions are normally prepared from solutions by the addition of such thickening agents . a pharmaceutically acceptable preservative can be employed to increase the shelf life of the compositions . benzyl alcohol may be suitable , although a variety of preservatives including , for example , parabens , thimerosal , chlorobutanol , or benzalkonium chloride may also be employed . a suitable concentration of the preservative will be from 0 . 02 % to 2 % based on the total weight although there may be appreciable variation depending upon the agent selected . those skilled in the art will recognize that the components of the compositions must be selected to be chemically inert with respect to the n . meningitidis polysaccharide - protein carrier conjugates . the invention will be further described by reference to the following illustrative , non - limiting examples setting forth in detail several preferred embodiments of the inventive concept . other examples of this invention will be apparent to those skilled in the art without departing from the spirit of the invention . preparation of neisseria meningitidis serogroups a , c , w - 135 , and y purified capsular polysaccharides powders separately , neisseria meningitidis serogroup a , c , w135 , and y wet frozen seed cultures were thawed and recovered with the aid of liquid watson scherp medium and planted in blake bottles containing mueller hinton agar medium . the blake were incubated at 35 to 37 ° c . in a co 2 atmosphere for 15 to 19 hours . following the incubation period , the growth from the blake bottles were dislodged and added to 4 l flasks containing watson scherp medium . the flasks were incubated at 35 to 37 ° c . for 3 to 7 hours on a platform shaker . the contents of the 4 l flasks were transferred to a fermenter vessel containing watson scherp medium . the fermenter vessel was incubated at 35 to 37 ° c . for 7 to 12 hours controlling dissolved oxygen content and ph with supplement feed and antifoam additions . after the incubation period , the contents of the fermentor vessel were transferred to a 500 l tank , cetavlon was added , and the material mixed for 1 hours . the cetavlon treated growth was centrifuged at approximately 15 , 000 to 17 , 000 × g at a flow rate of approximately 30 to 70 liters per hours . the crude polysaccharide was precipitated from the supernatant with a second cetavlon precipitation . cetavlon was added to the supernatant and the material mixed for at least 1 hour at room temperature . the material was stored at 1 to 5 ° c . for 8 to 12 hours . the precipitated polysaccharide was collected centrifugation at approximately 45 , 000 to 50 , 000 × g at a flow rate of 300 to 400 ml per minute . the collected paste was stored at − 60 ° c . or lower until further processed . the inactivated paste was thawed and transferred to a blender . the paste was blended with 0 . 9m calcium chloride to yield a homogeneous suspension . the suspension was centrifuged at approximately 10 , 000 × g for 15 minutes . the supernatant was decanted through a lint free pad into a container as the first extract . a second volume of 0 . 9m calcium chloride was added to the paste , and blended to yield a homogeneous suspension . the suspension was centrifuged as above , and the supernatant combined with the supernatant from the first extraction . a total of four extractions were performed , and the supernatants pooled . the pooled extracts were concentrated by ultrafiltration using 10 - 30 kda mwco spiral would ultrafiltration units . magnesium chloride was added to the concentrated , and the ph adjusted to 7 . 2 to 7 . 5 using sodium hydroxide . dnase and rnase were added to the concentrate , and incubated at to 28 ° c . with mixing for 4 hours . ethanol was added to a concentration of 30 to 50 %. precipitated nucleic acid and protein were removed by centrifugation at 10 , 000 × g for 2 hours . the supernatant was recovered and the polysaccharide precipitated by adding ethanol to 80 % and allowing it to stand overnight at 1 to 5 ° c . the alcohol was siphoned off , and the precipitated polysaccharide was centrifuged for 5 minutes at 10 , 000 × g . the precipitated polysaccharide was washed with alcohol . the polysaccharide was washed with acetone , centrifuged at 15 to 20 minutes at 10 , 000 × g . the polysaccharide was dried under vacuum . the initial polysaccharide powder was dissolved into sodium acetate solution . magnesium chloride was added and the ph adjusted to 7 . 2 to 7 . 5 using sodium hydroxide solution . dnase and rnase were added to the solution and incubated at 25 to 28 ° c . with mixing for 4 hours to remove residual nucleic acids . after incubation with these enzymes , an equal volume of sodium acetate - phenol solution was added to the polysaccharide - enzyme mixture , and placed on a platform shaker at 1 to 5 ° c . for approximately 30 minutes . the mixture was centrifuged at 10 , 000 × g for 15 to 20 minutes . the upper aqueous layer was recovered and saved . an equal volume of sodium acetate - phenol solution was added to the aqueous layer , and extracted as above . a total of four extractions were performed to remove protein and endotoxin from the polysaccharide solution . the combined aqueous extracts were diluted up to ten fold with water for injection , and diafiltered against 10 volumes of water for injection . calcium chloride was added to the diafiltered polysaccharide . the polysaccharide was precipitated overnight at 1 to 50 c by adding ethanol to 80 %. the alcohol supernatant was withdrawn , and the polysaccharide collected by centrifugation at 10 , 000 × g for 15 minutes . the purified polysaccharide was washed two times with ethanol , and once with acetone . the washed powder was dried under vacuum in a desiccator . the dried powder was stored at − 30 ° c . or lower until processed onto conjugate . depolymerization of neisseria meningitidis serogroups a , c , w135 , and y purified capsular polysaccharide powder materials used in the preparation include purified capsular polysaccharide powders from neisseria meningitidis serogroups a , c , w - 135 , and y ( prepared in accordance with example 1 ), sterile 50 mm sodium acetate buffer , ph 6 . 0 , sterile 1n hydrochloric acid , sterile 1n sodium hydroxide , 30 % hydrogen peroxide , and sterile physiological saline ( 0 . 85 % sodium chloride ). each serogroup polysaccharide was depolymerized in a separate reaction . a stainless steel tank was charged with up to 60 g of purified capsular polysaccharide powder . sterile 50 mm sodium acetate buffer , ph 6 . 0 was added to the polysaccharide to yield a concentration of 2 . 5 g polysaccharide per liter . the polysaccharide solution was allowed to mix at 1 to 5 ° c . for 12 to 24 hours to effect solution . the reaction tank was connected to a heat exchanger unit . additional 50 mm sodium acetate buffer , ph 6 . 0 , was added to dilute the polysaccharide to reaction concentration of 1 . 25 g per liter . the polysaccharide solution was heated to 55 ° c .± 0 . 1 . an aliquot of 30 % hydrogen peroxide was added to the reaction mixture to yield a reaction concentration of 1 % hydrogen peroxide . the course of the reaction was monitored by following the change in the molecular size of the polysaccharide over time . every 15 to 20 minutes , aliquots were removed from the reaction mixture and injected onto a hpsec column to measure the molecular size of the polysaccharide . when the molecular size of the polysaccharide reached the targeted molecular size , the heating unit was turned off and the polysaccharide solution rapidly cooled to 5 ° c . by circulation through an ice water bath . the depolymerized polysaccharide solution was concentrated to 15 g per liters by connecting the reaction tank to an ultrafiltration unit equipped with 3000 mwco regenerated cellulose cartridges . the concentrated depolymerized polysaccharide solution was diafiltered against 10 volumes of sterile physiological saline ( 0 . 85 % sodium chloride ). the depolymerized polysaccharide was stored at 1 to 5 ° c . until the next process step . the molecular size of the depolymerized polysaccharide was determined by passage through a gel filtration chromatography column sold under the tradename “ ultahydrogel ™ 250 ” that was calibrated using dextran molecular size standards and by multi - angle laser light scattering . the quantity of polysaccharide was determined by phosphorus content for serogroup a using the method of bartlet , g . r . j . ( 1959 ) journal of biological chemistry , 234 , pp - 466 - 468 , and by the sialic acid content for serogroups c , w135 and y using the method of svennerholm , l . ( 1955 ) biochimica biophysica acta 24 , pp 604 - 611 . the o - acetyl content was determined by the method of hesterin , s . ( 1949 ) journal of biological chemistry 180 , p 249 . reducing activity was determined by the method of park , j . t . and johnson , m . j . ( 1949 journal of biological chemistry 181 , pp 149 - 151 . the structural integrity of the depolymerized polysaccharide was determined by protein 1 h and 13 c nmr . the purity of the depolymerized polysaccharide was determined by measuring the lal ( endotoxin ) content and the residual hydrogen peroxide content . derivatization of neisseria meningitidis serogroups a , c , w - 135 , and y depolymerized polysaccharide materials used in this preparation include hydrogen peroxide depolymerized capsular polysaccharide serogroups a , c , w - 135 , and y from neisseria meningitidis ( prepared in accordance with example 2 ), adipic acid dihydrazide , 1 - ethyl - 3 -( 3 - dimethylaminopropyl ) carbodiimide ( edac ) for serogroup a only , sodium cyanoborohydride , sterile 1n hydrochloric acid , sterile 1n sodium hydroxide , sterile 1m sodium chloride , and sterile physiological saline ( 0 . 85 % sodium chloride ). each serogroup polysaccharide was derivatized in a separate reaction . a stainless steel tank was charged with the purified depolymerized polysaccharide , and diluted with sterile 0 . 85 % physiological saline to achieve a final reaction concentration of 6 g polysaccharide per liter . to this solution was added a concentrated aliquot of adipic acid dihydrazide dissolved in sterile 0 . 85 % physiological saline , in order to achieve a reaction concentration of 1 g per liter . for serogroup a only , edac was added as a concentrated aliquot dissolved in sterile 0 . 85 % physiological saline , to achieve a reaction concentration of 1 g per liter . the ph was adjusted to 5 . 0 ± 0 . 1 , and this ph was maintained for 2 hours using sterile 1n hydrochloric acid and sterile 1n sodium hydroxide at room temperature ( 15 to 30 ° c .). after two hours , a concentrated aliquot of sodium cyanoborohydride , dissolved in 0 . 85 % physiological saline , was added to the reaction mixture to achieve a reaction concentration of 2 g per liter . the reaction was stirred at room temperature ( 15 to 30 ° c .) for 44 hours ± 4 hours while maintaining the ph at 5 . 5 ± 0 . 5 . following this reaction period , the ph was adjusted to 6 . 0 ± 0 . 1 , and the derivatized polysaccharide was concentrated to 12 g polysaccharide per liter by connecting the reaction tank to a ultrafiltration unit equipped with a 3000 mwco regenerated cellulose cartridges . the concentrated derivatized polysaccharide was diafiltered against 30 volumes of 1m sodium chloride , followed by 10 volumes of 0 . 15m sodium chloride . the tank was disconnected from the ultrafiltration unit and stored at 1 to 5 ° c . for 7 days . the tank was reconnected to an ultrafiltration unit equipped with 3000 mwco regenerated cellulose cartridges , and diafiltered against 30 volumes of 1m sodium chloride , followed by volumes of 0 . 15m sodium chloride . the molecular size of the derivatized polysaccharide , the quantity of polysaccharide , and the o - acetyl content were measured by the same methods used on the depolymerized polysaccharide . the hydrazide content was measured by the 2 , 4 , 6 - trinitrobenzensulfonic acid method of snyder , s . l . and sobocinski , p . z . ( 1975 ) analytical biochemistry 64 , pp 282 - 288 . the structural integrity of the derivatized polysaccharide was determined by proton 1 h and 13 c nmr . the purity of the derivatized polysaccharide was determined by measuring the level of unbound hydrazide , the lal ( endotoxin ) content , and the residual cyanoborohydride content . lyophilized seed cultures were reconstituted and incubated for 16 to 18 hours . an aliquot from the culture was transferred to a 0 . 5 - liter flask containing growth medium , and the culture flask was incubated at 34 . 5 to 36 . 5 ° c . on a rotary shaker for 7 to 9 hours . an aliquot from the culture flask was transferred to a 4 - liter flask containing growth medium , and the culture flask was incubated at 34 . 5 to 36 . 5 ° c . on a rotary shaker for 14 to 22 hours . the cultures from the 4 - liter flask were used to inoculate a fermenter containing growth media . the fermenter was incubated at 34 . 5 to 36 . 5 ° c . for 70 to 144 hours . the contents of the fermenter were filtered through depth filters into a collection vessel . an aliquot of formaldehyde solution , 37 % was added to the harvest to achieve a concentration of 0 . 2 %. the ph was adjusted to 7 . 4 to 7 . 6 . the harvest was filtered through a 0 . 2 micron filter cartridge into sterile 20 liter bottles . the bottles were incubated at 34 . 5 to 36 . 5 ° c . for 7 days . an aliquot of formaldehyde solution , 37 %, was added to each 20 liter bottle to achieve a concentration of 0 . 4 %. the ph of the mixtures was adjusted to 7 . 4 to 7 . 6 . the bottles were incubated at 34 . 5 to 36 . 5 ° c . for 7 days on a shaker . an aliquot of formaldehyde solution , 37 %, was added to each 20 liter bottle to achieve a concentration of 0 . 5 %. the ph of the mixtures was adjusted to 7 . 4 to 7 . 6 . the bottles were incubated at 34 . 5 to 36 . 5 ° c . for 8 weeks . the crude toxoid was tested for detoxification . the bottles were stored at 1 to 5 ° c . during the testing period . the crude toxoid was allowed to warm to room temperature , and the contents of the 20 - liter bottles were combined into a purification tank . the ph of the toxoid was adjusted to 7 . 2 to 7 . 4 , and charcoal was added to the crude toxoid and mixed for 2 minutes . the charcoal toxoid mixture was allowed to stand for 1 hours , and was then filtered through a depth filter cartridge into a second purification tank . solid ammonium sulfate was added to the filtrate to achieve 70 % of saturation . the ph was adjusted to 6 . 8 to 7 . 2 , and the solution was allowed to stand for 16 hours . the precipitated protein was collected by filtration and washed with 70 % of saturation ammonium sulfate solution , ph 7 . 0 . the precipitate was dissolved into sterile distilled water , and the protein solution was filtered into a stainless steel collection vessel . the ph was adjusted to 6 . 8 to 7 . 2 , and ammonium sulfate was added to 40 % of saturation . the ph of the solution was adjusted to 7 . 0 to 7 . 2 , and the solution was allowed to stand for 16 hours . the precipitate was removed by filtration and discarded . ammonium sulfate was added to the filtrate to 60 % of saturation , and the ph adjusted to 7 . 0 to 7 . 2 . the mixture was allowed to stand for 16 hours , and the precipitated protein was collected by filtration . the precipitate was dissolved into sterile distilled water , filtered to remove undissolved protein , and diafiltered against 0 . 85 % physiological saline . the protein solution was concentrated to 15 g per liter and diafiltered against 10 volumes of 0 . 85 % physiological saline suing a 10 , 000 mwco regenerated cellulose filter cartridge . the concentrated protein solution was sterilized by filtration through a 0 . 2 micron membrane . the protein solution was stored at 1 to 5 ° c . until processed onto conjugate . the protein concentration was determined by the method of lowry , o . h . et . al ( 1951 ) journal of biological chemistry 193 , p 265 - 275 . the purity of the protein was measured by sterility , lal ( endotoxin ) content , and residual formaldehyde content . preparation of monovalent conjugates of neisseria meningitidis serogroups a , c , w - 135 , and y polysaccharide to diphtheria toxoid protein materials used in this preparation include adipic acid derivatized polysaccharide from neisseria meningitidis serogroups a , c , w - 135 , and y ( prepared in accordance with example 3 ), sterile diphtheria toxoid protein ( prepared in accordance with example 4 ), edac , ammonium sulfate , sterile 1n hydrochloric acid , sterile 1n sodium hydroxide , and sterile physiological saline ( 0 . 85 %). each serogroup polysaccharide conjugate was prepared by a separate reaction . all four conjugates were prepared by the following process . a stainless steel tank was charged with the purified adipic acid derivatized polysaccharide at a reaction concentration of 700 to 100 μmoles of reactive hydrazide per liter and purified diphtheria toxoid protein at a reaction concentration of 3 . 8 to 4 . 0 g protein per liter . physiological saline 0 . 85 %, was used to dilute the starting materials to the target reaction concentrations and the ph was adjusted to 5 . 0 ± 0 . 1 . an aliquot of edac was added to the polysaccharide protein mixture to achieve a reaction concentration of 2 . 28 to 2 . 4 g per liter . the ph of the reaction was kept at 5 . 0 ± 0 . 1 for 2 hours at 15 to 30 ° c . after two hours , the ph was adjusted to 7 . 0 ± 0 . 1 using sterile 1n sodium hydroxide , and the reaction was stored at 1 to 5 ° c . for 16 to 20 hours . the reaction mixture was allowed to warm to 15 to 30 ° c . and the reaction vessel was connected to an ultrafiltration unit equipped with a 30 , 000 mwco regenerated cellulose cartridge . solid ammonium sulfate was added to 60 % of saturation ( for serogroups a , w - 135 and y ) and 50 % of saturation ( for serogroup c ). the conjugate reaction mixture was diafiltered against volumes of 60 % of saturated ammonium sulfate solution ( for serogroups a , w - 135 and y ) and 50 % of saturated ammonium sulfate solution ( for serogroup c ), followed by 20 volumes of physiological saline , 0 . 85 %. the diafiltered conjugate was first filtered through a filter capsule containing a 1 . 2 micron and a 0 . 45 micron filter , and then through a second filter capsule containing a 0 . 22 micron filter . the quantity of polysaccharide and o - acetyl content were measured by the same methods used on the depolymerized and derivatized polysaccharide . the quantity of protein was determined by the lowry method . the molecular size of the conjugate was determined by passage through a gel filtration chromatography column sold under the tradename “ tsk6000pw ” that used dna as the void volume marker , atp as the total volume marker , and bovine thyroglobulin as a reference marker . in addition , the molecular size of the conjugate eluted from the tks6000pw column was measured by multi - angle laser light scattering . the antigenic character of the conjugate was measured by binding to antipolysaccharide serogroup specific antibody using double - sandwich elisa method . the purity of the conjugates was determined by measuring the amount of unbound ( unconjugated ) polysaccharide by elution though a hydrophobic interaction chromatography column , unconjugated protein by capillary electrophoresis , sterility , lal ( endotoxin ) content , residual edac content , and residual ammonium ion content . formulation of a multivalent meningococcal a , c , w - 135 , and y polysaccharide diphtheria toxoid conjugate vaccine materials used in this preparation include , serogroups a , c , w - 135 , and y polysaccharide - diphtheria toxoid conjugates ( prepared in accordance with example 5 ), sterile 100 mm sodium phosphate buffered physiological saline ( 0 . 85 % sodium chloride ). an aliquot of sterile 100 - 500 mm sodium phosphate buffered physiological saline was added to physiological saline ( 0 . 85 %) in a stainless steel bulking tank to yield a final vaccine concentration of 10 mm sodium phosphate . an aliquot of each of from two to four of the sterile monovalent meningococcal polysaccharide - diphtheria toxoid conjugates was added to the bulking tank containing 10 mm sterile sodium phosphate physiological saline to yield a final concentration of 8 μg of each serogroup polysaccharide per milliliter of buffer . the formulated tetravalent conjugate was mixed and filtered through a 0 . 2 μm filter into a second bulking tank . the quantity of each serogroup polysaccharide present in the multivalent formulation was determined by component saccharide analysis using high ph anion - exchange chromatography with pulsed amperometric detection . the quantity of protein was measured by the method of lowry . the ph of the vaccine was measured using a combination electrode connected to a ph meter . the antigenic character of the multivalent conjugate vaccine was measured by binding to antipolysaccharide serogroup specific antibody using a double - sandwich elisa method . immunogenicity of the multivalent conjugate vaccine was measured the ability of each conjugate present in the vaccine to elicit both a primary and booster anti - polysaccharide igg immune response in an animal model . the purity of the multivalent conjugate vaccine was determined by measuring the amount of unbound ( unconjugated ) polysaccharide using high ph anion - exchange chromatography with pulsed amperometric detection , sterility , lal ( endotoxin ) content , pyrogenic content , and general safety . preparation of aluminum - hydroxide adjuvanted multivalent meningococcal polysaccharide diphtheria toxoid protein conjugate preparation of conjugate adsorbed to aluminum hydroxide . materials used in this preparation include serogroups a , c , w - 135 , and y polysaccharide - diphtheria toxoid conjugates preparation described in example 5 , sterile physiological saline ( 0 . 85 % sodium chloride ), and sterile aluminum hydroxide in physiological saline ( 0 . 85 % sodium chloride ). an aliquot of each of the sterile monovalent meningococcal polysaccharide diphtheria toxoid conjugates was added to the bulking tank containing physiological saline to yield a final concentration of 8 μg of each serogroup polysaccharide per milliliter of buffer . an aliquot of sterile aluminum hydroxide in physiological saline ( 0 . 85 % sodium chloride ) was added to the multivalent conjugate vaccine to achieve a final concentration of 0 . 44 mg aluminum ion per milliliter vaccine . materials used in this preparation include serogroups a , c , w - 135 , and y polysaccharide - diphtheria toxoid conjugates preparation described in example 5 , sterile physiological saline ( 0 . 85 % sodium chloride ), and sterile aluminum phosphate in physiological saline ( 0 . 85 % sodium chloride ). an aliquot of each of the sterile monovalent meningococcal polysaccharide - diphtheria toxoid conjugates was added to the bulking tank containing physiological saline to yield a final concentration of 8μg of each serogroup polysaccharide per milliliter of buffer . an aliquot of sterile aluminum phosphate in physiological saline ( 0 . 85 % sodium chloride ) was added to the multivalent conjugate vaccine to achieve a final concentration of 0 . 44 mg aluminum ion per milliliter vaccine . the tetravalent conjugate vaccine was studied for its ability to elicit an immune response in small laboratory animals prior to evaluation in the clinic . mice , rats and rabbits have been used to study the immunogenicity of conjugate vaccines relative to the polysaccharide vaccines . these animal models are useful , because they are capable of distinguishing the conjugate vaccine from the corresponding polysaccharide by their immune response pattern . the conjugate vaccine elicits a t - dependent - like immune response in these models , whereas the polysaccharide vaccine elicits a t - independent - like immune response . in the mouse immunogenicity studies , the conjugate was diluted with physiological saline ( 0 . 85 % sodium chloride ) to administer between one - quarter to one - sixteenth of a human dose . the mice were administered one or two doses of vaccine , either conjugate or polysaccharide , and blood specimens were taken two weeks post vaccination . one group of mice served as an unimmunized control group . antibodies to each of the serogroup polysaccharides were measured by an elisa method . the serum samples were incubated with excess of each capsular polysaccharide that was bound to a elisa microtiter plate well . methylated human serum albumin was used to bind each serogroup polysaccharide to the microtiter well . following incubation the microtiter well was washed with buffer , and a secondary antibody - enzyme conjugate was added to the antibody - polysaccharide complex which binds to the anti - meningococcal polysaccharide antibody . the microtiter plate was washed , and a chemical substrate was added to the polysaccharide - meningococcal antibody - secondary antibody - enzyme conjugate . the enzyme hydrolyzes a portion of the chemical substrate that results in color formation . the amount of color formation is proportional to the amount of polysaccharide - meningococcal antibody - secondary antibody - enzyme conjugate that is bound to the microtiter well . the potency of the vaccine was determined by comparison to reference antisera for each serogroup , which is measured in the same microtiter plate , by a parallel line calculation using a four - parameter fit . the mouse reference antisera was generated in the same strain of mice that were individually immunized with three doses of each serogroup conjugate vaccine . the mouse reference antisera were assigned titers based on the inverse of dilution yielding an optical density of 1 . 0 . presented in table 1 is a summary of anti - polysaccharide igg titers for each serogroup achieved in swiss - webster mice who were vaccinated with two doses of either the tetravalent conjugate vaccine , both liquid and aluminum hydroxide formulation , or the corresponding tetravalent polysaccharide vaccine . the igg titers were measured on pooled sera from a set of ten mice . two sets of 10 mice were used to measure the immune response to each vaccine formulation . both sets were vaccinated on day 1 . on day 15 ( 2 weeks post vaccination ) blood specimens were taken from one set of 10 mice , and the second set of ten mice were vaccinated with a second dose of vaccine on day 15 . two weeks late on day 29 , blood specimens were taken from the second set of 10 mice , and from the unimmunized control group . all antibodies were titrated at the same time , that is , both the day 15 and day 29 blood specimens were assayed at the same time along with the unimmunized controls and the mouse reference sera . the tetravalent conjugate vaccine , both unadjuvanted and adjuvanted with aluminum hydroxide , is capable of eliciting a strong anti - polysaccharide igg immune response in this mouse model . the aluminum hydroxide adjuvant serves to improve both the primary and booster response to each of the four serogroup polysaccharide conjugates . the tetravalent polysaccharide vaccine elicits a negligible immune response to serogroups a , c , and w135 in this mouse model relative to the unimmunized control , whereas serogroup y does elicit a respectable immune response , but not a booster response . the tetravalent polysaccharide vaccine fails to elicit a booster response to all four serogroup polysaccharides in this model . this model can readily differentiate between the polysaccharide vaccine and the conjugate vaccine both by the magnitude of the immune response and booster response pattern to each of the serogroup conjugate vaccines . the unadjuvanted form of the tetravalent conjugate vaccine has been studied in the clinic for safety and immunogenicity in young healthy adults and in young healthy children . in the adult study , subjects were vaccinated with a single dose of vaccine , formulated to contain 4 μg of each of the four conjugates , as polysaccharide . blood specimens were taken immediately prior to vaccination and 28 - days post vaccination . antibodies to each of the serogroup conjugates were measured by an elisa measurement that quantified the amount of anti - polysaccharide igg . the elisa method is very similar to the method used to measure the amount if igg antibody present in mouse sera . briefly , the serum samples were incubated in elisa microtiter wells that were coated with excess meningococcal polysaccharide that was bound to the plate with methylated human serum albumin . the amount of bound antibody was determined by a reaction with peroxidase - labeled mouse anti - human igg specific monoclonal antibody . a subsequent reaction using peroxidase substrate generates a chromogenic product that was measured spectrophotometrically . the resulting optical density of the chromophore correlates with the amount of igg antibody in the serum that is bound to the meningococcal polysaccharide on the microtiter plate . the amount of antibody was calculated by comparison to a human reference sera ( cdc 1922 ) with an assigned value using a 4 - parameter logistic curve method . in addition , the antibodies were measured for their ability to lyse serogroup specific bacteria . the serum samples are first heat - inactivated to destroy complement . the serum samples are diluted by two - fold dilutions in a sterile 96 - well microtiter plate . serogroup specific bacteria along with baby rabbit complement were added to the serum dilutions and allowed to incubate . after an incubation period , an agar overlay medium was added to the serum / complement / bacteria mixture . the agar overlay was allowed to harden , and then incubated overnight at 37 ° c . with 5 % carbon dioxide . the next day , bacterial colonies present in the wells were counted . the endpoint titer was determined by the reciprocal serum dilution yielding greater than 50 % killing as compared to the mean of the complement control wells . presented in table 2 is a summary of the anti - polysaccharide mean igg concentrations for each serogroup and the mean serum bactericidal antibody ( sba ) titer in adult sera pre and post vaccination with the tetravalent conjugate vaccine formulated at 4 μg polysaccharide per dose . the immune response to all four serogroup conjugates were satisfactory , that is comparable to the immune response achieved by the licensed polysaccharide vaccine in terms of both igg antibody and functional bactericidal antibody responses . the vaccine was found to be safe for this age group and the safety profile was found to be similar to that of the licensed polysaccharide vaccine . in younger age groups , children less than 2 years of age , the immune response to the polysaccharide vaccine is weak and the immunity has been estimated to wane after one year . children 12 to 15 months of age were administered a single dose of tetravalent conjugate vaccine formulated at 4 μg of each serogroup polysaccharide per dose , and they were administered a second dose of tetravalent conjugate vaccine two months following the first dose . blood specimens were taken prior to the first and second vaccination , and one month post the second vaccination . the antibody responses to the four serogroup conjugates are summarized in table 3 . for each serogroup a booster response for igg antibody and for functional - bactericidal antibody was observed following a second dose of tetravalent conjugate . the level of igg antibody elicited by the conjugate vaccine is comparable to that elicited by the licensed polysaccharide for this age group ; a post 6 week response of 3 . 64 μg / ml ( 2 . 96 - 4 . 49 ) igg antibody response to serogroup c polysaccharide . however , the level of bactericidal antibody elicited by the conjugate vaccine is much higher than what is normally elicited by the licensed polysaccharide vaccine for this age group ; a post 6 week sba titer of 7 . 2 ( 5 . 0 - 10 . 4 ). the reason for this discordance between igg antibody and bactericidal antibody in the younger populations is thought to result from the polysaccharide eliciting a high proportion of low avidity antibody in the younger populations . conversely , the conjugate appears to elicit a much higher proportion of high avidity antibody . high avidity antibody is thought to be responsible for the bactericidal activity . in addition to the ability of the tetravalent conjugate vaccine to elicit a high functional antibody response in younger populations compared to the licensed polysaccharide vaccine , the tetravalent conjugate vaccine is capable of eliciting an anamnestic response , demonstrating that protection elicited by the tetravalent conjugate vaccine of the present invention is long - lived . in the development of the tetravalent conjugate vaccine , studies were first conducted on a bivalent ac conjugate formulation . the vaccine offers wider coverage than the current licensed monovalent c conjugate , but does not protect against disease caused by serogroups w135 and y . a clinical study was performed with infant subjects that compared the immune response to the bivalent ac polysaccharide vaccine versus the bivalent ac conjugate vaccine . in this study , a third group of infants were enrolled to serve as a control group and they received a haemophilus influenzae type b conjugate . all three vaccine groups receive the same pediatric vaccines . the bivalent ac conjugate group received three doses of conjugate vaccine ( 4 μg polysaccharide per dose ) at 6 , 10 , and 14 weeks of age . the bivalent ac polysaccharide group received two doses of a bivalent ac polysaccharide vaccine ( 50 μg polysaccharide per dose ) at 10 and 14 weeks of age . the haemophilus influenzae type b conjugate group received three doses of conjugate vaccine at 6 , 10 , and 14 weeks of age . blood specimens were taken at 6 weeks , pre - vaccination , and at 18 weeks , 4 weeks post vaccination . when the children were 11 to 12 months of age , blood specimens were taken and the children who had received either the bivalent ac conjugate or the bivalent ac polysaccharide vaccine received a booster dose of ac polysaccharide . the reason for the booster dose of polysaccharide was to evaluate whether or not the subjects would elicit an anemestic response . the results of this study , both the primary and polysaccharide booster immune responses are presented in table 4 for the igg antibody response and table 5 for the sba antibody response . the igg antibody response post primary series was approximately the same for both the polysaccharide and conjugate vaccine . however , the bactericidal antibody response in the conjugate vaccinated subjects was much higher than that for the polysaccharide vaccinated subjects . as observed with the one year old subjects , vaccination of infants with the polysaccharide elicits very little functional - bactericidal antibody . the antibody elicited by the infants to the polysaccharide vaccine is presumably low avidity antibody , whereas , the conjugate vaccine appears to elicit high avidity antibody , thereby accounting for the much higher titer of bactericidal antibody . the high level of functional antibody elicited by the booster dose of polysaccharide vaccine in the subjects who had received the conjugate vaccine in the primary vaccination series , indicates that these subjects have been primed for a memory or t - cell dependent antibody response . the subjects who received the polysaccharide vaccine in the primary vaccination series elicited a modest response to the polysaccharide booster dose , that is indicative of a t - cell independent in addition to the benefits that this invention offers to the improved protection against meningococcal disease in young populations and the wider protection against serogroups a , c , w - 135 and y , the tetravalent conjugate may provide protection to other pathogens by inducing an antibody response to the carrier protein . when the tetravalent conjugate vaccine , using diphtheria toxoid conjugate , was administered to infants , these subjects also received the routine pediatric immunizations , which included diphtheria toxoid . therefore , in these subjects there was no apparent improvement in the antibody response to diphtheria toxoid . however , when the diphtheria toxoid conjugate was administered to subjects that did not receive concomitant diphtheria toxoid containing vaccines , a strong booster response to diphtheria toxoid was observed . these subjects had received a three dose regiment of dtp at 2 , 3 , and 4 months of age . in this study , the subjects received either single dose of a bivalent ac conjugate or a single dose of bivalent ac polysaccharide vaccine between 2 and 3 year of age . blood specimens were taken at the time of vaccination and 30 - days post vaccination . the bivalent ac conjugate used diphtheria toxoid as the carrier protein . the immune response of diphtheria toxoid in the two vaccine groups is presented in table 6 . the polysaccharide did not serve to stimulate an anti - diphtheria immune response in these subjects as expected , however a strong anti - diphtheria immune response was observed for the subjects receiving the ac conjugate . therefore , the meningococcal conjugate vaccine may provide an added benefit of stimulating an immune response to carrier protein thereby providing protection against diseases caused by corynebacteria diphtheriae when diphtheria toxoid is used as a carrier protein . | US-201313843037-A |
a new and distinct variety of nectarine tree var . nucipersica , and which is denominated varietally as ‘ burnectseven ’, and which produces an attractively colored yellow - fleshed clingstone nectarine which is mature for harvesting and shipment approximately july 15 to july 22 under ecological conditions prevailing in the san joaquin valley of central california . | referring more specifically to the pomological details of this new and distinct variety of nectarine tree , the following has been observed in the fourth fruiting season under the ecological conditions prevailing at orchards located near the town of fowler , county of fresno , state of california . all major color code designations are by reference to the r . h . s . colour chart ( fourth edition ) provided by the royal horticultural society of great britain . size .— generally . — considered medium large as compared to other common commercial nectarine cultivars ripening in the mid season of maturity . the tree of the present variety was pruned to a height of approximately 314 . 8 cm to 386 . 7 cm at maturity . vigor .— moderately vigorous . the present variety grew from about 141 . 0 cm to 195 . 7 cm in height during the first growing season . the variety was pruned to a height of approximately 106 . 7 cm in the first dormant season and primary scaffolds were selected for the desired tree structure . productivity .— productive . fruit set varies from 2 . 0 to several times more than the desired crop load . fruit set is spaced by thinning to develop into desired market sized fruit . the number of fruit set varies with climatic conditions and cultural practices during the bloom period and is therefore not distinctive of the variety . bearer .— regular . fruit set has been heavy and thinning was necessary during the past 4 years . density .— medium dense . it has been discovered that pruning the branches from the center of the tree to obtain a resulting vase shape allows for air movement and appropriate amounts of sunlight to enhance fruit color and renewal of fruiting wood throughout the tree . hardiness .— the present tree was grown and evaluated in usda hardiness zone 9 . winter chilling requirements are approximately 700 hours below 7 . 0 degrees c . the variety appears to be hardy under typical central san joaquin valley climatic conditions . diameter .— approximately 16 . 0 cm in diameter when measured at a distance of approximately 15 . 24 cm above the soil level , at the end of the fourth growing season . bark texture .— considered moderately rough , with numerous folds of papery scarfskin being present . lenticels .— numerous flat , oval lenticels are present . the lenticels range in size from approximately 2 . 0 to 5 . 0 millimeters in width , and from 1 . 0 to 2 . 0 millimeters in height . bark coloration .— variable , but it is generally considered to be a grey - brown , ( rhs grey - brown group n199 b ). diameter .— average as compared to other varieties . the branches have a diameter of about 7 . 0 centimeters when measured during the fourth year after grafting . surface texture .— average , and appearing furrowed on wood which is several years old . crotch angles .— primary branches considered variable between about 45 to 49 degrees from the horizontal axis . this characteristic is not considered distinctive of the variety however . color of mature branches .— medium brown , ( rhs grey brown group n199c ). current seasons shoots .— color — light green , ( rhs yellow green group144 d ). the color of new shoot tips is considered a bright and shiny green ( rhs green group 141 c ). size .— considered medium for the species . leaf measurements have been taken from vigorous , upright , current - season growth at approximately mid - shoot . leaf base shape .— slightly oblique relative to the leaf longitudinal axis . mid - vein .— color . — light yellow green , ( rhs yellow green group 145 c ). leaf margins .— slightly undulating . form . — considered crenate , occasionally doubly crenate . uniformity . — considered generally uniform . leaf petioles .— size . — considered medium long to long . length . — 9 . 0 to about 12 . 0 mm . diameter . — 1 . 5 to about 2 . 5 mm . color . — pale green , ( rhs yellow green group 144 d ). leaf glands .— size . — about 1 . 0 mm in height and about 1 . 0 to 2 . 0 mm in width . number . — generally one per side , occasionally two or more per side . type . — reniform , considered reasonably unappressed to the petiole margin . color . — greenish brown , ( rhs yellow green group146 b ). leaf stipules .— size . — medium large for the variety . number . — typically 2 per leaf bud and up to 6 per shoot tip . form . — lanceolate in form and having a serrated margin . color . — green , rhs green group 132 a ) when young but graduating to a yellow - brown color , ( rhs grey orange group 177 a ) with advancing senescence . the stipules are considered to be early deciduous . flower buds .— generally — the floral buds , depending on stage of development are approximately 10 millimeters wide ; and about 15 millimeters long , conic in form ; and slightly appressed relative to the bearing shoot . flower buds .— color — the bud scales are reddish - brown , ( approximately rhs greyed purple group 183 a ). the buds are considered hardy under typical central san joaquin valley climatic conditions . hardiness .— no winter injury has been noted during the last several years of evaluation in the central san joaquin valley . the current variety has not been intentionally subjected to drought or heat stress and therefore this information is not available . blooming time .— considered mid - season in comparison to other commercial nectarine cultivars grown in the central san joaquin valley . date of full bloom was observed on mar . 2 , 2000 . the date of bloom varies slightly with climatic conditions and cultural practices . duration of bloom .— approximately 8 days . this date varies slightly with climatic conditions . flowers type .— the variety is considered to have a showy type flower . flower size .— flower diameter at full bloom is approximately 40 . 0 to 44 . 0 millimeters . petal size .— generally — considered large to very large for the species . length . — approximately 18 . 0 to 20 . 0 millimeters . width . — approximately 17 . 0 to 19 . 0 millimeters . petal color .— light pink when young , ( rhs red purple group 62 b ), and darkening with advancing senescence and exposure to sunlight to a medium to dark pink , ( rhs red purple group 62 a ). petal claw .— form . — the claw is considered truncate and has a medium - large size when compared to other varieties . length . — approximately 8 . 0 to 10 . 0 millimeters . width . — approximately 7 . 0 to 9 . 0 millimeters . petal margins .— generally considered variable , from nearly smooth , to moderately undulate and ruffled , especially apically . petal apex .— generally — the petal apices appear somewhat elongated and slightly domed . flower pedicel .— length . — considered medium - long , and having an average length of approximately 3 . 0 to 4 . 0 millimeters . diameter . — considered average , approximately 2 . 0 millimeters . color . — a medium brown , ( rhs grey brown group n199 d ). floral nectaries .— color . — a dull orange - gold , ( rhs greyed orange group 169 b ). calyx .— surface texture . — generally glabrous . color . — a dull red , ( approximately rhs greyed purple group 183 a ). sepals .— surface texture . — the surface has a short , fine , and wooly texture . size . — average , and ovate in form . color . — a dull red , ( approximately rhs greyed - red group 178 a ). anthers .— generally . — average to above average in length . color . — red to reddish - orange dorsally , ( approximately rhs greyed red group 179 a ). pollen production .— pollen is abundant , and has a yellow color , ( approximately rhs yellow orange group 17 b ). filaments .— size . — variable in length , approximately 11 . 0 to 13 . 0 millimeters in length . color . — pinkish - white , ( rhs red purple group 62 d ). pistil .— number . — usually 1 , rarely 2 . generally . — average in size . length . — approximately 15 . 0 to 18 . 0 millimeters including the ovary . color . — considered a very pale green , ( approximately rhs yellow green group 151 d ). surface texture . — the variety has a long glabrous pistil . maturity when described .— firm ripe condition ( shipping ripe ). date of first picking . — jul . 15 , 2000 . date of last picking . — jul . 22 , 2000 . the date of harvest varies slightly with climatic conditions . typical weight .— approximately 251 . 0 grams . this is highly dependent upon cultural practices and therefore not distinctive of the variety . fruit form .— generally — moderately oblate . the fruit is generally uniform in symmetry . fruit suture .— shallow , occasionally lipped , and extending from the base to apex . no apparent callusing or stitching exists along the suture line . suture .— color — this appears to be a yellow to golden yellow background , ( approximately rhs orange group 26 b ) and occasionally having some red coloration , ( approximately rhs red group 46 b ). stem cavity .— rounded to slightly elongated in the suture plane . average depth of the stem cavity is about 1 . 45 cm . average width is about 2 . 41 cm . fruit skin .— thickness . — considered medium in thickness , and tenacious to the flesh . texture . — glabrous . taste . — non - astringent . tendency to crack . — none observed . color .— blush color . — this red blush color is variable from a reddish orange , ( approximately rhs red orange group 34 a ) to a dark red , ( approximately rhs red group 45 c ). the blush color ranges from about 70 % to about 90 % of the fruit surface depending on sunlight exposure and growing conditions . ground color . — yellow orange , ( approximately rhs yellow orange group 21 b ). fruit stem .— medium in length , approximately 7 . 0 to 8 . 0 millimeters . diameter . — approximately 2 . 0 to 3 . 0 millimeters . color . — pale yellow - green , ( approximately rhs yellow green group 144 d ). flesh .— ripens . — evenly . texture . — firm , and dense . fibers . — few , small , and tender . aroma . — very slight . eating quality . — very good . flavor . — considered sweet and mildly acidic . the flavor is considered both pleasant and balanced . juice . — moderate . brix . — about 13 . 0 degrees . this characteristic varies slightly with the number of fruit one the tree , prevailing cultural practices and surrounding climatic conditions . flesh color . — pale yellow , ( approximately rhs yellow orange group 16b ). base .— the stone is usually rounded , but it may vary from rounded to straight . apex .— shape . — the stone apex is raised and has an acute , short tip . stone surface .— surface texture — irregularly furrowed toward the apex , and pitted toward the base . the stone exhibits substantial pitting laterally . substantial grooving over the apical shoulders is evident . surface pitting is prominent generally , and more frequently , it is present basally . ridges . — the surface texture varies from sharp to rounded . ventral edge . — width — considered medium , and having a dimension of approximately 3 to 4 millimeters at the mid - suture . the wings are most prominent over the basal area . dorsal edge . — shape . — full , heavily grooved , and having jagged edges . the dorsal edge is moderately eroded over the apical shoulder . stone color .— the color of the dry stone is a dull red , ( approximately rhs greyed red group 179b ). kernel .— size . — length 17 . 0 mm . width — 14 . 0 mm . thickness — 3 . 0 millimeters . form . — obovoid . pellicle . — pubescent . color . — ( rhs greyed orange group 166 c ). use .— the subject variety ‘ burnectseven ’ is considered to be a nectarine tree of the late mid - season maturity , and which produces fruit which are considered very firm , attractively colored , and which are useful for both local and long distance shipping . keeping quality .— excellent . fruit has stored well up to 21 days after harvest at 1 . 0 degree celsius . shipping quality .— good . fruit showed minimal bruising of flesh or skin damage after being subjected to normal harvesting and packing procedures . resistance to insects and disease .— no particular susceptibilities were noted . the present variety has not been tested to detect for any susceptibilities or resistances to any known plant and / or fruit diseases . although the new variety of nectarine tree possesses the described characteristics when grown under the ecological conditions prevailing near fowler , calif ., in the central part of the san joaquin valley of california , it should be understood that variations of the usual magnitude and characteristics incident to changes in growing conditions , fertilization , pruning , pest control and horticultural management are to be expected . | US-4218602-V |
a plunger that operates by a piston to drive a purging flow at relatively high pressure is disclosed . the plunger includes features so that the exterior of the plunger remains in a dry and sanitary condition . an optional storage unit is also disclosed where the storage unit includes at least one uv element . where the uv element decreases the amount of pathogens on the plumbing tool . | the subject invention provides devices and methods for clearing an obstruction from a drainage outlet (“ outlet ”) of a toilet , sink , washbasin , shower , bath , urinal , and the like . although variations of the devices described herein are discussed primarily for use in clearing an obstruction from a toilet , the devices and systems are not limited to such a use unless otherwise discussed . although the subject plungers described herein work optimally with its seal engaged under submerged conditions , variations of the invention may not be required to function in this manner . embodiments of the subject invention are described with reference to fig1 - 8c . generally , embodiments of the subject plunger are constructed to prevent contents of the toilet ( water , waste , obstruction particulates , etc . ), from contacting the exterior surface of the plunger when the plunger is used to dislodge or break - up an obstruction in a toilet , thereby preventing liquid from coming in contact with the user of the plunger — especially the user &# 39 ; s hands when using the plunger . fig1 a illustrates a variation of a plunger assembly 100 according to the present invention . as illustrated , the plunger assembly or device 100 includes a handle 108 , a neck portion , and a compliant member 112 . typically the plunger 100 will comprise a handle 108 and a gripping section . in the variation of fig1 a , the gripping section may comprise a neck portion 110 such that the handle 108 and gripping portion are on the upper part of the plunger body . however , variations of the plunger 100 include a gripping portion that is found on a lower part of the plunger body . the compliant member 112 is sufficiently compliable and / or conformable to permit formation of a seal between the plunger 100 and drain and / or toilet . a full or partial seal allows the plunger 100 to intake and exhaust fluids to clear any obstructions . the compliant member 112 for use with the devices described herein may be resiliently deformable members such as a soft , pliable double wall gasket such as an elastomeric gasket . the compliant member 112 can be conformable to the bottom or liquid dispensing end of the plunger and adapted to sealingly engage the opening of a the toilet outlet or drain . the gasket thus provides a flexible member that may form a seal against a variety of toilet bowl shapes and is adapted to allow a distal plunger location for flow - by liquid to discharge from the plunger ( into the bowl during use or into the base if it has not fully drained when it is put away ). the gaskets may be double walled gaskets . as shown herein , the gasket may connect to the housing wall to form a double lap joint and to the sleeve wall to form a single lap joint , as well as being adapted to be permissive of liquid flow therethrough . the gasket can include at least one through hole by which liquid ( from within the chamber and / or from the flow - by path ) is dispensed from the plunger to the drain . in certain embodiments , a gasket includes at least one liquid dispensing opening in communication with the interior of the sleeve and at least one liquid dispensing opening in communication with a flow - by path . as noted above , in the variation of fig1 a , the upper portion of the plunger 100 comprises the handle 108 and neck portion 110 . where the neck portion 108 is convenient for the user to grip when using the plunger 100 . although not shown , variations of the invention include a handle 108 and / or neck portion 110 having a handle grip type configuration to allow for the user to apply greater force when using the plunger 100 . the lower body portion generally includes the compliant member 112 and the part of the plunger 100 containing a reservoir ( not shown in fig1 a ). again , variations of the plunger 100 include the gripping portion located on the lower body portion . the system described herein may include base 200 , where the lower body portion nests within the base 200 when not in use . as shown , the base 200 may include drain openings 202 to allow any liquids to drain from the plunger 100 when in storage . fig1 b illustrates an exploded view of the plunger device 100 . as shown , the piston 106 is slidably located within a reservoir portion or first chamber 102 . the piston 106 is coupled to a shaft 114 . the shaft 114 terminates in a handle 108 . this configuration allows an operator to grasp the neck portion 110 and handle 108 to actuate the plunger device 100 while allowing the working end of the device 100 to direct fluid . as illustrated , the neck portion 110 may contain ribs to increase its column strength . alternatively , the neck portion may be solid . variations of the device 100 include at least two shells that form the body of the device 100 . alternatively , the plunger device 100 may be a single uniform piece of material . in any case , plugs may be used to fill any openings ( caused by fastening members ) in the external portion of the plunger body . as discussed below , the internal surfaces of the plunger assembly 100 may be reflective such that uv light is reflected within the reservoir to assist in sterilizing the plunger . alternatively , or in combination , a uv light source or other sterilization source , may be placed within the reservoir or housing of the plunger . in such cases , a power supply will be coupled to the plunger ( either through a coupling in the base , a battery operated system in the plunger body , or an external plug or charging source . furthermore , a photocatalyst may be provided with the plunger . for example , the photocatalyst may be provided in the material forming the plunger parts . alternatively , or in combination , the photocatalyst may be provided as a separate insert that is placed within the plunger . in any case , the photocatalyst will be placed within a line - of - sight of the uv light source and / or it will be placed such that uv light shines onto and activates the catalyst . fig1 b also shows the plunger 100 including a reservoir for displacement of fluids ( where fluids include gas and liquids ). the reservoir is generally divided into a first reservoir portion 102 or first chamber 102 and a second reservoir portion 104 or second chamber 104 . the reservoir , usually the first reservoir portion 102 terminates at an opening 118 in the lower body portion , where the opening is adapted to direct fluid into the drain . the piston 106 is slidably moveable in the reservoir , such that movement of the piston displaces fluid from the first reservoir portion 102 to the second reservoir portion 104 . the second reservoir portion 104 comprises at least one port 120 in the lower body portion allowing liquid in the second reservoir portion 104 to exit the plunger 100 body at a location away from the upper body portion . this assists in preventing fluid wastes from the plunger 100 from contacting the user &# 39 ; s hands . in the variation of fig1 b , the first and second reservoir portions 102 , 104 are separated by a wall 116 . the wall 116 spaces the first reservoir portion 102 from the body of the plunger . the spacing may then form the second reservoir portion 104 . to permit fluid flow between the reservoir portions , the wall can be open at the top of the reservoir portions 102 , 104 to allow for fluids to be displaced between reservoir portions 102 , 104 . for example , when the piston moves from the bottom of the plunger to the top of the first reservoir portion , air in the first reservoir portion displaces into the second reservoir portion . it is noted that any liquid may also move to the second reservoir portion without contacting the user or exterior of the plunger . as the piston moves upward in the plunger body , liquids fill in the first reservoir portion through the opening 118 in the bottom of the plunger . this fluid path between reservoir portions 102 , 104 is referred to as a “ flow - by path ”. it should be noted that the wall may have other openings as well as openings in the top . fig1 c illustrates a view of the bottom of the plunger 100 . as shown , the opening 118 of the reservoir is adjacent to the compliant member 112 . some variations of the device 100 may include a compliant member 112 having a cavity 122 ( not shown ). in such cases , the cavity 122 will have cavity openings 124 or apertures 124 to allow fluid to drain from the plunger through the port 120 of the reservoir . variations of the device 100 include ports that deliver fluid to an external surface of a lower body portion of the plunger or even back into the reservoir . fig1 d illustrates a partial sectional view of the plunger 100 of fig1 a - 1b . as shown , the piston 106 is slidably moveable within the first reservoir portion 102 . the shaft 114 passes through the reservoir and into the neck portion 110 . to prevent liquids form entering the neck portion 110 , a shaft opening 115 into the neck portion 110 may have a close tolerance to the shaft 114 and / or a seal may be used . in addition , to allow fluid communication between reservoir portions 102 , 104 , one or more flow - by openings 119 may be used . for example , if the plunger 100 uses a wall 116 to separate reservoir portions 102 , 104 , then the wall may have openings 119 as shown . alternatively , if the first reservoir portion 102 is defined by a sleeve 126 , then the sleeve may have openings 119 or may have an insert or cap with such openings 119 . fig2 a illustrates another variation of a plunger 100 according to principles described herein . fig2 b shows a cross sectional view taken along the lines a - a of fig2 a . as shown , the plunger 100 includes a sleeve 126 defining a first reservoir portion 102 or first chamber 102 . where , a piston head 106 is moveable in the first chamber 102 and serves as the mechanism to draw fluid in the assembly 100 and generate hydraulic pressure to unclog a drain such as a toilet drain or the like . as shown in fig2 b , the second reservoir portion 104 or second chamber 104 is exterior to the first reservoir portion 102 or first chamber 102 . as discussed above , the sleeve 126 is open at the top to allow for a flow - by path between chambers . this permits confinement of liquid within plunger device . fig2 c is an expanded view of the balloon 2 c from fig2 b . as shown , the double wall construction formed by the sleeve 126 helps confine liquid that may pass behind the piston 106 . this fluid is referred to as “ flow - by liquid ”. the flow - by liquid then exits the device 100 in a direction away from the user / handle 108 . fig2 d is an expanded view of the balloon 2 d from fig2 b . as shown , the port 120 from the second chamber 104 permits flow - by liquid to enter into a cavity 122 of the compliant member or gasket 112 . the flow - by liquid then exits via the aperture 124 . in this manner , the component pieces of the plunger 100 direct liquid to exit the plunger ( e . g ., to return to the toilet , or drain into the base 200 ) without contacting the exterior surface of the plunger . as noted above , variations of devices includes aperture and / or ports that deliver flow - by liquid externally to the body of the plunger in the lower body portion . fig3 a - 3e illustrate various internal components of the plunger 100 . fig3 a illustrates a variation of a sleeve 126 for use with a plunger 100 . as shown , the sleeve 126 includes mating portion 128 . the mating portions may be threaded portions , have ridges , or other such features that allow for placement and securing of the sleeve within the plunger body and ( optionally ) to the compliant member or gasket . typically , the bottom end of the sleeve allows for liquid to pass into and out of the plunger . the top end of the sleeve may be adapted to provide substantially unobstructed flow for flow - by liquid to the flow - by path . the top end of the sleeve may be substantially , including completely , open , thereby accommodating a wide volume of liquid that may leak past the piston / sleeve seal during use of the plunger . fig3 b illustrates a sleeve 126 being joined to a gasket 112 . fig3 c illustrates a gasket 112 or compliant member 112 . the gasket may be comprised of a thermoplastic elastomer . as noted herein , the materials used for the gasket are capable of cyanoacrylates and epoxies . the materials should be useful for industrial applications and should b compatible with heavy alkalis . fig3 d shows a variation of a piston 106 . the piston 106 may be fabricated from a thermoplastic elastomer , thermoplastic rubber / resin , polypropylene or any similar material . as shown , the piston may have a double seal and a flat top . both ‘ ridgelines ’ or seals on the piston may form an independent seal with the sleeve . finally , the top of the piston should not have cavities or wells in which ‘ flow - by ’ liquid may collect . however , other configurations of pistons may also be employed . fig3 e illustrates a shaft 114 . the shaft 114 may be fabricated from a stiff material such as a steel coated with a corrosion inhibiting material . alternatively , the shaft may be fabricated from a stiff polymer . fig4 a - 4c illustrates another variation of a set of internal components . fig4 a shows a sleeve 126 that is positioned in the interior of the housing and maintained in a fixed position by one or more sleeve - holding members or fixtures 130 , 132 which may be in the form of rings ( e . g ., rings with perforations to maintain the flow - by path allowing for passage of flow - by liquid ). for example , an upper retaining ring and / or a lower retaining ring may be used . the sleeve 126 may be spaced a distance apart from the housing so that spacing between the outer surface of the sleeve and the inner surface of the housing is provided that defines a liquid flow - by path for flow - by liquid . alternatively or in addition , the sleeve may include external grooves or flow channels for flow - by liquid . in one variation , the sleeve outer housing and flow channels may provide an integrated or one - piece structure . in any case , spacing between the first reservoir portion 102 ( i . e ., the piston bore ) and housing defines the second reservoir portion 104 and provides a liquid flow path that is adapted to receive flow - by liquid and direct the flow - by liquid to the bottom or dispensing end of the plunger . the flow - by path terminates at the distal or bottom end of the plunger or another location distal a user &# 39 ; s grip position for return of flow - by liquid to the toilet bowl without user contact . the sleeve 126 with the piston therein provides a chamber suitably constructed for receiving and holding liquid , until the liquid dispenses from the reservoir ( or chambers ) through an outlet to a toilet , by actuation of the piston . the chamber is designed to be compatible with substantial liquid contact . in other words , the chamber is constructed so that it is robust for repeated contact with liquid ( e . g ., toilet water , waste , etc . ), and does not provide an environment for fostering microbial growth that may result from contact with contaminated toilet water . the sleeve 126 is typically substantially rigid and constructed to maintain rigidity upon repeated and prolonged liquid contact . the sleeve 126 will typically be constructed of material that is compatible with drain - cleaning liquids , e . g ., heavy alkali drain cleaners . a smooth bore is preferred , so seams should be avoided . generally , extruded , pulltruded or cast polymeric material will suffice . material of interest include , but are not limited to , polypropylene , poly ( vinyl chloride ), and other opaque , stiff , non - hydrophillic or hydrophobic thermoplastics , preferably one that is capable of adhesion with epoxies and cyanoacrylates . however , some choice of materials may be preferable for ease of manufacturing but such materials may not hold up to the heavy alkali drain cleaner discussed above . materials include pvc , polypropylene or other such materials . the piston typically includes a polymeric material . the piston may be a simple disc or be otherwise suitably configured . the type of seal required must be one such that the user can easily actuate the rod or handle attached to the seal . consequently , the seal may not be air or liquid tight . yet , it will generally only “ leak ” or allow about 0 . 001 % to about 2 % of the liquid it is driving past its face to pass . still , either a better or worse seal may be employed . the chamber is configured to hold and dispense a suitable volume of liquid for the various applications . for example , when intended for use to unclog a toilet , the chamber may have a liquid volume capacity ( i . e ., the volume of liquid that may be displaced by one stroke ) that ranges from about 0 . 25 to about 2 liters , e . g ., 0 . 5 to about 1 . 0 liters . in certain embodiments , the volume of liquid that may be displaced by one stroke may be as little as about 0 . 05 liters , e . g ., if a motor is employed as described below . variations of the device include plungers with housings that include the sleeve - retaining portions and an elongate neck portion , wherein the two may differ in shape and / or size . for example , a sleeve - retaining portion may be in the form of a curved body portion ( e . g ., a bulbous portion ), which curved body portion extends into a narrower neck portion that terminates in an opening . such features may offer both design appeal as well as improved ergonomics . the neck portion of the housing may be adapted to accommodate a shaft connected to the piston . the piston shaft may terminate in a user - contactable handle or knob which may protrude from the opening of the neck portion of the housing . the handle and / or neck may be configured to provide an ergonomic holding and controlling location for the operator of the plunger . an operator may hold the handle and move it upward and downward to drive the piston inside the sleeve in a reciprocating manner causing liquid to be dispensed from the plunger to the toilet outlet . variations of the device may include motor means disposed in the housing for driving the piston assembly in reciprocating motion . the motor may be actuated by a manual switch secured to the housing . in another variation of the plunger , a system is provided that includes a brush portion ( not shown ) to be received at the bottom end of the plunger such that a subject plunger may be configured as a toilet brush . alternatively , the body of the plunger may be adapted to accommodate either one of the seal or brush in an interchangeable fashion . when no brush is attached to the plunger body , it may be received by a base . the base may include a central protuberance to help capture or stabilize the plunger received thereon . adjacent this section , drain holes may be provided to allow fluid that remains in the plunger body to eventually leak out to accumulate in a reservoir base . such a reservoir can be threaded onto or into an upper portion of the base . a chamber provided by these various components may be sized to receive a toilet puck , wafer or disk to aid in odor control . methods according to the invention include loading a plunger with liquid to be used to hydraulically clear an obstruction . however , fig5 a - 5c illustrate an example of use of a plunger 100 to clear a toilet . in using a subject plunger , downward hydraulic pressure may be repeatedly applied on an obstruction to dislodge or break - up the obstruction without contacting the exterior of the plunger with any liquid that bypasses the piston / sleeve seal of the device . use generally includes two successive plunger strokes — a liquid pickup or loading stroke , followed by a liquid dispensing stroke . this cycle may be repeated a number of times to address the issue at hand as shown in fig5 a , the user positions a bottom end of the plunger 100 into a drain ( in this case the toilet ). next , the compliant member 112 forms a seal between the body of the plunger 100 and the drain . alternatively , the bottom end of the plunger is simply placed within liquid and water is drawn into the reservoir and then the end of the plunger forms a seal with the drain . fig5 b shows a pulling motion on the handle 108 while the operator &# 39 ; s hand holds the neck portion . this action draws liquid into the sleeve by causing the piston to move in a proximal direction within the reservoir . ( i . e ., away from the drain outlet ). once loaded , the liquid may then be dispensed from the plunger with force . fig5 c illustrates a downward motion on the handle 108 . generally , the handle is pulled back and forth , causing the piston to move within the sleeve to force one or more streams of liquid from the sleeve and into the drain to dislodge and / or break - up an obstruction . this action may be repeated one or more times as needed . in certain embodiments , between about 2 and about 10 successive strokes may be used . as discussed above , the use of the structure described above ( including sealing the plunger , and the flow - by paths ) prevents liquid from splashing or otherwise contacting the user &# 39 ; s hands . furthermore , the device only permits liquid to exit the device towards the bottom portion to avoid contacting the user . fig6 a illustrates an example of a base 200 for use with plungers of the present invention . as shown , the base 200 may optionally include one or more drain holes 202 to drain liquids that accumulate after use of the plunger . fig6 a also illustrates one or more optional uv light sources 210 or other sterilization source . the base 200 may also include a base trap 204 used to collect any liquids that collect during storage of a plunger . fig6 b illustrates a cross sectional view of one example of a base trap . variations of the invention may include bases with or without base traps . fig6 c illustrates another example of a base 200 use with plungers 100 of the present invention . as shown , the base 200 may include one or more uv illumination sources 210 as discussed below . the uv sources 210 will be placed to sanitize / sterilize portions of the plunger 100 that come in contact with waste water from the drain / toilet . the subject invention also provides ultraviolet ( uv ) sterilization units or base modules for use with plungers and toilet brushes . accordingly , a subject uv sterilization unit may be used to sterilize or sanitize a plunger as described above ( configured with a fluid gasket or with a brush ), or any conventional plunger , toilet brush , and the like . the uv sterilization units may be used to aseptically store such a device for a prolonged period of time . also provided are systems that include a sterilization unit and at least one of a plunger ( including but not limited to a plunger of the subject invention ) and a toilet brush . ultraviolet light is part of the light spectrum between 100 and 400 nanometers ( nm ), just below the violet end of the visible spectrum . within uvc , wavelengths from 200 nm to 280 nm are known as the “ germicidal range ”. specifically , 253 . 7 nm is generally accepted as the apex of this range . germicidal ultraviolet ( uvc ) light kills cells by damaging their dna . the light initiates a reaction between two molecules of thymine , one of the bases that make up dna . uv light at this wavelength ( uvc ) causes adjacent thymine molecules on dna to dimerize . the resulting thymine dimer is very stable . if enough of these defects accumulate on a microorganism &# 39 ; s dna its replication is inhibited , thereby rendering it harmless . the principle of design is based on a product of time and intensity — both levels must be specified for a successful sterilization . in one variation , the system delivers between 2 , 500 - 250 , 000 mws / cm2 throughout the enclosure . this expose is believed to eliminate 95 % to 99 . 9 % of e . coli ., staphylococci , streptococcus , influenza , hepatitis and many other pathogens . in additional variations of the invention , the container will be enclosed to protect the user from even the smallest dosage level of this light . alternatively , or in combination , the system may include trigger switching to prevent unintended discharge of the uv light . uvc light may be provided by fluorescent or low pressure - type bulbs . however , a more desirable source may be led type bulbs which can produces ultraviolet light as well as cold cathode fluorescent lamps , which are smaller than the old low pressure bulbs . in one variation , the bulbs used deliver 95 % of their energy as 253 . 7 nm . systems of the present invention may be powered either from standard household electrical supply ( e . g ., 120 vac ). alternatively , the system may be configured to use standard dc batteries such as aa , aaa , 9v or even watch batteries . in yet another variation , a wind - up dynamo ( such as those used to power flashlights or radios ) may be employed . variations of the invention include devices used with any variation of the uv spectrum including uv cycles that provide varying ranges or wavelengths of the uv spectrum . fig7 a - 7b illustrates variations of storage units as described herein . the storage unit 250 includes a base 252 where the bottom portion of the base comprises a skirt 253 , having a uv source ( not shown in fig7 a or 7 b ). this variation includes a gate 254 that is moveable to allow insertion and removal of the plumbing tool 10 , 12 . typically , the gate 10 will be coupled to a switch for the uv source to avoid unintended exposure to the uv energy . the base can contain or surround a plumbing tool . typically at least the distal end or head of the plumbing tool is located within the base . in additional variations , as much of the handle as is practical ( i . e ., a wetted or otherwise contaminated portion ) is also enclosed in the base . the internal surface 262 of the unit 250 may have reflective properties to better distribute the uv energy . optionally , the system or unit 250 may include a removable collar 256 that allows retention of a standard plumbing tool 10 , 12 with the unit 250 . however , in most variations , the collar 256 is not removable but integral with the tool . in some cases , a plumbing tool may be provided with the system , where the plumbing tool incorporates features to allow nesting of the tool within the unit . fig8 a and 8b illustrate cross sectional views of storage units 250 . in these variations , the base 252 comprises an internal reflective surface at least in the area housing the plumbing tool 10 , 12 . variations of the unit 250 includes the bottom portion of the base 252 as shown by the arrows , light from the uv light sources 210 bounces within the unit 250 . any number of uv light sources may be employed in variations of the devices . moreover , the unit may be reflectively coated , or , the unit 250 may contain an insert that has a reflective coating . in variations of the unit 250 water that accumulates in a mid - wall 255 of the base 252 and eventually evaporates because of the uv exposure . in such variations , the base 252 is not in fluid communication with the interior skirt portion 258 of the unit 250 because the interior skirt portion 258 houses the electrical components and / or power supply of the system . accordingly , the base 252 is sealed from the interior skirt portion 258 to prevent water seeping into the interior skirt portion . typically , a mid - wall 255 separates the interior of the base 252 from the interior of the skirt 258 . in some variations , the interior portion of the skirt 258 may serve as a fluid trap 258 ( e . g ., the mid - wall 255 contains holes for drainage from the base 252 into the interior skirt portion 258 ). the fluid trap 258 collects liquid drainage from the plumbing tool . optionally , the fluid trap 258 area may have a reflective coating to expose the fluid to uv light . such exposure may be intended to reduce the pathogens in the drained fluid or to evaporate the drained fluid . in another variation , the fluid trap 258 may include a secondary source of uv light 212 . uv - a targeted at just below 380 nm in conjunction with a photocatalyst ( e . g ., tio2 ). this could be performed with an inexpensive cold cathode glass bulb or an led . available uv - a led &# 39 ; s include : roithner lasertechnik # rlt350 - 30 — peak wavelength of 350 nm , roithner lasertechnik # 380d30 — 380 nm , roithner lasertechnik # huuv - 5102l — 393 - 395 nm , ledtronics # l200cuv395 - 12d — 395 nm , wilycon # wuv503 - c395 - c — 390 nm minimum , 395 nm typical , 400 nm max , nichia america , nshu550e — 370 nm , lumex , part # ssl - lx5093suvc . the photocatalyst could be a ) mixed into the resin that is used to injection mold the chamber basin ; b ) mixed into the resin used for injection molding of the handle or head ( of the plunger or brush ); c ) coated onto the inner surface of the chamber with a film — this is advantageous as “ off the shelf ” films may soon be available allowing for the film to be vacuum formed directly onto the inside surface of the unit &# 39 ; s parts ; d ) a currently available solution is sprayed on in a solution and then dried to coat the entire inside of the unit ( see e . g ., greentekquest . com ); and / or coating a high surface area textile like fiberglass cloth and then die - cut and shape the cloth to line the inside of the unit . use uv - c targeted to 253 nm with a glass ccfl bulb . that this mode requires a ) a non - led bulb , and , b ) more power than the unit described above . as demonstrated by violight and steripen devices , this mode can still be powered by 4 aa or 2 9v to provide more than 25 sanitization cycles . this mode also produces some ozone that will kill some germs . use uv - c targeted to 253 nm with a special doped quartz ccfl bulb . this mode is useful for variations of the device in which ozone production is avoided . use uv - c targeted to 253 nm with a glass ccfl bulb and photocatalyst in the chamber . the uv - c provides a primary sterilization means while the photocatalytic oxidation provides as a secondary sterilization mans , and ozone serves as a tertiary sterilization . again , while this may mode has drawbacks in size and production of ozone , the effectiveness would be quite high and the cost would be medium . use uv - c targeted to 253 nm with a special doped quartz ccfl bulb and photocatalyst in the chamber this would have uv - c as the primary method of sterilization and photocatalytic oxidation as the secondary . this mode avoids ozone production . this mode requires a quartz ccfl bulb of a sufficient size to fit within the unit . in each of the above modes , the photocatalyst could be provided in the plunger and / or base . furthermore , the photocatalyst could be found in the actual housing . alternatively or in combination , the photocatalyst could be inserted as a separate piece . fig8 a also shows a variation of a plumbing tool 10 ( e . g ., a plunger ) having an internal reservoir 14 that is reflectively coated to aid in uv light distribution . in addition , it is further noted that the unit may be used with plumbing tools comprising handles only ( e . g ., a tool without a plunger cup or brush such as a disposable head toilet brush provided by , for example , clorox ®, sc johnson , or scotch - brite ™). fig9 a shows a cross sectional view of another variation of a unit 250 with a side view of a plumbing tool 12 . as illustrated , the unit 250 includes a base 252 , with a opening 260 for insertion of the plumbing tool . the unit 250 includes an illumination source 210 having associated circuitry 214 with a power supply 216 . in this variation , the power supply 216 comprises a set of batteries placed within the unit . however , variations include power supplies that are external to the unit or plugs for ac power . the unit 250 also includes a reflective interior surface 262 ( for example , the interior surface of the base 252 may be reflective , or an insert may be used ). fig9 a also shows a plumbing tool 12 in the form of a brush 12 . the brush has a brush head or attachment 16 coupled to a shaft 18 . the shaft includes a lid 20 that is receivable within or on the top of the unit 250 and a handle 22 . as shown , the unit 250 may be provided with a standard plug 228 so that the uv source obtains power from a wall outlet . as discussed herein , the unit 250 may also include a photocatalyst . for example , the photocatalyst may be provided in the material forming the parts of the unit ( e . g ., base , insert , lid , etc .) alternatively , or in combination , the photocatalyst may be provided as a separate insert 230 that is placed within the unit ( such inserts may also be combined with plungers and other plumbing tools as described herein .) in any case , the photocatalyst will be placed within a line - of - sight of the uv light source and / or it will be placed such that uv light shines onto and activates the catalyst . fig9 b shows an exploded view of the unit 250 . as shown , the unit may include the insert 262 within the base 252 and base cap 264 that is removable to access the electrical components and / or power supply . the bottom of the insert 262 is open or otherwise transparent to allow for the uv source ( not shown ) to deliver light into the insert 262 . the insert 262 may also contain a cover 220 to help in preventing liquids from contacting the light source or associated components . fig9 b also shows a variation of the circuitry 214 and power supply 216 associated with the unit 250 . in this variation , a switch 218 is used to trigger the light source . the switch 218 may limit the light source for activation upon placement of the tool . alternatively , or in combination , the switch 218 may be a safety type switch that prevents or terminates the light source upon removal of the tool 12 . fig9 c illustrates a sectional view of a top portion of the unit 250 . as shown , the switch 218 may be triggered by the weight of the tool or lid 20 . alternatively , the tool or lid 20 may complete the circuit of the switch 20 to trigger the uv cycle . fig9 d illustrates a variation of the illumination source 210 , circuitry 214 , and power supply 216 . in this variation , the circuitry 214 comprises a socket 222 for the uv source 210 , the socket is coupled to a printed circuit board 224 for containing the algorithms or cycle information ( see e . g ., fig1 ). in this variation , the circuitry 214 contains a starter 226 , where the voltage regulator ( not shown ) is housed on the circuit board . examples of such parts may be found as follows : switch contact crimp - terminal a3b - a4b type ( supplier digi - key part h9999 - nd , manufacturer a3b - 2630scc ); sensor wires 18 - 26 gauge ; socket —# 710 intermediate phenolic lampholder ( supplier lightbulbdepot . com ); lamp ( 9 . 09 v , 2 watt , 0 . 22 amp , base — e17 , shape t7 , length 55 mm , uvc , supplier bulbman . com ); ballast ( starter fs - 5 , manufacturer code 18344 , supplier bulbman . com ). fig9 e illustrates an exploded variation of a brush 12 for use with the present system . however , fig9 e illustrates features that may be incorporated with any plumbing tool as described herein . as shown , a plumbing tool may use a lid 20 member to activate the uv cycle and / or to block uv light . the lid 20 may be configured to permit a small amount of light to pass therethrough . this “ escaped ” light may be sufficient for the user to confirm activation of the uv light . fig1 illustrates a flowchart representation of a variation of the logic flowchart contained on a circuit board for controlling the unit . the bases described herein may be provided in any suitable form . the base may be constructed to sealably hold the head of a plunger or toilet brush when not in use , typically with a portion of the plunger or brush ( e . g ., the handle portion ) sticking up through an aperture in the top of the base , the base establishing a seal with the portion of the plunger or toilet brush that extends through the aperture . in certain embodiments , the uv base is in the form of a clamshell having a bottom surface and two or more side panels or petals connected ( e . g ., as by hinges ) to the bottom surface . the petals may be adapted to automatically close around the plunger or brush upon contacting the plunger or brush with the base . disposed within the interior of the base is an uv sterilization system including at least one uv light bulb or source . in many embodiments , a plurality of uv lights are provided and positioned about the interior of the base so as to be directed to different surface areas of the object being sanitized / sterilized . in one embodiment , a first or bottom light source is positioned on the bottom surface of the base and adapted to sanitize or sterilize at least the bottom or underside of a toilet brush or plunger . in certain instances , top bristles of a brush or the top of a traditional plunger dome will not be exposed to light from this bottom - surface light source . therefore , at least two additional uv bulbs or light sources may be included : one for each side of the top surface . embodiments may include a base having one or more top light sources positioned on one or more of the petals to sterilize the top or upperside and / or sides of a toilet brush or plunger . a light source may be associated with each petal of the base . for example , a 2 - petal base may include 1 uv light source on the bottom and one uv light source on each petal for a total of 3 light sources , a 3 - petal base may include 1 uv light source on the bottom and one uv light source on each petal for a total of 4 light sources , etc . in certain embodiments , the light source ( s ) are automatically activated once a plunger or toilet brush is received for storage therein . after a predetermined period of time , the light sources may automatically turn off . also provided are kits that include the subject plunger devices . a kit may include a subject plunger device and one or more interchangeable liquid dispensing caps and brushes to be used with the plunger . in one embodiment , a kit may include a subject plunger device and a sterilization unit for sterilizing the device . the kit my further include instructions for use , various cleaning supplies , etc . devices and methods of the present invention include combinations of features / aspects of various embodiments as well as the combination of the embodiments themselves wherever possible . as for other details of the present invention , materials and manufacturing techniques may be employed as within the level of those with skill in the relevant art . | US-38625606-A |
the present invention provides an apparatus and a method for stabilizing at least one medical device such as a tracheal or gastric tube entering or covering at least one facial cavity such as the mouth and / or nose , taking advantage of a stabilization stent to secure to a patient &# 39 ; s face the tracheal or gastric tube without the need to apply tape to the face , while maintaining visibility of tube markings , preventing kinking of the tube , and keeping infant &# 39 ; s face visible to parents and caregivers . in one form , the invention comprises a transverse stent comprising a superior border opposed to an inferior border , an inner surface and an outer surface . a first facial interface is attached to a first terminal end of the transverse stent , and positioned to adhesively adhere and mechanically clasp to a first side of a patient &# 39 ; s face . a second facial interface is attached to a second terminal end of the transverse stent and positioned to adhesively adhere and mechanically clasp to a second side of a patient &# 39 ; s face . a docking platform attached to the outer surface of the transverse stent supports the medical device . in a different form , the invention also includes gutters positioned on the inner surface of the respective first and second terminal end approximate to the respective first and second facial interface to channel oral fluids away from the respective first and second facial interface . the outer surface contains channels for containing and directing tubing , and fixaton points for attaching anchoring measures such as chin or head straps . the core of the transverse stent is hollowed to permit gas flow . | the present invention sets forth a method and an apparatus for stabilizing at least one medical device entering at least one facial cavity . such medical devices may include , for example , endotracheal tubes , nasotracheal tubes , nasalgastric tubes , naso or orojejunal tubes , nasal thermistors , nasal pneumotachometers , nasal capnographs , nasal masks , oxygen delivery tubing and nasal cpap delivery systems , although the present invention will stabilize any device entering or covering the mouth or nose . for the purposes of this disclosure , the term “ tube ” is meant to include all such medical devices entering the mouth or nose , and that the present invention is not limited to stabilizing medical devices tubular in shape . likewise , it should be understood that oral insertion , nasal insertion or both simultaneously will be stabilized equally well . as shown in fig1 , the present invention comprises a first 2 and second 4 facial interface positioned on opposite terminal ends of a transverse stent 6 to mechanically and adhesively clasp both sides of a patient &# 39 ; s face 29 ( fig2 ). a docking platform 8 is attached to the transverse stent 6 to support at least one medical device 22 ( fig2 ). the transverse stent 6 is generally arch shaped so as to follow the contours of the patient &# 39 ; s face 29 , and of a length sufficient to permit the first 2 and second 4 facial interface to rest on the right and left sides of a patient &# 39 ; s face 29 , for example , on the right and left cheek . while the transverse stent 6 may take any shape in cross - section , for example , triangular , round or oval , in its preferred form , the transverse stent 6 is square or rectangular in cross - section , having a superior border 10 opposed to an inferior border 12 , an inner surface 30 ( fig3 ) towards the patient &# 39 ; s face 29 and an outer surface 14 . these defined borders and surfaces allow for more precise placement of the docking platform 8 and optional mechanical clasps ( discussed below ). in a preferred embodiment , the transverse stent 6 is about 6 mm in width and about 2 . 5 mm deep . it will be understood , however , that both the width and depth will depend on the material used and the relative size of the patient . when the first 2 and second 4 facial interfaces are in proper position on the patient &# 39 ; s face 29 , the transverse stent 6 should remain about 1 mm to about 3 mm above the maxillary , or upper , lip 24 ( fig2 ), so as to not interfere with or traumatize the lip 24 or trap debris between the transverse stent 6 and maxillary lip 24 , and allow access for proper hygiene . the transverse stent 6 should be sufficiently rigid enough to support the attached medical device or devices 22 , yet have the ability to yield slightly in a manner that will allow the first 2 and second 4 facial interfaces to approximate ( move medially ) if the patient were to lay with the head on one or the other side . the ability of the transverse stent to yield slightly in all directions helps to dissipate any displacement force applied to the medical device 22 or to the transverse stent 6 , rather than directing the entire displacing force to the first 2 and second 4 facial interface . while metals such as , for example , stainless steel , titanium , ni — cr and other alloys may be used , ideally the transverse stent 6 should be hypoallergenic and , optionally , clear so as to not obstruct visualization of the patient &# 39 ; s face 29 or of the medical device 22 or any markings contained within or on the medical device 22 . materials useful for this purpose would include , for example , polymers such as , for example , polystyrene , polyurethane , polycarbonate , fiberglass and the like that preferably are transparent or translucent when polymerized . the transverse stent 6 and / or facial interface 2 , 4 may be manufactured into a variety of shapes and sizes that allow the clinician to choose the ideal transverse stent 6 and / or facial interface 2 , 4 for the individual patient . alternatively , at least a portion of the apparatus may be fabricated from a material that is pliable until activated , whereupon , once activated , the material sets to a clinician - predetermined shape . in this manner , the transverse stent 6 and / or facial interface 2 , 4 in its pliable form may be custom molded to the patient &# 39 ; s face 29 and then activated to take a permanent set . this activation may take the form of , for example , a light - activated polymer in which a predetermined wavelength of a light is applied to the material to effect polymerization and , hence , the permanent set , or it may take the form of mixing two materials together to initiate an auto - polymerization , or the polymerization may be heat activated . another alternative to establishing proper length of the transverse stent 6 is to cut the transverse stent 6 to its proper length prior to attachment , using known adhesive methods , of the first 2 and second 4 facial interface . still another alternative ( not shown ) to establishing a clinician - predetermined length is for a first half of the transverse stent to be slidably contained , for example , using a tongue and groove , within , in front , or behind a second half of the transverse stent . once the halves are slidably moved to establish the predetermined length , the halves are fixed in the predetermined length , for example , by crimping a metal band around the overlapping halves , or by stapling the halves within the overlapping portion . the first 2 and second 4 facial interface are mirror images of one another and in the interest of brevity will not be described separately . it is to be understood that the second facial interface 4 mirrors the first facial interface 2 description which follows . the facial interface 2 may be integrally fabricated as part of the transverse stent 6 , or it may be separately fabricated and subsequently adhered , using known adhesives techniques , to the transverse stent 6 . it may take any shape that provides a surface area of sufficient size to effectuate adequate adhesion to the patient &# 39 ; s face 29 once adhesive is applied . the facial interface 2 may be substantially flat or it may be substantially contoured to follow the contours of a patient &# 39 ; s face 29 . it must be stiff enough to resist deformation when a displacement force is applied to the transverse stent 6 . ideally , the surface area should be minimized so as to cover the least amount of the patient &# 39 ; s face possible yet maintain adequate resistance to displacement forces . in a preferred embodiment , the facial interface 2 is generally “ y ” in shape . while the advantages of the transverse stent 6 are obtained when the facial interface 2 is adhesively adhered to the patient &# 39 ; s face 29 by a substantially flat facial interface 2 , ideally , the facial interface 2 should mechanically clasp , as well as adhesively adhere to the patient &# 39 ; s face 29 . for the purposes of this disclosure , the term “ mechanically clasp ” is meant to include resistance to movement through primarily physical forces , for example , frictional forces ; and the term “ adhesively adhere ” is meant to include the bonding of two substances together by interfacial forces , for example , valence forces , interlocking action , or both . in a preferred embodiment , the facial interface 2 is fabricated from the same material as the transverse stent 6 , such material having plastic properties that allow contouring of the facial interface 2 to the patient &# 39 ; s face 29 . it is the contour which provides the mechanical clasping . ideally , the facial interface 2 is positioned such that at least a portion of the inferior border 16 of the facial interface 2 is contoured to overlie at least a portion of an inferior border of a patient &# 39 ; s mandible 23 . for the purposes of this invention , the term “ overlie an inferior border of a patient &# 39 ; s mandible ” means resting on a facial skin surface which covers the inferior border of the mandible . for example , to achieve this mechanical clasping , the inferior border 16 of the facial interface 2 is rotated medially about 5 degrees to about 35 degrees around the line 18 longitudinally bisecting the transverse stent 6 . this rotation of the facial interface 2 inferior border 16 may be pre - molded into the apparatus , or alternatively , if the facial interface 2 is fabricated separately and subsequently adhered to the transverse stent 6 , the appropriate rotation is maintained while adhering the facial interface 2 to the transverse stent 6 . the mechanical clasping , acting synergistically with an adhesive applied to the facial interface 2 , provides increased resistance to transverse stent 6 displacement forces . the adhesive may be pre - applied to the facial interface 2 and covered with a protective , removable backing ( not shown ), for example , polyurethane , cellophane or other backing material , as is well known in the art , which is removed prior to placement , or the adhesive may be applied directly to the patient &# 39 ; s face 29 prior to seating the facial interface 2 . when the facial interface 2 is seated , the adhesive layer should extend beyond the edge of the interface 2 to spread and reduce the adhesive forces on the skin . the adhesive is , for example , any protective adhesive that is nonirritating and , optionally , transparent to fragile newborn facial tissue , of sufficient viscosity to allow for controlled placement and spreading , allows for easy removal of excess adhesive , and permits for easy removal of the facial interface 2 ( preferably with water ) when desired , without damaging the underlying tissue . examples of such adhesives are water - based adhesives such as hydrogel adhesives sold through ludlow , and pectin based adhesives , for example , duoderm extrathin , manufactured by convatec , inc . and comfeel , manufactured by coloplast company . the medical device 22 , for example , an endotracheal tube , is fixed , for example , taped , to a docking platform 8 . in a preferred embodiment , the docking platform 8 is a cantilevered finger 20 , molded as part of the transverse stent 6 , projecting from the inferior border 12 of the transverse stent 6 at a predetermined angle , for example , about 65 degrees to about 115 degrees , preferably about 95 degrees , although it should be understood that any predetermined angle allowing for fixation of the medical device 22 is acceptable . optionally , the most distal portion 19 of the cantilevered finger 20 , about 35 mm in length is substantially flexible while the medial portion 17 , about 15 mm in length is substantially rigid . in this manner , some or all of a medical device displacement force will be dissipated through the flexible portion 19 before reaching the transverse stent 6 . at least one optional channel 15 may be molded into at least one surface , preferably the top surface , of the cantilevered finger 20 for receiving a medical device 22 , for example , a tube . affixing a tube to the cantilevered finger 20 prevents the tube from kinking . optionally , the cantilevered finger 20 may extend from the superior border 10 of the transverse stent 6 for support of nasal tubes ( not shown ). the cantilevered finger 20 may be molded on the top , bottom or both surfaces for receiving and fixing a medical device 22 , for example , an endotracheal tube or cpap prongs . it should be understood that the docking platform 8 may extend from the transverse stent at any angle required to make the docking platform 8 functional . this may range from a negative angle , as might be required , for example , for medical devices entering the nose , to an angle of about 180 degrees . the docking platform 8 may be located anywhere along the length of the transverse stent 6 to meet specific clinical indications . likewise , the docking platform 8 may project from the outer surface 14 at the superior border 10 , the inferior border 12 , or anywhere within the body of the transverse stent 6 , or may span the transverse stent 6 from the superior border 10 to the inferior border 12 , as clinically indicated . in another embodiment of the device , shown in fig4 ( a )–( d ), a universal docking station 41 is fabricated into outer surface 14 at , for example , as shown in fig4 ( a ), the center of the transverse stent 6 . the universal docking station 41 is , for example , a recess 40 to removably receive a projection , or other form of docking design that would permit the removable attachment of medical devices such as , for example , a cpap cannula 48 , using , for example , a snap fit arrangement ( described below ). alternatively , the docking platform 8 may be removably mounted to the universal docking station 41 using , for example , the snap fit arrangement or tongue and groove . the groove 40 molded within the universal docking station has slots 42 to mechanically engage docking platform tabs 44 extending from the docking platform tongue 48 . the tabs 44 are urged , such as by spring - loading , so that they may be disengaged for easy removal of the docking platform 8 . the transverse stent 6 may include more than one universal docking station 41 to provide flexibility positioning the docking platform 8 on the transverse stent 6 . a heavier medical device 22 attached to the docking platform 8 may require additional stabilization anchorage . as shown in fig1 and 7 , optional anchorage attachment 13 is positioned on the outer surface 14 of the apparatus for receiving an attachment point of at least one additional anchorage such as , for example , a head strap , chin strap or both ( not shown ). the anchorage attachment 13 may be any attachment that allows for easy attachment and removal of the additional anchorage , such as , for example , a button , hook , hook and loop , slot , tab , combinations thereof and the like . in still another embodiment , shown in fig3 , to prevent oral secretions from interacting with and interfering with the adhesive bond , and / or collecting and harboring bacteria , gutters 32 are fabricated into the inner surface 30 of the terminal ends 36 of the transverse stent 6 , proximate to the facial interface 2 , 4 , to channel oral fluids away from the facial interface 2 , 4 . these gutters 32 may take the form of , for example , a channel or groove molded into the inner surface 30 of the transverse stent 6 traversing the stent 6 from the superior border 10 to the inferior border 12 . an optional raised lip 34 running parallel and distal to the gutter 32 provides further protection from oral fluid contamination of the adhesive . returning to fig1 , optionally , the transverse stent 6 has one or more mechanical retaining points , such as clasps 60 or channel 61 , to removably receive a portion of at least one medical device 22 , for example a portion of a tube . the mechanical retaining points may be mechanically , chemically or metallurgically attached to the outer surface 14 of the transverse stent 6 using known methods , such as welding , bolting or screwing , or they may be integrally molded as part of the transverse stent outer surface 14 . the at least one clip 60 and / or channel 61 are appropriately sized to mechanically retain a tube to the transverse stent 6 , as shown in fig5 . the mechanical retaining points , such as the clasps 60 and channel 61 are particularly useful in , for example , retaining a nasalgastric tube 64 used in combination with an endotracheal tube 66 . in yet another embodiment , shown in fig6 , a hollow bore 70 of predetermined diameter is fabricated within the transverse stent 6 to transport a supply of gas , for example , a medical gas ( not shown ). the bore 70 has a first opening 72 at the distal end of the apparatus to receive the medical gas , and a second opening 76 at the docking station 8 to deliver the medical gas . the bore 70 runs substantially longitudinally through the interior of the transverse stent 6 . in still another embodiment , shown in fig7 and 8 , a groove 80 fabricated , for example , in the center of the superior border 10 of the transverse stent 6 further supports tubes that enter the nose , for example , feeding tubes , cpap prongs and oxygen tubes . a clamp 82 may optionally be molded to the bottom surface of the cantilevered finger 20 . the clamp 82 is fabricated to be urged , such as by spring loading to surround a medical device 22 , for example , an endotracheal tube . the clamp 82 only partially surrounds the tube , allowing a portion of the exposed tube to adhere to adhesive tape ( not shown ). the clamp 82 can accommodate tubes of varying sizes . in a preferred embodiment , the clamp 82 can accommodate tubes with internal diameters of about 2 . 5 mm to about 3 . 5 mm . the clamp must be of sufficient length to supportively engage the tube , preferably about half the length of the substantially rigid portion of the cantilevered finger 20 . in a preferred embodiment , this length is about 6 . 5 mm to about 8 . 5 mm , most preferably about 7 . 5 mm . optionally , the tube is further supported to the cantilevered finger 20 with adhesive tape covering , for example , the full length of the cantilevered finger 20 , including the clamp 82 . when desirable to remove the clamp , such as when the patient is nasally intubated , the clamp is removed by , for example , cutting , twisting or grinding . optionally , the clamp may be fabricated to removably attach to the cantilevered finger 20 , for example , as in the manner described above with the universal docking station 41 . in use , the present invention would operate as follows : after clinically determining the appropriate size and shape of the transverse stent 6 and the amount of mechanical clasping needed , a properly fitted stabilizing apparatus is either selected from stock or custom fabricated bedside . after the medical device 22 has been delivered to the patient , for example , after the endotracheal tube has been inserted , adhesive is applied to the predetermined area of the face 29 , or , alternatively , if the facial interface 2 , 4 is preloaded with adhesive , the protective backing , for example , an adhesive release liner , is removed . the facial interface 2 , 4 is placed on the face 29 and adhered to position the trasverse stent 6 above the patient &# 39 ; s maxillary lip 24 in the predetermined position . once the adhesive has set , the medical device 22 is removably fixed to the docking platform 8 , for example , by taping or clamping . in the preferred embodiment , the endotracheal tube 66 is taped to the cantilevered finger 20 . if , for example , a nasalgastric tube 64 is also in use , that is removably affixed to the docking platform 8 , or alternatively , removably fixed by the optional mechanical clasps 60 on the outer surface 14 of the transverse stent 6 . if additional anchorage is required , head or chin straps are removably affixed to the anchorage attachments 13 . with the present invention in place , the oral cavity presents easy access for support staff to main proper hygiene . markings on the tubes , for example , indicators to insure proper tube insertion are clearly visible . once stabilized , tubes maintain their original position , avoiding the risk of accidental extubation , laryngal trauma , or adverse influence on oral - facial growth and development . should emergency removal of the tubes be required , the tape affixing the tube to the docking platform may be quickly and easily cut , or alternatively , the transverse stent may be easily and quickly cut from the facial interface , allowing the tube and transverse stent to be removed simultaneously . the present invention also comprises the system for stabilizing at least one medical device entering at least one facial cavity formed by the above described method . although the present invention has been described in connection with specific examples and embodiments , those skilled in the art will recognize that the present invention is capable of other variations and modifications within its scope . these examples and embodiments are intended as typical of , rather than in any way limiting on , the scope of the present invention as presented in the appended claims . | US-29473305-A |
