{"text": "Pieridae is a large group of butterflies which plays an important role in evolutionary biology and contains many potential pests , was discovered for the first time, which comprises the first record of the genus Belenois in China and the highest altitude record of this species.The family al pests . PieridaB.aurota  is the first record of the genus Belenois from China. The specimen was collected at an altitude of about 3,000 m in Tibet Autonomous Region. Relevant details are presented for the species.The species  Pieridae, which is a cosmopolitan family, includes over 1,000 species in 83 genera  that is distributed in the Oriental and Australian Realms. China is a country with mega-biodiversity, with new taxa and new records of butterflies discovered nearly every year in recent times  has been collected from Tibet Autonomous Region. The migration of the African colonies of this species almost every year has received lots of attention. The biology of B.aurota is also well studied. B.aurota larvae feed on plants of the family Capparidaceae, in particular the genus Capparis. Under some circumstances, the population erupts at local scale and defoliates the entire bush of Capparis; for example, in the Rwenzori National Park in Uganda, it has been a regular pest on C.decidua (Chandra 1985). The specimens collected in this contribution are the first record of the genus Belenois from China.In this contribution, a well-known migratory species Photographs of the adult were taken with an interchangeable lens digital camera Olympus E-M1 with the lens M. ZUIKO DIGITAL ED 60 mm F2.8 Macro. After removal, the abdomen was soaked in 10% potassium hydroxide solution at room temperature for about 24 hours and was dissected under a Nikon SMZ18 microscope. The genitalia preparation was photographed by a Nikon D7500 digital camera attached to the microscope. Final plates were prepared in Adobe Photoshop CC . The specimen examined is deposited in the insect collection, Department of Forest Protection, Beijing Forestry University (BFU), Beijing.1D570FA8-EC16-50B9-8F38-C650FC7A78EFType status:Other material. Occurrence: recordedBy: Sixun Ge; individualCount: 1; sex: male; lifeStage: adult; disposition: in collection; Taxon: scientificName: Belenoisaurota ; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Lepidoptera; family: Pieridae; genus: Belenois; subgenus: Anaphaeis; specificEpithet: aurota; taxonRank: species; verbatimTaxonRank: sp.; scientificNameAuthorship: ; vernacularName: Pioneer White; taxonomicStatus: accepted; Location: country: China; stateProvince: Tibet Autonomous Region; county: Zanda County; locality: East of Diya township; verbatimElevation: 2983 m; verbatimCoordinates: 31\u00b078'83\"N, 78\u00b087'88\"E; Identification: identifiedBy: Sixun Ge; dateIdentified: 2019; Event: samplingProtocol: sweep net; year: 2019; month: 7; day: 17; habitat: Desolate valley beside the road; Record Level: basisOfRecord: PreservedSpecimenMale Belenoisaurota is found both in Asia and Africa, this species is migratory, the migration of the species in South Africa has received considerable attention in previous studies . We are more inclined to recognise this specimen as a stray butterfly based on its location \u2014 far from the known distribution area and a single record for several decades.Interestingly, although there has been no official publication of this species in China, we found a specimen labelled \u201cChina, Sichuan, Mt. Kintushan, [probably Jinfo Shan in Chongqing] (ohne Datum) [no date], ex coll. A. SCHULTE. M\u00e4nnchen [male].\u201d on a European butterfly website (B.aurota were mainly distributed in areas below 1,800 m, the highest altitude recorded for the distribution of this species being 2,400 m in Nilgiris, India (B.aurota was collected at an altitude of about 3,000 m which is the highest altitude record of this species. Colonies of an undetermined Capparis species were also found around Diya Township (Fig. Capparishimalayensis, which could be a suitable host plant for B.aurota larvae. Due to the existence of the host plant, we believe that our B.aurota specimen, collected in the Diya Township, was highly likely from a local population rather than a stray butterfly.In previous studies, the Himalayan populations of s, India . However"}
