Datasets:

hatakeyama-llm-team

/

PMC

like 0

Substance use during pregnancy often leads to involvement in the child welfare system, resulting in multiple social service systems and service providers working with families to achieve successful child welfare outcomes. The Vulnerable Infants Program of Rhode Island (VIP-RI) is a care coordination program developed to work with perinatal substance-users to optimize opportunities for reunification and promote permanency for substance-exposed infants. This paper describes services used by VIP-RI participants and child welfare outcomes.Data collected during the first four years of VIP-RI were used to identify characteristics of program participants, services received, and child welfare outcomes: closed child welfare cases, reunification with biological mothers and identified infant permanent placements.Medical and financial services were associated with positive child welfare outcomes. Medical services included family planning, pre- and post-natal care and HIV test counseling. Financial services included assistance with obtaining entitlement benefits and receiving tangible support such as food and clothing.Findings from this study suggest services that address basic family needs were related to positive child welfare outcomes. The provision of basic services, such as health care and financial assistance through entitlement benefits and tangible donations, may help to establish a foundation so mothers can concentrate on recovery and parenting skills. Identification of services for perinatal substance users that are associated with more successful child welfare outcomes has implications for the child welfare system, treatment providers, courts and families. According to the Substance Abuse and Mental Health Service Administration (SAMHSA), 5% of pregnant women used illicit drugs in the past month . The 200Maternal substance use raises concerns about a woman's capability to adequately care for her child. Risk factors associated with substance abuse such as co-occuring psychiatric problems, violence, difficulties in interpersonal relationships, limited social support, unstable employment histories, and medical problems raise additional concerns about parenting abilities -7. EstimWhen substance use during pregnancy results in child welfare involvement, multiple social service systems intervene to address the family's needs. There is limited information about specific services used by perinatal substance users with child welfare involvement. An examination of services received and child welfare outcomes can increase understanding about how best to intervene with perinatal substance users to achieve positive child welfare outcomes. The present study describes services received by women participating in the Vulnerable Infants Program of Rhode Island (VIP-RI) (described below) and three child welfare outcomes: 1) a closed child welfare case, 2) reunification with biological mother and 3) an identified permanent placement for the infant.The provision of comprehensive services is widely considered to improve treatment outcomes for pregnant and parenting substance-using women -18. WomeRecent research has examined substance abuse treatment services and child welfare outcomes. A study investigating reunification of children whose mothers participated in the California Treatment Outcome Project , reported factors associated with reunification were mother's length of time in treatment and participation in programs that addressed larger family needs such as employment and education . MothersThe Vulnerable Infants Program of Rhode Island (VIP-RI) began as a demonstration grant to provide care coordination services to mothers with an open child welfare case because of drug use during pregnancy. Enrollment in VIP-RI typically occurs during a mother's hospitalization following delivery. When prenatal substance exposure is identified either through maternal self-report or a positive toxicology screen, a hospital social worker informs the mother about VIP-RI and with her consent, makes a referral to the program. The VIP-RI care coordinator assesses maternal and infant needs and facilitates referrals to appropriate services. VIP-RI remains involved with families until a permanent placement for the infant has been identified. In some instances, because of the voluntary nature of the program, families may withdraw before a decision regarding permanency has been made.Mothers who participate in VIP-RI have the option of participating in the Rhode Island Family Treatment Drug Court (RI FTDC). RI FTDC is a specialized court for perinatal substance users that provides structure and support and takes an interactive, therapeutic approach that involves close monitoring and making referrals to substance abuse treatment and ancillary services.VIP-RI's model of closely collaborating with social service agencies expedites parents obtaining the services and supports they need. Services typically arranged by VIP-RI include substance abuse treatment, mental health, medical care, parenting, and help obtaining entitlement benefits. Such services are generally accepted as helpful for perinatal substance users, however, little is known about which services are actually utilized and their relevance to child welfare outcomes. The purpose of this paper is to describe the services used by mothers who participated in VIP-RI and the following child welfare outcomes: 1) status of the child welfare case 2) reunification with biological mother and 3) an identified permanent placement for the infant. To our knowledge this is the first study to describe services for perinatal substance users and child welfare outcomes.An analysis of data from the first four years of VIP-RI identified services used by mothers while participating in VIP-RI and if the child welfare case had been closed, if reunification had been achieved, and if a permanent placement for the infant had been established. The hospital Institutional Review Board granted approval for the pilot VIP-RI program.At enrollment, VIP-RI staff administered a semi-structured face-to-face psychosocial history interview that included measures of maternal characteristics and information about legal invovlement, substance abuse and treatment histories, trauma, and services received. The Substance Abuse Subtle Screening Inventory-3 was usedServices were divided into eight categories shown in Table Chi-Square analysis was performed comparing dichotomous variables and child welfare outcome variables .During the first four years, 70% of mothers referred to VIP-RI enrolled, for a total of 195 mothers. Reasons for not enrolling were active or passive refusal (64%) , ineligibility when a child welfare case was not opened after the initial CPS investigation (16%), and not being appropriate for reasons that included current incarceration, planning to place the child for adoption, psychiatric issues, not substance abuse, being identified as the primary problem (20%).Most participants in VIP-RI were Caucasian (56%), followed by African American (22%), Hispanic (14%), and other (8%). Primary drugs of choice were cocaine (46%), opiates (27%), marijuana (24%) and alcohol (3%). Maternal ages ranged from 17 to 43 years . At the time of enrollment in VIP-RI, 89% of the mothers were single and had an average of three children (range 1 - 9). Over one third of the sample had less than a high school education (37%), 61% had a high school diploma or equivalent, and 2% had a four-year college degree. Most mothers had no reliable source of income or received disability or entitlement benefits; only 6% were employed.A higher proportion of mothers with at least a high school education , fewer children , or only one child had closed child welfare cases. Maternal characteristics associated with having an open child welfare case were childhood physical abuse and a history of criminal conviction .Similar results were found when maternal characteristics and reunification outcomes were analyzed. A greater proportion of mothers with fewer children or only one child achieved reunification. A smaller proportion of mothers with less than a high school education were reunified with their children . A smaller proportion of mothers with a history of childhood physical abuse achieved reunification with their infants .At the time of hospital discharge, 32% of infants remained with biological parents, 32% were placed in kinship care, 32% were placed in non-relative foster care and 4% went to specilaized care. Infant placements at the time of discharge from VIP-RI were 56% living with biological parents, 22% in kindship care and 22% in non-relative foster care. There were no statistically significant associations between maternal characteristics and child welfare outcome measures and maternal race, income or age. There also were no statistically significant associations between maternal characteristics and infant permanent placements.As shown in Table As shown in Table As shown in Table Families with parental substance use and child welfare involvement are less likely to reunify and more likely to experience lengthy stays in foster care and higher rates of re-reporting ,33-36. IIn this study, the majority of services related to closed child welfare cases and reunification with biological mother were medical and financial services. Medical services included HIV pre/post test counseling, prenatal and postnatal care, primary medical care and family planning. Medical professionals should be aware of the positive impact they can have on the lives of substance-exposed infants and parents beyond the medical attention they provide. A strong connection with medical providers can serve families well in terms of following through with routine medical visits and providing a foundation of care for a mother to address concerns about her own and her children's health.Financial services that were associated with positive child welfare outcomes included assistance with entitlement benefits and obtaining food and clothing. Stress associated with not having essential needs met can interfere with a woman's ability to focus on treatment and may contribute to her questioning if she is able to adequately provide for her children. Ensuring that a family's basic needs are met may have the additional benefits of promoting a mother's ability to work on recovery and child welfare case plans by allaying worries about how to feed, clothe and shelter her children. Building in these services as part of child welfare, treatment, or court may contribute to more positive child welfare outcomes.Not all services were associated with favorable child welfare outcomes. Permanency services and residential drug treatment were less likely to be associated with reunification with the biological mother or identified permanent placements for infants. Permanency services included providing support to families who were voluntarily or involuntarily having parental rights terminated, which may account for these services being associated with infants not being reunified or having established permanent placements. Residential treatment may have been a marker for more severe addiction and related risk factors, which may have indicated a poorer prognosis.Involvement in child welfare because of drug use during pregnancy is a complicated issue and numerous factors affect child welfare outcomes. This study did not control for other factors that could have influenced child welfare outcome, such as social support networks, satisfaction with services, etc. This study did not correct for multiple comparisons because the purpose of the study was to describe services related to specific outcomes, as this had not been done previously. Adjustment for multiple comparisons protects against rejecting the null hypothesis when it is correct (type I error). However, the cost of this protection is to increase type II error that findings are attributable to chance when they are not.In addition, this study is limited to a population of perinatal substance users who participated in an innovative program, VIP-RI, which has an active partnership with the state's FTDC. There was no comparison group of mothers with open child welfare cases because of drug use during pregnancy who did not participate in VIP-RI.Services that addressed family health and financial needs were associated with favorable child welfare outcomes for perinatal substance users with child welfare involvement. When considering the range of services substance-using women often need, it is important to make sure that their basic needs are not overlooked. Alleviating health and financial pressures may have positive consequences for women struggling to address substance abuse while attempting to assume parenting responsibilities by allowing them to focus more on their recovery and parenting skills as they attempt to succeed with their child welfare case plans.The authors declare that they have no competing interests.KJM, JET & BML conceived of the study and wrote the manuscript. DC performed the statistical analysis. RS & LA coordinated VIP-RI and the collection of data. All authors have read and approved the final manuscript.

The epidemic of bovine spongiform encephalopathy (BSE) in the United Kingdom, which began in 1986 and has affected nearly 200,000 cattle, is waning to a conclusion, but leaves in its wake an outbreak of human Creutzfeldt-Jakob disease, most probably resulting from the consumption of beef products contaminated by central nervous system tissue. Although averaging only 10-15 cases a year since its first appearance in 1994, its future magnitude and geographic distribution cannot yet be predicted. The possibility that large numbers of apparently healthy persons might be incubating the disease raises concerns about iatrogenic transmissions through instrumentation and blood and organ donations. Government agencies in many countries continue to implement new measures to minimize this risk.

Gaucher disease is a progressive lysosomal storage disorder caused by the deficiency of glucocerebrosidase leading to the dysfunction in multiple organ systems. Intravenous enzyme replacement is the accepted standard of treatment. In the current report, we evaluate the safety and pharmacokinetics of a novel human recombinant glucocerebrosidase enzyme expressed in transformed plant cells (prGCD), administered to primates and human subjects. Short term (28 days) and long term (9 months) repeated injections with a standard dose of 60 Units/kg and a high dose of 300 Units/kg were administered to monkeys (n = 4/sex/dose). Neither clinical drug-related adverse effects nor neutralizing antibodies were detected in the animals. In a phase I clinical trial, six healthy volunteers were treated by intravenous infusions with escalating single doses of prGCD. Doses of up to 60 Units/kg were administered at weekly intervals. prGCD infusions were very well tolerated. Anti-prGCD antibodies were not detected. The pharmacokinetic profile of the prGCD revealed a prolonged half-life compared to imiglucerase, the commercial enzyme that is manufactured in a costly mammalian cell system. These studies demonstrate the safety and lack of immunogenicity of prGCD. Following these encouraging results, a pivotal phase III clinical trial for prGCD was FDA approved and is currently ongoing.NCT00258778ClinicalTrials.gov Since its introduction in 1991, glucocerebrosidase enzyme replacement therapy (ERT) has become the standard of care for patients with symptomatic Gaucher disease due to its safety and efficacy profile In an attempt to offer an alternative source for the production of the glucocerebrosidase enzyme, we have developed a biotechnological expression platform which is based on the industrial scale expression of human recombinant proteins in genetically engineered plant cells The protocol for this trial and supporting CONSORT checklist are available as supporting information; see 2 basis, respectively. The clinical dose of 60 units/kg, equivalent to approximately 1.8 mg/kg in humans, corresponds to 66 mg/m2 (using the conversion factor of 37 kg/m2 for humans), and corresponds to 5.6 mg/kg in cynomolgus monkeys (using the conversion factor of 12 kg/m2 for Cynomolgus monkeys). Studies were performed according to Good Laboratory Practice (GLP) at MPI Research . This facility maintains an Animal Welfare Assurance statement with National Institutes of Health, Office of Laboratory Animal Welfare. All experiments were performed in accordance with the guidelines of the Animal Care and Use Committee of the Hebrew University. Animals were subjected to clinical observations and assessed for body weight, hematology, coagulation, clinical chemistry and urinalysis evaluations. Animals were sacrificed at the end of treatment period and organ weights, macroscopic and microscopic pathology were also determined. Antibodies were measured on Day 1 and Day 28 in the acute study and on Day 1, followed by 1, 3, 6 and 9 months in the chronic study. Plasma concentrations and toxicokinetics were measured on Day 1 and Day 28 in the acute study and on Day 1, Week 9 and Week 39 in the chronic study.Two extensive safety toxicology studies were performed: an acute 4-week daily intravenous infusion study and a chronic 39-week intravenous infusion study in Cynomolgus Monkeys. In each study, twenty four (24) animals (4/sex/dose) were intravenously infused either daily (in the acute study) or once every 2 weeks (in the chronic study) over 1 hr with multiples of 1 or 5 times the clinical dose (60 units/kg) adjusted to animal body surface area. The doses of 5.6 and 27.8 mg/kg/day represent 1× and 5× the clinical dose on a mg/mnd of Nov 2005 and was completed 20th of March 2006).The phase I study was designed as a single-center, non-randomized, open label, safety and pharmacokinetic study of escalating single doses of prGCD administered as intravenous infusion (IV) to six healthy volunteers. This study was conducted according to FDA and European GCP guidelines, and was approved by the IRB of the Hadassah University Hospital and the Israeli Ministry of Health and under an FDA investigational new drug application (IND). The study was performed at the Phase I Unit at the Goldyne Savad Institute of Gene Therapy at the Hadassah Hebrew University Hospital. The study was approved by the Helsinki committee of Hadassah-Hebrew University Hospital Jerusalem, Israel, and all subjects gave written informed consent. Inclusion and exclusion criteria are presented in last, Tmax, Cmax and Cmin).A vehicle control placebo followed by three single escalating doses of prGCD were administered via intravenous (IV) infusions. The vehicle was administered at the baseline visit, followed by an initial prGCD dose of 15 units/kg administered on Day 8; 30 units/kg on Day 15, and 60 units/kg administered on Day 22. The infusion rate was 1.5 mL/minute (135 mL over 90 minutes), which was the same for all doses. Subjects were closely monitored for 8 hours from the time of the initiation of the infusion and returned after 24 hours from the time of initiation of infusion for blood sampling and additional safety assessments. A follow up visit was performed on day 29, at the end of the study. The issue of safety was the primary outcome in this study; safety measurements included adverse events, general infusion related toxicities, physical examinations including changes in vital signs and body weight, and laboratory tests. Pharmacokinetic parameters were the secondary outcomes in this study. Blood samples were collected prior to dosing (0) and at 5, 45, 80 and 90 minutes during the infusion and 100, 115, 130, 150, 180, 210 minutes and 24 hours from initiation of infusion, and the plasma was analyzed to provide a pharmacokinetic profile , and tabulated based on the incidence, severity, and causality to study treatment.Statistical analysis of the clinical trial data was performed by TechnoStat Ltd., Kfar Saba, Israel.Analysis of anti-prGCD antibodies was performed using a validated immunoassay we have developed . Controls and unknown samples were incubated in a 96-well microtiter plate coated with prGCD molecules and incubated with shaking at room temperature, allowing any anti-prGCD antibodies present to bind to the prGCD molecules. After incubation, the plate was washed to remove any nonreactive serum components. Biotinylated prGCD conjugate was added which enabled binding to anti-prGCD antibodies already bound to the prGCD solid phase. Detection was performed using a streptavidin-peroxidase conjugate. The plate was washed to remove any unbound protein and reagents followed by the addition of the substrate, tetramethylbenzidine (TMB) solution. After a 10-minute incubation, 2 M sulfuric acid was added and the absorbance was measured at 450 nm. The intensity of the color produced was proportional to the concentration of anti-prGCD antibodies in the sample. Antibody-positive samples were determined by comparing the optical density (OD) with a predetermined cutoff OD. An OD equal to or greater than the cutoff identifies a sample as antibody-positive. Samples that were presumed positive underwent immunodepletion testing by addition of prGCD. The addition of prGCD to samples containing anti-prGCD was expected to block the anti-prGCD antibodies from binding to the prGCD coat on the plate, thereby decreasing the OD readings. Any sample demonstrating a decrease of greater than 50%, after the addition of prGCD, was considered positive for anti-prGCD antibodies.Analysis of neutralizing antibodies was performed using a validated immunoassay we have developed. Controls and unknown samples were incubated in a 96-well microtiter plate coated with prGCD molecules and incubated with shaking at room temperature, allowing any anti-prGCD antibodies present to bind to the prGCD. After one hour of incubation at room temperature, the plate was washed to remove any non-reactive serum components. The substrate, p-nitrophenyl β-D-glucopyranoside, was mixed with the activity assay buffer and added to the wells. After a one-hour incubation at room temperature, 5 M sodium hydroxide was added to stop the reaction and enhance the intensity of the color developed. Control samples included neutralizing and non-neutralizing controls. A solution of prGCD, substrate and enzyme inhibitor conduritol B epoxide (CBE) which was added to the uncoated wells was used to perform enzyme inhibition. The control of pooled naive human serum was added to the coated wells to track the activity of the enzyme coated to the surface of the microtiter wells in the presence of normal human serum. A sample is considered positive for neutralizing activity if the OD obtained is less than or equal to the assay cutoff.Determination of prGCD plasma concentrations was performed using a validated immunoassay we have developed. Controls and unknown samples were incubated in a 96-well microtiter plate coated with chicken-anti-plant recombinant glucocerebrosidase (prGCD) antibodies and incubated with shaking at room temperature allowing any prGCD present to bind to the anti-prGCD antibodies. After two hours of incubation, the plate was washed to remove any non-reactive plasma components. Rabbit anti-prGCD antibodies were added and the plates were incubated 1.5 hours at room temperature to allow the rabbit anti-prGCD to bind to the prGCD. The plate was washed to remove any unbound protein and reagents followed by the addition of an alkaline phosphatase affinity-purified goat anti-rabbit IgG conjugate. After a 60-minute incubation at room temperature, the plate was washed and detection was performed with phosphatase substrate. The absorbance was measured at 405 nm and color was allowed to develop at room temperature for 30 to 45 minutes or until the optical density (OD) was 1.0 or greater. The intensity of the color produced was proportional to the concentration of prGCD in the sample. The prGCD levels were quantified according to a standard curve generated by measuring purified recombinant prGCD in a 4% cynomolgus monkey plasma or human plasma matrix utilizing a four-parameter curve fit equation.Plasma analysis data were analyzed by Noncompartmental pharmacokinetic analyses (NCA) using WinNonlin®, version 5.0.1 software and Microsoft Office Excel 2003. Plasma prGCD concentration versus time data for individual animals and human subjects were analyzed for maximum concentration (Cmax), the time at which Cmax occurred (Tmax), and for area under the plasma concentration versus time curve from the start of infusion to 24 hours post-infusion, using the linear trapezoid rule . All AUC calculations were based on the time interval from start of infusion to the last measurable plasma concentration (AUClast). , Clearance (CL) and the volume of distribution at steady-state (Vss) were determined.No treatment-related side effects on survival or any clinical signs were observed during both the acute and chronic studies in primates. There was no effect of prGCD on electrocardiogram parameters, ophthalmological, hematological, coagulation, clinical chemistry, or urinalysis values. Organ weights were not affected and there were no investigational drug-related macroscopic or histopathology findings. All changes were considered to be within normal limits for cynomolgus monkeys. Based on these data, a no-observed-adverse-effect-level (NOAEL) of 27.8 mg/kg/day, the highest dose tested, was identified.In the acute study, repeated daily dosing of monkeys with prGCD for 28 consecutive days did not result in production of any anti-prGCD antibodies or neutralizing antibodies. In the chronic study, samples from 5 of the 24 animals were found positive for anti-prGCD antibodies, 3 out of 8 animals receiving 5.6 mg/kg/day and in 2 out of 8 animals receiving 27.8 mg/kg/day. All antibodies were determined to be negative for neutralizing antibody activity.All animals treated with prGCD had significant plasma exposure to the investigational drug. The prGCD plasma exposure profiles were similar at both dose levels. Plasma concentrations of prGCD increased with increasing dose of prGCD.Seventeen volunteers were assessed for eligibility. Six volunteers were enrolled and allocated for the study. All six had completed all study steps and their data was available for analysis. None had dropped out during the study period. The volunteers, 3 males and 3 females, were all Caucasian aged 19–36.Six healthy volunteers were administered with the vehicle at the baseline visit, followed by an initial prGCD dose of 15 units/kg administered on Day 8; 30 units/kg on Day 15, and 60 units/kg on Day 22. Safety results indicated that prGCD was well tolerated with only non-drug- related, minor side effects that were self limited and resolved with no treatment. No serious adverse events were attributable to prGCD administered intravenously once a week at a dose of up to 60 units/kg. Laboratory tests for kidney and liver function tests were all within normal range. One volunteer had measurements of Bilirubin up to1.4 mg% during the follow-up period and a second volunteer had measurements of Bilirubin up to 1.1 during the follow-up period ; all the rest had normal Bilirubin levels within normal limit all along the study.. Immunological laboratory tests were all within normal limits. The Complete Blood Counts (CBC) differentials revealed that one volunteer had at screening and at follow-up a slight elevation in eosinophils, up to 7% ; and the second volunteer had a single measurement of 6% of eosinophils . Complement Component 3 (C3) measurements: 5 measurements were found to be slightly lower than normal range. One subject had lower values at screening and at Visit 1, which were normal afterwards. One subject had three values lower than normal: at Visit 3, Visit 4 and follow-up. None of these results were clinically significant. IgE measurements were within normal range in five volunteers and only one exhibited a slightly high value, which was similar to his baseline and the vehicle control dosing period. Adverse events were classified by body system using MedDRA, and tabulated based on the incidence, severity, and causality to study treatment . Adminislast). Inspection of the NCA results also confirmed no obvious difference between males and females for Cmax and AUClast for these small group sizes. A mean half-life (t½) of approximately 15 min (range: 8–32 min) was determined and is based on all subjects in the 30 and 60 units/kg dose groups. At 30 and 60 units/kg, individual CL values ranged from 0.8 to 3.4 mL/min/kg. Volume of distribution (Vss) estimates ranged from 34 to 94 mL/kg at 30 and 60 units/kg, which is consistent with the size of the human plasma compartment.Comparison of prGCD concentration versus time for males versus females at each dose level revealed no clear difference in exposure between genders. Combining prGCD concentration for males and females and plotting mean concentration versus time for all three doses indicate dose-dependence in exposure to prGCD. The pharmacokinetic profile, combined for 5 patients at 30 units/kg and 60 units/kg is presented in The primary objective of this Phase I clinical trial was to determine the safety of recombinant plant cell expressed glucocerebrosidase (prGCD) in healthy volunteers. The safety results confirmed that there was no clinical or laboratory evidence of any significant innate or humoral immune reactions of this investigational drug with any clinically significant adverse events. prGCD administered IV once a week up to 60 mg/kg was shown to be safe and non immunogenic. This data was strongly supported by pre-clinical toxicological studies in animals including primates, performed with prGCD. Based on these results, the US Food and Drug Administration (FDA) allowed prGCD to proceed to a Phase 3 pivotal clinical trial, which is currently ongoing. An interesting finding in this study comes from the pharmacokinetic results, wherein the half life of prGCD was prolonged relative to that of Cerezyme® , the commercially available enzyme, reported as 3.6–10.4 min Development of antibodies to the current commercially available recombinant human glucocerebrosidase, expressed in CHO cells, has been reported in approximately 15% of the treated patients tested and antibody formation was reported following 3–12 months of treatment There is a public concern regarding the high cost of the recombinant GCD enzyme approved for Gaucher's disease It remains to be determined in larger scale clinical studies, as required in any new protein drug development process, whether plant-derived biopharmaceutical glycoproteins are associated with any excessive immunogenicity effects or excessive neutralizing antibody formation, beyond the standard rate seen for recombinant therapeutic proteins, which may limit their use. However, the current regulatory viewpoint, based on data accumulated in a number of clinical trials involving different plant-expressed proteins, is quite promising in this regard Currently, several biotechnology companies have used plant biotechnology to produce protein pharmaceuticals, such as glucocerebrosidase to treat Gaucher disease in our case, lipase to treat cystic fibrosis, alpha-interferon, lactoferrin, and others, which are under evaluation in human studies Checklist S1CONSORT Checklist(0.06 MB DOC)Click here for additional data file.Protocol S1Trial Protocol(1.72 MB DOC)Click here for additional data file.

Sexual dysfunction is common in systemic sclerosis (SSc). Male erectile dysfunction (MED) has been reported in around 80% of subjects and more than half of female patients fulfill criteria for diagnosis as female sexual arousal Disorder (FSAD). While some evidence supports a role for cavernosal fibrosis, abundant data suggest that MED is yet another clinical feature of SSc related to vasculopathy. The contribution of vasculopathy to the more complex issues of female sexual dysfunction is less clear. Inhibitors of Type V phosphodiesterase are effective in men with MED secondary to SSc. Limited study in women suggests inconsistent effects on behavior (frequency) but not on measures related to perfusion. Sexual activity is an important component of quality of life and an important domain for the caregiver to address; it is not clear that it warrants primary consideration as a consistent measure of scleroderma-related vasculopathy. Any comprehensive hypothesis concerning the pathogenesis of systemic sclerosis must account for the varying contributions of vascular damage, extravascular tissue fibrosis, and inflammation . While cComplications from scleroderma do have a negative impact on sexual function and in turn on the overall quality of life. In spite of the 80% female predominance of SSc , most ofMED is defined as the consistent inability to attain and maintain an erection sufficient to permit satisfactory sexual performance . The firSeveral studies have ruled out a neurological basis for ED in SSc , 21. RecPenile vascular damage in SSc patients was assessed using Duplex ultrasonography , 23 showPhosphodiesterase type-5 (PDE5) is an enzyme which degrades cGMP. PDE-5 inhibitors enhance erectile function by blocking degradation of cGMP leading to an increase in intracellular cGMP in the corpus cavernosum and penile vasculature. The result is an increase in the relaxation of the smooth muscle leading to an increased blood flow and penile erection . There aThere is an inequality in the number of studies focusing on male versus female sexual dysfunction (FSD) in the general population and the Changes associated with SSc can have a negative impact on female sexuality and sexual functioning. Symptoms such as skin tightening around the vaginal introitus, joint contractures, muscle weakness, changes in skin around the breasts and breast muscle, and joint pain have been found to be associated with lower levels of sexual functioning, desire, arousal, lubrication, and satisfaction , 6, 30. The number of women with SSc reporting sexual dysfunction is higher than those reported in the general population and also higher than those reported in studies on other chronic conditions –13. BhadWhile there are many studies on the use of PDE-5 inhibitors in the treatment of ED there are few studies on their use in the treatment of female sexual arousal problems and their effectiveness is in question . Our undWhile there are few studies on the effectiveness of PDE-5 inhibitors for FSD in the general population, no studies were found in SSc patients. The paper by Chivers and Rosen regardinP =  .021; 2-tailed) as was the change from baseline . The only other statistically significant difference in this study was found in a change from baseline in the sexual desire domain of the FSFI for drug although this was not statistically different from the change in the placebo group. A total of 39 patients met all inclusion criteria, agreed to attempt sexual activity at least once weekly and successfully completed all 5 visits. When comparing change from baseline between drug and placebo on the six domains of the FSFI no statistically significant differences were found although patients reported greater change when on drug versus when on placebo. A significant difference was found between drug and placebo in the number of sexual activities with SSc patients reporting more frequent sexual activities when receiving drug than when on placebo . This difference was statistically significant in spite of a host of physical and psychological difficulties associated with their disease. Complete care should consider agents for vaginal lubrication, advice about positioning and attention to sexual adverse events of therapies.

Sarcodon imbricatum wildly grown in the Black Sea Region of Turkey were investigated in this study. Antioxidant activities were evaluated in terms of total antioxidant activity, reducing power, metal chelating ability, inhibition of linoleic acid peroxidation, superoxide, peroxide and hydrogen peroxide scavenging effects. Various antioxidant activities were compared to references antioxidants such as α-tocopherol, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), and trolox. In total antioxidant (12674.45 μmol α-tocopherol/g of extract), superoxide scavenging (53.74%) and peroxide scavenging activity (45.73%), the methanol extract of Sarcodon imbricatum showed stronger activity patterns than that of references antioxidants. Reducing power, metal chelating activity and free radical (DPPH•) scavenging activity was increased with the increasing concentration. The contents of total phenolic, flavonoid, anthocyanin, ascorbic acid, β-carotene and lycopene of Sarcodon imbricatum were determined and found to be noteworthy.The antioxidant activities of the methanol extract of The mixture was shaken vigorously and kept at room temperature for 30 min. Then the absorbance was measured at 517 nm. The decrease in the absorbance of the DPPH• solution indicates an increasing of DPPH• radical-scavenging activity. This activity was calculated by the following equation:The effect of of Blois. wherein • scavenging effect (%) = [(A0-A1)/A0 × 100],DPPH0 is the absorbance of control and A1 is the absorbance of mushrooms or standards.where Aet al.Hydrogen peroxide scavenging activity, (%) = (V0 is the volume of Na2S2O3 solution hydrogen peroxide (without extract), V1 is the volume of Na2S2O3 solution mixed with the extract or standard antioxidants.where V4 and H2O2. The reaction mixture contained 1 ml FeSO4 (1.5 mM), 0.7 ml H2O2 (6 mM), 0.3 ml sodium salicylate (20 mM) and sample . After incubation for 1 h at 37°C, the absorbance of the hydroxylated salicylate complex was measured at 562 nm. The percentage scavenging effect was calculated as follows:Peroxide scavenging activity was measured according to a modified method of Smirnoff and Cumbes. Peroxide1-A2)/Ao] × 100 where A0 is the absorbance of the control (without extract or standards) and A1 is the absorbance including the extract or standard, A2 was the absorbance without sodium salicylate.The peroxide scavenging activity (%)= [1- or standard errors (SE). The results were analyzed using one-way analysis of variance (ANOVA) followed by Tukey's HSD test with α= 0.05. This treatment was carried out using SPSS v.16.0 software.Sarcodon imbricatum.The amount of extractable compounds was 234 mg/g dry plant material for methanol extract of r2=0.9904) and expressed in gallic acid equivalents (GAE). The total phenolic content per gram of crude extract was found 30.20±1.38 mg GAE/g DW. The greater efficiency of methanol in extracting the phenolic compounds would be expected to result in higher antioxidant activity. This value was higher than that reported research.[Sarcodon imbricatum extract might account for the better results found in its antioxidant assays.The content of extractable phenolic compounds in extract, determined from regression equation of calibration curve and expressed in catechin equivalents. The total flavonoid content of methanol extract from Sarcodon imbricatum was found 0.260±0.009 mg quercetin/g of DW. Flavonoids are very important plant constituents because of active OH.− and show antioxidant activity.[The total flavonoid content of methanol extract from activity.Sarcodon imbricatum extract was 0.13 ± 0.03 as mg cyanidin 3-glucoside/g dry weight. It is to be expected that several activities might be related to a possible antioxidant action from anthocyanosides like polyphenol compounds. The extracts of edible plant were most abundant in phenolics were also most abundant in anthocyanins . It has been found that polyphenolic compounds are one of the most effective antioxidant constituents in plant foods, including fruits, vegetables and grains.[The content of total anthocyanosides in d grains.Sarcodon imbricatum extract was 0.013±0.002 mg ascorbic acid/g DW, 2.08±0.09 μg caratenoid/ g DW, and 2.03±0,05 μg lycopene / g DW, respectively. These values were found in valuable amounts, which were in agreement with other reports concerning ascorbic acid, β-carotene and lycopene quantification in different mushrooms.[The content of ascorbic acid, β-carotene and lycopene in the methanolic extract of ushrooms.–14max), 327 (λmax), and 356 (λmax).[max of extract 409 and 513 nm may be due to the presence of flavonoids and anthocyanins, respectively. It was found that flavonoids and anthocyanins exhibit comparable special bands to the values reported in the literature.[Sarcodon imbricatum extract and chemical contents.[The UV–Vis absorption 200-800 nm) spectra of the mushrooms extracts were assessed for the characterization of phenolic compounds, flavonoid and anthocyanins . Phenoli6 (λmax).39 λmax oterature.–40 These0-800 nm Sarcodon imbricatum and references antioxidants at 100 μg/mL concentration as measured by phosphomolybdenum method is presented in Sarcodon imbricatum and reference antioxidants exhibited the following order: BHA > Sarcodon imbricatum > BHT > trolox. These results were statistically significant, (P < 0.05). The results of the three plants are considered to be noteworthy when compared to the findings of other studies concerning medicinal plants in Turkey.[The phosphomolybdenum method usually detects antioxidants such as ascorbic acid, some phenolics, α-tocopherol, and carotenoids. The antin Turkey. The antin Turkey.–16Sarcodon imbricatum inhibited linoleic acid peroxidation. The results obtained for extract lower than the standards α-tocopherol, BHA, and trolox, but higher than BHT. In conclusion, we can infer that this mushroom extract competes with α-tocopherol, BHA, BHT, and trolox, but not significantly. In previous studies, the inhibition of linoleic acid of methanolic extraction of several commercial and medicinal mushrooms have been reported.[reported.–422.−, which is a reduced form of O2, has been implicated in the initiating oxidation reactions associated with aging. In the PMS/NADH-NBT system, superoxide anion derived from dissolved oxygen by PMS/NADH coupling reaction reduces NBT. Antioxidants are able to inhibit the blue NBT formation.[Sarcodon imbricatum had strong superoxide radical scavenging activity, higher than that of references antioxidants at the same concentrations, (P < 0.05). Superoxide radical scavenging activity of those samples followed the order: Sarcodon imbricatum > BHA > α-tocopherol > BHA > trolox. The results were found statistically significant (P<0.05). It was reported that the superoxide anion scavenging activity could be due to the action of a free hydroxyl group.[The production of highly reactive oxygen species such as superoxide anion radicals, hydrogen peroxide, and hydroxyl radicals is also catalyzed by free iron through Haber-Weiss reactions. O2.−, whormation. The decryl group.Sarcodon imbricatum extract did not show good hydrogen peroxide scavenging activity against H2O2, the lowest being that of reference antioxidants. H2O2 scavenging activity of those samples followed the order: BHT > BHA > trolox > α-tocopherol > Sarcodon imbricatum. These results were statistically significant, (P< 0.05). It is well established that hydrogen peroxide is not dangerous as it is, but may well be because of its ability to form the hydroxyl radical, thereby emphasizing on the importance of its elimination. Indeed, it has previously been proven that dietary phenols protect mammalian and bacterial cells from cytotoxicity induced by hydrogen peroxide,[2O2 scavenging activity of our edible mushrooms could be due to the presence of phenols.peroxide, indicatiSarcodon imbricatum had stronger scavenging ability against hydroxyl radicals than the antioxidants (P < 0.05) [Sarcodon imbricatum > α-tocopherol > BHA > BHT > trolox and these results were statistically significant, (P< 0.05). Previous studies had reported two types of antioxidant mechanism: suppression against hydroxyl radical generation, and cleaning hydroxyl radical generated.[The methanol extract of < 0.05) . Peroxidenerated. The formenerated.K3Fe(III)(CN)6+Ph−OH→Kx(Fen(III)Fe(II)(CN)63+Ph−O•+H+2+ concentration.[Sarcodon imbricatum was lower than that of the reference antioxidants. But, the reducing power of the extract increased with concentration significantly, P< 0.05. It was reported that the reducing power of mushrooms might be due to their hydrogen-donating ability.[Therefore, measuring the formation of Perl's Prussian blue at 700 nm can monitor the Fentration. The redu ability.+2 accelerates lipid peroxidation by breaking down hydrogen and lipid peroxides forms by Fenton free radicallic reaction; +2 ion can form complexes with ferrozine. In the presence of chelating agents, the complex formation is prevented, resulting in a decrease in the red color of the complex. Measurement of color reduction allows determination of metal chelating activity. Measurement of the rate of color reduction allows estimation of the chelating activity of the coexisting chelator.[Sarcodon imbricatum and the reference antioxidants interfered with the formation of ferrous-ferrozine complex, suggesting that it has chelating activity and captures ferrous ion before ferrozine. Sarcodon imbricatum > BHT > BHA > α-tocopherol > trolox, with percentage chelations of 98.90, 80.20, 80.00, 75.00, 69.50, and 64,00%, respectively. In parallel to the data obtained from some edible mushrooms that exhibited the methanolic extract of mushroom.[Iron has the most important lipid pro-oxidant. It is known that FeOH−+OH•). Fe+2 ionchelator. In this mushroom.• free radicals can be used to evaluate the antioxidant activity of specific compounds or extracts in a short time. The radical scavenging of mushroom extract was tested using a methanolic solution of the “stable” free radical, DPPH. Sarcodon imbricatum showed appreciable DPPH free radical scavenging activities at the selected scope of concentrations. The methanolic extract of mushroom tested showed much stronger scavenging activities against DPPH compared to antioxidant such as α-tocopherol, BHA, and BHT [Sarcodon imbricatum and reference antioxidants on the DPPH· radical were of the following order: trolox > Sarcodon imbricatum > BHA > BHT > α-tocopherol, with the percentage scavenging values of 98.80, 93.30, 86.00, 71.30, and 61.65%, respectively, at the concentration of 500 μg/ml. These results were statistically significant, P<0.05. The methanolic extracts from other mushrooms showed a moderate increase in DPPH free radical scavenging activities. In the previous studies, the same situations were reported for the methanolic extracts of wild grown mushrooms.[Free radical scavenging is one of the known mechanisms by which antioxidants inhibit lipid oxidation. The method of scavenging DPPH and BHT . The scaushrooms.Sarcodon imbricatum widely consumed in Giresun of Turkey. The results underline that the extract of mushroom has possessed significant antioxidant properties. Therefore, mushroom extract could be a potential source of natural antioxidants. The consumption of Sarcodon imbricatum might give certain level of health protection against oxidative damages. With the established antioxidant activity of this mushroom extract, the specific chemical characteristics and separation of the antioxidative components in the methanol extract should be further investigated.On the basis of the results obtained, we have herein demonstrated the antioxidant activities of the methanol extract of

One of the least-appreciated advances in pediatric rheumatology over the past 25 years has been the delineation of the many ways in which children with rheumatic disease differ from adults with the same illnesses. Furthermore, we are now learning that paradigms that are useful in evaluating adults with musculoskeletal complaints have limited utility in children. Nowhere is that more true than in the use of commonly used laboratory tests, particularly antinuclear antibody (ANA) and rheumatoid factor (RF) assays. This short review will provide the practitioner with the evidence base that supports a more limited use of ANA and RF testing in children. Order an ANA and a rheumatoid factor." It's common on adult wards, but it's used with disturbing frequency on pediatric wards as well. One of the least appreciated advances in pediatric rheumatology over the past 20 years has been the realization that models used to evaluate adults with musculoskeletal complaints do not serve children well . Thus, itologist ,4. This tologist . In thatThis short report will summarize some of the evidence base that supports a more limited use of ANA and rheumatoid factor tests by primary care physicians evaluating children for musculoskeletal complaints and/or suspected rheumatic disease. It is intended as a review for primary care physicians who wish to better understand how to use and interpret these two commonly-ordered tests.did have positive RF tests could be easily identified on the basis of the history and physical examination; the test did nothing to establish the diagnosis. McGhee and colleagues [Rheumatoid factor (RF) tests remain a standard assay for screening adult patients with musculoskeletal complaints and, depending on the population studied, may be positive in as many as 85% of adults with rheumatoid arthritis and fewer than 10% of healthy adult individuals . This tethere is never a reason to request a rheumatoid factor assay as a diagnostic test on a child. Pediatric rheumatologists will, however, continue to use rheumatoid factor testing as a prognostic biomarker until better indicators of prognosis emerge.Although the prevalence rate of RF-positive JRA/JIA is higher in certain populations , the diAntinuclear antibody (ANA) assays have the opposite shortcoming of RF assays: they are commonly positive in healthy children ,10) and Does this child have systemic lupus? It would be reasonable to propose, therefore, that a request for ANA testing in a child be accompanied by requests for a complete blood count and differential, urinalysis, and serum C3 and C4 levels, all of which have a high likelihood of being abnormal in childhood-onset systemic lupus [The limits of ANA in evaluating children with suspected JRA/JIA was corroborated in the earlier McGhee study , as showic lupus . Not surIt should be evident from the foregoing discussion that autoantibody testing has a much more limited utility in the evaluation of children with musculoskeletal complaints or suspected rheumatic disease than it does in adults. This is not to say that the laboratory is not helpful. A complete blood count and differential may, for example, provide the diagnosis in a child with severe musculoskeletal pain and refusal to walk, as musculoskeletal pain, and even frank arthritis, are common presentations of children with leukemia ,15. Simidistinctive clinical presentations of rheumatic disease in children, including the typical signs and symptoms, age range of the affected children, and diseases that mimic those under primary consideration.The reader will note that, in each of the above examples, the utility of the laboratory derives from the ability of the clinician to formulate a differential diagnosis based on the history and physical examination. Having a mental category called "rheumatic disease" is not particularly helpful in assessing children, as the different rheumatic diseases display a broad spectrum of presentations, affect children of different ages, and are characterized by physical findings that show only limited overlap between the different disease entities. This means, therefore, that the practitioner needs to be familiar with the children aren't just adults.It is reasonable for clinicians to desire a simple "test" that will allow them to consider or exclude "rheumatic disease" as a broad category in children. Unfortunately, such a test doesn't exist, any more than there's a "test" that excludes metabolic disease or endocrine disease (children with defects in steroid synthesis present at different ages and with different symptoms compared with children with type 1 diabetes). There is no reason to believe that such a test will ever emerge. We are therefore left with what good primary care physicians have always relied on: a good history, focused physical examination, and broad knowledge base. After all,

To evaluate changes in intraocular pressure (IOP) after clear corneal phacoemulsification (CCP) in normal patients.th day, lst, 2nd, 3rd month and 6 months after surgery.A prospective study including 273 normal patients selected for cataract extraction by CCP. Intraocular pressure was recorded on the 15For statistical analysis, Epi Info was used to determine the statistical significance of changes in IOP.P = 0.12), but significantly correlated with change in anterior chamber depth (ACD) (P = 0.002). The postoperative IOP was inversely related to preoperative ACD (P = 0.012). Age, sex and axial length were not significantly related to IOP reduction (P = 0.2–0.5)The mean age of 96 women and 177 men was 71 ± 12 years. The mean IOP before surgery was 14.18 ± 3.4 mmHg. Our patients showed a mean decrease in IOP of 2.25 mmHg (16%) compared to preoperative values. Change in IOP was not related to lens thickness (CCP was associated with a statistically significant reduction in IOP. The exact mechanism by which cataract surgery results in IOP reduction is unclear. CCP can be performed with the intent of achieving better IOP control. Cataract extraction surgery, independent of the technique used, induces variations in intraocular pressure (IOP). Although an elevation of the IOP in the early postoperative stage may be noted, many studies have reported a reduction in IOP.‐3 Some s4This was a prospective study including 273 normal patients selected for cataract extraction by phacoemulsification using a 3.2 mm clear corneal incision between June 2003 and January 2006. The study was approved by the Hassan II University Ethics Committee.A prospective analysis was performed using clinical charts focusing on patient age and sex, size of the capsulorhexis, and pre- and postoperative IOP. The axial length, lens thickness and anterior chamber depth (ACD) were measured during preoperative assessment three weeks before surgery using ultrasound A scan by contact technique. Central corneal thickness was not assessed. IOP was measured by Goldmann applanation tonometer by the same examiner preoperatively, on the 15th day, and subsequently one, two, three and six months after surgery. The mean change in IOP after surgery was calculated. The mean follow-up period was six months.Patients with history of ocular surgery, trauma, preoperative IOP greater than 21 mmHg, on ocular medication and who developed postoperative complication were excluded from the study.For statistical analysis, Epi Info was used to determine the statistical significance of changes in IOP. The statistical significance between the groups was estimated using Chi test. A valueAll surgeries were performed by the same surgeon.Most of the patients underwent surgery under peribulbar anesthesia using Lidocaine.Surgery involved a 3.2 mm superior clear corneal tunnel incision, injection of viscoelastic material into the anterior chamber, capsulorhexis of 5 mm, hydrodissection, in the bag phacoemulsification using phaco-chop technique, cortex aspiration, additional injection of viscoelastic material and insertion of foldable hydrophobic intraocular lens (IOL) in the capsular bag. The viscoelastic material was then removed. The corneal incision was closed by stromal hydration.Postoperatively, all patients were treated with topical combination of dexamethasone and Neomycin eyedrops during four weeks, and topical nonsteroidal antiinflammatory eyedrops four times daily for eight weeks.P = 0.012), after 1 month 11.98 ± 3.1 mmHg (P = 0.015), after two months 11.92 ± 2.4 mmHg (P = 0.005), after 3 months 11.84 ± 1.4 mmHg and after six months 11.82 ± 1.3 mmHg (P = 0.005).Two hundred and seventy three eyes of 273 patients were recruited for the study. The mean age of the 96 women and 177 men was 71 ± 12 years. The mean IOP before surgery was 14.18 ± 3.4 mmHg. Mean preoperative ACD was 2.96 mm and postoperative ACD was 4.09 mm. The mean lens thickness was 4.24 mm and axial length was 23 mm. A postoperative reduction of IOP was found as shown in The postoperative reduction in IOP in mmHg and in percentage is shown in Figures P = 0.011). Lens thickness was not significantly related to change in IOP (P: 0.12); however, it was significantly related to change in ACD (P: 0.002). The postoperative IOP was inversely related to preoperative ACD (P: 0.012). Age, sex, axial length were not significantly related to IOP reduction range of P: 0.2–0.5.The reduction of IOP measured after 15 days was 2.1 mmHg, after 1 month 2.26 mmHg, after three months 2.34 mmHg and after six months 2.36 mmHg. Our group had a mean decrease in IOP of 2.25 mmHg (15.77%) compared to preoperative values (Numerous studies have shown that cataract surgery by phacoemulsification with posterior chamber IOL induces a mid-and long-term lowering of IOP.‐10 Altho7IOP reduction has been shown to be more prominent after CCP than after phacoemulsification with sclerocorneal tunnel.14 Howeve20et al reported that the size of the capsulorhexis had an effect on the IOP after phacoemulsification; they showed that a capsulorhexis of 4 mm had a greater IOP lowering effect than a capsulorhexis of 6 mm.[The exact mechanism by which cataract surgery improves IOP is unclear. Many hypotheses have been presented in the literature, namely 1 of 6 mm. In our sStudies on patients with open-angle glaucoma have demonstrated a pressure lowering effect of CCP.1823 In e182In conclusion, cataract surgery by CCP induces reduction of IOP in normal patients. The pathogenic mechanisms are still unclear. CCP can be performed with the intent of achieving better IOP control.

Eight patients with angioimmunoblastic lymphadenopathy have been studied by a variety of immunological and pathological techniques. They exhibited a spectrum of immunological reactivities that, in this small series, could be roughly correlated with survival. Those patients with relative B-cell predominance as shown by cell marker studies, histologically showed large numbers of plasma cells, and this pattern was associated in 3 of our patients with a survival of 3 years or more. T-cell predominance or both B- and T-cell depletion was associated histologically with large numbers of blast cells and eosinophils, but with few plasma cells. These patients responded poorly to therapy and had short survival times. One patient with B-cell predominance subsequently died of a histiocytic lymphoma.

Grid cells in the rat entorhinal cortex display strikingly regular firingresponses to the animal's position in 2-D space and have beenhypothesized to form the neural substrate for dead-reckoning. However, errorsaccumulate rapidly when velocity inputs are integrated in existing models ofgrid cell activity. To produce grid-cell-like responses, these models wouldrequire frequent resets triggered by external sensory cues. Such inadequacies,shared by various models, cast doubt on the dead-reckoning potential of the gridcell system. Here we focus on the question of accurate path integration,specifically in continuous attractor models of grid cell activity. We show, incontrast to previous models, that continuous attractor models can generateregular triangular grid responses, based on inputs that encode only therat's velocity and heading direction. We consider the role of thenetwork boundary in the integration performance of the network and show thatboth periodic and aperiodic networks are capable of accurate path integration,despite important differences in their attractor manifolds. We quantify the rateat which errors in the velocity integration accumulate as a function of networksize and intrinsic noise within the network. With a plausible range ofparameters and the inclusion of spike variability, our model networks canaccurately integrate velocity inputs over a maximum of ∼10–100meters and ∼1–10 minutes. These findings form aproof-of-concept that continuous attractor dynamics may underlie velocityintegration in the dorsolateral medial entorhinal cortex. The simulations alsogenerate pertinent upper bounds on the accuracy of integration that may beachieved by continuous attractor dynamics in the grid cell network. We suggestexperiments to test the continuous attractor model and differentiate it frommodels in which single cells establish their responses independently of eachother. Even in the absence of external sensory cues, foraging rodents maintain anestimate of their position, allowing them to return home in a roughly straightline. This computation is known as dead reckoning or path integration. Adiscovery made three years ago in rats focused attention on the dorsolateralmedial entorhinal cortex (dMEC) as a location in the rat's brain wherethis computation might be performed. In this area, so-called grid cells firewhenever the rat is on any vertex of a triangular grid that tiles the plane.Here we propose a model that could generate grid-cell-like responses in a neuralnetwork. The inputs to the model network convey information about therat's velocity and heading, consistent with known inputs projectinginto the dMEC. The network effectively integrates these inputs to produce aresponse that depends on the rat's absolute position. We show that sucha neural network can integrate position accurately and can reproducegrid-cell-like responses similar to those observed experimentally. We thensuggest a set of experiments that could help identify whether our suggestedmechanism is responsible for the emergence of grid cells and for pathintegration in the rat's brain. Since the discovery of grid cells in the dorsolateral band of the medial entorhinalcortex (dMEC) These ideas differ radically from each other, but they share a common assumptionabout the nature of the input feeding into dMEC, namely, that the input conveysinformation primarily on the rat's velocity and heading. Within all thesemodels, grid cell activity must then arise from precise integration of therat's velocity.Grid cell firing exhibits remarkable accuracy: The periodic spatial tuning patternremains sharp and stable over trajectories lasting 10's of minutes, with anaccumulated length on the order of hundreds of meters in vitro intracellularrecordings in vivo extracellularrecordings How do theoretical models measure up, in estimating position from input velocitycues? The theta-oscillation model of grid cells For continuous attractor models, we previously showed Conceptually, the existence of an integrating apparatus seems pointless if it iscompletely dependent on nearly continuous corrections coming from an external sourcethat specifies absolute position. Thus, it seems reasonable to require thattheoretical models of path integration in dMEC, if using faithful velocity inputs,have the ability to reproduce stable grid cell patterns for trajectories lasting afew minutes.Our aim, therefore, is to establish whether it is possible for model grid cells toaccurately integrate velocity inputs. We restrict our analysis specifically tocontinuous attractor networks. As will become clear, the precision of velocityintegration can strongly depend on various factors including network topology,network size, variability of neural firing, and variability in neural weights. Herewe focus on three of these factors: boundary conditions in the wiring of the network(periodic vs. aperiodic), network size, and stochasticity in neural activityWe quantify path integration accuracy in both periodic and aperiodic recurrentnetwork models of dMEC, and demonstrate that within a biologically plausible rangeof parameters explored, such networks have maximum attainable ranges of accuratepath integration of 1–10 minutes and 10–100 meters. Larger, lessnoisy networks occupy the high end of the range, while smaller and more stochasticnetworks occupy the low end. We end with suggestions for experiments to quantifyintegration accuracy, falsify the continuous attractor hypothesis, and determinewhether the grid cell response is a recurrent network phenomenon or whether itemerges from computations occurring within single cells.In our model, each neuron receives inhibitory input from a surrounding ring of localneurons. The entire network receives broad-field feedforward excitation (To reproduce the regular single-neuron (SN) lattice patterns observed in experiment,the pattern formed in the neural population must be coupled to the rat'svelocity. This coupling is arranged in such a way neuronsarranged in a square sheet. Neurons close to each edge of the sheet formconnections with neurons on the opposite edge, such that the topology of thenetwork is that of a torus. We simulate dynamics in a network of neurons driven by velocity inputs obtainedfrom recordings of a rat's trajectory neurons also performs well enough to produce coherent SN grids over the sametrajectory, A deterministic periodic network of only 40The presence of a clear spatial grid in the SN response to velocity inputs aloneis a good indication of the accuracy of integration. If the rat'sinternal estimate of position were to drift by half a grid period, the neuronwould fire in the middle of two existing vertices rather than on a vertex. Asthe rat traveled over its trajectory, the neuron would fire at various“wrong” locations, with the resulting SN response becomingprogressively blurred until no grid would be discernible. This would happen evenif the population pattern remained perfectly periodic throughout.Therefore, the following properties are equivalent: (1) Coherent grids in the SNresponses, (2) Accurate path integration of the full trajectory over which theSN responses are visualized, with errors smaller than the grid period. Anexample of this equivalence is given in Next, because the population pattern phase accumulates errors whenever thepattern slips relative to rat motion, another equivalent condition for accuratepath integration is (3) Linear relationship between network flow velocity andinput velocity over the input velocity range, independent of direction.These equivalent conditions for accurate integration apply to both periodic andaperiodic network models of grid cells (discussed next).It is unclear whether a torus-like network topology, in which neurons alongopposite edges of the network are connected to form periodic boundaryconditions, exists in the rat's brain. Even if such connectivityexists, it may require, at an earlier stage of development, an initiallyaperiodic network also serve to stabilize the orientationof the population pattern (data not shown), suggesting that the undesirablecoupling of velocity inputs to rotation is also related to the existence ofthe boundaries.2 (∼104) neurons decay as the pattern relaxes to its preferred orientation.Similarly, distorting the pattern by stretching it, adding noise, or by removingblobs from the pattern will generate an unstable state, which will rapidly decayto a steady state within the attractor manifold.aperiodic network, translations of a steady state patternare similar but not exactly equivalent, because the phase of the activitypattern relative to the boundary affects the energy of the state. Strictlyspeaking then, these states do not form a continuous attractor manifold, In the A stable population pattern state can be rotated around the center of a circularaperiodic neural sheet to obtain another stable state that is identical inenergy to the original one. Hence, rotations correspond to a flat direction inthe energy surface, In the network models described here, the structure of the attractor manifolde.g., iscomplSo far we have considered errors in integration that occur in the absence ofnoise. Unlike in the noise-free case, neural noise can induce the populationpattern to flow or rotate even when velocity inputs are absent. To assess hownoise influences the precision of the network's response, we presentresults from spiking neural networks with the same connectivity as in the ratebased models. Dynamics in these networks are noisy due to the stochasticity ofdiscrete spiking events.For the same network parameters as in Integration can be decomposed into two elements: a memory that holds onto thestate of the integrator, and a mechanism that correctly increments the stateof the integrator in response to inputs. The linearity of the velocityresponse of the network, described earlier for noise-free networks, may beviewed as an assessment of the accuracy of the increment mechanism, whilethe degree of drift in the network state in the absence of velocity inputsand external corrective cues is a quantification of the network'sability to hold onto its current state. Therefore, a way to assess theeffect of noise on integration accuracy is to examine the drift in thepopulation state when external velocity inputs are absent.As shown in 4 neurons and CV = 1,roughly in agreement with our observations from Quantitatively, the drift in the phase of the population pattern appearsdiffusive to achieve a similarperformance, even though the two networks showed similar performance in thenoise-free case.Assuming that the translational drift in the aperiodic network is similar tothat measured in the periodic network we conclude that, in the aperiodicnetwork, rotations are the more severe source of noise-driven decoherence ofthe SN response. This conclusion is in agreement with the observation thatthe 128Motivated by the result that sub-Poisson spiking statistics are important foraccurate integration in the grid-cell network, we analyzed spike recordingsfrom neurons in dMEC For various reasons, it is not possible to exactly compare the CV used in oursimulations and the CV of the recorded cells in dMEC. For example, dMECcontains numerous cell types, each of which may have different CVs. Also,the effects of individual neural variability on integration performance areameliorated by averaging over the network population, but the size of theactual dMEC network may not be the same as in our simulations, and theactual network may contain correlations not included in our model, so thateven if we were able to pick the “correct” CV forindividual neurons, the net effect on integration performance may bedifferent in the model from that in dMEC. Finally, the CV is alow-dimensional measure that does not fully characterize the spikingstatistics of a neuron: even if we could match the size of the dMEC networkand the CV of each neuron type, the statistics of our model neurons couldgreatly differ from those in the rat.Despite these caveats, our results suggest that a significant blurring of theSN response is expected to occur on a time scale ranging between a fewminutes to a few tens of minutes, within a reasonable range of estimates forthe number of neurons in the network and the variability of neuralspiking.Armed with the proof-of-concept results that a continuous attractor network modelcan integrate velocity inputs accurately enough to produce SN grids, we nextseek to explore testable predictions of the continuous attractor hypothesis inthe grid cell system and contrast them with the properties of models in whichthe grid responses emerge independently in each cell relationship between cells, defined by whetherneurons are co-active or active at different phases. The stability of theattractor manifold and the instability of states outside it have a number ofimplications for experiment.As described earlier, the low-dimensional structure of the attractor meansthat only a very small subset of possible states of the network, defined bystrict inter-relationships in neural activity (population patterns), arestable, while other states quickly decay away. The quantity conserved acrosspattern translations and therefore across the attractor manifold is thephase Due to the stability of the attractor manifold, phase relationships in theperiodic network should be stable over the time-scale of days (because thepattern does not rotate), regardless of inevitable drifts in the absolutephase of individual neurons. Even in aperiodic networks, we expect phaserelationships to persist over 1–10 minutes, but possibly notlonger due to the possibility of rotations. Under similar conditions inmodels where the grid is generated separately by individual neurons(“independent neuron models”), like temporalinterference models Because the attractor dynamics are restoring, small perturbations of state without a componentalong the attractor manifold should not produce lasting changes in thestates of these neurons or the network. Network interactions should restorethe state to the original state that preceded the perturbation: thus, boththe absolute phases of cells and their phase relationships should beunchanged by the perturbation. This statement also applies to largeperturbations, if they have no appreciable projection along the attractormanifold . By contrast, following small or large perturbations tosubsets of cells in independent neuron models, the absolute activity statesof those cells, as well as their relative phase relationships withunperturbed neurons should change, due to the absence of restoring networkinteractions.Perturbations that have a large component along the attractor manifold shoulddrive a coherent transition to the point on the attractor manifold that isclosest to the perturbed state. Because the new state will be on theattractor manifold, phase relationships between neurons should be unchanged.Head direction cells provide a means to induce such a perturbation:Stimulating a subset of head direction cells should drive a rigid (coherent)and lasting translation of the entire population pattern, producing the sameshift in phase in all cells, regardless of whether or not they receiveddirect head direction input. By contrast, similar inputs provided only tosubsets of cells in independent neuron models should produce changes inphase only in the stimulated cells.The continuous attractor model predicts that all cells in the network musthave identical orientations, and all phases must be equally represented inthe population every cell in the network must display the sameirregularity, up to a global shift in phase. Indeed, our preliminaryanalysis of data from Further, in the continuous attractor model, if any cell's gridresponse contains a reproducible irregularity of any kind , it follows thatIn experiments where a familiar enclosure is resized, the SN response isobserved to rescale along the rescaled dimension of the enclosure, at leasttemporarily To explain why these rescaling experiments are consistent with a continuousattractor model of grid cells, it is important to stress the differencebetween the population-level and the SN responses. The attractor manifoldconsists of the steady states of the population response, which consists oftranslations of a canonical pattern.Thus, stretching and rotation of the population pattern are forbidden(unstable) and cannot be invoked within the continuous attractor models toexplain the experimental observations.The SN response, on the other hand, is not directly subject to constraintsimposed by the attractor manifold on the population pattern, because it is afunction of both the instantaneous population pattern and the velocityresponse of the pattern in time. If the pattern were to flow more slowlyalong one dimension than the other, for equivalent rat speeds, the SNresponse would be a stretched version of the regular underlying populationgrid, with the stretched dimension corresponding to the slow flow dimension.Hence, stretching of the SN response can be explained in the continuousattractor model by an amplitude modulation of head direction inputs tuned tothe relevant head direction, without inflicting such a deformation on thepopulation pattern . If the How can experiments distinguish between these two possibilities? Thecontinuous attractor model predicts that the phase relationships betweenneurons must remain unchanged upon stretching of the SN response . This prIn contrast, if the SN stretching is due to a similar stretching in thepopulation response, there should be little to no change in the amplitude ofvelocity modulation of the cells. In summary, changes in the phaserelationships between cells, or no change in the velocity modulation of thehead direction inputs to dMEC, when the SN responses have been stretched,would be evidence against the attractor model.Similarly, a rotation Lidocaine, or another blocker of spiking activity, applied locally to dMECwithout affecting inputs to dMEC should abolish periodic spatialresponsiveness in the subthreshold activity of grid cells. This is becauseall periodic patterning in the continuous attractor model arises fromrecurrent interactions within dMEC. By contrast, individual-neuron models,where the computation is performed within each neuron, may continue to showspatially periodic responses under such a manipulation.Given that both periodic and aperiodic continuous attractor network models ofdMEC are capable of accurate integration of rat velocity inputs, how mightit be possible to experimentally distinguish between the two possibilities?A periodic network shows no pinning, and rotations of the population responseare forbidden. Thus, phase relationships between neurons should beabsolutely stable over very long times even in the absence of any sensoryinputs. By contrast, aperiodic networks should be pinned for sufficientlylow velocity inputs, and in the absence of external corrective cues, areexpected to rotate on slow timescales (minutes to 10's of minutes).A population-wide rotation will be manifest in altered phase relationshipsbetween single neurons, or it could be probed by looking at differential(relative) rotations in the orientation of quickly estimated SN grids versusthe head direction cell population.Next, in an aperiodic network, neurons at the boundaries must receive fadinginput, meaning that their maximal activity is substantially lower than thatof neurons in the bulk; thus, the distribution of maximal rates across gridcells of the same type in an aperiodic network should be wide. If themaximal firing rate of every cell (of the same type) in the network isroughly the same, it would be inconsistent with an aperiodic network. Theconverse need not be true .We emphasize that the boundaries of the neural population are not related tophysical boundaries in space. Hence the neurons at the boundaries, discussedabove, are not expected to bear a relationship to the recently discoveredcells in dMEC whose receptive field encodes the rat's proximity toboundaries in the environment all SN responses would incidentally be strong evidenceof a continuous attractor network.Finally, if defects exist in the single neuron response, they may helpdistinguish between a periodic and an aperiodic network. By defects, here weonly mean those arising spontaneously from the pattern formation process ina network whose connectivity is itself defect-free. Defects arising fromimperfections in the weights will not flow in response to velocity inputs,and are therefore not expected to produce a systematic defect in the SNresponse. In the aperiodic case, any defect in the SN response must beeliminated if the rat returns to the area where the defect was observedafter first moving in one direction until the defect has flowed off thepopulation pattern. Conversely, if the defect persists upon return to thevicinity of the defect location even after long excursions, the lattice hasperiodic boundaries. The Presence of a stable defect which is present inThe last two predictions can help to distinguish even a well-tuned aperiodicnetwork, which may show relatively little rotation or pinning, from aperiodic network.The three main contributions of this work are:A demonstration through modeling that under reasonable conditions grid cellscan be good velocity integrators, and more specifically, that continuousattractor models are capable of accurate path integration.By ‘good’ integration, we mean that if the model networkis given accurate velocity inputs, it produces an accurate estimate of ratposition over comparable distance and time-scales to those probed inbehavioral assays. Within a plausible range of estimates for network sizeand neural stochasticity, higher accuracy was reached in larger andrelatively noise-free networks, sufficient to reproduce coherent grid cellpatterns in response to the full trajectories from Furnishing good upper bounds on idiothetic path integration accuracy withindMEC.A notable finding is that even noise-free, large networks (periodic andaperiodic) have only finite integration accuracy, and this level of accuracyis only a factor of 10–100 larger than known behavioral abilities.We provide estimates of integration accuracy in the presence of neuralnoise, which are in the range of 1–10 minutes. Integrationperformance in a fixed-size periodic network is not expected to vary greatlywith parameter tuning; aperiodic networks are more sensitive to parametertuning, and we have not optimized all parameters. However, aperiodicnetworks are upper-bounded in their performance by the correspondingperiodic network. Thus, we expect our estimates to serve as reasonable upperbounds on integration accuracy in dMEC, within the continuous-attractorpicture.Providing predictions that can falsify the continuous attractor hypothesisand help distinguish between the possibilities that grid responses aregenerated through continuous attractor networks or through independent cellcomputations.So far, the predictions of continuous attractor models are consistent with the fullcorpus of grid cell data, and explanatory of many results from experiment,suggesting, when combined with conclusion (1), that continuous attractor dynamicsare a viable, relevant mechanism for grid cell activity and path integration.Accurate behavioral dead reckoning is a cascaded result of accurate velocityinput (relative to the rat's motion) and accurate integration of thatinput. Our interest in this work was in assessing how well continuous attractormodels of dMEC can integrate their inputs. Thus, we did not focus on potentialinaccuracies (noise or biases) in the velocity inputs themselves. Even if thenetwork were a perfect integrator, errors in the input would produce anincorrect position estimate. Such errors are likely to play a role in reducingthe behavioral range over which rats display accurate dead-reckoning.A strength of attractor networks is that responses are self-averaging over thefull network: if the velocity inputs are unbiased estimators of rat movements,but are noisy, or if the velocity inputs to the network are not perfectlybalanced in number for all directions, the full network will average all itsinputs, and the net pattern flow will only reflect this average. For accurateposition estimation, however, it is important and therefore likely that inputsto the network are well tuned.Another factor that could degrade integration performance is inhomogeneity orstochasticity in the recurrent network weights. While stochasticity in neuralactivity causes the network state to drift along the attractor manifold,variability in network connectivity modifies the structure of the attractormanifold itself. If recurrent connectivity deviates significantly from thetranslation-invariant form needed to ensure that all translations of the patternare accessible without crossing over energy barriers, the activity pattern canbecome pinned at particular phases Because knowledge about synaptic strengths in the brain is exceedingly limited,it is unclear what level of variability should be expected in dMEC weights, andwhether this amount is sufficient to cause significant pinning. A question fortheory, not addressed in this work, is to estimate the amount of variability inthe network weights that would be sufficient to reduce the accuracy ofintegration below that observed in dead reckoning behavioral experiments. Forexperiments, the difficult challenge is to obtain an estimate of variability indMEC connectivity.3–104 neurons) may be viewed as awasteful proposed use of neurons, but it is broadly consistent with estimatesfor the total number of neurons in the entorhinal cortex The network size estimate in our continuous attractor model: each neuron would simply have spatially restrictedcenter-surround interactions with its neighbors. This has prompted theobservation that such a topographic network could serve as a starting point forthe development of a network with a less topographical layout and periodicboundaries We showed that the population pattern in a deterministic aperiodic network fullyequipped with a translational velocity shift mechanism and driven by purelytranslational velocity inputs, tends to rotate within a few minutes. This is theshort end of the time-scales over which plasticity mechanisms for networkdevelopment would act. If the network is entirely driven by noise and lacks aspecific velocity shift mechanism as in , the proThe problem of pattern rotations over the time scale of learning is pertinent forany effort to produce a periodic network from an initially aperiodic one in theabsence of anchoring sensory inputs and a velocity coupling mechanism.The concept of low-dimensional continuous attractors has influenced ourunderstanding of neural systems and produced successful models of a number ofneural integrators The dynamics of rate-based neurons is specified by:τ = 10 ms. The time-stepfor numerical integration isdt = 0.5 ms.The neural transfer function We assume that neurons are arranged in a 2-d sheet. Neuron The preferred directions are restricted to N,S,E,W for convenience in modeling; inthe rat, these preferences might span the continuum The recurrent weight matrix isThe feedforward input to neuron , e.g., .If The envelope function For the network with periodic boundary conditions, the envelope function is 1everywhere. For the aperiodic network,m-th spike and discarding all the other spikes. Thisprocedure generates a spike train with rate To simulate a Poisson process , ineach time-step Aperiodic network: initially network activity is low; neurons receive externalinput with The network is initialized to the exact same initial template state at thebeginning of each step . Each step consists of a constantvelocity input, with one of four directions . (A) Instantaneous activity within the neural sheet (colorrepresents the firing rate: black corresponds to vanishing rate). (B) Gridcell response: average firing rate of a single neuron (located at theelectrode tip in panel A), as a function of the rat's positionwithin the enclosure. (C) Velocity integration in the network. Top: Actualdistance of the rat from a fixed reference point (black), compared to thenetwork's integrated position estimate, obtained by tracking theflow of the pattern in the population response (blue). The reference pointis at the left-bottom corner of the square in which the circular enclosureis inscribed. Bottom: Accumulated difference between the integrated positionestimate and the actual position.Path integration and generation of grid cells in a small periodic network.Simulation of network response, with velocity inputs corresponding to arat's recorded trajectory in a 2 m circular enclosure (0.73 MB EPS)Click here for additional data file.Figure S2Population pattern in an aperiodic network with a modulation of weights. Thesteady-state pattern in a network where the strengths of the outgoingweights from each neuron are modulated based on the neuron'slocation in the sheet, according to the envelope function of Equation 5. Theexternal input is spatially uniform. All parameters are identical to thesimulation of (1.00 MB EPS)Click here for additional data file.Figure S3Path integration in periodic and aperiodic stochastic spiking networks.Simulation of network response, with velocity inputs corresponding to arat's recorded trajectory in a 2 m circular enclosure (3.43 MB EPS)Click here for additional data file.Figure S4v|<vcutoff = 8cm/s, which are of duration larger thanTv = 4 s. Wefound no blocks where the integrated displacement was more than λ/4cm, meaning that the intervals represented traverses of approximately oneblob diameter or less, with the typical distance being much shorter. Thus,the rat is likely to be either on or off a blob for the entire duration of ablock, and should have a roughly constant underlying firing rate. (2)Identify high-rate blocks where the rate is higher than some upper cutoffthreshold (to locate on-blob episodes), withrISI(t)>rhighfor each time in the block. Only those high-rate blocks of duration longerthan Tr were retained.rISI is the instantaneous firing rate,computed as the reciprocal of the inter-spike interval of adjacent spikes.rhigh = 10Hz was chosen to be large enough to exclude all intervals except those wherethe rat is clearly on a blob for the recorded cell. In all the above, theminimum interval durationTr = 5 s waschosen to eliminate random (non)spike events that momentarily change therate without reflecting an actual change in the underlying firing rate ofthe cell, while capturing as many intervals as possible for ISI analysis. Ineach of methods (1) or (2), we compute μ(ISI) and σ(ISI) foreach block as a single data-point. Next, we bin together data points withthe same rate (in bins of 1 Hz), pooling across all cells . The two methods (1) and (2) are complementary in the sense thatinterval sampling is based in the first case on rat velocity, and in thesecond case by rate-based on-blob or off-blob considerations. Neither methodguarantees that the underlying firing rate within one interval is constant.However, the two methods yield consistent results, and thus add a measure ofconfidence to the analysis.Stochasticity of recorded dMEC neurons. (A) Standard deviation (σ) ofthe inter-spike interval (ISI) distribution plotted against the mean ISI,for various values of the mean ISI. Data points from multiple simultaneouslyrecorded cells (from a single electrode) in dMEC (0.68 MB EPS)Click here for additional data file.Figure S5Deviations from a perfect triangular lattice in existing measurements. (A)Comparison of grid correlation functions from three simultaneously recordedcells, adapted from (0.59 MB EPS)Click here for additional data file.

Previous investigations have shown that, during metazoan radiation, the exon-intron patterns of serpin superfamily in lineages pre- and postdating the split of vertebrates. Multiple intron gains were detected in a group of ray-finned fishes, once the canonical groups of vertebrate serpins had been established. In two genes, co-occurrence of non-standard introns was observed, implying that intron gains in vertebrates may even happen concomitantly or in a rapidly consecutive manner. DNA breakage/repair processes associated with genome compaction are introduced as a novel factor potentially favoring intron gain, since all non-canonical introns were found in a lineage of ray-finned fishes that experienced genomic downsizing.Here we investigated intron dynamics in the serpin genes of a lineage of ray-finned fishes, but not in any other vertebrates, suggesting that insertion rates for introns may be episodically increased. The co-occurrence of non-standard introns within the same gene discloses the possibility that introns may be gained simultaneously. The sequences flanking the intron insertion points correspond to the proto-splice site consensus sequence MAG↑N, previously proposed to serve as intron insertion site. The association of intron gains in the serpin superfamily with a group of fishes that underwent genome compaction may indicate that DNA breakage/repair processes might foster intron birth.Multiple intron acquisitions were identified in Spliceosomal introns are key attributes of most eukaryotic genes. Their origin is still unclear, though descent from group II self-splicing introns seems to be likely ,2. All cvice versa, was proposed to foster functional diversification of serpins [The serpins are a superfamily of proteins that cover a highly divergent spectrum of functions ,13. The serpins ,15.serpin genes are often arranged in tandem arrays and they constitute a substantial fraction of mammalian genomes. During diversification of vertebrates the superfamily has undergone considerable expansion [Serpin genes of basal metazoans, in contrast, are not generally intron-rich, and their exon-intron structures are not conserved along the lineages leading to vertebrates. Sporadic investigations of various species revealed radically different intron patterns in serpin genes, indicating that, during diversification of eumetazoans, massive changes in gene architectures have occurred [serpin genes from various vertebrates and Branchiostoma floridae (B. floridae), representing a group of extant cephalochordates (phylum: Chordata). Experimental approaches disclosed several genes and cDNAs coding for serpins in B. lanceolatum, further superfamily members were detected by mining the genome of the closely related B. floridae [serpin genes (L1–L3) with distinctly different intron patterns were observed . The L2 genes contain introns at positions ~86b, 151c, 223b, 283c and 339c. The L3 genes exhibit common introns at positions 73b, 125b, ~175c and 339c, however, there are also introns that are unique to individual group members . Another intron in Bflor_Spn10 is located outside the conserved serpin scaffold (gene-specific numbering of position: 29a). There are several additional serpin-like sequences in the B. floridae genome, but it is currently not discernible whether they represent intact genes (not shown); however, it is clear that serpin genes from lancelets and vertebrates differ largely with respect to their exon-intron organizations. In fact, just a single intron location (position 339c) is shared. Apparently, major changes affecting the exon-intron patterns of serpin genes have occurred since the cephalochordate/vertebrate split.We first studied floridae . Altogetn genes L–L3 with n genes L–L3 with serpins in vertebrates, we turned to lampreys, a group of basal, jawless fishes. Lampreys, in sharp contrast with lancelets, depict at least four of the six canonical groups of vertebrate serpins. A survey of cDNA and genomic sequences from Lampetra fluviatilis and from Petromyzon marinus revealed representatives of groups V2, V4 and V6 . Members of groups V3 and V5 were not identified.Having established lancelets as appropriate outgroup for evaluating evolution of L. fluviatilis and P. marinus , among other features, definitely reveals this protein as member of the serpin superfamily.Inspection of lamprey serpin sequences disclosed the presence of angiotensinogen and heparin cofactor II (HCII), two prominent members of group V2. All known angiotensinogen proteins depict a conserved decapeptide sequence close to the N-terminus that, after controlled enzymatic cleavage, gives rise to formation of peptides (angiotensin I-IV) involved in blood pressure regulation and other important physiological processes . ClearlyP. marinus (see below). We also recognized a lamprey serpin exhibiting the exon-intron pattern of group V6 . Characteristic features of all HCII sequences are the highly conserved Arg/Lys-rich helix D that is involved in GAG binding and the acidic N-terminal extension that mediates GAG accelerated thrombin inhibition ,26. Thesollagens ,27. A haollagens and its serpin genes, the dynamics of their exon-intron patterns was analyzed. The list of species investigated included: man, chicken , the clawed frog , and several fishes including Danio rerio (D. rerio), Oryzias latipes (O. latipes), Gasterosteus aculeatus (G. aculeatus), Tetraodon nigroviridis (T. nigroviridis), and Takifugu rubripes (T. rubripes). Several serpin genes, though clearly members of one of the six canonical groups, were found to deflect from the standard organizations. Like their counterparts in lampreys, angiotensinogen genes of tetrapods and D. rerio exhibit the canonical gene architecture of group V2, the T. rubripes orthologue, however, contains two extra introns that split the exonic sequences at positions 77c and 233c, respectively . Though also found in O. latipes and G. aculeatus, this intron here is not considered any further, due to its location outside the serpin scaffold. Examination of lamprey HCII also revealed unique introns. The 83c intron (α1-antitrypsin numbering) is embedded in a well-conserved region; its origin, however, is difficult to evaluate. The others (correctly predicted?) map to the N-terminal extension (gene-specific numbering of positions: 38b and 118c).The mammals ,30, chicSpn_94a, with a surplus intron at position 94a . The origin of these genes is unclear; the unique surplus intron suggests that they share a common ancestor , all of which are equipped with the standard set of introns , which probably arose as a consequence of genome duplication events in the stem lineage of ray-finned fishes [Dan_HSP47_1, as indicated by the conserved gene order . In G. aculeatus, a second intact HSP47 homologue, Gast_HSP47_2, was identified. Dan_HSP47_2 and Gast_HSP47_2 are orthologous to each other, since they share a set of flanking markers ; Gast_HSP47_2, in contrast, merely possesses the default introns. These findings suggest that the novel introns, which are restricted to HSP47_1 orthologues, were acquired by group V6 during evolution of ray-finned fishes after divergence of the D. rerio lineage, though an intron loss scenario cannot be excluded. Two intron gains or a single, coupled intron gain event are/is sufficient to explain the exon-intron patterns found in group V6; the intron removal scenario, in contrast, requires multiple intron loss events. If such losses had occurred, they must have affected several taxa, including lampreys, tetrapods and fishes. Moreover, this scenario also demands that the same two introns (positions 36b and 102c) were always deleted in parallel, while all other introns were unaffected. The parallel emergence of introns at positions 77c and 233c in angiotensinogen genes , the only member of group V5, is a potent thrombin inhibitor in the presence of heparin. Among other characteristic features, AT orthologues are easily discernible through a highly conserved sequence centering around helix D . Intron 262c is a standard attribute of group V1 that is believed to share a common ancestor with group V5 [AT genes of tetrapods. We were not able to identify this gene in P. marinus; further tracing of the 262c intron was therefore not possible.In contrast with several intron gains, we detected a single case of probable intron loss during evolution of vertebrate group V5 . We therserpins from groups V3 and V4, deviations from the standard structures were not observed (not shown). All genes from group V3 analyzed featured introns at positions ~86a-90a, 167a, 230a, 290b, 323a, 352a, and 380a. The intron pattern characteristic of group V4 was also conserved.In T. rubripes [Spn_94a orthologues cannot be aligned without introducing gaps , referred to as proto-splice sites [serpins of ray-finned fishes were purchased from the Alfred-Wegener-Institut für Polar- und Meeresforschung, Helgoland, Germany. European river lampreys (L. fluviatilis) were obtained from the Bundesforschungsanstalt für Fischerei, Hamburg, Germany.Adult lancelets (The isolation of poly(A)-RNA and genomic DNA, the synthesis of cDNA, PCR amplification of serpin cDNA fragments using various sets of degenerate primers, and cloning of 5'- and 3'-cDNA ends followed published procedures ,51. DNA serpins from human, chicken [X. tropicalis [ D. rerio [ G. aculeatus [O. latipes [T. rubripes [T. nigroviridis [P. marinus [). Sequences from the B. floridae genome were gathered from the JGI genome browser . EST and cDNA data mining included searches in the NCBI trace archive and in the UCSC genome browser [Genomic data for chicken , X. tropopicalis , D. reriD. rerio , G. aculculeatus , O. lati latipes , T. rubrrubripes and T. noviridis were extoviridis , or in t marinus , from Pr browser , applyin1-antitrypsin as described [i.e. positions 33 to 394 of human α1-antitrypsin) were considered.All intron positions predicted by gene models were examined visually, corrected and amended manually, if necessary. Whenever cDNA or EST sequences were available, intron positions were checked by means of GENEWISE . Proteinescribed . All int)) and with RepBase Censor [Sequences of non-canonical introns were searched for repetitive elements with the RepeatMasker package (version 3.2.6; (ensor using dePhylogenetic analysis was performed using the Neighbor-Joining method conducteHR designed the study, performed part of data analyses, and wrote the paper. AK accomplished data analyses. KK, YW, CB, MAF, NP and OK generated data and contributed to data evaluation.Mapping of intron positions to aligned serpin sequences. Figure depicting intron positions of serpin genes mapped onto the aligned amino acid sequences.Click here for fileserpin genes analyzed in this study and their accession numbersList of . Table listing accession numbers of genes, cDNAs and ESTs investigated in this study.Click here for fileSpn_94a genesChromosomal gene order reveals orthology of . Figure showing chromosomal synteny of Spn_94a genes.Click here for fileserpin genesSequences of non-canonical introns from vertebrate . Figure depicting the sequences of non-standard introns.Click here for file

Both minimally invasive surgery (MIS) and computer-assisted surgery (CAS) for total hip arthroplasty (THA) have gained popularity in recent years. We conducted a qualitative and systematic review to assess the effectiveness of MIS, CAS and computer-assisted MIS for THA.An extensive computerised literature search of PubMed, Medline, Embase and OVIDSP was conducted. Both randomised clinical trials and controlled clinical trials on the effectiveness of MIS, CAS and computer-assisted MIS for THA were included. Methodological quality was independently assessed by two reviewers. Effect estimates were calculated and a best-evidence synthesis was performed.Four high-quality and 14 medium-quality studies with MIS THA as study contrast, and three high-quality and four medium-quality studies with CAS THA as study contrast were included. No studies with computer-assisted MIS for THA as study contrast were identified. Strong evidence was found for a decrease in operative time and intraoperative blood loss for MIS THA, with no difference in complication rates and risk for acetabular outliers. Strong evidence exists that there is no difference in physical functioning, measured either by questionnaires or by gait analysis. Moderate evidence was found for a shorter length of hospital stay after MIS THA. Conflicting evidence was found for a positive effect of MIS THA on pain in the early postoperative period, but that effect diminished after three months postoperatively. Strong evidence was found for an increase in operative time for CAS THA, and limited evidence was found for a decrease in intraoperative blood loss. Furthermore, strong evidence was found for no difference in complication rates, as well as for a significantly lower risk for acetabular outliers.The results indicate that MIS THA is a safe surgical procedure, without increases in operative time, blood loss, operative complication rates and component malposition rates. However, the beneficial effect of MIS THA on functional recovery has to be proven. The results also indicate that CAS THA, though resulting in an increase in operative time, may have a positive effect on operative blood loss and operative complication rates. More importantly, the use of CAS results in better positioning of acetabular component of the prosthesis. Total hip arthroplasty (THA) is considered to be one of the most successful orthopaedic interventions of the past 40 years, with 10-year survival rates exceeding 90% . In receDespite the increase in use of MIS THA, its risks and benefits are still an ongoing debate issue in the orthopaedic society. Proponents of MIS THA claim that it results in less soft-tissue trauma , reduced blood loss and fewer blood transfusion requirements. Postoperative benefits include less pain, shorter hospital stay, quicker return to function and better cosmetic appearance ,5. OpponProper positioning of the hip prosthesis is essential for improving the long-term success of THA. Higher rates of pelvic osteolysis, asymmetric polyethylene wear and component migration have been observed when the acetabular component is malpositioned . LewinneAs a result, the interest in computer navigation systems for orientation of the hip prosthesis is increasing, since it may be the solution for the aforementioned problems related to proper prosthetic positioning. Moreover, CAS is not only aimed at an improved alignment of the hip prosthesis, it also provides instant information and feedback to the surgeon, which may make the surgical technique easier to perform and may result in better clinical outcomes. The imaging systems that are used during CAS can be roughly divided into image-based and imageless systems. Image-based systems require the collection of morphological information by preoperative CT scans or MRI, or by means of intraoperative fluoroscopy. Imageless systems use a virtual anatomical model which is embedded in the software and is supplemented by intraoperative registration data of anatomical landmarks .CAS in THA is not very common nowadays, due to the fact that current CAS systems may involve longer operation times and the introduction of new equipment in the operating room. Other factors that limit the broad application of CAS are costs and complexity of computer navigation systems . SeveralThe use of CAS may be the solution to the limited visibility of anatomical landmarks during MIS THA . Some evFollowing the recommendations of the Cochrane collaborations, an extensive computerised literature search of PubMed, Medline, Embase and OVIDSP was conducted on all studies published between 1995 and May 2009. We used database-appropriate terms, including hip arthroplasty(ies)/replacement(s), minimally invasive/MIS/mini-incision, and/or computer-assisted/navigation/CAS/CAOS. The search strategy was formulated by an experienced medical librarian. To find more studies, the reference lists of all relevant studies were reviewed for potential articles.A study was included in the review if 1) a randomized controlled trial or a clinical controlled trials was conducted; 2) the study was published in English, Dutch or German; 3) the study was a full-length published article or fully-written published report; 4) the study population comprised patients aged 18 years or older who were undergoing a THA; 5) the study group and control group were similar at baseline with respect to age, gender and BMI; 6) the study contrast was minimally invasive total hip arthroplasty, computer-assisted total hip arthroplasty or a combination of both; and 7) at least one of the following outcome measures was assessed: operative outcome including blood loss and operative time; length of hospital stay; adverse events including intraoperative and postoperative complications; radiographic outcomes including number of outliers of acetabular components outside the desired alignment range; and/or one of the Outcome Measures in Rheumatology Clinical Trials (OMERACT) : pain, sThe procedure for inclusion of studies was based on the recommendations described by Van Tulder et al. The studThe methodological quality of all articles was independently assessed by two reviewers (IHFR and BPH) using a criteria list . This liAnalysis of the extracted data from the included articles was conducted in line with guidelines for systematic reviews from the Cochrane Collaboration Back Review Group . For conEfforts to retrieve raw data or means and their standard deviations to compute effect sizes or odds ratios by contacting the authors of articles where these data were not reported, were unsuccessful. We therefore chose to summarise the results by means of a qualitative analysis using a rating system that consists of five levels of scientific evidence, taking into account the methodological quality and the outcome of the original studies (best-evidence synthesis) Table 20]..20].Since the search strategy for MIS, CAS and computer-assisted MIS for THA contained similar components, the results of these search strategies overlapped. After removing double citations, 1841 citations remained. A flow chart of the results of the selection procedure after selection based on title, abstract and full text is shown in Figure Eventually, 25 articles were included. In 18 of these articles the study contrast was minimally invasive THA ,17,22-37None of the included articles had computer-assisted minimally invasive THA as study contrast. The characteristics of the included studies are presented in Additional file The results of the methodological quality assessment of the included articles are presented in Table Operative time was reported in 16 studies with MIS THA as study contrast Table . Two higOperative time was reported in four studies with CAS THA as study contrast Table . Except Intraoperative blood loss was reported in 14 studies with MIS THA as study contrast was reported in 13 studies with MIS THA as study contrast Table . The higAll studies with CAS THA as study contrast reported on the number of acetabular outliers Table . Five stIn order to evaluate physical functioning after THA, several physician-based and self-reported questionnaires are in use. Furthermore, objective assessment of physical function can be done by means of gait analysis. In total, thirteen studies with MIS THA as study contrast reported on physical functioning outcome measures. None of the studies with CAS as study contrast assessed physical functioning of patients after THA.Ten studies with MIS THA as study contrast reported on physician-based physical functioning outcome measures Table . In thesFive studies with MIS THA as study contrast reported on patient-reported physical functioning by means of two disease-specific outcome measures, namely the Western Ontario McMaster University Osteoarthritis Index (WOMAC) ,34,36,37Four studies with MIS THA as study contrast reported gait analysis data to evaluate physical function after THA Table . All fouFive studies with MIS THA as study contrast reported on pain Table . One stuCompared to conventional THA, strong evidence was found for a decrease in operative time and operative blood loss after MIS THA. The evidence for a shorter length of stay was moderate. Strong evidence was also found for no difference in complication rates and position of the acetabular component. Moderate to strong evidence was found for no difference in physical functioning six weeks and six months after surgery. The evidence of a positive effect of MIS THA on physical functioning three months postoperatively was conflicting, as was the evidence for less pain after MIS THA six weeks postoperatively. The evidence for no differences in pain levels three and six months after surgery was strong.Strong evidence was found for a positive effect of CAS THA on the position of the acetabular component. The evidence for a positive effect on operative blood loss was limited. Strong evidence was found for an increase in operative time and for no significant difference in complication rates after CAS THA.We have reviewed the current literature evaluating the effectiveness of MIS, CAS and computer-assisted MIS for THA. The extensive literature search resulted in 18 articles with MIS THA as study contrast, and seven with CAS THA as study contrast, yet no study with computer-assisted MIS for THA as study contrast was discovered. The results of this systematic review indicate that there were no significant differences in operative complications and acetabular component positioning between MIS THA and the conventional procedure. Furthermore, MIS THA resulted in a reduction in blood loss, operative time and reduced length of stay. The added value of MIS THA over the conventional procedure in terms of a faster functional recovery however remains to be proven. Computer-assisted THA results in better positioning of the acetabular component. It may also have a positive effect on operative blood loss and complications despite an increased operative time.Contrary to what proponents of MIS THA stated, this review showed that MIS THA had no effect on physical functioning, as measured by questionnaires as well as gait analysis. Since the main purported benefit of MIS THA is a decrease in the amount of soft-tissue (muscle) damage, it can be postulated that a difference in improvement of physical functioning and pain will only be seen in the early postoperative period. Only eight studies reported data on physical functioning at six weeks postoperatively ,31,34,37The results for CAS THA demonstrate an increase in operative time and limited evidence for a decrease in operative blood loss, but CAS THA had no effect on operative complication rates. Additionally, the use of CAS during THA had a positive effect on the outliers of the acetabular component position outside the desired range. These results justify use of computer navigation during THA. With improved surgery patients should benefit from having lower morbidity rates, better functional outcome and greater longevity of implants . Wines aDespite efforts to get an ample overview of the available literature on MIS and CAS for THA, no articles with computer-assisted MIS for THA as study contrast were discovered. Some of the studies included compared computer-assisted MIS for THA with either MIS THA ,39 or CASome critical remarks can be made on the included studies. First, a wide variety of surgical approaches was used in them. We chose to analyse all surgical approaches together, since the aim of this systematic review was to assess the effectiveness of minimally invasive THA, but not of any specific minimally invasive THA approach. Second, the surgical approaches were too heterogeneous and often poorly described to perform subgroup analyses. Studies on image-based and imageless navigation systems were also analysed together, since research has shown that imageless navigation is as reliable as image-based navigation for positioning the acetabular component . Third, Some limitations of this review and its conclusions need to be addressed. In this systematic review, a highly sensitive comprehensive search was conducted following the recommendations of the Cochrane collaboration in order to identify articles of interest. For practical reasons though, only studies published in English, Dutch or German were included in the final review, which might have led to selection bias. Additionally, in order to get a broad overview of all the literature on MIS, CAS and computer-assisted MIS for THA, we chose to include not only RCTs but also CCTs. Shrier et al. stated tThe results of this systematic review indicate that MIS THA is a safe surgical procedure, without increases in operative time, blood loss, operative complications and component positioning when compared to the conventional procedure. However, the surplus value of MIS THA over the conventional procedure in terms of a faster functional recovery remains to be proven. The results of this review also indicate that computer-assisted THA, despite an increased operative time, may have a positive effect on operative blood loss and complications. More importantly, the use of CAS during THA results in better positioning of the acetabular component of the prosthesis. Since minimally invasive THA and the use of computer navigation are becoming increasingly popular in orthopaedics, combining 'the best of both worlds' would be a sensible next step to take. With respect to future research, well-designed studies on MIS THA, CAS THA and especially computer-assisted MIS THA are needed, in which the used definitions, surgical technique, study population, outcome measures and study end-points are adequately described.The authors declare that they have no competing interests.IHFR co-coordinated the review, contributed to the literature search, and performed the data extraction, statistical analyses and drafting of the manuscript. BPH contributed to the literature search, data extraction and drafting of the manuscript. MS and WZ participated in the study design and have been involved in, together with SKB, JWG, ALB and RW, critically revising the manuscript. All authors read and approved of the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2474/11/92/prepubStudy characteristics. Characteristics of the included studies.Click here for file

During embryonic development, signalling molecules known as morphogens act in a concentration-dependent manner to provide positional information to responding tissues. In the early zebrafish embryo, graded signalling by members of the nodal family induces the formation of mesoderm and endoderm, thereby patterning the embryo into three germ layers. Nodal signalling has also been implicated in the establishment of the dorso-ventral axis of the embryo. Although one can infer the existence of nodal gradients by comparing gene expression patterns in wild-type embryos and embryos in which nodal signalling is diminished or augmented, real understanding can only come from directly observing the gradients. One approach is to determine local ligand concentrations in the embryo, but this is technically challenging, and the presence of inhibitors might cause the effective concentration of a ligand to differ from its actual concentration. We have therefore taken two approaches to visualise a direct response to nodal signalling. In the first, we have used transgenic embryos to study the nuclear accumulation of a Smad2-Venus fusion protein, and in the second we have used bimolecular fluorescence complementation to visualise the formation of a complex between Smad2 and Smad4. This has allowed us to visualise, in living embryos, the formation of a graded distribution of nodal signalling activity. We have quantified the formation of the gradient in time and space, and our results not only confirm that nodal signalling patterns the embryo into three germ layers, but also shed light on its role in patterning the dorso-ventral axis and highlight unexpected complexities of mesodermal patterning. One of the earliest events in vertebrate embryonic development is the patterning of the embryo into three germ layers: the ectoderm, mesoderm, and endoderm. Morphogens are signalling molecules that act in a concentration-dependent manner to induce the formation of different cell types. Members of the nodal family are thought to form a morphogen gradient in the developing zebrafish embryo and to be essential for pattern formation. Mesoderm and endoderm are believed to develop due to high levels of nodal signalling, while cells experiencing the lowest concentrations of nodal signalling become ectoderm. Although this idea is widely accepted, the formation of a nodal morphogen gradient has never been observed directly, and we have therefore used two different approaches to visualise the intensity of nodal signalling within individual cells. Our approaches have allowed us to visualise a gradient of nodal signalling activity in the developing zebrafish embryo. Quantification of the levels of nodal signalling experienced by individual cells confirms that nodal signalling patterns the animal-vegetal axis of the zebrafish embryo and, in contrast to previous studies, also suggests that it plays a role in patterning the dorso-ventral axis of the zebrafish embryo. Gradients of nodal signalling in developing zebrafish embryos are visualized using a novel biofluorescence complementation reporter and quantified, demonstrating a role for nodal signalling in dorso-ventral patterning in addition to specifying the animal-vegetal axis. One exathe tail . Similarst lefty ,5.sqt and cyc in the zebrafish animal pole indicate that cyc acts only over short distances, whereas sqt functions as a morphogen and exerts its effects over long distances to induce target gene expression [goosecoid (gsc) expression, whereas lower levels activate no-tail (ntl). Thus, gsc is expressed in cells near a source of sqt, and ntl is expressed in cells further away.Misexpression of pression . High lentl is essential for patterning of the zebrafish embryo, because homozygous mutations in ntl disrupt mesoderm and notochord formation [Xenopus embryos lacking Brachyury (Xbra) [Xbra in isolated animal regions converts ectodermal cells into a mesodermal fate [ntl expression fails to initiate in embryos with diminished nodal signalling [The correct regulation of ormation . The samy (Xbra) , and ectmal fate . Consistgnalling –5.Xenopus embryo [Xenopus prevented a proper study of endogenous signalling events [Together, these experiments suggest that nodal family members form a gradient that induces target gene expression and specifies mesoderm and endoderm. Activation of the nodal signalling pathway within a cell results in the phosphorylation of Smad2, which then interacts with Smad4 . The ress embryo . Yolk aug events , but in gsc are only expressed in dorsal marginal cells. Our data also highlight the complexities of ntl regulation and of the formation of the border between dorsal mesendoderm and the neural plate.Our data allow us to follow in space and time the formation of a gradient of nodal signalling activity within the developing zebrafish embryo. The results illustrate the dynamics of gradient formation, and in contrast to previous studies , clearlyIn a preliminary attempt to investigate nodal signalling levels during zebrafish development, we generated transgenic embryos that express a Smad2-Venus fusion protein under the control of a ubiquitous promoter. During zebrafish development, marginal cells are thought to receive the highest levels of endogenous nodal signalling while cells at the animal pole experience low levels, if any . As predntl expression was unaffected in 90% of cases (n = 124), and in the remaining embryos, expression was normal in the marginal zone with weak ectopic expression in animal pole cells (unpublished data). These experiments demonstrate that our Smad BiFC constructs are suitable reagents for the analysis of endogenous nodal signalling.In an effort to improve the signal-to-noise ratio in such experiments, we turned to BiFC. When zebrafish embryos were injected with the N- and C- terminal halves of a modified form of the fXenopus embryo [Consistent with the experiments described above, we observed no nuclear BiFC fluorescence in animal pole cells of embryos injected with VNSmad2 and VCSmad4 D. As in s embryo , howevers embryo , strong s embryo . DeletioTogether, these experiments demonstrate that our Smad2-Venus transgenic embryos and Smad BiFC constructs report the activation of the TGF-β signal transduction pathway in the zebrafish embryo.ntl and experience endogenous nodal signalling [n = 25) .We first investigated endogenous nodal signalling in zebrafish embryos at 5–6 hours post fertilisation (hpf), when they express gnalling . Observagnalling D, or in Smad2-Venus transgenic embryos do not exhibit detectable nuclear fluorescence in the yolk syncytial layer (YSL) of the embryo A, and noWe went on to investigate the spatial and temporal patterns of Nodal signalling by allowing embryos to continue development after imaging and then noting the positions of the imaged cells relative to the shield. This analysis exploited the superior signal-to-noise ratio of the Smad2/4 BiFC technique see and 2. Intl and then studied the expression of gsc. Injected embryos became elongated were imaged. Following imaging embryos were incubated at 28 °C until 6–7 hpf. The agarose dish was then placed in hot water to melt the agarose, the embryos were removed from the agarose using forceps, and the positions of the imaged cells in relation to the shield was noted. Individual Z sections were used for the quantification of animal pole cells. Fluorescence intensity was quantified using Volocity software (Improvision). Individual nuclei were identified using a protocol to mark objects with intensities between 10 and 100% in the CFP (histone) channel. Quantifications were analysed using Microsoft Excel. For each image, the nuclei of the YSL were identified and the average distance and intensity of these nuclei was subtracted from all nuclei in that image. Video S1(23.19 MB AVI)Click here for additional data file.Video S2(40.67 MB AVI)Click here for additional data file.

Over the past 30 years, benzimidazoles have increasingly been used to treat cystic echinococcosis (CE). The efficacy of benzimidazoles, however, remains unclear. We systematically searched MEDLINE, EMBASE, SIGLE, and CCTR to identify studies on benzimidazole treatment outcome. A large heterogeneity of methods in 23 reports precluded a meta-analysis of published results. Specialist centres were contacted to provide individual patient data. We conducted survival analyses for cyst response defined as inactive or as disappeared. We collected data from 711 treated patients with 1,308 cysts from six centres (five countries). Analysis was restricted to 1,159 liver and peritoneal cysts. Overall, 1–2 y after initiation of benzimidazole treatment 50%–75% of active C1 cysts were classified as inactive/disappeared compared to 30%–55% of CE2 and CE3 cysts. Further in analyzing the rate of inactivation/disappearance with regard to cyst size, 50%–60% of cysts <6 cm responded to treatment after 1–2 y compared to 25%–50% of cysts >6 cm. However, 25% of cysts reverted to active status within 1.5 to 2 y after having initially responded and multiple relapses were observed; after the second and third treatment 60% of cysts relapsed within 2 y. We estimated that 2 y after treatment initiation 40% of cysts are still active or become active again. The overall efficacy of benzimidazoles has been overstated in the past. There is an urgent need for a pragmatic randomised controlled trial that compares standardized benzimidazole therapy on responsive cyst stages with the other treatment modalities. Cystic echinococcosis (CE) is a parasitic infection of worldwide occurrence transmitted to humans by dogs. After infection cysts develop, mainly in the liver and lung. Ultrasound-based staging of cysts into active, transitional, and inactive has opened new venues for treatment and follow-up. Currently four treatment modalities are in use: (1) surgery, (2) percutaneous sterilization techniques, (3) chemotherapy with benzimidazoles, and (4) watch and wait for inactive cysts. However, evidence is insufficient for these four modalities, and determining individual treatment options for patients remains controversial. Medical treatment with benzimidazoles started in the 1970s. Important questions remain unanswered, however, such as efficacy stratified by cyst type and the duration of treatment. We therefore initiated EchinoMEDREV, a collaborative effort to collect individual patient data from patients treated with benzimidazoles and to analyze cyst outcome after initiation of benzimidazole therapy using a common analytical strategy across treatment centres. We found that the efficacy of benzimidazoles has been overstated in the past. Additionally, natural cyst decay has not been taken into account. Evidence from randomized controlled trials is urgently needed to determine the true efficacy of benzimidazoles. Our analysis will help to design benzimidazole trial arms on the basis of the currently available best evidence. Cystic echinococcosis is a parasitic disease of worldwide prevalence. Hydatid cysts occur mainly in the liver (70%) and the lung (20%). Clinical symptoms and signs depend on their localisation, size, and number. Currently four treatment modalities are in use: (1) surgery, (2) PAIR , (3) chemotherapy with albendazole (ABZ) or mebendazole (MBZ), and (4) watch and wait for inactive, clinically silent cysts. The evidence supporting any of the four treatment modalities, from carefully designed clinical studies, is insufficient, and choosing treatment options for patients remains controversial The use of benzimidazoles in CE treatment started in the 1970s with MBZ. In the early 1980s ABZ was introduced and since then has largely replaced mebendazole. The main advantages of ABZ are claimed to be a lower dosage and better intestinal absorption. In treatment centres MBZ and ABZ are given at the World Health Organisation (WHO) recommended dosages of Chemotherapy for the treatment of CE was initially recommended for inoperable patients and patients with multiple organ disease After more than 30 y of benzimidazole use, the following crucial question remains unanswered: what is the efficacy of benzimidazoles stratified by type and size of cysts, daily dose, and duration of treatment?This project started with a systematic review of the published literature on the efficacy of treating CE with benzimidazoles. We had to conclude, however, that we could not obtain a clear picture of the long-term outcome of benzimidazole treatment because inclusion criteria, treatment, outcome measures, and follow-up of published studies varied widely with substantial overlap of cohorts The main objectives of this collaborative study were to describe cyst outcome after initiation of benzimidazole treatment, with outcome defined by cyst stage determined by ultrasound following the WHO classification of 2001 A systematic search of MEDLINE, EMBASE, CCTR, and SIGLE was carried out from their inception until week 4 of 2004. The search was performed by a research librarian using the following search terms: echinococcosis, albendazole, mebendazole, hydatid disease, cystic echinococcosis. We also searched reference lists and asked researchers in the field for additional studies. No language restriction was used. Abstracts were screened for suitability by MS. The eligibility of studies was assessed independently by two investigators (TJ and MS). We included all types of study design with a minimum of 30 patients treated either with ABZ or MBZ. Studies in which drug treatment was an adjunct to surgery, PAIR, or a second drug were excluded.The studies identified in the literature search revealed that there were large differences in baseline assessment of cyst stages, interventions (dose and duration of chemotherapy), length of follow-up, and outcome measures between published trials. These differences precluded the possibility to perform a meta-analysis of published results. Therefore we decided to collect individual patient data from the identified centres and initiated the EchinoMEDREV project.Study centres that had conducted clinical studies on benzimidazole treatment of CE were contacted and asked to contribute published and unpublished individual patient data of benzimidazole-treated CE patients. Data extraction forms were developed, piloted, and revised. Data collection started in June 2005 and ended in December 2007. Data were extracted from patient charts at the individual treatment centres. Data collected were: demographic data ; treatment data ; imaging data . The forms were sent to the coordinating centre at the University Hospital in Heidelberg where data were electronically entered into a database with EpiData, using data entry checks. Accuracy in data entry was checked by double entry verification. A final dataset was created after correcting detected data entry errors and exported to Stata for statistical analysis. Patients with single or multiple hydatid cysts were eligible. Cyst stage had to be recorded at the beginning and at least once after completion of the initial treatment episode. The minimum follow-up period was 1 y after completion of initial treatment. Cyst activity had to be assessed by ultrasonography and classified according to WHO , Gharbi, Perdomo, or Caremani .The analysis presented here includes only liver and peritoneal cysts , which were assessed by ultrasonography, and excluded lung cysts as they are not usually assessed by ultrasonography.The cyst was used as the unit of analysis for a description of achieved outcomes, and the presence of multiple cysts was not taken into account. Data were analysed by intention-to-continue-treatment, ignoring treatment changes (MBZ/ABZ), interruptions, and subsequent treatment episodes.We analysed several endpoints. First, initial treatment success for a cyst was defined as transformation from an initially active or transitional stage to an inactive stage or disappearance of the cyst ; 25th percentile, lambda = p25/ln(1/0.75). We further assumed that the duration of the next phase is independent of the duration of the previous phase. For each simulated cyst we assessed the current stage at year 1 to year 5 after treatment initiation. All analyses were performed using Stata Version 10 (StataCorp).Out of 353 citations identified, 23 papers met the inclusion criteria . Three pAll 14 specialist centres identified were contacted: no reply was received from four centres The analysis presented here was restricted to patients with liver and peritoneal cysts, because of the reliability of ultrasound classification compared to other cyst locations. This restriction resulted in 1,159 cysts in 612 patients for analysis. Approximately 68% of data was obtained from one centre .p = 0.043), but not up to year one (p = 0.43), and a centre effect was noted from year one onwards .p = 0.006) and a strong centre effect was noted (p<0.0001).We further analysed the rate of inactivation/disappearance with regard to cyst size . OverallOverall, cysts that reached an inactive stage for the first time relapsed (returned into an A or T stage) in around 25% of cases 2 y after inactivation . Cysts tIn the simulation of hypothetical cysts, we estimated that 1 and 2 y after treatment initiation, 60% and 40% of cysts are still active or become active again.In a collaborative effort, individual data from patients with CE were pooled from six centres in five countries and outcomes of liver and peritoneal cysts treated with benzimidazoles were described. We found a strong association between cyst activity and response to treatment, with a better response in highly active CE1 cysts, and an association in treatment response depending on the size of the cyst at the beginning of treatment, with cysts <6 cm in diameter responding better. Thus, our data suggest that small highly active cysts show the best initial treatment response. Overall 25% of cysts reverted to active status within 1.5 to 2 y after having initially responded, and multiple relapses were observed. We estimated that 2 y after treatment initiation 40% of cysts are still active or become active again. Our results are biologically plausible because early in the disease host response resulting in an increasing thickness of the pericyst and consolidation of cyst content has not yet reached a degree that prevents the drug to reach its target There are several limitations to this study. The published data collected from participating specialist centres are from case series. Despite these limitations, to our knowledge, this study represents the largest CE dataset ever collected and analyzed in a uniform approach; further it is likely the only dataset obtained from the main international specialist groups. The recommendations on benzimidazole treatment of CE are currently based on the published results from these centres. Through the collection of individual patient data and the pooled analysis of these data we have managed to overcome some of the existing limitations present in the published literature.Does our study provide sufficient evidence to influence decisions for the treatment of CE? We think that our results are strong enough to cast doubts on overoptimistic expectations of the overall efficacy of benzimidazoles. When looking into substrata of the cyst population small CE1 cysts (diameter <6 cm) are a promising target for benzimidazole therapy, whereas stage CE2 and CE3 cysts respond poorly. The available evidence from this and other studies does not yet allow us, however, to formulate solid evidence-based drug treatment recommendations across all cyst stages, sizes, and locations. Our results highlight the urgent need to compare in a pragmatic randomised controlled trial the effect of standardized benzimidazole dose regimens on the individual active cyst stages substratified by cyst size. Such a trial would investigate as a primary outcome the proportion of cysts that become inactive (cyst stages CE4 and CE5) after treatment, and as a secondary outcome the yearly relapse rates up to 5 y after completion of treatment. The clarification of the efficacy of benzimidazoles in CE treatment is of paramount importance since benzimidazoles are the only drugs currently available to treat this neglected disease. Surgery as an alternative to benzimidazoles carries a significantly higher risk of adverse events, in particular intra- and postoperative morbidity and mortality and disseminated disease due to intraoperative spillage of viable hydatid material. Percutaneous fine needle techniques such as PAIR are only applicable to cyst stages CE1 and possibly CE3a, but not to CE2 and CE3b, which makes it necessary to explore large bore catheter techniques if albendazole turns out to be less effective in these cyst stages as suggested by our analysis.Checklist S1QUOROM checklist.(0.17 MB PDF)Click here for additional data file.