a method of preparing citrus fruit sections with a fresh fruit flavor and appearance is disclosed . thick albedo type grapefruit and oranges are cleaned and heated to a core temperature of about 20 ° to 40 ° c . they are subsequently scored to the juicy portion , vacuum infused with a commercial pectinase , incubated for critical time and temperature periods , and peeled . the resultant high quality fruit is stored in refrigeration . | in general , the overall process of the present invention may be described simply . the citrus fruit is subjected to the following operations . after washing with mild detergent and rinsing , the fruit is heated to a temperature that does not adversely affect the quality of the product but allows the enzymic softening process to proceed . core temperatures should be kept in the range of 20 ° to 40 ° c . while the surface temperature could be between 40 ° and 60 ° c ., but these temperatures are not exclusive and slightly lower and higher ranges are also operational . next , the peel surface of the fruit is carefully scored with a knife so as to barely penetrate the albedo , or white layer , and not scratch the juice section . the warm fruit is then vacuum infused with an aqueous solution of a commercial pectinase . the fruit is submerged in a desired enzyme solution , placed under vacuum and the vacuum released . the enzyme solution penetrates the air bubbles of the thick albedo of the fruit and is retained in the fruit by the infusion process . the infused fruit is then incubated for a short time , 10 to 60 minutes at a temperature range of 30 ° to 60 ° c . after incubation , the fruit is removed from the oven and peeled and the juice sections removed intact from the walls and membranes . fruit sections processed in this manner , retain the flavor , aroma , and texture of fresh fruit . the sections can be stored under refrigeration in various forms : dry , film coated in the liquid syrups and juice , to mention a few . the main advantages of the new process of making sections over the conventional method are increased yield and better quality . more importantly the new process eliminates polution problems of waste alkali disposal . another advantage is water conservation . water would not be required to wash the alkali from the fruit nor to cool the fruit before sectionizing . a grapefruit , as characterized by its thick white albedo , is incubated in a water bath set at about 50 ° to 80 ° c . after about 10 to 60 minutes the rind reaches a temperature of about 40 ° to 60 ° c . and the core stays between about 20 ° and 40 ° c . the fruit is removed from the bath and the surface is scored in sextants , more or less , and deep enough to reach the albedo but not deep enough to rupture the juice segments . the fruit is then submerged in a beaker of pectinase solution at about 25 ° to 50 ° c . commercial pectinases differ in their peeling activities . as little as 100 ppm of some products can be sufficient and as much as 10 times this concentration may be necessary for other products . since these commercial pectinases differ , table i is provided for determining the concentrations in ppm of pectinase of six different commercial products . other pectinases will suffice , however , the six pectinases listed in table i were tested in the instant invention . the beaker containing the fruit and pectinase solution is then placed in a container that can be evacuated . the air is removed by any evacuating means until a negative pressure of about 25 to 30 inches of mercury is attained . bubbles of entrapped gases emerge from the albedo of the fruit during the evacuation process and are replaced by the enzyme solution when the vacuum is broken and atmospheric pressure is restored in this vacuum infiltration method . this procedure can be repeated with a slight increase in gas displacement , if necessary until all of the air bubbles in the albedo are saturated with the enzyme . the fruit is transferred to an incubator set at about 30 ° to 60 ° c . after 15 minutes to 2 hours of incubation at this temperature , the peel is easily mechanically removed . after mechanical removal of the peel , the juice segments are gently lifted from the core by hand , scoop , sectionizer , etc ., and quickly chilled . these segments have the fresh fruit quality and represent 100 % recovery of the juice sections . a thick albedo type orange is incubated in a water bath set at about 50 ° to 80 ° c . after about 10 to 60 minutes the rind reaches a temperature of about 40 ° to 60 ° c . and the core stays between 20 ° and 40 ° c . the fruit is removed and the surface is scored in sextants , more of less , and deep enough to reach the albedo but not to rupture the juice segments . the fruit is then submerged in a beaker of pectinase solution at about 20 ° to 50 ° c . since commercial pectinases differ in their peeling activities , table ii is provided to show the amounts of pectinase to be added depending on six commercial pectinase products tested . the beaker is then placed in a container that can be evacuated . air is removed until pressure is reduced to about 25 to 30 inches of mercury , and then replaced . bubbles of entrapped gases emerge from the thick albedo of the fruit and are replaced by the enzyme solution when the vacuum is broken and atmospheric pressure is restored in this vacuum infiltration method . the procedure can be repeated with a slight increase in gas displacement , if necessary until all the air bubbles in the albedo are saturated with the enzyme . the fruit is transferred to an incubator set at about 30 ° to 60 ° c . after 15 minutes to 2 hours at this temperature the peel is easily removed . next , the juice segments are gently lifted from the core and quickly chilled . these segments have the fresh fruit quality and represent 100 % recovery of the juice sections . table i______________________________________minimum concentration of six brands ofpectinases for effective peeling andsectionizing of grapefruit and / orpeeled grapefruit and peeled orangespectinase - ( manufacturer ) conc . ppm . ______________________________________irgazyme - ( ciba giegy ) 50 - 300pectinex - ( novo laboratories ) 50 - 300klerzyme - ( g . b . fermentation industries ) 250 - 1500pektolafe - ( grindsted products ) 500 - 3000enzeco - ( enzyme development co .) 500 - 3000spark - l - ( miles laboratories ) 1500 - 9000______________________________________ table ii______________________________________minimum concentration of six brands ofpectinases for effective peeling andsectionizing of oranges . pectinase - ( manufacturer ) conc . ppm . ______________________________________irgazyme - ( ciba geigy ) 500 - 1500pectinex - ( novo laboratories ) 500 - 1500klerzyme - ( g . b . fermentation industries ) 2500 - 7500pektolafe - ( grindsted products ) 5000 - 15 , 000enzeco - ( enzyme development co .) 5000 - 15 , 000spark - l - ( miles laboratories ) 15 , 000 - 45 , 000______________________________________ | US-17162780-A |
an unmanned vehicle including a body and a frame structure extending from the body and supporting a plurality of propeller assemblies , each propeller assembly including at least one propeller and a corresponding motor with the motor housed in a watertight housing or coated and made corrosion resistant . the propellers comprise a first subset of propellers of the propeller assemblies and a second subset of propellers of the propeller assemblies which rotate in a plane positioned below a plane in which the first subset of propellers rotate , wherein said first and second subset of propellers are configured for independent operation of one another as the vehicle transitions from an air medium to a water medium . | it will be readily understood that the components of the embodiments as generally described herein and illustrated in the appended figures could be arranged and designed in a wide variety of different configurations . thus , the following more detailed description of various embodiments , as represented in the figures , is not intended to limit the scope of the present disclosure , but is merely representative of various embodiments . while the various aspects of the embodiments are presented in drawings , the drawings are not necessarily drawn to scale unless specifically indicated . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects as illustrative . the scope of the invention is , therefore , indicated by the appended claims . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope . reference throughout this specification to features , advantages , or similar language does not imply that all of the features and advantages that may be realized with the present invention should be or are in any single embodiment of the invention . rather , language referring to the features and advantages is understood to mean that a specific feature , advantage , or characteristic described in connection with an embodiment is included in at least one embodiment of the present invention . thus , discussions of the features and advantages , and similar language , throughout the specification may , but do not necessarily , refer to the same embodiment . furthermore , the described features , advantages and characteristics of the invention may be combined in any suitable manner in one or more embodiments . one skilled in the relevant art will recognize , in light of the description herein , that the invention can be practiced without one or more of the specific features or advantages of a particular embodiment . in other instances , additional features and advantages may be recognized in certain embodiments that may not be present in all embodiments of the invention . reference throughout this specification to “ one embodiment ”, “ an embodiment ”, or similar language means that a particular feature , structure , or characteristic described in connection with the indicated embodiment is included in at least one embodiment of the present invention . thus , the phrases “ in one embodiment ”, “ in an embodiment ”, and similar language throughout this specification may , but do not necessarily , all refer to the same embodiment . as used in this document , the singular form “ a ”, “ an ”, and “ the ” include plural references unless the context clearly dictates otherwise . unless defined otherwise , all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art . as used in this document , the term “ comprising ” means “ including , but not limited to ”. the need for unmanned vehicles has soared during recent years with many such vehicles being developed for countless applications in air and water . current uuvs and uavs can only operate in one medium ; either water or air . this disclosure relates to a fully submersible unmanned aircraft which can operate in air and underwater and transition between both mediums seamlessly . such a vehicle can have many military , industry , and consumer applications , for example , deployment of a payload in water ( e . g ., sensors , actuators ), and applications in underwater recovery and inspection ( e . g ., ships , oil platforms , or other waterborne platforms ). additional applications may include surveillance and underwater stealth approach in unknown environments . since underwater vehicles and air vehicles already exist , the challenge / discovery of this disclosure is finding a way to build a vehicle that can operate in both mediums and , more importantly , finding a way to transition smoothly and seamlessly between them . referring to fig1 - 4 , an unmanned vehicle 10 in accordance with an embodiment of the invention will be described . the unmanned vehicle 10 generally includes a body 20 , a frame structure 30 and a plurality of propeller assemblies 40 . the illustrated body 20 includes opposed housing members 22 and 24 with a sealing gasket 26 therebetween such that the body 20 defines a waterproof structure . the body 20 may house a controller , other instrumentation , sensors and the like . the controller ( not shown ) may be in the form of a microprocessor or the like and is preferably configured for wireless communication with a central station , a remote control and the like . the controller receives commands from the central station , the remote control , sensors or other inputs and controls the movement of the unmanned vehicle 10 in response thereto by controlling the rotation of each of the propellers 42 , 46 to achieve the intended motion as will be described in more detail hereinafter . the controller may also control other instrumentation , for example , a camera or payload delivery system . the frame structure 30 extends from the body 20 and includes a plurality of arms 32 which support the propeller assemblies 40 . the current embodiment includes four arms 32 supporting four propeller assemblies 40 and therefore has a quadcopter configuration ; however , the invention is not limited to such . in the present embodiment , support elements 34 depend from the arms 32 and are configured to further support the body 20 . additionally , landing supports 38 extend downward from the arms 32 and are configured to provide a landing structure for the vehicle 10 . the arms 32 are preferably manufactured as hollow tubing which is in water tight communication with the interior of the body 20 and with the respective propeller assembly 40 , as described hereinafter . with the waterproof construction , batteries , speed controllers and the like may be stored in the arms 32 . ideally , the body 20 and frame 30 are made of carbon fiber or other materials that are as light as possible and that can be waterproofed and also handle required immersion depth . in the illustrated embodiment , each propeller assembly 40 is a dual - propeller assembly with an upper propeller 42 co - axial with a lower propeller 46 , i . e . the propellers 42 , 46 have a common thrust axis . the propellers 42 and 46 are supported for rotation by a bracket 45 which is sealingly connected to a respective arm 32 . the bracket 45 also supports a motor 44 , 48 for each propeller 42 , 46 . the motors 44 , 48 are in communication with the controller and controlled thereby . rotation of the motors 44 , 48 is controlled to achieve desired movement of the vehicle 10 and also to assist with the transition between mediums as will be described in more detail hereinafter . referring to fig3 , an exemplary housing 60 for waterproofing of the motors 44 , 48 will be described . advantageously , by using motors 44 , 48 with copper windings 62 that are far more conductive than water , no shorts will occur and the motor does not need to be waterproof . nevertheless , to improve the efficiency and more importantly , the endurance of the system , the motors 44 , 48 may be sealed . in the illustrated embodiment , a sealed housing 60 extends about the windings 62 and a shaft 64 extends from the housing 60 and connects to the respective propeller 42 , 46 . a sealing gasket 66 extends about the shaft 64 and prevents water from entering the housing 60 at the propeller drive shaft 64 . the housing 60 protects the motor 44 , 48 from water and other environmental damage . however , the motors also need to breathe ( dissipate heat ) and sealing a shaft with such a high angular velocity as observed in multirotors will likely result in noticeable losses . depending on the material of the case and the medium in which it operates , the motor could overheat . as such , a more viable approach is to coat the windings on the inside of the motor ( which are stationary ) and replace sensitive mechanical components such as bearings with their corrosion resistant counterparts such as ceramic or glass materials . the magnets on the motor should also be coated . an issue that arises as a result of waterproofing is heat transfer . the battery and especially the speed controllers are susceptible to overheating and an effective heat sink must be employed . as these are generally components that are used for model airplanes , the housing is air breathing and the convection of wind flow is enough to keep them cool . however , there is no airflow in the waterproof body 20 . an example solution is a heat sink 70 which includes , for example , an aluminum or copper plate with fins coming off the side and extending out through the body 20 . an example heat sink 70 is shown in fig4 . the heat sink 70 is large to compensate for being enclosed in a plastic case . in an alternative embodiment , the heat sink may be exposed to the fluid medium in which it operates , and a large heat sink would not be necessary . the internal heat sink would be sufficient , depending on its intended use . in another embodiment , the body 20 may be constructed out of aluminum or another material with high thermal conductivity , and the case itself could act as a heat sink , eliminating the need for an internal heat sink altogether . referring to fig2 a - 2e , an exemplary transition of the vehicle 10 from air 100 to water 110 will be described . as illustrated in fig2 a , when the vehicle 10 is completely in the air 100 , both motors 44 and 48 are operated ( as indicated by the curved arrows ) so that both propellers 42 , 46 create a downward thrust toward the water 110 ( as indicated by the straight arrows ). when the lower propellers 46 reach the water 110 as illustrated in fig2 b , the lower propellers 46 slow down or stop rotating while the upper propellers 42 continue to rotate at regular speed and create downward thrust . slowing or stopping of the lower propellers 46 as they enter the water 110 avoids disturbance and allows for a smooth transition of the lower propellers 46 into the water 110 . meanwhile , the upper propellers 42 provide sufficient thrust to continue the downward motion of the vehicle 10 . moving to fig2 c , once the lower propellers 46 are submerged , they once again are rotated to provide a downward thrust which assists with the downward thrust generated by the upper propellers 42 . as the vehicle 10 continues to submerge and the upper propellers 42 reach the water 110 as illustrated in fig2 d , the upper propellers 42 slow or stop rotating while the lower propellers 46 continue to rotate and create downward thrust . again , slowing or stopping of the upper propellers 42 as they enter the water 110 avoids disturbance and allows for a smooth transition of the upper propellers 42 into the water 110 . meanwhile , the lower propellers 46 provide sufficient thrust to continue the downward motion of the vehicle 10 . once the propeller assembly 40 is completely submerged , as illustrated in fig2 e , the upper and lower propellers 42 , 46 each rotate and thereby create thrust to control motion of the vehicle within the water 110 . in the illustrated embodiment , sensors 50 , 52 and 54 are supported on the landing supports 38 and brackets 45 to signal to the controller the position of the propeller assemblies 40 relative to the water 110 such that the controller may stop and start the motors 44 and 48 to achieve the propeller rotation described above . with this configuration , the sensors 50 on the landing supports 38 are positioned below the plane of the lower propellers 46 and signal to the controller when the lower propellers 46 are about to enter the water 110 . in response , the motors 48 may be stopped . the lower sensors 52 on the brackets 45 are positioned above the plane of the lower propellers 46 and thereby signal to the controller when the lower propellers 46 are submerged in the water 110 such that the motors 48 may be restarted . the upper sensors 54 on the brackets 45 are positioned below the plane of the upper propellers 42 and signal to the controller when the upper propellers 42 are about to enter the water 110 such that the motors 44 may be stopped or slowed . the controller may be programmed such that the motors 44 are slowed or stopped for a predetermined amount of time to allow the transition of the propellers 42 to a submerged condition . alternatively , another sensor may be provided above the plane of the propellers 42 and operate similar to the sensors 52 . the sensors 50 , 52 , 54 may be , for example , float type sensors , however , any sensors configured to sense between an air atmosphere and a water atmosphere may be utilized . additionally , more or fewer sensors may be utilized . it is further contemplated that no water sensors may be utilized . instead , for example , the controller , or a sensor associated therewith , may be configured to sense a spike in resistance as the propeller 42 , 46 moves from the less dense air 100 to the more dense water 110 . the controller may then stop or slow the respective motor 44 , 48 for a predetermined amount of time to allow the smooth transition of the propeller 42 , 46 . as a further alternative , the propeller 42 , 46 entering the water 110 may naturally stop or slow due to the transition to the more dense water 110 and the respective motor 44 , 48 is not stopped , but instead is controlled , after a predetermined amount of time , to provide greater torque such that the propeller 42 , 46 will again rotate in the more dense medium . transition of the vehicle 10 from water 110 to air 100 may occur in reverse of the process described above . however , it has been found that the propellers 42 , 46 do not incur disturbance which affects the vehicle assent as they transition from the more dense water 110 to the less dense air 100 . accordingly , stopping or slowing of the propellers 42 , 46 during such transition may not be necessary . the controller is preferably further configured to control motor 44 , 48 operation based on the medium in which the vehicle 10 is operating . for example , when the vehicle 10 is submerged in water , the motors 44 , 48 will require larger torque to achieve the same speed achieved when operating in air . additionally , it has been found that the more dense water medium requires greater vehicle tilting to achieve forward / reverse and side - to - side motion . for example , to move the vehicle 10 forward in an air medium , the various motors 44 , 48 may be controlled such that the vehicle 10 tilts forward by approximately 5 °, with such tilt generating forward propulsion . similar tilt in a water medium generates little if any forward propulsion . it has been found that the motors 44 , 48 have to be controlled to achieve a significant tilt , for example , 70 °, to achieve the same forward propulsion . the specific variance will depend on the properties of the particular medium , however , the controller will be configured to adjust for such properties and to control the motors 44 , 48 accordingly . the advantage of electric motors is that they respond within milliseconds to any input so that a proper control should be achievable for all configurations considered . another factor in movement of the vehicle 10 between mediums and within each medium is the buoyancy of the vehicle 10 . archimedes principle states that the buoyant force on a submerged object is equal to the weight of the water displaced . applying this , if the density of the vehicle is higher than the density of water , the vehicle will sink , as gravity exerts a greater force . if the vehicle is less dense than water , it will float , as gravity exerts a lesser force on the vehicle . if the densities are exactly the same , the buoyant force and gravity cancel and the object will neither sink nor float . this presents three options for the vehicle : 1 ) make the density higher than water , and energy will be required to bring it to the surface ; 2 ) make the density less than water and energy will be required to push the vehicle underwater ; 3 ) make the vehicle neutrally buoyant and minimal energy is required to bring the vehicle under or to the surface . as it turns out , making the vehicle slightly lower density than water is beneficial as any failure in the vehicle would cause it to drift to the surface rather than sink . nevertheless , the two prototypes built were slightly heavier than water as recovery was not an issue with all the testing being done in different size pools where it could be easily recovered in case of malfunction . for instance , for a vehicle 10 with a target weight of two kilograms , and a target density of water , we can calculate the maximum volume for the entire vehicle 10 . the buoyant force can be written as here , ρ is the density of water , g is the gravitational constant , and v is the volume of water displaced , or the volume of the vehicle 10 . in order for the vehicle 10 to stay underwater , it needs to have a higher mass per volume than water . since the prototype vehicle weighs two kilograms , the volume would need to be less than the volume of two kilograms of water . two kilograms of water has a volume of 2000 cubic centimeters , or 122 cubic inches . if the vehicle volume was to exceed this volume , it would be less dense than water . furthermore , the weight of the vehicle 10 is not limited to two kilograms and could be either more or less . in addition , the vehicle 10 may be scaled to either a larger or lesser size , depending on payload requirements . to further enhance the operation of the vehicle 10 , the configuration of the body 20 may be varied . fig5 illustrates a vehicle 10 ′ in accordance with an alternative embodiment of the invention . in this embodiment , the vehicle 10 ′ again includes a body 20 ′, a frame structure 30 ′ and a plurality of propeller assemblies 40 . the body 20 ′ has a spherical configuration which tends to provide a stronger pressure vessel and which also helps to minimize drag and to be less susceptible to side forces . the frame structure 30 ′ includes arms 32 which are sealingly connected to openings 25 in the body 20 ′. the frame supports and landing supports are removed . the sensors 52 and 54 are again provided on the brackets 45 . the sensor 50 ( not shown ) may be provided directly on a lower surface of the body 20 ′ or the bracket 45 . in other respects , the vehicle 10 ′ operates substantially the same as the embodiment described above . as explained above , the vehicle 10 is not limited to a quadcopter configuration with dual propellers on each arm . various other exemplary , non - limiting configurations are illustrated in fig6 - 9 . fig6 illustrates a vehicle 10 ″ comprising a spherical body 20 ″, a frame structure 30 ″ and a plurality of propeller assemblies 40 . the spherical body 20 ″ of the present embodiment includes three openings 25 to support the three arms 32 of the frame structure 30 ″. in other respects , the vehicle 10 ″ operates substantially the same as the embodiments described above . referring to fig7 , the vehicle 10 ′″ includes a spherical body 20 ′″, a frame structure 30 ′″ and a plurality of propeller assemblies 40 a and 40 b . the spherical body 20 ′″ of the present embodiment includes eight openings 25 to support the eight arms 32 of the frame structure 30 ′″. in the present embodiment , two different propeller assemblies 40 a , 40 b are utilized , with each propeller assembly 40 a , 40 b having a single propeller 42 , 46 and motor 44 , 48 . the propeller assemblies 40 a are configured with upper propellers 42 with sensors 54 . the propeller assemblies 40 b are configured with lower propeller 46 and sensors 52 . it is recognized that the propeller assemblies 40 a , 40 b may be the same component , just rotated 180 ° about the axis of the arm 32 . the propeller assemblies 40 a and 40 b alternate with each other about the body 20 ′″, however , other configurations may be utilized . in other respects , the vehicle 10 ′″ operates substantially the same as the embodiments described above . the vehicle 10 iv illustrated in fig8 is substantially the same as the vehicle 10 ′″ in fig7 except that the body 20 iv includes four openings 25 to support the four arms 32 of the frame structure 30 iv . referring to fig9 , the vehicle 10 v has a body 20 v that includes four openings 25 to support the four arms 32 of the frame structure 30 iv and a fifth opening on the bottom thereof . in the present embodiment , each of the propeller assemblies 40 a supported by the arms 32 includes an upper propeller 42 , motor 44 and sensor 54 . the lower propeller 46 is provided by a propeller assembly 40 b which is connected directly to the fifth opening 25 in the bottom of the body 20 v . sensors may be associated with the propeller assembly 40 b . in other respects , the vehicle 10 v operates substantially the same as the embodiments described above . it is recognized that different applications of the vehicle 10 may have different requirements and therefore different body , frame and propeller structures may be better suited for one application versus another . to provide flexibility , fig1 illustrates an unmanned vehicle kit 80 which allows the user to assemble a vehicle having preferred characteristics for a given application . in the illustrated embodiment , the kit 80 includes a body 20 ′ with a plurality of openings 25 , for example , eight openings 25 . the kit further includes a plurality of arms 32 with vary various propeller assemblies 40 , 40 a , 40 b , each of which may be secured to a respective opening 25 . in the event that all of the openings 25 are not utilized , the kit 80 further includes plugs 82 which may be utilized to seal the unused openings 25 . once assembled , the vehicle would operate as described above . while various propeller assemblies are described herein , it is recognized that the propellers used as the lower propellers 46 do not need to be the same as those used as the upper propellers 42 . a preferable configuration would use water optimized propellers in the lower and air optimized propellers in the upper . water optimized propellers tend to be shorter in length and have higher pitch angle when compared to air propellers . the dominant differences between water and air propellers have to do with the differences between water and air . water is denser than air and is considered an incompressible fluid , unlike air . air is capable of taking better advantage of the aerodynamic density and pressure changes associated with its blade &# 39 ; s airfoil and velocity , which can be used toward propulsion ; the same cannot be said for water , as density does not deviate by much . additionally , rapid pressure changes in water are likely to result in cavitation , which is known to wear down and damage propellers . thus , the pressure difference that could in fact be used toward aerodynamic lift / thrust is limited by the occurrence of cavitation . as such , when dealing with propellers intended for air , they should be : longer ( so that the ends of the blade have a very high transverse velocity for a given angular velocity and desired since lift increases quadratically with stream velocity ) and with a flatter pitch ( so as to reduce drag on the blades and since airflow through means of high angular velocity / aerodynamics is desired and not by simply pushing the air out of the way ). alternatively , when dealing with propellers intended for water , they should be short ( as to avoid high transverse velocities ), have a higher pitch ( to compensate for its shorter length ) and have more blades ( to compensate for its lower angular velocity and shorter length ). for vehicles 10 intended to be used frequently in both mediums , it may be desirable to manufacture the propellers with a blended combination of features of both the air and water propellers . these and other advantages of the present invention will be apparent to those skilled in the art from the foregoing specification . accordingly , it will be recognized by those skilled in the art that changes or modifications may be made to the above - described embodiments without departing from the broad inventive concepts of the invention . it should therefore be understood that this invention is not limited to the particular embodiments described herein , but is intended to include all changes and modifications that are within the scope and spirit of the invention as defined in the claims . | US-201515312968-A |
an animal feeder has a container for being filled with animal feed which is pushed by a platform toward an open end of the container . the open end of the container is very large and thus is not blocked even when used with large feed such as apples . the platform is connected to a screw , which is turned by a motor . the motor is controlled in a timely manner with a programmable timer . | fig1 shows an animal feeder 10 having an outer wall 12 and a bottom 14 forming an open ended container 13 which will hold animal feed 16 such as apples , pears , wheat , corn etc . the top end or edge 18 of the outer wall 12 is open such that the feed 16 may pass over the edge 18 and fall to the ground . a roof 20 is attached to the outer wall 12 by two or more stays 22 . preferably stays 22 are made from a small diameter wire or a narrow structure so the feed 16 is not prevented from falling over the edge 18 of the outer wall 12 . roof 20 helps prevent the container 13 from filling with rain , snow or falling leaves . it is contemplated that two portions of the roof 20 could be hinged together by hinge 54 along its apex 56 so that a portion of the roof 20 may be lifted to facilitate filling the container 13 . it is contemplated that the roof 20 could be omitted without departing from the scope of the present invention . feeder 10 could be rested directly on the ground by legs 24 or alternatively the feeder 10 could be lifted above the ground using a rope 26 and pulley 28 or other mechanism . rope 26 could be attached to roof 20 or directly to the container 13 . a motor 30 and a battery pack 32 are attached to the bottom 14 of the container 13 . for ease of assembly , motor 30 and battery pack 32 are attached to the outside of the container 13 . these parts could also be attached within the container as well . the motor 32 is preferably fixed to the container 13 so not relative motion is permitted therebetween . attached to the motor 30 is a screw or worm gear 34 . screw 34 extends from the motor 30 , through an aperture 36 in bottom 14 of the container 13 , toward the tope edge 18 of container 12 . preferably , motor 30 and screw 34 are centered with respect to the container bottom 14 . fig7 shows an alternative connection between motor 30 and screw 34 . a gear reduction mechanism 58 is supplied between the motor 30 and screw 34 . gear reduction mechanism 58 contains one or more gears 60 . it is contemplated that the gear reduction mechanism 58 could be used to reduce the on - time of the motor 30 so as to require less power from the battery or reduce the necessary torque output required from motor 30 to turn screw 34 which will require less output from the motor 30 and also prolong battery life . returning to fig1 , a moveable platform 40 is connected to the screw 34 such that platform 40 moves along the screw 34 when motor 30 turns screw 34 . it is contemplated that screw 34 could mate with platform 40 with co - operating threads as shown in fig5 . to prevent platform 40 from rotating with the screw 30 during operation , platform 40 is equipped with one or more slots 44 . as best seen in fig3 , slide bars 42 are attached to the inside surface of outer wall 12 such that when assembled the slots 44 co - operate with the slide bars 42 so platform 40 can slide up and down along slide bars 42 while being prevented from rotating with screw 34 thus forcing the platform to raise or lower inside container 13 . with reference to fig4 , a square or rectangular container 113 and platform 140 could be used instead of the circular ones shown in fig1 and 2 . in this case , slide bars 142 could be used to simply prevent the jamming between platform 140 and container 113 . the non - circular shape of the platform 140 and container 113 themselves would prevent relative rotation therebetween . experimentation has also shown that slide bars 42 and slots 44 can be removed and the friction between the feed 16 , the container 13 and the platform 40 is sufficient to prevent platform 40 from rotating while moving upward . with reference to fig2 , attached to an upper end 46 of the screw 34 is a sweeper 48 . sweeper 48 is fixed to screw 34 such that it rotates with screw 34 . as the feed 16 is being pushed upward by platform 40 toward edge 18 of container 13 , sweeper 48 pushes the feed 16 toward and over edge 18 so that it will fall to the ground and avoid possibly hitting and jamming under roof 20 . as would be appreciate , when using feeder 10 without the roof 20 , the sweeper may not be necessary since the feed will automatically fall over the edge 18 at a certain height . to ensure that most of the feed is pushed over the edge once the platform has reached its maximum height ; it is preferable to use a sweeper 48 . sweeper 48 is preferably placed at a height equal to the height of the container 13 , and may extend radially away from the screw 40 to the container outer wall 12 and possibly beyond . although only one sweeper 48 is shown , multiple sweepers , placed at different angles from each other , can be used . to prevent small feed such as wheat or corn from falling between the platform 40 and container wall 12 , a seal 50 can be placed around the periphery of platform 40 to slidingly engage the container wall 12 . again , if platform 40 is snugly fitted within the container wall 12 such that only vertical movement of the platform is possible , the snug fit may ensure that no small grains will fall between the platform 40 and the container wall 12 and thus seal 50 can be omitted . with reference to fig6 . because most feeders are used away from electrical outlets , the battery 32 could be attached to a solar panel 50 to avoid having to remove the battery for charging . a programmable timer 52 is connected between the battery 32 and the motor 30 to open and close the current flow therebetween as desired . timer 52 can be of any well - known type and thus will not be described in further detail . timer 52 allows the user to set the time of day and duration the feed is to be distributed from the feeder 10 . fig8 shows an alternative embodiment of the present invention . like elements are numbered the same and will not be further described . feeder 110 has a roof 120 attached to the top edge 18 of container 13 by stays 122 . a cross member 124 spans between two opposing stays and has an aperture 126 to accept screw 34 . a ball bearing 128 can be provided within aperture 126 such that screw 34 can be vertically aligned to prevent any misalignment when attaching the motor 30 to the container 13 and thereby causing the platform 40 to bind against the container 13 during operation . a hinge 154 is again placed in a portion of the roof 120 so that a portion of the roof can be lifted out - of - way to ease filling of the container 13 . although v or tent - shaped roofs are shown , it is contemplated that conical - shaped roofs could also be used without departing from the scope of the present invention . the operation of the feeder 10 of the present invention will now be described . before filling container 13 with feed , the motor 32 should be operated in a first direction so that platform 40 is lowered or raised to a desired height such as that shown in fig1 . feed 16 is then emptied into container 13 through its open end . to facilitate filing , one may remove roof 20 , open the hinged portion 58 , or simply fill the feed 16 through the stays 22 . the motor 32 is then operated in a second direction such that the platform 40 is raised so that the feed 16 is level with the top edge 18 of the container 13 if not done so during filling . timer 52 is then programmed so that the feed 16 is distributed at the desired time and rate . it is preferred to have tested and calculated before programming the speed at which the platform 40 is raised within the container 13 so that the correct timing and rates are made . with reference to fig2 . once the programmed time is reached , the timer will close the circuit between the battery 32 and the motor 30 such that the screw 34 will rotate for the desired amount of time . during this time , platform 40 will move toward the top edge 18 of container 13 pushing the feed 16 toward sweeper 22 where the feed 16 is swept over edge 18 onto the ground for the animals to eat . once the desired on - time has passed , the timer 52 will open the circuit and the motor 30 will stop turning thus the feed 16 will stop falling over the edge 18 . as should be appreciated , feeder 10 can be used with small grains as well as large fruits without modifications . unlike the prior art there are no passages or doors to open or close which could get blocked and prevent further distribution . although this aspect of the invention has been described with respect to the embodiment illustrated in fig1 - 8 , various alternatives may be used without departing from the scope of the invention . for example , the game feeder may be constructed of plastic , metal , or wood , or a combination thereof . the game feeder may be constructed in any shape desired and can be camouflaged . it will be understood that various changes in the details , materials , and arrangements of the parts which have been described and illustrated above in order to explain the nature of this invention may be made by those skilled in the art without departing from the principle and scope of the invention as recited in the following claims . | US-3396808-A |
a medicine administering device for nasal cavities includes a medicine accommodating chamber configured to accommodate at once a powdery medicine used in a plurality of administrations ; a spray nozzle for spraying the powdery medicine into nasal cavities , the spray nozzle communicating with the medicine accommodating chamber ; and a pump for supplying an air into the medicine accommodating chamber and forcing the powdery medicine by the air out of the spray nozzle into the nasal cavities . | as stated above , a medicine administering device for nasal cavities according to the present invention has a medicine accommodating chamber configured to accommodate at once a powdery medicine used in a plurality of administrations . with this , it is not necessary in each administration to charge the medicine accommodating chamber with a powdery medicine . therefore , it is possible by the present invention to reduce a burden of charging the device with a powdery medicine and to efficiently conduct a medicine administration . with reference to fig1 - 6 , a medicine administering device for nasal cavities according to an embodiment of the present invention is described in detail in the following . as is seen from fig1 , medicine administering device for nasal cavities 1 is equipped with pump 3 , medicine accommodating chamber ( magazine ) 5 disposed above pump 3 , holding member 7 disposed above medicine accommodating magazine 5 , and a pair of spray nozzle portions 9 , 9 that are held by and project from holding member 7 . as is seen from fig2 , pump 3 is formed of pump member 11 that is cylindrical in shape and is made of rubber . pump chamber 13 is formed in the inside of pump member 11 . as is seen from fig4 , a plurality ( seven in fig4 ) of medicine accommodating compartments 15 are formed in the inside of medicine accommodating magazine 5 . as shown in fig2 , medicine accommodating compartment 15 in position for administration communicates with pump chamber 13 through first air passage 17 . first air passage 17 is formed of straight passage portion 17 a upwardly extending from pump chamber 13 , first communication passage portion 17 b horizontally extending from the top of straight passage portion 17 a , curved passage portion 17 c extending in a semicircular manner in the circumferential direction of medicine administering device 1 from a terminal end of communication passage portion 17 b , and second communication passage portion 17 d extending between a terminal end of curved passage portion 17 c and medicine accommodating compartment 15 in position for administration . perpendicularly bent portions 19 and 21 are respectively provided between straight passage portion 17 a and first communication passage portion 17 b and between first communication passage portion 17 b and curved passage portion 17 c . the semicircular passage of the curved passage portion 17 c itself is provided with substantially perpendicularly bent portion 23 . substantially perpendicularly bent portion 25 is provided between the terminal end of the curved passage portion 17 c and second communication passage portion 17 d . by the provision of bent portions 19 , 21 , 23 and 25 , it is possible to suitably control flow rate and flow velocity of the air supplied to medicine accommodating compartment 15 and to adjust the degree of diffusion of medicine depending on the type of medicine . thus , it is possible to conduct a stable medicine administration . medicine accommodating compartment 15 has a substantially cylindrical form for accommodating therein a capsule ( not shown in the drawings ) charged with a powdery medicine . above and below medicine accommodating compartment 15 there are respectively disposed first and second perforators 27 and 29 for perforating or opening the capsule in position for administration . as shown in fig1 and 2 , first perforator 27 is fixed to first slider 31 and thus is allowed to slide down by moving first slider 31 down to perforate the top of the capsule . second perforator 29 is fixed to second slider 33 and thus is allowed to slide up by moving second slider 33 up to perforate the bottom of the capsule . medicine accommodating compartment 15 in position communicates with medicine passage 35 of each spray nozzle portion 9 through second air passage 37 . second air passage 37 is formed of ( a ) first passage portion 37 a that extends obliquely upwardly from medicine accommodating compartment 15 and ( b ) second passage portion 37 b that is in line with medicine passage 35 . first passage portion 37 a is formed at its first and second ends with bent portions 39 and 41 , respectively . by the provision of bent portions 39 and 41 , it is possible to efficiently prevent reverse flow of the powdery medicine from medicine passages 35 of spray nozzle portions 9 , 9 . thus , bent portions 39 and 41 can act as a temporary medicine trap . as is seen from fig2 , medicine receiver 26 for receiving the powdery medicine that drops from medicine accommodating chamber 15 is formed under medicine accommodating chamber 15 in position . this medicine receiver 26 has a cylindrical base portion and annular projection 26 a formed on the cylindrical base portion . medicine receiver 26 also serves as a bush or collar for supporting second perforator 29 . in fact , medicine receiver 26 has a lower cylindrical void space for supporting the sliding movement of second perforator 29 and an upper cylindrical void space ( formed on the lower cylindrical void space ) for receiving the powdery medicine that drops from medicine accommodating chamber 15 . annular projection 26 a can be brought into a temporary engagement in a snap action manner with a bottom notch formed below each medicine accommodating chamber 15 , by rotating medicine accommodating magazine 5 . thus , each medicine accommodating chamber 15 can be stopped at proper position for administration shown in fig2 by this temporary engagement . annular projection 26 a can have a convex top surface to smoothly provide the temporary engagement and disengagement in alternation by rotating medicine accommodating magazine 5 . medicine accommodating magazine 5 has seven bottom notches at respective positions below seven medicine accommodating chambers 15 . furthermore , medicine receiver 26 has a passage portion for diffusing the air supplied from pump 3 . this passage portion extends outwardly and horizontally from the bottom of the upper void space of medicine receiver 26 . the diffused air can efficiently force the powdery medicine ( including the powdery medicine dropped from medicine accommodating chamber 15 ) to move toward spray nozzle portions 9 , 9 . as shown in fig3 - 5 , medicine accommodating magazine 5 is substantially cylindrical in form and is formed at its central portion in diametral direction with supporting through hole 45 . furthermore , medicine accommodating magazine 5 is formed on its outside surface with a plurality ( seven in fig4 ) of gripping notches 47 that are arranged at regular intervals in circumferential direction . each gripping notch 47 is a depression formed inward in radial direction and has a shape suitable for gripping by fingertips of a patient . as is shown in fig5 , each medicine accommodating compartment 15 extends along the axial direction of the medicine accommodating magazine 5 . each medicine accommodating compartment 15 has upper side surface 15 a that is cylindrical in shape and bottom surface 15 b that is inwardly curved . as shown in fig4 , seven of medicine accommodating compartments 15 are arranged at regular intervals in circumferential direction . as is seen from fig6 , each spray nozzle portion 9 is rotatably fit into nozzle holding hole 51 formed in holding member 7 . each spray nozzle portion 9 is a monolithic member and has base portion 9 a that is inserted into nozzle holding hole 51 and main body 9 b that is positioned above base portion 9 a . nozzle main body 9 b is formed into a substantially cylindrical shape having a diameter and an axial length , which are suitable for insertion into a nasal cavity of a patient . center axis c 2 of nozzle main body 9 b is designed to be away from center axis ( rotation center ) c 1 of base portion 9 a of spray nozzle portion 9 . therefore , it becomes possible to change the distance between nozzle main bodies 9 b , 9 b by rotating the spray nozzle portions 9 , 9 . in other words , it is possible to adjust the distance between spray openings 53 , 53 depending on the distance of nasal cavities of a patient . each base portion 9 a of spray nozzle portion 9 is formed at its outer surface with a projection that extends circumferentially and fit into an annular groove formed in holding member 7 . with this , each spray nozzle portion 9 is rotatably held in position . furthermore , each spray nozzle portion 9 is formed with medicine passage 35 that communicates at its lower end opening with second air passage 37 . this lower end opening of medicine passage 35 has center axis c 1 at its center . medicine passage 35 is formed at its upper end with spray opening 53 having center axis c 2 at its center . thus , medicine passage 35 is formed into an oblique passage extending between second air passage 37 and spray opening 53 . an exemplary medicine administration using the medicine administering device for nasal cavities is explained in the following . at first , medicine accommodating magazine 5 is charged with at least one unused capsule enclosing therein a powdery medicine . in case that the distance between spray nozzle portions 9 , 9 does not fit to the distance between nasal cavities of a patient , the former is adjusted by rotating the spray nozzle portions 9 , 9 until spray nozzle portions 9 , 9 fit to the nasal cavities . then , while gripping notches 47 of medicine accommodating magazine 5 are gripped by the patient &# 39 ; s fingers , medicine accommodating magazine 5 is rotated by a patient until an unused capsule comes to a position where the capsule is opposed to or inserted between first and second perforators 27 and 29 . then , first and second sliders 31 and 33 are respectively slid downwardly and upwardly to perforate the capsule by first and second perforators 27 and 29 . then , nozzle main bodies 9 b , 9 b are inserted into the right and left nasal cavities of a patient . under this state , pump member 11 is pressed to compressively deform pump chamber 13 . with this , air is introduced into medicine accommodating compartment 15 in position shown in fig2 through first air passage 17 to pressurize this medicine accommodating compartment 15 . thus , the powdery medicine of medicine accommodating compartment 15 is forced to upwardly move by the air through air passages 37 , 37 and then medicine passages 35 , 35 . then , the powdery medicine is sprayed from the spray openings 53 , 53 into the right and left nasal cavities . the entire contents of basic japanese patent applications 2004 - 279629 ( filed sep . 27 , 2004 ), of which priority is claimed in the present application , are incorporated herein by reference . although the invention has been described above by reference to certain embodiments of the invention , the invention is not limited to the embodiments described above . modifications and variations of the embodiments described above will occur to those skilled in the art , in light of the above teachings . the scope of the invention is defined with reference to the following claims . | US-23518605-A |
an ultrasonic catheter drug delivery device comprises an ultrasound transducer to produce ultrasonic waves , which transducer is mechanically attached to a catheter body or chamber . the ultrasonic transducer has a distal tip with a distal radiation surface , and when a therapeutic agent from a fluid source is directed to the catheter body or chamber , the radiation surface creates ultrasonic pressure and delivers liquid and simultaneously ultrasonic energy to a patient &# 39 ; s vascularity or a selected body lumen . the method applies therapeutic agent and ultrasonic waves to the vascular area , lung or any body lumen without requiring direct contact between ultrasound transducer and body , dissolves blood clots , and stimulates tissue cells . | the present invention is a method and device , which provides treatment of luminal conditions , particularly for the treatment of coronary and peripheral arterial disease and thrombosis , where the purpose is to dissolve or disrupt the clot , plague or other stenotic lesions which cause the disease , and for dilation of narrowed vessels . the method and device of the present invention also useful to enhance the administration of therapeutic agents primarily responsible for the disruption of the clots or other stenotic material . the ultrasonic energy agitates and promotes the penetration of the drug into the stenotic material . due to delivery of therapeutic agent and ultrasound energy through the agent , this method and device of the present invention are further useful for treatment of other body lumens , such as the urethra , ureter , fallopian tubes , or urological disorders related with prostate gland ( bph — benigh proctatic hyperplasia ), and can be used for impotency ( erectile dysfunction ) treatment by ultrasonically stimulating sexual organs , urinary tract , and the like . the present invention can be used for targeted and localized drug delivery for treatment of lung , vasculature , vasopasm and tumor treatment . in addition , this invention is very useful for the treatment of closed wounds as a fistulas , canals , etc ., by destroying bacteria cells and stimulating healthy tissue cells . the invention can perhaps be better appreciated by referring to the drawings . fig1 is a perspective view of ultrasound catheter drug delivery system 2 , comprising an ultrasound generator 4 , a connector 6 operatively connecting ultrasound generator 4 with a transducer 8 , a housing 10 surrounding transducer 8 , and a catheter 12 having a proximal portion 14 with a chamber 16 containing a therapeutic agent 18 . transducer 8 has a tip 20 with a radial surface 22 and a distal radiation surface 24 . chamber 16 is in fluid communication through tubing 26 with a fluid source 28 , and directly with at least one lumen 30 of the distal portion 32 of catheter 12 that extends to catheter distal end 34 . fluid source 28 can be , for example , a reservoir with a pressure pump or syringe . the proximal section 36 of catheter proximal portion 14 sealingly engages housing 10 . preferably the inner surface 38 of proximal section 36 has threads 40 that engage reciprocal threads 42 on the outer surface 44 of housing 10 . this arrangement will allow the operator to vary the distance between distal radiation surface 24 and the distal end 46 of chamber 16 to regulate ultrasonic pressure and energy level . while radial surface 22 can be smooth or substantially smooth , it is preferred that this surface is not smooth , for example , with rings , threads , barbs , or the like , which will create more ultrasonic pressure in catheter 12 . in the embodiment of the invention shown in fig1 ultrasonic energy at a pre - selected frequency is sent through the catheter 10 with fluid such as a therapeutic agent as a transmission member . ultrasound energy will pass through therapeutic agent 18 to catheter distal end 34 . catheter 12 may be formed from a conventional rigid or flexible material , dependent upon the application . it would be appropriate for catheter 12 to be flexible if the catheter is to be inserted into tortuous vascularity or if catheter distal end 34 is to be attached to a vessel , fistula , or the like . a second embodiment of the invention is shown in fig2 where transducer 50 is fixedly , optionally removably , attached to the proximal section 52 of the proximal portion 54 of a catheter 56 . transducer 50 has a tip 58 with a radial surface 60 and a distal radiation surface 62 . catheter proximal portion 54 has a chamber 64 with a therapeutic agent 66 that is in fluid communication with each of two fluid sources 68 , 70 through lumens 72 , 74 , respectively . fluid sources 68 , 70 may provide two or more fluids , e . g ., liquid or gas , such as saline or oxygen , to be ultrasonically mixed and delivered through lumen 76 to catheter distal end 78 . [ 0031 ] fig3 is a semi - cross - sectional view of the proximal end of a catheter according to the invention wherein three fluid sources 80 are each in fluid communication through a lumen 82 with chamber 84 of catheter proximal section 86 . the distal radiation surface 88 of a transducer ( not shown ) is positioned within chamber 84 . in fig4 a connector 110 operatively connects an ultrasound generator ( not shown ) with a transducer 112 , which has a tip 114 with a radial surface 116 and a distal end surface 118 . a catheter 120 has a proximal portion 122 with a chamber 124 containing a therapeutic agent 126 . chamber 124 is in fluid communication through tubing 130 with a fluid source 132 , and directly with at least one lumen 134 of the distal portion 136 of catheter 120 that extends to catheter distal end 140 . fluid source 132 can be , for example , a reservoir with a pressure pump or syringe . the proximal section 142 of catheter proximal portion 122 sealingly engages radial surface 116 . chamber 124 must be attached to ultrasonic transducer distal tip 114 at the mechanical resonant node , such as node 144 . if chamber 124 is not connected to the resonant node ( either a little before or a little after the mechanical node ), the intensity of the ultrasound energy at distal end 140 will be attenuated , i . e ., damped , and ultrasound waves and / or energy will be transferred to the walls of chamber 126 , possibly damaging the chamber 126 structure assembly , which may cause leakage . in the embodiment of the invention set forth in fig5 a connector 150 operatively connects an ultrasound generator ( not shown ) with a transducer 152 , which has a distal tip 154 with a radial surface 156 and a distal end surface 158 . a catheter 160 has a proximal portion 162 with a chamber 164 containing a therapeutic agent 166 . transducer distal tip 154 has a central orifice 170 . chamber 164 is in fluid communication with at least one fluid source 172 through central orifice 170 , which can be smooth , waved , ringed , slotted , grooved , or threaded , and infusion lumen 174 within tubing 176 . two or more fluid sources 172 and infusion lumens 174 can mix and deliver different therapeutic agents . chamber 164 is also in fluid communication with lumen 180 in the distal portion 182 of catheter 160 that extends to distal end 184 . the non - smooth surface of orifice 170 , such as rings or threads , increases the pressure of liquid in chamber 164 . chamber 164 should be attached to ultrasonic transducer distal tip 158 at a mechanical resonant node , such as node 190 . similarly , each lumen 174 should intersect central orifice 170 at a resonant node , such as node 192 . the catheter systems herein are comprised of conventional materials . the transducer and catheter chamber are preferably comprised of suitable metallic or even polymeric substances . most preferably the transducer distal tip is comprised of a metal such as titanium 0 . 25 or nitinol . as is mentioned throughout , the invention here can deliver one or more liquid or gaseous substances to a catheter distal end . such substances include , but are not limited to , therapeutic agents such as antibiotics or antiseptics , saline , oil , water , oxygen , anticoagulants such as heparin or cumadine , or even liquid medical polymers , or mixtures of two or more thereof . the preceding specific embodiments are illustrative of the practice of the invention . it is to be understood , however , that other expedients known to those skilled in the art or disclosed herein , may be employed without departing from the spirit of the invention or the scope of the appended claims . | US-81357701-A |
the stem is cast about an irregular plug body , which is then removed , leaving a wall thickness that satisfies the opposing constraints of high strength and relatively low stiffness . the plug narrows the prosthesis wall thickness in upper regions thereof and strengthens the wall about regions of recessed or discontinuous features , or high load coupling , to assure that the stem has adequate strength in regions of high strain , while effectively coupling strain to surrounding bone . the prosthesis is produced in a range of sizes , and plugs or entire molds for casting the hollow body are readily made and modified by a three - dimensional printing mold fabrication technique . | fig1 shows a prior art intramedullary stem hip prosthesis such as has been proposed in u . s . pat . no . 5 , 092 , 899 . the prosthesis has a femoral head 12 attached at a neck portion 14 to a stem 10 , via a generally large and contoured transition joint 18 and shoulder 16 . the stem 10 has a generally tapered and elongated body with at least a lower portion tapered at a small but fairly regular angle which is specified in that patent to be under approximately five degrees and adapted to fit securely within a suitably prepared central bore in the femur of a patient . a comparably tapered internal bore 26 extends axially through the center of the stem , either partially along the length to an intermediate depth 22 or 24 , or fully through the end 25 . the difference between the outer contour and the inner bore defines a wall thickness 20 , 29 , or 29 &# 39 ;, which may be either uniform , as shown on the lateral side or different at different places along the length , as appears in the medial side . the device of fig1 may be contrasted with , for example , a conventional solid prosthesis , having a somewhat similar outer contour but no interior hollow , and which therefore is more rigid . as shown , the position of the bore in the device of fig1 is utilized to thin out the walls in an upper region or even along the entire length of the device and make it more flexible . however , the use of a uniformly tapered bore within an irregular and partly geometric outer taper contour provides a constraint on the degree of flexibility that can be attained at different points along the length while maintaining a given degree of structural strength . furthermore , such prostheses are normally provided in a range of sizes to fit , for example , within a 12 mm , 13 mm , or even a 15 or 16 mm hollow in the femur . the actual stiffness of each of the prior art solid prosthesis differs , and it is not clear whether any value is gained by thinning the upper portion of a prosthesis in a manner proportionate or linearly related to the thinning occurring in a lower portion . indeed , while the construction of fig1 definitely provides a reduced wall thickness over the prior art , it is not clear whether such a tapered reduction is either effective to stimulate bone in the upper region , or helpful in any way in the lower region , for a given size of prosthesis . fig1 a shows , by way of further background a conventional prosthesis 10 &# 39 ; of solid construction . this prosthesis has been widely marketed by johnson & amp ; johnson , and includes regions of surface texture 30 , near the ends for enhanced bone coupling , as discussed further below . its outer contour is somewhat similar to that of the device of fig1 and includes an elongated portion configured to fit closely within a prepared medullary opening . fig2 shows a prosthesis 100 in accordance with the present invention applied to the prosthesis of fig1 a . in this embodiment , a stem 110 is substantially identical , for example , in its outer contour to that of the body 10 &# 39 ; of the prosthesis fig1 a , but is modified by having an irregular hollow 36 extending centrally at least partially therethrough . unlike bore 26 of the prior art article of fig1 the hollow 36 is not a machined boring , but rather is an irregularly - shaped void that provides a non - linear hollowing of the interior of the prosthesis 100 with a thin - walled proximal end , and preferential thickening of the prosthesis wall at one or more positions along its length . furthermore , the hollowing provides a net wall thickness in the range of about two to seven millimeters , such that substantially the entire prosthesis below the joint mounting , i . e ., below femoral head 12 and neck or post 14 , is a thinned - shell or somewhat bendable shaft . with this construction , forces exerted at or through the articulation hip ball or ball mounting post , cause a distributed strain field throughout the surface regions of the prosthesis which are to contact surrounding bone . in particular , the shell has a thickness such that axial and bending stiffness of the prostheses are of the same order of magnitude , even in the collar and shoulder regions of the prosthesis , as the natural axial and bending stiffness of the femur in which the prosthesis is to be inserted or embedded . furthermore , this is achieved without excessively diminishing the strength of the prosthesis in the upper area , without altering the outer surface , and preferably with selective thickening in localized areas of high strain . the embodiment shown in fig2 is a metal prosthesis having a number of rough or textured surface patches 30 disposed at the distal end and the proximal shoulder regions , and optionally in other intermediate positions ( not shown ) along the stem 110 . these textured outer surface regions may be of known type , and basically provide regions of porous surface relief which couple with very high shear strength attachment to newly - growing bone . these textured regions may be formed in a number of ways , such as by directly casting the prosthesis in a textured mold , separately machining a texture onto the surface of an already - cast prosthesis , or brazing or welding - on separate beads or wires of material ; such texturing constructions do not require detailed description . however , as pertinent to the present invention , one specific construction will be described in which the textured patches 30 are formed by originally forming the prosthesis with pockets or recesses corresponding to the region of each patch 30 , wherein the surface is recessed approximately one millimeter to form a shallow pool or tray . texture is then created in the tray by placing metal beads or grains in the tray and heating the assembly to weld or melt the beads or grains onto its recessed surface . fig2 a shows the prosthesis 100 in a section through such a textured patch 30 , illustrating representative contours of the inner wall 44 of the hollow interior in accordance with a preferred embodiment of the present invention , and showing the exterior wall 40 of the prosthesis . walls 44 and 40 together define the wall thickness t at each point . as shown , behind the outer recess or bead pocket defining the textured patch 30 , a support portion 32 of the wall extends with increased thickness t s to accommodate the high stresses which will be transmitted to bone in this area , while the thickness t r may be as great or greater at and beyond the distal portion of the outer pocket to define a thickened band 32b in that more highly strained , load - bearing region . as shown , this portion extends beyond the abrupt indentation forming the pocket edge , allowing the prosthesis wall to maintain uniformly high strength , while nonetheless distributing the load to thinner walls surrounding the pocket and providing a relatively low level of bending stiffness throughout . thus , rather than providing a regular hollow interior contour that is set below the maximal indentation , in general , the inner wall 44 follows a contour below the outer surface of the neck to assure a relatively thick collar , providing a strong , well - supported transfer of the load into the hollow stem , while thinning out to distribute strain in a hollow shell of reduced thickness in the regions below the shoulder extending into the femur . the thickness of this shell varies , being in general thinner where the stem is of larger diameter , and as noted above , selectively thicker in regions of high stress or where load transfer to surrounding bone is to be preferentially reduced . the wall may also be thickened in regions where bending deflection is highest , e . g ., toward the midpoint of the stem . fig2 b shows a corresponding section in the lower , or distal , region 110b of the stem 110 . in that region the overall stem diameter is much less than that of the proximal end , e . g ., under half as great , and the inner wall 44 defines a much thicker prosthesis wall thickness t . this thickness may be , for example , three to six millimeters , whereas the thickness just below the reinforcement 32b in the proximal region may be from about two to four millimeters . indeed , the hollow 36 may entirely terminate above region 110b , so that the distal end is entirely solid , at least for the smaller gauge stem sizes on the order of twelve millimeters . the precise inner diameter for each stem size may be selected by employing beam modeling to achieve the stiffness illustrated in fig6 and 6a . also shown in fig2 a is a cap piece 38 which closes the hollow prosthesis . cap 38 may also include a striker surface , that is struck to tap the stem into position when installing it in the femur . the wall thickness around the cap 38 is also substantial to assure that no cracks or deformations occur in the casting or cap during assembly or implantation . fig3 schematically shows a casting mold 200 used for forming the prosthesis 100 . as shown , the mold 200 comprises mold block including separable halves 200a , 200b and an inlet - defining portion 200c which together form a closed cavity in which the prosthesis is cast via inlets 201 , 202 as well as breather passages or sprues ( not shown ) of conventional type , which together allow the cavity 205 to entirely fill with molten metal . within the cavity 205 , a filler body or plug insert 210 formed of refractory material defines a central region which does not fill with metal , and which corresponds in size and shape , after accounting for thermal expansion , to the hollow interior of the finished prosthesis shown in fig2 . as shown , the filler body 210 is highly irregular , bulging out below the neck 207 of the casting mold cavity to generally follow the outer contour , but also defining a thickened support wall in the region corresponding to the post on which the hip ball mounts in the finished prosthesis . this provides a hollowing out of the prosthesis in a manner to generally leave a web or sheet of casting material structurally supporting the protruding post ( 14 , fig2 ) and dimensioned to receive the load distributed thereto . furthermore , the filler body 210 narrows appreciably at an intermediate position a along its length which corresponds roughly to a region of increased strength having both reduced flexibility and reduced strain in the elongated thinner portion of the finished prosthesis . the narrowing at region a of the filler body produces a thickening of the prosthesis wall cast in that region , and corresponds , for example , to a textured recess 30 . the filler body 210 tailored to the mold cavity 205 may be formed of a ceramic material and is preferably formed by a process of 3 - d printing such as that disclosed in applicant &# 39 ; s co - pending u . s . patent application , ser . no . 08 / 457 , 227 filed jun . 1 , 1995and now u . s . pat . no . 5 , 687 , 788 , and more generally in u . s . pat . no . 5 , 204 , 055 of sachs et al . fig4 illustrates this construction applied , for clarity of illustration , to an entire mold for such a prosthesis . the mold including insert portion 210 is built up layer by layer on a vertically movable table 225 by a process wherein a controller 220 iteratively controls a spreader to deposit a thin layer 250 of ceramic powder and drives a stepper - controlled hardening head 230 in a two dimensional scan across the upper surface over the deposited powder . the head 230 locally hardens part of the thin layer by depositing a liquid but hardenable medium in the thin layer of powder as it moves across the top surface of the plug body 210 under construction and , as illustrated , preferably also over regions radially outward therefrom which are to become the external mold body 200 . the hardenable material may be formed by a fine spray of colloidal silica binder ejected from piezoelectrically actuated nozzles in the head 230 . in other embodiments , the unconsolidated material may comprise a refractory powder in a curable flowable binder . in the latter case , a laser head may &# 34 ; fix &# 34 ; or harden the binder locally in a pattern by applying heat or light energy thereto . the table 225 is then lowered , and the steps of applying loose powder and selectively applying a curable binder are repeated , and these three steps are repeated sequentially so the plug body 210 is built up layer by layer in successive two dimensional scans across its then current top surface , to form a completed plug insert and mold assembly as shown in fig3 and fig4 ( iv ). it will be understood that the unconsolidated powder is removed and baking or firing are then applied to further bind and stabilize the plug and mold . the body may be consolidated into a solid ceramic by firing at high temperatures . the completed plug body 210 positioned in the center of mold body 200 thus defines a thin shell - like passage between the plug and the mold which is filled with metal in casting the prosthesis of fig2 . following casting , the outer mold block is separated or broken away and the plug body 210 is removed from the cast article , for example , by impact , ultrasonic pulverization , or by some combination of mechanical removal and chemical etching and cleaning techniques . for example , an etch or a differential etch which attacks the material of plug and mold but does not attack the surrounding metal may be used . fig5 is a view similar to fig2 illustrating in greater detail representative wall cross sections of the finished prosthesis . as shown , extending along its length the prosthesis has a number of regions 310 , 320 , 330 , 340 having distinctly different ratios or geometric properties . thus , in the uppermost region 310 various structural elements such as the post and plug have thick - walled adjacent regions of support , while in the neck 320 , the prosthesis has a wide diameter , and a preferentially thickened wall section in the region of the upper texture pocket 30 ( fig2 ). in an intermediate region 330 , the body has tapered somewhat but the wall again thickens locally to maintain a suitably high bending stiffness or high wall strength behind another textured region 30 . finally , in the lower region 340 , the wall may be of an intermediate thickness or may be entirely solid , distally beyond the end of the hollowing mold plug 210 ( fig3 ). thus , the wall thickens and thins locally , both along the length of the prosthesis and side - to - side , to simultaneously tailor wall strength and strain transfer to surrounding bone . the prosthesis in accordance with present invention may largely be constructed by conventional techniques in that the outer body may be formed in the same mold as conventionally used for forming a prosthesis of that size . however , the mold is modified by inclusion of a plug body to displace metal from the central region of the casting . because this plug body 210 is preferably formed by the process shown in fig4 its dimensions are readily scaled or modified via control 220 so that a similarly shaped but differently dimensioned plug may be built for each size of prosthesis , of a different diameter , such as an eleven millimeter , thirteen millimeter or fifteen millimeter nominal diameter stem . for an item such as a hip prosthesis stem , the &# 34 ; size &# 34 ; may be specified by several parameters , which may correspond , for example , to its taper and nominal diameter . these , as noted above , cover a well - defined range of sizes , for each of which a plug insert is readily constructed to fit within the external contour defined by each mold cavity and yet has a wall thickness calculated to produce effective strain transfer from the prosthesis to surrounding bone . in general , the thickness values are selected to define stiffness parameters approximating those of a natural bone of the size to which the prosthesis is fitted , and these latter stiffness values are readily calculated from the bulk modulus of bone and the bone dimensions . however , a minimal wall thickness ( e . g . 2 mm .) is set to assure that at least a minimum threshold of strength will be achieved despite dimensional variations which occur within the range of manufacturing tolerances . fig6 illustrates by way of example in curve a the axial stiffness of a typical bone , about one - half e 8 mm 4 × n / mm 4 , and shows a corresponding curve b of stiffness of a prosthesis in accordance with the present invention having a wall thickness on the order of two millimeters and using a titanium alloy . the horizontal axis corresponds to distance below the prosthesis collar . as shown , the wider proximal end has a stiffness above that of bone , but substantially less than ten times as great . in this critical region where stress shielding has conventionally been a problem , the prosthesis may be thinned further or provided with specialized structure such as a ribbed reinforcement of a thin shell to reduce stiffness yet provide adequate local load bearing strength . by way of contrast , the axial stiffness of the solid prosthesis of fig1 a is shown in curve c . fig6 a shows a corresponding graph of bending stiffness modeled for a similarly sized femur ( curve b ). in each case , the stiffness of a corresponding solid prosthesis is shown ( curve c ). the prostheses of the present invention generally are characterized by stiffnesses which lie in the region r disposed near curve b , and , at the proximal end , within the region s below curve c . furthermore the region r generally lies entirely above curve a . however , in a variation of the device , the device may be thinned at one or more intermediate regions to achieve a stiffness of or below that of curve a . this is feasible since the prosthesis need only resist compressive forces during installation , and in a healthy bone the implanted casting will be supported and constrained by surrounding bone so that its mid section need not be full strength . however , a critical concern for such construction will be the maintenance of suitably precise manufacturing tolerances to cast a wall thickness under two millimeters and achieve low stiffness without manufacturing defect . in general , it is desirable that the axial stiffness , and bending stiffness of the finished prosthesis lie near the curve b shown in fig6 and that the torsional stiffness if applicable to the particular bone under consideration , be similarly matched . in fact , while applicant is not aware of any studies correlating particular ( e . g ., axial , or torsional ) stiffness with bone growth , the process of adjusting structural stiffness by casting a hollow interior in accordance with the present invention is expected to allow one to optimize structural strength while adjusting one stiffness parameter , for example the torsional stiffness , to provide bone stimulation . in practice the characteristics of a finished prosthesis are readily measured , or may be modeled using software such as the program beam sections , of kern international , inc ., duxbury , mass ., so that the exact contours of the mold plug insert 210 for a given size casting are dependably and readily adjusted to reduce or increase the stiffness at a given point along the prosthesis length to achieve a stiffness of the desired range in the region r . the invention being thus disclosed in respect of a cast hip stem embodiment , adaptations to other shapes and types of prosthesis will occur to those skilled in the art , as well as variations and modifications for different joints , and different materials and different manufacturing processes . such adaptations , variations , and modifications are considered to lie within the scope of the invention , as set forth in the claims appended hereto . | US-76489596-A |
a housing for a power tool has an integral molded air channel or duct . the air channel surrounds the flywheel rotor of the power tool engine . the air channel is able to capture air pushed by the spinning flywheel rotor and direct the air directly towards the muffler of the engine . the air mixes with the exhaust gases from the muffler to reduce the temperature of the gases as they leave the housing . | referring to fig1 there is shown a partial perspective view of a leaf blower and back pack assembly 10 incorporating features of the present invention . although the features of the present invention will be described with reference to the embodiments shown in the drawings , it should be understood that features of the present invention can be embodied in many different alternate embodiments . in addition , any suitable size , shape or type of elements or materials could be used . the assembly 10 generally comprises a back pack 12 and a blower unit 14 . any suitable type of back pack could be provided , such as the back packs described in u . s . pat . nos . 5 , 011 , 058 and 5 , 176 , 303 . however , in alternate embodiments , a back pack need not be provided . the blower unit 14 generally comprises an internal combustion engine 16 , a housing 18 , a discharge tube 20 , and an impeller or fan blade ( not shown ) operably connected to the engine 16 . the engine 16 rotates the fan blade to push air into and through the discharge tube 20 . the blower unit 14 can be removed from the back pack 12 and converted into a vacuum , as is known in the art , by use of a vacuum accessory kit ( not shown ). the housing 18 includes a carry handle 22 , a fan blade housing section 24 , and a rear cover 26 . the fan blade housing section 24 has an air inlet ( not shown ) for the fan blade . in alternate embodiments , the housing 18 could be made of more members or fewer members . the rear cover 26 , in the embodiment shown , is attached to the rest of the housing to partially enclose the engine 16 . referring also to fig2 and 3 , the rear cover 26 , in this embodiment , is comprised of a single one - piece molded polymer or plastic member . the cover 26 has a general box - like shape with an open front end having mounting bosses 28 . the mounting bosses 28 are provided to fixedly attach the cover 26 to the rest of the housing by suitable fasteners , such as screws . the top wall 30 , back wall 32 , and a side wall 34 have air slots 36 for air to move into and out of the interior 38 of the cover 26 . the back wall 32 also has a hole 40 for the starter cord ( not shown ) attached to the starter handle 42 ( see fig1 ) to operably pass through the cover 26 . in addition , the cover 26 has another hole 44 located at an outlet to the engine &# 39 ; s muffler for exhaust gases from the muffler to exit from inside the cover 26 . located on the inside of the cover 26 are structural strengthening ribs 46 . projecting inwardly from the back wall 32 are three walls 48 , 49 , 50 that form an air channeling section . this air channeling section forms a channeling air flow path as further described below . an inwardly projecting post 52 is also provided to prevent the back wall 32 from being accidently pushed in . the post 52 could also be used to mount the recoil starter ( not shown ) to the cover 26 in area 54 . the air channeling section formed by the walls 48 , 49 , 50 is provided to interact with the flywheel rotor 56 ( see fig4 ) of the engine 16 . referring also to fig4 the rotor 56 has starter pawls 58 and fins 60 on its top surface 57 . in the embodiment shown , the top surface 57 is actually facing a rearward direction towards the back wall 32 of the cover 26 . the rotor 56 is fixed to the shaft of the engine and has a magnet ( not shown ) as is known in the art . the outer walls 48 , 49 of the air channeling section form a first integral inwardly extending air channeling wall section . the outer walls 48 , 49 are suitably sized and shaped to surround a substantial portion of a side perimeter of the rotor 56 or , in other words , substantially entirely surrounds the side perimeter of the rotor . both outer walls 48 , 49 have arcuate shapes . the smaller outer wall 49 has a substantially constant radius of curvature and faces the larger outer wall 48 . the larger outer wall 48 has a changing radius of curvature . as shown in fig4 the outer walls 48 , 49 and rotor 56 combine to form a flow path or conduit 62 from the rotor 56 directly to the muffler 64 of the engine . the changing radius curvature of the larger outer wall 48 forms the conduit 62 with a general volute shape . an open space 66 is provided between the ends of the outer walls 48 , 49 for locating the magneto section ( not shown ) of the engine proximate the side of the rotor 56 . the magneto section ( not shown ) substantially closes the gap between the ends of the outer walls 48 , 49 at the open space 66 . thus , the side perimeter of rotor 56 is substantially enclosed . an outlet 68 is provided , however , at the muffler 64 . the inner wall 50 forms a second wall section . the inner wall 50 is located inside an inner perimeter of the fins 60 . the inner wall 50 is inwardly projecting and generally circular . a notch 70 is provided in the inner wall 50 to allow the starter cord ( not shown ) to operably pass therethrough . the inner wall 50 establishes an inner barrier for air flow to enhance air movement by the fins 60 of the rotor 56 . vortexes or turbulence at the area of the rotor 56 inside the inner rim of the fins 60 is prevented from significantly interfering with air flow movement . with this arrangement , substantially all of the air pushed by the fins 60 of the rotor 56 is pushed through the conduit 62 for delivery towards the muffler 64 . the purpose of directing substantially all of the air pushed by the rotor 56 towards the muffler 64 is to reduce the temperature of exhaust gases from the engine at the point in which the exhaust gases leave the blower unit 14 . because the air from the rotor 56 is directed directly towards the muffler 64 and its outlet , the air both cools the housing of the muffler 64 and mixes with the exhaust gases as the gases pass from the outlet muffler 64 to the hole 44 in the rear cover 26 and out of the unit 14 . in addition , the cooling air also cools the area of the cover 26 surrounding the hole 44 . by using substantially all of the air from the rotor 56 , and integrating the air flow conduit with the rear cover , the present invention allows the unit 14 to pass governmental hot gas temperature standards without the use of an additional attachment or guard . this can obviously reduce the manufacturing cost of the unit 14 while meeting newer governmental hot gas standards . referring now also to fig5 a rear view with a cut away section of an alternate embodiment of the present invention is shown . in this embodiment the two outer walls 48a , 49a of the rear cover 26a that constitute the first air channeling wall section include both arcuate portions 72 and 73 and , straight portions 74 and 75 . the arcuate portions 72 , 73 are substantially similar to the walls 48 , 49 of the embodiment , shown in fig1 - 4 . the straight portions 74 and 75 extend from the arcuate portions 72 , 73 , respectively , directly to the hole 44a . with this embodiment , the cooling air from the rotor 56a is guided in the flow path 62a all the way to the hole 44a for a more concentrated cooling air mixture with the exhaust gases . from this embodiment , it should be evident to a person skilled in the art that various different shapes of air channeling sections could be provided . the walls that extend inwardly from the back wall 32 could be separate members that are attached to the cover 26 rather than integral with the rest of the cover . the cover 26 could be made from multiple members . in alternate embodiments , rather than the cover 26 being a back cover , it could be located at any suitable location ; wherever the flywheel rotor is located . the present invention could also be used with an engine that did not have a muffler ; the air channeling section directing air from the rotor 56 towards the exhaust outlet of the engine . the present invention could also be used in other types of power tools having internal combustion engines including other types of lawn and garden power tools . it should be understood that the foregoing description is only illustrative of the invention . various alternatives and modifications can be devised by those skilled in the art without departing from the invention . accordingly , the present invention is intended to embrace all such alternatives , modifications and variances which fall within the scope of the appended claims . | US-34548094-A |
a sheet wave water attraction includes a buoyant structure adapted for floating on a naturally occurring body of water , a sheet wave generator mounted to the structure , and a wave - forming ramp on the structure cooperating with the wave generator for the formation of waves on the ramp . the wave generator has a water intake below a waterline on the structure . the intake is configured to draw water from the body of water adjacent the structure . the buoyant structure has a shallow draft , including the draft of a water intake for the wave generator whereby near - costal off - shore positioning may be achieved for operationally positioning the water attraction close to shore . | the following description of the preferred embodiment of the invention is not intended to limit the invention to this preferred embodiment , but rather is illustrative of aspects of the invention that may be found in other embodiments falling within the scope of the invention , and so as to enable a person skilled in the art to make and use this invention . the floating sheet wave water attraction 10 , floats on a naturally occurring body of water 12 and includes a structural frame 14 which serves as a foundation for buoyancy devices and at least one wave generator system . the frame 14 may be built out of aluminum or fiberglass or other structural materials , preferably which will not corrode or absorb water . preferably also the frame 14 is relatively light - weight to decrease the required buoyancy . padding 16 may be removably attached to the frame 14 , for example along railings 18 . a ramp 20 is mounted also atop the frame 14 . the ride surface of ramp 20 may be made of a separate plastic material that is mounted to the frame components 14 a underneath ramp 20 . the surface material for ramp 20 would be known to one skilled in the art of constructing sheet wave generators and water attractions located on dry land . inclined walkways 22 , which may , for example , include a set of stairs ( not shown ), extend along and laterally outside of the sidewalls 24 to allow users &# 39 ; access to the top platform 26 . the walkway 22 may also be made of a plastic material and configured so as to allow water to drain through the walkway . the top platform 26 and the bottom platform 28 may have a grated or otherwise porous surface to allow the flow of water to fall back into the body of water 12 . platforms 26 and 28 may be padded to enhance safety and comfort for the users . the sheet wave generator system ( not shown with the exception of intake 30 and nozzle 32 ) draws water through intake 30 from the naturally occurring body of water 12 . the intake 30 feeds an axial flow pump ( not shown ) which forces a volume of water , for example at a flow rate of between 17 , 000 and 20 , 000 gallons per minute , through shaped nozzle 32 . the axial flow pump may be for example a flygt ™ 7000 series column pump , available presently from the xylem ™ company , distributors of flygt ™ pumps . other axial flow pumps , for example a diesel driven axial flow pump of sufficient capacity , may also work . nozzle 32 is shaped , as would be known to one skilled in the art , to shape the flow of water into a sheet which flows in direction a up the ramp 20 to form a sheet wave ( not shown ). the sheet wave is produced by the shape of the ramp 20 as the water flows over , and follows the contours of ramp 20 as would also be known to one skilled in the art . the sheet wave may then be used in a conventional manner to body - surf , or board , or conventionally surf in the manner of conventional sheet wave generators , with the exception of the unusual or unconventional wave forms caused by undulations of the floating water attraction 10 in the presence of waves or swells on body of water 12 . after flowing up the ramp 20 the flow of water in direction a flows on to the top platform 26 and falls through its grated or porous surface to drop back into the naturally occurring body of water 12 . vertical sidewalls 24 may be provided both for safety and to contain the flow of water pumped over ramp 20 . body surfing , boardriding or surfing is intended to take place on , aligned generally down the longitudinal length of , ramp 20 between sidewalls 24 . railing 18 on top platform 26 inhibits the users from being swept off the top platform by the flow of water coming off ramp 20 . the water delivery system pump may for example be located near the nozzle 32 or may be located under the ramp 20 structure 14 a . the pump and the balance of the water delivery system may be hidden from view by a housing 34 . the floating sheet wave water attraction 10 is mobile in one preferred embodiment . advantageously it may also be modular for ease of setup , takedown and storage . being modular allows for ease of transport if another location is desired and transport by water is not possible or desirable . in the modular embodiment , structure or frame 14 is produced in multiple sections . each individual section has floats 36 or other forms of buoyancy as would be known to one skilled in the art in order to make the water attraction self - buoyant , and sufficiently buoyant to support not only the dry weight of the water attraction but also the weight of the on - board water , including the sheet wave , and the weight of the users . the embodiment illustrated has three individual sections as seen in fig5 , although this is not intended to be limiting , as more or fewer sections would also work . thus left , center , and right sections 10 a , 10 b , 10 c are provided respectively . more sections may be added or removed as necessary to increase or decrease the overall size of the structure . advantageously , each section has a height , length , and width which allows for the individual sections to be transported by truck and trailer . the purpose of this modular construction is to make the transport and setup of the water attraction simple , fast , and inexpensive . once assembled , the water attraction may , for example , have a length of 45 feet , a width of 25 feet , and a height ( including below the waterline to the bottom of frame 14 ) of approximately 9 . 5 feet . when setting up the floating sheet wave water attraction 10 at the desired location the individual sections 10 a , 10 b , 10 c may be individually placed in the water because they are self - buoyant and advantageously self - righting . once all of the individual sections are in the water they can then be pieced together and releasably fastened , or coupled , to one another to complete their assembly . the floating sheet wave water attraction 10 is mobile because it can be easily disassembled , transported to desired location and then reassembled . the water attraction may also be transported by towing , without disassembly , to different locations on the same body of water 12 . in alternative embodiments the water attraction may be self - powered , for example , by the use of conventional nautical - use motors or engines or , for example , by the redirection of some or all of the throughput of the on - board water pump via directional steering nozzles ( not shown ) mounted to or under the structure . the water attraction may thus be propelled over the body of water by steering inputs to change the orientation of the steering nozzles relative to the structure and relative to the body of water . the water attraction will be positioned in an advantageous location on the body of water , and moored to secure it from drifting . moorage may be accomplished by the conventional use of an anchor or multiple anchors , and corresponding anchor lines secured to the frame 14 . because the water attraction is intended in many instances to be used by the public , for example on a pay - for - ride basis , a preferred location for the water attraction is near to shore . consequently , a shallow draft , for example in the order of three to four feet , is desirable . this however poses a problem in the design of intake for the wave generator pump . depending on the size of the surface area of ramp 20 , a sheet wave requires a considerable mass or volumetric flow rate of water being pumped over the ramp . for example , applicant expects that in one embodiment the axial pump in the wave generator must move a volume of water in the order of 17 , 000 to 20 , 000 gallons per minute for a water attraction having overall frame dimensions of the aforementioned approximately 45 feet length by 25 feet width by 9 . 5 feet height . this volume of water must then be supplied through the pump &# 39 ; s intake . however , regulatory guidelines , which will change depending on the locale and jurisdiction , may dictate the required size of screened intake relative to the volumetric flow rate through the intake . for example , in the case of okanagan lake in british columbia , canada , the regulatory requirements are described in guidelines published by the canadian federal department of fisheries and oceans , entitled freshwater intake end - of - pipe fish screen guideline ( dfo5080 , dated march 1995 ), which provides a table correlating intake pipe inflow rates with a corresponding intake screen area . scaling up the table rates to the aforementioned range of volumetric flow rates ( 17 , 000 - 20 , 000 gpm ) resulted in a corresponding open intake screen area of approximately 110 to 135 square feet respectively , the open intake screen area being defined as the total area of the openings in the screen ( which area excludes the material of the screen itself ). the effective intake screen area , defined as the area of screen material , required is dependent on the type of screen material used ; for example , a screen material comprising 80 % open area would result in requiring an effective intake screen area of approximately 130 to 170 square feet , for volumetric flow rates in the range of 17 , 000 gpm to 20 , 000 gpm . the challenge , then , is to provide such a large effective intake screen area while still achieving a minimal or shallow draft , so that close - to - shore operations are feasible . the resulting design , as illustrated , is to at least partially flush mount the intake 30 under the structure of frame 14 , for example centered as illustrated . intake 30 is shown as a rectangular prism , however this is not intended to be limiting , as other two or three dimensional shapes will work and still achieve the desired shallow draft , keeping in mind that typically a clearance is required between the intake screen and the floor or bed of the lake or ocean , so as to minimize the clogging of the intake screen and ingestion of silt . thus , the moorage depth must provide for the draft , including the weight of the on - board , above water - line water , and the weight of all users onboard , and also has to provide for the desired clearance between the intake screen and floor or bed of the water body , and also allow for the rise and fall of the water attraction due to waves and swells on the water body and tidal action as the case may be . in a further aspect , in locations where waves and swells on the body of water may be considerable , which may cause excessive pitch , roll and / or yaw ( or excessive rate of change of these ) of the floating water attraction , dampeners or other means for dampening the pitch , roll or yaw of the water attraction , may be desirable . for example , spring lines may be employed for the moorage lines ( where moored for example to pilings ) or for the anchor lines ( where positioned using anchors ) or combinations of these . other dampeners , such as sea anchors are known in the art and may be employed to control pitch , roll and yaw of the water attraction beyond that which provides entertaining or challenging waveforms as the sheet wave interacts dynamically with the waves or swells on the body of water . as a person skilled in the art will recognize from the detailed description and from the figures and claims , modifications and changes can be made to the preferred embodiment of the invention without departing from the scope of this invention . the invention should not be limited by the above described embodiment , method , and examples , but by all embodiments and methods within the scope of the invention . | US-201615232495-A |
a tool for the hygiene and cutting of cuticles , fingernails and toenails , wherein two interchangeable jaws , provided with respective cutting blades , are removably supported by two jaw holders connected to respective handles for gripping the tool itself ; the jaw holders and the handles are mutually hinged to rotate the aforementioned jaws between an open position and a closed and cutting position . | with reference to fig1 the reference number 1 indicates in its entirety a set of nail clippers for the hygiene and cutting of cuticles , fingernails and toenails . the nail clippers 1 are wholly made of stainless steel and comprise two arms 2 a , 2 b mutually hinged by means of pivot pin 3 in correspondence with respective ends defined by appendices 4 . each arm 2 a , 2 b presents , at opposite sides of its own appendix 4 , a longer portion , which is curved and shaped in such a way as to define a handle 5 for gripping the nail clippers 1 , and a short end portion 6 , which bears hinged a respective jaw holder 7 a , 7 b by means of a pivot pin 8 . in proximity to its own appendix 4 , at the opposite side of the end portion 6 , each arm 2 a , 2 b bears a screwed on cylindrical element 9 , which is oriented in the same direction as the appendix 4 itself and serves as an internal support element for a helical spring 10 interposed between the arms 2 a , 2 b themselves . the jaw holder 7 a , shown in greater detail in fig4 and 6 , is connected to the respective arm 2 a through its own end portion 11 defined by two appendices 12 positioned at opposite sides of the portion 6 and hinged thereon by means of the aforementioned pivot pin 8 . the jaw holder 7 a is provided with a seat 13 able removably to support a respective interchangeable jaw 14 a , shown , in detail , in fig1 , 11 and 12 . the jaw 14 a is defined by a single piece so shaped as to present a tip 15 provided with a cutting blade 16 , a substantially cylindrical terminal body 17 provided with an intermediate annular groove 18 , and a substantially cylindrical central body 19 positioned between the tip 15 and the aforesaid terminal body 17 . in particular , the central body 19 presents a diameter that is greater than the diameter of the terminal body 17 and is partially flattened , at the part confining with the terminal body 17 itself , in order to present two planar rectangular faces 20 diametrically opposite to each other . the seat 13 for supporting the jaw holder 7 a presents a first compartment 21 for receiving and supporting the central body 19 , and , in communication with the compartment 21 , a second compartment 22 able to house the terminal body 17 in its interior . specifically , the compartment 21 presents two planar lateral walls 23 , mutually parallel , which are at a mutual distance approximating by excess the distance between the faces 20 of the central body 19 so as to be coupled , each , with a respective face 20 . the compartment 21 also presents a bottom planar wall 24 , which is orthogonal to the walls 23 and serves as a support wall for the central body 19 . the bottom wall 24 centrally presents a circular hole 25 for communicating with the cylindrical cavity 26 defining the second compartment 22 . in particular , the cavity 26 presents a diameter approximating by excess the diameter of the terminal body 17 , and is placed in “ t ” communication with an additional cylindrical cavity defined by a through hole 27 obtained in the jaw holder 7 a . the hole 27 and the cavity 26 present respective mutually orthogonal axes 28 and 29 . the jaw 14 a , once housed in its seat 13 , is axially locked in the seat 13 itself by means of a screw 30 screwed inside the hole 27 and terminating inside the groove 18 . the jaw 14 b and the jaw holder 7 b are substantially similar to the jaw 14 a and to the jaw holder 7 a described above . in particular , for the reason described above , the jaw holder 7 b is shown in fig7 and 9 with the same reference numbers used to describe the jaw holder 7 a . lastly , as shown in fig1 the jaw holders 7 a and 7 b are mutually connected , in correspondence with respective end appendices 31 positioned adjacent to the seats 13 , by means of a pivot pin 32 parallel to the pivot pins 3 and 8 and to the screws 30 . in conclusion of the above , it should be stressed that the tip 15 of the pair of interchangeable jaws 14 a , 14 b can have a different shape from the one shown in fig1 , 11 and 12 described above . in this regard and as shown in fig1 and 14 , the aforementioned tip 15 assumes , respectively , a shape particularly suitable for cutting cuticles and a shape particularly suitable for cutting in - grown nails . this , in fact , constitutes a further advantage of the present invention , since it allows to have available , for each nail clipper set of the type described above , a plurality of jaws , each dedicated to a particular cutting requirement . it should , moreover , be noted that the interchangeable jaws , thanks to their relatively low cost , can conveniently be of the disposable type . the invention thus conceived can be subject to numerous modifications and variations , without thereby departing from the scope of the inventive concept . moreover , all components can be replaced by technically equivalent elements . | US-75675001-A |