{"text": "To determine whether location-linked anaesthesiology calculator mobile application (app) data can serve as a qualitative proxy for global surgical case volumes and therefore monitor the impact of the coronavirus disease 2019 (COVID-19) pandemic.We collected data provided by users of the mobile app \u201cAnesthesiologist\u201d during 1 October 2018\u201330 June 2020. We analysed these using RStudio and generated 7-day moving-average app use plots. We calculated country-level reductions in app use as a percentage of baseline. We obtained data on COVID-19 case counts from the European Centre for Disease Prevention and Control. We plotted changing app use and COVID-19 case counts for several countries and regions.A total of 100\u2009099 app users within 214 countries and territories provided data. We observed that app use was reduced during holidays, weekends and at night, correlating with expected fluctuations in surgical volume. We observed that the onset of the pandemic prompted substantial reductions in app use. We noted strong cross-correlation between COVID-19 case count and reductions in app use in low- and middle-income countries, but not in high-income countries. Of the 112 countries and territories with non-zero app use during baseline and during the pandemic, we calculated a median reduction in app use to 73.6% of baseline.App data provide a proxy for surgical case volumes, and can therefore be used as a real-time monitor of the impact of COVID-19 on surgical capacity. We have created a dashboard for ongoing visualization of these data, allowing policy-makers to direct resources to areas of greatest need. Many health-care systems have responded by cancelling or delaying elective surgical procedures.,\u2013Assessing the volume of global surgical care is notoriously difficult. Prior work in this area has relied on estimations based on modelling and labour-intensive retrospective analysis of data from nations where such information is routinely recorded and available.We previously developed a free anaesthesia calculator mobile application (app) for the Android platform, called Anesthesiologist.Our aim is to determine whether utilization of the app, aggregated over the large existing international user base, could serve as a real-time qualitative proxy for surgical case volume, and therefore be used to monitor the impact of, and recovery from, the COVID-19 pandemic.,,,Data collection using the app has been described in previous publications.We also queried the electronic data warehouses of the University of Washington and the Seattle Children\u2019s Hospital for aggregate surgical case counts for the period 1\u00a0October\u00a02018 to 18\u00a0April\u00a02020, a time period capturing the relevant drops in surgical case volumes associated with holidays in the USA. We used publicly available data to classify World Health Organization (WHO) regions.,We analysed raw data in R using RStudio v3.6.2 ;We performed change point detection in time-series data using the cpm package.The study was reviewed and approved by the Emory University Institutional Review Board (study no.\u00a000082571), and there is a reliance agreement in place with the University of Washington Institutional Review Board. The approval includes a waiver of written informed consent. Participants gave electronic consent anonymously before participating in any data collection. The app is a medical device that falls into the category of enforcement discretion as per the United States Food and Drug Administration.From 1 October 2018 to 30 June 2020, we collected and analysed 4\u2009827\u2009263 data points from 100\u2009099 unique users in 214 countries and territories . ApproxiBox\u00a01India: 12\u2009374; United States of America: 4259; Germany: 4092; Russian Federation: 3630; Indonesia: 3352; Italy: 3304; Mexico: 2888; Pakistan: 2844; Brazil: 2155; Poland: 2052; Turkey: 2003; Egypt: 1709; Algeria: 1679; Spain: 1625; Colombia: 1520; Malaysia: 1353; France: 1267; Ethiopia: 1249; Ukraine: 1218; Nigeria: 1204; Kenya: 1156; Romania: 1136; Philippines: 1112; Iran (Islamic Republic of): 1097; Sudan: 1085; United Republic of Tanzania: 1067; Peru: 1032; Ghana: 1031; Yemen: 1019; Portugal: 1010; Libya: 997; Iraq: 961; United Kingdom: 926; Saudi Arabia: 924; South Africa: 903; Argentina: 732; Cuba: 724; Ecuador: 720; Bangladesh: 705; Democratic Republic of the Congo: 678; Belarus: 628; Viet Nam: 614; Netherlands: 610; Afghanistan: 567; Morocco: 565; Hungary: 561; China: 535; Chile: 507; Czechia: 507; Bolivia : 505; Israel: 468; Nepal: 462; Slovenia: 453; Madagascar: 450; Australia: 446; Croatia: 437; Austria: 436; Cameroon: 