The formation of metastasis is the most common cause of death in patients with lung cancer. A major implement to understand the molecular mechanisms involved in lung cancer metastasis has been the lack of suitable models to address it. In this study, we aimed at establishing a highly metastatic model of human lung cancer and characterizing its metastatic properties and underlying mechanisms.in vivo selection in NOD/SCID mice. After three rounds of selection, a new SPC-A-1sci cell line was established from pulmonary metastatic lesions. Subsequently, the metastatic properties of this cell line were analyzed, including optical imaging of in vivo metastasis, immunofluorescence and immunohistochemical analysis of several epithelial mesenchymal transition (EMT) makers and trans-well migration and invasion assays. Finally, the functional roles of fibronectin in the invasive and metastatic potentials of SPC-A-1sci cells were determined by shRNA analysis.The human lung adeno-carcinoma SPC-A-1 cell line was used as parental cells for developing of highly metastatic cells by in vitro, including increased potentials for cell spreading, migration and invasion. Importantly, fibronectin, a mesenchymal maker of EMT, was found to be highly expressed in SPC-A-1sci cells and down-regulation of it can decrease the in vitro and in vivo metastatic abilities of this cell line.A spontaneously pulmonary metastatic model of human lung adeno-carcinoma was established in NOD/SCID mice, from which a new lung cancer cell line, designated SPC-A-1sci, was isolated. Initially, the highly metastatic behavior of this cell line was validated by optical imaging in mice models. Further analyses showed that this cell line exhibit phenotypic and molecular alterations consistent with EMT. Compared with its parent cell line SPC-A-1, SPC-A-1sci was more aggressive s.c. mouse model can further be used to identify underlying mechanisms of lung cancer metastasis.We have successfully established a new human lung cancer cell line with highly metastatic potentials, which is subject to EMT and possibly mediated by increased fibronectin expression. This cell line and its reproducible According to the World Health Organization, lung cancer is responsible for more than 1.3 billion deaths worldwide annually. Despite advances in the treatment of primary tumours, recurrence and metastasis are the most common cause of death in patients with lung cancer. The current poor understanding of the molecular mechanisms involved in lung cancer metastasis is due, in large part, to the lack of suitable models for its study . AlthougEMT, a process whereby cells acquire molecular alterations that facilitate cell motility and invasion, has been shown to play an important role in tumour metastasis . More reIn the present report, we successfully develop a spontaneously metastatic model of human lung cancer that represents the full spectrum of metastasis, from which a highly metastatic human lung cancer cell line, termed SPC-A-1sci, was derived. This cell line exhibits typical changes in cellular phenotype similar to EMT. Moreover, fibronectin plays an important role in these alterations, and thus resulting in the highly metastatic potentials of this cell line.2 atmosphere in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% fetal bovine serum , 100 U/ml penicillin, and 100 μg/ml streptomycin. Cells were regularly certified as free of Mycoplasma contamination.The human lung adeno-carcinoma cell line SPC-A-1 was obtained from Cellular Institute of Chinese Academy of Science . This cell line was originally isolated from the surgical specimens of a Chinese man with advanced lung adeno-carcinoma by Shanghai Chest Hospital and Cellular Institute of Chinese Academy of Science in 1980. The cel6 of the SPC-A-1 cells were injected subcutaneously (s.c) into NOD/SCID mice. When the subcutaneous tumour developed, small pieces of tumour tissue were implanted into the s.c. sites of mice in the first generation of mouse models and the primary tumours were excised 4 weeks later. Those mice were sacrificed under deep anesthesia when they showed signs of distress, and visual lung metastases were isolated and s.c. implanted into the new recipient mice in the second generation of mouse models for in vivo selection. These procedures were repeated for three rounds. At the end of the selection, the lungs harboring massive metastatic lesions were isolated and s.c. implanted into new recipient mice, after which the primary tumour was removed to initiate in vitro primary culture.Five- to 6-week-old male congenitally immune-deficient nonobese diabetic/severe combined immune-deficient (NOD/SCID) mice were maintained under specific pathogen-free (SPF) conditions. Mice were manipulated and housed according to protocols approved by the Shanghai Medical Experimental Animal Care Commission. To isolate a highly metastatic cell line, briefly, 2.0 × 10s.c. injection of minced tumour tissue suspended in PBS using a 1 cc tuberculin syringe and an 18-gauge needle.Subcutaneous tumour implantation was performed as described . In brievia s.c. injection, cells (2 × 106 per mouse) were injected subcutaneously into the right upper flank region of NOD/SCID mice. Mice were monitored weekly for tumour size and evidence of morbidity related to the primary tumour or metastases. Tumour size was quantified in two dimensions using calipers. Tumour volume was calculated as follows: tumour volume (mm3) = L × W × W/2, where L represents length and W represents width. Nine weeks later, all mice were sacrificed, and the organs, including lungs and livers, were removed and processed for standard histological studies. For histological analysis, the primary tumours and mouse organs were harvested at necropsy and fixed in 10% formalin. The fixed samples were then embedded in paraffin, and three non-sequential serial sections were obtained per animal. The sections were stained with H&E and analyzed for the presence of metastases.For primary tumour growth assays and spontaneous metastasis BamHI/XhoI sites of a pWPXL vector (Addgene). Transductions of SPC-A-1sci and SPC-A-1 cells were performed with the aforementioned lentiviral vector according to instructions supplied by Addgene http://www.addgene.org and stable transfectants were further isolated by cell sorting on the basis of their EGFP expression.The GFP-Luc lentiviral vector encoding a fusion gene of GFP and luciferase was generated by inserting the GFP-Luc gene from the plasmid eGFP-2A-CBGr99 (kindly provided by Professor Hammerling) into the MluI/ClaI sites of a pLVTHM vector (Addgene) with the following oligonucleotides respectively: 5'-CGCGTCGGCCCGGTTGTTATGACAATTTttcaagagaAAATTGTCATAACAACCGGGCTTTTTTGGAAT-3'and 5'-CGATTCCAAAAAAGCCCGGTTGTTATGACA ATTTtctcttgaaAAATTGTCATAACAACCGGGCCGA-3' for Fibronectin, and 5'-CGCGTCGTAGCGACTAAACACATCAATTttcaagagaAATTGATGTGTTTAGTCGCTATTTTTTGGAAT-3' and 5'-CGATTCCAAAAAATAGCGACTAAACACAT CAATTtctcttgaaAATTGATGTGTTTAGTCGCTACGA-3' for the negative control. Lenti-virus generation and infection of SPC-A-1sci cells were performed as described above. For experimental metastasis in vivo, SPC-A-1sci cells (2 × 106 per mouse) stably expressing shRNA against fibronectin or negative control were injected into the tail vein of NOD/SCID mice (n = 8). Four weeks later, the mice were sacrificed and the lungs were removed and processed for histological examination.The lenti-virus shRNA vector was constructed as described previously . Brieflyin vivo bioluminescence imaging (in vivo BLI), the animals were injected i.p. with 150 mg luciferin per kg of body weight, anesthetized with pentobarbital (10 mg/ml) in sterile water, and then placed in the NightOwl LB 983 Molecular Light Imager. For ex vivo biofluorescence imaging (ex vivo BFI), mice lungs were excised after in vivo BLI and placed in the chamber of the NightOwl LB 983 Molecular Light Imager and imaged.We used a Berthold LB983 NightOwl System to monitor the primary tumour growth and distant metastasis of SPC-A-1sci and SPC-A-1 cells in mouse models as previously described ,18. For The experiments were performed as described previously . For indFor immunohistochemical analysis, all tissue samples were fixed in phosphate-buffered neutral formalin, embedded in paraffin, and cut into 5-μm-thick serial sections. Immunohistochemical staining with antibodies to E-cadherin , Vimentin was performed according to standard procedures. Results were observed and photographed with an Axioskop 2 microscope and DP70 Imaging system .2 for three weeks. The colonies formed were photographed with an Axioskop 2 microscope and DP70 Imaging system . Pictures of three random fields in each well were obtained from three replicate, and the number of colonies was counted.Colony formation in soft agar was assayed as described previously . BrieflyThe experiment was performed as described previously with little modification . Cells wCell migration and invasion assays were performed using 6.5-mm trans-well chambers as described previously with some modifications . Cells w5) were applied to wells for various time points. After each time point, the wells were washed twice with PBS, and then the adherent cells were visualized and photographed with a CKX41 microscope at 200 × magnification and DP20 Imaging system .The experiments were performed as previously described with somTotal RNA of cultured SPC-A-1sci and SPC-A-1 cells were isolated using Trizol reagents (Invitrogen) according to the manufacturer's instructions. First-strand cDNA synthesis and amplification were performed using Reverse Transcription Reagents (Takara) following the manufacturer's instructions. Real-time PCR was carried out using a 7300 Real-Time PCR System with SDS RQ Study software (Applied Biosystems) according to the manufacturer's instructions. cDNA templates were combined with SYBR Green premix with Rox (Takara) to perform quantitative-PCR reactions. Primers used for quantitative-PCR were as follows: E-cadherin forward: 5'-TGGCTTCCCTCTTTCATC-3'; E-cadherin reverse: 5'-GTTCCGCTCTGTCTTTGG-3'; Fibronectin forward: 5'-GGAGTTTCCTGAGGGTTT-3'; Fibronectin reverse: 5'-GCAGAAGTGTTTGGGTGA-3'; Vimentin forward: 5'-CTGAACCTGAGGGAAACTAA-3'; Vimentin reverse:5'-AGAAAGGCACTTGAAAGCT-3'; β-actin forward: 5'-AGTGTGACGTGGACATCCGCAAAG-3'; β-actin reverse: 5'-ATCCACATCTGCTGGAAGGTGGAC-3'. Gene expression was normalized to β-actin. All reactions were run in triplicate.Cells were lysed and proteins were detected as described previously . Immunobt-test. P < 0.05 was accepted as statistically significant.Data are presented as the means ± SD and were evaluated with Student's in vivo selection, we removed the s.c. primary tumour from tumour-bearing mice to allow sufficient time for distant micrometastases to grow into macrometastases in the first generation of mouse models. Through three rounds of in vivo serial selection, the incidence of lung metastasis reached 100% in the fourth generation of the mouse model using the poorly metastatic human cell line SPC-A-1 as a starting point Fig. . The metel Table and s.c.in vivo behaviors of this cell line, we engineered SPC-A-1sci and its parent SPC-A-1 cells with dual reporters of GFP and Luciferase and monitored them in NOD/SCID mice by optical imaging techniques. As shown in Fig. in vivo bioluminescence imaging weekly, but also observe the pulmonary metastases by ex vivo fluorescence imaging in one sacrificed animal at week 7 and week 8. Subsequently, numerous metastases could be detected at week 9 in all remaining mice of this group when they displayed signs of being moribund. This was significant compared with the SPC-A-1 group, in which no fluorescence signals of pulmonary metastasis could be monitored at the same end-point when they still displayed an active status (data not shown). Briefly, we successfully developed a highly metastatic cell line from a poorly metastatic lung cancer SPC-A-1 cell line. Whereas the parental line SPC-A-1 required 14 weeks (post-primary tumour resection) for the formation of visible metastatic nodules in lungs, the SPC-A-1sci required only 7 weeks for the formation of large macroscopic nodules in the lungs.To further characterize The generation of motile, invasive carcinoma cells was recently found to share some of the key morphologic and molecular characteristics of EMT . As shows.c. primary tumours of SPC-A-1sci cells also confirmed the remarkably reduced expression of E-cadherin (Fig. This morphological change is one of the hallmarks of EMT. To determine whether the molecular alterations of EMT occurred in these cells, we examined the localization of several adherent junction proteins, such as E-cadherin and ZO-1, by confocal immunofluorescence staining. The results showed that the two proteins almost disappear from the cell membrane in the SPC-A-1sci cells but show strong membrane staining in their parent SPC-A-1 cells Fig. . Howeverrin Fig. . In contrin Fig. .EMT could be a reversible, dynamic process and may be regulated by the tumour microenvironment, carcinoma cells that have undergone EMT during invasion seem to regain their epithelial characteristics at the metastatic sites . As showCell proliferation and colonization are among the necessary functions required for metastatic progression of tumour cells. However, the SPC-A-1sci cells are not more aggressive than the parental population in the proliferation in culture and formation of subcutaneous tumours Fig. . This suin vivo.We next took steps to characterize other cellular properties that might be relevant to metastasis. First, we employed wound healing assays to determine migratory abilities of SPC-A-1sci and SPC-A-1 cells on fibronectin coated or uncoated plates. As shown in Fig. in vivo metastasis assays demonstrated the similar results. As shown in Fig. As described above, fibronectin could promote the spreading of the parent SPC-A-1 cells. We therefore examined the spreading ability of SPC-A-1sci and SPC-A-1 cells after plating on fibronectin coated or uncoated plates and found that SPC-A-1sci cells spread significantly faster than SPC-A-1 cells did on both conditions Fig. . Importavia direct injection of cancer cells into the circulation of mice, which puts the focus on end-stage metastatic cells. These models are thus likely to miss the essential genes and pathways required for the early steps of metastasis, including EMT, migration, invasion, and intravasion. It is therefore necessary to develop spontaneous metastatic models that faithfully mimic the selection and evolution of metastasis in human tumours.Metastasis, the foremost cause of mortality in cancer patients, accounts for more than 90% of all deaths in solid tumour diseases, but the underlying mechanisms remain elusive. Recently, a combination of tumour model systems and microarray profiling technologies has been proved to be effective in identifying relevant genes and pathways for tumour metastasis ,25. Howes.c. tumour implantation has been widely used for the majority of human tumour models [s.c. transplantation models [in vivo selection combined with resection of primary tumours in mice.Human tumours rarely metastasize from a primary tumour site in immune-deficient mice when they are transplanted into an ectopic site for the particular type of tumour being analyzed. Orthotopic implantation has been proved to be a better approach for the development of metastasis models. Unlike r models ,28, and n models ,29. It in models ,31. Recen models . In thisin vitro. The potentials of cell motility, migration and invasion are greatly increased in SPC-A-1sci cells. These results suggested that SPC-A-1sci cells acquire the increased abilities to migrate and invade, which further demonstrated that SPC-A-1sci cells have undergone EMT.Growing evidence suggests that EMT has an important role in tumour metastasis ,25. The in vitro and in vivo metastatic abilities of those cells. Furthermore, fibronectin is also a mesenchymal maker, whose expression positively correlates with EMT [The complex interactions between tumour cells and extracellular matrix play important roles in mediating and regulating many processes during tumour metastasis, including cell migration, cytoskeleton reorganization and morphologic transition ,40. Fibrwith EMT . But thes.c. mouse model and isolated a highly metastatic human lung adeno-carcinoma cell line by in vivo selection in NOD/SCID mice. The new cell line, SPC-A-1sci, possessed highly metastatic potentials and undergone an EMT program, which may be associated with increased expression of fibronectin. To the best of our knowledge, it is the first in the literature that reports the presence of EMT in lung cancer and the functional roles of fibronectin in lung cancer cell invasion and metastasis based on an in vivo tumour metastasis model. This model may provide a platform to identify elements that are important in the process of metastasis and to learn how they contribute functionally to the biology of lung cancer metastasis.In summary, we have successfully established a reproducible The authors declare that they have no competing interests.DJ performed major experimental work, and drafted the manuscript. MY, LL, HK carried out the experiments in mice. MW participated in the Trans-well migration and invasion assays. XF performed FACS analysis. LL performed lentiviral transduction of tumour cells. XH helped to draft the manuscript. JL performed the immnuohistochemical experiment and helped to draft the manuscript. MY participated in the design of the study, supervised the laboratory work. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/10/364/prepub

Reserves are the principal means to conserve forests and biodiversity, but the question of whether reserves work is still debated. In the Amazon, fires are closely linked to deforestation, and thus can be used as a proxy for reserve effectiveness in protecting forest cover. We ask whether reserves in the Brazilian Amazon provide effective protection against deforestation and consequently fires, whether that protection is because of their location or their legal status, and whether some reserve types are more effective than others.Previous work has shown that most Amazonian fires occur close to roads and are more frequent in El Niño years. We quantified these relationships for reserves and unprotected areas by examining satellite-detected hot pixels regressed against road distance across the entire Brazilian Amazon and for a decade with 2 El Niño-related droughts. Deforestation fires, as measured by hot pixels, declined exponentially with increasing distance from roads in all areas. Fewer deforestation fires occurred within protected areas than outside and the difference between protected and unprotected areas was greatest near roads. Thus, reserves were especially effective at preventing these fires where they are known to be most likely to burn; but they did not provide absolute protection. Even within reserves, at a given distance from roads, there were more deforestation fires in regions with high human impact than in those with low impact. The effect of El Niño on deforestation fires was greatest outside of reserves and near roads. Indigenous reserves, limited-use reserves, and fully protected reserves all had fewer fires than outside areas and did not appear to differ in their effectiveness.Taking time, regional factors, and climate into account, our results show that reserves are an effective tool for curbing destructive burning in the Amazon. A history of massive deforestation linked to large-scale infrastructure projects (notably roads) in the Brazilian Amazon, and government plans for more such projects, has spawned debate about ways to avoid repeating past trends In the Amazon, deforestation and fire are inextricably linked. Satellite-detected “hot pixels” are a good proxy for deforestation fires, and can thus effectively tell us whether reserves are protecting forest cover. In addition to biodiversity concerns, deforestation fires indicate that biomass has rapidly been released as carbon to the atmosphere, another important measure of reserve effectiveness. Our analyses concentrate on fires as a measure of human impact and on the ability of reserves to mitigate it.2 resolution GOES hot pixels for 1998 only. Finally, because Nepstad et al. Studies that have looked at fire in the Amazon We start by considering the factors that affect fire incidence. Because there is large year-to-year variation in climate and in fires de facto, a consequence of reserve location , or de jure, because legal protections are respected? (3) Are some reserve types more effective than others in preventing deforestation fires? We recognize that there will be confounding factors: (a) Given that severe droughts remove moisture limitations and thus promote the spread of fires, do different kinds of reserves offer varying levels of protection in El Niño Southern Oscillation (ENSO) years? (b) Do reserves prevent deforestation fires even when human access is possible through road networks? (c) Finally, given these other factors, do the answers vary from place to place across the Amazon?In short, we ask three key questions: (1) Do reserves actually protect Amazonian forests from deforestation and consequently fires? (2) Is protection In the Amazon, roads are the major conduits for deforestation and accompanying fires Theoretically, reserves may halt fire because of restrictions on land use (forests are less disturbed and fire is not used for management) or because of restricted access (fewer roads and fewer ignition sources). Different types of reserves in Brazil allow different land uses Whatever the mechanism, reserves clearly limit road building, deforestation and fire in many highly affected areas Climate patterns produce different spatial and temporal patterns of drought in different regions of the Amazon The leading edge of development in the Brazilian Amazon forms an arc from the southwestern to the southeastern Amazon. Here, seasonally dry forests Because processes affecting fire differ between these regions, we divided the Amazon using relevant political and geographical boundaries and analyzed forest areas in the two regions separately.We used 3 remotely-sensed data sources to track fires. The first provided the most years of data. The others ran for fewer years, detected more fires, and allowed us to test whether data source affected our results.2 resolution hot pixels from the European Space Agency's Ionia World Fire Atlas (WFA) We tracked fire patterns with monthly composites of nighttime 1-kmDetecting fire from space remains challenging and each sensor has advantages and disadvantages. Detection algorithm, overpass time and frequency, spatial resolution, land cover, and type of fire all affect which fires are detected 2, but these satellites have daytime and more frequent overpass times. They detect more fires than the WFA. In addition to analyzing the full ten years of WFA data, we also separated 2001–2003 WFA data and directly compared those years with the AVHRR and MODIS data.To confirm the general pattern of our results, we also analyzed 3-year data sets released by the Large-Scale Biosphere-Atmosphere Experiment (LBA) in Amazônia Because of rapid change in land cover over the large spatial and temporal scale of our study, we did not include detailed land cover data. Instead, we assigned designations of forest or savanna vegetation derived from ecoregions http://www.dpi.inpe.br/prodesdigital/prodesmunicipal.php, accessed January 31, 2008). Pará had approximately 19% deforestation in 2006, but the majority of that deforestation occurred east of the Xingu River. Therefore, areas in Pará east of the Xingu River we classified as high-impact and the areas north and west of the Xingu River we considered low-impact.Social and economic drivers of fire and deforestation, as well as environmental variables, vary across the Amazon We grouped reserves into fully protected parks , limited-use areas , and indigenous lands, on the basis of activities that they allow.2 unless they were adjacent to another reserve of the same type. To avoid double-counting areas that had two different designations, we excluded limited-use areas and protected parks that overlapped by more than half of their area with indigenous lands. Altogether, we included the forest ecoregion portions of 53 parks, 109 limited-use reserves, and 238 indigenous reserves, totaling 180,125 km2, 409,984 km2, and 936,819 km2, respectively. The combined area was 1,526,928 km2 or approximately 37% of the forest ecoregion area of the Brazilian Amazon. We used road data and the Legal Amazon boundary from IBAMA . Road data include state and federal roads, and some private roads, but omit many unofficial roads that are visible in Landsat Images. As the vast majority of hot pixels detected (∼90%) were ≤10 km of roads in our dataset, this omission should not significantly affect our results.World Wide Fund for Nature-Brazil compiled the shape files of reserves. The original sources were FUNAI , IBAMA , and the state secretaries of the environment (state protected areas). We excluded marine and mangrove reserves. To avoid co-registration errors, we excluded reserves of <100 km2 pixel in forest ecoregions, we recorded the distance to the nearest road and whether the pixel had burned in a given year. We used analysis of covariance to assess patterns of hot pixel frequency in different reserve types, land designations and distance to roads (binned to 10 km wide classes). We measured ENSO severity with the Multivariate ENSO Index (MEI) For each 1-km2 pixel. However, hot pixels are typically clustered at a scale of a few square kilometers . In any case, individual hot pixels were not independent observations. Consequently, we used regression analysis on the average number of hot pixels/100 km2, in each road distance class, and for each category . Here, the sample sizes were far smaller, but only the residuals about the model needed to be independent. At this scale, there is no reason to think that the residuals would be correlated. We restricted analyses to distance classes for which the total combined number of hot pixels in the 2 classes being compared was >50. Classes with <50 hot pixels were generally either very far from roads (very few hot pixels in huge remote areas) or had very little land area .The statistical analyses raise the issue of the independence of individual fires. Treating fires as independent observations would result in huge sample sizes. The sensors detect distinct fires — or clusters of fires — to the resolution of a 1-kmAs expected based on state deforestation statistics, the majority (88%) of hot pixels detected in forest ecoregions with a decade of WFA data were in high-impact forest Only 12%There were far fewer fires inside reserves than outside for both low- and high-impact forests improved the statistical fit over a model with a common slope. We expected that at large distances from roads, it should matter less whether or not forest was inside a reserve; so again, the test was one-tailed. These results were mixed: two results were significant at p<.05, two more were close, but all differences were in the expected direction ; row 3.Converging regression lines imply that there is some distance from roads beyond which there is no difference in fire frequencies between areas inside and outside of reserves. Treating each distance class as a separate variable in an ANOVA allowed us to ask at what distance from roads were fire frequencies statistically different inside versus outside reserves. For the eight sets of results in In addition, there were more fires (inside and outside of reserves) in high-impact than in low-impact forests , 3 and tThere were generally more hot pixels in years with high ENSO indices than in years with lower ones. This was true both close (<10 km) and far (>10 km) from roads and inside and outside reserves had no hot pixels in any given year. In reserves with hot pixels, the average number/100 kmSO years . A sligh factors as we wide facto or de jure.Our first question was whether reserves actually protect Amazonian forests from deforestation fires. Our analysis clearly shows that they do. There are caveats, however, that relate to the second question of whether that protection is Reserves had many fewer fires than areas outside, but protection differed between high- and low-impact areas. Overall, there are roughly 3 times more deforestation fires in high- than in low-impact areas. These regional differences have been obvious since at least the early-1970s These differences illustrate the differences in pressure on reserves in high-impact areas. Even correcting for greater area outside reserves, there were always consistently more hot pixels close to roads outside reserves than inside, in both low- and high-impact areas. This difference diminished with increasing road distance. Because hot pixels are a proxy for deforestation, fewer fires close to roads inside reserves may relate to a lack of available infrastructure or to protected status that discourages land uses conducive to deforestation and fire along roads. This suggests that reserves provide the greatest protection from fires where the likelihood of burning would otherwise be greatest, that is, close to roads. On the other hand, the difference between fire occurrence in high- and low-impact reserves also indicates that reserves may not always provide sufficient protection when the pressure on them becomes very great. In addition, reserves that do not suffer deforestation fires may be subject to less detectable disturbance such as illegal logging or understory fire There is no simple answer to our third question of whether some types of reserves are universally more effective. At the scale of the Brazilian Amazon, reserve type did not significantly affect fire frequency for a given distance to roads and region.Statistical issues made it difficult to deny any effect of reserve type, however. First, only ∼20% of reserves had any hot pixels in most years . In highTo illustrate regional differences, we examined 3 places where all the factors discussed were roughly equal, but where all 3 kinds of reserves were adjacent to each other . This wo2. Inside it was generally <2 hot pixels/km2.In Rondônia, a massively deforested area, the contrast between fires inside and outside reserves was striking . In the Along the BR-174 in Amazonas, large areas burned in 1997 . These fIn the eastern Amazon, in an area with many fires, no reserve has successfully kept fires at bay . For exaThese examples illustrate the importance of local factors to the success of any reserve in protecting forest Our results imply that the prevalently-held view that uninhabited reserves are the best kind for conservation may not be so clear cut, especially in the context of rapid infrastructure development and deforestation in the Brazilian Amazon. The fact that there is not a significant difference in deforestation fires in inhabited versus uninhabited reserves provides an immediate policy implication. Indigenous lands contain 5 times the land area of fully protected parks and form the majority of protected land in highly contested areas Debate about the Amazon's future has rightly focused on roads as one of the most important drivers of deforestation Although previous work has found correlations between ENSO and understory fires Most deforestation and fires have occurred in drier parts of the Amazon, but these processes already accompany roads built into more humid forests (notably BR-163). Even along roads within their borders, and even during ENSO-related drought, reserves of all types reduced fires that closely accompany roads throughout the Amazon. New and existing reserves should thus be an integral part of the planning process to mitigate the environmental impacts of roads Abstract S1Abstract in Portuguese(0.03 MB DOC)Click here for additional data file.Abstract S2Abstract in Spanish(0.03 MB DOC)Click here for additional data file.

In an attempt to immortalize immature T cells expressing a known T-cell antigenreceptor (TCR), Thy-1/c-myc transgenic mice were bred to αβ TCR transgenic mice (F5),and CD4+ CD8+ cell lines were established from thymic tumors in double-transgenic mice.These cells expressed high-level heat-stable antigen (HSA) and were able to undergoprogrammed cell death upon induction with steroids and CD3 cross-linking, but not withcognate peptide. In addition, one line had rearranged and transcribed endogenous TCR cand genes, in spite of the fact that transgenic α and β genes were also expressed.Furthermore, we show that Thy-1/myc transgenic mice deficient in recombination activatinggene-1 (RAG-1) do not develop tumors, in contrast to RAG-1-/- mice, which are alsotransgenic for both Thy-1/myc and the F5 TCR. This indicates that in order for thymocytesto be transformed by the Thy-myc transgene, they need to proceed to the double-positivestage.The c-

In this paper, we studied expression, kinetics, chromatin remodeling of the CD3 gene at different time-points post HTLV-I infection.HTLV-I infected CD4CD3γ followed by the subsequent progressive reduction in CD3δ, then CD3ε and CD3ζ mRNA. Transient transfection experiments showed that the CD3γ promoter was still active in CD3- HTLV-I infected cells demonstrating that adequate amounts of the required transcription factors were available. We next looked at whether epigenetic mechanisms could be responsible for this progressive decrease in CD3 expression using DNase I hypersensitivity (DHS) experiments examining the CD3γ and CD3δ promoters and the CD3δ enhancer. In uninfected and cells immediately post-infection all three DHS sites were open, then the CD3γ promoter became non accessible, and this was followed by a sequential closure of all the DHS sites corresponding to all three transcriptional control regions. Furthermore, a continuous decrease of in vivo bound transcription initiation factors to the CD3γ promoter was observed after silencing of the viral genome. Coincidently, cells with a lower expression of CD3 grew more rapidly.The onset of this phenomenon coincided with a decrease of We conclude that HTLV-I infection initiates a process leading to a complete loss of CD3 membrane expression by an epigenetic mechanism which continues along time, despite an early silencing of the viral genome. Whether CD3 progressive loss is an epiphenomenon or a causal event in the process of eventual malignant transformation remains to be investigated. I stimulates calcium release from the endoplasmic reticulum, which induces NFAT transcription factors leading to T-cell activation[HTLV-I infection can lead to the development of adult T-cell leukemia/lymphoma (ATLL) in 2–5% of infected individuals depending upon geographic location and exposure to etiologic factors. It is currently thought that tumors develop from a persistently infected T-cell reservoir, which can be amplified by cytokine-induced activation leading to viral gene expression, cellular proliferation and survival of some expanded cells. Viral gene expression has been implicated in the disruption of various normal cellular processes, including activation, growth, and apoptosis, the latter allowing accumulation of abnormalities leading to cellular transformation. Several viral proteins have been shown to play an important role in tumor progression by modulating transcription factors. The pleiotropic viral protein Tax mediates the NF-κB activation resulting in abnormal cytokine and cytokine receptor expression. Sumoylactivation,5. The vctivation.+ lines and T-cells from patients with ATLL are characterized by a CD3- or CD3low phenotype [A keystone of the antigen-specific immune response is the T-cell receptor (TCR)/CD3 complex. Infected CD4henotype -9. In a henotype we have henotype . We deci+ T cells with HTLV-I was known to progressively downregulate CD3 genes transcripts, eventually leading to a CD3- surface phenotype after 200 days of in vitro infection [+ T cells with HIV-1 [- CD4+ T-cell lymphoma mediated hypereosinophilic syndrome [CD3γ gene transcripts. All T-lymphotropic viruses induce CD3 downregulation in the absence of a generalized suppression of host protein synthesis.Experimental infection of CD4nfection ,13; howeth HIV-1 -17, HIV-th HIV-1 , as wellsyndrome , all linCD3γ gene transcripts, ultimately leading to a CD3- phenotype. However, we show that the initial CD3γ transcripts decrease is followed by a subsequent progressive and sequential reduction in CD3δ, CD3ε and CD3ζ genes transcription, going on after early viral genes silencing. Our experiments also demonstrate that these phenomena occur through chromatin remodeling and progressive closure of the CD3 genes promoter sites and are not the results of transcription factors depletion. Finally, this loss of CD3 expression is timely associated with a growth advantage, but further experiments will be needed to determine whether there is a causal relationship between these two observations.The HTLV LTR responds to T cell-activation signals, which s+ T cell line[The WE17/10 cell line is a human IL-2 dependent CD4cell line that wascell line. WE17/10coRI (no cut into the HTLV-I provirus) or SacI (cut once into the HTLV-I LTR) and electrophoresed in an agarose gel then transferred to nylon membrane . The filters were hybridized with radiolabeled probe : a KpnI fragment[pro gene and ending in the env gene, at 65°C for 12 hours, washed in buffers, and then exposed to X-ray film at -80°C.We used a standard southern blot protocol. The genomic DNA was digested with E fragment, correspCells were analyzed for CD3 surface expression by flow cytometry as previously described. BrieflyWE17/10 cells (uninfected and HTLV-I infected) were transiently transfected using standard DEAE-dextran protocols with wild-type (pHγ3-wt) promoter construct as previously described.2, 10 mM Tris pH 7.4, 300 mM sucrose, 0.1 mM EGTA, and 0.1% NP-40) to isolate the nuclei. The nuclei were then resuspended in 1 ml of nuclear digestion buffer . Nuclei from 20 × 106 cells were digested for 3 minutes at 22°C using increments of DNase I (Roche Diagnostics) from 0 to 28 U/ml. The reaction was stopped by adding nuclear lysis buffer containing 0.1 mg/ml proteinase K and incubating for 5 min at 55°C then overnight at 37°C. Genomic DNA was subsequently isolated using standard phenol chloroform extraction techniques.Isolation and DNase I digestion of nuclei was performed using a method previously described . BrieflyCD3δ promoter, BamHI for the CD3δ enhancer and SacI for the CD3γ promoter prior to standard Southern blot analysis. Promoter probes were amplified by PCR using the following primer pairs:Genomic DNA was digested with BglI for the CD3γ promoter: forward, 5'-CACCTGCTGAAACTGAGCTG-3', reverse, 5'-TCCCAGACAGTGGAGGAGTT-3';CD3δpromoter: forward, 5'-GTTCCTCTGACAGCCTGAGC-3' and reverse 5'-TTTTAGGCCTGATGGCCTCT-3'.CD3δ enhancer was a BamHI digest of the human CD3δ cDNA (NCBI accession # BC070321).The probe used to detect the CD3 genes have been previously described[Total RNA was isolated from cells using the TriPure Isolation Reagent (Roche Applied Science) in a single-step extraction method. Standard reverse transcription was performed using 1 μg of total RNA at 42°C for 45 minutes and 50 ng of the resulting cDNA was used per PCR reaction. The primer pairs used to amplify the individual described,26 and aCD3γ: forward 5'-CATTGCTTTGATTCTGGGAACTGAATAGGAGGA-3', reverse 5'-GGCTGCTCCACGCTTTTGCCGGAGACAGAG-3';CD3δ: forward 5'-TTCCGGTACCTGTGAGTCAGC-3', reverse 5'-GGTACAGTTGGTAATGGCTGC-3'.et al[Real-time RT-PCR was performed using a TaqMan Gene Expression Assay for each of the individual CD3 genes . Eukaryotic translation elongation factor1 α(EF-1-α) and cancer susceptibility candidate 3 (MLN51) were used as CD4+ T cell specific endogenous reference genes as described by Hamalainen et al. Relativ7 cells, and EMSA experiments were performed as described previously[1/CD3γInr binding site: Spγ1/CD3γInrwt, 5'-GTGATGGGTGGAGCCAGTCTAG-3'[Nuclear extracts were prepared from 2 × 10reviously. The radGTCTAG-3'. The oli1, CD3γInr, and Spγ2 (205-bp product), forward, 5'-GGGTTCTTGCCTTCTCTCTCAA-3', reverse, 5'-CCCCTAGTAGGCCCTTACCTT-3'.The ChIP assay was performed as previously described using th32P-labeled PCR product was separated on a 6% acrylamide gel and detected by autoradiography.The amplified + T cell line WE17/10 infected by the HTLV-I viruses produced by the MT-2 cell line. The latter, used as virus source, contains 8 complete or defective proviral genomic integrations some defective proviral genomes being able to produce viral RNA transcripts. The most dominant species of unintegrated viral DNA was 3.7 kb in size; it hybridized to a full-length HTLV-1 DNA probe but not to a KpnI viral DNA fragment beginning in the pro gene and ending in the env gene[The cell lines were derived from the IL-2 dependent CD4 env gene that is EcoRI, which does not cut within the 9 kb of the HTLV-I genome, the complete provirus probe revealed a smear witnessing a polyclonal integration of the provirus in the WE17/10 infected cells decreased in a progression from CD3hi to CD3low to CD3-, similar albeit slower than that previously described for HIV-infected cells[hi expression.Cryopreserved cells from different stages of the primary infection were thawed and CD3 surface density was quantified in a parallel experiment to ensure that the detected changes were not attributable to variation in antibody labeling experiments Figure . A signited cells,15,18. TCD3γ, δ, ε and ζ) were lost after HTLV-I infection in vitro, but these experiments did not provide insight into the order of their loss. Our previous experiments have shown that TCR/CD3 surface receptors are down-modulated after infection with HIV-1[CD3γ gene transcripts. We therefore asked whether the CD3γ gene was also initially targeted after HTLV-I infection and found that its specific decrease of transcription precedes the progressive loss of surface CD3 expression on HTLV-I infected cells.A previous study found thith HIV-1,17 and Hith HIV-1 linked tCD3γ transcripts . Subsequently, a precipitous drop of about 80% in CD3γ transcripts appears while the density of the TCR/CD3 on the cell surface is ~70%. This erosion in CD3γ transcript numbers progresses until all of the cells are CD3γ and surface CD3 negative (± 9–12 mo. p.i.). This loss of CD3γ gene expression is followed by a steady decrease in CD3δ transcripts followed by a slower but also progressive reduction in CD3ε and CD3ζ transcripts. Maintained continuously in vitro, the HTLV-I infected cells eventually become negative for CD3δ as well as CD3γ transcripts. The level of CD3ε and CD3ζ transcripts remains ~25% in the CD3γ-δ- cells even after more than three years p.i. In MT-2 cells CD3γ, CD3δ and CD3ε transcripts are completely lost while the CD3ζ transcripts are still expressed but at a very low level (data not shown).A real time RT-PCR assay for quantification of all four CD3 gene transcripts revealed that the loss of TCR/CD3 complex at the cell surface occurs quite later than the loss of s Figure . InitialCD3γ promoter activity in the HTLV-I infected cells after the loss of CD3γ gene expression we used our previously described construct (pHγ3-wt)[CD3γ promoter activity was similar to that of uninfected WE17/10 cells. It was over 2.5 fold of the activity measured for the pGL3 plasmid basic vector (pGL3-BV). The CD3γ promoter cloned into a plasmid vector was active while the CD3γ gene transcripts are lost after HTLV-I infection. Thus, after HTLV-I infection, CD3γ gene silencing could not be explained by a lack of transcription factors but potentially by a restrained accessibility to its transcriptional regulation region.In an effort to investigate the full-length (pHγ3-wt) in a traCD3γ, CD3δ and CD3ε genes are located in a 50 kb cluster on chromosome 11q23, with CD3γ and CD3δ positioned head-to-head and separated by 1.6 kb. DNase I hypersensitivity experiments using probes designed to specifically detect the CD3γ promoter, CD3δ promoter or CD3δ enhancer (an enhancer for the CD3γ gene has not been identified yet) revealed that in uninfected (positive control) and HTLV-I infected CD3γ+δ+ cells all three DNase I hypersensitive sites (DHS) are readily discernible -binding motifs, with an Initiator (Inr) element present in the primary core promoter[1/CD3γInr[+ uninfected WE17/10 or from CD3- HTLV-I infected WE17/10 cells trichostatin A in association with the DNA-methylation inhibitor 5' deoxy-azacytidine rescued CD3γ promoter by comparing TCR/CD3+ uninfected, untreated and TSA/AZA treated TCR/CD3- HTLV-I infected WE17/10 cells /CD3 complex is the keystone of the antigen-specific immune response. Infection by HTLV-I has been shown to ultimately downregulate infection,13; howeinfection-17 and Hinfection associathenotype . The virhenotype in infecin vitro infection leads to progressive downmodulation of TCR/CD3 complexes from the cell surface following a pattern of decreasing surface density reminiscent of that observed for HIV-1[CD3γ gene. To ensure that this phenomenon was not restricted to our experimental setting and the utilized cell line, we have tested a number of well-established HTLV-I infected CD4+ cell lines and found a general down modulation of TCR/CD3 surface expression in comparison to their uninfected counterpart.In this study, we investigated proviral integration, viral gene expression, CD3 surface density, CD3 gene transcription and chromatin structure over a period of time of three years post HTLV-I infection of the WE17/10 cell line. We found that HTLV-I for HIV-1,15 and Hfor HIV-1, except CD3γ by HIV[CD3γ, 48% CD3δ, 62% CD3ε and 75% CD3ζ gene transcripts. This extensive loss of CD3γ transcripts prior to significant TCR/CD3 down-modulation was similar to what we have observed previously for TCR/CD3 loss after HIV-I infection[CD3γ parallels the receptor negative phenotype in cell lines infected with both viruses, CD3- HTLV-I infected cells continue to progressively loosing expression of the remaining CD3 genes, with CD3δ transcripts being absent at 29 months p.i and about ~25% CD3ε and CD3ζ transcripts being still expressed at 3 years p.i. In contrast, HIV-1 infected cells maintain CD3δ, CD3ε and CD3ζ transcripts at >75% of normal levels in the presence of steadily decreasing CD3γ transcripts. Our data thus reveal that while both HIV-1 and HTLV-I target the expression of the CD3 genes, remarkably they appear to accomplish this task with distinct kinetics.However in contrast to the selective targeting of 3γ by HIV,18, HTLVinfection. These dinfection. AlthougImportantly, we also observed that, in contrast with HIV infected cells, an in vitro selection of certain clones occurs, as demonstrated in Fig CD3γ, CD3δ and CD3ε genes, located together on chromosome 11q23, are highly homologous due to their common ancestry[CD3ζ gene is located on chromosome 1 and has no apparent sequence homology with the other CD3 genes. It is therefore remarkable that all four genes are sequentially targeted in HTLV-I infected cells. Previous studies investigating the role of individual CD3 chains in thymopoiesis suggest that a mechanism exists for controlling access to the CD3γ, CD3δ and CD3ε gene cluster. Disruption of the CD3ε gene by insertion of a neomycin cassette in place of either exon 5[-/- mice who did not only show a CD3ε deficiency, but also underwent a significant inhibition of CD3γ and CD3δ genes transcription. Expression of CD3γ and CD3δ could be restored in CD3ε-/- mice by deletion of the neomycin cassette using in vivo recombination but not by transgenic reconstitution of CD3ε protein expression[CD3γ [CD3δ [CD3 genes. It has been reported that the coding sequence of neo gene can act as a transcriptional silencer[neo insertion in CD3ε potentially functions as an insulator by separating CD3γ and CD3δ genes from a putative locus control region. Taken altogether, these data indicate the existence of a mechanism for the global control of the 11q23 CD3 genes cluster that is likely to be critical in modulating the expression of these genes during the early stages of T-cell commitment. Similar cellular factors may also be involved in controlling the CD3ζ gene to ensure its coordinate expression with the other CD3 genes during T-cell differentiation and development.The human ancestry, while ter exon 5, exons 5er exon 5 or the per exon 5 left CD3xpression. Furtherion[CD3γ or CD3δ 3γ [CD3δ genes ha silencer, which sCD3γ expression could be restored in HTLV-I infected cells lacking endogenous CD3γ expression. This demonstrates that the loss of CD3γ is not due to a defect in factors binding to the CD3γ promoter region and rather suggests a lack of accessibility of these factors to the promoter regions in HTLVI infected cells. We further demonstrated that the loss of CD3γ and CD3δ transcripts is associated with progressive closure of the CD3γ promoter DHS followed by the CD3δ promoter and enhancer DHS. Modification in the corresponding DHS occurred in tandem with the reduction and loss of CD3γ and CD3δ gene expression p.i.However, by transient transfection we observed that in vivo binding of Sp1, Sp3 and TFIID to the CD3γ core promoter region in CD3- HTLV-I infected WE17/10 cells in comparison with TCR/CD3+ uninfected cells, while the in vitro binding was not affected. It has been shown that Sp1 and Sp3 transcription factor binding to TRE-I repeat III participates in the regulation of HTLV-I viral gene expression[In addition, we showed a reduction xpression. On the xpression.CD3γ core promoter was more abundant in CD3- HTLV-I infected compared to CD3+ uninfected WE17/10 cells. As expected, treatment with the histone deacetylase inhibitor (HDAC) trichostatin A in association with the DNA-methylation inhibitor 5' deoxy-azacytidine reestablished the H4 hyperacetylation status and reduced the HDAC binding to the CD3γ core promoter and rescued the transcription of CD3γ and CD3δ in the CD3- HTLV-I infected. This result reemphasizes that an epigenetic mechanism is at work to downmodulate the four CD3 genes after HTLV-I infection. We recently started a study aiming at unraveling the molecular determinants that coordinate the successive downregulation of the four CD3 genes.Histone H4 hyper-acetylation is a typical feature of active transcription. Histone H4 hyperacetylation was reduced and binding of HDAC to the +cell line leads to progressive alteration of Ca++ influx that eventually results in loss of CD7 expression and activation of an antiapoptotic pathway involving AKT and BAD which paves the way for malignant transformation[In a previous work we have shown that HTLV-I infection of WE17/10 CD4formation the loss-, CD7- phenotype associated with perturbation of calcium fluxes and constitutive activation of PI3 kinase, which prevents apoptosis and augments growth of the infected cells. The mechanism by which these phenomena continue after the loss of viral gene expression will be the subject of further studies, as well as determining whether CD3 progressive loss is an epiphenomenon or a causal event in the process of eventual malignant transformation.We conclude that HTLV-I expression initiates a process leading to several phenomena, among which a progressive loss of TCR/CD3 by epigenetic mechanisms. These modifications persist after HTLV-I genes are silenced through a mechanism that we have started to investigate. This eventually leads to a CD3HTLV-I, human T-cell leukemia virus type I; ATL, adult T cell leukemia/lymphoma; NF-κB, nuclear factor kappa-B; NFAT, nuclear factor of activated T cell; HBZ, HTLV-I bZIP factor; TCR, T cell receptor; HIV, human immunodeficiency virus; DHS, DNase I hypersensitive site; EF-1-α, eukaryotic translation elongation factor1 α; MLN51, cancer susceptibility candidate 3.The author(s) declare that they have no competing interests.HA conceived this project and carried out most of experiments in Figs. - or CD3low phenotype.CD3 expression on the surface of HTLV-I-infected cells. We have tested the HTLV-I infected cell lines MT-2, C91, WE/HTLV and an ATLL derived cell line PaBe for their TCR/CD3 surface expression. All the cells had a CD3Click here for file

Although urinary concentrations of phthalate metabolites are frequently used as biomarkers in epidemiologic studies, variability during pregnancy has not been characterized.n = 96 women) and repeated indoor air samples (n = 32 homes) for five phthalate diesters. Mixed-effects models were fit to evaluate reproducibility via intraclass correlation coefficients (ICC). We evaluated the sensitivity and specificity of using a single specimen versus repeat samples to classify a woman’s exposure in the low or high category.We measured phthalate metabolite concentrations in spot urine samples collected from 246 pregnant Dominican and African-American women. Twenty-eight women had repeat urine samples collected over a 6-week period. We also analyzed 48-hr personal air samples (r = 0.71), di-isobutyl phthalate (r = 0.44), and diethyl phthalate . In women sampled late in pregnancy, specific gravity appeared to be more effective than creatinine in adjusting for urine dilution.Phthalates were detected in 85–100% of air and urine samples. ICCs for the unadjusted urinary metabolite concentrations ranged from 0.30 for mono-ethyl phthalate to 0.66 for monobenzyl phthalate. For indoor air, ICCs ranged from 0.48 [di-2-ethylhexyl phthalate (DEHP)] to 0.83 [butylbenzyl phthalate (BBzP)]. Air levels of phthalate diesters correlated with their respective urinary metabolite concentrations for BBzP (n-butyl phthalate and BBzP. A single indoor air sample may be sufficient to characterize phthalate exposure in the home, whereas urinary phthalate biomarkers should be sampled longitudinally during pregnancy to minimize exposure misclassification.Urinary concentrations of DEP and DEHP metabolites in pregnant women showed lower reproducibility than metabolites for di- When urte (DEP) . It is ate (DEP) . Dermal Once a pregnant woman is exposed, phthalates can cross the placenta and enter fetal circulation . PhthalaPrevious studies on the reproducibility of phthalate metabolite concentrations in urine samples among nonpregnant individuals have shown a wide range of estimates of within-person variability , leadinga) to use biomarkers of exposure to evaluate variability in phthalate concentrations in pregnant women; and b) to evaluate variability in measures of phthalates in their external environment . As a secondary aim, we evaluated correlations between phthalate metabolite concentrations measured in maternal and newborn urine. Finally, we evaluated the correlation between phthalate levels in personal/indoor air and urinary metabolite concentrations.The primary aim of the current study was Subjects were recruited into the Columbia Center for Children’s Environmental Health (CCCEH) cohort at prenatal clinics located in three New York City neighborhoods in Northern Manhattan and the South Bronx. To be eligible for enrollment, subjects had to reside in the study area for at least 1 year, receive their first prenatal visit by the 20th week of pregnancy, and be free of diabetes, hypertension, and known HIV and drug or alcohol abuse . A varian = 96) were asked to wear a small backpack holding a personal ambient air monitor during the daytime hours for 2 consecutive days and to place the monitor near their beds at night. Over this period, the personal air sampling pumps operated continuously at 4 L/min, collecting particles ≤ 2.5 μm in diameter on a precleaned quartz microfiber filter and collecting semivolatile vapors and aerosols on a polyurethane foam (PUF) cartridge backup. At the end of the 48-hr monitoring period, all women gave a spot urine sample, which we refer to as 48-hr monitoring. Urine samples were also collected in the hospital from a subset of mothers (n = 16) and from their newborns (n = 19) 1 day after delivery. The newborn urine samples were collected by attaching urine-collection bags to the babies.During the third trimester of pregnancy, women (n = 32) who completed the 48-hr personal monitoring. Indoor air monitors placed in the women’s apartments ran continuously for 2 weeks. As previously described by The variability study was carried out on a subset of subjects , mono-benzyl phthalate (MBzP), and mono-2-ethylhexyl phthalate (MEHP). As analytical methods and knowledge of phthalate metabolism improved, the panel of urinary metabolites increased, and most participants also had measures for five additional metabolites: MEOHP, MEHHP, mono-2-ethyl-5-carboxypentyl phthalate (MECPP), mono-isobutyl phthalate (MiBP), and mono-3-carboxypropyl phthalate (MCPP). The 48-hr study urine samples were analyzed in four separate batches during 2001–2006. The variability study urine samples were all analyzed in the 2006 batch.All urine samples were analyzed at the National Center for Environmental Health of the CDC for four phthalate metabolites: mono-ethyl phthalate (MEP), mono-The analytical approach for measuring urinary phthalate metabolites involved enzymatic deconjugation of the metabolites from their glucuronidated form, solid-phase extraction, separation with high-performance liquid chromatography, and detection by isotope-dilution tandem mass spectrometry . To moniThe personal and indoor air samples were analyzed at the Southwest Research Institute for five phthalates: DEHP, DnBP, BBzP, DiBP, and DEP. Methods are described elsewhere . After bPhthalates were measured in blank PUF cartridges to estimate levels of potential phthalate contamination in the sampling and analysis process. If phthalate amounts in the blanks were > LOD, the samples were flagged. To obtain the concentration of phthalate per cubic meter of air, we divided the extract value by the total volume (in cubic meters) of air pulled through the pump during the sample period. Although mean phthalate levels in personal air samples were at least an order of magnitude higher than in air matrix blanks, a few air sample amounts of BBzP and DEHP were lower than the maximum air matrix blank amount for that phthalate.n = 209 for MEHP, MEP, and MBzP; n = 104 for MEOHP, MEHHP, MnBP, MiBP, and MCPP). Given that the NHANES sample was nonrandom, we used the recommended methods to correctly estimate variances and phthalate metabolites in urine (nanograms per milliliter) are reported as percentiles, and as geometric means with corresponding 95% confidence intervals (CIs). %MEHP3, the ratio of MEHP to three DEHP metabolites , was used as a phenotypic marker of DEHP metabolism . %MEHP4 ariances .Z transformation to estimate 95% CIs. In cases of multiple samples per subject, we used a geometric mean to summarize all values for that subject. When modeling variability, we applied a logarithmic transformation to the air and urine phthalate measurements to better approximate a normal distribution. Mixed-effects models were fit to estimate the temporal variability in phthalate concentrations and to estimate the intraclass correlation coefficients (ICCs). We chose the most appropriate covariance structure by comparing Akaike information criterion (AIC) values between a covariance that assumes a constant correlation between any pair of measurements made on the same subject versus a first-order autoregressive structure, which assumes that measurements on the same subject taken closer in time are more highly correlated than those taken further apart. An ICC, the ratio of between-subject variance to total variance, is a measure of reproducibility of a biomarker sampled from the same group of individuals over time, and ranges from 0 (no reproducibility) to 1 , indoor air, and personal air, we used Spearman correlations with a Fisher erences) .The sensitivity and specificity of using a single urine sample per woman to classify her exposure to phthalates as low or high, compared with using three to five samples per subject, was estimated by randomly selecting a single sample from among each woman’s repeated samples collected over all 8 weeks. The metabolite concentrations (nanograms per milliliter) for the single sample were compared to the NHANES geometric mean (nanograms per milliliter) for that metabolite calculated for U.S. women of reproductive age and classified as below (low) or above the geometric mean (high). The geometric mean of a woman’s repeat samples was considered to reflect her “true” exposure and was similarly classified as low or high relative to the NHANES geometric mean for that metabolite. For each woman, the single selected sample was compared to the geometric mean of all her remaining samples (excluding the selected sample) in terms of low versus high exposure, and the sensitivity and specificity were calculated. This process was repeated 1,000 times, generating 1,000 estimates of sensitivity and specificity. We report the empirical estimates of the median sensitivity and specificity and empirical CIs for each metabolite. We used SAS, version 9.1 for all statistical analyses. We used Microsoft Excel 2003 SP2 to generate graphics.The demographics of our study sample, shown in The distributions of the nine urinary phthalate metabolite concentrations among pregnant women are summarized in Comparisons between concentrations in mothers and their newborns are illustrated in r = −0.31, p = 0.19; MCPP, r = −0.39, p = 0.09; MBzP, r = −0.29, p = 0.22) with their newborns’ urinary metabolites measured 1 day after delivery .n = 27), there was a positive correlation between 48-hr personal air and the average indoor air levels over the 8 weeks of sampling for all five phthalate diesters, estimated as 0.54 for DnBP (p = 0.002), 0.67 for BBzP (p < 0.0001), 0.51 for DEP (p = 0.005), 0.31 for DiBP (p = 0.11), and 0.25 for DEHP (p = 0.21) .For the urine variability analysis, we excluded 3 women with only one urine sample and 1 woman with missing urinary creatinine values. Of the remaining 28 subjects, 12 women had two samples and 16 women had three or four samples. We were limited to samples collected over the 6-week monitoring period because of missing data on urinary dilution for the 48-hr monitoring sample. Onset of labor was the primary reason that urine samples were unavailable for some subjects at weeks 4 and 6, which correspond approximately to weeks 37 and 39 of gestation.The ICCs for the nine metabolites in urine ranged from 0.30 to 0.66 without adjustment for creatinine, and decreased to 0.21–0.65 with creatinine adjustment . MEP andn = 26) . The proFor the 32 women in the 6-week monitoring study, 6 provided two indoor air samples each, 11 women provided three samples each, and 15 women provided four samples each. Within a woman’s home, the indoor air phthalate levels were more stable over time than were her urinary phthalates. The ICCs were 0.61 for DEP, 0.54 for DiBP, 0.59 for DnBP, 0.48 for DEHP, and 0.83 for BBzP.n = 27). These correlations were compared to paired 48-hr personal air and urine samples (n = 62) and between BBzP in personal air and MBzP in urine . The correlation between DiBP in indoor air and MiBP in urine was weaker . There were significant associations between DEP in indoor air and MEP in urine and DEP in personal air and MEP in urine . No associations were detected between DEHP or DnBP and their respective metabolites.We calculated estimated Spearman correlation coefficients between phthalate levels in paired indoor air and urine samples collected over 6 weeks in late pregnancy ((n = 62) . After aIn a small sample of pregnant women, the reproducibility of urinary phthalate metabolite concentrations measured over a period of 6–8 weeks late in pregnancy was low to moderate. Reproducibility can be ranked in the following order: MEP (0.30), DEHP metabolites (mean ICC = 0.35), DnBP metabolites (mean ICC = 0.58), %MEHP3 and %MEHP4 (mean ICC = 0.62), and MBzP (0.64). The proposed measure of interindividual differences in metabolism and excretion (%MEHP) was more stable over time within a pregnant woman than the corresponding DEHP metabolites by approximately 2-fold. The CCCEH subjects had significantly higher mean urinary concentrations of MiBP (3-fold) and MnBP (43%) than U.S. females of reproductive age.An ICC of 0.40 has been proposed as a cutoff for sufficient reproducibility in a biomarker to justify its use in an epidemiologic analysis and has Within-subject variability in phthalate concentrations measured in indoor air during the same 6-week period was lower than that in urine, suggesting that exposures to phthalates are relatively constant within the home. Of the phthalates measured, DEHP has the lowest volatility , which mTo date, four separate studies have reported estimates of reproducibility of urinary phthalate metabolites . ICC estDepending on the research question, investigators may choose to group subjects by tertiles, quintiles, or even into low- and high-exposure categories. When relying on a single urine sample, this may reduce exposure misclassification because of within-subject variability. In our analysis of sensitivity and specificity, we found a similar trend as with the ICCs. DEP (0.43) and DEHP metabolites averaged (0.64) had the lowest specificity, whereas BBzP (0.73) and DnBP metabolites averaged (0.80) had the highest.The observation that creatinine adjustment actually increased within-person variability and reduced reproducibility in urinary concentrations of phthalate metabolites was unexpected and inconsistent with other studies . This diin utero, during the labor and delivery process, and/or within the first 24 hr after delivery. MECPP, which is largely in its free, unglucuronidated form in urine and has the longest elimination half-life of the DEHP metabolites examined, may be an appropriate biomarker of cumulative DEHP dose (The presence of MECPP in 100% of the newborn samples and the fact that it was at the highest concentration suggests that the newborns were exposed to DEHP EHP dose . The invEHP dose . HoweverThe correlations between phthalates in indoor air and urine partly confirmed our previous report . DiffereIn the present study, we found urinary phthalate metabolite concentrations to be moderately to highly variable in a small sample of pregnant women sampled over 6 weeks late in pregnancy, whereas indoor air concentrations were more stable during the same period. The variability that we observed could be in part due to changes in exposure and/or physiologic changes in pregnancy, which alter metabolism and excretion of phthalates. As proposed in previous studies , %MEHP p

Percutaneous core needle biopsy (CNB) is considered to be the standard technique for histological diagnosis of breast lesions. But, it is less reliable for diagnosing atypical ductal hyperplasia (ADH). The purpose of the present study was to predict, based on clinical and radiological findings, which cases of ADH diagnosed by CNB would be more likely to be associated with a more advanced lesion on subsequent surgical excision.Between February 2002 and December 2007, consecutive ultrasound-guided CNBs were performed on suspicious breast lesions at Seoul St. Mary's Hospital. A total of 69 CNBs led to a diagnosis of ADH, and 45 patients underwent follow-up surgical excision. We reviewed the medical records and analyses retrospectively.in situ, n = 8; invasive cancer, n = 2). Univariate analysis revealed age (≥ 50-years) at the time of core needle biopsy (p = 0.006), size (> 10 mm) on imaging (p = 0.033), and combined mass with microcalcification on sonography (p = 0.029) to be associated with underestimation. When those three factors were included in multivariate analysis, only age was an independent predictor of malignancy.Sixty-nine patients were diagnosed with ADH at CNB. Of these patients, 45 underwent surgical excision and 10 (22.2%) were subsequently diagnosed with a malignancy at the time of biopsy is an independent predictive factor for breast cancer at surgical excision in patients with diagnosed ADH at CNB. For patients diagnosed with ADH at CNB, only complete surgical excision is the suitable treatment option, because we could not find any combination of factors that can safely predict the absence of DCIS or invasive cancer in a case of ADH. Percutaneous core needle biopsy (CNB) is the standard technique for histological diagnosis of breast lesions. It has become the procedure of choice to investigate suspicious lesions of the breast and has been shown to be an effective means to rule out cancer, alleviating the cost and discomfort of surgery. Overall, CNB histological findings are in agreement with surgical biopsy in more than 95% of the cases -3. But, in situ (DCIS) [ADH is a proliferative lesion of the breast epithelium, which fulfils some but not all the criteria of low grade ductal carcinoma u (DCIS) . ADH caru (DCIS) ,6 and thu (DCIS) . Signifiu (DCIS) -14. Thisu (DCIS) . In addiu (DCIS) and, thuu (DCIS) . IdentifThe purpose of the present study was to predict, based on clinical and radiological findings, which cases of ADH diagnosed by CNB would be more likely to be associated with a more advanced lesion on subsequent surgical excision.P values < 0.05 were considered statistically significant.Between February 2002 and December 2007, 3476 consecutive ultrasound-guided CNBs were performed on suspicious breast lesions at the Seoul St. Mary's Hospital. A total of 69 CNBs led to a diagnosis of ADH, and 45 patients underwent follow-up surgical excision. Seven patients refused surgical excision and were only followed up and 12 patients were transferred other hospital as per their request while 5 were lost to follow-up. The definition employed for "histological underestimation" was a lesion diagnosed as ADH at CNB that was revealed to harbor malignant foci at follow-up surgical excision, including DCIS and invasive cancer. All patients in this study underwent clinical and radiological examination, including mammography and ultrasound. The radiological appearance of the lesion was characterized according to the American College of Radiology Breast Imaging Reporting and Data System lexicon and the final assessment categories. All lesions were evaluated for size on imaging and presence of microcalcification. Lesion size was defined as the greatest dimension on ultrasound imaging for most patients, or mammography size for patients with microcalcification dominant lesions. Ultrasound-guided biopsies were used for sonographically visible lesions, and were performed with patients in a supine or decubitus position using high-resolution sonography. The biopsy was performed using a device with a 14-gauge automated needle or with an 11-gauge vacuum assisted biopsy device. The core biopsy tissue sections were fixed in 10% formaldehyde and embedded in paraffin. Each biopsy specimen was stained with hematoxylin and eosin. The biopsy slides were reviewed by experienced pathologists and diagnosed according to the ADH diagnostic criteria of the World Health Organization guidelines. The data were analyzed using Chi-square and logistic regression, as well as Fisher exact test for the small sample. Sixty-nine patients were diagnosed with ADH at CNB. Of these, 45 underwent surgical excision at our institution. Of the 45 patients, 10 (22.2%) were diagnosed with a malignancy after surgical excision . Table Univariate analysis revealed that age (≥ 50 years) at the time of core needle biopsy (p = 0.006), size on imaging , and combined mass with microcalcification on sonography p = 0.029) were associated with underestimation was presently determined to be an independent predictive factor for breast cancer at surgical excision in patients with diagnosed ADH at CNB. Consistent with our findings, Ko et al observedSeveral studies have examined various mammographic, clinical, and pathological factors that may predict the presence of a more significant lesion on surgical excision after a CNB diagnosis of ADH ,19-21. IUse of vacuum assistance and more extensive sampling have improved the underestimation of carcinoma on surgical biopsy after a diagnosis of ADH on CNB from 33%-48% ,21 to 7%et al, [Jackman et al, recognizet al [Microcalcification with or without a mass has been reported to be the most common finding for both ADH 58% 88%) and DCIS (68% 98%) % 88% and-29. On het al found thet al ,31. Theset al . Our resLimitations of the present study include its retrospective nature and that it did not involve a randomized series of patients. Furthermore, 24 (34.8%) of the 69 ADH cases did not undergo surgical excision and were therefore excluded. It is possible that cases with a lower possibility of malignancy were recommended for imaging follow-up rather than surgical excision, which could affect the underestimation rate and other results.Only age at the time of biopsy (≥ 50 years) is an independent predictive factor for breast cancer at surgical excision in patients with diagnosed ADH at CNB. Identification of patients with ADH diagnosed by CNB who can be spared surgical excision is an area of active investigation. However, at present, clinical, radiologic, and pathologic factors on which to base this decision have not been consistently identified. So, for patients diagnosed with ADH at CNB, only complete surgical excision is a suitable treatment option because we could not find any combination of factors that can safely predict the absence of DCIS or invasive cancer in a case of ADH.The authors declare that they have no competing interests.BJC carried out the statistical analysis, participated in the sequence alignment and drafted and described the manuscript. AL carried out the Pathologic diagnosis. BJS and SSJ conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.

Borrelia burgdorferi, a causative agent of Lyme borreliosis, encodes a surface-bound lipoprotein, VlsE. This protein is encoded by the vlsE locus carried at the right end of the linear plasmid lp28-1. Adjacent to the expression locus are 15 silent cassettes carrying information that is moved into the vlsE locus through segmental gene conversion events. The protein players and molecular mechanism of recombinational switching at vlsE have not been characterized. In this study, we analyzed the effect of the independent disruption of 17 genes that encode factors involved in DNA recombination, repair or replication on recombinational switching at the vlsE locus during murine infection. In Neisseria gonorrhoeae, 10 such genes have been implicated in recombinational switching at the pilE locus. Eight of these genes, including recA, are either absent from B. burgdorferi, or do not show an obvious requirement for switching at vlsE. The only genes that are required in both organisms are ruvA and ruvB, which encode subunits of a Holliday junction branch migrase. Disruption of these genes results in a dramatic decrease in vlsE recombination with a phenotype similar to that observed for lp28-1 or vls-minus spirochetes: productive infection at week 1 with clearance by day 21. In SCID mice, the persistence defect observed with ruvA and ruvB mutants was fully rescued as previously observed for vlsE-deficient B. burgdorferi. We report the requirement of the RuvAB branch migrase in recombinational switching at vlsE, the first essential factor to be identified in this process. These findings are supported by the independent work of Lin et al. in the accompanying article, who also found a requirement for the RuvAB branch migrase. Our results also indicate that the mechanism of switching at vlsE in B. burgdorferi is distinct from switching at pilE in N. gonorrhoeae, which is the only other organism analyzed genetically in detail. Finally, our findings suggest a unique mechanism for switching at vlsE and a role for currently unidentified B. burgdorferi proteins in this process.Persistent infection by pathogenic organisms requires effective strategies for the defense of these organisms against the host immune response. A common strategy employed by many pathogens to escape immune recognition and clearance is to continually vary surface epitopes through recombinational shuffling of genetic information. vlsE gene to promote antigenic variation. In this work we have investigated the effect of independent mutation of 17 DNA replication, recombination and repair genes on the movement of genetic information into vlsE. We found that mutation of either of the genes encoding the two subunits of the RuvAB branch migrase blocked transfer of genetic information into vlsE during mouse infections, identifying the first required function for antigenic variation in the Lyme disease spirochete.A common strategy for evasion of the host immune system is the continuous variation of a major surface protein that elicits a dominant immune response (antigenic variation). Many pathogens accomplish this goal by unidirectional movement of DNA sequence information from silent or archival gene copies into an expression site. The molecular details of how this gene shuffling is accomplished are not understood for any organism. In the flat-wave shaped bacterium causing Lyme disease, information is moved from 15 silent cassettes into the Antigenic variation through targeted genome rearrangements is a common strategy for immune evasion and has been identified in many important pathogens including protozoa Borrelia burgdorferi, and related species. Disease progression occurs through three stages: early, disseminated and persistent and can result in various arthritic, cardiac and neurological concerns if left untreated B. burgdorferi requires continual segmental gene conversion at the vlsE locus, which encodes a 35 kDa membrane lipoprotein vlsE gene, or expression locus is carried at the right end of the linear plasmid lp28-1. In the absence of lp28-1 or when the vls locus is deleted a productive murine infection ensues, but the spirochetes are cleared between days 8 and 21 post-infection vlsE , is a contiguous upstream array of 15 silent cassettes separated from each other by 17 bp direct repeats, which also flank the vlsE variable region and used to transform the infectious B. burgdorferi B31 clone 5A4 B. burgdorferi transformants, they were screened using PCR with various primer combinations (Panel 1) and the absence of the expected deleted sequences (∼500 bp) from the disrupted target gene (Panel 2) were first confirmed using the indicated primer sets. The target gene was also amplified (Panel 3) to confirm the approximate 0.7kb size increase relative to wild-type DNA due to the insertion of the gentamicin resistance cassette. Finally, the correct insertion site was verified using combinations of the target and knockout primers to amplify the insertion boundaries (Panel 4). In addition to the PCR analyses, gene disruptions were independently confirmed by Southern hybridizations using probes specific to the gentamicin resistance cassette and the deleted portion of the target gene .A systematic approach was undertaken to disrupt 21 different genes in order to investigate their role in inations Fig. 1B.gent cassette. This was accomplished by either changing the polarity of the gentamicin resistance cassette relative to the gene target, or by adding (or removing) a T7 transcriptional terminator. Three gene targets required reconstruction of the knockout plasmid in order to successfully obtain B. burgdorferi gene disruptions. recJ was first attempted without the T7 terminator in the reverse orientation and resulted only in merodiploids. The gentamicin resistance cassette in the forward orientation with the T7 terminator did result in knockouts and further attempts were halted. The sbcD knockout was first attempted with a construct containing the T7 terminator and the gentamicin resistance cassette in the reverse orientation. This attempt resulted only in merodiploids; however, when the polarity was changed to the forward orientation, allelic exchange was successful. The recA disruption was also difficult to obtain. Unsuccessful attempts were first made with the gentamicin resistance cassette in the forward orientation with and without the T7 terminator. When the T7 terminator was removed and the gent gene was in the reverse polarity, true knockouts of the recA gene were obtained. Difficulty in obtaining a recA gene disruption has also been previously reported recA null mutant has been previously constructed with the insertion of a kanamycin resistance cassette in the forward orientation dnaB, hbb, recB and recC knockouts were not obtained despite changing the polarity of the gentamicin resistance cassette and adding or removing a T7 transcriptional terminator.Of the 21 DNA replication, repair and recombination gene knockouts attempted, 17 were successful Table 1.B. burgdorferi clones lacked plasmids that are not required for infection or persistence as follows: recJ1 lacks lp28-2, mag2 lacks lp28-4, ruvA1 is missing cp9, mutL2 lacks cp9 and cp32-3, nucA1 lacks lp21 and cp32-3, ruvB5 lacks lp28-4 and cp9 and priA3, recA2 and recA3 are missing cp9. The possible effect of the mutations on growth of B. burgdorferi in culture was assessed by performing growth comparisons of each of the mutants with the wild-type clone 5A4. All mutants displayed growth curves that were indistinguishable from the parent strain (data not shown).For each gene disruption two clones were chosen which contained the full plasmid complement required for infectivity, as determined by PCR screening with primers specific to the plasmids. Most mutant constructs contained the full complement of plasmids found in the parental clone B31 5A4 vlsE. The upper portion of vlsE have been cleared vlsE was amplified from DNA isolated from day 21 ear cultures and analyzed using RFLP assays as described in P assays Fig. 2, sbcD, sbcC and BBG32) switching was monitored and shown to occur using the RFLP assay. For the remainder of the mutant strains, infections were allowed to continue until day 35. At this time the mice were euthanized and spirochetes cultivated from heart, bladder, joint and ear. RFLP switching assays indicated that switching at vlsE had occurred in all mutant strains from tissues where spirochetes could be recovered at day 35, with the exception of those carrying the ruvA or ruvB mutations, whose functional genes encode the two subunits for a Holliday junction branch migrase ruvA and ruvB mutant strains recovered from organ harvest at day 35 were negative for switching by RFLP, DNA sequencing analysis revealed that switching had occurred at low efficiency (data not shown).The lower portion of B. burgdorferi strains that did not show switching in wild-type C3H/HeN mice using the RFLP assay (ruvA and ruvB) and five other mutants that displayed a decreased persistence at day 21 were used to infect SCID C3H/HeN mice, which lack an acquired immune response. This effectively removes the selective pressure on antigenic variation and allows B. burgdorferi mutants with defective switching at vlsE to persist in the host. Direct analysis of vlsE switching beyond 21 days post-infection can, therefore, be performed in SCID mice, whereas by this time non-switching spirochetes would be cleared in a wild-type mouse ruvA and ruvB mutant strains, which did not switch in wild-type mice using the RFLP assay and which showed greatly reduced levels of persistence at day 21 as well as two mutants that were shown to switch by RFLP at 35 days in wild-type mice, but that displayed no spirochetes in ear cultures at 21 days (recJ and mutL).The RFLP assay used here provides a quick and convenient assay method to detect switching at vlsE variable region) was amplified from the spirochetes recovered from four different tissue types at day 35 for each SCID mouse and gel purified and non-templated nucleotide changes vlsE had occurred displayed a unique sequence; hence, all switch variants from each mouse represented independent switching outcomes.For DNA sequencing studies the same PCR product used for the RFLP assay differing from the wild-type vlsE sequence in ruvA and no changes observed in any of the 40 ruvB clones. The single clone demonstrating switching at vlsE in the ruvA mutant was from a clone cultivated from joint that displayed at least four exchanges with silent cassettes and did not show any features with obvious differences from switching in wild-type B. burgdorferi. The P-values indicated a significant difference (<0.05) in the incidence of switching for all tissues, with the exception of the ruvA mutant in joint. These results corroborated the negative switching phenotype of the ruvA and ruvB mutants observed in the RFLP switching assay after infection of wild-type and SCID mice and gave similar results tissues or in three of the four four (sbcD and BBG32) tissue types (data not shown).Clones carrying a and ear Fig. 3. see also . DNA seqvlsE, some non-templated changes (NTCs), where new sequence at vlsE did not correspond to the sequence found in any of the silent cassettes, were also observed vlsE sequences analyzed for wild-type and ruvB clones. In ruvA, four NTCs were observed in non-switching clones and three in the single clone that switched. In the mutL mutant there were five NTCs and all of these occurred in clones that did not switch. Finally the recJ heart sample had six NTCs in three clones, two of which switched. Taken together there were a total of 18 NTCs in the ruvA, mutL and recJ mutants.In addition to the apparent templated nucleotide changes observed in switches at B. burgdorferi genes believed to be involved in DNA recombination, repair and/or replication to investigate their possible roles in recombinational switching at the vlsE locus. Seventeen genes were successfully disrupted. Three of these gene disruptions required either reversing the polarity of the gentamicin resistance cassette or adding (or removing) a T7 transcriptional terminator. Previous attempts at recA insertional mutation have either been unsuccessful recA disruptions were obtained only in the absence of a T7 terminator and with the aacC1 in the reverse orientation relative to recA, underscoring the importance of the transcriptional features in the drug resistance cassette when attempting B. burgdorferi gene disruptions. It is also worthy of note that although our gene disruption mutants carry both an ∼500 bp deletion of the target gene as well as an insertion of the aacC1 gene, expression of a partial gene product with some level of functionality cannot be rigorously ruled. Antiserum to the 17 disrupted genes is not currently available and immunoblotting experiments could therefore not be performed.Attempts were made to generate 21 disruptions in dnaB (a replicative helicase), recB or recC and hbb . Because switching events at vlsE usually involve short stretches of DNA Candidate genes involved in antigenic variation were identified by mouse infections in C3H/HeN and SCID mice. Initial screening for switching utilized an RFLP assay in wild-type mice followed by DNA sequencing of clones recovered from organ harvest cultures from SCID mice at 35 days post-infection. Analysis of the number of switching events and the source (silent cassette) of the new sequences at ypes see ; hence, gdorferi Fig. 3. ruvAB mutants, which are required for switching at vlsE, the remainder of the genes we disrupted were dispensable for animal infection. The major DNA assault expected by a microbe upon animal infection is oxidative DNA damage originating from the innate immune response. However, due to a lack of iron in B. burgdorferi, oxidative damage of DNA appears to be much lower than in other organisms, such as E. colivlsE switching in C3H/HeN mice to help mediate the process. The expendability of RecA for antigenic variation in B. burgdorferi is also a stark difference from antigenic variation systems in other organisms, as will be discussed below.Homologous recombination in bacteria is typically initiated by RecA-mediated pairing and strand invasion B. burgdorferi RuvA and RuvB share 32% and 48% identity with their E. coli orthologues, respectively. ruvAB mutants in E. coli have only modest defects in homologous recombination. However, these defects become significant when there are also mutations in other recombination proteins, such as recBC, recG and sbcBCB. burgdorferi.The RuvAB complex is required for homologous recombination and facilitates ATP-dependent branch migration of heteroduplex DNA in Holliday junctions ruvA and both ruvB mutant strains reported here was as previously observed for strains lacking either lp28-1 vls locus ruv mutant strains was observed in all cases in SCID mice , genetic complementation in B. burgdorferi is frequently difficult to achieve, for reasons not currently understood. We nonetheless argue for the absence of secondary mutations in the mutant B. burgdorferi strains based upon the following arguments: 1) Our studies were performed with two independent mutations in both the ruvA and ruvB genes. The four independent mutant strains demonstrated the same phenotype, making the existence of secondary mutations exceedingly remote. 2) Although not a strict genetic complementation, the rescue of persistent infectivity in all four ruv mutants following the infection of SCID mice is compelling evidence for the absence of any secondary mutations affecting infectivity. 3) Similar results and conclusions with ruv mutants made by transposon mutagenesis in the accompanying idependent study from the Norris lab vlsE.The phenotype and the dramatic inhibition of switching at vlsE Fig. 3 oB. burgdorferi does not encode a RuvC orthologue and has no characterized junction resolving enzyme. This leaves unanswered the question of how recombination intermediates involved in homologous recombination or switching at vlsE are processed. A series of putative LE family exonucleases encoded by the cp32 family of circular plasmids has been proposed as possible substitutes for RuvC in B. burgdorferiB. burgdorferi.A companion protein to RuvAB in most bacteria is the Holliday junction resolving enzyme RuvC. mutL and recJ are both players in bacterial mismatch repair E. coli MutL acts as a liaison between MutS, which recognizes the mismatch, and MutH which is responsible for introducing a nick on either side of the mismatch. Both mutS1 and mutS2 are present in the B. burgdorferi genome, but disruption of either gene did not affect the infectivity phenotype in wild-type mice or switching as assayed by RFLP. There is no identifiable mutH orthologue in B. burgdorferimutL resulted in a modest decrease in switching at vlsE that was significant (Table S3) in heart and bladder but not in ear and joint. The results did not allow a clear-cut conclusion on the involvement of MutL in switching as demonstrated for RuvA and RuvB. Further analyses will be required to derive an unambiguous answer to this question. It is possible that MutL plays a role in recombinational switching at vlsE, but that another B. burgdorferi protein can substitute for MutL because of functional redundancy. In such a case a double knockout will be required for further investigation; however, a functional paralogue of MutL has not been identified in B. burgdorferi at this time. It is also possible that the reduction in switching in mutL mutants results from a decreased level of fitness and a slower growth rate of the mutant in the mouse . Again, the results did not permit an unambiguous conclusion as to the possible involvement of RecJ in switching at vlsE. The slightly decreased vlsE switching phenotype observed in B. burgdorferi could be a result of redundancy of function for recJ and recD as has been previously reported in E. colirecD recJ double mutant, if viable, might provide further information regarding the role of recJ in vlsE recombination. Alternatively, the decrease in switching might simply reflect a decreased level of fitness and infectivity of the mutant spirochete in the mouse and there may be no direct role of RecJ in switching at vlsE.RecJ is a 5′ to 3′ exonuclease that in mutL and recJ were the only genotypes sequenced that also contained non-templated nucleotide changes (NTCs). mutL had five NTCs while recJ had six for a total of eleven across 7 clones. The NTCs in this study occurred predominantly in invariable regions where nucleotide changes are not normally observed. An explanation for why NTCs were only observed in mutL and recJ could be due to their involvement in the mismatch repair pathway. These data suggest that these repair proteins are normally operative at vlsE to correct mismatches and would, therefore, normally be temporally and spatially positioned to play a role in the switching process as well. Recent work on switching at vlsE has reported that approximately 15% of wild-type vlsE variants carry NTCs ruvA or ruvB mutant clones. We have no explanation for this discrepancy.Finally, it is noteworthy that N. gonorrhoeae and the protozoan parasite Trypanosoma brucei. Both of these organisms require either RecA vlsE in B. burgdorferi. In N. gonorrhoeae the recFOR pathway is also involved and disruptions in recQ, recO, recR or recJ result in elimination or fairly dramatic reductions in antigenic variation B. burgdorferi does not carry recO, recR or recQ orthologues and disruption of recJ did not demonstrate a clear role for its encoded protein in switching at vlsE. The Holliday junction resolution pathway was also found to be important in N. gonorrhoeae, with disruptions in these genes resulting in a dramatic decrease in antigenic variation B. burgdorferi we found the RuvAB branch migrase to be required for switching at vlsE, however, there is no known ruvC orthologue and disruption of recG, which encodes a helicase that can function in Holliday junction migration, does not affect switching at vlsE. In summary, the process of recombinational switching at the vlsE locus shows very dramatic differences in protein requirements compared to the antigenic variation process in N. gonorrhoeae, with only the RuvAB branch migrase in common. Further studies on the recombinational switching underlying antigenic variation will be required to unravel the elusive molecular details of this fascinating process.While a wide variety of bacterial and protozoan pathogens employ antigenic variation systems driven by gene conversion Borrelia burgdorferi 5A4, derived from the type strain B31 2 environment for plating). Bacterial density was determined using a Petroff- Hausser Chamber (Hausser Scientific Partnership) and dark-field phase contrast microscopy with a Nikon Eclipse E400 microscope. E. coli DH5α was used for all knockout plasmid construction and maintenance. B. burgdorferi 5A4 were transformed as previously described with 25–50 µg of knockout plasmid DNA 2. Recovery cultures were added to BSK II with 6% rabbit serum to a final volume of 50–100 ml and supplemented with 200 µg/ml gentamicin after which 250 µl aliquots were distributed into 96-well plates and incubated at 35°C and 1.5% CO2 until some wells with a visible color change from red to yellow were observed, usually between 8–12 days. Yellow wells were chosen for PCR analysis.Infectious B. burgdorferi B31 5A4 Table S1) with 5′ NheI restriction sites were designed within the target gene such that the amplicon produced did not contain approximately 500bp from the center of the target gene . The inverse PCR product was purified using the QIAquick PCR Purification Kit (Qiagen). The flgB promoter-driven gentamicin resistance cassette (aacC1) was used to disrupt the B. burgdorferi target gene. This cassette was incorporated into the knockout plasmid by amplifying the flgB promoter-driven gentamicin resistance gene from the plasmid shuttle vector pBSV2G 5′ CTG CTA ACA AAG CCC GAA AGG AAG CTG AGT TGG CTG CTG CCA CCG CTG AGC AAT AAC TAG CA TAA CCC CTT GGG GCC TCT AAA CGG GTC TTG AGG GGT TTT TTG 3′) was also used. This cassette was constructed using overlap extension PCR. The gentamicin resistance gene was amplified from pBSV2G using primers B820 and B1350, and the T7 terminator, originally from the pGEM-T easy vector (Promega), was amplified from a plasmid construct (pTAKanT7t) generously provided by Scott Samuels using primers B1349 and B1345. Following NheI (New England BioLabs) digestion the gentamicin resistance cassette and knockout plasmid backbone were ligated and used to transform DH5α, with selection using 10µg/ml gentamicin, with the addition of 50µg/ml kanamycin when the pCR BluntII-TOPO vector was used.Primers for amplifying a centrally located ∼1500 bp portion in the gene of interest were designed according to the published sequence information (accession numbers NC_001318 and NC_001852) bona fide gene disruptions and to distinguish them from merodiploids. PCR was performed using Taq polymerase (New England BioLabs) and a combination of primers to confirm legitimate allelic exchange . Standard procedures were used to pre-hybridize, hybridize and wash the blots Southern hybridization analysis was used for verification of legitimate allelic exchange in the mutants selected for further study. Approximately 600ng of genomic DNA, prepared using the Wizard Genomic DNA Purification Kit (Promega) or mini-genomic DNA preps SCIDPrkdc/IcrSmnHsd (SCID) mice were inoculated with 200 µl of 1×104 spirochetes/ml, in two 100 µl doses via dorsal subcutaneous and intraperitoneal injection. At seven days post-infection, 50 µl of blood was taken from the saphenous vein on the hind leg of the mouse under aseptic conditions. The exposed vein was opened using a needle prick and the pooled blood was drawn with a pipette. The pipette tip used to draw the blood was first coated with 0.5M EDTA to prevent clotting. The blood sample was suspended in 1.7ml BSK II supplemented with 6% rabbit serum and 1× Borrelia antibiotic cocktail and cultivated as described above. Ear biopsies were performed at days 14 and 21 and the recovered material was cultivated in 1.5ml of BSK II supplemented with 6% rabbit serum and 1× B. burgdorferi antibiotic cocktail for one to five weeks. The presence or absence of spirochetes was periodically monitored by dark-field microscopy. When necessary, a 35 day organ harvest was performed and the heart, bladder, joint and ear biopsy samples were removed aseptically and cultured in 1.7ml of BSK II supplemented with 6% rabbit serum as noted above.All animal infections were carried out in accordance with approved protocols from the University of Calgary Animal Research Centre and were approved by the University of Calgary Animal Care Committee. Three to four week old male C3H/HeN (wild-type) or three to five week old male C3H.C-vlsE locus was determined by a restriction fragment length polymorphism (RFLP) assay using the 775 bp product of PCR amplification of the vlsE expression site using primers B248 and B249 Switching at the vlsE, mutant B. burgdorferi strains were used to infect C3H/HeN SCID mice. Switching in SCID mice was characterized through sequencing of the variable regions of the vlsE expression site. PCR amplification was performed using primers B248 and B249 on 1µl of BSK-II cultures, grown to a density of 1×106 spirochetes/ml, taken from glycerol stocks of the heart, bladder, joint and ear organ harvests for each mouse. Reaction conditions were as follows: 98°C for 2 minutes, 28 cycles of 98°C for 10 seconds and 72°C for 30 seconds, followed by a final extension of 72°C for 5 minutes. PCR products were visualized and quantified on a 1% agarose gel run in TAE buffer at 75V for 1.5 hours, stained with 0.5 µg/ml ethidium bromide. Equimolar portions of the PCR product from each of the four mice (two mice for each clone) and each tissue type were combined to give a total of four samples: heart, bladder, joint and ear for each genotype investigated. These PCR products were run on a 1% agarose gel and the 775 bp PCR product was excised and gel purified using the Qiagen Gel Extraction Kit (Quiagen). The PCR fragments were cloned into the pJET1.2/blunt vector and used to transform E.coli DH5α. The transformations were plated on LB agar plates containing 100 µg/ml carbenicillin at 37°C. In preparation for sequencing, 10 colonies of each tissue type for each mutant were picked and grown in five ml LB supplemented with100 µg/ml carbenicillin for a total of 40 samples from each genotype. These cultures were grown overnight at 37°C and plasmid DNA was isolated using the Qiagen 96 Turbo miniprep kit (Qiagen). The University of Calgary Core DNA Services sequenced 500 ng of the plasmid DNA with the pJET1.2forward sequencing primer in a 96 well format using an Applied Biosystems 3730XL 96 Capillary Sequencer .For detailed analysis of switching at vlsE sequencing results for each tissue type in each mutant to the parental vlsE sequence of B.burgdorferi 5A4 were performed using the Seqman DNASTAR-Lasergene v6 Software. Templated nucleotide changes, those corresponding to the sequence of at least one silent casette, were counted in each variable region as well as the invariable regions and noted (Table S3). Additionally, non-templated changes were documented (data not shown). It is important to note that each of the 10 sequences obtained for each tissue type for each mutant were different and, therefore, all sequenced clones represented completely independent switching outcomes. Results were analyzed on a tissue-specific basis via two methods . The second method used to analyze switching was a comparison of data based on the number of nucleotide changes in each tissue for each mutant (Table S3). A two-tailed non-parametric Mann-Whitney student t-test was used to determine the P-values of these data (Graph Pad Prism).Alignments comparing the cloned methods Fig. 3. Figure S1flgB promoter (blue) with Nhe I sticky ends. The knockout plasmids were propagated in E. coli strain DH5α.Strategy for the construction of knockout plasmids. Construction of the knockout plasmids was accomplished by PCR amplification of an approximate 1.5 kb central portion of the target gene (yellow) inserted into a commercial blunt-end cloning vector. Inverse primers see with Nhe(0.24 MB PDF)Click here for additional data file.Figure S2mutL, sbcD and ruvA disruptions was digested with HindIII and run on a 1.2% agarose gel with a 1kb molecular weight ladder (M). Probes complementary to the gentamicin resistance cassette were used to probe for the gent insertion (left panel). pBSV2G served as the positive control (c+) and B. burgdorferi 5A4 genomic DNA served as the negative control (wt). mutL1 and 2, sbcD1 and 2 and ruvA1 and 2 clones displayed the expected fragments of 5.5kb, 7.4kb, and 2.8kb respectively. In the right hand panel, probes complementary to the deleted portion of the target gene were generated using the knockout primers Click here for additional data file.Table S1Primers used in this study.(0.03 MB PDF)Click here for additional data file.Table S2Southern blot analysis.(0.02 MB PDF)Click here for additional data file.Table S3vlsE aequence data.Expanded C3H/HeN SCID (0.14 MB PDF)Click here for additional data file.

In some younger preoperative AIS girls, the hypothalamic up-regulation to circulating leptin also involves the somatotropic (growth hormone/IGF) axis which exaggerates the sympathetically-induced asymmetric skeletal effects and contributes to curve progression, a concept with therapeutic implications. In the somatic nervous system, dysfunction of a postural mechanism involving the CNS body schema fails to control, or may induce, the spinal deformity of AIS in girls . Biomechanical factors affecting ribs and/or vertebrae and spinal cord during growth may localize AIS to the thoracic spine and contribute to sagittal spinal shape alterations. The developmental disharmony in spine and trunk is compounded by any osteopenia, biomechanical spinal growth modulation, disc degeneration and platelet calmodulin dysfunction. Methods for testing the theory are outlined. Implications are discussed for neuroendocrine dysfunctions, osteopontin, sympathoactivation, medical therapy, Rett and Prader-Willi syndromes, infantile idiopathic scoliosis, and human evolution. AIS pathogenesis in girls is predicated on two putative normal mechanisms involved in trunk growth, each acquired in evolution and unique to humans.Anthropometric data from three groups of adolescent girls - preoperative adolescent idiopathic scoliosis (AIS), screened for scoliosis and normals were analysed by comparing skeletal data between higher and lower body mass index subsets. Unexpected findings for each of skeletal maturation, asymmetries and overgrowth are not explained by prevailing theories of AIS pathogenesis. A speculative pathogenetic theory for girls is formulated after surveying evidence including: (1) the thoracospinal concept for right thoracic AIS in girls; (2) the new neuroskeletal biology relating the sympathetic nervous system to bone formation/resorption and bone growth; (3) white adipose tissue storing triglycerides and the adiposity hormone leptin which functions as satiety hormone and sentinel of energy balance to the hypothalamus for long-term adiposity; and (4) central leptin resistance in obesity and possibly in healthy females. The new theory states that AIS in girls results from developmental disharmony expressed in spine and trunk between autonomic and somatic nervous systems. The autonomic component of this The autonomic nervous system through its hypothalamic neuroendocrine control of puberty, menarche and skeletal growth -3 contridouble neuro-osseous theory for AIS pathogenesis in girls postulates developmental disharmony between somatic .double neuro-osseous theory generally depends on the relative contribution and outcome of the disharmony according to the y Figure between:a) vertebral growth plate asymmetries in up to three dimensions arising wholly or in part from dysfunction in the autonomic nervous system -29;b) postural control, with or without asymmetries, of a rapidly enlarging and actively moving ,71,149 aExplanations for undisputed facts about AIS, (2) Predilection for females b)).c) postural maturity concept, items 11 & 12).da et al suggesteda et al ,20. LateLittle discussed features of AIS pathogenesis are:• Prescoliotics of both sexes show body height, sitting height, and growth of sitting height greater than in non-scoliotic children ,136.• Early radiological maturation at 11-12 years of age in AIS subjects .• Early adolescent skeletal growth attained for age by AIS girls ,135-141.Together, these observations suggest that, collectively, AIS girls have a growth pattern different from normal, involving growth factors connected to the disease ,151, conPeriapical ribs longer on the concavity of right thoracic AIS in elderly scoliosis cadavers were found and givesentinels of vertebral and/or rib growth plate asymmetries and having pathogenetic significance. There is some evidence of a primary vertebral growth plate disorder in AIS concept, item 3).BMI is usually expressed as weight in kg/height in mitiative . BMI doeIn girls with AIS and young adults with scoliosis, lower body mass index -165 has There is a trend towards increasing numbers of adolescents with AIS in the overweight category ,171. TheFTO and MC4R (melanocortin-4 receptor) have been reproducibly associated with body mass index (BMI) . They rsitivity ,250 as d , a, a269], sensitivity of hypothalamic sympathetic functions and, in some girls, of the somatotropic axis, which subsequently develop an inverse relationship. We speculate that AIS arises from dysfunction of the normal LHS-driven mechanism to circulating leptin leading to hypothalamic asymmetry. The asymmetry is viewed as an adverse response to stress ..152].signal of thoracic vertebral and/or rib length asymmetry Left-right extra-spinal skeletal length asymmetries Figure with uppy Figure .up-regulation) involves the somatotropic (GH/IGF-I) axis ; andb) counter-rotations of upper thorax and arms (but not the head) providing counter-balancing torques generated by shoulder girdles and arm-swinging needed to oppose torques created by the pelvic rotations of hominin bipedalism ,268,303.Brain and pelvic depth. The large fetal brain size enabling a dramatic jump of adult brain size from about 0.5 mya, was made possible by further expansion of the birth canal, particularly sagittally (pelvic depth) Figure is is The pLHS concept for AIS pathogenesis suggests that the putative genetically-determined selectively increased hypothalamic sensitivity (up-regulation from mutations) to leptin leading to hypothalamic sympathetic asymmetry is rooted in the evolutionary origins of hominin fat deposition providing the energy needed for trunk width growth and later, brain growth and metabolism. We posit that increasing levels of circulating leptin associated with fat accumulation of adolescent girls whi whicentric axis ,122energ concept ,111.LHS concept) [(12) The autonomic nervous system component of the theory (concept) draws ev• thoracospinal concept for the pathogenesis of right thoracic AIS in girls -63;sympathetic nervous system to bone formation/resorption and bone growth [• new neuroskeletal biology relating the e growth -198;leptin secreted by adipose tissue which functions as a sentinel of energy balance and long-term adiposity to the hypothalamus; and• white adipose tissue, the adiposity hormone • central leptin resistance in obesity and possibly in healthy females.(13) A new hypothesis for AIS pathogenesis in girls is formulated incorporating white adipose tissue, energy homeostasis (bioenergetics), the hypothalamus and sympathetic nervous system, in a disorder presenting as asymmetric abnormalities of trunk growth and, as suspected in preoperative girls, with systemic skeletal overgrowth.LHS concept are discussed. An immediate need is to evaluate circulating hormone levels in AIS girls by relatively higher and lower BMI subsets; and later a possible clinical trial of medical treatment by a somatostatin analogue and β-blockers.(14) The endocrine and therapeutic implications of the (15) Some methods for testing the theory's hypotheses are outlined.sequentially for each of:(16) The putative hypothalamic dysfunction is thought to have an evolutionary origin in hominid fat deposition which in more than 3 million years, may have provided energy needed • trunk width growth at the pelvis , Figures and 12;• trunk width growth of upper thorax and shoulders Figures and 11; • brain growth with• pelvic depth increase Figure .We postulate that white adipose tissue still provides for skeletal growth processes in fetal and post-natal normal human development -302.central leptin resistance of the somatotropic (GH/IGF) axis to prevent too much energy being invested in female skeletal growth, thereby conserving energy for reproductive development. AIS is viewed as expressing central leptin sensitivity of hypothalamic sympathetic function and, in some younger preoperative girls, of the somatotropic neuroendocrine axis In some normal juvenile girls, but not boys, the hypothalamus may function with In some (18) A new interpretation involving the hypothalamus for some melatonin-deficient mouse models of scoliosis is presented.infantile idiopathic scoliosis is outlined suggesting a need to evaluate the hypothesis that white and brown adipose tissue, leptin, hypothalamus and the sympathetic nervous system may play a role in its pathogenesis.(19) Evidence for The authors declare that they have no competing interests.RGB and RKA undertook the day-to-day research producing results which RGB interpreted theoretically in relation AIS pathogenesis in discussion with MPG, PHD, AM, TLR and SIA. MPG has expert clinical knowledge of scoliosis, PHD in human growth studies including scoliosis, AM in research relating to pediatric orthopedics, TLR expert clinical knowledge of pediatric endocrinology and diabetes, and SIA special knowledge of bone biology.Some theories of AIS pathogenesis [ogenesis (1) Genetics -79.(2) Biomechanical spinal growth modulation -82.(3) Relative anterior spinal overgrowth (RASO) -90.(4) Dorsal shear forces and axial rotation instability ,91.(5) Asynchronous spinal neuro-osseous growth ,65,92,93(6) Postural abnormalities and hind brain dysfunction ,94-103.(7) Motor control problem .(8) Body-spatial orientation concept .(9) Neurodevelopmental concept ,106.(10) Thoracospinal concept -63.(11) Systemic melatonin deficiency -9.(12) Systemic melatonin-signaling pathway dysfunction -20.(13) Systemic platelet calmodulin dysfunction ,22,107.(14) Symmetry control dysfunction - developmental instability -110.(15) Collective and escalator models ,111.LHS) dysfunction with disharmony between somatic and autonomic nervous systems in the spine and trunk [(16) Leptin-hypothalamic-sympathetic nervous system (nd trunk -29.

It is believed that epistatic interactions among loci contribute to variations in quantitative traits. Several methods are available to detect epistasis using population-based data. However, methods to characterize epistasis for quantitative traits in family-based association analysis are not well developed, especially for studying thousands of gene expression traits. Here, we proposed a linear mixed-model approach to detect epistasis for quantitative traits using family data. The proposed method was implemented in a widely used software program SOLAR. We evaluated the power of the method by simulation studies and applied this method to the analysis of the Centre d'Etude du Polymorphisme Humain family gene expression data provided by Genetics Analysis Workshop 15 (GAW15). With the ability to measure simultaneously thousands of gene expression traits, understanding the causes of transcriptional variation has been of great interest. Genetic interactions, also called epistasis, have been shown to affect gene expression phenotypes. For example, Brem and Kruglyak found thSeveral statistical methods for studying epistatic interactions between loci for quantitative traits using populations of unrelated individuals or from experimental designs have been developed -6. For qIn this paper, we have extended the association-based linear regression model ,3 by addBased on the linear regression model of Cokerham and Zeng under the general dependency assumption [p-values equal to or less than 0.05 (FDR ≤ 0.05) are considered to be significant.To detect epistasis, for each gene expression phenotype, we ran Model (1) in SOLAR for each pair of single-nucleotide polymorphisms (SNPs) in the selected candidate regions (see Description of the data set for more details). The number of tests for each gene expression phenotype ranges from 6 to 820, depending on the marker density and size of the candidate regions selected for the epistasis search. For each gene expression phenotype, individual sumption within eiaa. Phenotypes of each individual was generated based on the Model (1), where a1 = 0.2, d1 = 0.01, a2 = 0.2, d2 = 0.01, iad = ida = idd = 0, β = 0.1 (the vector W only contains sex), iaa = 0.7 and iaa = 0, respectively. These values were chosen based on the estimated values from analysis of selected 27 traits in the CEPH family data. We plotted receiver operating characteristic (ROC) curve by calculating specificity and sensitivity as we varied the nominal threshold for determining the significant epistasis, where:We simulated a data set based on the pedigree structure from CEPH family data, which has 14 three-generation families of 194 individuals. We considered two unlinked diallelic markers in our analysis with allele frequency of 0.5. Marker genotypes for the grandparents were generated assuming Hardy-Weinberg equilibrium at each locus. Genotypes for parents and children were simulated conditional on their parental genotypes following Mendel's law. As an example we evaluated the power (true negative rate) and type I error of the proposed method in identifying additive-additive epistatic effect ® gene expressions measured for 194 individuals from 14 three-generation CEPH families. In addition, 2882 autosomal and X-linked SNPs were typed for these individuals.The CEPH family data provided by GAW15 includes 3554 AffymetrixThe software package pedStat as distributed in Merlin version 1.0.1 was usedcis effects (Table cis regulation (with cis peak markers) by the GWA analysis. For the phenotype PPAT there are two peak markers that point to both cis and trans regulation for this gene. For the remaining 12 phenotypes, the peak markers are trans markers. In our study, for each of the 27 phenotypes we selected a 15-Mb candidate region centered on the target gene location. If a trans peak marker was identified in the GWA analysis, we also selected an additional 15-Mb candidate region centred on that marker. We analyzed the epistatic effects for all possible combinations of the SNPs within the candidate regions.We limited our analysis to the 27 gene expression phenotypes with the strongest linkage evidence of iaa. In summary, simulation results indicate the proposed linear mixed model has high sensitivity (power) and specificity for detecting SNP-pair interaction in family data for two unlinked markers.We calculated the ROC profiles for detecting interacting SNPs using linear mixed Model 1). An ROC curve measures the trade-off between sensitivity and 1 - specificity for different cut-offs with SNPs. For example, the SNP rs1537638 is within the gene PTK7 (protein tyrosine kinase 7), which is located on chromosome 6 and shows significant interaction with the SNP rs1505694, which is close to the gene ITGB1BP1 (integrin β1 binding protein 1) on chromosome 2. This suggests that these two genes might physically or genetically interact with each other or be involved in the same biological process. In fact, proteins encoded by these two genes are indeed involved in the cell adhesion process, in which PTK7 is a receptor tyrosine kinase transducing extracellular signals across the cell membrane and ITGB1BP1 plays an important role during integrin-dependent cell adhesion by binding the β1 integrin cytoplasmic domain.When applying the linear mixed model to the analysis of the CEPH data, a total of six SNP pairs showed significant epistatic interactions for three gene expression phenotypes Table . Two outWe have presented an association-based method for detecting epistatic interactions for quantitative traits using family data, and applied this method to the analysis of gene expression phenotypes of CEPH family data provided by GAW15. When we applied the proposed method to the CEPH data, we detected six SNP pairs that showed significant epistatic interactions for 3 gene expression phenotypes among the 27 phenotypes analyzed. We study the epistasis among genes by analyzing the interactions of SNPs located in the corresponding genes. This kind of epistasis detected from statistical tests does not necessarily correspond to the classic model of epistasis. Strong epistatic interactions among SNPs may not always indicate biological interactions among genes.Although we demonstrated the association-based linear mixed-model approach for analyzing 27 phenotypes, the method is mainly proposed for analyzing thousands of phenotypes in genome-wide study. In general, one could identify two interacting linkage regions using two-dimensional genome linkage scan by allowing a higher a false-positive rate. Or one could do stepwise search of two interacting QTLs by identifying one primary QTL and then searching for the secondary QTL conditional on the primary locus being linked . Once thThe proposed linear mixed model could be implemented in two steps by first regressing out the fixed effects (not including genetic effects) and polygenic effects and then detecting genetic interaction effects using predicted residuals from the first-step analysis. This strategy is attractive because of its flexibility in identifying the best statistical model for the joint effects of loci and computational efficiency for analyzing thousands of gene expression traits in genome-wide study.The author(s) declare that they have no competing interests.

The dihedral angle between the two benzene rings is 2.8 (5)°, while the carboxyl group forms a dihedral angle of 88.5 (1)° with the pyrrole ring. Inter­molecular O—H⋯O hydrogen bonds may contribute to the overall stabilization of the crystal structure.In the title compound, C Å b = 5.340 (3) Å c = 13.134 (7) Å β = 97.756 (8)°V = 2229 (2) Å3 Z = 8 Kα radiationMo −1 μ = 0.09 mmT = 93 K 0.40 × 0.30 × 0.08 mm Rigaku SPIDER diffractometerAbsorption correction: none8360 measured reflections2534 independent reflectionsI > 2σ(I)1749 reflections with R int = 0.067 R[F 2 > 2σ(F 2)] = 0.048 wR(F 2) = 0.093 S = 1.00 2534 reflections159 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.22 e Å−3 Δρmin = −0.25 e Å−3 Δρ RAPID-AUTO used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809043463/cs2123sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809043463/cs2123Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Panax quinquefolius on diabetes is yet to be elucidated. Recent studies show that Panax quinquefolius increases insulin production and reduces the death of pancreatic beta cells. Mechanism studies indicate that Panax quinquefolius improves cell's immuno-reactivity and mitochondrial function through various factors. Clinical studies show that Panax quinquefolius improves postprandial glycemia in type 2 diabetic patients. Further studies to identify the component(s) of Panax quinquefolius linked with pancreatic islets/beta cells in vitro and in vivo are warranted for better understanding of the full effects of Panax quinquefolius.The mechanism of the beneficial effects of Increasing steadily in case numbers, diabetes mellitus has become a devastating illness with significant morbidity and mortality around the globe ,2. TherePanax quinquefolius L. and Panax ginseng CA Meyer [Panax ginseng increases blood flow and decreases fatigue. Experimental studies indicate that Panax ginseng alleviates oxidative stress generated by diabetes through the inhibition of lipid peroxidation [Panax quinquefolius has anti-aging effects, aids digestion [Panax quinquefolius may improve psychological conditions, immune function and conditions associated with diabetes ,8,9. Accxidation . On the es Table . Overallenelzine . HistoriPanax ginseng can be distinguished from Panax quinquefolius by using ginsenoside profiles because Panax ginseng contains ginsenoside Rf which is absent in Panax quinquefolius [Panax ginseng were studied in diabetic C57BL/6J ob/ob mice. The results indicate that the total ginsenoside extract has significant anti-hyperglycemic and anti-obesity properties [-diabetic rats in a dosage dependent manner [The main active components in ginseng responsible for ginseng's medical value have been identified as glycosides. Glycoside is a naturally occurring substance consisting of a sugar and non-sugar moiety. Some glycosides belong to a family of compounds named saponins which produce froth under agitation by reducing water surface tension. A group of saponins in ginseng have been named ginsenosides and classified into subclasses as Ro, Ra, Rb, Rc, Rd, Re, Rf, Rg and Rh. These ginsenosides can be differentiated in thin layer chromatography (TLC) based on their retention factor value, which is the distance that ginsenosides travel up the TLC column . Panax guefolius . The antoperties . In the operties . Rh2, ant manner . Recent t manner .Panax quinquefolius lowers blood glucose in diabetic patients [Panax quinquefolius in stimulating insulin production/secretion and anti-apoptosis are dosage dependent, suggesting a biological specificity of ginseng water extracts on beta cells. A high dosage of Panax quinquefolius is probably required to reverse IL-1 beta induced apoptosis. According to a clinical study by Vuksan et al., Panax quinquefolius attenuated postprandial glycemia in both type 2 diabetic and non-diabetic patients. While no difference was found in postprandial glycemia between placebo and ginseng groups in non-diabetic subjects when administered together with glucose challenge, in subjects with type 2 diabetes significant reductions were observed when ginseng was taken 40 minutes before the glucose challenge [patients , increaspatients . The reshallenge .Panax quinquefolius has not been fully elucidated. According to our findings, Panax quinquefolius water extracts reversed an IL-1 beta induced increase of uncoupling protein-2 , decreased pro-apoptotic protein caspase-9 and increased the level of anti-apoptotic protein Bcl-2. This indicates that the anti-apoptotic effects of Panax quinquefolius may be achieved through regulating mitochondrial UCP-2 and ATP levels, thereby influencing insulin synthesis and apoptotic cascades in beta cells [Panax quinquefolius, there are other reports on additional factors targeted by ginseng such as immuno-reactivity [et al. reported that Panax quinquefolius exerted an anti-lipolytic effect on type 2 diabetic conditions through a signaling pathway different from that of insulin, suggesting that Panax quinquefolius not only affects pancreatic cells through increasing insulin production and cell viability, but also through creating an anti-lipolytic effect and targeting glucose receptors to counter hyperglycemia [Panax quinquefolius to improve hyperglycemia and treat diabetes.The mechanism for the beneficial effects of ta cells significantly hinders insulin production and inhibits cell viability. During apoptosis, cells shrink; chromatin condenses; DNA is cleaved into pieces at internucleosomal regions . The celpoptosis . Previoucapase-9 . In a stpression . IL-1 bepression . Panax qof Bcl-2 . FurtherPanax quinquefolius products. It is also not certain whether different ginseng species would have the same effects on hyperglycemia. Sievenpiper et al. discovered that Panax ginseng showed both null and opposing effects on acute postprandial plasma glucose and insulin, which did not coincide with the findings with Panax quinquefolius [Panax ginseng has the same effects on humans as it does in animal models.Due to a lack of standardization in the herbal medicine industry, it is not certain whether the beneficial effects on hyperglycemia hold true for all uefolius . Reproduuefolius . FurtherPanax quinquefolius increases cell insulin production and cell viability through mediating mitochondrial proteins and apoptosis factors. These findings confirm that Panax quinquefolius improves pancreatic islet functions. The components of Panax quinquefolius that improve pancreatic beta cell function have not been identified. The precise actions of Panax quinquefolius components on other human cells such as muscle cells and lipocytes under diabetes therapy are yet to be investigated.The author(s) declare that they have no competing interests.ZW proposed to cooperate in this project and provided information for the manuscript. JL conceived this project, collected information and wrote the first draft of the manuscript. LL worked with JL to conceive this project, collected references andinformation, wrote and approved the manuscript. All authors approved the final manuscript.