improved footwear comprising a flexible cover component for a human foot including a sole portion , an upper portion integrally related with the sole portion including a toe section for defining a cavity adapted to receive a human foot , a pair of side sections extended rearwardly from the toe section , a heel tab integrally related to the rearward section of the sole portion and extended upwardly therefrom for confining the heel of the foot , and a flexible binder component for securing the cover component about the foot including a strap united with the heel tab and adapted to be united with the toe section employing velcro fasteners and the like . | turning first to fig1 , 3 and 7 , wherein is illustrated footwear comprising a foot cover , generally designated 10 , which embodies one embodiment of the instant invention , it is noted that the foot cover , when in an assemblied configuration , includes a cover component 12 for encasing a foot and a binder component 14 for securing the cover component to the encased foot . it is important to appreciate that the foot cover 10 may be employed indiscriminantly with either a right foot or a left foot and , within a practical range , may be employed for encasing feet of multiple sizes . referring now to fig3 it can be seen that the cover component 12 includes a first portion , herein referred to as a sole portion and designated 16 , corresponding and having the functions generally ascribed to the sole of a shoe . additionally , the cover component 12 includes an upper portion , designated 18 , corresponding and having functions generally ascribed to the &# 34 ; upper &# 34 ; of the shoe . the upper portion 18 includes a toe section 19 which along with the sole portion forms a toe cavity 20 , fig3 and includes flexible side sections 21 which serve to confine a foot . it is at this juncture important to understand that the material from which the cover 10 is fabricated is varied as desired . of course , the specific material from which the cover 10 is fabricated is dictated , at least in part , by the particular environment in which the cover is employed . however , as currently employed the cover 10 preferably is fabricated from light - weight fabric material having the general characteristics of woven cloth . as shown in fig7 a blank 22 having a central segment 24 from which extends a pair of wings , designated 26 and 28 , and a heel tab 30 initially is cut from a selected material . the central segment 24 forms the sole portion 16 , fig3 while the wings 26 and 28 are folded into engagement and stitched together above the central segment 24 for thus forming the cavity 20 of a size and configuration suitable for receiving a foot of any one of a plurality of similar sizes . it is important to note that the wings 26 and 28 also include extended tabs which form the side sections 21 , as best shown in fig3 . in order to facilitate adjustment of width for the cavity 20 , the wings may be secured together employing releasable fasteners such as velcro fasteners and the like , not shown . additionally , a heel tab 30 is provided as an integral part of the sole portion 16 and extends therefrom to form a loop 32 , as shown in fig2 . the function of the loop 32 , in turn , is to couple the binder component 14 to the heel tab 30 . as a practical matter , the binder component 14 preferably comprises a double - layered strap 34 having one layer extended through the loop 32 and the other layer thereof passed over the outer surface of the loop , as best illustrated in fig3 . consequently , the loop 32 captures the strap 34 in a manner which permits the positional relationship established therebetween to be varied . hence , the positional relationship of the strap and the sole portion 16 of the foot cover may be varied selectively for purposes of altering the over all length of the sole portion 16 of the cover component 12 . preferably , the opposite end portions of the strap 34 are connected to the toe section 19 employing velcro fasteners 36 . as is well known , velcro fasteners are formed of two portions or halves , one half comprising the so - called &# 34 ; hook &# 34 ; portion , and the other half the so - called &# 34 ; loop &# 34 ; or &# 34 ; woolly &# 34 ; portion . in instances where the cover component 12 is fabricated from material having a fibrous outer surface , such as material sold under the trademark velfoam , only one - half , or the hook portion , of a velcro fastener need be provided for coupling the strap to the toe section of the upper portion 18 . however , as shown , the velcro fastener 36 includes a first half or hook portion 36a stitched to the strap and a second half or loop portion 36b stitched to the external surface of the toe section at an appropriate location , as indicated in fig1 , 3 , and 7 . of course , fasteners other than velcro fasteners 36 can be employed . for example , buttons and snaps can be employed where so desired . referring now to fig4 , 6 and 8 , wherein is illustrated a further embodiment of the instant invention , there is shown footwear comprising a foot cover generally designated 40 . the foot cover 40 is similar in many respects to the foot cover 10 . therefore , and for the sake of convenience , similar components are similarly numbered . the foot cover 40 , as shown in the drawings , preferably is fabricated from a material such as the commerically available , aforementioned velfoam which is characterized by an outer fibrous surface , sometimes referred to as a &# 34 ; woolly &# 34 ; surface , to which the rigid or hook portion of a velcro fastener may readily be attached . in such instances utilization of velcro fasteners is greatly enhanced . however , when employing substantially frictionless material , such as velfoam , in the interest of safety , it often is desirable to affix a friction pad , not shown , to the sole of the foot cover in order to reduce the likelihood of a wearer slipping on floor surfaces and the like . as shown in fig4 and 6 , the foot cover 40 includes a binder component 42 comprising a strap 44 having a hook portion or half of a velcro fastener , designated 46 , stitched or otherwise affixed to each of its opposite ends . additionally , a hook portion or half of a velcro fastener , designated 48 , is stitched or otherwise affixed to the midsection of the strap 44 . as a practical matter , the velcro fastener halves 46 and 48 comprise rigid or hook valves of fasteners whereby the fasteners are particularly adapted to be releasably attached at any desired location to an adjacent woolly surface of the cover 40 , including the external surfaces of the toe section 19 as well as the heel tab 30 . referring for a moment to fig8 it can be seen that the heel tab 30 comprises a singular foldable member which differs from the heel tab 30 , as shown in fig7 in that no loop is provided . since the velcro fastener 48 is adapted to be employed for securing the binder component 42 to the surface of the heel tab 30 , the loop previously discussed may be deleted . the foot covers 10 and 40 are each supplied in a prefabricated form , as best illustrated in fig3 and 6 . in order to employ the foot covers , designated 10 and 40 , a wearer simply inserts his foot into the cavity 20 leaving the heel tab 30 extended rearwardly from the sole portion 16 of the foot cover . in the event the length of the upper portion 18 of either of the foot covers 10 or 40 exceed the length of the wearer &# 39 ; s foot , the tabs forming the side sections 21 are infolded rearwardly of the heel of the wearer and the binder component then wrapped about the wearer &# 39 ; s ankle with the ends of the straps 34 or 44 , as the case may be , being attached to the upper surface of the toe section 19 of the upper 18 . of couse , where velcro fasteners 36 are employed , opposite halves 36a and 36b of the velcro fastener 36 are united . where , however , velcro fastener halves 46 are utilized for securing the binder component 42 in place , the fastener halves simply are positioned and forced into frictional engagement with the outer surface of the toe section 19 , as best illustrated in fig5 . it should now be apparent that the sole portion 16 of the foot covers 10 and 40 selectively are foreshortened simply by repositioning the binder components 14 or 42 , as the case may be , relative to the heel tab 30 . for example , where the binder component 14 is employed , the binder component is displaced in a direction paralleling , generally , the axis of the foot cover for lengthening or shortening of the sole portion 16 , as desired . similarly , where the binder component 42 is employed the strap 44 is repositioned and resecured to the heel tab 30 , employing the velcro hook portion 48 . at this juncture it is noted that in some circumstances it may be found desirable to fabricate the strap 44 of the binder component 42 of a decorative , durable material which is suited to be employed with numerous long or short term wear foot covers . in such instances , the strap 44 is , preferably , formed of a decorative material and thus rendered suitable for use as an &# 34 ; ankle bracelet &# 34 ;. moreover , the foot cover 10 is particularly suited for use in instances where a &# 34 ; reversible &# 34 ; capability is desired . for example , it may be found desirable to provide an anti - friction surface on the sole portion of the foot cover in certain circumstances , while other textures having greater frictional characteristics may be more appropriate for other uses . hence , the foot cover may be fabricated from materials which accommodate a reversal in order to accommodate numerous uses . of course , the versatility of the velcro fasteners also makes it possible to employ these fasteners in numerous arrangements in order to further enhance the utility of the foot covers which comprise the improved footwear of the instant invention . in view of the foregoing , it is believed to be readily apparent that the foot covers embodying the instant invention provide a simple economic , practical and improved footwear characterized by enhanced utility . although the invention has been herein shown and described in what are conceived to be the most practical and preferred embodiments , it is recognized that departures may be made therefrom within the scope of the invention , which is not to be limited to the illustrative details disclosed . | US-87909678-A |
a method of quantitatively assessing the effectiveness of an audiovisual , visual or audio advertisement including the steps of : presenting the advertisement to a plurality of subjects , the advertisement having a sequence of audiovisual , visual and / or audio features which occur as a function of time ; obtaining , during presentation of the advertisement , eeg signals from the subjects from predetermined scalp sites thereof ; calculating ssvep amplitudes and / or phase differences from eeg signals obtained from the predetermined scalp sites in order to obtain output signals which represent predetermined psychological states of each subject to the features as a function of time ; combining the output signals from the subjects to obtain pooled output signals ; and displaying the pooled output signals to thereby enable quantitative assessment of the subjects &# 39 ; responses to the features of the advertisement in order to assess the effectiveness of the features of the advertisement . | the invention will now be further described with reference to the accompanying drawings , in which : fig1 is a schematic diagram of a system of the invention ; fig2 is a schematic view showing in more detail the manner in which visual flicker stimuli are presented to a subject ; fig3 is a schematic view illustrating the international 10 - 20 system of electrode locations ; fig4 is a diagrammatic representation showing opacity as a function of radius of a screen which is used in the system of the invention ; fig5 represents still frames from a video advertisement ; and fig6 to 11 illustrate data obtained from subjects as a function of time . fig1 schematically illustrates a system for determining the response of a subject or a group of subjects to audiovisual material presented on a video screen 3 and loudspeaker 2 . the system includes a computer 1 which controls various parts of the hardware and also performs computation on signals derived from the brain activity of the subject 7 , as will be described below . the computer 1 also holds the television program and advertisements which can be presented to one or more subjects 7 on the screen 3 and / or through the loudspeaker 2 . the subject or subjects 7 to be tested are fitted with a headset 5 which includes a plurality of electrodes for obtaining brain electrical activity from various sights on the scalp of the subject 7 . the headset includes a visor 4 which has for the left and right eyes of the subject half silvered mirrors 8 and white light light emitting diode ( led ) arrays 9 , as shown in fig2 . the half silvered mirrors 8 are arranged to direct light from the led arrays 9 towards the eyes of the subject 7 . the led arrays 9 are controlled so that the light intensity therefrom varies sinusoidally as a function of time ; under the control of control circuitry 6 . the control circuitry 6 includes a waveform generator for generating the sinusoidal signal . the circuitry 6 also includes amplifiers , filters , analogue to digital converters and a universal serial bus ( usb ) interface or a transmission control protocol ( tcp ) interface or other digital interface for coupling the various electrode signals into the computer 1 , as will be described in more detail below . a translucent screen 10 is located in front of each led array 9 . printed on the screen is an opaque pattern . the opacity of the opaque pattern is a maximum in a circular area in the centre of the centre of the screen . beyond the circular area , the opacity falls off smoothly with radial distance from the circular area circumference , preferably , the opacity falls off as a gaussian function described by equation 1 . the screen therefore reduces the flicker in the central visual field thus giving subjects a clear view of the visually presented material . the size of the central opaque circle ( not shown ) should be such as to occlude the visual flicker in the central visual field between 4 °- 6 ° vertically and horizontally . in other words the screen 10 blocks the flicker from the fovea of the subjects . the screen 3 presenting the advertisements typically subtends an angle of 10 °- 14 ° vertically and horizontally as measured from the eyes of the subject . if r ≧ r then p is given by the equation 1 below . where p is the opacity of the pattern on the translucent screen 10 an opacity of p = 1 . 0 corresponds to no light being transmitted through the screen while an opacity of p = 0 corresponds to complete transparency . r is the radius of the central opaque disk while r is the radial distance from the centre of the opaque disk . g is a parameter that determines the rate of fall - off of opacity with radial distance . typically g has values between r / 4 and 2r . fig4 illustrates the fall - off of opacity with radial distance from the centre of the disk . in fig4 , r = 1 and g = 2r . while a gaussian fall - off of opacity with radius is preferable , any function that is smooth and has a zero gradient at r = r and at r & gt ; 3g will be suitable . the computer 1 includes software which calculates ssvep amplitude phase and / or coherence from each of the electrodes in the headset 5 . details of the hardware and software required for generating ssvep are well known and need not be described in detail . in this respect reference is made to the aforementioned u . s . patent specifications which disclose details of the hardware and techniques for computation of ssvep . briefly , the subject 7 views the video screen 3 through the special visor 4 which delivers a background flicker to the peripheral vision . the frequency of the background flicker is typically 13 hz but may be selected to be between 3 hz and 50 hz . more than one flicker frequency can be presented simultaneously . the number of frequencies can vary between 1 and 5 . brain electrical activity will be recorded using specialized electronic hardware that filters and amplifies the signal , digitizes it in the circuitry 6 where it is then transferred to the computer 1 for storage and analysis . sspt is also used to ascertain regional brain activity at the scalp sites using sspt analysis software , which is known and does not need to be described herein . as mentioned above , the visor 4 includes led arrays 9 . in one embodiment , the light therefrom is varied sinusoidally . an alternative approach utilises pulse width modulation where the light emitting sources are driven by 1 - 10 khz pulses and the pulse duration is proportional to the brightness of the light emitting sources . in this embodiment , the control circuitry 6 receives a digital input stream from the computer 1 and outputs pulse width modulated pulses at a frequency of 1 - 10 khz . the time of each positive going zero - crossing from the sinusoidal stimulus waveform or combination of stimulus waveforms is preferably determined to an accuracy of about 10 microseconds and stored in the memory of the computer 1 . brain electrical activity is recorded using outputs from the multiple electrodes in headset 5 or another commercially available multi - electrode system such as electro - cap ( eci inc ., eaton , ohio usa ). the number of electrodes is normally not less than 8 and normally not more than 128 , typically 16 to 32 . the electrodes are disposed so as to obtain outputs from selected scalp sites which are identified by the international 10 - 20 system of electrode locations shown schematically in fig3 . brain activity at each of the electrodes is conducted to the control circuitry 6 . the circuitry 6 includes multistage fixed gain amplification , band pass filtering and sample - and - hold circuitry for each channel . amplified / filtered brain activity is preferably digitized to 16 - 24 bit accuracy at a rate not less than 300 hz and transferred to the computer 1 for storage on hard disk ( not shown ). the timing of each brain electrical sample together with the time of presentation of different features of the audiovisual material are also registered and preferably stored to an accuracy of 10 microseconds . the details of the control circuitry 6 are well known and need not be described . the digitized brain electrical activity ( electroencephalogram or eeg ) together with timing of the stimulus zero crossings enables one to calculate the ssvep elicited by the flicker at a particular stimulus frequency from the recorded eeg or from eeg data that has been pre - processed using independent components analysis ( ica ) to remove artefacts and increase the signal to noise ratio . ica is a mathematical technique for decomposing a signal into independent constituent components . this can be used to remove artefacts because artefact signals will be independent of brain activity . bell a . j . and sejnowski t . j . 1995 , an information maximisation approach to blind separation and blind deconvolution , neural computation , 7 , 6 , 1129 - 1159 ; t - p . jung , s . makeig , m westerfield , j . townsend , e . courchesne and t . j . sejnowskik , independent component analysis of single - trial event - related potential human brain mapping , 14 ( 3 ): 168 - 85 , 2001 . calculation of ssvep amplitude and phase coefficients for each stimulus cycle for a given stimulus frequency can be accomplished used fourier techniques using equations 2 and 3 below . equation 2 describes the calculation of stimulus frequency fourier coefficients for a single cycle of the flicker stimulus . essentially , the eeg output is sampled at specific points in time and is represented by f ( nt + iδτ ) while the stimulus is represented by the cosine function in equation 2 and the stimulus waveform shifted by 90 degrees is represented by the sine function . equation 2 enables calculation of the single cycle fourier coefficients ( real and imaginary ) by calculating the sum of the product of the eeg output waveform and the stimulus waveform ( cos ) and the stun of the product of the eeg output waveform and the stimulus waveform phase shifted by 90 degrees ( sin ) over a single cycle . the single cycle fourier coefficients are smoothed by averaging overlapping sets of fourier coefficients , where : a n and b n are the cosine and sine fourier coefficients respectively where ; ssvep amplitude and ssvep phase can be calculated using equation 3 below . where a n and b n are overlapping smoothed fourier coefficients calculated by using equation 4 below . amplitude and phase components can be calculated using either single cycle fourier coefficients ( a n and b n ) or coefficients that have been calculated by smoothing across multiple cycles ( a n and b n ). equations 3 and 4 describe the procedure for calculating the smoothed ssvep coefficients for a single subject . for pooled data , the ssvep coefficients ( a n and b n ) for a given electrode are averaged ( or pooled ) across all of the subjects or a selected group of subjects . as the number of cycles used in the smoothing increases , the signal to noise ratio increases while the temporal resolution decreases . the number of cycles used in the smoothing is typically in excess of 5 and less than 130 . the above equations apply to scalp recorded data as well as brain electrical activity inferred at the cortical surface adjacent to the skull and deeper regions . activity in deeper regions of the brain such as the orbito - frontal cortex or ventro - medial cortex can be determined using a number of available inverse mapping techniques such as besa , emse and loreta . once the system has been set up and headsets 5 fitted to one or more subjects , the audiovisual program or advertisement to be evaluated is displayed on the screen 3 , the visual flicker is switched on in the visor 4 and brain electrical activity of the subject or subjects is recorded continuously on the computer 1 . at the end of the recording stage , the ssvep amplitude and phase are separately calculated for each subject . once all recordings are completed , group averaged data is calculated by averaging the smoothed ssvep amplitude and phase data from selected subjects to be included in the group ( eg male , female , young , old ). changes in regional synaptic excitation or inhibition are indicated by ssvep phase changes while changes in regional activity ( irrespective of whether these changes are associated with excitation or inhibition ) are indicated by changes in ssvep amplitude . typically , such inverse mapping techniques require 19 or more scalp recording sites and preferably 64 or more scalp recording sites . in accordance with the invention , cognitive and emotional measures at specific points in time during the advertisement can be derived from the pattern of ssvep phase and ssvep amplitude changes at the various scalp recording sites or inferred brain regional activity . scalp recording sites typically used are identified by reference to the international 10 - 20 system ( jasper h h : electroenceph . clin . neurophysiol . 1958 ; 10 : 370 - 1 ) shown in fig3 . the psychological states associated with ssvep phase and amplitude changes at scalp and brain cortical locations are summarised below . activity at various brain sites can be determined using a variety of possible inverse mapping techniques such as emse and loreta that express brain activity in selected brain regions in terms of a function of ssvep amplitude and phase measures recorded over the entire scalp . typically such techniques require more than 20 scalp recording sites and preferably 64 or more scalp recording sites . this measure refers to the level of visual attention to detail . examples include visual attention to text and numbers as well as visual attention to details of a scene or a face . ssvep phase advance or amplitude change at the left occipital region , preferably electrode o 1 has been found to be relevant to assessment of the subject &# 39 ; s visual attention to detail . if inverse mapping techniques are used , the relevant location in the left cerebral cortex is the vicinity of brodmans area 17 . this measure refers to the level of visual attention to global features . examples include visual attention to images such as scenery or faces as a whole . ssvep phase advance or amplitude change at the right occipital region , preferably electrode o 2 has been found to be relevant to the assessment of the subject &# 39 ; s visual attention to global features including responses to facial expressions displayed on the screen . if inverse mapping techniques are used , the relevant location in the right cerebral cortex is the vicinity of brodmans area 17 . this measure refers to multi - modal or multi - sensory attention . typically this includes both auditory and visual attention to detail in the visual domain or speech in the auditory domain . when this attention measure is also associated with objects , it indexes the level of desirability associated with the said object . ssvep phase advance or amplitude change at the left parietal region , preferably electrode p 3 has been found to be relevant to the assessment of the subject &# 39 ; s multi - modal attention to detail or desire for the subject matter of the screened advertisement . if inverse mapping techniques are used , the relevant location in the left cerebral cortex is the vicinity of the left intraparietal area . this measure refers to multi - modal or multi - sensory attention . typically this includes both auditory and visual attention to global features such as facial expression , scenery in the visual domain or music in the auditory domain . when this attention measure is also associated with objects , it indexes the level of desirability associated with the said object . ssvep phase advance or amplitude change at the right parietal region , preferably electrode p 4 has been found to be relevant to the assessment of the subject &# 39 ; s multi - modal attention to global features or desire for the subject matter of the screened advertisement . if inverse mapping techniques are used , the relevant location in the left cerebral cortex is the vicinity of the right intraparietal area . this measure indicates the intensity of the emotional state experienced by subjects . this measure is independent of the specific emotion such as joy , fear , anger , anxiety , etc . ssvep phase advance or amplitude change at the right parieto - temporal region , preferably from a single electrode which is approximately equidistant from right hemisphere electrodes o 2 , p 4 and t 6 , has been found to be relevant to the assessment of the subject &# 39 ; s emotional intensity response to different parts of the screened advertisement . if inverse mapping techniques are used , the relevant location in the right cerebral cortex is the vicinity of the right parieto - temporal junction . this measure indicates the extent to which subjects are attracted or repelled to characters or situations represented in the advertisements . when activity at the combination of left hemisphere sites is greater than at the combination of right hemisphere sites , subjects are attracted to the scene or character and vice versa . the difference between ssvep phase advance at the left frontal / prefrontal and right frontal / prefrontal regions has been found to be relevant to the assessment of the subject &# 39 ; s attraction - repulsion response to the screened advertisement . attraction is indicated by a larger phase advance in the left hemisphere compared to the right while repulsion is indicated by a larger phase advance in the right hemisphere compared to the left . attraction - repulsion can be calculated as follows : attraction =( a 1 * ssvep phase advance at electrode f 3 + a 2 * ssvep phase advance at electrode f p1 − a 3 * ssvep phase advance at electrode f 4 − a 4 * ssvep phase advance at electrode f p2 ) a positive value for the attraction measure is associated with the subjects finding the screened material attractive and liked while a negative measure for attraction is associated with repulsion or dislike of the screened material . if inverse mapping techniques are used , the attraction can be calculated as follows : attraction =( c 1 * right orbito - frontal cortex ( in vicinity of brodman area 11 )+ c 2 * right dorso - lateral prefrontal cortex ( in vicinity of brodman area 9 )+ c 3 * left orbito frontal cortex ( in vicinity of brodman area 11 )+ c 4 * left dorso - lateral prefrontal cortex ( vicinity of brodman area 9 )) and wherein the averaged ssvep phase measures at the above sites are inserted in equation 6 . this measure indicates the level of engagement . engagement refers to the extent that different components of the advertisement elicit a sense of personal relevance . engagement of the subject in the screened advertisement can be calculated by the weighted mean ssvep phase advance at prefrontal sites described by the expression below . engagement =( b 1 * ssvep phase advance at electrode f 3 + b 2 * ssvep phase advance at electrode p p1 + b 3 * ssvep phase advance at electrode f 4 + b 4 * ssvep phase advance at electrode f p2 ) where b 1 = 0 . 1 , b 2 = 0 . 4 , b 3 = 0 . 1 , b 4 = 0 . 4 equation 7 engagement =( d 1 * right orbito frontal cortex ( in vicinity of brodman area 11 )+ d 2 * right dorso - lateral prefrontal cortex ( in vicinity of brodman area 9 )+ d 3 * left orbito frontal cortex ( in vicinity of brodman area 11 )+ d 4 * left dorso - lateral prefrontal cortex ( in vicinity of brodman area 9 )) where d 1 = 0 . 1 , d 2 = 0 . 4 , d 3 = 0 . 1 , d 4 = 0 . 4 equation 8 and wherein the averaged ssvep phase measures at the above sites are inserted in equation 8 . behavioural intent or the likelihood that the subjects are likely to act in accordance with the purpose of the screened advertisement , that is make a purchase , is associated with memory encoding at the time of branding . this is indicated by the level of long term memory encoding at the time that the brand is portrayed in the advertisement . long term memory encoding can be assessed as follows : ssvep phase advance or amplitude change at left frontal region , preferably a single electrode which is approximately equidistant from left hemisphere electrodes c 3 , f 3 and f 7 , has been found to be relevant to the assessment of the subject &# 39 ; s long term memory encoding for details and verbal memories of the subject matter of the screened advertisement . if inverse mapping techniques are used , the relevant location in the left cerebral cortex is the vicinity of brodmans areas 6 , 44 , 45 , 46 and 47 . ssvep phase advance or amplitude change at right frontal region , preferably approximately equidistant from right hemisphere electrodes c 4 , f4 and f 8 has been found to be relevant to the assessment of the subject &# 39 ; s long term memory encoding for emotional and non - verbal memories of the subject matter of the screened advertisement . if inverse mapping techniques are used , the relevant location in the right cerebral cortex is the vicinity of brodmans areas 6 , 44 , 45 , 46 and 47 . once data from long term memory encoding has been obtained for verbal and / or non - verbal memories , this can be correlated with the time sequence of the advertising material being presented to determine the relevant levels of memory encoding when the brand is portrayed in the advertisement . after this correlation , it is then possible to assess whether or not the subjects are likely to purchase goods or services shown in the advertisement . the following procedure is used to evaluate a television advertisement to a client such as the brand manager of a company and / or advertising agency . a selected number of subjects , say 50 , are seated in a test room and the headsets 5 are placed on their heads . the visors 4 are then placed in position and adjusted so that the foveal block by the screens 10 prevents the appearance of the flicker over the screens 3 where the advertisements are presented . the number of subjects in a recording session is variable and typically can vary from 1 to over 100 . when pooling subjects to create the average response , the number of subjects whose data is to be included in the average should be no less than 16 . the advertisements to be tested were included in an ‘ advertising break ’ comprising a block of 3 to 6 advertisements incorporated in a television program to simulate a standard commercial tv viewing environment . each advertising break is followed immediately by a 30 second sequence of still images of scenery and a musical accompaniment . typically , 60 images were presented over the period of 30 seconds with each image present for 0 . 5 seconds . the same sequence of images and music were presented after each advertisement break . brain activity levels during the adjacent scene images are used as a reference level for brain activity during the preceding advertisement break . this enables removal of any long - term changes in brain activity that may occur over the time course of the recording period . pooled or averaged data at various brain sites can then be displayed to the client as the difference between the reference level and the value at other points in time during the advertisement . a fixed offset between 0 . 2 to 0 . 6 preferably 0 . 3 radians is then added to the abovementioned difference to yield the ssvep phase data at each scalp site . to minimize subject irritation or discomfort to the subject due to the flicker , the flicker stimulus is of variable intensity and only switched to the highest intensity when material of interest to the client such as the block of advertisements is present on the screen . during the periods that material of interest is not present on the screen , the stimulus intensity is typically zero and never more than 10 % of the typical value used when material of interest is on the screen . preferably , the stimulus is not switched on abruptly but is slowly increased before the advertisement break and decreased slowly after the end of an advertisement break . typically , the stimulus is increased linearly over a 30 - 60 second epoch prior to the advertisement break so that it reaches its maximum value 60 seconds prior to the first advertisement . immediately the sequence of reference images at the end of the advertisement break ends , the stimulus intensity is linearly reduced to the minimum value over a 30 second period . the slow linear increase and decrease of stimulus intensity occurs for every advertisement break . fig5 schematically illustrates the television advertisement to be assessed . the advertisement is in relation to a sports utility vehicle 30 . the vehicle 30 is being driven along a road 32 in a dark forest 34 on a wet and stormy night , as indicated by still segment a . the vehicle 30 drives through a partially flooded roadway so as to cause a large spray 36 from the vehicle , as indicated in still segment b . the vehicle is then shown traversing steep grade , as shown in still segment c . the driver 38 then stops the vehicle where a large log 40 has fallen on the road 32 so as to remove it , as shown in still segment d . after clearing the branch from the road , the driver is about to re - enter the car when he realises that he is covered with mud and would soil the interior of the car were he to enter immediately , as indicated in still segment e . this scene features an abrupt change in the soundtrack when the music stops and is replaced by a period of silence . the driver ruefully finds a cake of soap in the glove compartment and proceeds to take a bath in the nearby stream during the storm . the final segment of the animated part of the advertisement shows a block of text with the brand of the vehicle in the text block , as indicated by still segment f . the final segment g runs for about 2 seconds and shows the brand and product being advertised . once the final subject recording has taken place , individual ssvep data is pooled for each specific group of subjects , for example , separate pooling or averaging could be effected for the entire group and also for subgroups such as male and female and young and old . to display the ssvep phase data in relationship to the associated commercial , an in - house program ( nv - show ) is used . nv - show displays the advertisement in a portion of a computer video monitor and the associated ssvep phase data as a graph below . as the advertisement is played in the upper portion of the screen , the graph describing the ssvep phase data is revealed below . alternatively , the graph of ssvep phase data can be present throughout the advertisement playing time and a moving time marker used to indicate the ssvep phase data corresponding to time in the advertisement being displayed . fig6 to 11 illustrate the brain measurement values at the various brain sites during the advertisement . the block arrows labelled ‘ a ’ to ‘ g ’ in fig6 to 11 correspond to the points in time a to g shown in fig5 . in fig6 , the line 50 shows the attraction - repulsion measure during the advertisement . the attraction - repulsion measures are calculated using equation 5 above and the results are displayed in graphical form on a time scale which corresponds to the duration of the advertisement . positive values or values above the horizontal time axis correspond to ‘ approach ’ or ‘ like ’ while negative values correspond to points in time where the audience ‘ withdraws ’ or ‘ dislikes ’. for the approach - withdraw measure in this study , any value larger than = 0 . 3 or smaller than − 0 . 3 is statistically significant . if a greater number of electrodes were used , it would be possible to use inverse mapping techniques to obtain somewhat higher resolution in the data and by using equation 5 . in fig7 the line 52 indicates the level of audience engagement in the advertisement as a function of time . the data is calculated using equation 7 and is again presented graphically on a time scale which corresponds to that of the advertisement . the term engagement relates to the level of personal or emotional relevance experienced by the subjects . in the study illustrated , engagement must exceed 0 . 4 to be significantly greater than baseline level while an engagement level above 0 . 7 is considered high . if inverse mapping techniques are used , equation 8 can be used to calculate the measure for engagement . in fig8 the line 54 indicates the equivalent changes in emotional intensity elicited by the advertisement . emotional intensity refers to the intensity of emotion experienced by the subjects irrespective of the type of emotion , e . g . fear , joy , anger , excitement etc . the data can be calculated as described above by using ssvep phase advance or amplitude change at right parieto - temporal region , from an electrode which is approximately equidistant from the right hemisphere electrodes o 2 , p 4 and t 6 . if inverse mapping techniques are used , the relevant location in the right cerebral cortex is in the vicinity of the right parieto - temporal junction . once again , any level above 0 . 4 is significantly higher than background while a level above 0 . 7 is considered high . the lines 56 and 58 in fig9 indicate memory encoding in detail and memory encoding global respectively during the advertisement . this measure indicates how effectively different components of the advertisement are being stored in long term memory . this measure is especially important as an advertisement is only effective if the key messages and information about the brand enters long - term memory . it has been found that the likely impact of the advertisement on behavioural intent is positively correlated with the level of long - term memory encoding during the time that branding information is presented in the advertisement . thus behavioural intent or the likely impact on behaviour of the subjects is indicated by the level of memory encoding at the time that branding information is presented in the advertisement , i . e . at points f and g where the branding information is positively displayed during the advertisement . both memory traces are important in regard to behavioural intent . as long as either left or right memory encoding state is high during “ branding ”, behavioural intent or the propensity to act on the message of the advertisement , is high . in fig1 the lines 60 and 62 indicate left hemisphere multi - modal attention and right hemisphere multi - modal attention respectively . multi - modal attention includes visual and auditory attention to details of the advertisement being displayed to the subjects . specifically , the line 60 indicates attention to detailed features such as text and speech and the line 62 indicates attention to global features such as facial expression and music ( for example ). in fig1 the lines 64 and 66 indicate the visual attention to detail and visual attention globally of the subjects to the advertising material being displayed . specifically , the line 64 indicates visual attention to detailed features such as text . the line 64 indicates visual attention to global features such as facial expression ( for example ). for this advertisement to be assessed as effective , it is necessary for memory encoding to be high during the times when the product or product benefits are emphasized , such as at point f and when the brand is explicitly featured such as at point g . as can be seen in fig1 , left memory encoding is moderate to high during point f as indicated by peak 68 in the line 60 indicating that there is adequate memory encoding for the text information the powerful new x ; now with a slick new interior near the end of the advertisement . during this point in time , engagement is also high indicating a high degree of personal relevance regarding the features mentioned as indicated by the peak 70 in line 52 . by contrast , the memory encoding for the branding information at point g is low and engagement is also low for this time as indicated by trough 72 in the line 56 . this indicates that the subjects will remember the vehicle interior but will not recall the brand . the behavioural intent measure is also low indicating that the advertisement is not effective as the subjects will be less inclined to act in accordance with the advertisement . this is again indicated by the trough 72 . accordingly , the advertisement can be assessed as not being commercially effective in that the branding information is not satisfactorily encoded in long - term memory . the dramatic structure of the advertisement is , however , effective in that ‘ joke ’ at point e in the advertisement works because the scene where the driver realizes he can &# 39 ; t re - enter the car without washing is well encoded in long - term memory and also leads to highest level of engagement as indicated by the peak 74 in line 52 . in addition , there is a high level of attraction that is associated with this humour as indicated by peak 76 in line 50 . it is also apparent that the overall structure of the advertisement is effective in that the key dramatic scene where the driver has to get out of the car to clear the road at point d is associated with high levels of emotional intensity as indicated by the peak 76 in line 54 ; high levels of memory encoding as indicated by peak 78 in line 56 ; and a high level of attention to global features as indicated by the peak 80 in line 66 . after assessment of the advertisement using the techniques of the invention , the client can appreciate that the overall effect of the advertisement is positive but some modification is required at points f and g where the brand is introduced . accordingly , the client is in a position to modify the advertisement so that it should become highly successful and avoid incurring substantial advertising costs in an advertising program which does not induce viewers to purchase the product . it will be appreciated that the principles of the invention can be applied other audiovisual commercial communications in addition to advertisements . many modifications will be apparent to those skilled in the art without departing from the spirit and scope of the invention . | US-52086306-A |
a handpiece having at least one set of piezoelectric elements polarized to produce longitudinal motion when excited at the relevant resonant frequency . the piezoelectric crystals are connected to an ultrasonic horn to which a cutting tip is attached . the horn and / or the cutting tip contains a plurality of diagonal slits or grooves . the slits or grooves produce optimized torsional movement in the cutting tip when the piezoelectric crystals are excited at a second resonant frequency . | as best seen in fig2 , horn 12 contains a plurality of spiral slits 24 . preferably , the width of slits 24 is between 2 % and 65 % of the outside diameter of horn 12 . this , of course , will affect how many slits 24 can be made on horn 12 ( e . g ., if slits 24 are 65 % of the diameter of horn 12 , then only one slit 24 may be cut into horn 12 ). the width of slits 24 selected will depend upon the desired amount of torsional movement . the depth of slits 24 in horn 12 preferably is between 4 % and 45 % of the outside diameter of horn 12 . slits 24 may have a flat or square cut bottom , but preferably have a rounded or radiused bottom , which are easier to manufacture . the length of slits 24 preferably is between 8 % and 75 % of the length of the larger diameter of horn 12 . the pitch of slits 24 preferably is between 125 % and 500 % of the larger diameter of horn 12 . by way of example , the inventors have found that one suitable configuration of slits 24 on horn 12 with an outside diameter of 0 . 475 inches is a total of eight slits 24 , having a width of 0 . 04 inches , a depth of 0 . 140 ( with a full radius bottom ), a length of 0 . 7 inches and a pitch of 1 . 35 inches gives suitable torsional movement of horn 12 without compromising the longitudinal movement of horn 12 . as best seen in fig2 , horn 12 contains a plurality of spiral slits 24 . preferably , the width of slits 24 is between 2 % and 65 % of the outside diameter of horn 12 . this , of course , will affect how many slits 24 can be made on horn 12 ( e . g ., if slits 24 are 65 % of the diameter of horn 12 , then only one slit 24 may be cut into horn 12 ). the width of slits 24 selected will depend upon the desired about of torsional movement . the depth of slits 24 in horn 12 preferably is between 4 % and 45 % of the outside diameter of horn 12 . slits 24 may have a flat or square cut bottom , but preferably have a rounded or radiused bottom , which are easier to manufacture . the length of slits 24 preferably is between 8 % and 75 % of the length of the larger diameter of horn 12 . the pitch of slits 24 preferably is between 125 % and 500 % of the larger diameter of horn 12 . by way of example , the inventors have found that one suitable configuration of slits 24 on horn 12 with an outside diameter of 0 . 475 inches is a total of eight slits 24 , having a width of 0 . 04 inches , a depth of 0 . 140 ( with a full radius bottom ), a length of 0 . 7 inches and a pitch of 1 . 35 inches gives suitable torsional movement of horn 12 without compromising the longitudinal movement of horn 12 . as best seen in fig1 , the location of longitudinal and torsional nodal points ( the points with zero velocity of the respective mode ) is important for proper functioning of handpiece 10 . the torsional node 26 preferably is located at the proximal longitudinal node 28 , so that the torsional node 26 and the longitudinal node 28 are coincident , e . g ., both of which are located on plug 18 . handpiece 10 also contains a distal longitudinal node 30 located at reduced diameter portion 32 of horn 12 . as best seen in fig3 , drive circuit 34 that may be used with handpiece 10 of the present invention preferably is similar to that described in u . s . pat . no . 5 , 431 , 664 , the entire contents of which being incorporated herein by reference , in that drive circuit 34 tracks admittance of handpiece 10 and controls the frequency of handpiece 10 to maintain a constant admittance . however , drive circuit 34 monitors both the torsional mode and the longitudinal mode and controls these modes in handpiece 10 using two different drive frequencies . preferably , the torsional drive signal is approximately 32 khz and the longitudinal drive signal is 44 khz , but these frequencies will change depending upon the piezoelectric elements 14 used and the size and shape of horn 12 and slits 24 . although both the longitudinal or the torsional drive signal may be supplied in a continuous manner , preferably the longitudinal drive signal and the torsion drive signal are alternated , so that the drive signal is provided in a desired pulse at one frequency and then switched to the other frequency for a similar pulse , with no overlap between the two frequencies , but no gap or pause in the drive signal . alternative , the drive signal can be operated in a similar manner as described , but short pauses or gaps in the drive signal can be introduced . in addition , the amplitude of the drive signal can be modulated and set independently for each frequency . the pause or gap between drive signals can serve various purposes . one purpose is to allow for the ultrasound movement of piezoelectric elements 14 and horn 12 to attenuate or stop so that lens fragments can once again be suctioned to tip 20 and an occlusion reestablished , thereby increasing the holding force on the lens fragment . reestablishing the occlusion will increase cutting efficiency of the following pulse of ultrasound , whether longitudinal or torsional . another purpose of the pause or gap between drive signals is to allow for the ultrasound movement of piezoelectric elements 14 and horn 12 to attenuate or stop prior to the other ( either longitudinal or torsional ) mode being excited . such attenuation between drive signals will reduce amount of potential non - linear interactions in the system which can generate undesirable heat and lead to premature degradation of piezoelectric elements 14 or mechanical failure of the entire assembly . alternatively , there can be a slight overlap in the longitudinal and torsional drive signals . the overlap may provide relatively short time intervals when the added action of both torsional and longitudinal displacements results in especially fast rate of lens emulsification , and yet the overlap is short enough to prevent piezoelectric elements 14 from premature degradation or failure of the entire mechanical assembly as a result of excessive stress . yet another alternative if to have both longitudinal and torsional drive signals overlap completely thus resulting in applying high stress levels to the lens material when the two signals overlap , and yet leaving a pause in between for the occlusion to reestablish itself and vacuum build - up , thus improving efficiency of the following pulse application . still another alternative is to apply a continuous longitudinal signal with a pulsed torsional signal , or vice versa , a continuous torsional signal with a pulsed longitudinal signal . continuous application of torsional ultrasound does not cause repulsion because tip 20 movement is oriented perpendicular to the direction of the engagement of tip 20 with the lens , and the pulsed applications of longitudinal ultrasound are short enough to prevent overheat or mechanical damage to piezoelectric elements 14 . finally , as discussed above , both the longitudinal and torsional drive signals can be applied continuously and simultaneously , with the amplitudes of the both signals being selected such that overheating and excessive mechanical stress on the system is reduced . if such a drive scheme is to be used , two sets of piezoelectric elements 14 are preferred with the torsional signal being applied to one set , while longitudinal signal applied to the other set . while certain embodiments of the present invention have been described above , these descriptions are given for purposes of illustration and explanation . variations , changes , modifications and departures from the systems and methods disclosed above may be adopted without departure from the scope or spirit of the present invention . | US-18359105-A |
the invention provides a method of treating a mammal having a condition associated with formation of amyloidogenic protein without deposition of amyloid plaques . this treatment includes administering to the mammal a pharmacologically effective amount of congo red or a pharmaceutically acceptable salt or derivative thereof to interfere with amyloidogenic protein formation or to destabilize amyloidogenic protein structures already formed in said mammal . the invention also provides a method of treating a mammal having a condition associated with deposition of amyloidogenic protein in plaques , and a method of inhibiting the transformation of prp - sen to prp - res in a tissue culture sample containing prp - sen . | the applicants &# 39 ; have discovered that congo red not only binds amyloid plaques , but can also inhibit the accumulation of amyloidogenic protein . in this regard , applicants have further discovered that administration of congo red to a mammal in vivo can provide effective treatment , prevention and / or inhibition of many , if not all amyloidogenic diseases . in particular , the invention can be used for both amyloidogenic diseases associated with deposition of amyloid plaques and amyloidogenic diseases , such as creutzfeldt - jakob disease , in which formation of amyloidogenic protein occurs without deposition of amyloid plaques . the ultimate treatment of the present invention is aimed at decreasing amyloidogenic protein accumulation and deposition by inhibiting its formation or decreasing its metabolic stability . amyloid plaques comprise amyloidogenic protein molecules bound in a fibriflous matrix and deposited on the cell surface . the present invention describes a method of inhibiting the accumulation of these plaque - forming proteins in vitro and in vivo by congo red . it is now possible to clinically classify the various amyloid proteins based on the nature of their biochemistry . applicants believe that inhibition of the accumulation of these types of amyloidogenic proteins by congo red would inhibit amyloid fibril formation possibly leading to cessation or stabilization of the disease state . table i lists a variety of amyloidogenic diseases along with their associated amyloidogenic proteins . applicants believe that congo red has the ability to reduce the amount of amyloidogenic protein production associated with many amyloidogenic diseases , inlcuding those listed in table 1 . thus , the administration of congo red to a mammal having one of these conditions is believed to be beneficial in the inhibition , prevention and treatment of these diseases . table 1__________________________________________________________________________the 1990 guidelines for nomenclature and classification of amyloid andamyloidosisamyloid protein . sup . a protein precursor clinical__________________________________________________________________________aa . sup . b aposaa reactive ( secondary ) familial mediterranean fever familial amyloid nephropathy with urticaria and deafness ( muckle - wells syndrome ) al kappa , lambda idiopathic ( primary ), myeloma or ( e . g ., k iii ) macroglobulinernia - associatedah igg 1 ( γ1 ) attr transthyretin familial amyloid polyneuropathy ( portuguese ) familial amyloid cardiomyopathy ( danish ) systemic senile amyloidosisaapoai apoai familial amyloid polyneuropathy ( iowa ) agel gelsolin familial amyloidosis ( finnish ) acys cystatin c hereditary cerebral hemorrhage with amyloidosis ( icelandic ) ab b protein precursor alzheimer &# 39 ; s disease ( e . g ., bpp 695 ) down &# 39 ; s syndrome hereditary cerebral hemorrhage amyloidosis ( dutch ) ab . sub . 2 m b2 - microglobulin associated with chronic dialysisascr scrapie protein , creutzfeldt - jakob disease , etc . precursor 33 - 35f gerstmann - staussler - scheinker cellular form syndromeacal ( pro ) calcitronin medullary carcinoma of thyroidaanf atrial natriuretic factor isolated atrial amyloidaiapp islet amyloid islets of langerhans polypeptide diabetes type ii , insulinoma__________________________________________________________________________ . sup . a nonfibrillar proteins , e . g ., protein ap ( amyloid pcomponent ) excluded . sup . b abbreviations not explained in table : aa = amyloid a protein ; saa serum amyloid a protein ; apo = apolipoprotein ; l = immunoglobulin light chain ; h = immunoglobulin heavy chain amyloid plaques associated with chronic infections such as tuberculosis , osteomyelitis , rheumatoid arthritis , granulomatous ileitis , and many types of mediterranean fever are composed of protein aa , an approximately 8 , 500 dalton , 76 amino acid molecule , heterogenous at the amino terminus . aa proteins have been isolated from a variety of species . the amino acid sequence of the aa protein in various human diseases is similar , contrasting the idiopathic amyloids that exhibit individual variability . the aa protein &# 39 ; s putative precursor is serum amyloid a ( saa ), a 12 . 5 kd ( 104 amino acid ) polymorphic protein with multiple isoforms ( table 1 ). the human saa family consists of six similar but distinct proteins . one in vivo model of amyloidosis in hamsters produces amyloidogenic plaques in the hamsters believed to be caused by aa protein . the following experiment describes one method of inhibiting amyloidosis in hamsters in this model using congo red . female syrian hamsters ( available from charles river labs ) normally develop amyloidosis of the liver , spleen and kidney one year after birth , resulting in a much shorter life expectancy for females than for males ( coe & amp ; ross , j clinical investigation 76 : 66 - 74 ( 1985 )). the amyloidosis can be accelerated markedly by the administration of diethylstilbestrol ( des ) so that it occurs within 2 - 3 months of initiating treatment . to determine the effects of congo red on amyloidosis in this model , four groups of hamsters are compared . the first group ( 10 hamsters ) are given des pellets at 3 months of age followed by a continuous treatment of 2 intraperitoneal injections of 0 . 5 mg congo red per week . the second group ( 10 hamsters ) receive only the des pellets . the third group ( 10 hamsters ) receive only congo red treatments at intervals coinciding with group 1 . the fourth group ( 10 hamsters ) receives injections of sterile water at intervals coinciding with group 1 injections . all animals are analyzed for amyloid deposits in the liver , spleen and kidney by a tissue squash method ( coe and ross , j . exp . med 171 : 1257 - 67 ( 1990 )) after 4 months . the hamsters injected with des and congo red show a reduction in the amount of amyloid deposits compared with group 2 ( des alone ). this result shows inhibition of amyloid plaque formation by congo red . another type of amyloid plaque comprises the al protein , normally detected in patients with multiple myeloma . al protein consists of a variable region portion of either the kappa or lambda immunoglobulin light chains . in some cases the entire kappa or lambda protein molecule is detected . while kappa chain amyloids are prevalent in multiple myeloma and monoclonal gammopathies , the incidence of lambda chain amyloids predominates by a 2 : 1 ration . the al protein amino acid sequence is identical from afl the organs of any one patient . virtually all kappa and lambda chain proteins known to date are amyloidogenic although some seem to be more susceptible to plaque formation than others . it has been known for years that brain tissue from alzheimer &# 39 ; s disease ( ad ) patients contained amyloid plaques which were stainable with congo red . amyloid fibrils from the cerebral blood vessels of ad and from down &# 39 ; s syndrome patients were isolated and found to be caused by the amyloid beta protein ( aibp ). this protein has now been accepted as a probable factor in the pathogenesis of ad . alpha - 1 antichymotrypsin ( a serine proteinase inhibitor ) was also shown to be intimately associated with beta protein in ad . an enormous number of studies have been done confirming that apb derives from an amyloid precursor protein ( app or abpp ). in the dutch type cerebral amyloid with hemorrhage syndrome , the amyloid plaque also comprises a beta protein but with a variant amino acid ( gln 22 ). the original icelandic form of this disease comprises an amyloid protein of cystatin c with one variant amino acid ( gln 68 ). applicant believes that congo red treatment of these diseases may cause a reduction in the level of amyloid protein accumulation . the transmissible dementias or spongioform encephalopathies such as creutzfeldt - jakob disease , gerstmann - straussler syndrome , kuru and a variety of animal diseases such as scrapie , are all characterized by abnormal accumulations of prp - res which often results in amyloid plaques . thus , inhibition of prp - res accumulation by congo red can be used in vivo as a treatment for these diseases . extensive studies have been carried out to assess common factors or substances related to all the amyloid - forming proteins , so far without success . however , the most prominent mechanism proposed for amyloid formation involves the p component of amyloid ( ap ) and its serum counterpart ( sap ). electron microscopy reveals that ap is a 230 kd protein composed of a pair of pentagonally shaped subunits . ap may serve as a scaffold for amyloid fibril formation . when isolated , ap is distinct from an amyloid plaque , does not bind congo red , and is without any fibrillar ultrastructure or cross beta pattern . however , ap has been found in virtually an known forms of amyloid . glycosaminoglycans ( gags ) have also been prominently associated with amyloid . multiple studies have attempted to relate specific gags to amyloid deposits . since most amyloids are associated with highly sulfated gags , it has been postulated that these very negatively charged molecules affect the protein product or precursor processing . traditional studies have regarded amyloid formation as a two - phase process . in the first phase , the production of amyloidogenic precursor proteins is initiated . in the second phase , amyloid fibril deposition or processing occurs . amyloid enhancing factor ( aef ) is known to , for example , shorten either the lag between phases or induction time . this elusive substance has been found in both animal and human amyloid plaques , but is not yet precisely characterized . applicants believe that congo red can inhibit amyloidogenic protein production at the first phase of the process . thus , applicants believe that congo red provides a general method of treatment , prevention and inhibition that is common to all amyloidogenic diseases . amyloidosis is normally suspected in individuals with unexplained renal disease , especially those with nephrotic syndrome . also suspect are individuals with hepatosplenomegaly in association with certain chronic inflammatory disorders such as rheumatic disease . congo red treatment may provide an effective treatment for these disorders . amyloidosis could be considered in patients with a wide range of diseases , for example , carpal tunnel syndrome , macroglossia , neuromuscular disease , congestive heart failure or malabsorption . especially suspect are individuals with plasma cell neoplasms or a homogeneous immunoglobulin in the serum or urine . patients with al amyloidosis frequently have bence jones proteins alone or in association with a serum monoclonal protein . in patients suspected of having al amyloidosis , an examination of the bone marrow can document the underlying plasma cell dyscrasia or possible myeloma . this type of examination can also be used to search for amyloid infiltrates , which can often be found in bone marrow . reactive ( aa ) ( secondary ) amyloid is classically associated with chronic inflammatory and infectious diseases . in recent years , it has become apparent that amyloid may complicate crohn &# 39 ; s disease with an incidence of at least 1 % and that it is a serious complication of chronic drug abuse . patients with cystic fibrosis have also been found to have amyloidogenic plaques . candidates for hereditary amyloidosis include those with family histories of neuropathy with early sensorimotor dissociation especially when it is associated with carpal tunnel syndrome , vitreous opacities , or renal or cardiovascular disease . specific clinical manifestations of amyloidosis vary enormously , depending greatly on the involved organ and the extent of the deposits . the following comments refer largely to generalized ( systemic ) amyloid , i . e ., reactive ( secondary ), idiopathic ( primary ) or heterofamilial , respectively . renal involvement is common in almost all forms of systemic amyloid , ranging from mild urinary red blood cell loss or mild proteinuria to extensive nephrosis . a renal lesion is usually irreversible possibly leading to progressive azotemia . hepatic enlargement from amyloid deposition is common , while signs of portal hypertension from hepatic amyloid plaques are uncommon . hepatic cholestasis with severe liver involvement can also occur due to amyloidosis , although liver function abnormalities , especially elevated serum alkaline phosphatase , are usually minimal , occurring late in the disease . liver scans are known to produce variable and nonspecific results . gastrointestinal symptoms in amyloidosis are very common and result from direct involvement of the gastrointestinal tract from infiltration of the autonomic nervous system with amyloid . the symptoms include those of obstruction , ulceration , hemorrhage , malabsorption , protein loss and diarrhea . cardiac manifestations of amyloidosis consist primarily of congestive heart failure and cardiomegaly . intractable heart failure may be the first manifestation and is the major cause of death in patients with generalized amyloidosis . although cardiac manifestations normally indicate predominantly diffuse myocardial amyloid plaques , the endocardium , valves , and pericardium may be involved . clinically significant amyloid heart disease is common in the al form and rare in aa form of the amyloid plaque . in an echocardiographic study of 28 patients with fap , it was shown that heart disease develops slowly but progressively and that left ventricular diastolic abnormalities precede the development of clinically overt heart disease . isolated cardiac amyloidosis itself has been reported as a cause of sudden death . finally , senile cardiac amyloid has been shown to be a cause of congestive heart failure . amyloid is identifiable in the skin in over one - half of patients with primary or secondary disease , whether or not clinically apparent lesions are present . the lesions vary widely from waxy , often translucent , papules or plaques to nodules or tumefactions . purpuric areas may be present . the lesions are seldom pruritic . involvement of the skin or mucosa may not be apparent even on close inspection but may be discovered at biopsy . patients with hereditary amyloid neuropathy have positive skin biopsies for amyloid in most cases . amyloidosis is infrequently seen in the synovium of patients with aa ( secondary ) disease , but it has been found in al ( primary ) and in disease associated with chronic hemodialysis ( beta - 2 - microglobulin ). in rare instances of al it can mimic rheumatoid arthritis and has been associated with a fullness in the shoulder called the &# 34 ; shoulder pad syndrome &# 34 ;. it has surprisingly a frequent association with osteoarthritis . amyloidosis can also accumulate in the muscles causing a frank myopathy . the β2m amyloid of chronic hemodialysis was first found in the lesions of carpal tunnel syndrome , but is now known to cause an extraordinary variety of bone and joint lesions ranging from carpal tunnel syndrome to destructive arthropathy and cystic bone lesions . kidney transplants have been shown to halt the progression and cause symptomatic relief , but have not as yet been shown to reverse the lesions . neurologic manifestations that are especially prominent in the classic hereditary neuropathies include peripheral neuropathies with early sensorimotor dissociation , and autonomic nervous system involvement with constipation , diarrhea , impotence , and postural hypertension . except for the finnish variety of hereditary neuropathy , cranial nerves other than those involving pupiuary reflexes are generally spared . it has been well known for many years that reactive ( secondary , aa ) amyloidosis is a major complication of rheumatoid arthritis . the early literature reported its incidence in a variety of ways , including renal biopsies , rectal biopsies , congo red tests , gingival biopsies , and with a variety of tissue stains , such that its true incidence was not clear . the earlier literature was also affected by the method in which amyloid was diagnosed in the tissue . crystal violet metachromasia and other histochemical and fluorescent stains as well as congo red were utilized . the current standard for amyloid identification is the demonstration of green birefringence on polarization microscopy after congo red staining and has been generally accepted in the literature since 1980 . although congo red has been used as a stain to identify many of the above disease states , applicants have discovered that congo red can be used in vivo to inhibit amyloidogenic protein accumulation . as stated above , a number of amyloidogenic diseases in mammals occur without actual completion of the plaque forming phase . in this diseases , the amyloidogenic proteins themselves are involved in the diseases - producing process . cruezfeldt - jakob disease is one example of such a disease . the applicants believe that a mammal suffering from amyloid protein production can be effectively treated by administration of a pharmaceutically effective composition of congo red . for instance , congo red ( or its pharmaceutically acceptable salt or derivative ) can be given to a mammal in need of such a treatment by oral or parenteral administration . preferred administration methods include intravenous injection , transdermal administration , intraperitoneal injection , subcutaneous injection , intramuscular injection , intrasternal injection , intrathecal injection or direct infusion techniques . use of appropriate congo red derivative compounds that retain the ability of congo red to interfere with generation and / or deposition of amyloidogenic protein are included within the scope of the present invention . preferred dosages in the treatment of amyloidogenic diseases in mammals are generally in the range of 1 μg / kg to 100 mg / kg . more preferably , the dosage is between 0 . 01 mg / kg and 10 mg / kg . the congo red can be administered in solution in water . however , in certain preferred embodiments of the present invention , a pharmaceutically acceptable carrier , filler , or excipient . congo red can also be administered in a lipophilic solvent or carrier to provide advantageous in vivo effects . lipophilic solvents and carriers include such compounds as dimethyl sulfoxide ( dmso ), phosphotidyl choline , or cholesterol . a patient suffering from cruezfeldt - jakob &# 39 ; s disease is given an intravenous injection comprising a pharmaceutically active concentration of congo red in deionized water . three weeks later , the patient &# 39 ; s progression of the disease state is measured . the patient performs at a higher level of functioning than prior to congo red injection . this example indicates the potential of congo red to inhibit diseases which relate to amyloidogenic protein production without plaque formation . the following examples describe methods of using congo red to inhibit plaque formation in amyloidogenic diseases having this type of manifestation . as discussed in more detail above , there are many diseases resulting in amyloid plaque formation including , transmissible spongioform encephalopathies ( tse &# 39 ; s ), alzheimer &# 39 ; s disease ( ad ), hereditary cerebral hemorrhage with amyloidosis icelandic - type ( hchwa - 1 ) and hereditary cerebral hemorrhage with amyloidosis dutch - type ( hchwa - d ). a patient suffering with a transmissible spongioform encephalopathy ( tse ) is intravenously injected with a pharmaceutically effective concentration of congo red . prior to treatment , a tissue biopsy finds that the patient has a large number of amyloid plaques comprising prp - res . the congo red solution is injected into the patient in a phosphotidyl choline carrier . the number of amyloid plaques in a secondary tissue biopsy finds a reduction in the number of prp - res amyloid plaques after congo red treatment . reducing number of amyloid plaques results in a further medical improvement of the patient . this is one method of successfully treating a patient diagnosed with tse using congo red . another example of using congo red in the prevention of an amyloidogenic disease associated with deposition of prp - res is provided below . in this example , the amyloidogenic disease is scrapie in mice . weanling random bred rml swiss mice were inoculated intraperitoneally with 50 μl 1 % brain homogenate from mice clinically ill with scrapie ( chandler strain ) containing 10 4 - 10 5 ld 50 scrapie agent . one group of eight mice was given twice weekly intraperitoneal injections of 0 . 5 mg congo red ( in sterile water ) starting within 6 hours of the scrapie inoculation . a control group of eight mice was given intraperitoneal injections of water alone . after five weeks , the spleens were harvested from all the animals . the pulp cells from individual spleens were sonicated , treated for 1 h with 33 μg / ml dnaase a ( 37 ° c . ), combined with an equal volume of 20 % sarkosyl , and centrifuged at 10 , 000 rpm in a beckman tl100 . 4 rotor for 30 min . the supernatants were then centrifuged at 70 , 000 rpm for 2 hr . the pellets were resuspended in 10 mm tris - hcl , ph 7 . 5 , sonicated , treated with 10 jig / ml proteinase k for 30 min ( 37 ° c .) and then repelleted at 70 , 000 rpm . the pellets were then analyzed for prp - res by immunoblot using anti - prp antiserum using standard procedures . the average immunoblot signal intensity of prp - res from spleens of congo red injected animals was 87 % less than the average control value . this result suggests that congo red treatment in vivo can substantially reduce the accumulation of prp - res . another example of treatment of an amyloidogenic disease is provided below . in this example , the beneficial effects of congo red are measured by the increase in life span in hamsters infected with scrapie agent . effect of congo red on the incubation time of scrapie in hamsters weanling syrian hamsters ( available from charles river laboratory ) are inoculated intraperitoneally with 0 . 5 %, 1 . 0 %, and 2 . 5 % dilutions of brain tissue from hamsters in the clinical stages of scrapie ( 263k strain ). 50 hamsters are treated with intraperitoneal injections of water alone ( control ). 50 hamsters are treated with 50 μl of a 1 % congo red solution in sterile water beginning several hours before the scrapie inoculation and continuing twice weekly for the life of the animal . the animals injected with congo red have a much longer life span due to reduction in their disease state . these results indicate that congo red can inhibit scrapie ( a prp related disease ) in vivo . in the following in vitro experiments , applicants demonstrate that accumulation of prp - res in mammalian cells can be inhibited by congo red . scrapie - infected mouse neuroblastoma cells were used as a model to study prion protein ( prp ) accumulation . identically seeded , nearly confluent 25 - cm 2 flasks of scrapie - infected mouse neuroblastoma cells ( race , et al . 1988 ) were rinsed twice with phosphate - buffered balanced salt solution and preincubated in 2 mi of methionine - free and cysteine - free minimal essential medium with 1 % dialyzed fetal bovine serum at 37 ° c . after 30 min . an aqueous concentrate of congo red ( sigma ) was added to the medium to give the designated final concentrations . immediately thereafter , 380 lici of tran 35 s - label ( icn ) was added to each flask for a 2 - h pulse labeling . following the radiolabled nucleotides was 10 ml of chase medium ( complete minimal essential medium with 10 % fetal bovine serum ) containing the designated congo red concentration , and incubation continued for 16 h to allow the labeling of prp - res . cell lysates were prepared by standard protocols and , following the removal of aliquots for the total labeled protein analysis , radiolabeled prp - res concentrations were measured using a previously described procedure ( caughey and raymond , 1991 ). in brief , the lysates were treated with proteinase k and ultracentrifuged to isolate prp - res . the prp - res was then solubilized , immunoprecipitated with a rabbit antiserum to prp peptide 89 - 103 ( caughey et al . j . virol 65 : 6597 - 6603 ( 1991 )), and analyzed by sodium dodecyl sulfate ( sds )- polyacrylamide gel electrophoresis ( page ) and fluorography . a 20 % acrylamide pharmacia lyb phastsystemo gel was used for the sds - page . nearly confluent flasks of cells were preincubated with fresh minimal essential medium containing 10 % fetal bovine serum for 20 h . the ceils were then rinsed , preincubated in methionine - and cysteine - free medium , labeled with 100 μci of tran 35 s - label for 90 min , and chased for 30 min according to the general procedure described above . after rinsing with phosphate - buffered balanced salts solution , the cells were incubated for 30 min at 37 ° c . with phosphatidyl - inositol - specific phospholipase c ( piplc ) from bacillus thuringiensis ( low , et al . ( 1988 ) c . j immunol methods 113 : 101 - 111 ) at an activity of 1 . 6 limol / min . the piplc media was centrifuged at 1 , 000 g for 2 min , and the supernatants adjusted to a final concentration of 0 . 5 % sodium deoxycholate , 0 . 1 % sds , 1 % nonidet p - 40 , 0 . 15 m nacl , 1 mm edta , 01 .% gelatin , 50 mm tris - hci ( ph 8 . 0 ). 5 μl of antiserum r34 was added to precipitate the prp - res . the remainder of the immunoprecipitation and analysis by sds - page - fluorography ( 12 . 5 % acrylamide gel ) was performed as described previously ( caughey , et al ., 1991a ). prp - res separated on a 20 % acrylamide gel was electrophoreticauy transferred onto a polyvinyl difluoride membrane ( miuipore ) using the pharmacia lkb phastsystf - mo the membrane was blocked with 5 % nonfat dried milk in 1 0 mm tris - hci ( ph 8 . 0 ), 150 mm nacl , and 0 . 05 % tween - 20 ( tbst ). the filter was incubated for 2 h at ambient temperature with anti - prp serum diluted 1 : 1000 in tbst . after washing in tbst , the filter was strained with horseradish peroxidase - conjugated goat anti - rabbit immunoglobulin and the ecl luminescence detection kit ( amerisham ). estimates of the relative amounts of prp - res detected in the immunoblot lanes were obtained by comparing the film exposure times giving densitometrically equivalent band intensities . the effect of congo red on the accumulation of newly synthesized prp - sen in scrapie - infected neuroblastoma cultures was tested by metabolically labeling prp - res in the presence of congo red . concentrations of congo red greater than 1 . 4 μm nearly eliminated detectable labeling of prp - res ( fig1 a ). fig1 describes the effect of congo red on the metabolic labeling of prp - res ( lanes a ) versus total lysate proteins ( lanes b ). prp - res was 35 s - labeled in scrapie infected neuroblastoma ceils in the presence or absence ( control ) of the designated concentrations of congo red . the total lysate proteins were methanol - precipitated from detergent lysates after nuclei and debris removal by low - speed centrifugation . equal flask equivalents were loaded onto each lane in both panels . the positions of molecular mass markers are designated in kda on the right side of fig1 . the inhibitory effect of 1 . 4 μm congo red on the labeling of prp - res as shown here was observed in three similar duplicative experiments . because the two generally recognized hallmarks of prp - res are its protease resistance and its aggregated state , a protocol was used employing both proteinase k treatment and ultracentrifugation to discriminate prp - res from normal prp . in addition , to test for the possibility that congo red decreased the proteinase k resistance of prp - res without affecting its aggregation state , or vice versa , the experiment was repeated using only proteinase k treatment ( followed by methanol precipitation ) or ultracentrifugation of the cell lysates before the solubilization and immunoprecipitation of prp - res . in each case , congo red - dependent reductions in prp - res labeling were observed , indicating that congo red inhibited the labeling of prp - res as defined by either aggregation or proteinase k resistance . the inhibitory effect of congo red appeared to be selective for prp - res since the highest concentrations of congo red tested ( 42 μm ) did not change the overall profile of labeled proteins in the cell lysates before proteinase k treatment ( fig1 b ). furthermore , there were no effects of these congo red treatments on cellular morphology . since phospholipase - sensitive , cell surface ( prp - sen ) is the precursor of prp - res ( caughey and raymond , j . biol chem . 266 : 18217 - 18223 ( 1991 )), it is possible that the newly discovered congo red inhibition of prp - res labeling could be indirectly due to prp - sen biosynthesis , turnover , or transport to the cell surface . however , 1 . 4 μm congo red had no influence on the [ 35 s ] methionine labeling and rate of degradation of prp - sen ( fig2 ) or the release of labeled prp - sen from the cell surface by piplc ( fig3 ). fig2 shows the results of an experiment to determine the effect of congo red ( cr ) on the metabolic labeling and turnover of prp - sen . control ( c ) flasks of scrapie infected neuroblastoma cells were pulse - labeled with 60 μci per flask of tran 35 s - label for 100 min by the general procedure described above and incubated in chase medium for the time indicated before the ceils were lysed . cells were then analyzed for prp - sen by immunoprecipitation , sds - page , and fluorography as described previously ( caughey et al ., 1991a ) except that a 20 % acrylamide phastsystem © gel was used . the cr - treated flasks were treated identically except that the pulse and chase media contained 1 . 4 μm cr . equal flask equivalents were loaded onto each lane . the positions of molecular mass markers are designated in kda on the right side of fig2 . there is no apparent effect of congo red on the cellular metabolism of prp - sen . fig3 shows the results of an experiment which confirms the lack of effect that congo red has on the transport of prp - sen to the cell surface . prp - sen was immunoprecipitated from the media of intact scrapie - infected neuroblastoma cells treated with piplc to release pulse 35 s - labeled prp - sen from the cell surface as described above . the analysis was performed on control cells ( no congo red ; lane 1 ) and cells treated with 1 . 4 μm congo red starting with the pulse ( lane 2 ) or a 20 - h preincubation before the pulse ( lane 3 ). the positions of molecular mass markers are designated in kda on the left . equal flask equivalents were loaded onto each lane . these observations provided evidence that , rather than affecting normal prp metabolism , congo red specifically prevented prp - res formation or greatly reduced its metabolic t 1 / 2 . the longer - term effect of congo red on the total prp - res content of scrapie - infected neuroblastoma cultures was also tested . inclusion of submicromolar concentrations of congo red in the growth medium of 5 - day cultures caused profound reductions in the total prp - res content detected by immunoblot using three distinct antisera raised against peptides corresponding to prp residues 89 - 102 ( fig4 ), 142 - 155 , and 218 - 232 . for instance , in fig4 the intensity of prp - res bands from the ceils treated with 0 . 14 μm congo red was & lt ; 10 % of control intensity . fig4 shows the inhibition of prp - res accumulation in cells grown media containing in congo red . scrapie - infected neuroblastoma cells were seeded at a 1 : 20 dilution of a confluent culture and grown for 5 days to confluence in the presence of the designated concentrations of congo red . prp - res was isolated from proteinase k - treated detergent lysates of the cells by ultracentrifugation . the 230 , 000 - g pellets containing prp - res were sonicated into 1 ml of 150 mm nacl , repelleted , and further analyzed for prp by immunoblotting as described above . each lane represents 0 . 2 25 - cm 2 flask equivalent . to control for the possibility that residual congo red in the lysates artifactually interfered with the immunochemical detection of prp - res , 14 μm of congo red was added to a control cell lysate before proteinase k digestion step . there was no reduction in the prp - res signal detected by the extraction and immunoblot procedure using anti - prp peptide 89 - 102 . the treatment of the cells with congo red ( up to 14 μm ) had no significant effect on the growth of the cultures because the total protein content in the lysates of the congo red - treated cells was within 85 % of the control values in all cases . again , no changes in cell morphology were observed . thus , without overt signs of cytotoxicity , congo red greatly reduced the amount of prp - res produced by the infected neuroblastoma cultures . the mechanism for the inhibition of the accumulation of prp - res and other amyloidogenic proteins by congo red is not known . however , because congo red binds to amyloid fibrils of prp - res it is likely that this direct interaction interferes with a critical event in the formation of amyloidogenic protein or destabilize the structure once it is formed . destabilization of amyloidogenic protein could make it susceptible to degradation by the endogenous proteases to which it is exposed . woody et al ., biochim . biopys , acta 655 : 82 - 88 ( 1981 ), have suggested that congo red can stack extensively and act as a polyanion . this theory is bolstered by applicants &# 39 ; discovery that congo red can serve to prolong the lifespan of scrapie - infected mammals , since prophylactic administration of certain polyanions has also been shown to prolong the lifespan of animals inoculated with scrapie ( kimberlin and walker , antimicrob . agents chemother . 30 : 409 - 413 ( 1986 )). as stated earlier , use of appropriate derivative compounds that retain the ability of congo red to interfere with generation and / or deposition of amyloidogenic protein are included within the scope of the present invention . thus , appropriate congo red derivate compounds for use within the scope of the present invention will include those that do not interfere with the formation of polyanion - like activity in the derivative . the foregoing detailed description has exemplified applicants &# 39 ; discoveries with reference to certain particular amyloidogenic proteins and amyloidogenic diseases . however , applicants have discovered a method of treatment , prevention and / or inhibition that is common to many amyloidogenic diseases . other discoveries also form a part of the present invention . thus , the scope of the present invention can be interpreted with reference to the appended claims . | US-91209792-A |
the present application relates to a method for determining the position or relative position of body parts , taking into account the anatomical symmetry , wherein at least one first - side body part is provided on the first side of an anatomical body , and at least one second - side body part is provided on the second side of the anatomical body , wherein the first side is separated from the second side by a body symmetry plane , said method comprising the steps of : providing first - side body part data which describes or implies the position of the at least one first - side body part ; providing second - side body part data which describes the position of the at least one second - side body part ; providing symmetry plane data which describes the position of the body symmetry plane ; calculating the mirrored position or mirrored positions of the at least one second - side body part which results after the position of the at least one second - side body part has been mirrored on the body symmetry plane , on the basis of the second - side body part data and the symmetry plane data , and determining and / or displaying a deviation between the mirrored position or positions of the at least one second - side body part and the position or positions of the at least one first - side body part ; and / or determining a mirrored relative position of the second - side body parts , on the basis of the second - side body part data and the symmetry plane data . | fig1 shows the joint - side end of the femur 10 and the tibia 20 . a patella tendon or an implant ligament 100 which is fastened at its ends to each of the femur and the tibia via screws 110 and 120 , is for example used as the cruciate ligament substitute . the ligament 100 passes through a drilling channel in the femur 10 and in the tibia 20 . these drilling channels have joint - side exit openings 111 ( on the femur ) and 122 ( on the tibia ). in order to be able to substitute the function of the cruciate ligament well , it is desirable for the relative distance between the exit openings 111 and 122 to remain as constant as possible , irrespective of the degree of flexion . these exit openings 111 and 122 represent examples of the aforesaid regions for which the relative variable ( the distance ) is intended to be as invariable as possible , irrespective of the relative placements . fig2 schematically shows the left and right leg of a recumbent person , as viewed from above . the left femur is indicated by 10 l , and the left tibia by 20 l . the right femur is indicated by 10 r , and the right tibia by 20 r . the median sagittal plane 200 is indicated by a broken line . the right and left leg are arranged symmetrically with respect to this plane . marker devices 22 l , 12 l , 22 r and 12 r , each comprising markers 1 , 2 and 3 which are detected by the detection device 300 , are situated on each leg . it is assumed that the left knee joint is diseased , i . e . for example , that it has a cruciate ligament rupture and is therefore operated on . in this case , the marker devices ( reference stars 22 l and 12 l ) are preferably fixedly connected to the femur and the tibia . on the healthy right leg , the marker devices ( for example , the “ ent headband ” 12 r and 22 r ) are preferably not attached invasively , but are rather for example wound around each of the femur and the tibia by means of a flexible strap . alternatively or additionally , individual markers can also be adhered onto the femur or the tibia , wherein so - called headbands which are known from head operations can be used . preferably , reference frames are assigned to the femur 10 l and 10 r and the tibia 20 l and 20 r . to this end , a joint - side landmark — preferably , the tibial plateau — is detected by a navigation system at said landmark , i . e . the tibial plateau , preferably by means of a pointer 30 , wherein the navigation system detects the markers on the pointer and thus detects the position of the pointer tip . during detection , the anterior - posterior direction is preferably selected as the direction of the pointer 30 , such that this direction is also detected by the navigation system . subsequently , the pointer 30 is then preferably placed halfway up the tibia at the most anterior point , in order to detect this landmark . this landmark is then shifted by the data processing device of the navigation system in the anterior - posterior direction already detected , until a line is intersected which starts from the tibial plateau landmark already detected and is perpendicular to the anterior - posterior direction . this intersection point , together with the tibial plateau landmark , then defines the direction of the tibial axis . this tibial axis can then form one of the axes of the coordinate system associated with the tibia . the other two axes are for example perpendicular to this , wherein one can for example point in the anterior - posterior direction . the lines 20 l and 20 r shown in fig2 may be interpreted as portions of the tibial axis which for example start from the tibial plateau point , which for example matches the end point 20 ar , and extend over a predetermined length , for example from a point 20 ar to a point 20 er , wherein the point 20 ar designates the end facing the joint . correspondingly , there are end points 20 al and 20 el on the left tibial axis 20 l . the position of the end points in the respective tibial reference frame is therefore also known . using the registration process described above , the position of the tibial reference frame relative to the reference stars 22 r and 22 l and thus relative to their markers is respectively known , and the respective reference frames are thus registered in the reference frame of the navigation system . as the next step , the reference frames of the femur then also have to be respectively determined . to this end , the following approach is for example taken . the reference frame associated with the tibia is copied and shifted along the tibial axis , in particular by a predetermined length ( for example by referring to the point 20 ar or 20 al ), in the direction of the femur , such that the origin of the copied reference frame lies in the femur . the copied reference frame thus obtained then becomes the reference frame of the femur . the portions 10 r and 10 l shown in fig2 can in particular be part of a coordinate axis of the femoral reference frame which , when the leg is extended , is part of an extended tibial axis . alternatively , a femoral reference frame can also be defined by detecting landmarks on the femur . the respective axial portions 20 l , 20 r , 10 r and 10 l are then registered in the reference frame of the navigation system in the way cited above . in particular , the position of the axial portions relative to each other is known , and end points 10 ar , 10 er and 20 ar and 20 er of the femoral portion can in particular also be determined , wherein it is for example defined that in the state of extension , a predetermined distance exists between 20 ar and 10 ar and / or between 20 er and 10 er . it is also possible to determine that a predetermined distance exists between 10 ar and 10 er and between 20 ar and 20 er . the relative position of the axial portions and also the relative position of the end points can thus be determined by detecting the marker devices 22 l , 12 l , 22 r and 12 r . the relative position data for the right side and the left side can thus be derived from said detection signal data . fig3 shows the transition from 0 ° flexion to 90 ° flexion on the right side . the axial portions for 0 ° flexion ( extension ) are indicated by 10 r and 20 r . the axial portions for 90 ° flexion are indicated by 10 r and 20 ′ r . the relative position between 10 r and 20 ′ r is detected by means of marker devices , and the detection signals are for example fed to a data processing device 400 ( see fig2 ). as described above , the relative position between 10 r and 20 r is already known . correspondingly , it is also possible to determine the position of the end points 20 ′ a r and 20 ′ e r . thus , as a whole , relative vectors va and ve can be determined from the available data . the relative vector va points from the end point 20 ar to the end point 20 ′ a r . the relative vector ve points from the end point 20 er to the end point 20 ′ e r . this merely represents one example . another approach would for example be to determine relative vectors from the end points 10 ar to the end point 20 ′ a r and from the end point 10 er to the end point 20 ′ e r . the change in the position could also be described using angles , for example the 90 ° angle , and by the plane in which the distance portions 20 r , 20 ′ r and 10 r lie . the invention is described in the following , by way of example , with the aid of the aforesaid vectors va and ve . as shown in fig4 , the leg is in extension in the known initial placement , i . e . the position of the leg is described by the distance portions 10 l and 20 l . the aforesaid vectors va and ve , which have already been calculated , are used to then calculate what the relative position of the left leg would look like at 90 ° flexion , without actually moving the left leg into 90 ° flexion . the vector va is positioned at the end point 20 al , in order to point to the end point 20 ′ a l . the vector ve is positioned at the end point 20 el , in order to point to the end point 20 ′ e l . this means that it is assumed that the left tibia performs the same movement relative to the left femur as the right tibia performs relative to the right femur . in the aforesaid example , it has been assumed that the movement is performed in a plane which is parallel to the median sagittal plane . the movement can of course also contain components which deviate from this exact parallelism . this case can be dealt with in accordance with the invention by taking into account symmetry rules . this is illustrated in the following on the basis of an example as shown in fig5 . fig5 is for example intended to be a view from above onto an upright patient who is raising his right and left arm . 50 l designates the left upper arm which is dorsally stretched out perpendicular to the median sagittal plane , and 50 r designates the right upper arm which is dorsally stretched out perpendicular to the median sagittal plane 200 . the left lower arm 60 l is situated in an extension of the left upper arm 50 l , and the right lower arm 60 r is situated in an extension of the right upper arm 50 r . the placements of 50 l relative to 60 l and of 50 r relative to 60 r are in turn each detected using marker devices , and the axial portions 50 l to 60 l and 50 r to 60 r are in turn each detected using a pointer , such that in analogy with the method described in fig2 , they are known in a reference frame , in particular in the reference frame of the navigation system . it is also assumed that the right side is the healthy side , i . e . the right elbow joint is healthy , while the left elbow joint is diseased . while 50 r and 60 r together form the first second - side relative placement , 50 r and 60 ′ r form the second second - side relative placement , for which the relative position between 50 r and 60 ′ r is likewise again determined by means of marker detection . it is in particular also possible to determine the relative positions between end points of the distance portions 50 r and 60 ′ r . by comparing the position of these end points , relative vectors we and wa can be determined in an analogous way to fig3 . these relative vectors can then be broken down into components parallel to and perpendicular to the median sagittal plane . the parallel component of we is indicated by wep , and the perpendicular component is indicated by wes . the perpendicular components are parallel to the frontal plane . as described above , it is assumed that the first second - side relative position comprising the axial portions 50 r and 60 r is symmetrical with respect to the first first - side relative position , which is described by 50 l and 60 l , relative to the median sagittal plane 200 . given this presupposition , the relative vector w ′ e for the left side , which is calculated from wep - wes , is determined from the vector we and in particular from the components wes and wep . it thus follows that the resultant vector w ′ e is symmetrical with respect to the vector we , relative to the median sagittal plane . correspondingly , a vector w ′ a is also calculated which is symmetrical with respect to the vector wa . the symmetrical vector w ′ e is then positioned at the end of the axial portion 60 l which faces away from the elbow joint , and the relative vector w ′ a is positioned at the end of the axial portion 60 l which faces the elbow joint . the tips of the two vectors then point to the respective ends of the axial portion 60 ′ l which is pivoted ( by 90 °), such that the position of the axial portion 60 ′ l results , wherein the symmetry rules have been considered . the position of the axial portion 60 ′ l thus designates the position of the left lower arm , assuming that the latter is moved symmetrically with respect to the right lower arm and is thus likewise bent or pivoted by 90 °. it is thus possible to determine how the left lower arm would lie at 90 ° flexion , if the left elbow joint exhibited kinematic symmetry with respect to the right elbow joint and likewise behaved like a healthy joint . in addition to the aforementioned examples of 90 ° flexion , other degrees of flexion are of course also possible , such as in particular 30 °, 20 ° or 60 °. the change in the relative position can also be mathematically described in ways other than by means of vectors as described above , such as for example by using angles and planes in which the movement is to be performed . the calculation is based on the aforementioned relative position data , assuming in particular that it was acquired in the neutral position of the respective body parts . for the leg , it is for example the case that in extension , the tibia is twisted relative to the femur in a way which allows a small clearance in a relative rotation of the tibia relative to the femur . in other relative positions , for example 30 ° flexion or 90 ° flexion , this way of twisting is not given . this applies in particular to the diseased leg ( cruciate ligament rupture ), for which reason virtually flexing the diseased leg in accordance with the invention is regarded as advantageous . for the healthy leg , the tibia is rotated relative to the femur in order to define the second or subsequent relative placements , i . e . in order to define the respective neutral placement , and the average value of the two extreme rotational angles ( maximum internal rotation and maximum external rotation ) is selected as the neutral placement . as already stated , this is not possible with the diseased leg , in particular the cruciate ligament rupture , because in this case , the cruciate ligament no longer limits the rotational angles for the internal and external rotation . in order to find regions which fulfill a particular condition , i . e . for which a relative variable is for example constant , it is possible to proceed as described in the following . a particular region 20 ′ b is for example designated using a pointer ( see fig4 ), said region for example being suitable as a joint - side end of a drilling through the tibia , in order to guide a strap 100 ( see fig1 ) through it . a region 10 b ( see fig4 ) is for example also determined by means of a pointer , said region likewise for example being situated in the vicinity of the joint - side end of the femur . in the example shown in fig4 , the regions 20 ′ b and 10 b lie on the respective axial portions . this is purely by way of example . in practice , they can perfectly well lie outside the axial portion . one example of the region 20 ′ b is the region 122 shown in fig1 . this has been correspondingly marked in fig4 . one example of the region 10 b is the region 111 in fig1 . using the pointer , the relative position of the regions 20 ′ b and 10 b relative to the coordinate system of the tibia and the femur is known . in particular , positions relative to the end points 20 ′ a l and 20 ′ e l as well as 10 al and 10 el are for example also known . in accordance with the invention , the leg can then be moved purely virtually . the tibia is for example moved from the position indicated by 20 ′ l to the position 20 l ( see fig4 ). other intermediate positions can also be occupied . as a whole , this therefore results in at least two relative placements for which the relative position between the region 20 ′ b and the region 10 b can be calculated . it is in particular possible to check whether the distance for the different relative placements is the same or changes . if the distance changes , then this can be displayed and a surgeon can then for example move the pointer in order to find a new region on the femur which is for example likewise in the vicinity of the joint and which fulfils the desired condition . as mentioned above , the position of the left diseased leg at 90 ° flexion is not reliable . however , it can be advantageous in this placement to tap regions between the joint using the pointer , since it is easier at 90 ° flexion to get the pointer between the femur and the tibia . in order to still have a defined placement at 90 ° flexion for the tibia , it is possible to check — by means of the marker device attached to the tibia — whether this 90 ° flexion placement matches the calculated 90 ° flexion placement ( the neutral placement at 90 ° flexion ). if there is a match , this can then be displayed and the surgeon can then tap the regions using the pointer in this 90 ° flexion placement which has been identified as a neutral placement . alternatively or additionally , it is possible — by detecting the marker device attached to the tibia — to calculate where the region tapped using the pointer would lie if the tibia occupied a calculated relative placement and / or the first first - side relative placement . in this way , it is possible to calculate — for each position of the pointer — whether the distance between 20 ′ b and 10 b is equal to the distance between 20 b and 10 b , without moving the leg . this can of course also be calculated for a plurality of relative placements . the pointer is for example moved to different points 10 b , and the display 500 of the navigation system 300 , 400 and 500 displays if the distance is the same or for example deviates by less than a predetermined percentage for the different calculated relative placements . the present invention is also suitable for checking the movement and relative placements of a diseased joint by comparing them with movements and relative placements of the healthy joint . it is in particular possible to detect and store a plurality of relative placements for the healthy joint and to calculate a movement trajectory from these . using the method in accordance with the invention , corresponding ( kinematically symmetrical ) relative placements and movement trajectories can then be calculated for the side of the body comprising the diseased joint . it is then possible to check , on the basis of the marker devices attached ( invasively or non - invasively ) to the diseased side , whether the movement trajectory is kinematically symmetrical with respect to the healthy joint or whether a kinematically symmetrical placement has been occupied . it is thus in particular also possible to identify whether the movement trajectory corresponds to a healthy trajectory . cruciate ligament ruptures can thus for example also be identified . in addition to the median sagittal plane 200 described above , other symmetry planes or symmetry axes can also be adduced when determining the second first - side relative placement . if , for example , the external rotation and internal rotation of a joint is considered , the axis about which the rotation is performed can likewise be regarded as a symmetry axis . if this is determined for both sides , then an external rotation of the second second - side joint , for example the right tibia , by a particular angle in a particular direction of rotation can for example be converted into a corresponding external rotation of the second first - side body part , i . e . for example the left tibia , by the same angle in the opposite direction of rotation , by applying the symmetry considerations . the tibial axis which has already been determined can for example be adduced as the symmetry axis of rotation for the respective side . the navigation system in accordance with the invention is likewise schematically shown in fig2 . the detection device 300 detects signals from the marker devices 22 r , 12 r , 10 l and 22 l and relays the detection signals to the data processing device 400 , which performs the method in accordance with the invention and displays display signals on the monitor 500 . fig5 can also be adduced as an example of another embodiment of the invention , in which the positions of the right and left upper arm and lower arm are given , and one wishes to determine whether the transition from full extension to 90 ° flexion is symmetrical for both sides . to this end , it is possible to simply mirror the relative vectors of one side , which represent a relative variable which describes the relative position , at the median sagittal plane 200 , i . e . the vectors we and wa , which are situated on the right side , describe the placement relative position of the right lower arm between the position in the placement before extension and the position in the placement at 90 ° flexion . the vectors we and wa can then be mirrored on the median sagittal plane . the mirrored vectors are the vectors w ′ a and w ′ e , which describe what the placement relative position on the left side would look like if the body is ideally symmetrical , i . e . they describe the placement relative position as mirrored from right to left . it is assumed in the example shown in fig5 that first - side body part data is predetermined which describes the position 60 l for the left lower arm in full extension and the position 60 ′ l at 90 ° flexion . in this case , the mirrored relative vector w ′ e is identical to a relative vector which is situated on the left side and connects the end of the axial portion 60 l to the end of the axial portion 60 ′ l . the mirrored vector w ′ a is identical to the vector which connects the start of the axial portion 60 l to the start of the axial portion 60 ′ l . the arrangement shown in fig5 would accordingly be ideally symmetrical , from full extension to 90 ° flexion , with respect to the placement relative position of the lower arm . in reality , deviations may of course occur , which can be visualized by displaying the mirrored relative vectors and the actual relative vectors on the left side . it is in particular possible to calculate variables which represent a value for the existing symmetry in the transition from full extension to 90 ° flexion , from the difference between the mirrored vectors and the relative vectors existing on the left side . fig6 shows a scenario in which such ideal symmetry is not given . the right and left leg are intended to be in extension . the patient has a varus of different magnitudes of extent . the varus on the right side is more pronounced than on the left side . in order to be able to determine the deviation between the right - side varus and the left - side varus , the femur 10 r and the tibia 20 r are mirrored on the median sagittal plane 200 in accordance with the invention , such that the situation shown in fig7 results . the mirrored right tibia is indicated by 20 ′ r , and the mirrored right femur is indicated by 10 ′ r . the left femur is indicated by 10 l , and the left tibia is indicated by 20 l . in one embodiment in accordance with the invention , distance portions 20 ′ r , 10 ′ r , 10 l and 20 l are displayed on a monitor , in order to provide an indication of deviations from an ideally symmetrical arrangement of the body parts . it can in particular be seen that the non - mirrored left body parts deviate in their position from the mirrored right body parts . this deviation can also be described by relative variables . an angle α between the mirrored distance portions 20 ′ r and 10 ′ r can for example be determined . a corresponding angle can be determined between the distance portions 20 l and 10 l . the angular difference then represents a relative variable which provides an indication of how pronounced a deviation from the ideally symmetrical arrangement of the body parts which is given is . alternatively , a distance δ can also be determined which for example connects the end points of the distance 10 r and 10 ′ r which are respectively closest to the distance 20 l and 20 ′ r . the greater the distance δ , the greater the deviation from the ideally symmetrical arrangement . computer program elements of the invention may be embodied in hardware and / or software ( including firmware , resident software , micro - code , etc .). the computer program elements of the invention may take the form of a computer program product which may be embodied by a computer - usable or computer - readable storage medium comprising computer - usable or computer - readable program instructions , “ code ” or a “ computer program ” embodied in said medium for use by or in connection with the instruction executing system . within the context of this application , a computer - usable or computer - readable medium may be any medium which can contain , store , communicate , propagate or transport the program for use by or in connection with the instruction executing system , apparatus or device . the computer - usable or computer - readable medium may for example be , but is not limited to , an electronic , magnetic , optical , electromagnetic , infrared or semiconductor system , apparatus , device or medium of propagation such as for example the internet . the computer - usable or computer - readable medium could even for example be paper or another suitable medium on which the program is printed , since the program could be electronically captured , for example by optically scanning the paper or other suitable medium , and then compiled , interpreted or otherwise processed in a suitable manner . the computer program product and any software and / or hardware described here form the various means for performing the functions of the invention in the example embodiments . although the invention has been shown and described with respect to one or more particular preferred embodiments , it is clear that equivalent amendments or modifications will occur to the person skilled in the art when reading and interpreting the text and enclosed drawings of this specification . in particular with regard to the various functions performed by the elements ( components , assemblies , devices , compositions , etc .) described above , the terms used to describe such elements ( including any reference to a “ means ”) are intended , unless expressly indicated otherwise , to correspond to any element which performs the specified function of the element described , i . e . which is functionally equivalent to it , even if it is not structurally equivalent to the disclosed structure which performs the function in the example embodiment or embodiments illustrated here . moreover , while a particular feature of the invention may have been described above with respect to only one or some of the embodiments illustrated , such a feature may also be combined with one or more other features of the other embodiments , in any way such as may be desirable or advantageous for any given application of the invention . | US-38871109-A |