434; Venezuela (Bolivarian Republic of): 434; Belgium: 420; Uzbekistan: 392; Canada: 389; Bulgaria: 386; Greece: 363; Tunisia: 360; Rwanda: 354; Serbia: 350; Myanmar: 327; Uganda: 315; Kazakhstan: 310; Switzerland: 305; Syrian Arab Republic: 298; C\u00f4te d\u2019Ivoire: 297; Dominican Republic: 295; Slovakia: 272; Sweden: 272; Thailand: 270; Jordan: 264; Somalia: 256; Republic of Korea: 245; Mali: 241; Zimbabwe: 236; United Arab Emirates: 230; Georgia: 221; Angola: 220; Bosnia and Herzegovina: 199; Burundi: 198; Lithuania: 197; Zambia: 197; Paraguay: 194; Ireland: 187; Norway: 186; Sri Lanka: 178; Azerbaijan: 175; Lao People's Democratic Republic: 173; Haiti: 161; Lebanon: 161; Kuwait: 154; Cambodia: 146; Liberia: 145; El Salvador: 144; Niger: 142; Latvia: 139; West Bank and Gaza Strip: 138; Taiwan, China: 135; North Macedonia: 130; Mauritius: 129; Papua New Guinea: 124; Chad: 120; Nicaragua: 117; Republic of Moldova: 117; Mozambique: 114; Oman: 112; Senegal: 110; Honduras: 104; Tajikistan: 98; Fiji: 97; Albania: 91; Trinidad and Tobago: 91; Burkina Faso: 90; Guatemala: 90; Turkmenistan: 89; Mongolia: 87; Japan: 85; Qatar: 84; Namibia: 81; Guinea: 78; Guyana: 76; Singapore: 76; China, Hong Kong SAR: 74; Kyrgyzstan: 74; Uruguay: 74; Panama: 73; Denmark: 72; Estonia: 71; Jamaica: 71; Finland: 69; Sierra Leone: 68; Armenia: 67; New Zealand: 67; Congo: 64; Gambia: 62; Malawi: 62; Kosovo: 56; Benin: 55; Costa Rica: 54; Mauritania: 54; Cyprus: 48; Puerto Rico: 45; South Sudan: 45; Bahrain: 39; Botswana: 38; Djibouti: 37; Lesotho: 36; Comoros: 33; Bhutan: 32; Gabon: 31; Togo: 29; Montenegro: 28; Maldives: 26; Luxembourg: 21; Belize: 20; French R\u00e9union: 19; Seychelles: 17; Suriname: 17; Bahamas: 16; Malta: 16; Sao Tome and Principe: 15; Barbados: 14; Iceland: 14; Antigua and Barbuda: 13; Central African Republic: 13; Solomon Islands: 13; Eswatini: 13; Timor-Leste: 12; Equatorial Guinea: 11; Cabo Verde: 10; Tonga: 9; Brunei Darussalam: 8; New Caledonia: 8; Guadeloupe: 7; Guinea-Bissau: 7; China, Macao SAR: 6; Tuvalu: 5; Vanuatu: 5; Aruba: 4; Martinique: 4; Monaco: 4; Anguilla: 3; Cayman Islands: 3; Kiribati: 3; Micronesia (Federated States of): 3; Saint Lucia: 3; Saint Vincent and the Grenadines: 3; American Samoa: 2; Eritrea: 2; French Polynesia: 2; Mayotte: 2; \u00c5land Islands: 1; Andorra: 1; Bermuda: 1; Cook Islands: 1; Cura\u00e7ao: 1; Dominica: 1; Faroe Islands: 1; Greenland: 1; Grenada: 1; Isle of Man: 1; Liechtenstein: 1; Palau: 1; Saint Martin (French part): 1; Samoa: 1; San Marino: 1; United States Virgin Islands: 1.App: mobile application; SAR: Special Administrative Region.Note: A small number of users (44) had country codes that were not standard ISO\u00a03166 \u03b1-2 codes, meaning that their country of origin could not be reliably determined.\u2013We demonstrate in ,We also observed an expected variation in app use by the day of the week, consistent with known data demonstrating that surgical case volumes are highest during the middle of the week and much lower over weekends (data repository).We illustrate the impacts of COVID-19 on app use in We further used this data to illustrate variability in app use relative to counts of COVID-19 cases. Overall, app use declined as COVID-19 cases increased during the study period . We founWe generated a map of the global impact of COVID-19 on app use (available in the data repository),Many people in low- and middle-income countries are already without adequate access to safe anaesthetic and surgical care at baseline.,The benefits and challenges associated with the collection of health-care data using mobile technology have been discussed in previous publications.A specific strength of our work is the practical use of the app from which data were gathered and analysed. Users download and use the app for the clinical care of patients. The app has never been advertised or its use encouraged via notifications or other mechanisms, meaning that use of the app reflects stochastic clinical care events. This same stochasticity highlights a limitation of the work, however; data from individual regions or countries with a small user base reduce the confidence we can assign to the association between app use time-series data and surgical case volume. By excluding many more high- and middle-income countries than low-income countries with zero app use during the relevant periods in our calculation of median app use reduction, we have probably underestimated the global impact