Early onset (EO) alcohol dependence (AD) has been found to represent a subtype of alcoholism with a distinct profile and prognosis compared to late onset (LO) alcohol dependence. Externalizing disorders, especially attention deficit hyperactivity disorder (ADHD) that may continue as attention deficit hyperactivity disorder, residual type in adulthood, may increase susceptibility to early-onset AD.To examine the relationship between ADHD and ADD, RT symptoms and age at onset of AD in a sample of Indian male patients. 70 male subjects with AD presenting to the De-Addiction Services of the National Institute of Mental Health and Neurosciences (NIMHANS), Bangalore, were studied. The study had a retrospective design.Patients were examined for evidence of past ADHD in childhood and current ADD, RT using structured instruments. Chi-square tests and odds ratios were used to express the relative risk of association of ADHD with early- and late-onset AD.P < 0.05) ADD, RT was also over-represented in EO probands.Significantly more EO alcoholics had a history of ADHD in childhood compared to LO alcoholics (7/28, 25%, The results of this study are consistent with previous research that shows a high incidence of ADHD in early-onset alcoholics. This may have important management implications. Early onset (EO) of alcohol dependence (AD) represents a discrete form of alcoholism2 which i52ADHD is one of the most studied disruptive behavior disorders in childhood. It usually first manifests by the age of 7 and is more common in boys (M: F = 2-3:1). Outcome studies of children with ADHD have showed that the disorder can persist into adolescence in 50-80% of cases.16 Althouet al.[et al.[et al.[Various studies have examined the co-occurrence of ADHD and substance use disorder in adolescents and adults. ADHD has been robustly associated with nicotine use disorder in mid-adolescence, as well 18et al. reportedet al.21–23 A fet al. of childet al. The assol.[et al. Impulsivl.[et al. Milin etl.[et al. reportedl.[et al.3070 male subjects aged 16-60 years, admitted for alcohol related problems to the De-addiction Centre at the National Institute of Mental Health and Neurosciences, India, who met ICD-10 Diagnostic Criteria For Research for AlcoThe patients who satisfied the criteria for AD were assessed and divided into Early Onset and Late Onset (LO - developed dependence after 25 years) groups. To minimize the potential overlap between these groups, subjects who had developed dependence after the age of 30 yrs were purposively selected. The severity of AD was rated using the Short Alcohol Dependence Data (SADD) questionnaire.th percentile of childhood hyperactivity. The PRS has been used by earlier researchers[34Two or more first degree relatives who lived in close contiguity to the subject - preferably the subjects’ mother and/or older siblings - who by reason of the extended or joint family systems commonly found in India, were likely to be most informative - were then interviewed to collect information on family history of AD, childhood symptoms of ADHD and current ADD, RT. If the mother or older sibling was not available, information was collected from at least three first-degree relatives. Family history of AD was collected using the Family Interview for Genetic Studies FIGS and retrsearchers3435 to rarchers34 based on70 subjects with AD were recruited. Of these, 37 had an EO of dependence and 33 had a LO. Of these, the records of seven subjects in the EO group and five in the LO group had to be discarded as there was insufficient data on both childhood ADHD and adult ADD, RT symptoms.t = 12.36, P<0.001). The two groups did not differ significantly on other demographic or clinical variables such as education, income, religion, marital status, residential status, and severity of alcoholism scores on the SADD.The EO subjects had a significantly lower age at onset of AD than the LO subjects and there was similar over-representation of ADD, RT in EO probands .The odds ratio of a subject with ADHD and/or ADD, RT developing EO alcoholism was 5.8. This was in contrast to the odds ratio of 0.17 obtained for subjects with ADHD and/or ADD, RT developing LO alcoholism .A significantly higher number of the EO subjects had a history of ADHD and/or ADD, RT compared to the LO subjects. The results of this study are consistent with previous research that show a high incidence of childhood ADHD and ADD, RT in substance abusers.2237–4022The odds ratio of subjects with ADHD and/or ADD, RT developing EO dependence was nearly 6:1 compared to those without comorbid ADHD. This supports the evidence that the presence of externalizing symptoms, especially ADHD, is an important risk factor for AD at an early age, and is in line with previous studies in this patient population.17 This aThe prevalence of ADHD in our sample was higher than in previous studies. However, most previous studies2122 have2170.8% of all subjects (17 of 24) in our study who had evidence of ADHD in childhood also had ADD, RT as adults. This data lends support to the finding that ADHD symptoms persist from childhood into adulthood in over 50% of cases.164016et al.[Several studies have shed light on the mechanisms underlying the association between disruptive behavior disorders and ADHD. Kuperman et al. found thet al. Various et al.26 impulset al. and seroet al.11 while The findings of this study must be interpreted in the context of several methodological limitations. Firstly, the retrospective assessment of ADHD relies heavily on the observation of informants, which may be coloured by recall and confounding biases, especially when delineating ADD, RT from alcohol-related behaviors. Secondly, the study sample was selected from a tertiary care center, and may have included severely ill patients, accounting for the high rates of comorbid ADHD. Other comorbidities, especially externalizing disorders, were not assessed, and the clinical profile of the two subgroups, apart from severity of dependence, was not compared, making it difficult to draw conclusions about the impact of comorbid ADHD. Thirdly, we do not have information on all those subjects who were screened and excluded from the study, or their socio-demographic or clinical variables. These people were excluded from the study at screening itself because neither parent was available to provide information. Finally, the study was cross-sectional in origin, so that course and outcome could not be commented upon.Nevertheless, these results strongly suggest a need for greater evaluation of ADHD in populations of adults with AD, especially those with an EO of AD, and more intensive management of this high-risk group in view of their poorer prognosis. Since treatment of ADHD in adolescents, including stimulants, is known to reduce substance use, including alcohol use,43 assess

There is little information about influenza disease among the Cambodian population. To better understand the dynamics of influenza in Cambodia, the Cambodian National Influenza Center (NIC) was established in August 2006. To continuously monitor influenza activity, a hospital based sentinel surveillance system for ILI (influenza like illness) with a weekly reporting and sampling scheme was established in five sites in 2006. In addition, hospital based surveillance of acute lower respiratory infection (ALRI) cases was established in 2 sites.The sentinel sites collect weekly epidemiological data on ILI patients fulfilling the case definition, and take naso-pharyngeal specimens from a defined number of cases per week. The samples are tested in the Virology Unit at the Institut Pasteur in Phnom Penh. From each sample viral RNA was extracted and amplified by a multiplex RT-PCR detecting simultaneously influenza A and influenza B virus. Influenza A viruses were then subtyped and analyzed by hemagglutination inhibition assay. Samples collected by the ALRI system were tested with the same approach.From 2006 to 2008, influenza circulation was observed mainly from June to December, with a clear seasonal peak in October shown in the data from 2008.Influenza activity in Cambodia occurred during the rainy season, from June to December, and ended before the cool season . Although Cambodia is a tropical country geographically located in the northern hemisphere, influenza activity has a southern hemisphere transmission pattern. Together with the antigenic analysis of the circulating strains, it is now possible to give better influenza vaccination recommendation for Cambodia. Influenza epidemics occur worldwide annually, resulting in considerable morbidity and causing 250,000 to 500,000 deaths annually worldwide . The epiPrior to the emergence of H5N1 related pandemic threat, influenza data were scarce in Cambodia as laboratory capacities were also limited. To better understand influenza in Cambodia, the NIC was established within a joint collaboration between the Center for Diseases Control Department/Ministry of Health and the Institut Pasteur in Cambodia (IPC) in August 2006. We summarize in this report data gathered from the Cambodian NIC which is based on sampling ILI patients from 5 sentinel outpatients' departments located across the country. Some of these sites were also selected for their proximity to neighboring countries since movement across the borders may result in importation of influenza strains. We also report influenza data during 2007 - 2009 from two hospitals in which IPC has collaborated with clinicians to determine bacterial and viral etiologies of inpatients with acute lower respiratory infections (ALRI).Cambodia is a country in Southeast Asia, bordered by Thailand, Laos, Vietnam and the Gulf of Thailand. Cambodia covers 181,035 square kilometers and consists of 27 provinces. As a tropical country, the climate has marked dry and rainy seasons of relatively equal length with averaging temperatures ranging from 24 to 38 degrees Celsius. The dry season runs generally from November to April and the rainy season starts in May-June and ends in October-November.The ILI surveillance encompasses 5 outpatients' departments located in the following provincial or referral hospitals: Takeo (southern Cambodia), Battambang (western Cambodia), Kampong Cham , a pediatric hospital in Siem Reap (north-west Cambodia) and the National Pediatric hospital in Phnom Penh capital . Since April 2007, the Institut Pasteur in Cambodia (IPC) has also collaborated with Takeo and Kampong Cham provincial hospitals to study the etiologies of acute lower respiratory infections among hospitalized patients. Each sentinel and study site was required to randomly collect nasopharyngeal swabs of 5 to 10 ILI patients per week all year long. For the hospital study we obtained nasopharyngeal samples from all hospitalized patients admitted to the two hospital sites collaborating with ALRI study. Swab specimens were immediately introduced into a sterile tube containing virus transport medium (VTM), kept in liquid nitrogen containers and transported to the Institut Pasteur in Phnom Penh on a weekly basis.Multiple respiratory viruses, including respiratory syncytial virus, parainfluenza viruses, adenovirus, and rhinovirus, can mimic influenza symptoms . Since tThe collected naso-pharyngeal samples were immediately frozen at the hospital in liquid nitrogen and the container was sent on a weekly basis to the IPC's Virology Unit where specimens were stored at -80°C prior to testing. Viral RNA was extracted from 140 μL of VTM by using the QIAamp Viral RNA Isolation Kit and amplified by multiplex reverse transcriptase-polymerase chain reaction (RT-PCR) detecting simultaneously influenza A virus, influenza B virus, respiratory syncytial virus and human metapneumovirus, as previously reported . InfluenThe comparisons between percentages and two means were tested by Chi2 test and Student's t test respectively. A p value < 0.05 was considered significant. Proportions, means and all statistical analyses were performed using STATA 9.0 .The number of influenza strains identified during the 2006-2008 period by both ILI and ALRI systems are detailed in Table ILI surveillance program tested a total of 3,148 samples during 2006-2008. The average age of the studied population was 11.9 years and 50.8% were male. Of these, 338 (10.7%) tested positive. The average age of positive patients was 8.7 years and 180 (53.3%) were male. There were no differences in age and gender distribution across the three testing years. However, the influenza-infected patients were significantly younger than those tested negative for influenza viruses . Overall positive rates varied from 5.8% in 2006, 7.7% in 2007 and 15.3% in 2008.The average age among the patients included in the ALRI study was 38.2 years (range: 1 month to 87 years) and 61.8% were male. Of the 1,868 patients admitted with ALRI during 2007-2008, only 64 (3.4%) tested positive for influenza virus - 1.4% in 2007 and 3.6% in 2008. The average age of positive cases was 15.2 years ; 28 (51.7%) were male. The patients with influenza infection were significantly younger than the other patients recruited in the ALRI study (p < 0.001).The difference between both ILI and ALRI system for influenza detection was significant (p < 0.001).From 2006 to 2008, influenza infections were observed mainly from June to December Figure . HoweverThe proportion of influenza virus detected among ILI specimens from 2006 to early 2009 varies between 0% in April and May and 50% in October 2008 Figure .The antigenic analysis show that influenza A/H1N1 isolates belonged to the A/New Caledonia/20/99-like group in 2007 and A/Brisbane/59/2007-like group in 2008. In 2006 and 2007, A/H3N2 strains tested were close to A/Wisconsin/67/2005-like, but in 2008 the strains drifted to A/Brisbane/10/2007-like. The influenza B strains were B/Malaysia/2506/2004-like in 2007 and B/Florida/4/2006-like in 2008. These data suggest that the influenza strains circulating in Cambodia from 2007 to 2008 match with the strains contained in the influenza vaccine recommended for the southern hemisphere -13. The This study provides data useful for accurate recommendations on influenza vaccination. People living in Cambodia would ideally receive vaccines by April - May in order to develop protective immunity before the peak season of transmission.We were able to also identify severe influenza infections among hospitalized patients paralleling the same seasonality as observed within the NIC's ILI surveillance. To our surprise, few cases were detected among hospitalized patients with ALRI. We believe that this low frequency of cases may not be a reflection of the extent of influenza-related severity, rather that it is explained by the delay in hospital admission of Cambodian patients presenting with severe respiratory infections. Indeed, most bacterial lung infections included in our hospital study were diagnosed among patients who attended hospital too late after the onset of respiratory symptoms for viral detection . It is plausible that many of these bacterial infections were secondary infections from an initial influenza disease. Further testing for influenza using serology should be performed among patients with bacterial respiratory infections during the seasonal epidemics to establish this hypothesis. In addition, the average age of the patients presenting to hospital with ALRI was significantly higher (p < 0.001) than patients with ILI symptoms since influenza is mainly found in children, it may explain the rate differences between both studies. In 2006, few influenza viruses were detected, as the NIC and its sentinel sites were just established in August 2006. In this year, all influenza-positive isolates belonged to influenza A/H3N2 sub-type which is consistent with influenza activity reported worldwide by WHO. Indeed, in 2006, a low influenza activity was observed and influenza A/H3N2 virus was the predominant subtype in many European and Asian countries . In 2007Since the establishment of the NIC and the ILI surveillance system, we observed a regular increase in the influenza positivity rates in the samples that were tested. This could be linked to a higher influenza activity but also to an improvement of the system from patient recruitment (with adjustment of the case definition in 2008 for the fever criteria), to sample collection and transport to testing. Significant differences in the influenza positivity rate were observed between the sentinel sites. It was expected that paediatric hospitals will have a higher positive rate than adult hospitals, but interestingly, comparing the two paediatric hospitals, the one based in Phnom Penh produced more influenza-positive samples than the hospital located in Siem Reap, perhaps emphasizing the important role of the physician in the successful recruitment of patients who are likely to have influenza infection.There are some limitations to the sentinel surveillance data. Sentinel data cannot be extrapolated precisely to the rest of the population, as the outpatients clinic serving sentinel sites were not truly representative. Random selection of patients is not yet well standardized and depends on the goodwill of physicians in participating in influenza surveillance. In addition, ILI consultation rates were not provided, and data is lacking on the catchment areas of the sentinel sites. As a result, little inferences can be made on disease burden or severity in Cambodia in general. Despite these problems, the system has been useful in meeting the purposes of influenza surveillance, identifying the predominant circulating strains in the community and allowing the formulation of guidelines for influenza vaccine composition for the subsequent year.Since 2005, a total of eight human cases of influenza A/H5N1 have been identified in Cambodia . InteresEven though there is little evidence of mild or asymptomatic H5N1 human infections, the increasing incidence of cases with influenza-like symptoms have been reported more frequently since 2005 . In mostThis study provides the first data regarding influenza activity in Cambodia, combining influenza-like illness surveillance and acute lower respiratory infection surveillance. It demonstrates that even though Cambodia is a tropical country geographically located in the northern hemisphere, influenza activity has a southern hemisphere transmission pattern. Together with the antigenic analysis of the circulating strains, it is now possible to provide better recommendations for influenza vaccination in Cambodia. The ILI surveillance system produced a higher number of seasonal influenza cases than the ALRI surveillance system. This system is therefore more useful for maximizing detection of seasonal influenza cases to generate data regarding vaccine composition, and antiviral susceptibility. Significantly, the parallel circulation of seasonal and avian influenza viruses represents a risk for pandemic by re-assortment during human co-infection. This highlights the importance to reinforce and develop the influenza surveillance systems (both ILI and ALRI); especially in countries where H5N1 virus infection has become endemic in poultry.The authors declare that they have no competing interests.SM performed analysis of the data and drafted the manuscript. SV, SL, SH, CH, CN, NA, MM, IB, SR, WZ, TK and ST participated in the design and coordination of the study. SV and DV revised the manuscript and did complementary analysis. PB conceived the study, participated in its design and coordination, and helped to draft the manuscript. All authors read and approved the final version of the manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/9/168/prepub

MTM1, MTMR1, 2 and 13) are causative for human neuromuscular disorders. However, the pathway and regulative mechanism remain unknown.It has been shown that mutations in at least four myotubularin family genes (Mtmr8, and revealed the expression pattern predominantly in the eye field and somites during early somitogenesis. Using morpholino knockdown, then, we observed that loss-of-function of Mtmr8 led to defects in somitogenesis. Subsequently, the possible underlying mechanism and signal pathway were examined. We first checked the Akt phosphorylation, and observed an increase of Akt phosphorylation in the morphant embryos. Furthermore, we studied the PH/G domain function within Mtmr8. Although the PH/G domain deletion by itself did not result in embryonic defect, addition of PI3K inhibitor LY294002 did give a defective phenotype in the PH/G deletion morphants, indicating that the PH/G domain was essential for Mtmr8's function. Moreover, we investigated the cooperation of Mtmr8 with PI3K in actin filament modeling and muscle development, and found that both Mtmr8-MO1 and Mtmr8-MO2+LY294002 led to the disorganization of the actin cytoskeleton. In addition, we revealed a possible participation of Mtmr8 in the Hedgehog pathway, and cell transplantation experiments showed that Mtmr8 worked in a non-cell autonomous manner in actin modeling.Here, we reported a new role for Mtmr8 in neuromuscular development of zebrafish. Firstly, we cloned and characterized zebrafish The above data indicate that a conserved functional cooperation of Mtmr8 with PI3K regulates actin filament modeling and muscle development in zebrafish, and reveal a possible participation of Mtmr8 in the Hedgehog pathway. Therefore, this work provides a new clue to study the physiological function of MTM family members. DGWDR’ exists commonly in all the enzymatically active membersMTMR8, have been found in the MTM family. Several studies have further demonstrated that the PH/G domain functions to localize MTM to different subcellular compartments in the cellin vitroPTEN (phosphatase and tensin homolog deleted on chromosome ten) and MTM (myotubularin myopathy) family factors are members of the growing class of dual-specificity phosphatases (DSPs), which can dephosphorylate the products of phosphoinositide 3-kinase (PI3K) and antagonize downstream effectors using 3-phosphoinositides as ligands Caenorhabditis elegans for endocytosisMutations or altered expression of PTEN or MTM family members have been observed in human cancersDictyosteliumDictyostelium, F-actin recruits additional PI3K to the newly forming leading edge, enhancing the PIP3 response and downstream effector function PI3K is conserved across eukaryotic organisms and regulates many facets of pathways involving cellular growth, survival, metabolism, vehicle trafficking, and chemotaxisMtmr8 from the model animal zebrafish. Based on its expression pattern predominantly in the eye field and somites during early somitogenesis, we analyzed its physiological roles in embryo development by morpholino-mediated knockdown. We firstly showed that loss-of-function of Mtmr8 led to defects in somitogenesis, and further examined the possible underlying mechanism and the PH/G domain function. Moreover, we investigated the cooperation of Mtmr8 with PI3K in actin filament modeling and muscle development, and revealed a possible participation of Mtmr8 in the Hedgehog pathway. The findings revealed a new role of Mtmr8 and its functional mechanism in neuromuscular development.To reveal the biological functions of MTM family members, we identified Mtmr8 encodes polypeptides of 632 amino acids, which contains 14 exons and 13 introns . An amino acid sequence alignment of zebrafish, chicken and human Mtmr8 polypeptides is shown in Mtmr8 may have the same functions as in human.The complete ORF for the in situ hybridization was used to analyze the expression pattern of Mtmr8 during zebrafish embryogenesis. The expression distribution of Mtmr8 was same to the result reported by Thisse B and C Mtmr8 mRNA is expressed in prechordal plate and eye field at 50% epiboly . In addition, overexpression of zebrafish Mtmr8 by injection of capped RNA (100 pg) did not cause a visible phenotype. We used 100 pg doses in all the gain-of-function experiments described below if not indicated otherwise.To determine the physiological effect of ogenesis . At 24hpogenesis , whereas embryos . In seve embryos . Fig. 2EMtmr8 expression gave distinct developmental phenotypes, we asked whether the PIP3 lipid phosphatase activity of Mtmr8 was conserved in the development of zebrafish. To confirm it, we compared the level of phosphorylated Akt (pAkt) to total Akt (Akt) in whole fish lysates prepared from wild type zebrafish and Mtmr8 morphant embryos. As shown in Mtmr8 expression produces a significant increase in the relative amount of pAkt compared to Cont MO injected embryos, whereas the elevated level of p-Akt could be reduced by coinjection with Mtmr8 mRNA. These results indicate that zebrafish Mtmr8 exhibits PIP3 lipid phosphatase activity and functions to negatively regulate the PI3-Kinase/AKT pathway.Recent studies indicated that several MTMs might control PI3K/Akt activation by virtue of its ability to dephosphorylate PIP3Mtmr8, we designed a splice junction morpholino targeted against the second coding exon-intron boundary. In the Mtmr8-MO2 morphants, the targeted exon was eliminated, which encodes partial of the PH/G domain, as shown by a smaller PCR transcript which was verified by bi-directional DNA sequencing as PTEN, which controls cell random movement through the Ras, PI3K, PTEN, and F-actin regulatory loop e fibres , comparemorphant and contmorphant . Howeveristurbed .in situ hybridization with zebrafish Nexilin riboprobes, and revealed that nexilin was significantly reduced and disorganized in the 24hpf Mtmr8-MO1 morphants -binding protein, which was strongly expressed at somites at 24hpf orphants , Howeverorphants and Contorphants . To furtorphants . Embryosorphants , compareorphants .Mtmr8 morphants have morphological traits in common with Hedgehog pathway mutants, such as U-shaped somite boundaries. To verify that the defects in Mtmr8 morphants are correlated with the changes in Hh signaling, we examined the expression of myod and patched1 (ptc1), a downstream target gene and receptor of Sonic hedgehog Myod and ptc1 expression is severely reduced and disorganized in Mtmr8 morphants . The action of myotubularin on PI3P levels may implicate two parallel pathways by acting both as a protein phosphatase decreasing PI3P level by down-regulating PI3K activity and, a lipid phosphatase directly degrading PI3P than PI4P in vivo308 by PDK1 followed by phosphorylation at Ser473 by the mTOR complexMtmr8 could inhibit PI3K/Akt activation through its functional PH/G domain, loss of which results in apoptotic signaling and cell death. Moreover, identifying the specific binding partners of the PH/G domains on the MTMs will provide important clues to the specific functions regulated by other MTMs as well as the mechanisms whereby loss of some MTMs lead to disease.In this study, we presented evidence that the PH/G domain is indeed a function domain of Mtmr8 that contributes to the development of zebrafish. Deletion of the PH/G domain could result in increasing the relative amount of pAkt . Akt is In vitro studies, activation of PI3K activity alone is sufficient to remodel actin filaments to increase cell migration through the activation of Akt and p70S6K1 in CEF cells in vivo, the F-actin polymerization and modeling is also Mtmr8-dependent. Although the PI3K/Akt was activated in Mtmr8 knocked embryos, it was not enough to model actin filaments alone. Nexilin is a F-actin binding protein and mediates cell motility, over-expression of which promoted cell migration and adhesionMtmr8 deficient embryos, the expression of Nexilin was reduced, which induced the defect of F-actin modeling. Inhibition of PI3K with LY294002 did not alter the initial formation of these F-actin-rich cup structures at the plasma membrane but it did prevent Akt/PKB recruitment to these cups and their subsequent fusion into the large rings characteristic of normalMtmr8 morphant and PH/G losing embryos. These indicated that the increasing of pAkt is a very important recovery mechanism for Mtmr8 deficient, although it could not completely rescue the defects.Recently studies demonstrated the existence of PI3K-dependent and -independent pathways for F-actin polymerization during chemoattractant-stimulated lamella extension in the human neutrophil. One pathway is dependent on PI3Kγ activation and downstream is dependent on PKCδ and Akt/PKB. This pathway controls the formation of 70% to 80% of the F-actin in the lamella region et al.Mtmr8, it was not enough to rescue the expression of Myod and Ptc1. Over-expression of dnPKA mRNA, a downstream of Shh, could reverse the defect induced by Mtmr8 deficient. Previous findings provide a basis for the synergistic role of PI3-kinase/Akt in Hh signaling in embryonic development and Hh-dependent tumors Mtmr8 led to hyper-activation of PKA, which caused the reduction expression of Nexilin and F-actin. All these suggested that Mtmr8 and PI3K/Akt play a synergistic role in regulation of Hh signaling in embryonic muscle development.The model about the mechanisms underlying the Hh signalling pathway is clearly shown by Masai Mtmr8 acts in non-cell-autonomous manner during embryos muscle development, which may suggest that cell therapy is not an efficient way to rescue the defect during early embryo development. The effectiveness of cell therapy could also be evaluated in human neuromuscular disorders caused by mutations in other myotubularin family genes.Currently, many potential therapies are evaluated by introducing fluorescently tagged cells into a diseased animal and then following their fate using fluorescence to determine if the introduced cells localize to muscle and participate in the repair processFrom our studies, we have demonstrated that Mtmr8 have the same function as lipid phosphatases PTEN to dephosphorylate the PI3K products by down-regulating PI3K activity, and to regulate actin modeling and muscle development of zebrafish Danio rerio) were maintained at 28.5°C on a 14 h (hour) light/10 h dark cycle A breeding colony of zebrafish from different stages and tissues, and the concentration and quality were determined by agarose electrophoresis and spectrophotometer. After treating with DNase I , the RNAs (about 1 µg) were reverse-transcribed with MMLV (Gibco) at 37°C with oligo(dT)15 primer. Mtmr8-MO1 (Splicing antisense), 5′-CACCTGCTGACTCAGACCTACCTTC-3′; Mtmr8-MO2 (Splicing antisense), 5′-GGCCAACATTACCCATGTTTCTTTG-3′; Nexilin-MO (Splicing antisense), 5′-ATAGCCTCTTCATACTTTACCTCTT-3′; Standard control MO (Cont MO), 5′-CCTCTTACCTCAGTTACAATTTATA-3′. For injection, MOs were injected into fertilized zebrafish eggs at the one-cell stage at a concentration of about 6 ng each embryo. After injection, embryos were incubated at 28.5°C in Embryo Medium Morpholinos were synthesized by GeneTools LLC . Following are the sequences for various morpholinos: Mtmr8 and pCS2-dnPKA were linearized for in vitro transcription. Capped sense RNAs were synthesized using SP6 RNA polymerase and the SP6 Cap-Scribe (Roche), following the manufacturer's instructions, re-suspended in water and injected at a concentration of 100 ng/µL.Plasmids pCS2-in vitro transcription using T7 or Sp6 RNA polymerase to generate DIG-labeled (Roche) sense and anti-sense probes. In situ hybridization was performed as described Embryos at different stages were collected and pre-treated and fixed as described Iowa, USA), and Prox1 antibody from Abcam . Zebrafish embryos were fixed overnight in 4% paraformadehyde at 4°C, and then washed in 0.1% Triton in PBS (PBT) and dechorionated. They were then incubated for 1 h in 0.5% Triton in PBS, followed by 5-h incubation in block solution . Embryos were then incubated overnight at 4°C in block solution containing Phalloidin and/or primary antibodies. They were then washed in PBT, and incubated for 5 h at room temperature with secondary antibodies. Antibody and Phalloidin staining of zebrafish embryos were performed as previously described F59 antibody was purchased from Developmental Studies Hybridoma Bank alone or in combination with 6 ng morpholino. Donor and host embryos were dechorionated. The cells were sucked from the prospective mesodermal region of a donor at the sphere stage, and transplanted into the same position of wild-type host embryos at the same stage. Locations of transplanted cells in the hosts were determined by fluorescence stereomicroscopy at the shield stage. Distribution of transplanted cells in the hosts were observed and photographed at 24 hpf postfertilization (hpf) using a Leica fluorescence stereomicroscope. We sucked out the embryos with transplanted cell mainly in the somites, which were fixed at 24 hpf for 2 h at room temperature in 4% paraformaldehyde, and later for phalloidin staining.Mtmr8 morphants and control morpholino groups were compared statistically using one-way analysis of variance (ANOVA), followed by the Tukey's post hoc test for multiple comparisons. A probability (P) of <0.05 was statistically considered significant.Data are presented as mean±SD. The relative expression level of p-Akt in

The two phen planes are oriented at a dihedral angle of 57.48 (11)°. The perchlorate anion links with the Mn complex cation via weak C—H⋯O hydrogen bonding.In the title complex, [Mn(CHO DOI: 10.1107/S1600536809049277/xu2641Isup2.hklStructure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:

S-nitrosylation both in vitro and by endogenous, pulmonary derived nitric oxide (NO) within a rodent acute lung injury model. S-nitrosylation is becoming increasingly recognized as an important post-translational modification with signaling consequences. The formation of S-nitrosothiol (SNO)-SP-D both in vivo and in vitro results in a disruption of SP-D multimers such that trimers become evident. SNO-SP-D but not SP-D, either dodecameric or trimeric, is chemoattractive for macrophages and induces p38 MAPK phosphorylation. The signaling capacity of SNO-SP-D appears to be mediated by binding to calreticulin/CD91. We propose that NO controls the dichotomous nature of this pulmonary collectin and that posttranslational modification by S-nitrosylation causes quaternary structural alterations in SP-D, causing it to switch its inflammatory signaling role. This represents new insight into both the regulation of protein function by S-nitrosylation and NO's role in innate immunity.The pulmonary collectins, surfactant proteins A and D (SP-A and SP-D) have been implicated in the regulation of the innate immune system within the lung. In particular, SP-D appears to have both pro- and anti-inflammatory signaling functions. At present, the molecular mechanisms involved in switching between these functions remain unclear. SP-D differs in its quaternary structure from SP-A and the other members of the collectin family, such as C1q, in that it forms large multimers held together by the N-terminal domain, rather than aligning the triple helix domains in the traditional “bunch of flowers” arrangement. There are two cysteine residues within the hydrophobic N terminus of SP-D that are critical for multimer assembly and have been proposed to be involved in stabilizing disulfide bonds. Here we show that these cysteines exist within the reduced state in dodecameric SP-D and form a specific target for S-nitrosothiols. In this multimeric state, the tail domains are buried, limiting the ability of SP-D to activate inflammation. S-nitrosylation causes the multimers to fall apart into trimers, exposing the tail domain. S-nitrosylated SP-D induces inflammatory cell activation as determined by chemotaxis, calcium influx, and phosphorylation state. This activity is dependent upon both the S-nitrosothiol and the disruption of SP-D's multimeric structure. These modifications are observed in an in vivo model of inflammation and form a critical part of the process. A model is proposed in which nitric oxide operates as a molecular switch for SP-D.Cells of the lung lining secrete a microbe-binding molecule called surfactant protein D (SP-D) that helps activate the inflammatory system against invading pathogens. In the absence of infection, SP-D is important in limiting inflammation, demonstrated by the fact that mice lacking the SP-D gene have chronic inflammation and emphysema. SP-D has two structural features—a lectin-like head domain and a collagenous tail domain—that, respectively, inhibit and stimulate inflammation. Here we define a mechanism for generating the active “inflammatory” version of SP-D. SP-D is held together in its multimeric state by interacting cysteine residues, which are susceptible to modification by the gaseous second messenger, nitric oxide, to form S-nitrosylation.Nitric oxide is shown to control the pro- and anti-inflammatory functions of surfactant protein D by altering its quaternary structure via Nitric oxide (NO) has long presented a curious dichotomy within biologic systems, namely that it is both an important physiological regulator and the mediator of many pathologies –3. NowheS-nitrosylation is emerging as an important regulator of protein function -1-(2-pyridyldithio) propionamide (Pierce). Biotinylated proteins were precipitated with Streptavidin-agarose beads and Western blot analysis was performed to detect the amount of SP-D remaining in the samples.h method . BAL . Proteins were electrophoresed using MEPS-SDS buffer at 200 V for 35–45 min per the manufacturer's instructions (Invitrogen). Native gel electrophoresis was performed using a Novex 4% tris-glycine gel (Invitrogen). Samples were mixed with a cold native gel sample buffer (Invitrogen) before loading. Electrophoresis was run at room temperature at a constant voltage of 80 V for 5 h. Proteins were then transferred from the gel to a nitrocellulose membrane using the XCell II Mini-Cell and sandwich blot module (Invitrogen) in Bicine-10% methanol-0.01% SDS transfer buffer (Invitrogen) at 30 V for 1 h. Blots were blocked for 1 h at room temperature with 10% nonfat milk and then incubated with primary SP-D antibody overnight at 4 °C. Blots were then incubated with 1:5,000 goat anti-rabbit IgG-horseradish peroxidase for 2 h at room temperature. Signal was detected using the enhanced chemiluminescence kit (Amersham), and blots were exposed to Kodak Biomax MS film.All animals for this study were housed in the Animal Care Facility of The Children's Hospital of Philadelphia under standard conditions with free access to food and water. All animal experimental protocols were reviewed and approved by the Animal Care and Use Committees of both the Children's Hospital of Philadelphia and The University of Pennsylvania. Either human clinical-grade, sterile, and lipopolysaccharide (LPS)-negative saline or 8.0 U/kg of bleomycin sulfate (Bristol Myers Squibb) in 25 μl of saline was administered intratracheally to 6-wk-old (200–250 g) male Sprague-Dawley rat littermates (Charles River Breeding Laboratories) as previously described . Similar6 cells/ml in DMEM were placed in the upper wells of a 48-well microchemotaxis chamber (Neuro Probe). The lower chambers contained 41 μl of test solution, consisting of DMEM and either nothing (control); various concentrations of SP-D, SNO-SP-D, BAL, or SNO-BAL. All test solutions were used in triplicate in each assay. A polyvinylpyrrolidone-free polycarbonate filter was placed between the wells along with the rubber gasket of the assembly. The filters used for macrophage chemotaxis had 5-μm pores (Neuro Probe). The chamber was incubated at 37 °C with 5% CO2 for 3 h, and then disassembled. Nonmigrating cells were scraped from the upper surface, and the migrating cells were stained with the Hemacolor differential blood stain. The filter was placed on a glass coverslip and mounted with immersion oil onto a glass slide. Cells that migrated through the filter were counted in ten randomly selected oil-immersion fields in each well at 1,000× magnifications. Data were expressed as cells per oil- immersion field for the three wells used for each solution.Directed migration (chemotaxis) of cells was performed as previously described Briefly,6) were plated on glass coverslips (Fisher Scientific) sized to fit a homeothermic perfusion chamber platform of an inverted Nikon microscope. The cells were loaded with 5μM fura-2 acetoxymethylester (Molecular Probes) and 0.2 mg/ml pluronic F-127 (Molecular Probes) in 2 ml HBSS supplemented with 1% FBS and 1.25 mM CaCl2 for 30 min at 37 °C. The cells were stimulated with HBSS at 37 °C containing BAL or SNO-BAL and excitation was performed at 334 and 380 nm with two narrow-bandpass filters. The emitted fluorescence was filtered (520 nm), captured with a Hamamatso CCD video camera (512 × 480-pixel resolution), digitized (256 gray levels), and analyzed with SimplePCI (Version 3.7.9) software. The amount of Ca2+ was calculated by comparing the ratio of fluorescence at each pixel to an in vitro 2-point calibration curve. The Ca2+ concentration presented was obtained by averaging the values of all pixels over a cell body. The data points were collected at intervals of 5 s.RAW cells (2 × 106 cells./ml) were cultured overnight, then incudbated with Bal or SNO-BAL (100 μg/ml) for 10 min. If anti-caltericulin was used in the experiments, the antibody (2 μg/ml) was added 30 min before the stimulation. Cells were lysed in lysis buffer containing protease inhibitors , and resolved in 4–10% SDS-PAGE, and blotted to a PVDF membrane as outlined above. The membranes were probed with a phosphospecific antibody to p38. To confirm the equal loading, the membranes were stripped and reprobed for p38.RAW cells (1 × 10

The packing is consolidated by further N—H⋯O links. The H atoms of two of the methyl groups are disordered over two sets of sites with equal occupancies.In the title compound, C Å b = 8.4514 (3) Å c = 16.7058 (6) Å β = 94.465 (1)°V = 1061.28 (7) Å3 Z = 4 Kα radiationMo −1 μ = 0.29 mmT = 150 (2) K 0.29 × 0.26 × 0.10 mm Bruker APEXII CCD diffractometerSADABS; Sheldrick, 2003T min = 0.920, T max = 0.971Absorption correction: multi-scan (12338 measured reflections3400 independent reflectionsI > 2σ(I)2944 reflections with R int = 0.025 R[F 2 > 2σ(F 2)] = 0.038 wR(F 2) = 0.111 S = 1.05 3400 reflections136 parametersH-atom parameters constrainedmax = 0.44 e Å−3 Δρmin = −0.34 e Å−3 Δρ APEX2 used to solve structure: SIR97 (Altomare et al., 1999SHELXL97 (Sheldrick, 2008ORTEP-3 for Windows (Farrugia, 1997WinGX (Farrugia, 1999Data collection: 10.1107/S1600536808014177/hb2733sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808014177/hb2733Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Coregonus clupeaformis) for which preliminary data suggest that postzygotic isolation emerges with intrinsic factors acting at embryo stages but also due to extrinsic factors during adult life.The evolution of barriers to reproduction is of key interest to understand speciation. However, there may be a current bias towards studying intrinsic postzygotic isolation in old species pairs as compared to the emergence of barriers to gene flow through adaptive divergence. This study evaluates the relative importance of both processes in the evolution of genomic isolation in incipient species of whitefish (Gene expression data were screened using cDNA microarrays to identify regulatory changes at embryo and juvenile stages that provide evidence for genomic divergence at the underlying genetic factors. A comparison of different life history stages shows that 16-week old juvenile fish have 14 times more genes displaying significant regulatory divergence than embryos. Furthermore, regulatory changes in juvenile fish match patterns in adult fish suggesting that gene expression divergence is established early in juvenile fish and persists throughout the adult phase. Comparative analyses with results from previous studies on dwarf-normal species pairs show that at least 26 genetic factors identified in juvenile fish are candidate traits for adaptive divergence in adult fish. Eight of these show parallel directions of gene expression divergence independent of tissue type or age of the fish. The latter are associated with energy metabolism, a complex trait known to drive adaptive divergence in dwarf and normal whitefish.Although experimental evidence suggests the existence of genetic factors that cause intrinsic postzygotic isolation acting in embryos, the analysis presented here provided few candidate genes in embryos, which also corroborate previous studies showing a lack of ecological divergence between sympatric dwarf and normal whitefish at the larval stage. In contrast, gene expression divergence in juveniles can be linked to adaptive traits and seems to be driven by positive selection. The results support the idea that adaptive differentiation may be more important in explaining the emergence of barriers to gene flow in an early phase of speciation by providing a broad genomic basis for extrinsic postzygotic isolation rather than intrinsic barriers. Drosophila are often completely sterile or inviable, which can be explained by Dobzhansky-Müller incompatibilities [i.e. during early development [The evolution of reproductive isolation is of fundamental interest in evolutionary biology because it represents a key step in speciation processes and the generation of biological diversity . Mergingbilities ,3. Postzelopment , whereaselopment . Howeverelopment -7. At leelopment ,8,9 and elopment .There may be a bias in our perception of the contribution of intrinsic and extrinsic postzygotic isolation to speciation processes. This is because it is usually more straightforward to analyse intrinsic barriers than to grasp extrinsic barriers experimentally, since the latter will most likely depend on unknown ecological interactions. Therefore, traits that could provide a basis for genomic isolation in young lineages remain insufficiently explored. A possible approach is given by transcriptome analysis. Here, gene expression data may help identifying key genes involved in speciation since regulatory evolution is hypothesized to be a key factor in microevolutionary processes -12. GeneCoregonus clupeaformis ) in order to identify candidate traits that could contribute to barriers to gene flow. This system is of particular interest to study the emergence of postzygotic isolation as the diverging lineages are of recent, most likely postglacial, origin (15 000 ya) [Salmo salar, Onchorynchus mykiss) can be readily used in whitefishes [et al. [et al. [In this study, we explore by means of transcriptomics the regulatory divergence between incipient species of lake whitefish ( 000 ya) . Dwarf a 000 ya) and geno, origin 000 ya [ 000 ya) while al 000 ya) have foutefishes . Derome [et al. ,21 and S [et al. have ideHere, we tie in with the above studies, which suggest than both intrinsic and extrinsic barriers to reproduction play a role in the divergence of dwarf and normal whitefish at the embryo stage and during the adult life respectively. Our main objective was to compare regulatory changes at different life history stages to obtain an insight into the processes that may contribute to genomic divergence. Our results indicate that there is little regulatory divergence in embryos in sharp contrast with evidence that numerous genes display regulatory divergence in juvenile fish. Given that the latter patterns can be partially linked to ecological divergence, we conclude that extrinsic postzygotic barriers may be more important to explain early evolutionary divergence of dwarf and normal whitefish than intrinsic barriers to reproduction.The number of features (spotted EST clones) for which we obtained gene expression data of sufficient quality for subsequent analyses was 7004 for the embryos and 5787 for the juvenile dataset. This discrepancy is correlated with technical aspects of the experiments. The number of spots that were excluded because they had a bad quality flag (obvious artefacts) after visual editing was 3209 in the juvenile dataset vs. 1055 in the embryo dataset. Furthermore, the average background in the embryo experiments was lower than in the juvenile experiments (744 vs. 849 relative fluorescence units). A total of 4293 features were common to both datasets. Accordingly, the embryo data contained 2711 and the juvenile data contained 1494 unique features. Those features of the whole embryo dataset that were associated with a GO term could be linked to 2034 unique unigene clusters and the features of the whole juvenile dataset represented 1549 unique unigene clusters.The overall representation of gene functional groups among the expressed features between the two datasets differed significantly according to the ease score provided by the EASE software. The juvenile fish dataset contained a significant relative excess (ease score < 0.05) of unigene clusters representing three GO-Biological processes: Catabolism , lipid metabolism , proteolysis and peptidolysis . In contrast, the embryo dataset contained an almost significant relative excess of unigene clusters representing two GO-Biological processes: Cell cycle and nucleobase\, nucleoside\, nucleotide and nucleic acid metabolism . These trends in the representation of genes in the two life history stages reflect the importance of metabolism and growth processes in the juvenile stage while gene transcription regulation and development predominate in the embryos.After applying a FDR correction for multiple testing, only 33 EST clones showed significant differential expression between the embryos of dwarf and normal whitefish [see Additional file For comparisons between datasets, EST clones were assigned to EST clone groups based on; i) unigene cluster or accession numbers (latest annotation following cGRASP) unless there was no known function, and ii) unique patterns of gene expression divergence. In doing this, significant patterns were integrated over replicate clones and overrepresentation of different genes by multiple clones was corrected. Among the features displaying significant differentiation in the embryo dataset, 20 can be assigned to one of twelve unigene clusters. Eleven out of the twelve unigene clusters that display significant differentiation in the embryo dataset also appear in the list of significant unigene clusters of the juvenile dataset [see Additional file Oncorhynchus mykiss IgH.A locus) was previously found to be differentially expressed in white muscle between laboratory dwarf and normal whitefish [et al. [Some of the EST clones displaying significant divergence of gene expression in the analyses presented above have already been demonstrated to display differential expression in dwarf and normal whitefish. Only one EST clone for which significant differentiation was detected in the embryo dataset as compared to embryos of the same experimental groups, which displayed little divergence in gene expression (33 EST clones). Although the number of evolutionary changes causing the observed differences is currently unknown, a fourteen-fold excess of unigene clusters displaying significant differentiation in the juvenile dataset suggests that multiple regulatory changes take effect only after development has passed the embryo stage. If gene expression divergence were the result of random accumulation of evolutionary differences between the studied populations, roughly equal proportions of gene expression differences would be expected to occur in both life history stages. The much more likely scenario is that evolutionary change in gene expression plays a greater role at the juvenile stages than the embryonic stage.Our results revealed a pronounced pattern of gene expression divergence for 502 EST clones between 16-week old juvenile dwarf and normal lake whitefish . Even if only half of all genes in the Dwarf whitefish from Lake Témiscouata and normal whitefish from Lake Aylmer studied here have a similar reproductive biology. Adult fish live in the lake throughout the year and enter tributaries only for a brief spawning period. Spawning migrations are short and occur on a daily basis at night from late October to early November. Eggs are dispersed in currents and settle into rock and gravel substrates where they are left unattended to develop. Ninety-one percent of the unigene clusters that displayed significant regulatory divergence in the embryos were also significantly divergent in juvenile fish and in one case, found to be differentially expressed in white muscle tissue of adults of the same laboratory strains used here. However, none of the significantly different genes of the embryo stage was found to be a candidate for adaptive divergence in previous studies. The fact that ecological divergence of the egg stages of whitefishes has not been discovered to date together with the relative lack of gene expression differentiation suggests strongly that little or no adaptive evolutionary divergence has occurred specifically at the embryo stage and that most of the gene expression differentiation between dwarf and normal whitefish must develop at a later phase of the ontogeny.Drosophila [Upon hatching whitefish larvae are washed from their natal river into the lakes were they spent their entire life. To date it is unknown at which phase of the life history the ecological differentiation into the dwarf (limnetic) and normal (benthic) lifestyles occurs in nature. In a study of dwarf and normal whitefish in Cliff Lake, larvae of dwarf and normal populations did not differ in their hatching time, diet, distribution and vertical migration within the lake . Unlike osophila . Hence, osophila to adultosophila .et al. [et al. [et al. [et al. [et al. [et al. [A total of 96 of the EST clones identified here matched with 26 accessions or genes that were also described by Derome et al. and St-C [et al. [see Add [et al. who foun [et al. . Accordi [et al. this eco [et al. and St-C [et al. have inf [et al. , the bio [et al. in diffeet al. [et al. [The results obtained here for juvenile fish and the comparison of the direction of the regulatory changes in different tissues or the controlled common environment vs. natural lakes shows that regulatory changes at candidate adaptive traits are not always congruent in terms of the direction of the change. It must be emphasized though, that the inference of adaptive divergence from parallel regulatory changes relies on the use of comparable samples. If tissue type and environmental context vary, the regulatory response can be expected to vary as well. Accordingly, there was more agreement in the direction of the regulatory changes when comparison based on liver tissue or natural environments were excluded [see Additional file et al. and St-C [et al. is not iThe identification of candidate adaptive gene expression divergence still draws an incomplete picture of the processes that ultimately lead to the life history differentiation into dwarf and normal whitefish. If adaptive differences at the transcriptome level are expressed as early as young 16 weeks) juvenile stage, then it is likely that these genetic factors may initiate the development of life history divergence. Although data on juvenile fish from natural lakes are missing, inferences can be made from our laboratory populations. Experimental fish were kept in a controlled common environment and the candidate adaptive traits remain prevalent at the transcriptome level suggesting that juvenile fish already display differential adaptation. On the other hand, the phenotypes of our experimental populations bred in the laboratory seem to contradict a persistent ecophenotypic differentiation between dwarf and normal whitefish. Although morphological features distinguishing dwarf and normal ecotypes are heritable [ weeks juin prep). In any case, the scarcity of regulatory divergence observed here for the embryo stage suggests that regulatory divergence is rare and may have a narrow genomic basis involving only a small number of genetic factors. This view would agree with the fact Rogers and Bernatchez [Aside directional selection driving divergence at the juvenile and adult stages, an alternative explanation for the relative lack of embryo gene expression may be derived from developmental biology. The embryos during the segmentation phase that were studied here correspond closely to the phylotypic stage, a developmental phase that corresponds to an archetype bauplan of all representatives of a given phylum. This stage is generally extremely conserved suggestirnatchez have onlCoregonus [et al. [At the level of the transcriptome, only traits causing regulatory divergence produce a phenotype that differs between two diverging lineages. These could be affected by natural selection and are therefore candidate traits that may reduce the fitness of individuals of mixed ancestry. Thus, a screen for regulatory divergence can identify traits that could have fitness effects under conditions of gene flow and serve as a genetic basis for the emergence of genomic isolation. Models suggest that recombination can oppose genomic divergence and speciation because loci that are not selected for may still be exchanged relatively freely among populations ,39. Evenoregonus ,38. It i [et al. provided [et al. . Moreove [et al. .Drosophila [Mus [A gap in the sampling of potentially relevant life history stages of this study is that the reproductive phase could not be analysed here. Studies on osophila and Mus ila [Mus have demet al. [If the relative rarity of gene expression divergence in embryo stages was a general pattern in recently diverged species, then a focus on embryo dysgenesis in studies of the early evolution of postzygotic isolation could be misleading in that they would distract from a large pool of adult characters. While tests for embryonic mortality are straightforward, it is much more difficult to test the role of particular genes on complex adult phenotypes as those may have small effects or theiret al. suggest,et al. ,45. Our et al. ,45.Coregonus clupeaformis were obtained from lab strains kept at the LARSA or harvested from wild fish that were caught on their natural spawning grounds. Normal whitefish used here originate from Lake Aylmer and were sampled at the spawning site in the St. Francois River in Disraeli in 1996 . Since then, they were kept in the laboratory as an outbred lab strain. Dwarf whitefish originate from Lake Témiscouata (St. Johns' river system in southern Quebec) and were caught on their spawning grounds in the Touladi River . Like the normal whitefish, dwarfs were maintained as an outbred laboratory strain. We also included new wild caught material from Lake Témiscouata dwarf whitefish collected in October 2006.Eggs of in vitro and incubated on grids that were submerged in slowly flowing water of a temperature of 4,5–5,5°C. All egg batches were incubated in the same flow through system and were thus subjected to compartments of the same environment. Weekly treatments with malachite green oxalate were performed to inhibit growth of fungi. Morbid eggs or embryos were removed on a daily basis. After hatching, free-swimming larvae were transferred into aquaria (50 × 25 × 30 cm) and fed ad libitum with Artemia nauplii and complemented with commercial fish food . All aquaria were aerated and connected by a flow through and filtering system that fed each aquarium from a common pool. This permitted constant water exchange and near identical temperature and chemical conditions. The temperature in the rearing tanks was kept at 8°C for the first 8 weeks, raised to 10°C for 3 weeks and finally adjusted to 12°C.Eggs and semen were stripped from deafened fish, fertilized th Oct. 2006) from the same lake using multiple females and multiple males. Two groups of normal whitefish (NN-C and NN-I) were created from one and five as well as two and three females and males of the lab strain of normal whitefish from Lake Aylmer, respectively.To capture the within population variance in gene expression and reduce family specific effects, we generally used crosses that were composed of several parents depending on the availability of mature fish at a given time. We have created two independent experimental groups for each biological group studied here. The group DD-E was derived from the lab strain of the dwarf whitefish from Lake Témiscouata and was created using one female and five different males. DD-G was created by crossing wild caught dwarf whitefish [It was our goal to analyse gene expression in a developmental stage corresponding to the phase for which Lu and Bernatchez and Rogeompare ) . Eggs thth 2007), when these attained a weight of approximately 800 mg (540–1190 mg). At this stage, the development of morphological features is finished and the young whitefish resemble their parents. Individuals chosen for gene expression analysis were well developed and in good general shape . Sampling was done in the morning following an 18 hour fast. Fish were then sacrificed with a blow, kept on ice and homogenized in TRIzol reagent for RNA extraction as quickly as possible (waiting time no longer than 20 min). The homogenate was stored at -80°C prior to RNA extraction.Juvenile fish were chosen as the next sampling stage as these represent an immature adult phenotype. All hatched larvae were transferred to basins and started external feeding in mid January 2007. The larvae had developed fin rays by the end of January 2007. We sampled juvenile fish at an age of approximately 16 weeks comparisons for both the embryonic and the juvenile fish stage were performed resulting in two sets of eight microarrays per stage according to the protocol of the vendor. For the embryo experiments, five whole embryos preserved in RNAlater were homogenized using a bead mill (Quiagen) while for the juvenile fish experiments a single whole juvenile fish was homogenized using a polytron homogenizer. Crude total RNA was further cleaned by ultra filtration using microcon (Millipore) spin columns (embryo experiments) or a combination of a lithium chloride precipitation and subsequent ultra filtration (juvenile fish experiments). Total RNA was quantified and quality checked using the Experion™ RNA StdSens Analysis Kit (BIO RAD). Total RNA was stored in pure water supplemented with Superase-In™ RNase Inhibitor (Ambion) at -80°C.et al. 2005). This microarray comprises 16 006 different cDNA features derived from salmonids as well as control spots that have previously been demonstrated to be useful to analyse gene expression in whitefish [Gene expression analysis was performed using the 16 K v2.0 Salmon cDNA microarray as provided by the cGRASP consortium and quantified using the Quantarray software. The positioning of all grids was checked manually for both dye channels. Suspicious spots of inconsistent shape or obvious artefacts were marked with a bad quality flag. Raw data were quantified using the histogram method and exported into text files. Microarray data are deposited at ArrayExpress, a public repository, under the following experiment accession number (ArrayExpress accession: E-MEXP-1973). Input for the statistical analyses was generated from separate text files using a Perl script. For each spot, local background was subtracted from the PMT value. Data were subsequently used in the statistical analyses only if there was no more than 12,5% missing or unusable data per gene . Here, unusable may mean: i) a bad quality flag or ii) a gene expression value that is lower than the average background + 2 times its standard deviation for both samples measured on a given spot. The average background was determined from 800 empty spots or blank wells on the 16 K salmon chip, provided that these spots were not excluded due to artefacts after visual inspection. Statistical analysis of the data was performed in R version 2.6.1 2007 ISBN 3-900051-07-0) using the R package R/maanova Version 1.4.1 ,48. Raw et al. [et al. [th 2008) provided on the cGRASP homepage . Analyses of the representation of functional categories of genes among datasets was based on the DAVID/EASE programs [The populations studied here have previously served to study gene expression divergence at the adult stage between specific tissues of dwarf and normal whitefish using a similar ANOVA. EST clones or genes for which significant differentiation was found in this study were compared with lists of candidate genes from studies on white muscle and liver tissue -22. Thiset al. used an [et al. were com [et al. as imple [et al. . All seqprograms .AWN conceived the study, collected the data, performed the analyses and wrote the manuscript. SR contributed to all parts of the experimental design, data collection and analysis. LB conceived the study, coordinated the work and edited the manuscript. All authors read and approved the final manuscript.EST clones for which significant divergence was detected between embryos or juveniles of dwarf and normal whitefish. List of all EST clones for which significant divergence of gene expression was detected for dwarf and normal whitefish (33 and 502 EST clones for the Embryo and Juvenile datasets). EST clone and annotation, the Log2-fold change of dwarfs relative to normals and the FDR adjusted Permutation p-value (significance criterion in this study) are given.Click here for fileRegulatory changes between juvenile dwarf and normal whitefish in a common environment. Similarity of regulatory changes between dwarf and normal whitefish at different life history stages in controlled common environments. All comparisons are based on the same strains . 108 EST clones that display significant differentiation in gene expression in whole juvenile fish (this study) were previously found to be differentially expressed in muscle tissue from adult fish [ult fish . When geult fish . EM = enClick here for fileRegulatory changes between juvenile dwarf and normal whitefish at candidate adaptive traits. Comparison of significant regulatory changes between juvenile dwarf and normal whitefish with patterns observed at candidate adaptive traits. Derome et al. [e et al. and St-Ce et al. analysede et al. , with ane et al. for adule et al. : DT = deClick here for file

CONTRAST is a gene predictor that directly incorporates information from multiple alignments and uses discriminative machine learning techniques to give large improvements in prediction over previous methods. We describe CONTRAST, a gene predictor which directly incorporates information from multiple alignments rather than employing phylogenetic models. This is accomplished through the use of discriminative machine learning techniques, including a novel training algorithm. We use a two-stage approach, in which a set of binary classifiers designed to recognize coding region boundaries is combined with a global model of gene structure. CONTRAST predicts exact coding region structures for 65% more human genes than the previous state-of-the-art method, misses 46% fewer exons and displays comparable gains in specificity. In this work, we consider the task of predicting the locations and structures of the protein-coding genes in a genome. Gene recognition is one of the best-studied problems in computational biology, and as such has been approached through the use of a wide variety of different methods.Ab initio predictors use only DNA sequence from the genome in which predictions are desired (the target genome). Predictors such as GENSCAN if possible or the two points with x-coordinates closest to d if not. The number of control points and their x-coordinates are fixed before CRF training (see the training procedure section), while the w-coordinates of the control points are learned by the CRF . This is accomplished by specifying the feature mapping such that it contains one feature for each control point associated with a particular classifier. Each such feature has non-zero value only if the labels correspond to a boundary of the classifier's type and the classifier's score at position i is such that is used as a control point to determine the CRF score. In that case, the feature's value is equal to the interpolation coefficient of its associated control point: (1 - c) if it is the control point with the lower x-coordinate and c otherwise.where is the weighted sum of the probabilities of all correct coding boundary labels and the negative probabilities of all possible incorrect coding boundary labels. Note that the training data may contain coding boundaries from unannotated genes, which will be penalized as incorrect. In such cases, a relatively high value of λ may be required to offset spurious penalties. We used λ = 15 for all experiments.Informally, EBA using a gradient-based optimization algorithm (described in the following). The gradient can be calculated efficiently using a dynamic programming algorithm that is only a small constant factor slower than the algorithm used to compute the gradient of L(w). The techniques used are very similar to those described previously [In practice, we optimize EBA, while the second is a regularization term added to combat overfitting.The sum in the regularization term is over weights for hexamer and trimer pair features only. The other weights were not subject to regularization, because their associated features occurred often enough in the training data that overfitting was not a significant problem.C was selected by performing a golden section search [The Rprop algorithm was used for optimization . We did n search to deter

The efficacy and safety of capecitabine and bevacizumab in elderly patients with metastatic colorectal cancer (mCRC) considered unsuitable for receiving first-line chemotherapy with an irinotecan or oxaliplatin-based combination were assessed in a phase II, open, multicentre, uncontrolled study.−2 (or 950 mg m−2 for patients with a creatinine clearance of 30–50 ml min−1) twice daily on days 1–14 and bevacizumab (7.5 mg kg−1) on day 1 every 3 weeks.Treatment consisted of capecitabine 1250 mg m−1 and the development of non-bevacizumab-related grade 3/4 AEs. The incidence of bevacizumab-associated AEs was consistent with that of previous reports in elderly patients.A total of 59 patients aged ⩾70 years with mCRC were enrolled. In an intention-to-treat analysis, the overall response rate was 34%, with 71% of patients achieving disease control. Median progression-free survival and overall survival were 10.8 months and 18 months, respectively. In all, 32 patients (54%) had grade 3/4 adverse events (AEs), the most common being hand–foot syndrome (19%), diarrhoea (9%) and deep venous thrombosis (7%). Four patients died because of treatment-related AEs. A relationship was detected between creatinine clearance ⩽50 ml minBevacizumab combined with capecitabine represents a valid therapeutic alternative in elderly patients considered to be unsuitable for receiving polychemotherapy. Colorectal cancer (CRC) is the third most frequent tumour in the world, with one million new cases being diagnosed every year ; hence, the therapeutic decisions in this population must be individualised.vs 5-FU–LV in patients considered unsuitable for polychemotherapy with irinotecan, a higher overall response rate , higher median progression-free survival and higher overall survival were observed for the combination is an oral fluoropyrimidine that has efficacy similar to that of 5-FU–LV in bolus as first-line treatment of advanced or metastatic CRC if their CrCl >50 ml min−1 and up to 950 mg m−2 twice daily if they had a CrCl of 30–50 ml min−1. Capecitabine was administered for 2 weeks, followed by 1 week of rest. Bevacizumab was administered as a 30–90 min intravenous infusion at a dose of 7.5 mg kg−1 on day 1 of a 3-week cycle.The initial dose of capecitabine was determined according to the patient's renal function . Patients received a capecitabine dose of 1250 mg m−1, treatment was stopped. Cycles were repeated every 3 weeks for a minimum of three per patient, unless disease progression was noted. Patients with a complete response (CR), partial response or stable disease continued receiving chemotherapy until progression or detection of unacceptable adverse events (AEs).The Cockcroft–Gault formula was usedThe administration of bevacizumab was permanently discontinued in case of grade ⩾3 thromboembolic events, grade ⩾3 bleeding or uncontrolled hypertension. In case of grade ⩾3 proteinuria, treatment was withheld until proteinuria improved to <2 g every 24 h. Dose reductions for grade 2–4 AEs were carried out for capecitabine as previously described , carcinoembryogenic antigen measurement, electrocardiogram and imaging studies , qualitative proteinuria analysis and ECOG PS. The Charlson co-morbidity scale were useTumour response was evaluated radiologically every 9 weeks (three cycles) or sooner if clinically indicated (together with carcinoembryogenic antigen measurement) during therapy, and every 12 weeks during the follow-up period. The same imaging technique was used throughout the study. RECIST v.1.0 response guidelines were used . For hand–foot syndrome, the previously published grading system was used and a statistical power of 80% (β error=0.20). Assuming that 10% of patients would not be assessable, a total of 59 patients were included.An optimal two-stage design as described by vs ⩾80 years), gender, CrCl (<50 vs ⩾50 ml min−1), Charlson co-morbidity scale (0 vs ⩾1), ECOG PS (0 vs ⩾1) and ADL and IADL (independent vs dependent). Efficacy rates according to the Charlson co-morbidity scale were also compared. Wilcoxon's signed-rank test (to compare quantitative variables) and Fisher's exact test (to compare percentages) were used. The OS and PFS values were calculated using the Kaplan–Meier method.As exploratory analyses, a univariate analysis was used to compare the rate of grade 3/4 AEs according to age of 7.1 (±6.5) cycles per patient were administered. All of the patients enrolled in the study received at least one dose of the study medication and were considered evaluable for safety. The mean dose intensity of capecitabine was 14.6 g m−1 and thrombocytopenia/anaemia. A total of 14 patients (24%) required at least one bevacizumab dose discontinuation because of AEs, mainly, hypertension, thromboembolism, proteinuria, haemorrhage and weight loss, all with a similar incidence rate.Capecitabine dose reduction/discontinuation was required in 35 (59%) patients because of AEs, the most frequent being non-haematological toxicities, principally, hand–foot syndrome and diarrhoea. Other causes included laboratory abnormal values, such as decrease in CrCl <30 mg 100 mlReasons for discontinuation of treatment were as follows: disease progression in 25 patients (43%), AEs in 11 (19%) patients, death for non-tumour causes in 6 patients (10%), patient refusal in 5 (9%), protocol violation in 1 (2%) and other reasons in 10 (17%).Out of the 59 patients enrolled in the study, 53 were considered to be evaluable for response. Five patients died and one patient discontinued study treatment because of AEs before completing the first 3 months of treatment and before response had been evaluated. However, they were included in the efficacy analysis as treatment failures in an intention-to-treat analysis . OverallProgression-free survival median was 10.8 months or irinotecan (n=6) with or without cetuximab. All these patients had no co-morbidities along with an acceptable IADL and ADL index at baseline, and their tolerability to study treatment was good.A total of 13 patients received second-line chemotherapy after progression, which consisted of oxaliplatin- reported at least one treatment-related emergent AE. The majority (74%) of treatment-related AEs were considered to be of grade 1/2. Hand–foot syndrome, diarrhoea, asthenia, pain, mucositis and arterial hypertension were the most frequent (>20%) treatment-related AEs reported . In all,−1 (23 vs 13% P<0.05). Furthermore, the CrCl mean value was significantly lower in cycles in which a grade 3/4 AE was reported than in cycles not reporting this AE grade .No correlation between the development of grade 3/4 AEs and age, ECOG, co-morbidity, IADL and ADL at baseline was observed. A higher frequency of bevacizumab-non-related grade 3/4 AEs was noted in those cycles in which CrCl was ⩽50 ml minThis is the first complete phase II study that analyses the efficacy and tolerability of bevacizumab combined with capecitabine chemotherapy in the elderly with mCRC. The efficacy of this regimen was noteworthy, with a 34% ORR, a disease control achievement in 71% of the patients and a median PFS and median OS of 10.8 and 18 months, respectively. These results seem to be better than those reported with the 5-FU–LV–bevacizumab regimen , even though the dose is reduced according to the common recommendations. In addition, clear instructions must be provided both to the patient and to his/her caregiver on the management of acute AEs, such as diarrhoea, mucositis or fever through regular telephone contact with their doctor or nurse.A relationship was found between renal function before the administration of each chemotherapy cycle and subsequent reporting of grade 3/4 AEs. Thus, caution should be exercised in this group of vulnerable elderly subjects regarding their renal function, and CrCl should be calculated before each chemotherapy cycle. Furthermore, administration of capecitabine in elderly patients with CrCl ⩽50 ml minvs 39% vs 15 vs 15%, respectively; Recently, results of some randomised studies in mCRC point to a similar survival rate irrespective of whether a first-line polychemotherapy is used in the first instance and treatment is changed to monotherapy after progression, or monotherapy is used in the first instance, followed by polychemotherapy on progression . In realIn conclusion, our results suggest that elderly patients with some vulnerability criterion (prefrail) unsuitable for receiving first-line polychemotherapy may benefit from bevacizumab in combination with capecitabine with an acceptable toxicity profile. Nevertheless, the most suitable therapeutic regimen for this group of patients is still pending and future studies particularly designed for this elderly population are needed.

It recognizes the sequence 5′-AGACC-3′ and methylates the internal adenine. M.EcoP1I requires Mg2+ for the transfer of methyl groups to DNA. M.EcoP1I is shown to exist as dimer in solution, and even at high salt concentrations (0.5 M) the dimeric M.EcoP1I does not dissociate into monomers suggesting a strong interaction between the monomer subunits. Preincubation and isotope partitioning studies with M.EcoP1I indicate a kinetic mechanism where the duplex DNA binds first followed by AdoMet. Interestingly, M.EcoP1I methylates DNA substrates in the presence of Mn2+ and Ca2+ other than Mg2+ with varying affinities. Amino acid analysis and methylation assays in the presence of metal ions suggest that M.EcoP1I has indeed two metal ion-binding sites [358ID(x)n … ExK401 and 600DxDxD604 motif]. EcoP1I DNA MTase catalyzes the transfer of methyl groups using a distributive mode of methylation on DNA containing more than one recognition site. A chemical modification of EcoP1I DNA MTase using N-ethylmaleimide resulted in an irreversible inactivation of enzyme activity suggesting the possible role of cysteine residues in catalysis.EcoP1I DNA MTase (M.EcoP1I), an N S-adenosyl-L-methionine (AdoMet) to form methylated DNA and S-adenosyl-L-homocysteine (AdoHcy). In prokaryotes, DNA methylation participates in DNA strand discrimination during postreplicative mismatch repair, protection against phages, gene regulation, cell cycle control, bacterial virulence, transcription, and control of DNA replication [6 position or cytosine residues at the N4 or C5 positions [4-methylcytosine or N6-methyladenine while endocyclic MTases methylate cytosine residues at the C5 position. A structure-guided sequence analysis of exocyclic and endocyclic DNA MTases showed that nine conserved motifs (motifs I-VIII and X) are present suggesting that DNA MTases are closely related to one another [DNA methyltransferases (MTases) catalyze the transfer of methyl groups to DNA from lication . The dislication . DNA MTaositions . Based o another .Escherichia coli [mod gene) can be purified with methylation as the only enzymatic activity. EcoP1I DNA methyltransferase (M.EcoP1I) catalyses the transfer of a methyl group from AdoMet to the second adenine in the recognition sequence 5′-AGACC-3′ to form N6-methyladenine in the presence of metal ions [β-subgroup of exocyclic amino MTases . Mutational analysis of the AdoMet-binding motif and the catalytic motif of M.EcoP1I abolished methylation activity suggesting the importance of the motifs in AdoMet binding and transfer of the methyl group to DNA [2+ and does not methylate single-strand DNA [2+ ion was required for base flipping during the methyl transfer reaction [EcoP1I belongs to the Type III R-M system encoded by the prophage P1 that infects tal ions . One of p to DNA . Unlike rand DNA . Mutatioreaction . This stEscherichia coli DH5α (F− 80dlacZ M15 (lacZYA-argF) U169 recA1 endA1hsdR17 phoAsupE44 −thi-1 gyrA96 relA1) cells were used for the isolation of DNA. Proteins were expressed in E. coli BL21(DE3) pLysS [F−ompT hsdSB(rB−mB−)gal dcm (DE3) pLysS (CamR)] cells by transformation with appropriate plasmid constructs, using standard protocol [S-Adenosyl-L-[3H] methionine (AdoMet) (78.9 Ci/mmol) was purchased from PerkinElmer Singapore Pte. Ltd, Singapore, and GE Healthcare Biosciences Ltd., Hong Kong. Calibration kits for molecular weight determination by gel-filtration chromatography analysis were purchased from BioRad Laboratory Inc., USA, and molecular weight markers for SDS-PAGE were purchased from Fermentas Life Sciences, USA. AdoMet, chloramphenicol, ampicillin, bovine serum albumin, HEPES, N-ethylmaleimide, Coomassie brilliant blue, EDTA, RNase A, and S-Adenosyl-L-homocysteine (AdoHcy) were purchased from Sigma-Aldrich Co., USA. Ni-NTA beads were purchased from Invitrogen, USA. Heparin-sepharose was purchased from GE Healthcare Biosciences Ltd. Hong Kong. DE 81 anion-exchange filter papers were purchased from Whatman, USA. ELISA plates were purchased from Thermo Fisher Scientific, Denmark. All other chemicals used were of the highest grade of purity. Oligonucleotides for methylation assays were purchased from the Sigma-Aldrich Co., USA. Double-stranded DNA concentration was measured spectrophotometrically, assuming an A260 of 1.0 to correspond to 50 μg/mL for double-strand DNA and 33 μg/mL for single-strand DNA.Restriction endonucleases and T4 DNA ligase were obtained from New England Biolabs. Phusion DNA polymerase was obtained from Finnzymes. M.EcoP1I gene was amplified by a polymerase chain reaction (PCR) using pVK1 construct and lysed by sonication. Inductions were checked by subjecting bacterial cell extracts to 0.1% SDS and 10% PAGE, followed by the staining of protein bands with Coomassie brilliant blue R-250.β-mercaptoethanol, 2 mM imidazole, 0.5% Triton-X-100, and 1 mM PMSF) and lysed by sonication on ice. The cell lysate was centrifuged at 27,200 g for 1 hour at 4°C, and the supernatant was loaded onto an Ni2+-NTA affinity column equilibrated with buffer A. The column was washed with 100 bed volumes of buffer A containing 30 mM imidazole and the protein was eluted with a linear gradient of 100–300 mM imidazole present in the same buffer. Fractions containing the pure (His)6-M.EcoP1I protein were pooled and dialyzed against buffer B and loaded onto the Heparin-Sepharose column. The column was washed with 10 bed volumes of buffer B and eluted with a linear gradient of 100–500 mM NaCl. Fractions containing the pure protein were dialyzed against a 10 mM Tris pH 7.4 buffer containing 50 mM NaCl and 20% glycerol and stored at 4°C. Protein concentrations were estimated using the Bradford reagent (Sigma-Aldrich Co.) with bovine serum albumin as the standard.Bacterial cells (2 g) were resuspended in 20 mL of buffer A (20 mM Tris-HCl buffer (pH 8.0) containing 500 mM NaCl, 10% glycerol, 2 mM E. coli JM109 by transforming plasmid pUC18-M.EcoP15I [M.EcoP15I was expressed in 3H-methyl]AdoMet to the washed filter. Background counts were measured at zero-time incubation, incubation in the absence of the enzyme was subtracted (less than 100 cpm), and the data were analyzed.All methylation assays monitored the incorporation of tritiated methyl groups into DNA containing EcoP1I and EcoP15I recognition sequences by using modified ion-exchange filter assays . All dat3H-methyl] groups in biotin-tagged oligonucleotides (duplex I and II) containing its recognition site. The reaction was carried out in 20 μl volume containing a 10 mM Hepes buffer, pH 8.0, containing 6.4 mM MgCl2, 0.25 mM EDTA, and 7 mM β-mercaptoethanol. Typically, the reactions were performed with 2 pmol of substrate DNA, 100 nM of purified M.EcoP1I, and 1 μM of [3H-methyl]AdoMet (78.9 Ci/mmol) at 37°C for 30 minutes.A biotin-avidin micro plate assay was used for the analysis of the enzymatic methylation of DNA . The MTaμg avidin dissolved in 100 μl of 100 mM NaHCO3 (pH 9.6) and incubated overnight at 4°C. The wells were washed five times with 200 μl PBST . To measure the activity of the enzyme, the methylation reaction mixture was pipetted into the wells of a micro plate. PBST supplemented with 500 mM NaCl and 1 mM EDTA was added to a total volume of 50 μl and the reaction mixture was incubated for 30 minutes to allow binding of the biotin-tagged oligonucleotides to the micro plate. The wells were washed five times with 200 μl PBST supplemented with 500 mM NaCl to remove the unreacted AdoMet and the enzyme. High salt in the washing buffer was used to prevent binding of the MTase to the DNA. Complete removal of the MTase was important, because unreacted AdoMet could bind to the protein and thereby be retained. Subsequently, the DNA was degraded using 500 ng Serratia marcescens endonuclease in 100 μl of 50 mM Tris–HCl, pH 8.0, 5 mM MgCl2 for 30 minutes at 37°C. The released radioactivity was estimated by liquid scintillation counting of the reaction mixture after adding 3 mL of scintillation fluid. Each experiment was done in duplicates and repeated three times, and the average values were reported.Microplates were coated with 1 280. The void volume (Vo) of the column was found to be 8 mL and the bed volume 24 mL. The elution volumes (Ve) of marker proteins and M.EcoP1I were determined. The molecular mass of M.EcoP1I was calculated from the plot of Ve/Vo  versus log molecular weight.Gel-filtration analysis was performed on a Superose 6 HR 10/30 column in buffer B. To determine the molecular mass of M.EcoP1I, the column was calibrated with suitable molecular weight markers ranging from 12 kDa to 150 kDa. The protein was eluted with the equilibration buffer at 0.2 mL/min and was monitored by measuring the AμM [3H-methyl]AdoMet at 25°C for 5 minutes. The preincubated enzyme was diluted to a final volume of 160 μl, containing labeled 1 μM [3H-methyl]AdoMet and 1 μM DNA (duplex I). Aliquots of 20 μl each were removed at 15-, 30-, 45-, 60-, 75-, 90-, 105- and 120-s time intervals and the product formation was analyzed. In a parallel reaction, the abovementioned preincubated mix was brought to 160 μl with a methylation buffer containing 1 μM unlabeled AdoMet and 1.0 μM DNA (duplex I) and the methylation reaction was carried out at 15-, 30-, 45-, 60-, 75-, 90-, 105-, and 120-s-time intervals. Product formation was analyzed using a filter-binding assay.M.EcoP1I (400 nM) was preincubated with 1 3H-methyl]AdoMet (1 μM), the concentration of DNA was varied in the range of 50 nM–1 μM. All data are corrected for the nonspecific binding of [3H-methyl]AdoMet to the washed filter. Values for KmDNA and Vmax were found by fitting the data to a rectangular hyperbola in Sigma Plot 9. Similarly, initial velocity experiments were carried out by varying the concentration of [3H-methyl]AdoMet in the range of 50 nM–2 μM while keeping the DNA concentration fixed at 1 μM and other reaction conditions identical. Values for KmAdoMet and Vmax were found by fitting the data to a rectangular hyperbola in Sigma Plot 9. The turnover number (kcat) was calculated as the ratio of Vmax to the enzyme concentration used. The equations used to obtain the kinetic constants Vmax, KmDNA, KmAdoMet, and kcat are as described in AdoMet (1 μM) or with duplex I (1 μM) for 5 minutes at 37°C, and the reaction was initiated by adding DNA or [3H-methyl]AdoMet, respectively. As shown in For the catalytic cycle of DNA MTases, the binding of substrates could occur in a random or sequential order. To determine this, M.EcoP1I (400 nM) was preincubated with AdoMet was added into reaction mixes containing an excess of DNA and labeled [3H-methyl]AdoMet or unlabeled AdoMet. The preincubation of M.EcoP1I with labeled [3H-methyl]AdoMet resulted in a burst of product formation upon reaction initiation with the addition of [3H-methyl]AdoMet and DNA . The enzyme showed maximal activity in the presence of Mg2+ and Ca2+ whereas in the presence of Mn2+, M.EcoP1I methylated DNA less efficiently. It has been shown that M.EcoP1I binds to DNA in the presence of various metal ions with varying affinities AdoMet was added to follow the methyl transfer reaction up to 15 minutes. To the other half, 1 μM of [3H-methyl]AdoMet and 20 μM of a 51 mer oligonucleotide substrate (duplex III) without a biotin-tag as a trap was followed by methylation up to 15 minutes. The methylation of the biotin-tagged oligonucleotide (duplex II) was followed by a biotin-avidin micro plate assay with a biotin-tag at the 5′ end that contained two EcoP1I recognition sites separated by 19 bp was used. The biotin-tagged oligonucleotide are more efficient MTases than Mod (M2) alone. While ATP stimulates methylation activity of the restriction enzyme, the activity of the M.EcoP1I is not affected. It is proposed that stimulation of methylation activity of R.EcoP1I and R.EcoP15I could be due to DNA translocation which transforms modification from a distributive to a processive reaction.We have also carried out experiments with Type III restriction enzymes (R.EcoP1I and R.EcoP15I) to determine the mode of methylation and the results suggest that these Type III restriction enzymes follow a distributive mode of methylation in the absence of ATP (data not shown). In the presence of ATP, Type III restriction enzymes might have been modified by NEM. However, substitution of Cys344 in M.EcoP15I with alanine resulted in an inactive enzyme which was able to bind AdoMet efficiently but failed to bind DNA. These results suggested that Cys344 is present in DNA binding domain and is important for enzyme activity. Mutational analysis of other cysteine residues did not result in change of enzyme activity [The thiol group of cysteine is one of the most reactive functional groups among all amino acid chains . Of all Kapp) were calculated from the slopes of the lines obtained from the first-order plot . This is because NEM is known to modify lysine residues at pH greater than 7, although the reaction is very slow. Inactivation kinetics was carried out with a freshly dialyzed enzyme at 1.0, 5.0, and 10 mM NEM . The modder plot . These vder plot to obtaiThe decrease in enzyme activity could be due to either the modification of a cysteine residue involved in methyl group transfer or because of the modification at the substrate binding sites. To investigate the latter possibility, the enzyme was incubated with AdoMet or the 31 mer duplex I containing the recognition sequence, prior to modification with NEM. Our results with M.EcoP1I indicate that a cysteine residue may be involved in AdoMet binding. The exact cysteine residue that plays a role in catalysis is not known. Sequence alignment of M.EcoP1I with M.EcoP15I showed that cysteine residues at positions 28, 211, 552, and 576 of M.EcoP1I correspond to cysteine residues at positions 30, 213, 553, and 577 of M.EcoP15I. Although Cys256 in M.EcoP1I is not conserved but it is present in target recognition domain as in the case of Cys344 of M.EcoP15I . Taken tThe key findings of the present study are the methylation of DNA in the presence of various divalent metal ions and mode of methylation by EcoP1I DNA MTase. Preincubation studies demonstrate an ordered mechanism for M.EcoP1I where DNA binds first followed by AdoMet suggesting that the M.EcoP1I-DNA complex is catalytically competent. M.EcoP1I catalyzes the transfer of methyl groups using a distributive mode of methylation on DNA containing more than one recognition site. The chemical modification of M.EcoP1I using NEM indicates that a cysteine residue may be involved in AdoMet binding. These findings provide an impetus for exploring the role of DNA methylation and metal ions in the structure and function of DNA MTases belonging to Type III R-M systems.

Defining regions of genomic imbalance can identify genes involved in tumour development. Conventional cytogenetics has identified several nonrandom copy number alterations (CNA) in uveal melanomas (UVM), which include monosomy 3, chromosome 6 abnormalities and gain of 8q. To gain further insight into the CNAs and define the regions involved more precisely we analysed 18 primary UVMs using 1 Mb BAC microarray comparative genomic hybridisation (CGH). Our analysis showed that the most common genomic imbalances were 8q gain (78%), 6p gain (67%) and monosomy 3 (56%). Two distinct CGH profiles could be delineated on the basis of the chromosome 3 status. The most common genetic changes in monosomy 3 tumours, in our study, were gain of 8q11.21–q24.3, 6p25.1–p21.2, 21q21.2–q21.3 and 21q22.13–q22.3 and loss of 1p36.33–p34.3, 1p31.1–p21.2, 6q16.2–q25.3 and 8p23.3–p11.23. In contrast, disomy 3 tumours showed recurrent gains of only 6p25.3–p22.3 and 8q23.2–q24.3. Our approach allowed definition of the smallest overlapping regions of imbalance, which may be important in the development of UVM. Uveal melanomas (UVM) are the most common primary intraocular malignant tumours on chromosomes 6 and 8 and the DNA concentration was determined using the RediPlate 96 PicoGreen dsDNA Quantitation Kit . Both procedures were performed following manufacturers instructions. The genomic DNA arrays used in these experiments were obtained from the Cancer Research UK DNA Microarray Facility and consist of 3421 BAC and PAC clones, which provide an average genomic resolution of 1 Mb. Reference DNA and test DNA were labelled separately with Cy3 and Cy5 dyes using the BioPrime Labelling Kit , following manufacturers instructions and as described previously (μl each) were combined and precipitated together with 100 μg of human Cot1 DNA and 50 μl yeast tRNA . The DNA pellets were resuspended in 10 μl of sterile water prior to being mixed with 10 μl of microarray hybridisation solution and 20 μl of deionised formamide . The reconstituted probes were then incubated at 72°C for 15 min followed by 30 min at 37°C. The probes were hybridised to BAC arrays and incubated for 48–72 h at 37°C in a humidified chamber. Slides were washed for 15 min at 42°C in 2 × SSC, 0.1% SDS, 15 min at 42°C in 50% formamide/2 × SSC, 30 min at 42°C in 2 × SSC, 0.1% SDS and 15 min at room temperature in 0.2 × SSC, before being dried by spinning in a centrifuge for 5 min at 150 g.Test and reference DNAs . Spots were defined by use of the automatic grid feature of the software and manually adjusted where necessary. The data was normalised and analysed using Normalise Suite v2.4 . It has been proposed that at least two cytogenetic pathways of clonal evolution exist for UVMs, one initiated with monosomy 3 and one with gain of 6p . In our study, excluding anomalies of chromosome 3, the frequency of CNAs were higher, albeit nonsignificantly, in the tumours with monosomy 3 than in tumours with disomy 3 ; 7.5 CNAs (range 2–20) and 3.5 CNAs (range 1–13) respectively. Recent work on other cancers has shown prognosis is worse when high rates of chromosome instability are a feature, probably a consequence of the accumulation of induced genetic alterations and 13.9 mm and after adjusting for tumour size there was little support for a relationship between monosomy 3 status and frequency of CNAs per se (P=0.80). Although only a small number of tumours were analysed in our study this finding invites speculation that monosomy 3 may be a consequence of clonal selection during tumour progression.UVMs characterised by monosomy 3 are associated with a greater tumour size and a poor prognosis for survival a number of rarely reported chromosomal regions of abnormality in UVM. The minimum regions defined are likely to harbour genes important to the development of UVMs.

Similarly, tumour-mediated immune suppression remains a controversial issue among tumour immunologists, although modern molecular immunology has identified at least a dozen mechanisms attributed to tumours and responsible for immune cell dysfunction in tumour-bearing hosts . In cultures of murine B16 melanoma cells, for example, the isolated MV were found to contain glycoprotein profiles identical to those in the tumour cell membrane .More than 25 years ago, reports appeared in the scientific literature describing isolation from supernatants of human tumour cell lines of membraneous vesicles (MV) expressing molecular markers characteristic of tumour plasma membranes close the gap between two parallel research fields, placing future investigations of exosomes and MV on the same platform; (b) give credence to the fact that MV/exosomes are involved in immune regulation in cancer and (c) open a way for creative novel approaches to the use of these structures in future therapy of cancer.Exosomes became a focus of particular interest to cancer investigators when Zitvogel and co-workers reported that dendritic cells (DC) generated from peripheral blood of cancer patients produce and release exosomes, which accumulate tumour-rejection antigens and thus can be used as antitumour vaccines . These iet al (1983b) reported that the serum level of MV increases prior to the clinical diagnosis of recurrent disease. Our own data suggest that the FasL content of MV in patients with head and neck cancer may be related to disease activity and prognosis, in that patients with Stage III and IV disease and those with lymph node metastases had MV in the sera with the highest content of the 41kDa FasL is not clear, but it appears that they persist in the circulation long after therapy. Taylor MV isolated from body fluids of patients with various malignancies are enriched in the membrane-bound molecules able to induce apoptosis in activated immune cells. This provides an explanation for spontaneous apoptosis of T lymphocytes observed in the peripheral circulation of patients with cancer . Thus, the role exosomes play in DC-mediated T-cell responses is not yet clear. DC appear to be able to edit exosome processing, with a final outcome directed toward tolerance rather than immune stimulation, depending perhaps on the route of MV administration or on their antigenic mosaic. MV/exosomes may function as messengers for positive or negative intercellular signalling and transfer of molecules between T cells, DC and the tumour or foreign graft. Caution is, therefore, needed in using MV/exosomes as antitumour vaccines for fear of inducing tolerance. Dissection of immunogenic vs tolerogenic signals delivered by these structures to DC or T lymphocytes is an important future challenge. There is evidence that MV can directly downregulate expression of the TcR-associated ζ chain as well as expression of JAK3 in Jurkat cells co-incubated with MV. While these data confirm suppressive effects of MV on activated T cells, a better understanding of the molecular mechanisms and signalling pathways targeted by MV/exosomes are necessary.An important aspect of the MV/exosome biology concerns their general role in immune tolerance. Thus, MV have been isolated from maternal blood and are known to be produced by placental cells . FurtherMV/exosomes are a perfect example of the efficiency of tumours in orchestrating their escape from the host immune system. By adapting a ubiquitous process of membrane shedding, tumours are able to accomplish the loss of those antigens that may be immunogenic and capable of signalling to immune cells as well as induce dysfunction or death of immune effector cells located at a distance from the tumour microenvironment. A better understanding of this process, and especially of molecular mechanisms involved in exosome/MV interactions with immune cells, is likely to provide significant insights into the phenomenon of tumour-related immune tolerance. In addition, insights into the MV/exosome biology are likely to offer opportunities for the development of novel approaches to immunotherapy of cancer, graft rejection and other diseases.

An examination of where in the income distribution income is most strongly associated with risk of mortality will provide guidance for identifying the most critical pathways underlying the connections between income and mortality, and may help to inform public health interventions to reduce socioeconomic disparities. Prior studies have suggested stronger associations at the lower end of the income distribution, but these studies did not have detailed categories of income, were unable to exclude individuals whose declining health may affect their income and did not use methods to determine exact threshold points of non-linearity. The purpose of this study is to describe the non-linear risks of all-cause and cause-specific mortality across the income distribution.We examined potential non-linear risk of mortality by family income level in a population that had not retired early, changed jobs, or changed to part-time work due to health reasons, in order to minimize the effects of illness on income. We used data from the US National Health and Nutrition Examination Survey (1988–1994), among individuals age 18–64 at baseline, with mortality follow-up to the year 2001 . Differential risk of mortality was examined using proportional hazard models with penalized regression splines in order to allow for non-linear associations between mortality risk and income, controlling for age, race/ethnicity, marital status, level of educational attainment and occupational category.We observed significant non-linear risks of all-cause mortality, as well as for certain specific causes of death at different levels of income. Typically, risk of mortality decreased with increasing income levels only among persons whose family income was below the median; above this level, there was little decreasing risk of mortality with higher levels of income. There was also some variation in mortality risk at different levels of income by cause and gender.The majority of the income associated mortality risk in individuals between the ages of 18–77 in the United States is among the population whose family income is below the median . Efforts to decrease socioeconomic disparities may have the greatest impact if focused on this population. Despite longstanding knowledge of an inverse association between income and mortality in the United States ,2 and caWithin the US, only two studies have explicitly examined the shape of the relationship between income and mortality ,10 and bThe aim of this paper is to describe the shape of the income and all-cause and cause-specific mortality associations among US adults age 18 to 64 at baseline (who were age 25–77 by the end of follow-up). We examined the association of income and mortality, restricting our analysis only to those individuals who were free from health conditions that caused them to change jobs, change to part time work, or retire early due to health reasons. By using data with a large number of income categories and by modelling the association without using a pre-specified functional form or pre-specified inflection points we are able to more accurately estimate the shape of the income and cause-specific mortality associations. We also compare the fit of models with baseline covariates and either a linear income term, a log-income term, or a smoothed spline income term in order to determine which income-mortality model provides the best fit to the data.The US Third National Health and Nutrition Examination Survey (NHANES III), 1988–1994, was designed to be representative of the non-institutionalized population of the U.S. when analyzed using weights to account for over-sampling and non-response . Our anaWe examined all-cause mortality and three cause-specific categories of adult mortality as defined by the following ICD-10 classifications: 1) heart disease , 2) cancer (C00-C97) and 3) injury .Total combined pre-tax family income for the 12 months prior to the survey included wages, salaries, income from self-employment, veteran's benefits, interest dividends, rental income and public assistance. Family income data were available in 28 income categories . Income from each half of the survey was adjusted to 1991 dollars using the Urban Consumer Price Index. For all analyses we used the midpoint of each income category and calculated the mid-point of the upper category of income by assuming a Pareto distribution of family income per standard methodology . Income Additional covariates included: (a) education (0–17 or more years), (b) race/ethnicity , (c) age (in years), and (d) occupation, referring to the longest held occupation, divided into 5 categories: (1): white collar and professional ; (2): white collar, semi-routine ; (3): blue collar, high skill ; (4): blue collar, semi-routine ; and (5): never worked. Detailed NHANES III occupational categories were used to create this variable [see Additional file In order to be consistent with prior work on the shape of the association of income and mortality ,8,9 we mThe income and cause-specific mortality associations were modelled with penalized splines (with a cubic basis) in proportional hazard survival models in order to allow for possible non-linear dependence of mortality hazard on income (as well as for education when included as a covariate),20. We uWe first present the unadjusted incidence rates of all-cause mortality by gender and income table . We thenTable Table Figure For all-cause mortality Figure , among bFor cause-specific mortality Figure , risk ofWe repeated the analyses shown in Figures We also examined the extent to which specifying a non-linear functional form of income improved the overall model fit for prediction of mortality as compared to: 1) baseline covariates and no income variable; 2) baseline covariates and a linear income variable; or 3) baseline covariates and a log transformation of income. We did so by comparing the likelihood ratios of each model, taking into account increased degrees of freedom of income and the non-linear income models Table . A lowerAmong US women and men age 18 to 64 at baseline, with follow-up of up to 13 years, we found evidence of a generally stronger associations of income with all-cause mortality at the lower end of the income distribution, i.e., under median income. Similar patterns occurred for deaths due to cancer and injury; by contrast, a more linear association across the full income range was evident for death due to heart disease. These results are unlikely to be substantially driven by contemporaneous effects of illness on income because of the restrictions of our sample to individuals with more than one year of follow up who had not ever changed jobs, changed to part-time work, or retired early due to health reasons. In fact, our results are likely a conservative estimate of the association due to the potential effects of income on illness, given that we restricted our analysis to a healthy sample that has not left the labor force due to health reasons.Our results for all-cause mortality are generally consistent with the previously reported logarithmic functional form of association with income ,10. HoweThese results should be considered within the context of several study limitations. First, the data we used lack specific income categories above $50,000 a year, which limits our understanding of the impacts of income for the 8% of families that had the highest equivalized income. Our estimates at the upper end of the income distribution are less precise, as indicated by the widening confidence intervals in the plots, and the point estimates in these regions should be interpreted cautiously. A second limitation of this analysis is that income is measured at only one point in time, thus not capturing household income dynamics that influence health outcomes -31. ThisBased on a qualitative inspection of the smoothed plots of the income-mortality association, and the overall tests of model fit, we have shown that a non-linear association with a stronger association below median income is the most prevalent pattern of association. There were however variations in this association by cause and by gender. For heart disease, in particular among men, there appears to be less of a threshold at median income. While this may be due to mortality risk for heart disease more evenly distributed across the income distribution, an alternative explanation is that we have limited power to detect the shape of the association due to a relatively small number of heart disease events above median income . Supporting this later speculation is prior work examining a two slope model of income and cardiovascular mortality that has shown there is a stronger association at lower income levels .While significant associations were observed for both men and women, and the shape of the relation was similar for all-cause, heart disease and injury mortality, there were different associations observed among women and men for cancer above median income – no association for men, and a slightly increasing association among women. Tests of overall model fit showed that while a linear or logarithmic model of income was an equally good fit to the data among men, a non-linear model was a better fit among women. This difference may be due to the positive association between socioeconomic position and rates of breast cancer mortality in women that does not exist as strongly for any site of cancer in men ,35. ThesOur results are generally consistent with the two other US studies that examined the shape of the income-mortality association ,10, despThe results presented have implications for understanding the etiological links between income and mortality. Based on the observed associations, income disparities in mortality chiefly among lower income populations (below the median income) appear to be driving the commonly reported socioeconomic gradients in all-cause, cancer among men and injury mortality. These findings also underscore why efforts to address income disparities in mortality cannot be restricted simply to persons below the US poverty line but instead should include persons with income at least up to the median level. The difference in size of these two populations is large: in 1991, the mid-point of the income data collection, 13% of families in the U.S. were below the poverty line as compared to 50% of families below the median family income , an absolute difference of 37% of US families, and similar to what we have in our study population (Table In the US context, in adults aged 18–64 at baseline, the non-linear risk of mortality with income arises from the stronger relationship between income level and mortality among lower compared to higher income populations. This evidence is supportive of the hypothesis that policies to improve the health of individuals among the lower half of the income distribution will have the most impact on reducing US income-based disparities in mortality, although from our data we cannot establish why this association exists. Second, if the associations presented are not due to residual confounding, measurement error, or unaccounted for reverse causation, they may also have implications for the importance of income in contributing to premature mortality. Future studies determining the pathways connecting income and mortality will benefit from a consideration of where in the income distribution the burden of disparity exists, and that this association varies by cause.The authors declare that they have no competing interests.DHR designed the study, conducted the analysis, and lead the writing of all sections of the manuscript. NK contributed to the design of the study and contributed to writing all sections of the manuscript. BC contributed to the design of the study, data analysis and contributed to writing all sections of the manuscript. LFB contributed to the design of the study and contributed to writing all sections of the manuscript.The pre-publication history for this paper can be accessed here:Table of occupational classifications. The data provided describes the categorization of the NHANES III occupational categories in order to create the occupation variable used as a covariate in the analysis.Click here for file

Brucella spp. are Gram-negative, facultative intracellular bacteria that cause brucellosis, one of the commonest zoonotic diseases found worldwide in humans and a variety of animal species. While several animal vaccines are available, there is no effective and safe vaccine for prevention of brucellosis in humans. VIOLIN (http://www.violinet.org) is a web-based vaccine database and analysis system that curates, stores, and analyzes published data of commercialized vaccines, and vaccines in clinical trials or in research. VIOLIN contains information for 454 vaccines or vaccine candidates for 73 pathogens. VIOLIN also contains many bioinformatics tools for vaccine data analysis, data integration, and vaccine target prediction. To demonstrate the applicability of VIOLIN for vaccine research, VIOLIN was used for bioinformatics analysis of existing Brucella vaccines and prediction of new Brucella vaccine targets. e.g., Vaxmesh) that provide in-depth analysis of Brucella vaccine literature. As a result of manual literature curation, VIOLIN contains information for 38 Brucella vaccines or vaccine candidates, 14 protective Brucella antigens, and 68 host response studies to Brucella vaccines from 97 peer-reviewed articles. These Brucella vaccines are classified in the Vaccine Ontology (VO) system and used for different ontological applications. The web-based VIOLIN vaccine target prediction program Vaxign was used to predict new Brucella vaccine targets. Vaxign identified 14 outer membrane proteins that are conserved in six virulent strains from B. abortus, B. melitensis, and B. suis that are pathogenic in humans. Of the 14 membrane proteins, two proteins (Omp2b and Omp31-1) are not present in B. ovis, a Brucella species that is not pathogenic in humans. Brucella vaccine data stored in VIOLIN were compared and analyzed using the VIOLIN query system.VIOLIN contains many literature mining programs (Brucella vaccines promotes classification and analysis of existing Brucella vaccines and vaccine candidates. Computational prediction of Brucella vaccine targets provides more candidates for rational vaccine development. The use of VIOLIN provides a general approach that can be applied for analyses of vaccines against other pathogens and infection diseases. Bioinformatics curation and ontological representation of Brucella is a Gram-negative, facultative intracellular bacterium that causes brucellosis in humans and animals [Brucella are taxonomically placed in the alpha-2 subdivision of the class Proteobacteria. Traditionally there are six species of Brucella based on the preferential host specificity: B. melitensis (goats), B. abortus (cattle), B. suis (swine), B. canis (dogs), B. ovis (sheep) and B. neotomae (desert mice). The first four species listed in decreasing order of severity are pathogenic to humans making brucellosis a zoonotic disease. These bacteria are also amenable for use in biological warfare and bio-terrorism. Recently, two new species B. cetaceae (cetacean) and B. pinnipediae have been described [Brucella strains are currently available in the NCBI RefSeq database. Four genomes from B. abortus, B. melitensis, and B. suis have been extensively analyzed [Brucella infections. Extensive studies on Brucella have recently been concentrated on understanding the mechanisms for protective Brucella immunity and the development of effective human brucellosis vaccines. animals . Brucellanalyzed -6. Whilhttp://www.violinet.org) is a web-based vaccine database and analysis system. VIOLIN contains general information on microbial pathogenesis, host ranges, and host protective immunity, as well as vaccine-specific information such as vaccine type, preparation method, genetically engineered genes, and host responses in various animal models. VIOLIN contains information about 454 vaccines and vaccine candidates for 73 pathogens. VIOLIN contains many bioinformatics tools for vaccine literature mining, vaccine data analysis and integration, and vaccine target prediction. For example, VIOLIN includes Vaxmesh and Vaxpresso programs that may be used to mine vaccine literature based on MeSH controlled vocabulary and natural language processing (NLP), respectively. Dr. Yongqun He, the founder of the VIOLIN initiated and leads community-based development of the Vaccine Ontology to support vaccine integration and automated reasoning. A web-based vaccine target prediction program Vaxign available in VIOLIN is used to predict vaccine targets based on genome sequence analysis using a reverse vaccinology strategy. VIOLIN is the controlled vocabulary thesaurus developed by the National Library of Medicine (NLM) to index articles deposited for the MEDLINE/PubMed database. There are over 25,000 MeSH terms organized in a hierarchical fashion based on 15 top-level categories. The MeSH hierarchical structure permits literature searching at various levels of specificity. Vaxmesh provides an interactive web interface for users to locate articles using MeSH terms in a hierarchical MeSH tree structure. Figure Brucella vaccine area , physical sciences (194 articles), and geographic locations (47 articles) -based vaccine literature mining program; VIOLIN Litesearch, an advanced keyword- and category-based search for vaccine literature; and Vaxlert, a literature alert program that provides periodical literature updates through Emails based on the specification of a VIOLIN user. Brucella vaccine information more efficient. Brucella vaccine curation was performed using a web-based literature mining and curation system called Limix [With many literature mining programs available in VIOLIN, it is possible to make manual curation of ed Limix ,8. LimixBrucella vaccines or vaccine candidates that have been officially licensed or proven to provide protection in an animal model . In terms of vaccine types, 1, 8, 10, and 19 vaccines are bacterial vector vaccine, DNA vaccines, subunit vaccines, and live attenuated vaccines, respectively. VIOLIN contains 38 curated el Table . SpecifiA biomedical ontology represents the consensus-based controlled vocabularies of terms and relations which are logically formulated in such a way as to promote automated reasoning. Ontologies are able to structure complex biomedical domains and relate the myriad of data to shared understanding of biomedicine. Ontologies can be used for different purposes. The Gene Ontology (GO) is a well-known example of an ontology created for the primary purpose of providing controlled and standardized terms for naming different types of biological processes, cellular components, and molecular functions . This onhttp://www.violinet.org/vaccineontology) is a collaborative, community-based ontology in the vaccine domain. VO can be used for vaccine data standardization, integration, and computer-assisted reasoning. VO utilizes the Basic Formal Ontology (BFO) (http://www.ifomis.org/bfo), a domain-independent ontology, as an upper level ontology. The VO was developed using the W3C standard Web Ontology Language (OWL) (http://www.w3.org/TR/owl-guide/). The latest version of VO is always available at http://purl.obolibrary.org/obo/vo.owl. In addition, VO has been listed in the OBO website (http://www.obofoundry.org/cgi-bin/detail.cgi?id=vaccine), and deposited in the NCBO BioPortal . To provide a means for users to visualize the definitions and usages of VO terms and their relations, a VO Browser (http://www.violinet.org/vaccineontology/vobrowser/) was developed. The Vaccine Ontology . VO includes 13 live attenuated Brucella vaccines that have the qualities of ‘live’ and ‘attenuated’. When these specific Brucella vaccine terms were also included in a PubMed search, the number of positive paper hits in PubMed increased by more than 10-fold [VO has been used in many applications associated with 10-fold . The com 10-fold . It was e.g., Influenza virus) which kill the infected host [e.g., Brucella) which cannot kill infected host but exhibit diminished replication in a vaccinated host than that in unvaccinated host [Brucella vaccines. To test this hypothesis, the data for 151 groups of Brucella vaccine protection investigations were collected in VIOLIN from peer-reviewed literature publications and analyzed using ANOVA. Out of 16 parameters, 10 were found statistically significant in contributing to protection based on a statistical ANOVA analysis. Examples of these parameters included vaccine strain, vaccine viability, vaccination route, vaccination dose. However, other six parameters, including IL-12 vaccine adjuvant, mouse sex, vaccination route, animal age, vaccination-challenge interval, and challenge dose, were not found statistically significant . A careful study of this use case led to building and validating an ontology-based semantic framework to formally represent ANOVA [Besides vaccine hierarchy, VO can also be used to represent (or model) vaccine investigation. As demonstrated in our two recent reports, vaccine protection investigation can be represented in VO by three continuous steps: vaccination, pathogen challenge, and vaccine efficacy measurement ,15. A me, mouse) or by paBrucella antigens , periplasm (4 proteins), and cytoplasmic membrane (1 protein). The VIOLIN Protegen program stores protective antigens that have been verified experimentally to induce protective immunity. Protegen contains 14 protective ns Table . Among tBrucella infections where T cell response is critical, subcellular localization is not usually an issue since a T cell response could be directed to any protein target. Our curated results confirm that protective Brucella antigens may occur in different subcellular locations.For vaccine development against e.g., human or mouse), and MHC class I and II epitope predictions. To predict Brucella vaccine targets, all 10 sequenced Brucella genomes available in NCBI RefSeq were used for a Vaxign analysis. Reverse vaccinology is an emerging vaccine development approach that starts with the prediction of vaccine targets using bioinformatics screening of an entire genome of a pathogenic organism . As partBrucella infections requires cell-mediated immunity (CMI). Secreted pathogen proteins are likely to stimulate cytotoxic T lymphocyte (CTL) responses [Brucella protein has been found to be secreted in any in vitro culture in a standard culture medium. An O-sialoglycoprotein endopeptidase in B. abortus strain 2308 was identified by Vaxign to be a potential secreted protein. This protein is also conserved in the other virulent B. abortus, B. melitensis, and B. suis strains.As with other intracellular pathogens, protection against esponses . HoweverBrucella outer membrane proteins (OMP) as potential vaccine targets using B. abortus strain 2308 genome [B. abortus strain 2308 are listed in Table B. abortus strain 9-941, B. melitensis strain 16M and ATCC 23457, and B. suis strains 1330 and ATCC 23445. Each of these strains is pathogenic to humans. One protein (BAB1_1944) has homology with human and mouse proteomes. Among these 14 predicted Brucella vaccine targets, Omp25 (YP_414164.1) and Omp31-1 (YP_414995.1) have been verified to be protective Brucella antigens [Brucella antigens have not been studied. The flagellar protein FlgJ appears in B. abortus strains 2308 and 9-941, B. melitensis strain 16M, and B. suis strain ATCC 23445; however, FlgJ is absent from B. suis strain 1330 and B. microti strain CCM 4915. Brucella flagellar genes have recently been found important in Brucella survival in vivo [Brucella flagellar genes can be used for Brucella vaccine development. Vaxign was used to predict 8 genome as the santigens . The lisBrucella vaccine, those Brucella proteins that exist in Brucella strains pathogenic to humans but are absent in Brucella strains that are non-pathogenic to humans would be ideal for vaccine development. Our studies have identified two proteins, Omp2b (YP_414102.1) and Omp31-1 (YP_414995.1), which are conserved in the above mentioned virulent B. abortus, B. melitensis, and B. suis strains that are pathogenic to humans, but absent from B. ovis that is non-pathogenic to humans. Omp2b and Omp31 are two major outer membrane proteins in B. abortus [Brucella infections. If a human Brucella vaccine is developed, these two proteins are considered as priority antigens. A further bioinformatics analysis indicates that the porin protein Omp2b does not exist in live attenuated B. abortus vaccine strain 19, suggesting that Omp2b likely contributes to the attenuation of this mutant. Omp2b also exists in B. canis that is weakly pathogenic to humans. However, Omp31-1 does not exist in B. canis. To develop a human abortus . It is lBrucella periplasmic proteins that are conserved in all B. abortus, B. melitensis, and B. suis genomes and lack sequence similarity with proteins in human or mouse genomes. The values of these proteins for vaccine development also deserve further analysis. Using the same criteria (sequence conservation and dissimilarity from human or mouse proteins), Vaxign detected approximately 1,000 cytoplasmic proteins. It is impractical to individually test this high number of proteins for vaccine development. Considering only five cytoplasmic proteins have been experimentally confirmed to be protective antigens out of 1,000 conserved cytoplasmic proteins adjuvant, Maltose binding protein (MBP). Two VIOLIN programs Vaxjo and Vaxvec permit analysis of vaccine adjuvants and vaccine vectors. The adjuvants used for Brucella vaccines. Animal response information can be searched through VIOLIN Vaxar (http://www.violinet.org/vaxar). Currently, annotated information for 68 host response studies of Brucella vaccines is available in Vaxar. VIOLIN contains many pages that are associated with other vaccine related topics, such as vaccine conferences, manufacturers, and useful web links.Additionally, VIOLIN contains the information for host responses to http://www.cdc.gov/vaccines/pubs/vis/default.htm). The Center for Biologics Evaluation and Research (CBER) under the Food and Drug Administration (FDA) regulates vaccine products and posts relevant information in their vaccine site: http://www.fda.gov/cber/vaccines.htm. There is also a Vaccine Adverse Event Reporting System , co-sponsored by FDA and CDC in USA. Many agent-specific databases are also available, for example, the HIV vaccine resource (http://www3.niaid.nih.gov/research/topics/HIV/vaccines/default.htm) created by the National Institute of Allergy and Infectious Diseases (NIAID) at the National Institutes of Health (NIH). Other vaccine resources include, the Vaccine Page: http://www.vaccines.org/), the Vaccine Resource Library , and the Immunization Action Coalition (http://www.immunize.org/). These databases primarily focus on available information concerning existing licensed vaccines and vaccine regulation. VIOLIN is unique in that it stores and analyzes research data concerning commercial vaccines and vaccines under clinical trial or in early stages of development [A large number of vaccine-related databases exist on the web. There are many government-supported vaccine databases. For example, the Centers for Disease Control and Prevention (CDC) maintain a Vaccine Information Statements (VISs) system (elopment . The development of the Vaccine Ontology (VO) is a community effort and involves many experts in the vaccine and biomedical ontology communities . With thNeisseria meningitidis (MenB), the major cause of sepsis and meningitis in children and young adults [Bacillus anthracis [Streptococcus pneumoniae [Mycobacterium tuberculosis [E. coli [Brucella vaccine targets. Experimental verification of many of these targets is currently under way. Vaxign also contains a program to predict immune epitopes that bind to MHC class I and II molecules in different animal species. Studies analyzing and ranking potential immune epitopes from predicted Brucella proteins are in progress. Promising epitopes will be tested in a wet laboratory. Compared to the traditional vaccine development approach that starts from a wet laboratory, reverse vaccinology begins with dry laboratory bioinformatics analysis, which makes the vaccine development more specific and efficient. Reverse vaccinology was first used by Rino Rappuoli in the development of a vaccine against serogroup B g adults . Since tnthracis , Streptoeumoniae , and Mycrculosis . While trculosis . Vaxign [E. coli . This ste.g., Vaxign and Protegen) obtain Brucella genome sequences and share Brucella gene annotations with the web-based Pathogen-host Interaction Data Integration and Analysis System [Brucella Bioinformatics Portal, a web-based portal with a special emphasis on Brucella genome annotation and literature mining [Brucella vaccines and vaccine targets more efficient. VIOLIN is also associated with other existing data resources. For example, many VIOLIN programs (dias.us) . PHIDIASe mining . PHIDIASBrucella vaccine analysis in this report are generic and also feasible for vaccine studies for other pathogens. It is noted that Brucella is one of the most annotated pathogens among these 73 pathogens listed in VIOLIN. The vaccine information for many pathogens is not systematically annotated to the extent of Brucella vaccines. More work and collaborations with the research experts in these pathogens are necessary to curate and analyze vaccines and vaccine candidates for these pathogens. VIOLIN currently includes vaccine data for 73 pathogens. The VIOLIN methods described for Brucella vaccine data and ontology representation of these vaccines using the Vaccine Ontology (VO). Many tools are developed in VIOLIN to support literature mining and data curation. Examples of data stored in the VIOLIN database include protective Brucella antigens and host responses induced by different Brucella vaccines. Brucella vaccine targets may be predicted using the VIOLIN Vaxign program. Various Brucella vaccine data can be queried using user-friendly web query programs in VIOLIN. The VIOLIN approach is generic and can be used for analyses of vaccines against other pathogens and infection diseases. VIOLIN provides manually curated Brucella vaccines using VIOLIN:Literature mining of The information of all PubMed papers associated with Brucella vaccine and vaccination were downloaded from the PubMed web service. The literature contents were processed using VIOLIN literature mining pipelines [ipelines . The proBrucella vaccines in VIOLIN:Bioinformatics curation of Brucella vaccine curation was performed on the VIOLIN web page using the Limix literature mining and curation system [e.g., NCBI Gene database). n system . Limix aBrucella vaccines:VO representation of Manually curated Brucella vaccines are entered into VO by following the VO development standards [http://protege.stanford.edu/). The FACT++ OWL reasoner [Brucella vaccine hierarchy. tandards . The VO reasoner is used Brucella vaccine targets:Vaxign prediction of All ten Brucella genomes stored in the NCBI RefSeq database were used for prediction of Brucella vaccine targets. The genome of B. abortus strains 2308 was used as a seed genome. The other genomes include five sequenced virulent strains from three main pathogenic Brucella species: B. abortus strain 9-941), B. melitensis strains 16M and ATCC 23457, and B. suis strains 1330 and ATCC 23445. These strain are pathogenic to human. The genome of Brucella vaccine strain S19 was also included in this study for comparison purposes. The other three Brucella genomes are from B. ovis strain ATCC 25840, B. canis ATCC 23365, and B. microti strain CCM 4915. More Brucella genomes have been sequenced and available at http://www.broadinstitute.org/annotation/genome/brucella_group. Since the annotations are not yet finished and their records are not stored in the NCBI RefSeq database, these genomes were not typically used in this study. The Vaxign pipeline was executed by using the Brucella genomes as input data. The processed results were stored in the Vaxign database. The Vaxign web query interface was used to query and analyzed the predicted results. Brucella vaccine information in VIOLIN:Query of All manually curated or computational processed data can be queried through various VIOLIN web pages. Selected query functions are described in detail in the body of this manuscript. COG: The Clusters of Orthologous Groups; GO: Gene Ontology; Limix: Literature Mining and Curation System; MeSH: Medical Subject Headings; NLM: National Library of Medicine; NCBI: National Center for Biotechnology Information; NCBO: National Center for Biomedical Ontology; OBO: Open Biomedical Ontologies; OWL: Web Ontology Language; SOD: Superoxide Dismutase; VIOLIN: Vaccine Investigation and Online Information Network; VO: Vaccine Ontology; W3C: World Wide Web Consortium.The authors declare that they have no competing interests.Brucella vaccine data analysis, VIOLIN design and project manager, manuscript writing. YH: Brucella vaccine data analysis, VIOLIN software developer and database administrator, manuscript editing.ZX:

The crystal packing is consolidated by inter­molecular C—H⋯O and O—H⋯N inter­actions, which link the mol­ecules into zigzag chains propagating along [010]. The chains are further linked into a three-dimensional network by N—H⋯O, C—H⋯N, C—H⋯O and C—H⋯π inter­actions.In the title compound, C Å b = 28.9314 (6) Å c = 9.6446 (2) Å β = 90.010 (1)°V = 1408.27 (5) Å3 Z = 4 Kα radiationMo −1 μ = 0.10 mmT = 100 K 0.53 × 0.20 × 0.08 mm Bruker SMART APEXII CCD diffractometerSADABS; Bruker, 2009T min = 0.950, T max = 0.992Absorption correction: multi-scan (33857 measured reflections4144 independent reflectionsI > 2σ(I)3534 reflections with R int = 0.030 R[F 2 > 2σ(F 2)] = 0.043 wR(F 2) = 0.110 S = 1.05 4144 reflections208 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.43 e Å−3 Δρmin = −0.22 e Å−3 Δρ APEX2 used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL and PLATON (Spek, 2009Data collection: 10.1107/S1600536810000371/hb5304sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536810000371/hb5304Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Caenorhabditis elegans and related parasitic nematodes do not synthesize heme, but instead require environmental heme to grow and develop. Heme homeostasis in these auxotrophs is, therefore, regulated in accordance with available dietary heme. We have capitalized on this auxotrophy in C. elegans to study gene expression changes associated with precisely controlled dietary heme concentrations. RNA was isolated from cultures containing 4, 20, or 500 µM heme; derived cDNA probes were hybridized to Affymetrix C. elegans expression arrays. We identified 288 heme-responsive genes (hrgs) that were differentially expressed under these conditions. Of these genes, 42% had putative homologs in humans, while genomes of medically relevant heme auxotrophs revealed homologs for 12% in both Trypanosoma and Leishmania and 24% in parasitic nematodes. Depletion of each of the 288 hrgs by RNA–mediated interference (RNAi) in a transgenic heme-sensor worm strain identified six genes that regulated heme homeostasis. In addition, seven membrane-spanning transporters involved in heme uptake were identified by RNAi knockdown studies using a toxic heme analog. Comparison of genes that were positive in both of the RNAi screens resulted in the identification of three genes in common that were vital for organismal heme homeostasis in C. elegans. Collectively, our results provide a catalog of genes that are essential for metazoan heme homeostasis and demonstrate the power of C. elegans as a genetic animal model to dissect the regulatory circuits which mediate heme trafficking in both vertebrate hosts and their parasites, which depend on environmental heme for survival.Heme is a cofactor in proteins that function in almost all sub-cellular compartments and in many diverse biological processes. Heme is produced by a conserved biosynthetic pathway that is highly regulated to prevent the accumulation of heme—a cytotoxic, hydrophobic tetrapyrrole. Caenorhabditis elegans is unique among model organisms because it cannot synthesize heme but instead eats environmental heme to grow and develop normally. Thus, worms are an ideal genetic animal model to study heme homeostasis. This work identifies a novel list of 288 heme-responsive genes (hrgs) in C. elegans and a number of related genes in humans and medically relevant parasites. Knocking down the function of each of these hrgs reveals roles for several in heme uptake, transport, and detection within the organism. Our study provides insights into metazoan regulation of organismal heme homeostasis. The identification of parasite-specific hrg homologs may permit the selective design and screening of drugs that specifically target heme uptake pathways in parasites without affecting the host. Thus, this work has therapeutic implications for the treatment of human iron deficiency, one of the top ten mortality factors world-wide.Heme is an iron-containing cofactor for proteins involved in many critical cellular processes. However, free heme is toxic to cells, suggesting that heme synthesis, acquisition, and transport is highly regulated. Efforts to understand heme trafficking in multicellular organisms have failed primarily due to the inability to separate the processes of endogenous heme synthesis from heme uptake and transport. From a nutritional perspective, heme is a readily bioavailable source of iron for human consumption Although the pathway and intermediates for heme biosynthesis and degradation have been well defined, the intracellular networks that mediate heme homeostasis in eukaryotes remain poorly understood Caenorhabditis elegans as an animal model ideally suited in which to conduct heme studies. We have previously demonstrated that this roundworm does not synthesize heme but instead relies on environmental heme for survival C. elegans genome encodes a repertoire of hemoproteins that have vertebrate orthologs. It is likely that the pathways for heme trafficking and incorporation are conserved in C. elegans, parasitic worms, and vertebrates C. elegans model system was recently underscored by the discovery of HRG-1 proteins that transport heme C. elegans hrg-1 and its paralog hrg-4 from microarray experiments as genes that were highly upregulated by low heme HRG-1, in Xenopus oocytes resulted in strong heme-induced electrophysiological currents – an indication that the corresponding proteins were heme transporters. Additionally, depletion of hrg-1 in worms led to aberrant heme homeostasis. Transient knockdown of hrg-1 in zebrafish caused severe impairment in erythropoiesis along with brain and skeletal defects; these phenotypes were fully rescued by worm hrg-1C. elegans as a model par excellence to dissect the pathways responsible for heme transport and homeostasis in mammals. Moreover, C. elegans bridges the evolutionary divide to heme auxotrophic parasitic species and provides insight into helminthic-specific vulnerabilities in heme uptake and utilization that can be exploited for drug design Progress in understanding heme homeostasis in most eukaryotic systems is hampered by the inability to separate heme biosynthesis from downstream intracellular transport pathways. To circumvent this issue, we established the genetically tractable nematode C. elegans wild-type worms grown in an axenic liquid medium at three different concentrations of heme was performed as a first step in the genome-wide identification of genes involved in heme homeostasis. Our results have identified several hundred heme-responsive genes (hrgs), some of which are evolutionarily conserved across metazoa while others are found only in nematodes. We anticipate that results from our genomic studies may be universally applicable and result in the discovery of heme homeostasis pathways in other metazoans.The current study specifically seeks to explain and draw conclusions from the genomic data that was generated from our microarray analysis. This expression array analysis using C. elegans lacks the highly conserved genes of heme biosynthesis but acquires heme from the environment for growth and development C. elegans0 hermaphrodites, worms were grown in their respective heme concentrations for two successive generations for the hrgs showed that, with one exception, the quality of the microarray data was consistent across biological replicates for all three heme concentrations. The data obtained from one of the 4 µM heme replicates showed an inconsistent global gene expression pattern when compared to the other two replicates and was, therefore, excluded from further analysis and the Pearson's correlation coefficient, the qRT-PCR confirmed that the changes observed with the microarray results were consistent and, therefore, reliable of C. elegans hrgs. The hrgs with human homologs were present among those upregulated in both extreme heme concentrations. Forty-four were upregulated at 4 µM heme and 42 were upregulated at 500 µM heme, while 28 were downregulated at 4 µM heme and 36 were downregulated at 500 µM heme and homologs to only 10 genes in the clade I nematodes . While the number of identified putative orthologs was much higher for the crown lineages than in the basal nematodes that reside at the root of the nematode evolutionary tree, two of the eight categories (categories 1 and 3) had no homologs in any of the parasitic species. Categories 1 and 3 are represented by 13 and 10 sequences in C. elegans, respectively.A small percentage of the 288 ematodes . To datehrgs identified from our microarray study were involved in processes as varied as embryonic development, electron transport, lipid metabolism, and iron-sulfur cluster assembly. Of the 288 genes in the study, 115 were annotated with a biological process (P<0.005) associated with the subset of genes that were upregulated at 4 µM heme were ‘embryonic development’, ‘lipid transport’, and ‘proteolysis’ (Gene ontology (GO) analysis process . Using teolysis’ ; ‘responeolysis’ , S8, S9.hrgs (∼3%) have been mapped to KEGG pathways is also frequently used to analyze complex microarray data and make functional predictions pathways . These hC. elegans each contain roughly equivalent numbers of genes (13–17%), whereas chromosome V has the most genes (25%) hrgs, but 35% of all hrgs were found on Chr V of all 288 hrgs using TRANSFAC If the genomic distribution of C. elegans, and the data from all these experiments are available on Wormbase (http://www.wormbase.org/). Forty-six hrgs (16%) had a reported RNAi phenotype experiments have been performed in henotype . RNAi knhrg-1::gfp transcriptional fusion (strain IQ6011) specifically respond to heme in the growth medium. Thus, strain IQ6011 can be used as a whole animal heme sensor to interrogate changes in organismal heme homeostasis hrgs in heme homeostasis, we established a functional RNAi screen using IQ6011 (see hrg mini-library in the E. coli feeding strain HT115(DE3) that expressed double-stranded RNA (dsRNA) against each of the 288 hrgs. Second, we established a sensitive GFP-based assay that conditionally screened for genetic modulators of heme homeostasis simultaneously in the presence of low (5 µM) or high (25 µM) heme. Third, we verified the positive candidate genes with a secondary screen to eliminate false positives using a vha-6::gfp transgenic worm that does not respond to heme and served as a negative control. Fourth, we confirmed the authenticity of each candidate gene by simultaneously measuring the GFP fluorescence intensity in IQ6011 and vha-6::gfp with a COPAS Biosort instrument that sorts each worm by its time of flight and extinction .We have previously reported that transgenic worms expressing the E. coli grown either in the presence of 5 µM or 25 µM heme on NGM agar plates. These experiments were performed in duplicate, and GFP levels and patterns in worms fed bacteria expressing each of the 288 hrgs were analyzed by eye. RNAi depletion of the 288 hrgs resulted in the identification of 32 genes that specifically upregulated or downregulated GFP expression in the IQ6011 heme-sensor strain but not in the vha-6::gfp control strain. These 32 genes were selected for further analysis by the COPAS BioSort. We identified six hrgs which caused either a two-fold increase or a two-fold decrease in GFP expression, or a putative lysosomal cysteine protease (F32H5.1/cathepsin-L) were depleted. In contrast, GFP was downregulated only when F46E10.11, which encodes an uncharacterized protein proposed to bind metals through cysteine residues, was depleted.Synchronized IQ6011 worms were grown in mCeHR-2 medium supplemented with 10 µM heme to repress GFP and subsequently transferred to NGM agar plates for exposure to dsRNA produced by ression, . A signihrgs which encoded for proteins with transmembrane domains (TMD). TMHMM analysis predicted that 41 of the 288 hrgs encoded for proteins with at least one putative TMD that transport small molecules such as glycerol, urea, and water; cyp-33C9 (one TMD) which belongs to the cytochrome P450 family of heme binding proteins; heme permeases (hrg-1 and hrg-4 with 4 TMD); and ABC transporters (mrp-5 and pgp-1 with ≥12 TMD).To identify potential heme transporters, we identified tive TMD . Among thrgs which encoded TMD proteins and exposed the worms to gallium protoporphyrin IX (GaPP), a toxic heme analog that causes severe defects in worm growth and development hrgs which, when depleted by RNAi, revealed greater survival of the F1 progeny at 1.5 µM GaPP, a concentration that is lethal to wild-type worms . Heme upol worms , a resulhrg-4 and mrp-5. We generated transgenic worms that expressed hrg-4::gfp and mrp-5::gfp transcriptional fusions. hrg-4::gfp was expressed specifically in the intestinal cells of larvae and adults . Some of the genes we identified were predictable, because they encode either known heme-binding proteins or permeases for transport of other small molecules. Other genes made sense in retrospect, such as glutathione transferases (GST). A recent proteomic analysis of C. elegans identified GST-19 as a highly abundant protein that was proposed to sequester heme when intracellular heme is in excess gst-22 and gst-16 were upregulated at 500 µM heme. Whether these GST proteins also bind heme remains to be determined.Our study of the genome-wide transcriptional changes associated with heme availability represents, to the best of our knowledge, the first study of nutrient-gene interactions in hrgs represent the full spectrum of biological processes. Interestingly, only a few hrgs are enzymes or proteins that are known to bind heme. We speculate that the transcriptional regulation by heme primarily targets the cellular pathways involved in heme homeostasis, including uptake and sequestration, rather than the genes which encode target hemoproteins. The vast majority of hrgs have no known function and, therefore, do not have any biological processes or pathways attributed to them. Furthermore, phenotypes from RNAi studies involving the 288 hrgs reported growth and developmental defects, plausibly because disruption of heme homeostasis will affect hemoprotein function in diverse biological pathways ranging from miRNA processing (DGCR8) to gas sensing (soluble guanylyl cyclases) to circadian clock control (Rev-erbα) GO and KEGG pathway analyses reveal that hrgs we identified also provide the first insight into metazoan heme regulation. The fact that >40% of hrgs have human homologs suggests that our study may provide genetic insights into mammalian heme regulation. This is underscored by the presence of human homologs for genes that were positive in our functional RNAi screen. Indeed, recent studies using C. elegans as a model system have led to the identification of HRG-1 as the first bona fide metazoan heme importer that is conserved in vertebrates The 288 hrgs in eight categories identified no common cis elements hrg-1 and hrg-4 belong, found no overrepresented transcription factor binding sites using all sequences against a control set of random promoter sequences. These in silico results corroborate our experimental studies and further support the concept that regulation of organismal heme homeostasis is complex, multi-tiered, and effected by diverse cellular modulators.Analysis of the presumptive promoters of all 288 Wolbachia – an intracellular bacterial symbiont that contains the intact heme biosynthesis pathway hrg homologs in protozoans and 62 hrgs in clade V nematodes. This finding is significant because these genes may encode proteins involved in heme uptake and sequestration from the parasitized host. Further studies aimed at elucidating the role of these hrgs in heme metabolism may validate them as novel anti-parasitic drug targets.Studies have demonstrated that the infectivity of hookworms, which feed on the blood of the host, is significantly lower in severely anemic hamsters fed a low-iron diet hrgs that encode for proteins which contain putative TMDs showed different levels of resistance against GaPP toxicity. Among these were a heme permease (HRG-4), ABC transporters (PGP-1 and MRP-5), and Major Facilitator Superfamily transporters (HMIT-1.1 and Y37A1A.2). The remaining 247 hrgs encoded proteins without any predicted TMDs. These proteins may encode soluble effectors for heme transport such as chaperones or sequestering proteins. In support of this concept, cellular iron is stored in ferritin, a cytosolic multi-subunit protein; cytoplasmic copper is delivered to membrane bound P-type ATPases in the secretory pathway by the copper chaperone Atox1 C. elegans and most metazoa We found that seven of the 41 C. elegans intestine mrp-5::gfp in worm tissues, and with the RNAi studies which show that mrp-5 depletion results in accumulation of ZnMP in the worm intestine and resistance to GaPP toxicity. Unlike HRG-4 and MRP-5 which are transporters with multiple TMD, F22B5.4 encodes a predicted Type II membrane protein with a single TMD. Although our results clearly implicate a role for F22B5.4 as an essential component of heme homeostasis in C. elegans, it is unclear how this protein may function in heme homeostasis. Excitingly, microarray and RNAi studies identified F22B5.4 as a gene that is highly upregulated by the hypoxia-inducible factor (HIF) transcription complex, a master regulator of hypoxia response C. elegans on heme for oxygen binding and sensing Interestingly, HRG-4, MRP-5, and F22B5.4 were the only positive candidates identified in both the heme-sensor and GaPP functional RNAi screens. RNAi studies have implicated HRG-4 as a heme transporter in the C. elegans. Although it is unclear mechanistically how worms respond to heme at the mRNA level, a thorough study to identify the cis regulatory elements and the corresponding trans acting factors will significantly accelerate our understanding of how C. elegans adapts to environmental and nutritional changes. Using the facile and genetically tractable C. elegans model system, the RNAi screen with the hrg mini-library can be easily adapted for whole genome screens to identify regulatory pathways which govern how metazoans sense and respond to heme at an organismal level.In the current study we have identified a novel catalog of genes that are responsive to heme in C. elegans wild-type N2 strain worms were grown either in an axenic liquid mCeHR-2 medium E. coli OP50 or HT115(DE3) strains 0 gravid worms grown in mCeHR-2 medium supplemented with hemin chloride 1 larvae in the L1 stage were inoculated in mCeHR-2 medium with 4, 20, or 500 µM hemin chloride and grown with gentle shaking at 20°C. Synchronized, F2 larvae in the L1 stage were obtained by hatching the eggs obtained from F1 gravid adults in M9 buffer containing 4, 20, or 500 µM hemin. Equal numbers of F2 larvae in the L1 stage were inoculated in mCeHR-2 medium supplemented with 4, 20, or 500 µM hemin. The F2 worms were allowed to develop to the late L4 stage, harvested, flash frozen in liquid nitrogen, and stored at −80°C. Frozen worm pellets were ground into a fine powder, and total RNA was extracted using Trizol . RNA thus obtained was subjected to RNase-free DNase treatment for 1 h at 37°C and purified using the RNeasy kit . Total RNA from three biological replicates was used to make cDNA, which was then hybridized to C. elegans Whole Genome Arrays .Equal numbers of FT values were used for 2−ΔΔCt calculations of relative fold changes in gene expression First strand cDNA was synthesized using 2 µg of total RNA using a Superscript II First Strand cDNA synthesis kit (Invitrogen). For quantitative real-time PCR (qRT-PCR), primers spanning at least one intron were designed using Primer Express (Applied Biosystems) and Beacon designer 4 (Premier Biosoft) programs. PCR was performed using the iCycler iQ Real-time PCR Detection System (BioRad) with 0.12 U/µl Taq DNA polymerase, 40 nM fluorescein (Invitrogen), and SYBR Green I Nucleic Acid Gel Stain (Invitrogen) diluted 1:10. The PCR amplification was run for 40 cycles. The PCR products were between 150 and 200 bp in length. Quality of the PCR products was determined by dissociation curve analysis and gel electrophoresis. Each experiment was performed in triplicate. Average C−4. Sequences for each of these 288 genes were obtained from WormBase and further analyzed for topology , motifs , and pathway classification (GO and KEGG).Expression data were normalized and analyzed using MAS 5.0 suite software (Affymetrix). Data from worms grown in mCeHR-2 medium with 4 and 500 µM hemin were compared to data from worms grown in medium containing 20 µM hemin (baseline samples). Microarray data were verified with the Robust Multichip Average Method . Quantile normalization and background corrections were performed using perfect match probe intensities. Using an initial cut-off of ≥1.2-fold change in mRNA expression for RMA and a ≥1.6-fold change for MAS 5.0 resulted in the identification of 370 genes. Increasing the stringency to ≥1.6-fold change for both RMA and MAS 5.0 reduced the number of genes identified as heme responsive to 288 genes. To identify putative human orthologs, worm protein sequences were used to query human genome databases at NCBI by reciprocal BLAST analysis with an E-value cut-off ≥10hrgs were absent from both libraries. To complete the hrg mini-library, we PCR amplified the missing genes from N2 worm genomic DNA and cloned the PCR fragments by TA cloning into the RNAi feeding vector pL4440. Only 19 of the 34 RNAi clones were in the final list of 288 hrgs. DNA for all 288 hrgs was sequenced to confirm authenticity.The Ahringer and Vidal feeding libraries were replicated to individual 96-well plates DE3) bacteria expressing double-stranded RNA (dsRNA) against each clone in the hrg mini-library. Duplicate bacterial cultures of each clone had been grown for 5.5 h in LB containing carbenicillin and tetracycline and 5 µM or 25 µM heme. Plates were seeded with a lawn of bacteria and dsRNA induction occurred for ≈20 h at room temperature. Subsequently, forty L1 larvae from gravid IQ6011 worms which had been grown in liquid media supplemented with 10 µM heme were added to each well of the 12-well plates. Each 12-well plate had 10 wells seeded with experimental clones and one well seeded with each of the control clones – vector and hrg-4. The plates were incubated at 15°C overnight and then incubated at 20°C for three additional days. The GFP levels in gravid adults were observed visually using a Leica Microsystems MZ16FA stereoscope. The intensity and pattern of GFP in gravid worms feeding on bacteria producing dsRNA against each hrg was compared to the intensity and pattern of GFP in same-stage worms feeding on bacteria transformed with the empty vector. Worms that displayed altered GFP in both replicates were designated as potential modulators. Potential modulators were screened in a strain that produced GFP under the control of a promoter that was not responsive to heme (vha-6::gfp). Any clone that altered GFP levels in the vha-6::gfp strain worms was removed from the list of modulators, since the change in GFP was not in response to heme.NGM agar plates containing IPTG, carbenicillin, and tetracycline were seeded with HT115 bacteria transformed with the gfp RNAi vector. The COPAS BioSort detects very low levels of GFP in these worms. The mean of all values for each sample was determined, and the average of each duplicate was calculated. This mean was normalized to the average value for the GFP obtained from the vector-only sample, and reported in arbitrary units ± SEM for each clone analyzed.A COPAS BioSort worm sorter was used to measure GFP levels in live worms. Plates, bacteria, and worms were prepared and treated as described in the previous section. After 84 h on RNAi plates, P1 wild-type worms in the L1 larval stage were obtained from P0 worms grown in mCeHR-2 containing 1.5 µM hemin. Equal numbers of these F1 worms were placed on NGM agar plates containing 2 mM IPTG, 50 µg/mL carbenicillin, 12 µg/mL IPTG and plated with a lawn of HT115(DE3) RNAi feeding bacteria harboring the respective L4440 plasmid that had been grown in LB broth with carbenicillin and tetracycline 0 worms were discarded in order to prevent additional eggs from being laid. On day 5, both the total number of surviving larvae and the number of unhatched eggs were counted. P values for statistical significance were calculated by using a one-way ANOVA with Student–Newman–Keuls multiple comparisons test by using GraphPad InStat v. 3.06 .Synchronized, F0 worms grown in mCeHR-2 plus 2 µM hemin were exposed to the RNAi bacteria on NGM plates containing 2 mM IPTG for 72 h. This was followed by exposure to 5 µM ZnMP plus 1.5 µM hemin chloride for 16 h in mCeHR-2 medium. ZnMP fluorescence intensity was measured as described previously Equal numbers of synchronized N2 L1 larvae obtained from Pgfp gene, and the 3′ untranslated region of the unc-54 gene were cloned by recombination into the entry vectors pDONR P4-P1R, pDONR 221, and pDONR P2R-P3, respectively, using the Gateway BP Clonase kit. Sequence verified entry clones were then recombined into a destination vector pDEST R4-R3 using the Gateway LR Clonase II plus enzyme kit to produce the final recombinant plasmid.GFP reporter fusion constructs were created using the Gateway cloning system . The promoter of interest, 6unc-119 (ed3) gravid worms were co-bombarded with 10 µg of Gateway reporter construct and 5 µg of unc-119 rescue plasmid (pDM016B) using the PDS-1000 particle delivery system . Worms were washed from bombardment plates and transferred to plates seeded with a lawn of E. coli strain JM109. After two-weeks at 25°C, multiple wild-type F2 worms were screened for gene integration either by PCR or transgene expression. Individual transgenic lines were isolated and transferred to axenic liquid mCeHR-2 medium supplemented with antibiotics. After two weeks of serial passages, worms were bleached and maintained as transgenic strains in axenic liquid mCeHR-2 medium.For microparticle bombardment, ≈5×10The microarray data was submitted to GEO on Aug 6, 2007. The GEO accession number is GSE8696 and available athttp://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE8696.Figure S1Heat map for the heme microarrays.hrgs with data from all nine chips represented. The up and down arrows indicate upregulation or downregulation in 4 or 500 µM heme when compared to 20 µM heme. Yellow represents no change in signal intensity, blue indicates a decrease, and red indicates an increase in signal intensity. The data from the first replicate sample from 4 µM heme, indicated with an asterisk at the top of the column, were inconsistent with the data from the other two biological replicates as determined by both principal components analysis and K-means clustering of the data.A compilation of heat maps generated following normalization of the data see legend u(2.43 MB TIF)Click here for additional data file.Figure S2Gene ontology (GO) enrichment analysis of heme-responsive genes.hrgs downregulated at 4 µM heme. (B) hrgs upregulated at 500 µM heme. (C) hrgs downregulated at 500 µM heme. Of the 288 hrgs identified in the study, 115 were annotated with a biological process. Genes were analyzed using the Fisher's exact test and the topGO package from R. The most significant GO terms and their associated parent terms were used to construct a hierarchical graph such that the specificity of the terms increased as we moved from top to bottom. The text in each rectangle provides the GO ID and the ratio of the number of genes annotated with the GO term in the tested subset to that in the total gene set. The shade of green of each rectangle corresponds to the significance of the GO result. Full GO terms are provided solely for genes with P<0.005. The complete table of P-values and a full description of the GO term associated with each gene can be found in (A) (0.08 MB PDF)Click here for additional data file.Table S1The 288 heme-responsive genes identified by the microarray.C. elegans whole genome array and analyzed by both Affymetrix MAS 5.0 software and RMA. Each entry in the table represents a gene whose expression changed at least 1.6 fold at one or both of the experimental heme concentrations. The table has six columns for each hrg. The “Description” column lists the unique Gene ID assigned by Wormbase to every gene in the C. elegans genome. The “Gene name” column provides the name of a gene, when one has been assigned. The first “4 µM” column gives the value of the change of expression of each gene, and the second “4 µM” column indicates whether the gene expression was increased (up) or decreased (down). If the column is blank, then the change was less than 1.6-fold. The pattern for the “500 µM” columns is the same as for the “4 µM” columns.Data was collected using the Affymetrix (0.10 MB PDF)Click here for additional data file.Table S2Heme-responsive genes whose expression is upregulated greater than 1.6 fold in worms grown at 4 µM heme.The gene ID (description), gene name, and amount of change at 4 µM compared to the control (20 µM) are provided for each gene whose expression increased at 4 µM.(0.08 MB PDF)Click here for additional data file.Table S3Heme-responsive genes whose expression is upregulated greater than 1.6 fold in worms grown at 500 µM heme.The gene ID (description), gene name, and amount of change at 500 µM compared to the control (20 µM) are provided for each gene whose expression increased at 500 µM.(0.73 MB TIF)Click here for additional data file.Table S4Heme-responsive genes used to corroborate the microarray results. Three genes were selected from each of the eight categories designed to show whether the expression of a gene increased, decreased, or did not change at a given heme concentration compared to the 20 µM control.(1.15 MB TIF)Click here for additional data file.Table S5Heme-responsive genes with known Gene Ontology terms.hrgs whose expression changed significantly in response to heme, the results of a gene ontology analysis were used to assign a known biological process and molecular function to 63 genes.Of the 288 (1.02 MB TIF)Click here for additional data file.Table S6Gene Ontology analysis of heme-responsive genes upregulated at 4 µM heme.Each GO ID is assigned a unique function or association. Both are listed here, even if the GO ID was not used in the GO analysis figure. Green shading indicates that term was included in the corresponding GO enrichment figures.(0.06 MB PDF)Click here for additional data file.Table S7Gene Ontology analysis of heme-responsive genes downregulated at 4 µM heme.Each GO ID is assigned a unique function or association. Both are listed here, even if the GO ID was not used in the GO analysis figure. Green shading indicates that term was included in the corresponding GO enrichment figures.(0.06 MB PDF)Click here for additional data file.Table S8Gene Ontology analysis of heme-responsive genes upregulated at 500 µM heme.Each GO ID is assigned a unique function or association. Both are listed here, even if the GO ID was not used in the GO analysis figure. Green shading indicates that term was included in the corresponding GO enrichment figures.(0.09 MB PDF)Click here for additional data file.Table S9Gene Ontology analysis of heme-responsive genes downregulated at 500 µM heme.Each GO ID is assigned a unique function or association. Both are listed here, even if the GO ID was not used in the GO analysis figure. Green shading indicates that term was included in the corresponding GO enrichment figures.(0.09 MB PDF)Click here for additional data file.Table S10Heme-responsive genes assigned to a biological pathway by KEGG analysis.hrgs identified in the microarray. Ten hrgs were mapped to KEGG pathways.The algorithms available on the Kyoto Encyclopedia of Genes and Genomes website were used to make functional predictions for each of the 288 (0.59 MB TIF)Click here for additional data file.Table S11Previously reported RNAi phenotypes of heme-responsive genes.hrgs were knocked down in experiments performed by other laboratories and compiled on Wormbase.Phenotypes observed when (0.85 MB TIF)Click here for additional data file.Table S12Heme-responsive genes with predicted TMDs.Worm protein sequences obtained from Wormbase were analyzed using TMHMM 2.0 and SOSUI to identify 41 proteins with putative hydrophobic membrane-spanning domains (TMDs). The 41 genes with putative TMDs have been arranged according to the number of TMDs. The change in levels of gene expression at 4 and 500 µM heme is indicated. Negative fold change implies down regulation.(0.74 MB TIF)Click here for additional data file.

Spironucleus vortens is a putatively commensal diplomonad of angelfish that grows to high cell densities in axenic culture. Genomic sequencing of S. vortens is in progress, yet little information is available regarding molecular and cellular aspects of S. vortens biology beyond descriptive ultrastructural studies. To facilitate the development of S. vortens as an additional diplomonad experimental model, we have constructed and stably transformed an episomal plasmid containing an enhanced green fluorescent protein (GFP) tag, an AU1 epitope tag, and a tandem affinity purification (TAP) tag. This construct also contains selectable antibiotic resistance markers for both S. vortens and E. coli.Diplomonads are common free-living inhabitants of anoxic aquatic environments and are also found as intestinal commensals or parasites of a wide variety of animals. S. vortens grew relatively rapidly (within 7 days) after electroporation and were maintained under puromycin selection for over 6 months. We expressed the enhanced GFP variant, eGFP, under transcriptional control of the S. vortens histone H3 promoter, and visually confirmed diffuse GFP expression in over 50% of transformants. Next, we generated a histone H3::GFP fusion using the S. vortens conventional histone H3 gene and its native promoter. This construct was also highly expressed in the majority of S. vortens transformants, in which the H3::GFP fusion localized to the chromatin in both nuclei. Finally, we used fluorescence in situ hybridization (FISH) of the episomal plasmid to show that the transformed plasmid localized to only one nucleus/cell and was present at roughly 10–20 copies per nucleus. Because S. vortens grows to high densities in laboratory culture, it is a feasible diplomonad from which to purify native protein complexes. Thus, we also included a TAP tag in the plasmid constructs to permit future tagging and subsequent purification of protein complexes by affinity chromatography via a two-step purification procedure.Stable transformants of Spironucleus vortens to serve as a new experimental model for cell biological studies and for comparatively assessing protein functions in related diplomonads such as the human intestinal parasite, Giardia intestinalis.Currently, progress in protistan functional and comparative genomics is hampered by the lack of free-living or commensal protists in axenic culture, as well as a lack of molecular genetic tools with which to study protein function in these organisms. This stable transformation protocol combined with the forthcoming genome sequence allows Spironucleus vortens is a putatively commensal diplomonad originally isolated from the intestinal lumen of the freshwater angelfish Pterophyllum scalare. S. vortens is typically described as a pear-shaped microaerophile, measuring 12.5 – 20.5 μm in length and 5.0 – 11.2 μm in width [S. vortens has two nuclei and eight flagella. One pair of axonemes is enclosed by a flagellar pocket, termed a "cytostomal canal", and each of the recurrent flagella lie in a separate flagellar pocket [Giardia are perhaps the most well known of the diplomonads and are unique among diplomonads due to the presence of the ventral disc, which is a novel microtubule organelle that facilitates attachment to the intestinal microvilli in vertebrate hosts [S. vortens lacks the ventral disc structure.Diplomonads are common microaerophilic protists in anoxic environments, and most known diplomonads have been isolated as either commensals or parasites of the metazoan intestinal tract . Nearly r pocket . As widete hosts ,8. S. voS. vortens likely lies midway along that continuum as either a commensal or an opportunistic parasite. For instance, S. vortens has been found in the intestines of healthy angelfish [S. vortens may be indirectly accumulating in lesions due to this bacterial presence rather than directly causing the lesions. Lastly, other commensal diplomonads such as Spironucleus torosa attach to the intestinal mucosa without causing detectable host damage [S. vortens is either a commensal or, under specific conditions, an opportunistic parasite [S. vortens is a non-pathogenic commensal (causing little or no damage to the host), an opportunistic parasite , or an obligate parasite [In the context of host-microbe interactions, microbes are traditionally described as free-living, commensals, symbionts, or parasites/pathogens . These hngelfish , does nongelfish , and doengelfish . Furtherngelfish . Thus itt damage . Thus inparasite . Furtherhe host) .Giardia intestinalis tag, an AU1 epitope tag, and a tandem affinity purification (TAP) tag. Both the eGFP and AU1 epitope tags permit visualization of protein fusions both in live and fixed cells, respectively. Fusion of S. vortens proteins with the TAP tag would permit the purification and identification of interacting proteins by standard proteomic approaches [To date, all molecular genetic studies of protein function in diplomonads have employed the common intestinal parasite, iewed in ). Conseqiewed in and/or uiewed in ,11,16-19proaches .S. vortens by adapting a methodology used in Giardia to generate stable transformants [S. vortens (puromycin resistance) and E. coli (ampicillin resistance). We demonstrate here a highly stable transformation of these constructs in S. vortens, and the ability to express GFP fusion constructs and visualize them in live and fixed cells in two stable GFP-expressing strains: SvH3P, which expresses GFP under the control of a S. vortens histone H3 promoter, and SvH3G, which expresses a histone H3::GFP fusion under the control of the native promoter.As a first step in developing a molecular toolkit that can be used to study protein function, we constructed, stably transformed, and maintained episomal shuttle vectors Figure and 1B iformants . These cS. vortens, we created three stable cell lines: SvPAC (expressed puromycin resistance (pac) gene); SvH3P (GFP expressed by the H3 histone promoter); and SvH3G (a histone H3::GFP fusion) (see Methods). The SvH3P and SvH3G strains were created by transfecting SvH3P.pac with a DNA probe against a 5 Kb amplified region of the episomal plasmid used in the transformed SvH3P strain. As seen in Figure E. coli (data not shown) at high efficiency.The number of plasmids that were transformed per nucleus per cell was estimated using fluorescence S. vortens cells to drive expression of GFP. In Figure In both the SvH3P and SvH3G strains, we observed significant GFP expression in live, highly motile stinalis . Images S. vortens histone H3 gene fused in frame to a C-terminal eGFP tag) and imaged the GFP localization in anti-α-tubulin immunostained cells (as above). As seen in Figure We also localized GFP expression in the SvH3G strain under puromycin selection for a period of over six months, indicative of stable rather than transient transformation.Electroporation takes advantage of the fact that membranes in cells essentially act as electrical capacitors . Transfor et al. . Based oP Figure , and thaP Figure and locaP Figure . We wereGiardia [S. vortens undergoes mitosis in a manner similar to that of Giardia intestinalis [Giardia, the two nuclei do not fuse during mitosis but instead behave autonomously so that only one copy of each parental nucleus is inherited by each daughter [Giardia, both nuclei migrate to the line of bilateral symmetry and are stacked one above the other . During anaphase, the nuclei divide and separate such that each daughter cell obtains a nucleus from each plane [S. vortens and supports the theory that the two nuclei of S. vortens do not fuse during mitosis. This state of singly transformed nuclei would be perpetuated throughout the population, although there is no information regarding whether both nuclei in S. vortens are transcriptionally active or whether they contain the same genetic material.Finally, we confirmed that the transformed episomal plasmid localized to only one nucleus per cell Figure , as is tGiardia ,42,43. Fstinalis . In Giardaughter . In Giarnucleus) . This inSpironucleus genome project was begun under the Community Sequence Program (CSP) through a collaboration with the DOE-Joint Genome Institute (JGI) in 2004. Currently, over 15,000 ESTs have been sequenced, in conjunction with roughly 4× genome coverage of the 16 Mb genome (unpublished data). We have engineered the SvGAT.pac shuttle vector so that a GFP fusion construct can easily be converted into one with an AU1 fusion tag by a double restriction digest with AgeI/NheI; alternatively, a tandem affinity purification (TAP)-tagged fusion protein can be created using an AgeI/AvrII restriction digest. When religated, the initial GFP gene fusion will remain in frame with either the AU1 epitope tag or TAP tag.The S. vortens grows robustly in axenic culture in the laboratory to densities of roughly 1 × 107 cells/ml, and tolerates temperatures ranging from 5–34°C [S. vortens at room temperature (25°C). Hence, due to its rapid growth in laboratory culture and its nearly completed genome sequence, Spironucleus seems a feasible diplomonad from which to purify proteins and protein complexes. For this reason, we included a TAP tag in the plasmid constructs to permit the tagging of proteins and subsequent purification of protein complexes by affinity chromatography via a two-step purification procedure. This proteomic strategy for identifying interacting proteins has been widely used in other organisms [S. vortens could include the purification of protein complexes followed by mass spectrometry to analyze protein components.m 5–34°C . For therganisms ,44. The rganisms ,44. FutuS. vortens strains could help confirm whether or not S. vortens is actually an obligate parasite in angelfish. Briefly, fluorescently tagged S. vortens could be used to confirm that: 1) S. vortens is present in all cases of "hole-in-the-head"-diseased angelfish; 2) inoculation of healthy angelfish with tagged S. vortens results in disease; and, 3) isolated, tagged S. vortens strains from newly diseased angelfish are also infectious. Following inoculation of these transformed S. vortens cells back into healthy angelfish, resultant "hole-in-the-head" lesions (if any) could be imaged and/or quantified using GFP fluorescence, which (if found) would indicate that S. vortens plays and obligately pathogenic role in angelfish. At this time, no such experimental verifications of the obligate parasitism of S. vortens have been performed.The use of this stable transformation protocol to generate fluorescently tagged Spironucleus vortens represents a new experimental system with which one can study comparative cell biology in diplomonads. Because it is putatively commensal and lacks the ventral disc present in Giardia [S. vortens could provide insight into Giardia's adaptations to parasitism – including the evolution of the ventral disc. Functional genomics in S. vortens also offers a strategy to test the hypothesis of its obligately parasitic role in angelfish. Finally, ongoing comparative and functional genomic analyses of putative commensal diplomonads as wellstinalis ) are cristinalis .Spironucleus vortens (ATCC 50386) was cultivated in 13 ml polypropylene screw cap tubes in 12 ml of medium at 25°C using previously described culture methodologies [S. vortens strains were grown in 24-well plates sealed in BioBags (Fisher) to maintain a low-oxygen tension.ens ATCC 0386 was S. vortens, we modified the previously constructed pMCS-GFP vector from Giardia intestinalis [S. vortens promoter regions for the puromycin resistance (pac) gene and for the GFP-AU1-TAP tag promoter region (roughly 100 nucleotides upstream of the S. vortens α-tubulin (atb1) gene) and the α-tubulin 3'UTR (roughly 50 nucleotides downstream).To create a stable episomal plasmid vector for transformation of stinalis to incluS. vortens α-tubulin promoter by PCR-amplifying the pac gene from the pMCS-GFP vector using the following oligonucleotide primers that included the S. vortens atb1 promoter region and 3'UTR: atbpacF: 5'GAA TTC TTA CGG TAA AAA TAA GAC CAG CGT CCG AAA TTT TGG CCA AAA ATT TTC CGG AAT TTT CGT ACC ATC TAT TCA TCC ATG GGC ACC GAG TAC AAG-3' and 3atbpacR: 5'GAA TTC GCT ACT TAA AAT ATA TTG AAA CTT ACT TAA AAT ATT GAA AAT AAT AAA CAG AAA GAT CAC TCG AGG GCA CCG GGC TTG CGG G3' . This PCR product was first subcloned into the pCR2.1 TOPO-TA vector (Invitrogen), digested with EcoRI, and ligated into the pMCS-GFP vector to create the SV.pac construct. Next, we replaced the GFP of the SV.pac vector with a triple protein tag driven by the S. vortens H3 histone promoter as identified from the in-progress S. vortens Genome Project (see Availability and requirements section for URL). These three protein tags each have a stop codon and short putative polyA signal region (TTTCTTT). The TAP tag and AU1 tagged portions of the GAT tag were amplified using PCR with the following oligonucleotide primers SVGATF: 5' TGT ACA AGT GAT TTC TTT GTT TAT TAT GCT AGC GAC ACG TAC CGA TAC ATATGA TTT CTT TGT TTA TTA TCC TAG GAT GGA AAA GAG AAG ATG G-3' and SVGATR: 5'-GCG GCC GCA TAA TAA ACA AAG AAA TCA GGT TGA CTT CCC CGC GGA ATT CG 3' using the pKG1810 plasmid as a template [S. vortens shuttle vector SvGAT.pac.We added the template . The oliS. vortens H3 histone promoter (H3P) from S. vortens genomic DNA using the oligonucleotide PCR primers: svh3PF: 5'GGC GCG CCG GAA ACG AAC TTT CGG AGT ATG CCG CTC GG-3' and svh3PR: 5'-ACC GGT AGC ATC TGC TTG ATT TCT GAA AGG GGA AGG G3'. This PCR product was initially cloned into the TOPO-TA vector (Invitrogen), and the insert was recovered by digestion with AscI/AgeI, then ligated into an AscI/AgeI digest of the SvGAT.pac vector. This created the SvH3P.pac vector that was subsequently used to transform S. vortens . This PCR amplicon was initially cloned into the TOPO-TA vector (Invitrogen), and the insert was recovered through an AscI/AgeI digest. The H3 histone was then ligated into the AscI/AgeI sites of the SvGAT.pac vector. This yielded the SvH3G.pac vector that was subsequently used to transform S. vortens to ytometer . At 50 μS. vortens, approximately 1 × 107 cells (one confluent 13 ml culture tube) was first centrifuged at 1500 × g for five minutes at 4°C. The pellet was then washed once in fresh medium, centrifuged again, and resuspended in 1 ml medium (approximately 107 cells/ml). Roughly 50 μg of the SvH3P.pac or the SvH3G.pac episomal plasmids were mixed gently with 300 μl of S. vortens cells in a 4 mm electroporation cuvette (BioRad) and incubated at 4°C for ten minutes. Various electroporation voltages (ranging from 325V to 425V) were used for initial studies, but the optimal transformation was achieved with GenePulserXL (BioRad) using the following conditions: 400V, 1000 μF, and 700 ohms.For the electroporation of S. vortens were transferred into 13 ml polypropylene tubes with 12 ml of medium. The electroporated S. vortens cells were grown for 24 hours at room temperature without antibiotic selection. Electroporated cells were then diluted 1:10, 1:100, or 1:1000 in 1.5 ml of S. vortens medium with a final concentration of 10 μg/ml puromycin in a 24-well plate (ThermoFisher). The plates were incubated at room temperature in BioBags (ThermoFisher) to maintain a low oxygen tension required for optimal growth. After 4–9 days, putative transformants were transferred to 13 ml polypropylene tubes with fresh medium, and antibiotic selection was increased to a final concentration of 50 μg/ml puromycin. Strains were maintained for greater than six months under selection with 50 μg/ml puromycin, and were aliquoted to medium containing 9% DMSO for storage in liquid nitrogen.Following electroporation, cuvettes were incubated on ice for 10 minutes, and then electroporated In vivo expression of GFP fusions in the transformed S. vortens strains (SvH3P and SvH3G) was confirmed by RT-PCR. Following total RNA extraction of a 13 ml culture (~1.0 × 107 cells) using RNA-STAT (Tel-Test), RT-PCR was performed with ~300 ng of S. vortens RNA from the transformed strains using the Superscript™ One-Step RT-PCR with Platinum Taq Kit (Invitrogen) according the manufacturer's instructions, using two GFP-specific PCR primers: GFPF: 5' TGAGCAAGGGCGAGGACGTGTTCACGG 3' and GFPR 5' ATCACTTGTACAGCTCGTCCATGCCG 3'. The expected size of the GFP fragment amplified using these primers is 721 bp.G. intestinalis that showed localization of episomal plasmids to one nucleus (even during mitosis) [S. vortens. Toward this end, we constructed a fluorescence in situ hybridization (FISH) probe to an AscI/AgeI fragment of the SvH3G.pac plasmid that lacked the histone H3 gene, using the incorporation of Cy3-labelled dUTPs by nick translation (Roche). The Cy3-labelled hybridization probe was precipitated in LiCl and used in hybridization experiments in the S. vortens SvH3P.pac strain as previously described .Based on prior work in mitosis) ,42,43, wS. vortens cell suspensions were then placed on poly-L-lysine-treated coverslips (0.1%) and allowed to attach for 30 minutes. Following fixation, coverslips were dehydrated in 70% ethanol, and rehydrated before use in 2× SSC. Coverslips were then treated with DNAse-free RNAse for 3 hours at 37°C, followed by permeabilization with 0.5% Triton X-100 at room temperature for fifteen minutes, and finally redehydrated in 70% ethanol for five minutes and 100% ethanol for five minutes. Prior to hybridization, slides were denatured for two minutes in 70% formamide/2× SSC at 70°C and dehydrated for five minutes each in cold 70% ethanol (-20°C) and cold 100% ethanol. Probes resuspended in 100% formamide were denatured at 95°C for 10 minutes and then kept on ice. Denatured probe (20 μl) was mixed with 10 μg each of salmon sperm DNA, and Saccharomyces cerevisiae tRNA, air dried, and finally resuspended in 10 μl of 100% formamide. For hybridizations, an equal volume of hybridization buffer was to the denatured probe. Coverslips were placed face down on the hybridization/probe solution and covered with Parafilm. After overnight incubation at 37°C, the coverslips were washed in 2× SSC with 50% formamide at 37°C for 30 minutes, followed by 2× SSC at 37°C and 1× SSC at room temperature for 30 minutes each and then placed on slides with ProLong anti-fade mounting medium. Three-dimensional images of in situ hybridizations were collected using epifluorescence deconvolution microscopy and processed as described below.In brief, transformed cells were centrifuged at 1500 × g for 5 minutes, and the cell pellet was resuspended in one ml HBS, and fixed in a final concentration of 4% paraformaldehyde. S. vortens strains in 12 ml culture tubes were fixed with 1% paraformaldehyde to maintain native GFP fluorescence, then centrifuged at 900 × g at 4°C. Pellets were washed twice in PEM buffer and attached to poly-L-lysine-coated coverslips. S. vortens cells were permeabilized with 1 ml of 0.1% Triton X-100 for 10 minutes, and then washed three times in PEM. Coverslips were then incubated in PEMBALG ) to block non-specific binding. Microtubules were counterstained by incubating coverslips with the monoclonal α-tubulin antibody TAT1 [Transformed ody TAT1 diluted Three dimensional images were collected using SoftWorX image acquisition software on an Olympus IX70 wide-field inverted fluorescence microscope with an Olympus UPlanApo 100× (NA 1.35) or an Olympus UPlanApo 60× (NA 1.4) oil immersion objective and a Photometrics CCD CH350 camera cooled to -35°C . To visualize the cells in three dimensions, serial sections were acquired at 0.2 μm intervals, and data stacks were deconvolved using the SoftWorX deconvolution software. 2D projections were created from the 3D data sets using the DeltaVision image analysis software for presentation purposes.in situ hybridization); H3P (H3 histone promoter); LC-MS-MS (Liquid Chromatography/Mass Spectrometry/Mass Spectrometry); MALDI-TOF (Matrix Assisted Laser Desorption/Ionization – Time Of Flight); pac gene (puromycin resistance gene); RT-PCR (reverse transcription polymerase chain reaction); SV.pac (S. vortens vector containing pac gene driven by atb1 promoter); SvGAT.pac ; SvH3G (S. vortens strain containing H3::GFP fusion driven by H3 promoter); SvH3G.pac ; SvH3P (S. vortens strain containing GFP expression driven by H3 promoter); SvH3P.pac ; SvPAC (S. vortens strain containing pac gene driven by atb1 promoter); TAP tag (tandem affinity purification tag); TEV (tobacco etch virus).amp gene (ampicillin resistance gene); atb1 gene (α-tubulin gene); CBP ; CSP (Community Sequence Program); DAPI ; eGFP (enhanced green fluorescent protein); FISH expressed from the H3 histone promoter. This short movie corresponds to the still image presented in Figure 3AClick here for fileLive 3D movie of the SvH3G strain. Live image analysis of the SvH3G strain using epifluorescent microcopy. This short three-dimensional stack presented as a movie corresponds to the still image presented in Figure S. vortens strain. This movie shows the live histone H3 GFP-tagged S. vortens strain and highlights the nuclear localization of the H3G:GFP fusion. This short movie corresponds to the still image presented in Figure 4AClick here for file

Bacterial meningitis is often associated with cerebral compromise which may be responsible for neurological sequelae in nearly half of the survivors. Little is known about the mechanisms of CNS involvement in bacterial meningitis. Several studies have provided substantial evidence for the key role of nitric oxide (NO) and reactive oxygen species in the complex pathophysiology of bacterial meningitis.In the present study, serum and CSF levels of NO, lipid peroxide (LPO) (mediators for oxidative stress and lipid peroxidation); total thiol, superoxide dismutase (SOD) (antioxidant mediators) and S-100B protein (mediator of astrocytes activation and injury), were investigated in children with bacterial meningitis (n = 40). Albumin ratio (CSF/serum) is a marker of blood-CSF barriers integrity, while mediator index is indicative of intrathecal synthesis.Compared to normal children (n = 20), patients had lower serum albumin but higher NO, LPO, total thiol, SOD and S-100B. The ratios and indices of NO and LPO indicate blood-CSF barriers dysfunction, while the ratio of S-100B indicates intrathecal synthesis. Changes were marked among patients with positive culture and those with neurological complications. Positive correlation was found between NO index with CSF WBCs ; CSF-LPO with CSF-protein ; total thiol with LPO indices ; S-100B and Pediatric Glasow Coma Scores ; CSF-LPO with CSF-S-100B ; serum-total thiol with serum S-100B .This study suggests that loss of integrity of brain-CSF barriers, oxidative stress and S-100B may contribute to the severity and neurological complications of bacterial meningitis. Bacterial meningitis is the most severe and frequent infection of the central nervous system (CNS). It remains an important public health problem worldwide. Even wi2.), hydrogen peroxide and hydroxyl radical [The mechanisms of CNS damage during meningitis have not been conclusively identified. During bacterial infections, neutrophils and macrophages gather at the site of infection to combat the microorganisms. Blood-derived and brain-resident immune cells employ reactive oxygen species (ROS) as part of their host defense mechanisms against invading bacteria. In this process, these cells consume molecular oxygen, which is converted into toxic superoxide anion (markers of oxidative stress and lipid peroxidation); total Thiol and superoxide dismutase (SOD) (markers of antioxidant activity). S-100B protein is a marker of astrocytic reaction or glial damage. We inve3, CSF: blood glucose ratio <60% or CSF glucose < 40 mg/dl and protein > 40 mg/dl in absence of CSF hemorrhage and positive CSF culture[3) with predominance of mononuclear cells, normal CSF glucose and chloride concentrations and normal or increased protein. We did not do CSF culture, serology or PCR for neurotropic viruses, 3) fetal and neonatal malformations; chromosomal abnormalities or developmental delay, 4) perinatal asphyxia, 5) immunodeficiency, 6) endocrine diseases as diabetes mellitus and obesity, 7) purpura, 8) impairment of hearing prior to diagnosis of sepsis, 9) neuromuscular diseases, and 10) recent neurosurgery or ventriculoperitoneal shunt.All consecutive children , aged <15 years (mean: 71.8 ± 8.23 months), blood pressure (99 ± 19 mmHg), admitted to the Pediatric Department, Hospital of Infectious Diseases , Assiut, Egypt, carried the diagnosis of bacterial meningitis, were included in this study. Septic meningitis was diagnosed by the presence of the following: CSF polymorphonuclear cell count > 5 mmF culture. The diaClinical data were collected as follow: 1) demographics , coexisting medical conditions, antibiotic pretreatment, vaccination status, temperature and duration of fever at the time of presentation and occurrence and timing of seizures, 2) physical examination findings, 3) routine tests for biochemistry and hematology were done on the date of lumbar tap including complete blood count, kidney and liver function tests, 4) chest x-ray, urine and stool analyses were done as indicated per patient, 5) CSF analysis included white and differential cell count, protein and glucose concentrations, gram-stained CSF smear examination and culture for bacteria, 6) the severity of brain involvement was assessed using the Pediatric Glasgow Coma Scale or scoring system (PGCS). This isUpon hospital discharge (survivors or non-survivors), summary data including total hospital stay and complications were collected for all patients.Serum and CSF samples were collected from patients upon admission. Only blood samples were obtained from the control children as our ethical committee did not permit CSF intake from normal children. CSF was collected under strict non-infected conditions. Standard hematological and biochemical analysis of peripheral blood were also documented. All samples were tested for white blood cell count with differential and bacterial cultures. Levels of CSF glucose, protein were determined by routine laboratory procedures. Methods for CSF processing and bacterial culture used in this study have been described previously. BrieflyNitric oxide (NO) was determined by a classic griess reaction with sulfanilic acid and alpha naphthylamine in diluted sulfuric acid medium as described by Ding et al. LPO was3/albumin serum concentration) was calculated as an indicator of blood-CSF barrier dysfunction in patients with meningitis[3/mediator serum concentration) with the albumin ratio , it is possible to infer whether the mediators of similar molecular weight to albumin are passively transferred across the disrupted blood-CSF barriers or intrathecally synthesized. The latter is indicated by calculation of the blood-derived mediator indices as follow: mediator index is equal to the mediator ratio (CSF/serum) divided by albumin ratio (CSF/serum). The higher the mediator ratio than albumin ratio indicates local intrathecal substance production. Estimation of marker indices seems to have a significance for blood-deriver proteins or substances but it is not applicable for brain-derived proteins or substances as S-100B which has an intrathecal fraction of ~99% [Albumin is an exclusively blood-derived CSF protein. It is transferred to the CSF via passive diffusion through the intact blood-CSF barriers. The CSF-to-serum albumin concentration was found to be 1:205. Increased albumin concentrations in CSF must always be due to blood CSF barrier dysfunction. In this study, albumin ratio . The serThe analysis was done using SPSS version 11.5. Data were expressed as mean ± 2SD or as a percentage when appropriate. One-way ANOVA or Mann-Whitney U tests were used for comparison between different groups. The Pearson's and Spearman correlation coefficient tests were used to evaluate associations between measured parameters (continuous and non-continuous variables). For all tests, p < 0.05 was considered significant.3, neutrophils: 92 ± 13% and lymphocytes: 8 ± 13%) as compared to our normal lab reference values . CSF-culture was positive in 37.5% (n = 15) of patients. Organisms identified were streptococcus pneumonia , staphylococcus aureus , haemophilus influenza and neisseria meningitides .This is a cross-sectional study. CSF biochemistries of the samples examined confirmed the diagnosis of bacterial meningitis and rigidity of the 4 limbs . Headache and drowsiness without other manifestations were observed in 30% (n = 12) which may be non-specific manifestations due to medications. Three patients with rigidity had streptococcus pneumonia and the 2 patients with 6th cranial nerve palsy had haemophilus influenzae and Neisseria meningitidis (one patient each). Mortality rate was 5% (n = 2). Organisms identified were streptococcus pneumonia , staphylococcus aureus , haemophilus influenza and neisseria meningitides . The high rate of culture negative disease was caused by multiple factors including the use of antibiotics before admission, a common problem in Egypt and many other developing countries [The frequent presenting clinical manifestations include: fever , vomiting , headache , seizures , nuchal rigidity , drowsiness , diarrhea , cough and bleeding tendency . According to PGCS, moderate to severe scores were identified in 40% of children. Fundus examination was normal. Neurological evaluation at the time of hospital discharge revealed persistence of specific neurological manifestations in 12.5% (n = 5) of patients in the form of squint ; CSF-LPO with CSF-protein ; NO and LPO indices ; total thiol with LPO indices ; S-100B and PGCS ; CSF-LPO with CSF-S-100B ; serum-total thiol with serum S-100B . In healthy controls, a positive correlation was found between serum S-100B with serum LPO .The results of this study may suggest the following: 1) Dysfunction of blood-CSF barriers occurs with bacterial meningitis, 2) Oxidative stress has an important role in the pathogenesis of bacterial meningitis, 2) Brain damage does occur in bacterial meningitis as evidence by increased intrathecal synthesis of S-100B, NO and LPO biomarkers, 3) the finding of association between the levels of mediators of oxidative stress, antioxidants and S-100B may suggest their role in disease severity and the occurrence of neurological complications.In the present study, the increased albumin ratio (CSF/serum) is an indicator of morphological and/or biophysical dysfunction of the blood CSF barriers caused by inflammation. Albumin is the main fraction (80%) of CSF proteins. Increased albumin concentrations in CSF must always be due to blood CSF barriers dysfunction (100% blood-derived protein). Furthermore, it has been suggested that the mediators' CSF-to-serum ratio and indices are better for diagnostic purposes rather than relying on CSF concentrations only and to infer whether the blood-derived mediators of similar molecular weight to albumin are passively transferred across the disrupted blood-CSF barriers or intrathecally synthesized. This has been attributed to the fact the difference in the CSF levels of these mediators throughout the day caused by CSF turnover and the to-and-fro motions of the CSF by cardiac cycles or the circadian rhythms. According to the laws of diffusion, it is important to know that all blood proteins traverse capillary walls of blood-CSF barriers by passive diffusion (molecular flux) into brain, extracellular fluid and CSF according to their molecular weight, e.g. smaller molecules like IgG (150 kDa) (serum/CSF ratio: 500:1), albumin (67 kDa) (serum/CSF ratio: 205:1) are fast in exchange than large molecules e.g. IgM (900 kDa) which are slower in exchange and subsequently form a steeper blood-to-CSF concentration gradient (IgM: serum/CSF ratio: 3400:1).In this study, serum and CSF levels of NO were elevated in children with meningitis. NO CSF/serum ratio and index are suggestive of local production in the CNS as well as passage through the disturbed blood brain barrier. Some authors suggested that the increased level of CSF-NO in patients with bacterial meningitis is due to blood-CSF barriers dysfunction or disturbed permeability as a result of the inflammatory process,23. BactA positive correlation was found between NO-index and CSF-WBCs. Another interesting result in this study is that the serum-NO level was higher in patients with gram positive CSF culture compared to negative culture indicating that the NO production is related to the presence of the organisms. Previous reports indicated that higher levels of NO are associated with severe disease . CSF pleIn this study, serum LPO levels were elevated in patients with meningitis which points to the presence of a general status of oxidative stress affecting cellular membranes-7,9,26.In this study, the high levels of NO, regardless of its source, have been associated with membrane lipid peroxidation. There is a substantial body of work implicating ROS, inflammation and oxidative stress in the development of cerebral edema, vascular damage, CSF pleocytosis and intracranial complications in bacterial meningitis and meningoencepahlitis,7. It isIn the present study, S-100B concentrations were increased. The results of S-100B CSF/serum ratio suggest increased intrathecal synthesis. Its levels were higher in patients with positive than with negative cultures and in presence of neurological complication than in their absence. A positive correlation was identified between CSF-S-100B and CSF-LPO and between S-100B ratio and the severity of meningitis as indicated by PGCS. The positive correlation was found between serum-S-100B with serum-total thiol lead to the suggestion that the damaged astrocytes may increase the formation of S-100B according to severity of oxidative stress.S-100B is a low molecular weight mainly brain-derived protein . In healthy subjects, natural autoantibodies of IgG class to S-100B are present in serum. However, the exact source of S-100B in the blood is unknown. At normal concentrations, it is able to protect hippocampal neurons against glutamate toxicity. It was The exact mechanisms that regulate the increased intrathecal levels of S-100B protein in bacterial meningitis are unknown. Inflammation ., glutamTo summarize, the present investigation provides a new perspective for the clinical study of S-100B, with special reference to neurologic sequelae after bacterial infections. We believe that this study has potential clinical importance in the field of pediatrics and biological processes although the results of this work in some of its parts are confirmatory to the previously established data and our suggestions of their role in the pathogenesis of bacterial meningitis are speculative in nature. This is the main limitation of this study. Further experimental studies are needed to confirm the direct or indirect causal relationship between bacteria, inflammation, oxidative stress and S-100B, markers in the pathogenesis of bacterial meningitis. Although CSF remains the biological fluid of choice, further investigations are needed in other biological fluids.The results of this study may have clinical and research implications. It may contribute to further understanding of factors involved in the pathogenesis of brain compromise in bacterial meningitis. It seems to be multifactorial and not due to direct infection of CSF or to the presence of toxins. It involves disruption of the blood-CSF barriers caused by inflammatory process, oxidative stress and impaired astrocyte function. If the results of this study are supported by further research, this may lead to the use of distinct profiles of mediators as possible biomarkers for the prediction of prognosis, monitoring response to treatment and improvement of management strategies of patients with bacterial meningitis.CNS: central nervous system; CSF: cerebrospinal fluid; BBB: blood-brain barrier; LPO: lipid peroxide; NO: nitric oxide; SOD: superoxide dismutaseThe authors declare that they have no competing interests.SAH carried out the clinical evaluation of the patients, collection of serum and CSF samples from patients, participated in the design of the study, statistical analysis and drafted the manuscript. EAH carried out the laboratory analysis of albumin and S100-B protein from serum and CSF and participated in the design of the study and its statistical analysis. MMZ carried out the laboratory analysis of NO, LPO, total thiol and SOD from serum and CSF and participated in the design of the study. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

The 1,3-di-4-pyridylpropane ligands link the CoII atoms into an infinite zigzag chain parallel to [010]. The chains are further linked through O—H⋯O and C—H⋯O hydrogen bonds, forming a three-dimensional supra­molecular network.In the title compound, {[Co(C N-oxide, see: Nathan et al. (C13H14N2)(H2O)]·2H2O = 0.059 wR(F 2) = 0.175 S = 1.00 3897 reflections290 parameters9 restraintsH-atom parameters constrainedmax = 0.66 e Å−3 Δρmin = −0.40 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536808032741/hy2158sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536808032741/hy2158Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Time, space and numbers are closely linked in the physical world. However, the relativistic-like effects on time perception of spatial and magnitude factors remain poorly investigated. Here we wanted to investigate whether duration judgments of digit visual stimuli are biased depending on the side of space where the stimuli are presented and on the magnitude of the stimulus itself. Different groups of healthy subjects performed duration judgment tasks on various types of visual stimuli. In the first two experiments visual stimuli were constituted by digit pairs (1 and 9), presented in the centre of the screen or in the right and left space. In a third experiment visual stimuli were constituted by black circles. The duration of the reference stimulus was fixed at 300 ms. Subjects had to indicate the relative duration of the test stimulus compared with the reference one. The main results showed that, regardless of digit magnitude, duration of stimuli presented in the left hemispace is underestimated and that of stimuli presented in the right hemispace is overestimated. On the other hand, in midline position, duration judgments are affected by the numerical magnitude of the presented stimulus, with time underestimation of stimuli of low magnitude and time overestimation of stimuli of high magnitude. These results argue for the presence of strict interactions between space, time and magnitude representation on the human brain. Time perception is fundamental to many aspects of our lives. Most scientists agree that the explicit study of time falls in the purview of physics, yet time is an integral part of virtually all psychological phenomena.A century ago Einstein's insight revolutionised physics, postulating the relativity of time in the physical world and its strict correlation with space. A similar conceptual approach is likely needed to understand the timing of visual events in the human brain.In fact, a wealth of human and animal research has supported common processing of temporal information with other magnitudes As to the relations linking time with spatial factors, previous evidence All these findings are unified in a theory stating that time, space and quantity are part of a generalized magnitude system in the primates' brains, where specific cortical areas process these elements of the environment However, in spite of this growing interest in the functional interactions between time and other magnitudes, there is relatively little in the literature on how spatial, numerical and temporal dimensions interact in the cognitive system and on the parallel or hierarchical nature of such interactions.Here, we used different ordered materials in the same task to test whether relativistic-like effects could compress and expand perceptual time according to two factors: the magnitude of the stimulus; the side of space where a visual stimulus is presented.When stimulus digits were presented in midline position, time perception was biased according to the magnitude of the digit: the duration of test low digits was underestimated compared with that of reference high digits and vice-versa, as revealed by the significant difference of bisection points in the two conditions .When stimulus digits were presented lateralised in the right and left visual hemifields, time perception was biased according to their spatial lateralisation: the “bisection” point was significantly longer in the left vs. right space, either when the digit 9 or the digit 1 was the test stimulus, as well as in the case of stimuli constituted by circles .Duration perception of spatially lateralized stimuli was still influenced by numerical magnitude: in fact, bisection points were significantly shorter when the test stimulus was the digit 9 as compared with digit 1, either in the right space or in the left space .The current findings suggest that, as in the physical world, psychological time is relative and elastic. Time can be compressed and expanded by a number of environmental factors such as the position of a stimulus, on a left-to-right vectorial distribution, or its magnitude.The relation between time and numbers seems to be influenced by numerical quantity: small numbers bias estimation towards short durations whereas large numbers bias estimation towards long durations in a behavioral standard time comparison task. These findings argue for a functional interaction between number magnitude processing and time estimation. The implicit influence of quantity on time estimation implies that subjects keep track of magnitude when cued to time, consistently with previous findings reporting that the numerical information interferes with subjects' ability to discriminate duration In addition to duration distortions induced by number magnitude, the present findings indicate a strong influence of spatial lateralisation on time judgments: left space biases estimation towards short durations whereas right space biases estimation towards long durations, irrespective on the magnitude of the stimulus timed. This pattern suggests that elapsing time is internally mapped onto spatial representations. We suggest that even the influence of number magnitude on duration judgments could be mediated by spatial attentional factors. In fact, the mere presentation of numbers induces a spatial attentional bias depending on the magnitude of the number: low numbers shifting attention to the left and high numbers to the right space Overall, these findings fit with the prediction that time could be cognitively represented by means of spatial coordinates, with a left-to-right oriented linear representation, in analogy with numbers and other types of ordered material, such as numbers In fact, recent evidence has provided direct support to the hypothesis of a left-to-right directionality in time representation. Manipulation of spatial attention by means of optokinetic stimulation biases temporal judgments in healthy subjects according to the side of space where attention is oriented: rightward attentional shifts induce temporal overestimation and leftward attentional shifts induce underestimation of temporal judgments These evidences challenge traditional views of temporal perception mechanisms, positing that perceptual events are timed by a centralized supramodal clock The combination of these findings fit with the proposal that relative time between events may be transformed into specific patterning in neural maps, interpretable with the same mechanisms used to decode cortical representation of spatial images.Twenty-eight right-handed healthy subjects , with normal or corrected vision, participated in the experiments after providing written informed consent.a computer monitor configured to a refresh rate of 100 Hz.Ten subjects participated in this experiment. They were positioned 60 centimeters from a P791 DellVisual stimuli constituted by digit pairs were presented in the centre of the screen or in the right and left space (5° eccentricity). The duration of the reference stimulus was fixed at 300 ms. The test stimulus was presented after an interval of 1000 ms from the reference one and its duration varied randomly from 150 to 450 ms in steps of 20 ms.Subjects had to indicate the relative duration of the test stimulus compared with the reference one, by pressing either of two response keys using their right hand.In this experiment, digit 1 was the reference stimulus and digit 9 the test stimulus. Each stimulus pair (reference and test cue) was presented lateralized in the right and left space or in central position in a randomized order. The corresponding conditions were: digit 1 in the left and digit 9 in the right space; digit 1 and digit 9 in central position; digit 1 in the right and digit 9 in the left space .Each condition consisted of 160 trials of reference and test cues .Ten subjects participated in this experiment. The task and the adopted procedure were identical to that of experiment 1, with the exception that digit 9 was the reference stimulus and digit 1 the test stimulus .Eight subjects participated in this control experiment, performed to test whether duration judgments are influenced by spatial position of the stimuli irrespective on their numerical magnitude.Reference and test cues were constituted by identical stimuli .Time intervals, number of trials and experimental procedure were identical to those of the first two experiments.Spatial position of reference and test cues was varied, such that they were presented in the left and right space or in central position in an equal number of trials. Therefore, the corresponding conditions were: reference cue in the left and test cue in the right space; reference and test cue in central position; reference cue in the right and test cue in the left space .Each condition consisted of 160 trials of reference and test cues .In order to measure the amount of temporal bias observed in each condition, the individual frequencies of “longer” responses were converted into probabilites and a logistic model was fitted to the data of each participant as a function of the duration of the test stimulus (from 150 to 450 ms). This allows to determine the subjective “bisection point” for each condition. This point represents the time interval for which the observer perceives the duration of reference and test stimuli as equal, and is computed as the time interval at which “longer” and “shorter” responses are reported equally often . A shift in the bisection point in either direction indicates a temporal bias in the corresponding experimental condition.A paired-t-test was then performed on the individual bisection points to compare the amount of temporal bias in each condition.

Ultra high throughput sequencing (UHTS) technologies find an important application in targeted resequencing of candidate genes or of genomic intervals from genetic association studies. Despite the extraordinary power of these new methods, they are still rarely used in routine analysis of human genomic variants, in part because of the absence of specific standard procedures. The aim of this work is to provide human molecular geneticists with a tool to evaluate the best UHTS methodology for efficiently detecting DNA changes, from common SNPs to rare mutations.We tested the three most widespread UHTS platforms on a well-studied region of the human genome containing many polymorphisms and a very rare heterozygous mutation located within an intronic repetitive DNA element. We identify the qualities and the limitations of each platform and describe some peculiarities of UHTS in resequencing projects.When appropriate filtering and mapping procedures are applied UHTS technology can be safely and efficiently used as a tool for targeted human DNA variations detection. Unless particular and platform-dependent characteristics are needed for specific projects, the most relevant parameter to consider in mainstream human genome resequencing procedures is the cost per sequenced base-pair associated to each machine. The possibility of obtaining nucleotide sequences in the range of hundreds of millions base pairs from various types of DNA templates allows for example to extend mutational screenings to very large portions of the genome, an experimental strategy that would be too expensive and time consuming to perform with methods based on the Sanger procedure The recent commercialization of ultra high throughput sequencing (UHTS) technologies, initially applied to the However, these “next-generation” technologies still have some limitations that must be taken into account. A well-recognized problem associated with the mapping of UHTS sequences is represented by the presence of repetitive elements or low-complexity stretches to which short UHTS reads cannot uniquely align PRPF31 gene. As a proof of concept for UHTS to be used in routine human genetic screenings, we sequenced 31 kb of the human chromosome 19 encompassing the PRPF31 region in a patient with this rare mutation as well as several common SNPs. For comparative purposes, we used the three currently most widespread UHTS platforms: Roche/454 GS FLX Titanium (Roche 454), Illumina/Solexa Genome Analyzer II (Illumina GA) and Applied Biosystems/SOLiD 3 (ABI SOLiD) instruments.Recently, we discovered a mutation (c.1347+654C>G) in one of these particular regions of the human genome associated with dominant retinitis pigmentosa, an hereditary blinding disease The Roche 454 technology is based on the clonal amplification of DNA fragments attached on individual beads in an emulsified PCR reaction. The beads are distributed on a 1.6 million wells substrate (PicoTiterPlate™) where pyrosequencing reactions occur This study was carried out in accordance with the tenets of the Declaration of Helsinki and was approved by the Institutional Review Boards of our University and of Harvard Medical School, where the blood was collected and the cell line derived. Written informed consent was obtained from the patient who participated in this study and donated her blood for research.PRPF31 c.1347+654C>G mutation (cell line #13189) and amplified the 31-kb NDUFA3-PRPF31 genomic region by 4 individually-amplified long-range PCR, designed as previously described We extracted DNA from a lymphoblastoid cell line derived from an affected individual carrying the Preparation of DNA libraries was performed following the guidelines provided by the manufacturers of each platform and sequenced by using: 1/8 of a plate for the Roche 454 Genome Sequencer FLX, Titanium series, 1 lane of an Illumina Genome Analyzer version II, and 1 “quad” of an ABI SOLiD 3 instrument. The exclusion of reads with very low quality was performed automatically by the Roche 454 and Illumina GA sequencing instruments, while for ABI SOLiD this had to be carried out a posteriori with the ABI's csfasta_quality_filter.pl application, available from the SOLiD Software Development Community.All analyses and statistics on quality-filtered reads were performed using the relevant tools of the software package CLC Genomics Workbench, version 3.7 as described below.In this process the parts of the reads with low quality scores were trimmed. The algorithm calculated base error probabilities based on their quality values, normalized to a PHRED scale. We set a cutoff value of 0.01, calculated as described in the software package manual, and discarded trimmed reads below 20 nt of length, independently from their residual score.The original reads as well as the trimmed sets were aligned to 31 kb of the corresponding reference sequence . To ensure uniformity, we applied comparable settings to all platforms, considering the different read length of each platform, inclusive of the color-space option for the ABI SOLiD platform. Specifically, we used the local gapped alignment algorithm for all alignments, keeping the default parameters for mismatch and deletion costs. Reads that aligned to more than one position of the reference sequence were discarded.de novo assembly procedure. The original reads were first aligned onto the Sanger-obtained sequence of the region by using the same parameters described above and by allowing random matches of reads with multiple mapping positions. Subsequently, we extracted the sequences that aligned to the region and used them for de novo assembly with the same parameters used for the reference assembly (no random matches).For the intronic repetitive DNA fragment we also re-assembled the reads by using a et al.Variant detection was performed with the SNP and INDEL detection tools. The settings for calling a variant were described previously by Harismendy We simulated different coverage depths by randomly sampling a subset of the reads from the *.fastq files exported after the trimming process. Each subset was sampled 3 times. Alignments to the reference sequence were performed as described above for the non-simulated sets of data. In order to have a balanced representation of the 4 amplicons, we calculated the average coverage at the level of the amplicons (and not of the entire region) and joined the amplicons with the same average coverage, considering them as a single sampling event. For SNP detection we maintained the same parameters as for the full dataset, but with a minimum coverage of 5 and at least 2 reads carrying the variant allele, to compensate for the reduced coverage introduced by the simulations.PRPF31 gene were available from previous analyses PRPF31 gene were sequenced starting from the long-range PCRs used as UHTS templates or from short-range PCRs obtained using standard HotStartTaq DNA polymerase protocols. PCR products were enzimatically purified using 1 µl ExoSAP-IT for 10-µl reactions, according to the manufacturer's instructions. Sequencing reactions were performed by mixing 5 µl of purified PCR product, 0.75 µM of 20mer primers and 1 ul of BigDye Terminator v1.1 cycle sequencing kit , and run on a ABI-3130XLS (Applied Biosystems).Data from the Sanger sequencing of the All computer-based analyses were performed with a commercial, user-friendly software. This choice was taken in order to be as close as possible to the setup of the average laboratory performing routine genetic testing without the specific support of computer analysts. The use of a simple pipeline, compatible with outputs generated by different sequencing platforms, also allowed treating the data in a uniform manner, thus eliminating possible biases deriving from machine-specific software or algorithms.de novo assembly.For our analyses we used 1/8 of the total sequencing capabilities of each machine. The Roche 454 platform (1 sector of the 8-sector gasket) generated ∼100,000 quality-passed reads with an average length of 318 nt, Illumina GA (1 lane) ∼4.6 million reads of 34 nt, and ABI SOLiD (1 “quad”) ∼17,3 million reads of 50 nt, corresponding to a throughput of ∼32 Mb, ∼157 Mb and ∼862 Mb, respectively . We did All raw sequences underwent quality filtering procedures consisting in the trimming of low quality nucleotides from the reads. After this procedure, 27.2% of the bases from the original throughput were discarded from the Roche 454 dataset, 12.4% from the Illumina GA dataset, and 38.0% from the ABI SOLiD dataset. However, despite the variable number of nucleotides that were rejected, for all platforms the large majority of the reads (>99.8%) were not eliminated, but simply shortened , Fig. S1Trimmed sequences, as well as un-trimmed ones, were mapped to the reference sequence (ref_seq). Since the number and the length of trimmed reads was lower with respect to raw reads, the total amount of bases from trimmed sequences mapping to the ref_seq was also lower. However, trimmed reads mapped to the ref_seq in higher percents, as a consequence of their increased content in high-quality bases, with the effect of producing in principle more accurate consensus sequences . These oPRPF31 gene also presented platform-specific gaps, as detailed below.The selected interval was entirely covered using the three datasets, with the exception of 2 very small gaps originating from non-overlapping PCRs and 2, aCoverage varied depending on the specific LR-PCR product analyzed, because of uneven loading of the individual PCR products . SimilarTo evaluate the accuracy of a base call in each platform after the alignment procedure, we used the “conservation” score, generally used in relationship to alignments of sequences originating from different species. In a resequencing context and as defined by the software package used, this value indicates the percent of the most represented base across the reads covering the same nucleotide in a sequence. An alignment at a given position would have a conservation score of 100% if all the reads carry the same base. For sake of simplicity, to compare the three alignments we selected only one PCR fragment , brought to a simulated average coverage of ∼250x by using sampled trimmed reads. This procedure also allowed evaluating reads that were already filtered by quality scores. The average conservation values were similar across the three platforms . However, important differences appeared when values at each position were individually ascertained. In short-read assemblies almost all nucleotides had perfect conservation, with some outliers corresponding to heterozygous SNPs (around 50%). In the long-read assembly the number of outliers was higher, especially within the 80–100% range . In thisPRPF31 pathogenic mutation, nor another VNTR in the TFTP gene, also present in this region.For comparative analysis of SNP detection performances we considered neither the intronic VNTR containing the The number of SNPs identified by setting an allelic threshold of 20% was very similar across all platforms . DecreasFor some heterozygous SNPs, mostly located within the 2nd long range PCR fragment, the number of reads relative to one allele was substantially higher with respect to reads belonging to the other one. This effect was particularly visible for the short-read platforms, to a point that the experimental results did not allow a clear detection of the variant, or a clear ascertainment between homozygous and heterozygous SNPs . ElectroIn all three platforms, the algorithm interpreted the duplication of a CAAG next to an A stretch (dbSNP:5828571) as 2 SNP.Coverage simulations were performed to ascertain the presence of features emerging from non-saturating conditions and to determine the minimum coverage required by each platform to detect the correct number of SNPs. We randomly sampled reads after the filtering and trimming procedure to obtain seven average depths . The average coverage of each fragment was proportional to the number of reads of a given length used in the assembly (data not shown), so that it was possible to calculate the number of reads to sample from each dataset in order to obtain the desired coverage depth.For each simulated sequencing experiment, we counted the number of SNPs identified. We eliminated all variants detected having less than 5x coverage, allowing at least 2 high-quality reads carrying the variant, since these parameters were already ascertained to produce reliable calls False positive appeared in all three platforms. Regardless of the simulated average coverage, they were the outcome of random errors in sequencing that could not be corrected by additional reads covering the same position. At lower depths, this limitation was the obvious effect a reduced number of available reads. At higher depths, false positives invariantly showed to have local coverage that was at least 10 times lower than the average (simulated) one, likely because of mapping difficulties, and thus easily recognizable as false calls.PRPF31 gene was found in alignments for the three platforms. For Illumina GA and ABI SOLiD this was the only indel detected, while for the Roche 454 we could identify 88 is a difficult issue both for Sanger sequencing and UHTS technologies. One heterozygous cytosine deletion (dbSNP:34064860) downstream of the ntify 88 and 124 No insertion was automatically found in any of the sequences generated by the three platforms, including the CAAG duplication, ascertained with Sanger sequencing and by manually checking the UHTS alignments (dbSNP:5828571).Repetitive regions represent more than 50% of the human genome TFTP gene: none of the three alignments could clearly detect two repeats present in the patient with respect to the four repeats reported in the ref_seq.An additional element of complexity typical of repetitive elements such as VNTRs is that they are polymorphic. The individual analyzed here was homozygous for 6 VNTR repeats, while the ref_seq reported a VNTR carrying 7 elements. None of the three platforms analyzed could resolve the correct structure, which was disclosed only by Sanger sequencing. When UHTS reads were aligned onto the correct sequence, short reads assemblies still could not match to the central portion, although the sizes of the gaps were reduced and more sequence could be covered, as consequence of the increased number of uniquely-placed reads. On the contrary, long reads could precisely map the entire region . The samde novo assembly of the subset of reads matching the PRPF31 VNTR . A contig could be obtained only with Roche 454 reads but, as before, the number of the repeats did not correspond to the ones of the patient (one of them was missing).To bypass the limitation arising from forcing an alignment to a reference sequence, we tried also The mutation associated with adRP in the patient was clearly detected by all three techniques with a frequency very close to 50% and a coverage similar to the rest of the fragment and regardless of the ref_seq used, likely thanks to its proximity with the 5′ anchoring non-repetitive region.To provide a proof of concept for routine genomic DNA resequencing by UHTS, specifically focused on the detection of disease-causing variants, we processed a 31-kb human genomic region with three next-generation sequencing platforms and analyzed the results with a commercial, user friendly software. In addition to several common SNPs and other typical variants of the human genome, this interval contained a rare mutation located in a particularly challenging region, thus representing an interesting benchmark for a comparative analysis.a priori by the machine since this platform relies more on quality control steps (color space) during the mapping procedure than during the pre-filtering process.The raw sequence throughputs obtained were consistent with the ones expected for the portion of the sequencing area used for each instrument, as specified by each manufacturer. For all platforms, the reads were minimally affected by the filtering (trimming) procedure, as only 0.2% or less of them were discarded. However, this result cannot be taken as a practical qualitative parameter, since reads of excellent quality but of very short length are basically useless in resequencing procedures. When a minimal length of 20 nt was included as a parameter in the filtering process, the three platforms began to reveal some differences. Roche 454 conserved basically all of the original reads, in virtue of its chemistry producing sequences much longer than 20 nt, while the other sequencers retained only 80–90% of them. It has to be noted, however, that this trimming procedure was heavily dependent on the strategies used by the single platforms to eliminate low quality and polyclonal sequences from the raw output and has only a relative value in terms of comparison across the different UHTS systems. For example, ABI SOLiD's low quality reads were not discarded Following mapping procedures, different platforms produced different coverage depths per base. This was simply the result of the initial different sequencing throughput typical of each platform, and not an issue related to the quality of the sequences or to the mapping procedure. Considering, however, that the same relative sequencing surface was used for all the machines , mapping of Roche 454 raw reads produced an average coverage of ∼770x/base, of Illumina GA reads ∼4,000x/base, and of ABI SOLiD reads ∼26,000x/base. The throughput of each machine is constantly increasing, following the technical development of the respective chemistries, making it difficult to provide updated comparisons relying on real data analyses. For example, the new released models from Illumina (HiSeq 2000) and ABI SOLiD (version 4) can reach a throughput of 100 Gb per run or more.Mapping accuracy appeared to correlate with the quality of the individual reads, rather than with parameters related to the mapping procedure itself. Specifically, short-read platforms produced assemblies having higher accuracy than Roche 454, simply because this latter platform is prone to introduce errors when stretches of homopolymeric bases are present Once the contigs were obtained, we focused on the detection of the human variants contained in the targeted region , the principal aim being the simulated discovery of pathogenic mutations. SNP detection was overall comparable across the three platforms; however, some differences could be detected. In Roche 454's long-read alignments, false positives and negatives (undetected SNPs) could be again connected to the typical errors of the 454 technology, related to homopolymer effects. We observed that the use of quality-trimmed reads could reduce these false positive calls, but it also reduced the number of true variants automatically detected. Nevertheless, when manually inspected, these variants could safely be identified. Similarly, in alignments from short-read platforms false negatives (one of which was in common between Illumina GA and ABI SOLiD) were due to the low frequency displayed by the “non ref_seq” allele, and they become detectable when the discovery threshold was lowered. In some particular instances, especially for Illumina GA data, the under-detection or the incorrect calling of SNPs as homozygous or heterozygous variants were not a consequence of UHTS errors, but could be explained by allelic unbalanced amplification. This phenomenon occurs when one of the two alleles is enriched during the PCR amplification of the template DNA, or perhaps during the amplification of the libraries, and results in a problem that is relevant also when high coverage depths are used Sensitivity in SNP detection with respect to the coverage increased from Roche 454 to ABI SOLiD and finally to Illumina GA. Since the differences detected were not too pronounced and SNP detection was heavily dependent on the regional sequence context, we can safely conclude that all platforms analyzed can be considered as having similar performances with respect to sensitivity at the same average coverage. Indeed, it is very hard to extrapolate the results from their specific sequence or random coverage contexts, as the mapping procedure was influenced by the complexity of the DNA to be sequenced and the number of reads available. At lower average coverage depths, the rate of discovery decreased sensitively and different random samplings gave different results because the number of poorly-covered regions was higher. As mentioned, in correspondence of false positive calls local coverage was low even when the average coverage depth was high, indicating a direct influence of the mapping procedure on automated identification of variants.With respect to detection of small insertions and deletions, the most relevant observation relates to the identification of a large number of false positive deletions in homopolymers stretches obtained with Roche 454 alignments, as also noted by others in analyses of longer genomic intervals PRPF31 was taken as a benchmark to assess whether “difficult” DNA variants could be detected by UHTS. Large-scale sequencing projects almost invariantly clash with the problem of mapping and carefully analyzing repetitive DNA elements PRPF31 and TFPT VNTRs analyzed. Nevertheless, it was not possible to precisely resolve the number of repeats composing these elements, neither by aligning them to a reference sequence, nor by de novo assembly.The c.1347+654C>G mutation in the 56-bp intronic VNTR of Conversely, despite the presence of repeats, all three platforms tested could successfully detect the mutation associated with the disease in the patient's genome. This favorable outcome is probably due to the presence of the pathogenic variant within the first of the 6 elements composing the VNTR, thus allowing the “anchoring” of some reads to the non-repetitive DNA region in 5′ of this repeat. Although previous attempts to identify this mutation with an earlier version of the Illumina GA (the “GA I” platform) failed in such a task Other rearrangements of the human genome characterized by a variable number of large and unique DNA copies are in general easily detected by UHTS. Because of the quantitative nature of the sequencing results, such rearrangements produce very noticeable variations of coverage when aligned to a ref_seq. For example, CNVs, sparse and non-repetitive elements spanning kilobases to megabases of DNA The increase of read length in UHTS platforms, an issue on which manufacturers are putting constant efforts, will probably help reducing some of the current weaknesses of this technology and accelerate the transition from Sanger sequencing to UHTS. Illumina, for example, has increased the length of the reads from 35 nt to 100 nt in less than a year; ABI SOLiD, from 50 to 75 nt. However, if we exclude repeats-related concerns, our data seem to indicate that this ever changing dimension in UHTS systems should not have a major impact on DNA variants detection in resequencing efforts , whereas the quality of the reads produced should. Hence, the data produced here can very likely be extrapolated to future longer reads from the same platforms, provided that the sequencing chemistry and procedures remain the same.In our analysis we did not consider the costs of sequencing as a comparative parameter, although it obviously represents an important factor to be taken into account while designing a sequencing project. From our results, no striking qualitative difference appeared across the three platforms, when appropriate conditions in terms of reads and coverage depths were fulfilled. As a general rule then, the less expensive platform producing the needed amount of sequences for a given project would probably also be the most suitable one, unless platform-specific characteristics are critical for the tests to be carried out or other endeavors with respect to genomic DNA resequencing (e.g. transcriptome sequencing) are performed.In conclusion, in our work we show that identification of DNA variants in complex DNA sequences such as the human genome can be achieved by highly-parallel techniques, with investments in terms of cost and time that represent a fraction of what is usually spent for conventional sequencing. Furthermore, our successful adoption of a user-friendly software and a straightforward analytical pipeline demonstrates that a strong bioinformatic background is not a compulsory requirement for investigators dealing with UHTS technology. In our example, we performed the analysis of a large genomic region from a single individual amplified by LR-PCR. However, the power of UHTS can be applied to sequence shorter DNA regions obtained by sequence capture or conventional PCR in multiple patients, i.e. to a procedure that is more similar to current routine setups in medical genetic laboratories. Although some limitations to this latter UHTS application still exist, the use of sample pooling Figure S1Distributions of read lengths from the three platforms tested. The output generated from short-read platforms consists in reads having the same length: Illumina GA generated only reads of 34 nt and ABI SOLiD generated mostly reads of 50 nt, with only a small fraction of them (0.4%) having shorter lengths.(0.61 MB TIF)Click here for additional data file.Figure S2TPFT and PRPF31 sequences are indicated by arrows. Vertical lines indicate the position of SNPs rs35705606 and rs2668836 at coordinates 13,761 and 14,098, respectively, that were under-detected by short read platforms.Similarity plot of the region analyzed. The VNTRs within the (7.67 MB TIF)Click here for additional data file.Table S1Coverage of individual amplicons.(0.05 MB DOC)Click here for additional data file.Table S2Details on false positive results detected, after assembly of untrimmed reads.(0.06 MB DOC)Click here for additional data file.Table S3SNPs detected after mapping of UHTS untrimmed reads. Black: SNPs detected by using the default threshold for heterozygozity (20%). Red: SNPs detected with a threshold between 10% and 20%. Blue: SNPs with a borderline limit definition of homo-heterozygosity. Green: variants corresponding to the CAAG insertion. Grey shadow: SNPs located in the 2nd long range PCR fragment, showing allelic imbalance. SNPs identified in the tandem repeats are not reported.(0.22 MB DOC)Click here for additional data file.Table S4Deletions detected with Roche 454 , using trimmed reads. The deletion at position 30,672 was also found using the other 2 platforms, likely being the only real small deletion.(0.16 MB DOC)Click here for additional data file.

Lactobacillus plantarum WCFS1 in vivo in two placebo-controlled human intervention studies in healthy volunteers. Transcriptional changes in duodenal mucosa upon continuous intraduodenal infusion of L. plantarum WCFS1 for one- and six h, respectively, were studied using oro- and nasogastric intubations with dedicated orogastric catheters and tissue sampling by standard flexible gastroduodenoscopy.There is limited knowledge on the extent and dynamics of the mucosal response to commensal and probiotic species in the human intestinal lumen. This study aimed to identify the acute, time-dependent responses of intestinal mucosa to commensal L. plantarum WCFS1 induced differential expression of 669 and 424 gene reporters, respectively. While short-term exposure to L. plantarum WCFS1 inhibited fatty acid metabolism and cell cycle progression, cells switched to a more proliferative phase after prolonged exposure with an overall expression profile characterized by upregulation of genes involved in lipid metabolism, cellular growth and development. Cell death and immune responses were triggered, but cell death-executing genes or inflammatory signals were not expressed. Proteome analysis showed differential expression of several proteins. Only the microsomal protein 'microsomal triglyceride transfer protein' was regulated on both the transcriptional and the protein level in all subjects.One- and six-h exposure of small intestinal mucosa to L. plantarum WCFS1 induced consistent, time-dependent transcriptional responses in healthy intestinal mucosa. This extensive exploration of the human response to L. plantarum WCFS1 could eventually provide molecular support for specific or probiotic activity of this strain or species, and exemplifies the strength of the applied technology to identify the potential bio-activity of microbes in the human intestine.Overall, this study showed that intestinal exposure to Many lactic acid bacteria (LAB) have a long history of use in the preservation of food ingredients . In addiLactobacillus plantarum on symptoms in patients suffering from irritable bowel syndrome (IBS) [L. rhamnosus GG on transcriptional responses of small intestinal mucosa in oesophagitis patients [The study of interactions between the human host and microbes that confer a health promoting effect is mostly limited to an evaluation of the effects of the microbes on gastrointestinal or systemic symptom scores. Several studies described beneficial effects of dietary supplementation with various LAB, including specific strains of the species me (IBS) , in inflme (IBS) , and on me (IBS) . Detailepatients , deliverL. plantarum WCFS1, a single colony isolate from NCIMB8826 . This strain was originally isolated from human saliva and is used as a model microbe in the study of host-microbe interactions, due to its established taxonomy, its ability to survive gastrointestinal (GI) transit [L. plantarum WCFS1 [The present study aimed to identify the response of healthy intestinal mucosa upon exposure to transit . The avaum WCFS1 has stroin vivo intestinal perfusion technique [L. plantarum WCFS1 in healthy subjects. These studies focused on the proximal small intestine, because in healthy people, only small amounts of microbes reside in this intestinal region, whereas it encounters and perceives large amounts of food-derived microbes. The fact that only small amounts of microbes reside in that specific niche enables to determine effects of the L. plantarum WCFS1 exposures without interference of other mucosa-microbe interactions, as would be the case in the distal small intestine or the colon, which harbour a large microbial community. This manuscript describes, for the first time in healthy subjects, the responses of the intestinal mucosa to intraluminal microbes. Biological interpretation of the gene expression analysis revealed that especially genes associated with lipid metabolism, cellular proliferation, cell death and survival and immune responses were modulated. The impact of the microbes on transcription of genes involved in these processes is presented and discussed in detail.In the present study, we applied a recently developed echnique to assesL. plantarum cells and their secreted products and that of cells from non-interacting, neighboring epithelial cells in the lamina propria, which are not directly exposed to luminal contents, and other cell types such as immune cells.The mucosal responses analyzed and presented here represent the acute response of epithelial cells interacting with L. plantarum WCFS1 intervention, whereas a fold change of 1.33 means that the expression of that gene increased by 33% due to the L. plantarum WCFS1 exposure.We observed significant changes in 669 gene reporters; 225 genes upregulated and 444 gene reporters downregulated . One of these spots was identified as microsomal triglyceride transfer protein (MTP), while the analysis failed to allow identification of the second spot. The microarray results showed that the expression of the gene encoding MTP (probeset 205675_at on the Affymetrix U113A microarray and indicated by UniGene reference Hs.195799) was increased by 19.3%, as a result of the exposure to L. plantarum. Paradoxically, the same gene appeared to be down-regulated by 36.8% in the 1 h L. plantarum intervention study, but this difference did not reach statistical significance. The tissue samples from study 1 were not subjected to proteome analyses.The proteome analyses of the tissue samples obtained in study 2 showed that two proteins differed consistently in all volunteers in response to the 6-h exposure to Fifty-four genes were regulated in both the 1 h and 6 h perfusion microarray datasets. Of these genes, 4 were differentially expressed in the same direction in both studies (3 were upregulated and 1 downregulated), 2 were upregulated and downregulated, and 48 were downregulated and upregulated in study 1 and 2, respectively. Below, the findings of the two studies are compared in detail using the Ingenuity Pathways Analysis (IPA) software tool (see Availability and requirements section for URL). The statistical assessments of significance of representation of the metabolic and signaling pathways that are part of the IPA output are based on a right-tailed Fisher's Exact Test. This test calculates the probability that genes participate in a given pathway, relative to their occurrence in all other pathway annotations covered by Ingenuity.L. plantarum, three genes involved in lipid and fatty acid metabolism were downregulated CD36, six acyl-CoA genes and isocitrate dehydrogenase-1 (IDH1), which is one of the more "central" hub proteins were all upregulated. However, important central regulatory proteins such as the obesity gene leptin or PPAR-γ were not differentially expressed after 6 h exposure , FOS (c-Fos), JUN (c-Jun) and the p65 subunit of the NF-κB transcription complex, RELA. From these responses, it appears that downregulation of genes modulating cellular metabolism and proliferation is the central mucosal response to the first perception of L. plantarum. None of these regulators were differentially expressed after the 6 h exposure.After 1 h exposure to TNFRS1A, which is a major receptor for TNF-α and a mediator of apoptosis and regulator of inflammation, and TNFRSF4 were downregulated after 1 h infusion of L. plantarum, whereas the TNF receptor TNFRSF25 (DR3) was upregulated after the 1-h exposure to L. plantarum WCFS1. Expression of the TNF-related proteins TNFAIP1 (B12), which is a membrane-located ion channel and a direct target of TNF-induced signaling, transforming growth factor alpha (TGF-α), and the TNFR inducer interleukin 1-β were downregulated as well after 1 h of exposure to L. plantarum WCFS1.Several genes encoding proteins which are involved in regulation and modulation of cell death were regulated in both studies. The tumor necrosis factor receptors (TNFRs) IKBKG (IKK-κ or NEMO), was upregulated. IKK phosphorylates IκB, thereby targeting IκB for proteolytic degradation and indirectly enabling nuclear translocation of NFκB. TNF receptor-associated factor 4 (TRAF4), which negatively regulates NF-κB activation upstream from IKK, was also upregulated after 1 h exposure.Under cellular immune-response stimulating conditions, translocation of the transcription factor NFκB to the nucleus promotes the expression of predominantly proinflammatory cytokines. The p65 (RelA) component of NF-κB was downregulated after 1 h exposure. Expression of one of the upstream regulators of NF-κB function, FASTK, was downregulated after 1 h exposure to L. plantarum.In line with the overall down- or nonregulation of death-mediating pathways, one of the non-TNF proteins which belong to the group of direct inducers of cell death by extracellular signals, the Fas-activated serine/threonine kinase TPT1 (or histamine releasing factor), cytokine induced apoptosis inhibitor 1 (cIAP-1), mitochondrial PUMA (BBC3), cathepsin B (CTSB), ATP6V0A1, cathepsin L and LAMP2, all of which are associated with cell-death related responses, were differentially expressed after the 1 h exposure to L. plantarum WCFS1. We found that those genes involved in regulation of cell death during acute responses were not regulated or expressed after 6 h exposure and that no other death-regulating genes were expressed as well. Of the TNFR family, only TTRAP, the TRAF and TNF receptor-associated protein, was upregulated after 6 h exposure to L. plantarum.The genes L. plantarum, interleukin-1 (IL-1), IL-1 receptors IL-1R and IL-1-like receptor IL1RL1 (ST2) were downregulated. The pro-inflammatory cytokine receptor IL8R1 was downregulated as well. No regulation of these genes was found after 6 h exposure.After 1 h exposure to L. plantarum WCFS1. In line with upregulation of C1S, downregulation of one of its inhibitors, SERPINE2, was observed.Several genes activating innate immune responses were upregulated after 1 h exposure Table . Among tThe C8G gene which encodes the γ polypeptide of complement component 8 was downregulated in the 1 h exposure study. C8G is part of the antibacterial Membrane Attack Complex (MAC), a cytolytic protein complex involved in damaging bacterial cell membranes. Also CD93 (C1QR1), a cell-surface glycoprotein and part of complement component 1, was downregulated. In contrast to 1 h exposure, none of these genes were regulated after 6 h exposure.de novo produced MHC class I molecules and the transporter associated with antigen processing (TAP), was upregulated. Only one of the MHC transmembrane (TM) receptors, HLA-DRA was regulated after 1 h exposure. The (downregulated) gene product is expressed in antigen-presenting cells (APCs) and is involved in immune response, exogenous antigen presentation and processing.Parts of the MHC class I pathway were found to be regulated after the 1 h exposure. The activating proteasome α and β subunits (PSME1/2) were among the few upregulated genes. The chaperone HSP70 which plays a role during processing of cytosolic antigens before uptake into the ER, was downregulated. Although no regulation of the TAP1 or TAP2 transporters was found, the TAP-binding protein (TAPBP) which mediates the interaction between L. plantarum WCFS1, the intestinal mucosa showed a different immune response-related expression profile. Several HLA-type TM receptors belonging to MHC class I and class II were upregulated . The observed up- or downregulation of eight out of ten genes was confirmed. The Q-PCR analysis of two genes, GUCA2A and PCNA, did not confirm the microarray data. In addition, QPCR analysis of the gene representing MTP confirmed the microarray results.in vivo studies aiming to elucidate the interaction between microbes and the intestine are hampered by medical and ethical limitations. Previously, mainly animal models have been employed to investigate mucosal responses to microbes. In germ-free mice, colonization with commensal bacteria induced genes involved in nutrient absorption, mucosal barrier fortification, xenobiotic metabolism, angiogenesis and postnatal intestinal maturation [in vivo situation, in which a complex community of different microbes is present. Data on the impact of commensal microbes on the transcriptome of human gut mucosa in vivo is restricted to studies describing the effects of supplementation of L. GG [Bacillus clausii [L. plantarum WCFS1 on gene transcription and pathway regulation was investigated in a human in vivo model in healthy volunteers that enabled to administer the microbes directly into the small intestine and sample intestinal tissue for transcriptional profiling. To the best of our knowledge this is the first example of a study that employs post-genomic technologies to unravel specific host-microbe interactions in healthy human subjects. In two subsequent intervention studies, effects of 1- and 6-h continuous injection of L. plantarum WCFS1 were investigated. An exposure time of 1-h was chosen as the 'short term' exposure time, whereas an exposure time of 6 h was considered as a prolonged exposure. Previous studies in our lab showed that after a 6-h period, problems may arise due to the long fasting period, during which subjects remain at rest and, hence, this was considered as the maximal time frame for the chosen experimental set-up.Human turation , and innturation . These sof L. GG and of B clausii on intesL. plantarum. Exposure of proximal small intestinal mucosa for 1 h to L. plantarum provoked a transcriptional response, which at least in part appeared to be modified in the prolonged (6 h) exposure. The temporal changes in gene transcription during the first hours of intraluminal injection of L. plantarum as described in this manuscript provides an in-depth overview of the cellular host response to intraluminal non-pathogenic microbes. The observed counter-regulatory responses are important for the maintenance of normal gut homeostasis. This was confirmed by the observations of the proteomics assay in the prolonged exposure study, in which only two proteins were consistently found to be differentially present after the L. plantarum exposure compared to placebo. In the acute exposure study, no attempts were undertaken to investigate differences in protein profiles, because the exposure period of 1 h was expected to be too short to provoke substantial differences at the protein level.The two studies presented here showed regulation of several hundreds of genes in small intestinal mucosa induced by intraluminal ingestion of L. plantarum, the transcriptional profile of lipid and fatty acid uptake and metabolism was also affected, reflecting an increase of fatty acid and lipid metabolism.Lipid and fatty acid uptake and metabolism participate in a diversity of cellular functions including membrane biogenesis, general metabolism and signaling. With increasing mucosal exposure time to L. plantarum in comparison to placebo-treated mucosa. In contrast, after the prolonged exposure of 6 h, three transcription regulators involved in lipid/fatty acid metabolism and protection from oxidative stress as a result of this metabolism were upregulated in comparison to the placebo treatment were downregulated, suggesting that the mucosal cells did not actively take up or metabolize additional fatty acids and lipids during the interaction with L. plantarum. The fatty acid binding protein FABP1 was upregulated in the 6-h exposure study, as was the microsomal and ER-localized triglyceride transfer protein, MTP, which is discussed in more detail below. Hence, it is clear that the prolonged exposure to L. plantarum induced upregulation of genes involved in fatty acid uptake. Several genes participating in mitochondrial and peroxisomal fatty acid metabolism (e.g. acyl-CoA genes) or membrane sphingolipid metabolism (ASAH1) were upregulated as well was modulated on the transcriptional and on the protein level during the interaction with tissues . Recentl tissues ,18, whic tissues , but theL. plantarum cells. The initial down-regulation of the cellular cycle may be the result of a shift in cellular activity towards microbial perception, cell defense and immune responses. Indeed, both during acute (1 h exposure) and later responses, modulation of immune response pathways and cellular death, survival and proliferation was observed.The down-regulation of major transcription factors stimulating cell proliferation observed in the acute exposure study suggests that cell proliferation is suppressed after the first perception of L. plantarum, appeared to be further enhanced by an upregulation of the proliferation-inhibiting gene product IFITM3. Generally, proliferation rates are primarily determined by two main and interacting pathways, i.e., the NFκB and the mitogen-activated protein (MAP) kinase pathways. After 6 h exposure, the MAP kinase ERK1 (MAPK3) was upregulated. In the cellular context, ERK1 may have acted as an inhibitor of cellular over-proliferation by downregulating important oncogene regulators such as c-Fos and by antagonistic effects on ERK2 function, a related MAPK, that mediates proliferative signals [Transforming growth factor-β (TGF-β) is an important regulator of cell proliferation . Althoug signals .L. plantarum, only down-regulation of the p65 subunit of NFκB was found, while no component of NFκB was differentially expressed after 6 h exposure. The exact role of NFκB in cell proliferation is not clear, but it was shown that NFκB is required for cell proliferation by mediating the expression of c-Myc [NFκB is one of the key regulators of both cell proliferation and apoptosis . Remarkaof c-Myc , which sof c-Myc .NFκB plays an important role in the regulation of apoptosis. It suppresses apoptosis by inducing the expression of several anti-apoptotic proteins and by modulating the expression or activity of pro-apoptotic proteins . ParadoxCell death induction during interactions with microbes occurs primarily through TLR signaling and expression of death-inducing cytokines, such as tumor necrosis factor (TNF) or Fas ligand (FasL) with concomitant increased expression of the appropriate death-signaling receptors. One receptor of the TNF family, TNFRSF25, was upregulated during acute response (1 h exposure). TNFRSF25, also called death receptor 3 (DR3), induces NFκB activation and thereby mediates the activation of apoptosis .L. plantarum but rather, to switch to a more proliferative phase with an overall expression profile characterized by upregulation of genes involved in cellular growth, proliferation and development. Notwithstanding this shift to cellular proliferation, monitoring of bacterial presence was still evident, as can be deduced from the upregulated expression of antimicrobial α-defensins and the major histocompatibility complex (MHC) antigen processing and presentation pathway.Although several genes associated with cell death were found to be differentially expressed, none of these are known to stimulate or execute cell death. Importantly, with progressing duration of exposure to the microbes, cells did not appear to maintain the cellular "gestation" phase with downregulated metabolism that characterized the acute 1-h response to L. plantarum, genes encoding major complement component 1 proteins were upregulated, representing a group of proteins that mediate the "classical pathway" of the complement immune response. In contrast, the C8G gene, which encodes the γ polypeptide of complement component 8 was downregulated. This gene is part of the antibacterial Membrane Attack Complex (MAC), a cytolytic protein complex involved in damaging bacterial cell membranes. The observation that this antibacterial protein was down-regulated might imply that the immune system in the intestinal mucosa can perceive L. plantarum within 1 h and recognize these as commensal and non-pathogenic bacteria.Important MHC and other innate immune system-related receptors and effectors were differentially expressed after 1 and 6 h exposure, respectively. After the 1 h exposure to L. plantarum induced MHC antigen processing and presentation pathways indicating that mucosal epithelia actively performed a bacterial monitoring and identification process. CD74, one of the major receptors, which can be bound by bacteria, was one of the upregulated genes. This receptor is involved in antigen presentation and immune responses [Prolonged infusion of esponses , but doeSeveral MHC-I and MHC-II transmembrane receptors were upregulated after the 6 h exposure. After prolonged exposure to lactic acid bacteria, CD74 and HLA-DMA and -B were upregulated. These receptors participate in the MHCII pathway of antigen endocytosis, processing and presentation ,32. The L. plantarum is in agreement with cellular proliferation. However, it should be noted that after 6 h perfusion, the Paneth-cell-specific defensin α5 was upregulated, which indicates that the luminal microbes were perceived and their numbers controlled by immune responses from the crypt regions of the intestinal mucosa.Summarizing, complement 1 was induced during acute responses and MHC antigen processing and presentation pathways were being expressed after 6 h exposure, which suggests the activation of bacterial monitoring and identification process. Based on the microarray data, no inflammatory immune responses were executed. Rather, the expression profile after 6 h of exposure to The Q-PCR analyses were in agreement with the microarray data. The gene expression results of eight out of ten genes were confirmed, which is in line with the consensus that the Affymetrix microarray platform provides a reliable platform to measure gene expression . The obsL. plantarum, describing time-dependent changes in transcriptional responses after 1 and 6 h of bacterial exposure to L. plantarum. The observed changes were modest, as genes were affected by maximally 78%. This is in concordance with the impact of an intervention study by our group in humans, in which also only modest impacts on fold changes, up to doubling of the gene transcripts, was observed [L. rhamnosus GG and of Bacillus clausii on transcriptional responses of small intestinal mucosa in humans [B. clausii, L. rhamnosus GG and L. plantarum WCFS1). In addition, our study revealed that L. plantarum WCFS1 mediates fatty acid uptake- and metabolism, contributing not only to lipid metabolism but also to immune response modulation as discussed above. It should be noted that, although the authors of the 30-d supplementation studies state that effects of probiotics on healthy duodenum were investigated, the use of medication (proton pump inhibitors) as well as the small sample size (n = 3 in each group) hamper the generalization of their results and, hence, comparison with the results of the present study may not be justified. We would like to emphasize that the effects on gene transcription, observed in the present study, may not be specific for L. plantarum WCFS1. As indicated above, some biological effects were also induced by other microbes. Future studies should reveal whether L. plantarum WCFS1 induces specific and unique responses in the gastrointestinal tract.The present manuscript provides an in-depth overview of the initial transcriptional response of healthy intestinal mucosa upon its interaction with live bacterial cells of observed . The bion humans . Immune L. plantarum WCFS1 induced time-dependent transcriptional changes in intestinal mucosa in healthy subjects. Among a variety of biological processes, especially lipid metabolism, cellular proliferation, cell death and survival and immune responses were modulated. The gene expression profiles suggest that cell death and pro-inflammatory responses were triggered, but not executed. This extensive exploration of the human response to L. plantarum WCFS1 may eventually provide molecular support for specific or probiotic activity of this strain and/or species, and exemplifies the strength of the applied technology for the identification of the potential bio-activity of microbes in the human intestine.In conclusion, the present study showed that nd WMA General Assembly, Edinburgh, Scotland, Oct 2000). All subjects gave their written informed consent prior to their inclusion into the study.This study encompassed two human intervention studies, which are described below under 'study 1' and 'study 2', respectively. Both studies were approved by the University Hospital Maastricht Ethical Committee, and conducted in full accordance with the principles of the 'Declaration of Helsinki' without a history of GI symptoms and free of any medication, were investigated on two separate occasions in a randomized placebo-controlled crossover study.11 L. plantarum WCFS1 was infused for one hour. Fluids were maintained at 37°C using a shaking water bath. Subjects remained in the supine position until the end of the experiment, and food or beverage consumption was not allowed during the experiment. After the perfusion experiment, the perfusion catheter was removed by gently pulling out the catheter. A second gastroduodenoscopy was performed exactly 15 minutes after the perfusion experiment to obtain tissue samples from the same intestinal region as earlier that day. The entire protocol was repeated on another day, 13 to 16 days after the first experiment, to randomly investigate the effects of placebo or L. plantarum WCFS1. In all tissue samples, gene expression levels were measured using genome-wide microarrays . No samples were taken for proteome analysis purposes, because changes at the protein level were not expected to occur within the 1-h exposure time to L. plantarum WCFS1.After an overnight fast, mucosal tissue samples were obtained from the horizontal part of the duodenum, approximately 15 cm distal to the pylorus, by standard flexible gastroduodenoscopy and a perfusion catheter was placed orogastrically in the proximal small intestine, as described previously . BrieflySeven healthy non-smoking volunteers (28 ± 6 y), without a history of gastrointestinal complaints and free of any medication, participated in a randomized placebo-controlled crossover study.® Bengmark, Nutricia Healthcare S.A., Chatel-St. Denis, Switzerland) was placed nasogastrically following the manufacturers instructions. No sedatives were given to the volunteers. After positioning of the catheter in the small intestine , a physiological saline solution containing 10 g/L glucose and a total of 1012 L. plantarum WCFS1 or, randomly on another test day, only physiological saline solution containing 10 g/L glucose, was injected continuously at 6.7 ml/min for 6 h. The concentration of bacteria present in the fluid was the same in both studies, which was important in order to allow proper comparisons between the different studies. The infusion rate was less than that in study 1, to avoid injecting too large amounts of fluid and bacteria, which could have induced gastrointestinal symptoms. Fluids were maintained at 37°C using a shaking water bath. Subjects remained in the supine position until the end of the experiment, and food or beverage consumption was not allowed during the experiment. After this 6-h period, tissue samples were obtained from the horizontal part of the duodenum, approximately 15 cm distal to the pylorus, by standard flexible gastroduodenoscopy, at approximately 15 cm distal to the pylorus. In all tissue samples, gene expression levels were measured using genome-wide microarrays . In duplicate tissue samples, differential proteome analyses were performed using the CyDIGE method with Maldi-TOF MS (see below).After an overnight fast, an intraduodenal feeding catheter according to the manufacturer's instructions. Hence, for study 1, 32 RNA samples were hybridized and for study 2, 14 RNA samples were hybridized onto the chips. Briefly, 1 mL TRIzol and 10 μL β-mercaptoethanol were added to each frozen tissue sample and shaken with a minibeadbeater for 30 seconds. 200 μL Chloroform was added and the samples were incubated for 3 minutes, followed by phase separation using centrifugation at 21000 g for 15 minutes. The upper aqueous phase was taken and 500 μL 70% Ethanol was added. Subsequently, the extracted RNA was purified using the RNeasy Mini Kit with extra DNA digestion by on-column RNase-Free DNase treatment . RNA purity was determined using nanodrop equipment . Only RNA samples with a 260/280 ratio between 1.9 and 2.1 were considered for further analysis. RNA integrity was determined using Bioanalyzer technology . RNA samples with RNA integrity numbers (RIN) above 8.0 were considered for further analysis.Total RNA was hybridized onto GeneChip microarrays according to the manufacturers' instructions. For this analysis, five micrograms of total RNA from each sample, and the one-cycle labeling system were applied as recommended by the manufacturer . Microarrays were scanned using a GeneChip Instrument System . The microarray data calculations to obtain detailed information on differentially expressed genes are described in the supplementary material reached an arbitrary Z-score of at least 3 on that MAPP for study 1 and at least 5 for study 2, and at least 3 genes were differentially expressed in that pathway. Different Z-score cut-off points were used for the two studies because effects in study 2 were more pronounced and revealed regulation of more biological pathways, thus allowing the use of a more stringent statistical cut-off in the pathway analysis.MappFinder software was used to select the MAPPs with relatively high numbers of differentially expressed genes, which were affected by Further refinement and biological interpretation of reconstructed pathways was performed by comparison with published information and pathways available from NCBI Entrez Gene info (see Availability and requirements section for URL), the Protein, Signaling, Transcriptional Interactions & Inflammation Networks Gateway database pSTIING, (see Availability and requirements section for URL) and BioCarta charts (see Availability and requirements section for URL). Based on the combined information from IPA and pSTIING and published data, a graphical representation of the microarray results in terms of their encoded and interacting proteins and pathways was reconstructed using the image ("toolbox") palette provided by Biocarta.Q-PCR First Strand cDNA was synthesized using the iScript cDNA Synthesis kit according to the manufacturer's instructions. 250 and 500 ng total RNA was used as template for the cDNA reaction of Study 1 en Study 2 respectively. The difference in starting quantities was the consequence of the smaller amount of RNA available for study 1, which was due to a smaller size of the tissue samples obtained in this study. The cDNA was diluted with RNase free H2O to a concentration of 5 and 10 ng/μl respectively. IQ Sybr Green Supermix was used for the Q-PCR. Each Q-PCR reaction of the Q-PCR contained 12,5 μl iQ Sybr Green Supermix, 1 μl of 10 μM gene-specific forward and reverse primers, 2 μl cDNA template solution and 8,5 μl sterile water. The following primers were used. Housekeeping genes were 18SrRNA: gtaacccgttgaaccccatt, ccatccaatcggtagtagcg; GAPDH: tgcaccaccaactgcttagc, ggcatggactgtggtcatgag and Calnexin: ccactgctcctccttcatctcc, cggtatcgtctttcttggctttgg. Genes study 1; GUCA2A: gggttgggaaactcaggaactttg, tacaggcagcgtaggcacag; PCNA: gccactccactctcttcaacgg, tggtgacagaaaagacttcagtatatgc; CD36: ggaatctgtcctattgggaaagtcactgc, ctgggttttcaactggagaggcaaagg; FOS: ctgtgtctcttttctctttctccttagtc, tccagcaccaggttaattccaataatg; DUSP1: agcagaggcgaagcatcatc, acggtggtggtggaggtg. Genes study 2; PLA2G2A: gcagaagtcaactgtgtgagtgtg, gggagggagggtatgagagagg; DEFA6: ggctcaacaagggctttcac, gtatgggacacacgacagtttc; CDS1: tggattcattgctgcctatgtgttatc, ctttagaaagggtggaagtgagtaagtc; REG3A: gctgtcccaaaggctccaagg, atcacatcactgctactccactcc; CD24: gtatttgggaagtgaagactggaagc, agtgttctaaatgtggctattctgatcc. Gene study 1 and 2; MTP: ggacctagcacagaggaatcag, ccaaatccaccagtttcttgaagc. Reactions were run on the My IQ Single Color Real Time PCR Detection System . The cycling conditions comprised 3 minutes at 95°C and 40 cycles at 95°C for 10 seconds and 60°C for 45 seconds followed by a melting program. The CT values were normalized using the IQ5 Optical System Software version 2.0 . Gene-transcripts were analyzed using a multivariate Gaussian linear regression, similar to the microarray analysis, with the difference of having the sample concentration, the test day, the perfusion procedure, repeats, and the best housekeeping gene among 18S ribosomal RNA, GAPDH and calnexin included. Detailes of the Q-PCR calculations are provided in Additional file L. plantarum intervention were loaded on one IPG-strip, together with a pooled internal standard. After the 2D-electrophoresis, the gels were scanned with a Typhoon confocal laser scanner , and the scanned images were loaded into DeCyder software to analyse the differences in protein profiles. Differentially expressed protein spots were picked with the Ettan Spot picker . Excised spots were subjected to mass-fingerprint identification using Maldi-TOF MS analysis as described elsewhere [Intestinal biopsies were prepared for protein analysis by sonication in a lysis buffer, and subjected to the 2-D Clean Up kit to remove non-protein material. Protein concentrations were measured using the 2-D Quant Kit . The samples were further processed for two-dimensional fluorescence difference gel electrophoresis with the Ettan™ DIGE technique, following the manufacturers instructions . Proteinlsewhere . under the experiment accession number E-MEXP-1328.Microarray data are available in the ArrayExpress database IPA: NCBI Entrez Gene info: pSTIING: BioCarta charts: FT conceived of the study, prepared and carried out the human experiments, and drafted the manuscript. PVB performed the bioinformatical- and pathway analyses, and contributed to the draft manuscript. PL was involved in the design of the study and performed the statistical analyses. AK carried out the RNA isolations and the Q-PCR analyses. WDV participated in the design of te study, and helped to draft the manuscript. MK conceived of the study, participated in its design and coordination and helped to draft the manuscript. RJB conceived of the study, participated in its design and coordination, performed the gastroduodenoscopy procedures, and helped to draft the manuscript. All authors read and approved the final manuscript.Genes study 1. Genes regulated by a 1-h exposure time to L. plantarum WCFS1. 669 Gene reporters were differentially expressed by the intervention; 225 genes were upregulated and 444 gene reporters were downregulated by L. plantarum WCFS1.Click here for fileGenes study 2. Genes regulated by a 6-h exposure time to L. plantarum WCFS1. 424 Gene reporters were differentially expressed by the intervention; 383 genes were upregulated and 41 gene reporters were downregulated by L. plantarum WCFS1.Click here for fileMicroarray and QPCR data calculations. Detailed description of the calculations of the microarray data and the quantitative RT-PCR analysis.Click here for file

It seems not so long ago that we were gathered in Cochin, attending the exceptional scientific sessions, meeting old friends (adding new ones), and celebrating the success of our incredible Federation of Operative Dentistry of India. Our past presidents highly acclaimed performance will always be remembered.All the federation’s existing initiatives and developments are a product of the hard work and dedication of our ever smiling secretary Dr. Lakshmi Narayanan L, under the able guidance of the DCI president, our own, Padma Bhushan Dr. Anil Kohli. Without a doubt the success we experienced in the past year would not have been possible unless we had his guidance and help. The highlights of this year’s achievements include two major factors, besides many more.The release of Grossman’s Endodontic Practice – Twelfth International Edition, which has been edited by two Indian authors, which makes this a remarkable achievement for Indian Endodontics, This classic textbook is co-edited by Dr. B. Suresh Chandra, a senior member of our Federation and Dr. V. Gopikrishna, the youth icon of Endodontics, who holds promise for a bright future for Endodontics in our country. We all join together in wishing Dr. B. Suresh Chandra a speedy recovery from his recent illness, with a hope that he will continue to spread the light of knowledge in the years to come.The other commendable achievement has been the indexing of our National Journal of Conservative Dentistry with Pubmed, due to the untiring efforts of our dynamic Editor-in-chief — Dr. V. Gopikrishna and his editorial team. I take this opportunity to congratulate him on behalf of our federation. This ensures that the scientific output of our federation reaches a global audience.Continuing And Never Ending Improvement.For my young friends in the Federation and profession, I can only say, be confident, have a positive attitude, dream big, and visualize success. In today’s technologically enhanced and highly competitive world, it is imperative not only to stay current, but also to stay ahead. If you are doing today what you did yesterday, then you are a day behind, therefore, we all have to be involved in the process of continuing education or perhaps we can call it ‘CANI’, that is, My best wishes to you all and I wish that everything you do far exceeds your expectations, always.