an adaptor arrangement that can be attached to many of the popular makes of &# 34 ; deep sea &# 34 ; fishing reels . the adaptor includes an electric motor with a convenient thumb operated switch and can be easily attached to the side member of a conventional fishing reel with no machine work necessary . when attached , the adaptor will provide power to the reel in the same manner as the hand crank . | fig1 and 6 show , by broken line , portions of a conventional reel for which the present attachment is intended . particularly , fig6 shows the frame 2 of the conventional reel having a threaded reel driving shaft 4 having flattened opposed sides , as will be described later . the conventional reel also includes a spring member 6 that can be flexed to apply pressure to a drag - adjusting mechanism 8 . the drag - adjusting mechanism is conventional and will not be further described herein . in the original reel , a handle was attached to shaft 4 and a sleeve surrounding the shaft threadedly engaged with the same to apply pressure to the spring 6 to thus adjust the drag mechanism . as shown in fig6 the handle and drag - adjusting means have been removed for purpose of attaching the present attachment . referring now to fig1 the attachment of the present invention comprises a plate 10 adapted to be screwed to the frame of the reel 2 and includes a casing portion 12 and an electric motor 14 . a cover plate 16 covers the outer face of the attachment and may be removed therefrom to expose the driving mechanism shown in greater detail in fig4 . in fig4 the motor 14 has a driving shaft provided with a pinion 18 meshing with a gear 20 mounted on a shaft and carrying a small sprocket wheel 22 . a sprocket chain 24 extends around the sprocket wheel 22 and around a larger sprocket wheel 26 constituting a portion of a one - way clutch . the one - way clutch is shown in greater detail in fig5 wherein the clutch is shown as comprising an outer race portion 28 ( part of sprocket wheel 26 ) and a separate inner hub portion 30 . the inner hub portion is provided with cam cutouts 32 in whih sprag rollers 34 are positioned . this is a more - or - less conventional one - way clutch mechanism and includes springs 36 to urge the rollers 34 into wedging or camming engagement between the hub 30 and outer race 28 . at its center , the hub 30 is provided with an opening corresponding to the shape of the reel shaft 4 . that is , the opening is of the shape shown at 38 in fig5 . the shaft 4 is essentially a cylindrical shaft threaded on its outer surface with opposed flat surfaces giving it a non - circular outline in the region extending outwardly from the reel frames . thus , the cam hub 30 is slidable on the shaft 4 , but is non - rotatable thereon . the motor 14 may drive the reel in one direction , but the reel is free to rotate in the same direction faster than the motor drive , so that the fishing line may be drawn therefrom . also , the shaft may be rotated by other means , to be described , and &# 34 ; overrun &# 34 ; the motor drive if necessary . referring now more particularly to fig6 the casing 12 of the attachment may be secured directly to the frame of the reel 2 in the manner shown , and the cover plate 16 secured thereover to enclose the drive mechanism . as shown in fig6 the rollers 34 are retained between the hub 30 and the outer race 28 by means of a cover plate 40 extending over the cutouts 32 and secured to the outer race or sprocket wheel 26 . with the attachment mounted as shown in fig6 the hub 30 is freely slidable along the driving shaft 4 , but is non - rotatable with respect thereto . the outer surface of the shaft 4 is threaded , as shown at 42 , and receives sleeve 44 threadedly mounted thereon and threaded sufficiently far so that the end of the sleeve can abut the hub 30 . the sleeve 44 extends outwardly through the cover 16 of the casing and has the star wheel 46 mounted thereon , which star wheel was originally on the reel before the attachment was mounted . a resilient seal 48 is provided between the sleeve 44 and the casing cover 16 to exclude water and dirt . the reel driving shaft 4 was initially provided with a socket 50 internally threaded , to receive a holding screw for the crank . an extension shaft extension 51 is provided with means for mounting the crank handle taken from the original reel and which was mounted on the shaft 4 . as shown in fig6 the crank handle is provided with a hook - shaped recess 52 engageable with a pin 54 on the shaft extension 51 to constitute a one - way drive through extension shaft 51 to the reel 2 . the outer end of the shaft 51 may also be provided with a spring - pressed ball detent 56 to prevent inadvertent removal of the crank handle . as shown in the drawings , the end of the shaft extension 50 may be of square configuration if necessary to accommodate the crank handle originally on the reel . as best shown in fig4 a motor control switch 58 is mounted on the casing wall and extends therethrough . a resilient seal 60 in the form of an o - ring is mounted between the switch 58 and the casing wall to provide a seal against moisture . a lever 62 is pivoted to the casing 12 at 64 and bears against the actuating member 66 of the motor control switch to operate the same . the control lever 62 is so shaped as to be conveniently manipulated by the thumb or finger of the user . electrical conductors 68 are connected to the switch 58 and motor 14 , and lead to a plug 70 adapted to be inserted in any suitable receptacle providing the proper electrical power . it will be apparent with the attachment secured to the reel in the manner described above , the motor may be employed to drive the reel in a forward direction through the one - way clutch and yet the line can be withdrawn from the reel by rotating the same in a forward direction faster than the motor would be driving same , since the over - running clutch permits such an operation . also , even with the motor stopped , the hand crank may be rotated to drive the reel in a forward direction without applying torque to the motor 14 . while a single specific embodiment of the invention has been shown and described herein , the same is merely illustrative of the principles involved and other forms may be adopted within the scope of the appended claims . | US-10453479-A |
a spinning reel having a housing and a spool for line . the line spool is parallel to a rod . the reel includes a spool rotation on an axial movement mechanism in order to move the spool both rotationally and axially in relation to the housing . a bail is moveable between a casting position and a line retrieval position . a drive mechanism drives the spool movement mechanism in order to wind the line onto the spool . | referring to the drawings in detail , fig1 a , 1b and 1c are exploded views showing the various elements which , taken together , illustrate an improved fishing reel constructed in accordance with the present invention . the reel 10 includes a spool assembly 12 having a desired length of line 14 wound thereon . the spool 12 will be generally parallel to a rod ( not shown ) which is well known in the art . the spool 12 includes a central , axial opening 15 through which extends a main level - wind shaft 16 retained thereon by a spool retaining clip 18 received in a notch 19 in the shaft 16 . the main level - wind shaft 16 passes through a spool drive and retaining nut 20 having a central opening to receive the main shaft 16 . the spool drive nut 20 includes a plurality of extending fingers 22 . in the present embodiment , the spool drive nut 20 includes three fingers which mate with and engage an equal number of recesses in a face of the spool 12 ( not visible in fig1 ). it will be understood that a greater or lesser number of fingers might be employed . the face of the spool is recessed from an extending skirt 23 . the spool 12 will rotate and move axially about level - wind shaft 16 . rotation of the spool will wind the line thereon . a plurality of screws 24 pass through a bearing retainer plate 26 and will ultimately be fastened to a center housing ( shown on fig1 a ). the bearing retainer plate 26 has a center opening 28 which receives a bail frame support shaft ( to be described ) therethrough . a pivot shaft lever 30 will be in operative engagement with the bail ( to be described in detail ). a thrust washer 36 and bearing 38 are mounted on a pinion gear 40 which passes through the bearing retainer plate 26 and is threadably engaged with the spool drive nut 20 . in operation , the drive nut rotates but does not oscillate axially . with reference to fig1 a , the housing in the present embodiment is in two sections , a first housing 44 and a second center housing 46 ( not shown in fig1 a ). other housing arrangements are , of course , possible within the scope of the invention . the pinion gear 40 extends into and through the opening 48 in the housing 44 . extending from the housing 44 is a mount 50 which terminates in a foot 52 which is attached to the rod ( not shown ) in any known manner . operating within a slot in the mount 50 is a trigger 54 which will move between a line retrieval and a line casting position . the trigger 54 has an inside extending post which engages with an opening in a bail locking pin 60 . movement of the trigger 54 will move the bail locking pin 60 . as seen in fig5 a bail locking spring 140 and screw 134 assist in keeping the trigger 54 in the normally closed position . the spring force may be overcome by grasping with the finger . a reel shaft 70 engages with a drag bushing collar 172 . as seen in fig7 clutch disks 164 and drag coil spring 168 also surround the reel shaft . a drag bushing 170 cooperates with a thrust washer 166 and a drag friction knob 174 to adjust the tension or drag of the reel . the crank handle 86 rotates the shaft 70 which causes the line to wind on the spool . with reference to fig1 b , the reel shaft 70 from fig1 a extends through drive gear ball bearing 90 as indicated by dashed line 91 . drive gear 92 is in axial alignment with drive gear ball bearing 90 and will engage reel shaft 70 ( shown on fig1 a ). drive gear ball bearing 94 and thrust washers 96 are received over drive gear 92 . crank handle shaft retaining screw 100 passes through housing 46 and into drive gear 92 . a plurality of screws 102 and washers 104 hold the housing 46 to the center housing 44 ( not shown in fig1 b ). an anti - reverse ramp 106 ( to be seen in detail below ) fits over projection 107 on housing 46 . housing 46 includes projection 107 having a snap ring groove 109 for snap ring 111 to hold the anti - reverse ramp 106 against the housing . a spool level - wind drive gear 110 cooperates with an oscillating slider 112 , an oscillating slider retainer 114 and a screw 116 to oscillate the spool 12 ( seen in fig1 c ) axially . fig2 shows a front view , fig3 shows a side view and fig4 shows a top view of a circular bail 32 which is a part of the present invention . the bail 32 includes a substantially circular loop 120 having an eccentric area 122 as best seen in fig2 . extending from the circular loop 120 are a pair of legs 124 and 126 which are parallel to each other and a bail shaft 128 which extends between the legs . the eccentric area may include a roller or guide 129 for the line . fig5 illustrates a sectional view of the reel 10 with portions removed while fig6 illustrates an exploded view of the bail movement , bail actuator and position lock mechanism . in fig5 the foot 52 would be connected to a rod ( not shown ). extending from the foot 52 is a mount 50 which is in angular relation to both the foot and the rod . the trigger 54 extends from and operates in a slot 53 which is in communication with an opening 130 in the mount . a guide pin 132 extending from the bail locking pin 60 moves in the slot 53 and prevents rotational movement of the locking pin 60 . a screw 134 and washer 136 connects the trigger 54 to the locking pin 60 . the locking pin 60 contains a notch 138 to retain the bail 32 when in the line retrieval position . the bail shaft 128 is welded or otherwise rigidly secured to the pivot shaft lever 30 . a spring 140 anchored on one end to the housing urges the bail toward the line casting position ( shown in dashed lines ). location of the trigger permits movement while the fisherman &# 39 ; s hand is on the rod . the bail is shown in the line recovery position in fig5 . the dashed line position of the bail is the casting position . as can be appreciated , the line will always pass through the bail 32 . fig7 and 8 are exploded views illustrating the drag mechanism assembly of the present invention . a cylindrical opening 158 in the handle 86 forms a drum and will receive in sequence a bushing 160 , a washer 162 , a series of washers 164 with tabs to fit matching internal key ways , a washer 166 , a compression spring 168 , a bearing 170 and a bushing 172 . the foregoing is received over shaft 70 . a knob 174 has a threaded end 176 which engages with internal threads in the cylindrical opening 158 of the handle 86 . rotation of the knob 174 adjusts the tension or drag . an anti - reverse knob 180 , shown in fig7 is shown in detail in fig8 . the ramp 106 is attached to the housing 46 via a snap ring 111 . a roller leaf spring assembly 182 will be engaged with the ramp 106 at slot 184 . as long as the drum , which is formed by the cylindrical opening in the handle 158 , is rotated in the counter clockwise retrieval direction , the friction created between the roller 186 and drum will force the roller away from the ramp . the counter clockwise rotation keeps the roller out of a wedging action created by the arc of the drum and the incline of the ramp , allowing the handle to continue its counter clockwise rotation . alternatively , if the reel handle is rotated in a clockwise direction , the roller would be trapped in a wedging motion , in effect , jamming the roller between the ramp and the drum locking the handle against any clockwise rotation . in this motion , the reel spool through the gear train can rotate against the clutches in the drag assembly without any rotation of the reel retrieval handle . the anti - reverse function is selected or deselected by a rotating ring which has a detent or a cam pushing a plunger or pin which contacts the leaf spring assembly , forcing the roller away from this potential wedging action . it will remain in that position until the anti - reverse function is selected and the pin is allowed to retreat by moving the detent away from the pin . whereas , the present invention has been described in relation to the drawings attached hereto , it should be understood that other and further modifications , apart from those shown or suggested herein , may be made within the spirit and scope of this invention . | US-4199398-A |
an orthopedic apparatus includes an orthopedic knee brace including at least one hinge , an adjustable pad removably attachable to the hinge , the adjustable pad including a top plate , a base plate , an adjuster located between the top plate and the base plate , at least one ramp including a plurality of ramp angles , the ramp inclined so that at least two of the ramp angles are spaced differently from a foot of the ramp , and at least one spoke positioned and arranged to selectively engage one of the ramp angles of the at least one ramp to set an overall height of the pad , and wherein the adjustable pad is installable on the brace hinge for adjusting the side force applied to the user &# 39 ; s knee to help relieve the pain of medial or lateral unicompartmental osteoarthritis while providing additional stability for ligament or cartilage insufficiencies . | one primary embodiment for an adjustable pad is shown and described in connection with adjustable pad 10 and fig1 to 7 as follows . fig1 is an exploded view showing the different pieces of adjustable pad 10 . from left to right , hook sheet 18 is adhered to the top wall 16 c of top plate 16 . the hook sheet 18 indexes a hook surface that removably attaches to a pile surface of a cushioned or gel encapsulating pad 19 illustrated below that has inner cushioning foam or gel . the outer surface of the cushion is soft , e . g ., felt , and abuts the user &# 39 ; s knee . the inner surface of the cushion includes pile material that attaches to hook material provided on the outer surface of sheet 18 . hook sheet 18 is adhered to an assembly that includes top plate 16 , an adjuster ring 14 and a base plate 12 , discussed in detail below . top plate 16 , adjuster ring 14 and base plate 12 can each be made of plastic , metal or some combination thereof . a base pile layer 20 is adhered to the inside surface of base plate 12 . base pile layer 20 enables the assembled adjustable pad 10 to be removably connected to hook material provided on either hinge of a knee brace ( fig7 ). a label 15 is provided on , e . g ., adhered to , base plate 12 to provide an indication of the current state of expansion for adjustable pad 10 . for purposes of disclosure , sheet 18 has been described as having hook material , while layer 20 has been described as having pile material . it should be appreciated that for any embodiment of the adjustable pads of the present disclosure , a surface can have hook or pile material interchangeably . fig2 . illustrates base plate 12 in more detail , while fig3 illustrates adjuster ring 14 in more detail . in fig2 , a second ring 12 b residing outwardly from a center ring 12 a of base plate 12 is interrupted by two spring - like , cantilevered polygonal tabs pt 1 and pt 2 , spaced about 90 ° apart from each other at approximately nine o ′ clock and six o ′ clock , respectively , in fig2 . cantilevered polygonal tabs pt 1 and pt 2 each have a v - shaped projection protruding radially outwardly from an inner rectangular portion of the tabs . the v - shaped projections are indexer tabs that operate as spring fingers to snap into and out of mating female v - shaped grooves g located on the inner surface of the innermost ring ir of adjuster ring 14 ( fig3 ). the operation and purpose of the v - shaped projections and grooves g are discussed in more detail below . base plate 12 of fig2 also illustrates an inner ring 12 a has four longitudinally extending semi - cylindrical tabs lt 1 to lt 4 . longitudinally extending tabs lt 1 to lt 4 of base plate 12 extend through semi - cylindrical apertures a 1 to a 4 , respectively , formed in top plate 16 shown in fig4 ( only three apertures a 1 , a 2 and a 4 are visible in fig4 ). likewise , polygonal tabs pt 1 and pt 2 of base plate 12 extend into polygonal , five - sided holes ph 1 and ph 2 , respectively , formed in the top plate 16 . when adjustable pad 10 is fully contracted , such that base plate 12 sits as deep as possible into top plate , semi - cylindrical or arched apertures a 1 to a 4 allow the like - shaped longitudinally extending tabs lt 1 to lt 4 to extend respectively through apertures a 1 to a 4 and outwardly past the predominantly solid outer surface 16 a of top plate 16 . likewise , polygonal tabs pt 1 and pt 2 are allowed to extend through polygonal holes ph 1 and ph 2 and outwardly past the predominantly solid outer surface 16 a of top plate 16 . polygonal holes ph 1 and ph 2 are oversized as needed to allow polygonal tabs pt 1 and pt 2 to flex radially back and forth within polygonal holes ph 1 and ph 2 . the distal portions of each of the tabs lt 1 to lt 4 , pt 1 and pt 2 extending past the solid outer surface 16 a of top plate 16 are covered by the felt cushion attached to hook sheet 18 and thus are not felt or sensed by the patient . on the other hand , when adjustable pad 10 is fully telescoped and expanded , longitudinally extending tabs lt 1 to lt 4 of base plate 12 even though removed from apertures a 1 to a 4 of top plate 16 are still able to maintain sliding contact with the outer surfaces of centrally located semi - cylindrical tabs ct 1 and ct 2 extending longitudinally inwardly within top plate 16 . the sliding contact between the inside surfaces of longitudinally extending tabs lt 1 to lt 4 of base plate 12 and the outer surfaces of semi - cylindrical tabs ct 1 and ct 2 of top plate 16 throughout the entire range of motion for adjustable pad 10 is accordingly achieved , provides stability and protects against top plate 16 and base plate 12 tilting against each other during adjustment . base plate 12 of fig2 is also illustrated as having six spring - like , cantilevered fingers f 1 to f 6 along its outer wall 12 c that are bent slightly as the finger slide along respectively slots s 1 to s 6 formed on an inner surface of sidewall 16 b in top plate 16 of fig4 . the tops of fingers f 1 to f 6 each include outwardly projecting lips 12 d that mate with and are pushed by the walls of slots s 1 to s 2 . apertures 16 c are provided in solid wall 16 a of top plate 16 located at the end of each slot s 1 to s 6 , so that fingers f 1 to f 6 can travel into slots s 1 to s 6 if need be to prevent fingers f 1 to f 6 from bottoming out against wall 16 a . the felt cushion attached to sheet 18 shown in fig1 again covers the projecting lips 12 d , so that the lips do not impact the user . the fitting of fingers lips f 1 to f 6 into respective slots / apertures s 1 to s 6 16 c also provides ( i ) rotational stability of base plate 12 relative to top plate 16 and ( ii ) additional tilting stability of the base plate relative to the top plate . the innermost rings 12 a and ct 1 / ct 2 of base plate 12 and top plate 16 , respectively , each include matching openings o 1 and o 2 that allow for the small extension springs 22 shown in fig1 , 5 a , 5 b and 6 to mount , each on one spring 22 end to a mounting hole mh 1 or mh 2 of the solid wall 16 a of top plate 16 and to extend to connect each on their opposing spring 22 end to a rod 24 carried by base plate 12 , which is also shown in fig1 , 5 a and 5 b . springs 22 can be metal or plastic and in an embodiment include a hook at both ends to releasably latch onto mounting holes mh 1 and mh 2 or rod 24 . rod 24 can also be metal or plastic and releasably sits in tubular end supports es 1 and es 2 ( fig2 and 5a ) located in the solid wall of base plate 12 . rod 24 extends across the central opening in the solid wall of base plate 12 from end support es 1 to end support es 2 . the exposed portion of rod 24 accepts the opposing ends of extension springs 22 . extension springs 22 pull base plate 12 and top plate together against adjuster ring 14 of fig3 regardless of the translational position of base plate 12 relative to top plate 16 . base plate 12 does not rotate relative to top plate 16 . the plates instead translate away from or towards each other , such that adjustable pad 10 either expands or contracts . adjuster ring 14 of fig3 on the other hand rotates relative to both base plate 12 and top plate 16 . as shown in the views of fig2 to 4 , adjuster ring 14 sits as it is shown in fig3 with its handle h forming an upwards “ u ” shape when adjuster ring 14 is placed in base plate 12 and base plate 12 is oriented as it is shown in fig2 . top plate 16 is then turned upside down relative to its position of fig4 ( so that s 1 and s 6 match f 1 and f 6 ) to fit over the adjuster ring 14 sitting in base plate 12 . adjuster ring 14 as illustrated in fig3 includes an inner ring ir , an outer ring or and spokes sp 1 to sp 4 extending between the rings . spokes sp 1 to sp 4 each have slight positively or outwardly pointing ramp angles on both top and bottom sides of each spoke . that is , the spokes form slightly angled rooftop type shapes on both the upper and lower sides of adjuster ring 14 shown in fig3 . the slight positively or outwardly pointing ramp angles of spokes sp 1 to sp 4 mate with any one of five mating negatively or inwardly pointing ramp angles ra 1 to ra 5 of a respective inclined ramps r 1 to r 4 . that is , ramp angles ra 1 to ra 5 are indented , forming a flatly angled v - shape . ramps r 1 to r 4 are provided on both base plate 12 and top plate 16 . each of ramps r 1 to r 4 has the five ramp angles ra 1 to ra 5 . each ramp angle ra 1 to ra 5 ( i ) extends along an incline of the ramp so as to have a different distance from a foot of the ramp than does an adjacent ramp angle and ( ii ) corresponds to one of the five telescoping expansion / compression settings of adjustable pad 10 . each of the five expansion / compression settings of adjustable pad 10 is provided on label 15 ( shown in fig1 , 5 a , 5 b and 7 ) attached to top plate 16 . the numbers on the illustrated label correspond to millimeters of adjustment . the lowest number is 4 millimeters (“ mm ”), which represents the initial starting height of pad 10 . there are five positions in the illustrated embodiment , which as illustrated are : 4 mm , 6 mm , 8 mm , 10 mm , and 12 mm . these numbers correspond roughly to 3 °, 4 . 5 °, 6 °, 7 . 5 °, and 9 ° of knee compartment correction , respectively . the settings could vary as desired and more or less than five settings could be provided alternatively . the most compressed position of base plate 12 relative to top plate 16 occurs when adjuster ring 14 is rotated such that all four of its spokes s 1 to s 4 sit between ramp angles ra 1 of each of mating base plate 12 side and top plate 16 side ramps r 1 / r 1 , r 2 / r 2 , r 3 / r 3 and r 4 / r 4 . the second most compressed position of base plate 12 relative to top plate 16 occurs when adjuster ring 14 is rotated such that all four of its spokes sp 1 to sp 4 sit between ramp angles ra 2 of each of mating ramps r 1 / r 1 , r 2 / r 2 , r 3 / r 3 and r 4 / r 4 , and so on . thus , the most expanded position of base plate 12 relative to top plate 16 occurs when adjuster ring 14 is rotated such that all four of its spokes s 1 to s 4 sit between ramp angles ra 5 of each of mating ramps r 1 / r 1 , r 2 / r 2 , r 3 / r 3 and r 4 / r 4 . the two springs 22 discussed above hold ramps r 1 to r 4 sandwiched against spokes sp 1 to sp 4 of adjuster ring 14 . the relatively small springs 22 , the relatively slight angles of spokes sp 1 to sp 4 , and the relatively sight angles of mating the ramp angles ra 1 to ra 5 are not required to hold adjuster ring 14 releasably locked to any of the expansion / compression settings . additionally , as described above , polygonal spring tabs pt 1 and pt 2 are provided to lock releasably each into one of the five grooves g provided on the inside of the inner ring ir of adjuster ring 14 . thus each of the five grooves g also corresponds to one of the five expansion / compression settings of adjustable pad 10 device provided on the label . the relatively steep , e , g ., 45 °, ramp angles of the positively or outwardly angled polygonal spring tabs pt 1 and pt 2 and mating inwardly angled grooves g provide a good locking force but on the other hand do not require undue force to index adjuster ring 14 . fig5 a shows the assembled adjustable pad 10 in its most compressed position from the base plate 12 side of pad 10 . pile layer 20 has been removed to show additional detail on plate 12 . top plate 16 extends past the mated base plate such that a lip l forms around the periphery of this brace hinge mating side of adjustable pad 10 . the lip l fits around the periphery of hinge 32 of the knee brace 30 as shown below in fig7 . lip l provides mounting stability to the removeable attachment of pad 10 to hinge 32 . for example , lip l makes the twisting of pad 10 relative to hinge 32 difficult , helping to prevent pad 10 from twisting off of hinge 32 and brace 30 by accident . again , hinge 32 is provided with a hook material that attaches releasably to the pile material provided on base pile layer 20 ( fig1 and 7 ) adhered to the face of base plate 12 . a foam cushion 19 is removably attached to hook sheet 18 ( fig1 and 5b ) on the opposing side of pad 10 . foam cushion 19 provides a softened interface with the patient &# 39 ; s knee . as illustrated in fig4 , 5 a and 5 b , notch n provided in sidewall 16 b of top plate 16 allows handle h to travel back and forth to different height adjustment settings for adjustable pad 10 . notch n also provides end of travel stops at the lowest height setting and the largest height setting so that adjuster 14 cannot be moved or rotated any further , which would potentially cause spokes sp 1 to sp 4 to slip onto a different ramp , e . g ., from a largest height setting of the correct ramp immediately to the lowest height setting of an adjacent ramp . fig5 b shows the assembled adjustable pad 10 from the top plate 16 side of the pad . hook sheet 18 is shown having a hook material hatch . fig5 b illustrates certain features of top plate 16 that are more difficult to see in fig1 and 4 , which also illustrate top plate 16 . fig5 b shows setting label 15 of base plate 12 and handle h of adjuster ring 14 . also illustrated from base plate 12 are spring tip lips 12 d of spring - like cantilevered fingers f 1 to f 6 . lips 12 d are illustrated as just meeting or slightly inserted through mating aperture 16 c of slots s 1 to s 6 formed along the inside of sidewall 16 b of top plate 16 . if it is desired to remove top plate 16 from base plate 12 , springs 22 are unhooked from rod 24 . as discussed above , outer surface 16 a of top plate 16 ( as shown in fig1 — needs to be labeled in fig5 b ) of fig5 b defines semi - cylindrical apertures a 1 to a 4 , which respectively accept longitudinally extending tabs lt 1 to lt 4 as the tabs are translated outwardly or inwardly via the ramp angle settings ra 1 to ra 5 . likewise , polygonal holes ph 1 and ph 2 formed in outer surface 16 a of top plate 16 receive polygonal tabs pt 1 and pt 2 , respectively , as the tabs are translated outwardly and inwardly via ramp angle settings ra 1 to ra 5 . the engagement of base plate 12 and top plate 16 via each of ( i ) spring fingers f 1 to f 6 , ( ii ) longitudinally extending tabs lt 1 to lt 4 and ( iii ) polygonal tabs pt 1 and pt 2 constrains base plate 12 and top plate 16 from rotating or tilting relative to each other as the plates are translated together and apart via ramp angle settings ra 1 to ra 5 . the four spokes and sets of ramp angles also provide an evenly distributed force around the circumference of pad 10 . fig5 b also illustrates spring mounting holes mh 1 and mh 2 defined by outer surface 16 a of top plate 16 . spring mount holes mh 1 and mh 2 each accept one end of two extension springs 22 . the other ends of springs 22 hook or otherwise attach to metal or plastic rod 24 positioned in base plate 12 . as discussed above , springs 22 compresses base and top plates 12 and 16 to adjuster ring 14 throughout the movement of spokes sp 1 to sp 4 through ramps r 1 to r 4 of both base and top plates 12 and 16 . while adjustable pad 10 has been illustrated with angled ramps r 1 and r 4 on both base and top plates 12 and 16 , it is contemplated in an alternative embodiment to provide ramps r 1 to r 4 having ramp angles , such as ramp angles ra 1 to ra 5 , on only one of base plate 12 and top plate 16 . the other plate could have non - changing , constant height semi - cylindrical ridges instead of angled semi - cylindrical ramps r 1 to r 4 , or have no ridges at all . further , for any embodiment of pad 10 , more or less than four ramps may be provided . referring now to fig6 , a simplified sectioned view of adjustable pad 10 is illustrated . fig6 is not meant to replicate the structures of fig1 to 5 . instead , fig6 is intended to illustrate the movement and the holding together of pad 10 in a more simplified manner . fig6 also shows base plate 12 , adjuster ring 14 and top plate 16 fastened together in a sectioned view , which is helpful ( note that in reality the two ramps actually slide past one another when they are completely telescoped closed ). base plate 12 illustrates ramp angles ra 1 to ra 5 , which can be of any of the orthogonally spaced apart ramps r 1 to r 4 of the base plate . likewise , top plate 16 illustrates mating ramp angles ra 1 to ra 5 , which can again be of any of the orthogonally spaced apart ramps r 1 to r 4 of the top plate . base plate 12 is also illustrated with fingers f 1 to f 6 as described above . base plate 12 and top plate 16 are both illustrated accepting springs 22 . while the actual configuration and placement of springs 22 may be different than is shown in fig6 , the function and purpose of the springs is conveyed . the upper and lower positive or outwardly projection rooftop ramp angles or spokes sp 1 to sp 4 on the upper and lower surface of spokes sp 1 to sp 4 engage the negative or v - shaped indentations ra 1 to ra 5 of ramps r 1 to r 4 . as spoke sp 1 to sp 4 is pushed left to right in fig6 , springs 22 and spring , fingers f 1 to f 6 , and polygonal tabs pt 1 and pt 2 cause the user to feel a resistance as the spoke moves to the next position . eventually , at the next position , plates 12 and 16 snap together as the greatest height of the cross - section of the spoke moves past the most pinched together opening of the adjacent mated ramp angles . springs 22 keep compression on the assembly of plates 12 and 16 and adjuster ring 14 . in fig6 , spoke sp 1 to sp 4 is shown positioned at the middle adjustment location between ramp angles ra 3 of plates 12 and 16 . the collective height of any given adjustment location is the sum of the height of spoke sp 1 to sp 4 plus the distances of the mated ramp angles to their respective top and bottom of the top and base plates 16 and 12 . thus if spoke sp 1 to sp 4 is moved to the right between ramp angle ra 4 , the overall telescoping height of the adjuster 10 increases because the distances between ramp angles ra 4 to top and bottom of respective plates 16 and 12 increases relative to that of mated ramp angles ra 3 . conversely , if spoke sp 1 to sp 4 is moved one position to the left , to mated ramp angles ra 2 , the overall telescoping height of adjuster 10 decreases because the distances between ramp angles ra 2 to the top and bottom of respective plates 16 and 12 decreases relative to that of mated ramp angles ra 3 . springs 22 compress accordingly to maintain pressure on the ramp and spoke assembly . it should be appreciated therefore that mated ramp angles ra 1 yield the least telescoped overall height , while mated ramp angles ra 5 yield the greatest telescoped overall height of adjuster 10 . springs 22 maintain compression on the assembled adjuster pad 10 regardless of the mated ramp angle location ra 1 to ra 5 to which spoke sp 1 to sp 4 has been rotated . as shown in fig7 , adjustable pad 10 is placed removably by the user on the inside of one hinge 32 of the brace 30 . pad 10 pushes up against one side or the other side of user &# 39 ; s knee . a felt cushion 19 is provided on the inside of pad 10 to make comfortable contact with the user &# 39 ; s knee . most of the time , adjustable pad 10 is positioned at the lateral or outer side of the user &# 39 ; s knee because the majority of knee problems are medial ( inner ) condyle compartment or medial osteoarthritis , requiring adjustable pad 10 to push the knee inward . a small percentage of patients have problems with the lateral ( outer ) condyle compartment . here , adjustable pad 10 is switched to the other side of the knee brace and is worn such that adjustable pad 10 is located on the inside of the patient &# 39 ; s knee to push outwardly on the patient &# 39 ; s knee , thus opening the lateral compartment . a second primary embodiment for an adjustable pad is shown and described in connection with adjustable pad 110 and fig8 to 11 as follows . fig8 is an exploded view showing the different pieces of adjustable pad 110 . fig8 in general flows oppositely from the flow of fig1 . that is , from left to right , adjustable pad 10 in fig1 flows from the side of the pad that abuts the wearer &# 39 ; s knee to the side of the pad that attaches to the knee brace . in fig8 , adjustable pad 110 flows left to right instead from the side of the pad that attaches to the knee brace to the side of the pad that abuts the wearer &# 39 ; s knee . from left to right , adjustable pad 110 includes a mounting screw or fastener 124 , a pressure - applying washer 126 , a compression spring 122 , a base hook or pile layer 120 , a base plate 112 , an adjuster ring 114 , a label 115 , a threaded mounting insert 128 , a top plate 116 , a top plate pile or hook sheet 118 , a pad hook or pile layer 117 , and a cushioned pad 119 . as mentioned above , for any embodiment of the adjustable pads of the present disclosure , any surface can have hook or pile material interchangeably . mounting screw or fastener 124 can be a metal , e . g ., steel or stainless steel , screw , such as a flathead screw . pressure - applying washer 126 can likewise be metal , e . g ., steel or stainless steel , and in an embodiment is formed with a chamfered hole that allows the flathead of screw 124 to sit flush with the outer surface of pressure - applying washer 126 . threaded mounting insert 128 can likewise be made of metal , e . g ., steel or stainless steel , or be made of a hard plastic . base hook or pile layer 120 is applied to , e . g ., adhered to , outer surface 112 a of base plate 112 . top plate pile or hook sheet 118 is applied to , e . g ., adhered to , the outer surface of top plate 116 . pad hook or pile layer 117 is applied to , e . g ., adhered to , an inner surface 119 a of cushioned pad 119 . adjustable pad 110 is removably attached to hinge 32 of brace 30 via a hook and pile attachment with hook or pile layer 120 . cushioned pad 119 is removably attached to top plate 116 for cushioned contact with the side of a user &# 39 ; s knee via a hook and pile attachment between top plate pile or hook sheet 118 and pad hook or pile layer 117 . label 115 can be attached to , e . g ., adhered to , any of base plate 112 , adjuster ring 114 ( discussed in more detail below ) or top plate 116 . label 115 can include the same or different , more or less , demarcations as label 15 discussed above . base plate 112 , adjuster 114 and top plate 116 can be metal or plastic , e . g ., molded plastic , and be made of any of the materials discussed above for base plate 12 , adjuster 14 and top plate 16 . threaded mounting insert 128 is molded into or press - fit into a central aperture 116 a formed in top plate 116 . base end 128 a of threaded mounting insert 128 is female threaded to threadingly receive screw 124 . top end 128 b of threaded mounting insert 128 can be blind or solid to provide a hard stop for screw 124 . or , aperture 116 a can be a blind aperture and provide a hard stop for screw 124 , allowing insert 128 to be open on both ends 128 a and 128 b . screw 124 can be glued into place within threaded mounting insert 128 . alternatively , threaded mounting insert 128 can be lined with a self - locking liner , such as a nylon liner used with self - locking nuts or aircraft type nuts . insert 128 can have a portion that extends out from aperture 116 a or be fully inserted into aperture 116 a , such that base end 128 a is at least substantially flush with aperture 116 a . with threaded mounting insert 128 fixed to top plate 116 , screw 124 extends through pressure - applying washer 126 , spring 122 , base plate 112 and adjuster ring 114 and fastens to threaded base end 128 a of threaded mounting insert 128 , capturing pressure - applying washer 126 , spring 122 , base plate 112 , adjuster ring 114 and top plate 116 together forming an assembled adjustable pad 110 . screw 124 in this manner holds adjustable pad 110 together . spring 122 is compressed between washer 126 and an offset surface 112 b of base plate 112 . in this configuration , compression spring 122 presses base plate 112 , adjuster ring 114 , and top plate 116 together for operation . when spring 122 is fully compressed , assembled adjustable pad 110 cannot be further expanded . the most expanded setting along label 15 is therefore configured to occur before spring 122 is fully compressed . when adjustable pad 110 is in its most compressed state , spring 122 is in its most expanded state but is still compressed enough to apply a suitable holding force to hold base plate 112 , adjuster ring 114 , and top plate 116 together for operation . here , the head of screw 124 may extend out past outer surface 112 a and hook or pile layer 120 . hinge 32 of brace 30 can have a natural recess or open area for accepting the extended head of screw 124 , so that the screw does not interfere with the hook and pile attachment between adjustable pad 110 and hinge 32 . alternatively , the amount that surface 112 b is offset from outer surface 112 a of base plate 112 and / or the length of screw 124 are selected so that the head of screw 124 does not extend outwardly past outer surface 112 a and hook or pile layer 120 regardless of how compressed adjustable pad 110 becomes . top plate 116 includes receiver posts 116 b that extend towards base plate 112 . receiver posts 116 b receive mating studs 112 c ( fig1 ) extending from an inside of base plate 112 towards top plate 116 . the mating of receiver posts 116 b and studs 112 c provides adjustable pad 110 with the rotational and tilt stability as has been discussed above for adjustable pad 10 . more than two receiver posts 116 b and mating studs 112 c can be provided alternatively to help prevent the tilting and rotating of top plate 116 relative to base plate 112 . receiver posts 116 b can lead to openings in the top wall of top plate 116 or studs 112 c can be short enough such that the studs do not bottom out against the inside of the top wall of top plate 116 even when adjustable pad 110 is fully compressed . as with pad 10 , cushioned pad 119 will negate any user detection or feeling of studs 112 c if the studs extend out past the top wall of top plate 116 . adjuster ring 114 includes a handle 114 a that enables the user to grasp and turn adjuster ring 114 . while adjusters 14 and 114 have been described as rings , it should be appreciated that the adjusters could alternatively be linearly actuated adjusters and therefore do not have to be adjuster rings . referring now to fig9 , adjuster 114 is illustrated in more detail . with pad 10 , ramps r 1 to r 4 are provided on one or both of base plate 12 and top plate 16 , while spokes sp 1 to sp 4 are provided on adjuster 14 . with pad 110 on the other hand , a plurality of ramps are provided instead on one or both sides of adjuster 114 . adjuster 114 includes four ramps r 1 to r 4 as before , each ramp including five ramp angles ra 1 to ra 5 . adjuster 114 can alternatively include more or less ramps having more or less ramp angles . while ramps r 1 to r 4 can be provided on one or both sides of adjuster 114 , in the illustrated embodiment , ramps r 1 to r 4 are provided only on the side of adjuster 114 that faces base plate 112 . adjuster 114 also includes or defines a notch 114 b that receives a head portion 115 a of label 115 . notch 114 b helps to hold and orient label for connection to adjuster 114 . with adjustable pad 10 , the handle h moved relative to stationary label 15 . in the illustrated embodiment of adjustable pad 110 , label 115 moves along with handle 114 a . base plate 112 and / or top plate 116 therefore need only provide a mark that aligns with one of the moveable indicia of label 115 to indicate a current height setting . fig9 also illustrates that adjuster 114 includes an inner tubular collar 114 c including or providing a plurality of inwardly disposed v - shaped grooves g . in the illustrated embodiment , v - shaped grooves g span the entire three - hundred sixty degree inner circumference of inner tubular collar 114 c . referring now to fig1 , the side of base plate 112 that mates with ramps r 1 to r 4 of adjuster 114 is illustrated . offset surface 112 b of base plate 112 described above for receiving and interacting with spring 122 is illustrated . offset surface 112 b also defines a central hole for receiving screw 124 . alignment studs 112 c discussed above for insertion into receiver posts 116 b of top plate 116 for tilt and rotational stability are also illustrated . base plate 112 includes a spoke ring 112 d that provides structural rigidity to base plate 112 itself as well as to spokes sp 1 to sp 4 connected at their inner ends to spoke ring 112 d . spokes sp 1 to sp 4 are paddle shaped as opposed to the ramped or double - ramped polygonal shapes of spokes sp 1 to sp 4 of adjustable pad 10 . paddle shaped spokes sp 1 to sp 4 are slender and rounded along their surfaces for interacting with ramp angles ra 1 to ra 5 and are thus readily able to snap fit into the female v - shaped grooves of the ramp angles . as before , each ramp angle ra 1 to ra 5 extends along an incline of the ramp so as to have a different distance from a foot of the ramp than does an adjacent ramp angle . in the illustrate embodiment , like above with adjustable pad 10 , spoke sp 1 of base plate 112 is dedicated to ramp r 1 of adjuster 114 , spoke sp 2 of base plate 112 is dedicated to ramp r 2 of adjuster 114 , spoke sp 3 of base plate 112 is dedicated to ramp r 3 of adjuster 114 , and spoke sp 4 of base plate 112 is dedicated to ramp r 4 of adjuster 114 . spokes sp 1 to sp 4 ride along the changing height of ramp angles ra 1 to ra 5 of ramps r 1 to r 5 , respectively , changing the overall height in the manner illustrated in connection with fig6 . here , as opposed to fig6 , only one set of ramps r 1 to r 4 is provided . nevertheless , the mode of changing the height of adjustable pad 110 is aptly illustrated by fig6 . and as has been described , spring 122 holds spokes sp 1 to sp 4 to ramps r 1 to r 4 , respectively , regardless of which ramp angle ra 1 to ra 5 is selected and applied . referring additionally to fig8 , top piece 116 provides radially extending paddles 116 c . paddles 116 c could be modified to be spokes that operate with a second set of ramps extending from adjuster 114 towards top plate 116 . in the illustrated embodiment , however , radially extending paddles 116 c serve to provide rigidity to top plate 116 and to space or center adjuster 114 within top plate 116 for proper operation . top plate also includes or defines a notch 116 d that limits the travel of handle 114 a and adjuster 114 about base plate 112 and top plate 116 , maintaining lining a set relationship between spokes sp 1 to sp 4 and respective ramps r 1 to r 4 as has been described with notch n of adjustable pad 10 . fig1 also shows that top piece 116 includes or defines polygonal tabs pt 1 and pt 2 that serve largely the same purpose as the polygonal tabs pt 1 and pt 2 of adjustable pad 10 . polygonal tabs pt 1 and pt 2 of top plate 116 are spring - like and include outwardly facing triangular shapes that bendingly snap - fit into mating contact with multiple ones of v - shaped grooves g spanning the circumference of inner tubular collar 114 c of adjuster 114 . the snap - fitting connection between polygonal tabs pt 1 and pt 2 and grooves g provides tactile feedback to the user . the snap - fitting connection also holds adjustable pad 110 in a desired telescoped height setting . the many v - shaped grooves g can provide a finer amount of adjustability than do the five ramp angle setting shown above . that is , a ramp angle could be provided for each groove g per ramp r 1 to r 4 . thus if there are twelve grooves g per ramp r 1 to r 4 , there could be twelve ramp angles ra 1 to ra 12 . the four mm to twelve mm pad height adjustment discussed above could be divided into twelve setting instead of the five shown above . or , the height adjustment range could be expanded over the twelve settings , e . g ., four mm to 12 . 25 mm over 0 . 75 mm increments , or four mm to fifteen mm over 1 . 00 mm increments . there can also be more or less than twelve grooves g per ramp . in any case , the grooves g and polygonal tables pt 1 to . . . ptn hold adjuster 114 and adjustable pad 110 in a set position until modified by the user . referring now to fig1 , an assembled adjustable pad 110 is illustrated . base hook or pile layer 120 is exposed so that pad 110 can be removably attached to hinge 32 of brace 30 . screw 124 is shown being flush with press - applying washer 126 , both of which are in turn substantially flush with base plate 112 . base plate 112 could be pushed inwardly from screw 124 and washer 126 , in which case screw 124 and washer 126 can reside inside a recess of hinge 32 , allowing base hook or pile layer 120 to be fastened to the mating pile or hook material of brace hinge 32 . gel cushioned and / or foam padding cushioned pad 119 is removably fastened to adjustable pad 110 for cushioned impact with the side of the user &# 39 ; s knee . handle 114 c is available to be rotatably pushed or pulled to change a height adjustment setting . as mentioned in the summary , the apparatuses of the present disclosure operate via methods to provide a varied amount of side load on a user &# 39 ; s knee . the method includes enabling a user to turn or maneuver a handle provided by a removable telescoping pad that can be placed on the medial or lateral side of a user &# 39 ; s knee . the handle moves or turns a structure , such as an adjustable ring . the ring can have a spoke for example . the turning of the causes the ring , e . g ., spoke , to wedge into a new set of features , e . g ., ramp angles , provided by first and second plates surrounding the adjustable ring . the wedging of the ring into the new set of features causes a telescoping expansion or compression of the assembly to apply a changed side load to the knee . a spring compression force is supplied to compress the plates to the adjustable ring during adjustment or changing of the wedge . in the above method , the ramp angles and associate ramps are provided on one or both sides of the adjuster ring , either physically on the plates or on the adjuster itself , while the spokes or other ramp angle mating features are provided alternatively on the adjuster or on one or both of the mating first and second plates . as shown above , the spring can be an extension spring that is pulled apart and is biased to compress back to its natural shape to provide the compressive force . the spring can alternatively be a compression spring that is pushed together and is biased to expand back its natural shape to provide the compressive force . it should be understood that various changes and modifications to the presently preferred embodiments described herein will be apparent to those skilled in the art . for example , many features of the top plate could be provided instead on the base plate and vice versa . this is reflected below in the claims . such changes and modifications can be made without departing from the spirit and scope of the present subject matter and without diminishing its intended advantages . it is therefore intended that such changes and modifications be covered by the appended claims . | US-201113307869-A |
the floss is comprised of a texturized yarn that has been coated and impregnated with a water - soluble polymer and the water - soluble polymer coating cured and set while the yarn is stretched and is under tension . the yarn while stretched and tensioned is at a reduced width , which allows for easier insertion of the yarn floss between teeth . the yarn floss is wound onto a spool in the decreased width condition . for use , a length of floss is removed from the spool and placed between teeth . the saliva in the mouth dissolves the cured and set water - soluble polymer with the floss expanding to fill the space between the teeth . the floss is optionally coated with flavors , medicants and other substances . these can be synthetic or naturally occurring substances such as herbal substances . | the yarn that is to be used as the floss is a particular yarn . it consists of a plurality of bundles of filaments . these are sometimes referred to as cables . in each filament bundle there can be perhaps 20 or more filaments . the filaments have been texturized by forced air , mechanical and / or heat treatments to form coils , curves , twists , crimps and / or loops . these yarns have the property of being stretchable so that the cross - sectional diameter of the yarn will be reduced when the yarn is under tension . when not under tension the yarn will regain substantially its original length and cross - sectional diameter . this in combination with an irregular honeycomb surface on the yarn results in the yarn being an effective dental floss . the yarn can be tensioned to reduce its diameter to facilitate placing the yarn between a persons teeth , and then relaxed to increase the diameter for use as a floss . this cleans food debris and other materials from between close interstitial spaces . the yarn will be comprised of about 4 to 10 filament bundles , and preferably about 6 . the yarn at rest will have a cross - sectional diameter of about 10 mm to 40 mm , and preferably about 15 mm to 30 mm . in general , the yarn will approximate a circular cross - section . upon stretching , the cross - sectional diameter of the yarn can be reduced to about as low as 10 percent of its non - tensioned diameter . in length it can be increased up to about 150 percent of its original non - tensioned length when put under tension . these are useful properties for the yarns when used as a dental floss . the floss can be inserted into inter dental spaces when tensioned and used to remove food debris when in a relaxed , increased cross - sectional diameter form . the yarns cannot be used directly as a floss . there is a tendency for the yarns to shed parts of filaments . if used directly as a floss filament , parts of the yarn can be left between teeth . this is annoying and is not considered to be acceptable to a person who is flossing . consequently , the yarn is coated with a coating to lock / bond / network the filaments into a yarn . the coating preferably is a substantially water soluble polymer that will wet the filaments of the yarn and which can be set by solvent evaporation or other polymerization . in the alternative , non - water soluble polymers also can be used as a first coating followed by a coating with a water - soluble polymer . when first coated with a non - water - soluble polymer , this coating , and the subsequent curing , are conducted with the yarn under minimal to no tension as described in u . s . application ser . no . 08 / 648 , 332 filed may 15 , 1996 . only enough tension is used to move the yarn through the coating process . polymers set by solvent evaporation are set by the evaporation of the solvent through heating . the solvent can be water or an organic . in any regards , the end result is a dental floss with the filaments locked into the yarn structure . however , the yarn retains its original characteristics as set out above . it is stretchable . the coated yarn under tension can acquire about as low as 10 percent of the cross - sectional diameter of the yarn at rest . and the coated yarn can stretch to more than 150 percent of its length as compared to the yarn under no tension . as discussed , the yarn can be pretreated with a polymer to lock / bond / network the filaments of the yarn together . in such an instance the pretreatment can be with a range of polymers . these can be water - soluble or water - insoluble polymers . when the yarn is so pretreated , the objective is to maintain , as much as possible , the original cross - section of the yarn . consequently , the yarn is coated with the polymer and the polymer cured on the yarn while the yarn is under minimal to no tension . the only tension on the yarn is that needed to pull the yarn through the polymer coating bath . the curing preferably is conducted while the yarn is moving downward solely under its own weight . that is , the only tensioning force is a gravitational force . this pretreatment prevents the yarn from fraying when used as a floss . in the main treating step , the yarn , virgin or pretreated , is coated with a water - soluble polymer . the yarn then passes through nip rolls to remove excess polymer and to further impregnate the polymer into the yarn . the yarn then is maintained under a tension during curing of the water - soluble polymer so as to substantially decrease the cross - sectional dimension of the yarn . the tension is such that the cross - section dimension is decreased up to 90 %, with the yarn being elongated to more than 150 % of its original length . the yarn is cured while in this tensioned form . the coating can be by immersion by passing the yarn through a polymer bath , roller coating or spray coating . a preferred technique is by immersing the tensioned yarn in a polymer bath . in addition the coating can be applied in one or more stages . a two - stage coating process is preferred with the yarn under tension in each stage . this preferred process is comprised of a first polymeric solution coating followed by a second coating with a flavor and / or medicant solution . however the first polymeric solution can contain flavorants and / or medicants . after coating any excess polymer can be removed by passing between nip rolls and optionally through a calandering system to impregnate the polymer into the tensioned yarn . preferably there is a single calandering after the second stage coating . however there can be a calandering after each stage of coating . the coated and calandered yarn thereafter passes to a curing station , which usually is a solvent removal station . the solvent usually is water but can be an organic or a water / organic mixture . after the coating has been set by solvent removal or other polymerization technique , the coated yarn , which now is the floss , is wound onto a spool . these can be larger spools for professional use or smaller spools for personal use . as noted , in the first stage or second stage coating solutions there can be flavorants and various medicants , alone and in various combinations . the flavorants include eucalyptus , peppermint , wintergreen , spearmint , tee tree oil , sage oil , licorice , cinnamon and fruit flavors such as orange and lemon , and herbal flavors . the medicants include fluoride , densitizing agents , antitartar agents , antiplaque agents , antibacterials , herbs , antifungal agents , antiprotozoan agents , antiseptics and coagulants . the various medicants can be synthetic or naturally occurring . there are many naturally occurring agents that have medicant properties . these naturally occurring agents include chamomile tincture , myrrh tincture , aloe vera , nicotine , sanguinaria , chelerythine and benzophenanthridine alkaloids . the flavorant and / or medicant is solubilized or emulsified in the water - soluble polymer solution , which usually is an aqueous solution . it preferably is applied to the yarn by immersion of the yarn in the solution , calandering to impregnate the polymer and the other coating components into the yarn , and curing the yarn by removing the water or water / organic solvent . the coating will be applied in one or more stages . preferably it will be conducted in two stages . the yarn will contain about 20 % to about 60 % by weight of cured polymer solution plus flavorants and / or medicants , and preferably about 30 % to about 50 % by weight of cured polymer plus flavorant and / or medicant . the cured water - soluble polymer will be on the yarn in a content of about 5 % to about 12 % by weight . if there is a pretreatment polymer content this will be in addition to the content of the cured water - soluble polymer content . the useful pretreatment polymers include polyurethanes , polyesters , polyamides such as nylons , vinyl alcohol homopolymers and copolymers , vinyl acetate homopolymers and copolymers . various polyurethanes can be ultra - violet cured . useful solvent based polymers include vinyl acetate copolymers , vinyl alcohol copolymers and nylon dissolved in a water , ethanol , or ethanol / water mixture . when the solvent is evaporated the polymer sets to keep the filaments locked to the yarn and the yarn in the cross - sectioned structure in which the polymer has been set . suitable water soluble polymers include vinyl alcohol polymers and copolymers , vinyl acetate polymers and copolymers and copolymers of vinyl acetate / ethylene copolymer . the water - soluble polymer will be applied to the yarn so as to comprise about 3 % to about 15 % of the yarn . as noted , the coating can be applied by immersion in a bath , by being passed over a coating roller , by being passed through two coating rollers and by being sprayed with the water - soluble polymer . in use a section of the floss is cut from the remainder of the spool and used as a floss . during use the floss will increase in diameter about 3 to 10 times as the water - soluble polymer is dissolved . this floss is easy to thread into tight interdental spaces , and during use increases in diameter to fill the interdental space . this provides for better removal of food and other debris . the present invention will be disclosed in more detail with reference to the following example . a nylon 66 polyamide texturized yarn having a denier of 948 , 34 filaments and two - ply ( dupont merge 697 ) is coated with a coating formulation having the following concentration of components : ______________________________________ingredients % by weight______________________________________polyvinyl acetate / ethylene copolymer ( airflex 400 ) 20 . 5cremephor rh 40 ( castor oil hydrogened ) 4 . 0xylitol 2 . 0sodium saccharin 0 . 15chamomile tincture 0 . 475myrrh tincture 0 . 95polyethylene glycol 6000 23 . 025polyethylene glycol 400 6 . 0sage oil 0 . 19tea tree oil 0 . 285flavor sorriso herbal kb - 8112 - 1 - 11 19 . 0glyceryl triacetate ( triacetin ) 1 . 5water to 100 % ______________________________________ the yarn which has a large cross - section diameter is tensioned to a decreased diameter and pulled through a two stage coating bath . the first bath contains the polymer , ( pva / e copolymer as a 55 % emulsion ), cremophor , xylitol , sodium saccharin , chamomile tincture and myrrh tincture along with about an equivalent weight of water . the second stage will contain the peg 6000 , peg 400 , herbal flavor , sage oil , tea tree oil and glyceryl triacetate . this second stage coating does not contain any water . the yarn after coating is passed through a curing oven to remove the solvent which primarily is water . the curing oven is maintained at a temperature to remove the water solvent . the residence time of the coated yarn in the curing process over is about 4 to 60 seconds depending on the temperature of the curing oven . the end product texturized yarn floss has the following concentration of components : ______________________________________ % by meter ofingredients finished product______________________________________nylon semitexturized raw yarn 61 . 728polyvinyl acetate / ethylene copolymer 7 . 385cremephor rh 40 ( castor oil hydrogened ) 2 . 620xylitol 1 . 310sodium saccharin 0 . 098chamomile tincture 0 . 311myrrh tincture 0 . 622polyethylene glycol 6000 11 . 939polyethylene glycol 400 3 . 111sage oil 0 . 099tea tree oil 0 . 148flavor sorriso herbal kb - 8112 - 1 - 11 9 . 851glyceryl triacetate ( triacetin ) 0 . 778total 100 . 0______________________________________ the floss is easy to thread into and through various sized interdental spaces . during flossing the moisture in the mouth partially dissolves the water soluble polymer and the floss expands to fill the interdental space being flossed . | US-37919099-A |
the present invention provides a protective ear guard assembly for covering and protecting portions of a user &# 39 ; s head , particularly for wrestlers . the assembly includes a pair of ear guards each consisting of a resilient semi - rigid shell having a cup shaped center section and a peripheral outer flange , a plurality of strap attachments , an outer partially compressed foam pad corresponding to the shape and size of the shell and having a plurality of raised areas , an inner foam ring corresponding substantially to the outer flange of the shell and a molded flexible outer cover substantially covering the foam pads and having openings corresponding to the raised areas of the outer foam pad whereby those raised areas protrude through the outer skin cover . the assembly also includes a plurality of retention straps adjustably connectable to the strap attaching means and adapted to traverse the user &# 39 ; s head enabling the headgear assembly to be held in position on the head ; and accessory protective guards consisting of a forehead pad and auxiliary ear pads which are removably attachable to the ear guards and the retention straps . | fig1 illustrates the protective ear guard assembly 1 of the present invention showing the left and right ear guards 2 , 3 joined together in wearable form by retention straps 4a - e to form a headpiece . straps 4a and 4e are illustrated with optional foam coatings 5 which provide added padding to the straps where they cross the wearer &# 39 ; s upper forehead and chin . foam coatings 5 may be molded directly to straps 4a and 4e or they may be preformed with a longitudinal slot 6 and slid onto straps 4a and 4e when desired . straps 4a - e are preferably made from molded , flexible plastic and cooperate with attachment means for connecting to ear guards 2 , 3 . preferably the attachment means provide adjustability to permit the assembly 1 to be sized to different individuals . a preferred attachment means comprises paired slots 7 spaced around the periphery of the ear guards 2 , 3 through which the ends of straps 4a - e are passed . to lock straps 4a - e in place within slots 7 , each of the pair of slots 7 is provided with a plurality of molded teeth 8 along the edge adjacent to the other slot of the pair . straps 4a - e are provided with a plurality of parallel spaced ridges 9 which are perpendicular to the longitudinal axis of the straps . ridges 9 extend upward from the outer surface of the straps and engage teeth 8 when the straps are woven through the paired slots 7 as shown in fig1 thereby serving as detents to prevent the straps 4a - e from loosening . in order to permit the user to easily don and remove the assembly 1 , one end of chin strap 4e is provided with a snap 10 or other releasable fastener , one of the ear guards 2 or 3 having a corresponding part of such fastener mounted thereon in place of the paired slots 7 in the comparable position on the other ear guard . other attachment means , such as snaps or the like , may be used in place of the paired slots 7 ; however , the slots are preferred to avoid inadvertent separation during use . a safety feature of the assembly 1 is partially shown in fig1 . with previous headgear of this type it has been usual for the ends of retention straps to be allowed to hang free . this presents a hazard to the eyes of a wrestler &# 39 ; s opponent . assembly 1 of the present invention provides means facilitating the insertion of strap ends 11 under the protective padding of the ear guards 2 , 3 . the nature of this feature will become more evident from fig2 and 3 and the description thereof which follows . fig2 illustrates left ear guard 2 of fig1 . right ear guard 3 is substantially identical except for the substitution of an additional pair of parallel slots 7 in place of the snap half 10 shown here . ear guards 2 , 3 are constructed from four parts ; an inner semi - rigid shell 12 , an inner foam pad 13 , an outer foam pad 14 and an outer flexible molded cover 15 . semi - rigid shell 12 is molded from a plastic material and comprises a cup shaped center section 16 having a concave inner surface and a convex outer surface . cup 16 is sized to comfortably receive the user &# 39 ; s outer ear . substantially centrally located in the cup 16 is at least one aperture 17 which serves to permit the equalization of air pressure over and within the user &# 39 ; s ear when the assembly 1 is worn . although illustrated with only one such aperture 17 , ear guards 2 , 3 may be constructed with more than one aperture 17 without departing from the spirit of this invention . around the outer periphery of cup 16 is a flat flange 18 in which paired slots 7 with teeth 8 are located . preferably flange 18 does not completely encircle cup 16 inasmuch as the forward edge 19 of ear guard 2 , 3 is preferably molded to provide a passage 20 into cup 16 to facilitate hearing while the assembly is worn . in addition , forward edge 19 is preferably substantially straight in a vertical direction whereas the rest of the periphery of inner shell 12 is curved . also located in flange 18 and extending downward into passage 20 is accessory slot 21 , the purpose of which will be described later . as noted previously , the material from which inner shell 12 is molded is preferably a plastic having sufficient rigidity at a minimum thickness to maintain its shape under stress but with a degree of resiliency which allows shell 12 to flex to a certain degree when struck . in this manner , inner shell 12 is able to absorb forces and shocks which may be applied to ear guards 2 , 3 and which are greater than those absorbed by inner and outer foam pads 13 and 14 . examples of suitable plastic materials from which inner shell 12 may be molded include polyethylene , polystyrene , polyurethane , and the like . inner foam pad 13 is a ring having an outer dimension substantially equal to the outer dimension of inner shell 12 and an inner dimension substantially equal to the circumference of cup 16 . the material of inner foam pad 13 is preferably eva foam which is cut to shape and may be partially compressed , although pad 13 may also be provided in the uncompressed state as well as being formed from other foams having open or closed cells . in addition to a central aperture over cup 16 , inner pad 13 is provided with apertures 22 at locations corresponding to paired parallel slots 7 which permit straps 4a - e to be more easily inserted into paired slots 7 . furthermore , an aperture 23 corresponding to accessory slot 21 is provided in the forward portion of inner pad 13 . outer foam pad 14 has a dimension substantially equal to that of the outer surface of inner shell 12 and includes cut out areas 24 in its periphery corresponding to the locations of paired parallel slots 7 and snap 10 . an additional cut out 25 corresponds to the location of accessory slot 21 . at least one aperture 28 is centrally located and corresponds to the position of aperture 17 . as shown in fig2 the underside 26 of outer pad 14 is provided with channels 27 molded or otherwise formed in the surface 26 of pad 14 . channels 27 extend radially inward from the inner edges of cut out areas 24 such that when pad 14 is placed against the outer surface of inner shell 12 , space is provided in which the ends 11 of straps 4a - e are received . in addition , outer pad 14 may be substantially planar or it may be molded to conform in varying degrees to the outer surface of inner shell 12 . turning to fig3 the upper surface 29 of outer pad 14 is seen . like inner foam pad 13 , outer pad 14 is preferably formed from eva foam . however , whereas inner pad 13 is provided in a single thickness , outer pad 14 is molded to include a plurality of raised areas 30 surrounded by compressed areas 31 . preferably , the raised areas 30 constitute greater than 50 % of the area of outer pad 14 with the compressed areas being less than 50 % of the area . most preferably , the relationship is about 75 % raised and about 25 % compressed . the compressed areas 31 are preferably about one half the thickness of the raised areas of foam which preferably has an overall thickness of about one half ( 1 / 2 ) to about three quarters ( 3 / 4 ) of an inch with each raised area 30 being substantially surrounded by compressed area 31 . the compressed areas 31 preferably have a thickness of about one quarter ( 1 / 4 ) to about one half ( 1 / 2 ) of an inch . furthermore , at least the upper surfaces of the raised areas 30 of foam are provided with a sealed smooth surface or skin . the structure of the outer foam pad 14 may be produced in any way suitable for molding foam . for example , a block of uncompressed foam may be molded between molded between two dies to compress the foam in areas and a pattern corresponding to the compressed areas 31 of pad 14 . alternatively , the foam precursors may be introduced into a closed mold having the shape of the pad to be produced whereupon expansion of the foam fills the mold and cures to form pad 14 . preferably pads 13 and 14 are formed with a smooth skin providing sealed , smooth surfaces . they may also be encased in a thin , lightweight woven or non - woven fabric , such as a tricot , applied during or after molding . outer cover 15 is molded from a flexible plastic material , such as vinyl or the like , and has an outer framework 32 which fits over the outer foam pad 14 and an underskirt 33 which extends radially inwardly from the periphery of the outer cover 15 over the inner foam pad 13 . the effect is of a jacket which encloses the inner shell 12 , inner pad 13 and compressed areas 31 of outer pad 14 . for added comfort , the inner edge of underskirt 33 is provided with a skirt 34 which extends inwardly into cup 16 . as shown in fig1 the raised areas 30 of outer pad 14 are exposed on the outer faces of ear guards 2 , 3 through framework 32 of outer cover 15 . the raised areas 30 preferably extend beyond the outer cover 15 a distance of about one quarter ( 1 / 4 ) to about one half ( 1 / 2 ) of an inch . this framework 32 of outer cover 15 is illustrated in fig4 and 5 and includes a plurality of apertures 35 corresponding in size , shape and location to the raised areas 30 of outer pad 14 . webbing 36 of framework 32 overlays the compressed areas 31 of outer pad 14 which may be adhered to inner surface 37 of webbing 36 . in addition to foam apertures 35 , outer cover has strap apertures 38 in locations corresponding to the locations of paired slots 7 . strap apertures 38 permit access to slots 7 and snap 10 for fastening of straps 4a - e to ear guards 2 , 3 . furthermore , accessory apertures 40 are provided in outer cover 15 corresponding to the location of accessory slot 21 . although it is not a requirement , all apertures 34 , 38 and 40 in outer cover 15 , may by provided with peripheral skirts 41 extending inwardly similar to skirt 34 on underskirt 33 . where skirts 41 are present around strap apertures 38 , notches 42 will be provided lining up with channels 27 thus providing passage for the strap ends 11 into channels 27 . applicant has found that the above - described construction for ear guards provides a greater degree of protection to users and opponents and greater absorbance of shock than is achieved with the prior art constructions where the foam pads are of a single thickness and completely encased within an outer cover . the structure of applicant &# 39 ; s outer foam pad 14 wherein the raised areas 30 of the foam extend beyond the outer cover 15 and are exposed to direct contact before the rest of the ear guard results in a two level rate of absorption of shock . when in use , the first contact with the ear guards is on the exposed uncompressed foam which compresses to absorb any force applied thereto without transmitting that force to the user . as these areas are compressed to the level of the outer cover 15 and the compressed areas 31 , the rest of the outer foam pad begins to absorb the forces being applied thereto . in addition , some of the excess force being applied to the now compressed raised areas 30 is directed laterally into the body of foam pad 14 by the shape of cup 16 to be finally transferred to inner foam pad 13 which surrounds the wearer &# 39 ; s ear . furthermore , the exposure of the softer and more compliant foam as the first surface of contact affords greater protection to the wearer &# 39 ; s opponents than a less yielding material such as the continuous vinyl cover of prior ear guards . in the event a sudden shock is applied to the outer surface of ear guards 2 , 3 , not only is a portion of that shock absorbed and redirected by the structure of the foam pads 14 and 13 , but , where the force of the shock is sufficient , inner shell 12 flexes and thus absorbs and diverts the shock radially outward . in this manner less of the shock and associated pressure is transmitted to the user &# 39 ; s ears . turning now to the accessories which are provided as part of the assembly of the present invention , fig6 shows a forehead pad 50 which attaches to the ear guards 2 , 3 and to the upper forehead retention strap 4a . forehead pad 50 is molded from a substantially triangular or three lobed piece of foam which is preferably compressed around the periphery 51 and along three lines 52 , 53 and 54 as shown . these lines of compression provide lines of greater flexibility to the foam pad 50 enabling it to better conform to the shape of the user &# 39 ; s forehead . although pad 50 may be left uncoated , it is preferred that a protective layer of either curable material , such as vinyl , or a fabric be applied over the foam thereby encasing the forehead pad 50 . where the protective layer is a fabric , it may be a fabric such as a tricot knit which is bonded to the foam at the time it is molded . alternatively , the fabric may be a cotton or other woven or non - woven material which is bonded or sewn to the foam pad 50 . when a curable coating is used , it to may be applied at the time the foam is molded or it may be applied later by spraying or dipping . as with pads 13 and 14 of the ear guards 2 and 3 , forehead pad 50 is preferably molded from an energy absorbing foam such as open or closed cell eva foam . other foams may also be used and similar methods of manufacture , i . e ., compression molding , expansion molding , etc ., may be used for fabrication . attachment of pad 50 to the ear guard assembly 1 is preferably by means of straps 55 , 56 and 57 provided at the three apices of the substantially triangular shape of the pad . fig6 illustrates the placement of these straps and shows the forehead pad 50 attached to left ear guard 2 by means of strap 55 which is looped through accessory slot 21 and then attached to itself . any form of self attachment may be employed including mechanical fasteners . however , it is preferred to use a simple hook and pile fastener 58 applied to the back side of the straps 55 , 56 and 57 . strap 56 attaches the other end of pad 50 to right ear guard 3 in the same manner by being looped through accessory slot 21 therein and strap 57 is looped around upper forehead retention strap 4a of the assembly 1 . this method of attachment permits the forehead pad 50 to be quickly and easily attached to or removed from the assembly 1 and does not interfere with adjustment of the assembly 1 to different sized users . the second accessory for use with the ear guard assembly of the present invention is an auxiliary ear pad 60 for use by individuals who have suffered an injury , such as &# 34 ; cauliflower ear &# 34 ;, or by those who require additional padding between the ear guards 2 and 3 and their ears . shown in fig7 the auxiliary ear pad 60 consists of an additional ring 61 of compressed or uncompressed foam having dimensions substantially equal to those of inner foam pad 13 of the ear guards 2 and 3 . as with forehead pad 50 , ring 61 may be provided as uncoated foam , although preferably with smooth and sealed surfaces , or it may be coated in the manner discussed above . ring 61 is provided with a means for attachment to the ear guards 2 , 3 which cooperates with the paired slots 7 and retention straps 4a - e of the headgear . the ring attachment means consists of a plurality of strap members 62 spaced around the ring 61 at locations corresponding to those of the paired slots 7 of the ear guards 2 and 3 . as shown in fig8 strap members 62 are preferably molded into foam ring 61 and extend laterally therefrom at a point substantially equidistant in the thickness of ring 61 between the parallel faces 64 , thus permitting ring 61 to be reversible for mounting on either left or right ear guards 2 and 3 . inner ends of strap members 62 preferably have an anchor means to resisit pulling out of foam ring 61 . such anchor means may take the form of an enlargement as shown in fig8 or apertures in the strap member through which the foam extends to lock the strap member in place . in a still further embodiment , the strap members 62 may be an integral part of the ring 61 formed by extensive compression of laterally extending sections of the foam ring material . this embodiment is particularly suited to use with disposable auxiliary pads . the ends of the strap members 62 are provided with paired parallel slots 63 having a relationship which corresponds to that of slots 7 in ear guards 2 and 3 . to attach the ring 61 to an ear guard 2 or 3 , the ring 61 is placed on the inside of the ear guard 2 , 3 against the exposed surface of underskirt 33 . strap members 62 are wrapped around the periphery of the ear guard and the slots 63 therein lined up with the paired slots 7 of the ear guard . the tips 64 of strap members 62 may be tucked into channels 27 through strap apertures 38 . with the slots 63 and 7 aligned , retention straps 4a - e are then woven through both sets of slots , thereby securing the auxiliary ear pad to the ear guard . in the case of the ear guard having a snap half thereon for the releasable end of chin strap 4e , the corresponding strap member 62 of auxiliary ear pad 60 is preferably provided with appropriate snap halves on both sides instead of the parallel slots . in this case , the strap member 62 will be snapped over the snap half on the ear guard and will carry another snap half for attachment of chin strap 4e thereto . alternatively , the strap member may be provided with a hole of sufficient size to allow passage of the ear guard snap half for connection to the snap half 10 on the end of chin strap 4e thereby securing the strap member between the ear guard and the end chin strap 4e . the protective ear guard assembly of the present invention is preferably provided as a complete set which includes the left and right ear guards , retention straps , the forehead pad and at least one reversible auxiliary ear pad . while the invention has been described with respect to certain specific embodiments , it will be appreciated that many modifications and changes may be made by those skilled in the art without departing from the spirit of the invention . it is intended , therefore , by the appended claims to cover all such modifications and changes as fall within the true spirit and scope of the invention . | US-39495195-A |
a portable pen assembly for being placed within a bathtub such that a user is retained within the assembly includes a base that may be positioned within a bathtub . a pair of first walls is each movably coupled to opposite sides of the base . each of the pair of first walls is positionable in a deployed position . the pair of first walls extends upwardly from the base . a pair of second walls is each removably coupled between the pair of first walls . each of the pair of first and second walls encloses the base . the assembly may contain the user . a liner is positionable within the assembly . the liner covers the base and each of the pair of first and second walls . | with reference now to the drawings , and in particular to fig1 through 7 thereof , a new pen device embodying the principles and concepts of an embodiment of the disclosure and generally designated by the reference numeral 10 will be described . as best illustrated in fig1 through 7 , the portable pen assembly 10 generally comprises a base 12 . the base 12 has an outer edge 14 extending between each of a top side 16 and a bottom side 18 of the base 12 . the base 12 is positionable within a bathtub 20 . additionally , the bottom side 18 of the base 12 abuts a top surface 22 of the bathtub 20 . the bathtub 20 may be a bathtub of any conventional design . a plurality of suction cups 24 is coupled to the bottom side 18 of the base 12 . each of the plurality of suction cups 24 is positioned proximate an associated one of four corners 26 of the base 12 . an open end 28 of each of the plurality of suction cups 24 suctionally engages the top surface 22 of the bathtub 20 . the plurality of suction cups 24 retains the base 12 on the top surface 22 of the bathtub 20 . a pair of first walls 30 is provided . each of the pair of first walls 30 has an extraneous edge 32 extending between each of a inner side 34 and an outer side 36 of each of the pair of first walls 30 . a lower side 38 of the extraneous edge 32 of each of the pair of first walls 30 abuts the top side 16 of the base 12 . each of the pair of first walls 30 is coextensive with an associated one of a front side 40 and a back side 42 of the outer edge 14 of the base 12 . a foot 44 extends outwardly from the outer side 36 of each of the pair of first walls 30 . the foot 44 is coextensive with the lower side 38 of the extraneous edge 32 of each of the pair of first walls 30 . the outer side 36 of each of the pair of first walls 30 has a pair of insets 46 . the pair of insets 46 is coextensive with an associated one of a first oblique side 48 and a second oblique side 50 of the extraneous edge 32 of each of the pair of first walls 30 . the outer side 36 of each of the pair of first walls 30 has a pair of tabs 52 extending outwardly therefrom . each of the pair of tabs 52 is positioned proximate an associated one of the first 48 and second 50 oblique sides of the extraneous edge 32 of each of the pair of first walls 30 . the pair of tabs 52 is each positioned on an associated one of the pair of insets 46 . additionally , each of the pair of tabs 52 is coextensive with the associated one of the first 48 and second 50 oblique sides of the pair of first walls 30 . a pair of hinges 54 is each coupled between the top side 16 of the base 12 and the inner side 34 of each of the pair of first walls 30 . each of the pair of first walls 30 is hingedly coupled to the base 12 . additionally , each of the pair of first walls 30 is positionable in a deployed position . the pair of first walls 30 each extends upwardly from the base 12 in the deployed position . the foot 44 on each of the pair of first walls 30 abuts the top side 16 of the base 12 when the pair of first walls 30 are positioned in the deployed position . the foot 44 on each of the pair of first walls 30 retains each of the pair of first walls 30 in the deployed position . each of the pair of first walls 30 has a plurality of apertures 56 extending through the inner 34 and outer 36 sides of the pair of first walls 30 . the plurality apertures 56 is evenly spaced apart and distributed along an entire length and width of each of the pair of first walls 30 . the plurality of apertures 56 allows a fluid 58 to pass through each of the pair of first walls 30 . the fluid 58 may be water . a pair of second walls 60 is provided . the pair of second walls 60 each has an outermost edge 62 extending between each of an innermost side 64 and an outermost side 66 of each of the pair of second walls 60 . each of a first lateral side 68 and a second lateral side 70 of the outermost edge 66 of each of the pair of second walls 60 is directed forwardly from the innermost side 64 of each of the pair of second walls 60 . moreover , each of the pair of second walls 60 has a u - shape . the innermost side 64 of each of the pair of second walls 60 has a pair of insets 72 . the pair of insets 72 is coextensive with an associated one of the first 68 and second 70 lateral sides of the outermost edge 66 of each of the pair of second walls 60 . the innermost side 64 of each of the pair of second walls 60 has a pair of grooves 74 extending therein . the pair of grooves 74 is positioned proximate an associated one of the first 68 and second 70 lateral sides of the outermost edge 66 of each of the pair of second walls 60 . each of the pair of grooves 74 is positioned on an associated one of the pair of insets 72 . the pair of grooves 74 is each coextensive with the associated one of the first 68 and second 70 lateral sides of the outermost edge 66 of each of the pair of second walls 60 . each of the pair of second walls 60 is positionable such that the pair of insets 72 on each of the pair of second walls 60 engages an associated one of a pair of insets 46 on each of the pair of first walls 30 . additionally , the pair of tabs 52 on each of the pair of first walls 30 engages an associated one of the pair of grooves 74 on each of the pair of second walls 60 . each of the pair of first 30 and second 60 walls forms a barrier around the outer edge 14 of the base 12 . the assembly 10 may contain a user 76 . the user 76 may be an infant or toddler . each of the pair of second walls 60 has a plurality of openings 78 extending through the innermost 64 and outermost 66 sides of each of the pair of second walls 60 . the plurality of openings 78 is evenly spaced apart and distributed along an entire length and width of each of the pair of second walls 60 . the plurality of openings 78 allows the fluid 58 to pass through each of the pair of second walls 60 . a liner 80 is provided . the liner 80 has a top surface 82 and a bottom surface 84 . the liner 80 is positionable within the assembly 10 so the bottom surface 84 of the liner 80 covers the top side 16 of the base 12 , the inner side 34 of each of the pair of first walls 30 and the innermost side 64 of each of the second walls 60 . the liner 80 may be comprised of a fluid impermeable material such as rubber or other similar material . in use , the pair of first walls 30 are positioned in the deployed position and the pair of second walls 60 are coupled to the pair of first walls 30 . the assembly 10 is positioned within the bathtub 20 when the user 76 is to be bathed . the bathtub 20 is filled with the fluid 58 . the user 76 is positioned within the assembly 10 so the user 76 is prevented from tipping over and drowning in the fluid 58 . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of an embodiment enabled by the disclosure , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by an embodiment of the disclosure . therefore , the foregoing is considered as illustrative only of the principles of the disclosure . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the disclosure to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the disclosure . in this patent document , the word “ comprising ” is used in its non - limiting sense to mean that items following the word are included , but items not specifically mentioned are not excluded . a reference to an element by the indefinite article “ a ” does not exclude the possibility that more than one of the element is present , unless the context clearly requires that there be only one of the elements . | US-201414328145-A |
the paddle of the present invention is a paddle having an extendable and retractable spear . the paddle of the present invention provides the customary utility of providing motion when used in connection with a water vessel . the present invention is particularly directed to an interior or exterior spear , which the user can selectably extend and retract . | the following detailed description is merely illustrative of the nature of the present invention , and is not intended to limit the scope of the present invention to the details of the particular described embodiments . as used herein , the terms “ representative ” or “ illustrative ” or “ embodiment ” mean merely a representative application of the present invention . additional and equivalent implementations of the concepts of the present invention will be apparent to one of ordinary skill in the art . there is no intention for the scope for the present invention to be limited or bound by the illustrative embodiments set forth herein . detailed reference will now be made to illustrative embodiments of the present invention as set forth hereafter and in fig1 - 5 . as shown in fig1 , a paddle 10 is the subject of the present invention . paddles commonly comprise a grip 20 , a shaft 30 , and a blade 40 . the grip 20 may be any conventional grip providing the structure suitable to the user to satisfy any ergonomic or comfort features of the grip . the grip 20 is traditionally located on one end of the shaft 30 . shaft 30 comprises three portions , namely , an upper shaft portion 31 , and middle shaft portion 32 , and a lower shaft portion 33 . traditionally , grip 20 is attached to upper shaft portion 31 . in one embodiment of the present invention , shaft 30 comprises a first shaft portion 35 and a second shaft portion 36 . first shaft portion 35 and second shaft portion 36 is configured so as to have a telescoping nature . that is , one shaft portion may slide within the other shaft portion . for example , shaft portion 36 may slide in a telescoping manner within shaft portion 35 . at a shaft juncture 37 , a means 37 for fixing the relative positions of first shaft portion 35 and second shaft portion 36 may be disposed . such means may comprise a selectively releasable clamping mechanism to fix the relative position of first shaft portion 35 with second shaft portion 36 . this means will be referred to in this application as the positioning means 37 . positioning means 37 can be any conventional screw - type tightener , clamping mechanism , or other known mechanism by which the position of telescoping members are held in a selectably fixed relationship one to another . the description of one embodiment of this invention are not dependent upon the nature of the positioning means but only on the ability of the user to cause one shaft portion to move in a telescoping fashion within another shaft portion as described below . as known by those skilled in the art , shaft 30 may be a straight shaft or a bent shaft . for purposes of this invention , a straight shaft is illustrated . one of skill in the art would understand how the concepts of the invention described in this patent can be adapted when used in connection with a bent shaft . the blade 40 comprises a throat portion 41 defining a transition point between shaft 30 and blade 40 . blade 40 comprises a power face which contacts the water during a forward stroke and back face opposite the power face . for purposes of this invention , whether extendible and retractable rod member is used in conjunction with the power face or back face is only represented illustratively . blade 40 also comprises an edge or tip 42 designating the extreme end of the paddle . as shown in fig2 , one embodiment of the present paddle invention comprises a rod 50 slidable within shaft 30 . one embodiment is illustrated in fig2 . depicted are a handle / shaft adapter 51 , a control rod 52 , a shaft guide 53 , an upper shaft adapter 54 , and upper shaft 55 , a cable adapter 56 , a flexible cable 57 , a lower shaft 58 , and a tip 60 . this configuration illustrates the present invention in which telescoping members of shaft 30 house components of rod 50 to effect deployment and retraction of rod 50 in a paddle including a kick - back angle ø between shaft 30 and blade 40 , see fig3 . as depicted in fig2 , handle / shaft adapter 51 is configured to be fixed within second shaft portion 36 of paddle 10 . control rod 52 engages handle / shaft adapter 51 . shaft guide 53 is disposed within first shaft portion 35 . shaft guide 53 is connected to control rod 52 and slides within shaft 30 . upper shaft adapter 54 is attached to shaft guide 53 . upper shaft adapter acts as a host to upper shaft 55 . the combination of control rod 52 , shaft guide 53 , upper shaft adapter 54 , and upper shaft 55 is a rod member which can slide on the interior of shaft 30 . cable adapter 56 is attached to upper shaft 55 . cable adapter 56 allows the attachment of a flexible cable 57 because the embodiment illustrated in fig2 employs a kick - back angle between shaft 30 and blade 40 . flexible cable 57 allows a force being exerted along control 52 to be transmitted at an angle within shaft 30 and blade 40 . lower shaft 58 is then attached to flexible cable 57 . lower shaft 58 acts as a host for tip 60 . tip 60 may comprise any number of functional configurations , for example , if the device of the present invention is used as a defense mechanism against any undesirable water fowl or creatures , tip 60 may comprise a spear tip or an exploding spear tip that can be detonated by impact or some other conventional trigger means . if the paddle is used for collecting debris , tip 60 could comprise some type of gathering or grasping tip or even a small net . if the technology of the present invention is used for sport fishing , tip 60 could be a detachable barbed spear tip with an attached line , the tip being detachable or releasable such that when a barbed tip penetrates a fish and is lodged therein , the tip releases or breaks away but remains tethered by a line held by the user or the paddle . in any event , tip 60 is selectively removable and interchangeable depending upon the desired use and tip configuration . the illustrative drawings of this application show a pointed spear tip , which could be used for a number of applications . fig3 depicts an angle ø or a kick - back angle between the axis of shaft 30 and the plane of blade 40 . a kick - back angle can be advantageous for paddling . as shown in fig2 , members 51 through 58 provide one embodiment of rod 50 contained within shaft 30 which can be deployed and retracted using a telescoping configuration of the paddle . as further illustrated in fig3 , and 5 , an opening on a face of paddle 40 acts a host to lower shaft 58 as rod 50 extends and retracts through the face of blade 40 . as shown in fig4 , rod 50 with tip 60 resides in a retracted position adjacent a face of blade 40 . when extended or employed , as shown in fig5 , lower shaft 58 extends outward beyond blade edge 42 allowing tip 60 to be utilized by the user . in a telescoping configuration of shaft 30 , upper shaft 58 can be extended and retracted by a corresponding mechanical movement or change in relative position of first shaft portion 35 and second shaft portion 36 when positioning means 37 permits or facilitates such movement . tip 60 may be selectively added to or removed from upper shaft 58 . the connection between tip 60 and upper shaft 58 can be by any conventional means such as a threaded connection , a bayonet connection , a friction connection , or any other customary or known structure which allows this selective attachment and detachment of tip 60 to upper shaft 58 . while the description above discloses a manual , mechanical means for deploying rod 50 housed within shaft 30 and blade 40 to an extended position and a retracted position , other embodiments are contemplated . for example , rather than having a push rod as shown in fig2 , an element of rod 50 could be attached to a compressible spring device which would allow rod 50 to be housed within shaft 30 in such a way that the spring mechanism is compressed and rod 50 is held within shaft 30 and blade 40 by an alternative positioning means 37 holding rod 50 stationary . alternative positioning means 37 would comprise a release mechanism allowing spring - loaded rod 50 to move within shaft 30 under the force of the compressed spring as the spring extends rod 50 to protrude or extend beyond paddle edge 42 . rod 50 could be retracted by exerting force on tip 60 pushing rod 50 back into blade 40 and shaft 30 again compressing the spring mechanism and again allowing alternative positioning means 37 to hold rod 50 in place within shaft 30 and blade 40 until the next occasion upon which the user desired to deploy rod 50 . another deploying means could include compressed gas which acts upon an alternative handle / shaft adapter 51 forcing movement of control rod 52 and its associated component parts to extend rod 50 out of blade 40 and beyond blade edge 42 . compressed gas canisters in various forms are commonly available and could be configured to be compatible with shaft 30 such that the user was able to control the compressed gas canister for selective deployment of rod 50 . a person of ordinary skill of the art that there may be other equivalent propulsion mechanisms whether they be manual , spring - actuated , pneumatic , electrical , hydraulic , or other cabling devices which would allow a force to be exerted upon rod 50 to cause it to be extended and which would allow rod 50 to also be retracted back within blade 40 and shaft 30 . an alternative embodiment could also include a rod 50 disposed exterior along a length of shaft 30 . one such embodiment comprises a recessed channel or groove along the length of shaft 30 . rod 50 would be disposed in the groove along shaft 30 and traverse at least a portion of blade 40 when extended and retracted by any movement of rod 50 relative to shaft 30 and blade 40 . such movement of rod 50 along shaft 30 could be accomplished by a similar telescoping shaft configuration in which exterior rod 50 is retained in fixed relation to shaft portion 36 but allowed to slide in a channel or groove along shaft part 35 , not shown in the figures . in this way , an extendable and retractable rod member along the outside of shaft 30 could be part of an alternative embodiment . | US-201615346558-A |