of COVID-19 on surgical case volumes.Another important limitation is that the app is used primarily for the care of paediatric cases (about 75% of app uses are for patients aged 12 years and younger), and this predominance may drive greater use of the app in low- and middle-income countries where (i)\u00a0subspecialty training in paediatric anaesthesia is less prevalent compared with in high-income countries; and (ii)\u00a0as much as 50% of the population in low- and middle-income countries may be younger than 16 years. Notably, these needs in low- and middle-income countries are not trivial: 1.7 billion children lack adequate access to surgical care and an estimated 85% of children will need surgical care by the age of 16 years.Finally, we acknowledge that many factors may drive changes in patterns of app use, and hence the relationship between app use and surgical case volume for a given country or region. For example, users are more likely to consult the app during emergencies,http://globalcases.info). Longer term, our app could be combined with other data to assist with measurement of global surgical capacity as part of the Global Surgery 2030 initiative. In conclusion, we present a real-time qualitative monitor of the impact of COVID-19 on global surgical volumes, particularly in low- and middle-income countries. Combined with other information sources, our app provides governments, global health organizations and philanthropic groups access to data providing markers of recovery \u2013 or otherwise \u2013 of surgical capacity, as well as the opportunity to direct resources to the areas of greatest need. To ensure the ongoing accessibility of this information, we have developed a near real-time dashboard ("}
{"text": "Correction to: BMC Pediatrhttps://doi.org/10.1186/s12887-017-0844-6Following the publication of article by Cauble et al. , typograThe paper lists the Deierlein equation as:The correct Deierlein equation is:The paper lists the Lingwood equation as:The correct Lingwood equation is:"}
{"text": "Following publication of the original article , the autThe Funding section originally read:This work was funded by Grants #82070034, #81970033, #31900424, #81570026, #81670002 and #3167188 from the NSFC; Grants #2017JJ2402, #2019JJ50760 from the Hunan Natural Science Foundation; Grant #20K142 from open Foundation of Hunan College Innovation Program and Grants #2018zzts813, #2018zzts812, #2019zzts327, #2019zzts1008 from the Fundamental Research Funds for the Central Universities of Central South University.The Funding section should read:This work was funded by Grants #82070034, #81970033, #31900424, #81670002 and #31671188 from the NSFC; grants #2020JJ4776, #2020JJ4688, #2019JJ50760 from the Hunan Natural Science Foundation; grant #20K142 from open Foundation of Hunan College Innovation Program and grants #2019zzts327, #2019zzts1008 from the Fundamental Research Funds for the Central Universities of Central South University.The original article  has been"}
{"text": "Objective: This study aims the perspectives of older adults on their sexual well-being. For this purpose, a qualitative research was carried out, which analyzes older adults\u2019 perspectives on indicators of sexual well-being in Portugal and Romania. Methods: Forty seven older participants aged 65 to 91 years, were interviewed. Participants lived in the community. All the interviews went through content analysis. Results: Preliminary results of content analysis generated 5 themes for the Romanian sample: Supportive relationship ; positive financial situation ; good health ; education ; and family support ; and five themes for the Portuguese sample: Supportive relationship ; demonstration of love ; sharing joint activities ; positive attitude and good humor ; and open communication ; Conclusions: This study highlighted the perspectives of Portuguese and Romanian older adults concerning sexual well-being. For both samples, showing a supportive relationship with a partner was the more frequent theme. Keywords: Content analysis; cross-national; older adults; qualitative study; sexual well-being."}