This pattern is established and maintained by a regulatory network between several transcription and secreted factors that is not yet understood in full detail. In this contribution we show that a Boolean analysis of the characteristic spatial gene expression patterns at the murine MHB reveals key regulatory interactions in this network. Our analysis employs techniques from computational logic for the minimization of Boolean functions. This approach allows us to predict also the interplay of the various regulatory interactions. In particular, we predict a maintaining, rather than inducing, effect of Fgf8 on Wnt1 expression, an issue that remained unclear from published data. Using mouse anterior neural plate/tube explant cultures, we provide experimental evidence that Fgf8 in fact only maintains but does not induce ectopic Wnt1 expression in these explants. In combination with previously validated interactions, this finding allows for the construction of a regulatory network between key transcription and secreted factors at the MHB. Analyses of Boolean, differential equation and reaction-diffusion models of this network confirm that it is indeed able to explain the stable maintenance of the MHB as well as time-courses of expression patterns both under wild-type and various knock-out conditions. In conclusion, we demonstrate that similar to temporal also spatial expression patterns can be used to gain information about the structure of regulatory networks. We show, in particular, that the spatial gene expression patterns around the MHB help us to understand the maintenance of this boundary on a systems level.The isthmic organizer mediating differentiation of mid- and hindbrain during vertebrate development is characterized by a well-defined pattern of locally restricted gene expression domains around the Wnt1 depends on Fgf8 for stable maintenance. A time-course analysis of Wnt1 expression after implantation of Fgf8-coated beads in mouse neural plate/tube explants experimentally validates our prediction about the interactions between these two key patterning molecules. Subsequently, we demonstrate that available data allows construction of a mathematical model able to explain the maintenance of the signaling center at the MHB. We begin to understand this small aspect of brain formation on a systems level.Understanding brain formation during development is a tantalizing challenge. It is also essential for the fight against neurodegenerative diseases. In vertebrates, the central nervous system arises from a structure called the neural plate. This tissue is divided into four regions, which continue to develop into forebrain, midbrain, hindbrain and spinal cord. Interactions between locally expressed genes and signaling molecules are responsible for this patterning. Two key signaling molecules in this process are Fgf8 and Wnt1 proteins. They are secreted from a signaling center located at the boundary between prospective mid- and hindbrain and mediate development of these two brain regions. Here, we logically analyze the spatial gene expression patterns at the MHB and predict interactions involved in the differentiation of mid- and hindbrain. In particular, our analysis indicates that During vertebrate development, the central nervous system arises from a precursor tissue called neural plate. Shortly after gastrulation this neural plate is patterned along the anterior-posterior axis into four regions, which continue to develop into forebrain, midbrain, hindbrain and spinal cord. This patterning is determined by a well-defined and locally restricted expression of genes, and by the action of short and long range signaling centers, also called secondary organizers Otx2, Gbx2, Fgf8, Wnt1, the Engrailed genes En1 and En2, which we subsume under the identifier En, as well as the Pax genes Pax2 and Pax5, which we subsume under the identifier Pax. A justification of this selection as well as of the simplifications with respect to En and Pax is given in the in situ hybridization experiments, for a review see e.g. The IsO is characterized by the localized expression of several transcription and secreted factors. In this contribution, we focus on the following eight IsO genes: Otx2 and Gbx2 in the anterior and posterior neuroectoderm, respectively, defines the position of the prospective fore- and midbrain (Otx2+/Gbx2−) and hindbrain/spinal cord (Otx2−/Gbx2+), respectively Wnt1 at the rostral border of the MHB in the caudal midbrain, and of Fgf8 at the caudal border of the MHB in the rostral hindbrain is initiated independently of a requirement of Otx2 and Gbx2 for this process Engrailed genes En1 and En2 are both expressed across the boundary Wnt1 signaling pathway in the midbrain Fgf8Engrailed, Pax5 is also expressed across the boundary Pax2 is restricted to the caudal part of the isthmic organizer Pax2 -deficient embryos Pax2 for the induction of Fgf8. In short, it has been demonstrated that by E10.5 these genes have become interdependent and form the core module of a regulatory network that guarantees the stable maintenance of their specific expression patterns The initial expression of Although a great deal of experimental effort has been made, this regulatory network is not yet understood in full detail. For this reason, we now approach this problem on the systems level. In Systems Biology experimentalists and theoreticians make a concerted effort to unravel the functionality of complex biological systems in a holistic fashion. We closely follow the Systems Biology research cycle as proposed in Boolean modelsspecies, can assume only two discrete states, referred to as In a first step, we describe a methodology for the inference of regulatory interactions by systematic logical analyses of spatial gene expression patterns. As our information about gene expression at the MHB is of purely qualitative nature we base our analysis on Wnt1 by Fgf8 in gain-of-function (GOF) assays performed in vitro and in vivoFgf8 expression in the anterior neural plate initiates several hours after Wnt1, and as Wnt1 is expressed in a very broad domain at the time most experimental manipulations took place Wnt1 expression by Fgf8 might have been mis-interpreted as an ectopic activation. Our analysis indeed predicts that Fgf8 and Wnt1 signaling are dependent on each other for stable maintenance, but Fgf8 is not sufficient to ectopically induce Wnt1 expression. We validate this prediction experimentally by performing a time-course analysis of Wnt1 expression after Fgf8 -bead implantation into mouse anterior neural plate/tube explants. Thus, our analysis clarifies epistatic relationships at the MHB, especially between the two key patterning molecules Fgf8 and Wnt1.Applied to the wild-type gene expression pattern at the MHB our method predicts several genetic interactions, which well agree with published data. In this context, an unclarified experimental issue is the reported ectopic induction of In a subsequent step, the results of our previous analysis combined with published data allow construction of spatial models that are able to explain the stable maintenance of the characteristic gene expression patterns at the MHB. These patterns are the result of a refinement and sharpening of initially blurred expression domains. Our models are competent to simulate this process. Moreover, we are able to reproduce the phenotypes of various loss-of-function (LOF) experiments even in a correct spatio-temporal order. We conclude with a robustness analysis of our models.Otx2+/Gbx2−) and IV–VI to the prospective hindbrain (Otx2−/Gbx2+). The boundary compartments III and IV are characterized by the expression of Wnt1 and Fgf8, respectively. We assumed that the secreted Wnt1 and Fgf8 proteins are still present in compartments II and V due to passive or active diffusion We subdivided the expression patterns of the IsO genes at E10.5 into six compartments I–VI, cf. the dashed lines in Otx2 is expressed.Only Otx2, En and Pax are expressed. Secreted Wnt1 protein is present.Otx2, En, Pax and Wnt1 are expressed. Secreted Wnt1 and Fgf8 proteins are present.Gbx2, En, Pax and Fgf8 are expressed. Secreted Wnt1 and Fgf8 proteins are present.Gbx2, En, and Pax are expressed. Secreted Fgf8 protein is present.Gbx2 is expressed.Only The crucial point is that this expression pattern is stably maintained by a regulatory network. In the next section we demonstrate that key genetic interactions of this network can be obtained already by analyzing only this spatial information.IDGenes database (http://www.helmholtz-muenchen.de/idgenes). Here we compiled detailed information about gene expression domains at the MHB in anterior–posterior, dorso–ventral and medio–lateral directions. This information is complemented by already published interactions between the IsO genes. Using a web interface it is possible to visualize regional distinctions in the expression of genes within the embryonic mouse neural tube in a three dimensional manner and epistatic relationships between these genes in GOF and LOF mutant mice. The task of elucidating gene regulation at the MHB therefore leads to the theoretical challenge of inferring as much information as possible about the structure of multi-cellular regulatory networks from their spatial expression patterns. To this end, we now describe a methodology for the inference of regulatory interactions by systematic logical analyses of spatial gene expression patterns.So far, information about genetic interactions at the MHB has been obtained mainly from the analyses of gene expression patterns genes Wnt1 see .In a second approach, we determined as simple a Boolean update function as possible for each species such that the expression pattern is still maintained. This analysis is based on the assumption that the thus obtained minimal network is the core module of the real network. However, we cannot be sure that all the interactions are indeed necessary. The following minimal functions could be derived using a technique called Karnaugh-Veitch maps see :(1)Fgf8 and Wnt1 two equally minimal expressions could be found, indicated by the bracketed factors, of which at least one has to be included. The corresponding networks are shown in In the case of Otx2 and Gbx2, these two transcription factors have antagonistic effects on Fgf8 and Wnt1 expression. This agrees well with experimental results showing that opposing interactions between Otx2 and Gbx2 are required for the positioning and refinement of the MHB En and Pax was predicted which is well supported by experimental results from Fgf8 and Wnt1, this analysis revealed that Fgf8 and Wnt1 require each other for their stable maintenance but are not sufficient to induce each other's expression, as the respective update rules contain at least one additional factor. The early loss of Fgf8 expression in Fgf8 expression Wnt1 expression.The minimal networks from Wnt1 expression in vivo, we performed a time-course analysis of Wnt1 expression after implantation of Fgf8 -coated beads into mouse anterior neural plate (E8.0–E8.5) or tube (E9.0–E9.5) explants and was confined to the dorsal midline of the midbrain and to the rostral border of the MHB in the control side of explants incubated for 18 and 24 h. Fgf8 -coated beads implanted within or close to the endogenous Wnt1 expression domain in the midbrain maintained Wnt1 expression within but not outside of this domain over 24 h . Notably, Fgf8 -coated beads placed outside the endogenous Wnt1 expression domain in the rostral hindbrain or forebrain (Otx2+/Gbx2− territory) did not induce ectopic Wnt1 transcription at any time-point analyzed, as predicted by our logical analysis. When these experiments were performed with E9.0–E9.5 anterior neural tube explants incubated for 24 h for Wnt1, which implies that Wnt1 expression requires Fgf8 for stable maintenance, but that Fgf8 is not sufficient to induce Wnt1 ectopically.To find out if Fgf8 only maintains or de novo induces ants see . In E8.0ants see , Wnt1 ex h as in model. The variables are now no longer coarse-grained into discrete states but assume continuous values. Continuous variables are necessary as we cannot assume that a gene is induced already to its full expression level. Rather the model should amplify a gene's expression at the right positions while downregulating it elsewhere.The ODE model is still based on the six compartments shown in in silico experiments on the three models that we derived from the network.We analyzed if the network constructed in the previous section indeed fulfills its three functions. To this end, we performed several A simple simulation of the multi-compartment Boolean model (not shown) confirmed that the regulatory network stably maintains the expression patterns from Otx2 and Gbx2 on the anterior as well as posterior side of the boundary and the levels of Fgf8, Wnt1, En and Pax, whose initial expression domains were all set to the four central compartments. This guarantees that the initial conditions were not biased towards the desired expression pattern of these genes. In all simulations a steady state was reached that can be assigned to one of the six classes Otx2 and Gbx2 is still established, expression of the other IsO genes, however, is lost. Finally, in Otx2 or Gbx2 is expressed along the whole neural tube. The distribution of the six steady states over the For different initial conditions, MHB see . In andOtx2 and Gbx2 are upstream of all other species and mutually inhibiting each other, cf. Otx2 and Gbx2 to be solely dependent on the initial conditions of these two species in a compartment. More precisely, we expected that in each compartment the initially dominating species will continue to be expressed and ultimately repress the other. In our simulations this expectation was met. First of all, we observed that in none of the steady states these two genes are coexpressed in any compartment. Moreover, from the pie charts in Otx2 – Gbx2 interface), Gbx2 – Otx2 interface), Otx2) and Gbx2) were each reached in about In our network Otx2 expression in the mid- and of Gbx2 expression in the hindbrain as well as sufficient (unpatterned) expression of Fgf8, Wnt1, En and Pax around the boundary, the model was able to establish and maintain the correct pattern of expression domains and of Gbx2 – Otx2 interface, yellow and cyan areas) were independent of the gene's initial expression levels. The difference between the sampling schemes is that with increasing randomness in the Otx2 – Gbx2 switch parameters the shares of Otx2 is expressed) and Gbx2 is expressed) got larger, cf. the red and blue areas. This was due to the increasingly biased behavior of the switch. Still, for We repeated the computational experiment from Fgf8, Wnt1, En and Pax expression domains and thus affect the model's steady state. However, they can be varied over a wide range without changing the qualitative behavior of the model the latter problem can be easily solved by inspection. For larger functions the Quine-McCluskey algorithm can be used instead, whose tabular form is less illustrative but easier to implement. However, also the Quine-McCluskey algorithm has a limited range of use, as it tries to solve a problem which has been shown to be NP-complete, cf. the Cook-Levine Theorem about the Boolean satisfiability problem Standard ways of finding minimal Boolean functions are either Karnaugh-Veitch maps En and Pax become centered around the MHB even when started from perturbed initial conditions. Obviously, this is not the case for the minimal network since here En and Pax are seperated from the other genes. Their steady state expression domains consequently depend only on their initial conditions and are independent of the other genes. In particular, their expression domains will not be centered around the MHB. Hence, the additional regulations included in We observe that the literature network from Remarkable about the structure of the networks from Otx2 and Gbx2 (interaction (1) in Otx2+/Gbx2− and an Otx2−/Gbx2+ territory. Opposing interactions (2) and (3) of Otx2 and Gbx2 restrict the expression of Fgf8 and Wnt1 to the Otx2−/Gbx2+ and Otx2+/Gbx2− territory, respectively. The mutual dependence between Fgf8 and Wnt1 (4) confines their expression domains to the rostral and caudal side of the MHB, respectively. In particular, if simulating e.g. the PDE model without the predicted maintaining influence of Fgf8 on Wnt1 (not shown), the expression of Wnt1 spreads up to the rostral end of the neural tube. Finally, a densely connected positive loop between Fgf8, Wnt1, En and Pax (5)–(8) ensures the stable maintenance of these genes' expression as well as their central alignment around the MHB.Summing up our analyses of the literature network, we can describe the role of its single interactions as follows: The mutual inhibition of In order to evaluate our IsO network we derived spatial dynamical models from it. Theoretical modeling has long been used to explain pattern formation in living organisms. The employed models range from coarse-grained multi-compartment Boolean Fgf8 and Wnt1 signaling. The setup of a mass-action based model of the whole IsO network was infeasible due to our lack of information about mechanistic details.In a first approach, we used a parameter-free Boolean model. Boolean models are generally applicable in a purely qualitative context and well able to deal with the exquisite, intricate mechanisms of gene regulation Fgf8 and Wnt1 signaling. These diffusion processes are typically modeled by expressions based on the so-called Heat equation. Together with terms for production and decay these expressions constitute reaction-diffusion PDEs. This type of equation is frequently used to model pattern formation in living organisms, see e.g. WNT signaling. The Heat equation actually describes the distribution of heat in a given region over time. It is based on Fourier's law which states that the local flow rate of heat energy is proportional to the negative temperature gradient. We argue that, in our example, the Heat equation describes the diffusion of secreted proteins at least in a crude qualitative sense: Diffusion is directed from regions with high concentrations to regions with low concentrations and the rate of diffusion positively correlates with the difference in concentrations. Therefore, we consider the PDE model suitable to qualitatively test statements about the refinement and sharpening of expression domains.In the PDE model, a critical point is the modeling of intercellular communication. In The transformation of a Boolean model into a continuous model entails the introduction of kinetic parameters. Especially in the context of pattern formation it has been shown that a network's function is carried out robustly against perturbations of these kinetic constants Our modeling pipeline — from Boolean over ODE to PDE models — exemplifies how more and more detailed models of regulatory networks can be built from qualitative information. The transformation methods that we used see ensure tFgf signaling inhibitors and a more refined picture of Engrailed and Pax expression patterns and interactions), other important genes for MHB establishment, IsO function and mid-/hindbrain development such as Lmx1bGrg4IDGenes database.Apart from the previously mentioned extensions of our models and integrated into IDGenes. Via the web interface an anatomical area and developmental stage can be set and the corresponding information about gene expression as well as genetic interactions can be retrieved from the IDGenes database (see IDGenes website.rg/) see . Gene exbase see . FurtherFgf8 and Wnt1 signaling. Since all cells in one of the six compartments I–VI from Fgf8 and Wnt1 signaling and show the same expression pattern we can subsume them into one compartment. Of course, these compartments do not have to be equally long, i.e. they can contain different numbers of cells. So, our neural plate/tube consists of six compartments Otx2, Gbx2, Fgf8, Wnt1, En and Pax is working. To specify this network we introduce a set of template variablesfgf and wnt . For Fgf8/Wnt1 is expressed in the compartment itself or in any adjacent compartment. Hence for these species we have the relationsOtx2, Gbx2, En and Pax have cell-autonomous roles, whereas Fgf8 and Wnt1 function non-cell-autonomously via diffusion of secreted protein.We think of the neural plate/tube as a chain of cells, which are able to communicate via Now given update functions Our goal is now to find update rules, such that model (3) has a steady state patternNow, each of our update functions true to false changes true to false , otherwise the interaction is called negative. We conduct an exhaustive search of the partially filled truth tables for necessary interactions. More precisely, we look for all pairs of (determined) entries with different outputs that differ in exactly one input. This way, we find that In a first step, we determine all non-trivial dependencies in the truth tables. Species Fgf8 and Wnt1 two equally minimal expressions can be found, the two possibilities are given in brackets.In a next step, we look for minimal Boolean expressions describing the partially filled truth tables. In our example, we find the minimal Boolean expressions given in (1) by using the Karnaugh-Veitch maps shown in Note that in our modeling environment any auto-regulation is excluded. We can now see why this restriction is necessary. Otherwise, the method outlined above would always yield the trivial minimal solution, where each species Explant cultures of anterior neural plates/tubes (open-book preparations) from wild-type (C57BL/6) mouse embryos were essentially prepared as reported by Explants were fixed in fresh En was modeled using OR gates. Stated in terms of the template variables these Boolean functions readFrom the network shown in NOT, AND and OR are then replaced by continuous expressions as shown in NOT is substituted for by a negative Hill function AND and OR gates are obtained by an interpolation technique. Using this transformation, we obtain, for instance,This model was subsequently transformed into an ODE model consisting of the now continuous variables http://www.mathworks.com) implementations of the models can be found in In order to analyze spatial effects in a continuous manner, the multi-compartment model was transformed into a reaction-diffusion PDE model. The neural plate/tube is now no longer coarse-grained into compartments and we no longer add a subscript Text S1Supplementary text(3.01 MB PDF)Click here for additional data file.Video S1Simulation of the PDE model under wild-type conditions(0.60 MB MP4)Click here for additional data file.Video S2Fgf8−/− mutant conditionsSimulation of the PDE model under (0.34 MB MP4)Click here for additional data file.Video S3Wnt1−/− mutant conditionsSimulation of the PDE model under (0.33 MB MP4)Click here for additional data file.Video S4En−/− mutant conditionsSimulation of the PDE model under (0.26 MB MP4)Click here for additional data file.Video S5Pax−/− mutant conditionsSimulation of the PDE model under (0.24 MB MPG)Click here for additional data file.Dataset S1ODE model as MATLAB .m file(0.01 MB TXT)Click here for additional data file.Dataset S2Archive containing MATLAB files for simulation of the PDE model(4 KB ZIP)Click here for additional data file.

We report the case of a male, low birth weight, stillborn fetus of 36 weeks gestation with limb body wall complex. An interesting and rare feature noted in the propositus was the absence of the left subclavian artery and complete absence of the left upper limb. These findings seem to favor the vascular theory in the pathogenesis of this condition. The Limb Body Wall Complex (LBWC) is characterized by severe congenital anomalies, chief of which are thoracoschisis, abdominoschisis, limb defects, and exencephaly . In our The mother was an unbooked, 24 year old primigravida, with an uneventful antenatal period. There was no history of consanguinity or family history of any malformations. There was no history of intake of drugs other than hematinics and calcium during the pregnancy. No antenatal ultrasonogram had been done. She had been clinically diagnosed to have polyhydramnios prior to being referred to our institute. At 36 weeks of gestation, she was admitted with preterm onset of labour and delivered a stillborn fetus weighing 1900 g.On external examination, the placenta was normal; the umbilical cord was short; two umbilical arteries and one umbilical vein were present in the cord. The head and facies were normal. There was amelia of the left upper limb. There was a large defect in the body wall involving the thorax and the abdomen. The sternum, the anterior costal parts of the ribs on the left side and the diaphragm were absent. There was ectopia cordis, evisceration of the lungs, stomach, liver, spleen and intestines Figure .At autopsy, the above mentioned findings were confirmed. Dissection of the heart revealed a patent foramen ovale. The arch of the aorta gave rise to the right brachiocephalic trunk and a small left common carotid artery. The left subclavian artery was absent. The right lung was normal, but the left was firm, hypoplastic and without lobations. The thymus was normal. The intestines were nonrotated, with the small intestine on the right and the large intestine on the left side. The small intestine was dilated and distended with thick meconium forming a cast of the intestine. The terminal ileum was stenosed. The large intestine was short, stenosed and ended in a blind pouch; the terminal part of the large intestine and the rectum were atretic; the anal canal was patent and the anal opening normal. The liver was trilobulated and the gall bladder was absent. The pancreas and spleen were normal. The kidneys and ureters were normal but the bladder was found to have a vesicourachal diverticulum arising from its apex. The external genitalia were male and both testes were intraabdominal. The cranial contents were normal. Scoliosis of the spine was present Figure . MicroscThe limb body wall complex is also known as the body-stalk syndrome. It is a rare entity characterized by severe malformations. Most fetuses are aborted, either spontaneously or by medical means. Most of the remaining are stillborn. Postnatal survival for a significant duration is extremely rare, but at least one such case is reported; the child has severe physical handicaps. The etiology is unknown. No teratogen has been implicated and no genetic abnormality has been identified . FamiliaThe diagnostic criteria for LBWC are still being discussed, but the most commonly quoted are those originally set forth by Van Allen et al in 1987, i.e., the presence of two of the following three malformations: (a) exencephaly/encephalocele and facial clefts; (b) thoraco and/or abdominoschisis; and (c) limb defects . Russo eTheories on the pathogenesis of the BWC include(a) germ disc defect with early embryonic maldevelopment ,(b) primary rupture of the amnion leading to the formation of amniotic bands ,(c) vascular disruption and(d) disturbance of the embryonic folding process .Though limb defects are present in the vast majority of cases, absence of a limb is seen in less than a tenth and uppeAntenatal diagnosis is usually made on ultrasound examination. Serum alpha fetoprotein levels are often elevated. The importance of early antenatal diagnosis in this severe condition with a poor prognosis lies in differentiating it from an isolated gastroschisis, which has a much better prognosis. Early diagnosis can be followed by medical termination of the pregnancy."Written informed consent was obtained from the patient for publication of this case report and accompanying figures. A copy of the written consent is available for review by the Editor-in-Chief of this journal."The authors declare that they have no competing interests.NP did the literature review and prepared the manuscript, JJ made the diagnosis, critically reviewed and corrected the manuscript, SEJ conducted the autopsy, JC was involved in the literature review and manuscript preparation, SS made the final corrections, approved the manuscript and will act as guarantor. All authors read and approved the final manuscript.

Dioxins and related compounds are suspected of causing neurological disruption. Epidemiological studies indicated that exposure to these compounds caused neurodevelopmental disturbances such as learning disability and attention deficit hyperactivity disorder, which are thought to be closely related to dopaminergic dysfunction. Although the molecular mechanism of their actions has not been fully investigated, a major participant in the process is aryl hydrocarbon receptor (AhR). This study focused on the effect of 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin (TCDD) exposure on the regulation of TH, a rate-limiting enzyme of dopamine synthesis, gene expression by AhR.N2a-Rβ cells were established by transfecting murine neuroblastoma Neuro2a with the rat AhR cDNA. TH expression induced by TCDD was assessed by RT-PCR and Western blotting. Participation of AhR in TCDD-induced TH gene expression was confirmed by suppressing AhR expression using the siRNA method. Catecholamines including dopamine were measured by high-performance liquid chromatography. A reporter gene assay was used to identify regulatory motifs in the promoter region of TH gene. Binding of AhR with the regulatory motif was confirmed by an electrophoretic mobility shift assay (EMSA).Induction of TH by TCDD through AhR activation was detected at mRNA and protein levels. Induced TH protein was functional and its expression increased dopamine synthesis. The reporter gene assay and EMSA indicated that AhR directly regulated TH gene expression. Regulatory sequence called aryl hydrocarbon receptor responsive element III (AHRE-III) was identified upstream of the TH gene from -285 bp to -167 bp. Under TCDD exposure, an AhR complex was bound to AHRE-III as well as the xenobiotic response element (XRE), though AHRE-III was not identical to XRE, the conventional AhR-binding motif.Our results suggest TCDD directly regulate the dopamine system by TH gene transactivation via an AhR-AHRE-III-mediated pathway. The AhR- mediated pathway could have a particular AhR-mediated genomic control pathway transmitting the effects of TCDD action to target cells in the development of dopaminergic disabilities. Their effects are predominantly negative, such as oncogenesis, reproductive toxicity, immunosuppression, and neurological dysfunction dopa in the right midbrain was 48% greater in 10 children with ADHD as compared to 10 normal children [11C] dopa influx rate in the midbrain was 17.2% lower in 8 male adolescents with ADHD as compared to 8 normal boys [Experimental animal studies and epidemiological studies indicated that TCDD and related compounds potentially cause neurodevelopmental disabilities such as learning disabilities and ADHD ,11. Clinchildren . Anothermal boys . A disorThe SNc, a midbrain nucleus, has abundant dopaminergic neurons, mainly A9 neurons ,41. As sAt the molecular level, dioxins, including TCDD, affect gene transcription through AhR binding and successive AhR activation. AhR is a nuclear receptor that binds to dioxins and is a ligand-dependent transcription factor belonging to the bHLH-PAS family ,15. The Transcriptional regulation of the rat TH gene has been well studied. Basal transcription depends on transcription factor activity at the partial dyad element -17 bp), CRE -45 bp), AP-1(-205 bp), and the dyad symmetry element (-201 bp) ,38. Tran bp, AP-1 bp, CRE Recently, several studies suggested that AhR binds regulatory sequences differently from the consensus XRE ,43. For TH gene expression induced by TCDD exposure would be regulated by AHRE-III mediated mechanism independent of the conventional AhR-mediated pathway.Although XRE and other motifs are rarely found together in the promoter regions of the same gene, the mechanism of selection for AhR binding among multiple motifs was not investigated. According to the ontological characterization of AHRE-II-regulated genes, XRE-regulated, AnoC-regulated and AHREIn order to investigate the relation of the AHRE-III-AhR-mediated pathway to cell function, we performed a genome-wide homology search with AHRE-III. One of the results of this search indicated that AHRE-III was found at -6769 bp of the 3'-flanking region of the Mash-2 gene . Mash-2 is a member of the bHLH transcription factor family, similar to AhR. Members of the bHLH family are related to neural development and differentiation and form a molecular signaling network. For example, Hes-1 (hairy and enhancer of split homolog 1) and Hes-5 downregulate Mash-1 and Math-1, respectively. Mash-1 and Math-1 subsequently downregulate NeuroD and Math-2, and finally regulate the expression of nerve-specific genes . Hes-1, Therefore, we hypothesize that AhR could mediate a wide variety of genetic controls, including the detoxification process and neural development through transactivation, driven or not driven by XRE. The target pathway of AhR-mediated gene expression could be selected by cell types based on their functions and the molecular processes that characterize them.Consequently, the AhR-AHRE-III-mediated pathway participates in neural development rather than xenobiotic metabolism or the detoxification process, and TCDD may induce neurodevelopmental disabilities through the AhR-AHRE-III-mediated pathway.The toxicity of TCDD in the nervous system has not been well studied. In this study, we suggest that TCDD directly regulates the dopamine system by TH gene transactivation via the AhR-AHRE-III-mediated pathway. The mechanism differs from the conventional AhR-XRE-mediated pathway and xenobiotic responses.Concerning the neurotoxic phenotype of TCDD, this is the first evidence of a direct correlation between abnormal expression of the TH gene, which is an elementary process of dopaminergic dysfunction, and AhR-mediated genomic control transmitting TCDD action to the cells.AhR: aryl hydrocarbon receptor; TH: tyrosine hydroxylase; ARNT: aryl hydrocarbon receptor nuclear translocator; TCDD: 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin; XRE: xenobiotic response element; ADHD: attention deficit hyperactivity disorder; EMSA: electrophoretic mobility shift assay.The authors declare that they have no competing interests.EA designed the study and performed all experiments. SY was responsible for the HPLC experiment and EMSA. SU contributed to the EMSA experiment. MIS contributed to experimental design, participated in data analysis, and wrote the manuscript. All authors participated in the preparation of the final manuscript and approved the submission.

The pulmonary status is a vital factor for patients undergoing open heart surgery. The cardiac surgery itself deteriorates the actual pulmonary functions. Today, patients are no longer living with a cardiac disease due to compromised respiratory functions secondary to various pathologies, patients with lung disorders more often seek solutions for their cardiac disease and they are commonly operated. However, the resection of a lobe or a whole lung is a major challenge for the patients planned for cardiac surgery. In this report, we present a 65-year-old patient, who had left pnemonectomy which had been performed 8 years ago and was admitted for mitral valve replacement and subaortic membrane resection. Open heart surgery is associated with postoperative deteriorated respiratory functions. Cardiac surgery is a challenge both for the patients and the whole cardiac surgery and reanimation team in the pre- and postoperative periods as well as during the surgery. The medical literature contains series on concomitant heart and lung surgery , 2; howeThis report presents a 65-year-old male patient with 8 years history of pneumonectomy and who was operated for left ventricular outflow tract stenosis and mitral valve disease. 2), dilated left atrium (7.8 × 8.5 cm diameters), moderate tricuspid valve insufficiency (2-3+), and mild aortic regurgitation and a subaortic ridge with a mean aortic gradient of 25 mmHg, and ejection fraction of 55%. The pulmonary function tests showed a mixed obstructive and restrictive pattern with forced expiratory volume in 1 second and forced expiratory volume at 1 second/forced vital capacity of 1.30 L and 0.60 , respectively. The room air arterial blood gas analysis revealed PaO2 of 60 mmHg, PaCO2 of 48 mmHg and oxygen saturation of 90%. After a week of pulmonary rehabilitation with chest physiotherapy, steroids, and bronchodilatators [A 65-year-old male patient presented to the clinic with dyspnea and easy fatigability. In his medical record there was a left pneumonectomy which was performed 8 years ago. The physical examination revealed normal temperature, blood pressure but atrial fibrillation. There was mid-late systolic murmur on cardiac auscultation. No respiratory sounds could be heard in the left hemithorax and right side lung sounds were normal. The chest X-ray examination indicated deviation of the mediastinal structures to the left and hyperinflation of the right lung . On echoμgr/kg/minute of dobutamine and 3 μgr/kg/minute of dopamine. At the intensive care unit, forced diuresis was achieved with furosemide to avoid pulmonary edema. Intravenous morphine sulphate was applied near extubation to minimize the pain induced respiratory dysfunction and the patient was extubated at the 6th postoperative hour. The inotropes were ceased on day 1 after the patient was discharged to the ward. The chest physiotherapy, steroids, and bronchodilatators were continued until the discharge on the 7th postoperative day. The patient has been regularly followed at our institution since the operation and is free off symptoms 6 months postoperatively. Following standard median sternotomy, aortic, and bicaval cannulations, cardiac arrest was provided with antegrade cold blood cardioplegia. Topical ice slush was avoided to minimize the risk of phrenic nerve injury. The mitral valve was replaced with transseptal approach with a 29 mm St. Jude Medical Mechanical Heart Valve . The subaortic fibromuscular membrane together with septal muscular resection was performed through aortotomy. Cross clamp and cardiopulmonary bypass times were 52 and 70 minutes, respectively. The patient was weaned off cardiopulmonary bypass with negative total fluid balance and on 5 The preoperative respiratory reserve is an important prognostic factor for patients undergoing open cardiac surgery; apart such procedures themselves are associated with respiratory compromise, atelectasis, and infections –5. ExcepA number of issues have been raised in patients undergoing cardiac surgery with prior pneumonectomy. These mainly include maneuvers to prevent decreasing the present pulmonary status. The avoidance of fluid overload preoperatively is of utmost important in these patients with borderline respiratory reserve as well as taking precautions in order to protect the phrenic nerve during the mediastinal dissection and the internal thoracic artery harvesting in case of coronary artery bypass procedures –7. We avIn a recent review by Stoller et al. , a serieAs the exercise capacity of a patient with prior pneumonectomy and mitral regurgitation is poor, the patient is early symptomatic even when the regurgitation is not severe and the conventional cardiac surgery guidelines may need to be adapted on an individual basis . The expThe accurate understanding of the risk factors and the outcome of the cardiac surgery, valvular surgery in particular, following prior pneumonectomy, have not been possible due to the very limited number of patients presented in the literature. In the review including both coronary artery bypass grafting and valve surgery patients by Stoller et al. , the oveThe surgical challenges in this group of patients in addition to high mortality/morbidity rates do not, however, preclude surgery. In appropriately selected cases, careful preoperative preparation aids in a favorable outcome. Short bypass times and short mechanical ventilation positively contributes to respiratory functions and prognosis.

Twenty to 30 percent of all transient ischaemic attacks and ischaemic strokes involve tissue supplied by the vertebrobasilar circulation. Atherosclerotic stenosis ≥ 50% in the vertebral artery accounts for vertebrobasilar stroke in at least one third of the patients. The risk of recurrent vascular events in patients with vertebral stenosis is uncertain and revascularisation of vertebral stenosis is rarely performed. Observational studies have suggested that the risk of subsequent stroke or death in patients with vertebrobasilar ischaemic events is comparable with that in patients with carotid territory events. Treatment of vertebral stenosis by percutaneous transluminal angioplasty has been introduced as an attractive treatment option. The safety and benefit of stenting of symptomatic vertebral stenosis as compared with best medical therapy alone remains to be elucidated in a randomised clinical trial.The primary aim of the Vertebral Artery Stenting Trial (VAST) is to assess whether stenting for symptomatic vertebral artery stenosis ≥ 50% is feasible and safe. A secondary aim is to assess the rate of new vascular events in the territory of the vertebrobasilar arteries in patients with symptomatic vertebral stenosis ≥ 50% on best medical therapy with or without stenting.This is a randomised, open clinical trial, comparing best medical treatment with or without vertebral artery stenting in patients with recently symptomatic vertebral artery stenosis ≥ 50%. The trial will include a total of 180 patients with transient ischaemic attack or non-disabling ischaemic stroke attributed to vertebral artery stenosis ≥ 50%. The primary outcome is any stroke, vascular death, or non-fatal myocardial infarction within 30 days after start of treatment. Secondary outcome measures include any stroke or vascular death during follow-up and the degree of (re)stenosis after one year.Improvements both in imaging of the vertebral artery and in endovascular techniques have created new opportunities for the treatment of symptomatic vertebral artery stenosis. This trial will assess the feasibility and safety of stenting for symptomatic vertebral artery stenosis and will provide sufficient data to inform a conclusive randomised trial testing the benefit of this treatment strategy. The VAST is supported by the Netherlands Heart Foundation . Twenty to 30 percent of all transient ischaemic attacks (TIA's) and ischaemic strokes involve tissue supplied by the vertebrobasilar (VB) circulation ,2. The vCommon causes of VB ischaemia are embolism from the heart or large arteries, or small-vessel disease . In the In contrast to carotid stenosis, there has been little systematic research into the prognosis and the prevention of recurrent vascular events in patients with vertebral artery stenosis. In the carotid surgery trials, patients with ≥ 50% symptomatic carotid stenosis randomised to medical treatment alone had a 5-year risk of ipsilateral carotid ischaemic stroke of 21.2% [In patients with carotid stenosis of 50% or greater, carotid endarterectomy (CEA) leads to an absolute reduction in the 5-year cumulative risk of ipsilateral carotid ischaemic stroke and any stroke or death within 30 days after surgery of 8.5% [The endovascular access to the vertebral artery is relatively easy and the procedure can be performed without general anaesthesia, enabling continuous neurological monitoring of the patient. However, the procedure also has disadvantages. The major risk of endovascular treatment is dislodgement and distal embolisation of plaque and thrombotic debris, which may lead to stroke. In a recent review of reports on 331 endovascular treatments of vertebrobasilar stenosis, the 30-day risk of TIA, stroke, or death was 6.4% . After aCase series are prone to publication bias and the percentages reported above may be different in daily clinical practice. The combined 30-day incidence of any stroke or death in randomised trials on carotid stenting versus CEA, was 8.2% 126/1492) after stenting [/1492 aftIn conclusion, stenting of vertebral artery stenosis appears a promising technique for the prevention of recurrent vascular events in the VB territory, but is still without a proven benefit. The procedure may be complicated by disabling stroke and early restenosis. Before widespread application, the procedure should be assessed in a large randomised trial. As a prelude to such a trial, the present study aims to determine the safety and feasibility of stenting for symptomatic vertebral artery stenosis.The present study aims to determine whether stenting for symptomatic vertebral artery stenosis ≥ 50% in patients with a recent transient ischaemic attack or minor disabling ischaemic stroke in the posterior circulation is feasible and safe. In addition, the rate of new vascular events in the territory of the vertebrobasilar arteries will be assessed in patients with symptomatic vertebral artery stenosis ≥ 50% who receive best medical treatment or best medical treatment combined with endovascular therapy. The results will serve to design a large and conclusive randomised clinical trial in which stenting plus best medical treatment will be compared to best medical treatment alone in patients with symptomatic vertebral artery stenosis.This is a randomised, open, multi-centre clinical trial with masked outcome assessment, comparing the combination of vertebral artery stenting and best medical treatment with best medical treatment alone in patients with a recently symptomatic stenosis of a vertebral artery of at least 50%. A total of 180 patients will be included. Follow-up will continue until one year after inclusion of the last patient.Endovascular treatment will be performed by an experienced interventional radiologist with a track record of at least 50 interventions in the carotid or vertebral arteries in the last 5 years. The procedure will include percutaneous transluminal angioplasty followed by stenting. The type of stent and the use of a protection device will be left to the discretion of the interventionist. If stent placement is not feasible or deemed contra-indicated, angioplasty without stent placement will be performed. The procedure will be performed under local anaesthesia, with continuous monitoring of heart rhythm and blood pressure. All patients randomised to stenting will receive clopidogrel 75 mg daily starting at least five days before the procedure and continued for 30 days after the procedure. Patients not on clopidogrel the day before the procedure should be loaded with 300 mg clopidogrel at least six hours before stenting. Best medical treatment will be left to the discretion of the neurologist, but should include rigorous control of vascular risk factors, the use of antiplatelet agents, and the use of a statin.Patients can be enrolled in the study if the following criteria have been met:1. TIA or non-disabling ischaemic stroke of the posterior circulation;2. symptoms occurred in the 180 days preceding randomisation;3. possibility to perform stenting within two weeks after randomisation;4. stenosis of the vertebral artery of 50% or greater, diagnosed by both duplex ultrasound and CT angiography (CTA), contrast-enhanced MR angiography (MRA), or conventional angiography, and presumed to be of atherosclerotic origin and accessible for endovascular treatment;5. score on the modified Rankin scale ≤ 3 ;6. age 40 years or older;7. written informed consent.Patients will be excluded from the study in case of1. a potential cause of TIA or minor stroke other than stenosis in a vertebral artery ;2. a vertebral artery stenosis caused by arterial dissection;3. previous surgical or endovascular treatment of the stenosis;4. a life expectancy shorter than three years;5. another serious illness that may confound outcome assessment;6. severe renal impairment, precluding contrast administration;7. allergy to iodinated contrast agent;8. pregnancy.In the majority of patients, blood supply via the posterior cerebral artery (PCA) to the occipital lobes is through the VB circulation. However, in a substantial portion of patients the PCA is fully supplied by the carotid artery instead of the VB arteries . For thiA total of 180 patients will be included in the study. Patients will be randomised to either the combination of vertebral artery stenting and best medical treatment or best medical treatment alone with use of a web-based randomisation system, which includes a minimisation algorithm . RandomiClinical outcome assessment will be performed by three independent adjudicators on the basis of an anonymised written description of the outcome event and ancillary investigations. This description will be made by the research physician in such a way that the adjudicators will remain masked to the allocated treatment.The primary outcome measure will be vascular death, non-fatal myocardial infarction, or non-fatal stroke within 30 days after start of the treatment (see Appendix for definitions).Secondary outcome measures will be vascular death, non-fatal myocardial infarction, or non-fatal stroke during follow-up. Other outcome measures include any stroke in the supply territory of the symptomatic vertebral artery during follow-up and the degree of stenosis of the symptomatic vertebral artery after one year, as assessed with both Duplex ultrasound and CT angiography.At baseline, medical history will be assessed and clinical and neurological examination (including blood pressure) will be carried out. The baseline neurological and functional status will be assessed with the National Institutes of Health Stroke Scale (NIHSS) and with the modified Rankin Scale ,13. The The degree of stenosis in the vertebral artery will be assessed with duplex ultrasound and MRA, CTA, or conventional angiography. Except for duplex ultrasound, the degree of the stenosis will be calculated by dividing the residual lumen (N) by vessel diameter at a point distal to the stenosis where the normal vessel calibre has been restored (D), and applying the formula: (1 - N/D) × 100% = degree of stenosis . To asseCT and MRI scans will be performed to investigate the presence and type of a cerebral infarct Follow-up visits will be performed at one day and at 1, 6, and 12 months after stenting (or randomisation in the conservative treatment group) and every year thereafter. The close-out visit of each patient will be scheduled one year after randomisation of the last patient.Follow-up data to be obtained at one day and after 1, 6 and 12 months, every year thereafter, and at close out will include:1. the occurrence and type of vascular event;2. complications associated with the endovascular procedure;3. medication;4. blood pressure;5. score on the modified Rankin Scale;6. the degree of (re)stenosis assessed with duplex ultrasound and CTA will be assessed after one year and following an ischaemic stroke.With 90 patients in the endovascular intervention arm, a complication rate of 7.8% (7 events) would yield a 95% confidence interval from 3.2 to 15.4%. The estimate of 7.8% is comparable to that of 8.2% for carotid stenting [Inclusion of a total of 90 patients in the medical arm during three years and one final year of follow up for these patients will provide 225 patient years of follow up. This number of patient years would yield a 95% confidence interval of 4.1 to 11.5% for an annual event rate of 7%.An additional analysis will be done to compare the incidence of vascular events between the two treatment groups. This analysis will be based on the intention-to-treat principle and reported in terms of the hazard ratio with corresponding 95% confidence intervals calculated with the Cox proportional hazard model.We consider the precision of the above estimates sufficient for reliable calculation of the sample size of a conclusive randomised clinical trial.The major risk of endovascular treatment is dislodgement and distal embolisation of plaque and thrombotic debris, which may lead to stroke. In a recent review of reports on 331 endovascular treatments of VB artery stenosis, the 30-day risk of TIA, stroke, or death was 6.4% . Other nThe study will be conducted according to the principles of the Declaration of Helsinki, as amended in 2000 and clarified in 2004, and in accordance with the Dutch Medical Research Involving Human Subjects Act (WMO). Approval by the local medical ethical review board is required for each participating centre before start of patient inclusion. The patients will be informed about the trial by their treating physician but will whenever possible be asked for consent by a physician not involved in their treatment. Patients should reach a decision about participation within 180 days after the last vertebrobasilar symptom.The trial compares two existing forms of treatment currently used in many hospitals worldwide. The investigators anticipate that some patients may be harmed inadvertently as a result of either the stenting procedure or the decision to refrain from invasive treatment. The determination of the rate of these adverse outcome events is in fact the major aim of the trial. In the majority of patients with a recently symptomatic carotid stenosis of 50% or greater, CEA reduces the long-term risk of stroke despite the risks of the intervention but at pThe sponsor/investigator has a liability insurance which is in accordance with article 7, subsection 6 of the WMO.The sponsor has an insurance which is in accordance with the legal requirements in the Netherlands . This insurance provides coverage for damage to research subjects through injury or death caused by the study.adverse event is any unfavourable and unintended sign, symptom, or disease occurring during the follow-up period of the study. Adverse events occurring after randomisation will be recorded on the adverse event page of the CRF.An serious adverse event is defined as any adverse event that results in:A 1. death;2. a life-threatening condition;3. inpatient hospitalisation or prolongation of existing hospitalisation;4. persistent or significant disability/incapacity.important medical event that may not result in one of the above conditions may be considered a serious adverse event when, based upon medical judgement, it may jeopardise the patient and may require medical or surgical intervention to prevent one of the outcomes above. A reasonably related adverse event is defined as one that is possibly, probably, or definitely related to the trial treatment.An All serious adverse events occurring within 30 days after stenting (or within 30 days after randomisation in the conservative treatment group) and adverse events that are serious and reasonably related to the trial treatment but occur after the first 30 days require completion of the safety report, which should be sent to the trial co-ordination centre within 5 working days of observation or notification of the event. All serious adverse events not related to trial treatment during follow-up require completion of the safety report at the planned follow-up visits.Each outcome event will be reported to the Data Monitoring and Safety Committee (DMSC). We propose the DMSC to use the lower limit of the 95% confidence interval of the complication rate as a criterion to advice the Steering Committee to stop the trial. This lower limit should not be higher than 8.2%, the rate reported for carotid artery stenting. Moreover, we will ask the DMSC to perform one interim analysis halfway during the trial, i.e. after one half of the planned patient-years have been accrued. For this interim analysis we propose the simple 3 standard deviation stopping rule proposed by Peto, that essentially advises to stop at p < 0.001 . We consThe trial results will be published by the members of the Steering Committee, on behalf of the investigators.We present the protocol of a randomised clinical trial designed to test the safety and feasibility of vertebral artery stenting in patients with a symptomatic stenosis ≥ 50% of a vertebral artery. Case reports suggest that vertebral artery stenting is relatively safe with a periprocedural risk of stroke or death ranging from 1.6 to 13.8%.In a recent review, stenting of the extracranial vertebral artery in 313 patients resulted in technical success in 98 to 100% of the cases, with a 0.3% risk of death and 5.5% risk of neurological complications . StentinThe interpretation of outcome after vertebral stenting is complicated by the lack of data on the risk of recurrent stroke in patients with vertebral stenosis on best medical therapy alone. To date no reliable data are available on the prognosis of VB stroke. In a recent review, the risk on recurrent stroke in the acute phase (up to seven days) is considered probably higher in patients presenting with a VB event compared with patients presenting with carotid events .Stenting of the proximal vertebral artery might be associated with a relatively high rate of restenosis at follow-up. In the above-mentioned review, restenosis of the proximal vertebral artery has been reported in a quarter of the cases after a mean follow-up of 11.8 months . The defSince the natural course of a symptomatic vertebral artery stenosis in patients on best medical treatment alone is unknown and the exact indications for vertebral stenting are unclear a randomised clinical trial is needed. By comparing outcome in patients on best medical treatment alone and patients with vertebral artery stenting, a conclusion can be drawn on the safety and feasibility of vertebral artery stenting in symptomatic vertebral artery stenosis.Conventional angiography is the gold standard for the diagnosis of vertebral artery stenosis. Randomisation to either stenting or best medical treatment in this study will take place before angiography is performed. It is not considered ethical to perform conventional angiography in each patient included in the study because this procedure is associated with a small but inevitable risk of stroke. This might lead to randomisation of patients to stenting without a significant stenosis on conventional angiography. In approximately half of the patients , grading of the stenosis will be done on the basis of CTA or MRA and duplex ultrasound alone. Studies of sufficient quality validating the accuracy of diagnosing and grading vertebral artery stenosis with non-invasive imaging techniques against the gold standard of intra-arterial angiography are scarce. No studies have compared the different imaging modalities against intra-arterial angiography in the same cohort of patients. Contrast-enhanced MRA and possibly CTA may be more sensitive in diagnosing vertebral artery stenosis than duplex ultrasound .The trial has started 1 June 2008 in two centres in the Netherlands. Four other Dutch centres are expected to join the trial shortly. Other centres, also from other countries than the Netherlands, that have adequate experience with the management of vertebral artery stenting are welcome to participate.The Steering Committee carries the ultimate responsibility for the trial. Specific tasks of the steering Committee are:1. approval of the study protocol;2. approval of amendments to the study protocol;3. deciding whether or not to continue the trial based on the recommendations of the DMSC;4. reviewing protocols for satellite studies;5. approval of reports and publications of the trial.The Steering Committee is constituted of the principal investigators of each actively randomising centre, and of the members of the executive committee.As of 20 July 2008, members of the Steering Committee are : A. Algra,* clinical epidemiologist, University Medical Centre, Utrecht – A. Compter,* research physician, University Medical Centre, Utrecht – L.J. Kappelle,* neurologist, University Medical Centre, Utrecht, co-principal investigator – T.H. Lo, interventional radiologist, University Medical Centre, Utrecht – W.P.Th.M. Mali, radiologist, University Medical Centre, Utrecht – F.L. Moll, vascular surgeon, University Medical Centre, Utrecht – W.J. Schonewille,* neurologist, St. Antonius Hospital, Nieuwegein – J.A. Vos,* radiologist, St. Antonius Hospital, Nieuwegein – H.B. van der Worp,* neurologist, University Medical Centre, Utrecht, co-principal investigator. The members of the Executive Committee, who are responsible for the trial on a day-to-day basis, are marked with an asterisk.The Trial Co-ordination Centre is located at the Trial Office Neurology of the Department of Neurology of the University Medical Centre, Utrecht, The Netherlands. The centre will be staffed by the trial co-ordinator and a data manager.The DMSC performs analyses of the unblinded data on a permanent basis and formulates recommendations for the Steering Committee on the continuation of the trial. The Data Monitoring Committee may also offer unsolicited recommendations.Members of the Data Monitoring Committee are being sought.The authors declare that they have no competing interests.AC participated in writing the protocol and is concerned with patient recruitment and data management. HBW wrote the protocol, applied for financial support, and is concerned with patient recruitment. WJS participated in writing the protocol and is concerned with patient recruitment. AA participated in writing the protocol and is responsible for data management. THL participated in writing the protocol and performs stenting. WPThMM participated in writing the protocol. FLM participated in writing the protocol. JAV participated in writing the protocol and performs stenting. LJK participated in writing the protocol, applied for financial support and is concerned with patient recruitment. All authors have read and approved the manuscript.1. Death from vascular causes:a. Fatal cerebral infarction: cerebral infarction causing an increase of handicap to Rankin 4 or 5, followed by death. Death should have been an unlikely event without the preceding infarction.b. Fatal cerebral hemorrhage: cerebral haemorrhage causing an increase of handicap to Rankin 4 or 5, followed by death. Death should have been an unlikely event without the preceding bleeding.c. Fatal myocardial infarction: Documented myocardial infarction (see 6) followed by death, at least one hour after onset of symptoms.d. Definite sudden death: witnessed sudden death with reliable observation of timing; i.e. patient died within one hour after onset of symptoms.e. Probable sudden death: witnessed death, but unreliable data on timing of events, or found dead and previously "healthy."f. Terminal heart failure.g. Fatal arterial bleeding.h. Other fatal vascular complication, e.g. gastric bleeding, pulmonary embolism.2. Cerebral infarction.a. Definite new cerebral infarction: clinical evidence of the sudden onset of a new neurological deficit, persisting for more than 24 hours, with a corresponding new infarct on a repeat CT scan.b. Probable new cerebral infarction: clinical evidence of the sudden onset of a new neurological deficit, or an increase in an existing deficit, persisting for more than 24 hours, without a new infarct on repeat CT scan.3. Intracerebral haemorrhagea. Clinical evidence of a sudden new neurological deficit, or an increase in an existing deficit, persisting for more than 24 hours, with a corresponding cerebral haemorrhage on a CT or MRI scan.4. Subarachnoid haemorrhagea. A sudden unusual headache and/or a reduction in consciousness with a corresponding subarachnoid haemorrhage on CT or MRI, or signs of subarachnoid haemorrhage in the cerebrospinal fluid.5. Unspecified strokea. Clinical evidence of a sudden new neurological deficit, or an increase in an existing deficit, persisting for more than 24 hours, with no imaging performed.6. Myocardial infarctiona. Myocardial infarction: At least two of the following characteristics have to be documented: a history of chest discomfort for at least half an hour, specific cardiac enzymes more than twice the upper limit of normal, or the development of specific abnormalities (e.g. Q waves) on the standard 12-lead electrocardiogram.

The first four authors, Ayesha Murshid, Shiuh-Dih Chou, Thomas Prince, and Yue Zhang, should be noted as contributing equally to this work.

EYFP reporter as a model system to quantitatively analyze HTLV-1 particles released from producer cells.Human T-lymphotropic virus type 1 (HTLV-1) is an important human retrovirus that is a cause of adult T-cell leukemia/lymphoma. While an important human pathogen, the details regarding virus replication cycle, including the nature of HTLV-1 particles, remain largely unknown due to the difficulties in propagating the virus in tissue culture. In this study, we created a codon-optimized HTLV-1 Gag fused to an The codon-optimized Gag led to a dramatic and highly robust level of Gag expression as well as virus-like particle (VLP) production. The robust level of particle production overcomes previous technical difficulties with authentic particles and allowed for detailed analysis of particle architecture using two novel methodologies. We quantitatively measured the diameter and morphology of HTLV-1 VLPs in their native, hydrated state using cryo-transmission electron microscopy (cryo-TEM). Furthermore, we were able to determine HTLV-1 Gag stoichiometry as well as particle size with the novel biophysical technique of fluorescence fluctuation spectroscopy (FFS). The average HTLV-1 particle diameter determined by cryo-TEM and FFS was 71 ± 20 nm and 75 ± 4 nm, respectively. These values are significantly smaller than previous estimates made of HTLV-1 particles by negative staining TEM. Furthermore, cryo-TEM reveals that the majority of HTLV-1 VLPs lacks an ordered structure of the Gag lattice, suggesting that the HTLV-1 Gag shell is very likely to be organized differently compared to that observed with HIV-1 Gag in immature particles. This conclusion is supported by our observation that the average copy number of HTLV-1 Gag per particle is estimated to be 510 based on FFS, which is significantly lower than that found for HIV-1 immature virions.In summary, our studies represent the first quantitative biophysical analysis of HTLV-1-like particles and reveal novel insights into particle morphology and Gag stochiometry. There are approximately 15-20 million people infected by human T-lymphotropic virus type 1 (HTLV-1) worldwide . DespiteThe Gag polyprotein is the main retroviral structural protein and is sufficient, in the absence of other viral proteins, for the production and release of immature VLPs . The GagStudies with many retroviruses, including human immunodeficiency virus type 1 (HIV-1), have shown that retroviral assembly is initiated by binding the myristoyl moiety of MA with lipid rafts at the plasma membrane -11. The Cryo-electron tomography (cryo-ET) combined with three-dimensional (3D) reconstructions have provided highly detailed structural information for HIV-1. Structural studies have revealed that HIV-1 Gag proteins form an incomplete paracrystalline lattice in immature particles ,15. ThisDespite limited amino acid sequence homology among different retroviruses, the atomic tertiary structures of individual Gag domains exhibit high similarity -18. Thercis-elements on the RNA transcript required for efficient nuclear export.Previous molecular analyses of HTLV-1 replication have been severely hampered by the fragility of HTLV-1 proviral sequences as well as the low levels of viral replication in tissue culture. Given the technical and experimental limitations of working with HTLV-1, we first sought to create an experimental model system that would be amenable to successfully and efficiently analyze HTLV-1 Gag trafficking and virus particle assembly and release. It is well-established that retroviral Gag polyprotein is sufficient for the assembly and release of VLPs [reviewed by ]. Our prEYFP is expressed from a CMV promoter, and a Kozak consensus sequence was engineered upstream of the start codon to facilitate translation initiation as well as an in-frame insertion of the EYFP gene sequence just prior to the HTLV-1 Gag gene stop codon. The plasmid is quite stable and readily amplified in E. coli (data not shown).In order to create a tractable and robust system for Gag expression and virus-like particle production, we designed and created a codon-optimized HTLV-1 Gag construct to improve HTLV-1 Gag expression. In order to readily detect Gag expression, trafficking, and incorporation into VLPs, we fused the EYFP to the C-terminal end of the Gag protein. Figure To confirm expression of the fusion construct, 293T cells were transiently transfected with three independent clones of pEYFP-N3 HTLV-1 Gag in parallel experiments. Thirty-six hours post-transfection, HTLV-1 Gag-EYFP protein expression was examined from both cell culture supernatants on independently prepared samples resulted in a mean diameter of 75 ± 4 nm for the VLPs.FFS provides information about the size of a particle through the autocorrelation function and the brightness and concentration of the particles through the photon counting histogram (PCH). Recent advances have expanded this technique to allow for the examination of protein oligomerization of larger complexes, including our recent analysis of HIV-1 particles . In the 2 ≥ 10). Including a second VLP brightness species into the fit model was required to reproduce the experimental data. A fit of the photon counting histogram to a 2-species model (reduced χ2 = 1.5) is shown in Figure i is characterized by its normalized brightness bi and average particle number Ni in the observation volume. Note that the normalized brightness is the same as the Gag copy number of the VLP. It is illustrative to briefly ignore the brightness heterogeneity by calculating the average Gag copy number bavg of the VLP sample according to [The same raw data was analyzed with PCH analysis to determine the average copy number and concentration of VLP samples. A model assuming a single VLP brightness species leads to poor fits of the experimental PCH data (reduced χrding to .n = 5) we determined an average Gag copy number per VLP of 510 ± 50 remained approximately constant for all measured samples, f2 = 19 ± 7%. Thus, a population of ~19% of the VLPs is associated with the higher Gag copy number. Note that a similar heterogeneity in Gag copy numbers has also been reported for HIV-1 VLPs [The average Gag copy number was determined from the two brightness species identified by PCH analysis. Repeated measurements of multiple independent sample preparations confirmed the presence of the two species. Their brightness values, which typically varied very little across experiments, correspond to Gag copy numbers of V-1 VLPs .Recent progress in cryo-TEM, cryo-ET and 3 D reconstruction has led to many major breakthroughs in our understanding of virus structure. For instance, the architecture of immature and mature HIV-1 ,23,24, mWhile our model system does not express Gag in the context of a proviral sequence , our results indicate that the VLPs produced have the morphology of the authentic HTLV-1 immature particles. Furthermore, while the Gag trafficking pathways used by the HTLV-1 Gag in this model system may be different from that of Gag expressed from the provirus, the production of VLPs argues that the trafficking pathways are biological relevant since VLP production is the result of expression of the codon-optimized Gag-EYFP fusion. The altered Gag trafficking pathways could influence envelope incorporation into VLPs, though our cryo-TEM data revealed an abundance of VLPs with VSVG. The VLPs characterized in our study resemble immature HTLV-1 and can be readily observed in ultrathin sections of 293Ts transfected with pEYFP-N3 HTLV-1 Gag Figure . In addiWe found that the intracellular localization of HTLV-1 Gag-EYFP was comparable to that of authentic Gag in HeLa cells Figure . This imOur cryo-TEM and FFS analysis determined that the average VLP diameter was 71 ± 20 nm and 75 ± 4 nm, respectively. As observed in other retroviruses, the size of HTLV-1-like particles varies greatly, ranging from 30 to 237 nm. According to the size distribution Figure , over 25We used FFS to also investigate Gag stoichiometry in the VLPs by performing brightness analysis of the FFS data. We determined that the average Gag copy number per VLP is ~510, which implies that only half of the available membrane surface is covered by Gag. Brightness analysis further revealed heterogeneity of the Gag copy number by identifying two brightness species. The presence of heterogeneity in the Gag copy number has also been observed for HIV-1 Gag-based VLPs . Since FAmong the thousands of cryo-TEM images of VLPs examined in our study, we commonly observed particles that did not have electron density consistent with a Gag shell covering the entire membrane surface Figure . These rIn vitro studies suggest that the HTLV-1 Gag shell is very likely to be organized differently compared to that of HIV-1 Gag [IV-1 Gag -18. WhenIn summary, we have developed the first efficient and robust model system for the analysis of HTLV-1 Gag cellular trafficking, virus particle assembly, release and particle morphology. This system will allow for significant advancements in understanding of the basic mechanisms of HTLV-1 replication - which has been severely hampered due to the limitations in studying HTLV-1 in tissue culture. Our study also represents the first description of immature HTLV-1 particles as well as quantitative measurements of particle size, Gag copy number, and an initial analysis of the HTLV-1 Gag lattice. Future application of cryo-electron tomography will aid in gaining greater insight into HTLV-1 particle morphology. A deeper understanding of the basic mechanisms involved in HTLV-1 particle assembly and morphology should help to enhance our global understanding of the basis of HTLV-1 particle infectivity, transmission and pathogenesis.gag contains an optimal Kozak consensus sequence [ATGG (start codon in bold). Two restriction enzyme sites, Hind III and Bam HI, were also engineered into the 5' and 3' end of the gene, respectively, for sub-cloning purposes. For reporter gene construction, the artificial HTLV-1 gag was cloned into a pEYFP-N3 vector using the HindIII and BamHI restriction sites, creating pEYFP-N3 HTLV-1 Gag.A codon-optimized HTLV-1 Gag gene was designed using the UpGene program and syntsequence ,39 at th293T cells were transiently transfected with the pEYFP-N3 HTLV-1 Gag construct using GenJet according to the manufacturer's instructions. Thirty-six hours post-transfection, cell pellets and supernatant were collected and lysates were prepared as previously described . LysatesHeLa cells were grown on Lab-Tek II chamber slides (Fisher Scientific) and transfected with either the pEYFP-N3 HTLV-1 Gag construct or a HTLV-1 proviral clone (a kind gift from Dr. Marie-Christine Dokhelar) . Thirty-G) protein (10:1) expression construct using GeneJet. Twenty-four hours post-transfection, the cell culture media was changed to a serum-free media and incubated for an additional 12 hr. In order to harvest VLPs, tissue culture supernatant was centrifuged at 3000 × g for 5 min to remove large cellular debris, then the supernatant was passed through an Amicon Ultra- 15 Centrifugal Filter Unit (100 KDa) to concentrate samples. The concentrated samples were then subjected to a 10-40% linear sucrose gradient prepared with a Gradient Master . Samples were then ultracentrifuged at 35,000 rpm for 30 min at 4°C using a SW55 Ti rotor. The VLP fraction was extracted and pelleted at 35,000 rpm, 4°C for 1.5 hr using a SW55 Ti rotor (Beckman). After centrifugation, the pellet was resuspended in 1× STE buffer at 4°C for 4 hr and then analyzed by cryo-TEM.293T cells were co-transfected with pEYFP-N3 HTLV-1 and a vesicular stomatitis virus G were acquired and stained with uranyl acetate and lead citrate, then examined by electron microscopy using a JEOL 1200EX transmission electron microscope.293T cells were transfected with either pEYFP-N3 HTLV-1 or a HTLV-1 proviral clone as described above. Thirty-six hours post-transfection, cells were harvested and washed twice with 1× PBS followed by an additional wash in 0.1 M sodium cacodylate. To prepare thin sections, cell pellets were first fixed with 2.5% glutaraldehyde for 40 min and then washed three times with 0.1 M sodium cacodylate. After washing, the samples were post-fixed with 1% OsOA 3ul aliquot of the purified and concentrated HTLV-1 VLP sample preparation was applied to a glow-discharged c-flat holey carbon grid and used for plunge freezing into liquid ethane with a Fhttp://cryoem.ucsd.edu/programDocs/runRobem.txt. The center of each particle was determined using the program EMCORORG that calculates cross-correlation of each image with its 180° rotational image http://cryoem.ucsd.edu/programDocs. The radial profile for each particle was then calculated by computing the rotationally averaged density relative to the center of the particle. A group of 14 VLP images with a diameter in the range of 70-80 nm was used for calculation of the averaged radial profile. Each pixel in the image corresponds to a 3.0-Å spacing in the VLP. The defocus levels of these images were between 1.5-3.7 μm, which allows for visualization of both membrane leaflets of the viral membrane. The radial profile of each particle was first calculated to obtain the highest density position of the outer membrane leaflet. The radial profile of each particle was then linearly interpreted to match the position of the outer membrane to the averaged position (367-Å radius). The average radial profile and standard deviation were then calculated.In order to calculate the radial density profile, images of VLPs with spherical morphology were boxed using RobEM Cryo-TEM images were analyzed using ImageJ software . For each VLP, two perpendicular diameters were used to calculate the average diameter. The histogram was generated using GraphPad Prism 5 software .293T cells were co-transfected with pEYFP-N3 HTLV-1 and a VSV-G expression construct (10:1) as described earlier. Aliquots of the cell culture supernatants used for subsequent cryo-TEM analysis were removed for parallel analysis by FFS. Thirty-six hours post-transfection, VLPs were harvested and clarified of cellular debris by low-speed centrifugation at 3000 × g for 5 min as well as passing through a 0.22 μm filter. The resulting clarified supernatants were then used for FFS measurements.A mode-locked Ti:sapphire laser pumped by an intracavity doubled Nd:YVO4 laser is the source of two-photon excitation. Experiments were performed on a modified Zeiss Axiovert 200 microscope as previously described . Each FFD1/τD2 = r1/r2. The measured diffusion time of fluorescent spheres with a known radius of 50 nm serves as a reference to calculate the average diameter of the VLPs [ε and the average number N of particles in the optical observation volume. The particle number N is converted into a concentration after the observation volume is calibrated with a dye sample. One of the three species is required to take the auto-fluorescent background of the solution into account as discussed in a recent paper on HIV-1 VLPs [A brief description of the analysis method is provided here. A detailed discussion of FFS analysis of VLP samples can be found elsewhere . The difthe VLPs . The FFSthe VLPs . Each inV-1 VLPs . This baV-1 VLPs . PCH fitV-1 VLPs .N remains constant, which establishes a constant optical observation volume. The brightness of a protein complex scales with the number of YFP-labels it contains [b = ε/εYFP, where εYFP is the brightness of the YFP monomer and ε is the brightness of the complex. A calibration measurement of YFP brightness, εYFP, is necessary to determine copy number. Because YFP brightness is difficult to determine at the low powers that the VLPs must be measured at to avoid saturation of the detector, the YFP brightness, εhigh, is measured at a higher excitation power, Phigh. Conversion to the YFP brightness εlow for the low power Plow of VLP experiments is achieved by using the relationship of power to brightness εlow = εhigh(Plow2/Phigh2). The data acquisition time for the VLP measurements was chosen such that at least 1000 VLPs passed through the observation volume, which is sufficient for statistical analysis of the data. All VLP measurements were performed at excitation powers that are free from saturation and bleaching artifacts [bavg of the two species is determined by a non-linear relationship [To avoid unwanted optical effects, all experiments are conducted in a power range where the fluorescence intensity of YFP scales quadratically with excitation power. We also confirmed that within this power range the average occupation number contains . The YFPrtifacts . The FFStionship ,bi and Ni are the normalized brightness and the number of particles in the observation volume of each species.where The authors declare that they have no competing interests.IFG, WZ, JLJ, KF, YC and JR carried out the experimental work, participated in the data analysis and interpretation, and contributed in the writing of the manuscript. WZ, JDM, YC and LMM conceived of the study, oversaw experimental design, data analysis, and interpretation as well as edited the manuscript. All authors read and approved the final manuscript.Supplemental Figure 1. Low magnification cryo-TEM image of VLPs produced from 293T cells. Image provides another example of the types of particles observed by cryo TEM. Scale bar = 100 nm.Click here for file

Optical and spectroscopic technologies working at subcellular resolution with quantitative output are required for a deeper understanding of molecular processes and mechanisms in living cells. Such technologies are prerequisite for the realisation of predictive biology at cellular and subcellular level. However, although established in the physical sciences, these techniques are rarely applied to cell biology in the plant sciences.Arabidopsis cells in their tissue environment. We show a rapid, brassinolide-induced cell wall expansion and a fast BR-regulated change in the BRI1-GFP fluorescence lifetime in the plasmamembrane in vivo. Both cell wall expansion and changes in fluorescence lifetime reflect early BR-induced and BRI1-dependent physiological or signalling processes. Our experiments also show the potential of one-chromophore fluorescence lifetime microscopy for the in vivo monitoring of the biochemical and biophysical subcellular environment using GFP fusion proteins as probes.Here, we present a combined application of one-chromophore fluorescence lifetime microscopy and wavelength-selective fluorescence microscopy to analyse the function of a GFP fusion of the Brassinosteroid Insensitive 1 Receptor (BRI1-GFP) with high spatial and temporal resolution in living in vivo dynamic and quantitative analysis of cellular processes at high resolution which are not addressable by pure imaging technologies or transmission electron microscopy.One-chromophore fluorescence lifetime microscopy, combined with wavelength-specific fluorescence microscopy, opens up new frontiers for Our ocFLM system consisted of a confocal sample scanning microscope (CSSM), a spectrally integrating detector for measuring fluorescence intensity and a time-correlated single-photon counting board for recording fluorescence lifetime decays, which was custom-built in our lab To overcome these limitations, we applied one-chromophore fluorescence lifetime microscopy (ocFLM), combined with wavelength-selective fluorescence microscopy, to plant cells in their tissue environment in in vivo dynamic, quantitative analysis of molecular and subcellular processes at high local resolution.As shown here, our combined optical-spectroscopic application, together with a novel data analysis approach using BRI1-GFP as a model receptor, provides unprecedented insight into cells and opens up new frontiers for To differentiate between background fluorescence and the BRI1-GFP signal, we recorded a two-dimensional fluorescence intensity image over the plasmalemma-cell wall area of BRI1-GFP-expressing and wild type seedlings in root and shoot (cotyledon) cells. In contrast to the spectra of non-transformed wild type cells [25]. HoFurthermore, we were faced with the problem that the cell wall in the CSSM images appeared to be much thicker than when it was determined by transmission electron microscopy (TEM) . HoweverIn addition, the differences of GFP and background fluorescence with respect to their spectra and fluorescence lifetime enabled us to choose the appropriate experimental set-up for the distinction of subcellular compartments such as the plasmalemma and the cell wall . Thus, wWe next addressed the problem of real-time measurement of possible physiological effects of BRI1-GFP at subcellular level in living plant cells. Former studies have shown that BL does not alter the fluorescence intensity, the number of vesicles in the endosomal pool and the intracellular distribution of BRI1-GFP in root cells The spatial separation of the plasmalemmata could have been caused by BL-induced plasmolysis or BL-induced cell wall expansion. Therefore, we determined the spatial behavior of the cell wall in response to BL treatment in BRI1-GFP-expressing seedlings. The measurement of fluorescence from different subcellular origins was possible as demonstrated before . The celWe also carried out a TEM analysis of control and BL-treated (30 min) root cells. Root tips from two seedlings of each were frozen under high pressure, freeze-substituted in osmium tetroxide containing acetone, embedded in epoxy resin, cut and subjected to TEM. Using the TEM images, the width of 72 periclinal cell walls of each was measured, and the mean width calculated. The measurements resulted in a wall width of 62,5±10,8 nm for the control and 64,9±10,1 nm for BL-treated root tip cells and 7. FTo determine the specificity of the response, we carried out identical experiments on seedlings, expressing plasmalemma-located aquaporin-GFP The lifetime of GFP fluorescence provides information about the physical and chemical environment of the fluorophore and, thus, the GFP fusion protein To determine whether BL also induces changes in the environment of BRI1-GFP, we analysed the fluorescence lifetime of the receptor fusion. After the addition of BL, we again observed cell wall expansion . FurtherArabidopsis as shown by treatment with Brefeldin A (BFA) Recent studies suggested that the endosomal pool of BRI1 is critical for the signaling and regulation of BL-responsive genes in As shown in via BRI1-mediated transcriptional and post-transcriptional activation of cell wall-loosening enzymes Arabidopsis cells.Our data demonstrate that the cell walls significantly expand within a few minutes of BL treatment in BRI1-GFP expressing cells. A slight expansion response was also observed in aquaporin-GFP expressing and wildtype seedlings which was without clear overall statistical significance. However, when determined at single cell level, almost every cell showed a BL-induced wall expansion. This suggests that BRI1-GFP is necessary for the rapid BL-induced expansion of the cell wall but its over-expression is required to produce a significant effect. A more detailed analysis of many cells from independent seedlings showed that there is a linear relationship between BRI1-GFP fluorescence intensity and the degree of cell wall expansion . BL is known to alter the biophysical properties of the cell wall, such as its relaxation in vivo.From the resolution point of view, it should, in principle, also be possible to determine cell wall expansions of the observed dimension by TEM. However, it is not technically possible to produce a series of TEM sections at the identical subcellular region before and after the addition of BL. Thus, different seedlings have to be used for the comparative physiological analysis using TEM. The set of difficulties is documented by our own TEM analysis, which demonstrates a high variability of cell wall thicknesses between individual cells and even individual periclinal walls. The high variability is probably due to the different age of the cells, which have different wall dimensions, and the difficulty to exactly localize the site of the measurement along the wall. For instance, the wall thickness at the edge of a cell is different form the width in the middle. In addition, although we used cryofixation and freeze-substitution for the preparation of the probes, we can not entirely exclude the possibility that this treatment may influence the water status and spatial dimension of the cell wall. On the one hand, we conclude that it is almost impossible to determine weak, dynamic changes in cell wall expansion using a TEM approach. On the other hand, these findings unequivocally demonstrate the potential of our approach for the analysis of the dynamics of subcellular processes in vivo. Ongoing experiments are aimed at discovering which parameters may influence the fluorescence lifetime of BRI1-GFP, aquaporin-GFP and other fluorophore-tagged proteins in vivo.The observed differences in BRI1-GFP and aquaporin-GFP fluorescence lifetime suggest strong gradients of physico-chemical parameters, such as membrane potential, pH-value, osmotic conditions and refraction index + currents in guard cell protoplasts of Vicia faba and to increase ATPase activity in Azuki bean epicotyls and maize roots, leading to proton extrusion Arabidopsis cells which depends on the presence of BRI1-GFP. The causal relationship between BL-induced BRI1-GFP activation, the change in BRI1-GFP fluorescence lifetime and cell wall expansion is currently under elucidation.After the addition of BL, we observed a significant change in the fluorescence lifetime of BRI1-GFP with time, which was not detected in BL-treated aquaporin-GFP expressing plants. These results can be interpreted to suggest that the activation of BRI1-GFP by BL could alter the physico-chemical properties of the plasmalemma or plasmalemma/cytoplasm interface, which do not affect the fluorescence lifetime of aquaporin-GFP. The observed changes would then be a cell physiological response initiated by BL-activated BRI1-GFP. This idea is substantiated by the fact that BFA inhibits the BL-induced change in BRI1-GFP fluorescence lifetime. As BL was shown to inhibit inwardly rectifying Kin vivo, providing new information about their molecular properties, cell physiological function and subcellular environment. This enables the unambiguous identification and clear intracellular localisation of GFP fusion proteins in plant cells. Furthermore, ligand-induced physiological responses in plant cells and receptor dynamics at subcellular resolution can be quantitatively recorded. The use of autofluorescence as “native” fluorophore avoids the use of additional chromophors or the expression of further markers which might interfere with the plant cell's physiology. This is a marked advantage of our approach over STED, PALM and STORM. In addition, with an image acquisition time of approximately 3 h, PALM and STORM do not allow the fast recording of subcellular processes. We, therefore, propose that high resolution ocFLM combined with wavelength-selective fluorescence microscopy will not only lead to new experimental abilities in plants but also is a valuable novel tool for the accomplishment of cell biology in any cell system.Compared to pure imaging techniques with ultra-high spatial resolution, such as STED BRI1-GFP The measurements were performed with a homemade CSSM, based on a Zeiss Axiovert, and equipped with a pulsed 473 nm diode laser operating at a repetition rate of 10 MHz as source for excitation light and a high numerical aperture oil immersion objective The cell physiological experiments were repeated at least 3 times using independent seedling samples.Seedlings were incubated in water or 10 nM brassinolide solution for 30 min at room temperature. Thereafter, root tips were high-pressure frozen and freeze-substituted in acetone containing 2.5% osmium tetroxide before transfer for 60 min to 0°C The standard deviations in the Gaussian fits of the intensity profiles, as represented by the error bars, reflect the accuracy of the fit and rest on the different signal-to-noise ratio of the measurements. The FWHM-based and TEM-based wall measurements of cells before/without and after treatment with BL were performed as indicated in the The lifetime values derived from mono- or multi-exponential decay fittings. The error bars were calculated according to Figure S1Reference fluorescence spectrum and lifetime decay rate of purified GFP. (A) Fluorescence spectrum of GFP at a concentration of 10−5 M after pulse excitation with light of 473 nm. The spectrum shows a peak at 510 nm and a shoulder at 540 nm. (B) Fluorescence decay rate of GFP at a concentration of 10−7 M in 20 mM TRIS (pH = 6.8) after pulse excitation with light of 473 nm. The decay shows a mono-exponential function. The residuals indicate the deviation between the measured and the model decay function. In a good fit the residuals are distributed symmetrically around 0. IRF, instrument response function.(0.07 MB PDF)Click here for additional data file.Figure S2BL induces changes in the BRI1-GFP fluorescence lifetime in plant cells. (A–B) Fluorescence lifetimes of BRI1-GFP in 4.0 µm plasmalemma-cell wall sections of two hypocotyl cells from two independent seedlings before (black squares) and 10 (red squares), 20 (blue squares) and 30 min (green squares) after addition of 25 nM BL.(0.08 MB PDF)Click here for additional data file.Figure S3BL-induced cell wall expansion and change in BRI1-GFP fluorescence lifetime require a functional intracellular trafficking system. (A–C) FWHM values of GFP intensity profiles (left) and fluorescence lifetime decays (right) recorded over plasmalemmata-cell wall sections of three hypocotyl cells from three independent, BRI1-GFP expressing Arabidopsis seedlings in the presence of 50 µM BFA before (black) and 30 min (green) after application of 25 nm BL.(0.15 MB PDF)Click here for additional data file.Table S1Fitting parameters of lifetime decay traces.(0.17 MB XLS)Click here for additional data file.Table S2FWHM changes in the widening of the plasmalemma-bound GFP fluorescence signal in BRI1-GFP expressing hypocotyl and root cells before (0 min) and 30 min after application of 10 nM BL (30 min.).(0.01 MB PDF)Click here for additional data file.Table S3FWHM changes in the expansion of the cell wall autofluorescence in BRI1-GFP expressing hypocotyl and root cells before (0 min) and 30 min after application of 10 nM BL (30 min).(0.01 MB PDF)Click here for additional data file.Table S4FWHM changes in the expansion of Calcofluor-stained cell walls in BRI1-GFP expressing hypocotyl and root cells before (0 min) and 30 min after application of 10 nM BL (30 min).(0.01 MB PDF)Click here for additional data file.Table S5Statistics of 72 periclinal cell wall width measurements, each, derived from ultrathin TEM sections of BRI-GFP expressing, high-pressure-frozen root cells, which were either mock-treated or treated for 30 min with 10 nM BL.(0.01 MB PDF)Click here for additional data file.Table S6FWHM changes in the widening of the plasmalemma-bound GFP fluorescence signal in aquaporin-GFP expressing hypocotyl and root cells before (0 min) and 30 min after application of 10 nM BL (30 min.).(0.01 MB PDF)Click here for additional data file.Table S7FWHM changes in the widening of the cell wall autofluorescence in wildtype hypocotyl and root cells before (0 min) and 30 min after application of 10 nM BL (30 min).(0.01 MB PDF)Click here for additional data file.Text S1Calculation of the width of plasmalemma-cell wall sections from apparent GFP fluorescence data .(0.23 MB PDF)Click here for additional data file.

Single nucleotide polymorphisms (SNPs) have been increasingly utilized to investigate somatic genetic abnormalities in premalignancy and cancer. LOH is a common alteration observed during cancer development, and SNP assays have been used to identify LOH at specific chromosomal regions. The design of such studies requires consideration of the resolution for detecting LOH throughout the genome and identification of the number and location of SNPs required to detect genetic alterations in specific genomic regions. Our study evaluated SNP distribution patterns and used probability models, Monte Carlo simulation, and real human subject genotype data to investigate the relationships between the number of SNPs, SNP HET rates, and the sensitivity (resolution) for detecting LOH. We report that variances of SNP heterozygosity rate in dbSNP are high for a large proportion of SNPs. Two statistical methods proposed for directly inferring SNP heterozygosity rates require much smaller sample sizes (intermediate sizes) and are feasible for practical use in SNP selection or verification. Using HapMap data, we showed that a region of LOH greater than 200 kb can be reliably detected, with losses smaller than 50 kb having a substantially lower detection probability when using all SNPs currently in the HapMap database. Higher densities of SNPs may exist in certain local chromosomal regions that provide some opportunities for reliably detecting LOH of segment sizes smaller than 50 kb. These results suggest that the interpretation of the results from genome-wide scans for LOH using commercial arrays need to consider the relationships among inter-SNP distance, detection probability, and sample size for a specific study. New experimental designs for LOH studies would also benefit from considering the power of detection and sample sizes required to accomplish the proposed aims. More than 99% of each person's genome is identical to everyone else's. Many of the differences involve single base pairs, termed single nucleotide polymorphisms (SNPs). SNPs are used as genetic markers to facilitate identification of disease-causing genes, as well as in cancer studies by aiding in determining which regions of the genome may be lost (LOH) or amplified during neoplastic progression. One drawback to SNPs is their low informativity: a SNP is only informative if it is polymorphic on the two different alleles found on each chromosome of a pair; and if there is not an informative SNP in the region of genome of interest, it is impossible to detect alterations occurring there through LOH. A common solution to this problem is to use arrays containing hundreds of thousands of SNPs to ensure adequate coverage, but for many studies this is prohibitive on a cost and sample amount basis. In addition, SNP distribution itself can constrain the size of loss that can be reliably detected at the population level. We examined the relationship between chromosome loss sizes and detection probability of LOH genome-wide. The study provides useful information for researchers designing LOH-related studies and evaluating results obtained from such studies. Single nucleotide polymorphisms (SNPs) are common DNA sequence variations and have been widely investigated for their roles in disease causation or assochttp://www.ncbi.nlm.nih.gov/SNP), the heterozygosity (HET) rates estimated for a substantial number of SNPs have large estimated variances, likely due to small sample sizes, among other reasons [Detection of LOH requires SNPs to be heterozygous . In the largest public SNP database, dbSNP directly by population allele frequencies [These results indicate that a significant number of the SNPs in dbSNP have large estimated variances, which would not provide enough precise information for designing studies requiring the accurate estimation of SNP HET rates . Traditionally, for diallelic alleles with quencies . This merh(1 − rh))/(N − 1), where N is the sample size. N = 100), the confidence interval or CVs are quite large for all values of HET rates listed, particularly for lower HET rates . With 500 subjects tested, the estimated CI and variance are small, but such a sample size is prohibitively large for many studies.Using hypothetical parameters for true HET rates and sample sizes, we first show the relationships among true HET rates, estimated HET rates, their estimated variances, and sample sizes using the score method with continuity correction . The varrsh versus a prespecified HET rate value rh0 . With a given power and sample size n, we have:We introduce two different approaches to deal with the unrealistically large sample size requirement. In using SNPs to evaluate LOH in a specific chromosomal region, it is desirable that the HET rates of selected SNPs used in the region be higher than a specific value to increase the probability that at least one SNP will be informative for each patient. Therefore, the question is to test the statistical hypothesis for the HET rate of a specific SNP βZ, where αZ and βZ are the 100(1−α)th and 100(1−β)th percentile of the standard normal distribution.To get sample size, we have: H0 is reasonably small in most cases; e.g., when rh0 = 0.2, and rsh = 0.35, only 50–72 subjects need to be tested. However, when a SNP HET rate rsh is near the desired threshold value rh0, the required sample size becomes much larger.Using h using the hypothesis 0: h = hH0 versus H11: h = h, (h1< h0). The likelihood ratio isα, and type II error level β, (power = 1 − β ), it has been shown that sample testing should continue if lnln) < lnln(λ) reaches or passes beyond the two bounds, then sample testing should stop. The hypothesis H0 will be accepted when ln ln(λ), or H0 will be rejected and H1 accepted when ln(λ) ≥ lnh,0h1, α, β, and the underlying HET rate h of a specific SNP. In the SPRT approach, for fixed h, α, and β, the ASN (average sample number) depends on h0 and h1. h0 = 0.3, and h1 = 0.2 against various true (sample) SNP HET rates h. For example, if the true SNP HET rates under testing are h = 0.4 or above, approximately 15 to 40 subjects need to be tested, on average, to make a decision on whether h = h0, and, under the most optimistic situations, only four subjects are necessary to determine the HET rate regarding hypothesis H0. Depending on the goals of a study, the SPRT method could be used to significantly reduce the testing sample size required for SNP HET rate inference level th (0 < th ≤ 0.5), then k SNPs are needed such that 1 − (1 − th)k ≥ threshold to guarantee at least one or more heterozygous SNP will be in the lost segment. However, th is not constant across all SNPs (k SNPs are needed to have:k) to satisfy α level which guarantees that the left-hand-side of α) 100% of the time. The probability density distribution of k is shown in k) is 10, and for a SNP HET rate ≥0.4, the required number of SNPs (k) is 9 .We also examined the number of SNPs needed for reliable detection of LOH for random chromosomal regions of a specific length assuming the SNP HET rate distribution shown in all SNPs . TherefoNP rates , Monte CGiven the non-random distribution pattern of SNP HET rates in the genome, the next obvious question is how long (in base pairs) must a random chromosomal segment be to contain one or more heterozygous SNPs so that LOH is detected with a high probability . Based on HapMap data, we used three approaches to ascertain this relationship, including simulation using the fitted dbSNP HET rate distribution pattern in s be the size (in nucleotide base pairs) of the DNA being lost on a chromosome, d the distance (in nucleotide base pairs) between two SNPs (inter-SNP distance), and heth the SNP HET rate, assuming the SNPs to be evenly distributed. If s ≤ d, the probability of the lost DNA segment containing a SNP can be estimated as p = d = phhetp . The probability that at least one SNP is heterozygous can be estimated as dp = 1 − (1 − heth)k. The relationships are shown in Many publications ,18–20 ha = phhet A. When sFinally, we used a bootstrap method to randomly sample the heterozygous SNPs on Chromosomes 1, 3, 9, and 17 genotype data within a 500 kb window in two human subjects from the HapMap database. Using SNPs for LOH detection is of great value for chromosomal instability studies and cancer risk prediction, but a better understanding of the resolution of the technique and how to select an informative panel of SNPs for a given application is needed. The variances of SNP HET rates are large for a large number of SNPs. In most cases, this is likely to be due to the small sample sizes used for estimation of allele frequencies in most cases. Differences in ethnic groups might also contribute to the variance of averaged HET rates. Relatively large sample sizes are needed to accurately estimate SNP HET rates using traditional methods. In order to reduce sample size for practical use, we presented two statistical methods that could be used to determine the number of individuals in the population that would need to be examined to determine if a SNP HET rate was above or below a specified threshold. The Monte Carlo simulation was performed on SNPs in dbSNP with HET rate estimation values ≤0.5 as well as all SNPs, with essentially no change in the conclusion of the study . Only 0.r2), the estimation of r2 and variance of r2 themselves are subject to the effects of sample size and evolutionary history of specific SNPs [r2 should be considered when r2 are used for inferring SNP HET rates if a study has stringent requirements .Based on specific study goals or technologies, more study specific methods such as truncated SPRT schemes could pofic SNPs . TherefoWe did not distinguish coding and non-coding regions of the genome in this simulation since Cargill et al. reportedp > 0.95 or 0.99) detecting LOH of segment sizes smaller than 50 kb (Our study showed that a region of LOH greater than 200 kb could be detected with high probability (>90%), with losses smaller than 50 kb having a substantially lower detection probability when using all SNPs currently in the HapMap database . Higher an 50 kb . Finallyan 50 kb ; howeverUsing dbSNP and HapMap data, this study evaluated the distribution of SNP HET rates and resolution of LOH genome wide. The results of this study have two important implications that might improve design and interpretation of future genome wide LOH screens of cancers and premalignant tissues. First, retrospective review of previous genome-wide LOH screens indicate that technology limitations used in the experiments could have missed significant numbers of LOH events that were below the resolution of the SNP array –31. By uLOH has been frequently proposed as a candidate biomarker for cancer risk prediction. The ability to detect an LOH event will depend on informativity, SNP density, and the size of the LOH event. Our results could improve sample size calculations for design of future LOH studies. If one would like to detect the effect of an LOH event on the risk of progression to cancer, then the sample size depends on the LOH detection probability. For example, in a study with a 1:5 ratio of cases and controls, a minimum detectable relative risk of the LOH of 5, a statistical detection power 0.9, and an LOH prevalence rate of 30% among informative subjects, at least 23 cases and 117 controls will be needed if the LOH detection probability is 100% (large region loss or high density of informative SNPs). However, if the LOH detection probability is 0.7 or 0.3, for example, , then at least 44 cases and 190 controls or 116 cases and 468 controls will be needed, respectively.All the results obtained in this analysis are based on the assumption that heterozygous SNPs are required for detection of LOH. New technologies are emerging that could be used to detect chromosome copy number changes (including deletion) using homozygous SNPs with a reasonably high accuracy ,34. Howeftp://ftp.ncbi.nih.gov/snp/organisms/human_9606/database/organism_data/). HapMap SNP data for the human genome were downloaded from the HapMap Web site (July 2006 release) (http://www.hapmap.org/genotypes/). We only used the CEU population (Utah residents with Northern and Western European ancestry) data from HapMap. Our methods can easily be extended to other ethnic group data. The estimated SNP HET rates >0.5 were dropped from the analysis of HET rate distribution. The estimated variances for SNP HET rates were directly obtain from dbSNP.The data for SNPs HET rates were downloaded from dbSNP (build 126) which guarantees that the left-hand-side of α) 100% of the time (Data from dbSNP were used to summarize the HET rate distribution pattern of SNPs and evalthe time . The simthe time was donethe time red lineTo examine the spatial pattern of LOH detection probability along a chromosome , we chos

We introduce a QTL-mapping algorithm based on Statistical Machine Learning (SML) that is conceptually quite different to existing methods as there is a strong focus on generalisation ability. Our approach combines ridge regression, recursive feature elimination, and estimation of generalisation performance and marker effects using bootstrap resampling. Model performance and marker effects are determined using independent testing samples , thus providing better estimates. We compare the performance of SML against Composite Interval Mapping (CIM), Bayesian Interval Mapping (BIM) and single Marker Regression (MR) on synthetic datasets and a multi-trait and multi-environment dataset of the progeny for a cross between two barley cultivars.In an analysis of the synthetic datasets, SML accurately predicted the number of QTL underlying a trait while BIM tended to underestimate the number of QTL. The QTL identified by SML for the barley dataset broadly coincided with known QTL locations. SML reported approximately half of the QTL reported by either CIM or MR, not unexpected given that neither CIM nor MR incorporates independent testing. The latter makes these two methods susceptible to producing overly optimistic estimates of QTL effects, as we demonstrate for MR. The QTL resolution (peak definition) afforded by SML was consistently superior to MR, CIM and BIM, with QTL detection power similar to BIM. The precision of SML was underscored by repeatedly identifying, at ≤ 1-cM precision, three QTL for four partially related traits . The set of QTL obtained using a 'raw' and a 'curated' version of the same genotypic dataset were more similar to each other for SML than for CIM or MR.The SML algorithm produces better estimates of QTL effects because it eliminates the optimistic bias in the predictive performance of other QTL methods. It produces narrower peaks than other methods (except BIM) and hence identifies QTL with greater precision. It is more robust to genotyping and linkage mapping errors, and identifies markers linked to QTL in the absence of a genetic map. The notion that DNA polymorphism explains the phenotypic diversity of living organisms has been the driving force behind the Human Genome Project and widespread investment in plant and animal genomics. Over the last 30 years, many examples of causal effects on phenotypes arising from DNA sequence variation have been reported. Finding associations between DNA variation and phenotypes is straightforward for 'simple' traits that are inherited in a Mendelian fashion as monogenic characters. Yet, most of the economically important phenotypic variation (e.g. crop yield and its components) is inherited through a number of Quantitative Trait Loci (QTL) with different magnitudes of effect and complex interactions among themselves and with the environment .QTL can be identified through their genetic linkage with molecular markers. In a typical experiment, the progeny of an experimental population are simultaneously analysed for their genetic makeup (molecular markers) and one or more phenotypic traits of interest. The marker data are used to build a genetic map, which is a pre-requisite for the majority of QTL-detection methods ,3. The sThe Composite Interval Mapping (CIM) approach refines the SIM algorithm by incorporating background markers as cofactors into a multiple regression model . In thisHere we explore a conceptually quite different QTL-mapping approach that focuses on generalisation ability. The approach is based on Statistical Machine Learning (SML) and differs from other methods in that it estimates the generalisation performance of a QTL model by splitting the data into independent training and testing subsets that are used for model induction and evaluation, respectively Figure . Resamplchange in variance explained after each elimination (measured on the test set) to the marker that was removed. The entire process is then repeated numerous times to derive an unbiased bootstrap estimate of the predictive power of each marker. To generate a QTL profile across the genome, the contributions of genetically linked markers within a sliding map window are added.Our QTL detection method determines the contribution of each marker to the model performance during the recursive feature elimination (RFE) procedure. First, a linear model containing every marker is fitted to the phenotype. The model is then reduced in size by recursively eliminating the least useful markers and refitting the model until only a single marker is left, which is similar to recursive feature elimination support vector machines ,11. We a1 of a cross between cultivars Steptoe and Morex, and study some synthetic datasets.We compare the performance of the SML algorithm with the performance of two conventional QTL-mapping methods and the more recently developed BIM. For this purpose, we re-analyse a well-known multi-trait and multi-environment dataset for a population of doubled haploid (DH) lines derived from the FIn QTL mapping, we are primarily interested in quantifying the influence of genotypic variation on phenotypes. In practice, this is confounded by environmental variation to differing extents depending on the trait. In this paper, we limit our approach to mapping the genotypic component of the traits. The interaction between QTL and environments (QTL × E), an important element influencing phenotypic variation of many quantitative characters, will be addressed in a separate paper.In order to precisely measure the genotypic component we use data collected on genetically identical Steptoe/Morex DH lines grown in multiple environments. We standardise the phenotypes within each environment to a mean of 0 and a standard deviation of 1, and then calculate the mean (per phenotype and genotype) across all environments. The scaling within environments aligns the distributions, and the averaging provides an estimate of the common underlying signal. The resulting increase in QTL detection power for a whole-genome SML model based on 548 markers is demonstrated in Figure α-amylase, and plant height where the inclusion of more environments produces a substantial increase in performance over a single environment. We can therefore use the degree of increase in variance explained as a crude measure of environmental "susceptibility" or, conversely, heritability of the trait. For example, heading time appeared to be less influenced by environmental factors (2-fold increase in variance explained) than plant height (3.5-fold increase) and the degree of lodging (5.5-fold increase). The performance improvement due to the inclusion of multiple environments is, of course, accompanied by a decrease in the fraction of the total (multi-environment) variance that remains after averaging the scaled phenotypes across environments . It starts with a whole-genome model and progressively eliminates individual markers from the model. When the algorithm starts removing markers with predictive value, the predictive variance explained starts dropping. The number of markers in the smallest model that explains a close-to-maximum fraction of the variance can therefore be used as an indicator of the genetic complexity of a trait.The SML algorithm combines Recursive Feature (marker) Elimination (RFE) with ridge regression and bootstrapping (see Pub). All additional markers actually decrease performance as they only add noise rather than information. This effect was also observed for other traits such as yield (not shown). Plant height is an example of a trait that can be accurately modelled with a small number of markers, thus suggesting a relatively low genetic complexity. Diastatic power and α-amylase, by contrast, are traits that appear to be genetically quite complex. For example to accurately model diastatic power, 100 markers are required, while 400 markers are required for α-amylase. These large numbers suggest that the genetic signal is spread out throughout the genome, and that many markers influence the phenotypic outcome.Figure To verify the accuracy of estimating the number of QTL, we performed simulation experiments using a group of 100 artificial datasets. These datasets were simultaneously analysed by Bayesian Interval Mapping (BIM) ,13 for tMethods). In this way, independent data are reserved for testing the model derived from the training data. This approach produces less biased estimates of the generalisation error (the predictive performance of a model on data unseen during training), and hence a better estimate of the true effect of a putative QTL [An important estimation technique used in our method is bootstrap resampling. Bootstrap resampling involves creating a subset of the data for training, and using the remainder for testing . This is despite the fact that SML uses marker information only, while CIM requires the additional information of a genetic map. The BIM profiles were less correlated with the profiles generated by other methods on average.To further benchmark SML against other QTL mapping methods, we identified QTL for nine traits using SML, single Marker Regression (MR), Composite Interval Mapping (CIM) and BIM. In the case of CIM we used 20 markers at > 10 cM distance from the investigated interval to adjust for the genome background. For BIM, the default values specified in the R/qtlbim package were used for the priors and sampling parameters. Table p < 0.05 , diastatic power , grain protein content , malt extract , heading date (2 H), height , lodging and yield (3 H) .We also compared the genome profiles of variance explained (the QTL effects) derived from the 100 synthetic datasets discussed earlier, in order to benchmark SML against BIM and MR. These methods were selected to represent the two extremes of algorithmic complexity of existing QTL mapping methods. To summarise these profiles and give an idea of overall performance of each method, we considered each dataset to be a binary classification problem – for each marker, classify it as a QTL or not a QTL. Such a binary classification can be accomplished by choosing a threshold and classifying markers exceeding this threshold as linked to QTL. However, as the threshold affects the trade-off between type-I and type-II errors, we used the Area under the Receiver Operating Characteristic (AROC) to measup = 0.499). We conclude that both methods are similar with respect to locating QTL.Figure Finally, we examined a single synthetic dataset comprising of a 2,000 cM-long 'chromosome' that contained 20 randomly positioned QTL of random strength. Figure amount of variance explained supportable by the data will be less than the theoretical variance explained shown in red due to small sample size (100 samples with 2001 features) and noise. Measuring the AROC on both variance explained profiles gives 0.83 for SML and 0.78 for BIM, indicating the SML peaks are better aligned with QTL and more distinct than the BIM peaks.It is important to emphasize that the Amy2 (64 cM) and Brz (95.2 cM) affecting the trait. Figures ic power ,18.α-amylase QTL could be attributed to Amy2, a structural gene encoding low-pI α-amylase [Amy2 locus (the other was further away). Given that various partially related traits mapped to identical QTL with less than 1-cM precision superfluous markers will be removed. The remaining marker(s) will still explain most of the variance, while the variance attributed to the superfluous markers will be small, thus resulting in well-defined QTL peaks.Genotyping errors affect the accuracy of the marker order on a genetic map and hence the performance of QTL-detection methods that require a linkage map. We compared the QTL profiles produced with SML, CIM and MR using two different genotypic datasets: the dataset underlying a 'raw' version of the Steptoe/Morex map and the dataset corresponding to a 'curated', re-optimised version of the map . Table Statistical validation of QTL through bootstrapping above). However, 81% of these QTL were consistent between map versions. In contrast to CIM, the SML method can function independently of a genetic map. We only used the map for smoothing and conveniently plotting the results. An erroneous marker order in a linkage map, therefore, affects SML only marginally during the final smoothing/plotting step.As a result of the bootstrap-validation step, SML reported less than half of the QTL identified by other methods but arguably higher than that of a typical dataset generated with (semi)manually scored markers (AFLP or SSR). From this it follows that:Interestingly, the quality of the "crude" genotyping data set used in the analysis reported here is lower than that of a typical dataset produced by a standard DArT assay (see the 'Genotypic data' section in 1. 'Standard' QTL mapping approaches (like CIM), when performed on genotyping datasets obtained with gel-based marker technologies, may produce inconsistent marker/trait associations; and2. The SML approach is likely to perform well in detecting and estimating QTL effects when using marker data with a quality similar to that of a standard DArT assay, with negligible improvement afforded by either replicating DArT assays or employing technically more complex and costly SNP genotyping platform(s).The QTL identified with SML are broadly consistent with those detected by other methods. Yet the SML algorithm offers some advantages over QTL methods such as MR, CIM and BIM. SML produces narrower peaks than MR and CIM and hence identifies QTL with greater precision. BIM generates similarly narrow peaks as SML, but unlike SML seems to underestimate the genetic complexity of traits and overestimate the QTL effects on synthetic data. Because of the use of bootstrap resampling, SML avoids the optimistic bias in predictive performance (% variance explained), which is an inherent feature of other methods. Consequently, SML provides better estimates of the QTL effects supportable by the data, thus reducing the false-discovery rate.Finally, unlike several other QTL algorithms SML does not require a genetic map. It is therefore applicable to any species or population. Because of this feature, SML is a potentially attractive alternative for association-mapping experiments, an idea that will be explored in a future paper.1-derived DH plants from a cross between barley cultivars Steptoe and Morex [Our study is based on existing data for 94 Fnd Morex -23. Thisnd Morex .We used part of the segregation data from a high-quality Steptoe/Morex map with more than 1,000 markers. This map was built from RFLP, DArT and SSR markers , and hadmachine-learning algorithm below). Genotypes (A/B) were used to identify QTL using the map-based CIM approach. Missing genotypes were replaced with expected genotypes derived from flanking markers after genetic-map construction.Allele calls (0/1) were used to identify QTL using SML and MR. Missing allele calls were imputed with 0.5 because the ridge regression algorithm underlying our method works on continuous input values (see section entitled QTL error > 4) [For the purpose of displaying SML results and identifying QTL by CIM, we built a genetic map for the dataset of 548 selected markers . The marker order was established with RECORD software, and the cM distances between markers were estimated using a multipoint regression algorithm ,26. The ror > 4) with misThe phenotypic data for nine traits, measured in up to 16 different environments, were downloaded from the GrainGenes website Additio.pij be the phenotype measurement for plant i in environment j, nenv, nmrk, and np be the number of environments, markers, and plants respectively. Then the mean and standard deviation of phenotypes within environments are given byWe introduce a method strongly related to principal component analysis. Let sj and j calculated across all plants i ∈ 1..np. The scaled phenotypes are then given bywhere Finally, we can combine the estimates into a single more robust value by calculating the mean across all environmentssj and Note that missing values can be handled during the calculation of yi are very similar to results obtained by projecting onto the first principal component. This can be seen by observing that the yi provide a good linear approximation to the full set pi,j. We verified this on the barley dataset by calculating the principal component projection and measuring the correlation with the values obtained by the above method. The result was a mean correlation coefficient of 0.99 across all traits.These final values R/qtl package [Synthetic datasets were created using the package . All datThe QTL detection algorithm is based on a few key concepts: a linear predictive model, recursive feature elimination, bootstrap resampling for estimation of model performance and marker effects, and generation of QTL profiles by local summation. Figure xij be the genotype of plant i at marker j, and i. Under the linear assumption, the estimate of yi for plant i isUnderlying our whole technique is the assumption of linear dependence. We assume that contributions from markers are additive. Let K is a set of markers, xik is the genotype of marker k for plant i, b is the bias parameter.where b are estimated from the training data using the well-known ridge regression algorithm [The parameters lgorithm ,30. In bλ > 0 is a tuning parameter for adjusting the amount of regularisation. The regulariser encodes a preference for smoother functions by shrinking the weights towards 0 , and gives both a unique solution to the ill-posed minimisation problem and increased robustness against noise. For our QTL analyses, we set λ = 1.where the first term is the sum of squares, the second term is the regulariser, and K of low cardinality (i.e. with a low number of elements in the set) that is sufficient for accurate phenotype prediction. This feature (marker) selection is performed by using Recursive Feature Elimination (RFE) to train and evaluate linear models ranging in size from all features to one feature.While a model over the entire set of markers is useful for predicting the phenotypic outcome, we wish to determine the key markers contributing to the genetic variation of traits. In other words, we seek a model with βk). As the model is linear and all markers have the same range, the absolute value |βk| is an estimate of the importance of the marker k. The kth marker with minimal |βk| is deemed the least important and is discarded. Note that re-optimisation of RFE commences with the full model using all features and then discards the least important feature. This process is recursively applied until a model of desired size is reached (we created models down to one marker). In coupling RFE with ridge regression (RFE-RIDGE), the importance can be estimated from the weights t from applying ridge regression with the set of markers Mt. The initial model at time step t = 1 is fitted with all markers M1 = {1,2,..., m}. At each time step, determine the least important feature as Mt+1 = Mt\{ζt}.More precisely, let ε-0 bootstrap method was used [To estimate the performance of models the was used . As mentb) and we wish to evaluate the variance explained on some test set T. Then, the variance explained is defined asTo evaluate the performance of a model we used the fraction of variance explained as a criterion. Suppose we have a model (where j | βkl = 0} > {# j | βj(i+1) = 0}, and dl be the marker eliminated between ml and ml+1. ThenIn addition to evaluating the model, a measure of the contribution of individual markers is needed to locate putative QTL. Quantifying these can be done by recasting this problem as a novelty-detection problem: we wish to quantify the amount of additional predictive power provided by each marker given some already selected set of markers. We measure this degree of novelty using the models built with RFE-RIDGE. As RFE-RIDGE produces nested subsets of selected markers, we can attribute the change in variance explained to the marker that was removed between two consecutive models. More precisely, let is a measure of the novelty of a marker with respect to all the remaining markers in the model. We expect that a key QTL marker will be novel in this sense and result in a large change of variance explained when dropped from the model. The average over the bootstrap iterations provides a robust estimate of the importance of each marker to trait prediction. This estimate is referred to as r2 (dl) is immediately useful; we can examine which markers are found to have significant contributions. If a linkage map is available, we can use it to create graphs similar to conventional QTL profiles by simply plotting The information provided by ΔFinally, there are two methods for determining a 95% significance threshold. We assume the smoothed tributed , and 95%si be a score (for example the apportioned variance explained produced by the SML) for each marker i, Q be the set of indices of 'QTL markers' and N be the set of indices of 'non-QTL markers.' The AROC is then given byThe Area under the Receiver Operating Characteristic (AROC) is a genGiven a finite set of scores the AROC can simply be estimated by counting:To obtain the fraction of variance explained for individual markers, the Pearson correlation coefficient between the marker and the phenotype was squared. A phenotype permutation test of 1,000 iterations was used to derive empirical 95% significance thresholds for genome profiles of variance explained .QTL were also identified by CIM using Cartographer 2.5 software ,36. The qtlbim [Finally, SML was also benchmarked against BIM using thqtlbim . The algThe QTL profiles generated by different methods were compared by computing the Pearson correlation coefficient between the genome profiles of variance explained. For the comparison between different map versions , the genome scans were first approximated by loess curves based on 1,000 evenly spaced loci.p < 0.05). Each contiguous stretch of above-threshold markers was considered to belong to a single QTL peak. Small clusters of above-threshold markers at less than 5 cM distance from such a stretch of markers (if present) were considered to be part of the shoulder of the same QTL peak. The overlap between the sets of QTL identified using different methods (or map versions) was quantified by counting the instances in which they detected significant QTL within 10-cM of each other.Statistically significant QTL were identified for each method by recording the cM positions of peak maxima in genome-wide plots of variance explained QTL detected with different algorithms and trait .Click here for fileUnsmoothed results obtained in the analysis of a synthetic 'chromosome'. PowerPoint file with two plots containing the unsmoothed results from which the plots in Figure Click here for fileGenotypic data used for QTL analysis. Excel file containing 0/1 allele calls and A/B genotypes (segregation data) for both the 'raw' and the 'curated' Steptoe/Morex genetic map.Click here for filePhenotypic data used for QTL analysis. Excel file containing phenotypic data for the nine traits investigated in this study . The data is from up to 16 different environments and includes averages across standardised environments (see section entitled 'Pre-processing of phenotypic data' in Methods).Click here for file