a surgical bone milling tool , in particular for the arthrodesis of a , preferably the first , metatarsophalangeal joint , with a rotatable milling cutter holder and at least one milling cutter for the production of a concave or convex milling contour in the bone , which is able to be fixed detachably on the milling cutter holder by a fixing element . provision is made that the fixing element comprises a detent having a spring element provided for the detachable engagement of the milling cutter on the milling cutter holder . | in the figures , identical elements and elements with identical function are marked by identical reference numbers . a first example embodiment of a surgical bone milling tool 1 is shown in fig1 a to 1 f . this comprises a milling cutter holder 2 , rotatable by means of an electric tool , which milling cutter holder has in the region of its rear , or respectively in the drawing lower end , a drive 3 for cooperating with such a tool . the milling means holder 2 carries on the side facing away from the drive 3 a milling cutter 4 , in the practical example embodiment a concave milling cutter 4 for the production of convex millings . the milling cutter 4 has four blade sections 5 a to 5 d offset by respectively 90 ° to one another , in the centre of which a centring point 6 is situated . the milling cutter 4 is secured exclusively by engaging in axial direction with the aid of fixing means 7 which are to be explained further below , or respectively is detachably secured on the milling cutter holder . as anti - twist protection , form - fitting means 8 are provided in the form of axial guides , which reliably prevent a twisting of the milling cutter 4 relative to the milling cutter holder 2 . the fixing means 7 comprise a , here single , spring element 9 constructed as a spring ring , which is held in an ( outer ) peripheral groove 10 of the milling cutter holder 2 . the spring element 9 penetrates in peripheral direction axial guides 11 for the milling cutter 4 and lies in the region of these axial guides 11 in the engaged state in detent recesses 12 on the peripheral side in the milling cutter 4 and secures the latter in axial direction . as can be seen from fig1 a to 1 f , the spring element 9 , constructed as a spring ring , is provided at a peripheral location with a slot 13 , i . e . is interrupted and thus be expanded in an elastic manner . as can be seen in particular from the sectional illustration according to fig1 b , the milling cutter 4 penetrates the spring element 9 in the engaged state in axial direction and embraces the spring element 9 partially from the interior radially by receiving the spring element 9 in the four detent recesses which are offset to one another by 90 °. in fig2 a to 2 g , the milling cutter 4 of the bone milling tool 1 according to fig1 a to 1 f is shown in detail in different views , together with the spring element 9 actually secured on the milling cutter holder 2 , which spring element is illustrated in the engaged position , i . e . received in the four detent recesses 12 of the milling cutter 4 . it can be seen that the milling cutter 4 is composed of a first and a second cutter part 14 , 15 , wherein the cutter parts 14 , 15 intersect each other . alternatively , the cutter parts 14 , 15 can be placed detachably in one another or can be permanently connected securely with one another , for example by gluing or welding . a one - piece embodiment of the milling cutter 4 is also theoretically conceivable . the cutter parts 14 , 15 have in an inner region the four blade sections 5 a to 5 d and are contoured in a straight line on their outer periphery , in the manner of plate sides . with these plate sides the cutter parts 14 , can be received in these associated axial guides 11 by axial insertion , wherein the axial guides surround the cutter parts 14 , 15 in peripheral direction , in order to thus reliably prevent a twisting of the milling cutter 4 relative to the milling cutter holder 2 . in the region of these axial guides , the milling cutter 4 is engaged i . e . at a total of four locations with the spring element 9 which is constructed as am annular spring element . an alternative bone milling tool 1 is illustrated in fig3 a to 3 f , which is constructed according to a similar principle to the bone milling tool according to fig1 a to 1 f , so that to avoid repetitions , reference is to be made to the above figures with associated description with regard to commonalities . essentially , differences are to be entered into below . it can be see that the milling cutter 4 is constructed as a convex cutter for the production of concave millings . also in the embodiment according to fig3 a to 3 f , the spring element 9 , constructed as an annular spring element , is received in a corresponding peripheral groove 10 of the milling means holder 2 and is penetrated in the engaged state in axial direction by the milling cutter 4 , which is guided in a radially inner region axially in a central axial guide 11 . in fig4 a to 4 h different illustrations of the convex milling cutter 2 are shown , which is engaged with the spring element 9 , which is received for this in two diametrically opposed detent recesses 12 on the peripheral side . the spring element 9 is penetrated axially in the engaged state by two cutter parts 14 , 15 , which can be placed detachably adjacent to one another in an analogous manner to the other example embodiment , or can be permanently connected securely with one another . in the example embodiment which is shown , only the second cutter part 15 penetrates the spring element and is received in the milling holder 2 in the above - mentioned axial guide . with the aid of fig5 to 8 the assembly process is explained by way of example by means of a bone milling tool with a concave milling cutter . firstly in fig5 the milling cutter holder 2 is to be seen with its form - fitting means 8 , constructed as axial guides 11 , for anti - twist protection of the milling cutter 4 , which is moved from above in axial direction , indicated by two parallel arrows , towards the milling cutter holder 2 , and namely such that the milling cutter , which is cruciform in the axial projection , is received on the edge side in the axial guides 11 . in fig5 it can be seen very clearly that in the example embodiment which is shown , the axial guides 11 are delimited by linear interruptions of a hollow - cylindrical peripheral wall 16 , which surround the blade sections 5 a to 5 d radially externally in the assembled state . it can be seen furthermore from fig5 that the spring element 9 , constructed as a metallic spring ring , is received in the peripheral groove 10 of the peripheral wall 11 and penetrates the axial guides 11 in peripheral direction . as can be seen from the next step according to the illustrations in accordance with fig6 a and 6 b , the milling cutter 4 is provided with a total of 4 leading chamfers 17 , which are arranged such that by axial force application of the milling cutter 4 a radial force component results onto the spring element 9 , which presses the latter in radial direction outwards during the assembly process and thereby tensions it temporarily , until the leading chamfer 17 is overcome and the spring element 9 can snap in radial direction inwards back into the detent recesses 12 in the region of the axial guides 9 . in fig7 the leading chamfer 17 is overcome , the milling cutter 4 lies axially on a contact surface 18 of the milling cutter holder 2 and the spring element 9 lies , preferably tightly in a tensioned manner , in any case less tensioned than during the assembly process or respectively during the abutting of the spring element 9 , against the leading chamfers 17 in the detent recesses 12 . in other words , the milling cutter 4 engages with a lower wall of the detent recess 12 under the spring element 9 , whereby the milling cutter 4 is secured against axial lifting from the milling cutter holder 2 . fig8 shows in part the assembled bone milling tool 1 with the milling cutter 4 , which is secured against rotation in peripheral direction in the axial guides 11 of the peripheral wall 16 and is secured by the spring element 9 in axial direction . by means of fig9 to 16 , a preferred releasing process with the aid of a system , comprising a bone milling tool 1 and a releasing tool 19 , is now described . a lateral mount 20 , contoured in the form of an annular ring in cross section , can be seen in the peripheral wall 16 of the milling cutter holder 2 , into which the releasing tool 19 is able to be introduced in the illustrated arrow direction . the releasing tool 19 can therefore be guided beneath the milling cutter 4 . the releasing tool 19 is introduced up to the stop , wherein the introducing process can be seen in more detail in fig1 . from the sectional view according to fig1 and the side view according to fig1 , it can be seen that the introduction section 22 of the releasing tool 12 is constructed so as to be flattened , so that an upper side 21 is initially spaced apart axially from an underside of the milling cutter 4 which is projecting axially into the mount 20 ( mount channel ). from the side view , it can be readily seen that the introduction section 22 has in cross - section the shape of a truncated cylinder , wherein the lower solid material section provides for a congruent mounting and guidance on the inner periphery of the mount 22 . as can be seen from fig1 and 14 , the releasing tool 19 , by twisting about its longitudinal extent axis , comes in contact with the milling cutter 4 and acts upon the latter in axial direction upwards , whereby owing to the curvature of the detent recess 12 a radial force component results onto the spring element 9 , acts upon the latter again temporarily with force in radial direction outwards during the releasing process and is tensioned and thus the milling cutter 4 comes free from the engagement , as is shown in fig1 . there , the spring element is in the relaxed or respectively more relaxed state again and the free milling cutter 4 can be removed axially as shown in fig1 . different parts and embodiments of convex milling cutters 4 are illustrated in fig1 to 22 . here , fig1 and 19 show a lower second cutter part 15 , and fig1 and 20 show the upper ( first ) cutter part 14 matching it . the first cutter part 14 has a lower cut - out 24 in the width of the second cutter part 15 . a corresponding cut - out 25 , opposed to the cut - out 24 , in the width of the first cutter part 14 is provided in the cutter part 15 , so that the cutter parts 14 , 15 , as shown in fig2 and their cut - outs 24 , 25 are able to be inserted into one another and therefore describe a convex covering contour . as already mentioned several times , the cutter parts 14 , 15 can be constructed so as to be able to be inserted into one another or onto one another detachably , for example secured by gluing or welding or produced in a single piece . in the example embodiment which is shown , the second cutter part 15 according to fig1 is constructed asymmetrically with regard to its blade sections , whereas the first cutter part according to fig1 is configured symmetrically . embodiments are also able to be realized in which both cutter parts are constructed symmetrically or both cutter parts are constructed asymmetrically . fig2 shows a milling cutter 4 , which is composed of an asymmetrical second and a symmetrical first cutter part . in an analogous manner , fig2 to 28 show different components or respectively embodiments of a concave cutter part 4 , wherein fig2 and 25 show a second cutter part and fig2 shows an associated first cutter part 14 , which are able to be placed together intersecting one another in the manner as the cutter part according to fig1 to 22 . the cutter part according to fig2 is constructed asymmetrically with regard to its two blade sections , whereas the first cutter part 14 according to fig2 is configured symmetrically . fig2 shows a milling cutter 4 composed from these two cutter parts 14 , 15 . all milling cutters according to fig1 to 28 have a serration . | US-201313747982-A |
disclosed and claimed are cocoa extracts such as polyphenols or procyanidins , methods for preparing such extracts , as well as uses for them , especially as antineoplastic agents and antioxidants . disclosed and claimed are antineoplastic compositions containing cocoa polyphenols or procyanidins and methods for treating patients employing the compositions . additionally disclosed and claimed is a kit for treating a patient in need of treatment with an antineoplastic agent containing cocoa polyphenols or procyanidins as well as a lyophilized antineoplastic composition containing cocoa polyphenols or procyanidins . further , disclosed and claimed is the use of the invention in antioxidant , preservative and topiosomerase - inhibiting compositions and methods . | as discussed above , it has now been surprisingly found that cocoa extracts exhibit anti - cancer , anti - tumor or antineoplastic activity , antioxidant activity and , inhibit dna topoisomerase ii enzyme . the extracts are generally prepared by reducing cocoa beans to a powder , defatting the powder , and extracting the active compound ( s ) from the defatted powder . the powder can be prepared by freeze - drying the cocoa beans and pulp , depulping the cocoa beans and pulp , dehulling the freeze - dried cocoa beans , and grinding the dehulled beans . the extraction of active compound ( s ) can be by solvent extraction techniques . the extracts can be purified ; for instance , by gel permeation chromatography or by preparative high performance liquid chromatography ( hplc ) techniques or by a combination of such techniques . the extracts having activity , without wishing to necessarily be bound by any particular theory , have been identified as cocoa polyphenol ( s ) such as procyanidins . these cocoa procyanidins have significant anti - cancer , anti - tumor or antineoplastic activity ; antioxidant activity ; and inhibit dna topoisomerase ii enzyme . anti - cancer , anti - tumor or antineoplastic or , antioxidant or dna topoisomerase ii enzyme inhibiting compositions containing the inventive cocoa polyphenols or procyanidins can be prepared in accordance with standard techniques well known to those skilled in the pharmaceutical art . such compositions can be administered to a patient in need of such administration in dosages and by techniques well known to those skilled in the medical arts taking into consideration such factors as the age , sex , weight , and condition of the particular patient , and the route of administration . the compositions can be co - administered or sequentially administered with other antineoplastic , anti - tumor or anti - cancer agents or antioxidant or dna topoisomerase ii enzyme inhibiting agents and / or with agents which reduce or alleviate ill effects of antineoplastic , anti - tumor or anti - cancer agents or antioxidant or dna topoisomerase ii enzyme inhibiting agents ; again , taking into consideration such factors as the age , sex , weight , and condition of the particular patient , and , the route of administration . examples of compositions of the invention include solid compositions for oral administration such as capsules , tablets , pills and the like , as well as chewable solid formulations , to which the present invention may be well - suited since it is from an edible source ( e . g ., cocoa or chocolate flavored solid compositions ); liquid preparations for orifice , e . g ., oral , nasal , anal , vaginal etc ., administration such as suspensions , syrups or elixirs ; and , preparations for parental , subcutaneous , intradermal , intramuscular or intravenous administration ( e . g ., injectable administration ) such as sterile suspensions or emulsions . however , the active ingredient in the compositions may complex with proteins such that when administered into the bloodstream , clotting may occur due to precipitation of blood proteins ; and , the skilled artisan should take this into account . in such compositions the active cocoa extract may be in admixture with a suitable carrier , diluent , or excipient such as sterile water , physiological saline , glucose or the like . the active cocoa extract of the invention can be provided in lyophilized form for reconstituting , for instance , in isotonic aqueous , saline buffer . further , the invention also comprehends a kit wherein the active cocoa extract is provided . the kit can include a separate container containing a suitable carrier , diluent or excipient . the kit can also include an additional anti - cancer , anti - tumor or antineoplastic agent or antioxidant or dna topoisomerase ii enzyme inhibiting agent and / or an agent which reduces or alleviates ill effects of antineoplastic , anti - tumor or anti - cancer agents or antioxidant or dna topoisomerase ii enzyme inhibiting agents for co - or sequential - administration . the additional agent ( s ) can be provided in separate container ( s ) or in admixture with the active cocoa extract . additionally , the kit can include instructions for mixing or combining ingredients and / or administration . furthermore , while the invention is described with respect to cocoa extracts preferably comprising cocoa procyanidins , from this disclosure the skilled organic chemist will appreciate and envision synthetic routes to obtain the active compounds . accordingly , the invention comprehends synthetic cocoa polyphenols or procyanidins or their derivatives which include , but are not limited to glycosides , gallates , esters , etc . and the like . the following non - limiting examples are given by way of illustration only and are not to be considered a limitation of this invention , many apparent variations of which are possible without departing from the spirit or scope thereof . several theobroma cacao genotypes which represent the three recognized horticultural races of cocoa ( enriquez , 1967 ; engels , 1981 ) were obtained from the three major cocoa producing origins of the world . a list of those genotypes used in this study are shown in table 1 . harvested cocoa pods were opened and the beans with pulp were removed for freeze drying . the pulp was manually removed from the freeze dried mass and the beans were subjected to analysis as follows . the unfermented , freeze dried cocoa beans were first manually dehulled , and ground to a fine powdery mass with a tekmar mill . the resultant mass was then defatted overnight by soxhlet extraction using redistilled hexane as the solvent . residual solvent was removed from the defatted mass by vacuum at ambient temperature . procyanidins were extracted from the defatted , unfermented , freeze dried cocoa beans of example 1 using a modification of the method described by jalal and collin ( 1977 ). procyanidins were extracted from 50 gram batches of the defatted cocoa mass with 2 × 400 ml 70 % acetone / deionized water followed by 400 ml 70 % methanol / deionized water . the extracts were pooled and the solvents removed by evaporation at 45 ° c . with a rotary evaporator held under partial vacuum . the resultant aqueous phase was diluted to 1l with deionized water and extracted 2 × with 400 ml chcl 3 . the solvent phase was discarded . the aqueous phase was then extracted 4 × with 500 ml ethyl acetate . any resultant emulsions were broken by centrifugation on a sorvall rc 28s centrifuge operated at 2 , 000 xg for 30 min . at 10 ° c . to the combined ethyl acetate extracts , 100 - 200 ml deionized water was added . the solvent was removed by evaporation at 45 ° c . with a rotary evaporator held under partial vacuum . the resultant aqueous phase was frozen in liquid n 2 followed by freeze drying on a labconco freeze dry system . the yields of crude procyanidins that were obtained from the different cocoa genotypes are listed in table 2 . alternatively , procyanidins are extracted from defatted , unfermented , freeze dried cocoa beans of example 1 with 70 % aqueous acetone . ten grams of defatted material was slurried with 100 ml solvent for 5 - 10 min . the slurry was centrifuged for 15 min . at 4 ° c . at 3000 xg and the supernatant passed through glass wool . the filtrate was subjected to distillation under partial vacuum and the resultant aqueous phase frozen in liquid h 2 , followed by freeze drying on a labconco freeze dry system . the yields of crude procyanidins ranged from 15 - 20 %. without wishing to be bound by any particular theory , it is believed that the differences in crude yields reflected variations encountered with different genotypes , geographical origin , horticultural race , and method of preparation . procyanidins obtained from example 2 were partially purified by liquid chromatography on sephadex lh - 20 ( 28 × 2 . 5 cm ). separations were aided by a step gradient into deionized water . the initial gradient composition started with 15 % methanol in deionized water which was followed step wise every 30 min . with 25 % methanol in deionized water , 35 % methanol in deionized water , 70 % methanol in deionized water , and finally 100 % methanol . the effluent following the elution of the xanthine alkaloids ( caffeine and theobromine ) was collected as a single fraction . the fraction yielded a xanthine alkaloid free subfraction which was submitted to further subfractionation to yield five subfractions designated mm2a through mm2e . the solvent was removed from each subfraction by evaporation at 45 ° c . with a rotary evaporator held under partial vacuum . the resultant aqueous phase was frozen in liquid n 2 and freeze dried overnight on a labconco freeze dry system . a representative gel permeation chromatogram showing the fractionation is shown in fig1 . approximately , 100 mg of material was subfractionated in this manner . fig1 : gel permeation chromatogram of crude procyanidins on sephadex lh - 20 chromatographic conditions : column ; 28 × 2 . 5 cm sephadex lh - 20 , mobile phase : methanol / water step gradient , 15 : 85 , 25 : 75 , 35 : 65 , 70 : 30 , 100 : 0 stepped at 112 hour intervals , flow rate ; 1 . 5 ml / min , detector ; uv @ λ 1 = 254 nm and λ 2 = 365 nm , chart speed : 0 . 5 mm / min , column load ; 120 mg . procyanidins obtained from example 2 and / or 3a were partially purified by semi - preparative hplc . a hewlett packard 1050 hplc system equipped with a variable wavelength detector , rheodyne 7010 injection valve with 1 ml injection loop was assembled with a pharmacia frac - 100 fraction collector . separations were effected on a phenomenex ultracarb 10μ ods column ( 250 × 22 . 5 mm ) connected with a phenomenex 10 μ ods ultracarb ( 60 × 10 mm ) guard column . the mobile phase composition was a = water ; b methanol used under the following linear gradient conditions : [ time , % a ]; ( 0 , 85 ), ( 60 , 50 ), ( 90 , 0 ), and ( 100 , 0 ) at a flow rate of 5 ml / min . a representative semi - preparative hplc trace is shown in fig1 n for the separation of procyanidins present in fraction d + e . individual peaks or select chromatographic regions were collected on timed intervals or manually by fraction collection for further purification and subsequent evaluation . injection loads ranged from 25 - 100 mg of material . procyanidin extracts obtained from examples 2 and / or 3a were partially purified by semi - preparative hplc . a hewlett packard 1050 hplc system , millipore - waters model 480 lc detector set at 254 nm was assembled with a pharmacia frac - 100 fraction collector set in peak mode . separations were effected on a supelco 5μ supelcosil lc - si column ( 250 × 10 mm ) connected with a supelco 5μ supelguard lc - si guard column ( 20 × 4 . 6 mm ). procyanidins were eluted by a linear gradient under the following conditions : ( time , % a , % b ); ( 0 , 82 , 14 ), ( 30 , 67 . 6 , 28 . 4 ), ( 60 , 46 , 50 ), ( 65 , 10 , 86 ), ( 70 , 10 , 86 ) followed by a 10 min . re - equilibration . mobile phase composition was a = dichloromethane ; b = methanol ; and c = acetic acid : water ( 1 : 1 ). a flow rate of 3 ml / min was used . components were detected by uv at 254 nm , and recorded on a kipp & amp ; zonan bd41 recorder . injection volumes ranged from 100 - 250 μl of 10 mg of procyanidin extracts dissolved in 0 . 25 ml 70 % aqueous acetone . a representative semi - preparative hplc trace is shown in fig1 o . individual peaks or select chromatographic regions were collected on timed intervals or manually by fraction collection for further purification and subsequent evaluation . procyanidin extracts obtained from example 3 were filtered through a 0 . 45μ filter and analyzed by a hewlett packard 1090 ternary hplc system equipped with a diode array detector and a hp model 1046a programmable fluorescence detector . separations were effected at 45 ° c . on a hewlett - packard 5μ hypersil ods column ( 200 × 2 . 1 mm ). the flavanols and procyanidins were eluted with a linear gradient of 60 % b into a followed by a column wash with b at a flow rate of 0 . 3 ml / min . the mobile phase composition was b = 0 . 5 % acetic acid in methanol and a = 0 . 5 % acetic acid in deionized water . acetic acid levels in a and b mobile phases can be increased to 2 %. components were detected by fluorescence , where λ ex = 276 nm and λ em = 316 nm . concentrations of (+)- catechin and (−)- epicatechin were determined relative to reference standard solutions . procyanidin levels were estimated by using the response factor for (−)- epicatechin . a representative hplc chromatogram showing the separation of the various components is shown in fig2 a for one cocoa genotype . similar hplc profiles were obtained from the other cocoa genotypes . procyanidin extracts obtained from examples 2 and / or 3 were filtered through a 0 . 45 μ filter and analyzed by a hewlett packard 1090 series ii hplc system equipped with a hp model 1046a programmable fluorescence detector and diode array detector . separations were effected at 37 ° c . on a 5μ phenomenex lichrosphere silica 100 column ( 250 × 3 . 2 mm ) connected to a supelco supelguard lc - si 5μ guard column ( 20 × 4 . 6 mm ). procyanidins were eluted by linear gradient under the following conditions : ( time , % a , % b ); ( 0 , 82 , 14 ), ( 30 , 67 . 6 , 28 . 4 ), ( 60 , 46 , 50 ), ( 65 , 10 , 86 ), ( 70 , 10 , 86 ) followed by an 8 min . re - equilibration . mobile phase composition was a = dichloromethane , b = methanol , and c = acetic acid : water at a volume ratio of 1 : 1 . a flow rate of 0 . 5 ml / min . was used . components were detected by fluorescence , where λ ex = 276 nm and λ em = 316 nm or by uv at 280 nm . a representative hplc chromatogram showing the separation of the various procyanidins is shown in fig2 b for one genotype . similar hplc profiles were obtained from other cocoa genotypes . procyanidins were purified by liquid chromatography on sephadex lh - 20 ( 28 × 2 . 5 cm ) columns followed by semi - preparative hplc using a 10μ μbondapak c18 ( 100 × 8 mm ) column or by semi - preparative hplc using a 5μ supelcosil lc - si ( 25 × 10 mm ) column . partially purified isolates were analyzed by fast atom bombardment — mass spectrometry ( fab - ms ) on a vg zab - t high resolution ms system using a liquid secondary ion mass spectrometry ( lsims ) technique in positive and negative ion modes . a cesium ion gun was used as the ionizing source at 30 kv and a “ magic bullet matrix ” ( 1 : 1 dithiothreitol / dithioerythritol ) was used as the proton donor . analytical investigations of these fractions by lsims revealed the presence of a number of flavan - 3 - ol oligomers as shown in table 3 . the major mass fragment ions were consistent with work previously reported for both positive and negative ion fab - ms analysis of procyanidins ( self et al ., 1986 and porter et al ., 1991 ). the ion corresponding to m / z 577 ( m + h ) + and its sodium adduct at m / z 599 ( m + na ) + suggested the presence of doubly linked procyanidin dimers in the isolates . it was interesting to note that the higher oligomers were more likely to form sodium adducts ( m + na ) + than their protonated molecular ions ( m + h ) + . the procyanidin isomers b - 2 , b - 5 and c - 1 were tentatively identified based on the work reported by revilla et al . ( 1991 ), self et al . ( 1986 ) and porter et al . ( 1991 ). procyanidins up to both the octamer and decamer were verified by fab - ms in the partially purified fractions . additionally , evidence for procyanidins up to the dodecamer were observed from normal phase hplc analysis ( see fig2 b ). without wishing to be bound by any particular theory , it is believed that the dodecamer is the limit of solubility in the solvents used in the extraction and purification schemes . table 4 lists the relative concentrations of the procyanidins found in xanthine alkaloid free isolates based on reverse phase hplc analysis . table 5 lists the relative concentrations of the procyanidins based on normal phase hplc analysis . fig3 shows several procyanidin structures and fig4 a - 4e show the representative hplc chromatograms of the five fractions employed in the following screening for anti - cancer or antineoplastic activity . the hplc conditions for fig4 a - 4e were as follows : hplc conditions : hewlett packard 1090 ternary hplc system equipped with hp model 1046a programmable fluorescence detector . column : hewlett packard 5μ hypersil ods ( 200 × 2 . 1 mm ) linear gradient of 60 % b into a at a flow rate of 0 . 3 ml / min . b = 0 . 5 % acetic acid in methanol ; a = 0 . 5 % acetic acid in deionized water . λ ex = 280 nm ; λ em = 316 nm . fig1 o shows a representative semi - prep hplc chromatogram of an additional 12 fractions employed in the screening for anticancer or antineoplastic activity ( hplc conditions stated above ). the mtt ( 3 -[ 4 , 5 - dimethyl thiazol - 2yl ]- 2 , 5 - diphenyltetrazolium bromide )— microtiter plate tetrazolium cytotoxicity assay originally developed by mosmann ( 1983 ) was used to screen test samples from example 5 . test samples , standards ( cisplatin and chlorambucil ) and mtt reagent were dissolved in 100 % dmso ( dimethyl sulfoxide ) at a 10 mg / ml concentration . serial dilutions were prepared from the stock solutions . in the case of the test samples , dilutions ranging from 0 . 01 through 100 μg / ml were prepared in 0 . 5 % dmso . all human tumor cell lines were obtained from the american type culture collection . cells were grown as mono layers in alpha - mem containing 10 % fetal bovine serum , 100 units / ml penicillin , 100 μg / ml streptomycin and 240 units / ml nystatin . the cells were maintained in a humidified , 5 % co 2 atmosphere at 37 ° c . after trypsinization , the cells are counted and adjusted to a concentration of 50 × 10 5 cells / ml ( varied according to cancer cell line ). 200 μl of the cell suspension was plated into wells of 4 rows of a 96 - well microtiter plate . after the cells were allowed to attach for four hours , 2 μl of dmso containing test sample solutions were added to quadruplicate wells . initial dose - response finding experiments , using order of magnitude test sample dilutions were used to determine the range of doses to be examined . well absorbencies at 540 nm were then measured on a bio rad mp450 plate reader . the mean absorbance of quadruplicate test sample treated wells was compared to the control , and the results expressed as the percentage of control absorbance plus / minus the standard deviation . the reduction of mtt to a purple formazan product correlates in a linear manner with the number of living cells in the well . thus , by measuring the absorbance of the reduction product , a quantitation of the percent of cell survival at a given dose of test sample can be obtained . control wells contained a final concentration of 1 % dmso . two of the samples were first tested by this protocol . sample mm1 represented a very crude isolate of cocoa procyanidins and contained appreciable quantities of caffeine and theobromine . sample mm2 represented a cocoa procyanidin isolate partially purified by gel permeation chromatography . caffeine and theobromine were absent in mm2 . both samples were screened for activity against the following cancer cell lines using the procedures previously described : little or no activity was observed with mm1 on any of the cancer cell lines investigated . mm2 was found to have activity against hct - 116 , pc - 3 and achn cancer cell lines . however , both mm1 and mm2 were found to interfere with mtt such that it obscured the decrease in absorbance that would have reflected a decrease in viable cell number . this interference also contributed to large error bars , because the chemical reaction appeared to go more quickly in the wells along the perimeter of the plate . a typical example of these effects is shown in fig5 . at the high concentrations of test material , one would have expected to observe a large decrease in survivors rather than the high survivor levels shown . nevertheless , microscopic examinations revealed that cytotoxic effects occurred , despite the mtt interference effects . for instance , an icso value of 0 . 5 μg / ml for the effect of mm2 on the achn cell line was obtained in this manner . these preliminary results , in the inventors &# 39 ; view , required amendment of the assay procedures to preclude the interference with mtt . this was accomplished as follows . after incubation of the plates at 37 ° c . in a humidified , 5 % co 2 atmosphere for 18 hours , the medium was carefully aspirated and replaced with fresh alpha - mem media . this media was again aspirated from the wells on the third day of the assay and replaced with 100 μl of freshly prepared mccoy &# 39 ; s medium . 11 μl of a 5 mg / ml stock solution of mtt in pbs ( phosphate buffered saline ) were then added to the wells of each plate . after incubation for 4 hours in a humidified , 5 % co 2 atmosphere at 37 ° c ., 100 μl of 0 . 04 n hcl in isopropanol was added to all wells of the plate , followed by thorough mixing to solubilize the formazan produced by any viable cells . additionally , it was decided to subfractionate the procyanidins to determine the specific components responsible for activity . the subfractionation procedures previously described were used to prepare samples for further screening . five fractions representing the areas shown in fig1 and component ( s ) distribution shown in fig4 a - 4e were prepared . the samples were coded mm2a through mm2e to reflect these analytical characterizations and to designate the absence of caffeine and theobromine . each fraction was individually screened against the hct - 116 , pc - 3 and achn cancer cell lines . the results indicated that the activity did not concentrate to any one specific fraction . this type of result was not considered unusual , since the components in “ active ” natural product isolates can behave synergistically . in the case of the cocoa procyanidin isolate ( mm2 ), over twenty detectable components comprised the isolate . it was considered possible that the activity was related to a combination of components present in the different fractions , rather than the activity being related to an individual component ( s ). on the basis of these results , it was decided to combine the fractions and repeat the assays against the same cancer cell lines . several fraction combinations produced cytotoxic effects against the pc - 3 cancer cell lines . specifically , ic 50 values of 40 μg / ml each for mm2a and mm2e combination , and of 20 μg / ml each for mm2c and mm2e combination , were obtained . activity was also reported against the hct - 116 and achn cell lines , but as before , interference with the mtt indicator precluded precise observations . replicate experiments were repeatedly performed on the hct - 116 and achn lines to improve the data . however , these results were inconclusive due to bacterial contamination and exhaustion of the test sample material . fig6 a - 6d show the dose - response relationship between combinations of the cocoa extracts and pc - 3 cancer cells . nonetheless , from this data , it is clear that cocoa extracts , especially cocoa polyphenols or procyanidins , have significant anti - tumor ; anti - cancer or antineoplastic activity , especially with respect to human pc - 3 ( prostate ), hct - 116 ( colon ) and achn ( renal ) cancer cell lines . in addition , those results suggest that specific procyanidin fractions may be responsible for the activity against the pc - 3 cell line . to confirm the above findings and further study fraction combinations , another comprehensive screening was performed . all prepared materials and procedures were identical to those reported above , except that the standard 4 - replicates per test dose was increased to 8 or 12 - replicates per test dose . for this study , individual and combinations of five cocoa procyanidin fractions were screened against the following cancer cell lines . individual screenings consisted of assaying different dose levels ( 0 . 01 - 100 μg / ml ) of fractions a , b , c , d , and e ( see fig4 a - 4e and discussion thereof , supra ) against each cell line . combination screenings consisted of combining equal dose levels of fractions a + b , a + c , a + d , a + e , b + c , b + d , b + e , c + d , c + e , and d + e against each cell line . the results from these assays are individually discussed , followed by an overall summary . fig7 a - 7h show the typical dose response relationship between cocoa procyanidin fractions and the pc - 3 cell line . fig7 d and 7e demonstrate that fractions d and e were active at an ic 50 value of 75 μg / ml . the ic 50 values that were obtained from dose - response curves of the other procyanidin fraction combinations ranged between 60 - 80 μg / ml when fractions d or e were present . the individual ic 50 values are listed in table 6 . fig8 a - 8h show the typical dose response relationship between cocoa procyanidin fractions and the kb nasopharyngeal / hela cell line . fig8 d and 8e demonstrate that fractions d and e were active at an ic 50 value of 75 μg / ml . fig8 f - 8h depict representative results obtained from the fraction combination study . in this case , procyanidin fraction combination a + b had no effect , whereas fraction combinations b + e and d + e were active at an ic 50 value of 60 μg / ml . the ic 50 values that were obtained from other dose response curves from other fraction combinations ranged from 60 - 80 μg / ml when fractions d or e were present . the individual ic 50 values are listed in table 6 . these results were essentially the same as those obtained against the pc - 3 cell line . fig9 a - 9h show the typical dose response relationships between cocoa procyanidin fractions and the hct - 116 colon cell line . fig9 d and 9e demonstrate that fraction e was active at an ic 50 value of approximately 400 μg / ml . this value was obtained by extrapolation of the existing curve . note that the slope of the dose response curve for fraction d also indicated activity . however , no ic 50 value was determined from this plot , since the slope of the curve was too shallow to obtain a reliable value . fig9 f - 9h depict representative results obtained from the fraction combination study . in this case , procyanidin fraction combination b + d did not show appreciable activity , whereas fraction combinations a + e and d + e were active at icso values of 500 μg / ml and 85 μg / ml , respectively . the ic 50 values that were obtained from dose response curves of other fraction combinations averaged about 250 μg / ml when fraction e was present . the extrapolated ic 50 values are listed in table 6 . fig1 a - 10h show the typical dose response relationships between cocoa procyanidin fractions and the achn renal cell line . fig1 a - 10e indicated that no individual fraction was active against this cell line . fig1 f - 10h depict representative results obtained from the fraction combination study . in this case , procyanidin fraction combination b + c was inactive , whereas the fraction combination a + e resulted in an extrapolated ic 50 value of approximately 500 μg / ml . dose response curves similar to the c + d combination were considered inactive , since their slopes were too shallow . extrapolated ic 50 values for other fraction combinations are listed in table 6 . fig1 a - 11h show the typical dose response relationships between cocoa procyanidin fractions and the a - 549 lung cell line . no activity could be detected from any individual fraction or combination of fractions at the doses used in the assay . however , procyanidin fractions may nonetheless have utility with respect to this cell line . fig1 a - 12h show the typical dose response relationships between cocoa procyanidin fractions and the sk - 5 melanoma cell line . no activity could be detected from any individual fraction or combination of fractions at the doses used in the assay . however , procyanidin fractions may nonetheless have utility with respect to this cell line . fig1 a - 13h show the typical dose response relationships between cocoa procyanidin fractions and the mcf - 7 breast cell line . no activity could be detected from any individual fraction or combination of fractions at the doses used in the assay . however , procyanidin fractions may nonetheless have utility with respect to this cell line . atypical dose response curves were originally obtained against the ccrf - cem t - cell leukemia line . however , microscopic counts of cell number versus time at different fraction concentrations indicated that 500 μg of fractions a , b and d effected an 80 % growth reduction over a four day period . a representative dose response relationship is shown in fig1 . the ic 50 values obtained from these assays are collectively listed in table 6 for all the cell lines except for ccrf - cem t - cell leukemia . the t - cell leukemia data was intentionally omitted from the table , since a different assay procedure was used . a general summary of these results indicated that the most activity was associated with fractions d and e . these fractions were most active against the pc - 3 ( prostate ) and kb ( nasopharyngeal / hela ) cell lines . these fractions also evidenced activity against the hct - 116 ( colon ) and achn ( renal ) cell lines , albeit but only at much higher doses . no activity was detected against the mcf - 7 ( breast ), sk - 5 ( melanoma ) and a - 549 ( lung ) cell lines . however , procyanidin fractions may nonetheless have utility with respect to these cell lines . activity was also shown against the ccrf - cem ( t - cell leukemia ) cell line . it should also be noted that fractions d and e are the most complex compositionally . nonetheless , from this data it is clear that cocoa extracts , especially cocoa procyanidins , have significant anti - tumor , anti - cancer or antineoplastic activity . all human tumor cell lines were obtained from the american type culture collection . cells were grown as monolayers in imem containing 10 % fetal bovine serum without antibiotics . the cells were maintained in a humidified , 5 % co 2 atmosphere at 37 ° c . after trypsinization , the cells were counted and adjusted to a concentration of 1 , 000 - 2 , 000 cells per 100 μl . cell proliferation was determined by plating the cells ( 1 , 000 - 2 , 000 cells / well ) in a 96 well microtiter plate . after addition of 100 μl cells per well , the cells were allowed to attach for 24 hours . at the end of the 24 hour period , various cocoa fractions were added at different concentrations to obtain dose response results . the cocoa fractions were dissolved in media at a 2 fold concentration and 100 μl of each solution was added in triplicate wells . on consecutive days , the plates were stained with 50 μl crystal violet ( 2 . 5 g crystal violet dissolved in 125 ml methanol , 375 ml water ), for 15 min . the stain was removed and the plate was gently immersed into cold water to remove excess stain . the washings were repeated two more times , and the plates allowed to dry . the remaining stain was solubilized by adding 100 μl of 0 . 1 m sodium citrate / 50 % ethanol to each well . after solubilization , the number of cells were quantitated on an elisa plate reader at 540 nm ( reference filter at 410 nm ). the results from the elisa reader were graphed with absorbance on the y - axis and days growth on the x - axis . cells were cloned in soft agar according to the method described by nawata et al . ( 1981 ). single cell suspensions were made in media containing 0 . 8 % agar with various concentrations of cocoa fractions . the suspensions were aliquoted into 35 mm dishes coated with media containing 1 . 0 % agar . after 10 days incubation , the number of colonies greater than 60 μm in diameter were determined on an ominicron 3600 image analysis system . the results were plotted with number of colonies on the y - axis and the concentrations of a cocoa fraction on the x - axis . the xtt assay procedure described by scudiero et al . ( 1988 ) was used to screen various cocoa fractions . the xtt assay - was essentially the same as that described using the mtt procedure ( example 6 ) except for the following modifications . xtt (( 2 , 3 - bis ( 2 - methoxy - 4 - nitro - 5 - sulfophenyl )- 5 -[( phenylamino ) carbonyl ]- 2h - tetrazolium hydroxide ) was prepared at 1 mg / ml medium without serum , prewarmed to 37 ° c . pms was prepared at 5 mm pbs . xtt and pms were mixed together ; 10 μl of pms per ml xtt and 50 μl pms - xtt were added to each well . after an incubation at 37 ° c . for 4 hr , the plates were mixed 30 min . on a mechanical shaker and the absorbance measured at 450 - 600 nm . the results were plotted with the absorbance on the y - axis and days growth or concentration on the x - axis . for methods a and c , the results were also plotted as the percent control as the y - axis and days growth or concentration on the x - axis . a comparison of the xtt and crystal violet assay procedures was made with cocoa fraction d & amp ; e ( example 3b ) against the breast cancer cell line hcf - 7 pl68 to determine which assay was most sensitive . as shown in fig1 a , both assays showed the same dose - response effects for concentrations & gt ; 75 μg / ml . at concentrations below this value , the crystal violet assay showed higher standard deviations than the xtt assay results . however , since the crystal violet assay was easier to use , all subsequent assays , unless otherwise specified , were performed by this procedure . crystal violet assay results are presented ( fig1 b - 15e ) to demonstrate the effect of a crude polyphenol extract ( example 2 ) on the breast cancer cell line mda mb231 , prostate cancer cell line pc - 3 , breast cancer cell line mcf - 7 p163 , and cervical cancer cell line hela , respectively . in all cases a dose of 250 μg / ml completely inhibited all cancer cell growth over a period of 5 - 7 days . the hela cell line appeared to be more sensitive to the extract , since a 10 μg / ml dose also inhibited growth . cocoa fractions from example 3b were also assayed against hela and another breast cancer cell line skbr - 3 . the results ( fig1 f and 15g ) showed that fraction d & amp ; e has the highest activity . as shown in fig1 h and 15i , ic 50 values of about 40 μg / ml d & amp ; e were obtained from both cancer cell lines . the cocoa fraction d & amp ; e was also tested in the soft agar cloning assay which determines the ability of a test compound ( s ) to inhibit anchorage independent growth . as shown in fig1 j , a concentration of 100 μg / ml completely inhibited colony formation of hela cells . crude polyphenol extracts obtained from eight different cocoa genotypes representing the three horticultural races of cocoa were also assayed against the hela cell line . as shown in fig1 k all cocoa varieties showed similar dose - response effects . the uit - 1 variety exhibited the most activity against the hela cell line . these results demonstrated that all cocoa genotypes possess a polyphenol fraction that elicits activity against at least one human cancer cell line that is independent of geographical origin , horticultural race , and genotype . another series of assays were performed on crude polyphenol extracts prepared on a daily basis from a one ton scale traditional 5 - day fermentation of brazilian cocoa beans , followed by a 4 - day sun drying stage . the results shown in fig1 l showed no obvious effect of these early processing stages , suggesting little change in the composition of the polyphenols . however , it is known ( lehrian and patterson , 1983 ) that polyphenol oxidase ( ppo ) will oxidize polyphenols during the fermentation stage . to de termine what effect enzymically oxidized polyphenols would have on activity , another experiment was performed . crude ppo was prepared by extracting finely ground , unfermented , freeze dried , defatted brazilian cocoa beans with acetone at a ratio of 1 gm powder to 10 ml acetone . the slurry was centrifuged at 3 , 000 rpm for 15 min . this was repeated three times , discarding the supernatant each time with the fourth extraction being poured through a buchner filtering funnel . the acetone powder was allowed to air dry , followed by assay according to the procedures described by mclord and kilara , ( 1983 ). to a solution of crude polyphenols ( 100 mg / 10 ml citrate - phosphate buffer , 0 . 02m , ph 5 . 5 ) 100 mg of acetone powder ( 4 , 000 μ / mg protein ) was added and allowed to stir for 30 min . with a stream of air bubbled through the slurry . the sample was centrifuged at 5 , 000 xg for 15 min . and the supernatant extracted 3 × with 20 ml ethyl acetate . the ethyl acetate extracts were combined , taken to dryness by distillation under partial vacuum and 5 ml water added , followed by lyophilization . the material was then assayed against hela cells and the dose - response compared to crude polyphenol extracts that were not enzymically treated . the results ( fig1 m ) showed a significant shift in the dose - response curve for the enzymically oxidized extract , showing that the oxidized products were more inhibitory than their native forms . evidence in the literature suggests a relationship between the consumption of naturally occurring antioxidants ( vitamins c , e and b - carotene ) and a lowered incidence of disease , including cancer ( designing foods , 1993 ; caragay , 1992 ). it is generally thought that these antioxidants affect certain oxidative and free radical processes involved with some types of tumor promotion . additionally , some plant polyphenolic compounds that have been shown to be anticarcinogenic , also possess substantial antioxidant activity ( ho et al ., 1992 ; huang et al ., 1992 ). to determine whether cocoa extracts containing procyanidins possessed antioxidant properties , a standard rancimat method was employed . the procedures described in examples 1 , 2 , and 3 were used to prepare cocoa extracts which were manipulated further to produce two fractions from gel permeation chromatography . these two fractions are actually combined fractions a through c , and d and e ( see fig1 ) whose antioxidant properties were compared against the synthetic antioxidants bha and bht . peanut oil was pressed from unroasted peanuts after the skins were removed . each test compound was spiked into the oil at two levels , − 100 ppm and − 20 ppm , with the actual levels given in table 7 . 50 μl of methanol solubilized antioxidant was added to each sample to aid in dispersion of the antioxidant . a control sample was prepared with 50 μl of methanol containing no antioxidant . the samples were evaluated in duplicate , for oxidative stability using the rancimat stability test at 100 ° c . and 20 cc / min of air . experimental parameters were chosen to match those used with the active oxygen method ( aom ) or swift stability test ( van oosten et al ., 1981 ). a typical rancimat trace is shown in fig1 . results are reported in table 8 as hours required to reach a peroxide level of 100 meq . these results demonstrated increased oxidative stability of peanut oil with all of the additives tested . the highest increase in oxidative stability was realized by the sample spiked with the crude ethyl acetate extract of cocoa . these results demonstrated that cocoa extracts containing procyanidins have antioxidant potential equal to or greater than equal amounts of synthetic bha and bht . accordingly , the invention may be employed in place of bht or bha in known utilities of bha or bht , such as for instance as an antioxidant and / or food additive . and , in this regard , it is noted too that the invention is from an edible source . given these results , the skilled artisan can also readily determine a suitable amount of the invention to employ in such “ bha or bht ” utilities , e . g ., the quantity to add to food , without undue experimentation . dna topoisomerase i and ii are enzymes that catalyze the breaking and rejoining of dna strands , thereby controlling the topological states of dna ( wang , 1985 ). in addition to the study of the intracellular function of topoisomerase , one of the most significant findings has been the identification of topoisomerase ii as the primary cellular target for a number of clinically important antitumor compounds ( yamashita et al ., 1990 ) which include intercalating agents ( m - amsa , adriamycin ® and ellipticine ) as well as nonintercalating epipodophyllotoxins . several lines of evidence indicate that some antitumor drugs have the common property of stabilizing the dna — topoisomerase ii complex (“ cleavable complex ”) which upon exposure to denaturing agents results in the induction of dna cleavage ( muller et al ., 1989 ). it has been suggested that the cleavable complex formation by antitumor drugs produces bulky dna adducts that can lead to cell death . according to this attractive model , a specific new inducer of dna topoisomerase ii cleavable complex is useful as an anti - cancer , anti - tumor or antineoplastic agent . in an attempt to identify cytotoxic compounds with activities that target dna , the cocoa procyanidins were screened for enhanced cytotoxic activity against several dna — damage sensitive cell lines and enzyme assay with human topoisomerase ii obtained from lymphoma . the in vitro inhibition of topoisomerase ii decatenation of kinetoplast dna , as described by muller et al . ( 1989 ), was performed as follows . nuclear extracts containing topoisomerase ii activity were prepared from human lymphoma by modifications of the methods of miller et al . ( 1981 ) and danks et al . ( 1988 ). one unit of purified enzyme was enough to decatenate 0 . 25 μg of kinetoplast dna in 30 min . at 34 ° c . kinetoplast dna was obtained from the trypanosome crithidia fasciculata . each reaction was carried out in a 0 . 5 ml microcentrifuge tube containing 19 . 5 μl h 2 o , 2 . 5 ml 10 × buffer ( 1 × buffer contains 50 mm tris - hcl , ph 8 . 0 , 120 mm kcl , 10 mm mgcl 2 , 0 . 5 mm atp , 0 . 5 mm dithiothreitol and 30 mg bsa / ml ), 1 μl kinetoplast dna ( 0 . 2 μg ), and 1 μl dmso - containing cocoa procyanidin test fractions at various concentrations . this combination was mixed thoroughly and kept on ice . one unit of topoisomerase was added immediately before incubation in a waterbath at 34 ° c . for 30 min . following incubation , the decatenation assay was stopped by the addition of 5 μl stop buffer ( 5 % sarkosyl , 0 . 0025 % bromophenol blue , 25 % glycerol ) and placed on ice . dna was electrophoresed on a 1 % agarose gel in tae buffer containing ethidium bromide ( 0 . 5 μg / ml ). ultraviolet illumination at 310 nm wavelength allowed the visualization of dna . the gels were photographed using a polaroid land camera . fig1 shows the results of these experiments . fully catenated kinetoplast dna does not migrate into a 1 % agarose gel . decatenation of kinetoplast dna by topoisomerase ii generates bands of monomeric dna ( monomer circle , forms i and ii ) which do migrate into the gel . inhibition of the enzyme by addition of cocoa procyanidins is apparent by the progressive disappearance of the monomer bands as a function of increasing concentration . based on these results , cocoa procyanidin fractions a , b , d , and e were shown to inhibit topoisomerase ii at concentrations ranging from 0 . 5 to 5 . 0 μg / ml . these inhibitor concentrations were very similar to those obtained for mitoxanthrone and m - amsa [ 4 ′-( 9 - acridinylamino ) nethanesulfon - m - anisidide ]. cocoa procyanidins were screened for cytotoxicity against several dna - damage sensitive cell lines . one of the cell lines was the xrs - 6 dna double strand break repair mutant developed by p . jeggo ( kemp et al ., 1984 ). the dna repair deficiency of the xrs - 6 cell line renders them particularly sensitive to x - irradiation , to compounds that produce dna double strand breaks directly , such as bleomycin , and to compounds that inhibit topoisomerase ii , and thus may indirectly induce double strand breaks as suggested by carters et al . ( 1991 ). the cytotoxicity toward the repair deficient line was compared to the cytotoxicity against a dna repair proficient cho line , br1 . enhanced cytotoxicity towards the repair deficient ( xrs - 6 ) line was interpreted as evidence for dna cleavable double strand break formation . the dna repair competent cho line , br1 , was developed by barrows et al . ( 1987 ) and expresses 0 6 - alkylguanine — dna — alkyltransferase in addition to normal cho dna repair enzymes . the cho double strand break repair deficient line ( xrs - 6 ) was a generous gift from dr . p . jeggo and co - workers ( jeggo et al ., 1989 ). both of these lines were grown as monolayers in alpha - mem containing serum and antibiotics as described in example 6 . cells were maintained at 37 ° c . in a humidified 5 % co 2 atmosphere . before treatment with cocoa procyanidins , cells grown as monolayers were detached with trypsin treatment . assays were performed using the mtt assay procedure described in example 6 . the results ( fig1 ) indicated no enhanced cytotoxicity towards the xrs - 6 cells suggesting that the cocoa procyanidins inhibited topoisomerase ii in a manner different from cleavable double strand break formation . that is , the cocoa procyanidins interact with topoisomerase ii before it has interacted with the dna to form a noncleavable complex . noncleavable complex forming compounds are relatively new discoveries . members of the anthracyclines , podophyllin alkaloids , anthracenediones , acridines , and ellipticines are all approved for clinical anti - cancer , anti - tumor or antineoplastic use , and they produce cleavable complexes ( liu , 1989 ). several new classes of topoisomerase ii inhibitors have recently been identified which do not appear to produce cleavable complexes . these include amonafide ( hsiang et al ., 1989 ), distamycin ( fesen et al ., 1989 ), flavanoids ( yamashita et al ., 1990 ), saintopin ( yamashita et al ., 1991 ), membranone ( drake et al ., 1989 ), terpenolds ( kawada et al ., 1991 ), anthrapyrazoles ( fry et al ., 1985 ), dioxopiperazines ( tanabe et al ., 1991 ), and the marine acridine — dercitin ( burres et al ., 1989 ). since the cocoa procyanidins inactivate topoisomerase ii before cleavable complexes are formed , they have chemotherapy value either alone or in combination with other known and mechanistically defined topoisomerase ii inhibitors . additionally , cocoa procyanidins also appear to be a novel class of topoisomerase ii inhibitors , ( kashiwada et al ., 1993 ) and may thus be less toxic to cells than other known inhibitors , thereby enhancing their utility in chemotherapy . the human breast cancer cell line mcf - 7 ( adr ) which expresses a membrane bound glycoprotein ( gpl7o ) to confer multi - drug resistance ( leonessa et al ., 1994 ) and its parental line mcf - 7 pl68 were used to assay the effects of cocoa fraction d & amp ; e . as shown in fig1 , the parental line was inhibited at increasing dose levels of fraction d & amp ; e , whereas the adriamycin ( adr ) resistant line was less effected at the higher doses . these results show that cocoa fraction d & amp ; e has an effect on multi - drug resistant cell lines . the synthesis of procyanidins was performed according to the procedures developed by delcour et al . ( 1983 ), with modification . in addition to condensing (+)- catechin with dihydroquercetin under reducing conditions , (−)- epicatechin was also used to reflect the high concentrations of (−)- epicatechin that naturally occur in unfermented cocoa beans . the synthesis products were isolated , purified , analyzed , and identified by the procedures described in examples 3 , 4 and 5 . in this manner , the biflavanoids , triflavanoids and tetraflavanoids are prepared and used as analytical standards and , in the manner described above with respect to cocoa extracts . since the polyphenol extracts are compositionally complex , it was necessary to determine which components were active against cancer cell lines for further purification , dose - response assays and comprehensive structural identification . a normal phase semi preparative hplc separation ( example 3 b ) was used to separate cocoa procyanidins on the basis of oligomeric size . in addition to the original extract , twelve fractions were prepared ( fig2 b and 15o ) and assayed at 100 μg / ml and 25 μg / ml doses against hela to determine which oligomer possessed the greatest activity . as shown in fig2 , fractions 4 - 11 ( pentamer - dodecamer ) demonstrated ic 50 values of approximately 25 μg / ml . these results indicated that these specific oligomers had the greatest activity against hela cells . additionally , normal phase hplc analysis of cocoa fraction d & amp ; e indicated that this fraction was enriched with these oligomers . from the foregoing , it is clear that the extract and cocoa polyphenols , as well as the compositions method and kit , of the invention have utility . in this regard , it is mentioned that the invention is from an edible source and , that the activity in vitro can demonstrate at least some activity in vivo , especially considering the doses discussed above . additionally , the above description shows that the extract and cocoa polyphenols , as well as the compositions , method and kit have antioxidant activity like that of bht and bha , as well as oxidative stability . thus , the invention can be employed in place of bht or bha in known utilities of bha and bht , such as an antioxidant , for instance , an antioxidant food additive . the invention can also be employed in place of topoisomerase - inhibitors in the presently known utilities therefor . accordingly , there are many compositions and methods envisioned by the invention ; for instance , antioxidant or preservative compositions , topoisomerase - inhibiting compositions , methods for preserving food or any desired item such as from oxidation , and methods for inhibiting topoisomerase which comprise either the extract and / or cocoa polyphenol ( s ) or which comprise contacting the food , item or topoisomerase with the respective composition or with the extract and / or cocoa polyphenol ( s ). having thus described in detail the preferred embodiments of the present invention , it is to be understood that the invention defined by the appended claims is not to be limited by particular details set forth in the above descriptions as many apparent variations thereof are possible without departing from the spirit or scope of the present invention . 1 . barrows , l . r ., borchers , a . h ., and paxton , m . b ., transfectant cho cells expressing 0 6 - alkylguanine — dna - alkyltransferase display increased resistance to dna damage other than o 6 - guanine alkylation , carcinogenesis , 8 : 1853 ( 1987 ). 2 . boukharta , m ., jalbert , g . and castonguay , a ., efficacy of ellagitannins and ellagic acid as cancer chemopreventive agents — presented at the xvi th international conference of the groupe polyphenols , lisbon , portugal , july 13 - 16 , 1992 . 3 . burres , n . s ., sazesh , j ., gunawardana , g . p ., and clement , j . j ., antitumor activity and nucleic acid binding properties of dercitin , a new acridine alkaloid isolated from a marine dercitus species sponge , cancer research , 49 , 5267 - 5274 ( 1989 ). 4 . caragay , a . b ., cancer preventive foods and ingredients , food technology , 46 : 4 , 65 - 79 ( 1992 ). 5 . chu , s . - c ., hsieh , y . - s . and lim , j . - y ., inhibitory effects of flavonoids on maloney murine leukemia virus reverse transcriptase activity , j . of natural products , 55 : 2 , 179 - 183 ( 1992 ). 6 . clapperton , j ., hammerstone , j . f . jr ., romanczyk , l . j . jr ., chan , j ., yow , s ., lim , d . and lockwood , r ., polyphenols and cocoa flavor — presented at the xvi th international conference of the groupe polyphenols , lisbon , portugal , jul . 13 - 16 , 1992 . 7 . danks , m . k ., schmidt , c . a ., cirtain , m . c ., suttle , d . p ., and beck , w . t ., altered catalytic activity of and dna cleavage by dna topoisomerase ii from human leukemic cells selected for resistance to vm - 26 , biochem ., 27 : 8861 ( 1988 ). 8 . delcour , j . a ., ferreira , d . and roux , d . g ., synthesis of condensed tannins , part 9 , the condensation sequence of leucocyanidin with (+)- catechin and with the resultant procyanidins , j . chem . soc . perkin trans . i , 1711 - 1717 ( 1983 ). 9 . deschner , e . e ., ruperto , j ., wong , g . and newmark , h . l ., quercitin and rutin as inhibitors of azoxymethanol — induced colonic neoplasia , carcinogenesis , 7 , 1193 - 1196 ( 1991 ). 10 . designing foods , manipulating foods to promote health , inform , 4 : 4 , 344 - 369 ( 1993 ). 11 . drake , f . h ., hofmann , g . a ., mong ., s . - m ., bartus , j . o ., hertzberg , r . p ., johnson , r . k ., mattern , m . r ., and mirabelli , c . k ., in vitro and intercellular inhibition of topoisomerase ii by the antitumor agent membranone , cancer research , 49 , 2578 - 2583 ( 1989 ). 12 . engels j . m . m ., genetic resources of cacao : a catalogue of the catie collection , tech . bull . 7 , turrialba , costa rica ( 1981 ). 13 . enriquez g . a . and soria j . v ., cocoa cultivars register iica , turrialba , cost rica ( 1967 ). 14 . ferreira , d ., steynberg , j . p ., roux , d . g . and brandt , e . v ., diversity of structure and function in oligomeric flavanoids , tetrahedron , 48 : 10 , 1743 - 1803 ( 1992 ). 15 . fesen , m . and pommier , y ., mammalian topoisomerase ii activity is modulated by the dna minor groove binder — distainycin in simian virus 40 dna , j . biol . chem ., 264 , 11354 - 11359 ( 1989 ). 16 . fry , d . w ., boritzki , t . j ., besserer , j . a ., and jackson , r . c ., in vitro strand scission and inhibition of nucleic acid synthesis on l1210 leukemia cells by a new class of dna complexes , the anthra [ 1 , 9 - cd ] pyrazol - 6 ( 2h )- ones ( anthrapyrazoles ), biochem . pharmacol ., 34 , 3499 - 3508 ( 1985 ). 17 . hsiang , y . - h ., jiang , j . b ., and liu , l . f ., topoisomerase ii mediated dna cleavage by amonafide and its structural analogs , mol . pharmacol ., 36 , 371 - 376 ( 1989 ). 18 . jalal , m . a . f . and collin , h . a ., polyphenols of mature plant , seedling and tissue cultures of theobroma cacoa , phytochemistry , 6 , 1377 - 1380 ( 1978 ). 19 . jeggo , p . a ., caldecott , k ., pidsley , s ., and banks , g . r ., sensitivity of chinese hamster ovary mutants defective in dna double strand break repair to topoisomerase ii inhibitors , cancer res ., 49 : 7057 ( 1989 ). 20 . kashiwada , y ., nonaka , g . - i ., nishioka , i ., lee , k . j . - h ., bori , i ., fukushima , y ., bastow , k . f ., and lee , k . - h ., tannin as potent inhibitors of dna topoisomerase ii in vitro , j . pharm . sci ., 82 : 5 , 487 - 492 ( 1993 ). 21 . kato , r ., nakadate , t ., yamamoto , s . and sugimura , t ., inhibition of 12 - o - tetradecanoylphorbol - 13 - acetate induced tumor promotion and ornithine decarboxylase activity by quercitin : possible involvement of lipoxygenase inhibition , carcinogenesis , 4 , 1301 - 1305 ( 1983 ). 22 . kawada , s . - z ., yamashita , y ., fujii , n . and nakano , h ., induction of heat stable topoisomerase ii - dna cleavable complex by nonintercalative terpenoids , terpentecin and clerocidin , cancer research , 51 , 2922 - 2929 ( 1991 ). 23 . kemp , l . m ., sedgwick , s . g . and jeggo , p . a ., x - ray sensitive mutants of chinese hamster ovary cells defective in double strand break rejoining , mutat . res ., 132 : 189 ( 1984 ). 24 . kikkoman corporation , antimutagenic agent containing proanthocyanidin oligomer preferably having flavan - 3 - ol - diol structure , jp 04190774 - a , jul . 7 , 1992 . 25 . lehrian , d . w . ; patterson , g . r . in biotechnology ; reed , g ., ed . ; verlag chemie : weinheim , 1983 , vol . 5 , chapter 12 . 26 . leonessa , f ., jacobson , m ., boyle , b ., lippman , j ., mcgarvey , m ., and clarke , r . effect of tamoxifen on the multidrug - resistant phenotype in human breast cancer cells : isobolograms , drug accumulation , and m r 170 , 000 glycoprotein ( gp 170 ) binding studies , cancer research , 54 , 441 - 447 ( 1994 ). 27 . liu , l . f ., dna toposimerase poisons as antitumor drugs , ann . rev . biochem ., 58 , 351 - 375 ( 1989 ). 28 . mccord , j . d . and kilara a . control of enzymatic browning in processed mushrooms ( agaricus bisporus ). j . food sci ., 48 : 1479 ( 1983 ). 29 . miller , k . g ., liu , l . f . and englund , p . a ., homogeneous type ii dna topoisomerase from hela cell nuclei , j . biol . chem ., 256 : 9334 ( 1981 ). 30 . mosmann , t ., rapid colorimetric assay for cellular growth and survival : application to proliferation and cytoxicity assays , j . immunol . methods , 65 , 55 ( 1983 ). 31 . muller , m . t ., helal , k ., soisson , s . and spitzer , j . r ., a rapid and quantitative microtiter assay for eukaryotic topoisomerase ii , nuc . acid res ., 17 : 9499 ( 1989 ). 32 . nawata , h ., chong , m . t ., bronzert , d . and lippman , m . e . estradiol - independent growth of a subline of mcf - 7 human breast cancer cells in culture , j . biol . chem ., 256 : 13 , 6895 - 6902 ( 1981 ). 33 . okuda , t ., yoshida , t ., and hatano , t ., molecular structures and pharmacological activities of polyphenols — oligomeric hydrolyzable tannins and others — presented at the xvi th international conference of the groupe polyphenols , lisbon , portugal , jul . 13 - 16 , 1992 . 34 . phenolic compounds in foods and their effects on health ii . antioxidants & amp ; cancer prevention , huang , m . - t ., ho , c . - t ., and lee , c . y . editors , acs symposium series 507 , american chemical society , washington , d . c . ( 1992 ). 35 . phenolic compounds in foods and their effects on health i , analysis , occurrence & amp ; chemistry , ho , c . - t ., lee , c . y ., and huang , m . - t editors , acs symposium series 506 , american chemical society , washington , d . c . ( 1992 ). 36 . porter , l . j ., ma , z . and chan , b . g ., cocoa procyanidins : major flavanoids and identification of some minor metabolites , phytochemistry , 30 , 1657 - 1663 ( 1991 ). 37 . revilla , e ., bourzeix , m . and alonso , e ., analysis of catechins and procyanidins in grape seeds by hplc with photodiode array detection , chromatographia , 31 , 465 - 468 ( 1991 ). 38 . scudiero , d . a ., shoemaker , r . h ., paull , k . d ., monks , a ., tierney , s ., nofziqer , t . h ., currens , m . j ., seniff , d ., and boyd , m . r . evaluation of a soluble tetrazolium / formazan assay for cell growth and drug sensitivity in culture using human and other tumor cell lines , canur research , 48 , 4827 - 4833 ( 1988 ). 39 . self , r ., eagles , j ., galletti , g . c ., mueller - harvey , i ., hartley , r . d ., lee , a . g . h ., magnolato , d ., richli , u ., gujur , r . and haslam , e ., fast atom bombardment mass spectrometry of polyphenols ( syn . vegetable tannins ), biomed environ . mass spec . 13 , 449 - 468 ( 1986 ). 40 . tanabe , k ., ikegami , y ., ishda , r . and andoh , t ., inhibition of topoisomerase ii by antitumor agents bis ( 2 , 6 - dioxopiperazine ) derivatives , cancer research , 51 , 4903 - 4908 ( 1991 ). 41 . van oosten , c . w ., poot , c . and a . c . hensen , the precision of the swift stability test , fette , seifen , anstrichmittel , 83 : 4 , 133 - 135 ( 1981 ). 42 . wang , j . c ., dna topoisomerases , ann . rev . biochem ., 54 , 665 - 697 ( 1985 ). 43 . warters , r . l ., lyons , b . w ., li , t . m . and chen , d . j ., topoisomerase ii activity in a dna double - strand break repair deficient - chinese hamster ovary cell line , mutat . res ., 254 : 167 ( 1991 ). 44 . yamashita , y ., kawada , s . - z . and nakano , h ., induction of mammalian topoismerase ii dependent dna cleavage by nonintercalative flavanoids , genistein and orbol ., biochem pharm , 39 : 4 , 737 - 744 ( 1990 ). 45 . yamashita , y ., kawada , s . - z ., fujii , n . and nakano , h ., induction of mammalian dna topoisomerase i and ii mediated dna cleavage by saintopin , a new antitumor agent from fungus , biochem ., 30 , 5838 - 5845 ( 1991 ). | US-34277203-A |
method of producing a therapeutic laser device . the tld includes stretchable , flexible membranes which comprise a high pressure air cavity . high air pressure is produced by fans which are speed controllable by computer . standoff posts provide , an attachment function , and a separation function between the tld and the patient . semiconductor laser diodes and lens sets in a two dimensional array produce the therapeutic laser light . cooling air tubes direct air controlled by temperature sensors from the high pressure cavity onto laser diodes . capacitive proximity sensors in conjunction with infrared radiation sensors confirm close contact with a patient and allow lasing . power is supplied either by battery or by connection to mains power . a touch screen computerized device with wireless communication displays information to the user and controls the therapy session . the tld and the power supply both have stretchable straps enabling the tld to be fixed to the patient . | the following references to the drawings are discussed in the narrative below . 3 high pressure fan with speed control and air filter 10 flexible membrane with bonded flat braided and / or non - braided electrical conductors 27 zipper attachment for stretchable straps with hook and loop fasteners the present disclosure relates to producing a therapeutic laser device . specific examples of membranes , layer configuration , materials , and other arrangements are described below to simplify the present disclosure . these are , of course , merely examples and are not intended to limit the invention from that described in the claims . referring now to fig1 of the drawings , the reference numeral ( 1 ) refers to a stretchable , flexible closed cell membrane . the term stretchable in this context means the ability to elongate at least 10 % of its length without permanently deforming . the term flexible in this context means the ability to bend in an arc with radius of 4 inches or less without permanently deforming . the term closed cell membrane in this context means a material similar to polyethylene foam , neoprene foam , polystyrene foam and others . the membrane ( 1 ) has mounted on it one or more high pressure fans with speed control and air filters reference numeral ( 3 ), which draw air in from above and force it beneath membrane ( 1 ). referring now to fig2 and fig3 and fig5 of the drawings , the reference numeral ( 11 ) refers to a narrow stretchable , flexible closed cell membrane bonded to membrane ( 1 ). reference numeral ( 9 ) refers to a flexible , non - stretchable membrane bonded to membrane ( 11 ). the term non - stretchable in this context means the inability to stretch more than 5 % of the amount of elongation of the stretchable , flexible closed cell membrane when applying the same tensile force . examples of this type of material are viton , butyl , hypalon , epdm , and others . the arrangement of membranes ( 1 ) and ( 11 ) and ( 9 ) form a high pressure air cavity shown as reference numeral ( 13 ). the air trapped in ( 13 ) is forced into the tops of the one or more cooling air tubes and spacers shown as reference numeral ( 8 ). the tops of the one or more air tubes ( 8 ) provide a supporting / spacing function to keep air cavity ( 13 ) open between membrane ( 1 ) and membrane ( 9 ). the air forced into the tops of one or more air tubes ( 8 ) is then forced down through the one or more air tubes ( 8 ) and onto the front side of the one or more semiconductor laser diodes and lens sets shown as reference numeral ( 7 ). this forced air in addition to cooling the one or more semiconductor laser diodes and lens sets provides a cooling and drying effect on the patient &# 39 ; s treatment area thereby enhancing comfort and preventing moisture from attenuating the laser beams . the term high pressure in this context means a varying air pressure greater than the surrounding atmospheric pressure and capable of forcing air through the one or more air tubes ( 8 ) in a manner sufficient to cool the one or more semiconductor laser diodes and lens sets . referring now to fig7 of the drawings , reference numeral ( 26 ) refers to the one or more holes in membrane ( 9 ) directly adjacent to the pin connector side of the one or more lasers ( 7 ). reference numeral ( 21 ) refers to the one or more automatic power control circuit electronic modules and reference numeral ( 25 ) refers to the flat braided and / or non - braided electrical conductors . the one or more holes ( 26 ) allow high pressure air to cool the one or more power control ( 21 ) and the pins of one or more laser ( 7 ) and conductors ( 25 ). this cooling effect in conjunction with the cooling effect on the front side of the one or more lasers ( 7 ) discussed in paragraph [ 0026 ] above maintains the one or more lasers ( 7 ) at the optimal temperature for laser propagation . referring now to fig6 of the drawings , reference numeral ( 20 ) refers to one or more temperature sensors bonded to the radiation emitting side of the one or more lasers ( 7 ). referring now to fig1 of the drawings , reference numeral ( 14 ) refers to an electrical cable for power and sensor data communication and reference numeral ( 4 ) refers to power supply and computer control with wireless communication . referring now to fig1 and fig5 and fig6 and fig7 of the drawings , the output of the one or more temperature sensors ( 20 ) is passed through power cable ( 14 ) to computer control ( 4 ) where a computer analyzes the temperature of the one or more lasers ( 7 ) and sends via power cable ( 14 ) power and timing information to regulate the speed of the one or more fans ( 3 ) thereby maintaining a constant temperature of the one or more lasers ( 7 ). the one or more lasers ( 7 ) receive power from the conductors ( 25 ) which in turn receive power from power cable ( 14 ) which in turn receives power from computer control ( 4 ). referring now to fig1 and fig6 of the drawings , reference numeral ( 16 ) refers to one or more infrared radiation sensors and reference numeral ( 15 ) refers to one or more capacitive proximity sensors . the one or more sensors ( 16 ) sense ambient light infrared radiation and infrared radiation from the patient &# 39 ; s treatment area . the one or more sensors ( 15 ) sense a capacitive increase from the patient &# 39 ; s treatment area when in close contact with the patient &# 39 ; s treatment area . the one or more sensors ( 16 ) and the one or more sensors ( 15 ) send data via power cable ( 14 ) to the computer control ( 4 ) where a computer analyzes infrared radiation and the capacitance information and determines if the tld is in close contact with the patient &# 39 ; s treatment area . the infrared radiation must be below what is received from ambient light ( high threshold ) and must be equal to or greater than what is expected from the treatment area of a patient ( low threshold ). if the infrared radiation is equal to or greater than the low threshold and below the high threshold the computer then checks the capacitance value . if both the infrared radiation levels and the capacitance levels are within range the computer sends a signal to the touch screen computerized device with wireless communication reference numeral ( 5 ) and will allow a therapy session to begin when initiated by computerized device ( 5 ). if during the therapy session either the one or more sensors ( 15 ) or the one or more sensors ( 16 ) present data to computer control ( 4 ) which is out of range computer control ( 4 ) will send a signal to computerized device ( 5 ) and computerized device ( 5 ) will terminate the therapy session . this function ensures that laser radiation is directed onto the patient &# 39 ; s treatment area and not in a direction that would potentially cause harm . it also protects against malicious use of the tld . in addition to the functions described above computerized device ( 5 ) displays information to the user , communicates with the computer control ( 4 ) via wireless communication , initiates a laser therapy session , terminates a laser therapy session , maintains therapy duration timing , lets a user set therapy duration , displays to the user the elapsed time and the time left in the therapy session , displays to the user battery charge level and prohibits the initiation of a therapy session if battery charge is below a prescribed level , lets a user set laser power level , lets the user set the total therapy dosage , calculates the laser power level and therapy duration based on total therapy dosage , lets the user choose between continuous or pulsed laser operation , stores previous therapy session data and lets the user select a previously stored therapy regimen , lets a medical professional transmit a therapy regimen to the touch screen computerized device with wireless communication via the internet or cellular telephone and monitor the status of the tld and the number of therapy sessions completed , sounds an audible signal when a therapy session is initiated , sounds an audible signal when a therapy session is terminated , waits a standard length of time after the audible signal before initiating laser power , sounds an audible alarm in the case the tld becomes separated from the patient &# 39 ; s treatment area , warns the user of problems encountered by the tld , shuts the tld down in the event of malfunction , lets the user pause the therapy session and restart the therapy session , displays a standard laser warning message about laser safety , maintains a constant wireless communication dialog with computer control ( 4 ) and in the event the communication dialog is broken computer control ( 4 ) terminates the therapy session . the communication transmission between the computerized device with wireless communication and the power supply and computer control is encrypted for security as is the transmission over the internet or cellular phone . the touch screen computerized device with wireless communication is either a made for purpose device programed to perform the functions described above and provided with the tld or it is an application program ( computer code ) loadable to a cellphone , touch screen tablet , lap top computer or a desk top computer which has been approved and certified as being capable of performing the stated functions . referring now to fig4 and fig5 and fig1 of the drawings , reference numeral ( 6 ) refers to the one or more standoff posts . membrane ( 9 ) is attached to flexible membrane with bonded flat braided and / or non - braided electrical conductors reference numeral ( 10 ) by means of the one or more standoff posts which penetrate and hold together membrane ( 9 ) and membrane ( 10 ). membrane ( 10 ) can be made of polyimide , polyester , polyethylene napthalate , or polyetherimide among others . the one or more standoff posts provide , in addition to their attachment function , a separation function between the lasers ( 7 ) and the surface area to be treated on a patient . reference numeral ( 12 ) refers to one or more flexible membrane washers which add rigidity to the standoff posts ( 6 ). the standoff posts are formed to present a small cross sectional area to the laser light so as not to block a large degree of the laser light from reaching the treatment area . referring now to fig3 and fig9 of the drawings , reference numeral ( 12 ) refers to one or more flexible membrane washers which add rigidity to the one or more air tubes ( 8 ). referring now to fig8 and fig1 of the drawings , reference numeral ( 19 ) refers to the one or more semiconductor laser diodes , reference numeral ( 17 ) refers to the one or more collimating lenses and reference numeral ( 18 ) refers to one or more plano - concave lenses which in combination comprise the one or more lasers ( 7 ). the light emitted by the one or more diodes ( 19 ) is in the form of an ellipse as indicated by ‘ light pattern without lenses ’ on fig1 . the light emitted by lasers ( 7 ) after passing through the one or more lenses ( 17 ) and ( 18 ) is in the form of a circle as indicated by ‘ light pattern with lenses ’ on fig1 . this light pattern transformation is necessary to produce and even distribution of laser light radiation under each of the one or more laser ( 7 ) to affect a uniform dosage . the standoff posts ( 6 ) are formed in such a way that the distance between the lasers ( 7 ) and the patient &# 39 ; s treatment area is optimized such that the entire treatment area is uniformly radiated with the prescribed dosage . referring now to fig1 and fig3 and fig1 of the drawings , reference numeral ( 2 ) refers to stretchable straps with hook and loop fasteners . the stretchable straps with hook and loop fasteners ( 2 ) enable the tld to be fixed to a patient in a manner that allows movement of the area to be treated and movement of the patient within and without the treatment premises . the stretchable straps with hook and loop fasteners ( 2 ) are connected to the tld with zippers , reference numeral ( 27 ), to enable quick removal for cleaning and replacement . the movement of the patient must not exceed the maximum range of the communication capability between computer control ( 4 ) and computerized device ( 5 ) or the therapy session will be terminated by computer control ( 4 ). computer control ( 4 ) also has stretchable straps with hook and loop fasteners ( 2 ). computer control ( 4 ) can provide power either by battery or by connection to mains power at the wall . computer control ( 4 ) maintains the voltage and current to the semiconductor lasers within close tolerances to ensure the correct laser power and dosage levels . computer control ( 4 ) contains a key lock reference numeral ( 22 ) which provides security against unauthorized use , a laser radiation full duration indicator light reference numeral ( 23 ) which provides laser - on indication and a laser radiation momentary at start audible signal device reference numeral ( 24 ) which provides an indication of the beginning of a therapy session . referring now to fig1 and fig1 and fig1 and fig1 of the drawings show additional possible embodiments of the present invention but do not limit the potential embodiments that could be created using the same technology . fig1 shows an embodiment designed for the elbow . fig1 shows an embodiment designed for the shoulder . fig1 shows an embodiment designed for the knee . fig1 shows an embodiment designed for the neck . additional embodiments could include but are not limited to the lower back , the ankle , the top of the foot , the bottom of the foot , the head , the hand , the buttocks , the lower leg , the face , etc . referring to fig1 of the drawings it is shown that physiological activity affected by laser light energy is not uniform but is greater in certain wavelengths than others . | US-201314036739-A |
a carton with an improved dispenser at one of the carton which preserves the integrity of the carton when the carton is opened by permitting a bottom end flap attached to the bottom panel to remain in place and also a portion of each side end flap that is adjacent to the bottom end flap . this dispenser may also provide a safety net for the first container that is automatically dispensed when the carton is opened . | the present invention is intended primarily for use with cans and bottles of the types used to contain soft drinks , beer and the like . the blank 10 is formed from a foldable sheet material , such as paperboard . the blank has a top flap 12 which is connected by fold line 14 to side panel 16 , which in turn is connected by fold line 18 to bottom panel 20 . bottom panel 20 is connected by fold line 22 to side panel 24 , which in turn is connected by fold line 26 to top flap 28 . this carton is capable of containing cans or bottles in two rows of six containers each . this carton has the “ racetrack ” handle 30 and 32 formed in the top flaps , 12 and 28 , respectively . cushioning flaps 34 and 36 are provided for the comfort of a person &# 39 ; s hands , and are foldably joined to top flaps 12 and 28 . on the exiting - end of the carton , top end flap 38 is joined to top flap 12 by fold line 40 . side end flap 42 is joined to side panel 16 by fold line 44 . bottom end flap 46 is joined to bottom panel 20 by fold line 48 . side end flap 50 is joined by fold line 52 to side panel 24 . top end flap 54 is joined to top flap 28 by fold line 56 . on the closed end of the carton , top end flap 58 is connected to top flap 12 by fold line 60 , side end flap 62 is connected to side panel 16 by fold line 64 , bottom end flap 66 is attached to bottom panel 20 by fold line 68 , side end flap 70 is connected to side panel 24 by fold line 72 and top end flap 74 is connected to top flap 28 by fold line 76 . it will be understood by those skilled in the art that the carton of the present invention is generally symmetrical about a horizontal line of bisection , as viewed when fig1 is rotated lengthwise . this symmetry aids in the efficient production of the present carton . in forming this blank 10 into a carton , top flap 12 is glued to top flap 28 forming a sleeve . the cans or bottles are then loaded into the carton on their sides and the various end flaps on both ends are closed . using one end as an example , top end flaps 38 and 54 are folded downwardly and bottom end flap 46 is folded upwardly and then side end flaps 42 and 50 are folded sideways . these various end flaps are held together by glue or other means . the other end of the carton is glued and closed in the same fashion . when the blank is folded and glued , the resulting carton has a closed end and an exiting end . however , a dispenser can be placed on both ends of the cartons . the containers exit the carton through the exiting end of the carton . the exiting end of the carton has a tear line 78 that extends through the top flaps 12 and 28 , through the side panels 16 and 24 to form a triangular dispensing flap on the dispenser 79 into the side end flaps 42 and 50 . in order to facilitate the opening of this dispenser 79 , a finger flap 82 may be provided for the easy insertion of the fingers to start the tearing of the dispenser 79 . finger flap 82 is connected to top flaps 12 and 28 by tear line 80 . finger flap 82 may be provided with insertion flap 86 to facilitate entry of the fingers into the carton . for the opening of the dispenser 79 , insertion flap 86 is connected to finger flap 82 by fold line 84 . finger flap 82 and insertion flap 86 are connected to the dispenser 79 by fold line 88 which interrupts the tear line 78 . it will be noticed that tear line 78 extends into side end flaps 42 and 50 so as to form a substantial bottom portion 90 and 92 so that the end of the carton will have a bottom end when the dispenser 79 is opened . fig2 shows the carton full of cans with the dispenser 79 open except for the tear lines 78 through the side end flaps 42 , 50 . it will be noted that the dispenser is a unitary structure . the dispenser 79 is opened by a person inserting his or her fingers into finger flap 82 and pulling the dispenser 79 open . insertion flap 86 is provided to facilitate the entry of the fingers into the opening provided by finger flap 82 . finger flap 82 and insertion flap 86 are placed so that the fingers will enter the interior of the carton between the first and second cans . fig3 shows the dispenser 79 completely opened but still attached to the carton by tear line 78 not being torn open through side end flaps 42 and 50 . when the dispenser 79 is completely opened , the top can c will fall into the basket formed by the dispensing flap 79 and be retained . this dispenser 79 serves as a safety net to prevent the can from leaving the vicinity of the carton . the dispenser 79 forms a basket with triangular flaps forming side walls , side end flaps 42 and 50 forming a bottom wall and the torn off portions of the top flaps 12 and 28 forming an end wall . in order to maintain the structural integrity of this carton , the bottom portions 90 and 92 of the side end flaps 42 and 50 are not removed from the carton when the dispenser is removed . the structural integrity of the carton is improved by the fact that the bottom end flap 46 is not removed . the bottom end flap 46 has a height h approximately equal to the distance between a and b along fold lines 44 and 52 respectively . this means that the bottom end flap 46 has the same height as the bottom portions 90 and 92 of the side end flaps 42 and 50 , thus producing a strong bottom end structure . if desired , the dispenser 79 can be totally removed from carton or left attached along tear line 78 in side flaps 42 and 50 and reclosed . as illustrated in fig4 , a can c can be easily removed from the carton by using the fingers f and the thumb t of a hand . fig5 is a plan view of a blank from which a carton containing cans in three rows of four cans each according to the invention is formed . this carton has a single slot handle for carrying . the blank 110 has a bottom flap 112 which is connected by fold line 114 to side panel 116 , which in turn is connected by fold line 118 to top panel 120 . top panel 120 in turn is connected by fold line 122 to side panel 124 which in turn is connected by fold line 126 to bottom flap 128 . on the closed end of the carton , bottom end flap 130 is foldably connected by fold line 132 to bottom flap 112 . side end flap 134 is connected by fold line 136 to side panel 116 . top end flap 138 is connected by fold line 140 to top panel 120 . side end flap 142 is connected by fold line 144 to side panel 124 and bottom end flap 146 is connected by fold line 148 to bottom flap 128 . the exiting end of the carton has a bottom end flap 150 which is connected to bottom flap 112 by fold line 152 . side end flap 154 is connected by fold line 156 to side panel 116 . top end flap 158 is connected by fold line 160 to top panel 120 . side end flap 162 is connected by fold line 164 to side panel 124 . bottom end flap 166 is connected by fold line 168 to bottom flap 128 . this carton has a slot handle 170 formed by cut line 172 and fold lines 174 and 176 . it also has a score line 178 to assist in dissipating the forces involved in lifting a loaded carton . a dispenser 180 is formed by tearing tear line 182 which extends from the top panel 120 through side panels 116 , 124 and into side end flaps 154 and 162 . tear line 182 extends into side end flaps 154 and 162 , so as to leave bottom portions 184 , 186 that has a height when the carton is formed along lines 156 , 164 respectively that is approximately equal to the height of bottom end flaps 150 and 166 in order to provide structural strength to the carton . this carton may have a finger flap 188 connected to dispenser 180 by fold line 190 and insertion flap 192 connected to finger flap 188 by fold line 194 . finger flap 188 and insertion flap 192 are joined to top panel 120 by tear line 196 . a sleeve from this carton is prepared by gluing the bottom flap 112 and 128 in an overlapping relationship . this carton is then loaded in the same manner as the carton shown in fig2 through as the end of the cartons . side end flaps 134 , 142 , 154 , and 162 are glued over the bottom end flaps 130 , 146 , 150 , 166 and top end flaps 138 and 158 to close the ends of the carton . the dispenser is opened in the same manner as the dispenser shown in fig1 and 2 . the dispenser of this invention can be used for both cans and other types of cylindrical containers . it is particularly useful for pet bottles having a stubby configuration . one of the unique features of the dispenser of this invention is that it provides easy access to the cans or bottles in the carton but yet does not greatly diminish the structural integrity of the carton . this is partly because the bottom end of the end panel in which the dispenser is located is retained . this accomplished by leaving a bottom portion on the side end panel that is equal in height to the bottom end flaps . the dispenser of this invention provides an easy opening feature in that it has a finger flap and insertion flap so that a person &# 39 ; s fingers can be inserted between the first and second can to open the dispenser . this dispenser also provides a safety net or basket in that if the tear line for the dispenser is not torn along the side end flaps , it remains attached to the carton and can catch in its basket a can as it is removed from the carton . while the invention has been disclosed in its preferred forms , it will be apparent to those skilled in the art that many modifications , additions , and deletions can be made therein without departing from the spirit and scope of the invention and its equivalents as set forth in the following claims . | US-47042806-A |
the present invention discloses a leaf snatcher consisting of a protective grille , a blade activated by a motor . the blade is shaped so as to have vacuum capabilities to suck the unwanted leaves and debris . the leaf snatcher is generally setup over a waste container to receive the leaves and debris sucked by the blade . when the grille is lifted , it automatically stops the blade for increased safety . | referring generally to fig1 - 3 , a leaf snatcher ( 10 ) has a protective grille ( 12 ) mechanically fastened to a grille frame ( 13 ). the grille frame is hingedly attached to a frame structure ( 14 ) by way of a hinge ( 19 ) which in large part defines the leaf snatcher ( 10 ). from the frame structure extends downwardly support legs ( 21 ) which are easily removable for transport or storage . the grille ( 12 ), besides a hinge ( 19 ) has retaining means ( 23 ) to maintain the grille frame ( 13 ) shut . a snap ring ( 33 ) ( in dotted lines ) is used for snapping a mesh type bag ( not shown ). the bag has an adjustable ring configured to frictionally engaged over the snap ring . it is important that the bag be of such a design as to allow air to pass through . these elements of the bag are , however , well known in the art and bags of that nature are readily available for other applications . referring generally to fig4 - 6 , underneath the grille ( 12 ) ( partially visible in fig1 ) is a blade ( 16 ) which has an axis of rotation , two long generally parallel sides each having a sharp section ( 27 ). opposite the sharp section ( 27 ) are holes ( 29 ) to receive mechanical fasteners ( 40 ) used for mechanically fastening a vane ( 22 ). the blade ( 16 ) has a bevel ( 39 ) situated on the top side so as to prevent the sharp section ( 27 ) from hitting the grille ( 12 ). the blade ( 16 ) with its vanes ( 22 ) has two functions , the first being to cut and the second being to act as suction means to suck down debris . to do that second function , are the vanes ( 22 ) which extend generally perpendicularly along each longitudinal sides of the blade ( 16 ), and can be semi - circular in shape as per the figures or could be square , rectangular , in the shape of a quarter circle or any other suitable shapes which create adequate suction through the grille ( 12 ) as well as enough of a blow once debris has passed the vanes ( 22 ) so as not to create a jam , while at the same time not creating too much strain on the motor . it should be understood that various shapes for the vanes ( 22 ) are possible all within the scope of this instant invention . also , the vanes ( 22 ) can either extend integrally from the blade ( 16 ) or be mechanically fastened or even welded to the blade ( 16 ). as seen in fig6 c , the vanes ( 22 ) are slightly offset in view of the horizontal plane so as to generate a suction effect as is done for fan blades , propellers and the like . an angle of a range approximately between 10 - 35 degrees is generally adequate for creating proper suction but other angles can be considered depending upon various factors such as motor strength , vane size and shape , all within the scope of the present invention . a motor ( not shown ) situated inside a motor housing ( 18 ) activates the blade ( 16 ) by way of a shaft ( 11 ) interfacing the motor to the blade ( 16 ). the motor housing is connected to the frame structure ( 14 ) by way of members ( 15 ). at least one threaded pin ( 17 ), preferably a plurality , are threading through the motor housing ( 18 ) and making contact with the motor ( not shown ) for use in aligning the motor ( not shown ) so that it will position the blade ( 16 ) parallel to the grille ( 12 ). over time , misalignement can occur so it is important to be able to make such an adjustment easily . in use , the leaf snatcher ( 10 ) is setup on its legs ( 21 ) and the bag having an adjustable ring is snapped onto the snap ring ( 33 ) to receive the debris sucked by the blade ( 16 ). wiggling plants on top of the grille ( 12 ) so as to present all parts of the plant to the grille ( 12 ) selectively passes parts of the plant so as to separate desirable parts from undesirable debris sucked away by the sucking action of the blade ( 16 ). the grille ( 12 ) has a plurality of slots ( 20 ) configured and sized to allow passage of leaves and not the parts of the plant a user wants to keep . the grille ( 12 ) is interchangeable so that various sized slots ( 20 ) can be fitted on the leaf snatcher ( 10 ). also , as shown in fig1 , a single grille ( 12 ) can have two or more sections ( 31 , 32 )) of differently sized slots ( 20 ) to increase its versatility and reduce the need for changing grilles ( 12 ) according to what has to be removed from the plant . when the grille frame ( 13 ) is opened , two safety mechanisms are triggered , the first being a conventional cutoff switch ( not shown ) which reacts to the lifting of the grille frame ( 13 ), and the second is a braking system ( 41 ) which makes contact with a hub ( 34 ) frictionally attached to and surrounding the shaft ( 11 ). a string ( 35 ) pulls on a brake pin ( 36 ) which is biased by a biasing means ( 37 ) into frictionally engaging the hub ( 34 ). when the grille frame ( 13 ) is closed , an l shaped stem ( 38 ), presses down against the string ( 35 ) which pulls the brake pin ( 36 ) which does not make contact with the hub ( 34 ), but when the grille frame ( 13 ) is lifted , the l shaped stem ( 38 ), which is fixedly attached to the grille frame ( 13 ), no longer presses down on the string ( 35 ) and the pin ( 36 ) is biased back into frictionally engaging the hub ( 34 ). | US-84491804-A |