{"text": "The authors of \u201cTreatment Adherence and Secondary Prevention of Ischemic Stroke Among Discharged Patients Using Mobile Phone- and WeChat-Based Improvement Services: Cohort Study\u201d :e16496) noticed several errors in their published article. The following corrections have been implemented:In the Abstract, the sentence:Of the platform registry participants, 88.9%  adhered to inputting information into WeChat for 8-96 weeks.Has been corrected to:Of the platform registry participants, 89.7%  adhered to inputting information into WeChat for 8-96 weeks.This change does not impact the findings of the paper.The following additional changes have also been made within the manuscript. The caption of Figure 3 has been corrected from \u201cUntitled.\u201d to:Synchronous web terminal of the WeChat information platform part 1.Figure 4 was formerly captioned:Synchronous web terminal of the WeChat information platform.This has been revised to:Synchronous web terminal of the WeChat information platform part 2.Figure 6 was formerly captioned:Flowchart of the study design. PUSH: Peking University Shougang Hospital; PUTH: Peking University Third Hospital; ITT: intention-to-treat.This has been revised to:Selection bias analysis of the WeChat platform registry population. DM: diabetes mellitus; HLP: hyperlipidemia; HP: hypertension; TIA: transient ischemic attack.Figure 7 was formerly captioned:Selection bias analysis of the WeChat platform registry population. DM: diabetes mellitus; HLP: hyperlipidemia; HP: hypertension; TIA: transient ischemic attack.This has been revised to:Participants' usage of the WeChat-based modules.Figure 8 was formerly captioned:Participants' usage of the WeChat-based modules.This has been revised to:Survival functions: Kaplan-Meier analysis of the rate of endpoint events during the 1-year follow-up.Finally, Figure 9 was formerly captioned:Survival functions: Kaplan-Meier analysis of the rate of endpoint events during the 1-year follow-up.This has been revised to:Demographics of the participants with good and poor adherence.The correction will appear in the online version of the paper on the JMIR website on April 29, together with the publication of this correction notice. Because this was made after submission to PubMed, PubMed Central, and other full-text repositories, the corrected article has also been resubmitted to those repositories."}
{"text": "There is an error in the Competing Interests statement. The correct Competing Interests statement is as follows: Co-author K. Nakayama is a co-founder and shareholder of Cyfuse Biomedical KK. and an inventor/ developer designated on the patent for the Bio-3D printer. Patent title: Method for Production of Three-Dimensional Structure of Cells; patent number: JP4517125. Patent title: Cell Structure Production Device; patent number: JP5896104. The other authors have declared that no competing interests exist. This does not alter the authors' adherence to PLOS ONE policies on sharing data and materials."}
{"text": "Prevalence of mental health conditions, sensory impairments and physical disability in people with co-occurring intellectual disabilities and autism compared with other people: a cross-sectional total population study in Scotland. BMJ Open 2020;10:e035280. doi: 10.1136/bmjopen-2019-035280.Dunn K, Rydzewska E, Fleming M, This article was previously published with an error. The funding information in the published article was incomplete. The updated funding information is stated below:This work was supported by the UK Medical Research Council, grant number: MC_PC_17217) and the Scottish Government via the Scottish Learning Disabilities Observatory."}
{"text": "The following information is missing from the Data Availability statement: The plasmids described in this study are available from Addgene:plasmid pBDC, Addgene ID: 135188plasmid pBDK, Addgene ID: 135190plasmid pCNA, Addgene ID: 135191plasmid pSNA, Addgene ID: 135192plasmid pSNK, Addgene ID: 135193There is an error in S2 Table(DOCX)Click here for additional data file."}
{"text": "The online article and PDF will be updated in due course.In this research article by Dagens and colleagues (BMJ 2020;369:m1936, doi:"}
{"text": "Metformin blunts muscle hypertrophy in response to progressive resistance exercise training in older adults: A randomized, double\u2010blind, placebo\u2010controlled, multicenter trial: The MASTERS trial. Aging Cell. 2019; 18:e13039. c mean (SD) were incorrect. The correct data is shown as follow:In Table In addition, related measures presented in Appendix S2 under Supporting Information have been updated online.The authors would like to apologize for the inconvenience caused."}