The antigenically variable neisserial opacity (Opa) proteins are expressed during infection and have a semivariable (SV) and highly conserved (4L) loop that could be targeted in a vaccine. Here we compared antibodies to linear (AbSV cyclic bound a greater number of different Opa variants than AbSV linear, including variants that differed by seven amino acids. Antibodies to the 4L peptide did not bind Opa-expressing bacteria. AbSVcyclic and AbHV2cyclic, but not AbSVlinear or AbHV2 linear agglutinated homologous Opa variants, and AbHV2BDcyclic but not AbHV2BDlinear blocked the association of OpaB variants with human endocervical cells. Only AbHV2BDlinear were bactericidal against the serum resistant parent strain. Consistent with host restrictions in the complement cascade, the bactericidal activity of AbHV2BDlinear was increased 8-fold when rabbit complement was used. None of the antibodies was protective when administered vaginally to mice. Antibody duration in the vagina was short-lived, however, with <50% of the antibodies recovered 3 hrs post-administration.Ab2 loop-specific cyclic peptides elicited antibodies with agglutination and adherence blocking abilities. The use of human complement when testing the bactericidal activity of vaccine-induced antibodies against serum resistant gonococci is also important.We conclude that an SV loop-specific cyclic peptide can be used to induce antibodies that recognize a broad spectrum of antigenically distinct Opa variants and have agglutination abilities. HV Gonorrhea is the second most commonly reported disease in the United States with over 350,000 cases reported in 2006 N. gonorrhoeae does not express a capsule, which is the target of several effective meningococcal vaccines. Therefore, research towards a gonorrhea vaccine has focused on other surface antigens such as outer membrane proteins. The neisserial opacity (Opa) proteins are a family of outer membrane proteins that mediate adherence to and invasion of tissue culture cells opa genes 1 and HV2) loops, and one conserved (4L) loop opa gene undergoes phase variation via a frame shift mechanism, and therefore, a single gonococcus can express no Opa proteins, one Opa protein, or multiple Opa proteins simultaneously The development of a gonorrhea vaccine is challenged by the lack of known correlates of protection. Repeat infections are common even with the homologous strain N. gonorrhoeae appears to be important during urogenital tract infections. The majority of urethral isolates from naturally The expression of Opa proteins by N. gonorrhoeae and the capacity to protect female mice from experimental genital tract infection when delivered topically.While the HV loops are highly variable among Opa proteins, the SV and 4L loops are relatively and highly conserved, respectively and could be targeted in a vaccine. Immunization with whole Opa proteins may prevent generation of high levels of antibodies against the conserved loops due to the immunodominance of the HV loops SVlinear) and 4L (Ab4Llinear) loop sequences by western blot. Ab4Llinear strongly recognized all of the Opa proteins of strain FA1090 except OpaE bound homologous Opa variants in a dose-dependent manner assay, which utilizes whole gonococci, was used to compare the concentration of antibodies needed for detectable binding to the different Opa variants of strain FA1090. Affinity-purified rabbit antibodies against linear HVt manner and not variants , which i compare . No specn tested .SVcyclic bound intact OpaA, OpaB, OpaD, OpaF, OpaK and OpaI variants above background in the SBI assay at a dilution of 1∶40, while OpaC, OpaE, and Opa-negative variants were not recognized by AbSVcyclic bound OpaA variants as well as OpaK and OpaF-expressing gonococci, but none of the other Opa variants. AbSVcyclic bound the same set of Opa variants as recognized in the SBI assay, but not OpaC or Opa-negative variants (2BD peptide bound OpaB variants at a higher dilution (1∶100) than antiserum against the cyclic SV loop peptide (1∶30). Ab4Llinear did not bind any Opa-positive gonococci at concentrations of 1.2 µg/mL or 2.4 µg/mL (data not shown), a result that confirms the negative SBI results with these antibodies with NHS versus 1∶288 (3.5 µg/mL) with BBS) .Strain FA1090 is inherently resistant to the bactericidal activity of NHS due to the binding of the complement regulatory protein human C4b-binding protein (hC4BP) to its porin e strain . To furtith BBS) . AbHV2BDHV2BDcyclic agglutinated OpaB variants at a titer of 1∶200 with ∼40 aggregates per 40X field compared to only ∼4 aggregates per field with the same dilution of NMS. (HV2BDlinear did not agglutinate OpaB variants at dilutions as low as 1∶2 (500 µg/mL) (data not shown). AbSVcyclic agglutinated OpaA and OpaB variants but not OpaK variants at a titer of 1∶12.5 compared to NMS (SVcyclic bound OpaK variants. AbSVlinear did not agglutinate any Opa variants tested (data not shown).The capacity to agglutinate bacteria may facilitate shedding of bacteria in vaginal secretions and thus may be another important effector function of antibodies. Ab of NMS. . In contd to NMS althoughHV2BD linear, AbHV2BDcyclic, or AbSVcyclic. Treatment with AbHV2BDcyclic (SVcyclic (data not shown) resulted in a dose-dependent decrease in the number of cell-associated bacteria as compared to NMS. In contrast there was no decrease in the number of cell-associated bacteria when bacteria were treated with 0.25 µg/mL or 2.5 µg/mL of AbHV2BDlinear versus AbHV2Clinear, which does not bind OpaB variants (data not shown). We conclude AbHV2BD cyclic, but not AbHV2BD linear block OpaB-mediated interactions with human endocervical cells.Antibody-mediated inhibition of Opa-mediated adherence and invasion may also be protective. Most Opa proteins mediate invasion of human cells via binding to human carcinoemybryonic cellular adhesion molecules (CEACAMs) Dcyclic but not N. gonorrhoeae despite the absence of human CEACAMs The CEACAM residues that are important for Opa-mediated adherence are not conserved in the murine CEACAM1 HV2linear, and the amount of rabbit IgG in vaginal washes was measured over time. A 50% decrease in the amount of rabbit IgG recovered was observed between 2 and 15 min post-inoculation. Antibody levels were maintained for at least another 45 min, after which a gradual decline was observed over the next 4 hours. Low levels of antibody were detected in all but one mouse at 9, 12, and 24 hrs post-inoculation on days 1 and 2 post-inoculation. However, this difference was not observed in two subsequent experiments and statistical analysis of combined data from all three experiments showed no significant decrease in recovery of gonococci from mice inoculated with AbHV2BD linear-treated OpaB variants on days 1 and 2 post-inoculation compared to AbHV2Alinear-treated bacteria (HV2BDlinear and 71% of the AbHV2A linear-treated mice infected on day 1 (p = 0.45). We considered the possibility that subpopulations of gonococci that express a different Opa protein than that of target variant were responsible for the colonization of test groups. However, the distribution of Opa phenotypes of vaginal isolates on day 1 did not differ significantly from that of the inoculum in any experiment. We conclude that none of the HV2-specific antibodies tested are protective against N. gonorrhoeae colonization, including antibodies with bactericidal activity, and the lack of effectiveness of these antibodies in vivo is not due to escape variants establishing infection.None of the HV2-specific antibodies that we tested as potential positive controls in studies with SV loop-specific antibodies showed protection. Results from initial pilot studies suggested inoculation of mice with 10ctively) . There wN. gonorrhoeae is a highly successful Gram-negative bacterium that is noted for the antigenic variability of its surface and the frequency by which it causes repeat infections. Opa proteins are expressed during infection and have two conserved loops, the SV and 4L loops, which could be targeted in a vaccine. Here we analyzed antibodies against peptides that correspond to the SV and 4L loops for the capacity to bind to gonococci that express different Opa proteins and for correlates of antibody-mediated protection. Antibodies against linear or cyclic peptides that correspond to the SV loop recognized intact gonococci as assessed by two different methods, and promisingly, antibodies generated against cyclic SV peptides bound the surface of 6 of the 8 Opa variants of strain FA1090, including Opa variants with 7 amino acid differences from the target peptide. In contrast, 4L-specific antibodies did not bind the bacterial surface. The cyclic SV loop peptide also induced antibodies with agglutination ability, while the SV linear peptide did not. The broader reactivity and agglutinating ability of AbSV cyclic may be explained by the fact that the cyclic SV peptide was longer (36 amino acids) than the linear peptides (20 amino acids) and included more conserved regions of the loop. Cyclic peptides may therefore carry more conserved epitopes, T-cell epitopes, and possibly conformational epitopes that are shared by Opa proteins with a less related primary sequence. Interestingly, bactericidal activity was only exhibited by antibodies against linear peptides. This result was in contrast to the demonstration that cyclic peptides were more successful for inducing bactericidal antibodies against the class 1 protein of N. meningitidisHV2BD linear and AbHV2BD cyclic, one should consider the fact that the antibodies were produced in different animal species and that AbHV2BD linear were high titer affinity-purified antibodies. Antibodies generated by the linear or cyclic SV loop peptides were not bactericidal, however, even when rabbit serum was used as a complement source to by-pass the host-restricted serum resistance of this strain. It is possible that a different adjuvant might improve the potential of the SV loop as a vaccine target by promoting the induction of bactericidal antibodies.With regard to the difference in bactericidal activity between AbN. gonorrhoeae. Some P1B strains, like strain FA1090 are resistant to NHS due to the binding of human C4BP to the P1B molecule HV2BDlinear killed OpaB variants of a SS derivative of strain FA1090 better than SR wild type OpaB variants when NHS was used as the complement source. AbHV2BDlinear was also more bactericidal against OpaB variants of strain FA1090 when rabbit serum was used. These results illustrate the importance of considering the complement source in bactericidal assays designed to predict vaccine efficacy in humans versus laboratory animals. Ideally, antibodies that are strongly bactericidal against SR strains in the presence of NHS are desired.We also showed that the species used as the complement source in bactericidal assays is important when examining the bactericidal activity of vaccine-induced antibodies against SR strains of N. meningitidis elicited an antibody response, which while not always bactericidal, blocked Opa-CEACAM interactions on tissue culture cells HV2BDcyclic but not SV-specific antibodies decreased the total number of bacteria associated with CEACAM-expressing endocervical cells. The inability to block adherence with SV-specific antibodies is in accordance with studies on N. meningitidis Opa proteins that show the SV loop is not involved in CEACAM-binding A vaccine-induced immune response against Opa proteins could also block Opa-mediated adherence and invasion, which has been the focus of vaccine studies on meningococcal Opa proteins. de Jonge et al. 2 loop-specific antibodies showed no protection in mice when mixed with the homologous variant prior to vaginal inoculation. We conclude the SV or HV2 Opa protein loops may not be effective targets for antibody-mediated protection. It is possible, however, that technical limitations may have prevented us from detecting a protective effect. The concentration of antibodies may not have been high enough and similar to that reported by Sherwood et al. Chlamydia trachomatis was detected in mouse vaginal secretions for up to 48 hrs when delivered intraperitoneally 2-specific rabbit antibodies used in this study, and we therefore chose to deliver the antibodies topically.Finally, SV loop-specific and selected HVIn summary, we have demonstrated that broadly-reactive antibodies can be generated against a relatively conserved Opa protein loop that bind to the bacterial surface and have agglutination ability. These antibodies could potentially recognize many Opa variants produced by different gonococcal strains and therefore, the use of different adjuvants or other strategies to induce high titered SV loop-specific antibodies with bactericidal activity that can be delivered systemically is warranted. The in vitro and in vivo experiments described here should be useful in the development of other vaccine antigens against gonorrhea.Neisseria gonorrhoeae strain FA1090 was originally isolated from a female patient with disseminated gonococcal infection. Strain FA1090 expresses 8 antigenically distinct Opa proteins: OpaA, OpaB, OpaC, OpaD, OpaE, OpaF, OpaI and OpaK. Frozen stocks of each Opa variant were prepared as described F62por5–8 is a serum sensitive (SS) derivative of strain FA1090 in which porin loops 5–8 were replaced with loops 5–8 of the SS strain F62 as described by Ram et al. F62por5–8 is sensitive to NHS, and does not bind human C4b-binding protein (hC4BP). OpaA, OpaF, and Opa-negative variants were isolated from OpaB-expressing FA1090F62por5–8 bacteria after 2–3 serial passages of individual colonies that were screened by colony suspension immunoblots with HV2-specific antibodies as described N. gonorrhoeae was cultured on GC agar (Difco) with Kellogg's supplement 3)3 at 37°C under 7% CO2. GC-VCNTS agar was as described linear) and mouse antisera raised against cyclic peptides (Abcyclic). Ab4Llinear, AbHV2A linear, AbHV2BD linear, AbHV2C linear, AbHV2F linear, AbHV2I linear, and AbHV2K linear antibodies were previously described SVlinear), which were generated against a linear 20 amino acid peptide (DYPEPTGAKKGKISTVSDYF) that corresponds to the SV loop of OpaA and OpaK (OpaA/K) of strain FA1090 (SV cyclic and AbBD cyclic) to two cyclic peptides that correspond to the SV loop sequence of OpaA/K or the HV2 loop sequence that is common to OpaB and OpaD (OpaB/D) . Cyclic peptides were synthesized by Celtek Peptides through the addition of a disulfide bond between added terminal cysteine residues, and six week-old female BALB/c mice were immunized subcutaneously three times at three week intervals with 50 µg of peptide suspended in TiterMax Gold . Blood was collected two weeks after the final boost, and individual samples were analyzed by enzyme linked immunosorbent assay (ELISA) for peptide-specific antibody titers essentially as described 3 (pH 9.6), and incubated with three-fold dilutions of mouse sera followed by goat anti-mouse IgG (γ chain-specific) conjugated to horseradish peroxidase (HRP) and HRP substrate (Sigma). Absorbance was read at 405 nm on an EL800 Universal Microplate Reader and analyzed with KC Junior software (Bio-Tek Instruments). Background was set at 3 standard deviations above the average A405 readings of 3 wells to which no primary antibody was added. Sera with titers >1∶7,290 were pooled and frozen at −20°C. The relative levels of IgG isotypes within Opa loop-specific mouse antisera were measured with a mouse antibody isotyping kit as per the manufacturer's instructions.Two general types of antibodies were evaluated in this study, specifically affinity-purified rabbit polyclonal antibodies against linear peptides , Ab4L linear , or AbSVcyclic , followed by goat anti-rabbit IgG HRP (Bethyl Laboratories) or anti-mouse IgG HRP (Sigma). Primary and secondary antibodies were diluted in block, and blots were washed three times in PBS with 0.05% Tween 20 after each incubation. Detection was with ECL detection reagent (Amersham Biosciences) as per the manufacturer's instructions. Attempts to utilize an ELISA with whole bacteria as the antigen to measure surface-binding were not successful due to the bacteria not adhering well enough to the wells. Therefore, a semi-quantative surface-binding immunoblot (SBI) similar to that described by Afonina et al. 600 of 0.20 and diluted 1∶20 in PBS. One hundred microliters (∼5×105 CFU) of the final suspensions were applied to a nitrocellulose membrane via a 96-well vacuum manifold apparatus . The membrane was dried at RT, incubated for 30 min at 37°C, and then blocked for 1 hr in PBS with 3% BSA (Sigma). The filter was returned to the manifold and individual wells were incubated for 1 hr with 100 µL of two-fold serial dilutions of affinity-purified rabbit antibodies or mouse antisera . Positive control wells were incubated with serial dilutions of rabbit polyclonal antiserum against heat-killed FA1090 bacteria or the porin-specific monoclonal antibody B2E8 . All antibodies were diluted in PBS with 3% BSA, and secondary detection, washes, and exposure of the membranes to substrate were as for western blots. Spot intensities were quantified by densitometry (Image J Version 1.37v) and the mean intensity of three wells incubated without primary antibody was subtracted from that of wells with Opa-specific antibodies (test wells) or anti-whole bacteria or B2E8 antibodies (control wells). The spot intensities of the control wells were plotted against the antibody concentration or antiserum dilution , and values that fell within the linear regions of the curves were used to normalize for slight differences in the number of bacteria in each spot. Normalized data were obtained by dividing the mean intensity of the test wells by that of the appropriate control well (mouse or rabbit antibody).For western blots, bacteria were suspended in lithium acetate buffer and incubated in Laemmli buffer (Sigma) containing sodium dodecyl sulfate (SDS) and β-mercaptoethanol for 10 min at 100°C to denature the samples or at room temperature (RT) to preserved native conformations. Samples were fractionated on 11.5% SDS polyacrylamide gels and transfered to polyvinylidene fluoride (PVDF) membranes. After blocking in 0.5% Tween 20, membranes were incubated with AbHV2 linear (0.87–1.2 µg/mL), AbSVlinear (2.2 µg/mL), Ab4L linear (2.4 µg/ml), and AbHV2 cyclic (1∶100) and AbSV cyclic (1∶30). Secondary antibodies were goat anti-rabbit or goat anti-mouse IgG conjugated to AlexaFluor 488 (1∶500) and incubations were for 30 min. All antibodies were diluted in blocking buffer and wells were washed five times with PBS after each incubation. Antibodies specific for the HV2 loop of each Opa variant were used as positive controls (0.87–1.2 µg/mL) in all IFA assays; polyclonal rabbit antisera against heat-killed FA1090 was used as a positive control for Opa-negative variants; negative controls were antibodies against heterologous HV2 loops and wells that were not incubated with primary antibodies. Slides were examined with an Olympus BX60 system microscope with a BX-FLA reflected light fluorescence attachment and Olympus U-M41001 filter. All images were obtained with a SPOT charge-coupled-device digital camera .Single colonies of FA1090 Opa variants were suspended in water, applied to IFA slides , and fixed in 100% methanol at −20°C after drying at RT. Slides were blocked for 1 hr in PBS with 0.1% immunoglobulin-free BSA (Sigma) (blocking buffer). Slides were incubated with primary antibodies for 1 hr at the following final concentrations or dilutions, which were determined empirically: AbF62por5–8, 1% NHS was used. These serum concentrations are >2-fold lower than that concentration that showed no killing of the target strains in the absence of added antibody as determined by Garvin et al linear or Abcyclic were serially diluted in minimal essential medium (MEM) , and 50 µl of diluted NHS or BBS were added to each well to achieve the final serum concentrations stated above based on a final 250 µl volume. Bacteria to be tested were harvested from solid GC agar after 20–22 hrs growth, suspended in MEM, and 50 µl containing 1.5–2.5×103 CFU were added to each well. Plates were incubated at 37°C in 7% CO2 for 1 hr, after which 50 µl of GCB were added and mixed. Two 50 µl aliquots were cultured on GC agar and the average number of CFU recovered was determined. The bactericidal50 titer was that concentration of antibody that resulted in a 50% reduction in the number of CFU recovered from wells that contained serum but no added test antibodies. Polyclonal rabbit antiserum against whole gonococci, which showed high level bactericidal activity against all Opa variants tested, was used as a positive control and antibodies that do not bind the target strain were used as negative controls. Heat-inactivated (HI) NHS and BBS were prepared by incubation at 56°C for 30 min, and were tested in parallel for each assay; none of the test or control antibodies had activity when HI serum was used. At least two independent experiments were performed for each test antibody, and the results were similar.Bactericidal assays against wild type FA1090 Opa variants were performed in microtiter plates using 10% normal human serum (NHS) or 1% baby bunny serum (BBS) as the complement source. For assays that used strain FA1090600 of 0.4. Test antibodies or antisera were serially diluted 2-fold and 10 µL of each dilution were incubated with 10 µL of bacteria (∼5×106 CFU) at 37°C in a microtiter plate for 45 min. Bacteria were incubated with the same dilutions of normal mouse sera (NMS) or affinity-purified polyclonal rabbit antibodies against heterologous HV2 loops in parallel. After incubation, 5 µL were spotted on a glass slide and stained with HEMA3 (Exaxol Corp). The average number of aggregates per at least three 40X fields was determined under light microscopy. Agglutination titers were defined as the highest dilution of test antibodies that caused greater than three times the number of aggregates seen in the same dilution of NMS or control antibodies. Comparisons between piliated and non-piliated variants of the same Opa type were also performed and identical results were obtained (data not shown).Agglutination titers were determined by the method of Pal et al N. gonorrhoeae as described 3, 104, or 105 CFU of predominantly OpaB-variants that were pre-incubated in PBS with 250 or 500 µg/ml of AbHV2BD linear or in PBS alone for 20 min at 37°C. In subsequent experiments with loop-specific affinity purified rabbit antibodies, bacteria (∼5×104 CFU/ml) were preincubated in PBS with 250 µg/ml of AbHV2Alinear, AbHV2BD linear, or AbSV linear and 20 µl of the suspension (∼103 CFU and 5 µg of antibodies) were inoculated vaginally into mice (n = 7–15 mice per group). In studies with mouse antisera against cyclic peptides, mice were inoculated with a 20 µl suspension containing 6×103 CFU that were preincubated with AbHV2BDcyclic, AbSVcyclic, or NMS (n = 10–11 mice per group). For all experiments, vaginal mucus was quantitatively cultured for N. gonorrhoeae daily for 3 days as described Female BALB/c mice 6–8 weeks of age were treated with 1.5 mg water-soluble 17β-estradiol (Sigma) and antibiotics to promote susceptibility to In separate experiments, the amount of topically applied antibody recovered from the vagina was measured over time by inoculating 23 untreated, 6 week-old female BALB/c mice vaginally with 20 µL of PBS containing 10 µg of affinity-purified rabbit polyclonal Opa-specific antibodies. The vaginas of 2–3 mice per time point were washed 3 times with 40 µL PBS and the three samples from each mouse were pooled (∼120 µL) and centrifuged at 13,000 rpm for 3 min. Supernatants were frozen at −20°C. Control samples were collected from 3 untreated mice. The concentration of rabbit IgG in murine vaginal washes was measured with the Rabbit IgG Quantitative Kit ELISA (Bethyl Laboratories). Animal experiments were conducted in the laboratory animal facility at USUHS, which is fully accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care, under a protocol approved by the USUHS Institutional Animal Care and Use Committee.3)3 to an A600 of 0.07. Bacterial suspensions were diluted 1∶10 and pre-incubated for 5 min with mouse antisera against HV2 or SV cyclic peptides (test) or NMS (negative control) , or with 0.25 µg/mL or 2.5 µg/mL of AbHV2BDlinear (test) or AbHV2Clinear (negative control). Bacterial suspensions (500 µl) were applied to cells in triplicate wells. After 2 hrs at 37°C in 7% CO2, monolayers were washed four times with PBS to remove nonadherent bacteria. Cells were lysed with 0.5% saponin (Sigma) and the number of cell-associated bacteria was determined by serial dilution and culture of the saponin-treated supsensions. Results are expressed as the number of cell-associated bacteria divided by the number of bacteria in the inoculum (% cell-associated). The average percent of cell-associated bacteria recovered from in test and control wells was calculated from three independent experiments that were each performed in triplicate. Standard error bars are shown.ME180 cervical epithelial cells were grown to near confluency in 24-well tissue culture plates in McCoy's 5A medium supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 2.2 g/L sodium bicarbonate. Non-piliated OpaB-expressing bacteria were subcultured from the freezer and passed once to GC agar before being suspended in McCoy's 5A medium supplemented with 2.2 g/L sodium bicarbonate and 5 mg/L Fe(NOA Fishers Exact test was used to compare the number of mice colonized in each experimental group in passive protection experiments. Differences in the number of gonococci recovered from mice and the recovery of cell-associated gonococci in tissue culture experiments were analyzed by the Student's t-test.

Lignin, a polyphenolic molecule, is a major constituent of flax shives. This polyphenolic molecular structure renders lignin a potential source of a variety of commercially viable products such as fine chemicals. This work compares the performance of different lignin isolation methods. Lignin from flax shive was isolated using both conventional alkaline extraction method and a novel experimental pressurized low polarity water (PLPW) extraction process. The lignin yields and chemical composition of the lignin fractions were determined. The conventional alkali treatment with 1.25 M NaOH, heated at 80 °C for 5 h, extracted 92 g lignin per kg flax shives, while lignin yields from the PLPW extracts ranged from 27 to 241 g lignin per kg flax shives. The purity and monomeric composition of the lignins obtained from the different extraction conditions was assessed via UV spectroscopy and alkaline nitrobenzene oxidation. Lignin obtained from conventional alkali treatment with 1.25 M NaOH, heated at 80 °C for 5 h was of low purity and exhibited the lowest yields of nitrobenzene oxidation products. With respect to alkali assisted PLPW extractions, temperature created an opposing effect on lignin yield and nitrobenzene oxidation products. More lignin was extracted as temperature increased, yet the yield of nitrobenzene oxidation products decreased. The low yield of nitrobenzene oxidation products may be attributed to either the formation of condensed structures or the selective dissolution of condensed structures of lignin during the pressurized alkaline high temperature treatment. Analytical pyrolysis, using pyroprobe GC-MS, was used to investigate the molecular composition of the lignin samples. The total yield of pyrolysis lignin products was 13.3, 64.7, and 30.5% for the 1.25 M NaOH extracted lignin, alkaline assisted PLPW extracted lignin, and the unprocessed flax shives, respectively. Key lignin derived compounds such as guaiacol, 4-vinyl guaiacol, 4-methyl guaiacol, syringol, eugenol, isoeugenol, catechol, homocatechol, and vanillin were detected in all of the samples. The phenomenon of global warming and its impact on the environment has called attention to the use of more environmentally friendly processes and the use of agricultural waste as a lignocellulosic biomass resource to ensure environmental, social, and economic sustainability . Flax shi.e., condensed linkages) while non-condensed lignins contain more alkyl-aryl ether linkages [i.e., softwoods), lignin structural elements are predominantly derived from more than 95% coniferyl alcohol. It is the large amount of functionalized aromatic structures present in lignin which makes it an attractive raw material for aromatic compounds [Flax shives possess high lignin ∼24%), cellulose ∼53%) and hemicellulose (∼24%) contents [% and hem%, cellulinkages) . The hetinkages) ,9. Ligniompounds . Depolymompounds .Compositional analysis of lignin is typically performed by chemical or thermal degradation of the lignin macromolecule into small compounds which are separated by means of chromatographic techniques . Key cheet al. [Analytical pyrolysis is another useful technique for lignin analysis . Pyrolyset al. demonstret al. .et al. [Valorization of lignin represents a great opportunity in terms of economic, environmental and societal sustainability; however the separation of lignin from cellulose and hemicellulose is very difficult. The cause for this has been suggested to be the strong bonds between lignin, hemicellulose, as well as the crystalline regions of cellulose. Processes traditionally used for fractionation of lignocellulosic biomass are acid hydrolysis, alkaline hydrolysis, ammonia treatments, and oxidation . Furtheret al. have demet al. . Even soThe main objectives of this work were to: (1) characterize flax lignin isolated via a conventional alkaline extraction procedure; (2) characterize flax lignin isolated via an environmentally benign process, PLPW; (3) provide a comparison of the characteristics of the flax lignins extracted with different methods; and (4) apply analytical pyrolysis to provide information on the chemical composition of the lignin samples.−1 flax shives, w/w dry basis). The amount of Klason lignin (acid insoluble lignin) present in the flax shives as determined by the NREL method [L method was 26% −1 lignin on a flax shives basis extracting nearly 34% of the lignin present in the flax shives. Extraction temperature positively affected the amount of lignin obtained from alkali assisted PLPW processing as the highest lignin yield (241 g kg−1 lignin on a flax shives basis) was obtained with alkali assisted PLPW extraction with 0.47 M NaOH at 180 °C. This treatment extracted nearly 88% of the lignin present in the flax shives. More lignin was present in the 0.47 M NaOH-180 °C extract, 241 g kg−1, compared to the water-180 °C extract, 27 g kg−1. Notably, the extraction conditions of water-180 °C yielded less lignin than the 1.25 M NaOH, at 80 °C for 5 h extraction condition. These results demonstrate the effectiveness of alkali assisted pressurized low polarity water a method for extracting lignin from lignin-carbohydrate complexes. Delignification is achieved through cleavage of phenolic α-O-4-linkages, β-O-4-linkages, non-phenolic β-O-4-linkages, and carbon–carbon linkages in lignin and is therefore enhanced in an alkaline extraction medium [−1 and free phenolic acid contents of 3.9 and 4.7 g kg−1, respectively. Both pH and temperature have been shown to affect removal of carbohydrates from lignin-carbohydrate complexes. Increased removal of carbohydrates from flaxseed meal was achieved through the use of neutral and acidic extraction solvents [et al. [n medium . Both th [et al. , which ii.e., minimal bound carbohydrate). Alternatively, the lowest absorbance values were observed in the lignin samples obtained from the 1.25 M NaOH-80 °C and 0.47 M NaOH-100 °C treatments and although the 1.25 M NaOH-80 °C treatment yielded 92 g lignin per kg flax shive, these lignin samples likely contained higher amounts of bound carbohydrate and were less pure. These results indicate that even though delignification is enhanced in an alkaline solvent the efficiency of alkali assisted PLPW is superior to conventional alkaline extraction. The pressurized solvent possesses decreased surface tension and viscosity, which allowed for enhanced extraction [UV-visible light absorption measurements have been used to semi-quantitatively assess the purity of lignin samples –29. The traction . The imptraction . Our reset al. [et al. determinet al. . The liget al. ,32. On aet al. [et al. reportedet al. ,34.trans-isoeugenol were all concentrated to the greatest extent in the lignin obtained from extraction with PLPW. Phenols are valuable products with high commercial value as phenols are the starting material in the industrial production of aspirin, herbicides, and synthetic resins [Pyrolysis-GC-MS was used to determine the compounds present in the lignin samples obtained from conventional alkaline extraction with 1.25 M NaOH at 80 °C for 5 h, alkali assisted PLPW extraction with 0.47 M NaOH at 180 °C, and the unprocessed flax shives. et al. [Overall, the molar yield of the guaiacyl (G) type lignin was about 4.7, 13.1, and 19.7 times higher than the syringyl (S) type lignin for the 1.25 M NaOH extracted lignin, alkaline assisted PLPW extracted lignin, and the unprocessed flax shives, respectively. Or in other words, the S/G ratio was 0.21, 0.08, and 0.05 for the 1.25 M NaOH extracted lignin, alkaline assisted PLPW extracted lignin, and the unprocessed flax shives, respectively. These values indicate a greater effect of extraction conditions on S/G ratio compared to the nitrobenzene oxidation data which indicated comparable S/G ratios for all samples. The pyrolysis data may be more reflective of the monomer composition of the samples since the main factor affecting release of monomer products during pyrolysis is the amount of energy required for the rupture of primary bonds (C-C or C-O-C) . With niet al. indicateet al. , was 27.et al. . AnalytiFlax shives were obtained from Biolin Research Inc. and ground using a Wiley mill using a 0.35 mm blade gap and a 4 mm screen. The screened flax shives with a particle size between 1 and 2 mm were further separated by air flotation to remove residual fiber. The ground flax shives were kept in sealed bags in a freezer at −25 °C.2SO4 followed by hydrolysis with 4% H2SO4 to solubilize all of the carbohydrate components. The resulting residue is termed acid insoluble lignin (or Klason lignin) and the low molecular fraction of lignin presenting the filtrate is called acid soluble lignin and quantified using UV spectroscopy [The lignin, cellulose, hemicellulose, ash, and wax content of flax shives were determined using published methods. The following method was usedtroscopy . The ashtroscopy .et al. [i.e., hemicellulose) was washed with 70% ethanol and allowed to air dry. Ethanol was evaporated from the filtrate, and the alkali soluble lignins were obtained from the filtrate by precipitation at pH 1.5 by addition of 6 N HCl. The alkali soluble lignin was washed with acidified water (pH 2), centrifuged and freeze dried. All extractions were conducted in triplicate.Lignin was extracted from the samples using two different methods. The first step for both extraction methods involved drying the flax in an oven at 60 °C for 16 h. Method 1 was performed by following the alkaline hydrolysis procedure of Sun et al. with somd-glucose [Method 2 involved using PLPW (PLPW) processing to extract lignin from the flax shives. The extraction conditions were as described by Kim and Mazza with the-glucose ,41. All The composition of the noncondensed monomeric units of lignin was characterized by nitrobenzene oxidation. Following the methods ,42, lignAnalysis of phenolic compounds was conducted on an Agilent 1100 HPLC system with a G1329A autosampler and a G1312A pump, which was controlled by Agilent ChemstationPlus software . The HPLC method used a Luna C18 coupled with a C18 Security Guard cartridge, both from Phenomenex . The injector and column temperatures were set at 35 °C, and the injection volume was 20 μL. The mobile phases consisted of methanol (solvent A) and 4.4% (v/v) formic acid (solvent B) with a gradient as described by Kim and Mazza . BrieflyUV spectra were recorded on a Cary 50 Bio UV-Visible Spectrophotometer . Isolated lignin sample was vacuum dried at 50 °C for 24 h. The dried lignin sample (5 mg) was dissolved in 10 mL of dioxane-water . A 1 mL aliquot was diluted to 10 mL with 50% (v/v) dioxane-water, and the absorbance between 205 and 380 nm was measured .For this work, the Pyrolysis-GC-MS method of Ralph and Hatfield was foll−1 flax shive and the UV spectra of this lignin demonstrated its purity. With respect to the alkali assisted PLPW extract, temperature created an opposing effect on lignin yield and nitrobenzene oxidation products. The highest lignin yield was obtained from the 0.47 M NaOH-180 °C extraction condition; however this lignin presented the lowest nitrobenzene monomer yields, indicating a more condensed structure. Although the amount of lignin present in the PLPW extract obtained from processing with 180 °C water was less, 27 g kg−1 lignin, this lignin was also relatively pure and possessed a less condensed structure as shown by UV spectroscopy and nitrobenzene oxidation, respectively. This work also presents a detailed component analysis, including peak number, retention time, compound name, and relative proportion (% area) of the pyrolysis compounds of the lignin obtained by the different extraction methods using pyrolysis GC/MS. Overall, the majority of the products formed from the pyrolysis of lignins extracted by different methods were phenols with significant amounts of guaiacol, vanillin, and sryingol being detected. Comparison of the nitrobenzene oxidation results with the pyrolysis GC-MS results provided further insight into the degree of condensation exhibited by the different samples. In all, the results of this study demonstrate the potential of flax shives to serve as a source of lignin and consequently valuable biochemicals.Lignin extraction in terms of composition and yield was affected by the extraction method: solvent type, time and temperature were all important variables. Alkali assisted PLPW extraction was very effective in extracting lignin from flax shives. The amount of lignin present in the 0.47 M NaOH-180 °C extract was nearly 241 g kg

Creating geometric or mathematical proportion to relate the successive width of maxillary anterior teeth is a critical aspect in Esthetic dentistry. Golden proportion, recurring esthetic dental (RED) proportion and golden percentage are new theories in this field.To investigate the existence and suitability of Golden proportion, Recurring Esthetic Dental, and Golden percentage between the widths of maxillary anterior teeth in individuals with natural dentition, with the aid of digital photographs and computer analysis.Standardized frontal images of 56 dental students, 20 male and 36 female, were captured. Each maxillary anterior tooth was digitally measured. Once the measurements were recorded, the three theories were applied and the data was analyzed statistically.The golden proportion was found to exist only in 14-25% of the subjects, between perceived maxillary anterior teeth in natural dentition. The value of RED proportion was not constant, and as one moved distally, this proportion gradually increased.Furthermore, the results revealed that golden percentage was rather constant in terms of relative tooth width. Central incisor represented 22%, lateral incisor 15% and canine 13% of the width of six maxillary anterior teeth, as viewed from the front.Both golden proportion and RED proportion are unsuitable methods to relate the successive width of the maxillary anterior teeth in natural dentition. However, the golden percentage theory can be applied if percentages are adjusted, taking into consideration the ethnicity of the population. Golden proportion, golden percentage and recurring esthetic dental are theories introduced in this field.24 Lombar2However, in a more recent study, it was reported that the golden proportion did not exist between the widths of the maxillary anterior teeth in individuals who have an esthetic smile. Ward sugTo investigate the existence and suitability of Golden proportion, Recurring Esthetic Dental, and Golden percentage between the widths of maxillary anterior teeth in individuals with natural dentition, with the aid of digital photographs and computer analysis.Fifty six dental students, 20 male students and 36 female students in the 20-25 age group, were selected for the study.Subjects : Asian origin; natural dentition in maxillary anterior region.Exclusion criteria: Subjects who have undergone orthodontic treatment; maxillary anterior tooth size alterations.Standardized frontal image of each subject's smile was taken, using digital camera NIKON D100, AF MICRO NIKKORE, 105MM, in the following manner:Subjects were positioned in the natural head position.The camera was positioned and adjusted so as to obtain a sharp image of the face, from the tip of the nose to the tip of the chin. The distance between the camera and the subject was fixed at a working distance of 60 cm. The camera was stabilized with the help of a tripod, at this fixed distance.The subject was asked to smile and the image was captured during the smile.The images were then downloaded to a personal computer. All the measurements were taken with the help of the software Adobe Photoshop 7, by one investigator.The Golden proportion for each subject was measured thus: the width of the central incisor was multiplied by 62% and compared with the width of adjacent lateral incisor. Similar values indicate that the width of the central incisor is in golden proportion to the width of the lateral incisor.By comparing the width of the lateral incisor multiplied by 62% with that of the canine, it can be determined whether the width of the lateral incisor is in golden proportion to the width of the canine.RED proportion was calculated by dividing the width of each lateral incisor by the width of the adjacent central incisor and the resulting number was multiplied by 100. Similarly, the width of each canine was divided by the width of adjacent lateral incisor and the resulting number was multiplied by 100. If the values obtained are constant, it means that the central incisor, lateral incisor, and canine are in RED proportion.The golden percentage was calculated by dividing the width of each central incisor, lateral incisor and canine by the total width of all six maxillary anterior teeth and multiplying the resulting value by 100, in order to obtain the golden percentage for each tooth. If the values from canine to canine were 10, 15, 25, 25, 15, and 10%, it indicates that the six maxillary anterior teeth are in golden percentage.P < .05 %.The data was statistically analyzed using the paired T test A cut off value was arrived at, to determine whether the subjects lie in the golden proportion range or not. The cut-off value was calculated as follows:First, the difference between two groups was calculated, following which an average mean was calculated. Once the average mean was derived, values lying within the range of average mean + 1 Standard Error was considered to be in golden proportion.Out of the total subjects, 17.9% had left central incisor in golden proportion to left lateral incisor [Graphs Twenty five percent of the subjects had left lateral incisor in golden proportion to left canines [Graphs The percentage that showed right central incisor in golden proportion to right lateral incisor [Graphs The number of subjects with right lateral incisor in golden proportion right canine [Graphs The mean values and standard deviation for RED proportions for males and females are listed in The values obtained for golden percentage, beginning with the right side canine and moving to the left canine, in this study were 12.5, 15.5, 22, 22, 15.5 and 12.5%.Graphs It is important to determine a mathematical or geometrical relationship between teeth, in order to achieve an esthetic restorative result. It would be helpful if statistically reliable relationships existed to support the existing relationship theories.This study was conducted on 56 dental students, 20 being male subjects and 36 female subjects. With respect to the theory of golden proportion, the best results in this study were seen in relation to perceived left lateral incisor width and perceived left canine width as seen from front. This was observed in a total of 14 (25%) out of 56 subjects, of which three (15%) were male subjects and 11 (30.6%) were female subjects.et al and Fayyad MA et al. In their study of subjects with esthetic smile, they evaluated the existence of golden proportion by measuring the mesio-distal width of six anterior teeth, on scanned pictures of individuals. They arrived at the conclusion that golden proportion did not exist in natural dentition.[The overall results showed that the golden proportion did not seem to exist. This was in accordance with the studies conducted by Minoo Mahshid entition.7With respect to RED proportion, the results of this investigation showed that the ratio of the width of maxillary lateral incisors to the width of central incisors is between 69.5 and 70.3%. The ratio of width of canine to width of lateral incisor is between 80 and 83%. In the present study, the ratio between central and lateral incisors and between lateral incisor and canine is not constant. The ratio increases as one moves distally.et al,[The value 69.5-70.3%, which was the ratio of the width of maxillary lateral incisors to width of central incisors, is in agreement with the 70% RED proportion suggested by Ward, and the The ratio between central and lateral incisors and between lateral incisor and canine is not constant, as suggested by WardHence, there is no evidence in this study to support the RED proportion theory as applied to natural dentition.As for using Golden percentage theory to correlate the six anterior teeth, the result of the present investigation suggests that the mean values for golden percentage for central incisor is 21.9-22.3%. The mean value for lateral incisors is 15.3-15.5%. With respect to golden percentage of canines, the result of this study showed a mean value of 12.0-12.6%.The values for lateral incisor was in agreement with those suggested by Snow, who recoThe figures obtained for central incisor are slightly lower than those suggested by Snow, who estiCanines have a slightly higher value than those suggested by Snow, who recoIn general, it appears that the width of central incisors is slightly smaller and the width of canines is slightly larger than those suggested by the golden percentage theory. A value of 22% for centrals, 15.5% for laterals, and 12.5% for canines can be adopted, as these percentages are more applicable to the natural dentition. Minor variations in the values obtained in this study, as compared to previous studies,[The theory of Golden percentage was more applicable to the subjects of this study.The golden proportion was not found to exist between perceived maxillary anterior teeth on natural dentition.RED proportion was not found to exist between the six maxillary anterior teeth.In order to establish objectively quantifiable width ratio between maxillary anterior teeth, ethnic differences should be taken into consideration. This will also help determine exactly what percentages are truly golden.In the light of the results of this investigation the following conclusions can be derived:

The inter­lamellar regions contain hydrogen-bonded cyclic water hexa­mers which facilitate layer stacking into a pseudo-three-dimensional crystal structure. The water hexamers themselves are formed by the operation of crystallographic inversion centers on sets of three crystallographically distinct water molecules of hydration.In the title compound, {[Cu DOI: 10.1107/S1600536808023131/sj2520Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Elemental imbalances of carbon (C): nitrogen (N): phosphorus (P) ratios in food resources can constrain the growth of grazers owning to tight coupling between growth rate, RNA allocation and biomass P content in animals. Testing for stoichiometric constraints among invasive species is a novel challenge in invasion ecology to unravel how a successful invader tackles ecological barriers in novel ecosystems.Dreissena polymorpha), collected from two Swedish lakes. Concurrently, we analyzed the elemental composition of the food (seston) and tissue of the mussels in which nutrient composition of food and mussels varied over time. Zebra mussel condition factor was weakly related to the their own tissue N∶P and C∶P ratios, although the relation with the later ratio was not significant. Smaller mussels had relatively lower tissue N∶P ratio and higher condition factor. There was no difference in C∶P and N∶P ratios between seston and mussels' tissues. Our results indicated that the variation in nutrient stoichiometry of zebra mussels can be explained by food quality and quantity.We examined the C∶P and N∶P ratios and the condition factor of a successful invader in lakes, the zebra mussel (Our study suggests that fitness of invasive zebra mussels is not constrained by nutrient stoichiometry which is likely to be important for their proliferation in novel ecosystems. The lack of imbalance in C∶P and N∶P ratios between seston and mussels along with high tissue C∶P ratio of the mussel allow them to tolerate potential P limitation and maintain high growth rate. Moreover, zebra mussels are able to change their tissue C∶P and N∶P ratios in response to the variation in elemental composition of their food. This can also help them to bypass potential nutrient stoichiometric constraints. Our finding is an important step towards understanding the mechanisms contributing to the success of exotic species from stoichiometric principles. Biological invasion is an ubiquitous form of global change of biota, capable of causing native extinctions and affecting geographical speciation At anthropogenic eutrophication, nutrient enrichment increases in the freshwater ecosystems. P enrichment may lead to increased algal C content Dreissena polymorpha) has been shown to exploit available niche opportunities in the novel environment Dreissena has been one of the most successful invading species in European and North American lakes with rapid growth rate and flexible feeding behaviour capable of changing phytoplankton community structure, energy pathway, nutrient cycling, seston stoichiometry, and energy transfer efficiency from primary producers to upper trophic levels in both the pelagic and benthic food webs Although native species have shown to possess higher performance than exotic species when they are exposed to low resource conditions Pinna bicolor) Mytilus galloprovincialis) Mytilus edulis) We examined the relation between C∶P and N∶P ratios and the condition factor [(tissue condition index: TCI)] of zebra mussels collected from six sampling sites at each of two Swedish lakes: Lake Erken and Lake Ekoln. TCI is often used as a measure for the well being or health of mussels n = 338] and Lake Ekoln [n = 178] was observed.There was no significant relation between tissue C∶P molar ratio and TCI p>0.05; , althougn = 338] and Lake Ekoln [n = 178], and a negative effect on the TCI . In Lake Erken, condition index of zebra mussels varied over time , N∶P , and C∶N ratios of Dreissena varied among months (a (Chl a) explained the variation in tissue C∶N∶P stoichiometry of zebra mussels over time 179.1±104.8, 29.3±17.1, and 6.2±0.9 in Lake Erken. Although the mean sestonic C∶P and N∶P molar ratios did not differ from those of the mussels, there were significant differences between the mussels and seston in their C∶N molar ratio . HoweverDreissena were in a relatively better condition in June and November when their tissue N∶P and C∶P ratio were relatively low . Smaller Dreissena, therefore, would presumably grow faster than large DriessenaSmaller mussels had relatively lower tissue N∶P ratio and better condition. Similarly, a small size-class of fan mussels has been observed to have higher condition index and growth rate than medium and larger size-class mussels r strategists and have rapid growth rate Lampsilis radiata siliquoidea, 2.4–3.4%; Daphnia lumholtzi has a growth rate, P content, and fecundity similar to their native congeners D. magna and D. pulicaria, it contains a higher RNA level which may facilitate quicker resting egg production resulting in higher chance of invasion success A relevant question in relation to the discussion above is how zebra mussels are successful in a novel ecosystem despite stoichiometric constraints. Unlike native mussels, zebra mussels are Dreissena can be surmised to have low P demands and thus be less sensitive to P deficiency. According to resource-ratio theory, the species that survives at the lowest levels of a limiting resource will be the superior competitor for that resource Dreissena could be successful in P-limited environments and become very effective at exploiting resources. Further, experiments with dietary P supplements are needed to address whether high tissue C∶P ratio of the zebra mussel is a result of consumption of food having high C∶P ratio and whether the mussels' growth rate is affected by such food. Based on physiological models, when herbivores are exposed to a value above critical C∶P levels of food, they maintain their homeostasis in C∶P ratio, which can lead to a reduction in their growth rate Daphnia fed on high C∶P ratio food, a direct P deficiency in this herbivore was indicated Dreissena than that of invertebrates such as snails (Theodoxus fluviatilis) and tube-making caddisflies (Polycentropodidae) among seasons In fact, the high value (mean and standard deviation) of tissue C∶P ratio in the zebra mussels in this study, is higher than that for most of the benthic invertebrates in the littoral zone of Lake Erken Dreissena are not restricted in the range of their body mass stoichiometry and may not be P limited if they graze on seston (supporting our second hypothesis). However, zebra mussels similar to other invertebrates in Lake Erken had smaller C∶N ratio than their food Our results also revealed an equal coefficient of variation of C∶N∶P ratio and lack of imbalance in C∶P and N∶P ratios between seston and mussels, suggesting that a concentrations, and dissolved N∶P ratio of the water (supporting our second hypothesis). This suggests that consumers' stoichiometry can be affected by dietary changes through elemental stoichiometry, corroborating findings from both pelagic Further, we indicated that the variation in nutrient stoichiometry of zebra mussels can partly be explained by productivity, food quality in term of C∶N and C∶P ratios, food quantity in term of Chl Dreissena are stripping the P from the water column through feeding on Chl aa) until an asymptote is reached at 2 g C L−1a increases in the water, thereby sequester more phosphorous in their tissue which in turn can lead to a reduction in their N∶P ratio. This could possibly explain the negative effect of Chl a on the tissue N∶P ratio. On the other hand, because increasing Chl a leads to an increase in the mussels' growth rate a and tissue N∶P ratio. The concentration of Chl a was also proposed to be an important factor in the elemental composition of a calanoid copepod, Mixodiaptomus laciniatusa) limitation, we can expect an increase in the tissue N∶P ratio, a reduction in the growth rate and lower invasion success of the zebra mussels.It has been shown that TP is negatively correlated with the C∶P ratio of phytoplankton Taken together, this study suggests that nutrient stoichiometry cannot reduce the fitness of invasive zebra mussel, and thus, is not able to constrain their proliferation in novel ecosystems. The lack of imbalance in C∶P and N∶P ratios between seston (food) and mussels along with high tissue C∶P ratio of the mussel allow them to tolerate potential P limitation, and thus, maintain high growth rate and proliferate in many novel ecosystems. Moreover, zebra mussels are able to change their tissue C∶P and N∶P ratios in response to the variation in elemental composition of their food. This can also help them to bypass potential nutrient stoichiometric constraints. Further, zebra mussel ability to exploit dissolved organic carbon −1) lake with a relatively small catchment dominated by forest, and has a surface area of approximately 24 km2, a mean depth of 9 m, and a maximum depth of 21 m and Lake Ekoln which is a sub-basin of Lake Mälaren, a rather deep eutrophic lake with a catchment more dominated by agriculture, and has a surface area of approximately 30 km2, a mean depth of 16 m, and a maximum depth of 50 m a concentration were immediately observed since zebra mussel establishment in Lake Erken (Erken database). Moreover, the occurrence of cyanobacteria, Gloeotrichia echinulata, blooms increased after zebra mussel invasion The study was conducted in two Swedish lakes. Lake Erken which is a mesotrophic , 27 µg LTo evaluate the relation between tissue C∶P and N∶P ratios and condition factor of the mussels, six sampling sites (sites A-F) were selected around each of the lake. Six transect lines were established perpendicular to the shoreline at all sites (one transect line per site) in Lake Erken in June 2005 and in Lake Ekoln in October 2006. Mussel samples were collected at each site by SCUBA diving, placed in buckets filled with lake water and transported to the laboratory Mussels were freeze dried to constant weight and the dry mass (DM) of each individual was determined a, we performed a monthly sampling from the mussels and the water from the one sampling site at the eastern part of the Lake Erken during June-November 2005. Concurrent to the monthly collection of 38–40 mussels (8–35.5 mm shell length), we took water samples to measure the quantity and quality of food (seston C∶N∶P stoichiometry) available to zebra mussels and nutrient concentrations . The mussels were cleaned, kept overnight in water without food, and stored in the freezer. Three 2-l samples were taken about 25 cm above the lake bed at the sampling site. The water sample was divided into five different subsamples for each site. (1) for the analysis of TP and total nitrogen (TN); (2) to measure phytoplankton biomass (defined as Chl a); (3) for the analysis of ammonium-N (NH4+- N), nitrate- nitrite- nitrogen (NO2−NO3−- N), and phosphate-P (PO43−-P); (4) water was filtered on precombusted GF/C filters for the analysis of particulate C and particulate N; (5) water was filtered on precombusted GF/C filters for the analysis of particulate P.To address how mussel tissue C∶N∶P stoichiometry vary in relation to seston nutrient composition and Chl 4∶PO4) for seston stoichiometry were calculated for each of the six sampling sites. Concentration of Chl a was determined using delayed fluorescence excitation spectroscopy C, N, and P contents of the mussels' tissues were measured and the stoichiometric C∶N∶P ratio were calculated in molar units. Particulate C and particulate N of seston were measured using the same methods as for tissue nutrient analyses. Dissolved ammonium was analyzed with the Tecators method and total phosphorus and dissolved phosphate with the ammonium-molybdate method a, PC, PP, PN, NO2−NO3−-N, and PO43−-P as well as between setston C∶P ratio and N∶P ratio (r = 0.97). Chl a was preferred to other related parameters due to its importance in mussels growth 4+- N, and dissolved N∶P ratio were considered in our model (see below) due to their role in growth of phytoplankton a food of herbivore mussels.A Pearson correlation coefficient was performed to test for correlations between environmental variables. When the variables were collinear (p<0.05), only one variable was chosen. There was a high correlation between Chl Dreissena against seston nutrient concentration , dissolved N∶P ratio, sestonic C∶P and C∶N molar ratios, and Chl a. We used the paired samples T test to compare C∶N∶P stoichiometry between mussels tissue and seston. Data were log-transformed when necessary to meet assumptions of normality and homogeneity of variances. We used a non-parametric Kruskal Wallis to compare zebra mussel condition factor and tissue C∶N∶P stoichiometry among months. All statistical tests were performed with software package SPSS 16.0. Statistical significance was accepted at the p<0.05 level.The relationship between condition factor and tissue C∶P and N∶P ratios of the mussels was analyzed with linear regression. Linear regression was also applied to analyze the relationships between mussels size (shell length) against tissue C∶P and N∶P ratios and condition of zebra mussels. We performed stepwise multiple regressions to determine the factors that best predicated zebra mussel tissue C∶N∶P stoichiometry. Thus, we regressed separately the tissue C∶P, N∶P, and C∶N molar ratios of

It exhibits a UO7 penta­gonal-bipyramidal coordination geometry about the UVI atom, involving two bidentate acetyl­acetonate ions and one water mol­ecule. The N atoms of the pyrazine mol­ecules are not coordinated to the UVI atom, and are connected with the aqua O atom by hydrogen bonds. This results in a zigzag chain arrangement along the [10The asymmetric unit of the title compound, [U(C DOI: 10.1107/S1600536808009021/hk2447Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

We performed a logistic regression to examine the relation of levels of each biomarker to the risk of cartilage loss in any knee. All analyses were adjusted for gender, age, and body mass index (BMI); results stratified by gender gave similar results. One hundred thirty-seven patients with symptomatic knee OA were assessed. At baseline, the mean (standard deviation) age was 67 (9) years and 54% were male. Seventy-six percent of the subjects had radiographic tibiofemoral OA and the remainder had patellofemoral OA. With the exception of COMP, none of the other biomarkers was a statistically significant predictor of cartilage loss. For a 1-unit increase in COMP, the odds of cartilage loss increased 6.09 times . After the analysis of COMP was adjusted for age, gender, and BMI, the risk for cartilage loss was 6.35 (95% CI 1.36 to 29.65). Among subjects with symptomatic knee OA, a single measurement of increased COMP predicted subsequent cartilage loss on MRI. The other biochemical markers of cartilage synthesis and degradation do not facilitate prediction of cartilage loss. With the exception of COMP, if changes in cartilage turnover in patients with symptomatic knee OA are associated with cartilage loss, they do not appear to affect systemic biomarker levels.We used data from a longitudinal observation study to determine whether markers of cartilage turnover could serve as predictors of cartilage loss on magnetic resonance imaging (MRI). We conducted a study of data from the Boston Osteoarthritis of the Knee Study (BOKS), a completed natural history study of knee osteoarthritis (OA). All subjects in the study met American College of Rheumatology criteria for knee OA. Baseline and follow-up knee magnetic resonance images were scored for cartilage loss by means of the WORMS (Whole Organ Magnetic Resonance Imaging Score) semiquantitative grading scheme. Within the BOKS population, 80 subjects who experienced cartilage loss and 80 subjects who did not were selected for the purposes of this nested case control study. We assessed the baseline levels of cartilage degradation and synthesis products by means of assays for type I and II cleavage by collagenases (Col2:3/4C Osteoarthritis (OA) is characterized by the degeneration of articular cartilage. This results from a direct attack on matrix molecules, resulting in their cleavage, damage to these molecules, and their loss. It is also accompanied by a response of the tissue to this damage which involves enhanced matrix synthesis and turnover. The most direct evidence of pathology is cartilage degradation. A secondary and more indirect indication is cartilage matrix synthesis. The amount of synthesis in relation to degradation may prove of great importance in determining disease progression .The ability to use biochemical markers to predict disease progression and identify patients most likely to progress is a top priority in the future management of OA. Ultimately, it would enable much more rapid assessment of structure-modifying therapies in clinical trials. It may also allow the identification of patients at highest risk of progression, allowing the efficient testing of new treatments. Biochemical markers of OA progression represent a surrogate for structural change which may have advantages over existing methods of measuring structure. Therapeutic development in OA is constrained by the slow progress of structural changes using standard imaging techniques. The development and validation of biochemical markers may accelerate the pace of therapeutic development.Some recent work on type II collagen has suggested that assays for type II collagen degradation, when used in combination or with markers of collagen synthesis, can distinguish populations with knee OA which exhibit progression of joint damage from non-progressors. The ratio of the type II collagen crosslinking C-telopeptide (CTX-II) to the amino propeptide of type IIA collagen or the rThe overarching aim of this investigation was to conduct a study within an existing longitudinal dataset of knee OA with serial knee magnetic resonance imaging (MRI) to evaluate and validate promising biochemical markers, markers that have been reported in either cross-sectional or longitudinal studies to be related to OA or its progression. MRI of the knee has the advantage of covering the whole joint in one examination, meaning that the cartilage defects in the joint can be visualized directly, regardless of their location . Direct More specifically, we assessed the baseline levels of cartilage degradation, synthesis, and turnover products using collagenase-generated C1,2C, and C2C; Col II C-telopeptide (CTX-II assay); C-propeptide of type II collagen; aggrecan 846 epitope; and COMP in a sample of knees with known knee cartilage loss and controls. Our prior hypotheses were that increased levels of cartilage degradation products would be predictive of cartilage loss and that imbalance of cartilage synthesis and degradation would be predictive of cartilage loss.We conducted an analysis of data from the Boston Osteoarthritis of the Knee Study (BOKS), a completed natural history study of knee OA . To be eOf 324 subjects who entered the study, 86% completed a full comprehensive follow-up at a later time point (15 and/or 30 months). These comprehensive examinations consisted of an MRI of the more affected knee and a comprehensive set of radiographs, including a semiflexed fluoroscopically positioned posteroanterior radiograph using the method of Chaisson and colleagues and BuckBlood and urine (second morning void) specimens were also obtained at baseline. Specimens were aliquoted and immediately frozen; serum was frozen at -70°C and urine at -20°C. The specimens were stored at a long-term repository .Within the BOKS population, 80 subjects with MRI cartilage loss and 80 subjects without cartilage loss were selected for the purposes of this nested case control study. Cartilage loss was defined as an increase in cartilage score at 30 months from that at baseline. After completion of the assays, 153 participants had data available for all of the biomarker assays. Once the biomarker assay data and MRI data were merged, 137 subjects had complete data available for analysis. These participants were similar to those from the larger study sample. The institutional review boards of Boston University Medical Center and the Veterans Administration Boston Health Care System approved the baseline and follow-up examinations, and informed consent was obtained from all participants.All studies were performed with a Signa 1.5T MRI system using a phased-array knee coil. A positioning device was used to ensure uniformity of positioning among patients. The imaging protocol included sagittal spin-echo proton density- and T2-weighted images with a slice thickness of 3 mm, a 1-mm interslice gap, 1 excitation, a field of view (FOV) of 11 to 12 cm, and a matrix of 256 × 192 pixels and coronal and axial spin-echo fat-suppressed proton density- and T2-weighted images with a slice thickness of 3 mm, a 1-mm interslice gap, 1 excitation, and the same FOV and matrix.Cartilage on MRI was scored paired and unblinded to sequence on 14 plates using the Whole Organ Magnetic Resonance Imaging Score (WORMS) semiquantitative method . Both caIn WORMS, grade 1 does not represent a morphologic abnormality but rather a change in signal in cartilage of otherwise-normal morphology. Grades 2 and 3 represent similar types of abnormality of the cartilage, focal defects without overall thinning. Therefore, to create a consistent and logical scale for evaluation of cartilage morphologic change, we collapsed the WORMS cartilage score to a 0-to-4 scale in which the original WORMS score of 0 and 1 were collapsed to 0, the original scores of 2 and 3 were collapsed to 1, and the original scores of 4, 5, and 6 were considered 2, 3, and 4, respectively. Cartilage loss was defined as an increase in the score at any subregion compared to baseline in any of the 14 subregions of the knee scored for cartilage in each knee.We selected subjects who attended the baseline and final visits with an intervisit duration generally more than 30 months. Within the BOKS population, all of the biomarkers mentioned and cartilage loss on serial MRI were available on 137 participants.long, also known as C2C) was measured by means of an enzyme-linked immunosorbent assay (ELISA) , Col2:3/4Cshort , and Col2CTx). We performed the same analytic approach as above with the predictor variable being a synthesis/degradation marker.To test this hypothesis, we grouped biomarkers into those that potentially reflect cartilage synthesis (CPII) and those that reflect cartilage degradation age was 67 (9) years and 54% were male. The remainder of the demographic characteristics are presented in Table The results of the logistic regression for univariate biomarker predictors with the outcome cartilage loss in any plate are presented in Table Increased COMP levels predict subsequent cartilage loss on MRI, but the association is modest (area under the curve = 0.60). The other biochemical markers of cartilage synthesis, turnover, and degradation do not facilitate prediction of cartilage loss.Articular cartilage is a multiphasic material with at least two major phases: a fluid phase composed of water and electrolytes and a solid phase composed of chondrocytes together with matrix molecules that include collagen and proteoglycans. The predominant type of collagen is type II, which is found predominantly in cartilage . It forms the basic fibrillar structure of the extracellular matrix which imparts its tensile strength.As articular cartilage degenerates in OA, chondrocytes upregulate their biosynthetic activities, including type II collagen, as if to compensate for this damage. Only after secretion, as the molecules reach the extracellular space, are the non-helical domains at the end cleaved from the helical domain.The C-propeptide content and release from the cartilage are directly correlated with collagen synthesis . In OA, in vivo. Type II collagen is degraded by proteolytic enzymes secreted by chondrocytes and synoviocytes. The cleavage of the type II collagen triple helix by collagenases results in the generation of neoepitopes at cleavage sites. Since the initial cleavage that generates the neoepitope is followed by subsequent cleavage of the alpha chain, there is release of the epitope from the tissue [in vivo by immunoassays with antibodies that recognize cleavage epitopes called COL2-3/4Clongmono and specific for type II collagen [short or C1,2C, which detect cleavages of both type II and I collagens [It is hoped that the availability of assays to measure degradative, synthetic, and turnover products of cartilage matrix metabolism in body fluids offers opportunities to try and monitor cartilage turnover e tissue . Thus, acollagen , and colollagens , have beollagens . These eollagens . Howeverollagens ,28. AlteSome recent work on type II collagen has suggested that assays for type II collagen degradation, when used alone or in combination or with markers of collagen synthesis, can distinguish populations with knee OA which exhibit progression of joint damage from non-progressors ,29-31. TIn addition to type II collagen, the second main component of the extracellular matrix of articular cartilage is aggrecan, which, like collagen type II, is almost specific to this tissue. Aggrecan is a proteoglycan composed of a core protein to which GAG chains are covalently attached. The compressive stiffness of articular cartilage is a product of the hydration and swelling of aggrecan, embedded as macromolecular aggregates within the collagen fibrillar network. The monoclonal antibody CS 846 prepared for aggrecan reveals the presence of the largest apparently intact molecules that predominate in fetal cartilages but that are almost absent from healthy adult cartilage . In OA, Cartilage oligomeric protein is a pentameric protein of the thrombospondin family which can bind type I, II, and IX collagens . It is sSome further limitations of this work, some of which are generic to the application of biomarkers, warrant mentioning. Age-related increases are commonly seen in biochemical markers and these may produce variation in both biomarker levels and cartilage loss . EffortsAnother potential explanation for the lack of association found relates to limitations with the endpoint, namely cartilage loss on MRI. This was measured semiquantitatively with inherent potential observer bias and possible measurement error. Nonetheless, a number of studies have found plausible biologic associations with cartilage loss on MRI in this dataset, including relations to alignment , bone maWith the exception of COMP, if changes in cartilage turnover in patients with symptomatic knee OA are associated with cartilage loss, they do not appear to affect systemic biomarker levels. Where there are other markers such as alignment and bone marrow lesions that are potent predictors of progression, we would not advocate one-time measurement of biochemical markers to predict MRI progression in patients with symptomatic knee OA, with the possible exception of COMP.long) = collagenase cleavage of triple-helical type II collagen; CI = confidence interval; Col2CTx = crosslinked peptides from the C-telopeptide domain of type II collagen; COMP = cartilage oligomeric matrix protein; CPII = C-propeptide of type II collagen; ELISA = enzyme-linked immunosorbent assay; FOV = field of view; K&L = Kellgren & Lawrence; MRI = magnetic resonance imaging; OA = osteoarthritis; TE = time to echo; TR = repetition time; WORMS = Whole Organ Magnetic Resonance Imaging Score.BMI = body mass index; BOKS = Boston Osteoarthritis of the Knee Study; C2C (also called Col2:3/4CThe authors declare that they have no competing interests.DH conceived of the study, participated in its design and coordination, and drafted the manuscript. JL and ML carried out the statistical analyses. JD carried out the assays. AG and DG read and interpreted the MRIs. DB, MN, RP, DE, and DF participated in the design of the study. All authors read and approved the final manuscript.

Response was determined by semiquantitative assessment of disease volume on serial computed tomographic (CT) scans and serum tumour marker changes at 12 weeks. Between 2003 and 2006, 40 patients were recruited through a national centre for the treatment of peritoneal surface tumours. At baseline, 23 patients had progressive disease and 17 had stable disease. Of 39 assessable patients, 15 : 25, 54%) benefited from chemotherapy in the form of either reductions in mucinous deposition or stabilisation of progressive pretreatment disease determined on CT scan. Notably, two patients, originally considered unresectable, following MCap and re-staging underwent potentially curative cytoreductive surgery. Grade 3/4 toxicity rates were low . Twenty out of 29 assessed patients felt that their Global Health Status improved during chemotherapy. This is the first trial to demonstrate an apparent benefit of systemic chemotherapy in patients with advanced unresectable PMP.Pseudomyxoma peritonei (PMP) is a rare neoplastic process characterised by progressive intra-abdominal dissemination of mucinous tumour, and generally considered resistant to systemic chemotherapy. A phase II study in patients with advanced unresectable PMP was undertaken to evaluate the combination of systemic concurrent mitomycin C (7 mg m Pseudomyxoma peritonei (PMP) is a rare neoplastic process (approximately 1–2 per million per year), arising in the majority of cases from the appendix, defined by disseminated peritoneal mucinous tumour deposition and progressive accumulation of mucinous ascites . HoweverConventionally, PMP is considered resistant to systemic chemotherapy, and, to date, there are no published chemotherapy trials in the setting of advanced unresectable disease. However, a recent report described a patient with PMP responding to capecitabine – an oral fluoropyrimidine ; (ii) MMThe aim of this study was to undertake a phase II study to evaluate tumour response, survival, toxicity and quality of life in patients undergoing MCap chemotherapy for advanced unresectable PMP.Between April 2003 and December 2006, patients referred with histologically confirmed PMP to the Peritoneal Tumour Service of Christie Hospital NHS Foundation Trust , one of the two national centralised centres in the UK, and considered unresectable by a dedicated PMP multidisciplinary team meeting, were considered for this trial. Unresectability was determined by predefined criteria on oral contrast computed tomography (CT) scan, namely, gastric encasement, extensive small bowel mesenteric involvement and/or fistulating disease, supplemented wherever possible by pre-referral operative records and/or intraoperative photographs. Histological classification was described by 9 per l and platelet count ⩾150 × 109 per l), hepatobiliary function ; ALP ⩽5 × ULN; transaminase (AST or ALT) ⩽3 × ULN) and renal function (estimated Cockcroft clearance ⩾50 ml min–1). Advice about contraceptive precautions was given, and for women of childbearing potential, a negative pregnancy test was required.The inclusion criteria were as follows: age ⩾18 years, World Health Organisation performance status 0–2 and life expectancy >3 months. All patients were required to have adequate haematological function at the appropriate therapeutic dose.−2 intravenous injection on day 1 and capecitabine 1250 mg m−2 twice daily on days 1–14, with a break in treatment on days 15–21. The next cycle consisted solely of capecitabine 1250 mg m−2 twice daily on days 1–14, with a break in treatment on days 15–21. These 3-week cycles were alternated so that eight cycles were given in total (four of each) (The MCap regimen consisted of MMC 7 mg mof each) . ProphylPatients were assessed at baseline and every 3 weeks and the following parameters recorded: performance status, weight, abdominal girth and toxicity scored using the National Cancer Institute's Common Terminology Criteria for Adverse Events version 3.0 . The folA CT scan was performed at baseline, and at the end of cycles 4 (12 weeks) and 8 (24 weeks). Standard CT scan RECIST criteria for the assessment of disease response were not applicable, as disease characteristics, such as cystic areas and ascites, are not included in these criteria . InsteadChemotherapy was administered unless a criterion for study discontinuation was met. Treatment was stopped at the request of the patient for any reason, or if, in the opinion of the investigator, it was in the patient's best interest to do so. At each review, a score of toxicity criteria was made according to NCI-CTCAE documents. Patients were treated only if all of these toxicity criteria were grade 1 or less. Patients with persistent grade 2 symptoms were deferred until their symptoms had improved to at least grade 1. If patients experienced grade 3 or 4 toxicity, then chemotherapy was delayed until their symptoms had resolved to grade 1 or better. Further doses of capecitabine and MMC were then reduced by 20% and this was continued for the rest of the course.Quality of life was assessed using the European Organization for Research and Treatment of Cancer (EORTC) questionnaires QLQ-C30 (version 3) . 95% confidence intervals (CIs) for single proportions were estimated using the Wilson score method without continuity correction . The WilAs there was no precedent, a response rate of at least 20% was considered to be acceptable in this study. Therefore, 14 patients were treated in the first instance and the study was extended on the response measured in that group. Only patients receiving the first 12 weeks of treatment were included in the assessment of the objective response rate. As more than 1 out of the first 14 patients responded, the minimum number of patients required to obtain a measurable response was 27 and the maximum 40 in order to give an estimate of the true response rate to a s.d. of 7.5%.Forty patients were recruited to the trial. Baseline characteristics are shown in The flow diagram of disease status at baseline and subsequent responses to treatment are shown in Out of the 23 patients with progressive disease prior to trial entry, 19 patients received 3 months of treatment and 15 completed a full course of chemotherapy over 6 months. One patient had a fit during the first cycle and had no further treatment and was therefore not assessable for response. Three patients (14%) responded to the treatment with a reduction in the volume of mucus, and one of these patients also had a reduction in the volume of the solid component of their disease. After 6 months of chemotherapy, these patients had a sustained reduction in disease and nine patients (41%) were found to have stable disease. These patients had progressive disease prior to chemotherapy .−1 from cutaneous fistula/sinuses. In one patient, the discharge settled completely with the cutaneous opening healing after 3 months of treatment. Another patient had two sinuses at the start of the treatment. After chemotherapy, one of the sinuses was dry and discharge from the other reduced from 50 ml day−1 to approximately 20 ml day−1. There was also a change in the consistency of the discharge from mucoid to serous responded to treatment with a reduction in the volume of mucus, which was maintained at 6 months. At this time point, nine patients (53%) were found to have stable disease and five (29%) were found to have progressive disease .Overall, out of the 39 assessable patients, 15 (38%) benefited from the chemotherapy regimen in terms of a reduction in mucus (with or without a solid component) or development of stability when known to be progressing prior to treatment . PatientWith a median follow up of 17 months (range 3.3–34.0), the 1-year and 2-year tumour-related survival rates for the 40 patients were 84% and 61%, respectively .P=0.001) and CA125 (P=0.002), but not CA19-9, between pre- and post-trial values . For those patients who completed a full chemotherapy course, there were reductions in the tumour marker levels by more than 50% for CEA in 11 patients; CA125 in 7 patients and CA19-9 in 6 patients. Twenty patients had a reduction in one or more tumour markers by more than 50% with chemotherapy. Overall, there were statistically significant reductions in the concentrations of CEA died early during their treatment due to disease progression; three of them had either PMCA-I/D or PMCA histological subtypes. Thirty-one patients completed 24 weeks of MCap chemotherapy. One patient suffered an epileptic fit during the first cycle and had no further treatment. Three patients stopped chemotherapy after the interim scans showed progressive disease; one patient stopped before the final cycle due to grade 3 toxicity. Grade 3 toxicities occurred in 12 out of 277 cycles; grade 4 toxicities in 4 out of 277 cycles – an overall rate of 6% . All these toxicities were the hand and foot syndrome .−2 – no cumulative MMC toxicity was evident. After this, patients were only treated with capecitabine at the same dose. Notably, two patients, originally considered unresectable, following MCap and re-staging underwent potentially curative cytoreductive surgery.Despite disease progression, 17 patients had a repeat MCap chemotherapy. Of these, 7% achieved disease stabilisation. The maximum amount of MMC given was 6 doses of 7 mg mP=0.005). There was no statistically significant difference in change in quality of life during the chemotherapy course stratified by initial disease status (stable vs progressive).Overall, quality-of-life parameters remained stable, with only the Global Health Status and chemotherapy-related side effects showing some alteration with treatment. The Global Health Status (QL2) provides an insight into a patients overall feeling about their well being. In this regard, out of the 15 patients with initially progressive disease prior to chemotherapy who completed a full course, 10 (67%) felt that their Global Health Status was the same or better at the end of the course, but 4 felt that it was worse (1 patient did not complete the form). Out of the 16 patients with initially stable disease prior to chemotherapy who completed a full course, 10 (63%) felt that their Global Health Status was the same or better at the end of the course, but 5 felt that it was worse (1 patient did not complete the form). Analysis of data from each section of the questionnaire showed that the only statistically significant reduction in a specific area of quality of life was chemotherapy-related side effects overall assessment of the disease volume including mucin (supported by measurement of discrete deposits where possible); (ii) recording of new disease sites and (iii) the extent of compressive effects of disease on intraperitoneal organs, for example, degree of scalloping of the liver and spleen, compression of the stomach and strictures of the small or large bowel. Decreases in volumes of mucin alone were not recorded as responses.The present study has a number of advantages. First, data on treatment responses, survival, toxicity and quality of life were collected prospectively. Second, uniform criteria were used to report histological classifications and radiological responses. Third, the study was set within the framework of a dedicated Peritoneal Tumour Multidisciplinary meeting –commissiWe explored whether serum tumour markers, namely CEA, CA125 and CA19-9, may be helpful in the prediction of response to systemic chemotherapy. We rationalised the following: (i) serum CEA and CA19-9 levels are elevated in over 50% PMP patients at presentation and drop markedly following cytoreductive surgery and HIPEC (−2).For an unselected population of patients with PMP, over half of the cases at initial presentation will be advanced and unresectable. For these, we recommend 3-monthly CT scan. Where disease is stable, a ‘watch and wait’ policy with repeat imaging every 3–6 months may be prescribed. These patients should be considered for MCap chemotherapy if they become symptomatic or their disease is radiologically progressing. We recommend up to a 6-month course of treatment followed by a rest period with CT surveillance; repeat MCap courses may be prescribed if disease progresses (the maximum total dose of MMC used in this study was 42 mg mOne unresolved questions from this study is that of optimising patient selection criteria. We noted that three out of the four patients that died early had aggressive histological types. Based on its effectiveness in the management of advanced colorectal cancer , we hypo

Fat abnormalities are common among HIV-infected persons, but few studies have compared regional body fat distribution, including visceral fat, in HIV-infected and HIV-uninfected persons and their subsequent trajectories in body composition over time.Between 1999 and 2002, 33 men with clinical evidence of lipodystrophy (LIPO+), 23 HIV-infected men without clinical evidence of lipodytrophy (LIPO-), and 33 HIV-uninfected men were recruited from the four sites of the Multicenter AIDS Cohort Study (MACS). Participants underwent dual-energy x-ray absorptiometry, quantitative computerized tomography of the abdomen and thigh, and circumference measurements of the waist, hip and thigh. Circumference measurements at each semi-annual MACS visit between recruitment and 2008 were used to compare average annual anthropometric changes in the 3 groups.2, respectively, p < 0.001). The average amount of visceral adipose tissue (VAT) was similar in all three groups (p = 0.26), but after adjustment for BMI, VAT was higher in the LIPO+ group (169 ± 10 cm2) compared to the LIPO- men and the HIV-uninfected group . Subcutaneous adipose tissue and total extremity fat were less in the HIV-infected men (LIPO+ and LIPO-) than in the HIV-uninfected men. Over an average of 6 years of follow-up, waist circumference increased at a faster rate in LIPO+ group, compared to the LIPO- men and HIV-uninfected control men . The annual changes in hip and thigh circumferences were similar in all three groupsBody mass index (BMI) was lower in LIPO+ men than in the LIPO- men and the HIV- uninfected controls (BMI: 23.6 ± 0.4 vs 26.8 ± 1.5 vs 28.7 ± 0.9 kg/mSubcutaneous lipoatrophy was observed in HIV-infected patients, even those without clinical evidence of lipodystrophy, compared to age-matched HIV-uninfected men. Despite markedly lower BMI, HIV-infected men with lipodystrophy had a similar amount of VAT as HIV-uninfected men and tended to have more rapid increases in waist circumference over 6 years of follow-up. These longitudinal increases in waist circumference may contribute to the development of cardiovascular risk in HIV-infected patients with lipodystrophy. In the era of highly active antiretroviral therapy (HAART), body habitus changes occur frequently among HIV-infected patients. These iRelatively few studies, however, have compared fat distribution in HIV-infected and HIV-uninfected individuals using techniques that can separate subcutaneous and visceral fat in the abdomen, such as quantitative computerized tomography (CT) or magnetic resonance imaging (MRI). The largest study to date that has compared body composition in HIV-infected men and women to HIV-uninfected controls is the Study of Fat Redistribution and Metabolic Change in HIV Infection (FRAM). Data from this study indicated that HIV-infected men and women with clinical lipoatrophy had less visceral adipose tissue (VAT) than HIV-uninfected controls,6. AnothEven fewer studies have compared longitudinal changes in body composition in HIV-infected and HIV-uninfected individuals. In the Multicenter AIDS Cohort Study (MACS), we found that waist circumference increased more rapidly in HIV-infected men compared to HIV-uninfected men after adjustment for cumulative antiretroviral exposure, although baseline waist circumference was markedly lower in HIV-infected men. This moWe conducted a substudy in the MACS whose primary goal was to compare fat distribution, including VAT, in HIV-infected men with and without lipodystrophy to HIV-uninfected men using direct quantitative measurements, in addition to anthropomorphic measurements. Furthermore, to better understand body shape changes over time, we examined the relationship between these data and longitudinal changes in anthropometry in these three groups over the 6 years following the cross-sectional assessment.The MACS is an ongoing multicenter prospective cohort study of homosexual and bisexual men who are followed on a semi-annual basis. Each semi-annual MACS visit includes a detailed medical history, a physical examination, and collection of biological specimens. The institutional review boards at each site approved study protocols and forms, and each participant provided written informed consent both for the overall study and this substudy.Beginning in April 1999 (visit 31), each MACS study visit included anthropomorphic measurements. At that time, there were 1952 men under observation, including 849 HIV-infected men and 1103 HIV-uninfected men. Participants for the Lipodystrophy Substudy were recruited between 1999 and 2002. Cases were identified by standardized clinical examinations that were completed semi-annually at each study site, as previously described [Two control groups were recruited: 1) HIV-infected men without evidence of lipodystrophy by clinical examination and 2) HIV-uninfected healthy men. Controls were matched to cases for age within 5 years and by MACS site. All HIV-infected men were required to have consistently received the same level of antiretroviral treatment during the 2 years prior to study entry. HAART was defined according to the US Department of Health and Human Services (DHHS) Kaiser Panel guidelines as previOf the HIV-infected men under follow-up between 1999 and 2002, 281 met criteria for study entry and could be evaluated for exclusion criteria. Of these, 135 were excluded due to use of hormonal agents and 34 due to diabetes, and 35 due to inconsistent antiretroviral therapy level in the 2 years preceding the first clinical evidence of lipodystrophy. Of the remaining 77 men, matched HIV-infected and HIV-uninfected controls could be found for 60, which constituted the recruitment pool for cases.Substudy participants underwent body composition measurements, including anthropometry, CT of the abdomen and thigh, and total body DXA. Body circumferences , weight, and height were measured using the protocol established in the Third National Health and Nutrition Examination Survey (NHANES III) by train2). Adipose tissue areas were calculated for visceral adipose tissue (VAT), subcutaneous adipose tissue (SAT) of the abdomen, and SAT of the thigh. The coefficient of variation was 2–5%.Quantitative CT was used to measure visceral and subcutaneous adipose tissue. For the abdominal scan, one axial image with 3–10 mm slice thickness was obtained using the space between the fourth and fifth lumbar vertebrae as the origin point. For the thigh scan, one axial image with 3–10 mm slice thickness was acquired using the midpoint of the total femur length as the origin point. Images were sent digitally from each MACS site and were analyzed centrally using image analysis software . Adipose tissue was identified by selecting the pixels that ranged between -190 and -30 Houndsfield units. The sum of specific tissue pixels multiplied by the individual pixel surface area yielded the respective tissue areas was undertaken to assess whole body tissue composition and regional body composition . Procedures were done using a Lunar Prodigy in conjunction with Encore 2002 software at the Pittsburgh site and Hologic 4500A machines with QDA4500A software version 9.03 at the other sites.2 testing. Continuous demographic, anthropometric and body composition variables were compared using analysis of covariance (ANCOVA), adjusted for the MACS site and race (white vs. non-white) using PROC GLM in SAS version 9.0 [pdiff option in the LS-means statement of PROC GLM.Categorical demographic variables were compared between the three groups using χCary, NC). Since tCary, NC), and thiTo determine whether longitudinal changes in anthropomorphic measurements differed between the three groups, multivariable linear mixed effects regression models were implemented. Measurements that were larger than the upper quartile + 1.5 (upper quartile – lower quartile) or smaller than the lower quartile – 1.5 (upper quartile – lower quartile) were considered outliers and were excluded from the analysis. SAS PROC MIXED procedure with a random intercept was used to account for the correlation of repeated measurements. The dependent variables were waist, hip, and thigh circumferences. The independent variables were the study group, BMI at the baseline visit, MACS site, age centered at 50 yrs, and race. P-values < 0.05 were considered significant. Longitudinal changes in anthropometrics for the entire MACS cohort between 1999 and 2003 have been previously reported.Eighty-eight men were included from the four MACS sites: 32 HIV-uninfected men, 23 HIV-infected men without clinical lipodystrophy (LIPO-), and 33 HIV-infected men with clinical lipodystrophy (LIPO+). Clinician-generated severity ratings for lipoatrophy were: 10 (30%) mild, 11 (33%) moderate, and 12 (36%) severe. Severity ratings for lipohypertrophy were: 9 (27%) mild, 17 (52%) moderate, and 7 (21%) severe.Additional file The LIPO+ group differed from the LIPO- group at the baseline visit in having a higher proportion of men receiving HAART, and lower current and nadir CD4 cell counts. The mean duration of HAART at the time of enrollment was similar between these two groups.Additional file Amounts of subcutaneous adipose tissue in the abdomen and thigh were lowest in the LIPO+ group, intermediate in the LIPO- group, and highest in the HIV-uninfected men. Adjustment for BMI or lean mass reduced the magnitude of the differences between the groups. After adjustment for BMI, only the differences between the LIPO+ and HIV-uninfected groups remained significant. After adjustment for lean body mass, differences in abdominal SAT were significant between the HIV-uninfected group and the two HIV-infected groups. For thigh SAT, the LIPO+ group was found to have less fat compared to the HIV-infected and LIPO- groups, and thigh SAT tended to be lower in the LIPO- group compared to the HIV-uninfected group (p = 0.06).Additional file Extremity fat was lowest in the LIPO+ group, intermediate in the LIPO- group, and highest in the HIV-uninfected group. After adjustment for BMI, the differences among the groups became smaller and either non-significant (LIPO+ vs. LIPO- groups) or borderline significant (LIPO- vs. HIV-uninfected group). After adjustment for lean body mass, the amount of extremity fat was significantly lower in the LIPO- group compared to the HIV-uninfected group.Additional file Hip circumference was lowest in the LIPO+ group, intermediate in the LIPO- group, and highest in the HIV-uninfected group. After adjustment for BMI, the differences between the HIV-uninfected and each of the HIV-infected groups remained statistically significant. Thigh circumference was lower in both of the HIV-infected groups compared to the HIV-uninfected group, regardless of the adjustment made.Figure In this nested case-control study in the MACS, we used DXA, quantitative CT, and simple anthropometry to compare regional body composition in HIV-infected men with and without clinical evidence of lipodystrophy to HIV-uninfected control subjects. VAT was similar in all 3 groups despite marked differences in BMI, and peripheral lipoatrophy was accentuated in HIV-infected men, regardless of clinical evidence of lipodystrophy, compared to HIV-uninfected men. Finally, over 6 years of follow-up waist circumference increased more rapidly in HIV-infected men who had clinical evidence of lipodystrophy, compared to the HIV-infected men without lipodystrophy and HIV-uninfected men, whereas rate of change in hip and thigh circumference did not differ by group.While multiple studies have shown that HIV-infected patients with lipodystrophy have more VAT than HIV-infected patients without body composition changes ,15, rela2 vs. 25.1 ± 4.4 kg/m2, p < 0.0001). In some FRAM analyses[Cross-sectional studies have taken different approaches to this problem. The FRAM study, the largest such study comparing body composition in men and women with and without HIV infection, reported similar amounts of VAT in 926 HIV-infected and 258 HIV-uninfected subjects. Body ma analyses. To accoIn the present study, as in the MACS as a whole , HIV-infConsistent with the report by Joy et al, which used stratification, our findings suggest that HIV-infected men with clinical lipodystrophy tend to have more VAT for a given BMI than HIV-uninfected men. Because apparent differences in VAT between HIV-infected and -uninfected persons after matching, adjusting, or stratifying on BMI may be inflated, the FRAM investigators did not directly adjust for BMI in their analyses, noting that "BMI is being influenced by the phenomenon being studied: quantity of fat". NeverthOur second major finding was that SAT (thigh or abdomen) and extremity fat were markedly lower in HIV-infected men, with or without clinical lipodystrophy, compared to HIV-uninfected controls. After adjustment for BMI or lean body mass, the magnitude and statistical significance of these differences decreased, with differences in thigh SAT between the HIV-infected men without lipodystrophy and the HIV-uninfected group no longer being statistically significant. However, by DXA, extremity fat in HIV-infected men without lipodystrophy was 20–30% lower than in HIV-uninfected men, regardless of the adjustment. This is consistent with the FRAM study, in which HIV-infected subjects with and without clinical lipoatrophy had lower leg fat than HIV-uninfected subjects ,6. TakenFew longitudinal data are available on changes in body composition in HIV-infected men with and without clinical lipodystrophy, relative to HIV-uninfected persons. In this study, semi-annual body circumference measurements were available over the 6 years after the substudy visit. HIV-infected men who had clinical evidence of lipodystrophy had a more rapid increase in waist circumference compared to the HIV-infected men without lipodystrophy, and HIV-uninfected men. In contrast, no differences were observed between the groups in the change in hip or thigh circumference over the 6 year interval.Because measurement of waist circumference does not distinguish between visceral and subcutaneous fat, the more rapid increase in waist circumference in the HIV-infected men with clinical evidence of lipodystrophy could be due to an expansion of either the subcutaneous or visceral fat compartments, or both. Given the severity of lipoatrophy in this group (mean extremity fat 4.5 g), it is possible that some of this increase is due to a reversal of abdominal subcutaneous lipoatrophy. However, if this were the case, more rapid increases in hip and thigh circumference would have also been expected, and these did not occur. Further longitudinal studies, such as the FRAM follow-up study, are required to confirm this finding and understand the extent of change in each of the fat depots in those with a history of body fat abnormalities. Further studies are also needed to understand the factors contributing to the differences in the change of waist circumference in HIV-infected and uninfected patients and whether these are attributable to antiretroviral therapy, increased caloric intake, decreased physical activity, or other factors. In a previous MACS analysis using the entire cohort , we founThe present study had several limitations. First, our cases were defined based on clinical examination alone. In the time since our study was designed, other studies have defined lipodystrophy based on both patient-reported and clinician-observed fat abnormalities,5,14 whiLipoatrophy and lipohypertrophy are common in HIV-infected individuals and are associated with increased cardiometabolic risk and impaired quality of life. Our findings would suggest that even those HIV-infected without clinical evidence of lipoatrophy have reduced subcutaneous and extremity fat compared to their HIV-uninfected peers, highlighting the importance of subclinical lipoatrophy. Our findings would also suggest that abdominal adiposity increases more quickly in HIV-infected men with clinical lipodystophy, compared to those HIV-infected men without lipodsytrophy and HIV-uninfected men. The mechanisms underlying this process and its effects on cardiovascular risk require further investigation.TTB has served as a consultant to Abbott Laboratories, EMD Serono, and has received research support from Theratechnologies, Inc, GSK, and Abbott Laboratories. MDW has served as a consultant to Gilead Sciences and Tibotec Pharmaceuticals and has received research support from Tibotec Pharmaceuticals. XX, MJ, JS, FJP, LAK, JBM, and ASD declare that they have no competing interests.TTB drafted the manuscript and directed the statistical analysis. XX and MJ performed the statistical analysis and helped draft the manuscript. JS helped draft the manuscript and assisted with database management. LAK and FJP participated in the design of the study, assisted with its execution, and assisted with the interpretation of the data. MDW provided administrative and intellectual support for the study. JBM participated in the design of the study, assisted with its execution and provided administrative and intellectual support for the study. ASD conceived of the study design and was responsible for its conduct. All authors read and approved the final manuscript.Supplementary Table 1. Study population characteristics.Click here for fileSupplementary Table 2. Body composition by computerized tomography (CT) and dual-energy X-ray absorptiometry (DXA) in HIV-uninfected men (HIV-), HIV-infected men without clinical evidence of lipodystrophy (HIV+LIPO-), and HIV-infected with clinical evidence of lipodystrophy (HIV+LIPO+).Click here for fileSupplementary Table 3. Anthropometry in HIV-uninfected control men (HIV-), HIV-infected men without clinical evidence of lipodystrophy (HIV+LIPO-), and HIV-infected with clinical evidence of lipodystrophy (HIV+LIPO+).Click here for file

Hemiprocne mystacea, a small, 60g tree swift from the New Guinea region. This species breeds and molts in all months of the year, and flight feather molt occurs during breeding in some individuals. H. mystacea is one to be the smallest species for which stepwise replacement of the primaries and secondaries has been documented; yet, primary replacement is extremely slow in this aerial forager, requiring more than 300 days if molt is not interrupted. We used growth bands to show that primaries grow at an average rate of 2.86 mm/d. The 10 primaries are a single molt series, while the 11 secondaries and five rectrices are each broken into two molt series. In large birds stepwise replacement of the primaries serves to increase the rate of primary replacement while minimizing gaps in the wing. But stepwise replacement of the wing quills in H. mystacea proceeds so slowly that it may be a consequence of the ontogeny of stepwise molting, rather than an adaptation, because the average number of growing primaries is probably lower than 1.14 feathers per wing.The functional life span of feathers is always much less than the potential life span of birds, so feathers must be renewed regularly. But feather renewal entails important energetic, time and performance costs that must be integrated into the annual cycle. Across species the time required to replace flight feather increases disproportionately with body size, resulting in complex, multiple waves of feather replacement in the primaries of many large birds. We describe the rules of flight feather replacement for The feathers of birds have a functional life span that is always much shorter than the potential life span of adult birds. Thus feathers must be renewed regularly during periods of molt, wherein old feathers are pushed out and lost as new feathers are generated from the same feather follicle. Molt is costly to birds because feathers are time-consuming to build, because the synthesis of new feathers results in the turnover of a great deal of body protein, and because molt gaps in the flight feathers reduce lift and missing or growing contour feathers create irregularities in the body surface that increase drag 0.31, while the growth rate of the primaries increases as M0.17, meaning that large birds take disproportionately (M0.31/M0.17 = M0.14) more time to replace their primaries Across species, the time required to replace the primaries increases disproportionately with body size, making molt far more time-demanding for large than small birds. This is true because primary length increases with mass (M) as MPtilinopus and Columbina doves, francolins, and frogmouths, often contain two runs of new primaries that are separated by older primaries . So far as we know, however, no small species featuring a mix of new and old primaries has been studied in enough detail to determine whether primary replacement is stepwise or whether their primaries are divided into two separate molt series. Most of the literature on flight feather replacement lacks quantitative data summaries that allow critical assessments of the mode of flight feather replacement. Yet critical assessment of conclusions requires knowing the number of growing feathers examined for each flight feather locus and knowing the direction of replacement between each adjacent pair of flight feathers Stepwise primary molt, defined as two or more waves of feather replacement moving through the primaries at the same time and in the same direction Hemiprocne mystacea , the Moustached Tree Swift. This tropical aerial forager breeds just south of the equator in the Moluccas, New Guinea, most of the Bismarck Archipelago, and the Solomon Islands. At about 60g, this is the smallest resident species for which stepwise replacement of the flight feathers has been described. Primary replacement requires over 300 days. Molt and breeding take place in all months of the year and the intensity of molt in the primaries and secondaries is so low that there is seldom more than a single feather growing per wave of molt. All of these features seem designed to allow extensive overlap between molt and breeding and we have records of adults that were molting primaries when they were shot at their nests. Flight feather replacement is likely to be interrupted when the demands of parental care are large. These interruptions generate the mechanism by which multiple waves of feather replacement that characterize stepwise molting are generated because, in all species where the ontogeny of multiple waves has been established, molt reinitiates both where it was arrested and again at primary one Here we follow the methods proposed by Rohwer etc.Throughout this paper primaries, secondaries and rectrices are abbreviated by P, S, and R, respectively. The primaries are numbered from P1, the innermost primary, to P10, the outermost primary. Secondaries are numbered from S1, the outermost secondary, to S11, the innermost secondary. Rectrices are numbered from R1, the innermost rectrix to R5, the outermost rectrix. Feather pairs are symbolized as P1/P2, or P1/S1, H. mystacea.Repeated examination of living birds in active molt would be the ideal way to determine the rules of flight feather replacement, but such studies generally follow just a few captive birds. Most quantitative studies of molt come from the examination of museum specimens or from individuals captured during the molt and scored for feather replacement. Rohwer H. mystacea collected throughout their range to provide data on feather age and feather replacement in the primaries, secondaries and rectrices (see Acknowledgments for collections and acronyms). Recently-fledged birds can easily be distinguished from adults by their distinctive brown and mottled juvenile body plumage and by the white fringes on the tips of their primaries and secondaries. Young birds that had replaced their juvenile body plumage were considered immatures if they still showed white fringing on their flight feathers. Our sample of adults likely includes some young birds that had not yet replaced all their juvenile flight feathers but that were old enough when collected to have worn away the white fringing on their flight feathers.LKW scored immature and adult specimens of Growing primaries and secondaries were scored as decimal fractions of their full length, varying from 0.1 to 0.9. Missing feathers were given a score of 0.05 and new feathers replaced in the current episode of molting were scored as 1. For birds in active molt, old feathers received scores of 2, indicating that these feathers had been replaced in the previous episode of molting. We found no highly worn or faded feathers, so never assigned scores of 3, which would indicate feathers replaced two molts previously. For birds that were not growing primaries or secondaries when collected but that had two generations of feathers in their wings, each feather was scored as a 1 or 2 to indicate its replacement in the last (1) or next-to-last (2) episode of molting. These data constituted the raw data table illustrated in Rohwer H. mystacea because the replacement of flight feathers progresses so slowly that directionality scores required comparing a growing feather with its neighbors and scoring directionality on the basis of whether the neighbor was new or old.Following the details in Rohwer With this annotated molt summary table we then used various versions of the COUNTIF function in Excel to create the molt summary table. This table gives the number of growing feathers at every position, the number of nodal feathers, the number of terminal feathers, and the number of each of the three directionality scores for each adjacent pair of feathers where one or both were growing. This summary table is essential to give readers a sense of the reliability of conclusions concerning: 1) the number of molt series , again suggesting that the primaries are a single replacement series (sign test p<0.001). Note, however, that the sample size of growing primaries is low for P8–P10, making omissive molt, wherein P8 or P9 is skipped to generate a second outer wave of primary replacement in the next episode of molt, impossible to evaluate Without exception, the direction of replacement in the primaries is distal (p = 0.019), though sample sizes of growing feathers are poor from S3 through S8.Between secondary pairs S1/S2 and S7/S8 replacement is mostly proximal (12 cases) and seldom distal .Between the secondary pairs S11/S10 and S9/S8 replacement tends to be distal, with a total of 6 cases of distal directionality and 4 cases of proximal directionality , which is consistent with the primaries being a single molt series. The cases of proximal replacement are difficult to explain. They could represent errors in assigning feather age or they could be real if a wave of feather replacement in the inner primaries had progressed outward far enough that the growing feather in that wave was proximal to a new feather replaced in that same episode of molting by another wave of molt that was initiated in the outer primaries.The direction of replacement in the primaries in adults is much more distal (n = 294) than proximal , suggesting that S1 through S7 or S8 constitutes the outer molt series in the secondaries.Between secondary pairs S1/S2 and S7/S8 secondary replacement is much more strongly proximal (45 cases) than distal .Between the secondary pairs S11/S10 and S9/S8 secondary replacement tends to be distal, with 8 cases of distal directionality and 6 cases of proximal directionality , we split the score as .5 to S7 and .5 to S8 .H. mystacea, we also doubt that this interpretation is correct because data for immatures ; five had two waves of secondary replacement separated by fully-grown secondaries. Thus stepwise replacement of the outer secondaries was seen in 12.8% of adults that were molting secondaries. If this figure for the outer secondaries is adjusted upward in proportion to the difference in the number of feathers in the outer secondary series (7) and the primaries (10), step-wise replacement would occur about 18.3% of the time, compared to 21.0% in the primaries. Although we also observed a few cases of multiple waves in the inner secondaries, we do not present similar percentages for this molt series because directional scores were so contradictory that we are unsure how S8–S11 are replaced and if they constitutes a single molt series.H. mystacea was 1085.3 mm . Because many more birds were molting primaries than secondaries . Together these data suggest that R5 constitutes its own molt series.R5 is frequently nodal and the direction of replacement between R4 and R5 is often contradictory than distal , suggesting that R4 through R1 are a single molt series.The direction of replacement from R4 to R1 is much more strongly proximal , but the groups were suggested by the data, so the significance value cannot be trusted.H. mystacea, we can infer that the lower frequency of molting birds in July, August and September reflects arrests in primary replacement.While data from specimens examined at just a single point in time cannot directly demonstrate the interruption of primary molts, we can infer arrests in primary replacement from the ontogenetic mechanism for developing multiple waves of feather replacement. In all species for which the ontogeny of step-wise molting been studied, it develops as a consequence of molt being arrested before a wave of feather replacement reaches the terminal feather in its molt series H. mystacea has many interesting life history implications. The second is that the tables we use to summarize molt data from hundreds of specimens should succinctly and clearly allow others to assess both the validity of our interpretations and whether those interpretations are based on adequate data. Hopefully, the iterated versions of these tables will make our interpretations of the patterns of flight feather replacement more easily accessible. These tables should speak for themselves, so we offer no further discussion of them.There are two important messages in this paper. The first is that the biology of flight feather replacement in H. mystacea is the first small species studied well enough to be certain that the primaries constitute a single molt series. Although Apus apus sometimes replaces P10 while inner primaries are growing H. mystacea appear to be the first clear demonstration of stepwise primary replacement occurring throughout the wing in a small bird. We also show that the secondaries are divided into at least two molt series and that replacement in the outer secondary series (S1–7) can also be stepwise. As documented for Western Kingbirds, Tyrannus verticalisStelgidopterix ruficollisH. mystacea also replaces its rectrices in two molt series, with the outermost rectrix constituting a unique series, even though the outermost rectrix is R6 in the former two species and R5 in H. mystacea. Unlike these (and other) passerines, however, H. mystacea replaces its inner rectrices proximally, rather than distally.Complex primary replacement has been reported for more than 200 species of birds that weigh less than 100g, but almost all of these are small parrots, falcons, and kingfishers in which the primaries are divided into two or more molt series H. mystacea are estimated to grow 2.86 mm/d based on measures of growth bands, and this rate falls close to the expected value for a 60g bird H. mystacea that were replacing wing quills, the mean number of primaries growing per wing was only 1.14 feathers. Non-aerial foragers of similar size often grow 3–4 primaries simultaneously The primaries of H. mystacea is probably exceedingly slow for two reasons. First, aerial foragers replace their primaries very slowly relative to other birds of similar size, as shown by data on the duration of the primary molt in two species of swallows H. mystacea. Second, species that overlap molt and breeding typically have less than two primaries growing per wing, which greatly prolongs primary replacement H. mystacea clearly show that molt and breeding overlap extensively at the population level, and four adults shot at nests were molting primaries when collected. However, documenting that interruptions of molt are associated with high demands of parental care will require following marked individuals. Interruptions in the replacement of primaries and outer secondaries likely provide the mechanism for generating multiple waves of feather replacement that are sometimes observed in these two molt series Primary replacement in H. mystacea, but we examined so few juvenile H. mystacea replacing outer primaries that we cannot safely infer its absence.Stepwise molting has the disadvantage of replacing the inner primaries, which wear the least, more frequently than outer primaries, which wear the most Stepwise replacement of the primaries has been reported in a great diversity of avian lineages, mostly involving large species H. mystacea is so exceedingly slow that arguing that stepwise molting evolved to facilitate rapid primary replacement is implausible. Instead, it may be a consequence of the ontogeny of stepwise flight feather replacement. In 13 species for which data on the mode of development of stepwise molting has been summarized, immatures started their first primary replacement at P1 and did not develop a second wave of primary replacement until the first episode of molt was interrupted H. mystacea, stepwise replacement of the primaries and secondaries may be a consequence of interruptions of flight feather replacement caused by the demands of parental care or by poor environmental conditions for molting, rather than an adaptation to reduce the time in molt. When stepwise molting evolves to reduce the time in molt, we expect to see multiple primaries at several spaced-out loci growing simultaneously H. mystacea, the number of primaries growing simultaneously is lower than has been recorded for any other bird, including another aerial forager with simple descendent replacement of the primaries H. mystacea suggests that the occasional stepwise replacement found in its the primaries and outer secondaries could be an accident of history and ontogeny in this remarkable bird.Primary replacement in

Bacteremia is recognized as a critical condition that influences the outcome of sepsis. Although large-scale surveillance studies of bacterial species causing bacteremia have been published, the pathophysiological differences in bacteremias with different causative bacterial species remain unclear. The objective of the present study is to investigate the differences in pathophysiology and the clinical course of bacteremia caused by different bacterial species.We reviewed the medical records of all consecutive patients admitted to the general intensive care unit (ICU) of a university teaching hospital during the eight-year period since introduction of a rapid assay for interleukin (IL)-6 blood level to routine ICU practice in May 2000. White blood cell count, C-reactive protein (CRP), IL-6 blood level, and clinical course were compared among different pathogenic bacterial species.P < 0.001). The 515 eligible culture-positive blood samples harbored a total of 593 isolates of microorganisms . The incidence of Gram-negative bacteremia was significantly higher in the septic shock group than in the sepsis group (P < 0.001) and in the severe sepsis group . CRP and IL-6 blood level were significantly higher in Gram-negative bacteremia (n = 176) than in Gram-positive bacteremia (n = 407) .The 259 eligible patients, as well as 515 eligible culture-positive blood samples collected from them, were included in this study. CRP, IL-6 blood level, and mortality were significantly higher in the septic shock group (n = 57) than in the sepsis group (n = 127) (The incidence of Gram-negative bacteremia was significantly higher in bacteremic ICU patients with septic shock than in those with sepsis or severe sepsis. Furthermore, CRP and IL-6 levels were significantly higher in Gram-negative bacteremia than in Gram-positive bacteremia. These findings suggest that differences in host responses and virulence mechanisms of different pathogenic microorganisms should be considered in treatment of bacteremic patients, and that new countermeasures beyond conventional antimicrobial medications are urgently needed. Despite recent advances in critical care medicine, the mortality of sepsis in ICU remains high ,2. AmongSince 2000, we have used a rapid assay system for interleukin (IL)-6 blood level, aiming at real-time assessment of the magnitude of inflammatory response to facilitate prompt determination of disease severity and therapeutic effects . The objWe reviewed the medical records of all consecutive patients admitted to the general ICU of a university teaching hospital during the period from May 2000 to October 2008. Patients with one or more blood samples processed for culture were enrolled in the study. Among culture-positive patients, those fulfilling diagnostic criteria for sepsis described below and undergoing blood sampling for measurement of white blood cell count (WBC), C-reactive protein (CRP), and IL-6 concomitantly with collection of blood culture samples were finally included in the extensive review described below ); (2) a documented source of infection.For the diagnosis of sepsis, the criteria of the American College of Chest Physicians/Society of Critical Care Medicine Consensus Conference were applied . The crisevere sepsis nor the septic shock group comprised the sepsis group.Among patients meeting the diagnostic criteria for sepsis described above, those also meeting at least one of the following criteria for organ failure were classified in the severe sepsis group: hypoxemia (PaO2/FiO2 < 300), acute oliguria (urine output <0.5 mL/kg/hr persisting two hours or longer), serum creatinine >2.0 mg/dL, coagulation disorder (PT-INR > 1.5), thrombocytopenia , hyperbilirubinemia (T-Bil > 2.0 mg/dL), and hyperlactatemia (blood lactate >18 mg/dL). Of those in the severe sepsis group, those with a systolic pressure of 90 mmHg or lower that persisted despite appropriate fluid resuscitation and required a vasopressor were classified in the septic shock group. The remaining patients classified in neither the Patients with hematological malignancies and autoimmune disorders who needed treatment of immunosuppressive drug therapy were excluded from the present study. Immunosuppressive drugs include predonisolone, methylpredonisolone, cyclophosphamide, cyclosporine, doxorubicin, vincristine, methotrexate, rituximab and FK506. Patients with positive blood culture but not meeting the diagnostic criteria for sepsis were also excluded from the study to eliminate the possibility of samples false-positive as a result of contamination. Samples collected through central venous catheter and samples collected through peripheral vein puncture were excluded from the study to eliminate the possible variance of blood levels of biomarkers between arterial blood and venous blood. Patients whose blood culture showed skin indigenous bacteria in only one of the duplicate samples were also excluded. Coagulase-negative Staphylococcus, Corynebacterium species, Micrococcus species and Propionibacterium species were defined as skin indigenous bacteria.Blood culture samples were collected from arterial catheters by ICU staff doctors. Before taking blood samples, catheter ports or stopcocks were disinfected with povidone-iodone swab and 70% isopropyl alcohol swab. A 10 mL blood sample was divided evenly into anaerobic and aerobic culture bottles at the bedside. Blood samples were processed using a BACTEC 9240 automated blood culture system in combination with both standard aerobic and anaerobic media available from the instrument manufacturer . Bacteria were identified using standard methods. Two distinct episodes of bloodstream infection were recorded for a patient, regardless of bacterial species detected, if at least six days had elapsed between the two positive blood cultures, provided appropriate therapy had been implemented and significant clinical improvement had been obtained between the two episodes.Blood samples were obtained from arterial catheter simultaneously with collection of culture samples in all the patients studied. IL-6 blood levels were measured with a chemiluminescence enzyme immunoassay using a rapid measurement system . The duration of processing for IL-6 measurement was approximately 30 minutes .First, the three patient groups divided according to severity of sepsis were compared for white blood count, CRP, and IL-6 blood level as well as mortality.Culture-positive blood samples were divided into two groups, Gram-positive (GP) sample group and Gram-negative (GN) sample group, according to the bacterial species detected. When both Gram-positive and Gram-negative bacteria were detected in one blood culture sample, the sample was included in both the GP and GN sample groups. WBC, CRP, and IL-6 blood levels were compared between these two sample groups.Finally, all bacteremic patients were divided into three groups according to bacterial species detected during the clinical course: GP patients' group, one or more Gram-positive species detected; GN patients' group, one or more Gram-negative species detected; and GP/GN patients' group, both Gram-positive and Gram-negative species detected. These three patient groups were compared for severity and clinical outcome. Severity of illness was assessed by calculating Acute Physiology and Chronic Health Evaluation (APACHE)-II score and SequP < 0.05. Statistical analyses were performed with the SPSS 13.0 J for Windows software package .Comparisons of variables among groups were performed with the unpaired Student's t-test, except for sex, mortality, and positivity for Gram-positive and Gram-negative bacteria, which were compared with the chi-square test. Statistical significance was defined as Between May 2000 and October 2008, 4,092 patients were admitted to the ICU, and 2,528 of them underwent blood culture tests. Positive blood culture was confirmed for 743 of 4,191 samples submitted. After eliminating those meeting the exclusion criteria the remaining 515 culture-positive samples were included in the present study. These samples were collected from 259 patients and harbored a total of 593 microorganism isolates , have been already recognized , few stuThe magnitude of biological response to insult has been believed to be determined by the magnitude of insult as well as host predisposition. This concept has been schematized in the recently proposed PIRO model . When thEarlier initiation of appropriate antimicrobial therapy is clearly crucial in the treatment of sepsis . On the PAMPs from Gram-negative and Gram-positive bacteria are known to act as ligands for mutually different pattern recognition receptors including Toll-like receptors , and theThe present study has the following limitations. First, it was a retrospective study. Second, it was a single-center study in which it is difficult to rule out the possibility of bias in bacterial species identified and in patients' characteristics. In particular, the high percentage of male patients (69.5%, Table Patients admitted to the ICU with bacteremia were classified according to severity of sepsis for comparison of pathogenic microorganisms and blood levels of inflammatory biomarkers. The incidence of Gram-negative bacteria and CRP and IL-6 blood level were significantly higher in the septic shock group than in the sepsis and severe sepsis groups. Furthermore, CRP and IL-6 blood level measured concomitantly with sampling for blood culture were significantly higher in Gram-negative bacteremia than in Gram-positive bacteremia. These findings suggest that differences in host responses and virulence mechanisms of different pathogenic microorganisms should be considered in treatment of bacteremic patients, and that new countermeasures beyond conventional antimicrobial medications are urgently needed.• CRP and IL-6 blood level were significantly higher in Gram-negative bacteremia than in Gram-positive bacteremia.• The incidence of Gram-negative bacteremia was significantly higher in bacteremic ICU patients with septic shock than in those with sepsis or severe sepsis.• Characterization at the molecular level of the differences in virulence mechanisms between Gram-negative and Gram-positive bacteria is required.APACHE-II: Acute Physiology and Chronic Health Evaluation-II; CRP: C-reactive protein; IL-6: interleukin-6; PAMPs: pathogen-associated molecular patterns; SOFA: Sequential Organ Failure Assessment; WBC: white blood cellThe authors declare that they have no competing interests.RA designed the study and interpreted the results. OS and HH made critical revision of the manuscript for important intellectual content. TS, MN, YH, and YT drafted the manuscript. KS participated in the analysis of data and performed the statistical analysis. All authors read and approved the final manuscript.RA is Assistant Professor, Department of Emergency and Critical Care Medicine, Chiba University Hospital and a Board Certified Member of the Japanese Society of Intensive Care Medicine. OS is Professor and Chairman, Department of Emergency and Critical Care Medicine, Chiba University Graduate School of Medicine, and a Board Certified Member of the Japanese Society of Intensive Care Medicine. HH is Professor Emeritus and Former Chairman, Department of Emergency and Critical Care Medicine, Chiba University Graduate School of Medicine, and is Immediate Past President of the Japanese Society of Intensive Care Medicine.