the present invention is related to a botanical extract , called p compound , comprises anti - infection activities . the botanical sources , extracting process , formulation , and applications are disclosed within this invention . | raw materials from camellia sinensis , rooibos , and yerbe mate were suspended in hot water ( 80 ° c . ), p compound were extracted according the following steps : extraction - - - filtration - - - cooling - - - concentration - - - cooling - - - extracted by ethyl acetate - - - concentrating the liquor with centrifugation - - - spraying and drying - - - sifting and blending clinical product testing was performed under the auspices of an independent microbiological laboratory ( s ). the test objective was to determine the feasibility / compatibility of a p ( prevent ) compound additive to the ingredients present in a well - established antiseptic brand . a quantity of p compound formula , directly added to the leading antiseptic ( ethyl alcohol based ) packaged brand , produced unprecedented results . when p compound direct additive ingredient was included , one topical application reliably and totally eliminated populated colonies of staph aureus mrsa , strap mutants and e faecalis bacteria . conversely , absent the p compound additive , topical pre - testing of this leading brand has determined repeated applications were unable to eliminate colonies comprised of the same drug resistant bacteria . see fig1 for comparative product test screen results ( p formula screens illustrating the results of diluted and undiluted bacteria control zone of inhibition experiments ). also , a two - year series of clinical microbiological studies has been conducted . the result documents unprecedented success of p compound in reliably eliminating the presence of staph aureus , strap mutants , e faecalis , mrsa bacteria and bacteriophaget 1 . other leading national antiseptic brands under testing are unable to claim elimination of drug resistant super bugs such as staph / mrsa bacteria / human viruses . in addition , early research trials with p compound has demonstrated similar results in eliminating vancomycin - resistant enterococcus ( vre ), a new mutant strain of deadly enterococcus bacteria for which there is no antibiotic drug cure . typically , all the above referenced microorganisms begin as health care acquired infections with hospital / dental personnel as the initial carriers . for anti - bacteria testing , the antibacterial effect of p compound on s . aureus and b . cereus was obtained by observing zones of inhibition of bacteria grown on mannitol salt agar ( kirby - bauer technique ). the zone of inhibition was equally pronounced for p compound and is significant in that we are unaware of other topically applied products , commercially available , offering this level of a solution . a series of photographs in support of these findings , based on diluted and undiluted bacteria control experiments , are enclosed herewith to serve as documentation of these results ( see fig2 and fig3 ). our results showed that the antibacterial effect of p compound was significant . for example , 1 % of p compound dissolved in water totally destroyed staphylococcus aureus ; 6 % of p compound dissolved in water totally destroyed salmonella enteritides . these natural extract compounds had a substantially greater effect on the gram positives than on the gram negatives . the antibacterial effects of these additives were obtained by observing zones of inhibition of bacteria grown on either mueller hinton ii agar or hektoen enteric agar ( kirby - bauer technique ), and by direct plate counts of bacterial colonies grown on tryptic soy agar using the standard plate technique . the antibacterial effect of an instant hand sanitizer was also investigated . the addition of p compound to an instant hand sanitizer destroyed staphylococcus aureus and bacillus cereus . in absence of the additives , the hand sanitizer was ineffective . the following table 1 showed that the anti - mrsa effects of 7 . 5 % of p compound . the following p compound test results also showed that 1 ml of different concentrations of p compound ( 0 . 2 %; 2 %; or 10 %) with different exposing times to control mrsa bacteria could eliminate the growth or colony forming of bacteria significantly . method 1 . 1 ml of different concentrations of p compound ( 0 . 2 %; 2 %; or 10 %) was added to a tsa agar plate and then added 0 . 1 ml of mrsa bacterial organism with different dilutions and spread . plates are placed in a 37 ° c . incubator and examined colonies of bacteria after 18 - 24 hours . method 2 . 1 ml of different concentrations of p compound ( 0 . 2 %; 2 %; or 10 %) was added to a tsa agar plate and then added 0 . 1 ml of mrsa bacterial organism with different dilutions and spread . plates are placed in a 37 ° c . incubator and examined colonies of bacteria after 30 seconds and 15 minutes . for anti - virus testing , bacteriophage t1 , which infects escherichia coli b , was adversely affected by p compound . the percent loss of titer , due to the addition of p compound , was observed for the phage after ten minutes of intermittent mixing at room temperature . after one hour ( without mixing ), t1 was totally inactivated . further research is also warranted in testing p compound as a nutraceutical or as a raw material that may have widespread implications in the treatment of potentially pathogenic microorganisms . all ingredients contained in p compound are naturally derived and generally recognized as safe based on the food & amp ; drug administration and fema gras lists . p compound ingredients can be added into hand sanitizers , soaps , baby wipes , moist towelettes , etc . although the invented p compound and the method of using same according to the present invention has been described in the foregoing specification with considerable details , it is to be understood that modifications may be made to the invention which do not exceed the scope of the invention claims and modified forms of the present invention done by others skilled in the art to which the invention pertains will be considered infringements of this invention when those modified forms fall within the claimed scope of this invention . | US-73291010-A |
a portable , multi - configurable exercising device which allows a full range of traditional exercises and also marital arts movements to be performed in correct fashion on a compactable , weight and tension adjustable apparatus . all components are collapsible within itself and also reconfigures in such a way as to form a multi - exercise embodiments . several components are adjustably de - attachable thereby creating multiple embodiments and allowing the performance of many exercises . | referring now to the drawing , my exercise bar includes two collapsible hollow cylindrical left end pieces , a similar right end piece as shown in fig8 , and a cylindrical center piece as shown in fig5 . the center piece includes hand grips 3 at each end along with a locking mechanism . said locking mechanism may be nut not limited to a screw mechanism or bolting mechanism which may also be unlocked as commonly known to persons skilled in the art . additionally the center portion of the center piece includes an adjustable tension mechanism 1 to provide resistance to the bar being contorted from its linear shape . the tension mechanism 1 may be but not limited to a tension spring , polymer material with high resistance to bending and returns to its original shape as commonly known in the art . the end pieces include locking mechanisms at their ends for selective engagement with the center piece . either end of each end piece can thus be the locked onto the center piece . removable end caps 5 , 11 are attached into the outer ends of the end pieces to insert additional weights . the end pieces 9 , 3 include a hand grip at each end and on the opposing end additional weights may be inserted into the body or looped onto the outer surface . these are handgrips for the user . the preferred exercise with the two end pieces detached from the center piece may be used as a weighted billy club exercise . the user may simulate traditional marital arts movements within his exercise . said end pieces are collapsible to adjust length depending on exercise or for storage concerns . the small portion of the end piece 3 inserts into the hollow of larger end piece 9 and locks into place . any form of locking mechanism as mentioned above may be utilized additionally one end piece may be selectively being attached to the center piece for additional exercises as shown in fig7 . this form allows the user to simulate exercises similar to marital arts sword exercises , baseball movements , tennis movements as well as other traditional sports or martial arts techniques . the adjustable tension mechanism along with the weight parts creates a tensional imbalance which the user must utilize additional muscle groups to control the movement of the apparatus . the center piece alone may be used for an exercise in itself . the center tensional mechanism 1 is adjustable for increasing the strengthening and toning activities . in accordance with the invention , there is provided an exercise device including a pair of nonaligned hand grips which are rotatably mounted on a nonlinear bar and tensional mechanism which may be a spring - biased to provide adjustable resistance to motion through predetermined symmetrical strokes . the device preferably includes detachable auxiliary weights 5 , 11 which enable the total weight of the device to be adjusted the spring biasing force applied to the grips is preferably individually adjustable for each grip . the orientation of the biasing means , enabling symmetrical movement of the grips against spring torsion , enables the user to move both arms and hands in identical , symmetrical motion in an exercise , with either the same force resisting torsion of each grip , or a selected difference in the tensional resistance between the two grips by adjusting proximity of said grips . the further the distance of the grips from each other , the more reduced the tension of the spring . the springs are preferably coil springs which are disposed within the respective grips . in accordance with one feature of the invention , the grips are biased for rotation by a pair of torsion springs disposed internally of the grips to apply torque to the grips such that the grips may be reciprocated symmetrically with respect to one another . the center piece as shown in fig5 allows the user to simulate martial art techniques with additional resistance and user added weights . said martial art techniques may also be in the form of nun chuck exercises . additionally with both end pieces attached to the center piece as shown in fig6 , exercises similar to martial arts staff techniques and traditional aerobic movements like rowing may be simulated additionally with an unstablized core created by the tensional mechanism creates more challenges during the movements . additionally users may add additional weight onto said staff further enhancing said workout . said entire center piece may be collapsible within the center hollow of the end pieces . additionally the end pieces collapse into themselves reduces the length of the end pieces by half . in fully collapsed form said apparatus can be easily stored . workouts may also be done with the apparatus in different collapsed stages . for aerobic movement , the bar is used with un - weighted end pieces of weight w and center piece of weight m . for muscle toning activity , weighted pieces are used , up to a maximum of five additional pounds in the center piece and each end piece . the end caps are rubber tipped to provide friction for a non - slip use of the bar , as where the bar is used as a support . the exercise bar is a multi - purpose exercise and fitness device . it is used as a non - weighted bar for aerobic movements and routines . it is used as a weighted bar for specific muscle strengthening and toning activity . the foregoing description of a preferred embodiment of this invention , including any dimensions , angles , or proportions , is intended as illustrative . the concept and scope of the invention are limited only by the following claims and equivalents thereof . | US-97330307-A |
a shirt collar in which the material forming at least the neckband , but alternatively both the neckband and the collar , is arranged with the weave thereof on a bias so that in the event the length of the threads shrinks there is only a negligible reduction in the circumferential size of the collar , and the collar is stretchable in a direction parallel to the circumferential direction . the stitching that forms the seams attaching the collar to the neckband , and the neckband to the body of the shirt , may be applied in a pattern , e . g ., zig - zag or skip stitching , that enables the seams to stretch in the circumferential direction of the collar . | referring more specifically to the drawings , a prior art shirt is indicated generally at 5 in fig1 . in this shirt , the threads 6 in the neckband 11 run “ north - south ”, or circumferentially and perpendicular to the circumference , respectively . with this arrangement , if the threads shrink when the shirt is laundered , the length of the threads can decrease from three to five percent . this can result in a reduction in circumference of the collar of more than one - half inch . a shirt incorporating the invention is indicated generally at 10 in fig2 . in this shirt , the threads 9 of the neckband 11 are placed on a bias , i . e ., rather than run north - south , the threads extend at approximately 45 ° to the circumference . the neckband is sewn to the body 12 of the shirt , and a collar 13 is sewn to the neckband . the threads of the collar need not be placed on a bias , but may extend conventionally in a north - south direction . a collar button 14 and button hole 15 in opposite ends of the neckband are utilized to hold the collar in closed position about the neck of the wearer . the present invention differs significantly from conventional shirts in the orientation of the weave of the fabric forming the neckband to minimize or eliminate shrinkage , and in the provision of additional means to insure that the collar can expand or adapt to slightly different neck sizes . this enables shirts to be made and stocked in fewer sizes , and insures that a shirt will remain comfortable to wear even when the neck size of the wearer changes slightly , or in the event that the shirt should shrink when laundered . with the threads forming the material of the neckband extending at an angle to the longitudinal axis or circumferential direction of the collar , the material will not shrink noticeably in a circumferential direction even if the threads shrink in length , and the neckband is enabled to flex or stretch when force is applied in a direction parallel to the longitudinal axis or circumference of the collar . in a preferred embodiment , the threads forming the weave extend at 45 ° to the longitudinal axis of the collar , but the broad objective of the invention can be achieved if the threads extend at an angle in the range of from about 10 ° to about 80 ° relative to the longitudinal axis of the collar . clearly , however , less shrinkage occurs in a circumferential direction , and greater flexibility is achieved when the weave is on a bias of about 45 °. in conventional shirts , the material of the collar and neckband is oriented so that the weave is orthogonal relative to the longitudinal axis or circumferential direction of the collar . in other words , the threads forming the material extend parallel and perpendicular , respectively , to the longitudinal axis of the collar . see fig1 . in this orientation , if the length of the threads decreases due to shrinkage , the circumference of the collar also decreases the same amount . further , the material does not flex or stretch any significant amount when force is applied , since the force is in a direction parallel to the direction of the threads . in the invention , in addition to orienting the material of the neckband so that the weave is at an angle relative to the longitudinal axis of the collar , the seams that secure the collar and neckband together , and that secure the neckband to the body of the shirt , may be formed by using stitching that enables the seams to stretch or expand in the circumferential direction of the collar . further , the threads in the material forming the collar may be arranged on a bias as shown in fig3 if desired . however , this is not necessary , and the weave or threads of the collar may extend north - south , as shown in fig2 . as depicted in fig3 and 10 , the stitching 16 securing the collar 13 to the neckband 11 , and the stitching 17 securing the neckband to the body 12 of the shirt , may comprise an interrupted zig - zag stitch . this style of stitching , together with the orientation of the material of the neckband on a bias , insures that the collar does not shrink noticeably in a circumferential direction when it is laundered , and the collar can expand or stretch in a circumferential direction when force is applied to it . the extent of expansion is substantial , with more than one inch of expansion being possible in a size sixteen collar . many dress shirts have interfacing between the inner and outer layers of the collar , and / or between the inner and outer layers of the neckband , and this interfacing can be flexible or stiff , and can be glued to the inner layer of the collar , or stitched in the seam that joins the collar to the neckband . the interfacing in the neckband , when present , generally comprises the same material that the body of the shirt is made of . [ 0043 ] fig4 depicts an arrangement in which a layer of interfacing 18 extends between the inner and outer layers of the collar . in the embodiment shown , the interfacing is made of an open weave , mesh - like material , oriented on a bias , and with the bottom edge 19 scalloped or cut in a zig - zag pattern so that only the peaks of the edge are stitched in the seam between the collar and neckband . the stitching 20 that secures the collar to the neckband , and the interfacing at its scalloped lower edge , is shown as an uninterrupted straight stitch . however , it should be understood that any other suitable form of stitching could be employed . in this regard , it should be noted that the uninterrupted straight stitching will permit adequate stretching of the seam , but an interrupted stitch , or a stitch applied in a zig - zag pattern , will permit greater stretching of the collar . the stitching 21 shown connecting the neckband to the body of the shirt in this figure is an interrupted straight stitch , for example . alternate forms of stitching are shown in fig5 , 7 and 9 . fig5 and 7 show the neckband 11 and collar 13 turned inside - out for forming the seam between them , and in fig5 the stitching 20 comprises an uninterrupted straight stitch . in fig6 the stitching 22 comprises an uninterrupted zig - zag stitch ; in fig7 the stitching 21 comprises an interrupted straight stitch ; and in fig9 the stitching 23 for joining the neckband to the body of the shirt comprises an uninterrupted straight stitch . the invention insures that no more than negligible shrinkage will occur in a circumferential direction , and enables the collar size to increase from about one - half of an inch up to about one inch when a force is applied thereto in a circumferential direction . this resistance to shrinkage and ability to stretch enables fewer sizes to be manufactured and stocked , makes the shirt more comfortable to wear , and makes it easier to button . moreover , these benefits are accomplished without any noticeable change in the appearance of the shirt . manufacturers and / or retailers may find the invention to be desirable because it could enable them to stock fewer sizes , thereby making room for more styles . this would also reduce the number of shirts in odd sizes that are required to be stocked but that may not sell . further , the invention may be a value - added feature , enabling the shirt to be priced higher than conventional shirts . while particular embodiments of the invention have been illustrated and described in detail herein , it should be understood that various changes and modifications may be made to the invention without departing from the spirit and intent of the invention as defined by the scope of the appended claims . | US-78385301-A |
a method of ocular refractive surgery which employs heat application to reshape and enhance the refractive power of the central cornea of a surgical subject . radio frequency energy is employed to coagulate segments of corneal stroma in the perilimbal area at the pole of the corneal meridian having the lowest keratometric reading , causing the radius of curvature of the central cornea to increase in that meridian , whereby astigmatism can be safely and permanently corrected . | my method of ocular refractive surgery is different from all surgical techniques employed to correct refractive errors in an astigmatic surgical subject . radio frequency energy is employed to coagulate arcuate sections of corneal stroma tissue in the perilimbal area , at or immediately adjacent to the limbus . these arcuate sections are created at the poles of the corneal meridian having the lowest keratorefractive reading . pursuant to the principles of coupling as described in the article astigmatic keratotomy : a review of the basic concepts with case reports , by spencer p . thornton , m . d ., j . cataract refract . surg ., pp . 430 - 435 , vol . 16 , july 1990 , the coagulated corneal stroma causes an increase in the radius of curvature of the central cornea at a selected meridian , thereby increasing the refractive power of the central cornea and improving the visual acuity of the surgical subject without the use of external corrective lenses . a generator such as those presently available commercially and known in the art of ocular surgery is employed to produce radiofrequency energy to heat the corneal stroma of the perilimbal area in the eye of an astigmatic surgical subject . in the preferred embodiment , a bipolar forceps such as those typically employed in electrosurgery of the eye is coupled to the radio frequency energy source and a desired power level for coagulation is selected . it is advisable to begin with a lower power setting and adjust the intensity upward as required . however , high power levels for coagulation are not required and should be avoided as the risk of tissue damage is increased . prior to surgery , keratometric measurements of the surgical subject &# 39 ; s astigmatic cornea are meticulously evaluated and the corneal meridian having the lowest keratometric reading is determined . the generator is activated , supplying radio frequency energy to the bipolar forceps . the bipolar forceps then are manipulated to contact the perilimbal area of the surgical subject &# 39 ; s cornea at the limbus or the immediately adjacent clear cornea . the exact demarcation of the limbus is often difficult to determine due to the transitional nature of the ocular tissue in the limbal zone . the bipolar forceps contact the perilimbal area of the cornea at the poles of the corneal meridian previously determined to have the lowest keratometric reading . the radio frequency energy passing between the tips of the bipolar forceps causes heat to be generated in the underlying corneal stroma of the perilimbal area contacted . the underlying corneal stroma tissue is coagaluted in arcuate segments by contacting with the bipolar forceps the perilimbal tissue at the poles of the meridian selected and the perilimbal area adjacent to the poles . it is preferred that the length of each coagulated arcuate segment of stromal tissue be evenly divided at poles of the meridian selected . the heat generated by the radio frequency energy causes the collagen fibers of the corneal stroma beneath the perilimbal area contacted by the bipolar forceps to coagulate and shrink , thereby increasing the radius of curvature of the corneal meridian selected , resulting in an increase in the refractive power of the central cornea at the meridian selected . thus the unaided visual acuity of the surgical subject is improved . the use of the bipolar forceps permits controlled , focused application of heat and radio frequency energy to those segments of perilimbal corneal tissue at and adjacent to the selected corneal meridian poles . the localized nature of the radio frequency energy passing between the tips of the bipolar forceps inhibits current flow through the entire eye and body , greatly reducing the risk of damage due to stray current . thus , heat application is limited to coagulate and shrink only those segments of corneal stroma necessary to effect the desired degree of corneal reshaping . the perilimbal tissue is chosen as the area of heat and radio frequency energy application because the epilethilial layer and stroma layer of the cornea is thickest at the limbus . therefore the underlying endothelial layer is well - insulated and protected from the effects of the radio frequency energy and heat generated by the bipolar forceps , greatly decreasing the risk that the endothelial cells will be damaged . moreover , because the area of eye tissue coagulated is located at the outermost edge of the cornea , any potential scarring of the cornea will be least likely to cause visual distortions and the risk of induced irregular astigmatism is eliminated . keratometric readings must also be meticulously measured intraoperatively to guard against excessive over - correction of the astigmatic condition . immediately following cataract surgery , care must be taken to inflate the eye to normal pressure levels in order to observe true physiologic changes in corneal topography . the length of the coagulated arcuate segments created range between 1 mm to 6 mm . it has been observed that the radius of corneal curvature increases as the length of the coagulated arcuate segments is increased . although the coagulation of perilimbal tissue in the manner herein described effects permanent increases in the radius of curvature of the cornea , there may be a degree of regression toward the pre - operative corneal curvature . by carefully increasing the intensity of the radio frequency energy employed and by increasing the coagulated arcuate segments of the perilimbal corneal tissue , this regression can be lessened . it has been observed that an over - correction by about two diopters of corneal refractive power will counteract the regression . thus , when the regression is complete , the desired degree of permanent corneal reshaping and refractive correction is attained . although the desired degree of corneal curvature increase may be attained by coagulating perilimbal stroma at only one pole of the corneal meridian selected , most surgical cases will require heat application at both poles . the application of heat in the manner described herein will cause coagulation and whitening of epithelial cells in the cornea of the perilimbal area contacted by the bipolar forceps . however , these epithelial cells quickly regenerate such that within only a few days after the procedure is performed , no physiologic changes to the eye are visible by slit slamp examination and the eye is completly healed . because the heat application is effected at the thickest region of the cornea , the risk of induced irregular astigmatism is eliminated . other techniques employing heat to coagulate stromal tissue have an increased risk of induced irregular astigmatism because stromal tissue can be coagulated in the thinner , more centrally located areas of the cornea . moreover , my method of ocular refractive surgery does not require that the cornea be incised or punctured , greatly reducing the risk of post - operative infection and eliminating the risk of the scarring and weakening of the cornea that can be caused by invasive incisions and puncture wounds . accordingly , the reader will see that the method of ocular refractive surgery of this invention provides a safe , efficient , economical means for ocular surgeons to correct astimatisms in surgical subjects by the application of heat to the corneal stroma . when the method described above is implemented , permanent correction of refractive error due to astigmatisms can be attained and the ocular tissue of the surgical subject will be completely healed after only a few days post operation . further , this invention has further advantages in that : it does not require invasive incisions nor puncture wounds to be made in the cornea ; it eliminates or reduces dependence on external corrective lenses to correct refractive errors due to astigmatism ; it provides an ocular refractive surgical method which can easily be employed in conjunction with other surgical procedures ; it provides a method of correcting astigmatism by applying heat to the corneal stroma which does not cause scarring and clouding of the cornea ; it provides a method of heating corneal stroma tissue to correct astigmatism which greatly reduces the risk of heat - related damage to the non - regenerative endothelial cell layer of the cornea ; it provides a method of heating corneal stroma tissue to correct astigmatism which does not induce irregular astigmatisms ; it provides a method of heating corneal stroma tissue to correct astigmatism which does not require the passage of electric current through the entire eye , reducing the risk of damage to the cornea , retina , and optic nerve ; although the description above contains many specificities , these should not be construed as limiting the scope of the invention , but as merely providing illustrations of some of the presently preferred embodiments of this invention . for example various energy sources such as a cautery probe or a monopolar electrode may be employed to heat stromal tissue in the perilimbal area . moreover , full correction of an astigmatic cornea may be attained by coagulating tissue at only one pole of the corneal meridian having the lowest keratometric reading and the arcuate segments of coagulated stromal tissue may be varied in length to effect the desired degree of refractive correction . thus , the scope of the invention should be determined by the appended claims and their legal equivalents , rather than by the examples given . | US-18676494-A |
a drive mechanism for use with an elongated medical implement comprises a motor , a first pulley mechanically coupled to the motor , and a second pulley . the drive mechanism further comprises a connector mechanically coupled to the second pulley . the connector is configured for laterally receiving the medical implement . the drive mechanism further comprises a belt wrapped around the first and second pulleys to transmit force from the motor to the connector . a robotic medical system comprises a user interface configured for receiving at least one command , a drive mechanism including a motor and a connector configured for laterally receiving the medical implement , and an electrical controller configured for directing the motor to cause the drive mechanism to move the medical implement within at least one degree - of - freedom . | a description of preferred embodiments of the invention follows . referring to fig1 there is shown a catheter system 5 including three separate catheter shafts 10 , 20 , and 30 , with an end effector 12 supported at the distal end of the catheter shaft 10 . the end effector 12 may be , for example , an articulated tool such a grasper with a pair of jaws 12 a and 12 b that pivot about a joint 15 to grasp an item between the two jaw members . other articulated tools that may be used as the end effector 12 include scissors , needle holders , micro dissectors , staple appliers , tackers , suction irrigation tools , and clip appliers . the end effector 12 can also be a non - articulated tool , such as a cutting blade , probe , irrigator , catheter or suction orifice , and dilation balloon . further details of catheter systems , particularly those relating to mechanisms for multiple degrees - of - freedom of motion of catheter shafts can be found in u . s . application ser . nos . 10 / 023 , 024 , 10 / 011 , 449 , 10 / 022 , 038 , 10 / 012 , 586 , 10 / 011 , 371 , 10 / 010 , 150 , all of which were filed nov . 16 , 2001 and are incorporated herein by reference in their entirety . each of the catheter shafts 10 , 20 , and 30 has a different diameter that is able to move with multiple degrees - of - freedom . the catheter shafts shown in fig1 are arranged in a coaxial manner with the small diameter catheter 10 positioned inside the medium diameter catheter 20 which in turn is positioned inside the large catheter 30 . the arrangement in fig1 is a coaxial arrangement with the small diameter catheter 10 adapted for sliding inside of the medium diameter catheter 20 . as illustrated in fig1 , as well as fig2 a , the catheter 30 is able to move with a linear translation in the direction 31 , while the medium diameter catheter 20 is able to slide inside the catheter 30 with a linear translation motion in the direction 21 , and the small catheter 10 is able to slide inside the medium catheter with a linear translation motion in the direction 11 . in addition to the translation motions , each of the catheter shafts 10 , 20 , and 30 is able to rotate and bend . hence , the shafts 10 , 20 , and 30 have three degrees - of - freedom of movement . the rotational motion of the catheters 10 , 20 , and 30 is indicated by the double arrows s 3r , s 2r and s 1r , respectively , and the orthogonal bending motions of the catheters 10 , 20 , and 30 are indicated by the double arrows s 3b1 and s 3b2 , s 2b1 and s 2b2 and s 1b1 and s 1b2 referring also to fig2 b , there is shown the coaxial arrangement of the catheters 10 , 20 , and 30 , as well as the rotational motions of the catheters identified by the double arrows 13 , 23 , and 33 , respectively . indicated in fig2 a are the operative segments 01 , 02 , and 03 of the respective catheters 10 , 20 , and 30 where the bending may occur in each of the catheters . as shown , this bending generally occurs near the distal end of the respective catheters . however , the operative segments may also be located at different places along each of the catheters or may not be required at all . turning now to fig3 , the multiple coaxial catheters 10 , 20 , and 30 are shown coupled to a drive system 35 . also shown in fig3 are the operative sections 01 , 02 , and 03 of the catheters 10 , 20 , and 30 , respectively , as well as the linear translational degree - of - freedom 11 , 21 , and 31 . at some position along the catheters , there is a patient interface , not specifically illustrated in fig3 but considered to be the location where the catheter enters the anatomic body . the entry of the catheter may , for example , be percutaneously , via an incision , or even through a natural body orifice . procedures to be described below are particularly adapted for transitioning a multi - shaft catheter constriction through an anatomic body vessel such as through the intestines . of course , the concepts of the illustrated embodiments may be used in association with the control and transition of the catheters through other body vessels or body cavities as well . each catheter 10 , 20 , and 30 is arranged and supported in a manner to enable multiple degrees - of - freedom of the catheter including movement of the catheter to an anatomic body target site , as well as rotation of the catheter . in particular , there are respective support blocks 40 , 50 , and 60 associated with the catheters 10 , 20 , and 30 . in the embodiment illustrated in fig3 , these support blocks 40 , 50 , and 60 are coupled to the respective proximal ends of the catheters identified as 10 a , 20 a , and 30 a . each of the support blocks controls linear translational movements of the catheters with the use of wheels 42 , 52 , and 62 . in support block 40 , there is also illustrated control of the rotational motion 46 of the catheter 10 . similarly , support blocks 50 and 60 provide rotational control 56 and 66 to the respective catheters 50 and 60 . the drive system 35 also includes an electromechanical drive member 70 coupled to the support blocks 40 , 50 , and 60 with mechanical cablings 80 , 81 , and 82 , respectively . the drive member 70 is a under the direction of a controller 72 that is also coupled to an input device 76 which interfaces the drive system 35 , and hence the catheter system 5 , with a user who is typically a surgeon . in the illustrated embodiment , the electromechanical drive member 70 is a motor array with a plurality of drive motors . the mechanical cablings 80 , 81 , and 82 provide control of the respective blocks and controls the linear and rotational movement of the respective catheters . thus , in the motor array 70 , there can be at least one motor for controlling linear translation , and a separate motor for controlling rotational translation relative to each of the support blocks . thus , when the system 35 is in use , the surgeon provides instructions to the controller 72 through the input device 72 . in turn , the controller 72 directs the operation of the motor array 70 and hence the support blocks 40 , 50 , and 60 which drive the respective catheters with multiple degrees - of - freedom of movement . the motor array 70 also includes separate motors for driving the bending movements s 3b1 and s 3b2 , s 2b1 and s 2b2 and s 1b1 and s 1b2 of the catheters as previously indicated in fig1 . in fig3 , in addition to the operative segments 01 , 02 , and 03 where the bending of the individual catheter occurs , there are also shown in cut - out cross - section in each of the catheters respective cablings c 1 , c 2 , and c 3 . these cablings extend along the length of the respective catheters and can be used for controlling the bending of the operative segments . also , cabling that extends through catheters 10 , 20 , and 30 can be used to operate the end effector 12 as well . the cabling c 1 , c 2 , and c 3 can extend through the catheters and through the corresponding support blocks , coupling through the various mechanical cablings 80 , 81 , and 82 . accordingly , there may be control motors in the motor array 70 that control the bending movements of the catheters , as well as operation of the end effector 12 . further details of mechanical cabling used for the operation of catheters including bending and flexing thereof can be found in the u . s . application ser . nos . 10 / 023 , 024 . 10 / 011 , 371 , 10 / 011 , 449 , 10 / 010 , 150 , 10 / 022 , 038 , and 10 / 012 , 586 mentioned earlier . in some embodiments , the controller 72 is a microprocessor that receives input commands from the input device 76 . the input device 76 can be one of various types of controls such as a dial , joystick , wheel , or mouse . a touch - screen can also be employed as the input device 76 to allow the surgeon to input information about the desired location of a particular portion of the catheter by touching the screen . in this regard , reference may also be made to u . s . application ser . no . 10 / 216 , 669 filed herewith , the entire contents of which are incorporated herein by reference , which describes a catheter tracking system that enables an operator at the input device to select a particular anatomic body site and direct the catheter automatically to that site . referring to fig4 and 6 , there is shown another implementation of the catheter control . here , the system employs multiple catheters with multiple balloons in combination with a control mechanism by which the balloons are inflated and deflated to move the catheters in increments through a body vessel . in fig6 , a set of catheters 110 , 120 , and 130 are located within a body vessel 100 . associated with catheter 120 is a distal balloon d . and similarly , associated with the distal end of catheter 130 is a proximal balloon p . in fig6 there are also shown ports d 1 and p 1 through which air or other fluid is introduced into each of the balloons to inflate the balloons or removed to deflate the balloons . in fig6 the proximal balloon p is shown inflated and the distal balloon d is shown deflated . note that although only two balloons are shown , one or more additional balloons can be associated with a third or even a fourth catheter . in the block diagram of fig4 there is identified an inner catheter 86 and an outer catheter 87 , which may correspond respectively to catheters 120 and 130 in fig6 . also illustrated in fig4 is an inner catheter control 84 and an outer catheter control 85 . these controls may be similar to the controls illustrated in fig3 for at least controlling the advancement in a linear manner of the corresponding catheter . thus , the catheter control 84 can be considered as controlling the linear movement of the inner catheter 86 while the catheter control 85 can be considered as controlling the linear translation of the outer catheter 87 . the outputs of a motor array 90 are coupled to the inner catheter control 84 and the outer catheter control 85 , while a controller 92 is coupled to and controls the motor any 90 . an input device 96 connected to the controller 92 provides an interface for a user such as surgeon to operate the inner and outer catheters 86 and 87 . also illustrated in fig4 is a balloon controller 94 associated with the controller 92 and that has two separate outputs coupled to the proximal , p , and distal , d , balloons . under the direction of the controller 92 the balloon controller controls the inflation and deflation of the proximal balloon p and the distal balloon d . details about the timing of the inflation and deflation sequence are illustrated in fig5 . the proximal , p , and distal , d , balloons are inflated and deflated in a sequence in association with advancement of the different catheter segments 86 and 87 . this is carried out so that the catheters can progress in increments under automatic control . hence , the surgeon or other operator need not direct the catheter continuously by hand , but instead the controller 92 initiates a sequence by which the catheter creeps or advances in increments through a vessel 100 ( fig6 ). an example of the timing sequence for the advancement of the inner and other catheters 86 and 87 of fig4 or 120 or 130 of fig6 is illustrated in fig5 . once the advancement sequence is initiated , for example , through the input device 96 , no further control via the input device is necessary . instead the controller 92 simply repeats a predetermined sequence to cause incremental movement of the catheter system through the body . fig5 depicts certain timing actions relating primarily to the inflation and deflation of the balloons , p and d , as well as the forward advancement of the catheters 86 and 87 , or 120 and 130 . in step ( a ), there is an inflation of the proximal balloon p . this causes the catheter 130 to lock against the side wall of the vessel 100 to create an anchor point for the distal end of the catheter 130 . next , in step ( b ) the inner catheter 120 is advanced by a certain amount in the vessel 100 . note that , as illustrated in fig6 , the distal balloon d is deflated , and thus is not locked in position but is readily moveable in a forward direction with the catheters 110 and 120 . in step ( c ), the process inflates the distal balloon d , which locks the distal end of catheter 120 to the inner wall of the vessel 100 . subsequently , the proximal balloon p is deflated so that it is no longer locked against the inner wall of the vessel 100 . the outer catheter 130 is then free to move . in step ( e ) the outer catheter 130 in fig6 is moved forward carrying the proximal balloon p . which has previously been deflated allowing it to move readily through the vessel 100 . after the catheter 130 and its associated proximal balloon p has moved a certain distance , then , as illustrated in step ( f ) the process again inflates the proximal balloon p , and in step ( g ) deflates the distal balloon d . once this occurs , the catheter system is then in the position illustrated in fig6 , having advanced by an incremental amount related to the length of movement of the inner and outer catheters 120 and 130 . note that the particular control illustrated in fig4 - 6 does not necessarily require the use of an input device . alternatively , if an input device is used , it can be of the type that simply initiates a sequence that is stored in the algorithm of controller 92 . hence again , in this way , once the sequence is initiated , then subsequent moves are controlled by the controller 92 and not by any specific manipulations at the input device 96 . moreover , there may also be provided a force feedback , usually associated with a distal catheter 110 . if the distal end of this catheter , or an end effector supported at the distal end , detects an obstruction or some blockage that provides a force feedback signal to the controller , then the controller may interrupt the sequence of steps depicted in the timing diagram of fig5 . this enables the surgeon to observe the position of the catheters , for example , through the use of known display techniques including fluoroscopy , ultrasound , mri , ct , or pet . referring now to fig7 , there is shown another embodiment of a catheter system having separate catheters 210 , 220 and 230 , and a detector 240 . for illustrative purposes , the catheter 220 may be considered a proximal catheter , while the catheter 210 may be considered a distal catheter . a drive system such as that shown in fig3 is used for the linear translation of the catheters . a particular feature of the catheter system shown in fig7 is a feedback signal provided to the detector 240 to indicate movement of the catheters , as well as relative movement between catheters . to accomplish this , each of the catheters 210 , 220 , and 230 is provided with indicia 211 , 221 , and 231 , respectively , that may be of the optical type . the detector 240 may be or include a counter that counts passing indicia . as an example , if the catheter 220 is stationary and the catheter 210 is being moved forward linearly , then the detector 240 such as an optical system can simply read the indicia 211 as the catheter 210 moves coaxially out of the catheter 220 . each of the indicia is separated by a predetermined length and the optical system simply reads each indicia as it moves relative to an adjacent fixed catheter to determine the overall distance of movement of the catheter system . the detection system 240 illustrated in fig7 may be used with the incremental advancement system depicted in fig4 - 6 . in connection with the balloons illustrated in fig4 and 6 , mention has been made of the incremental forward movement of the inner and outer catheters 86 and 87 , or 120 and 130 . the optical detection scheme illustrated in fig7 can be used to measure the distance of movement of either or both of the catheters . a further embodiment is illustrated in the schematic and block diagram of fig8 . unlike the drive arrangement shown in fig3 where coaxial catheters are driven from their proximal ends , the catheters 210 , 220 , and 230 shown in fig8 are driven from their distal ends . the catheter system also implements the indicia and detector 240 described with reference to fig7 . here , the catheter 220 is considered the proximal catheter and the catheter 210 is considered the distal catheter . the operation of the catheters 210 , 220 , and 230 are controlled from the drive member 160 . the drive member 160 may be placed at the master station of fig3 , or controlled from a remote location such as at the master station , usually with surgeon input control . each catheter is driven relative to an adjacent coaxial catheter member , such as catheter 220 relative to catheter 230 , with drive mechanisms 150 and 140 mounted to frame pieces 225 and 235 extending from more proximal catheters . in fig8 there are illustrated two drive blocks 140 and 150 which control the respective catheters 210 and 220 . note that the catheter system of fig8 may also include the proximal drive arrangement of fig3 for one or more of the catheters . if both proximal and distal drive is used for any one particular catheter , then the proximal drive may be considered as a “ coarse ” drive while the more distal drive may be considered as a “ fine ” drive . the drive block 140 includes wheels 142 for controlling linear translation of the catheter 210 , as illustrated by arrow 144 . in the drive block 140 there is also illustrated rotational translation of the catheter 210 , as illustrated by the arrow 146 . in a similar manner , the linear translation relating to drive block 150 is represented by wheels 152 indicated by the arrow 154 . also , with regard to drive block 150 , and catheter 220 , the arrow 156 illustrates rotational movement of the catheter 220 produced by the drive block 150 . fig8 also illustrates the feedback signal to the detector 240 to sense incremental of movement of the respective catheters . for this purpose , on each of the catheters there is provided indicia that may be of the optical type described earlier . in fig8 these are indicated as indicia 211 on catheter 210 , indicia 221 on catheter 220 , and indicia 231 on catheter 230 . the detector 240 may include a counter that counts passing indicia to indicate the liner distance of relative movement between catheters . although the drive blocks 140 and 150 are shown in a schematic fashion about each of their respective catheters , it is understood that the drive mechanisms can also be employed within the catheter construction , such as shown in fig1 , or other drives may be employed between adjacent catheters . also , the block 160 illustrated in fig8 as a drive block may in practice be cabling that connects back through the catheters to the motor array , such as the motor array 70 depicted in fig3 . in this way , at an input device , such as the input device 76 in fig3 , the surgeon can control the movement of the catheters in both a proximal manner and in a distal manner , or either manner . the feedback at detector 240 may be incorporated with the drive 160 so that the drive provides for “ fine ” movement of catheters in an incremental manner . the movement is fed back by way of detector 240 to provide for fine adjustment of the catheters , particularly the smaller diameter distal catheter 210 . mention has been made that control of the movement of the catheters can be provided at both the proximal and distal ends of the coaxial catheter system . for certain procedures , it may be advantageous to control the proximal end of the catheters , as well as directly control the movement at the distal end of the catheters . for example , fig9 depicts a coaxial catheter system extending through the aorta 300 of the heart 304 and used in a vascular artery 302 that may be considered as including a main artery and several branches of the artery that are to be negotiated by the catheter system . in the particular embodiment illustrated in fig9 the coaxial catheter system includes a large outer catheter 330 , a middle catheter 320 , and a small distal or inner catheter 310 . the distal end of the catheter 310 supports or carries an end effector 312 which may be in the form of a jaw member . for the particular system depicted in fig9 , the outer catheter 330 and the middle catheter 320 are driven from their respective proximal ends in a manner as illustrated in fig3 with the use of the input device 76 , controller 72 , and motor array 70 . to position each of the separate catheters , there is illustrated in fig9 a fixing or securing means such as balloon 332 located at the distal end of large outer catheter 330 and balloon 322 located at the distal end of the middle catheter 320 . each of these balloons may be inflated to hold its corresponding catheter in a relatively fixed position in the body vessel . alternatively , rather than the use of balloons , other securing devices may be employed such as sonic type of expandable mechanical member . regardless of the type of securing member employed , it is capable of being operated by the surgeon from a remote location at the master station , and at the appropriate time selected by the surgeon . the balloons 322 and 332 can be a single lobed balloon that totally obstructs the vessel when inflated . alternatively , the balloons may have a multi - lobed configuration as illustrated in fig9 a . the balloon 322 or 332 shown in fig9 a has three lobes 305 that when inflated in a vessel 306 allows fluid to flow in the space 307 between the lobes . the balloon 322 or 332 can have fewer or more than three lobes in other arrangements . in certain implementations , the individual lobes can be inflated independently of each other . initially , both the middle catheter 320 and the small inner catheter 310 may be in a withdrawn position , coaxially positioned within the outer catheter 330 . when the outer catheter 330 is controlled by the surgeon to be positioned in the manner illustrated in fig9 , the surgeon can then instruct the balloon 332 to inflate to secure the outer catheter 330 in the position illustrated in fig9 . the balloon 332 expands against the walls of the vessel and essentially locks the outer catheter in position , particularly at its distal end . next , under the control of the surgeon through the use of an input device , the middle catheter 320 is moved forward linearly through the vessel of the anatomy . the control of the forward movement of the catheter 320 relative to the catheter 330 may be carried out in a manner illustrated in fig3 from the proximal end of the catheter 320 . previously , mention was made that the balloon 332 is inflated to secure the outer catheter 330 . after the middle catheter 320 is moved forward some distance , then the balloon 322 may also be inflated . this procedure is under the surgeon &# 39 ; s control at the master station through the input device to now secure the distal end of the middle catheter 320 at an appropriate position within a body vessel . for “ fine ” control of the small inner catheter 310 , it is intended , in the embodiment of fig9 , that the control of the inner catheter 310 is implemented in the manner illustrated in fig8 in which the support and drive block 140 can provide direct drive of the inner catheter &# 39 ; s 310 forward linear movement out of the middle catheter 320 . although the drive is located at the distal end of the catheter , the drive is remotely controlled by the surgeon at the master station . again , this control can be by way of an input device such as an input interface or a joystick moved in a direction to cause a consequent movement of the various catheters depicted in fig9 . because of the significant length of the catheters that may be employed in a surgical procedure , it may be desirable to provide direct drive of the inner catheter 310 at its distal end , rather than drive it at its proximal end . for example , this may be particularly desirable when the length of the entire catheter system is so long that it may have some tendency to deflect or bend even when secured by , for example , the balloons 322 and 332 . after the balloons 322 and 332 are inflated , the surgeon at the master station can continue to control the forward movement of the distal end of inner catheter 310 . as indicated previously , the drive for the inner catheter 310 is typically of the type illustrated in fig8 , or in fig1 discussed below . in fig1 , the small diameter inner catheter 310 is driven relative to the middle diameter catheter 320 . the linear movement of the catheter 310 is illustrated by the arrow 352 when driven by the wheels 350 . the rotation of the catheter 310 relative to the catheter 320 is driven the block 354 , as indicated by the rotational arrow 356 . fig1 also illustrates a detector or reader 360 . this again may be an optical device that detects the passage of the indicia 311 on the inner catheter 310 . appropriate electrical signal lines coupled from the detector 360 back to the master station transmit information related to the movement of the inner catheter 310 relative to the middle catheter 320 . the detector 360 may also be used for detecting rotation of the catheter 310 relative to the catheter 320 . for this purpose , in addition to the linear set of indicia 311 on the catheter 310 , the catheter 310 is also provided with additional indicia 315 that extend about the circumference of the catheter . the reader 360 is able to read not only linear passage of indicia 311 , but also read rotation of the indicia 315 from one linear set of indicia 311 to the next . although a single detector 360 is shown in fig1 , other detectors may also be employed . for example , one detector could be used for detecting linear translation of the catheter 310 , and a second detector could be used for detecting rotation of the catheter 310 with the use of indicia 315 . the catheter drive system described above can be implemented in other configurations as well . for example , there is shown in fig1 a a catheter drive system associated with a fluid or drug delivery system . note in fig1 a , emphasis is placed on the proximal end of a catheter 1070 and guide wire 1072 . the more distal portion of the catheter is identified by the dotted lines . details of the distal portions of the catheter 1070 and guide wire 1072 can be found in u . s . application ser . no . 10 / 216 , 067 filed herewith , the entire contents of which are incorporated herein by reference . at some position along the catheter 1070 , there is a patient interface illustrated at 1074 where the catheter may be considered as entering into the patient &# 39 ; s body . the entry of the catheter may , for example , be percutaneously , via an incision , or even through a natural body orifice . a support block 1076 supports the catheter 1070 in a manner to enable at least two degrees - of - freedom of the catheter including axial movement of the catheter to an anatomic body target sit ; as well as rotation of the catheter . the support block 1076 controls both the linear translation of the catheter 1070 by the wheels 1078 , as indicated by the arrow 1079 , and the rotational translation of the catheter , as illustrated by the arrow 1080 . again , further details of such a catheter support system illustrating multiple degrees - of - freedom can be found in the u . s . patent application ser . nos . 10 / 023 , 024 , 10 / 011 , 371 , 10 / 011 , 449 , 10 / 010 , 150 , 10 / 022 , 038 , and 10 / 012 , 586 mentioned earlier . in fig1 a , there is also a block 1082 which controls the movement of the guide wire 1072 . in particular , the wheels 1084 move the guide wire 1072 in a linear manner in the direction 1085 . the block 1082 is also able to rotate the guide wire 1072 in the direction 1086 . note that the blocks 1076 and 1082 can be supported on a common support structure 1120 . although the support 1120 provides a physical connection between the blocks 1076 arid 1082 , the blocks are operated independently so that the guide wire 1072 and the catheter 1070 can be driven independently of each other . the drive or support blocks 1076 and 1082 arc coupled to an electromechanical drive member or motor array 1090 that controls the movements of both the catheter 1070 and the guide wire 1072 with at least two degrees - of - freedom . in particular , mechanical cablings 1087 and 1088 couples the motor array 1090 to the support blocks 1076 and 1082 , respectively . the motor array 1090 is also coupled to a controller 1092 that directs a plurality of motors in the motor array . an input device 1096 provides an interface to the system for use by a surgeon . the mechanical cablings 1087 and 1088 transmit the mechanical movements of the various motors in the motor array 1090 to the respective support blocks 1076 and 1082 to provide the linear and rotational movements of the catheter 1070 and guide wire 1072 . thus , in the motor array 1090 , there may be at least one motor for the linear translation and a separate motor for the rotational translation for the block 1076 . similarly , there can be motors in the motor array 1090 for both the linear and rotational translations of the support block 1082 . the controller 1092 , maybe a microprocessor that receives input commands from the input device 1096 . the input device 1096 may include various types of controls such as a dial , joystick , wheel or mouse . a touch screen may also be employed as the input device 1096 to input information about the desired location of a particular portion of the catheter . details of such a tracking system can be found in the u . s . application ser . no . 10 / 216 , 669 , mentioned earlier . such a tracking system enables an operator , such as a surgeon , through the input device to select a particular anatomic body site and direct the catheter directly and automatically to that site . although a manifold 1100 is shown with a single port , the manifold may include multiple ports . the manifold 1100 provides a delivery conduit to the catheter 1080 for the delivery of fluids to a site in the patient &# 39 ; s body . for example , one of the fluids 1105 employed may be a contrast fluid for purposes of visualization , which is coupled to a feed line 1107 by a valve a . there may also be a drug delivery system indicated generally at 1108 coupled to the feed line 1107 by way of a line 1109 to a valve b . alternatively , the manifold 1100 can be provided with two separate ports with a respective valve a and b in each of these ports . as shown in fig1 b , the manifold 1100 includes an end piece 1200 sealed to the back end of the manifold 1100 and provided with an opening 1202 through which the guide wire 1072 enters into the manifold 1100 , and hence the catheter 1070 . positioned within the manifold 1110 and adjacent to the end piece 1200 is a gasket 1204 . the guide wire 1072 pierces the gasket 1204 such that the gasket forms a seal about the guide wire . thus , as fluid enters from the feedline 1107 into the manifold 1100 , the gasket 1204 prevents the fluid from leaking out the back end of the manifold 1100 . as indicated previously , the input device 1096 may take on a variety of different forms . if a wheel , dial , or pivoting switch is employed as the input device 1096 , then one of these may be used for controlling the two degrees - of - freedom of movement of the catheter 1070 , while another such device is used to control the two degrees - of - freedom of movement of the guide wire 1072 . thus , the operator has independent control of the drive or support blocks 1076 and 1082 byway of the input device 1096 . this permits the operator to selectively move the guide wire 1072 and the catheter 1070 independently of each other . typically , the operator advances the guide wire 1072 a certain distance , and then the catheter 1070 , such that the guide wire 1072 can be used to access certain twists or turns in a body lumen such as an artery or vein . the input device 1096 may also operate means such as buttons , switches , etc . that provide signals through lines 1111 and 1112 to the respective valves a and b for controlling the dispensing of liquids from the fluid sources 1105 and 1108 . although shown coupled to the controller 1092 , the lines 1111 and 1112 can be coupled directly to the input device 1096 in other implementations . when the system is in operation , the surgeon advances the catheter 1070 and guide wire 1072 through the patient &# 39 ; s body with the drive system . to provide visualization of the end of the catheter , the surgeon can instruct , with the input device 1096 , the valve a to open . that is , the surgeon interfaces with the system through the input device 1096 to generate a signal on line 1111 that opens the valve a to dispense a contrast fluid through the manifold 1000 and the catheter 1070 to the target site of interest . similarly , the surgeon may deliver drugs to the target site by instructing the valve b to open which would allow drugs from the source 1108 to flow through the catheter 1070 into the body . in the following discussion , greater detail will be provided about the drive mechanisms ( fig1 - 16 ) and various devices ( fig1 - 19 ) used to couple the medical instruments to the drive mechanisms . although the drive mechanisms and connectors are described in reference to the catheter 1070 and guide wire 1072 discussed above , they can be used in any number of combinations with any of the other medical instruments described earlier . the catheter 1070 referred to in these figures is of the type commonly used in angioplasty . the catheter 1070 includes a first leg 1300 joined with a second leg 1302 at a coupler 1304 , and a single extended leg 1306 that extends from the coupler 1304 . typically , a part or much of the extended leg 1306 is the portion of the catheter 1070 that is inserted into the patient . the leg 1302 is connected to an end piece 1305 through which the guide wire 1072 is inserted such that the guide wire 1072 typically extends from outside the end piece 1305 through the legs 1302 and 1306 . as are the legs 1302 and 1306 , the leg 1300 is hollow to allow the transmission of a liquid or gas through the leg 1306 to the surgical site . hence , the leg 1300 would function in much the same way as the feedline 1107 shown in fig1 . the leg 1300 is also provided with a valve 1307 that controls the delivery rate of the liquid or gas , and prevents the liquid or gas from escaping once the liquid or gas source is disconnected from the leg 1300 . note that a gasket is typically located in the coupler 1304 or the end piece 1305 that forms a seal with the guide wire 1072 to prevent the liquid or gas from escaping out the opening of the end piece 1305 . referring now to fig1 and 12 a , the drive or support block described earlier is identified as drive mechanism 1308 a associated with the catheter 1070 . as can be seen in fig1 a , which is a view of the drive mechanism along the length of the leg 1306 , the drive mechanism 1308 includes a gripping device 1310 in which the catheter 1070 is secured , and a motor 1312 . a belt 1314 is wrapped around pulleys 1315 a and 1315 b of the motor 1312 and gripping device 1310 , respectively . hence , as the motor 1312 rotates , this rotary motion is transmitted to the gripping device 1310 through the belt 1314 as indicated by the double arrow 1316 , such that the catheter 1070 rotates accordingly as indicated by the double arrow 1318 ( fig1 ). as shown in fig1 , a similar type of drive mechanism 1308 b can be coupled to guide wire 1072 to provide it with a rotary motion as indicated by the double arrow 1318 b . in addition , the drive mechanisms 1308 a and 1308 b shown in fig1 also provide the catheter 1070 and guide wire 1072 with linear motion as indicated by the double arrows 1319 a and 1319 b ( referred to generally as direction 1319 ), respectively . in certain embodiments , as shown in fig1 , the drive mechanisms 1308 a and 1308 b are supported on and slide back and forth along respective rails 1350 and 1352 . to move the drive mechanisms 1308 a and 1308 b ( referred to generally as drive mechanism 1308 ) linearly in the direction 1319 , various configurations can be used as illustrated in fig1 a , 15b , and 15 c . referring in particular to fig1 a , there is shown a lead screw drive arrangement 1360 with a threaded connector 1362 attached to the drive mechanism 1308 . a lead screw 1364 is threaded through the connector 1362 and coupled to a stationary motor 1366 . accordingly , rotary motion of the lead screw 1364 induced by the motor 1366 in the direction 1368 results in a linear motion of the connector 1362 . since the connector 1362 is attached to the drive mechanism 1308 , linear motion of the connector 1362 produces a consequent linear motion of the drive mechanism 1308 in the direction 1319 . referring now to fig1 b , there is shown a rack and pinion drive arrangement 1370 for moving the drive mechanism 1308 in a linear manner . the rack and pinion drive 1370 includes a rack 1372 attached to the drive mechanism 1308 , and a pinion 1374 coupled to a stationary motor 1376 . the teeth of the pinion 1374 engage with those of the rack 1372 such that as the motor 1376 rotates the pinion 1374 in the direction 1378 , the rack 1372 and hence the drive mechanism 1308 moves linearly back and forth in the direction 1379 . turning now to fig1 c , there is illustrated yet another configuration for moving the drive mechanism 1308 linearly . in particular there is shown a belt / pulley drive 1380 that includes a belt , chain or cable 1382 wrapped around a pulley 1386 and a motor pulley 1384 coupled to a stationary motor . the belt , chain , or cable 1382 is attached in turn to the drive mechanism 1308 with a connector 1388 . hence , rotary motion of the motor pulley 1384 produced by the motor is transformed into a linear motion of the connector 1388 . thus , as the motor rotates the motor pulley 1384 , the drive mechanism 1308 moves back and forth in the direction 1319 . greater detail of the catheter 1070 and guide wire 1072 arrangement of fig1 is illustrated in fig1 , and that of the drive mechanism 1308 is shown in fig1 a and 16b . in particular , the catheter 1070 and guide wire 1072 are shown as a typical “ off - the - shelf ” apparatus coupled to a base unit 1400 . that is , the base unit 1400 is meant to be easily coupled to and decoupled from any number of medical instruments , such as the catheter 1070 and guide wire 1072 combination . in other implementations , such as some of those described earlier , the medical instrument and base unit is considered as a single instrument not to be decoupled from each other . referring now in particular to fig1 a and 16b , in addition to the features illustrated in fig1 a , the drive mechanism 1308 includes a housing 1401 which encloses much of the moving parts of the drive mechanism 1308 . as described before , rotary motion of the motor 1312 is transferred by the belt 1314 to the guide wire 1072 or the leg 1306 of the catheter 1070 via the pulley 1315 b coupled to the gripping device 1310 ( fig1 a ). the pulley 1315 b itself is supported in the housing 1401 with a pair of bearings 1402 . turning now to the discussion of the connector 1310 , to facilitate coupling the catheter 1070 and the guide wire 1072 to their respective drive mechanisms 1308 , many types of connectors can be used . in some implementations , a toohy borst type of fitting may be optimal . another type of connector 1310 is shown in fig1 a , in which the leg 1306 or guide wire 1072 would be placed in an enlarged portion 1500 of a slot 1502 . a clamping force 1504 would then be provided to secure the leg 1306 or guide wire 1072 to the drive mechanism . for example , as shown in fig1 b , the clamping force could be provided with a thumb screw 1506 threaded into a block 1508 in which the connector 1310 is mounted . in another type of arrangement shown in fig1 c , a sliding ring 1510 is fifted over the connector 1310 in the direction 1512 . the clamping force can also be provided by a vise like device that functions similar to a collet / pin vise . in another embodiment , as shown in fig1 a , the connector 1310 and the pulley 1315 b are one and the same device . here , the leg 1306 or guide wire 1072 snaps into an enlarged portion 1520 of a slot provided in an extended segment 1522 of the connector device 1310 . since , the enlarged portion 1520 is slightly smaller than the diameter of the leg 1306 or the guide wire 1072 , the legs 1524 of the segment 1522 provide a sufficient clamping force to the leg 1307 or guide wire 1072 . in this arrangement , the belt 1314 is wrapped around the pulley 1315 a of the motor 1312 and attaches to the two curved segments 1526 of the connector 1310 . thus , rotary motion of the pulley 1315 a produces a rotary motion of the connector 1310 , and hence the leg 1306 or guide wire 1072 , indicated by the double arrow 1318 . referring now to fig1 , 19a and 19 b , there is shown another embodiment of the connector 1310 . in this embodiment , the connector 1310 includes an inner 1550 and an outer 1552 c - shaped rings . to grasp the leg 1306 or guide wire 1072 , the outer ring 1552 is slid over the inner ring 1550 in the direction 1554 . the guide wire 1072 or the leg 1306 of the catheter 1070 is placed in the inner ring 1550 , and the outer ring 1552 is then rotated or twisted in the direction 1556 around the inner ring 1550 , thereby capturing the leg 1306 or guide wire 1072 . alternatively , the leg 1306 or guide wire 1072 can first be placed in the inner 1550 and outer 1554 rings , and then the outer ring 1554 can be rotated about the leg or catheter and subsequently slid over the inner ring 1550 . yet another embodiment of the connector 1310 is shown in fig2 a and 20b . in this embodiment , the connector 1310 includes a pin vise 1600 provided with slot 1602 cut along its length , and a sleeve 1604 that is threaded onto the pin vise 1600 . the pin vise is operated by turning the sleeve 1604 so that as it threads onto the vise 1600 in the direction 1606 which causes the slot 1602 to narrow . thus to secure the leg 1306 or guide wire 1072 to the drive mechanism 1308 , the leg or guide wire is first placed into the slot 1602 as shown in fig2 b . the operator then rotates the sleeve 1604 to thread it over the pin vise 1600 , and hence to close the slot 1602 about the leg or guide wire until the pin vise is sufficiently tightened about the leg 1306 or guide wire 1072 . this invention can be implemented and combined with other applications , systems , and apparatuses , for example , those discussed in greater detail in u . s . provisional application no . 60 / 332 , 287 , filed nov . 21 , 2001 , the entire contents of which are incorporated herein by reference , as well as those discussed in greater detail in each of the following documents , all of which are incorporated herein by reference in their entirety : u . s . application ser . no . 09 / 783 , 637 , filed feb . 14 , 2001 , which is a continuation of pct application serial no . pct / us00 / 12553 filed may 9 , 2000 , which claims the benefit of u . s . provisional application no . 60 / 133 , 407 , filed may 10 , 1999 ; u . s . application ser . no . 10 / 208 , 807 , filed jul . 29 , 2002 , which is a continuation of u . s . application ser . no . 09 / 827 , 503 , filed apr . 6 , 2001 , which is a continuation of u . s . application ser . no . 09 / 746 , 853 , filed dec . 21 , 2000 , which is a divisional of u . s . application ser . no . 09 / 375 , 666 , filed aug . 17 , 1999 , which is a continuation of u . s . application ser . no . 09 / 028 , 550 , filed feb . 24 , 1998 , pct application serial no . pct / us01 / 11376 filed apr . 6 , 2001 , which claims priority to u . s . application ser . no . 09 / 746 , 853 , filed dec . 21 , 2000 , and u . s . application ser . no . 09 / 827 , 503 , filed apr . 6 , 2001 ; u . s . application ser . nos . 10 / 014 , 143 , 10 / 012 , 845 , 10 / 008 , 964 , 10 / 013 , 046 , 10 / 011 , 450 , 10 / 008 , 457 , and 10 / 008 , 871 , all filed nov . 16 , 2001 , and all of which claim benefit to u . s . provisional application no . 60 / 279 , 087 , filed mar . 27 , 2001 ; u . s . application ser . no . 10 / 077 , 233 , filed feb . 15 , 2002 , which claims the benefit of u . s . provisional application no . 60 / 269 , 203 , filed feb . 15 , 2001 ; u . s . application ser . no . 10 / 097 , 923 , filed mar . 15 , 2002 , which claims the benefit of u . s . provisional application no . 60 / 276 , 151 , filed mar . 15 , 2001 ; u . s . application ser . no . 10 / 034 , 871 , filed dec . 21 , 2001 , which claims the benefit of u . s . provisional application no . 60 / 257 , 816 , filed dec . 21 , 2000 ; u . s . application ser . no . 09 / 827 , 643 , filed apr . 6 , 2001 , which claims the benefit of u . s . provisional application no . 60 / 257 , 869 , filed dec . 21 , 2000 , and u . s . provisional application no . 60 / 195 , 264 , filed apr . 7 , 2000 . while this invention has been particularly shown and described with references to preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims . for example , although a detector for sensing relative movement between adjacent catheters has been described , a detector for sensing movement of any one or more of the catheters relative to a base position that may or may not be a location on a particular one of the catheters can be employed . also described herein is the use of cabling through the catheters for controlling the movement of the catheters . in certain embodiments a piezo - electric arrangement may be employed in which electrical signal wires would extend through the catheter system for actuation of a mechanical ( piezoelectric ) member to provide motion of the distal end of the catheter . | US-2394308-A |
a bone cement mixture comprised of a polymer component containing an x - ray contrast medium and a monomer component , wherein the x - ray contrast medium is a polymer or copolymer having compounds of radio - opaque elements bonded thereto , or is in the form of substantially spherical polymer or copolymer particles with radio - opaque inorganic nano - particles dispersed therein . | bone cement mixtures containing such x - ray contrast agents , wherein said mixtures are composed of a polymer component and a monomer component , with the polymer component comprising polymers and / or copolymers , are prepared pursuant to the invention in that during preparation of the polymers and / or copolymers a polymer and / or monomer containing radio - opaque elements or radio - opaque inorganic nano - particles with a particle size of 3 – 15 nm are added . when the x - ray contrast agent is produced by polymerizing zirconyl - di - methacrylate and / or other methacrylates containing zirconium and / or other radio - opaque elements into a polymer or copolymer , x - ray contrast agents or bone cement mixtures prepared this way contain no mineral components that cause the above - mentioned disadvantages since the resulting x - ray contrast agent pursuant to the invention is produced as a polymer or copolymer . even when the x - ray contrast means contains radio - opaque inorganic nano - particles of a particle size of 3 – 15 nm with an outer polymer layer are problems caused by abrasion avoided . it has proven useful that the x - ray contrast medium contains zirconium and / or barium and / or other radio - opaque elements , in particular zirconyl - di - methacrylate and / or other methacrylates containing zirconium and / or other radio - opaque elements . in particular zirconyl - di - methacrylate is polymerized into the polymer or copolymer and added to the polymer component . polymer or copolymers containing barium and / or zirconium and / or radio - opaque elements can be used pursuant to the invention as radiographic contrast media in bone cement mixtures . when the x - ray contrast agent is introduced into the ( co ) polymer as inorganic nano - particles , it has proven useful if the inorganic nano - particles are surface - modified , preferably with suitable silanes known to the expert . the nano - particles can have spherical , ellipsoid , plate - like or irregular shapes . the inorganic nano - particles preferably consist essentially of zro 2 . a monomer component common in bone cements is used as the monomer component . the polymer component is produced from a copolymer with 20 % zirconyl - di - methylacrylate and an initiator , which represents approximately 1 % of the polymer component . in a second example , the polymer component is made from a copolymer with 40 % zirconyl - di - methacrylate , a polymer made of polymethyl - methacrylate or copolymers and an initiator , wherein the copolymer containing zirconyl - di - methacrylate represents 50 %, the polymer 49 % and the initiator 1 % of the overall component . a third example contains the same components as the second example , wherein the copolymer contains an 80 % portion of zirconyl - di - methacrylate and represents 25 % in the overall mixture of the polymer component , while the polymer represents 74 % and the initiator 1 %. instead of the zirconyl - di - methacrylate other zirconium - containing acrylates can be used as well . the opacity of the material can be adjusted with the zirconium ( or barium ) content . a bone cement mixture pursuant to the invention with inorganic nano - particles of a particles size of 3 – 15 nm can be obtained for example by using a monomer component conventionally used for bone cements as the monomer component , and by introducing therein a polymer component with ( co ) polymer particles with radio - opaque inorganic nano - particles dispersed therein . the ( co ) polymer particles with radio - opaque inorganic nano - particles dispersed therein are prepared in advance by subjecting monomers to suspension polymerization in the presence of coated or uncoated zro 2 particles of the particle size 7 nm . this creates spherical polymer or copolymer particles with radio - opaque inorganic nano - particles dispersed therein . the percentage of zro 2 particles present in the ( co ) polymer that is obtained this way is e . g . 15 %. the polymer component for the bone cement is now prepared from the above - described spherical polymer or copolymer particles with the radio - opaque inorganic nano - particles dispersed therein and an initiator , which represents about 1 % of the polymer component . in another example for a bone cement mixture with inorganic nano - particles of the particle size 3 – 15 nm , a monomer component common for bone cements is used . the polymer component consists of ( co ) polymer particles with radio - opaque inorganic nano - particles dispersed therein and of spherical polymer or copolymer particles without radiographic contrast medium and of an initiator . the ( co ) polymer particles with radio - opaque inorganic nano - particles dispersed therein are prepared in advance by subjecting conventional monomers to suspension polymerization in the presence of coated or uncoated zro 2 particles of the particle size 7 nm . this creates spherical polymer or copolymer particles with radio - opaque inorganic nano - particles dispersed therein . the portion of zro 2 particles dispersed in the ( co ) polymer obtained this way is e . g . 30 %. the polymer component for the bone cement is now prepared from the above - described spherical polymer or copolymer particles with radio - opaque inorganic nano - particles dispersed therein at a ratio of 50 % and spherical polymer or copolymer particles without radiographic contrast medium at a ratio of 49 % and an initiator , which represents roughly 1 % of the polymer component . by adding non - radio opaque ( co ) copolymer , the radio - opacity of the bone cement mixture can be adjusted such that the radio - opacity level corresponds to an amount of about 5 – 45 %, preferably 8 – 16 % x - ray contrast medium in the polymer component of the bone cement . | US-42533703-A |
the invention relates to an improved hygienic packaging unit including a strip being arranged in a v - folded assembly , such strip having a sealed enclosure having a protective upper and lower layers wherein it is possible to separate the layers and expose the contents of the enclosure in a single fluid movement . in addition , the described packaging unit allows the sealed enclosure to be opened by using only one hand . preferably , a plurality of packaging units are connected end - to - end and stacked in a z - folded assembly within a dispenser which facilitates the release of individual packaging units . | the packaging unit of the present invention may be applied to most forms of sterile medical dressing but can equally be utilized for almost any small object which is sealed between two outer protective strips . various embodiments of the present invention are described hereinafter with reference to the figures . it should be noted that the figures are not drawn to scale . it should also be noted that the figures are only intended to facilitate the description of specific embodiments of the invention . in addition , an aspect described in conjunction with a particular embodiment of the present invention is not necessarily limited to that embodiment and can be practiced in any other embodiments of the present invention . referring now to the invention in more detail , fig1 shows a top perspective 10 and side view 12 of the simple packaging unit 14 , demonstrating the z - fold aspect which allows the distal tab 16 and proximal tab 18 to protrude in opposite directions . fig2 shows a top view 20 and side view 21 of the packaging system ready to be opened with the contents held inside the sealed enclosure 22 of the packaging unit 14 . the enclosure is formed between an upper layer 23 and lower layer 24 of the packaging . although not shown in fig1 and 2 , it will be readily apparent to those skilled in the art that the packaging can be manufactured from a continuous strip of the same material . preferably , such material may be comprised of plastic ( e . g . pvc ) or tear resistant paper . in preparing the packaging , the material strip 25 is folded at the v - folded edge 27 around the item to be enclosed and the two side enclosure edges 26 and one top enclosure edge 28 are then sealed with sealing means , such as heat sealing , to form the enclosure 22 . crucially , the distal tab 16 and proximal tab 18 is left protruding from the end of the package 14 which has been sealed , and the proximal tab 18 is folded back onto the upper layer 23 of the enclosure 22 to form the flattened z - fold . however , it will be apparent to those skilled in the art that the distal tab 16 could also be folded back in a similar manner to form an inverted z - fold , in which case reference to the distal and proximal tab is exchanged . this leaves the sealed enclosure 22 in the centre with two tabs pointing in opposite directions ready to be pulled apart to open the packaging . in a single unit , the distal tab 16 is left long enough to protrude beyond the end of the folded and sealed part of the package 14 to provide an easy element to grip . fig3 shows an angled view of a packaging unit 14 in the first stage of opening the enclosure 22 containing an adhesive bandage 30 . the material strip is pulled from the proximal tab 32 to open the enclosure . in this particular embodiment , a protective tab 34 covering part of the adhesive bandage is attached to the upper layer 23 of the packaging 14 , thus ensuring the adhesive bandage can be applied to a wound . fig4 shows the packaging unit 14 open with protective tabs 40 covering the adhesive bandage and its adhesive surfaces , which are attached to the lower layer of the packaging . in this case , the protective tabs have not been removed when the enclosure is opened . fig5 shows the packaging unit 14 open with an adhesive bandage 51 , which has one of its protective tabs 50 removed by being attached to the upper layer and the other protective tab 52 still attached to the adhesive bandage 51 . preferably , the protective tab 50 is attached to the upper layer with adhesive means , such as gum arabic , such adhesive means being stronger than the adhesive force of the protective tab 52 to the adhesive bandage . fig6 shows the packaging unit 14 open with an adhesive bandage 60 which has a single protective tab 62 removed , presenting the sterile dressing 64 to be placed over a wound using the adhesive surface 66 . an additional significant benefit of this design is that it obviates the necessity for the user to remove the protective tabs with their fingers or even to place their fingers anywhere near the antiseptic dressing and thus greatly reduces the risk of cross - contamination of the dressing with dirt or bacteria before it is applied . alternatively , there are no protective tabs covering the adhesive bandage , but instead the upper layer 23 of the material strip 25 has means for ensuring the adhesive bandage 51 is kept sterile , such as a silicon layer . fig7 shows a perspective view of a plurality of packaging units 70 which are attached to a dispensing container 72 . the enclosure 22 of the material strip 25 may be opened by pulling on the proximal tab 78 . the packaging unit 70 can also be removed by tearing along the perforated edge 76 adjacent to the distal tab 77 . in this particular embodiment , proximal tab 78 is longer and has a protruding tab 74 which is folded outwards , which allows it to be gripped more easily by a user . preferably , the force required to pull on the distal tab 77 to open the enclosure 22 is less than the force required to tear the perforated edge 76 . this allows the enclosure 22 to be opened with one hand before removing the packaging unit 70 by tearing the perforated edge 76 . where the enclosure 22 contains an adhesive bandage , this allows the entire packaging unit to be applied to a wound with one hand , as illustrated in the description of fig1 - 13 below . although the dispensing container 72 illustrates a particular embodiment with multiple packaging units 70 dispensed from a stack , it will be apparent to those skilled in the art that different widths , sizes or types of content are easily dispensed alongside each other from a dispensing container 72 . fig8 shows a perspective view of a packaging unit 14 after being partially opened by pulling on the proximal tab 80 which exposes an adhesive bandage 82 contained within the enclosure 84 . the adhesive seal around the perimeter has been broken at the top enclosure edge 86 but is still intact at the side enclosure edges 88 . fig9 shows a perspective view of a packaging unit after being opened further with the dressing 92 becoming exposed as the seals are broken along the two outside edges 94 . fig1 . shows a perspective view of a packaging unit 14 which is attached to a dispensing container 104 after it has been completely opened and presenting an adhesive bandage 100 . in this particular embodiment one of the protective tabs 102 is still covering half the adhesive bandage . the material strip can be removed with one hand by tearing along the perforated edge 106 when holding the proximal tab 108 . the dispensing container has a loop of material 107 attached to the same end as the distal tabs to enable it to be attached to a door handle , hook , wall or other piece of furniture . fig1 - 13 show the stages in applying an adhesive bandage which has been opened and presented to a wound using the dispenser system described herein , in this case on the index finger of the user &# 39 ; s left hand . it should be noted that this being a fairly typical wound creates a clear advantage in being able to open , present and apply an adhesive dressing using only one hand ( in this case the right hand ). in fig1 , the proximal tab 110 of the packaging unit 14 is held between a finger and thumb of one hand having unfolded and opened up the enclosure . the adhesive surface 119 of the adhesive bandage is exposed and presented facing upwards but still tacked to the lower layer 114 underneath to hold it in place whilst it is being positioned . the adhesive dressing 116 has also been exposed and is presented ready to apply to the wound . the distal tab 118 of the material strip may still be attached to either a stack or continuous roll of packaged plasters which are in turn held in a box which can be hung from a convenient item such as a door handle , thus facilitating the single - handed operation as shown here . the injured finger in this case is first applied to the proximal end of the adhesive part of the bandage with the wound facing towards the sterile dressing 116 and pressed against the adhesive surface 119 . fig1 shows the second stage of a user applying the packaging unit 14 to a wound . by rolling the finger up along the material strip 120 , or alternatively simply wrapping the material strip 120 around the finger , the adhesive bandage 121 is simultaneously detached from the packaging unit 14 and adheres to user &# 39 ; s finger 122 , with the adhesive dressing ( not shown ) now applied to the wound and the second side of the adhesive surface 124 being pressed up against the finger to secure it in place . fig1 shows the third and final stage in applying an adhesive bandage 121 which has been opened and presented using the using the system described herein . the adhesive bandage 121 is now neatly applied to the finger 130 having used only one hand and without the necessity of ever touching or getting near the adhesive surfaces or adhesive dressing ( except where applied directly to the wound ). an adhesive or tacky material 132 ( e . g . gum arabic or similar ) which was used to hold the adhesive bandage in position on the material strip 134 while being applied , can be seen still attached to the packaging unit 14 . the material strip 134 itself is now ready to be disposed of and if required can be torn from a continuous strip or stack of other items along a perforated edge ( not shown ) adjacent to the distal tab 136 . fig1 shows the dispensing container 144 suspended from a door handle 140 with an alternative embodiment of stacked packaging units of different widths 142 . fig1 shows the user detaching a single packaging unit from the dispensing container 154 by tearing across the perforated edge 150 adjacent to the distal tab 152 . fig1 shows a perspective view of an alternative dispensing container 160 where the packaging units 14 are connected end - to - end and dispensed through an opening 162 having securing means 164 to secure individual packaging units 171 . in this embodiment , the proximal tab 166 on the individual packaging unit 171 that has been dispensed from the dispensing container 160 can be pulled to open its enclosure 167 . the proximal tab 168 on the adjacent packaging unit 169 is connected end - to - end to the individual packaging unit 171 via a perforated edge 170 which can be torn to remove the individual packaging unit 171 . after the individual packaging unit 171 is removed , the proximal tab 169 of the adjacent packaging unit 169 will remain outside the dispensing container 160 which allows a user to pull on it to dispense the adjacent packaging unit 169 . it will be apparent to those skilled in the art that subsequent packaging units 14 can be dispensed in a similar manner and the securing means 164 can be configured to allow packaging units 14 to be released from the opening 162 and individually secured . in this embodiment , the means to secure each packaging unit 14 is facilitated using securing holes 172 in the material strip which allows the securing means 164 to secure an individual packaging unit 171 in place , for example , the securing means comprises a spring - loaded mechanism to push a rigid but retractable block through the securing holes 172 . once secured , the proximal tab 166 can be pulled to release the contents of the enclosure 167 . fig1 shows a side view of an alternative dispensing container shown in fig1 with identical reference numbers . it will be apparent to those skilled in the art that various items could be contained within the enclosure of the packaging unit disclosed herein and / or could be applied to a dispensing system as disclosed herein . these include , but are not limited to : chewing gum ; hypodermic needles ; tablets ; disposable contact lenses . prophylactics ; cutlery ; surgical instruments ; medical requisites ; veterinary supplies ; catering supplies ; horticultural consumables ; blades ; babycare ; cosmetics . while the invention has been illustrated and described in detail in the foregoing description , such illustration and description are to be considered illustrative or exemplary and non - restrictive ; the invention is thus not limited to the disclosed embodiments . features mentioned in connection with one embodiment described herein may also be advantageous as features of another embodiment described herein without explicitly showing these features . variations to the disclosed embodiments can be understood and effected by those skilled in the art and practicing the claimed invention , from a study of the disclosure and the appended claims . in the claims , the word “ comprising ” does not exclude other elements or steps , and the indefinite article “ a ” or “ an ” does not exclude a plurality . the mere fact that certain measures are recited in mutually different dependent claims does not indicate that a combination of these measures can not be used to advantage . | US-201213433383-A |
a dual wall cooking vessel is formed by the impact or friction bonding of the an inner to an outer vessel wherein a laminate of aluminum and copper layers is disposed between the outer surface of the bottom of the inner vessel and the inner surface of the bottom of the outer vessel . the aluminum layers are arranged to surround the copper layer of the uppermost aluminum layer being the upper aluminum layer being thinner than the lower aluminum layer and having a slightly smaller diameter than the copper and aluminum layer . the appropriate dimensions of the aluminum layers and sequence of welding and bonding operation results in the co - extrusion of both aluminum layers into a portion of the adjacent sidewall formed by the gap between the walls of the inner and outer vessel . this co - extruded layer s of aluminum within the side walls and the bottom of the vessel improves the heat transfer from the outer vessel to the inner vessel during cooking , but without significantly diminishing the insulating properties of the dual wall vessel that serve to keep the food warm while it is being served . | in accordance with the present invention , fig1 illustrates . . . thermally conductive material is interposed between inner pan 135 and outer pan 125 encompassing the bottom 200 of vessel 100 . however , by fabricating the vessel 100 according to the teachings of this invention the thermally conductive material extends upward to fill the lower portion of the cavity 105 separating the outer surface 130 a of the upright wall 130 of the inner pan 202 and the inner surface 120 b of the upward wall 120 of the outer pan 201 . as illustrated in the expanded view in fig1 b , marked as a , the thermally conductive material in this preferred embodiment comprises at least three layers of materials . the first layer 150 is in contact with the outer surface 135 a of the inner pan , having the opposing side in contact with a middle or second layer 150 . the other side of the middle layer 150 is in contact with the a first surface of the third layer 160 , the other surface of layer 160 being contact with the inner surface 125 b of the outer pan . as will be further illustrated with reference to fig2 , the middle layer generally does not extend upward into the cavity 105 , thus layers 150 and 160 are connected over the extent of the cavity 105 which they partially fill , terminating at an edge 210 , having a common interface therein 206 . layers 150 and 160 are preferably aluminum , or a suitable allow thereof , and surround a middle layer 150 comprising copper or a suitable allow thereof . the middle copper layer , being more thermally conductive than the surrounding aluminum layers transfer heater laterally from layer 160 , such that the temperature across the inside bottom surface 135 b of the inner pan 202 is uniform for cooking foodstuff , thus accommodating a range of heating methods and burner or flame configures used to heat the vessel 100 from the bottom of surface of the outer pan 125 a . referring back to fig1 a , the cooking vessel has an upper rim 102 formed at the termination of the edge 103 of the outer upper wall 120 , with edge 104 of the inner upper wall 130 . edges 104 and 103 are preferably welded together during fabrication to prevent water from seeping in or entering cavity 105 . the heating from cooking would rapidly vaporize a small quantity of water trapped in cavity 105 , which may present a hazard or damage the vessel 100 in escaping rapidly therefrom . further , edge 104 flairs outward in a substantially horizontal direction before terminating at the contact point with upper end of the inner wall 130 , thus forming a sealable surface for receiving lid 110 . lid 110 has a domelike central region 112 terminating at its periphery with an edge 115 that conforms to the shape of rim 104 . a slight upward facing concavity in rim 104 provides for the collection of condensed moisture therein , thus providing a sealing liquid between rim 102 and lid 110 to form a so called “ waterless ” cooking vessel . lid 110 is illustrated as including an optional handle or knob 166 for ease of placement and removal from vessel 100 . it should be noted that the outward extending flair of rim portion 104 also approximately defines the width of cavity 105 , as wall section 103 extends in the substantially vertical direction where it intersect rim 104 at edge 102 . dual wall cooking vessel 100 also preferably includes one or more handles ( not shown ) disposed on the exterior side surface for grasping during cooking or serving . the method and result of friction bonding the inner and outer vessels is illustrated by the schematic expanded view of fig2 a and 2b , which corresponds to region b in fig1 . initially an aluminum plate 160 is disposed on the bottom surface 125 b of the outer vessels 125 . a copper layer in the form of a sheet or plate 140 is disposed on top of aluminum plate 160 . a second aluminum plate 150 is then disposed on top of copper plate 140 . finally , the outer surface 135 b of the bottom of vessel 201 is disposed on top of aluminum plate 150 . as the copper plate 140 has a series perforations or holes to enhance the attachment with the surrounding aluminum plates 150 and 160 , which are illustrated as a series of gaps 145 . as will be further described with respect to fig3 , upon impact or friction bonding of the assembly in fig2 a the gaps 145 , caused by perforations in copper plate 140 , are filled as the upper surface of aluminum plate 160 has become bonded or welded to the lower surface of aluminum plate 150 at interface 205 . both the upper 150 and lower aluminum plate 160 have are essentially welded or fused to the surrounding stainless steel layers 125 b and 135 b respectively by the friction bonding process . both aluminum plates 150 and 160 are reduced in thickness due to the lateral flow caused by the impact bonding , the upper aluminum plate 150 is reduced in thickness more than the lower plate 160 . the preferred sequential steps used to construct a dual wall vessels from the two single wall vessels is illustrated in fig3 a through 3g , inclusive . fig3 a and 3b merely illustrate that the inner vessel 201 and outer vessels 202 , which are initially formed of stainless steel by a drawing operation that shapes the inchoate rims 104 and 103 in shaping the upper portions proximal to the open end of each vessel . in fig3 c the previously described assembly of the lower aluminum plate or layer 150 , copper layer 140 and upper aluminum layer 160 are spot welded via electrodes 301 ( disposed on the inside of the vessel 201 , and electrode 302 , contacting bottom of the lower aluminum layer 150 , the assembly of layer being aligned with the center of vessel 201 . preferably , each of the aluminum plates and copper plate are substantially circular corresponding to the shape of the bottom of vessel s 201 and 202 , however the upper aluminum plate 150 in addition to being about half the thickness of aluminum plate 160 in this preferred embodiment also has a smaller diameter owing to its greater propensity to flow during impact bonding process illustrated by fig3 e . however , prior to impact bonding of the inner and outer vessels to the intervening aluminum copper layers , as shown in fig3 d , it is also preferable that the inner vessel 201 and outer vessel 202 are carefully co - axially aligns such that the inchoate rim 103 of outer vessel 202 is in contact with the inchoate rim 104 of inner vessel 201 . this assembly is then stabilized by spot welding at the center of the bottom of vessels 201 and 202 a shown by the presence of inner electrode 301 ′ and the outer electrode 302 ′. thus the inner vessel 201 and outer vessel 202 is attached at the centers of their respective bottom portion 135 and 125 to aluminum later or plate 160 , copper sheet 140 and aluminum plate 150 . in the step portrayed by fig3 e the inner and outer pans are impact or friction bonded to each after first pre - heating the assembly 300 e to about 500 ° c . o , after which a forming mandrel contacting the inner bottom surface 135 b is accelerated by a driven mass downward toward the support under the bottom surface 125 a of vessel assembly 300 e . as the aluminum layer having the lowest melting point of the material in the assembly and have been preheated to about 80 % of its melting point , the friction and heat generated by the sudden impact causes the flow and fusion of the intervening aluminum layers to each other and the remainder of the contacting layers of the vessels not previously welded together to form strong bonds there between . it should be noted in fig3 c that as upper aluminum layer 150 has a narrower diameter than both the copper layer 140 and the bottom aluminum layer 105 such that the force applied by the friction or impact bonding process results in a proportionately higher compressive stress on layer 150 , thus causing it to extrude laterally and upward into cavity 105 . as lower aluminum layer 160 also flows into cavity 105 , generally surrounding and embedding copper layer 140 , its flow terminates at substantially the same height as extruded aluminum layer 150 about the air - metal interface labeled 210 in fig1 b . not wishing to be bound by theory , it is believed that the initial flow of layer 150 eventually equalizes the stress on both layers causing them to flow together into cavity 105 . also not wishing to be bound by theory , it is further believed that the initial and greater extrusion of layer 150 serves another purposes in that it facilitates the initial fusion bonding of layer 160 to the stainless steel bottom 125 at interface 125 b , further stabilizing the friction bonding and flow of the other layers in a uniform and repeatable manner . as the fusion or friction bonding occurs in less than a fraction of a second the actual manner and operation of the invention is not certain , and hence was not readily predictable . after impact bonding as described with respect to fig3 e , the rim of the pan is formed in the steps illustrated by fig3 f and fig4 . in the first of a sequence of two steps , the now aligned and contacting inchoate rims of the inner 104 and outer wall 103 as welded by the electrode assembly and process illustrated further detail in fig4 . counter rotating electrodes 410 and 420 substantially conform to the external shape of the inchoate rim surfaces formed during the drawing processes in the internal vessel 210 and external vessel 202 illustrated in fig3 a and 3b . thus , complimentary shaped electrodes 400 and 420 rotating about their respective spindles 411 and 423 grasp the mating rim portion causing the rotation of the bonded assembly ( which will form double wall vessel 100 shown in fig3 g ) about its central axis 431 , thus exposing the entire periphery of the rim to the welding electrodes 410 and 420 . therefore the entire periphery of the contact wall edges that form surface 103 and 104 in fig1 are welded together . the welding operation thus seals cavity 105 . in the second step , illustrated in fig3 f , the final rim shape of vessel 10 is formed by a circular cutting tool 310 that follows around the upper end of outer wall 120 of vessel 202 trimming an annulus through the weld to form the top edge 102 illustrated in fig1 . the thus completed double wall vessel 100 is illustrated in fig3 g . it should be appreciated that the aluminum layers 160 and 150 are optionally laminates of multiple layers of thinner aluminum sheet with the outer layers being selected for their ability to adhere to stainless steel , copper , the adjacent aluminum layer encountered between the gaps in the copper sheet , or alternative materials used to formed the inner and outer vessels , or a substitute heat transfer layer for the copper sheet . in a preferred embodiment the lower aluminum sheet 160 is constructed of three layers of aluminum in which aluminum alloy 3003 is surrounded by layers of aluminum alloy 1050 to provide a total thickness of 6 mm . the outer aluminum layers in this laminate preferably have thickness of about 0 . 2 to 0 . 3 mm . the upper aluminum layer 150 is similarly of a three layer construction with aluminum alloy 3003 being surrounded by sheets of aluminum alloy 1050 , however the initial thickness is preferably less , or about 3 . 5 mm . this construction is preferred as the 3003 aluminum alloy is harder than the surrounding 1050 aluminum alloys . however , it should be appreciated that the other metals may be substituted for the inner layer of 1003 aluminum layer . the copper layer preferably has a thickness of about 0 . 6 mm before impact bonding . the holes or gaps in the copper layer are preferably of a diameter of about 2 to 10 mm and cover less than about 30 % of the area of the sheet . after impact bonding the upper aluminum layer 150 is reduced in thickness from its initial value of about 3 . 5 mm to about 1 . 5 mm . the lower aluminum layer or plate 160 undergoes a more limited reduction of thickness , from the initial value of 6 mm to about 3 mm . the copper layer is only slightly deformed from about 0 . 6 mm to 0 . 5 mm the surrounding inner and outer vessel walls if fabricated from stainless steel do not undergo a substantial change thickness upon impact bonding , retaining their initial thickness of about 0 . 5 mm . although the copper layer is preferably of comparable dimensions to the bottom of the inner and outer vessels , it may also extend into the cavity 105 there between , as it can be initially fabricated in a bowl like shape to conform to the intended cavity shape or , being significantly thinner than the surrounding aluminum layers , is readily deformed from a plate into a bowl like shape as the inner and outer vessel are nested together in fig3 d . it should be appreciated that the outer surface of the outer vessel can have cladding or decorative layers outside of the stainless steel , for example one or more layers of external copper cladding optionally extends partly upward corresponding to the portion of the cavity that is filled with the aluminum layers during fusion or impact bonding . such a contrasting external layer also serves a non - decorative function of alerting the consumer to the distinct thermal characteristics of the bottom portion of the pan , as opposed to prior art dual wall cooking vessels . while the invention has been described in connection with a preferred embodiment , it is not intended to limit the scope of the invention to the particular form set forth , but on the contrary , it is intended to cover such alternatives , modifications , and equivalents as may be within the spirit and scope of the invention as defined by the appended claims . | US-29912305-A |