Weaknesses in health systems contribute to a failure to improve health outcomes in developing countries, despite increased official development assistance. Changes in the demands on health systems, as well as their scope to respond, mean that the situation is likely to become more problematic in the future. Diverse global initiatives seek to strengthen health systems, but progress will require better coordination between them, use of strategies based on the best available evidence obtained especially from evaluation of large scale programs, and improved global aid architecture that supports these processes. This paper sets out the case for global leadership to support health systems investments and help ensure the synergies between vertical and horizontal programs that are essential for effective functioning of health systems. At national level, it is essential to increase capacity to manage and deliver services, situate interventions firmly within national strategies, ensure effective implementation, and co-ordinate external support with local resources. Health systems performance should be monitored, with clear lines of accountability, and reforms should build on evidence of what works in what circumstances. Global Health Initiatives, such as the Global Fund to fight AIDS, Tuberculosis and Malaria (GFATM), the Global Alliance for Vaccines and Immunization (GAVI) have raised large sums of money for essential health care and have challenged previous notions of what is possible. However the ability of countries to spend the new funds effectively is often constrained by fundamental weaknesses in their health systems -3. HenceHere we review the challenges that face those seeking to strengthen health systems. Drawing on the framework proposed in the 2000 World Health Report , we viewA major conclusion is the urgent need for evaluative research to discover what works and in what circumstances. First, however, we need to understand what the problems are. We therefore examine the main health system functions according to the categoriation set out above, describing key issues that emerge.The paper combines a review of literature identified from an initial search of PubMed using combinations of the terms "health system", strengthen*, full and abbreviated forms of GFATM and GAVI, vertical and horizontal, with follow up of relevant citations, and from the literature collections amassed by the authors over many years of working in this area . The material used is limited to that published in English. The review does not seek to provide an exhaustive catalogue of everything that has been written on this topic, but it does capture the essential elements and provides a range of examples to illustrate them.Those in most need of health care are often least able to afford it or to judge the quality of care they obtain. Financing of health systems has three main elements: collection of funds, pooling them, and purchasing effective care. All three elements often fail. In poor countries weak infrastructure and enforcement systems mean that payment of taxes and other contributions are essentially optional, while in others, what capacity that exists to collect taxes is not fully utilized. Most care is paid for by a combination of external funds, typically earmarked for specific conditions, and private out of pocket payments. Global Health Initiatives have brought substantial additional resources for particular activities . HoweverFailure of co-ordination increases burdens on already pressured national institutions ; thus whInternational funding channels, whether through vertical mechanisms or general budget support, are often disconnected from local revenue-generating initiatives, such as community based health insurance. Scarce local funds inadequately fill gaps that external funders decline to support. Multiple financing arrangements make resource pooling impossible and the myriad of individual transactions from out of pocket payments precludes strategic purchasing of services from providers. A second problem is the plight of families faced with catastrophic expenditure due to serious illness . Both haTraditional vertical programs can succeed in scaling up basic interventions such as vaccination as long as the external funding lasts, but they have failed to respond to the complex challenges now confronting them. Conditions such as AIDS, diabetes, and schizophrenia require long term relationships between patients and multi-disciplinary teams, access to different levels of care, and reliable supplies of pharmaceuticals . Those sMoney is important but not sufficient for strengthening health systems. Many health systems have limited absorptive capacity. They face shortages of key staff, migration, and low skill levels . Human rNecessary resources go beyond people and things. Health systems should also have systems to generate the knowledge resources they need to function optimally. Governments attending the 2008 Global Ministerial Forum on Research for Health in Bamako, Mali, agreed on the importance of building research infrastructure into health systems ,34. It iThe stewardship function , has beeMany health systems are already unable to respond adequately to contemporary challenges yet emerging pressures will intensify. Populations are changing, through both ageing and migration, with the latter likely to be driven partly by environmental degradation. The threat from newly and re-emerging infections is ever present. Products underlying the epidemic of chronic disease in the west, such as tobacco and energy dense processed food, are being marketed aggressively in the developing world. Growing road traffic is resulting in increasing injuries and sedentary lifestyles.The success of existing initiatives tackling major killers such as common childhood illnesses means that the burden of disease is now dominated by chronic disorders requiring complex packages of care. The development of integrated models of care for people with complex chronic conditions has challenged the richest countries ; there iThe response to contemporary global challenges has led to proliferation of new institutions and calls for a new 'global architecture' . SeveralDonor alignment and coordination and strengthening of health systems are being pursued through several global initiatives Table . The IntThis commitment is also apparent in the funding strategies of major donors, including the GFATM and the GAVI. Indeed the Taskforce process stimulated the Global Fund, GAVI Alliance and World Bank to propose a joint mechanism for investment in health systems. Yet applications to the GFATM focused primarily on health system strengthening have so far had limited success . Their gThese approaches are being accompanied by a greater emphasis on the need to develop sustainable financing, including well-functioning collection systems and risk-pooling arrangements . The rolThe Sector-Wide Approach (SWAp) is a mechanism whereby funds from different projects contribute to a sector-specific umbrella that is tied to a defined sector policy under a government authority. It calls for a new form of partnership between governments and development agencies, in which the leadership role of the former is strengthened. Key characteristics include clear ownership and leadership of the programme by the national government and a common effort by external partners to support that programme, including provision of all or a major share of funding for the sector, in support of the government's unified policy and expenditure programme.The high level Taskforce on Innovative International Financing for Health Systems has called for an additional $10 bn per year of external assistance by 2015, as well as substantially increased domestic public financing for health .Many of the actions required flow directly from weaknesses identified earlier. The health systems framework set out in the 2000 World Health Report draws attention to the need to focus on otherwise neglected areas, such as mobilizing resources, risk pooling, and stewardship. In some areas the degree of underinvestment is clearly acknowledged, for example the need to increase numbers of health workers and appropriate 'task shifting'. It is, The traditional distinction between vertical (disease-specific) and horizontal approaches is being reassessed. Each has strengths and weaknesses. Where health systems are extremely weak, vertical programs can play an important role, but they need to be designed in ways that act as a catalyst for wider system change (as is being attempted by the GFATM and GAVI), becoming interwoven in a matrix with horizontal programs . It is aTaking the example of the Global Fund, Ooms et al. argue that diagonal approaches to financing can be an intermediary step towards horizontal financing involving coordination and integration of disease-specific interventions into the broader health systems .According to WHO, diagonal approaches reconcile the need to keep some specialised functions while recognising that programmes and their scaling up require stronger health systems. A related concept is that of "integration of service delivery", links between prevention and treatment, between different stakeholders, between public, voluntary and private sectors, and between levels of the health system.Such approaches offer scope to benefit from synergies in the management of different diseases, particularly for complex chronic disorders such as AIDS, diabetes, and cardiovascular disease. All require functioning pharmaceutical distribution systems and mechanisms to train staff in areas as diverse as management, quality assurance, information systems and palliative care but it is wasteful to organize each of them separately. Yet achieving synergies will often require considerable effort to overcome historical patterns of provision, based on established funding streams, hierarchies, training and clinical routines that serve the interests of the provider rather than the patient.This highlights the importance of paying attention not only to the design of health systems strategies but also to the implementation of change and the ways of overcoming the factors that hamper it . There iFor this to happen, there is a need to realign the focus of much existing research, based on a better understanding of how health systems develop and change in different contexts. Too often in the past it has been assumed that a policy developed in one setting will work in another and, even when it is clear that the policy has failed, there is little interest in asking what it was about the context into which it was transplanted that caused it to do so. This requires a greater understanding of the concept of path dependency whereby, in the absence of a severe shock to the broader political system, the development of a health system is constrained by the history, culture, economic development, and institutional structures of the country in which it is situated ,57. ThesImproved health systems functioning demands change in the global aid architecture. Key issues include coordination, comprehensiveness, continuity, capacity, and accountability.Health systems strengthening can give the impression of becoming simply the latest fashion, with many actors now becoming engaged through funding, agenda setting, provision of technical advice, and oversight of implementation. This can bring benefits, as each actor can have competitive advantages, based on skills, areas of expertise, and established links but also poses challenges.These actors must fulfill a number of different roles. While almost all provide some degree of technical assistance, some are primarily donors providing funds to strengthen health systems, some of whom will focus on specific diseases or interventions, such as the GFATM, GAVI, and PEPFAR, while others take a broader perspective on the overall health system (and beyond), typified by bilateral development agencies such as DFID, DANIDA, and SIDA. Both types have a responsibility to ensure that they recognize the complex interlinkages between their various activities. They also must ensure that the evidence base for policy and practice is strengthened, available evidence is acted upon in programs that they fund, and that these programs contribute to health system strengthening in effective and transparent ways. Examples include developing a cadre of health workers that can contribute to health system priorities and not just a single disease, supporting sustainable health system financing mechanisms, and putting in place quality assurance systems which can cover a range of health outcomes. However, efforts by donors to invest in disease-specific programmes that also contribute to system-building are hampered by the limited evidence on what activities actually result in strengthening health systems and under what conditions .Others have a normative role in addition to the technical assistance they provide at country level. These include the WHO and, in some respects, the World Bank. Their role should be to ensure that the best available evidence is used to inform the development and implementation of effective policies, activities that have recently been endorsed by the leaders of eight of the global health agencies, including the WHO, World Bank, GFATM, and GAVI .These roles are clearly complementary but the increased global engagement in health systems strengthening is leading to considerable fragmentation in priorities and strategies ,59. The This analysis implies a need for leadership. Yet it is far from clear where this leadership should come from. Although the WHO views itself, and is viewed by many others, as occupying a position of leadership in global health, the complementarities of the many specialized institutions involved means that there may be different leaders in different situations. Rather, it seems that there is a need for dynamic partnerships in which different institutions lead in different areas, but in ways that support rather than undermine the work of others. These partnerships should support leadership by developing countries and South-South coalitions as far as possible . Where tThere are already some positive developments seeking to improve the effectiveness and predictability of aid flows and reduce duplication across donors and implementing agencies . HoweverThe diversity of actors in part reflects a multiplicity of interests. Agencies such as the GFATM and GAVI have clear mandates to focus on specific elements of health care. Non-governmental and private donors have also carved out niches, often focused on individual diseases. However, policies on health systems are more vulnerable than disease control policies to ideological influences, as evident in controversies over user fees and social health insurance, with donors often influenced by their own health service traditions and cultures. Effective coordination requires agreement on both investment priorities for health systems strengthening and implementation strategies. Aligning disbursement procedures is likely to pose challenges and will require significant commitment from both donor and recipient governments and a willingness to sacrifice some direct control over funding for greater aggregate impact. This will require greater independent evaluation of aid effectiveness over sustained periods.Experience with SWAps highlights both the importance and difficulties of pooling resources, agreeing priorities, coordinating reporting systems, monitoring, and embedding aid flows within national plans and budgets as a pre-requisite for creation of comprehensive approaches. Although experience has varied, where SWAps have been effective, as in Uganda, they have helped governments to develop strategic oversight over policies and resources, while working in partnership with donors and implementing agencies . Yet theSome have argued for an explicit focus on the extent to which funding achieves demonstrable synergies , with otThe SWAp experience highlights the importance of continuity, based on stable relationships among the major international actors and with recipient countries, and the ability to rise above the turbulence caused by short term priorities, funding cycles, and transient personal agendas. This requires a sustained focus on long-term objectives , eschewiJust as at national level, there is a need to boost capacity at international level. As already noted, the body of knowledge that can be drawn upon to guide decision making is limited and there is often inadequate understanding of the extent to which findings are contextually bounded. Many major donors and national governments face difficulties in recruiting individuals with appropriate skills and experience but this problem is especially great in the area of health systems. Translation of research into policy-relevant messages is often weak, with considerable scope to develop and evaluate cadres of knowledge brokers to function as intermediaries between researchers and policymakers . AlthougFinally, there is a need to strengthen systems of accountability, at global, national and sub-national level. This will never be easy, given the diversity of bodies involved and the fact that development assistance is intrinsically political. There is also a need for a better understanding of the role of the private and voluntary sectors, the interests they represent, and the ways in which they can be held accountable. Governments and private donors cannot be made to do something they would otherwise not do. However, they are not immune from public opinion, especially when a light is shone on their activities by non-governmental agencies, such as Global Health Watch .The need for health systems support to recipient countries now appears well accepted, but there is currently no clear way forward as to how this should implemented. Indeed, there is a risk that efforts to address health system strengthening will simply aggravate the current crowded scene of diverse global initiatives. Simply adding health system funding streams to existing global initiatives is not enough. There needs to be radical action to simplify the global health architecture and reduce the transactions costs they impose on countries. Five key actions are needed.First, there is a need for agreement on which international agencies, or partnerships, should be involved in health systems strengthening and in what ways, taking into account their mandates, expertise, and comparative advantage . In partSecond, it is vital that recipient countries should have, or should be supported to develop, a coherent national strategy for prioritizing external support and managing it together with local resources in a coordinated way. There should be effective agreements that standardize health worker remuneration, so that one initiative does not poach staff from another, although reaching such agreements may be difficult as they must take account of local labor market conditions and, especially, the need for some form of equivalence with the private sector. Parallel systems should not be created, whether to procure drugs or account for expenditures. Given the scarcity of resources for delivery of care, agencies that provide disease specific funding should be required to ensure they do not free-ride on a health system infrastructure which they do not support.Third, while many countries require greater technical capacity in managing and controlling specific diseases, and national or regional disease control programs have considerable value, it is vital that disease control activities are integrated with other health services at the level of service delivery. In particular, there are substantial synergies in delivery of care to those with AIDS and non-communicable diseases, both of which require well-managed pharmaceutical supply chains, trained multi-professional teams, and management systems to support long-term relationships between patients and health care providers at different levels of the system. The exceptions would be where the nature of the intervention is such that it is free-standing - as with national media campaigns, for example, or interventions in other sectors such as schools.Fourth, advocates of health system support need to give more careful thought to how the success of health systems strengthening can be assessed. Historically, health systems have been seen as not just a black box but also a black hole, absorbing resources without visible results . The chaFinally, the evidence base from which countries can draw examples of successful approaches to improving health systems performance is extremely weak. There is an urgent need for greater investment in applied health systems research in low income countries, especially that focusing on implementation of effective approaches to improving health system performance, including training of researchers and strengthening of research institutions . This inSuccessful implementation of these five steps should increase the prospects substantially for attainment of the MDGs, as well as enabling health systems to respond to other health challenges.The authors declare that they have no competing interests.DB and MM jointly drafted the manuscript. AM, GW, and AH revised it. All authors read and approved the final manuscript.

The mean plane of the isoxazole ring is inclined to those of the two benzene ring mean planes by 38.32 (16) and 43.91 (18)°.The title compound, C Å b = 25.966 (2) Å c = 7.4721 (19) Å β = 106.171 (3)°V = 1221.2 (5) Å3 Z = 4 Kα radiationMo −1 μ = 0.30 mmT = 295 K 0.3 × 0.2 × 0.2 mm Bruker SMART CCD diffractometerSADABS; Bruker, 2001T min = 0.928, T max = 0.952Absorption correction: multi-scan (2820 measured reflections2132 independent reflectionsI > 2σ(I)1851 reflections with R int = 0.050 R[F 2 > 2σ(F 2)] = 0.063 wR(F 2) = 0.197 S = 1.15 2132 reflections204 parametersAll H-atom parameters refinedmax = 0.27 e Å−3 Δρmin = −0.40 e Å−3 Δρ SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 for Windows (Farrugia, 1997enCIFer (Allen et al., 2004PARST (Nardelli, 1995Data collection: 10.1107/S1600536809034254/su2135sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809034254/su2135Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Also, HgCl2- injected rats develop glomerular cell infiltrates consisting of ED1+ cells (monocyte/macrophage), starting on day 4 and reaching a maximum on day 8. Treatment with anti-TNF-α antiserum had preventative effects as it reduced the urinary protein levels to close to the normal range and also blocked the influx of inflammatory cells in the renal glomeruli and interstitium, but circulating anti-GBM and lineal glomerular IgG deposits were unmodified. In addition, whole isolated glomeruli from HgCl2-induced nephritis secreted TNF-α commencing on day 8, being maximally detected on day 11 and preceding, between 2 to 3 days, the development of proteinuria. The administration of anti-TNF-α antiserum or anti-α4 integrin mAb completely abrogated the synthesis of TNF-α in glomeruli isolated from the respective treated groups of animals, in addition to the proteinuria. Taken together our results confirm that TNF-α plays an important role in the induction and development of HgCl2-induced nephritis and highlights the pathogenic importance of the local release of TNF in those renal diseases in which prominent glomerular macrophage accumulation is a constant feature.HgCl

Organizational context plays a central role in shaping the use of research by healthcare professionals. The largest group of professionals employed in healthcare organizations is nurses, putting them in a position to influence patient and system outcomes significantly. However, investigators have often limited their study on the determinants of research use to individual factors over organizational or contextual factors.The purpose of this study was to examine the determinants of research use among nurses working in acute care hospitals, with an emphasis on identifying contextual determinants of research use. A comparative ethnographic case study design was used to examine seven patient care units (two adult and five pediatric units) in four hospitals in two Canadian provinces (Ontario and Alberta). Data were collected over a six-month period by means of quantitative and qualitative approaches using an array of instruments and extensive fieldwork. The patient care unit was the unit of analysis. Drawing on the quantitative data and using correspondence analysis, relationships between various factors were mapped using the coefficient of variation.Units with the highest mean research utilization scores clustered together on factors such as nurse critical thinking dispositions, unit culture , environmental complexity (as measured by changing patient acuity and re-sequencing of work), and nurses' attitudes towards research. Units with moderate research utilization clustered on organizational support, belief suspension, and intent to use research. Higher nursing workloads and lack of people support clustered more closely to units with the lowest research utilization scores.Modifiable characteristics of organizational context at the patient care unit level influences research utilization by nurses. These findings have implications for patient care unit structures and offer beginning direction for the development of interventions to enhance research use by nurses. Traditionally, the factors studied in nursing have tended to be determinants of research use that could be characterized as individual – such as age ,11, attii.e., urban versus rural) a, also suDespite growing support for the importance of organizational context to research utilization, little is known about which contextual factors are important for research utilization by nurses and how these factors operate. This lack of certainty was evident in the findings from a Cochrane systematic review on organe.g., role, access to research, a favorable organizational climate towards research use, material support to attend conferences, time to read research, and organizational educational activities such as mini-courses) had statistically significant but inconsistent associations with research use. These findings suggest that while the contexts in which nurses work may be important to research use, further study in this area is needed.A more recent review that wasi.e., leaders who are visionary, enthusiastic, supportive, value education and professional development, maintain open lines of communication with staff nurses), the ability of staff nurses to establish and maintain therapeutic nurse-patient relationships, nurse autonomy and control, and collaborative nurse-physician relationships at the unit level . We excluded nurses at time two who already replied at time one so not to bias the findings by placing a greater weight on the responses from individuals responding twice. Due to the short time frame (six months) between times one and two, we also elected to combine responses from both periods. Further, our qualitative analyses during this six month interval did not show any evidence that the context of the units had changed and thus supported combining time one and time two responses. Table In months one and six of observations on each unit, two one-week periods of quantitative data collection occurred. Using survey instruments, data were collected on research use, organizational measures, critical thinking dispositions, unit workload, unit environmental complexity, and unit culture. The only inclusion criterion for participants was to be a registered nurse employed in one of the seven participating units. Sealed questionnaire packages were sent to all nurses working in the seven units, with two to three weeks allowed for completion. Participation was voluntary and anonymity was maintained. Posters, pamphlets, and informal communication with on-site data collectors during observation work were used as reminders to complete the questionnaires and return them to a centrally established location on the unit. Response rates varied with each instrument according to the time ( one N = 76 + timeSix instruments were used to collect the quantitative data: A Demographic (DEM) Inventory, a Research Utilization Survey, the Environmental Complexity Scale (ECS), the Nursing Unit Cultural Assessment Tool (NUCAT) Version 3, the Project Research in Nursing (PRN) 80, and the California Critical Thinking Disposition Inventory (CCTDI). These are described briefly in sections that follow. The ECS and PRN were both completed by research associates on the unit during the two separate week-long quantitative data collection periods, while the remainder of the instruments were self-administered by the nurses. A sample of the items and scales used to measure the study variables and corresponding reliability coefficients for scales are shown in Additional File The DEM developed for this study, included questions on gender, age, education, hours of work per week, length of shift, years working in nursing, membership in nursing organizations or groups, and the number of years worked on the unit.The Research Utilization Survey was first developed and reported by Estabrooks ,73. A shThe ECS -76 was dThe NUCAT3 was developed by Coeling ,78. The The PRN is a Canadian classification system used to measure the level of nursing care required by patients in hospitals and nursing homes . It consThe CCTDI is a 75-question, six-point 'agree/disagree' Likert-type scale. There are seven subscales to the inventory: truth-seeking, open-mindedness, inquisitiveness, systematicity, maturity, self-confidence, and analyticity. The maximum overall score attainable on this tool is 420, with each subscale contributing a maximum of 60 points. The standard scores for each subscale and all scales combined are 40 and 280 respectively. A score less than 40 on any subscale or less than 280 overall indicates limitations or weakness, whereas subscale scores of 50 or higher and overall scores at 350 or higher indicate a strength in critical thinking dispositions .2/ΣK]); 2) interclass correlation ICC (2) = (BMS - WMS)/BMS; 3) η2 = SSB/SST, where SSB is the sum of squares between groups and SST is the sum of squares total; and 4) ω2 = (SSB - [N - 1]WMS)/(SST + WMS). For each nursing characteristic analyzed, there was strong agreement among nurses in each given unit when ICC(1) was greater than 0.1. Aggregated data were considered reliable when the F statistic from the ANOVA table was statistically significant (p < 0.05) and/or ICC(2) was greater than 0.60 WMS), where BMS is the between-group mean square, WMS is the within-group mean square, and K is the number of subjects per group. The average K for unequal group size was calculated as K = (1/[N - 1]) F statistics and/or ICC(2) values greater than 0.60 indicate greater reliability and justification for aggregating the variables at the unit level. The ICC(1) values greater than 0.00 indicate some degree of perceptual agreement of nurses about the mean values within each unit. That is, the nurses' perceptions about their own unit were highly similar. However, the relative effect sizes for both η2and ω2 values were smaller, with η2 indices ranging from 0.02 to 0.54 and ω2 indices ranging from 0.00 to 0.48. Negative ω2 indices are reported as 0.00 and lower reported environmental complexity (as measured by changing patient acuity and re-sequencing of work). These factors represent modifiable conditions in the hospital environment and have important practical implications for work and unit structures and for organizing nursing service delivery to enhance nurses' use of research findings to improve patient outcomes.The authors declare that they have no competing interests.CAE conceived the study and its design, secured funding, provided leadership and coordination for the two projects and participated in data analysis and interpretation, writing, and final approval of the submitted manuscript, SS, KMcG, and JPM participated in data collection and concurrent data analysis, SS participated in drafting the manuscript, JES made substantial contributions to data analysis and interpretation and made major contributions to writing of the manuscript, BS participated in conceptualization of study, securing grant funding, in the start-up of the study (with data collection) and served as a lead investigator for the pediatric study, coordinating one of the participating sites, JWW participated in conceptualization of study, securing grant funding, in the start-up of the study (with data collection) and served as a lead investigator for the adult study, coordinating one of the participating sites, JL participated in conceptualization of study, securing grant funding and in the start-up of the study (with data collection), LOP participated in study conception, served as a senior advising member on work environment measures, and funded the collection of workload data in two hospitals. KGB participated in interpretation of the findings, GD participated in study conception, data collection and interpretation, GB participated in start-up of the study helping to shape the sampling and data collection activities, CKH coordinated the data linkage activities, participated in data analysis and interpretation, and provided critical commentary, JW participated in data analysis and interpretation, provided critical commentary and served as senior advisor to the team and principal investigator. All authors read and approved the final manuscript.additional table 1. Instrument Properties.Click here for fileadditional table Click here for file

We have used data from adolescents ages 10–18 who participated in the 2003 Tobacco Survey, a representative sample of adolescents in Northwest Ohio. A self-report of cigarette smoking was obtained using a questionnaire administered in classrooms. Data were analyzed using weighted chi-square and multiple logistic regressions in SAS that accounted for the survey design. The prevalence rates for adolescents that ever tried smoking were 7.4% in elementary (grades 4–5); 17.7% in middle (grades 6–8), and 41.4% in high (grades 9–12) schools, respectively. The highest prevalence rate was among Hispanics. Having a close friend that smoked and a smoker at home correlated significantly with both initiation of smoking and smoking at an earlier age. Smoking was correlated with low academic achievement among adolescents in all grades. Students who reported smoking by parents or siblings were significantly more likely to start smoking at an earlier age, compared to other students living in a non-smoking home environment. Smoking prevention program should include components focused on adolescents’ home environment and should start as early as the 4 In the United States, during 1997–2001, cigarette smoking and exposure to tobacco smoke resulted in an estimated 438,000 premature deaths, and 92 billion dollars in annual productivity losses [Two of the national health objectives for 2010 are to reduce the prevalence of current tobacco use to ≤21% among adults and to ≤16% among high school students . An impoTobacco smoking among adolescents is of public concern because of the immediate and long-term adverse health consequences such as asthma, chronic cough, cancers, chronic obstructive airways and cardiovascular diseases. Regular smoking by children is associated with increased risk of new-onset asthma . AdolescSmoking initiation in adolescents is also a problem with great impact on individual’s well being. It may lead to retardation in physical development . AdolescThe age at which the individual begins smoking may influence his/her health at an older age. Children who begin to smoke during elementary school may be more likely to smoke as adults than individuals who begin at older age . Those wTo determine the interventions needed to prevent early initiation of smoking, it is important to identify predictors of tobacco use by adolescents. Many variables that influence the likelihood of smoking initiation in adolescent population have been studied. However, the effect of these variables on age at onset is not well understood. In this paper, we investigated predictors of smoking initiation and age at start of smoking among adolescent in Northwest Ohio.2.The Northwest Ohio Youth Tobacco Survey (NOYTS) conducted in 2003 was a cross sectional study, using a multi-stage cluster sampling technique. In the first stage, schools were selected based on agreement to participate in the survey. In the second stage, systematic samples of classes were selected. All students in the selected classes were eligible to participate in the survey.All schools in Northwest Ohio were asked to participate in the survey. A total of 124 schools (64%) out of 194 agreed to participate and to provide access to their students. These schools were representative of all the 16 counties in Northwest Ohio.The survey questionnaire was developed based on the 2001–2002 National Youth Tobacco Survey (NYTS) core questionnaire . The NYTEver smokers were identified according to the question “Have you ever smoked cigarettes daily, that is, at least one cigarette every day for 30 days?” Subjects were considered smokers if they answered “yes”. Smoking status was assessed by a question asking to describe their smoking at the time of the survey. Subjects were considered current smokers if they answered “I smoke” or “I quit, but now I smoke again. Subjects were considered past smokers if they answered “I quit smoking within the past 6 months or more than 6 months ago”. Age at smoking onset was obtained from the question “How old were you when you smoked a whole cigarette for the first time?” Age at start of smoking was defined using 6 ordered categories .Researchers at Great Lakes Marketing (GLM), a commercial company, implemented the survey and supervised the data collection procedures. They contacted school administrators to obtain permission to survey students and also were involved in the design of the survey. The survey questionnaire was tested in a pilot study involving five classrooms from the selected schools. Students required an average of 30 minutes to complete the survey. Data were collected at schools, using a self administered questionnaire. The teacher left the classroom after introducing the researcher, who explained that students did not have to write their names on the questionnaires and assured strict confidentiality of the responses. Subsequently, the questionnaires were distributed in the class by the researcher.Data were weighted to provide estimates for adolescents in Northwest Ohio. For the estimation of prevalence or proportions, the weights were selected to account for design effect (selection of school and class levels), non response and the sample representation relative to racial and gender distribution in the total population. To some extent, the weighted estimates were representative of the population of adolescents aged 10 to 18 living in Northwest Ohio in 2003.Exploratory analyses were used to investigate the distribution of the independent variables. Categorical variables were described as percentages together with their corresponding 95% confidence intervals and quantitative variables were described as mean (SD). Binary logistic regression was used to examine initiations of smoking as it relates to some established risk factors . Adjusted odds ratio (OR) along with 95% confidence interval (CI) was calculated for the risk factors. Generalized ordered logistic regression was used to identify predictors of age at start of smoking. This analysis uses a cumulative logit model with the proportional odds assumption. Age at onset of smoking was recorded using 6 ordered categories. All the analysis was done using SAS 9.1 software. Weighted analysis was performed using both the suveyfreq and surveylogistic procedures in SAS . All sta3.Of the original sample of the students who participated in the study , a weighted sample was estimated as 5,021. About 54% were males; 87% whites and with almost equal distribution from grade 4 to grade 12. Approximately 26% of the population has initiated tobacco smoking. The distribution of smoking initiation by weighted demographic characteristics of the study population is shown in th graders and was 50.7% among 12th grade students. Smoking prevalence increased with age, and increased sharply betweens grades 8 and 9. About 7.4% of the students in elementary school (grades 4–5) were ever smokers compared to 17.7% in middle school (grades 6–8) and 41.4% in high school (grades 9–12) .The rate of smoking initiation in males was similar to that for females in all grades. The smoking prevalence was significantly different by race in grades 6–8, and grades 9–12. The highest initiation rate was among Hispanics. Initiation rates among African American were not statistically different from the rates among whites. Smoking was significantly correlated with lower academic achievement and for all grade levels. The percentage of ever smokers among students with bad performance at school was 13.2% for grades 4–5, 34.5% for grades 6–8, and was 55.2% for grades 9–12. Living with a smoker was associated with higher percentage of ever smokers for all grades. Peer smoking was significantly correlated with higher prevalence of smoking in all grades. When none of the closest friends smoked, smoking prevalence rates were 4.5% for grades 4–5, 9.6% for grade 6–8, and 26.3% for grades 9–12.No significant difference was found between males and females. Hispanic students were one and half times more likely to initiate smoking than Whites (p=0.04). Student with poor academic achievement was three times more likely to initiate smoking compared to an “A” student. Parent smoking was associated with increased risk of initiating smoking. The OR for a mother smoker was higher than the OR for a father smoker. In the same household, brother or sister smoking was the strongest correlate of smoking initiation. Having one closest friend smoking increased the likelihood of initiating smoking by almost five times.Participants reporting having a best friend who smokes were three times more likely to start smoking at earlier age. Participants having a higher percentage of friends who smoke were four times more likely to initiate smoking earlier than other students. Academic achievement was a significant predictor of early age at smoking initiation. Participants who made B or C were more likely to initiate smoking earlier compared to those making A. Similarly those who made D or F had three time the odds of reporting initiation of smoking at earlier age compared to those making A .4.This study examined the prevalence and correlates of smoking initiation among adolescents in Northwest Ohio. The estimated prevalence rates are comparable to those reported in the 2003 Youth risk behavior surveillance [et al.[We found that gender is not a significant correlate of either smoking initiation or age at the start of smoking. This is in line with the finding of other studies . This iset al.. By age et al.. Higher et al..In contrast to national data for youths aged 12–17 , prevaleNo significant difference was found between Whites and African American adolescents in our study. Two studies in the literature , 23 haveSmoking by a family member is a strong correlate of smoking. Parent smoking habits was significantly related to both initiation and early onset of smoking. The association between exposure to smoking parents and smoking status of a teenager is consistent with other studies , 27. ParIn this study, the likelihood of initiating smoking when mother smoked increased two fold and this tended to occur at younger age. Mothers play a crucial role in molding the behavior of young children. The finding that mother’s smoking correlates with earlier age at onset is important and point to the triggering effect earlier in life. Mothers’ effects on adolescent cigarette smoking are mostly during earlier age and thus most of the initiation triggered by mother smoking will occur earlier in life. Offspring of nicotine-dependent women had a higher rate of nicotine dependence, and this relation is greater if the mother also smoked during the offspring’s gestation . Our finSmoking by a sibling tripled the likelihood of both initiation and early onset of smoking. Sibling influence could be through social influence affecting the adolescent’s thoughts, feeling, and actions. The social influence of families and other significant individuals is well supported in the literature .Having closest friends smoking was correlated with age at smoking initiation. Those who started smoking earlier tend to be triggered by a friend smoking. It is possible that those who started earlier accumulated more friends with similar smoking habit over a longer time than those who started later. Another explanation for this may be the tendency of smokers to associate with smokers. However, peer smoking appears to be the most important factor influencing smoking initiation. Some studies , 31 suggAcademic achievement was a significant correlate of smoking initiation. Failing grades was correlated with increased risk of smoking initiation and this was more pronounced in grades 6–8. This finding is consistent with a number of different studies in the literature. , 35–36. et al. [The present study has some limitations. First, conclusions that can be drawn from this study are limited by the cross-sectional nature of the data. Specifically, it is not possible to determine whether the observed differences emerged before or after smoking initiation. We could use the same argument to explain the correlation between closest friend smoking and onset of individual smoking. Second, the sample size was relatively small for Hispanic and other races to allow for additional analyses stratified by race. Third, we did not investigate personal factors in this study and these factors may affect smoking initiation in adolescents. For example, adolescents with depressive symptoms are more likely to start smoking compared to non-depressed adolescent . Youngeret al. reportedet al. et al.[Finally, smoking status was based on self-report and therefore subject to respondent recall and may be deliberate misreporting. Data on current smoking were not verified by biomarkers such as cotinine assessment or exhaled carbon monoxide. However, we used a validated NYTS methodology, and weighted analysis that adjusted for design effect and non-response bias. By doing so, our findings are valid, and could be compared to other studies using the same methodology. High school students in the United States report personal health risk behaviors reliably over time as reported by Brener et al..th grade. The possible impact of the smoking ban in Ohio in reducing cigarette smoking among adolescents in Northwest Ohio remains to be observed.In conclusion, our data indicated that race, smoking by family member or closest friend, and performances in school are significant correlates of smoking initiation in adolescents. These variables are important not only in affecting experimentation with cigarette smoking but also in facilitating this at an earlier age. In order to reduce the risk of smoking initiation, smoking prevention programs need to focus on environmental influences of early adolescent smoking such as parent and peer smoking. Smoking prevention programs should include components focused on adolescents’ home environment and to start as early as the 4

The crystal structure is stabilized by N—H⋯Cl and O—H⋯Cl hydrogen bonds, forming infinite chains along the a and b axes.The quinuclidinium cation of the title compound, C Å c = 18.145 (9) Å V = 803.6 (6) Å3 Z = 4 Kα radiationMo −1 μ = 0.41 mmT = 100 (2) K 0.50 × 0.34 × 0.08 mm Kuma KM-4 CCD κ-geometry diffractometerCrysAlis RED; Oxford Diffraction, 2007T min = 0.86, T max = 0.97Absorption correction: analytical (11241 measured reflections3310 independent reflectionsI > 2σ(I)3128 reflections with R int = 0.022 R[F 2 > 2σ(F 2)] = 0.026 wR(F 2) = 0.063 S = 1.00 3310 reflections92 parameters1 restraintH-atom parameters constrainedmax = 0.36 e Å−3 Δρmin = −0.20 e Å−3 ΔρAbsolute structure: Flack 1983, 1361 FrFlack parameter: −0.01 (3) CrysAlis CCD used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008XP in SHELXTL (Sheldrick, 2008SHELXL97.Data collection: 10.1107/S1600536808009185/pk2091sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536808009185/pk2091Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

One hundred cases of retinoblastoma were diagnosed in New Zealand-born children between 1948 and 1977 inclusive. Five patients had an affected parent, and of the remaining sporadic cases 25 had bilateral and 70 unilateral tumours. The frequency of retinoblastoma, 1 in 17,500 births, was similar to that reported for most other countries. There was no evidence of an increase in the incidence of all cases of sporadic retinoblastoma during the 30-year period studied, nor was there any significant fluctuation in their incidence with space and time. There was an excess of bilateral sporadic cases in the southern-most districts of New Zealand, but this was of marginal significance. There was no significance evidence for any environmental influence on the occurrence of retinoblastoma.

Crystallization is a major bottleneck in the process of macromolecular structure determination by X-ray crystallography. Successful crystallization requires the formation of nuclei and their subsequent growth to crystals of suitable size. Crystal growth generally occurs spontaneously in a supersaturated solution as a result of homogenous nucleation. However, in a typical sparse matrix screening experiment, precipitant and protein concentration are not sampled extensively, and supersaturation conditions suitable for nucleation are often missed.We tested the effect of nine potential heterogenous nucleating agents on crystallization of ten test proteins in a sparse matrix screen. Several nucleating agents induced crystal formation under conditions where no crystallization occurred in the absence of the nucleating agent. Four nucleating agents: dried seaweed; horse hair; cellulose and hydroxyapatite, had a considerable overall positive effect on crystallization success. This effect was further enhanced when these nucleating agents were used in combination with each other.Our results suggest that the addition of heterogeneous nucleating agents increases the chances of crystal formation when using sparse matrix screens. Crystallization is considered to be a major bottleneck in the process of structure determination of macromolecules by X-ray crystallography. Crystallization is thought to occur in two steps: (i) nucleation and (ii) growth of nuclei to macroscopic crystals In a popular approach to macromolecular crystallization, initial crystallization screening is carried out using sparse-matrix screens An alternative mechanism to achieve nucleation is heterogeneous nucleation. Heterogeneous nucleation involves the introduction of a solid material termed the heterogeneous nucleating agent, nucleant or seed. Nucleation occurs on the surface of this material, which creates a higher local concentration of macromolecules, lowers the energy barrier for nucleation and bypasses the high kinetic barrier of spontaneous nucleation. A lower level of supersaturation is required under such circumstances for the nucleation step to occur, compared to homogenous nucleation.Anecdotally, protein crystals have often been observed to grow on the surface of fortuitous impurities in the drop, such as dust particles and fibers. This has led to more systematic studies of the benefits of including heterogeneous nucleation agents in protein crystallization. The main lines of research have involved studies of epitaxic nucleants and repeated the experiment on lysozyme . The resAll the initial experiments were performed using a set amount of nucleating agent, chosen somewhat arbitrarily as the largest amount of nucleant that allowed unobstructed visualization of crystals under the microscope . To examine the effect of the quantity of nucleating agent, we chose one crystallization condition , 2% PEG 400, 2 M ammonium sulfate) and set up drops with diminishing amounts of nucleant (6 replicate drops for each amount of nucleant). Crystals appeared in 92%, 80% and 33% of the drops containing 1, 1/25 and 1/50 of the initial amount of the nucleant, respectively. The results indicate that reducing the amount of nucleating agent from the original value we used reduces the chances of successful nucleation.Nucleation and crystallization occur as a result of random association events and are influenced by a number of different factors. It is therefore important to establish the reproducibility of the effect of heterogeneous nucleating agents. However, due to the scope of the initial experiment to establish the effect of different nucleants (10 protein variables and 11 nucleating agent variables), resulting in over one hundred 96-well crystallization plates and over 10,000 crystallization drops, it was not feasible to set up replicates of the whole experiment. Instead, we performed duplicate experiments for selected conditions. Based on the results of the original crystallization screen experiments, eight conditions that showed a positive nucleation effect were chosen for each protein see also , and tweAmong the heterogeneous nucleating agents we studied, dried seaweed emerged as the most successful nucleant, triggering crystallization in new conditions for every one of the proteins tested, and inhibiting crystallization in only very few cases, as compared with the control. Notably positive results were also obtained with horse hair and cellulose. Hydroxyapatite led to new crystallization conditions for all the proteins tested, but also inhibited crystallization in a larger number of cases, although the overall effect was positive. By contrast, while fumed silica and CM Sephadex identified some new crystallization conditions, they inhibited many more, resulting overall in a negative effect. Other nucleants tested had a smaller overall effect, with glass wool and sand displaying no major effects on crystallization.Interestingly, the conditions identified as supporting crystallization only with the addition of nucleant tended to be unique to a given nucleant. The less successful nucleants identified few if any unique crystallization conditions. Consistent with these observations, combining the different nucleating agents with each other had a stronger positive effect than any individual nucleant. Our data do not show clear evidence of a synergistic effect; the effect of combining the nucleants with each other is most likely cumulative.An analysis of the conditions in which the nucleants induced new crystallizations reveals some interesting trends. For example, dried seaweed and hydroxyapatite seem to preferentially cause nucleation in formulations containing PEG as precipitant, whereas horse hair was more successful in conditions that did not contain PEG. Interestingly, most of the inhibition caused by dried seaweed also occurred in conditions containing PEG as precipitant. Validation of the observed trends will require further testing.Our results are not surprising, as several heterogeneous nucleating agents used here have been found previously by others to have positive effects. For example, horse hair and dried seaweed have been reported previously to promote nucleation of lysozyme, glucose isomerase, trypsin and malonyl coenzyme A-acyl carrier protein transacylase We chose to add the nucleating agent to the protein solution before combining protein and reservoir solutions in the drop, as this appeared to be the simplest way to add the nucleating agent when setting up sparse matrix screens. The results show that this approach achieves reasonable reproducibility. With different automation, different techniques might be more appropriate We also tested if our approach can be used with the sitting drop vapor diffusion technique, as sitting drop experiments are becoming the standard in many medium- and high-throughput crystallization laboratories. We saw a similar positive effect with both hanging drop and sitting drop approaches for a lysozyme/dried seaweed experiment either with or without the nucleant. We set up a crystallization experiment for lysozyme (in the absence of the nucleating agent) under a condition that only yielded crystals in the presence of dried seaweed as the nucleating agent . We then varied the precipitant concentration (in the absence of the nucleating agent). At a higher precipitant concentration (PEG concentration of 32–34%), crystals appeared in the absence of the nucleating agent. This result is consistent with a model suggesting that when crystallization only occurs in the presence of the heterogeneous nucleating agent, it likely occurs in the metastable zone of the phase diagram. In such cases, crystallization is likely achievable in the absence of nucleating agent if protein or precipitant concentrations were increased.Alternatively, a crystallization hit obtained by screening in the presence of heterogeneous nucleating agents provides material for traditional seeding approaches using homo-nucleation The use of heterogeneous nucleating agents has much broader utility than traditional seeding techniques used in protein crystallization, such as macroseeding, microseeding and streak seeding We compared several heterogeneous nucleating agents and showed that the addition of some of these provides a simple method to increase the chances of crystal formation when using sparse matrix crystallization screens. The most successful nucleating agents consisted of pulverized dried seaweed, horse hair, cellulose and hydroxyapatite, all widely available materials. Although mixtures of nucleants perform better than individual nucleants, it may be advantageous to set up crystallization screens in the presence of individual nucleants as well; individual nucleants often yielded crystals under unique crystallization conditions. We recognize that we have screened only a limited range of materials, and further studies may uncover heterogeneous nucleating agents with even better properties when used to increase the success of crystallization screening.The proteins catalase (Cat. No. C-3155), myoglobin (Cat. No. M0630), ribonuclease A (Cat. No. R4875), pepsin (Cat. No. P7000), thaumatin (Cat. No. T7638), trypsin (Cat. No. T8003), xylanase (Cat. No. X2753) and α-lactalbumin (Cat. No. L5385) were purchased from Sigma-Aldrich, Missouri, U.S.A. Lysozyme (Cat. No. 837059) was obtained from Roche Applied Sciences, Indianapolis, U.S.A, and glucose isomerase (Cat. No. HR7-100) from Hampton Research, California, U.S.A. The proteins were dissolved in 25 mM Tris-HCl (pH 7.0) except for glucose isomerase, which was dialyzed into 10 mM Tris (pH 7.0) and 1 mM magnesium chloride. All proteins were used at a concentration of 10 mg/ml. The proteins were filtered through a 0.22 µm filter .Ulva, local name hai-tsai) was purchased from a local Asian grocery store in the form of fresh seaweed .The heterogeneous nucleants titanium(IV) oxide (Cat. No. 634662), carboxymethyl (CM) Sephadex (Cat. No. C50120), cellulose (Cat. No. 310697), hydroxyapatite (Cat. No. 289396), fumed silica (Cat. No. S5130) and Pyrex fiber glass wool (Cat. No. CLS3950) were obtained from Sigma-Aldrich, Missouri, U.S.A. Horse hair was obtained from a local violin shop, sand was obtained from a local beach, and green seaweed of each nucleant in an Eppendorf tube.The heterogeneous nucleating agent was added in the ratio of 0.5 µg to 1 µl of the protein solution and was mixed gently by tapping the tube. The solution was stored on ice and used within 30 min.Crystal Screen HT sparse matrix crystallization screen was used in this study. In order to minimize the contamination from any fortuitous substances such as dust particles and fibers, crystallization plates were removed from their plastic covers just prior to setting up the experiments and sealed with sealing tape immediately after 96 sparse matrix crystallization conditions were dispensed into the plate, and stored at 4°C until further use. One hundred µl (50 µl in the case of sitting drops) of crystallization condition was dispensed in each well of the 96-well plate. For hanging drop experiments, we used 96-well plates from TPP and Viewdrop 96-well plate seals from Millennium Science . For sitting drop experiments, Greiner low profile 96-well plates were used. In both cases, crystallization drops containing 100 nl protein solution were combined with 100 nl of reservoir solution using a Mosquito robot at room temperature. All plates were incubated at 20°C.To assess the reproducibility of crystallization experiments, eight conditions that showed a positive nucleation effect were chosen for each protein based on the results of the original crystallization screen experiments. Twelve replicates for each condition were set up across a row of a 96-well plate. A similar control plate was set up without the nucleant. In the case of glucose isomerase and myoglobin, only six conditions with a positive nucleation effect were available, therefore two of the conditions were repeated to fill the 96-well plate.Crystallisation experiments were imaged using a Crystal Monitor workstation on days 1, 3, 7 and 14. The data from day 7 were used in the analysis of results. All crystalline objects were counted as crystallization hits, as assessed by straight edges and using polarized light.Table S1Formulations in Crystal Screen HT(0.08 MB PDF)Click here for additional data file.Table S2All successful crystallizations(0.08 MB PDF)Click here for additional data file.

Staphylococcus aureus (SA) is a leading cause of a diverse spectrum of bacterial diseases, including abscesses. Nitric oxide (NO) is a critical component of the natural host defense against pathogens such as SA, but its therapeutic applications have been limited by a lack of effective delivery options. We tested the efficacy of a NO-releasing nanoparticle system (NO-np) in methicillin-resistant SA (MRSA) abscesses in mice. The results show that the NO-np exert antimicrobial activity against MRSA in vitro and in abscesses. Topical or intradermal NO-np treatment of abscesses reduces the involved area and bacterial load while improving skin architecture. Notably, we evaluated pro- and anti-inflammatory cytokines that are involved in immunomodulation and wound healing, revealing that NO-np lead to a reduction in angiogenesis preventing bacterial dissemination from abscesses. These data suggest that NO-np may be useful therapeutics for microbial abscesses. Staphylococcus aureus (SA) is an immotile Gram positive coccus that frequently colonizes human nasal membranes and skin. This bacterium is responsible for the majority of superficial and invasive skin infections, resulting in over 12,000,000 outpatient/emergency room visits SA clinical strains have recently evolved resistance to vancomycin, an antibiotic to which staphylococci have previously been uniformly sensitive. Although the vancomycin-resistant strains remain rare, methicillin-resistant strains (MRSA) are increasingly common SA infections. Furthermore, the incidence of community acquired strains of MRSA has markedly increased over the past several years SA infections Topically applied nitric oxide (NO) is a potentially useful preventive and therapeutic strategy against superficial skin infections, including MRSA subcutaneous abscesses. Based on our previous work in vivo setting. To validate this hypothesis, we investigated the biological impact of NO-np on MRSA using a mouse infection model.In this study, we investigate the applicability of topically applied NO via nanoparticles (NO-np) to MRSA growth was determined in real-time for 24 h using Bioscreen C analysis and 2.5 mg/mL of np or medium alone. Interestingly, MRSA grown with 5 mg/mL np resulted in a significant reduction in bacterial growth after 16 h, which is likely due to the effects of chitosan on the np. However, after this time point the bacteria subjected to 5 mg/mL np increased their replication rate.The effect of NO-np on MRanalysis . NO-np sSA abscesses. MRSA-infected NO-np treated abscesses showed significantly lower microbial burden than untreated or np-treated abscesses (P<0.001) (10) 4.85±0.29) in comparison to untreated (CFU (log10) 5.59±0.45) (P<0.01) or np-treated abscesses (CFU (log10) 5.50±0.24) (P<0.001).To maximize the exposure of the NO-np to the bacteria in the abscesses, we initially tested the compound by intradermally administering NO-np into the MRP<0.001) . To deteSA-infected abscesses, both untreated and np-treated, displayed a dense, neutrophil rich infiltrate along with extensive cell necrosis and ∼17.34 mm2 (P<0.001), respectively , respectively. Notably, complete abscess resolution of MRSA-infected and NO-np-treated mice is 7±2 days in comparison with ∼14–21 days in the other infected groups (data not shown).The effect of NO-np on abscess formation in Balb/c mice was investigated . Applicaectively . In sepaSA in infected tissue with flattening of all layers of the epithelium. There were no keratohyaline granules tissue was selected as it is representative of a normal keratinizing epithelium, comprised of basal cells, spinous keratinocytes, granular keratinocytes with basophilic keratohyaline granules, and keratinizing cells, yet without the capacity for recruitment of inflammatory cells that may exacerbate host tissue damage . RHE infd tissue . Infectigranules . The numSA was co-cultured with RHE in the presence or absence of NO nanoparticles for 24 h , a diatomic free radical that plays a key role in the natural immune system response to infection SA, a real time-killing assay was performed in tryptic soy broth (TSB) using a Bioscreen C device. Such real time-kill studies offer valuable information regarding the temporal efficacy of antimicrobial agents SA, NO-np significantly reduced bacterial growth when compared with MRSA grown with np only or medium alone. Interestingly, the highest concentration of np without NO resulted in a significant reduction in bacterial growth at 16 h, which is likely due to the effects of chitosan on the np core. The antimicrobial activity of chitosan, a hydrophilic biopolymer industrially obtained by N-deacetylation of crustacean chitin, has been observed against a wide variety of microorganisms including fungi, algae, and bacteria In our previous work, we showed that NO-np were effective against 20 different clinical isolates of MRSA (11 strains) and MSSA (9 strains) using CFU analysis SA abscesses. Bacterial abscesses can lead to serious complications including sepsis, tissue damage, and death. Abscesses are difficult to treat due to their tendency to prevent immune cells from attacking or reaching the causative microorganism. In this regard, since NO is a gas, it is able to diffuse into the abscess thereby reducing bacterial burden and the area of subcutaneous abscesses by inducing vascular permeability and vasodilation. Furthermore, NO stimulates the infiltration of immune cells such as neutrophils, macrophages, and lymphocytes Our studies demonstrated that NO-np have significant antimicrobial efficacy in the setting of MRSA abscesses is the stimulation of healing by induction of collagen deposition. NO promotes wound healing through collagen secretion by fibroblasts et al. demonstrated that collagen deposition was enhanced in wounded rats transfected in vivo with the gene for inducible nitric oxide synthase, and the increased nitric production within the wound milieu preceded the observed increase in collagen synthesis Another benefit of NO-np treatment of MRSA subcutaneous abscesses with NO-np, as proposed in our study, we showed that NO-np can modulate immune responses to facilitate the reduction of bacterial burden. This is the highest priority in treating chronic and non-healing abscesses since a persistent infection and accumulation of bacterial antigens, as commonly seen in microbial abscesses, can impair host responses SA abscesses. In fact, the downregulation of IL-10, which can antagonize IFN-γ effects SA dissemination within phagocytes. Additionally, other pro-inflammatory cytokines/chemokines, particularly TNF-α, IL-1β, and MCP-1 were up-regulated by NO-np. Sustained expression of these pro-inflammatory effector molecules permits a prolonged presence of neutrophils, macrophages, lymphocytes, and mast cells in the chronic abscess contributing to an effective inflammatory response and bacterial clearance In treating MRSA abscesses in a murine model. Conceivably, this technology might be used as a potential therapy prior to or in addition to surgical drainage of bacterial abscesses. It is further possible that the NO-np could be useful in the treatment of deep abscesses via injection into tissues such as the lung or liver. Interestingly, the NO-np appear to significantly stimulate the immune system. These results suggest that this platform has the potential to serve as a novel, easily administered class of topical antimicrobials for the treatment of subcutaneous infections and abscesses.In summary, application of NO as topical agents has been used with success in augmenting wound healing and reducing wound bacterial burden All animal studies were conducted according to the experimental practices and standards approved by the Animal Welfare and Research Ethics Committee at the Albert Einstein College of Medicine.SA (MRSA) 6498 is a clinical isolate selected for this study because the strain is resistant to diverse commonly used antibiotics and it was extensively utilized in our prior superficial wound model Methicillin-resistant The synthesis of NO-np was recently reported along with its potential as a treatment for superficial infections SA to NO-np, TSB was inoculated with a fresh colony grown on BHI plates and suspended in 1 mL of medium. A suspension of 100 µL of MRSA was transferred to a 200-well plate with 100 µL of TSB per well containing NO-np or np . Bacteria and nanoparticles were incubated at 37°C for 24 h. Wells containing bacteria with TSB alone was used as a control. Growth was estimated by measuring optical density at 600 nm every 30 min using a Bioscreen C microplate reader .To evaluate the susceptibility of MR2, and 0.4 µg/mL hydrocortisone without antibiotics in 6-well tissue culture plates according to the manufacturer's instructions. The reconstituted human epidermis (RHE) was generated from human keratinocytes derived from juvenile foreskin obtained during surgery. Cultures were fully differentiated three-dimensional tissues, grown on the air-liquid interface for 14 days prior to delivery. The tissues were inoculated with 107 MRSA 6498 in 100 µL PBS by adding the cell suspension to the 1 mL cell culture medium in the absence or presence of 5 mg/mL of NO-np. Control cultures were grown in medium inoculated with 50 µL PBS. All cultures were incubated at 37°C with 5% CO2 at 100% humidity for 24 h. Tissue inserts were removed, fixed in 10% formalin for 24 h, processed, and embedded in paraffin. Four micron vertical sections were fixed to glass slides, stained with hematoxylin and eosin (H&E) and examined by light microscopy.Reconstituted human tissues were obtained from SkinEthic Laboratory and reconstituted by incubating in serum-free, MCDB 153 defined medium , containing 5 µg/mL insulin, 1.5 mM CaClSA 6498 cells alone incubated under identical conditions were included as negative controls. The LDH released in the presence of bacteria was expressed relative to the untreated control tissue with the LDH activity of MRSA cells alone subtracted from the LDH of the tissue plus the bacteria.The release of LDH from the HSF or RHE into the medium was monitored as a measure of cell damage. LDH in medium from cultures containing uninfected and infected tissues was measured at 24 h by CytoTox-ONE™ kit according to the manufacturer's instructions. MRSA, female Balb/c mice were anesthetized with 100 mg/kg ketamine and 10 mg/kg xylazine, the hair on their flanks was shaved, and the skin disinfected with iodine. Then, a suspension of 100 µL with 107SA 6498 in PBS was inoculated subcutaneously in each flank of the animals (two abscesses per mouse). The next day (day 2), a suspension with 5 mg/mL of NO-np or np dissolved in PBS was injected into or topically applied above the abscesses. Mice receiving topical therapy were also treated with a second topical application of NO-np or np on day 3. Untreated, infected and non-infected mice were used as additional controls. On day 4, the mice were euthanized and the abscesses were excised, homogenized, and cultured quantitatively by plating on tryptic soy agar.To investigate the antimicrobial efficacy of NO-np for subcutaneous abscesses formed by MRSA abscess formation after infection and treatment as above, abscess tissues were excised from euthanized mice, fixed in 10% formalin for 24 h, processed, and embedded in paraffin. Four micron vertical sections were fixed to glass slides and subjected to H&E, Gram, Gomori's trichrome, or CD34 staining to observe the tissue morphology, bacteria, collagen deposition, or vascularization, respectively. Slides were examined by light microscopy with an Olympus AX70 microscope, and images were obtained with QCapture Suite V2.46 software (QImaging).At day 4 after MRAbscess area analysis was performed at day 4 after infection. Each abscess was measured using a caliper and the area was determined.g for 10 minutes to remove cell debris, and the supernatant was frozen at −80°C until tested. The supernatants were assayed for IL-1β, IL-4, IL-10, IL-12p70, MCP-1, TNF-α, TGF-β, and IFN-γ using ELISA . The detection limits of cytokine assays are 7.8 pg/mL for IL-4 and MCP-1, 15.6 pg/mL for IL-1β and TNF-α, 31.3 pg/mL for IL-10 and IFN-γ, 60 pg/mL for TGF-β, and 62.5 pg/mL for IL-12p70, as stated by the manufacturer.Mice were euthanized at day 4 post-infection and two abscesses per mouse were individually homogenized in 2 mL PBS in the presence of protease inhibitors . The homogenates were centrifuged at 6,000 P values were calculated by analysis of variance and were adjusted by use of the Bonferroni correction. P values of <0.05 were considered significant.All data were subjected to statistical analysis using GraphPad Prism 5.0 .

De novo eukaryotic promoter prediction is important for discovering novel genes and understanding gene regulation. In spite of the great advances made in the past decade, recent studies revealed that the overall performances of the current promoter prediction programs (PPPs) are still poor, and predictions made by individual PPPs do not overlap each other. Furthermore, most PPPs are trained and tested on the most-upstream promoters; their performances on alternative promoters have not been assessed.In this paper, we evaluate the performances of current major promoter prediction programs using 42,536 distinct human gene promoters on a genome-wide scale, and with emphasis on alternative promoters. We describe an artificial neural network (ANN) based meta-predictor program that integrates predictions from the current PPPs and the predicted promoters' relation to CpG islands. Our specific analysis of recently discovered alternative promoters reveals that although only 41% of the 3' most promoters overlap a CpG island, 74% of 5' most promoters overlap a CpG island.9 bps of human genome sequence reveals the specific strengths and weaknesses of individual PPPs. Our meta-predictor outperforms any individual PPP in sensitivity and specificity. Furthermore, we discovered that the 5' alternative promoters are more likely to be associated with a CpG island.Our assessment of six PPPs on 1.06 × 10 Initiation of transcription is regulated by a coordinated binding of many transcription factors to the core promoter region. The initiation process is further modulated by binding of activators and repressors in more distal regions ,2. The cTo understand eukaryotic transcriptional regulation, accurate identification and localization of core promoters are important . The difIt is widely recognized that promoter regions are correlated with CpG islands. CpG islands are regions of DNA longer than 200 bps with a G+C content of at least 50%, and the number of CpG dinucleotides being at least 60% of what could be expected from the G+C content ,16. CpG To evaluate fairly the performance of the PPPs, we separated promoters into two subtypes – CpG-rich and CpG-poor, depending on whether they are CpG-island related or not . To ensuDifferent programs utilize different characteristics of the genomic sequence near the promoter to make predictions. For example, DragonGSF and DragonPF use CpG islands as a global landmark and integrate additional attributes using an Artificial Neural Networks (ANN) to predict TSSs within the ± 3700 bps of CpG islands ,29. FirsThe previous evaluations were limIn this paper, we first describe the relationship between CpG island and promoters. We then evaluate the performance of PPPs on a large set of ATSS, which includes MUTSS as well as the other promoters, including the middle TSS (MTSS) and the most downstream TSS (MDTSS). Finally, we introduce a meta predictor that combines promoter predictions from top-performing PPPs using Artificial Neural Networks, as well as the genomic information such as CpG island Figure . Our larWe used TSS annotations from DBTSS and RefS9 bps, which equaled approximately 30% of human genome. These sequences were used for promoter prediction. Among the 42,536 ATSS, there are 14,566 MUTSS, 13,114 MDTSS, and 14,856 MTSS. The distance distribution among these TSSs is shown in Additional file We then integrated the TSSs from the two datasets into one and clustered them based on their genomic locations. If twoTSSs are less than 5 bps apart, we take the upstream one as a representation of the cluster. After removing the redundant TSSs, we obtained 42,536 distinct ATSS. We pooled these ATSS together and clustered them into 14,566 clusters (see Methods). For each cluster, we extracted the region spanning 5 kb upstream of the MUTSS to the end of the gene . We thus obtained 14,566 sequences, with a total of 1.06 × 10Since CpG islands play a vital role in promoter prediction, we analyzed the correlation between CpG islands and human gene promoters. To illustrate the relationship between different types of promoters, we classified the promoters as MUTSS, MDTSS and middle promoters (MTSS), depending on their locations in the cluster. We used a less stringent CpG island detection program , which wWe also used the CpG islands that were annotated in UCSC genome browser and obseThe 14,566 sequences were used for promoter prediction by each PPP. We obtained a total of 339,960 TTS-predictions from six PPPs. We then classified the predictions into two categories. If a prediction was within ± 5 kb of a CpG island, it was classified as a CpG-rich prediction otherwise a CpG-poor prediction. The classification resulted in 247,540 (72.8%) CpG-rich predictions and 92,420 (27.2%) CpG-poor predictions. The composition of the predictions contributed by each PPP was shown in Table We then looked at the average number of predictions made by each PPP per promoter. As shown in Table We evaluated the performance of six PPPs on CpG-rich and CpG-poor promoters separately. The sensitivity and specificity of each PPP were reported at three levels of resolution – high (50 bps), intermediate (200 bps) and low (2000 bps). All the predictions were subject to the same evaluation criteria and the results were shown in Figure For CpG-rich promoter evaluations, we added a baseline prediction as a control. To perform the baseline prediction, we picked a random location near each CpG island (defined as such in the UCSC genome browser) , and useWe evaluated the performance of DragonPF, FProm and PSPA on CpG-poor promoters Figure . We exclTo evaluate the similarity of these PPPs, we compared the correct predictions from each pair of PPPs at medium resolution (200 bp) and the results were shown in Tables Another notable feature in Figure The promoter prediction problem was much harder for CpG-poor sequences. Since there was no CpG island to serve as the landmark, the PPPs had to consider a much larger region for prediction. An alternative approach was to use the feature of a gene as a landmark, since gene prediction programs use context information derived from a higher degree of conservation in the encoding region. It was shown that integration of gene prediction and EST information improved promoter prediction ,38. A reNext we used a neural-network-based approach to integrate the predictions made by individual PPPs to improve the overall prediction accuracy. We included the performance of the different PPPs at the intermediate resolution of 200 bps. The performance of MetaProm was based on 10-fold cross-validation. The sensitivity~specificity coordinate of each PPP was shown in Figure It is widely recognized that promoter regions are correlated with CpG islands. CpG islands were originally found around TSSs in about 55% of the human promoters, based on hundreds of experimental screening of human genes . Since tSince the discovery of the close association between CpG islands and promoters, this association has been widely utilized for promoter and gene prediction. Previous studies showed that about 50~60% of the promoters are associated with CpG islands, we founMore importantly, we found that the 5' alternative promoters were more closely linked to CpG islands than the 3' promoters of the same gene. Consistent with the role of CpG islands in the recruitment of chromatin modification enzymes, it is conceivable that the most upstream promoters represent the broadly used substrate in a hierarchical regulation of gene transcription, whereas the downstream, non-CpG-associated promoters are used in a tissue-specific fashion in conjunction with the upstream promoters. We hypothesize that most polymerase II transcription complexes are assembled at the vicinity of a CpG island. It then either starts transcription, or slides to another active promoter to initiate transcription.Our results also showed that improvements on CpG island prediction can further reveal the relationship between CpG islands and promoters. Since the new CpG island program detects substantially more CpG islands, not surprisingly, we found more promoters are associated with CpG islands. It also provides us a challenge to develop CpG island detection programs that can help identify promoters. We believe this is especially important in the current context of DNA methylation and histone modification studies ,43. The Different PPPs capture different characteristics of mammalian core promoters. Because most PPPs are based on machine learning approaches, the genomic attributes captured by the PPPs are not thoroughly investigated. These attributes will be important in understanding mammalian promoters and in return help us to develop a better PPP. As a first step, we propose a MetaProm tool that integrates the predictions by individual PPPs using an artificial neural network. By combining these predictions, our MetaProm showed significant improvement over the individual PPPs. Liu and States have devSeveral reasons contribute to MetaProm's lack of improvement on CpG-poor promoter prediction. First, only three PPPs make predictions on this type of promoters and the number of predictions is much lower comparing to the CpG-rich promoters. Second, the overlaps between the three PPPs are also substantially lower than that of CpG-rich promoters. Third, the proportion of overlap does not increase as we go from a high resolution to a low resolution Table . Since MThe recent large-scale determination of full length cDNAs has generated large amount of reliable promoter data, and has led to some novel insights. For example, recent data shows that 58% of genes have multiple alternative start sites and these often correspond to tissue-specific expression of the transcript . In thisEven though the large-scale experimental data provide us with a large number of cDNAs, these cDNAs are by no means comprehensive and exhaustive. Some false positive predictions by the MetaProm program might prove to be true positives once the experimental detection of promoters becomes more sensitive. The core promoter prediction programs also provide a basis for designing the whole-genome promoter array. Furthermore, algorithms that are successful on human promoter prediction can hopefully be used in other mammalian genome promoter prediction, and thus guide experimental studies.Previous evaluation on MUTSS reports greater variability of the performance on different chromosomes . Our evaWhile this manuscript was under review, another promoter prediction program was publOur genome wide evaluation was based on all available promoters, including alternative promoters. We discovered that promoters at the 5' end of the gene are more likely to be linked to a CpG island. Evaluation based on the human genome shows that MetaProm performs better than any of the individual PPP both in terms of sensitivity and specificity. This meta prediction method should be useful in locating the promoter region of a gene, and thus facilitating the analysis and understanding of gene regulation. The MetaProm program and the genome wide predictions are available upon request.9 bps, or about 30% of the human genome. Among these sequences, only 326 (2.2%) sequences do not contain any CpG island.We retrieved the coordinates of full-length cDNA sequences from the DBTSS and RefSOut of 42,536 total ATSS, we have 37,793 (88.9%) CpG-rich promoters and 4,743 (11.1%) CpG-poor promoters; this proportion is similar to the that of MUTSS . CpG islPromoters are predicted on each sequence by individual PPP with default parameter settings as described in ,13. BrieDragonGSF: threshold 0.994 (default)DragonPF: sensitivity 0.65FirstEF: default setting of P(Exon)>0.5, P(Donor)>0.4, and P(Promoter)>0.4.McPromoter: threshold = -0.05FProm: default settingPSPA: score cutoff = 100 for CpG-rich, and cutoff = 150 for CpG-poor.Similar to the classification for real promoters, we classified each predicted TSS into CpG-rich or CpG-poor based on whether there is a CpG in the surrounding ± 5 kbps region. The performances of individual PPPs are evaluated separately on CpG-rich and CpG-poor predictions. We also added a baseline prediction as control for CpG-rich promoter prediction. In each of the annotated CpG island in the 1AB = (CAB × 2)/(CA + CB), where is the number of correct predicted ATSS by both A and B, CA, CB are the numbers of correctly predicted ATSSs by A and by B, respectively.We adopted the evaluation approach as previously described . BecauseFor each prediction, the MetaProm program makes a decision on how reliable the prediction is. The decision is based on the features we extracted from the genomic context, the prediction itself and the other two closest predictions in the surrounding region, either by the current PPP or by other PPPs. We observed that for the CpG-rich promoters, the overlap of correct predictions between PPPs increased rapidly from 50 bp resolution to 200 bp resolution and further to 2 kb resolution Table . This imWe classified all predictions into 247,540 (72.8%) CpG-rich and 92,420 (27.2%) CpG-poor predictions. The two groups were trained and tested separately. For each prediction from any PPP, a total of 28 features were extracted from the individual prediction and its surrounding predictions. The MetaProm used these features to calculate the likelihood of this prediction to be true Figure . The detFeatures of the current prediction: which PPP made the prediction, the prediction score, is the prediction CpG-rich or CpG-poor. For some PPPs that do not provide prediction scores, we use the rank value.Statistics on neighboring predictions: for example, how many predictions are made by other PPPs within a certain distance away from current prediction. We also used the attributes of the closest prediction by any of other PPPs, such as which PPP makes the prediction, whether the prediction is CpG-rich or CpG-poor, the prediction score, and distance from current prediction. We also use the same attributes of the second closest prediction.Finally, we used the attributes of the closest CpG island (or no CpG island for CpG-poor predictions). These include the length of the CpG island, G+C content, GC observed expected ratio, whether the prediction is in the CpG island, or 100, 200, 500, 1 k, 2 k, 5 k bps away from the edge of the closest CpG island and the distance of the prediction from closer side of the CpG island, farther side, and central of the CpG island.The MetaProm does not make new predictions, it recalculates score (probability) of each predicted promoter of being real. Every prediction from each individual PPP, along with their features, was used as one instance to the MetaProm Artificial Neural Network (ANN) model for training and testing. We used the MultilayerPerceptron function in the Weka package to perfoThe prediction accuracy for the MetaProm is obtained by the 10-fold cross-validation: the dataset is partitioned into 10 equal parts, and the ANN model is iteratively trained on nine parts and tested on the remaining part. The predictions with an ANN score above the cutoff (selected based on ROC curve) were taken as positives, and were clustered if they were within 5 bps with each other. The prediction with the highest ANN score in the cluster was selected as the final prediction. To draw the sensitivity-specificity curves of the MetaProm prediction, we pooled predictions from the 10-fold cross-validation and ranked the MetaProm prediction scores (probabilities), and selected different cutoffs to get the Sensitivity-Specificity pairs at that cutoff. Since we were not able to obtain the training versions of PPPs other than our own PSPA, we could only obtain one Sensitivity-Specificity pair for each predictor, where the cutoffs were pre-determined by the individual developer.The author(s) declares that there are no competing interests.JW conceived, designed and coordinated the study, implemented the software, performed the analysis and drafted the paper.LHU contributed to the design of the study, and manuscript editing.HT contributed to discussion and manuscript editing.SH contributed to the design of the study, and manuscript editing.All authors have read and approved the final manuscript.Distances between alternative TSSs within a sequence.Click here for fileDistance between Transcription Start Site (TSS) and CpG island (annotated in UCSC).Click here for filePairwise overlaps of correct predicted promoters between each PPP at high (50 bp) and low (2 kb) resolutions.Click here for fileEvaluation of MetaProm at high and low resolutions on genomewide promoter prediction.Click here for fileFeatures used for ANN based MetaProm promoter prediction.Click here for file

Considering that HTB140 melanoma cells have shown a poor response to either protons or alkylating agents, the effects of a combined use of these agents have been analysed.Cells were irradiated in the middle of the therapeutic 62 MeV proton spread out Bragg peak (SOBP). Irradiation doses were 12 or 16 Gy and are those frequently used in proton therapy. Four days after irradiation cells were treated with fotemustine (FM) or dacarbazine (DTIC). Drug concentrations were 100 and 250 μM, values close to those that produce 50% of growth inhibition. Cell viability, proliferation, survival and cell cycle distribution were assessed 7 days after irradiation that corresponds to more than six doubling times of HTB140 cells. In this way incubation periods providing the best single effects of drugs (3 days) and protons (7 days) coincided at the same time.Single proton irradiations have reduced the number of cells to ~50%. FM caused stronger cell inactivation due to its high toxicity, while the effectiveness of DTIC, that was important at short term, almost vanished with the incubation of 7 days. Cellular mechanisms triggered by proton irradiation differently influenced the final effects of combined treatments. Combination of protons and FM did not improve cell inactivation level achieved by single treatments. A low efficiency of the single DTIC treatment was overcome when DTIC was introduced following proton irradiation, giving better inhibitory effects with respect to the single treatments. Most of the analysed cells were in G1/S phase, viable, active and able to replicate DNA.The obtained results are the consequence of a high resistance of HTB140 melanoma cells to protons and/or drugs. The inactivation level of the HTB140 human melanoma cells after protons, FM or DTIC treatments was not enhanced by their combined application. The disseminated melanoma is generally not curable using conventional clinical tools. Despite recent advances in the immunotherapy and vaccinotherapy, the chemotherapy remains the standard therapeutic option . HoweverFotemustine (FM) is a member of the chloroethylnitrosourea class of alkylating agents that has been proven active against the disseminated melanoma and primary brain tumours . SpontanSome forms of specially localized melanoma tumors, are presently treated with therapeutic proton beams giving positive results . PhysicaWith the goal to find a more efficient way to treat melanoma, combined treatments of either FM or DTIC with proton irradiations were examined. In our previous studies, we investigated the effects of proton irradiations and single drug treatments on HTB140 cells, as well as the effects of proton irradiations on these cells that were pre-treated with FM or DTIC -12. The 2 plastic tissue culture flasks at 37°C in a humidified atmosphere with 5% CO2. Under these conditions, the plating efficiency (PE) for the HTB140 cells was 62 ± 7.3%, while the doubling time (Td) evaluated from the growth curve was 24 ± 2.7 h.The human melanoma HTB140 cells were purchased from the American Tissue Culture Collection . They were grown in the RPMI1640 medium supplemented with 10% fetal bovine serum, penicillin-streptomycin and L-glutamine. The cells at the passage number 35 to 60 were maintained in 6 ml of the medium in 25-cmThe exponentially growing cells were irradiated within the spread out Bragg peak (SOBP) of the 62 MeV proton beam at the CATANA (Centro di Adro Terapia e Applicazzioni Nucleari Avanzati) treatment facility. The applied doses were 12 or 16 Gy at the dose rate of 15 Gy/min. These are the doses commonly used in proton therapy. The irradiation position in the middle of SOBP was obtained by interposing 16.3 mm thick Perspex plate (Polymethyl methacrylate – PMMA) between the final collimator and the cell monolayer. The obtained relative dose was 99.42 ± 0.58%, having the mean energy of protons of 34.88 ± 2.15 MeV. The reference dosimetry was performed using plane-parallel PTW 34045 Markus ionization chamber which was calibrated according to the IAEA code of practice ,14. All The chemotherapeutic drugs used were fotemustine or dacarbazine . Stock solutions of the drugs made for this study were prepared according to the manufacturer's instructions: 10 mM FM diluted in 43.3% ethanol and 10 mM DTIC diluted in water.In a previous study a wide range of FM or DTIC concentrations and incubation periods were investigated . It has 2 plastic tissue culture flasks or on 96-well plates, depending on the biological assay to be used. After 24 h the cells were treated with drugs (100 or 250 μM) without replating and all biological assays were performed 72 h later.For the single drug treatments cells were seeded at a suitable number into 25-cm2). Then the culture medium was replaced with the fresh medium containing drugs (100 or 250 μM) and the cells were incubated for additional 72 h. In this way the biological assays were carried out after the incubation period of 7 days after irradiation.In the treatment combining proton irradiation and drugs, after being irradiated exponentially growing cells were detached by trypsinization (1.98% trypsin/0.02% EDTA in PBS), replated appropriately for each biological assay and incubated for 4 days under standard conditions assay, which is based on the measurement of cellular protein content, was used for the determination of cell density. The assay was performed according to the method of Skehan and co-workers . After iThe DNA synthesis and cell proliferation were measured using a 5-bromo-2-deoxyuridine (BrdU) assay . The cells were grown in 96-well plates (four wells per dose or concentration in each of three independent experiments) and BrdU labeling was performed according to the manufacturer's instructions. The absorbance was measured at 550 nm using a microplate reader .2 plastic tissue culture flasks (four flasks per dose or concentration in each of three independent experiments) at a suitable number for colony assay and incubated at 37°C for 7 days. This incubation period is appropriate since it represents more than six cell-doubling times. Moreover, the results of the colony assay that was performed 14 days after irradiation did not show statistically significant differences in the cell inactivation level with respect to those obtained after 7 days [After irradiation or drug treatment the cells were harvested by the trypsinization, seeded into 25-cmr 7 days . Therefo2 plastic tissue culture flasks (four flasks per dose or concentration in each of two independent experiments). For the flow cytometric evaluation of the cell cycle status 1 × 106 cells were taken from each flask, washed with Phosphate Buffered Saline (PBS), fixed overnight with 70% cold ethanol and stained with PBS buffer that contained 50 μg/ml Propidium Iodide (PI) and 50 μg/ml RNase. After the incubation for 30 min at room temperature, the cells were analyzed by the flow cytometry using the XL SYSTEM II software.The cells were grown in 25-cmt-test, with the level of significance set at p < 0.05. Results were presented as the Mean ± S.D. (standard deviation). All data processing was carried out using the software OriginPro 7.5.Quadruplicate measurements were made during each experiment, while each experiment has been repeated three times, except for flow cytometry that was performed in two replicate experiments. All obtained data for viability, proliferation and survival assays were normalized to the untreated controls to obtain percentage of cells or surviving fraction. The significance of differences among the experimental groups was assessed by the independent Student's Single treatments with protons or FM, presented in Figure After combined treatments with these agents, as compared to controls, cell viability also decreased and is shown in Figure Cell proliferation after combined treatments, given in Figure vs. control , as shown in Figure Cell survival, estimated through the colony forming ability, revealed important reduction for single and combined treatments After exposure to single and combined treatments with protons and DTIC, as shown in Figure There was a high inhibition of cell proliferation after single and combined treatments with protons and DTIC, as compared to control cells , and is given in Figure A reduction of cell survival vs. control, as it is shown in Figure Compared to untreated controls, proton irradiation of HTB140 cells induced a dose dependent increase of G1 cell population. FM provoked a raise of G2 phase followed by a reduction of S phase with some changes in G0/G1 cell population. After combined treatments with protons and FM, there was an improvement of S and G2 phase followed by a decrease of G0/G1 cell population Figure . It appeSingle DTIC treatment did not provoke changes in the cell cycle distribution as compared to control. It differed from proton effects by an increase in S and G2 cell population. Cell cycle distribution after combined application of protons and DTIC remained in the range of controls and single DTIC effects Figure .Radio- and chemoresistance of malignant melanoma can be related to the phenotypic heterogeneity, including different degrees of cellular pigmentation, diverse cell morphology and growth rate of variety of melanoma types ,18. It hResponse of the HTB140 cells to different chemotherapeutic drugs is uneven and corresponds to moderate cellular inactivation . AlthougTo achieve better cellular inactivation than it has been obtained by single treatments with either protons or drugs a study of combined effects of these agents has been undertaken. Irradiation doses were those frequently used in proton therapy , whereasThe level of cellular radiosensitivity is almost exclusively assessed by clonogenic assay. Different viability tests, for instance SRB, microtetrasolium (MTT) or BrdU are basically employed for the estimation of cellular chemosensitivity. They are also adapted for the evaluation of the cellular response to the radiation damage ,23. All In combined treatments the common order of administration of different agents is exposure to drug and then to radiation ,28. ConsIn another experimental setup the effects of combination of drugs and protons were estimated 7 days after irradiation of HTB140 cells . The selAccording to the discussed results of the two experiments, an improvement of combined treatments, with respect to the single once, was achieved only after the combination of FM and protons, 7 days after irradiation ,12.To increase the efficiency of combined treatments, particularly the combination of DTIC and protons, the order of administration of drugs and radiation was inversed. The new experimental set up was conceived knowing the position on the time scale where the best effect of each single treatment with FM, DTIC or protons was reached . The HTBThe described combination of protons and FM reduced cell proliferation to ~40% and clonogenic survival to ~50%, while there was ~80% of viable cells estimated by the SRB assay Figure . With reThe combination of protons and DTIC reduced cell proliferation to ~32% while after single treatments this level was higher that is constitutively expressed in melanoma cells . NF-κB iotherapy . Alkylatotherapy ,28,37. Hotherapy .In the HTB140 cells proton irradiation induced G1 phase arrest, while FM as well as combined treatments provoked significant G2 arrest Figure . After iThe obtained FACS results may be influenced by a specific feature of melanoma cells which is melanogenesis. This metabolic activity of melanoma cells triggers arrest and accumulation of cells in the G1 phase . FACS anTo improve single effects of protons, FM or DTIC on the inactivation of HTB140 melanoma cells, combined treatments with these agents have been investigated. After being irradiated with protons cells were exposed to either FM or DTIC. The combination of protons and FM did not improve the cell inactivation level achieved by each single treatment. The poor efficiency of the single DTIC treatment was overcome when DTIC was introduced following proton irradiation, giving better inhibitory effects with respect to the single treatments. The molecular mechanisms activated by protons enabled DTIC to express its cytostatic nature. However, under the studied experimental conditions the level of sensitivity of the HTB140 cells to protons, FM or DTIC remained within 50% of cell inactivation also after their combined application.The authors declare that they have no competing interests.AMRF, IMP, GC and GP designed the experiments. LBK and JJŽ carried out cell culture experiments and viability tests. GI performed FACS analysis. AMRF, IMP, LMV and GC carried out the irradiation experiments. LBK performed the statistic analysis. AMRF and IMP supervised the experiments and drafted the manuscript. All authors have read and approved the final version of the manuscript.

We treated two groups of animals that were either CD8+ lymphocyte-depleted or controls with antiretroviral therapy, and used mathematical modeling to assess the lifespan of infected cells either in the presence or absence of CD8+ lymphocytes. We found that, in both early (day 57 post-SIV) and late (day 177 post-SIV) chronic SIV infection, depletion of CD8+ lymphocytes did not result in a measurable increase in the lifespan of either short- or long-lived productively infected cells in vivo. This result indicates that the presence of CD8+ lymphocytes does not result in a noticeably shorter lifespan of productively SIV-infected cells, and thus that direct cell killing is unlikely to be the main mechanism underlying the antiviral effect of CD8+ T cells in SIV-infected macaques with high virus replication.While CD8+ T cells are clearly important in controlling virus replication during HIV and SIV infections, the mechanisms underlying this antiviral effect remain poorly understood. In this study, we assessed the in vivo remain poorly understood. This lack of knowledge represents a key obstacle to our efforts to develop a CD8+ T cell-based AIDS vaccine. In this study, we implemented a new experimental system in which we determined the lifespan of productively SIV-infected cells in vivo, either in the presence or absence of CD8+ lymphocytes. The lifespan of productively infected cells was calculated based on the slope of the decline of SIV plasma viremia after initiation of ART using a widely accepted mathematical model. Using this novel approach, we determined that CD8+ lymphocytes control virus replication without noticeably decreasing the lifespan of productively infected cells, thus suggesting that the major mechanism of antiviral activity by CD8+ lymphocytes during pathogenic SIV infection may not be direct cell killing of productively SIV-infected cells.Despite overwhelming evidence that CD8+ T cells are important in controlling virus replication during HIV and simian immunodeficiency virus (SIV) infections, the mechanisms responsible for this antiviral effect The global spread of the HIV pandemic, currently affecting over 30 million individuals worldwide, emphasizes the urgency to develop a safe and effective vaccine. While many challenges face the AIDS vaccine development effort, the most fundamental obstacles are still at the level of the basic biology of the interaction between HIV and the human immune system in vivo depletion of CD8+ lymphocytes is consistently associated with increased virus replication in SIV-infected rhesus macaques (RMs) in vivo are still poorly understood. Conceivably, these mechanisms can be summarized into three major, non-mutually exclusive categories: CD8+ T cells may reduce production of virions by (i) direct killing of productively infected cells (thus decreasing their average lifespan); (ii) direct killing of infected cells before they begin producing virus, (iii) inhibition of the rate of virus production by non-cytolytic mechanisms; and (iv) reduction of the number of available target cells and hence the number of cells that become productively infected.Due to the current absence of immunogens that can elicit HIV-specific neutralizing antibodies in vivo antiviral effect of CD8+ T cells will be important in designing of an effective, CD8+ T cell-based AIDS vaccine. In this study, our goal was to assess the relative contribution of cytotoxic T lymphocyte (CTL) activity to the antiviral effect of CD8+ lymphocytes. As previously proposed in in vivo lifespan of productively SIV-infected cells. In order to directly measure the impact of CD8+ lymphocytes on the lifespan of productively infected cells, we treated two groups of chronically SIVmac239-infected RMs with antiretroviral therapy (PMPA and FTC) in the absence or presence of CD8+ lymphocytes. We next calculated the lifespan of productively infected cells based on the slope of the decline of SIV plasma viremia after initiation of ART using a mathematical model in vivo. This result suggests that the CD8+ lymphocyte-mediated, direct killing of cells producing virus that results in shorter lifespan of these cells is unlikely to be the main mechanism underlying the antiviral effect of CD8+ T cells in SIV-infected macaques.Elucidating the basis for the in vivo antiviral role of CD8+ lymphocytes during SIVmac239 infection of rhesus macaques (RM) by measuring the lifespan of productively infected cells in the presence or absence of CD8+ cells. To this end, we first infected ten RMs with 3,000 TCID50 of SIVmac239 and observed them throughout the acute phase of infection . We subsequently divided these ten SIVmac239-infected animals in two groups of five and treated them with potent antiretroviral therapy (ART) either alone or after depletion of CD8+ lymphocytes with the OKT8F mAb (in vivo (in the presence and absence of CD8+ T cells) was estimated using a mathematical model that allows the calculation of the lifespan of short and long-lived productively infected cells In this study, we sought to better understand the mechanisms underlying the KT8F mAb . SeveralAs expected based on our previous experience with the use of the OKT8F monoclonal antibody 10 (and in 16 out of 17 instances of treatment by at least 1.5 log10) within a week after initiation of therapy was conducted during both early and late phases of the study . In the CD8+ lymphocyte-depleted animals, this timing corresponded to initiation of ART three days after the last OKT8F infusion. As expected, during both phases of the study, ART effectively suppressed virus replication in all RMs by at least 0.5 log therapy . The obsA = (NkTo)/(c−δ), C = (c−NkTo)/(c−μ) and 0V is the initial viral load, k is the infection rate, N is the viral burst size, δ is the death rate of short-lived productively infected cells, μ is the death rate of long-lived productively infected cells, and c is the rate of virion clearance V(t) given by equation (1) to the natural logarithm of the measured SIV RNA between initiation and termination of therapy, we were able to estimate δ and μ, the death-rate of short-lived and long-lived productively infected cells, for each animal either in the presence or absence of CD8+ T cells (C = 0 in (Eq. 1), i.e., setting NKT0 = c, and estimated δ but not μ.Previous studies T cells . Howeverδ) is similar regardless of the presence or absence of CD8+ T cells. Specifically, during the early phase, the mean lifespan for group A (CD8+ lymphocyte depleted RMs) was 1.11 (±0.39 s.d.) days (median = 0.87), while the mean lifespan for group B was 1.05 (±0.35 s.d.) days (median = 0.93) (p = 0.83) were also not different between CD8+ lymphocyte depleted and not depleted animals . A notable observation, however, is that of the seven RMs that participated in both the early and late phase studies, five had a shorter lifespan of short-lived infected cells (by an average of 36%) later in infection. This finding, together with the slightly higher increase in viremia that we observed after CD8+ lymphocyte depletion in the late phase as compared to the early phase . During  = 0.83) . These dly phase is somewTo further confirm these results, and avoid any potential bias from the modeling approach used, we also analyzed the observed first-phase decays of the logarithm of the viral load during treatment with a linear mixed-effects model. In this approach, we tested directly whether the slopes of the first-phase decay in the data are different in the two groups, with each animal as a random sample from treated or untreated macaque. Again, we did not find any differences in the slopes in either the acute or chronic groups , thus lending support to our conclusions that depletion of CD8+ lymphocytes does not affect the dynamics of viral decay. We note that this approach with linear mixed effects models makes optimal use of the data by fitting a simple line to the decay and taking into consideration all the available data at the same time .1) used to determine the death-rate of infected cells is based on the assumption that the virus and the target cells are at their set-point or steady state levels upon the initiation of therapy and that therapy is 100% effective in blocking new infections (2) (in (1) to assess if, and to what extent, viral load increases before the start of therapy altered estimated δ values in with a kδ values . Second,δ values . Third, δ values and S2. A conceivable conceptual limitation of our experimental system is that antiretroviral treatment might have an immediate impact on the number and/or function of SIV-specific CD8+ T cells, thus introducing a potential bias in our effort to assess the impact of CTL activity on the lifespan of infected cells based on the decline of viremia after ART. To directly address this issue, we measured the magnitude and functionality of SIV-specific CD8+ T cells before and after ART in non-CD8+ lymphocyte depleted animals and found that ART did not cause any significant changes in SIV-specific CD8+ T cell responses during either the early or late phase of the study (data not shown), therefore not supporting the possibility that the use of ART generated an intrinsic bias in our assessment of the impact of CD8+ lymphocytes on the lifespan of SIV-infected cells.in vivo in specific anatomic microenvironments. However, as shown in in vivo, and whose plasma concentration was decreased after CD8+ lymphocyte depletion to an average of 50% (±51%) of baseline levels. Plasma levels of the pro-inflammatory and potentially antiviral cytokines IFN-γανδ TNFα were also, on average, reduced to 49% (±40%) and to 76% (±10%) of baseline levels, respectively, after CD8+ lymphocyte depletion. Plasma concentrations of the lympho-tropic cytokine IL-7 were also decreased to 51% (±48%) of baseline levels after CD8+ lymphocyte depletion. As all of these cytokines may have an important antiviral effect during SIV infection, lower levels of these molecules after CD8+ lymphocyte depletion may contribute to the observed rise in viremia. While these data are not conclusive, they suggest that soluble factors produced by CD8+ lymphocytes may play a key role in the suppression of virus replication mediated by these cells in SIV-infected RMs.As discussed above, the results of this study support the hypothesis that the strong antiviral effect of CD8+ lymphocytes during chronic SIVmac239 infection of RMs is due to mechanisms that do not affect the lifespan of productively infected cells. Potential non-cytolytic mechanisms of SIV suppression by CD8+ T cells include the block of virus spread and entry via production of chemokines such as CCL3/MIP-1α, CCL4/MIP-1β, and CCL5/RANTES). To address this possibility we measured the plasma levels of these chemokines and numerous other cytokines, including those with potential antiviral activity such as TNFα, IFN-α, and IFN-γ, in the plasma of the SIV-infected RMs included in this study at multiple time points after CD8+ lymphocyte depletion. In most instances, cytokine plasma levels were either unchanged or showed only irregular fluctuations after CD8 depletion, thus possibly reflecting the very local nature of many of these factors. As such, this result does not necessary rule out that changes in the concentration of certain cytokines may occur The finding that CD8+ lymphocyte depletion does not result in a prolonged lifespan of productively infected cells is also consistent with the possibility that the observed increase in virus replication is caused, at least in part, by increased CD4+ T cell activation, which would result in an increased availability of target cells for SIV infection. Several factors may be involved in this CD4+ T cell activation, including homeostatic responses to lymphopenia, increased availability of CD4+ T cell tropic and/or pro-inflammatory cytokines, reactivation of latent virus infections, and other potential changes in the lymphoid microenvironment(s). To address this possibility, we measured the expression of activation and proliferation markers in CD4+ T cells before and after CD8+ lymphocyte depletion. As shown in in vivo during pathogenic HIV and SIV infections in vivo antiviral effect of CD8+ lymphocytes is unknown. Direct killing of productively HIV- or SIV-infected cells by CD8+ T cells has been shown in many in vitro settings and is very likely to occur in vivo as well Numerous studies indicate that CD8+ lymphocytes play an important role in suppressing virus replication in vivo lifespan of productively infected cells during chronic SIVmac239 infection of RMs in the presence or absence of CD8+ lymphocytes. The assessment of the turnover of infected cells was conducted using a well-characterized mathematical model that is based on the analysis of the decline of viral load after initiation of antiretroviral therapy in vivo lifespan of productively infected cells in vivo.In this study, we set to address the relative contribution of cytolytic vs. non-cytolytic mechanisms of CD8+ lymphocyte-mediated control of virus replication by measuring the in vivo depletion of CD8+ lymphocytes is associated with a marked and consistent increase in viral load were infected with 3000 TCID50 of SIVmac239 i.v. for this study. All animals were housed at the Yerkes National Primate Research Center and maintained in accordance with NIH guidelines. The number of RMs used for this study were determined based on power analysis (Text S3). RMs belonging to the two groups were age and weight matched. These studies were approved by the Emory University and University of Pennsylvania Institutional Animal Care and Use Committees.RMs were treated with 4mg/kg/day i.v. of OKT8F mAb for three consecutive days. Depletion efficiency in blood was calculated based on flow cytometric analysis and complete blood cell counts; depletion efficiency in tissues other than blood was calculated based on flow cytometry, as fraction of the baseline percent of CD8+ T cells.R-(2-phosphonomethoxypropyl)adenine and beta-2,3-dideoxy-3-thia-5-fluorocytidine were provided by Gilead Sciences and administered to each animal i.m. for 28 days during both early and late phases of the study .Reverse transcriptase inhibitors 9-Peripheral blood mononuclear cells were isolated by gradient centrifugation (ficoll). Procedures for lymph node biopsies, rectal biopsies, and bronochoalveolar lavage as well as isolation of lymphocytes form the obtained samples were performed as previously described Multicolor flow cytometric analysis was performed on whole blood or isolated cells according to standard procedures using human mAbs that crossreact with RMs. Predetermined optimal concentrations were used of the following antibodies: anti-CD3-Alexa700 , anti-CD8-PacOrange , anti-CD8-PE-TR , anti-CD4-PE-Cy5.5 , anti-CD4-PerCP-Cy5.5 , anti-CD4-PacBlue , anti-Ki67-FITC , anti-CCR5-PE , anti-CD69-PE-Cy7 , anti-HLA-DR-PE-Cy5 , Aqua Live/Dead amine dye-AmCyan (Invitrogen). All samples were permeabilized and fixed using CytoFix/Perm Kit (BDPharmigen) and intracellularly stained to detect Ki67. Flow cytometric acquisition was performed on at least 100,000 lymphocytes on an LSRII cytometer driven by the FACS DiVa software . Analysis of the acquired data was performed using FlowJo software . For all analysis of specific cell subsets, we used a threshold of 200 collected events.Quantitative real-time reverse-transcriptase (RT)-PCR assay to determine SIVmac239 plasma viremia was performed as previously described SIV-specific T cell responses were measured by intracellular cytokine staining for interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α), and Interleukin-2 (IL-2), as well as the degranulation marker CD107a, in response to pools of 15-mer peptides overlapping by 11 amino acids and spanning the entire sequence of three major antigenic proteins of SIVmac239 as detailed in Plasma levels of the beta-chemokines CCL3/MIP-1α, CCL4/MIP-1β, and CCL5/RANTES in conjunction with other cytokines and chemokines were measured using a sandwich immunoassay-based protein array system, the human cytokine 25-Plex , as instructed by the manufacturer and then read by the Bio-Plex array reader (Bio-Rad Laboratories), which uses fluorescent bead-based technology from Luminex.Text S1Supplementary figure legends, text, and references.(0.05 MB DOC)Click here for additional data file.Table S1Values for δ and μ for each animal, including lower and upper 95% confidence intervals. Values for δ and μ were estimated based on Eq. 1. 95% confidence intervals were calculated from 500 bootstrap replicates.(0.02 MB XLS)Click here for additional data file.Figure S1Effects of fitting the viral load data with a model that assumes the viral load is in steady state, when in reality viral load is increasing. Surrogate data for SIV kinetics with virus not in steady state (black dots) was created using Eq. 2 with the(1.69 MB TIF)Click here for additional data file.Figure S20 used in the supplemental text to define the T cell increase during CD8+ lymphocyte depletion. Analysis of the surrogate SIV RNA data indicates that the effect of changes in CD4+ T-cells and SIV RNA due to CD8+ lymphocyte depletion has a negligible (<3.5%) effect on the estimates of δ and μ when the drug effectiveness is high (∼99%).CD4+ T cell data used to estimate the change in target cells after CD8+ lymphocyte depletion. Measured CD4+ T cell values for Rsq8 in late chronic infection, (black line) and data smoothed by using a 3 point moving average (purple line). The 3-point moving average was then fit using linear regression to obtain the parameters α and T(1.97 MB TIF)Click here for additional data file.

The hydr­oxy group is involved in bifurcated hydrogen bonds. The first is an intra­molecular O—H⋯O hydrogen bond, involving the ester carbonyl O atom, which gives rise to the formation of a boat-like hydrogen-bonded chelate ring. The second is an inter­molecular O—H⋯N hydrogen bond involving the first N atom of the azide group of a symmetry-related mol­ecule. In the crystal structure this leads to the formation of a polmer chain extending in the c-axis direction.In the title compound, C Å b = 14.0710 (12) Å c = 10.1861 (12) Å β = 110.496 (13)°V = 1272.4 (2) Å3 Z = 4 Kα radiationMo −1 μ = 0.12 mmT = 153 (2) K 0.40 × 0.30 × 0.30 mm Stoe IPDS diffractometerAbsorption correction: none8743 measured reflections2451 independent reflectionsI > 2σ(I)1587 reflections with R int = 0.074 R[F 2 > 2σ(F 2)] = 0.036 wR(F 2) = 0.088 S = 0.87 2451 reflections230 parametersAll H-atom parameters refinedmax = 0.23 e Å−3 Δρmin = −0.21 e Å−3 Δρ EXPOSE in IPDS Software used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 (Farrugia, 1997Mercury (Macrae et al., 2006SHELXL97.Data collection: 10.1107/S1600536808043857/lh2749sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536808043857/lh2749Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

H4-34 gene segment. By flowcytometric and immunohistochemical assessments, a monoclonal CD20+κ+B-lymphocyte population has been demonstrated in the bone marrow of 90% of the patients, and lymphoplasmacytic lymphoma is a frequent finding. Novel attempts at treatment for primary CAD have mostly been directed against the clonal B-lymphocytes. Phase 2 studies have shown that therapy with the chimeric anti-CD20 antibody rituximab produced partial response rates of more than 50% and occasional complete responses. Median response duration, however, was only 11 months. In this review, we discuss the clinical and pathogenetic features of primary CAD, emphasizing the more recent data on its close association with clonal lymphoproliferative bone marrow disorders and implications for therapy. We also review the management and outline some perspectives on new therapy modalities.Chronic cold agglutinin disease (CAD) is a subgroup of autoimmune hemolytic anemia. Primary CAD has traditionally been defined by the absence of any underlying or associated disease. The results of therapy with corticosteroids, alkylating agents and interferon-a have been poor. Cold reactive immunoglobulins against erythrocyte surface antigens are essential to pathogenesis of CAD. These cold agglutinins are monoclonal, usually IgMκ auto antibodies with heavy chain variable regions encoded by the V Mycoplasma pneumoniae or viral infections, and paroxysmal cold hemoglobinuria. Only CAD will be further addressed in this review. CAD has traditionally been classified into a primary or idiopathic type which has been regarded unrelated to underlying conditions, and a secondary type associated with malignant disease, most often lymphoma [Autoimmune hemolytic anemia (AIHA) is classified into warm and cold reactive antibody types. Several entities are recognized within the cold antibody group; chronic cold agglutinin disease (CAD), acute cold antibody mediated AIHA complicating lymphoma –3. The tlymphoma ,5.Cold hemagglutination was first reported by Land-steiner in 1903 and founBinding of CA causes agglutination of erythrocytes ,10,14 anManagement was largely unsatisfactory until the last decade ,19,20. RIn single-center series, primary CAD has been found to account for 13–15% of the cases of AIHA ,22. In aCold-induced circulatory symptoms, although often not emphasized by physicians, are considered typical for CAD ,17. We fAccording to review articles, anemia in CAD is variable and usually not severe ,17. HoweIn the great majority of CAD patients, CA are specific for the I antigen, an erythrocyte surface carbohydrate macromolecule ,27. AntiThe mechanisms of red-cell agglutination and subsequent destruction have been elucidated in detail ,15,16,32The thermal amplitude, defined as the highest temperature at which the antibody binds the antigen, appears to be more important than the titer with respect to the pathogenicity of CA ,13,33. TChristenson and co-wIn our population-based descriptive study of primary CAD, a monoclonal band was detected by electrophoresis and immunofixation in sera from 79 (94%) of 84 patients with available data . The monH), diversity (D), and joining (JH) gene segments. The diversity created by this recombination process is further increased by enzymatic modification at the cut ends of the gene segments, followed by the event of somatic hypermutation, typically occurring in the hypervariable segments of VH genes. Pascual, Thorpe, Stevenson and others have shown that anti-I CA found in serum samples from patients with primary CAD are preferentially encoded by the VH4-34 gene segment, formerly termed VH4.21 [H4-34 gene expression by testing sera from 11 CAD patients with hemagglutination inhibition assay using the rat monoclonal anti-idiotypic antibody 9G4, which is specific for VH4-34 encoded protein. All patient sera were confirmed to be idiotope positive [H gene segments other than VH4-34 [During maturation, each B-lymphocyte constructs its specific immunoglobulin heavy chain by assembly of coding sequences from the variable declined to zero. In a subsequent study, we assessed C protein levels in 15 CAD patients and found reduced levels of C3 in nine and C4 in 11 patients, six of whom had low CH50 [Reduced C factor levels in CAD were described early by Jonsen and otheIn order to further investigate these phenomena, we under took a longitudinal, prospective, 12 month follow-up study of one single patient with “paradoxical” exacerbations of hemolysis . In the The findings of C consumption and depletion may have clinical implications. First, administration of C-containing plasma products should probably be avoided. Second, these data explain why a majority of patients with CAD have exacerbations during conditions associated with acute phase reaction. Third, a non-functional classical C pathway may affect the therapeutic potential of monoclonal antibodies in CAD –50.+CD20+κ+ lymphocytes was detected in 10 of 11 patients.Pathogenic B-lymphocyte clones in CAD have been suspected or postulated for decades, based on the findings of monoclonal IgMκ CA in most, if not all patients ,31,37–39+κ+ lymphocytes were found in the bone marrow of most patients in whom a flow cytometric assessment had been performed. Based on previously published data [In a recent retrospective study, the medical records of 86 patients otherwise classified as having primary CAD were re-examined with regard to the presence of a clonal lymphoproliferative bone-marrow disorder . Monoclohed data ,53, a κ/hed data , 33 patiAccording to recent criteria, Waldenström's macro-globulinemia (WM) is defined as lymphoplasmacytic lymphoma of the bone marrow combined with monoclonal IgM at any serum concentration . When thCytogenetic features have been difficult to assess, probably because the cell clones usually are small and the neoplastic cells are indolent and hard to make proliferate in cultures. Trisomy 3q and translocation 8;22, respectively, have been reported in single cases ,57.CAD patients diagnosed by us and others to have a low-grade lymphoproliferative bone marrow disorder undoubtedly represent the same majority that used to be classified as having primary CAD ,27,31,48Based on the characteristics discussed in the preceding paragraphs and available literature ,10,17,27According to literature, counseling on cold avoidance should be the mainstay in management of primary CAD ,19,60. I+B-cell disorder and the success of treatment with the monoclonal anti-CD20 antibody rituximabin CD20+ non-Hodgkin's lymphoma [The recognition of primary CAD as a clonal lymphoproliferative CD20lymphoma ,65 made lymphoma ,65, and lymphoma . One smalymphoma ,67,68 halymphoma . In the lymphoma ,71. The 2 on day 1, 8, 15 and 22. Re-treatment was permitted in patients who responded and subsequently relapsed. The response criteria are summarized in We reported on 37 courses of rituximab single agent therapy administered to 27 patients with primary CAD in a prospective, uncontrolled trial . Each elThe benefit achieved by rituximab single agent therapy in CAD is limited by a 45–50% failure rate and relatively short response duration. Further studies are warranted, therefore, in order to explain the variable effect of rituximab therapy, identify possible predictors, and improve on response rates and response duration.+κ+ lymphocyte clone can merely be detected and monoclonal IgM is present at low levels, patients may have a clinically severe disease with a high CA titer or CA with high thermal amplitude [Even when a CD20mplitude ,31. Smalmplitude ,73. Thusmplitude . This mamplitude . To our + cells by at least three mechanisms; C-dependent cytotoxicity (CDC), antibody-directed cellular cytotoxicity (ADCC), and induction of apoptosis by direct intracellular signaling [in vitro and in vivo data indicate that CDC is an essential mechanism of action and, therefore, the reduced availability of C proteins in many patients with CAD may turnout to be of clinical importance [Rituximab has been shown to kill CD20ignaling . Some inportance ,50. In oportance . The admportance and up-rportance ,77. In oportance . Patient+ lymphocytes by anti-CD20 induced ADCC requires binding of the Fc-domain of the CD20-bound antibody to the Fc-receptor of effector cells [Elimination of CD20or cells . Polymoror cells ,79. Althor cells .Purine analogues have shown a remarkable efficacy in low-grade lymphoproliferative diseases, including WM ,82. AlthWe are now running a phase 2 study on the safety and efficacy of rituximab and fludarabine combination therapy in primary CAD , still uSince the hemolytic activity of CA is C dependent, one might consider direct C modifying agents as possible therapeutic options. Infusion of the humanized, monoclonal anti-C5 antibody eculizumab has recently been documented as a powerful therapeutic measure in paroxysmal nocturnal hemoglobinuria . No repo

High-throughput sequencing of the small RNA transcriptome of locust reveals differences in post-transcriptional regulation between solitary and swarming phases and provides insights into the evolution of insect small RNAs. All the reports on insect small RNAs come from holometabolous insects whose genome sequence data are available. Therefore, study of hemimetabolous insect small RNAs could provide more insights into evolution and function of small RNAs in insects. The locust is an important, economically harmful hemimetabolous insect. Its phase changes, as a phenotypic plasticity, result from differential gene expression potentially regulated at both the post-transcriptional level, mediated by small RNAs, and the transcriptional level.Here, using high-throughput sequencing, we characterize the small RNA transcriptome in the locust. We identified 50 conserved microRNA families by similarity searching against miRBase, and a maximum of 185 potential locust-specific microRNA family candidates were identified using our newly developed method independent of locust genome sequence. We also demonstrate conservation of microRNA*, and evolutionary analysis of locust microRNAs indicates that the generation of miRNAs in locusts is concentrated along three phylogenetic tree branches: bilaterians, coelomates, and insects. Our study identified thousands of endogenous small interfering RNAs, some of which were of transposon origin, and also detected many Piwi-interacting RNA-like small RNAs. Comparison of small RNA expression patterns of the two phases showed that longer small RNAs were expressed more abundantly in the solitary phase and that each category of small RNAs exhibited different expression profiles between the two phases.The abundance of small RNAs in the locust might indicate a long evolutionary history of post-transcriptional gene expression regulation, and differential expression of small RNAs between the two phases might further disclose the molecular mechanism of phase changes. Regulation of gene expression can occur at both transcriptional and post-transcriptional levels. In recent years, the discovery of numerous small RNAs has increased interest in post-transcriptional gene expression regulation during development and other biological processes. Small RNAs include several kinds of short non-coding RNAs, such as microRNA (miRNA), small interfering RNA (siRNA), and Piwi-associated RNA (piRNA), which all regulate gene expression at the post-transcriptional level. Typically, miRNAs are approximately 22 nucleotide small-RNA sequences that plaInsects comprise the largest group of metazoans, and previous studies have shown that small RNAs are involved in a significant number of biological processes in them . Many smLocusta migratoria) is a typical hemimetabolous insect within the family Acrididae and is a worldwide, highly prevalent agricultural pest causing hundreds of millions of dollars worth of damage every year. The locust has also been used in research as a model organism for the study of developmental, physiological, immune, and neural pathways, as well as others . We obtained 1,566,242 reads from the gregarious library and 1,949,248 reads from the solitary library after discarding the empty adapters. Generally, length distribution of small RNAs in two phase libraries is different . Although in most cases the key 'seed' site of the miRNA is nucleotides 2-8 [D. melanogaster miR-79 (dme-miR-79) has been validated as being at nucleotides 1-8 [We identified 55 miRNA sequences, belonging to 50 families , in the migratory locust by BLAST against the miRBase v11.0 . Most ofides 2-8 ,19, the ides 1-8 , which iFor lmi-miR-10, much like lmi-miR-79, the mature sequence in the locust has an additional nucleotide at the 5' end, in this case a uridine , which is the same as the miR-10 of non-insect organisms. Previous studies have demonstrated that miR-10 in both species that do and do not have an extra U have similar targets . AlthougD. melanogaster miRNA* in the locust library, indicating conservation of these miRNAs* between the locust and the fruit fly.Although mature miRNA and miRNA* (the miRNA:miRNA* duplex) are complementary, their base-pairing is imperfect in the presence of compensatory substitutions , and the miRNA* is generally less stable than the mature miRNA . AnalysiTo test whether the locust miRNA* and their corresponding mature miRNA sequences came from the same precursors, we used a PCR-based method to confirm the relationship between the miRNA and its miRNA*. If the miRNA and its miRNA* came from the same precursor, we should be able to amplify 55-70 bp fragments from the genomic DNA. As expected, we amplified 55-70 bp products from all the miRNAs with the exception of mir-iab-4 Figure , and theWe used the sequences of the amplified products of the conserved miRNA precursors to predict their secondary structure using mfold ,23, and Since the locust and fruit fly separated about 350 million years ago , it is sIn an attempt to discover locust-specific miRNA families, we integrated the data from the locust small RNA libraries we created with those of the locust EST database ,14. ThisWe obtained 185 miRNA duplex-like pairs . Reads of the most abundant miRNAs are about 10,000-fold higher than those of the scarce miRNAs. Such extreme variation can provide some basic insight into the function of these miRNAs. The most abundant miRNA is mir-1, which had approximately 163,143 reads in the gregarious library and 135,794 in the solitary library. As a muscle-specific miRNA , mir-1 ip < 1.0 × 10-6).As miRNA abundance is linked to the extent of conservation ,20, consciboulot gene of fruit fly, which encodes an actin binding protein and plays a major role in axonal growth during Drosophila brain metamorphosis [In animals, although miRNAs have been shown to repress the expression of their targets by binding to sequences in the 3' untranslated region (UTR) in most cases ,30, bothorphosis .Drosophila gene pale has significant differences in its expression levels between the two phases . We found that the 3' UTR sequence of locust pale contains a target site of lmi-miR-133 ; see Materials and methods; Figure Drosophila species also have conserved target sites of miR-133 in the 3' UTR sequences of the pale gene [pale at the post-transcriptional level. Therefore, miR-133 may contribute to the different expression of pale between the gregarious and solitary phases (see Discussion).We also found that some unigenes that had significant differences at the expression level between the gregarious and solitary phases were targeted by miRNAs. Although these genes may be regulated at the transcriptional level, it is possible that miRNAs play roles in regulating their expression. For example, microarray results in our lab show that the locust homolog of the ale gene ,20,32 and some appear to be much younger . Such age differences indicate that there is an ongoing process of miRNA evolution and it is possible that the insect lineage gave birth to the insect-specific miRNAs. Previous work in volution .Although the 50 miRNA families in the locust are highly conserved throughout widely divergent animal taxa, there are lineage-specific sequence substitutions in most of these families that are present in both vertebrates and insects. Based on their characteristic sequences in different lineages, we divided these families into five categories Table ; in doinDespite the short sequences of mature miRNAs, the major clades are well separated due to substitutions in categories II to IV Figure , indicatWe found that 26,519 reads matched the sense strand of ESTs and 11,596 reads matched the antisense strand ,14 in thThe proportion of endo-siRNAs in the small RNA libraries of locust is much lower than that of miRNAs Figure . HoweverAbout 20% of the small RNAs with a perfect match with ESTs were derived from transposons. Previous research has shown that transposons can generate two kinds of small RNAs: endo-siRNA and piRNA [There are a variety of transposons that could generate small RNAs regardless of whether they are siRNAs or piRNAs , which may indicate the presence of a broad range of small RNAs for silencing these selfish genetic elements. Analysis of the transposons we observed indicated that long interspersed elements (LINEs) were the dominant class producing small RNAs . CR1 and RTE-BovB are the dominant subtypes generating small RNAs . As more transposon sequence information in the locust becomes available, we expect there will be additional transposon-derived small RNAs identified, which will give greater understanding of the impact of these elements on genome evolution of the locust and related species.The rest of the sequences in the locust small RNA libraries remained unannotated. Most of the unannotated sequences in the gregarious library were 22 and 23 nucleotides long and commonly began with uracil . We expected that these were miRNAs missed in our search process, and thus suspected that these 22- and 23-mer RNAs included additional locust-specific miRNAs. In order to identify the potential miRNA candidates in the remaining 22- and 23-nucleotide sequences, we analyzed their 5' ends to determine whether they were similar in features to the miRNA 5' terminus that generally began with uracil, especially in the solitary library . Their features indicated that these 26-29-mer small RNAs might be of the piRNA class of small RNAs. Therefore, we analyzed the sequences of these small RNAs to look for the presence of an adenine at position 10, a common feature of piRNAs [Small RNAs in the gregarious library were enriched for lengths of 22-23 nucleotides, a typical length for animal miRNAs, and those in the solitary library were enriched for lengths of 26-29 nucleotides and 22-23 nucleotides Figure . For smamir-276, mir-125, mir-1, and let-7) in the gregarious phase were shown to be expressed 1.94-fold, 1.87-fold, 1.5-fold, and 1.5-fold as much as in the solitary phase, respectively in order to make a comparison between the gregarious and solitary small RNA libraries. Almost each kind of small RNA, including miRNAs, endo-siRNAs, and piRNA-like small RNAs, had some differences in expression level between the two phases. Seventeen conserved and 84 predicted locust-specific miRNAs differed by ≥ 1.5-fold between the two phases. Four examples of conserved miRNAs small RNAs in the solitary phase were much higher than in the gregarious phase . The findings here provide additional support for the feasibility and reliability of our method. We believe that more than 100 of our predicted locust-specific miRNAs would be canonical.In addition to the PCR-based method of validation, we also assessed the reliability of our miRNA prediction method by using Although the principle of our method, based on features of miRNA biogenesis, coincides with that of miRDeep , our metIt is difficult to predict miRNA targets in animals because the detailed mechanism of interaction between miRNA and its target transcripts is not clear, although several bioinformatic tools have been developed, such as miRanda. None of the available computational methods can predict miRNA targets accurately and they all give results with higher false positive rates ,32,35. Mpale gene, a potential target of lmi-miR-133 and the phenomena of phase changes are both linked with metamorphic processes, we think that the two miRNAs and the phenotype of phase changes may be related. mir-1 and mir-315 also have different expression levels (data on mir-315 expression levels is not shown). mir-1 is a muscle-specific miRNA [mir-315 is a potent activator of Wingless signaling in Drosophila [mir-1 and mir-315.We found 17 conserved miRNAs to have different expression levels between the gregarious and solitary phases. These miRNAs may be involved in gene expression regulation at the post-transcriptional level during phase transition. Especially, we are most interested in 5 of the 17 miRNAs that are expressed differentially in the two phases. s Figure , althougosophila ,43. Phasic miRNA , and mirosophila . BecauseBased on our analysis of the small RNA expression levels in gregarious and solitary locusts, we believe that some small RNAs that regulate the expression of protein coding genes in the two phases must be involved in the process of phase changes. It is possible that we could provide insight into the phase changes and find new approaches to control the locust plagues throughout the world by small RNAs.High-throughput sequencing provides a good chance for us to study small RNAs in the locust, which is an important worldwide pest. This study led to the discovery of a large number of small RNAs in the locust, including miRNAs, endo-siRNAs and piRNA-like small RNAs. Importantly, we have identified 185 potential locust-specific miRNA candidates using the method we developed, although there is no locust genome sequence available. Our method makes it possible to discover more miRNA families in a broader range of species whose genome sequences have not been sequenced. We further show the evolutionary path of miRNAs in the locust, indicating the potential evolutionary mechanism of miRNAs. The function of small RNAs in phase changes of the locust is disclosed in our study. We found significant differences in the expression of small RNAs between the two phases of the locust and target prediction shows that some genes expressed differentially in the two phases are targets of miRNAs, which gives us clues to further discover the mechanisms of phase change in locusts.Locusta migratoria that we fed in our lab. We collected 0-1, 2-3, 4-5, 6-7, 8-9, 10-11, 12-13 and 14-15 day-old embryos cultured at 30°C in clean sand with relative humidity. For the larvae, we collected the whole body except the midgut and pooled them to ensure every instar was present in the sample. We chose to collect adults at eclosion, sexual maturation, post-spawning, and elderly stages separately and then pooled them together. Total RNA was extracted according to the manufacturer's protocol. We examined the quality of RNA using an Agilent 2100 Bioanalyzer.Total RNA was extracted using TRIzol reagent from mixed-stage RNA fragments 14-30 bases long were isolated from total RNA by Novex 15% TBE-Urea gel (Invitrogen). Then, a 5' adaptor was ligated to purified small RNAs followed by purification of ligation products on Novex 15% TBE-Urea gel. The 5' ligation products were then ligated to a 3' adaptor (Illumina) and products with 5' and 3' adaptors were purified from Novex 10% TBE-Urea gel (Invitrogen). Subsequently, these ligation products were reverse transcribed followed by PCR amplification. The amplification products were excised from 6% TBE-Urea gel (Invitrogen). The purified DNA fragments were used for clustering and sequencing by Illumina Genome Analyzer at the Beijing Genomics Institute, Shenzhen.D. melanogaster or other insects were identified as conserved miRNAs.We discarded bad reads that were the result of incorrect sequencing or were the reads of adaptor contamination that were not ligated to any other sequences. We clustered the remaining reads based on sequence similarity and the dominant reads were analyzed as follows: the reads were analyzed by BLAST against EST database and FlyBC. elegans, D. melanogaster, and Arabidopsis [We first looked at the high-throughput sequencing data of small RNAs in other species, including bidopsis ,20,38, aBased on the biogenesis features of miRNA Figure , we deveIn order to satisfy the requirement of input sequences analyzed by mfold, we joined the two sequences in each candidate pair using a standard hairpin-forming linker sequence (GCGGGGACGC). Those pairs that met the following conditions were analyzed further: the pairs had a free energy less than or equal to -21 kcal/mol ; the pairs had no bulge bigger than 6 nucleotides and multiple loops. The way of determining the best parameters and of testing this method is described in the Methods in Additional data file 3.We extracted genomic DNA from the fifth instar locust using a Gentra Puregene Tissue Kit according to the manufacture's protocol. We designed primers for 8 conserved miRNAs and 24 candidate miRNA-miRNA* pairs we predicted based on a dependence of the sequences of the mature miRNA and miRNA* species using Primer Premier 5.0. Because mature miRNA may come from either arm of the precursor, we designed two pairs of primers for each duplex. Corresponding fragments were amplified by PCR and the length of amplification products was examined on 2.5% agarose gels. Fragments between 55 and 70 nucleotides in length were subcloned into pMD18-T vector for sequencing analyses.The 23-29 nucleotide long RNAs matching ESTs annotated as transposons were considered as piRNA-like small RNAs. Those small RNAs that perfectly matched EST antisense strands were considered as candidate endo-siRNAs if they were not from annotated transposons. Moreover, we also searched the ESTs for miRNA precursors. Although there were some sequences that perfectly matched EST sense strands, no typical hairpin structure of these ESTs could be identified using mfold. Rather than folding the entire EST sequence, regions of 70 nucleotides, 100 nucleotides and 150 nucleotides on either side of the small RNA sequences were folded.Unigene sequences from the EST database of the locust ,14 were pale gene was obtained by 3' rapid amplification of cDNA ends (RACE) using a SMART RACE cDNA Amplification Kit with the primer GCGACCTGGACAACTGCAACCACCTCAT according to the manufacturer's protocol.The 3' UTR sequence of the locust endo-siRNA: endogenous siRNA; EST: expressed sequence tag; lmi-miR number: locust miR-number; miRNA: microRNA; piRNA: piwi-associated RNA; RACE: rapid amplification of cDNA ends; siRNA: small interfering RNA; UTR: untranslated region.YW and LK designed the study. YW performed all the bioinformatic analysis except target prediction of miRNAs. SC provided help to analyze piRNA-like small RNAs. PY predicted targets of miRNAs and YW analyzed the prediction results. SC and YW isolated total RNA and carried out PCR experiments. ZM carried out 3' RACE experiments. YW and LK prepared the manuscript. All authors read and approved the final manuscript.Drosophila miRNA data.The following additional data are available with the online version of this paper. Additional data file Locust endo-siRNAs.Click here for fileLocust piRNA-like small RNAs.Click here for fileDrosophila miRNA data.Figure S1 shows alignment of miR-79 and miR-10 of different species. Figure S2 shows expression patterns of locust miRNAs. Figure S3 shows transposon types from which small RNAs are derived in the locust. Figure S4 shows lengths and initial nucleotide distributions of the unannotated small RNA sequences. Table S1 lists the sequences of conserved miRNAs and miRNA*s in the locust. Table S2 lists precursor sequences of the seven conserved miRNAs that have a conserved star sequence. Table S3 lists sequences of predicted locust-specific miRNAs. Table S4 lists the ten most abundant miRNA-like 5'-end small RNAs in the remaining reads after annotation of miRNAs, siRNAs and piRNA-like small RNAs. Table S5 lists endo-siRNAs with different expression levels between the two phases. Table S6 lists piRNA-like small RNAs with different expression levels between the two phases. The Methods show the way to determine the best parameters of our miRNA prediction method and assess the reliability of our method using Click here for file