a method of installing a dental implant includes positioning a drill guide tube adjacent to a jawbone and taking a tomographical scan of the two . based on the scan , a computer - generated image is created and analyzed to confirm whether the drill guide tube is properly aligned . if the drill guide tube is in the correct position , that same tube to used to guide a drill bit into the jawbone . in some cases , the tube also helps guide a biopsy punch in cutting just a small , round opening into the gum tissue , which minimizes the time needed for healing . | for simplicity and clarity , the invention will be described with reference to replacing a single missing tooth , however , it will be appreciated by those skilled in the art that the method can be readily applied to multiple teeth or even an entire set of teeth . thus , the term , “ crown ” broadly encompasses an individual prosthetic tooth , bridge , denture , etc . for the illustrated example , a patient 10 is missing his lower - right cuspid as shown in fig1 - 4 . to replace the missing tooth , the process may begin by creating a cast model 12 ( fig1 ) of the patient &# 39 ; s lower jaw . arrow 14 indicates the general area of the missing tooth . model 12 may be a plaster casting ; however , the actual structure and method of making such a model may vary . such models and methods of making them are well known to those skilled in the art . in fig2 a drill guide tube 16 , can be placed on model 12 in the area of the missing tooth . tube 16 is preferably made of metal or some other generally radially opaque material . the tube &# 39 ; s longitudinal centerline 18 should lie generally along the anticipated centerline of the prosthetic tooth and its supporting implant . in some cases , tube 16 is preferably held temporarily to model 12 using some type of clamp or bonding material . examples of such a clamp include , but are not limited to , a fastener , screw , nail , tack , etc ., and examples of a bonding material ( see material 20 of fig7 ) include , but are not limited to wax , adhesive , thermoplastic , etc . in other embodiments of the invention , tube 16 is placed in the area of the missing tooth after a stent is made . in fig3 a surgical stent 22 is made by vacuum - forming an acrylic sheet over model 12 ; however , it should be appreciated by those skilled in the art that there are other ways of making a surgical stent that are well within the scope of the invention . in some embodiments of the invention , stent 22 is formed over both model 12 and tube 16 . once stent 22 is formed , a small hole in the stent can be drilled or cut away so that the stent does not close off the inner bore of tube 16 . in some cases , tube 16 may be repositioned to protrude through the hole . in some embodiments , stent 22 is formed over model 12 without tube 16 in place , and tube 16 is attached to stent 22 afterwards . in the later case , a temporary removable filler member or plug ( e . g ., cylindrical or tooth shaped ) may need to be installed on model 12 in the area of the missing tooth to reserve space for tube 16 within stent 22 . after stent 22 is made , tube 16 can be affixed to the stent in the space left by the filler member . again , a small hole can be cut away or drilled through stent 22 to open the inner bore of tube 16 . regardless of how the stent is made , stent 22 with the attached tube 16 is placed on the patient &# 39 ; s lower jaw as shown in fig4 . this places tube 16 in the actual area of the missing tooth with the tube being in the same relative orientation as it was when the stent and tube were on model 12 . a tomographical scan is taken of the patient &# 39 ; s jaw to record the position of tube 16 relative to a bone 28 ( i . e ., the patient &# 39 ; s upper or lower jawbone ). for illustrative purposes , the patient &# 39 ; s mouth is shown open only to show that stent 22 and tube 16 are in the patient &# 39 ; s mouth . from the tomographical scan , a computer 24 creates a first image 26 that shows tube 16 at a first position in relation to bone 28 as shown in fig5 . for reference purposes only , an outline of an adjacent tooth 30 is also shown in image 26 , wherein tooth 30 corresponds to a lower - right first bicuspid 30 ′ of the model in fig1 . the equipment and method for taking a tomographical scan is well known to those skilled in the art . tomography generally involves creating a computer - generated image ( e . g ., image 26 ) from a plurality of x - rays as indicated by lines 32 and 34 of fig4 . other terms used for tomography include , but are not limited to , ct scan ( computed tomographical scan ), eit ( electrical impedance tomography ), cat scan ( computerized axial tomography ). system 36 of fig4 is schematically illustrated to represent all types tomography systems . some examples of system 36 include , but are not limited to a commcat is - 2000 , panorex cmt , and a panorex cmt plus , all of which are products of imaging sciences international , inc ., of hatfield , pa . image 26 of fig5 shows that drill guide tube 16 is not properly aimed toward bone 28 , so in this particular case , the next step in the process would be to reposition tube 16 . a second image 38 of fig6 illustrates the step of repositioning tube 16 to a second position . repositioning tube 16 simply involves releasing the clamp or bonding material that holds tube 16 to sent 22 , and reaffixing the tube at the second position shown in fig6 . once tube 16 is fixed at the second position , system 36 takes another tomographical scan of the patient with stent 22 and tube 16 again in the patient &# 39 ; s mouth . the resulting second image of fig6 shows that tube 16 is now properly aligned relative to bone 28 , so tube 16 can now be used as a tool guide . in fig7 a circular cutter 40 is inserted through tube 16 . circular cutter 40 represents any cutter that can cut a substantially round opening into gum tissue 42 that covers bone 28 . one example of cutter 40 is a cylindrical biopsy punch . in fig8 cutter 40 is shown cutting a substantially round opening into gum tissue 42 , while tube 16 helps guide the angular position of cutter 40 relative to bone 28 . to help hold tube 16 at its proper position , it should be noted that stent 22 engages the patient &# 39 ; s teeth ( e . g ., tooth 30 ) and / or the patient &# 39 ; s gums 42 ( in the case where a patient has no teeth ). in fig9 cutter 40 is shown withdrawing a round plug 44 of gum tissue as cutter 40 is withdrawn from tube 16 . this leaves a substantially round opening 46 in gum tissue 42 . in fig1 , a drill bit 48 is inserted through tube 16 , so tube 16 can help guide the drill bit as the drill bit drills a hole 50 into bone 28 . in fig1 , stent 22 and tube 16 are entirely removed from the patient &# 39 ; s mouth to allow room for a larger drill bit 52 to enlarge hole 50 in diameter and / or depth , thereby producing an enlarged hole 54 . in fig1 , a conventional implant 56 is shown being inserted ( arrow 58 ) and anchored into hole 50 ( enlarged to hole 54 ). the actual structure of implant 56 may vary widely as can be appreciated by those skilled in the art . in fig1 , a healing cap 60 is attached to implant 56 to allow the gum tissue 42 to heal around the perimeter of opening 46 . healing cap 60 protrudes sufficiently above gum tissue 42 to inhibit tissue 42 from completely closing opening 46 at any time during a period extending from when opening 46 was first created ( fig9 ) until healing cap 60 is removed from implant 56 ( fig1 ). in fig1 , healing cap 60 is removed from implant 56 , and a conventional abutment 62 is attached to implant 56 . the actual structure of abutment 62 may vary widely as can be appreciated by those skilled in the art in fig1 , a crown 64 ( e . g ., an individual prosthetic tooth , bridge , denture , etc .) is attached to abutment 62 . crown 64 can be bonded and / or mechanically fastened to abutment 62 . in some cases , for example , a bonding material 66 bonds crown 64 to abutment 62 . although the invention is described with reference to a preferred embodiment , it should be appreciated by those skilled in the art that various modifications are well within the scope of the invention . therefore , the scope of the invention is to be determined by reference to the claims that follow . | US-42908803-A |
the invention is dental floss applicator and interdental stimulator that is flexible and also includes a guard to ensure that the dental floss has not been used or otherwise tampered with . users can adjust the angle of the dental floss applicator and stimulator into a configuration that best suits their particular needs . when flex adjusted , the applicator is able to hold its new configuration while maintaining sufficient strength to allow the user to comfortably maneuver the apparatus to properly floss the teeth or stimulate the gums . furthermore , the invention is disposable , rendering it convenient to use after a meal when the user is away from a private bathroom setting , such as at a home or other lodging . | the invention provides a dental hygiene apparatus with teeth - cleaning means and a flexible handling means whereby the teeth - cleaning means and the flexible handling means are united and pliable at their points of joinder . the teeth - cleaning means and handling means are “ united ” in the sense that they are brought together to form a single apparatus by joining , securing , connecting , linking , or the like . the apparatus can be of one construction or an aggregate of parts composed of the same or different material , consistent with the teachings of this disclosure . “ pliable ” means that the apparatus is flexible and receptive to change such that it is capable of being flex adjusted ( bent ) numerous times without breaking and will readily adhere to a new configuration after flex adjustment . the meaning will become more apparent upon reading the full disclosure and the examples contained herein . the teeth - cleaning means comprises arms for securing one or more lengths of floss . however , the strands of material need not be limited to floss . the floss can be substituted for strands of other interdental materials , such as those related to cosmetics ( e . g ., whitening ) or medicine for the gums . the teeth - cleaning means further comprises a tapered portion at one end of the apparatus , chisel - shaped or pointed , for use as an interdental cleaner and / or stimulator . the invention further provides a flexible elbow and tapered end for increased maneuverability and effectiveness when cleaning the teeth . between the flexible elbow and tapered end is the handling means which comprises a handle with ridges , grooves , or a combination thereof for the desired grip . in one embodiment , the dental hygiene apparatus is made of one solid construction of polypropylene . it comprises a narrow , chisel - shaped feature at one end which gradually transitions and widens into a handle and before tapering to a flexible elbow adjoining the two applicator arms which secure a length of floss . the flexible elbow and chisel - shaped feature are pliable and designed to permit maximum maneuverability for the user when flossing . many other embodiments are possible and will become apparent upon reading the entire disclosure and the examples contained herein . approximately where the handle transitions into the applicator arms , there is a ridged flexible elbow that is capable of being flex adjusted into the desired position when flossing . the user need merely bend the apparatus at the flexible elbow to the desired angle . the invention is designed such that is pliable but yet remains sufficiently strong for use , despite numerous flex adjustments . for instance , the user may flex adjust the flexible elbow anywhere from 0 to about 15 degrees when flossing the teeth in the front of the mouth . when flossing the teeth on the side , the user may desire to flex adjust the flexible elbow anywhere from about 15 to 30 or to about 45 degrees . when flossing the teeth in the rear of the mouth , the user may then desire to flex adjust the flexible elbow anywhere from about 45 to 60 or to about 90 degrees . the invention is such that the apparatus will remain at the desired angle after it is flex adjusted . when flossing the other side of the mouth , the user need merely flex adjust apparatus as described above . the apparatus can be flex adjusted multiple times and still remain strong . the dental floss applicator is designed for single - use and thus be disposable . in most circumstances , one single dental floss applicator will last for an entire flossing session , depending on the number of flex adjustments . during a complete flossing session , users will be bending the flexible elbows to the left and the right , and to different angles . the flexible elbow is designed to withstand multiple bendings . some users may just want to floss one or two gaps between their teeth , so they would bend the flexible elbow maybe just 2 times . other users may bend the flexible elbow 5 times before discarding the dental floss applicator . during a typical flossing session , users may bend the flexible elbow about 10 times . during a long flossing session , users may bend it about 20 times . if the users intend to reuse the dental floss applicator , the flexible elbow should be able to last until about 40 bendings before breaking . experiments were conducted on the prototypes of the dental floss applicators to see how many times a flexible elbow can be flex adjusted ( bent ) before it breaks . a group of 50 applicators were tested . the following is a summary of the results : number of times the dental percent of dental floss floss applicator were bent applicator that break 2 0 % 5 0 % 10 0 % 20 0 % 40 2 % it is important that the dental floss applicator be capable of withstanding multiple flex adjustments . typically , a material loses much of its strength when bent multiple times . however , the present dental floss applicator is designed such that the flexible elbow remains relatively strong , stable , and rigid even after it has been bent multiple times . experiments were conducted on the prototypes of the dental floss applicators to see how rigid the flexible elbow is after it is bent multiple times ( and remains bent at 45 degrees ). a group of 50 applicators were tested . the following is a summary of the results : average force needed to bend number of times the dental dental floss applicator away floss applicator were bent from the teeth by 30 degrees 2 12 lbs 5 12 lbs 10 12 lbs 20 12 lbs 40 10 lbs on one end of the dental floss applicator is a tapered portion , chisel - shaped or pointed , that can be a used as a pick to clean the teeth and to stimulate the gums . the tapered portion is designed to be pliable such that a user can bend it to effectively reach the gums and interstices of the back teeth . typically , when people use toothpicks , the teeth in the front of the mouth do not present a challenge . however , there is difficulty in trying to reach the interstices of the back teeth because the toothpick is straight and cannot reach the rear interstices since they are essentially perpendicular to the toothpick . as a result , people will try to bend the toothpicks , but the results are limited . the toothpicks are not very flexible and can only be bent so much before they begin to splinter . on the other hand , the flexible tapered end ( pick ) of the present invention ( like the flexible elbow discussed previously ) can be bent anywhere from 0 to about 15 , 30 , 45 , 60 , or about 90 degrees depending on which teeth and gums the user wishes to clean and stimulate . like the flexible elbow , the tapered end of the apparatus is designed so as to “ remember ” and remain in the adjusted position while it is being used . in other words , the flexible tapered end will not bounce back to its original position after one stops applying force to it . like the flexible elbow , the flexible tapered end is designed to withstand multiple bending . a flexible pick can be bent a number of times during a session . some users just want to pick one or two gaps between their teeth , so they may bend the flexible pick maybe 2 times . during a longer session , users may bend it 10 , 20 , or more times . the flexible pick should be able to withstand 20 flex adjustments without breaking . experiments were conducted on the prototypes of the dental floss applicators to see how many times the flexible pick can be bent before breaking . a group of 50 apparatus were tested . the following is a summary of the results : number of times the dental percent of dental picks picks were bent that break 2 0 % 5 0 % 10 0 % 20 0 % the flexible feature of the dental floss applicator is accomplished by using a class of polypropylene materials , possessing the desired properties of being able to “ remember ” a new position when flex adjusted and having the requisite strength necessary for manipulation of the applicator / stimulator while still being yielding enough to allow for the safe and gentle cleaning of the interdental spaces and proximate gum tissues . suitable thermoplastic resins and polymers may be used to wholly or partly construct the apparatus so as to provide it with the desired characteristics described . for the present invention , polypropylene has performed particularly well . colors can also be added to increase the appeal to users of all ages and groups . from the colors of the rainbow , pastels , or fluorescents , the applicators can be manufactured in an array of colors according to the target audience . for example , bright , “ fun ” colors may be used to attract a younger user by making the floss applicator appear appealing as opposed to clinical and unpleasant . for the present invention , the preferred class of polypropylene has the following physical properties : astm physical properties methods units value melt flow rate d1238l gram / 10 15 minutes density d792 gram / cm 3 0 . 904 tensile strength , yield d638 kg / cm 2 365 elongation , yield d638 % 9 flexural modulus d790ia kg / cm 2 17000 hardness , rockwell d785a r scale 100 heat deflection temperature at d648 ° c . 100 4 . 6 kg / cm 2 izod impact strength , notched d256a kg - cm / cm 2 . 3 mold shrinkage d995 % 1 . 51 a device is provided near the dental floss so as to cover it . this device is designed as a “ guard ” of the dental floss such that one has to remove this “ guard ” before one can use the dental floor applicator . this device is also designed such that it cannot be installed back onto the dental floss applicator once it is removed . the intent is to allow users to easily identify unused and / or untampered applicators . because the applicator will be used in a semi - internal fashion ( the mouth ), cleanliness is a key concern . several designs of these guards have proved useful . in general , one or more small holes are added onto the dental floss applicator such that the dental floss guard can be installed . the dental floss guards are manufactured separately from the dental floss applicator . there are one or more locking devices designed to fit securely into the holes on the dental floss applicators . the part connecting the locking devices and the main body of the guards are designed to be thin and weak and therefore easily broken . when a user takes away the dental floss guard , the locking devices will break off but remain in the holes on the dental floss applicators . with the holes on the applicators blocked , no guard can be installed back to the dental floss applicators once it has been used or otherwise tampered with . another design of the dental floss guard is to make such guard with thin plastic film that will be tightly wrapped around the area around the dental floss . when a user takes away the dental floss guard , the dental floss guard would be destroyed and cannot be reused . with this “ guard ,” users of the dental floss applicators can be guaranteed that the dental floss applicators are new , unused , and safe . to floss in between all the teeth properly , the dental floss should be positioned ouch that it is parallel to the gap between teeth . however , the gaps between teeth in the front of mouth are perpendicular to the gaps between teeth in the back of mouth . most existing disposable dental floss applicators have their handle parallel to the dental floss . while it is quite easy to floss in between the teeth in the front , it is all but impossible to floss the teeth in the back properly . the solution is the invention of a disposable dental floss applicator that allows the users to easily manipulate the angle of the dental floss . this invention is significant because if the dental floss applicator is flexible , users can now adjust the applicator such that the sharp dental simulator will never point toward the vulnerable portions of the mouth , thus promoting safe use . this invention is significant because if the dental floss applicator is flexible , it is feasible for the manufacturer to make a longer dental floss applicator . a longer dental floss applicator achieves at least two goals . 1 .) it is now impossible to point the sharp dental simulator toward the mouth flesh or gums when in use because it is too long . the chance of getting hurt during flossing is reduced . 2 .) users can control the applicators without putting their fingers in their mouths . thereby , users do not need to open their mouths extra wide during flossing , allowing them to floss more discreetly if they intend to do so in public . users have different preferences and needs regarding how they use dental floss . a dental floss applicator allows users to be creative in how to achieve the task of comfortably placing the dental floss between the teeth or maneuvering the interdental stimulator / pick within the mouth in a safe and comfortable manner . the invention is pocket size , can be made disposable , and thus can be carried in public and used in a discreet and unembarrassing manner . this invention is also significant because of the dental floss “ guard ” device . with this device , one can be sure that the dental floss applicators are new , unused , and safe . this further encourages users to use the dental floss applicators they are given in public establishments , such as hotels or eateries . this invention also helps users to use dental floss applicators more discreetly and to distinguish new from used applicators . in the preferred form of the invention , the handle and applicator arm are formed from polypropylene and / or the like to define a short “ c ” shaped handle with applicator arms reaching off from the flexible elbow . the applicator arms do not protrude from the applicator handle like straight tines , but rather curve out in a manner visually resembling a “ c ” with a short handle rather than the “ y ” shape employed by some existing designs . the handle itself comprises an interdental stimulator ( pick ) and then widens into a thicker middle ( designed for a secure grip ) and then narrows down before softly angling up and transitioning into the applicator arms . at the point of transition a strong , flexible section capable of repeated bending is imbedded [ or externally applied ] providing for a 90 degree adjustable sweep of the applicator arms in either direction . the apparatus is such that it will respond to pressure without losing the desired angle and shape , thus allowing for easy and gentle usage . the pick is also designed to be flexible such that it can reach the back teeth and gums . other features and advantages of the invention will become apparent from the following description and figures which further illustrate the principles of the invention . after the designs of the dental floss applicator and / or the dental floss guard are finalized , industrial grade moldings are custom made according to the final designs . depending on the size of the moldings , a number of copies of the dental floss applicator and / or dental floss guard can be made simultaneously . to produce the dental floss applicators , multiple lines of dental floss are placed on one side of the moldings first , then heated polymer material in liquid form is injected into the moldings to form the dental floss applicators . the dental floss applicators are then ejected from the moldings . based on the design of the moldings , some dental floss applicators ejected from some moldings are connected by dental floss , some are not connected by dental floss . to separate the dental floss applicators connected by dental floss , one can cut the dental floss either by a sharp object or by heat . to produce the dental floss guard , heated polymer material in liquid form is injected into the moldings to form the dental floss guards . the dental floss guards are then ejected from the moldings . | US-59370105-A |
a warewasher includes a liquid recirculation system for spraying wares with wash liquid from a collecting tank . the warewasher includes a filter arrangement for capturing food debris in a wash spray before the wash spray reaches the wares being cleaned . | referring to fig1 , an exemplary conveyor - type warewash system , generally designated 10 , is shown . warewash system 10 can receive racks 12 of soiled wares 14 from an input side 16 which are moved through tunnel - like chambers from the input side toward a dryer unit 18 ( optional ) at an opposite end of the warewash system by a suitable conveyor mechanism 20 . either continuously or intermittently moving conveyor mechanisms or combinations thereof may be used , depending , for example , on the style , model and size of the warewash system 10 . flight - type conveyors in which racks are not used are also possible . in the illustrated example , the racks 12 of soiled wares 14 enter the warewash system 10 through a flexible curtain 22 into a pre - wash chamber or zone 24 where sprays of liquid from upper and lower pre - wash manifolds 26 and 28 that feed spray tubes ( also known as spray arms ) above and below the racks , respectively , function to flush heavier soil from the wares . the liquid for this purpose comes from a tank 30 via a pump 32 and supply conduit 34 . a drain system 36 provides a single location where liquid is pumped from the tank 30 using the pump 32 . liquid can be drained from the tank via drain path 36 , for example , for a tank cleaning operation . the racks proceed to a next curtain 38 into a main wash chamber or zone 40 , where the wares are subject to sprays of cleansing liquid from upper and lower spray systems in which manifolds 42 and 44 feed lateral spray tubes 47 and 49 with associated nozzles along the lengths of the spray tubes . the manifolds are supplied through a supply conduit 46 by a pump 48 , which draws from a main tank 50 . a heater 58 , such as an electrical immersion heater provided with suitable thermostatic controls ( not shown ), maintains the temperature of the cleansing liquid in the tank 50 at a suitable level . not shown , but which may be included , is a device for adding a cleansing detergent to the liquid in tank 50 . during normal operation , pumps 32 and 48 are continuously driven , usually by separate motors , once the warewash system 10 is started for a period of time . the warewash system 10 may optionally include a power rinse ( also known as post - wash ) chamber or zone ( not shown ) that is substantially identical to main wash chamber 40 . in such an instance , racks of wares proceed from the wash chamber 40 into the power rinse chamber , within which heated rinse water is sprayed onto the wares from upper and lower manifolds . the racks 12 of wares 14 exit the main wash chamber 40 through a curtain 52 into a final rinse chamber or zone 54 . the final rinse chamber 54 is provided with upper and lower spray heads 56 , 57 that are supplied with a flow of fresh hot water via pipe 60 under the control of solenoid valve 62 . a rack detector 64 is actuated when rack 12 of wares 14 is positioned in the final rinse chamber 54 and through suitable electrical controls , the detector causes actuation of the solenoid valve 62 to open and admit the hot rinse water to the spray heads 56 , 57 . the water then drains from the wares into tank 50 . the rinsed rack 12 of wares 14 then exits the final rinse chamber 54 through curtain 66 , moving into dryer unit 18 . as seen in fig1 , an exemplary wash arm filter arrangement 100 may be associated with one or more of the spray tubes in one or more of the pre - wash , wash and / or post - wash / power rinse zones . notably , multiple upper spray tubes 47 and lower spray tubes 49 are located along the conveyor path , each having respective spray nozzles . as noted above , wash water is recirculated from a tank to the spray tubes via a pump . a last of the spray tubes in the conveyance direction 84 , here designated as spray tube 47 ′, includes an associated external filter arrangement 100 for limiting food debris that exits the spray nozzles from being directed onto wares traveling along the conveyor 20 . as seen in fig2 and 3 , the filter arrangement 100 forms a channel below the last spray tube 47 ′, and the channel includes screening material 88 aligned with the spray nozzles of the last spray tube . in the illustrated embodiment , the channel has an upstream edge with barrier 90 and a downstream edge with barrier 92 , relative to the conveyance direction 84 , to inhibit flow out of the upstream and downstream edges of the channel . one or both ends 94 , 96 of the channel are open such that debris captured by the screen material 88 tends to be flushed out of the end or ends of the channel , such that the debris drops downward at locations laterally of the conveyor path ( as suggested by arrows 98 in the schematic end view of fig4 ) so as to avoid being dropped onto wares traveling along the conveyor path 20 . notably , the filter arrangement therefore provides a self - cleaning or self - flushing feature that reduces the need to remove and clean the filter member . in the illustrated embodiment , the channel is formed by a bracket structure 86 having multiple windows ( e . g . holes ) therethrough and the screening material 88 overlies the windows . however , other arrangements could be used , including an arrangement in which the entire channel is formed by screening material . in addition , although a rectangular bracket structure forming the channel is shown , a round structure that surrounds the spray tube could also be used to form the filter arrangement . moreover , other spray tubes could include a similar external filter arrangement , such as the last two spray arms in the conveyance direction the last upper and lower spray arms in the conveyance direction . as mentioned above , the subject filter arrangement may be used in any of the wash zones . however , in the most effective arrangement the filter arrangement is provided at least in the wash zone that is immediately upstream of the final rinse section of the machine . in this manner , the last water that is sprayed onto the wares before the rinse section is largely free of significant food debris , reducing redeposit and making it easier for the final rinse section to achieve desired results . notably , the external filter arrangement allows food debris to exits the spray nozzles before capturing it , so that the external filter arrangement does not result in build - up of food debris within the spray tube . testing has shown the ability to reduce food debris particulates per rack of wares entering the rinse section by over fifty percent as compared to the same machine without the filter arrangement . in some cases this result will reduce the amount of rinse water that will be required to be sprayed in the final rinse , thereby reducing overall machine operating cost . fig5 - 9 show other depictions in which the conveyance direction 84 ′ relative to multiple spray tubes 80 ( as shown on the page ) is generally opposite that shown for fig1 - 4 . as best seen in fig8 and 9 , the filter arrangement 120 may be coupled to the last spray tube 80 ′ utilizing a clamp arrangement that includes an upper housing member 122 that may be fixedly attached to the spray tube 80 ′ ( e . g ., by one or more fasteners 124 ) and two which latch mechanisms 126 are mounted . the latch mechanisms interact with the channel bracket 128 of the filter structure ( e . g ., by downwardly extending fingers 130 of the latch that engage with the underside of the bracket 128 and / or with small flanges 132 that extend downward from the bracket ). the latch mechanisms ( e . g ., which may be of the over center type ) may be released to enable the bracket 128 to be removed for cleaning . notably , in the illustrated embodiment , the upper edges of the channel bracket 128 engage with lower edges of the housing member 122 ( e . g ., in simple abutment or by slight insertion into downward facing recesses 134 ) to assure that any liquid / debris flow that does not pass through the screening material is forced towards the ends of the channel bracket . end 94 is of the channel bracket 128 is open to allow the debris to flush outwardly as mentioned above , and end 96 abuts against the manifold bracket 136 , but includes a downwardly facing open ( i . e ., unscreened ) window 138 for the same purpose . the underside of the housing member 122 may sit flushly against the outer surface of the tube 80 ′ to assure that no food debris can move upward between the housing member and the tube 80 ′. the channel bracket 128 includes screened openings 88 ′ that align with the spray nozzles of the tube 80 ′, similar to bracket 86 above . it is to be clearly understood that the above description is intended by way of illustration and example only and is not intended to be taken by way of limitation , and that changes and modifications are possible . accordingly , other embodiments are contemplated and modifications and changes could be made without departing from the scope of this application . for example , although a conveyor - type machine is shown in fig1 , the wash arm filter arrangement could be implemented on other machines . warewash machines are categorized into two types based on the operating modes ( i . e ., batch or continuous ) and the wash arm filter arrangement could be used on spray tubes of both machine types . | US-201514683337-A |
a composition and method to alleviate oral mucosal discomfort and irritation in an orthodontic patient . a wax matrix containing less that 15 % analgesic / anesthetic agent such as benzocaine and excipients enhanced and extended release of the analgesic / anesthetic agent compared to known art formulations . the composition exhibited desirable aesthetic properties , was easy to apply , and the relatively lower concentration of active agent provided enhanced safety . | as used herein , all percentage concentrations are weight / weight . as used herein , all concentration ranges are inclusive in that the upper and lower values are included within the range , and in that all sub - ranges within the range are encompassed . for example , and by way of illustration only , a range of 0 %- 10 % concentration of a component includes the absence of that component ( 0 %), and every concentration up to and including 10 % ( e . g ., 0 . 01 %- 10 %, 0 . 1 %- 10 %, 0 . 2 %- 10 %, 0 . 1 %- 9 . 9 %, 0 . 1 %- 9 . 8 , and so on ). in one embodiment , the formation contains xanthun gum as a sustained release agent , and benzocaine ( each from spectrum ) as the analgesic / anesthetic agent . in one embodiment , this formulation additionally contains microcrystalline wax ( koster keunen ), glyceryl monosterate , heavy mineral oil , peg 1500 , and tween 80 . as shown above , in embodiments , excipients are added to improve product characteristics . in general , in the above formulation of anesthetic / analgesic agent , the microcrystalline wax provides a matrix ; glyceryl monostearate has known properties as an emollient , solubilizing agent , stabilizing and sustained - release ingredient ; heavy mineral oil has known properties as an emollient , lubricant , and oleaginous vehicle making the wax softer and less rigid ; polyethylene glycol - 1500 ( peg 1500 ) enhances matrix hydrophilicity ; tween 80 ( polysorbate 80 ) serves as a wetting / dispersing / suspending agent in lipophilic bases ; and xanthum gum is a stabilizing agent and suspending agent , as described in the handbook of pharmaceutical excipients ( 7 th edition , london : pharmaceutical press , 2012 ), the relevant sections of which are expressly incorporated by reference herein in their entirety . the following instruments were used in evaluations : mettler ae 200 weighing balance , 4802 uv / vis double beam spectrophotometer , and hanson vision elite 8 dissolution apparatus microcrystalline wax was melted in a beaker placed in a water bath maintained at 90 ° c . once melted , glyceryl monostearate was added , followed by 250 μl heavy mineral oil with mechanical stirring . at about the same time , peg 1500 was melted in another beaker placed in a water bath maintained at 90 ° c . and stirred using a magnetic stirrer at 80 rpm . benzocaine was added in portions every 2 . 5 min over a period of 12 . 5 min waiting for each addition to solubilize before adding the next . tween 80 was added with continuous stirring and heat . xanthum gum was then added in 0 . 25 g quantities over a period of two min while increasing stirring to 150 rpm . the wax mixture was poured into the peg - drug mixture over two to three min while stirring at 200 rpm and stirred for an additional five min . the two mixtures were stirred mechanically with visual inspection . as soon as the wax began to solidify , the mixture was poured in a mold . the formulation of table 1a was assessed for an in vitro benzocaine release profile from the wax using an artificial saliva formulation that was prepared according to table 2 . the in vitro analgesic / anesthetic release study used the artificial saliva formulation containing potassium phosphate monobasic ( kh 2 po 4 ), sodium phosphate dibasic ( na 2 hpo 4 ), potassium bicarbonate ( khco 3 ), sodium chloride ( nacl ), magnesium chloride hexahydrate ( mgcl 2 . 6h 2 o ), calcium chloride ( cacl 2 ), citric acid anhydrous , dilute hydrochloric acid ( nci ), methanol , and milliq filtered water ( resistivity = 18 . 0 megaohms ). each ingredient was dissolved in 150 - 200 ml milliq filtered water and poured in a 4 l volumetric flask placed on a stirrer ( 350 rpm ). kh 2 po 4 , na 2 hpo 4 and mgcl 2 were ground before weighing . the final ph of the solution was adjusted to 6 . 7 using dilute hcl . a standard curve of benzocaine was prepared . one mg benzocaine was dissolved in 20 ml methanol to make a stock solution . the stock solution was used to make 5 ml of increasing concentrations of benzocaine in artificial saliva ( 5 μm , 10 μm , 15 μm , 20 μm , 25 μm , 30 μm , 35 μm , 40 μm , 45 μm , 50 μm , 55 μm , and 60 μm ). absorbance of each concentration was measured at 284 nm using a uv / vis double beam spectrophotometer . the cuvette was washed 3 - 4 times with water between each measurement . each measurement was performed in triplicate , with the average absorbance of each concentration used to generate the standard curve . a hanson vision elite 8 dissolution apparatus was used for the in vitro benzocaine release study . degassed artificial saliva was the dissolution medium ( 900 ml ). the paddle speed was 50 rpm and the water bath was maintained at 37 ° c . five ml of medium was withdrawn at each time point ( 0 min , 30 min , 60 min , 120 min , 180 min , 240 min , 300 min , 360 min , 420 min , 480 min , and 77 hours ) and replaced by an equal volume of warm artificial saliva . sinkers were used to place about 150 mg benzocaine wax in each basket . the results of a standard benzocaine curve prepared in artificial saliva are reported in table 3 and shown in fig1 . the results of in vitro release of 5 % benzocaine , formulated as shown in table 1a , in the artificial saliva formulation from table 2 are reported in table 4 and shown in fig2 . as the data show , this formulation had an average of 56 % percent benzocaine released into the artificial saliva medium after eight hours . this release rate was more than twice that obtained for a previous first - generation formulation described in u . s . pat . no . 6 , 074 , 674 ( the &# 39 ; 674 patent ) which is expressly incorporated by reference herein in its entirety . the &# 39 ; 674 patent formulation was 7 . 1 % tragacanth , 70 . 9 % microcrystalline wax , 2 . 0 % span 80 , and 20 . 0 % benzocaine . the &# 39 ; 674 patent formulation had an in vitro release of only 22 . 7 % benzocaine released into the medium after eight hours . this difference was unexpected . without being limited to a specific theory , and with all other variables being equal , fick &# 39 ; s law of diffusion would predict a greater release of analgesic / anesthetic agent from a matrix that contains a higher concentration of the analgesic / anesthetic agent . from the results shown herein , however , a greater percent of benzocaine was released from the disclosed formulation that contained a relatively lower benzocaine concentration , compared to that in the &# 39 ; 674 patent . specifically , the analgesic / anesthetic agent that was released from the formulation now disclosed was 11 . 3 % at 1 hr , 16 . 6 % at 2 hr , 18 . 8 % at 3 hr , 23 . 8 % at 4 hr , 29 . 7 % at 5 hr , 39 . 8 % at 6 hr , 48 . 3 % at 7 hr , and 56 . 0 % at 8 hr . the analgesic / anesthetic is released in one embodiment up to 24 h . in embodiments using a sustained release agent , xanthum gum provided both a good release rate and a good product aesthetic appearance . without being bound by a specific theory , this may be due to the structure of the xanthum gum compound , its hydrophilic characteristic , and its emulsifying property that may facilitate saliva penetration of the wax matrix and release of the analgesic / anesthetic . xanthum gum is used in oral and topical pharmaceutical formulations , cosmetics , and foods as a suspending agent , stabilizing agent , thickening agent , and emulsifying agent . it is nontoxic , compatible with most other pharmaceutical ingredients , and has good stability and viscosity properties over a wide ph and temperature range . it has been used to prepare sustained - release matrix tablets . such properties are known , as disclosed in the following references , each of which is expressly incorporated by reference herein in its entirety : jansson p e , kenne l , lindberg b . structure of extracellular polysaccharide from xanthamonas campestris . carbohydr res 1975 ; 45 : 275 - 282 ; melton l d , mindt l , rees d a , sanderson g r . covalent structure of the polysaccharide from xanthamonas campestris : evidence from partial hydrolysis studies . carbohydr res 1976 ; 46 : 245 - 257 ; dhopeshwarkar v , zatz j l . evaluation of xanthan gum in the preparation of sustained release matrix tablets . drug dev ind pharm 1993 ; 19 : 999 - 1017 . compared to the &# 39 ; 674 patent formulation containing a relatively higher 15 %- 25 % concentration of analgesic / anesthetic , the formulations disclosed herein have a lower concentration of analgesic / anesthetic agent . this results in enhanced patient safety and ease of regulatory approval , while also providing an enhanced release profile for increased efficacy . the formulations disclosed herein have an improved aesthetic appearance , facilitating patient use and compliance , and are more similar to unmedicated waxes , and less similar to the tragacanth - containing wax described in the &# 39 ; 674 patent with a yellow appearance . the increased percentage of the wax matrix assists in retaining a wax - like character ; sufficiently flexible to be broken off of a wax strip and applied to an orthodontic bracket without crumbling or falling apart , as shown in fig3 . this increases both patient acceptability , as well as formulation retention on orthodontic brackets . in use , the wax is applied to the bracket . it will then be in contact with the mucosa as the gums lay against the teeth . without the wax , the mucosa lays against the metal bracket ; this is the source of irritation to the mucosa . the wax will stay on the metal bracket because the wax is malleable . the wax will be molded onto the part of the bracket that protrudes and is in contact with the mucosa . the ingredients that may be used in embodiments of the formulation are as follows : analgesic / anesthetic agents , also termed active agents , include benzocaine , lidocaine , novocaine , procaine , butalaine , dyclonine , prilocaine , tetracaine , butamben ( butyl 4 - aminobenzoate ), cocaine , fidocaine , dibucaine , oxybuprocaine , pramoxine , proparacaine , proxymetacaine , amethocaine , cholorbutanol , ambroxol hcl , hexylresorcinol , amylmetacresol dichlorobenzylalcohol , dichlorobenzene , benzyl alcohol . combinations of anesthetics include emla ( eutectic mixture of local anesthetics ) which is a combination of lidocaine and prilocaine ; tac which is a combination of tetracaine , adrenaline / epinephrine and cocaine ; let which is a combination of lidocaine , adrenaline / epinephrine and tetracaine . a wax or mixture of waxes capable of serving as a matrix and maintaining its integrity after incorporation of all active ingredients and excipients , including after application in the mouth , may be used . thus , any wax or combination of commercially available natural or synthetic waxes and including but not limited to the following may be used : anionic emulsifying wax , bleached wax , carnauba wax , cetyl esters wax , hard wax , microcrystalline wax , nonionic emulsifying wax , refined wax , white wax , white beeswax , yellow wax , yellow beeswax . in one embodiment , the wax is microcrystalline wax . in one embodiment , a non - ionic polymer is selected from the group consisting of sodium carboxymethyl cellulose , carbopol ® etd 2001 resin , tragacanth , poly ( ethylene oxide ), methylcellulose , hydroxy - propylmethylcellulose , karya gum , cellulose , soluble starch , gelatin , poly ( vinyl pyrrolidone ), poly ( ethylene glycol ) 8000 , poly ( ethylene glycol ) 4000 , poly ( vinyl alcohol ), and combinations thereof . in one embodiment , the non - ionic polymer is peg 1500 . in one embodiment , the surfactant is selected from the group consisting of sorbitan monolaurate , polysorbate 80 , spans , tweens , and combinations thereof . in one embodiment , the surfactant is polysorbate 80 ( tween 80 ). in one embodiment , the formulation contains one or more swelling agents , emulsifiers , surfactants , and / or wetting agents , each described in the handbook of pharmaceutical excipients . these may be included to optimize or otherwise alter the release of active , e . g ., benzocaine , from the wax matrix , e . g ., alginic acid ( also known as e400 , kelacid ™, l - gulo - d - mannoglycuronan , polymannuronic acid , protacid ®, satialgine h8 ®); bentonite ( also known as abagel ®, e558 , magnabrite ®, mineral soap , polargel ®, soap clay , taylorite , veegum ® hs , wilkinite ); calcium alginate ( also known as alginic acid calcium salt , algin , ca33 , calc align , calcium polymannuronate , calginate , e404 , kaltostat ®); carbomer ( also known as acritamer ®, acrylic acid polymer , carbopol ®, carboxy polymethylene , polyacrylic acid , carboxyvinyl polymer , pemulen ®, carbopol ® ultrez ); carboxymethylcellulose calcium ( also known as calcium carboxymethylcellulose , calcium cmc , ecg 505 , nymcel ® zsc ); carboxymethylcellulose sodium ( also known as akucell ®, aquasorb ®, blanose ®, cellulose gum ; cmc sodium ); cellulose acetate phthalate ( also known as acetyl phthalyl cellulose , aquacoat ® cpd , cap , cellacephate , cellulose acetate benzene - 1 , 2 - dicarboxylate , cellulose acetate hydrogen 1 , 2 - benzenedicarboxylate , cellulose acetate hydrogen phthalate , cellulose acetate monophthalate , cellulose acetophthalate , cellulose acetylphthalate ); ceratonia ( also known as algaroba , carob bean gum , carob flour , ceratonia gum , ceratonia siliqua , ceratonia siliqua gum , cheshire gum , e410 , gomme de caroube , locust bean gum , meyprofleur , st . john &# 39 ; s bread ); croscarmellose sodium ( also known as ac - di - sol ™ crosslinked carboxymethylcellulose sodium , explocel ™, modified cellulose gum , nymcel ® zsx , pharmacel ® xl , primellose ®, solutab ®, vivasol ®); crospovidone ( also known as crosslinked povidone , e1202 , kollidon ® cl , kollidon ® cl - m , polyplasdone ® xl , polyplasdone ® xl - 10 , polyvinylpolypyrrolidone , pvpp , 1 - vinyl - 2 - pyrrolidinone homopolymer ); gelatin ( also known as byco ™, cryogel ®, gelatin , instagel ™, solugel ™); glyceryl monooleate ( also known as aldo ® mo , atlas ™ g - 695 , capmul ® gmo , glycerol - 1 - oleate , glyceryl mono - oleate , kessco ™ gmo , ligalub , monolein , monomuls ® 90 - 018 , mono - olein , a - mono - olein glycerol , peceol ®, priolube ® 1408 , stepan ® gmo , tegin ®); guar gum ( also known as e412 , galactosol ™, guar flour , jaguar gum , meyprogat , meyprodor ™, meyprofin ); hectorite ( also known as hector clay , hectabrite ® aw , hectabrite ® dp , ghassoulite , laponite ®, shca - 1 , strese & amp ; hofmann &# 39 ; s hectorite ); hydroxyethyl cellulose ( also known as cellosize ® hec , cellulose hydroxyethyl ether , cellulose hydroxyethylate , ethylhydroxy cellulose , ethylose , hec , he cellulose , 2 - hydroxyethyl cellulose ether , hydroxyethyl ether cellulose , hydroxyethyl starch , hyetellose , natrosol ®, oxycellulose , tylose pha ); hypromellose ( also known as benecel ® mhpc , e464 , hydroxypropyl methylcellulose , hpmc , methocel ®, methylcellulose propylene glycol ether , methyl hydroxypropylcellulose , metolose ®, tylopur ™); hypromellose acetate succinate ( also known as aqoat ®, aqoat ® as - hf / hg , aqoat ® as - lf / lg , aqoat ® as - mf / mg , cellulose 2 - hydroxypropyl methyl ether acetate succinate , hpmcas ); hypromellose phthalate ( also known as cellulose phthalate hydroxypropyl methyl ether , hpmcp , hydroxypropyl methylcellulose benzene - 1 , 2 - dicarboxylate , 2 - hydroxypropyl methylcellulose phthalate , methylhydroxypropylcellulose phthalate ); kaolin ( also known as argilla , bolus alba , china clay , e559 , kaolinite , lion , porcelain clay , sim 90 , weisserton , white bole ); magnesium aluminum silicate ( also known as aluminosilicic acid magnesium salt , aluminum magnesium silicate , carrisorb , gelsorb ™ magnabrite ®, magnesium aluminosilicate , magnesium aluminum silicate colloidal , magnesium aluminum silicate complex colloidal , neusilin ®, pharmsorb , silicic acid aluminum magnesium salt , veegum ); methylcellulose ( also known as benecel ®, culminal ® mc , e461 , methocel ®, metolose ®); polacrilin potassium ( also known as amberlite ™ irp - 88 , methacrylic acid polymer with divinylbenzene potassium salt , polacrilinum kalii ); polycarbophil ( also known as noveon ® aa - 1 ); polyethylene oxide ( also known as polyox ®, polyoxirane , polyoxyethylene ); polymethacrylates ( also known as acryl - eze ®, acryl - eze ® mp , eastacryl ® 30d , eudragit ®, kollicoat ® mae 30 d , kollicoat ® mae 30 dp , polymeric methacrylates ; usp / nf non - proprietary names are ammonio methacrylate copolymer , methacrylic acid copolymer , methacrylic acid copolymer dispersion ; saponite ( also known as afrodit , aluminum - saponite , auxite , cathkinite , ferroan saponite , griffithite , licianite , lucianite ); sodium starch glycolate ( also known as carboxymethyl starch sodium salt , explosol ®, explotab ®, glycolys ®, primojel ®, starch carboxymethyl ether sodium salt , tablo ™, vivastar ® p ); starch ( also known as amido , amidon , amilo , amylum , aytex ® p , c * pharmgel ®, fluftex ™ w , instant pure - cote ®, melojel ®, meritena , paygel ® 55 , perfectamyl ® d6ph , pure - bind ®, pure - cote ®, pure - dent ®, pure - gel ®, pure - set ®, purity 21 , purity 826 , tablet white ); tragacanth ( also known as algaroba , carob bean gum , carob flour , ceratonia gum , ceratonia siliqua , ceratonia siliqua gum , cheshire gum , e410 , gomme de caroube , locust bean gum , meyprofleur , st . john &# 39 ; s bread ); xanthan gum ( also known as corn sugar gum , e415 , keltrol ®, polysaccharide b - 1459 , rhodigel ®, vanzan ® nf , xantural ®); d - a - tocopherol ( vitamin e ) ( also known as copherol ® f1300 , ( )- 3 , 4 - dihydro - 2 , 5 , 7 , 8 - tetramethyl - 2 -( 4 , 8 , 12 - trimethyltridecyl )- 2h - 1 - benzopyran - 6 - ol ; e307 , eastman ® vitamin e tpgs , synthetic alpha tocopherol , all - rac - atocopherol , dl - a - tocopherol , 5 , 7 , 8 - trimethyltocol ); benzalkonium chloride ( also known as alkylbenzyldimethylammonium chloride , alkyl dimethyl benzyl ammonium chloride , bkc , hyamine ® 3500 , pentonium , zephiran ®); cetostearyl alcohol ( also known as cetearyl alcohol , crodacol ™ cs90 , lanette ® o , tego ® alkanol 1618 , tego alkanol 6855 ); cetrimide ( also known as bromat ™, cetab , cetavlon ®, cetraol , lissolamine v , micol , morpan chsa , morphans , quammonium , suticide ); cetylpyridinium chloride ( also known as c16 - alkylpyridinium chloride , cepacol ®, cepacol chloride , cetamiun , cetyl pyridium chloride , dobendan , hexadecylpyridinium chloride , 1 - hexadecylpyridinium chloride , medilave , pristacin ; pyrisept ); diethanolamine ( also known as bis ( hydroxyethyl ) amine , dea , diethylolamine , 2 , 20 - dihydroxydiethylamine , diolamine , 2 , 20 - iminodiethanol ); docusate sodium ( also known as bis ( 2 - ethylhexyl ) sodium sulfosuccinate , dioctyl sodium sulfosuccinate , dss , sodium dioctyl sulfosuccinate , sulfo - butanedioic acid 1 , 4 - bis ( 2 - ethylhexyl ) ester sodium salt ); glyceryl monostearate ( also known as capmul ® gms - 50 , cutina ® gms , 2 , 3 - dihydroxypropyl octadecanoate , glycerine monostearate , glycerin monostearate , glycerol monostearate , glycerol stearate , glyceryl stearate , gms , imwitor ® 191 , imwitor ® 900 , kessco ™ gms , lipo gms 410 , lipo gms 450 , lipo gms 600 , monoester with 1 , 2 , 3 - propanetriol , monostearin , myvaplex ™ 600p , myvatex ™, 1 , 2 , 3 - propanetriol octadecanoate , protachem gms - 450 , rita gms , stearic acid monoester with glycerol , stearic monoglyceride , stepan ® gms , tegin ®, tegin ® 503 , tegin ® 515 , tegin ® 4100 , tegin ® m , unimate ™ gms ); lauric acid ( also known as c - 1297 , dodecanoic acid , dodecoic acid , duodecylic acid , n - dodecanoic acid , hydrofol ™ acid 1255 , hydrofol ™ acid 1295 , hystrene ® 9512 , laurostearic acid , neo - fat 12 , neo - fat 12 - 43 , ninol ® aa62 extra , 1 - undecanecarboxylic acid , vulvic acid , wecoline 1295 ); lecithin ( also known as e322 , egg lecithin , lsc 5050 , lsc 6040 , mixed soybean phosphatides , ovolecithin , phosal ® 53 mct , phospholipon ® 100 h , soybean lecithin , soybean phospholipids , sternpur , vegetable lecithin ); macrogol 15 hydroxystearate ( also known as 12 - hydroxyoctadecanoic acid polymer with alpha - hydro - hydroxypoly ( oxy - 1 , 2 - ethanediyl ), polyethylene glycol 660 12 - hydroxystearate , solutol ® hs 15 ); medium - chain triglycerides ( also known as bergabest ®, caprylic / capric triglyceride , captex ® 300 , captex ® 355 , crodamol ™ gtc / c , glyceryl tricaprylate / caprate , labrafac ™ cc , mct oil , miglyol ® 810 , miglyol ® 812 , myritol ®, neobee ® m5 , nesatol , oleum neutral , oleum vegetable tenue , thin vegetable oil , waglinol 3 / 9280 ); monoethanolamine ( also known as δ - aminoethyl alcohol , colamine , ethylolamine , β - hydroxyethylamine , 2 - hydroxyethylamine ); myristic acid and its salts ( also known as edenor ® c14 98 - 100 , n - tetradecanoic acid , 1 - tridecanecarboxylic acid ); palmitic acid and its salts ( also known as cetylic acid , edenor ® c16 98 - 100 , emersol ® 140 , emersol ® 143 , n - hexadecoic acid , hexadecylic acid , hydrofol ™, hystrene ® 9016 , industrene ® 4516 , 1 - pentadecanecarboxylic acid , hexadecanoic acid sodium salt , palmitic acid sodium salt , sodium hexadecanoate , myricyl palmitate ); poloxamer ( also known as lutrol , monolan ™, pluronic ®, poloxalkol , polyethylene - propylene glycol copolymer , polyoxyethylene - polyoxypropylene copolymer , supronic , synperonic ®); polyoxyethylene alkyl ethers ( synonyms applicable to polyoxyethylene alkyl ethers are brij ®, cremophor ® a , cyclogol ™ 1000 , empilan ® kb , empilan ® km , emulgent ®, ethylan ™ c , macrogol ethers , marlowet ®, plurafac ™, procol ®, ritoleth , ritox , texofor a , volpo ); polyoxyethylene castor oil derivatives ( also known as acconon ®, arlatone ®, cremophor ®, etocas ™, eumulgin ®, jeechem ®, lipocol ®, mapeg ®, marlowet ®, nikkol ®, protachem , simulsol ™; polyoxyethylene sorbitan fatty acid esters ( also known as tweens , polysorbates of varying molecular weight ); polyoxyethylene stearates ( also known as ethoxylated fatty acid esters , macrogol stearates , marlosol ™, peg fatty acid esters , peg stearates , polyethylene glycol stearates , poly ( oxy - 1 , 2 - ethanediyl ) a - hydro - o - hydroxyoctadecanoate , polyoxyethylene glycol stearates ); potassium sorbate ( also known as e202 , 2 , 4 - hexadienoic acid ( e , e )- potassium salt , potassium ( e , e )- hexa - 2 , 4 - dienoate , potassium ( e , e )- sorbate ; sorbic acid potassium salt ); sodium lauryl sulfate ( also known as dodecyl sodium sulfate , elfan ® 240 , sodium dodecyl sulfate , sodium laurilsulfate , sodium monododecyl sulfate , sodium monolauryl sulfate , texapon ® k12p ); sorbitan esters ( sorbitan fatty acid esters ) ( also known as spans ); stearic acid and its salts ( also known as cetylacetic acid , crodacid , e570 , edenor ®, emersol ®, hystrene ®, industrene ®, kortacid ™ 1895 , pearl steric , pristerene ®, stereophonic acid , tegostearic ); triethanolamine ( also known as tea , tealan , triethylolamine , trihydroxytriethylamine , tris ( hydroxyethyl ) amine ); triethyl citrate ( also known as citric acid ethyl ester , citroflex ® 2 , citrofol ™ al , e1505 , hydagen ® cat , tec ). the embodiments shown and described in the specification are only specific embodiments of the inventor who is skilled in the art and thus are not limiting in any way . various changes , modifications , or alterations may be made or resorted to without departing from the spirit of the invention or the scope of the following claims . as only two examples , additional actives may be incorporated into the formulation to provide additional medicinal effects , and / or the formulation may be provided in another type of carrier for self - application to the orthodontic bracket . | US-201314439535-A |
a method , system and apparatus for augmenting the surgical repair of soft tissue injuries , in which a first end of a bridge member attaches to a first portion of healthy tissue , and a second end of the bridge member attaches to a second portion of healthy tissue . the bridge member used to augment the soft tissue repair may be interconnected or function independently . flexibility and elasticity of the bridge member are determined by the situation and may be altered to improve healing . the device may be used in arthroscopic procedures , and may be manufactured in a variety of lengths , or may be manufactured one length and be cut to the desired length , or otherwise altered to provide an optimal length of the bridge member . | the present invention overcomes the shortcomings of current soft tissue repair techniques by incorporating one or more bridge members of selected length to accommodate proper attachment across injured tissue in connection with the repair of such tissue . for illustrative purposes of this document , embodiments of the present invention and methods for using embodiments of the present invention are described as it may be used to repair rotator cuff tears . those skilled in the art will recognize that the present invention is capable of repair of other soft tissue injuries without departing from the spirit or scope of the present invention . referring to fig4 , the present invention generally comprises a bridge member 10 that includes a bridging section 12 to which is attached a first connector end 14 and a second connector end 16 . the bridging section 12 is adapted with a selected length adequate to span the injured tissue and to provide attachment to healthy attachment points . the bridging section 12 may be comprised of any of a number of materials that are appropriate for use in the human body and provide the desired flexibility , elasticity or rigidity for a particular application . examples of materials that may be used to construct the bridging section 12 include , but are not limited to , polyethylene , an orthopedic plastic manufactured under the trade name delrin , bioabsorbable materials , and biologic materials , and / or combinations of these materials . ideally , the bridging section 12 has a cross section adapted for non - injurious contact with the injured tissue to minimize the possibility of cutting or otherwise further injuring the tissue , and furthermore having a minimal thickness to reduce the volume of the device when in place in the body . the particular thickness and width in cross - sectional shape of the bridging section 12 may be varied with the material that is used to construct the bridging member 10 in order to provide the requisite strength for a given application . it is believed that this element of design will be known to those of ordinary skill in the art in light of the present disclosure . in designing the bridging section 12 , different degrees of flexibility or elasticity may be desirable . for example , in some repair situations , it may be beneficial for the bridge member 10 to be substantially rigid . in other situations , it may be beneficial for healing if the bridge member 10 has some degree of flexibility , such as lateral or torsional flexibility . further , in some situations , it may be beneficial for the bridge member 10 to have some degree of elasticity , so that a selected degree of the stretching of the bridge member 10 longitudinally is permitted . such flexibility or elasticity may be desirable to permit limited movement of the spanned tissue — both the injured tissue and the healthy tissue — to stimulate blood flow and to permit healing . accordingly , it is contemplated under the present invention that the material of which the bridging section 12 is comprised will be selected to provide the desired degree of flexibility and / or elasticity for a particular application for a particular type of repair . referring still to fig4 , the bridge member 10 further includes a first connector end 14 attached to the bridging section 12 . the first connector end 14 is adapted to accommodate attachment of the bridge member 10 to bone or healthy tissue . therefore , first connector end 14 may take a number of suitable shapes providing appropriate apertures or attachment members to enable attachment of the bridge member 10 to the bone or healthy tissue . in the preferred embodiment , the first connector end 14 has a generally flat , circular shape as shown in fig4 in order to provide sufficient material strength to support the connection between the bone and the healthy tissue and the bridging section 12 . in the preferred embodiment , the first connector end 14 further has an aperture 13 adapted to receive an attaching device such as a suture or a mechanical fastener . as will be appreciated in light of the present disclosure , aperture 13 is sized and configured to be complementary with the anticipated attaching device for the particular application . as with the bridging section 12 , the first connector end 14 may be comprised of any of a number of materials suitable for use in human beings . for example , the first connector end 14 may be comprised of metal or orthopedic plastic . because the first connector end 14 must accommodate the secure attachment of the bridge member 10 to healthy bone or tissue , in the preferred embodiment , the first connector end 14 will be substantially rigid or have only moderate flexibility in order to provide a stable attachment point with the bone or healthy tissue . the first connector end 14 may be connected to the bridging section 12 in a number of ways suitable for providing a non - detachable connection between the first connector end 14 and the bridging section 12 . in the preferred embodiment , it is contemplated that the bridge member 10 will be formed as a unitary body such that the bridging section 12 , the first connector end 14 , and the second connector end 16 are all integrally formed as a single piece . referring still to fig4 , the bridge member 10 also includes a second connector end 16 adapted to enable attachment of the bridge member 10 to a different , opposing section of healthy bone or tissue from the bone or tissue to which the first connector end 14 was secured . in the simplest preferred embodiment , the second connector end 16 has a shape and configuration similar to the first connector end 14 and includes an aperture 15 as shown in fig4 . in the simplest embodiment , the second connector end 16 is made of the same material that is similar to the material that is used to make the bridging section 12 and the first connector end 14 and , in a preferred aspect of this embodiment , is formed as part of a unitary body with the bridging section 12 and the first connector end 14 . as discussed above , the length of the bridging section 12 and of the bridge member 10 is selected to enable the device of the present invention to be attached at two healthy attachment points and span injured tissue . the necessary length and shape of the bridge member 10 , therefore , will vary with the particular application and the extent of the injury to be repaired . referring to fig5 , 6 , 7 , and 8 , there are shown alternative embodiments of the present invention that are designed to accommodate the repair of situations of differing lengths and shapes . for example , in the embodiment shown in fig5 , the bridge member 10 comprises an elongated second connector end 16 having a plurality of apertures designated as 15 a , 15 b , and 15 c , selectively positioned along the length of the second connector end 16 . in use , the bridge member 10 can be severed before the attachment aperture 15 c or before the attachment aperture 15 b depending upon the overall length that is needed for the bridge member 10 . referring to fig6 , there is shown an alternative that is similar in nature to the embodiment shown in fig5 . in particular , the embodiment shown in fig6 comprises a plurality of apertures 15 a , 15 b , 15 c , 15 d , and 15 e , all disposed along the length of the second connector end 16 to accommodate the selective attachment of the bridge member 10 across soft tissue of a determined length . referring still to fig5 and 6 , the bridge member 10 may further include surface fasteners 18 on any surface that is intended to contact soft tissue . the surface fasteners 18 may take the form of spikes , barbs , or other mechanical features that penetrate the soft tissue and / or enhance fixation at the bone / tendon interface . in fig5 and 6 , the surface fasteners 18 are depicted by way of example as many spikes . referring still to fig4 - 8 , the embodiments shown depict bridge member 10 having a first connector end 14 that is generally circular in shape and a second connector end 16 that varies in length . it is to be understood by those skilled in the art that the shapes and lengths of the attachment ends may be varied in selectively determining the length of the attachment member in accordance with the present invention . just as the shape and length of the respective attachment ends 14 and 16 may be varied to provide greater flexibility in terms of length and use , the shape and configuration of the apertures 13 and 15 may also be varied to accommodate different means of fastening . for example , an end may be configured to have an aperture of suitable diameter and have additional selectively spaced apertures of smaller diameter to accommodate the use of a soft tissue cleat to attach the end to soft tissue . similarly , the holes 13 or 15 may be varied in size to accommodate use of sutures , screws , or other attaching devices . referring now to fig7 and 8 , there are shown alternative embodiments having irregularly shaped or multiple attachment ends 16 to accommodate multiple points of fixation and to accommodate the spanning of more complex injury sites . it will be appreciated , based upon the present disclosure , that other geometric configurations could be utilized to provide differing numbers of extensions and differing lengths to address particular injuries . fig9 is a view of a shoulder soft tissue repair site illustrating use of a bridge member 10 in accordance with one embodiment of the present invention . in this example , the bridge member 10 attaches to healthy soft tissue 45 on the proximal side of the injury using sutures 25 , spans the injured tissue , and reattaches the injured tissue to the healthy bone tissue 47 at a second point of attachment through the use of sutures 27 and bone tunnels 29 . in particular , the sutures 25 attach a first connector end 14 of the bridge member 10 to the healthy rotator cuff tissue 45 proximal to the torn edge of the injured tissue , where the tissue is thicker and stronger . additionally , spikes 18 ( not shown ) on the undersurface of the bridge member 10 may be used to enhance fixation of the bridge member 10 to the soft healthy tissue 45 . typically , in this repair , one or more tunnels 29 are drilled through bone tissue 47 at a second point of attachment . suture 27 passes through one tunnel 29 , through a portion of the rotator cuff soft tissue 45 , through an opening or other feature in the bridge member 10 and through a second tunnel 29 in the bone 47 . the suture 27 is tied over the outside of the bone 47 over a cortical bridge between the tunnels 29 . the soft tissue 45 is thereby reattached to the bone 47 using a bridge member 10 to augment the soft tissue side of the repair . fig1 is a view of another example of a shoulder soft tissue repair site in which rotator cuff tissue 45 is reconnected to healthy bone tissue 47 using a bridge member 10 in accordance with one embodiment of the present invention . in this example , reattachment of the avulsed tissue 45 is accomplished using a soft tissue cleat 23 to connect the bridge member 10 to a portion of healthy soft tissue 45 , and screw 51 to connect to the bridge member 10 and reattach the avulsed tissue 45 to the bone tissue 47 . in particular , first connector end 14 of the bridge member 10 is of a design adapted to accommodate connection to a soft tissue cleat 23 , such as described in co - pending u . s . patent application ser . no . 09 / 963 , 132 . in this embodiment , the soft tissue cleat 23 connects a first connector end 14 of a bridge member 10 to a healthy portion of the rotator cuff tissue 45 proximal to the torn edge , where the tissue is thicker and stronger . spikes 24 on the soft tissue cleat 23 may be utilized to enhance fixation of the bridge member 10 to the healthy soft tissue 45 . as disclosed in co - pending u . s . patent application ser . no . 09 / 963 , 132 and as shown in fig1 , the soft tissue cleat 23 is used for coapting soft tissue of the rotator cuff tissue 45 and the connection end 14 of the bridging member 10 . the soft tissue cleat 23 includes a first disc or side 26 and a second disc or side 28 . the first disc 26 is attached to the second disc 28 to coapt an area of soft tissue 45 at the connection end 14 of the bridging member 10 . the first disc 26 has a plurality of fixed - length projections or spikes 24 and 25 extending perpendicularly from the bottom surface of the first disc 26 . the projections or spikes 24 and 25 of the first disc 26 are configured to perforate the soft tissue 45 . the second disc 28 has at least one indention 29 configured to receive a portion of at least one of the projections or spikes 25 . this at least one spike 25 is positioned through the aperture 15 in the connection end 14 and is securely joined to the indentation 29 in the second disc 28 . in one aspect of the present invention , the indention 29 in the second disc 28 has a mechanical locking mechanism for securely joining to the at least one spike 25 of the second disc 26 . the bridge member 10 spans the torn edge of the rotator cuff 45 to a portion of healthy bone tissue 47 , where screw 51 is used to attach the second connector end 16 of bridge member 10 to the bone 47 . in this embodiment , bridge member 10 is adapted to accommodate connection to screw 51 and operable to facilitate reattachment of avulsed soft tissue 45 to the bone 47 . fig1 is a view of a soft tissue repair in which portions of soft tissue 45 are reconnected using tissue anchors , such as , but not limited to , soft tissue cleats as described in copending u . s . patent application ser . no . 09 / 963 , 132 , on both sides of the injury . in this embodiment , both first and second connector ends 14 and 16 are of a design adapted to accommodate connection to a soft tissue cleat 23 , such as described in co - pending u . s . patent application ser . no . 09 / 963 , 132 . the soft tissue cleat 23 connects the bridge member 10 to a healthy portion of the rotator cuff tissue 45 where the tissue 45 is thicker and stronger . spikes ( not shown ) on the soft tissue cleat 23 and spikes ( not shown ) on the undersurface of the second connector end 16 of the bridge member 10 may be included to enhance fixation of the bridge member 10 to the healthy soft tissue 45 . the bridge member 10 spans the torn portion of the rotator cuff to a second point of attachment on the opposite side of the injury site in another portion of healthy soft tissue 45 . reconnection of the portions of the soft tissue 45 is thereby accomplished with bridge member 10 and soft tissue cleats 23 to provide augmentation to the soft tissue repair . fig1 is a cross - sectional view of a soft tissue repair site in which a bridge member 10 according to one embodiment of the present invention , a tissue anchor 23 , and a suture anchor 50 are utilized in order to reattach an avulsed rotator cuff tissue to the proximal humerus 47 . in this example , a soft tissue cleat 23 , such as described in co - pending u . s . patent application ser . no . 09 / 963 , 132 , securely attaches a first connector end 14 of the bridge member 10 to the healthy rotator cuff muscle 45 proximal to the torn edge of the injured tissue where the tissue is thicker and stronger . spikes 24 on the soft tissue cleat 23 enhance fixation of the bridge member 10 to the healthy soft tissue 45 . the bridge member 10 spans the injury site and is adapted for connection to the bone tissue 47 by means of a suture anchor 50 and sutures 46 . typically , the suture anchor 50 is engaged into bone 47 . the suture 46 passes through an aperture of suture anchor 50 , through a selected portion of tissue 45 that has avulsed from the bone 47 , and through an aperture 15 in the second connector end 16 of bridge member 10 , such that the soft tissue 45 is affixed to the bone 47 . in this manner , the soft tissue 45 is supported through the healing process with the bridge member 10 facilitating reattachment of the avulsed soft tissue 45 to the bone 47 . the rotator cuff is thereby repaired using a bridge member 10 and soft tissue cleat 23 to augment the construct . advantageously , embodiments of the present invention may provide improved pullout strength due in part to a moment generated by the bridge member 10 in contact with a soft tissue cleat 23 . in some embodiments , the moment is generated on the soft tissue cleat 23 when the muscle 45 contracts . the moment typically causes the soft tissue cleat 23 to tilt with respect to the line of action of the muscle pull , such that portions of the soft tissue cleat 23 are compressed into the soft tissue 45 . the result of a tilted fastener is a larger surface area than that of any penetrating sutures , posts , or barbs , contacting the soft tissue to increase pullout strength . therefore , a larger surface area of a soft tissue cleat 23 , tilted at some angle , may be advantageous for enhancing the fixation and pullout strength of the soft tissue cleat 23 . with the tilt , a central fixation peg or peripheral projections or both , and portions of the all contribute to the overall pullout strength of the repair . without the tilt , the only surface areas resisting pullout are those of a central fixation peg or peripheral projections or both . fig1 is a view of a shoulder with a tear in a rotator cuff similar to the tear illustrated in fig1 , repaired using a bridge member 10 according to one embodiment of the present invention similar to the system shown in fig1 . in addition to repairing the tear ( accomplished here by a technique of interrupted sutures ), the repair is augmented with a bridge member 10 similar to those shown in fig9 and 11 , and a soft tissue cleat 23 . those of skill in the art will appreciate the improved stability and strength of the repaired injury augmented by a bridge member 10 , which in this figure comprises a bifurcated second connector end 16 to distribute forces or to accommodate variations in stress occurring from motion of the shoulder . fig1 is a view of an injured rotator cuff as shown in fig2 . in this case , the edges of the torn rotator cuff have been reconnected using interrupted sutures 46 . in addition , the repair has been augmented utilizing a system of interconnected bridge members 10 . in various aspects of this embodiment , bridge members 10 are connected at a single attachment point on one end and their other ends are spaced at different attachment points in healthy soft tissue 45 on the other side of the injury . furthermore , bridge members 10 are connected to each other and connected to healthy soft tissue 45 on the same side of the injury , which may provide even more strength and stability to the repair . in this manner , the present invention may be used to emulate the structure or function of a trestle . advantageously , the use of a bridge member with current tissue anchors , sutures , and particularly soft tissue cleats may shorten the amount of time needed to perform a repair procedure . it will be obvious in view of the present disclosure and description that the present invention provides a secure connection for repairing soft tissue injuries , in a convenient form . therefore , instead of the surgeon spending time suturing through soft tissue or connecting a suture to a tissue anchor on the bony side of the repair , the surgeon is able to focus on optimum placement for anchoring devices and connecting the ends to the appropriate anchoring device . the present invention has been disclosed in connection with specific embodiments . however , it will be apparent to those of skill in the art that variations from the illustrated embodiments may be undertaken without departing from the spirit and scope of the present invention . for example , a soft tissue cleat , screw , or suture anchor may be incorporated into an attachment end . additionally , embodiments of the present invention may be attached to attachment points not located in healthy soft tissue . furthermore , the present invention may be adapted to accommodate connection to other mechanical fasteners such as staples or tacks to facilitate secure connections . these and other variations will be apparent to those skilled in the art in view of the above disclosure and are within the spirit and scope of the invention . as used in this specification and in the appended claims , it should be understood that the word “ a ” does not preclude the presence of a plurality of elements accomplishing the same function . | US-86622007-A |
a cosmetic applicator brush having a twisted wire core and an array of thermoplastic bristles with free tips extending radially outwardly from the core , wherein at least some of the bristles have shapes and / or surface textures modified at one or more localities between their free tips and the core by selective irradiation of the aforesaid locality or localities with laser energy . a method of making the brush includes the steps of assembling the core and bristles to form a brush , trimming the bristles to achieve a desired brush profile , and selectively irradiating at least some of the bristles with a laser beam at localities between the bristle tips and the core . | the cosmetic brush of the present invention , in illustrative embodiments , may be a twisted - in - wire mascara brush in which at least some of the bristles are modified , in shape and / or surface texture , with radiant energy delivered by application of a laser beam selectively to one or more localities on the modified brushes . in a method of making such a brush according to the invention , a twisted - in - wire brush of initially conventional character may be produced and trimmed using entirely conventional brush - making equipment . equipment of this type , and procedures for using it to produce a conventional twisted - in - wire mascara brush , are well known to persons skilled in the art and accordingly need not be further described . examples of such procedures are set forth , for instance , in u . s . pat . nos . 4 , 733 , 425 and 4 , 861 , 179 , the disclosures of which are incorporated herein by this reference . as shown in fig3 a , the brush 10 at this stage is constituted of an axially rectilinear twisted wire core 11 from which a multiplicity of fibers or bristles 12 extend in a radial array from the core 10 . each bristle has opposed free ends or tips 14 and is gripped between these tips by the wire core ; the tips cooperatively define a profile or notional envelope of the bristle brush array . after assembly and twisting of the core , the bristle ends are trimmed ( e . g . by mechanical cutting equipment ) to shape the brush profile as a cylinder with a distally tapering frusto - conical portion at the distal end 16 of the brush . the proximal end 18 of the core extends for some distance beyond the bristle array to enable the brush to be gripped , and ultimately to be mounted in the stem of a cap ( not shown ). in the stage represented by fig3 a , the individual bristles extend in essentially straight lines from the core 10 , which grips their midpoints , to their respective free tips . the bristles are lengths of a thermoplastic fiber , such a nylon fiber formed by extrusion ; in cross - section they may have any of a variety of configurations including , but not limited to , solid round , hollow round , multifinned and multilobed . the bristles of the brush of fig3 a are all of the same thickness , cross - section and material , for ease of production , but the invention in its broader aspects is not limited to brushes having uniform bristles throughout . as a feature of the method of the invention , a brush in the condition shown in fig3 a is placed into a holding fixture and presented to a laser which emits a beam of focused energy that is guided to selectively irradiate at least some of the bristles at one or more localities intermediate their free tips and the core and thereby to modify the shapes and / or the surface textures of the individual irradiated bristles . in this way , i . e . by selective irradiation with guided laser energy , the bristles , already assembled to form a brush as shown , can be altered from their original straight configuration to have bends at various distances along their length ( i . e . between their free tips and the core ) to improve the ability of the brush to carry and deliver the cosmetic product . fig3 b shows such a brush , embodying the present invention and produced from the brush of fig3 a by selective laser irradiation to bend some of the bristles at localities 20 , with local enlargements 21 at the points of bending . additionally , the tips of the bristles can be expanded or melted back ( not shown ), to create the effect of beaded tips on the bristles altering the cross - sectional shape of the fiber to improve the separating action of the brush on the lashes . the surface texture of the fibers can also be made rougher in selected areas of the brush , by the irradiation of those areas with laser energy , to improve the ability of the fibers to hold a mascara formula . the various effects of the laser treatment to the fibers can be combined , in an individual brush , to customize the brush as desired . any single type of treatment can be applied to the whole brush , or only to a selected portion of it without affecting the remaining fibers . during this laser irradiation process , the motion of both the brush and the laser are controlled on multiple axes to allow focusing of the laser energy in selected areas while the energy level and dwell time on the bristles are also being controlled . the holding fixture for the brush and the laser unit can be mounted on multi - axis computer controlled positioning systems . in currently preferred embodiments , the brush is held in a fixture that is rotated by means of a computer controlled stepper motor that can rotate continuously or through defined patterns of motion during treatment . the laser unit is mounted on a multi - axis computer controlled slide and rotation mechanism that allows for control of the motion of the focused light energy with respect to the brush . more particularly , the apparatus shown diagrammatically in fig1 includes a stepper motor 22 in which the proximal end 18 of the core of a twisted - in - wire mascara brush 10 ( i . e ., the brush illustrated in fig3 a as described above ) is held for rotation about the axis of the core ( axis a ) while portions of the brush bristle array are selectively irradiated by a beam from a laser 24 . in the showing of fig1 , the direction of the beam emitted by laser 24 is perpendicular to the plane of the view . the laser is movable , under control of a computer , about two axes ( represented as an x axis and a y axis perpendicular thereto ) with respect to the rest of the apparatus . such two - axis computer controlled lasers , including mounts and mechanisms for moving them , are known and are currently employed for such purposes as laser engraving or laser coding . the laser can be turned on and off during the progress of its beam across the brush . the brush can be rotated through any angle around its central axis a as controlled by a computer ( not shown ) driving the stepper motor 22 . motion can be started , stopped or pulsed as desired to expose various portions of the brush to continuous or varying amounts of electromagnetic radiation from the laser . in addition , the motor assembly holding the brush is supported on a mount 28 for rotation through a range of 270e around an axis b with respect to the laser , allowing for exposure of the brush to the laser from any angle including parallel to axis a . fig2 a , 2b and 2c illustrate various simple examples of the path 29 of the laser 24 with respect to the brush 10 . in these examples , the brush is shown as remaining stationary to indicate the variability of path options for the laser in the x - y axis as driven by paired linear actuators ( not shown ). independent motion of the brush as described above provides the flexibility to direct the energy from the laser at a multitude of positions and angles with respect to the brush . the x - y axis controller in the apparatus is programmable to drive the laser across the brush in any desired path . the brush can remain stationary ( as shown ) during treatment or be rotated and / or angled to present any portion of its surface to the radiation . fig3 b , viewed in comparison with fig3 a , shows the effect of selectively directing energy to the bristles via the laser ; i . e ., whereas fig3 a shows the assembled twisted - in - wire brush prior to the laser treatment , fig3 b illustrates the brush after treatment with the laser beam to selectively deform and deflect sections of bristles . areas 20 of the array of bristles are melted at some point along their length to deflect them at random angles with respect to the untreated bristles . the functional aspect of the treatment is to provide relatively short bristles shaped in a way to hold a pasty cosmetic product like mascara while leaving longer , untreated bristles to provide a combing action . the diagram shows a brush with some groups 20 of bristles of one side deflected by melting the plastic material of the bristles near their midpoints . using the apparatus described above it will be possible to treat up to 100 % of the bristles in any area of the brush . in a hypothetical example of currently preferred apparatus features and process conditions , the laser used is a co 2 laser capable of power output from 25 to 250 watts . feed speeds for the laser as it moves across the material range from 1 to 50 meters per minute . motions of both the laser and the brushes are controlled as described above ; the most likely configuration has two - axis motion of the laser while the brush can be rotated and angled with respect to the beam . air assist ( not shown ) is employed to remove any loose material freed by the process but the goal is not to cut the fiber , only to modify it at any point along the individual fibers . fibers are made of thermoplastic material , most commonly polyamide ( nylon ); the wire of the core is most commonly stainless steel . end uses of the produced brush are for the application of viscous cosmetic products , particularly mascara for eyelashes . it is to be understood that the invention is not limited to the features and embodiments hereinabove specifically set forth , but may be carried out in other ways without departure from its spirit . | US-53000108-A |
a method for treating an abnormal polyglutamine - mediated disease is disclosed , which comprises : administering a pharmaceutical composition comprising a trehalose - based compound to a subject in need . additionally , the pharmaceutical composition optionally further comprises a trehalase inhibitor . | we searched trehalose analogs from the zinc compound database ( http :// zinc . docking . org /) based on compound topology and function group analyses ; and obtained the human trehalase structure with a homology - modeling server . in addition , we used our in - house docking tool , gemdock to discover inhibitors and binding sites for several targets . after the docking procedure , igemdock was used to screen those with similar hydrogen bonding network to trehalose . a total of 17 , 833 , 934 compounds including fda drugs and natural products were examined , 21 were selected and 9 available were obtained . the 9 commercial available compounds are shown in fig1 , which are respectively trehalose ( c 12 h 22 o 11 , mw 342 . 30 ), α - d - lactose ( c 12 h 22 o 11 , mw 342 . 30 ), α - d - lactulose ( c 12 h 22 o 11 , mw 342 . 30 ), tobramycin ( c 18 h 37 n 5 o 9 , mw 467 . 52 ), kanamycin a ( c 18 h 36 n 4 o 11 , mw 484 . 50 ), acarbose ( c 25 h 43 no 18 , mw 645 . 61 ), d -(+)- melibiose ( c 12 h 22 o 11 , mw 342 . 30 ), trehalose - 6 - phosphate ( c 12 h 21 o 14 p , mw 420 . 26 ), palatinose hydrate ( c 12 h 22 o 11 , mw 342 . 30 ), and thiodiglucoside ( c 12 h 22 o 10 s , mw 358 . 36 ) from the left to the right and from the upper to the bottom ( herein , the formulas and the molecular weights of all the compounds are respectively shown under the structures thereof , as shown in fig1 ). the aforementioned compounds were used to test for their potentials to reduce the atxn3 / q 75 aggregation . polyadenylated rna ( 200 ng ) isolated from neuroblastoma sk - n - sh cells was reverse transcribed using the superscript ™ iii reverse transcriptase ( invitrogen ). the sense and antisense primers used for atxn3 / q 14 cdna (+ 826 ˜+ 1152 , nm_004993 ) amplification were 5 ′- attcagctaagt atg caaggtagttcca ( codon for met257 underlined , seq id no : 1 ) and 5 ′- catg ccatgg catgtttttttccttctgtt ( ncoi site underlined , seq id no : 2 ). the amplified 3 ′ polyq - containing cdna fragment ( translated into amino acids 257 ˜ 361 ) was cloned into pgem - t easy ( promega ) and sequenced . the atxn3 / q 14 cdna was excised with ecori ( in pgem - t easy vector ) and ncoi and subcloned into pegfp - n1 ( clontech ). then , dna fragment containing in - frame atxn3 / q 14 - egfp was excised with hindiii - noti and subcloned into the pcdna5 / frt / to ( invitrogen ). the atxn3 / q 75 cdna was made by replacing an 88 bp atxn3 / q 14 bsmbi - bsmfi fragment with a 271 bp atxn3 / q 75 fragment from the cdna clone of a sca3 patient . the cloned pcdna5 / frt / to - ntbp / q 36 ˜ 79 - gfp plasmids were used to generate the isogenic tbp cell lines by targeting insertion into flp - in sh - sy5y cells . the cloned plasmids and pog44 ( invitrogen ) plasmids for expression flp recombinase were co - transfected into the aforementioned sh - sy5y host cell lines by using the liposome - mediated transfection ( lf2000 , invitrogen ). in addition , the cloned pcdna5 / frt / to - atxn3 / q 14 and q 75 plasmids were used to generate the isogenic atxn3 / q 14 ˜ 75 cell lines by targeting insertion into flp - in ™ 293 cells . the aforementioned cell lines were grown in medium containing 5 μg / ml blasticidin and 100 μg / ml hygromycin ( invivogen ). 293 atxn3 / q 75 - gfp cells were plated into 96 - well ( 2 × 10 4 / well ) dishes , grown for 24 hr and treated with different concentrations of the trehalose or analogs ( 100 nm ˜ 100 μm ) and suberoylanilide hydroxamic acid ( saha , cayman chemical ) for 8 hr . then , doxycycline ( 10 μg / ml , bd ) was added to the medium in each well to induce atxn3 / q 75 - gfp expression for 6 days . oxaliplatin ( 5 μm , sigma ) was also added to increase aggregate accumulation through inhibition of cell division . then , cells were stained with hoechst 33342 ( 0 . 1 μg / ml , sigma ) and aggregation percentage was assessed by high content analysis ( hca ) system ( imagexpressmicro , molecular devices ), with excitation / emission wavelengths at 482 / 536 ( egfp ). sh - sy5y tbp / q 79 - gfp cells were seeded in 6 - well ( 2 × 10 5 / well ) plate , with all trans - retinoic acid ( 10 μm , sigma ) added at seeding time . at day 2 , cells were treated with trehalose or analogs ( 10 μm ) for 8 hr . then doxycycline ( 5 μg / ml ) was added and the cells were kept in the medium containing 10 μm trans retinoic acid , doxycycline and trehalose / analogs for 7 days . after that , cells were stained with hoechst 33342 ( 0 . 1 μg / ml ) and aggregation percentage was assessed by hca . hydrolysis of trehalose and analogs was tested using porcine kidney trehalase ( sigma - aldrich , t8778 ). the standard reaction was performed by adding 0 . 001 unit of trehalase into 50 μl reaction solution containing 135 mm citric acid ( ph 5 . 7 ) and 28 mm trehalose or trehalose analogs . in addition , the inhibition of analog against the trehalase activity was also examined . the standard reaction was performed by adding 0 . 001 unit of trehalase into 50 μl reaction solution containing 135 mm citric acid ( ph 5 . 7 ) and 44 . 8 mm α - d - lactulose , 44 . 8 mm α - d - melibiose , 0 . 2 μm validamycin a , or 0 . 2 μm validoxylamine a . trehalase was incubated with analog for 30 min at 37 ° c ., and the reaction was then started by addition of trehalose . after incubation at 37 ° c . for 2 hr , the reaction was terminated by heating the mixture in boiling water for 15 min . the activity of trehalase was assayed by measuring the amount of glucose produced from trehalose . the amount of carbohydrates after each enzymatic reaction was measured using a high - performance liquid chromatography ( hplc ) system ( schambeck sfd 2100 ) equipped with an refractive index ( ri ) detector ( sfd , ri 2000 ) at a flow rate of 1 ml / min . a carbohydrate analysis column ( shodex sugar sz5532 , 6 . 0 mm id × 150 mm l ) equilibrated with 75 % acetonitrile , 24 % milli - q water , and 1 % formic acid was used . the ri detector and column oven temperature were set to 40 and 60 ° c ., respectively . the pdsred - lc3 construct encoding human microtubule - associated protein 1 light chain 3 beta ( map1lc3b , nm_022818 ) was generated by pcr amplification of lc3 coding sequence from human cdna using the forward ( 5 ′- aagctt ccatgccgtcggagaag , hindiii site underlined , seq id no : 3 ) and reverse ( 5 ′- ttttacactgacaatttcatc , seq id no : 4 ) primers . the amplified lc3 cdna was cloned into pgem - t easy ( promega ) and sequenced . the lc3 cdna was excised with hindiii and ecori ( in pgem - t easy ) restriction enzymes and subcloned into the corresponding sites of pdsred - monomer - c1 ( clontech ). then , agei ( blunted )- bamhi ( in pdsred - monomer - c1 ) dna fragment containing in - frame dsred - lc3 was ligated with bamhi - ahdi ( 997 ˜ 4215 ) and ahdi - ecorv ( 4215 ˜ 1032 ) fragments of pcdna5 / frt / to ( invitrogen ). the flp - in dsred - lc3 cells were generated using the resulting plasmid according to the supplier &# 39 ; s instructions ( invitrogen ) and maintained in medium containing 5 μg / ml blasticidin and 100 μg / ml hygromycin ( invivogen ). for examining autophagy activity induced by trehalose and analogs , the dsred - lc3 cells ( 10 6 ) were transfected using t - pro reagent ( jf biotechnology ) with atxn3 / q 75 plasmid ( 5 μg ). after 24 hr , the transfected cells were plated into 96 - well ( 2 × 10 4 / well ) dishes , grown for 20 hr , and treated with trehalose , lactulose or melibiose ( 10 ˜ 50 μm ) for 8 hr . then doxycycline ( 10 μg / ml ) was added to the medium to induce dsred - lc3 and atxn3 / q 75 expression for 6 days and punta within cells was analyzed by using hca system , with excitation / emission wavelengths at 562 / 624 nm . total proteins were prepared using lysis buffer containing 5 % glycerol , 0 . 5 % triton x - 100 , 1 mm dithiothreitol , and protease inhibitor cocktail ( sigma ). proteins ( 20 μg ) were separated on 10 % sds - polyacrylamide gel electrophoresis and blotted on to nitrocellulose membranes by reverse electrophoresis . after blocking , the membrane was probed with gfp ( 1 : 500 dilution , santa cruz ), lc3 ( 1 : 3000 dilution , mbl international ), β - actin ( 1 : 5000 dilution , millipore ) or gapdh ( 1 : 1000 dilution , mdbio ) at 4 ° c . overnight . then the immune complexes were detected by horseradish peroxidase - conjugated goat anti - mouse or goat anti - rabbit igg antibody ( 1 : 5000 dilution , genetex ) and chemiluminescent substrate ( millipore ). whole brain were isolated from p7 sca17 mice and transferred to ice - cold culture medium containing 50 % basal medium eagle ( invitrogen ), 25 % hank &# 39 ; s buffered salt solution ( invitrogen ), 25 % horse serum ( invitrogen ), 0 . 5 % d - glucose ( sigma ), 1 mm glutamax - i ( invitrogen ), 100 u / ml penicillin ( invitrogen ) and 100 μg / ml streptomycin ( invitrogen ). the cerebellum was separated from the other brain regions in ice - cold medium , and the hemisphere was then cut into 350 μm parasagittal sections with a vibratome ( vt1200s , leica ). to improve the survival rate of cerebellar slices , we continuously bubbled the medium with 95 % o 2 and 5 % co 2 during the sectioning . the slices were then cultured on 0 . 4 μm pore size culture plate inserts ( millipore ) in six - well plates . all treatments were applied to the slices at day 2 . after culture for 7 days , cells were immunostained with primary antibody [ ip3r - 1 ( for purkinje cells ), 1 : 1000 , santa cruz ; 1tbp18 ( for aggregation ), 1 : 30000 , qed bioscience ], fluorescence - conjugated secondary antibody ( 1 : 500 , invitrogen ) and dapi ( 1 : 10000 , sigma ). the staining results were observed by confocol microscope ( dmre , tcs sp2 , leica ). for each set of values , data were expressed as the means ± standard deviation ( sd ). three independent experiments were performed and non - categorical variables were compared using the student &# 39 ; s t - test . all p - values were two - tailed , with values of p & lt ; 0 . 05 considered significant . in the present example , gfp - tagged atxn3 c - terminal q 14 ˜ 75 - containing fragment was cloned to establish flp - in 293 cells with atxn3 / q 14 ˜ 75 - gfp expression in an inducible fashion , wherein atxn3 / q 14 was used as a control . as shown in fig2 , the gfp antibody detected 40 kda atxn3 / q 14 - gfp and 57 kda atxn3 / q 75 - gfp proteins in doxycycline ( dox ) induced atxn3 cells . [ effect of trehalose and analogs on atxn3 / q 75 aggregation in flp - in 293 cell model ] in the present example , the influences of the trehalose and analogs and hdac inhibitor saha in the atxn3 / q 75 - gfp cells were respectively examined . after 6 days of the treatment of doxycycline and oxaliplatin , the fluorescence microscopy images were observed , and aggregation percentage of atxn3 / q 75 - gfp cells was assessed by high - content analysis system . the result was shown in fig3 , as a positive control , hdac inhibitor saha reduced the atxn3 / q 75 aggregation to 85 % ( at 100 nm ) as compared to untreated cells ( 100 %). the tested trehalose , lactulose and melibiose displayed good aggregation - inhibitory potential ( 77 ˜ 85 %) at 100 nm ˜ 100 μm . hydrolysis of trehalose , lactulose and melibiose ( 28 mm ) was tested using porcine kidney trehalase ( 1 mu ). as shown in fig4 a , while trehalose was readily digested by trehalase , no smaller carbohydrates , such as glucose , fructose , or galactose , were observed with the addition of lactulose or melibiose . this implys that lactulose and melibiose could not be hydrolyzed by trehalase . in addition , as shown in fig4 b , the amount of glucose generated from trehalose with the addition of lactulose or melibiose was similar to that with the addition of trehalose only , implying that the addition of lactulose or melibiose did not inhibit the trehalase activity . furthermore , there were no peaks represented glucose observed with the addition of trehalase inhibitor validamycin a or validoxylamine a , implying that the addition of validamycin a or validoxylamine a can inhibit the trehalase activity for digesting trehalose into glucose . to test trehalose and analogs potentially enhancing autophagy activity , we established a 293 - based fluorescent reporter cell model with induced dsred - lc3 expression . as shown in fig5 a , the lc3 antibody detected a 42 kda dsred - lc3 protein in doxycycline (+ dox ) induced cells . the flp - in cells were transfected with atxn3 / q 75 plasmid for 24 hr , treated with trehalose , lactulose or melibiose ( 10 ˜ 50 μm ) for 8 hr and induced dsred - lc3 expression . frequency of cells exhibiting dsred - lc3 - positive vacuoles ( punta ) was quantified as indicative of autophagosome formation . as shown in fig5 b , treatment of trehalose , lactulose and melibiose significantly ( 130 %˜ 136 %, p = 0 . 047 ˜ 0 . 009 ) induced the recruitment of dsred - lc3 to autophagic vacuole . to examine if trehalose and analogs also induced autophagy in induced atxn3 / q 75 293 cells , we compared the expression levels of lipid phosphatidylethanolamine ( pe )- conjugated lc3 - ii and cytosolic lc3 - i between with and without trehalose / analogs and / or dox treatment , as lc3 - ii is the only known protein that specifically associates with autophagosomes and not with other vesicular structures . as shown in fig5 c , induced expression of atxn3 / q 75 (+ dox ) for 6 days attenuated the lc3 - ii / lc3 - i ratio ( 76 %, p = 0 . 012 ). this reduction can be rescued by the addition of trehalose , lactulose or melibiose ( 10 μm ), with significantly increased lc3 - ii / lc3 - i ratio ( 106 %˜ 116 %, p = 0 . 020 ˜ 0 . 012 ). these findings indicated that trehalose and analogs enhanced autophagy activity on 293 atxn3 / q 75 cell model . [ effect of trehalose , lactulose and melibiose on sh - sy5y tbp / q 79 ] to test the aggregation reduction potential of trehalose and analogs in neuronal cells , we constructed flp - in sh - sy5y sca17 cells with n - terminal tbp / q 79 - gfp expression in an inducible fashion . when tbp / q 79 sh - sy5y cells were differentiated for 7 days using retinoic acid , aggregates were seen in about 2 % tbp / q 79 - gfp cells ( not shown in the figure ) under a microscope . the sh - sy5y tbp / q 79 - gfp cells were used to examine if trehalose and analogs reduce aggregation . as shown in fig6 , treatment of 10 μm trehalose , lactulose or melibiose leaded to 38 %˜ 33 % of aggregation reduction ( p = 0 . 024 ˜ 0 . 014 ) in tbp / q 79 expressed differentiated neuronal cells . these findings indicated that trehalose , lactulose and melibiose reduce tbp / q 79 aggregation in differentiated neuronal cell model . [ effect of trehalose , lactulose and melibiose on purkinje cell aggregation in sca17 mouse cerebellar slice culture ] we tested the aggregation reduction potential of trehalose and analogs ( 100 μm for 6 days ) in sca17 mouse cerebellar slice culture . the quantitative results of treatment are shown in fig7 . trehalose , lactulose and melibiose reduced the purkinje cell aggregation significantly ( 65 %˜ 57 %, p = 0 . 049 ˜ 0 . 013 ). although the present invention has been explained in relation to its preferred embodiment , it is to be understood that many other possible modifications and variations can be made without departing from the spirit and scope of the invention as hereinafter claimed . | US-201414331613-A |
a valvuloplasty system comprises a balloon adapted to be placed adjacent leaflets of a valve . the balloon is inflatable with a liquid . the system further includes a shock wave generator within the balloon that produces shock waves . the shock waves propagate through the liquid and impinge upon the valve to decalcify and open the valve . the balloon is carried on a catheter that includes a guidewire lumen . the system further includes a debris collecting basket carried on the catheter proximal to the balloon . | referring now to fig1 , it is a cut away view of the left ventricle 12 , the aorta 14 , and the aortic valve 16 of a heart 10 with a stenotic and calcified aortic valve 16 . here more particularly , it may be seen that the opening 17 of the stenotic and calcified aortic valve 16 is restricted in size and that the valve leaflets 18 are thickened with calcium deposits and fibrotic tissue . the thickened leaflets 18 and smaller valve opening 17 restrict blood flow from the heart creating excess work for the heart 10 and poor cardiac output . as previously mentioned , current treatment includes replacement of the valve or attempts to stretch the valve annulus with a balloon . fig2 is a cut away view of the aortic valve 16 with a treatment balloon 22 placed on both sides of the aortic valve leaflets 18 . the balloon 22 may be formed from a compliant or a non - compliant material . the balloon , as seen in fig2 , is at the distal end of an elongated tube 23 . the treatment balloon 22 has two longitudinally spaced chambers 24 and 26 that share a common inflation lumen 25 of the tube 23 . alternatively the balloon chambers 24 and 26 may not share the same inflation fluid path . the chambers 24 and 26 are longitudinally spaced such that chamber 24 is positioned on one side of the aortic valve leaflets 18 and chamber 26 is positioned on the other side of the aortic valve leaflets 18 . the chambers 24 and 26 are inflated with saline / contrast mixture , for example . each chamber 24 and 26 may contain an electrode ( as shall be seen subsequently ) that can produce electrical arcs to deliver timed shock waves . the shock waves can be synchronized to concurrently impinge upon both sides of the leaflets 18 to maximize the effectiveness of breaking calcium deposits . such shock waves may be generated and also synchronized to the r wave of the heart 10 in a manner as described for example in co - pending application no . 61 / 061 , 170 filed on jun . 13 , 2008 , which application is incorporated herein in its entirety . fig3 is a schematic view of a valvuloplasty system 11 that includes the dual shockwave balloon 22 . the balloon 22 has received a high voltage catheter 32 that is connected to a high voltage power supply 30 . the schematic representation shows the positioning of the balloon chambers 24 and 26 above and below the leaflets 18 of the aortic valve 16 . as previously described , shock waves will impinge upon opposite sides of the leaflets 18 to more effectively break calcium deposits in the valve leaflets 18 . the annulus will also be treated in this arrangement . to that end , the high voltage catheter 32 includes electrode pairs 34 and 36 that are coaxially arranged electrodes placed in chambers 24 and 26 respectively of the balloon 22 . more specifically , electrode pair 34 is at the distal end of a first cable and comprises a center conductor 33 and an outer conductive shield 35 . similarly , electrode pair 34 is at the distal end of a second cable and comprises a center conductor 37 and an outer conductive shield 39 . high voltage pulses from power supply 30 are applied to the electrode pairs 34 and 36 in a manner as described in the aforementioned application ser . no . 61 / 061 , 170 to create shockwaves within the fluid within the chambers 24 and 26 of the balloon 22 . the shock waves impinge upon the valve leaflets 18 and the valve annulus to cause the break up of calcium deposits and fibrotic tissue on the valve leaflets 18 and annulus to open and smooth the aortic valve 16 . fig4 shows an alternate valvuloplasty shock wave balloon 42 at the distal end of an elongated tube 43 . the balloon 42 is placed in the annulus of the aortic valve 16 . to that end , the balloon 42 has a reduced diameter portion 45 for being received within the valve annulus . the balloon 42 has a high voltage catheter 44 therein that terminates in an electrode pair 46 . as in the previous embodiment , the electrode pair 46 may comprise a pair of coaxially arranged electrodes where a center conductor may form at least a part of one electrode and at an outer conductive shield may form at least a part of the other electrode . the catheter 44 and its electrode pair 46 provide shock waves as previously described . such an arrangement will decalcify the leaflets 18 . this not only will decalcify the leaflets 18 , but will also soften the aortic valve annulus and expand its diameter . hence , the balloon 42 provides the added advantage of exerting expansion pressure directly to the annulus of the valve to remodel the annulus diameter . fig5 is a cut away view of a valvuloplasty system 50 embodying the present invention including a shockwave balloon 52 deployed on both sides of the aortic valve leaflets 18 . the balloon 52 may be formed from a compliant or a non - compliant material . the balloon , as seen in fig5 , is at the distal end of an elongated tube 53 . the treatment balloon 52 has two longitudinally spaced chambers 54 and 56 that share a common inflation lumen 55 of the tube 53 . alternatively the balloon chambers 54 and 56 may not share the same inflation fluid path . the chambers 54 and 56 are longitudinally spaced such that chamber 54 is positioned on one side of the aortic valve leaflets 18 and chamber 56 is positioned on the other side of the aortic valve leaflets 18 . the chambers 54 and 56 may be inflated with saline / contrast mixture , for example . the system 50 further includes a shockwave generator including electrical arc generators 60 and 62 . each of the electrical arc generators 60 and 62 includes an electrode pair 64 and 66 , respectively . the electrode pairs may include coaxially disposed electrodes similar to the electrodes of electrode pairs 34 and 36 of fig3 . each balloon chamber 54 and 56 contains one of the electrodes pairs . as seen in fig5 , balloon chamber 54 has electrode pair 64 and balloon chamber 56 has electrode pair 66 . the elongated tube 53 further includes a center guide lumen 70 . the center guide lumen is sized to fit over a guide wire 72 . also , shown is a guide tube 80 which is used to deliver the shockwave balloon to the desired area of the heart . as in previous embodiments , the balloon chambers 54 and 56 may be expanded with a mixture of saline and contrast which aides in shock formation and visualization via x - ray . an added benefit to contrast is the absorption of uv light waves generated by the arc of the shockwave generators . the shock waves can be synchronized to concurrently impinge upon both sides of the leaflets 18 to maximize the effectiveness of breaking calcium deposits . such shock waves may be generated and also synchronized to the r wave of the heart 10 in a manner as described for example in co - pending application no . 61 / 061 , 170 filed on jun . 13 , 2008 , which application is incorporated herein in its entirety . fig6 is a cutaway view showing the system 50 of fig5 with the balloon in position about the aortic valve 18 and carried on the guide wire 72 . the guide wire 72 is placed through the aortic valve and in the left ventricle 12 to direct the placement of the system 50 . for simplicity the electrodes are not shown in fig6 . fig7 is a partial cut away view of the aorta and the aortic valve of a heart to an enlarged scale together with a valvuloplasty system embodying the invention . the valvuloplasty system shown in fig7 is the valvuloplasty system 50 of fig5 but further including an embolic protection basket 90 carried on the elongated tube 53 proximal to the balloon 52 . the embolic protection basket 90 is also deployed on the elongated tube 53 distal to the brachiocephalic trunk 102 , the common carotid artery 104 and the subclavian artery 106 . with the embolic protection basket thus positioned , it will capture debris resulting from a valvuloplasty procedure performed with the valvuloplasty system 50 and prevent such debris from entering the brachiocephalic trunk 102 , the common carotid artery 104 or the subclavian artery 106 . the embolic protection basket 90 may be fixed to the elongated tube 53 . alternatively , the basket may include a proximal extension 92 to permit the basket 90 to be slidingly disposed on the elongated tube 53 . this would allow the relative distance between the basket 90 and the balloon 52 to be adjusted . the basket preferably has an umbrella - like structure 94 formed of nitinol , for example . as is well known , nitinol has shape memory permitting the basket to be placed into the introduction guide tube 80 in a collapsed state . when the guide tube 80 is pulled back , the basket 90 will be freed and expand from the collapsed state to an expanded and deployed state as shown . in use of the system 50 and the embolic protection basket 90 , the guide wire 72 is first advanced into the heart and through the aortic valve leaflets 18 . the distal tip of the guide wire will extend into the left ventricle 12 . next , the guide tube 80 is advance over the guide wire 72 until it is just past the valve leaflets 18 . the system 50 , together with the embolic protection basket 90 is then guided down the guide tube 80 on the guide wire 72 . once the balloon 52 is adjacent the valve leaflets 18 , the guide tube is pulled back to expose the balloon 52 . the guide tube is pulled back further until the embolic protection basket 90 is exposed . this frees the basket to expand from the collapsed state to the expanded deployed state . the balloon 52 may now be inflated to form the chambers 54 and 56 . electrical energy pulses may now be applied to the system 50 to create shock waves in the balloon chambers 54 and 56 . as previously described , the shock waves can be synchronized to concurrently impinge upon both sides of the leaflets 18 to maximize the effectiveness of breaking calcium deposits . such shock waves may be generated and also synchronized to the r wave of the heart in a manner as previously described . during the procedure , the basket captures debris dislodged by the shock waves to protect against such debris from entering the brachiocephalic trunk 102 , the common carotid artery 104 or the subclavian artery 106 ( and hence the brain ) while at the same time allowing blood to flow through those arteries . after use , the system 50 and debris can be retracted into the over tube 80 and removed from the body . while particular embodiments of the present invention have been shown and described , modifications may be made , and it is therefore intended to cover all such changes and modifications which fall within the true spirit and scope of the invention . | US-201113232730-A |
an oral hygiene device comprising a detachable head and a handle into which the detachable head can be inserted . a plurality of detachable heads each having a different oral hygiene means thereon is also provided . the detachable heads and the handle form a system for complete oral hygiene home care unit . | according to the present invention , an oral hygiene device comprising a handle which is so designed to fit most users &# 39 ; hand and a detachable head having disposed thereon an oral hygiene means , the detachable head being insertable into the handle is provided . various dental hygiene means such as toothbrush , gum massager , dental floss holder , sulci area brush , dental mirror and denture brush may be provided on the detachable head . in addition , a safety razor may be disposed on the detachable head to form a disposal razor . with reference to the drawings , fig1 a illustrates the handle 10 of the present invention which comprises three portions , a front portion 12 , a rear portion 14 and a connecting portion 16 . the longitudinal axes of front portion 12 and rear portion 14 are generally in parallel . the longitudinal axis of connecting portion 16 forms an angle α of about 30 to about 50 degrees , preferably about 35 to about 45 degrees , most preferably 40 degrees , with those of portions 12 and 14 . the free end 18 of front portion 12 is provided with an opening or socket 20 into which the detachable head may be inserted . the front portion 12 constitutes about 35 to 40 % of the overall length of handle 10 , connecting portion 16 about 8 to 12 % and rear portion 14 , about 50 to 54 %. as shown in fig1 b , front portion 12 has a generally square cross - sectional configuration . as to rear portion 14 , it has a generally oval cross - sectional configuration which is shown in fig1 c . the top and bottom surfaces 22 and 24 of connecting portion 16 are indented to form thumb and finger rests , respectively , for the user &# 39 ; s hand . such indentations are shown in more detail in fig1 d and 1e wherein fig1 d shows the bottom view and fig1 e , the top view . of course , all of the edges in the handle are smooth in order to avoid injury to the user . the cross - sectional area of the handle decreases from a maximum at the butt end 15 of the rear portion to a minimum at the free end 18 of front portion 12 . fig1 f shows the construction of socket 20 in free end 18 of front portion 12 . socket 20 comprises a main tapered opening 26 in communication with side opening 28 . walls 30 and 32 of opening 26 are inclined to define a tapered opening , with the largest cross sectional area being at the free end 18 of the handle 10 . side opening 28 is provided primarily for engaging a projection or male extension on the detachable head to provide a firm hold on the detachable portion . the length of tapered opening 26 is about 10 to 14 % of the overall length of the handle . as shown in fig1 e , side opening 28 is provided on the same side as bottom surface 24 of handle 10 . the present handle has an overall length of about 5 to 6 inches . thus , from the butt end 15 of the handle , rear portion 14 extends horizontally for a length of about 3 inches at which point it descends at an approximately 40 degree angle for about 0 . 5 inch , and continues horizontally again for a length of about 2 inches where it terminates at free end 18 of front portion 12 . the width of the handle from a lateral view tapers from about 0 . 7 inches at the butt end 15 to about 0 . 32 inches at the free end 18 . the thickness or height of the handle is also tapered from the butt end 15 to free end 18 . in this connection , the height starts at about 0 . 5 inch and decreases to about 0 . 32 inch . the contour of the handle is such that there are no sharp corners or protrusions which would injure the tissues of the user &# 39 ; s hand or mouth and that the handle is easy and comfortable to hold . the shape and size are so designed that the handle fits the hand of an average adult or child . in addition , the handle &# 39 ; s shape is designed to easily reach the interproximal areas of the mouth and to provide proper finger and thumb positions for easily controlled oral hygiene use . it will be readily appreciated that the bulk of the handle and the particular angular result in a favorable torque which allows the best results for all attachments that need pressure without bending of the handle . the detachable head 33 used in conjunction with the above described handle comprises in general a body portion 34 ( shown in part only ) and a male extension 36 , as shown in fig2 a . body portion 34 may be provided with one of various oral hygiene means such as toothbrush , dental floss holder , dental mirror , gum massager , denture brush and sulci area brush . each of these means will be discussed hereinbelow . male extension 36 in turn comprises a main section 38 disposed adjacent to body portion 34 and an end portion 40 having a reduced cross - sectional area . at the tip of end portion 40 is provided a projection 42 . the small cross - sectional area in the end portion 40 ensures a wedge fit into socket 20 of handle 10 . projection 42 is adapted to extend into lateral opening 28 in handle 10 to lock detachable head 33 onto handle 10 . of course , detachable head 33 can be &# 34 ; snapped &# 34 ; off from handle 10 by pulling the head away from the handle . thus , the male extension 36 is so constructed that a tight fit is attained between detachable head 33 and handle 10 . the overall length for male extension 36 is about 0 . 66 inches . the thickness of the main section adjacent the body portion 34 is about 0 . 23 inch and that of the end portion at tip 44 is about 0 . 18 inch . as shown in fig2 a , male extension is tapered , i . e . the width of male extension 36 starts at about 0 . 2 inch adjacent to body portion 34 and decreases to about 0 . 15 inch at tip 44 . each of the various oral hygiene means which may be provided in body portion 34 of detachable head 33 is now described . it is understood that all of the detachable heads are formed with a male extension having a construction similar to that shown in fig2 a and 2b . when in use , the detachable head is inserted into the handle to form an oral hygiene device or safety razor . fig3 a shows a detachable head 46 which comprises body portion 48 and male extension 50 . body portion 48 is in the general shape of a flat rectangular plate , with its longitudinal axis being aligned with male extension 50 and handle 10 . on the working or brush side of body portion 48 , five longitudinal rows of tufts are provided to form a toothbrush . as shown in fig3 a , the inner three rows 52 of tufts have ten tufts or bundles of bristle in each row whereas the two outer rows 54 of tufts have six tufts in each row . since the inner rows 52 have more tufts per row than the outer rows 54 , the inner rows of tufts located at the two ends extend symmetrically beyond those of the outer rows . the male extension 50 for detachable head 46 is similar in construction to that disclosed in fig2 and 2a . the detachable head of fig3 a may be inserted into handle 10 of fig1 a to form a toothbrush which is used with a massaging motion to the long axis of the teeth . since the tufts are disposed along the longitudinal axis of the handle , one arch is brushed at a time on the cheek side of the teeth and on the tongue side of the teeth . the toothbrush so disclosed is still considered to be an &# 34 ; interproximal &# 34 ; brush because of the placement of the tufts which breaks up bacterial plaque in an effective manner . due to the particular configuration of the handle , the thumb and finger positions will always be approximatly the same on the defined areas of the handle . fig3 b shows another embodiment of a toothbrush disposed on the detachable head . in this embodiment , the bristles disposed near the middle of the toothbrush have shorter lengths to provide a curved profile in a lateral view to fit the curvature of the outer surface of a tooth . as shown in fig3 b , the bristles at the outer ends have a length of about 0 . 5 inch whereas those near the center have a length of about 0 . 35 to 0 . 4 inch . of course , a toothbrush wherein all the bristles have the same length to define a flat profile can also be provided in lieu of the curved profile on body portion 48 . fig4 illustrates a detachable head wherein a brush for cleaning the interproximal spaces , i . e . areas in between the teeth is provided . detachable head 56 comprises body portion 58 and male extension 60 which is similar to that shown in fig2 a and 2b . body portion 58 is connected to housing 62 from which a single large tuft 64 extends . when in use , detachable head 56 is inserted into handle 10 to form a brush which is specifically for cleaning the interproximal spaces , i . e . spaces between the teeth . this brush is particularly effective in sulci areas or interproximal areas which have been deepened by gingival disease or by molar alignment of teeth . the brush is used in a rotary massage motion at right angles to the inbetween spaces of the teeth to break up and remove bacterial plaque . the detachable head of the present invention can also be formed with a dental mirror . as shown in fig5 a , detachable head 66 comprises body portion 68 and male extension 70 . body portion 68 is provided with dental mirror 72 which forms an angle β of about 30 degrees with body portion 68 . mirror 72 has such a size that it can be easily maneuvered within the user &# 39 ; s mouth . as to male extension 70 , its construction is shown in fig2 a and 2b . when in use , detachable head 66 is inserted into handle 10 to form a dental mirror which can be maneuvered easily to allow the user a clear view of his / her teeth . the angular disposition of the mirror 72 enables the user to see the rearward facing parts of his / her teeth . fig6 illustrates a gum massager which is provided on the detachable head of the present invention . detachable head 74 comprises body portion 76 and male extension 78 which has a construction similar to that shown in fig2 a and 2b . body portion 76 comprises a housing 80 from which a gum massager 82 in the form of a pointed cone extends . usually , gum massager 82 is formed of a rubbery material . fig7 a and 7b shows a denture brush detachable head 84 for use with handle 10 . in this embodiment , detachable head 84 comprises male extension 92 and front and rear portions 86 and 88 , respectively , joined by connecting section 90 . although front body portion 86 is shown to be circular and rear body portion 88 , rectangular , the general shapes of these body portions are not significant . as shown in fig7 a and 7b , a plurality of tufts 94 are disposed on front body portion 86 . tufts 96 are also provided on rear body portion 88 but on a surface opposite to that of tufts 94 . the bristles on front body portion 86 have a greater length than those on rear body portion 88 . the front portion 86 is for cleaning the inside of a full or partial denture and the rear portion 88 is for cleaning the outside of the denture . tufts 94 in the front portion 86 are arranged in the shape of a rhombus as follows . seven longitudinal rows of tufts are used . the center row has six tufts . on each side of the center row is a row of five tufts . a row of four tufts is placed outside each of the row of five tufts . the outermost row on each side has twb tufts . in rear portion 88 , there are also seven longitudinal rows of tufts , each row having five tufts . the tufts in either front or rear portions 86 and 88 may have the same length . optionally , the tufts may have a shorter length in the middle part of the brush to form an arc to fit the curvature of a tooth . the arc may be along the longitudinal or transverse axis of the detachable head . male extension 92 has a construction similar to that shown in fig2 a and 2b . the detachable head can also be formed into a dental floss holder for use in conjunction with the handle 10 . as shown in fig8 a and 8b , detachable head 98 comprises a body portion 100 and male extension 102 . body portion 100 is generally in the shape of the letter &# 34 ; v &# 34 ; and comprises two arms 104 which are spaced apart . each arm is provided with a slit 106 into which the floss may be fed . optionally , a disc 108 may be formed in body portion 100 for anchoring the floss . in this case , the floss is first wound around disc 108 to anchor one end of the floss . thereafter the floss is fed through slit 106 on one arm , across the space between the arms 104 and then through the slit on the other arm . the floss is then wound around disc 108 to anchor the free end of the floss . as shown in fig8 b , arms 104 may have a curved profile to allow easier application of the dental floss holder . the construction of male extension 102 is similar to that shown in fig2 a and 2b . the present handle can also be used in connection with a detachable head having provided therein a safety razor . such a detachable head is shown in fig9 a and 9b wherein reference numeral 110 refers to the detachable head . detachable head 110 comprises body portion 112 and male extension 114 . the forward end of body portion is connected to a safety razor 116 . any conventional safety razor may be used in connection with the present detachable head . as shown in fig9 b , body portion 112 forms an angle of about 45 ° with the longitudinal axis of male extension 114 to provide a more comfortable shave . safety razor 110 is intetrally formed for insertion into free end 18 of handle 10 . the present handle and detachable head may be formed of any suitable material such as nylon , polypropylene etc . any conventional method such as injection moulding may be used to form the handle and detachable heads . typically , the handle is of one piece construction as well as the detachable head . | US-64282484-A |
the invention relates to a medical dressing having an elastic material for encircling about a body member , an elastomer attached to the elastic material and adapted to directly contact a wound on the body member , and where the elastomer includes an additive for treating the wound , wherein the elastic material applies compressive force to the elastomer and wound as the elastic material encircles the body member . | fig1 depicts medical dressing 20 in accordance with the invention . medical dressing 20 includes bandage 30 and elastomer 40 . in some embodiments , additive 50 is embedded or dispersed into elastomer 40 . in other embodiments , elastomer 40 absorbs additive 50 . in yet other embodiments , additive 50 is adhered to elastomer 40 . in further embodiments , additive 50 is mixed into elastomer 40 during formation or making of elastomer 40 , which is usually in a liquid state . the finished state for elastomer 40 is cured to a solid state . in further embodiments , elastomer 40 acts as a vehicle for carrying or delivering additive 50 to body member 22 or wound , where body member 22 is any part of a wearer &# 39 ; s body that bandage 30 may attach ( see fig3 ). additive 50 is more particularly described below . as shown , bandage 30 is an elastic material that may be wrapped or encircled about body member 22 , where bandage 30 is secured by first end 32 being attached to second end 36 or middle section 34 of bandage 30 via adhesive or fasteners , such as clips that dig into the material of bandage 30 . in other embodiments , bandage 30 is a compression or cohesive bandage which adheres to itself . in further embodiments , bandage 30 is a non - elastic material that is attached via adhesive to body member 22 ( see fig4 ) once backing layer 35 is removed . elastomer 40 is a synthetic dressing that facilitates delivery of additive 50 because elastomer 40 provides generally uniform and compressive contact to wound 51 on body member 22 . by being in such contact with the wound , additive 50 within elastomer 40 is delivered to the wound in a more efficient manner than traditional bandages . also , continuous delivery of additive 50 is achieved for certain types of additives that are embedded throughout and within elastomer 40 , particularly when moisture is transferred from the wound to elastomer 40 where the moisture from wound 51 dissolves or otherwise enhances transition of additives embedded in elastomer 40 toward surface 33 of elastomer 30 and ultimately delivered to the wound . in addition , elastomer 40 molds to the shape of body member 22 and this also facilitates uniform contact with the wound . as described above , by being in more uniform contact with the wound than traditional bandages , elastomer 40 better absorbs moisture excretions from the wound , such as blood or pus . however , elastomer 40 is better suited for absorbing moisture without failing than traditional bandages and can last longer in moist environments than natural or fibrous materials . another benefit of elastomer 40 is that it also provides cushioning to the wound , and thereby acts as a protector from bumps or abrasions that could inhibit healing . natural or fibrous materials tend to fully desiccate a wound site until the absorptive capacity of the material is reached , after which time excess exudate from the wound may be held beneath the dressing which may result in maceration of the surrounding tissue . elastomer 40 is comprised of a hydrocolloid or hydrogel absorptive agent which is dispersed into and integrally affixed to a hydrophilic polyurethane foam matrix . the hydrophilic nature of the polyurethane foam component of elastomer 40 results from the high oxyethylene content of the precursor polyol components used in its preparation . the hydrophilic foam allows the absorption of exudate from the wound without excessive desiccation of the wound site . some of the moisture absorbed from the wound by the hydrophilic polyurethane polymer matrix may diffuse to the hydrocolloid or hydrogel absorptive agent dispersed through the foam where it may take up additives ( i . e . antibiotics ) held within the hydrocolloid or hydrogel and return them to the wound bed . in addition , unlike natural or fibrous materials , elastomer 40 forms an occlusive dressing , one that seals the wound and protects it from infection . the dressing formed by elastomer 40 is non - adherent and can be removed without trauma to the wound bed . elastomer 40 is applied as a gel , foam , or film . in some embodiments , elastomer 40 is hydrophilic . in other embodiments , elastomer 40 is hydrophobic . in use with bandage 30 , elastomer 40 continuously absorbs moisture and moves it away from the wound toward the outside of elastomer 40 . preparation of medical dressing 20 includes a hydrophilic polyurethane foam pad attached to an end of bandage 30 as described below . those skilled in the art will recognize that the materials and reaction conditions may be varied and additional steps employed to produce hydrophilic polyurethane foams encompassed by the present invention , as demonstrated by the following examples . an aqueous mixture of a hydrophilic polyurethane prepolymer , comprising at least one isocyanate - capped polyol , is mixed with an aqueous suspension or solution of an additive , such as a hydrocolloid absorptive agent in a predetermined ratio so that the polymerization of the polyurethane foam forms a matrix binder for the hydrocolloid absorptive agent . the predetermined ratio is defined by the chemical nature , composition and properties which are desired to be present in the resulting polyurethane . in another embodiment , an aqueous mixture of a hydrophilic polyurethane prepolymer , comprising at least one isocyanate - capped polyol , is mixed with a hydrogel in a predetermined ratio so that the polymerization of the polyurethane foam forms a matrix binder for the hydrogel the predetermined ratio is defined by the chemical nature , composition and properties which are desired to be present in the resulting polyurethane . prior to setting , the resulting prepolymerization mixture is cast as sheets or rolls or poured into molds to obtain the desired shapes of the finished foam pad . in another embodiment , the resulting mixture is cut to the desired shape after setting or curing . the polymerization reaction time is varied from approximately 1 minute to approximately 72 hours . in a preferred embodiment , the reaction time is between approximately 5 and approximately 1200 minutes . in a more preferred embodiment , the reaction time is between approximately 15 and approximately 360 minutes . in a most preferred embodiment , the reaction time is between approximately 30 and approximately 240 minutes . in a further preferred embodiment , the reaction time is between approximately 1 and approximately 10 minutes . reaction temperature is varied between approximately 0 ° c . and approximately 100 ° c . in a preferred embodiment , the reaction temperature is between approximately 0 and approximately 70 ° c . in a more preferred embodiment , the reaction temperature is between approximately 10 and approximately 50 ° c . in a most preferred embodiment , the reaction temperature is between approximately 10 and approximately 45 ° c . reaction pressure is varied between approximately 0 . 1 atmospheres to approximately 10 . 0 atmospheres . in a preferred embodiment , the reaction pressure is between approximately 0 . 5 and approximately 5 . 0 atmospheres . in a more preferred embodiment , the reaction pressure is between approximately 0 . 5 and approximately 2 . 0 atmospheres . in a most preferred embodiment , the reaction pressure is between approximately 0 . 9 and approximately 1 . 1 atmospheres . the finished or resulting hydrophilic polyurethane foam pad 40 is attached to a distal end of bandage 30 using an adhesive . in some embodiments , the prepolymerization mixture is allowed to polymerize while in direct contact with bandage 30 , which allows the hydrophilic polyurethane foam pad to self - adhere to bandage 30 . the prepolymer of the instant invention is comprised of at least one isocyanate - capped polyol having a reaction functionality of at least two , the total of said polyol present having an oxyethylene content of at least 40 weight percent prior to capping . examples of such polyols include linear polyols formed by the reaction of ethylene oxide initiated by ethylene glycol . in some embodiments , ethylene oxide is mixed with other alkylene oxides so long as the mole percent of ethylene oxide is at least 40 %. preferably , the mole percent of ethylene oxide in such alkylene mixtures is at least 60 %. most preferably , the mole percentage of ethylene oxide in such alkylene oxide mixtures is at least 75 %. those skilled in the art will recognize other polyfunctional initiators which would provide polyols of functionality two or more . as stated , it may be desirable to include diisocyanate crosslinkers with these systems in which case said crosslinker may be included into the water into which the prepolymer is dispersed . where the linear polyethers are mixtures of ethylene oxide with other alkylene oxides , e . g . propylene oxide , the polymer can be either random or a block copolymer and the terminal units can be either hydroxyethyl , or 1 or 2 hydroxypropyl units . alternatively , the class of polyols includes those with a reactive functionality of three or more . such polyols are commonly formed by reacting alkylene oxides with a polyfunctional initiator such as trimethylolpropane or pentaerythritol . other embodiments include polyfunctional initiators which would provide polyols of functionality three or more . polyols of reactive functionality of three or more are formed using alkylene oxides such as ethylene oxide or mixtures of ethylene oxide with other alkylene oxides . alternatively , polyols of reactive functionality of two or greater may be formed by the methods described above in the presence of an initiator or crosslinker such as a polyisocyanate . specific examples of such polyols are formed by reaction of a mixture of polyethylene glycol ( m . w . approx 1000 ) with trimethylolpropane , trimethylolethane or glycerol with excess polyisocyanate to provide a prepolymer . alternatively , the linear or branched polyols , ( e . g . polyethylene glycol ) can be reacted separately with excess polyisocyanate . the initiator , e . g . trimethylolpropane , can be separately reacted with excess polyisocyanate . subsequently , the two capped materials are combined to form a prepolymer . polyisocyanates for preparing prepolymers include toluene - 2 , 4 - diisocyanate , toluene - 2 , 6 - diisocyanate , commercial mixtures of toluene - 2 , 4 - and 2 , 6 - diisocyanates , cyclohexylene - 1 , 4 - diisocyanate , m - phenylene diisocyanate , 3 , 3 ′- diphenyl - 4 , 4 ′- biphenylene diisocyanate , 4 , 4 ′- biphenylene diisocyanate , 1 , 6 - hexamethylenediisocyanate , 1 , 5 - naphthalenediisocyanate , cumene - 2 , 4 - diisocyanate , 2 , 4 ′- diisocyanatodiphenylether , 5 , 6 - dimethyl - 1 , 3 - phenylenediisocyanate , 2 , 4 - dimethyl - 1 , 3 - phenylenediisocyanate , 4 , 4 ′- diisocyanatodiphenylether , 9 , 10 - anthracenediisocyanate , 2 , 4 - diisocyanatostilbene , 1 , 4 - anthracenediisocyanate , 2 , 4 , 6 - toluenetriisocyanate , isophorone diisocyanate , p , p ′ p ″- triphenylmethane triisocyanate , and combinations thereof . initiators for preparing prepolymers include propylene glycol , trimethylene glycol , 1 , 2 - butylene glycol , 1 , 3 - butanediol , 1 , 4 - butanediol , 1 , 5 - pentanediol , 1 , 2 - hexane glycol , 1 , 10 - decanediol , 1 , 2 - cyclohexanediol , 2 - butene - 1 , 4 - diol , 3 - cyclohexene - 1 , 1 - dimethanol , 4 - methyl - 3 - cyclohexene - 1 , 1 - dimethanol , 3 - methylene - 1 , 5 - pentanediol , diethylene glycol , 1 , 2 , 6 - hexanetriol , 1 , 1 , 1 - trimethylolpropane , 3 -( 2 - hydroxyethoxy )- 1 , 2 - propanediol , 3 -( 2 - hydroxypropoxy )- 1 , 2 - propanediol , 2 , 4 - dimethyl - 2 -( 2 - hydroxyethoxy ) methylpentanediol - 1 , 5 , 1 , 1 , 1 - tris [( 2 - hydroxyethoxy ) methyl ] ethane , 1 , 1 , 1 - tris [( 2 - hydroxypropoxy ) methyl ] propane , triethanolamine , triisopropanolamine , resorcinol , pyrogallol , phloroglucinol , hydroquinone , 4 , 6 - di - tertiarybutyl catechol , catechol , resorcinol , and combinations thereof . the water reactant phase is comprised of up to 100 % water . a surfactant can be added to the water to modify the properties of the resulting foam such as the cell size or resilience . surfactants include ethylene oxide / propylene oxide blends such as basf f - 68 , f - 88 , l - 62 , l , 64 , t - 904 and t - 1301 . in other embodiments , surfactants such as corgis emulgrade n - 1000 or emulgin b - 2 , sodium lauryl sulfate , alpha olefin sulfates or dow chemical triton x - 100 are used . those skilled in the art will recognize the choice of desired surfactant varies to provide the properties desired in the finished foam . in another embodiment , the water reactant phase incorporates additives 50 into the finished foam . these include , but are not limited to , fillers such as feldspar , diatomaceous earth , silica , fibers , pharmaceutical agents such as analgesics , coagulants , anti - inflammatories , anesthetics , antihistamines , steroids , antimicrobials , antibacterials , antivirals , antifungal agents , soaps , other cleaning agents , vitamins , skin conditioners , health additives , and combinations thereof . in one embodiment , additive 50 is dispersed with drugs , such as an over - the - counter drugs . the ranges covered include those allowed in fda &# 39 ; s over - the - counter drug monograph . additive 50 includes menthol as a topical analgesic for the treatment of joint pain as an example : a regular strength product would be used on mild pain , a high strength product would be used on moderate pain , and a maximum strength product would be used on severe or intense pain . the definition of mild , moderate , and severe pain is highly subjective in that each prospective drug has its own allowable levels for a given condition to be treated . a comparison with the drug monograph shows that the low end of the monograph corresponds to regular strength , middle part of the monograph corresponds to high strength , and top end of the monograph corresponds to maximum strength . see table a below . in some embodiments , the monograph includes a step by step method for selling over - the counter drugs without having to get additional drug approvals from the fda . among the steps spelled out in the monograph are the allowable levels for each drug in an over - the - counter drug product . for example , for menthol , the fda allows menthol levels from 1 . 5 % to 16 % to be sold as an over the counter topical analgesic provided all other requirements of the monograph are met . for each drug in the various different monographs there is a different level allowed . in other embodiments , the monograph includes 1 . 5 % to 5 %. in further embodiments , monograph is 16 % for severe pain . in a further embodiment , multiple additives 50 are dispersed in the foam , including approximately 1 . 5 %- approximately 16 . 5 % menthol ( topical analgesic ), approximately 2 . 0 %- approximately 4 % lidocaine ( topical anesthetic ), approximately 0 . 5 %- approximately 2 % salacylic acid ( acne ), approximately 5 %- approximately 10 % benzoyl peroxide ( acne ), approximately 0 . 5 - approximately 10 % hydrocortisone , and combinations thereof . these percentages are weight percentages of finished product . these examples of additives , among others listed in fda monographs , are incorporated into a foam or hydrogel . in another embodiment , silver is used as additive 50 between approximately 1 % and approximately 10 % of dry weight , where silver is an antimicrobial and anti - odor ingredient . it functions by releasing ions which kill bacteria . a cost sensitive range is between approximately 1 % and approximately 3 % dry weight or weigh percentage to reduce bacterial growth . a preferred range is between approximately 4 and approximately 7 %. a most preferred range is between approximately 85 and approximately 10 %. the higher the percentage of silver , the greater the reduction of bacteria . in a further embodiment , additive 50 is a property modifier , such as polyethylene glycol , glycerin and propylene glycol . these additives alone or in any combination increase softness and water wicking properties . typical levels are between approximately 5 % and approximately 15 % of dry weight . the choice of a modifier is determined by the goal to be achieved . for example , glycerine is highly effective in increasing the wicking ( ability of the foam to transmit liquids along polymer matrix ) properties of the foam and makes a softer foam . it also has antimicrobial properties . however it has a tendency to flash off at temperatures above 230 f ., which limits its usefulness for foam which is dried . a range of glycerine is between approximately 5 % and approximately 15 %. below approximately 5 %, glycerine has little or negligible effects . above approximately 15 %, glycerine softens the foam to the point where the foam properties are severely degraded . polyethylene glycol is another modifier used in softening the foam . this is particularly effective when using hydrocolloids , which tend to make the foam hard and stiff . polyethylene glycol reduces the hardness or stiffness caused by hydrocolloids , thereby offsetting the negative effects of hydrocolloids . in addition , polyethylene increases wicking and is less sensitive to heat and therefore is more useful in foam that is dried than glycerine . a range is between approximately 5 % and approximately 20 %. below approximately 5 %, it has little or negligible effects . above approximately 20 %, it softens the foam to the point where the foam properties are severely degraded . propylene glycol is another modifier used mainly to soften the foam . it actually decreases both the wicking and the hydrophilicity . wicking is the ability of the foam to move liquid along the polymer . it allows liquid entering the foam at a point to spread throughout the entire foam mass . for example , wicking is desirable in a heavily exuding wound and not desirable in a dry wound . hydrophilicity is an indication of an amount of water the foam will absorb of the foam . it is the most heat resistant of the three modifiers and would be used where relatively high heat is used to dry . it is also the most desired of the three modifiers if softness is more important than wicking . softness is important when the ability of the foam to conform to an irregular surface ( such as skin ) is desired . it is also important when the product is used against damaged or tender skin . a range is between approximately 5 % and approximately 10 %. below approximately 5 %, it has little or negligible effects . above approximately 10 %, it softens the foam to the point where the foam properties are severely degraded . another additive which is used in addition to any of the above modifiers , analgesics , menthol , or silver , is a surfactant . in an optional embodiment , the surfactant is used in lieu of the above modifiers , analgesics , menthol , or silver . this category of additives that are surfactants are used to modify the cell size , resilience , or strength of the foam . typically , a surfactant is between approximately 0 . 5 % and approximately 5 %. although most surfactants affect increase resilience , some surfactants , such as basf &# 39 ; s f - 88 , also increase cell size . the basf f - 88 at approximately 0 . 5 % yields a smaller cell size than basf f - 88 at approximately 5 . 0 %. cell size is measured in pores per inch ( ppi ). a large cell is typically less than 30 ppi and a small cell is greater than 100 ppi . the middle is medium cell size . cell size is affects the aesthetic property of the foam and , in the case of a hydrophilic foam , cell size affects absorbency rate , liquid retention , and liquid capacity . as cell size increases , rate ( the speed at which liquid is absorbed ) and capacity ( the amount of liquid the foam can absorb as expressed as a multiple of dry weight ) increase as well but retention ( the amount of liquid the foam retains after squeezing ) decreases . the finished foam typically has a ratio of softness to strength that varies according to the customer &# 39 ; s specifications . for example a 1 : 1 ratio of softness to strength indicates a high strength , firm foam . a ratio of 2 : 1 of softness to strength indicates a medium strength , softer foam . a ratio of 3 : 1 of softness to strength indicates a low strength , soft foam . as polymer increases in proportion to aqueous ; strength increases and softness decreases . strength is measured by tensil strength in pounds / sq . in . and high strength foam would have a tensil above 75 with low strength being under 3 . softness is measured by durometer with a reading over 100 being a relatively hard foam and under 30 being relatively soft . below are the descriptions of two embodiments of foams , namely a foam with a hydrocolloid agent and a foam with a skin conditioning agent . as shown in fig5 , 6 and 7 , the medical dressings of the present invention includes at least one monolithic , polyurethane foam layer generally designated 1 which is formed by polymerizing an aqueous mixture having one or more hydrocolloid absorptive agents with an aqueous mixture of a hydrophilic polyurethane prepolymer , in a predetermined ratio , so that the polymerization of the polyurethane foam forms a matrix binder for the one or more hydrocolloid absorptive agents . as shown in fig6 , the hydrocolloid absorptive agents generally designated 2 are thereby incorporated and integrally dispersed directly into the matrix of the formed foam . the term “ hydrocolloid absorptive agent ” as used in accordance with the present invention includes natural , chemically modified , and synthetic hydrocolloids . suitable hydrocolloids include , but are not limited to , natural gums such as arabic gum , ghatti gum , karaya gum , tragacanth gum , guar gum , locust bean gum and acacia gum ; seaweed extracts such as agar , algin , alginate salts and carrageenin ; cereal gums ; starches ; fermentation or microbial gums such as dextran gum and xanthan gum ; pectins ; gelatins ; casein ; and collagens . modified forms of the hydrocolloids may also be used , including , for example , the oxidized , acetylated , carboxylated , esterified , methylated , aminated , etherated , sulfated , borated and phosphated derivatives of the hydrocolloid absorptive agents . suitable synthetic gums include polyvinylpyrrolidone , low methoxyl pectin , propyleneglycol alginates , carboxymethyl cellulose and guar gum . the medical dressings of the present invention are formed by metering and mixing an aqueous mixture including adequate water and at least one hydrocolloid absorptive agent with a predetermined ratio of hydrophilic urethane prepolymer to provide a prepolymerizing mixture . the hydrocolloid absorptive agents are included in the aqueous phase in an amount of about 0 . 5 % to about 20 . 0 % by weight . more preferably , the hydrocolloid absorptive agents are included in an amount of about 5 % to about 15 % by weight . preferably , the hydrophilic urethane prepolymer is included in the aqueous phase in an amount of about 25 % to about 45 % by weight . suitable surfactants , such as , for example , basf pluronic l 92 or basf pluronic f - 88 ( basf , mt . olive , n . j . ), may preferably be added to the aqueous phase . preferably surfactants may be added in an amount of about 0 . 2 % to about 25 . 0 % wet weight of the aqueous phase . more preferably surfactants may be added in an amount of about 0 . 5 % to about 2 . 5 % wet weight of the aqueous phase . the hydrophilic urethane prepolymer materials used in the medical dressings of the present invention are available in the commercial marketplace , and include , for example , bipol 6 , available from mace adhesives and coatings , and hypol from dow chemical . general procedures for the preparation and formation of such prepolymers can be found in polyurethanes : chemistry and technology by j . h . saunders and k . c . frisch published by john wiley & amp ; sons , new york , n . y ., at vol . xvi part 2 , high polymer series , “ foam systems ”, pages 7 - 26 , and “ procedures for preparation of polymers ”, pages 26 , et seq ., which are hereby incorporated by reference herein . a hydrogel is a network of polymer chains that are water soluble , sometimes found as a colloidal gel in which water is the dispersion medium . hydrogels are superabsorbant natural or synthetic polymers . due to their superabsorbant properties hydrogels have found use in disposable diapers , contact lenses and sanitary towels . by their aqueous nature , hydrogels are well suited and useful for the transport of soluble factors , drugs and skin conditioning agents onto the skin . the medical and wound dressings of the present invention can also include various combinations of other ingredients without departing from the scope of the present invention , including , for example , medicaments , soaps , disinfecting and sterilizing agents , odor management agents , hemostatic agents , proteins , enzymes and nucleic acids . preferably these agents may also be incorporated directly and dispersed throughout the prepolymerization aqueous mixture and are thereby incorporated into the foam matrix . alternatively these other ingredients may be incorporated into the dressing by absorbing them into the formed foam cover layer following the polymerization reaction by affixing to the formed medical and wound dressings , by any suitable means , an additional layer incorporating such other ingredients , as will be understood by those skilled in the art . suitable medicaments , soaps , disinfecting and sterilizing agents , proteins , and enzymes are provided in the commercial market place by a myriad of suppliers and include those which aid recovery of wounds . preferably , the medicaments include antifungal agents , antibacterial agents , angiogenesis promoting agents and the like . more preferred medicaments include antifungal agents such as metronidazole and antibacterial agents such as chlorhexidine . any suitable soap , disinfecting and sterilizing agent may be used . a preferred disinfecting and sterilizing agent includes hydrogen peroxide . suitable proteins and enzymes include those which aid in wound recovery such as fibrin sealants and angiotensins , as described in u . s . pat . nos . 5 , 962 , 420 and 5 , 955 , 430 , hereby incorporated by reference herein . after blending and mixing the combination of the aqueous mixtures and hydrophilic urethane prepolymer , the polymerizing foam composition is preferably deposited on a releasable bottom sheet material on a movable carrier . the upper surface of the polymerizing composition is then covered with a releasable top sheet material and advanced along the moveable carrier for sizing of the foam to the desired thickness and until the foam is tack free . the releasable top and bottom sheets are then sequentially removed . when polymerization is complete , residual water may be driven off by drying the foam . preferably , the drying is done in a drying unit at a temperature of about 200 . degree . f . drying may also be performed at lower temperatures under reduced pressures . the medical dressings of the present invention may be formed to have any desired thickness or shape . the foam layer is preferably relatively thin . more preferably , the foam layer should have a thickness of about 1 mm to about 10 mm , and more preferably about 1 . 5 mm to about 6 . 0 mm . various forms of the preformed foam medical dressings of the present invention are contemplated . in a preferred embodiment , the medical dressing is an occlusive dressing which includes the foam layer and a biocompatible backing sheet or layer 3 which surrounds the foam layer . any suitable biocompatible backing may be used , however , preferably , the backing is moisture vapor permeable . as shown in fig7 , in a preferred embodiment , the backing layer 3 is a hydrophilic polyurethane film which has been laminated to the foam layer 1 . the backing layer 3 may extend beyond the foam layer 1 for contact with the skin of the patient . suitable noncytotoxic and substantially nonallergenic adhesives and / or tapes may be used to apply the medical dressings of the present invention to the skin of a patient . in a preferred embodiment , the adhesive is applied to all or a portion of the backing layer which extends beyond the foam cover layer . preferably , the adhesives and / or tapes include those formed from polymers containing hydrophilic groups , such as hydroxyl , carboxyl , amine , amide , ether and alkoxy . more preferably , the adhesive is a pressure - sensitive acrylic adhesive . such adhesive and tapes are well known in the art and therefore are - not more fully described . it is to be understood that the above - detailed description of the preferred embodiment of the invention is provided by way of example only . various details of the design , construction and composition may be modified without departing from the scope of the invention as set forth in the claims . in addition , the invention will be further described by reference to the following detailed examples . these examples are merely illustrative and not limitative of applicants &# 39 ; invention in any way . an aqueous mixture comprising 4 % karaya gum , water and a suitable surfactant is combined in a 60 : 40 ratio with hydrophilic prepolymer to form the foam . purified water : 190 . 38 parts karaya gum : 8 . 00 parts basf pluronic l 92 : 1 . 60 parts basf pluronic f - 88 : 0 . 02 parts mixing was done at room temperature . l - 92 and f - 88 were added to water and mixed until they were completely dispersed in the water . speed of the mixture was increased and the gum was added slowly into the vortex . mixing was complete when the mixture was smooth ( no gel particles visible ). when mixing was complete , the aqueous was combined with hydrophilic prepolymer as follows the combination was mixed in a high speed mixing vessel until the parts were homogeneous . the combination was then poured and sized using suitable releasable substrate or substrates and allowed to cure until the foam structure was stable . an aqueous mixture comprising 2 % locust bean gum , water and a suitable surfactant was combined in a 60 : 40 ratio with hydrophilic prepolymer to form foam . purified water : 194 . 38 parts locust bean gum : 4 . 06 parts basf pluronic l 92 : 1 . 60 parts basf pluronic f - 88 : 0 . 02 parts . mixing was done at room temperature . l - 92 and f - 88 were added to the water and mixed until they were completely dispersed in the water . speed of the mixture was increased and the gum was added slowly into the vortex . mixing was complete when the mixture was smooth ( no gel particles visible ). the aqueous was then combined with hydrophilic prepolymer as follows : the combination was mixed in a high speed mixing vessel until the parts were homogeneous . it was then poured and sized using suitable releasable substrate or substrates and allowed to cure until foam structure was stable . comprising 4 % alginate , water and a suitable surfactant was combined in a 60 : 40 ratio with hydrophilic prepolymer to form foam . purified water : 190 . 38 parts kelco lvcr alginate : 8 . 00 parts basf pluronic l 92 : 1 . 60 parts basf pluronic f - 88 : 0 . 02 parts . mixing was done at room temperature . l - 92 and f - 88 were added to the water and mixed until they are completely dispersed in the water . speed of the mixture was increased and the gum was added slowly into the vortex . mixing was complete when the mixture was smooth ( no gel particles visible ). when mixing was complete , the aqueous was combined with hydrophilic prepolymer as follows : the combination was mixed in a high speed mixing vessel until the parts are homogeneous . it was then poured and sized using suitable releasable substrate or substrates and allowed to cure until foam structure is stable . a test was designed to measure the amount of water retained in the foam after squeezing . with the foam containing the hydrocolloid additive , a noticeable increase in the amount of retained water was observed . results of this test using the average of five samples are as follows : sample dry weight after squeezing standard hydrophilic foam 2 . 34 grams 4 . 53 grams ( 1 . 9 × dry weight ) sample 99 - 309 3 . 39 grams 19 . 94 grams ( 5 . 9 × dry weight ) hydrocolloid foam w . 10 % alginate . results show that standard hydrophilic foam retains about 2 . times its own weight and hydrocolloid foam retains 3 times to 8 . times its own weight depending on levels of hydrocolloid used . the hydrophilic foam pads of the present invention are formed by polymerizing an aqueous mixture having one or more skin conditioning agents with a predetermined quantity of a hydrophilic urethane prepolymer binder so that the polymerization of the polyurethane foam forms a matrix binder for one or more skin conditioning agents . the skin condition agents are incorporated directly into the cell structure of the foam pads and remain there until the foam pads are wetted or contacted with a sufficient moisture content . once the pads are wetted or contacted with a sufficient moisture content , the skin conditioning agents are released from the matrix and diffuse toward the surface of the pad for contact with the skin . the formation of the cosmetic pads in accordance with the present invention is done by metering and mixing an aqueous mixture including adequate water and at least one skin conditioning agent with a predetermined ratio of hydrophilic urethane prepolymer to provide a polymerizing mixture . the aqueous mixture includes water which is present in amounts from about 15 to about 95 % by weight . the concentration of the skin conditioning agents in the aqueous phase is from about 0 . 5 % to about 3 . 5 %. the skin conditioning agents of the present invention are nonvolatile agents and include vitamins , mineral salts , trace elements , plant and animal extracts , proteins , enzymes , and other agents which have therapeutic benefits for the skin . by the term “ nonvolatile ” it is meant that the skin conditioning agents have a high boiling or subliming temperature at normal pressures and thus do not readily evaporate at normal temperatures and pressures . the skin conditioning agents may first be dispersed into a typical surfactant material in a prepared premix . surfactants may be used in the aqueous solution to increase the concentration of the skin conditioning agents in the aqueous mixture . the surfactants are preferably present in amounts of about 0 . 5 to about 3 . 5 % by weight of the aqueous mixture . the surfactants may be prepared from nonionic polyethylene and polypropylene oxides such as basf surfactant available under the trademark “ pluronic ”. other components may be added to the aqueous mixture to increase the concentration of the skin conditioning agent , such as citric acid which acts as a buffer for reducing the ph of the water component . the aqueous mixture may further consist of various combinations of other components without departing from the scope of the present invention , including , for example , soaps , bactericides and fungicides . bactericides are provided in the commercial marketplace by a myriad of suppliers for controlling bacterial and fungal growth . one preferred material is supplied by lauricidin co . of galena , ill . 61036 , under the trademark “ lauricidin ”. the hydrophilic urethane prepolymer component of the present invention is available in the commercial marketplace . suitable prepolymers will be readily recognized by those of ordinary skill in the art and are described in prior art u . s . pat . nos . 4 , 137 , 200 ; 4 , 209 , 605 ; 3 , 805 , 532 ; 2 , 999 , 013 and general procedures for the preparation and formation of such prepolymers can be found in polyurethane &# 39 ; s chemistry and technology by j . h . suanders and k . c . frisch published by john wiley & amp ; sons , new york , n . y ., at vol . xvi part 2 , high polymer series , “ foam systems ”, pages 7 - 26 , and “ procedures for the preparation of polymers ”, pages 26 et seq . one preferred prepolymer for use in the present invention is bipol 6 available from mace adhesives and coatings . the hydrophilic urethane prepolymer is present in amount of about 20 to about 50 % by weight of the total composition . as will be appreciated by those skilled in the art , the cosmetic pads of the present invention can be formed to have any desired thickness and shape . after blending and mixing the combination of the aqueous mixtures and hydrophilic urethane prepolymer , the polymerizing foam pad composition is preferably deposited on a releasable bottom paper on a movable carrier . the upper surface of the polymerizing composition is then covered with a releasable top paper and advanced along the moveable carrier for sizing of the foam to the desired thickness and until the foam is tack free . the top and bottom releasable paper are sequentially removed . when polymerization is complete , residual water may be driven off by drying the foam in a drying unit at a temperature of about 200 . degree . f . preferably the foam pads of the present invention have a thickness of about 1 mm to about 40 mm . the foam pad may initially be formed into large blocks which are then cut into any desired shape . in some embodiments , the bacteriostatic agent is silver . silver is incorporated as elemental silver or used as a compound such as silver chloride . in either case silver ions are released to kill germs . elemental silver has more ions to be released but it can be toxic if large amounts of free silver are available to the skin or wound bed . we have chosen to use a form of elemental silver which involves permanently bonding an ultra thin layer of the silver around a synthetic fiber core . preferred fibers are polyester and nylon . the result is a large surface area of elemental silver which allows for a high ion release level . at the same time the binding to the fiber core prevents the release of silver to the skin or wound bed . this aqueous mixture was then metered with the hydrophilic prepolymer at a ratio of 2 parts aqueous to 1 part polymer by weight and dispensed onto a moving casting liner . after polymerization , the web is sized and compressed to achieve the target thickness . this aqueous mixture was then metered and mixed with a hydrophilic prepolymer in a ratio of 3 . 2 parts to 1 part by weight . after polymerization the web is sized and compressed to desired thickness . this aqueous mixture was then metered and mixed with a hydrophilic prepolymer in a ratio of 2 . 7 parts to 1 by weight . after polymerization the web is sized and compressed to desired thickness . the embodiments described above should provide adequate details of the invention . however , it should be noted by those skilled in the art that the disclosures herein are exemplary only and that various other alternatives , adaptations and modifications may be made within the scope of the present invention . accordingly , the present invention is not limited by the specific embodiments as illustrated . | US-93176607-A |
a wearable badge for displaying removable indicia includes a backing having an attachment fastener and defining an indicia portion . the wearable badge also includes a frame defining an opening and having a first frame edge and a second frame edge . the first frame edge is joined to the backing such that the first and second frame edges at least partially surround the indicia portion . the indicia portion is viewable through the opening and the second frame edge is moveable away from the backing to facilitate insertion and withdrawal of indicia between the backing and the frame . | with reference to fig1 , an article , such as a badge 20 , is illustrated and can be worn by a person in various environments , such as , for example a restaurant , a retail store , or by an on - site cable technician , a bus driver , etc ., or any other person in an environment in which it is useful for the wearer to display some indicia on his / her person . the indicia , for example , may identify an individual , or advertise , promote or market a service or product . the indicia may comprise , for example , text , pictures , colors , numbers , symbols , illustrations , etc . badge 20 includes a housing 24 having a first indicia portion 28 and a second indicia portion 32 . the badge 20 can assume a variety of different configurations and can include any number of indicia portions . for example , badge 20 can include three indicia portions . in such an example , one of the indicia portions can be for identification of a person and the other two , for advertising . in the illustrated construction , including only two indicia portions , first indicia portion 28 is used to identify the user of badge 20 and second indicia portion 32 is used for advertising , promoting or marketing purposes to advertise , promote or market a product ( s ) or service ( s ). alternatively , the first indicia portion 28 can be used for advertising , promotional or marketing purposes and the second indicia portion 32 can be used for identification purposes . with reference to fig1 - 4 , housing 24 includes a frame 36 extending around and between the first and second indicia portions 28 , 32 to discretely separate them and define a first receptacle 40 and a second receptacle 44 , corresponding respectively to the first and second indicia portions 28 , 32 ( see fig3 ). badge 20 also includes a first plate 48 containing a first indicia 52 thereon and a second plate 56 containing a second indicia 60 thereon ( see fig1 and 2 ). the first and second plates 48 , 56 are positionable in the first and second receptacles 40 , 44 , respectively , and are each surrounded by frame 36 . the frame 36 assists in proper insertion and alignment of the plates 48 , 56 in the first and second receptacles 40 , 44 because the plates preferably substantially fill the area , but not necessarily the depth , of the respective receptacles . referring to fig2 - 4 , the plates 48 , 56 can be either removably or permanently attached to housing 24 within the receptacles 40 , 44 in a variety of manners . in the illustrated construction , double - sided adhesive tape 64 is applied to the rear of the first plate 48 , which is adhesively attached to floor 41 within the first receptacle 40 . in this manner the first plate 48 is removably and adhesively attached to housing 24 and can be removed from the housing 24 to attach another plate to the housing 24 within the first receptacle 40 or for other reasons ( discussed in more detail below ). alternatively , the adhesive tape 64 could include the appropriate adhesive properties to permanently attach the first plate 48 to the housing 24 , thereby preventing the first plate 48 from being removed and replaced with another plate . also in the illustrated construction , the second plate 56 is magnetically attached to the second receptacle 44 . a stepped recess 68 is defined in the floor 45 within the second receptacle 44 and includes a first step 72 and a second step 76 concentric with the first step position ( see fig3 and 4 ). first step 72 lies below floor 45 and second step 76 lies below first step 72 . badge 20 further includes a metallic member 80 capable of magnetic attraction connected to the rear of the second plate 56 and a magnet 84 connected to the housing 24 within the second step 76 of the stepped recess 68 . to removably and magnetically attach the second plate 56 to the housing 24 , the metallic member 80 is aligned with and fits within the first step 72 of the stepped recess 68 , where the magnet 84 magnetically attracts the metallic member 80 thereto and magnetically attaches the second plate 56 to the housing 24 . in the illustrated construction , the metallic member 80 and the first step 72 of the stepped recess 68 are complimentarily shaped to assist , in combination with the frame 36 , with obtaining the proper orientation and attachment of the second plate 56 to the housing 24 . the metallic member 80 and the first step 72 of the stepped recess 68 can assume any appropriate shape , either complimentary or uncomplimentary to each other , so long as the member 80 and magnet 84 can magnetically connect and the second plate 56 lies flat against floor 45 . that is , the depths of the first and second steps and the corresponding thicknesses of member 80 and magnet 84 must be such as to permit second plate 56 to lie flush with floor 45 . also , the magnet 84 and the metallic member 80 can be reversed with one another and connected to the other of the second plate 56 and the second step 76 of the stepped recess 68 . the magnet 84 and metallic member 80 can be of any shape or size as long as a secure magnetic attachment is made therebetween and maintained during normal use of the badge 20 . the first and second plates 48 , 56 can be connected , either permanently or removably , to the housing 24 within the appropriate receptacle 40 , 44 in a variety of other manners , such as , for example , gluing , hooks and loop fasteners ( velcro ), permanently bonding ( i . e ., melting ), integrally forming , suitable combinations of connecting systems , etc . it should further be understood that the first and second plates 48 , 56 can be similarly attached ( i . e ., both adhesively attached or both magnetically attached ) or differently attached ( i . e ., as illustrated in the figures and described hereinbefore ) to the housing 24 . referring particularly to fig3 and 5 , badge 20 includes a pin 88 for attaching badge 20 to clothing of a worker . pin 88 is formed by bending a wire spring . the pin 88 has a bent profile 92 - 100 in a horizontal plane and an upstanding spring bend 104 and a hook 108 in a vertical plane . pin 88 also has a bar 112 , pointed on one end 116 , which may be inserted through any suitable fabric in order to attach badge 20 to the clothing of a person . at bend 104 , the wire spring bends back upon itself to form a spring section , which is reminiscent of a corresponding part of a safety pin . from there , the wire spring has a profile in a horizontal plane and the profile preferably begins with a somewhat straight section 92 . the straight section 92 facilitates installation of the pin 88 through a hole 120 defined through the housing 24 in the first receptacle 40 . next , the wire spring forming the pin 88 has an arcuate stabilizing section 96 in a horizontal plane . the arcuate stabilizing section 96 of the pin 88 is similar in shape to an arcuate stabilizing section 124 of a groove 128 defined in the floor 41 of first receptacle 40 of the housing 24 . it should be understood that the arcuate stabilizing section 96 of the pin 88 and the groove 128 can have a variety of configurations , as long as the configurations are sufficient to stabilize the pin 88 relative to the housing 24 . at the end of the arcuate stabilizing section 96 , the wire spring has a straight section 100 , again to facilitate insertion of hook 108 through a second hole 132 in the housing 24 . the wire spring ends in upstanding hook 108 for receiving and capturing end 116 of bar 112 . attaching the first plate 48 to the housing 24 within the first receptacle 40 secures the pin 88 to the housing 24 . removal of the first plate 48 from the housing 24 allows the pin 88 to be removed from the housing 24 . when the badge 20 is repeatedly attached and removed from the user &# 39 ; s clothing , sometimes the pin 88 may form an undesirable impression on the face of first plate 48 caused by the pin &# 39 ; s movement relative to the groove 128 in the housing 24 . to avoid this from occurring , the pin 88 may be glued or otherwise secured in place so that it will not move during use of the badge 20 . when the pin 88 is glued in the groove 128 , the pin 88 will not normally be removable . while gluing is a suitable means for securing the pin in place , it is a labor - intensive step , which is costly . referring to fig6 - 9 , another means of securing involves wedging a portion of the plastic material of the housing 24 adjacent the groove 128 over the pin 88 after the pin 88 is placed in groove 128 . wedging the material over the pin 88 secures or pinches the pin 88 in place and prevents the pin 88 from moving within the groove 128 . the wedging operation is performed with a punch 133 that includes a tip 134 appropriately shaped to force plastic material of the housing 24 over the pin 88 to secure the pin 88 in the groove 128 . the tip 134 can be a variety of shapes as long as the pin 88 is properly wedged within the groove 128 . the punch 133 moves toward the housing 24 and the tip 134 engages a portion of the housing 24 on each side of the pin 88 to force a suitable portion of the material of the housing 24 over the pin 88 to secure or pinch the pin 88 within the groove 128 . after the punch 133 travels sufficiently toward the housing 24 to secure the pin 88 within the groove 128 , the punch 133 moves away from the housing 24 in preparation for the next operation . badge 20 can be attached to the wearer &# 39 ; s clothing in other ways . for example , badge 20 could be attached by a snap , a clip , a jump ring , hook and loop fasteners , magnetically , a military fastener using a nail and a clutch , a pendant , or the like . referring to fig3 and 4 , an aperture 136 is defined in the first step 72 of the stepped recess 68 . the aperture 136 allows an object ( not shown ), such as , for example a pen , a pencil , or any other appropriately sized tool , to insert therethrough and engage and push the metallic member 80 , together with the second plate 56 away from the magnet 84 . in this way the second plate 56 can be easily removed from the housing 24 . in the illustrated construction , the aperture 136 is defined in the first step 72 of the stepped recess 68 ; however , the aperture 136 can be located elsewhere on the housing 24 so long as a suitable object can be inserted therethrough to engage the second plate 56 and push it away from the housing 24 . a similar aperture can be provided in the first indicia portion 28 of the housing 24 to facilitate removal of plate 48 from the first indicia portion 28 of the housing 24 in those instances where the plate 48 is removably attached to the housing 24 . referring to fig5 , badge 20 can receive a plurality of identification plates 140 and a plurality of advertising plates 144 , which are removably attached and thereby selectively interchangeable by the user . for example , person a having his or her name on the identification plate 140 a can attach identification plate 140 a to the first indicia portion 28 and can attach advertising plate 144 d to the second indicia portion 32 . the following day , person a can remove advertising plate 144 d from the housing 24 and attach advertising plate 144 e to the housing 24 . indicia d and e may be different forms of advertising for the same product or advertising for different products . in this example , badge 20 is used to identify the same person and the advertising plates 144 are interchangeable to change the advertising performed by badge 20 . in another example , several people can use the badge 20 to advertise the same product . in such an example , identification plate 140 a can be attached to the housing 24 for person a and advertising plate 144 f can be attached to the housing 24 . if person b needs to use the badge 20 , person b removes identification plate 140 a from the housing 24 and attaches identification plate 140 b to the first indicia portion 28 . advertising plate 144 f remains attached to the housing 24 and , therefore , person b is advertising the same product as person a using the same badge 20 . any member of suitable combinations can be achieved among several people according to the desires and needs of the employers of these people . in yet another example , multiple workers can use badge 20 to advertise a plurality of advertisements . this example is a combination of the two previously explained examples in that the identification plates 140 are interchanged between two workers and the advertising plates 144 are interchanged to advertise various advertisements . with reference to fig1 and 11 , an alternative article , such as a badge 200 , is customizable and reusable and includes a first indicia portion 204 and a second indicia portion 208 . in the illustrated embodiment , the second indicia portion 208 is configured similarly to the second indicia portion 32 of the badge 20 illustrated in fig1 - 5 , and includes a stepped recess 68 for holding magnet 84 ( not shown in fig1 ). indicia 212 is configured for placement in the second indicia portion 208 and has mounted to a rear surface thereof a metallic plate ( not shown ) that is attracted to the magnet 84 for removably securing the indicia 212 within the second indicia portion 208 , as discussed above with respect to the embodiment of fig1 - 5 . second indicia portion 208 also includes an aperture 136 that allows an object to be inserted therethrough from the rear of the badge 200 to push the indicia 212 away from the second indicia portion 208 to facilitate removal and replacement of the indicia 212 for various purposes . in this regard , attaching and removing indicia 212 to / from the second indicia portion 208 involves moving the indicia in a direction substantially perpendicular to a plane defined by the second indicia portion 208 . the illustrated second indicia portion 208 includes a curved upper edge 216 and straight side and bottom edges 220 . it should be appreciated , however , that the second indicia portion 208 can be substantially any desired shape . furthermore , in some embodiments , the badge 200 may include only the first indicia portion 204 , with the second indicia portion 208 being eliminated . in still other embodiments , the second indicia portion 208 of the embodiment of fig1 - 14 may be configured similarly to the first indicia portion 28 of the embodiment of fig1 - 5 , in which case the indicia ( not shown ) may be attached to the second indicia portion 208 by adhesive . the various alternative configurations and arrangements and discussed above with respect to the second indicia portion 32 may also be incorporated or applied to the second indicia portion 208 . as illustrated in fig1 , the badge 200 includes a backing 224 including an upper portion 228 that corresponds to the first indicia portion 204 and a lower portion 232 that corresponds to the second indicia portion 208 . the lower portion 232 includes the recess 68 and the aperture 136 discussed above . the upper portion 228 includes an arcuate first backing edge 236 that defines a lower boundary of the first indicia portion 204 and an arcuate second backing edge 240 that defines an upper boundary of the first indicia portion 204 . the first and second backing edges 236 , 240 cooperate to define a first indicia portion perimeter . in the illustrated embodiment , the first indicia portion perimeter is substantially oval - shaped . in other embodiments , the first indicia portion perimeter may be differently shaped ( e . g ., rectangular ), and may be further defined by additional straight or arcuate edges other than the first and second backing edges 236 , 240 . in the illustrated embodiment , the upper portion 228 defines apertures 120 , 132 and a groove 128 similar to those discussed above with respect to the badge 20 to facilitate attachment of an attachment fastener in the form of a pin 88 ( see fig3 ) to the upper portion 228 . the pin 88 may be attached to the upper portion 228 by the staking process described above and illustrated in fig7 - 9 , and is provided to facilitate attachment of the badge 200 to an article of clothing . the lower , first backing edge 236 defines a plurality of spaced - apart apertures 244 ( e . g ., five apertures ) extending along the sides and bottom of the upper portion 228 . the upper portion 228 defines a generally semi - circular cutout 248 that , in the illustrated embodiment , substantially bisects the upper , second backing edge 240 . the first and second backing edges 236 , 240 are raised slightly relative to the remainder of the upper portion 228 and define a shallow recess 250 into which an indicia card 252 fits ( see fig1 ). with reference to fig1 , the badge 200 also includes a frame 256 that is joined to the backing 224 and that supports and maintains the indicia 252 within the first indicia portion 204 . the frame 256 is generally oval - shaped and defines an opening 260 through which the indicia 252 is viewed when the frame 256 is joined to the backing 224 . the frame 256 includes a lower , first frame edge 264 and an upper , second frame edge 268 that cooperate to define a frame perimeter that substantially corresponds to the indicia portion perimeter . it should be appreciated that in some embodiments the frame perimeter may not correspond to the indicia portion perimeter , and that like the indicia portion perimeter , the frame perimeter may have other shapes ( e . g ., rectangular ) and may be formed by a combination of straight and / or arcuate edges . the frame 256 includes a rear surface 272 that faces the backing 224 when the frame 256 is joined to the backing 224 . the frame 256 also defines a recess 276 a , 276 b that extends around the opening 260 and that is recessed with respect to the rear surface 272 . in the vicinity of the lower first frame edge 264 , the recess 276 a , 276 b includes relatively thicker portions 276 a separated by relatively thinner portions 276 b . a single relatively thinner portion 276 b extends along the entire length of the upper , second frame edge 268 . the frame 256 also includes a plurality of projections or pins 280 that extend from the rear surface 272 . the illustrated frame 256 includes five pins 280 that correspond to , and are configured to be received by , the five apertures 244 spaced along the first backing edge 236 . three of the five pins 280 are generally aligned with respective ones of the three relatively thinner recess portions 276 b positioned along the lower , first frame edge 264 . the other two pins 280 are positioned adjacent the transitions between the outer - most relatively thicker recess portions 276 a and the single relatively thinner portion 276 b associated with the second frame edge 268 . as a result , each relatively thicker portion 276 a is bounded by a pair of pins 280 . with reference also to fig1 , a clear indicia overlay 284 , typically formed of a suitable plastic , is configured for insertion into the recess 276 a , 276 b of the frame 256 . the illustrated overlay 284 is generally oval shaped and includes a castellated lower edge 288 comprising alternating projections 292 and recesses 296 . the projections 292 are sized and shaped to fit within the relatively thicker recess portions 276 a , and the recesses 296 are sized and shaped to fit within the relatively thinner recess portions 276 b . when the badge 200 is fully assembled , the indicia 252 is viewed through the overlay 284 , which provides a glossy , professional appearance . the castellated configuration of the overlay substantially interlocks with the relatively thicker and thinner recess portions 276 a , 276 b such that , when the badge 200 is assembled , the overlay 284 is securely held ( e . g ., cannot be removed during normal use ) between the backing 224 and the frame 256 . with reference also to fig1 , the lower , first frame edge 264 is shown joined to the backing 224 by the pins 280 . the pins 280 extend through the apertures 244 and are staked , melted , or otherwise deformed to prevent removal of the pins 280 from the apertures 244 . in some embodiments , the apertures 244 are chamfered or counter - sunk from the rear of the backing 224 such that the deformed pins do not project beyond the rear surface of the backing 224 . along the upper , second frame edge 268 , the cutout 248 exposes both the rear surface 272 of the frame 256 and a portion of the indicia card 252 . the cutout 248 allows a user to position a finger against the exposed portion of the indicia card 252 and slide the indicia card 252 out from between the backing 224 and the frame 256 . in this regard , inserting and removing the indicia card 252 involves moving the indicia card 252 in a direction that is substantially parallel to a plane defined by the first indicia portion 204 . as shown in phantom lines , the cutout 248 also allows a user to move the second frame edge 268 ( e . g ., by bending ) forwardly and away from the backing 224 , thereby relieving some of the pressure applied to the indicia card 252 by the natural resilience of the frame 256 , and reducing the amount of force required to remove the indicia card 252 from between the frame 256 and the backing 224 . bending the frame 256 in this manner also simplifies insertion of a replacement indicia card 252 between the frame 256 and the backing 224 . the extent of bending of the second frame edge 268 will of course depend upon the force applied by the user and the relative stiffness of the material that makes up the frame 256 . as mentioned above , the overlay 284 is securely held between the backing 224 and the frame 256 by its castellated configuration and the relatively thicker and thinner recess portions 276 a , 276 b . the attachment of the pins 280 to the backing 224 by way of the apertures 244 also contributes to securement of the overlay 284 between the backing 224 and the frame 256 . thus , the overlay remains secured between the backing 224 and the frame 256 during removal and replacement of the indicia card 252 . although the illustrated overlay 284 has a substantially uniform cross - section , the overlay 284 may also be configured as a dome , including a relatively thin flange - like section for engagement within the recess 276 a , 276 b and a domed portion that extends forwardly into the opening 260 defined by the frame 256 . in some embodiments , the indicia card 252 is opaque and may be printed with whatever indicia is desired , including a corporate logo , an employee name , and the like . in other embodiments , the indicia card 252 may be at least partially transparent and may be printed to include “ variable ” indicia , while the recess backing 224 is printed to include “ permanent ” indicia that is viewed through the partially transparent indicia card 252 when the indicia card 252 is positioned between the frame 256 and the backing 224 . in this way , a company may order badges having its logo or other relatively unchanging information ( e . g ., “ permanent ” indicia ) printed on the backing 224 , and can then print customized indicia cards 252 having “ variable ” indicia , such as employee names or information regarding time - limited sales promotions , and the like . such a configuration may simplify the printing equipment that is used by the customer to produce custom badges , and may also allow for the use of metallic , sparkly , or other specialized finishes on the backing 224 that can be printed by the manufacturer , but which might be difficult to produce using on - site printers , such as those used by customers to print the customized indicia cards 252 . although particular constructions of the present invention have been shown and described , other alternative constructions will be apparent to those skilled in the art and are within the intended scope of the present invention . | US-83564810-A |
a novel surgical instrument suitable for insertion and assembly of multi - ring compression devices for circular anastomosis of tubular tissue sections including a body having means to support and align the rings , means for clamping the rings around the free ends of the tissue sections , means for coring away excess clamped tissue and the centers of the rings , separate means for releasing the clamped rings from the instrument and dwell means to delay releasing the rings until after the coring operation is complete . the dwell means consists of an external cap containing separate and coaxial elements for the coring means and the releasing means which are provided with a series of recesses and a plurality of shifter keys to separate the operation of coring from the separate operation of releasing the assembled multi - ring compression device from the instrument . the instrument may additionally include means for detaching a portion of the support means to facilitate installation and alignment , and a safety to ensure safe operation and interchangeable knife blades . | with reference now to the drawings wherein like numerals represent identical parts throughout the several views , and more particularly with reference to fig1 the ring applier 10 generally includes a body portion 12 , a head portion 14 and a retractor portion 16 extending through body portion 12 and head portion 14 . an external tube 18 joins head portion 14 to body portion 12 . as shown in fig2 body portion 12 further includes a saddle member 20 having a bore 22 therethrough , an l - shaped handle 24 pivotably mounted on saddle member 20 and having an end 26 extending into bore 22 , and a tail member 28 extending outward from saddle member 20 . saddle member 20 includes a threaded collar 30 slidably disposed within bore 22 and pivotably connected to inward extending end 26 of handle 24 such that movement of handle 24 slides collar 30 within saddle bore 22 . it is further contemplated to provide locking springs 44 designed to hold collar 30 at the end of its forward travel . saddle member 20 further includes a return spring 46 for biasing collar 30 rearward within saddle bore 22 . tail member 28 extends outward from saddle member 20 and defines a bore 32 coaxial and communicative with saddle bore 22 . a clamp knob 34 is rotatably suspended at one end 36 of tail member 28 and has a bore 38 coaxial with tail bore 32 . knob 34 has a threaded base section 40 in which a threaded shaft 42 is slidably suspended within bore 38 and in threaded engagement with knob 34 such that turning knob 34 moves shaft 42 within tail bore 32 . the multi - ting compression devices used in connection with ring applier 10 generally include a plurality of interlocking rings for clamping tissue therebetween . typically these devices consist of an outer ring 94 and an intermediary ring 52 between which the tissue is clamped and an inner ring 72 for locking insertion into intermediary ring 52 . the insertion of the inner ring 72 forces outward biased edges of the intermediary ring 52 against inside edges of the outer ring 94 for a press - fit connection . when the inner ring 72 is fully seated within the intermediary ring 52 , an outward facing lip of the inner ring 72 locks into place on an annular recess on an inside edge of the intermediary ring 52 thus locking the entire assembly together . turning now to fig1 - 22 , a preferred embodiment of the multi - ring compression device consists of fragmentable ring assemblies . the outer ring assembly 94 consists of a male fragmentable ring 94a ( fig2 ( a - e )), having a shoulder 21 on a rim 23 thereof , which fits over a similar female fragmentable ring 94b ( fig1 ( a - e )). rings 94a and 94b are each molded in two side - by - side halves to facilitate manufacture . each half includes a semi - circular central hub 25 to allow capture on one end of ring applier 10 . rather than provide uniform hub thickness thin ribs 27 are incorporated into relatively less thick region of the hub 25 . the ribs and less thick region make it easier for hub 25 to be cut free from the body and ring applier 10 as described hereinbelow . the sectional areas of the first ring are offset from the sectional areas of the second ring , the two rings being held together by an overlapping series of projections 29 on ring 94a and recesses 31 on ring 94b . preferably , the projections 29 on ring 94a and recesses 31 on ring 94b are aligned with the molding plane to facilitate molding . the intermediary fragmentable ring 52 is fully sectioned and has an annular projection 33 at a base 35 thereof for mounting on ring applier 10 . slots 37 in the base projection facilitates ejection of the ring assembly from ring applier 10 . the locking inner fragmentable ring 72 is also sectioned into four pieces and has male and female sides so the pieces can lock together . the preferred version is more easily molded in the manufacturing process than other known versions and incorporates fillets ( internal ) and radii ( external ) on all parts to avoid sharp corners . referring now to fig4 head portion 14 comprises an external cap 48 having a grooved distal end 50 for support of intermediary ring 52 and is threadably engagable with external tube portion 18 at a proximal end 54 of cap 48 thereof . external cap 48 further includes a plurality of dwell recesses 56 located on an inner surface 58 of external cap 48 and disposed within a restricted bore section 60 of external cap 48 . a pusher 62 having shifter key channels 64 is slidably disposed within an enlarged bore area 66 of external cap 48 and has a circumferential flange 68 at a distal end which abuts a restricted edge 70 of restricted bore section 60 . pusher 62 slidably supports inner ring 72 . a knife holder 74 having a circumferential flange 76 at a proximal end is slidably disposed within pusher 62 . knife holder 74 further includes a plurality of shifter key recesses 78 on an outer surface 80 and means for support of a circular knife blade 82 affixed to a distal end of knife holder 74 . a plurality of shifter keys 84 reside in shifter key channels 64 . referring to fig8 a and 8b , in the preferred embodiment , shifter keys 84 have a generally trapezoidal cross section along an arcing longitudinal axis . however , one skilled in the art will appreciate that other cross - sectional configurations may be substituted therefor . a knife tube 86 is coaxial with and slidably supported within external tube 18 . ( see fig2 and 3 .) knife tube 86 is threadably engaged with collar 30 at a proximal end and threadably engaged with knife holder 74 at a distal end thereof such that movement of handle 24 causes knife holder 74 to slide within pusher 62 thereby transmitting the movement of handle 24 to pusher 62 . referring to fig3 retractor portion 16 includes a clamp rod 88 affixed at a proximal end to a coupling 90 to transmit motion of shaft 42 through tube 18 to coupling 90 . coupling 90 resides in tail member 28 and is engagable with threaded shaft 42 . clamp rod 88 has an annular projection 92 at a distal end thereof for carrying outer ring 94 . clamp rod 88 further includes a threaded retainer 96 to hold outer ring 94 in place against annular projection 92 . in a preferred embodiment of the invention retainer 96 and annular projection 92 are located on a center rod 98 which is detachable from said clamp rod 88 . referring to fig3 center rod 98 has an annular projection 100 disposed proximally along its length . at the extreme proximal end of center rod 98 is a pointed tip 99 having a hole 101 therein for attachment of a suture or thread . in this preferred embodiment clamp rod 88 is hollow at a distal end thereof . an annular depression 102 is located on an inner surface of clamp rod 88 and is supplied with a plurality of leaf springs 95 biased inward into depression 102 for snap - fit receipt of annular projection 100 on center rod 98 . referring to fig1 and 11 , in this embodiment there is also provided a pointed trocar tip 104 having a suture or thread retaining hole 97 at a point 91 and an annular projection 93 at a proximal end thereof for snap fit insertion in the annular depression 102 of clamp rod 88 . in still a further embodiment of the invention a safety button 106 , fig3 is provided on saddle 20 for preventing handle 24 from being prematurely closed . as can be seen in fig1 ( a - c ) the knife blade 82 may have several cutting profiles designed to optimize a particular cutting operation . in these embodiments the leading edge of the knife blade 82 may have a flat shape ( fig1 a ), a sinusoidal shape ( fig1 b ) or a hyperbolic shape ( fig1 c ). it is within the contemplated scope of the invention to use varying knife blade profiles not limited to those shown herein . referring now to fig2 - 13 the sequence of operation of the present invention will now be described . in preparing ring applier 10 for use , outer ring 94 is placed over projection 92 of clamp rod 88 . retainer 96 is threaded over outer ring 94 securing outer ring 94 to clamp rod 88 . inner ring 72 is inserted into enlarged area 66 and abuts flange 68 of pusher 62 . intermediary ring 52 is then press fit into the grooved distal end 50 of external cap 48 . in this manner , the ring applier 10 is readied for use . in a preferred use of the invention the detachable center rod 98 assembly including outer ring 94 and retainer 96 , and a trailing suture 103 attached to a hole 101 of center rod tip 99 , would have been inserted into a healthy section of tubular tissue and located distally from the diseased tissue fig9 . as further shown in fig9 the diseased tissue would then be excised by known methods such as applying several staggered rows of staples about each end of diseased tissue and cutting and removing the diseased and now stapled &# 34 ; packet &# 34 ; of diseased tissue leaving two healthy free ends of tissue stapled closed . referring to fig1 , a small incision would then be made to grasp trailing suture 103 and pull pointed tip 99 of center rod 98 through the stapled section of tissue . with trocar tip 104 snap fit into place on clamp rod 88 , tip 104 would be inserted up to the opposing stapled tissue end and pulled through the staples by a suture 87 affixed to hole 97 in point 91 in the same manner as above , as best seen in fig1 a . as shown in fig1 , trocar tip 104 can then be removed from clamp rod 88 by grippers 105 or other known methods , after which clamp rod 88 is then snap fit over the proximal end of center rod 98 to attach center rod assembly 98 to clamp rod 88 of ring applier 10 fig1 and 13 . once the two rods , 88 and 98 , have been joined , with the stapled free ends of tubular tissue now located between outer ring 94 and intermediary ring 52 the clamp rod 88 is retracted by turning the clamp knob 34 which draws the threaded shaft 42 and thus the clamp rod 88 rearward . drawing clamp rod 88 rearward pulls outer ring 94 over intermediary ring 52 thus clamping the free ends of the tubular tissue sections between rings 94 and 52 . the remaining operation can best be easily understood in stages wherein fig4 is stage one showing outer ring 94 fully retracted over intermediary ring 52 . the free ends of the tissue sections ( not shown ) would be captured between the rings 52 and 94 . at the end of stage one the center of outer ring 94 and the excess tissue are ready to be cored by knife blade 82 . in this stage it can be seen that pusher 62 and knife holder 74 are disposed fully to the rear of external cap 48 and shifter keys 84 reside between shifter key channels 64 in pusher 62 and shifter key recess 78 on knife holder 74 . the positions of the base of knife holder 74 are indicated by reference letter a , the base of the pusher 62 by reference letter b , the forward edge of the knife blade 82 by reference letter c and the position of the shifter keys 84 are indicated by reference letter d . when the handles 42 are pivoted inward after the first stage knife tube 86 moves pusher 62 and knife holder 74 together as a unit , connected by said shifter keys , forward . pusher 62 thus moves inner ring 72 forward into locking engagement with intermediary ring 52 at which point ( stage 2 ) the shifter keys 84 are forced out of shifter key recesses 78 and into dwell recesses 56 ( reference point d ) due to the angles on the edges of shifter keys 84 and shifter key recesses 78 . as can be seen in fig5 at the end of the second stage the end of pusher 62 ( reference point b ) and the end of the knife holder 74 ( reference point a ) are still spaced apart . referring to fig6 in stage 3 handles 24 continue to pivot and knife tube 86 advances knife holder 74 , independent of pusher 62 which is disengaged from knife holder 74 , until rear flanges 76 on said knife holder 74 ( reference point a ) abut the rear edge of the pusher 62 ( reference point b ). during stage 3 advancing knife holder 74 advances knife blade 82 ( reference point c ) through the captured excess tissue and through the portion of outer ring 94 held by retainer 96 thus fully coring the multi - ring clamp assembly to provide a clear passageway therein . it will be noted that with shifter keys 84 positioned in dwell recess 56 there is nothing to advance the pusher 62 until the end of stage 3 wherein said knife holder flange 76 abuts the rear end of pusher 62 . finally , as can best be seen in fig7 ( stage 4 ) as handles 24 are pivoted fully closed flange 76 of knife holder 74 ( reference point a ) is moved forward by knife tube 86 carrying with it pusher 62 ( see reference point b ). shifter keys 84 now move forward in dwell recesses 56 allowing pusher 62 to finally push the assembled rings free of the annular holding groove 50 on external cap 48 . at this point the rings have been fully assembled about the free ends of the tissue sections , excess tissue and the center of outer ring 94 have been cored out leaving a clear passageway therein and the assembled rings are freed from ring applier 10 . thus the use of the shifter keys and dwell recesses allows the coring operation to be fully complete before the ring assembly is pushed free of the instrument . ring applier 10 can now be removed . eventually the clamped tissue will necrotize while the tubular tissue ends heal together . the necrotized tissue and ring assembly will then detach from the healthy tissue and be expelled from the body . as described above , in a preferred use of the invention the ring assembly is of the fragmentable variety to facilitate expulsion . furthermore , whether of the solid or fragmentable variety , the ring assembly may be partially or wholly formed of degradable or bio - absorbable materials which are degraded or absorbed over time as the tissue heals leaving less or no clamp material to be expelled by the body . an alternative embodiment of the present invention is illustrated in fig1 and 23 wherein ring applier 200 generally includes a body portion 202 , a head portion 204 and a retractor portion 206 extending through body portion 202 and head portion 204 . as shown in fig1 and 23 , body portion 202 is comprised of an elongated front end tube 208 , preferably curved , having a bore 210 therein and a wing shaped back end 212 having a bore 214 coaxial with bore 210 . body 202 includes a pair of handles 216 , pivotally and opposingly mounted on body wing 212 , having inwardly extending front ends 218 extending into wing bore 2141 . a knife cam 220 is slidingly disposed within wing bore 214 and in abutting contact with inwardly extending front ends 218 such that pivoting handles 216 inward forces knife cam 220 forward within wing bore 214 . body portion 202 further includes a tail member 222 , defining a bore 224 coaxial and communicable with wing bore 214 , which extends backwards from body wing 212 and is centered between opposing handles 216 . a barrel 226 , defining a bore 228 , is rotatably attached to body wing 212 at a first end and is rigidly affixed to tail bore 224 at a second end for rotatable support tail member 222 on body wing 212 . a clamp cam 230 having a variable helical depression 232 on an outer surface thereof , and defining a bore 233 is rotatably suspended within barrel bore 228 . the variable helical depression 232 in cam 230 is initially of a slow rate of twist at a proximal end of cam 230 to provide a rapid initial approximation of rings 52 and 94 . at the distal end of cam 230 the helical depression 232 changes to a rapid rate of twist to provide slower more precise approximation of rings 52 and 94 and to provide increased torque for clamping rings 52 and 94 around ends of tubular tissue sections . a guide tube 234 is affixed to wing body 212 at a first end and extends through bore 233 on clamp cam 230 into tail bore 224 to guide clamp cam 230 within tail bore 224 . a guide pin 236 is rigidly affixed to barrel 226 at a proximal end thereof and extends into barrel bore 228 such that a free end of pin 236 engages the helical depression 232 of clamp cam 230 . by rotating tail member 222 , barrel 226 drives pin 236 in helical depression 232 , thereby drawing clamp cam 230 along guide rod 234 initially at a fast rate and subsequently in a slower , stronger and more precise fashion . referring to fig1 , 18 and 23 head portion 204 is similar to head portion 14 referred to above and contains the same parts / elements recited therein including pusher 62 , knife holder 74 , knife blade 82 and shifter keys 84 which function together in exactly the same manner recited hereinabove . as shown in fig1 a in one embodiment of ring applier 200 external cap 48 is integral with front end tube 208 . in a second embodiment of ring applier 200 , fig1 b , external cap 48 is partially integral with tube 208 and has a threadably detachable front portion 201 to facilitate insertion of the rings . in a third embodiment of ring applier 200 , fig1 a and 17b , external cap 48 is affixed to body tube 208 by a threaded sleeve - head 203 threaded into external cap 48 . as shown in fig1 b , 18b and 23 , a pair of abutting semicircular guide inserts 238 are disposed within tube bore 210 and extend therethrough . each insert 238 has a pair of longitudinally extending grooves along each of their respective longitudinal edges such that , when paired in abutting relation to form a complete tube , the inserts 238 define inner 240 and outer 242 pairs of coaxial and longitudinally extending channels in inserts 238 . a pair of knife bands 244 are slidably supported within outer channels 242 and extend therethrough . knife bands 244 are affixed to knife cam 220 at a proximal end and to knife holder 74 at a distal end such that pivoting handles 216 slides knife holder 74 within pusher 62 thereby transmitting the motion through tube 208 . referring to fig1 a and 17b retractor portion 206 includes a shortened clamp rod 248 extending into external cap 48 at a proximal end thereof and having the leaf - spring snap - fit type of engagement with center rod assembly 98 referred to above in ring applier 10 and is supplied with a similar trocar tip 104 , fig1 c . as shown in fig1 a and 18b , in a second embodiment of shortened clamp rod 248 , an annular projection 250 on clamp rod 248 engages an annular depression 252 on center rod 98 for a snap - fit type of engagement similar to that of the first embodiment but without a plurality of leaf springs 95 . a pair of trocar points 254 and 256 similar to those mentioned above are provided for snap - fit connection to clamp rod 248 and annular depression 252 on center rod 98 respectively . referring to fig1 b , 18b and 23 , retractor portion 206 further includes a pair of clamp bands 246 slidably suspended within inner channels 240 and attached at distal ends thereof to clamp rod 248 . bands 246 are affixed to clamp cam 230 at proximal ends thereof such that turning tail member 222 moves clamp cam 230 and thus center rod assembly 98 thereby transmitting the motions of cam 230 through tube 208 to center rod assembly 98 . referring to fig1 , 16 , and 23 ring applier 200 is preferably provided with a wing safety 249 rotatably mounted on wing body 212 and positioned between handles 216 such that safety 249 blocks movement of handles 216 in a first position and allows free movement of handles 216 when safety 249 is rotated to a second position . in use , ring applier 200 is readied and operated in similar fashion to ring applier 10 . in one embodiment of ring applier 200 , after center rod assembly 98 has been deployed in a distal section of tubular tissue , both trocar tips 254 and 256 are removed from the surgical field by grippers 105 prior to attaching center rod assembly 98 to clamp rod 250 as shown in fig1 b . turning tail member 222 , analogous to the turning of clamp knob 34 above , draws helical cam 230 rearward initially a rapid rate to provide quick approximation of rings 52 and 94 and subsequently at a slower rate for more precise approximation of rings 52 and 94 . increased torque accompanies the slower approximation rate to apply a higher clamping force between rings 52 and 94 and the tissue section clamped therebetween . pivoting handles 216 is analogous to the pivoting of handle 42 above in that the knife holder 74 is forced forward to initially insert locking inner ring 72 into intermediary ring 52 , subsequently core the ring assembly and thereafter finally push the multi - ring assembly and clamped tissue free of ring applier 200 . while the invention has been particularly shown and described with reference to the preferred embodiments , it will be understood by those skilled in the art that various modifications and changes in form and detail may be made therein without departing from the scope and spirit of the invention . accordingly , modifications such as those suggested above , but not limited thereto , are to be considered within the scope of the invention . | US-95915292-A |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.