The dihedral angle between mean planes of these two chloro-substituted benzene rings is 46.7 (7)° compared to 46.0 (1) and 32.4 (1)° in similar published sructures. The angles between the mean plane of the prop-2-en-1-one group and the mean planes of the 3-chloro­phenyl and 4-chloro­phenyl rings are 24.1 (2) and 29.63°, respectively. While no classical hydrogen bonds are present, weak inter­molecular C—H⋯π-ring inter­actions are observed, which contribute to the stability of crystal packing.The title compound, C Å b = 7.3328 (9) Å c = 14.6752 (16) Å α = 102.821 (10)°β = 95.003 (10)°γ = 92.933 (11)°V = 613.88 (14) Å3 Z = 2 Kα radiationCu −1 μ = 4.61 mmT = 110 K 0.53 × 0.33 × 0.28 mm Oxford Diffraction Gemini R CCD diffractometerCrysAlisPro; Oxford Diffraction, 2007T min = 0.067, T max = 0.275Absorption correction: multi-scan (4041 measured reflections2402 independent reflectionsI > 2σ(I)2147 reflections with R int = 0.035 R[F 2 > 2σ(F 2)] = 0.047 wR(F 2) = 0.133 S = 1.04 2402 reflections163 parametersH-atom parameters constrainedmax = 0.48 e Å−3 Δρmin = −0.39 e Å−3 Δρ CrysAlis Pro used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809037805/zs2009sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809037805/zs2009Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

In the crystal structure, the mol­ecule adopts a photoactive anti­parallel conformation, with two n-pentyl groups located on opposite sides of the cyclo­pentene ring. The cyclo­pentene ring assumes an envelope conformation. The distance between the two reactive C atoms on the thio­phene rings is 3.834 (7) Å. One of the n-pentyl groups is disordered over two positions; the site occupancy factors are ca 0.7 and 0.3.The title compound, C Å b = 12.3670 (16) Å c = 15.596 (2) Å α = 67.730 (2)°β = 85.482 (2)°γ = 72.804 (2)°V = 1576.1 (4) Å3 Z = 2 Kα radiationMo −1 μ = 0.23 mmT = 291 (2) K 0.29 × 0.21 × 0.16 mm Bruker SMART APEXII CCD area-detector diffractometerSADABS; Sheldrick, 1996T min = 0.932, T max = 0.963Absorption correction: multi-scan (12153 measured reflections5828 independent reflectionsI > 2s˘I)3782 reflections with R int = 0.026 R[F 2 > 2σ(F 2)] = 0.049 wR(F 2) = 0.142 S = 1.03 5828 reflections384 parameters14 restraintsH-atom parameters constrainedmax = 0.41 e Å−3 Δρmin = −0.26 e Å−3 Δρ APEX2 used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL.Data collection: 10.1107/S160053680800202X/xu2397sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S160053680800202X/xu2397Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The rupture of retroperitoneal varices is a rare and catastrophic complication of portal hypertension. We describe a case of this nature, the first in Brazilian medical literature, and also reviewing all previous 34 cases. We systematically analyzed all therapeutic approach and propose a management algorithm for diagnosis and treatment of this lethal condition. The majority of the patients presented with abdominal pain, distention and hypotension, and developed hemorrhagic shock. Rupture of retroperitoneal varices can be properly managed if an early diagnosis is made and surgery is performed promptly, which is the only effective treatment. Arteriography should be used when the suspicion is of rupture of hepatocellular carcinoma. The first case of rupture of retroperitoneal varices, a rare and catastrophiccomplication of portal hypertension, has been reported in 1958 . We usedA 51-year-old woman entered the Emergency Department of Universitary Hospital of theUniversity of Sao Paulo (USP) in March 2006 presenting with abdominal pain fortwo days, associated with nausea and vomits. She also reported abdominaldistention for the last fourteen days.Her pastmedical history showed a chronic abuse of alcohol leading to liver cirrhosisassociated to Hepatitis B. She had been under medical follow-up with aclinician from 2001 to 2004, when she abandoned medical care.Herphysical examination was remarkable for an ill-appearing, pale, jaundiced, anddyspneic patient. She had a heart rate of 100 beats/min and a systolic bloodpressure of 95 and diastolic of 65 mm Hg. Abdominal examination revealeddiminished bowel sounds, a slight distention, and diffuse tenderness duringpalpation, with no guarding. Admission laboratory values showed hemoglobinlevel of 6.4 g/dL. MELD score of 24, Child-Pugh grade C.Anendoscopy was carried out, which showed a healed distal esophageal ulcer, ahiatal hernia, and erosive gastritis of the body and antrum. There were no signsof esophageal varices.A fewhours after entering the Emergency Department she developed severe hypotensionof 70/40 mm Hg, Glasgow coma scale 14, tachycardia of 125 beats/min. Sheunderwent volume resuscitation with no sustained response. Treatment forSpontaneous Bacterial Peritonitis was initiated with Ceftriaxone. Additionaltreatment with norepinephrine was started as she remained hypotensive evenafter the continuous infusion of volume. She was then transferred to theintensive care unit. She had progressive hemodynamic instability, abdominaldistention, and altered mental status, requiring endotracheal intubation.At thistime a surgeon was requested to examine the patient. A paracentesis was carriedout; the peritoneal fluid was hemorrhagic with a hematocrit of 12%. Laboratoryvalues at this moment were hemoglobin level of 3.8 and INR of 7.29. She wasthen transfused with packed RBCs and plasma. Reaching hemodynamic stability sheunderwent an exploratory laparotomy.About 5 L of blood were evacuated from the peritoneal cavity. A rupturedretroperitoneal varix was found to be the cause of bleeding, next to themesenteric root. Direct ligation of the vessel led the bleeding to stop . The livReturningto the intensive care unit the patient was massively transfused with packedRBCs and plasma for anemia and coagulopathy. She continued to behemodynamically unstable associated with renal and hepatic failure. On the sixthposoperatory she died of multiple organ dysfunction syndrome.Traumaand nonmalignant gynecological conditions account for more than 90% ofintraperitoneal hemorrhages . The maiIncirrhotic patients with ascites the intraperitoneal bleeding occurs most of thetimes due to structural lesions such as hepatocellular carcinoma or ovarycancer and rupture of intraperitoneal varices .Theintraperitoneal varices rupture is a rare event, whose incidence unknown, andit is related to severe portal hypertension. We believe that the real incidenceof this pathology is much superior than the 34 cases described in literature dueto misdiagnosis. It also appears in patients with terminal liver disease,mostly in a fulminate way.Portalhypertension leads to the development of portosystemic shunts in well-definedanatomic sites. The most acknowledged sites include the gastroesophageal veinsconnecting the azigohemiazigos system, the hemorrhoidary veins from theinferior mesenteric vein, communicating with the tributaries of the InternalIliac Vein and the Umbilical and periumbilical veins draining to the leftPortal Vein and to the epigastric veins of the anterior abdominal wall. Therecanalization of the Umbilical vein is known as Cruveillier-BaumgartenSyndrome , 4. TherThereare 34 cases of intraperitoneal bleeding due to rupture of varices described inliterature, as shown in Themajority of the patients presented with abdominal pain, distention andhypotension, and developed hemorrhagic shock. The diagnosis was established byparacentesis, angiography, ultrasound Doppler, and tomography. Even so, thediagnosis was confirmed only by laparotomy.Thehemoperitoneum diagnosis is confirmed by paracentesis when the Ht > 5%. Theparacentesis was important in the diagnosis and surgical indication is most ofthe cases. Only two cases out of ten who survived did not undergo theparacentesis . In one Theangiography was used as an attempt to achieve the diagnosis in 6 cases ofhemoperitoneum by varices inside the abdomen –12. The The onlyeffective treatment was surgery. None of the 7 patients treated in anonchirurgical basis survived. Twenty eight were operated, twelve survived. The global mortality rate was 65.7%. And for the patients submitted to surgeryit was of 57.1%. The causes leading of death were uncontrollable or recurrentbleeding, liver failure, kidney failure, heart failure, and aspiration of bloodfrom ruptured esophageal varices.Out of28 cases that underwent surgery, in twenty six the ligation of the bleedingvessels was successful, and eleven survived the after surgery period. In twocases who underwent surgery, the ligation was not possible , 13, andThemanagement of the bleeding from intra-abdominal varices is difficult sincethere are no randomized trials due to the rareness of this situation . HoweverThepatients' survival rate seems to be related to three important facts: thepatient's functional hepatic reserve, the importance of the hemorrhagic shockin its presentation, and the early operative intervention and control of thebleeding source , 16.Thefirst challenge in the management of these cases is in the differentialdiagnosis of acute hemorrhagic abdomen in a cirrhotic patient. We suggest a flowchartbased on the analysis of all the published cases related to intraperitonealvarices and a review of the articles related to the other causes ofhemoperitoneum in cirrhotic patients .Theparacentesis with Ht over 5% is a precise indicator of intra-abdominal bleedingthat can dimish the risk of unnecessary laparotomies . It may Once thebleeding in a cirrhotic patient was identified, the diagnostic orientation ismade on differing HCC rupture, bleeding intra-abdominal varices, vascularcauses such as aorta's aneurism, and gynecological causes.Wesuggest checking the dosage level of HCG in women, followed by Abdominal DuplexScan in both sexes as the first diagnostic step. Duplex scan can provideinformation on the Aorta and its branches, the abdominal collateralcirculation, the patency of the Portal Vein, hepatic nodules and tumors, and theovaries.Computerizedtomographic scanning was suggested by Bataille et al. and GoldArteriographyhas proved to be an inefficient investigation for diagnosis and treatment ofretroperitoneal bleeding varices. It postpones the surgical treatment , the onlThefundamental treatment of variceal bleeding is the ligation of the vessel. Nevertheless, the Surgical Portosystemic Shunt or the Transjugular IntrahepaticPortosystemic Shunt (TIPSS) must be considered for selected patients.In theoperation room, the decision of performing a Portosystemic shunt must take intoconsideration the patient's clinical condition and the time needed to performthe shunt. In unstable patients and with little hepatic functional reserve westrongly suggest not increasing the surgical time. However, multiple bleedingvarices or the possibility of a new bleed should be analyzed in order to decideif the shunt must be performed.TIPSSwas not performed in any of the reported cases. Nevertheless, the way weunderstand its use for treatment of gastroesophageal varices can help us in treating variceal bleeding from the retroperitoneum. Therefore TIPSS can be usedmainly for the patient's postoperatory when there is suspicion of a newbleeding, or for diminishing the portal tension in selected patients serving asa bridge for liver transplantation. Before deciding if the TIPSS will beperformed, one must be aware of its contraindications and complications as bleeding,perforation of the liver capsule, and encephalopathy, among others.Bleedingintraperitoneal varix is a rare complication of portal hypertension, butcarries a high mortality rate. Nonetheless, the physician must know thiscondition, as the clinical suspicion is the only way of establishing an earlydiagnosis and indicating surgery at once, which is the only effectivetreatment.Wesuggest a flowchart to optimize the treatment of the acute hemorrhagic abdomenin the cirrhotic patient. Paracentesis followed by ultrassonography with DuplexScan or Computerized Tomography seems to be the most important procedure forestablishing the correct diagnosis of abdominal pain, distention, and shock. Thereafter,surgery must be performed as soon as possible in case of ruptured varices. Arteriography should be used when the suspicion is of rupture of hepatocellularcarcinoma.

The aim of the study was to examine the relations between widowhood and divorce and overall survival among women with cancer. All Norwegian women born between 1935 and 1954, and diagnosed with cancer between 1966 and 1990, were followed up until 1991. In all, 14,231 cases were followed up for a median length of approximately 4.5 years (mean = 6 years), and 4311 women died during follow-up. In addition to overall cancer, separate analyses have been made for cancer at specific sites. Widows had a risk of dying which was nearly identical to that of married women for all sites except colorectal cancer, for which widows had a 2-fold increased death rate compared with married women. Divorced women had an overall increased hazard ratio of 1.17 (95% CI 1.07-1.27), which was confined to cancer of the breast, lung and cervix. With few clear exceptions women with children had a better survival than nulliparous women .

Purpose: To improve function after pelvic resection involving the acetabulum, using an anatomic composite implant built with screws and cement. Material and method: Since 1990, 66 patients with peri-acetabular bone malignancies have been treated by extensive resection followed by hand-modelled innominate prosthesis with partially constrained total hip prosthesis.The hand-modelled innominate prosthesis was made of a titanium cup, a set of long titanium screws and two or three packs ofgentamycine-loaded cement. Results: Many postoperative complications were observed: deep infection (14%), hip prosthesis dislocation (25%) and local recurrence (15%).Sixteen patients (25%) had to be reoperated. Nevertheless, at last follow-up, 62 patients stillhad composite prosthesis. The mean functional result, rated according to a modified Enneking's staging system, was 80% with unlimited walking without support, average hip flexion 100°, length discrepancy less than 1 cm. Discussion: These results were similar to those described in the literature for custom-made innominate prostheses and muchbetter than those of alternative reconstructive procedures. Hand-modelled composite prostheses are cheaper, easier, moreadaptable and enables better anchorage than custom-made prostheses. Such a procedure can be used even after total iliacwing resection. Conclusion: The advantages of such a procedure plead for its extensive use after acetabular resection. But long-term follow-up is necessary to validate indications.

Drosophila melanogaster. We found that Importin-α2 was expressed in the nervous system where it was required for normal active zone density at the NMJ and axonal commissure formation in the central nervous system. Other aspects of synaptic morphology at the NMJ and the localization of other synaptic markers appeared normal in importin-α2 mutants. Importin-α2 also functioned in development of the body wall musculature. Mutants in importin-α2 exhibited errors in muscle patterning and organization that could be alleviated by restoring muscle expression of Importin-α2. Thus, Importin-α2 is needed for some processes in the development of both the nervous system and the larval musculature.Nuclear import is required for communication between the cytoplasm and the nucleus and to enact lasting changes in gene transcription following stimuli. Binding to an Importin-α molecule in the cytoplasm is often required to mediate nuclear entry of a signaling protein. As multiple isoforms of Importin-α exist, some may be responsible for the entry of distinct cargoes rather than general nuclear import. Indeed, in neuronal systems, Importin-α isoforms can mediate very specific processes such as axonal tiling and communication of an injury signal. To study nuclear import during development, we examined the expression and function of Importin-α2 in To ensure a proper long-term response to stimuli, cells must have communication between the cytoplasm and the nucleus. Signals arising from diverse pathways must be imported into the nucleus where they can affect gene transcription. This process is largely accomplished through the function of importin proteins The importin family comprises two major classes of protein: Importin-α and Importin-β Drosophila genome importin-α1 is involved in wing patterning importin-α2 may be involved in cell proliferation and cell cycle progression importin-α3 is involved in cell fate decisions importin-α3 fail to import a synaptic dSmad2 signal into the nucleus and show defects in proper axonal tiling of photoreceptors importin-α1 and importin-α2 mutants survive through to adulthood importin-α1 and importin-α2.There are three evolutionary clades of Importin-α homologues and each is singly represented in the importin-α2 is required in the muscle for normal patterning and organization of the larval body-wall musculature.We recently identified a role for Importin-α2 outside the germline. Importin-α2 contributes to postsynaptic development of the neuromuscular junction (NMJ) by permitting the import of a Fz2-derived signal, the C-terminal peptide of the Fz2 receptor, into muscle nuclei Drosophila strains were raised at 25°C on cornmeal-molasses food. The isogenic stock y, w; FRT42D was used as the wild-type control. The following alleles and transgenic strains were used: D3imp-α2, D14imp-α2Df(3L) α1S1, referred to here as DfImp-α1Larvae were grown on standard grape juice agar plates at low density at 25°C. Wandering third-instar larvae were dissected and processed for immunohistochemistry as described Larvae were imaged using an LSM 510 Meta laser scanning confocal microscope and either a 63× 1.4 NA or 40× 1.0 NA objective. Images were processed in separate channels using the LSM software or Adobe Photoshop CS2 .Scoring for bouton counts, commissural defects and muscle patterning errors were performed using a Nikon E800 fluorescent microscope. For boutons, NMJs on muscles 6 and 7 of segments A2 and A3 on both the right and left sides were analyzed; bouton number was normalized to muscle surface area. Commissures were scored as defective if they had discontinuous axons at the midline of the ventral nerve cord. Muscle patterning was analyzed in segments A2 through A7. Genotypes were processed in the same tube and imaged with identical settings. Bruchpilot (Brp) and GluRIIC puncta were manually counted at MN4b synapses on muscle 4 from confocal z-stacks and terminal area was calculated using the threshold function in Metamorph for the HRP channel as previously Fluorescent intensity was measured in ImageJ as previously n) is described either in the figure legend or in the Statistical analysis was conducted using Prism 5 software and significance (relative to wild-type unless otherwise noted) was calculated using a one-way analysis of variance (ANOVA) with a Dunnett post-hoc test to a control sample. When only two samples were tested, an unpaired student's t-test was used. Values are given as mean ± SEM; sample size . In aggregate, although no deviations from the normal pattern were observed in 96 wild-type segments examined, a quarter of the 228 mutant hemisegments contained defects and every importin-α2 mutant larva had at least 1 defective hemisegment (Importin-α2 is present in muscle nuclei and is required for normal postsynaptic development by mediating a synapse-to-nucleus Fz2 signal e fibers . Most fre fibers . Additioe fibers , arrow oe fibers . We alsoe fibers . Unlike isegment . Expressisegment . The proimportin-α2 in Drosophila nerve and muscle. Rather than preventing all nuclear import and causing cell lethality, importin-α2 mutants display specific defects in active zone development, central axon projections, and muscle patterning. These defects arise in the context of larvae whose overall patterning and development appear to be normal.We have identified an array of consequences of the loss of Drosophila Importin-α2 in the nervous system based on transcript expression Previous work suggested roles for importin-α2 phenotypes described here, can entail regulation of the synapse. In particular, studies of Aplysia and hippocampal neurons indicated an essential role of an Importin-α in long-term synaptic plasticity Drosophila NMJ indicated a role in controlling the density of release sites and their accompanying postsynaptic receptor clusters. While there were no obvious phenotypes involving synaptic morphology and bouton number at the neuromuscular junction (Neuronal functions of the Importin-α family have been reported recently in several systems junction , active junction . The addimportin-α2 also showed defects in the organization of the central nervous system. Specifically, the axon tracts that cross the midline of the CNS and express the cell adhesion molecule Fasciclin III In addition to these peripheral defects, mutants in Drosophila larval body walls importin-α2 mutants. The importance of signaling pathways in establishing the normal pattern has been demonstrated previously by mutations in the toll/dorsal pathway and in dystroglycan and POMT1. The phenotypes of these mutants and others entail muscle duplications, absent muscles, branched muscles and errors in muscle insertion importin-α2 mutants and arose from the loss of Importin-α2 expression in the muscle (dystroglycan and POMT1 that affect larval muscle integrity also display patterning defects akin to and at similar frequencies to those of the importin-α2 mutants The stereotypical patterning and unique identification of each muscle in e muscle . While tDrosophila Importin-α2 is required in multiple cell types for distinct aspects of development but is not required for general development or cell viability may reflect a high degree of cargo specificity for this Importin-α importin-α2. The identification of those phenotypes is a critical step towards identifying the mechanisms and cargo molecules through which the importins contribute to cellular processes.In current models of nuclear import, Importin-α binds cargo molecules destined for nuclear entry Figure S1Active Zone Density is Normal in importin1 Mutants. A C Representative confocal images of larval NMJs from muscle 4 stained with antibodies against Bruchpilot magenta, GluRIIC green and HRP blue in wildtype control animals y,w FRT42D . Each Brp punctum is closely apposed by a corresponding GluRIIC punctum. D F Representative confocal images of importin1 mutants w Df3L 1S1 stained as above. No changes in active zone apposition are apparent. Scale bar 10 m. G J Histograms of NMJ area G, Brp density H, GluRIIC density I and the ratio of Brp to GluRIIC J at wildtype and importin1 mutants NMJs at muscle 4. No significant changes in these parameters are evident. n 12 NMJs for each genotype error bars represent SEM.TIFClick here for additional data file.

Innovations to be deployed during consultations with patients may influence the clinical performance of the medical practitioner. This study examined the impact on General Practitioners' (GPs) consultation performance of novel computer software, designed for use while consulting the patient.Six GPs were video recorded consulting six actor-patients in a simulated clinical environment. Two sessions were recorded with six consultations per GP. Five cases presented cancer symptoms which warranted a referral for specialist investigation. Practitioners were invited to use a novel software package to process referrals made during the consultations in the second session. Two assessors independently reviewed the consultation performance using the Leicester Assessment Package (LAP). Inter-rater agreement was assessed by a Bland-Altman plot of the difference in score against the average score.Sixty of the seventy two consultations were successfully recorded. Each video consultation was scored twice by two assessors leaving 120 LAP scores available for analysis. There was no evidence of a difference in the variance with increasing score (Pitmans test p = 0.09). There was also no difference in the mean differences between assessor scores whether using the software or not The actor-patient consultation can be used to test clinical innovations as a prelude to a formal clinical trial. However the logistics of the study may impact on the validity of the results and need careful planning. Ideally innovations should be tested within the context of a laboratory designed for the purpose, incorporating a pool of practitioners whose competencies have been established and assessors who can be blinded to the aims of the study. Innovations are required in clinical practice in order to improve outcomes for patients. Implementation of such innovations requires substantial evidential support. Glazious and Haynes postulated that a significant barrier to the introduction of research evidence into clinical practice is that the relevant action must be recalled at the right time and the necessary task achievable at the opportune moment. In many "...the ideal consultation. The doctor's attention is devoted exclusively for a short period of time to the life and problems of another human being. He is there to listen and to help. His training will have made him receptive to a wide range of distress signals and given him the means, to answer them. The occasion will be unhurried and something will be gained by both participants; a good consultation brings satisfaction to the doctor as well as to the patient." [atient." Therefore any intervention that may impact on this consultation has implications for outcome for the patient. Whilst there is a demand for more research to take place in general practice there is an on-going imperative to continue to function efficiently and effectively whether or not testing innovations or new ways of working. The perceived adverse impact on practitioner work flow may be one barrier to innovation in general practice. Thereforthat and turning on the rules for this"). Problems arise when switching costs conflict with productivity and safety, both of which are required in general practice. Thus, diagnostic and therapeutic errors may occur when either stage is compromised.General Practitioners are required to manage multiple tasks during consultations. Meyer et al. describe two stages that help people to unconsciously switch between tasks. Human "executive control" processes have two distinct, complementary stages. One is "Although switch costs may be relatively small, they add up when switching repeatedly back and forth between tasks. Brief mental blocks created by shifting between tasks can consume up to 40% percent of someone's productive time and increase the risk of error. It wouldThis study received ethics approval from HREC at Curtin University of Technology (RD-54-08)This pre and post study involved two sessions of simulated consultations using actors as patients. These sessions were conducted on the premises of a General Practice in Perth, Western Australia.Five of six 'patients' presented with a red flag symptom of common cancers. The sympAn interactive referral pro forma was developed by a project team consisting of general practitioners and technical experts. The software was designed as an interactive referral letter which highlighted a 'red flag' presentation following algorithms based on recommended guidelines to one of three specialists: respiratory, colorectal and breast. A referral letter could be produced within two minutes and was intended to be used at the point where the practitioner had decided to make a referral. Screen grabs in relation to the colorectal referral are presented in Figure Six GP volunteers were asked to consult with the six actor-patients as though they had previously visited the practice for one or two ongoing medical problems . The practitioners were allocated 15 minutes per consultation. GPs were asked to make clinical notes and outline any management plan in as much detail as they would in their practice. GPs were informed that the study was about 'testing an innovation'. In the second set of consultations the practitioners were asked to deploy the software during the consultation if they decided to refer the patient. Video recordings were independently reviewed by two investigators (RMK and MJ).Consultation competence: The LAP has been shown to facilitate reliable assessments of consultation performance and its face validity has been confirmed for general practice consultations. -9 Three Sixty of the seventy two consultations were recorded with sufficient sound and picture quality to allow analysis using the LAP. There were 60 consultations available for assessment, 36 before and 24 after the intervention. The distribution of consultations by intervention is shown in Table Each video consultation was scored twice by two assessors leaving 120 LAP scores available for analysis. The mean difference in score between the two assessors was 2.9 (95% CI 0.6–5.3) with levels of agreement (+/- 2 SD) ranging from -15.2 to 21.0. This is illustrated in Figure GEE modeling with main effects only indicated that there was no difference between mean LAP scores before and after the intervention and after taking clustering by GP and assessor into account . The type of scenario and use of the software was also not associated with a mean change in LAP score. However, an interaction between GP and intervention was observed in a subsequent GEE model which indicated that the effect of the intervention varied by GP (Table The approach had several strengths; we were able to replicate conditions that may be difficult to control in clinical practice. The practitioners all consulted the same patients in the same practice on the same evening. In many ways the methodology involving consulting actor-patients mimics the formal assessment or examinations of candidates seeking membership to many professional colleges. This study however illustrates methodological and technical challenges of investigating the impact of innovations on consultations in this context.Participating GPs were volunteers and perhaps unrepresentative. That alone was not considered a major limitation in the design of this study which was intended to demonstrate the impact on the performance of volunteers in two stages. However we have no measures of how the volunteer practitioners perform in routine practice out with the study using the LAP or any other consultation competence measure. We are therefore unable to confirm how well their performance here reflects their competencies when consulting 'real' patients. We therefore recommend a preview of practitioner performance in routine practice or the development of a pool of practitioners available to test innovations in controlled conditions in order to provide a practitioner performance baseline. The data from this study also suggest that there was no significant harm in relation to the consultation competencies in the second phase of the study. In particular, we had hypothesized that this intervention could have disrupted the flow the consultations – the 'switch costs' of the intervention. ,5 We hadMany more people present to general practitioners with symptoms which could indicate cancer, than people who actually have cancer: symptoms have a relatively low sensitivity and specificity. Conversely, forty percent of cancer patients reported significant problems communicating their concerns in the pre-diagnostic period and needed recurrent GP consultations before being 'taken seriously'. We hypotRecording of consultations needs to be facilitated by technicians guaranteeing high quality footage and with the least disruption or inconvenience to the participants. Unfortunately a proportion of consultation was not captured on tape due to technical failures and so could not be analysed. It may be helpful in a repeat of this study to employ a professional media team to facilitate the recordings. We were unable to assess the impact of observation on the GPs' performance although the literature on video recording for the purposes of assessment suggests that it has no significant adverse effect. AgreemenSeveral important lessons were learned in relation to testing innovations in 'controlled conditions'. The design of a 'clinical laboratory' in general practice, focusing on the consultation, requires painstaking attention to details such as the performance of the technical equipment, the actors, the practitioners and the assessors. There is a risk of significant failures in all aspects, each having a bearing on the validity of the results. In this study we offer some preliminary ideas on the design of such a facility with respect to testing innovations as prelude to a formal clinical trial in general practice.The authors declare that they have no competing interests.MJ, RMcK, designed the study and co-authored the paper, KS analysed the data and co-authored the paper, HA and MS organized the simulated consultations, collected the data and co-authored the paper. All authors read and approved the manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2288/9/54/prepub

Two sets of disordered mol­ecules share almost the same locations (related by an in-plane translation), ensuring that the c-glide plane condition is not attained. C—H⋯O inter­actions provide structural cohesion. The site occupancy factors of the disordered molecules are ca 0.72/0.28 and 0.67/0.33.The asymmetric unit of the title compound, C Å b = 22.0379 (11) Å c = 17.3408 (8) Å β = 109.450 (3)°V = 4327.0 (4) Å3 Z = 12 Kα radiationMo −1 μ = 0.09 mmT = 99 (2) K 0.66 × 0.25 × 0.17 mm Bruker–Nonius APEX2 CCD area-detector diffractometerSADABS; Bruker, 2006T min = 0.800, T max = 1.000 (expected range = 0.789–0.986)Absorption correction: multi-scan (106040 measured reflections13444 independent reflectionsI > 2σ(I)8097 reflections with R int = 0.062 R[F 2 > 2σ(F 2)] = 0.109 wR(F 2) = 0.374 S = 1.03 13444 reflections1113 parameters1 restraintH-atom parameters constrainedmax = 0.79 e Å−3 Δρmin = −0.69 e Å−3 Δρ APEX2 (Bruker, 2006SAINT (Bruker, 2006SAINT and SADABS (Bruker, 2006SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 (Farrugia, 1997PLATON (Spek, 2003Mercury (Macrae et al., 2006SHELXL97, PLATON and Mercury.Data collection: 10.1107/S1600536808006740/sj2473sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808006740/sj2473Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Lactobacillus and Gardnerella vaginalis have shown that these organisms shared compatibility profiling for the majority of the normal bacterial constituents of the female genital tract. Dominance disruption appears to come from the addition of compatible co-isolates and presumed loss of numerical superiority. These phenomena appear to be the keys to reregulation of BFFGT. Lactobacillus appears to be the major regulator of both G. vaginalis and anaerobic bacteria. When additional organisms are added to the bacterial flora, they may add to or partially negate the inhibitory influence of Lactobacillus on the BFFGT. Inhibitor interrelationships appear to exist between coagulase-negative staphylococci and Staphylococcus aureus and the group B streptococci (GBS) and other beta hemolytic streptococci. Facilitating interrelationships appear to exist between S. aureus and the GBS and selected Enterobacteriaceae.Analysis of 240 consecutive vaginal swabs using the compatibility profile technique revealed that only 2 bacteria have the ability to be a sole isolate and as such a candidate to be a major aerobic regulator of the bacterial flora of the female genital tract (BFFGT). Compatibility profiles of

The application of transesophageal echocardiography (TEE) has been continuously increasing over past several decades. It is usually considered a very safe diagnostic and monitoring device. Though the complications are rare, but these complications must be known to the operators performing TEE. The goal of this article is to encapsulate the potential complications associated with TEE. The complications are primarily related to gastrointestinal, cardiovascular and respiratory systems along with some miscellaneous problems related to probe insertion, drugs and inexperience of the operator. Strategies for the prevention of these complications are also analyzed in order to avoid the risk. Transesophageal echocardiography (TEE) is a semi invasive monitoring and diagnostic modality of immense utility. The practical clinical use of TEE was first described in 1976 when a modified rigid endoscopic probe with single M-mode crystal was used. Since that time, TEE technology has evolved rapidly with developments in flexible endoscopic probe technology, phased-array ultrasound systems, and crystal miniaturization. Presently, TEE is being used widely in operation theatres, intensive care units, cardiac catheterization laboratory and day care units. Although the technique is quite safe, if conducted by a skilled person, it is important to overview the procedure related complications, considering its widespread use. In the following article, we are trying to give a deep insight regarding the complications of TEE examinations.Dental trauma246The hypopharynx and upper esophagus are most prone to perforation9Non pulsatile flow, prolonged cardio pulmonary bypassIn conscious and sedated patient, perforations are evident from signs of subcutaneous emphysema, dyspnoea and pain. But under general anaesthesia, esophageal intubation is easy and perforation usually goes unnoticed, ultimately resulting in mediastinitis, sepsis and multi organ failure.Lesions such as neoplasm, diverticulum216Normal anatomical variations like aortic impression, large left atrium and left main bronchus or pathological variations such as mediastinal tumours17Vascular abnormalities like esophageal varices due to portal hypertension can cause bleeding during TEE.19Factors contributing to this problem are lack of cooperation from patients and inexperience of operator as well as anatomic abnormalities like double aortic arch21Risk factors associated with upper GI bleeding due to TEE include previous ulcerative process, vasoactive drugs and failure to use H2 antagonist drugs in the perioperative period.TEE exposes the esophageal mucosa to ultra sound waves and pressure for long periods. Mucosal edema, erosion, hematomas and petechiae can be produced specially in small children.26Splenic laceration can occur due to deep insertion of the probe into the stomach for transgastric imaging .Probe tip buckling is caused due to tip flaccidity in an old TEE probe, improper insertion, general anaesthesia and inexperience. It can cause injury when withdrawn hastily.3134Breakage and dislodgement of temperature probe and esophageal stethoscope during TEE are reported.352 saturation. Incidence of oxygen desaturation and aspiration increases with obesity 48TEE examinations in sedated patient may be associated with small reduction of Ord degree heart block.5354Esophageal intubation can induce vagal and sympathetic reflexes such as hypertension or hypotension, tachy arrhythmias or bradycardia and even myocardial infarction.Valsalva maneuver associated with retching and coughing leads to increase in intrathoracic, central venous and pulmonary pressures and release is associated with abrupt decrease of systemic pressure. Large intrathoracic pressure and associated hemodynamic changes resulting from retching may cause fatal pulmonary embolisation from right atrium mass, 5558Risk of bacteremia is associated with TEE and may lead to morbid infections such as endocarditis. The most common organisms responsible for bacteremia after TEE intubation include α-hemolytic streptococcus, staphylococcus aureus and staphylococcus epidermidis. 59Use of prophylactic antibiotic therapy during TEE, though controversial, is suggested for patients who are immuno suppressed, have prosthetic valves, cyanotic congenital heart disease, surgically constructed shunts and previous history of endocarditis. 61Sedation improves patients’ tolerance to TEE probe insertion and reduces coughing, vomiting and pain. Benzodiazepines, propofol and short acting narcotics are most commonly used for sedation. Side effects of these drugs like respiratory depression, hypotension, agitation and allergy may occur and must be treated promptly.Local anaesthetic used systemically to blunt the hemodynamic effects of TEE, for superior laryngeal nerve block and in jelly can cause anaphylactic or overdose reactions. Congenital absence of methemoglobin reductase enzyme and topical local anaesthetics like prilocaine, lidocaine and benzocaine can lead to methemoglobinemia.6364Disruption of protective probe sheath can create a lumen between core and sheath which can get filled with fluids and contaminants such as glutaraldehyde and which can be ingested during TEE.66TEE in emergency unit, especially in trauma patients, leads to more complications such as death, respiratory insufficiency, hypotension, emesis, agitation and cardiac dysrrhythmias. These are the patients which present with compromised hemodynamic and respiratory conditions and unstable cervical spine damage. These patients are with full stomach and altered sensorium and thus are at increased risk of aspiration. Therefore, endotracheal intubation is highly recommended in these patients.Powerful ultrasound beam can cause vibration of gas filled structures leading to hemorrhage and hemolysis.68History Dysphagia Odynophagia Mediastinal radiation Recent upper gastrointestinal surgery Recent esophagitis Thoracic aortic aneurysm Stricture Tumour Diverticulum Varices EsophagitisInformed consent must be obtained.Allergy.Bleeding disorder.Dysphagia to solid and liquid.Esophageal varices, diverticulum, esophageal web, upper GI bleeding, peptic ulcer, GERD & hiatal hernia.Previous gastric, esophageal and neck surgeries.Radiation therapy.Cervical arthrosis.Use of antacid, salicylates, anticoagulants and antiplatelet agents.Careful medical history.The oral and dental hygiene and loose teeth.Assessment of neck mobility, stability and arthritic changes.Assessment of airway.Physical Examination.Endocarditis prophylaxis for high risk patients.Fasting for 6 hr before an elective procedure.Surveillance and monitoring of vital signs at baseline and throughout the procedure.O2 supplementation and venous access should be established. Suction device and resuscitation equipments must be kept ready.In emergency settings, rapid sequence induction with orotracheal intubation is performed while in elective procedures, TEE can be performed on awake or mildly sedated patient with 6 hr fasting.Dentures should be removed and bite guard should be placed to protect instrument and fingers.TEE probe should be lubricated and kept in unlocked control-wheel position. It should never be forced into the passage. TEE probe must be inspected for mechanical dysfunction and damage of outer sheath causing electrical and thermal injuries leading to arrhythmias and death.70Awake patient is asked to swallow while under general anesthesia probe can be placed under direct laryngoscopy which reduces the trauma.Insertion of probe only upto 40-50 cm from incisors is advocated. Any nasogastric or feeding tube or temperature probe should be removed to avoid potential, kinking, knotting or gastric migration and prevent interference during imaging.During cardiac surgery special care is taken as the probe is used for longer duration and anticoagulation during cardiopulmonary by-pass and hypothermia leave the mucosa more vulnerable to pressure necrosis and ischemia.Patient should be monitored until fully awake and eating and drinking is allowed once the effect of local anesthetic is dissipated.Evaluation and surveillance of patients:Transesophageal echocardiography provides better imaging of cardiac anatomy and function but since it is more invasive than transthoracic echocardiography, operators should be aware of the likely complications , minimize the risk factors and take measures to prevent the complications.

Saccharomyces pastorianus) ferment faster than ale strains (Saccharomyces cerevisiae). Two lager and two ale strains had similar maltose transport activities at 20 °C, but at 0 °C the lager strains had fivefold greater activity. AGT1, MTT1 and MALx1 are major maltose transporter genes. In nine tested lager strains, the AGT1 genes contained premature stop codons. None of five tested ale strains had this defect. All tested lager strains, but no ale strain, contained MTT1 genes. When functional AGT1 from an ale strain was expressed in a lager strain, the resultant maltose transport activity had the high temperature dependence characteristic of ale yeasts. Lager yeast MTT1 and MALx1 genes were expressed in a maltose-negative laboratory strain of S. cerevisiae. The resultant Mtt1 transport activity had low temperature dependence and the Malx1 activity had high temperature dependence. Faster fermentation at low temperature by lager strains than ale strains may result from their different maltose transporters. The loss of Agt1 transporters during the evolution of lager strains may have provided plasma membrane space for the Mtt1 transporters that perform better at a low temperature.Lager beers are traditionally made at lower temperatures (6–14 °C) than ales (15–25 °C). At low temperatures, lager strains ( Among different beer types, ales are made by fermentation of brewer's wort at 15–25 °C, whereas lagers are traditionally made by fermentation at lower temperatures, 6–14 °C . Brewer'Saccharomyces cerevisiae suggested posthybridizational reorganization. S. cerevisiae and S. bayanus. They propose that distinct, but similar, S. cerevisiae strains were involved in the two events, and that hybridization was followed by the loss of a large portion of the S. cerevisiae genome from Group 1, whereas in Group 2, the loss of S. cerevisiae genes was much smaller.Most ale strains are thought to be varieties of hybrids . Lager storianus . They ha bayanus ;. The hy+-symporters that are driven by the electrochemical proton gradient across the plasma membrane. The active transport of maltose and maltotriose across the plasma membrane is a major rate-limiting step in the fermentation of wort occur in five unlinked MAL loci (MAL1–MAL4 and MAL6). Most studies (e.g. Km∼3 mM) and turanose, but activity towards maltotriose has been claimed occur on different chromosomes and encode transporters able to carry maltose (Km∼4 mM), maltotriose (Km∼7 mM), α-methylglucoside and turanose (AGT1 (α-glucoside transporter) encodes the α-glucoside transporter with the widest substrate specificity reported so far (Km∼8 mM) as well as maltose, maltotriose and α-methylglucoside (Km 20–35 mM) than for maltose (Km∼70 mM) and can also carry trehalose and possibly turanose . Here, we call this gene Sb-AGT1, although nothing is known yet about the substrate specificity or other properties of the transporter it encodes.Several kinds of genes for α-glucoside transporters are found in 0–35 mM) . A gene Several authors have compared maltose transport by individual ale and lager yeast strains. For example, AGT1 and several MALx1 genes in some, but not all lager strains and less frequently in ale strains and on external factors, such as the osmotic pressure (c. 70-fold between 0 and 20 °C) for an ale strain. However, c. 11-fold) for a lager strain. The apparent predominance of Agt1 transporters in ale strains, but not in lager strains, suggested that the different temperature dependencies of maltose transport in ale and lager strains might reflect differences in the properties of their maltose transporters. This article presents evidence supporting this hypothesis. We report (1) the distribution of MTT1, defective S. cerevisiae-derived AGT1 and S. bayanus-derived AGT1 genes among ale and lager strains and (2) the temperature dependence of maltose transport into ale and lager strains and into genetically engineered yeasts expressing AGT1, MALx1 and MTT1 maltose transporter genes from particular brewer's yeast strains. A preliminary report of some of this work has been given . Maltose for uptake experiments and trehalose were from Sigma-Aldrich , and maltotriose was from MP Biomedicals . Maltose and glucose for growth media were from Fluka . G418 was from Invitrogen .U-The industrial strains used in this work are listed in MTT1 genes, total chromosomal DNA from each strain was used as a template with MTT1 Frw and MTT1 Rev primers to generate a 247-bp fragment. To test for the presence of S. cerevisiae-type AGT1 genes, the primers AGT1 Frw and AGT1 Rev were used to generate 986-bp fragments. These fragments (842–1828 of the AGT1 ORF) include the frame shift and premature stop codon (starting at nucleotide 1183) described previously was repaired using an integration cassette containing nucleotides 1–1478 of the AGT1 ORF from ale strain A60 functionally fused to a PGK1 promoter and flanked on the 5′-side by the AGT1 promoter sequence (−1 to −705). The ORF of the repaired gene has the ale yeast sequence from nucleotide 1 to somewhere between 1183 and 1478 (i.e. the frame shift and premature stop codon are removed), followed by the lager yeast sequence to the end of the AGT1 gene, and it is under the control of a PGK1 promoter.Construction of Integrant 1 has been described previously (−1) containing 40 g maltose L−1. YP-40 g glucose L−1 was used for the growth of Integrant 1, so that its endogenous maltose transporters were repressed. YP-40 g glucose L−1 supplemented with G418 (200 mg L−1) was used for S150-2B derivatives transformed with a YEplac195-KanMX plasmid (with or without an AGT1 gene). S150-2B derivatives transformed with YEplac195 plasmids lacking KanMX (and with or without an MTT1 or MALx1) were grown in a synthetic complete medium while sugar was still present, but were grown into the stationary phase when so stated. After centrifugation , the yeast pellets were washed with ice-cold water and then with ice-cold 0.1 M tartrate-Tris (pH 4.2) and finally suspended in the same buffer to 200 mg of fresh yeast mL−1. For standard assays, about 1-mL portions of yeast suspension were equilibrated for 10 min to assay temperature (0–20 °C) in a water bath. Zero-trans [14C]-maltose uptake rates were then determined at 5 mM maltose (unless stated otherwise) as described and any inhibitors specified in the text. Reactions were stopped after 10–300 s by addition of 10 mL ice-cold water and immediate filtration through a (prewashed) HVLP membrane (Millipore). The membrane was rinsed with another 10 mL of ice-cold water and transferred to a scintillation cocktail and the radioactivity in the trapped yeast was counted. To ensure linearity with respect to time, two reaction times, t and 2t, were used, each in duplicate. Reaction times were chosen according to the yeast and temperature, so that the reaction rate calculated from the 2t assays was at least 90% of that calculated from the t assays.For maltose transport studies, native ale and lager strains were grown in YP differ slightly from the sequence in the SGDB, but encode full-length proteins, whereas those in two lager strains (A15 and A24) encode truncated, 394 amino acid polypeptides because of a frame shift and a premature stop codon at nucleotide 1183 to 13.1±0.4 U g−1 dry yeast or 10.0 U g−1 dry yeast (AGT1 from A179). Maltose transport by transformants carrying AGT1 genes from A60 or A179 was strongly inhibited by 50 mM maltotriose and 75 mM trehalose , which is characteristic of maltose transport by the broad specificity Agt1 transporter. Between 0.5 and 55 mM maltose, the transporter encoded by AGT1 from A60 exhibited a single Km of 1.5 mM maltose, which is lower than that (5–10 mM) estimated by AGT1 genes from these two ale strains encode functional, broad-specificity α-glucoside transporters, whereas the defective AGT1 gene from lager strain A15 does not encode a functional maltose transporter.The AGT1 genes in different kinds of industrial yeasts was studied by PCR , but not in any of the five ale strains can decrease. The adenylate energy charge and maltose transport rates of such cells can be increased by treatment with glucose for a few minutes immediately before the zero-−1 g−1 dry yeast, 20.3±3.5 for the lager strains and 19.2±5.9 for the ale strains; means±SDs, n=5, P>0.72 (two-tail Student's t-test). However, at 0 °C, the lager strains had about fivefold greater activity than the ale strains and the difference was highly significant. Maltose transport activities at 0 °C in μmol min−1 g−1 dry yeast were 1.7±0.4 (8.4% of the 20 °C activity) for the lager strains and 0.31±0.05 (1.6% of the 20 °C activity) for the ale strains . The relatively smaller activities of the ale strains were also evident at 10 °C.When harvested during growth on maltose, two lager strains and two ale strains had similar maltose transport activities at 20 °C, but the activities of both ale strains were markedly more temperature dependent than those of the lager strains . At 20 °AGT1 in place of the defective native AGT1 of A15. The chimera consists of nucleotides 1 to x (where x is between 1183 and 1478) of an AGT1 gene from ale strain A60 and nucleotides x+1 to 1848 of the native AGT1 of strain A15, driven by a PGK1 promoter and MTT1 . MALx1 transformants had high activity (55 μmol min−1 g−1 dry yeast) during growth on glucose and lower activity (6 μmol min−1 g−1 dry yeast) in the stationary phase. Both growing- and stationary-phase transformants exhibited strong temperature dependence (n=5) for growing cells and 1.9±0.6% for stationary-phase cells.pendence . The ratMALx1 transformants, both growing and stationary-phase MTT1 transformants exhibited lower maltose transport activity at 20 °C, about 1.0 μmol min−1 g−1 dry yeast at 5 mM maltose and 6.5 μmol min−1 g−1 dry yeast at 50 mM maltose. Mtt1 is reported to have a high Km for maltose and 7.5±2.5% . The absolute maltose transport activity at 50 mM maltose (6.5 μmol min−1 g−1 dry yeast) was similar to that at 5 mM maltose of stationary-phase cells transformed with MALx1 (6 μmol min−1 g−1 dry yeast). Thus, the marked differences in temperature dependence between cells transformed with MALx1 and cells transformed with MTT1 are not explained by differences in their absolute maltose transport activities.Compared with AGT1 genes with a premature stop codon starting at nucleotide 1183. Here, we show that the AGT1 from A15 does not encode a functional maltose transporter. AGT1 gene in a third lager strain, WS34/70. We extend these results to show that the premature stop codon at 1183 is present in the S. cerevisiae-type AGT1 genes of all nine tested lager strains, but is absent from all five tested ale strains. Because the premature stop codon is caused by an easily reversible point mutation, then if the Agt1 transporter were advantageous to lager strains in their normal habitat, one would expect to find lager strains in which this reversal has occurred. The observations that reversal has not occurred in any of the nine tested lager strains, whereas the mutation causing the premature stop codon was not present in any of the five ale strains, suggest that there has been selection pressure in favour of inactivation of AGT1 during the evolution of lager strains, but not during the evolution of ale strains. The main difference between the conditions under which ale and lager strains have evolved is the lower temperature of lager fermentations. MTT1 genes were present in all nine lager strains, but in none of the five ale strains. This suggests that the replacement of Agt1 transporters by Mtt1 transporters is an important difference between lager and ale strains, probably related to the lower temperature of lager fermentations.Because Agt1 is the only maltose transporter known to accept both trehalose and α-methyl glucoside as substrates . At 20 °C, all four strains had similar maltose transport activity, but at 0 °C, the ale strains showed about fivefold smaller activities. When single maltose transporters were studied, using genetically engineered strains, their temperature dependence decreased in the order Agt1≥Malx1>Mtt1. The temperature dependence of Mtt1 (in a laboratory strain) was similar to that of maltose transport by lager yeasts. An ale-type Agt1 transporter working in a lager yeast (Integrant 1) had the high temperature dependence of maltose transport observed for ale yeasts . This suS. bayanus-derived MALx1 and S. cerevisiae-derived AGT1, encoded truncated proteins. They also noted an increase in the copy number of MTT1, which was present on both the S. bayanus and the S. cerevisiae versions of chromosome VII. These results are consistent with the suggestion that in lager strains, Mtt1 transporters have become more important at the expense of Agt1 and Malx1 transporters. MAL31 gene to S. cerevisiae chromosome II (Chr. Sc-II) and an MPH2 gene to Chr. Sc-IV. These loci were earlier observed in most, but not all, studied lager strains by hybridization of specific probes to chromosome blots to Chr. VII from both lager and ale strains, whereas MTT1 gene on both the S. cerevisiae and the S. bayanus versions of Chr. VII from lager strain WS34/70. MTT1 is 91% identical to MALx1, and so probably in the lager strains, the MAL61-probe bound to MTT1 genes, which were not known at the time of these hybridization studies. S. cerevisiae-derived AGT1 gene, but did not locate the gene. Presumably, this is the AGT1 detected on Chr. VII in both hybridization studies. S. bayanus-derived AGT1 (Sb-AGT1) on Chr. Sb-XV-VIII and a truncated, S. bayanus-derived MAL31 on Chr. Sb-V. Neither of these genes was noted in the hybridization studies, which used probes based on S. cerevisiae sequences. Our present results show that Sb-AGT1 is present in all eight studied lager strains, but, as expected, in neither of the two ale strains studied. The sequence of the Sb-AGT1 in strains A15 and A24 was identical to that reported by AGT1 from S. cerevisiae).We do not yet know what differences between Agt1 and Mtt1 transporters account for their different temperature dependencies. Membrane proteins are sensitive to membrane lipid composition and dynamics. They can have specific lipid requirements for their optimal activity , correctMAL21 and MAL41 genes on Chr. III and Chr. XI, respectively. Such genes were not observed by MAL21 was lacking from 13 of the 25 studied lager strains and MAL41 was lacking from one lager strain (Both hybridization studies detected

Induction of FGFR2 and FGFR3 protein as well as fgfr2-luc activity was also observed with Erbitux, an EGFR-specific monoclonal antibody. Moreover, inhibitors of c-Src and MEK stimulated fgfr2-luc activity to a similar degree as gefitinib, suggesting that these pathways may mediate EGFR-dependent repression of FGFR2 and FGFR3. Importantly, our studies demonstrate that EGFR TKI-induced FGFR2 and FGFR3 are capable of mediating FGF2 and FGF7 stimulated ERK activation as well as FGF-stimulated transformed growth in the setting of EGFR TKIs. In conclusion, this study highlights EGFR TKI-induced FGFR2 and FGFR3 signaling as a novel and rapid mechanism of acquired resistance to EGFR TKIs and suggests that treatment of NSCLC patients with combinations of EGFR and FGFR specific TKIs may be a strategy to enhance efficacy of single EGFR inhibitors.Despite initial and sometimes dramatic responses of specific NSCLC tumors to EGFR TKIs, nearly all will develop resistance and relapse. Gene expression analysis of NSCLC cell lines treated with the EGFR TKI, gefitinib, revealed increased levels of FGFR2 and FGFR3 mRNA. Analysis of gefitinib action on a larger panel of NSCLC cell lines verified that FGFR2 and FGFR3 expression is increased at the mRNA and protein level in NSCLC cell lines in which the EGFR is dominant for growth signaling, but not in cell lines where EGFR signaling is absent. A luciferase reporter containing 2.5 kilobases of A general goal of molecular studies in cancer is to dissect the dominant oncogenic pathways and highlight specific components of these pathways as therapeutic targets. In this manner, the EGFR has emerged over the past years as an important target that likely plays key roles in non-small cell lung cancer (NSCLC) Among the NSCLC patients who initially respond to EGFR TKIs, all will eventually relapse reviewed . In factin vitro studies reveal frequent co-expression of specific FGFs as well as FGFR1 and FGFR2 Clinical and biological evidence suggest that EGFR signaling is only one important signaling pathway in lung cancer. If self-sufficiency in growth is a hallmark of cancer, then additional receptor tyrosine kinases capable of signaling for growth, which render EGFR autocrine signaling redundant, can account for the reduced effectiveness of EGFR TKIs in lung cancer. Multiple studies support the hypothesis that EGFR independent receptor tyrosine kinase signaling pathways are active in EGFR TKI insensitive NSCLC Total RNA from H322c NSCLC cells treated 4 days with DMSO (0.1%) as a control or with the EGFR TKI, gefitinib, was purified and used to probe Affymetrix human U133 plus 2.0 arrays. Gene expression changes detected by microarray analysis revealed induction of FGFR2 and FGFR3 but not FGFR1, FGFR4, or FGFR ligands in gefitinib treated cells . Other tfgfr2 and fgfr3 genes are not amplified but are being regulated at the transcriptional level. To test whether mRNA levels are regulated transcriptionally or post-transcriptionally, the 5′ flanking region of the fgfr2 gene (accession number: NT_030059) containing the basal fgfr2 promoter fgfr2-luc reporter was then transiently transfected into H322c and H1650 cells, followed by treatment with or without 1 µM gefitinib for 48 hrs. FGFR2 promoter activity significantly increased after gefitinib treatment, whereas the empty vector showed no change in activity following gefitinib treatment , PI3K (LY294002), c-Src (saracatinib) and p38 MAP kinase (SB239063), for 48 hrs. MEK inhibitor, PD98059, and c-Src inhibitor, saracatinib, showed a similar induction of FGFR2 transcription activity as gefitinib treatment grown at the air water interface to promote differentiation into a pseudostratified epithelium consisting of mucous secreting and ciliated cells [28]. ThA clear theme arising from clinical trials with single targeted therapeutic agents is the emergence of acquired resistance mechanisms, both delayed and rapid 3SeO3 and 1% bovine serum albumin) to limit mitogenic inputs from serum components. HGF-1 fibroblasts were obtained from ATCC .All NSCLC cell lines except Colo699, H661, and H226 were previously described by Coldren et al. Total RNA prepared from control and gefitinib-treated H322c cells was used to probe Affymetrix U133 Plus 2.0 arrays within the University of Colorado Cancer Center Gene Expression Core. All data are MIAME compliant and the raw data has been deposited in a MIAME compliant database, GEO. (Accession #: pending)5′-CCA TCG GCA TTG ACA AGG AC-3′ and reverse primer 5′-GCA TCG TCT TTC AGC ATC TTC AC-3′ for FGFR3 using a My iQ real time-PCR detection system . GAPDH mRNA levels were measured by quantitative RT-PCR in replicate samples as a housekeeping gene for normalization of the different mRNA expression and the data are presented as “Relative Expression”.Total RNA (5 µg) was reverse transcribed in a volume of 20 µl using random hexamers and MMLV reverse transcriptase . Aliquots (5 µl) of 25-fold diluted reverse transcription reactions were subjected to PCR in 25 µl reactions with SYBR® green Jumpstart Taq Readymix and the primers previously described for FGFR2 2O for 30 min. at room temperature and rinsed extensively in H2O To measure the effect of EGFR TKIs on clonogenic growth, cells were plated in 6-well plates at 100 cells/well and cultured in full growth medium with or without 0.1 µM AG1478 , 1 µM RO4383596 (Hoffmann-La Roche), 10 ng/mL FGF2 or FGF7 for 2 weeks. Colonies were rinsed with PBS, stained with 200 ml of 6% (vol/vol) glutaraldehyde, 0.5% (wt/vol) crystal violet in HFor measurement of anchorage-independent cell growth, 40,000 cells (H322c) or 20,000 cells (H1650) were suspended in 1.5 mL RPMI 1640 containing 10% fetal bovine serum and 0.35% DifcoTM agar noble and overlaid on base layers containing 1.5 mL RPMI 1640 containing 10% fetal bovine serum and 0.5% agar noble in 6-well plates. The wells were covered with 2 mL growth medium containing drugs and growth factors . This media was replaced with fresh media containing drugs and growth factors every 7 days. In experiments with human fibroblasts, HGF-1, co-culture cells were plated 1 day prior to being overlaid with agar as described above. The plates were incubated in a 37°C CO2 incubator for 21 days after which viable colonies were stained for 24 hrs with 200 mL of 1 mg/mL nitroblue tetrazolium. Following digital photography, the colony number was quantified using the MetaMorph imaging software program.3VO4, 2 mM MgCl2, 1 mM EGTA, 1 mM DTT, 0.3 M NaCl, 2 µg/ml leupeptin and 4 µg/ml aprotinin) and centrifuged . The particulate fractions were discarded and 10 µg (phospho-ERK) or 200 µg (phopho-FRS2) of the soluble extracts were mixed with SDS sample buffer and submitted to SDS-PAGE. Following electrophoretic transfer onto nitrocellulose, the filters were blocked in 3% bovine serum albumin in Tris-buffered saline with 0.1% Tween 20 (TTBS) and then incubated with anti-phospho-ERK or phospho-FRS2-α for 16 hours at 4°C. The filters were washed thoroughly in TTBS, then incubated with alkaline phosphatase coupled goat anti-rabbit antibodies and developed with LumiPhos reagent according to the manufacturer's instructions. The filters were subsequently stripped and reprobed for total ERK1 and ERK2 or NaK-ATPase using a mixture anti-ERK1 (sc-93) and ERK2 (sc-154) or NaK-ATPase α-subunit (sc-21712) antibodies . For immunoblot analysis of FGFR1, FGFR2, FGFR3, EGFR and the α-subunit of NaK-ATPase, NSCLC cells were collected in phosphate-buffered saline, centrifuged and suspended in MKLB after treatment with 1 µM gefitinib or 2 µg/mL Erbitux . Aliquots of the cell lysate preparations containing 75 µg of protein were submitted to SDS-PAGE and immunoblotted for FGFR1 (sc-121), FGFR2 (sc-122), FGFR3 (sc-13121) and NaK-ATPase α-subunit (sc-21712) with antibodies from Santa Cruz Biotechnology . EGFR was detected with a rabbit polyclonal antibody (#2232) from Cell Signaling Technology, Inc.For analysis of phospho-ERK, cells were seeded in 6-well dishes to allow cell attachment. After 24 hrs, cells were treated with DMSO or 0.1 µM AG1478 for 72 hrs after which media was switched to HITES plus DMSO or AG1478 for another 2 hrs. Subsequently, the cells were then treated with 1 µM RO4383596 or DMSO for 1 hr, after which cells were stimulated with 10 ng/mL of FGF2, FGF7 or PBS for 15 min. For phospho-FRS2 analysis, cells were seeded in 10 cm dishes and allowed to attach. After 24 hrs, cells were treated with DMSO, 1 µM gefitinib , or 1 µM gefitinib in combination with 0.3 µM AZ12908010 , for 72 hrs after which media was refreshed with drugs 1 hr prior to stimulation with 10 ng/mL FGF2 or PBS for 15 min. Growth factor and/or drug-treated NSCLC cells were collected in 1 mL phosphate-buffered saline, centrifuged at 1,000× g for 5 min, lysed in MAP kinase lysis buffer , 0.1 mM Na5′-GCCATTGACGAAAGGGTTC-3′ and reverse primer 5′-TGCCTCCACCAAACTTTGCTC-3′ that anneal at −2165 and +267 relative to the published transcription start site of human fgfr2m, followed by 20 cycles with an annealing temperature at 57°C. Purified PCR products were then cloned into pCR-Blunt using the Zero Blunt cloning kit from Invitrogen and submitted to DNA sequencing. The FGFR2 promoter region (−2165 to +267) was shuttled into pGL3-basic using KpnI and SmaI sites. The ligation junctions in the FGFR2 promoter luciferase vector were verified by DNA sequencing. Cell lines were transfected in 6-well plates with 0.5 µg of pGL3-basic or pGL3 fgfr2 (−2165 to +267) alone or in combination with LXSN-C.A. MEK1 Human genomic DNA (50 ng) was submitted to PCR using Phusion polymerase, forward primer Figure S1FGFR2 protein is regulated downstream EGFR signaling in cancer cell lines of epithelial origin. A. Cell lysates from the indicated HNSCC and breast cancer (MCF-7) cell lines that had been treated with or without 1μM gefitinib (72hrs) were immunoblotted for FGFR2 and the α-subunit of the NaK-ATPase as a loading control. B. H322c cells transfected with 3 independent EGFR siRNA or scramble control were cultured 72 hrs and immunoblotted for the EGFR, FGFR2 and NaK-ATPase. C. H226 cells were cultured with PBS or EGF (10 ng/ml) for 72 hrs. Cell lysates were immunoblotted for FGFR1, FGFR2, FGFR3, EGFR and the α-subunit of the NaK-ATPase.(1.42 MB TIF)Click here for additional data file.Figure S2Rapid induction of FGFR2 and FGFR3 mRNA. Quantitative RT-PCR assay for FGFR2 and FGFR3 mRNAs after treatment with 1μM gefitinib for varying amounts of time was performed on total RNA from H322c cells and normalized for GAPDH mRNA levels. Data are shown as fold expression over DMSO treated cells at the indicated times. The results are a representative of 3 independent experiments.(0.18 MB TIF)Click here for additional data file.Figure S3AZ12908010 is a specific inhibitor of FGFR receptors. Human gingival fibroblasts (HGF-1) purchased from ATCC were treated for 2 hrs with or without 100 nM AZ12908010 and then for another 15 minutes with or without FGF2 (10 ng/mL), EGF (10 ng/mL), PDGF-BB (20 ng/mL) or IGF-1 (10 ng/mL) as indicated. Cell extracts were prepared and submitted to SDS-PAGE and immunoblotted for phospho-ERK. The filters were subsequently stripped and reprobed for total ERK1 and ERK2 to verify equal loading. Only FGF2-stimulated phospho-ERK was inhibited by AZ12908010.(0.56 MB TIF)Click here for additional data file.Figure S4FGF2 rescues EGFR TKI dependent growth inhibition in HNSCC cells. UMSCC8 and HN31 head and neck squamous cell carcinoma lines were submitted to the clonogenic growth assay in the presence and absence of gefitinib and/or AZ12908010, an FGFR specific TKI (see Supplementary (1.26 MB TIF)Click here for additional data file.Figure S5FGFR2 and FGFR3 mRNA are induced during human bronchial epithelial cell differentiation at the air-water interface. GEO Data Set GSE5264 containing Affymetrix Human Genome U133 Plus 2.0 arrays of human bronchial epithelial cells grown over a 28 day period at the air-water interface (28) were queried for expression of EGFR, FGFR2 and FGFR3 using the Affymetrix IDs EGFR (201983_s_at), FGFR2 (203638_s_at), and FGFR3 (204379_s_at). Following normalization for GAPDH expression, the data were plotted to show the relative mRNA expression of these genes over time at the air-liquid interface. The data points reflect the mean and SEM of the three independent experiments performed.(0.42 MB TIF)Click here for additional data file.Table S1Gene expression changes in response to gefitinib treatment in H322c cells. Total RNA from H332c cells treated for 4 days with DMSO or 1 μM gefitinib was submitted to Affymetrix human U133 plus 2.0 arrays. Expression levels of selected tyrosine kinases and ligands are listed below. ("A" indicates absent and "P" present as assessed by the Affymetrix software program).(0.37 MB DOC)Click here for additional data file.

This technical note entitled “Computed tomography (CT)-guided vertebroplasty using a stereotactic guidance system [stereo-guide]” focuses on the utilization of this protractor with CT guidance in the radiology suite to perform percutaneous vertebroplasty with greater safety and accuracy. Their protractor consisted of a flat plastic block with “deeply grooved protractor markings at 5° intervals” (range from 0° to 30°). While in the CT scanner, the device was placed on the patient's back, and the needle was optimally directed through the center of the pedicle through the appropriate groove. It was successfully employed in nine patients undergoing 10 procedures involving either the thoracic or lumbar spine; there were no complications. Furthermore, the CT scanner additionally facilitated monitoring the injection of vertebroplasty material into the vertebral body; cement consolidation and the presence/absence of extravasation could be immediately assessed. The authors should be commended for devising this protractor that appears to be a useful adjunct when performing percutaneous vertebroplasty in the radiology suite utilizing CT guidance.Previously, when vertebroplasties were performed under fluoroscopic guidance either in the radiology suite by neuroradiologists/radiologists or in the operating room by spine surgeons, localizing the correct level, particularly in the thoracic spine, was often difficult. Another limitation was the inability to “accurately” document extravasation of material into the spinal canal, disc space, etc. (as compared with the use of the CT scan in the radiology suite). This, therefore, increased the risk of inadvertently injecting more material, causing further neural and/or other injuires.Although other studies have routinely employed CT-guidance in radiology suites to perform vertebroplasty/kyphoplasty (VK), one unique report focused on the safety and efficacy of utilizing the Isocentric C-arm fluoroscopic cone beam CT (Iso-C) in the operating room. In this One of the major concerns regarding the performance of vertebroplasty is the advanced age of the patients involved, and their increased number of attendant comorbidities making them poor candidates for “open” operations. Osteoporotic compression fractures of vertebral bodies occur in 5-20% of patients between the ages of 50 and 80, and are four times more frequent in females.[Vertebroplasty and kyphoplasty can also cause severe neurological injury in an estimated of 1-19% of cases utilizing polymethylmethacrylate (PMMA) or Cortoss .–5 In PatNevertheless, with malignant disease, the risks of neurological injury from VK are mitigated by the patients' limited long-term prognoses. In a series involving 74 vertebrae in 51 patients with terminal metastatic disease or multiple myeloma, 15 (29%) had incomplete/complete cord compression before vertebroplasty and sustained no further deficits; only one patient developed a new cauda equina syndrome within 48 h.[An added concern is the increased risk for adjacent-level fractures following VK. In one study, 2 of 25 patients treated with VK compared with none managed conservatively developed delayed adjacent-level fractures. In anothGiven the risks/complications associated with VK procedures utilizing any modality, we should reexamine patient selection based upon short- and long-term outcomes. In a randomized prospective study, 50 patients with acute/subacute osteoporotic compression fractures (<8 weeks old) were treated either with percutaneous vertebroplasty or conservative management. Within 1

Although, an understanding of siderophore biosynthesis is known, the mechanism of their secretion and uptake still remains elusive.Elucidation of the basic mechanistic and biochemical principles underlying siderophore mediated iron uptake in mycobacteria is crucial for targeting this principal survival strategy Mycobacterium tuberculosis (M.tb) proteins, namely, Rv1348 (IrtA), Rv1349 (IrtB) and Rv2895c in export and import of M.tb siderophores across the membrane and the consequent iron uptake. IrtA, interestingly, has a fused N-terminal substrate binding domain (SBD), representing an atypical subset of ABC transporters, unlike IrtB that harbors only the permease and ATPase domain. SBD selectively binds to non-ferrated siderophores whereas Rv2895c exhibits relatively higher affinity towards ferrated siderophores. An interaction between the permease domain of IrtB and Rv2895c is evident from GST pull-down assay. In vitro liposome reconstitution experiments further demonstrate that IrtA is indeed a siderophore exporter and the two-component IrtB-Rv2895c system is an importer of ferrated siderophores. Knockout of msmeg_6554, the irtA homologue in Mycobacterium smegmatis, resulted in an impaired M.tb siderophore export that is restored upon complementation with M.tb irtA.Here, we demonstrate an interplay among three iron regulated Our data suggest the interplay of three proteins, namely IrtA, IrtB and Rv2895c in synergizing the balance of siderophores and thus iron inside the mycobacterial cell. Mycobacterium tuberculosis (M.tb) within the hostile environment of the host macrophages depends upon a variety of mechanisms, including its ability to obtain essential nutrients from the host. Mycobacteria can acquire almost all the nutrients except iron that is sequestered within the host as an immune response against the invading pathogen in vivo and therefore is a key virulence determinant The survival of http://genolist.pasteur.fr/TubercuList/). While the two ABC transporters, IrtA and IrtB, coded by ORF Rv1348 and Rv1349 respectively, are regulated by IdeR, Rv2895c present at a different locus lacks an upstream IdeR binding site in vitro and in vivo methods, we have identified the role of IrtA as a carboxymycobactin (cMyco) exporter and IrtB-Rv2895c as a two component importer of ferri-carboxymycobactin (Fe-cMyco). In addition, by integrating in silico and biochemical approaches, we provide molecular evidence for the interaction of IrtB and ferri-carboxymycobactin loaded Rv2895c.The mechanisms underlying sequestering of host iron for metabolic processes constitute one of the basic survival strategies in mycobacteria and presently, are the subject of intense investigations. Recent studies have suggested the involvement of two IdeR (Iron dependent Regulator) regulated transporter proteins Rv1348 and Rv1349, also known as IrtA and IrtB respectively, in carboxymycobactin mediated iron acquisition and survival of mycobacteria in mouse infection model irtA and irtB showed the presence of characteristic nucleotide binding Walker A (WA), Walker B (WB) and ABC transporter Signature Motifs (SM) at the C-terminal end. Furthermore, IrtA has six transmembrane segments 644GPSGSGKST652, WB 767LILDEATAFAD777 and SM 746LSGGERQ752 whereas IrtB has WA 365GPSGCGKST373, WB 491LLVDEATSALD501 and SM 470LSGGERQ476 and motif scanning of proteins coded by GGERQ476 sequenceWhile there is no definitive method to determine the orientation of the SBD and the ATPase domains of rIrtA (recombinant purified IrtA), we attempted tryptic digestion of the liposome reconstituted rIrtA (LP-48). Limited trypsinization for one hr, we argued, will ensure extensive digestion of the exposed portions while protecting the intraliposomal fractions. Accordingly after limited trypsinization, the digestion reaction was fractionated on 10% SDS–PAGE followed by silver staining. Two major bands corresponding to ≈26 kDa and ≈29 kDa proteins could be seen , lane 2 The 26 kDa protein possibly represents the SBD domain of IrtA, as this is the only other domain besides the ATPase which is non-membrane spanning, thus rendering it susceptible to tryptic digestion, if it were to be present towards the extraliposomal surface. However, the digestion of the exposed loops could not yield a peptide with a size equivalent to 26 kDa, thereby, suggesting that the two domains (SBD and ATPase) are present on the same side of the membrane. The ATPase function of a protein requires the cytoplasmic milieu for its optimal activity. Hence the positioning of the SBD on the same side of the membrane, as that of ATPase domain of IrtA, points to its cytoplasmic location.M.tb, IrtA and IrtB, and their M.smeg counterparts msmeg_6554 and msmeg_6553 possess an upstream IdeR binding site. The regulation of M.tb genes by IdeR has been experimentally shown M.smeg genes could as well be expected to be IdeR dependent. The chromosomal positioning and sequence analysis of irtA and irtB as well as msmeg_6554 and msmeg_6553 (M.tb H37Rv RNA (M.smeg mc2155 RNA using primer pair E1+E3 (M.smeg DNA was used as a template (lane 4). Control lanes (lanes 3 and 6) ruled out possible artifacts. These results conclusively demonstrate that M.tb irtA and irtB, similar to the corresponding transporter from M.smeg, msmeg_6554 and msmeg_6553, are indeed transcribed as a part of a single operon.The genes encoding the two transporters of meg_6553 suggeste37Rv RNA generate37Rv RNA , lane 2 ir E1+E3 generatein silico analyses, the membrane localization and the putative siderophore transport functions of the gene products of ORFs Rv1348, Rv1349 and Rv2895c, immunoblotting and RT-PCR experiments were designed initially to validate the cellular localization and the iron dependent regulation of these proteins. The purified M.tb H37Rv cell fractions corresponding to the cell wall, cytoplasmic membrane and cytosol were probed with antibodies specific to IrtA, IrtB and Rv2895c. Results clearly showed that all the three proteins were present only in the cytoplasmic membrane fraction values of rSBD and rRv2895c for cMyco and its ferric complex, Fe-cMyco, were determined from these fluorimetric assays at physiological pH at 30°C . These control experiments involving salicylate and FeCl3 binding demonstrate the specificity of binding of SBD and Rv2895c to their respective substrates namely, cMyco and Fe-cMyco.In the absence of substrates, cMyco or Fe-cMyco, there was no change in the intrinsic fluorescence quenching of the two proteins over a period of time (M.tb lysate. As evident from M.tb H37Rv lysate proteins from iron stressed cultures were pulled down with resin bound rGST-IrtB (M.tb H37Rv lysate corresponding to 31 kDa band was indeed Rv2895c (data not shown). Furthermore, the interaction between these two proteins was not seen in the absence of Triton X-100 in the buffer, as evident from the disappearance of rRv2895c protein band when Triton X-100 was absent .To identify whether Rv2895c, harboring a putative siderophore interacting motif and showing a higher affinity towards ferrated siderophores, could serve as a substrate binding domain of IrtB, the interaction between the GST-tagged IrtB and Fe-cMyco bound rRv2895c was analyzed by pull down assay . While tGST-IrtB , lane 8.s absent , lane 6.M.tb lysate of iron stressed cultures. These control experiments indicate that the interaction between rGST-IrtB and Fe-cMyco bound Rv2895c is specific and not an artifact or non-specific interaction of Rv2895c either with rGST alone was constructed . The amplification of 3.3 kb from pMtb1348 plasmid corresponds to the size of the knockout (lane 4). The double cross over mutant, KO48-DCO in M.smeg mc2155 (msmeg_6553 (homologous to M.tb irtB) is expected to be involved in siderophore uptake, appropriate cloning strategy was used to prevent the polar effect of knockout on the downstream genes of the operon. Subsequent RT-PCR analysis of RNA isolated from mc2155▵6554 indicates that the disruption of the upstream msmeg_6554 has no effect on the expression of the downstream gene, msmeg_6553 and as expected, shows increased expression under iron depleted conditions solid agar based media under iron replete or depleted conditions, was assessed phenotypically in terms of halo formation. The orange halo formation is a reflection of siderophore release into the medium as a consequence of the siderophore action. The knockout strain, mc2155▵6554, showed slow growth, small colonies and a sick phenotype in iron rich media (msmeg_6554 gene.The 2155▵6554 with a plasmid harboring M.tb irtA (pMtb1348), the halo formation was significantly better than the knockout strain (mc2155▵6554) which, however, was restored to a level similar to the wild type upon transformation with pMtb1348.Upon complementation of mcormation , A3 as wormation , A6 was replete , B1 or i replete , B2 cond replete , B1 the msmeg_6554 gene knockout is also evident in the supernatant from mc2155▵6554 cultures which, after three days of growth, showed significantly less blue color quenching (0.63 versus 0.35 in mc2155), indicating low production of CAS reactive substance i.e. siderophores could restore normal growth of the strain in low iron conditions showed the release of intraliposomal carboxymycobactin. However, the ferrated carboxymycobactin bound rRv2895c could interact with liposome incorporated rIrtB (LP-49) to bring about its internalization. msmeg_6554 caused a defective siderophore release without any visible effect on the expression of downstream gene (msmeg_6553) in the knockout strain. The unaltered expression of msmeg_6553 in mc2155▵6554 strain, as shown by RT-PCR (M.tb irtA that shares a significant sequence similarity (∼60%) with msmeg_6554, thus, conclusively demonstrating the role of IrtA in siderophore export. On the basis of the ability of M.tb IrtA to export analogous M.smeg siderophores, we speculate its alternate role in efflux of the structurally related drugs, thereby conferring drug resistance to mycobacteria. The fact that irtA and irtB are present in a single operon, under the control of a common promoter is indicative of their plausible co-expression msmeg_6554, homology searches indicated that M.smeg genes namely msmeg_6553 and msmeg_6552 could be the counterparts of M.tb irtB and Rv2895c, respectively. However, all the three M.smeg genes are co-operonic in nature, unlike their M.tb counterparts. Further studies are therefore needed to address conclusively whether Msmeg_6553 and Msmeg_6552 proteins perform similar functions like those of M.tb.Disruption of y RT-PCR , indicatM.smeg, exiT, was postulated to be involved in siderophore export Pseudomonas aeruginosa, a 50 kDa outer membrane protein, OprM was shown to be iron regulated with the probable involvement in pyoverdin export, though it was primarily established as a multidrug efflux pump Bordetella pertussis, AlcS protein functions as an exporter necessary to maintain appropriate intracellular alcaligin levels M.tb growth within macrophages is evident from the poor survival of a siderophore biosynthetic mutant within the human macrophages Published reports on siderophore mediated iron uptake in mycobacteria essentially lack details about these energy dependent secretion and uptake processes. Although, one of the locus in irtB mutant M.tb strain in comparison to irtAB double mutant could be attributed to the ability of the strain to secrete carboxymycobactin (by virtue of the presence of irtA in the irtB mutant). The inability of the strain, however, to import ferrated carboxymycobactin due to irtB mutation is significantly overcome by the relay of iron from the extracellular carboxymycobactin to the cell membrane bound mycobactin. The pronounced growth defect of the double mutant (irtAB) could be attributable to the in vivo toxicity caused by the intracellular accumulation of the carboxymycobactin, eventually leading to cell lysis. In addition, the elevated concentration of mycobactin synthesis, reported by Rodriguez and Smith irtAB mutant strain, to synthesize more of mycobactin. This appears very likely as mycobactin and carboxymycobactin follow the same synthetic pathway and the higher cytosolic levels of carboxymycobactin, due to the inability of irtAB mutant to secrete it out, may induce mycobactin production to a higher rate. Similarly, mbt mutant survives low iron growth when supplemented with the culture supernatant from irtAB mutant, possibly because of the presence of siderophores released by the lysis of irtAB mutant cells. Experiments with just the irtA mutant, on similar lines like that of irtAB and irtB mutant Our findings, in contrast to a previously published report M.tb during its growth in iron depleted conditions, possibly involves a complex interplay of three different proteins namely, IrtA and the two-component IrtB-Rv2895c system. IrtA and IrtB-Rv2895c possibly function in two independent (export and import) but apparently co-regulated pathways. The substrate binding domains of the two systems appear to possess different selectivity/affinity for their cognate substrates i.e. ferrated and non-ferrated siderophores.The extensive biophysical and biochemical characterization involving gel filtration and circular dichroism studies of iron-siderophore exporter and importer proteins suggest that IrtA and IrtB indeed homodimerize to carry out an effective transport , in contrast to the previous report speculating their active heterodimerization in vivo. The siderophores, produced as a consequence of the low intracellular iron, are transported outside the cytoplasm in an energy dependent process by means of the IrtA exporter protein. These iron quenching siderophores, by virtue of their high affinity, extract iron from host molecules like transferrin and ferritin. Subsequently, they are internalized and assimilated into the mycobacterial cytoplasm and this process of internalization involves the interplay of IrtB-Rv2895c importer system. In this model, Rv2895c captures ferrated siderophores which are then internalized into the cytoplasm by the permease and ATPase activity of IrtB. Another IdeR regulated gene fecB, coded by Rv3044 and annotated as a periplasmic component of ferric citrate pathway in the Tuberculist database, also exhibited binding to ferrated siderophores. We, therefore, speculate that it could as well function in the siderophore mediated iron uptake pathway. However, direct studies including M.tb knockout are needed to prove its function either in siderophore mediated or citrate dependent pathway. Our findings contribute to the understanding of mycobacterial adaptability and survival mechanisms in highly intricate and fiercely competitive host environments and the role of iron regulatory networks therein. Abrogation of such iron sequestering pathways could then form the basis of an effective intervention against this human pathogen.We speculate that this exporter-importer system could beE. coli DH5α, used for all cloning purposes, was propagated in Luria Bertini (LB) medium. E. coli BL21(DE3) cod+ strain was used for the heterologous expression of proteins, SBD (rSBD) and Rv2895c (rRv2895c), while E. coli C43(DE3) cod+ was the expression host for IrtA (rIrtA) and IrtB (rIrtB). rSBD, rIrtA, and rIrtB were expressed in terrific broth (TB) medium, whereas rRv2895c in LB with 5% glycerol. M.smeg and M.tb H37Rv were grown in 7H9-OADC media with 0.1% Tween 80.Bacterial strains and vectors used and constructed in this study are listed in irtA, at NdeI/HindIII site of pET23a, irtB and SBD at NdeI/HindIII and of Rv2895c at NdeI/BamHI sites of pET28a. For GST pull down, irtB was cloned in pGEX4T1 at BamHI/EcoRI sites. pMtb1348 was generated by cloning irtA at NdeI/MluI site of MCS2 of pSD5.hsp vector.The constructs for protein expression were generated by cloning the PCR products of http://www.enzim.hu/hmmtop/) along with TmPred and TMHMM programs for predicting transmembrane domains and topology of the proteins http://www.tigr.org/) for irtA, irtB and Rv2895c homologous gene searches in M.smeg and ImageJ at the NIH website (http://rsb.info.nih.gov/ij/download.html) to quantify the RT-PCR bands, were used.The server HHMTOP was used as template for all PCR amplifications. PCR for all the genes were carried out using Accutaq (Sigma) at annealing temperatures mentioned in EcoRV site of pBluescript II SK (+) vector and subcloned into pET23a, pET28a or pGEX4T1 for protein expression, or pSD5.hsp for complementation or PCK0686 for knockout studies in M.smeg. The different clones thus generated are listed in The primer sequences used for generating the constructs carrying E. coli DH5∝. For protein expression, E. coli BL21(DE3) cod+ (Stratagene) was used to overcome the M.tb codon bias. The transformed cells were cultured aerobically in TB or LB-glycerol at 37°C. The cultures were induced with 1 mM IPTG for 3 to 4 hrs. Cells were harvested and processed for His-tag affinity purification using TALON resin (Clontech) as described E. coli expression strain C43(DE3) which was pre-transformed with cod+ plasmid prior to transformation with the constructs to create C43(DE3) cod+ strain. The culture conditions were as described The chimeric constructs were propagated in M.tb H37Rv grown under normal iron as well as iron depleted conditions (by addition of 100 µM 2′2′-dipyridyl) using TRIZOL reagent (Clontech). Reverse transcription PCR (RT-PCR) reactions were carried out with RT-PCR kit using 2 µg DNA-free RNA, 20 pmol of primers and 1U AMV reverse transcriptase (Promega) as described 16S rRNA housekeeping gene was used as RT-PCR control besides serving as a non iron regulated gene control. Primer pairs used for PCR of the reverse transcribed cDNA were A1+A2 for irtA, C1+C2 for irtB, D1+D2 for Rv2895c and R1+R2 for 16S rRNA membrane pellet fraction of M.tb H37Rv cultures grown in low iron media were probed using mouse anti-rIrtA, anti-rIrtB and anti-rRv2895c antiserum at 1∶500 dilutions, anti-MEM antiserum and anti-acyl CoA synthatase antiserum at a dilution of 1∶1000. A peroxidase conjugated secondary rabbit anti-mouse antibody (1∶2000) was employed for chemiluminescence detection . Recombinant purified proteins were taken as immunoblotting controls.Immunoblotting was performed as described M.tb H37Rv grown under low iron conditions, as described earlier 3+ was removed from carboxymycobactin by exhaustive dialysis against 10 mM NaHPO4 (pH 7.0) buffer containing 50 µM 2′2′-dipyridyl, at 25°C. The buffer was changed at regular intervals of 8 hrs for 48 hrs. The ferrated as well as deferrated siderophores were chromatographically purified using Sephadex LH20 (Sigma) in 10 mM NaHPO4 (pH 7.0) and the concentration was determined spectrophotometrically. The fluorescence emission spectra for cMyco and Fe-cMyco were scanned following the excitation at 250 nm, to ascertain maximum emission wavelength, which gave a value of 430 nm for cMyco and 450 nm for Fe-cMyco.Iron complexes of the siderophore carboxymycobactin (cMyco) were isolated from the culture supernatants of The binding affinities of cMyco and Fe-cMyco to rSBD and rRv2895c were monitored by fluorimetric titration method. Tryptophan fluorescence quenching of the proteins (rSBD and rRv2895c) was recorded at a slit width of 3 mm with a characteristic excitation at 280 nm and emission at 340 nm after addition of upto ten fold molar excess of siderophores. Measurements were made at a protein concentration of 100 µM in 30 mM Tris (pH 7.5) and 150 mM NaCl buffer. For each data point, Fe-cMyco or cMyco was added and after five minutes of equilibration at 25°C, the change in fluorescence was recorded using Perkin Elmer Fluorimeter LS55. None of the ligands exhibited any significant absorbance at 280 nm within the concentration ranges used, and hence, the inner filter effect was negligible. The temperature during the experiment was maintained at 30°C by continuous stirring. All the experiments were performed in triplicates.0). The values of the equilibrium dissociation constant (Kd) were fitted to experimental values of fluorescence and ligand concentration by a nonlinear least square regression method, as implemented in the program DYNAFIT The data obtained from the above assay were processed and fitted assuming the single site equilibrium, L+ R⇔LR, where L, R, and LR are ligand, protein (rSBD/rRv2895c), and the ligand-protein complex, respectively. Fluorescence quenching was normalized and expressed as the percentage difference in fluorescence upon ligand binding at specific substrate concentration compared to the fluorescence at saturating levels of substrate containing IrtA or IrtB protein at a protein-to-lipid ratio of 1∶100 (w/w). cMyco at a concentration of 50 µM was also added in the assay buffer for LP-48. Vesiculation was initiated by the addition of SM-2 Biobeads (80 mg/ml), pre-equilibrated in the reconstitution buffer (assay buffer without Triton X-100 and ATP), in the lipid dispersion. The vesiculation was carried out by overnight rotatory mixing of samples at 4°C followed by removal of biobeads by centrifugation and addition of fresh SM-2 biobeads in the dispersion which was subsequently changed twice after every 4 hrs. The liposomes were separated from unencapsulated ATP or cMyco by passing them through Sepharose CL6B column. The presence of liposomes in the fractions was determined by checking the turbidity and the fractions containing liposomes were pooled and concentrated by centrifugation at 15,000 rpm for 30 min at 4°C. The pooled liposomes were washed twice with reconstitution buffer. The concentration of entrapped ATP was measured by monitoring liposome associated radioactivity and cMyco was determined by monitoring fluorescence intensity measured at 430 nm. About 80% of ATP and 20% of cMyco was determined to be liposome encapsulated. The presence of rIrtA or rIrtB in the LP-48 and LP-49 liposomal membranes was monitored by fractionating them on SDS-PAGE and subsequent visualization of the proteins by coomassie staining. The mean diameter of the liposomes measured from the volume distribution curves by Photocore Particle Analyzer was found to be 120 nm. These proteoliposomes were subsequently used for transport assays at 30°C.The unilamellar liposomes containing reconstituted rIrtA (LP-48) or rIrtB (LP-49) proteins and entrapped ATP and cMyco or only ATP, respectively were prepared by SM-2 biobeads mediated Triton X-100 removal method To demonstrate cMyco export characteristics of rIrtA or rIrtB incorporated liposomes, LP-48, that contains 10 µM cMyco and 8 mM ATP intraliposomally were incubated at 30°C for 2 hrs in the assay buffer (excluding ATP). The efflux of cMyco into extraliposomal medium, mediated by SBD domain of IrtA as a function of intraliposomal ATP hydrolysis, was monitored by aliquoting 250 µl of the reaction every 15 min for up to two hrs. The aliquots were centrifuged at 15,000 rpm for 30 min at 4°C and the supernatant was analyzed for the presence of cMyco by monitoring the fluorescence emission at 430 nm. Liposomal pellet was lysed in assay buffer (without ATP) containing 1% Triton X-100 and monitored for ATP hydrolysis.In order to assay the Fe-cMyco import property of IrtB-rRv2895c combination, Fe-cMyco bound rRv2895c was incubated with the rIrtB reconstituted liposomes, LP-49 loaded with 8 mM ATP (LP-49) at a molar ratio of 10∶1. 250 µl aliquots were processed, as mentioned above, and the lysed pellet was analyzed for the presence of internalized Fe-cMyco by monitoring the increase in fluorescence emission at 450 nm. The activity of the ATPase domain was assayed by measuring inorganic phosphate release. In order to preclude the possibility of free (ATP independent) diffusion of cMyco and Fe-cMyco outside or inside the liposomes respectively, protein embedded ATP deficient liposomes were generated. Incubation of LP-48-A in the assay buffer only and LP-49-A in the assay buffer containing Fe-cMyco was carried out for 2 hrs. Intraliposomal Fe-cMyco and extraliposomal cMyco for LP-49-A and LP-49-A respectively, were analyzed by fluorescence measurements. LP-48 without cMyco or with Fe-cMyco and LP-49 were also incubated for 2 hrs at 30°C to assess the basal ATP hydrolysis. LP-49 liposomes were incubated with rRv2895c or cMyco bound rRv2895c similar to the procedure described over for Fe-cMyco bound rRv2895c, to assess transport.50 µl of the transport reaction was aliquoted for monitoring the ATPase activity. Following Triton X-100 treatment of the liposomes, the supernatant was used for inorganic phosphate (Pi) estimation as a measure of ATPase activity The import or export of siderophores was determined by fluorimetric analysis by taking 50 µl of supernatant from LP-48 and 50 µl of intraliposomal medium of the LP-49 liposomes. The intraliposomal medium was extracted by treating LP-49 liposomes with 1% Triton X-100 followed by centrifugation at 50,000 rpm in a total volume of 100 µl of reconstitution buffer. The emission was monitored at 430 nm for cMyco and 450 nm for Fe-cMyco after excitation at 250 nm. The intensity of fluorescence represented the concentration of siderophores.Tryptic digestion of LP-48 was carried out to determine the orientation of the SBD and ATPase domains of rIrtA. Aliquots of LP-48 were incubated at 30°C for 1 h with 1U of trypsin. The reaction, stopped by the addition of Laemmli sample buffer, was fractionated on 10% SDS-PAGE and subsequently silver stained as described M.tb lysate and rotated end-over-end at room temperature for 30 min or at 4°C for 4 hrs in 1× PBS buffer or 1× PBS buffer containing 0.1% Triton X-100. The beads were collected after centrifugation for 5 min at 500×g at 4°C and washed three times with 1× PBS. Pull down eluates were heat denatured in Laemmli sample buffer and fractionated on 12% SDS-polyacrylamide gels, fixed and visualized by silver staining using standard protocol. Incubation of unbound Glutathione Sepharose beads besides rGST alone was carried out to verify any non-specific interaction of rRv2895c with the resin.A GST pull-down assay utilizing rGST-IrtB fusion protein or rGST, as a negative control, was performed to test an interaction between IrtB and Rv2895c. 100 µl of the prepared Glutathione Sepharose 4B beads bound to rGST-IrtB or rGST alone were mixed with 40 µg of recombinant purified rRv2895c or 100 µg msmeg_6554, M.smeg homologue to M.tb irtA, was knocked out using pCK48hyg, constructed in the suicide vector pCK0686 which contains hygromycin-resistance cassette flanked by unique multiple cloning sites (MCS). A left flank PCR product (primer pair N1+N2) containing 980 bp proximal to the msmeg_6554 gene and a right flank PCR product (primer pair E1+E2) containing 768 bp distal to the msmeg_6554 gene were cloned in two independent MCS of pCK0686. The specific flanks were cloned so that the central region encoding msmeg_6554 gene would be deleted and replaced by hygromycin cassette liquid and CAS agar assays were carried out as described 630 due to a decrease in the amount of iron-complexed CAS. The absorbance (A630) of supernatants from the three test strains was compared with the medium-only control (which gave an O.D. of 0.75). Briefly, 1 ml aliquots of filtered culture supernatants at day 1 or at day 3 were mixed with equal volume of CAS reagent and the decrease in blue color quenching, as a function of siderophore release, was measured at 630 nm 2155, mc2▵6554 and mc2▵6554 complemented with pMtb1348 are listed in To investigate the consequences of

Since this up-regulation has not been detected in T cells in GCs and in Concanavalin A-stimulated T cells in vitro, selective function of GANP molecule on B cell proliferation and differentiation might exist.Adaptive immunity is dependent on proliferation of antigen-driven B cells for clonal expansion in germinal centers (GCs) against T cell-dependent antigens (TD-Ag), accompanied with somatic hypermutation of variable-region gene and class switching of B cell antigen receptors. To study molecular mechanisms for B cell differentiation in GCs, we have identified and studied a 210 kDa GANP protein expressed in GC-B cells. GANP has domains for MCM3-binding and RNA-primase activities and is selectively up-regulated in centrocytes surrounded with follicular dendritic cells (FDCs) upon immunization with TD-Ag

Fascicular ventricular tachycardia (VT) is an idiopathic VT with right bundle branch block morphology and left-axis deviation occuring predominantly in young males. Fascicular tachycardia has been classified into three subtypes namely, left posterior fascicular VT, left anterior fascicular VT and upper septal fascicular VT. The mechanism of this tachycardia is believed to be localized reentry close to the fascicle of the left bundle branch. The reentrant circuit is composed of a verapamil sensitive zone, activated antegradely during tachycardia and the fast conduction Purkinje fibers activated retrogradely during tachycardia recorded as the pre Purkinje and the Purkinje potentials respectively. Catheter ablation is the preferred choice of therapy in patients with fascicular VT. Ablation is carried out during tachycardia, using conventional mapping techniques in majority of the patients, while three dimensional mapping and sinus rhythm ablation is reserved for patients with nonmappable tachycardia. The first report of fascicular ventricular tachycardia was in 1979 by Zipes et al in 1981 Zipes et al postulatFascicular tachycardia has been classified into three subtypes (1) leftFascicular tachycardia can be induced by programmed atrial or ventricular stimulation. Administration of isoprenaline by infusion may be needed to facilitate induction in some cases; however this tachyarrhythmia may be non inducible in a significant number of patients ,11. It iThe tachycardia circuit can be constructed from the observations during VT. During tachycardia two distinct potentials can be observed before the ventricular electrogram, namely the purkinje potential (PP) and pre Purkinje potential (Pre-PP), also designated P2 and P1 respectively 13,14].,14.13,14During VT, the antegrade limb of the circuit proceeds through the specialized, verapamil sensitive zone from the basal to the apical site of the left ventricular septum, giving rise to the Pre PP. Therefore the earliest Pre-PP is seen in the basal septum and the latest pre-PP is seen in the apical septum. The lower turn around site of the reentrant circuit occurs in the lower third of the septum with the capture of the fast conduction Purkinje fibers which are rapidly activated in either direction during tachycardia. Antegrade activation occurs down the septum to break through in the posterior septal myocardium below, and retrograde activation occurs over the posterior fascicle from apical to basal septum forming the retrograde limb of the tachycardia. The reentrant circuit of fascicular tachycardia is completed by a zone of slow conduction between Pre PP and PP areas in the basal interventricular septum. The slow conduction zone which is the upper turn around point of the circuit is located close to the main trunk of the left bundle branch . The opFascicular VT is frequently misdiagnosed as supraventricular tachycardia with aberrancy on account of the narrow-QRS duration during tachycardia (120 ms), responsiveness to intravenous verapamil, and the occurrence in young patients with structurally normal hearts . HoweverInterfascicular VT, which is a type of bundle branch reentrant VT, has a typical RBBB morphology and left or right axis deviation during VT mimicking fascicular VT. However, interfascicular VT is most commonly seen in patients with an anterior infarction and either left anterior or posterior hemi fascicular block. During EP study, the ventricular depolarization is preceded by His bundle depolarization in interfascicular VT which is not seen in fascicular VT .Idiopathic mitral annulus VT has RBBB morphology with right axis deviation of the frontal QRS vector and hence mimics anterior fascicular VT. Tada et al describeThe first report of ablation of fascicular VT was in 1987 by Fontaine et al by the aUsually ablation of this tachycardia is performed during VT because the electrophysiologic targets are clear and the end point of ablation is termination of tachycardia. Various investigators have used different targets for ablation during tachycardia.Nakagawa et al preferreAiba et al and NogaIn patients with non-inducible tachycardia and in those with ill sustained tachycardia during the study, mapping and ablation during tachycardia is not possible. Moreover, the critical substrate of the tachycardia is amenable to mechanical injury due to catheter manipulation, thus making the tachycardia non-inducible during the study. Various methods of mapping and ablation of fascicular VT in such patients have been described.In general, pace mapping is more useful in mapping focal tachycardias whereas outcomes in reentrant tachycardia ablation are less favourable ,24. In tAnatomic data gathered together with endocardial electrogram data by various electroanatomic mapping systems have facilitated ablation of this arrhythmia in sinus rhythm. Chen et al reportedCatheter ablation is the preferred choice of therapy in patients with fascicular VT. The success rate for ablation is more than 80% and complications are infrequent. Most of the patients with fascicular VT can ablated during tachycardia, using conventional mapping techniques. Three dimensional electro anatomical mapping and sinus rhythm ablation is to be reserved for patients with non - inducible or illsustained tachycardia and in patients with recurrences.

Angioedema is an abrupt swelling of the skin, mucous membrane, or both including respiratory and gastrointestinal tracts. This study aimed to report an experience of angioedema in a university hospital with respect to etiologies, clinical features, treatment, and outcome. One hundred and five patients were enrolled. About half had angioedema without urticaria. The common sites of involvement were periorbital area and lips. Forty five patients (49%) had systemic symptoms. The most common cause of angioedema was allergic angioedema. Nonsteroidal anti-inflammatory drug-induced angioedema and idiopathic angioedema were detected in 20% and 18%, respectively. Among patients with allergic angioedema, 41.7% were caused by food, 39.6% by drugs. Thirty seven patients (39%) had recurrent attacks of angioedema. Mean standard deviation (SD) number of attacks in patients with recurrent angioedema was 3.9 (2.7) (ranging from 2 to 10 times). Patients who had older age and multiple sites of skin involvement had tendency to have systemic symptoms. Angioedema is an abrupt swelling of the skin, mucous membrane, or both includingrespiratory and gastrointestinal tracts . The sweGreaves et al. classifiedangioedema according to the causes, that is, allergic, nonsteroidal antiinflammatory drug (NSAID)-induced,idiopathic angioedema, angioedema associated with idiopathic or autoimmuneurticaria, associated with urticarial vasculitis, infection, and infestations,angioedema with eosinophilia, associated with some physical urticarias and withcholinergic urticaria, associated with allergic contact urticaria, defect inthe plasma inhibitor of the first component of complement (C1-INH deficiency)-hereditary(HAE), acquired angioedema, HAE with normal C1-INH in women,and angiotensin-converting enzyme inhibitor (ACEI)-induced angioedema .Therewere some reports of immunogenetic differences between Oriental andCaucasian populations, resulting in differences in the clinical presentationand frequency of autoantibodies detected in some autoimmune diseases , 6. MoreThisstudy has been approved by the Siriraj Hospital institutional review board.Records of patients with angioedema who attended the outpatient department of Siriraj Hospitalbetween January 2005 andDecember 2006 were retrospectively reviewed. Patientsaged at least 15 years were assigned a diagnosis ofangioedema by an attending physician by having an abrupt and short-livednonpitting swelling of skin in areas such as the face, lips, oral cavity; mucousmembranes or both, withoutevidence of infectious, traumatic, or other clear causes of the swelling.Demographicdata, etiologies, clinical features, course of the disease, treatment, andoutcome were studied. With the exception of ACEI, a drug reaction was regardedas a likely cause if taken within 24 hours before onset of angioedema. Allsuspected drugs used were discontinued or replaced with chemically unrelateddrugs. Food intolerance was regarded as a likely cause if angioedema occurredwithin 2 hours after ingestion of suspected foods. Skin prick testing, drugprovocation tests, and oral food challenge tests were performed if necessaryand if the disease severity was not severe. Foods and drugs that weresubsequently tolerated after challenging in remission period were excluded fromthe causes of angioedema. Laboratory investigation included complete bloodcounts, urinalysis, erythrocyte sedimentary rate (ESR), stool examination, andother investigations that were necessary for the individuals, that is, BUN,creatinine, AST, ALT, ALP, bilirubins, total protein, albumin, HbsAg, anti-HCV, free T3, free T4, thyroidstimulating hormone (TSH), antithyroid autoantibodies, that is, antithyroglobulin,and antimicrosomal antibodies , antinuclear antibodies (ANA), cryoglobulins, serum complement level , chest, and sinus X-ray studies. Other data obtained were personalhistory of allergic rhinitis, asthma, atopic dermatitis, and allergicconjunctivitis.All statistical analyses were two sided at 95% confidence level using SPSS version10 for Windows. The One hundred and five patients were enrolled in the study and 82 cases (78.1%) were female. Mean(SD) age of the patients was 39.4 (18.4) years with an age ranged of 15 to 88years. Fifty five patients (52.4%) had angioedema without urticaria .Forty fPatientswith systemic symptoms had statistically significant higher mean age . Sevenof 21 patients (33.3%) with NSAID-induced angioedema had atopic histories. None in idiopathic angioedema group hadhistory of atopy. Six of 20 patients (30%) who had reactions to foods had atopichistories .Acquired C1-INH deficiency was presumedto be the cause of angioedema in 4 patients (3.8%) who were diagnosed and fulfillcriteria of systemic lupus erythematosus (SLE). All patients had decreasedlevel of C4 and C1q and had no other explanations for the causes of theirangioedema. However, it was not confirmed by special serologic testing for C1-INHlevels. Among patients who had angioedema associated with contact urticaria,the responsible agents were hair dye, face cleansing foam, herb, and corrosiveagent used in tin cleansing. Two patients had upper respiratory tract infectionsimultaneously with angioedema.With exception of patients with C1-INHdeficiency, 90 patients (90%) were treated with antihistamine. Othermedications included corticosteroids (71%), adrenaline (24%), H2 blocker (20%),and proton pump inhibitor (3%). Fifteen percent of the patients receivedintravenous fluid replacement and thirteen percent received oxygen therapy. However,no patients needed emergency intubation. Drugs suspected to be the cause ofangioedema had been discontinued in all cases. Patients with acquired C1-INHdeficiency received prednisolone treatment for the underlying LE disease aswell as prophylactic androgenic compounds. One patient with HAE receiveddanazol as a prophylactic medication with a good response. He had a previoushistory of emergency tracheostomy in the rural hospital.Two thirds of the patients had theirfirst visit at the emergency department. However, only three percent of thepatients were admitted as inpatient. No patients in the present study died as aresult of angioedema. Thirty seven patients (39%) had recurrent attacks ofangioedema. Mean (SD) number of attacks in patients with recurrent angioedemawas 3.9 (2.7) (ranging from 2–10 times).Most patients with angioedema in this study were female. This is similar to thestudy of Cohen et al. which 63% of their patients were female . HoweverIn 2002, Vichyanond et al. reported the prevalence of allergic rhinitis; andasthma in Thai university students was 26.3% and 8.8%, respectively,. In the Acuteallergic angioedema is usually accompanied by urticaria . AllergiInour study, 21 of 48 patients (43.8%) with allergic angioedema had urticarialwheals accompanied with angioedema. Abouthalf of patients who had personal histories of atopy had allergic angioedema.The common causes of allergic angioedema in this study were foods (mostlyseafood), and drugs (other than NSAIDs). It should be noted that penicillin isless commonly used in our country nowadays.IgE-and mast cell-mediated reactions leading to urticaria and angioedema can becaused by physical stimuli such as cold urticaria. In this study, besidescontact urticaria and angioedema, no patients had symptoms caused by other physicalstimuli.Becauseof the increasing of ACEI use in this era, many studies reported an increase inACEI-induced angioedema which had been reported to occur in 0.1–0.5% ofpatients taking these drugs . MegeriaInour study, NSAIDs were the second common cause of angioedema. The most commonNSAID causing angioedema in this study was ibuprofen. The prevalence ofurticaria and angioedema to NSAIDs in the general populationhas beenreported to be 0.1–0.3% , 15.HowIthas also been recognized that NSAIDs can aggravate skin lesions in up to one thirdof patients with active chronic urticaria, but they do not appear to induce anyeruptions during the symptomless periods of the disease . ChallenInour study, patients with NSAID-induced angioedema had statistically significantincreased prevalence of asthma but had no increased prevalence of allergic rhinitisand atopic dermatitis. All patients with NSAID-induced angioedema had facialinvolvement and the most common was periorbital area. The group withNSAID-induced angioedema showed statistically significant periorbitalinvolvement (Patientswith serum sickness or necrotizing vasculitis, angioedema, and urticaria aremediated by immune complex-mediated reaction . Inour Themainstay of emergency medical treatment of HAE is intravenous fresh frozenplasma or C1 inhibitor concentrate or lyophilized vapor-heated C1 inhibitorconcentrate , 20. ForSeveresymptoms of other forms of angioedema may be treated with epinephrine injectionand less severe symptoms are often controlled by antihistamine. The use ofcorticosteroids may reduce the possibility of relapse .Insummary, our study provided an overview of angioedema based on etiologicalaspects and clinical features. Patients who had older age and multiple sites ofskin involvement had tendency to have systemic symptoms. In contrast to reportsfrom Western countries, ACEI-induced angioedema was uncommonly detected in thepresent study. Ibuprofen was the most common NSAID that caused angioedema inthis study whereas aspirin was reported to be the most common culprit NSAID inWestern countries.