{"text": "Correction to: BMC Infect Dis (2020) 20:897https://doi.org/10.1186/s12879-020-05605-3Following publication of the original article , the autThe incorrect caption is: \"Admission early in the epidemic versus later in the epidemic\".The correct caption is: \"Multivariate analysis of risk factors for death versus hospital discharge\".The original article  has been"}
{"text": "Scientific Reports 10.1038/s41598-019-56360-8, published online 27 December 2019Correction to: In the original version of this Article, Parastoo Mojtahed Zadeh-Ardabili and Sima Kianpour Rad were omitted as equally contributing first authors. Therefore, the below equal contribution statement has been added:\u201cThese authors contributed equally: Parastoo Mojtahed Zadeh-Ardabili and Sima Kianpour Rad.\u201dIn addition, the author contribution statement has been updated from:Designing of experiments: Abolfazl Movafagh, Parastoo Mojtahed Zadeh-Ardabili and Sima Kianpour Rad; Consultation: Abolfazl Movafagh; Experimental works: Parastoo Mojtahed Zadeh-Ardabili and Sima Kianpour Rad; Acquisition of data: Sima Kianpour Rad; Analysis and interpretation of data: Sima Kianpour Rad; Drafting of manuscript: Parastoo Mojtahed Zadeh-Ardabili, Sima Kianpour Rad and Soheila Kianpour Rad; Critical revision: Sima Kianpour Rad and Abolfazl Movafagh. All authors contributed toward data analysis, drafting and critically revising the paper, and agree to be accountable for all aspects of the work.to:Parastoo Mojtahed Zadeh-Ardabili and Sima Kianpour are considered as first authors in this publication. Designing of experiments: Abolfazl Movafagh, Parastoo Mojtahed Zadeh-Ardabili and Sima Kianpour Rad; Consultation: Abolfazl Movafagh; Experimental works: Parastoo Mojtahed Zadeh-Ardabili and Sima Kianpour Rad; Acquisition of data: Sima Kianpour Rad; Analysis and interpretation of data: Sima Kianpour Rad; Drafting of manuscript: Parastoo Mojtahed Zadeh-Ardabili, Sima Kianpour Rad and Soheila Kianpour Rad; Critical revision: Sima Kianpour Rad and Abolfazl Movafagh. All authors contributed toward data analysis, drafting and critically revising the paper, and agree to be accountable for all aspects of the work.These errors have now been corrected in the PDF and HTML versions of the paper."}
{"text": "The online version has been amended.This paper by Weedon and colleagues (BMJ 2021;372:n214, doi:"}
{"text": "Additionally, focal mechanism solutions of the main Mw 6.5 and its biggest triggered aftershock Mw 5.2 events were acquired. Such datasets could provide a basis for further seismology analysis, including seismic tomography, source mechanism analysis, and further seismic hazard analysis in the Ambon and Seram islands. This paper and its dataset are a companion for a published article in the Tectonophysics under the title \u201cSource Mechanism and Triggered Large Aftershocks of the Mw 6.5 Ambon, Indonesia Earthquake\u201d This article presents earthquake catalogs of the 2019 Ambon aftershocks compiled from regional the Agency for Meteorology, Climatology, and Geophysics of Indonesia (BMKG) and local seismic networks deployed in  The second sheet includes the velocity model used in locating the aftershocks in The first dataset contains station coordinates and velocity model for determining the hypocenter location of 2019 Ambon aftershocks. This is a Microsoft Excel worksheet consisting of two sheets. The first sheet contains the coordinates of the eleven local seismographic stations used for monitoring the 2019 Ambon aftershocks A: YEAR; B: MONTH; C: DAY: date type variables indicating the date for each earthquake.D: HOUR; E: MINUTE; F: SECOND: date type variables indicating the time for each earthquake.G: LONGITUDE; H: LATITUDE: double type variables  indicating the location (longitude and latitude) for each event.I: DEPTH: double type variable  indicating the depth of each individual earthquake.J: MAGNITUDE: double type variables indicating the reported magnitudes  for the included earthquakes. The type of the magnitude is ML  for regional BMKG catalog K,L,M: UNCERTAINTY: double type variables indicating the calculated uncertainty  for each event. This information is only available for aftershock catalog determined using local seismic network The second Microsoft Excel file in the Mendeley Data repository includes earthquake catalogs of 2019 Ambon aftershocks. The files contain a total of 1009 and 1764 earthquakes taken from BMKG catalog A\u2013I: similar with the format of the aftershock catalog mentioned earlier.J: MAGNITUDE: double type variable  indicating the final considered moment magnitude for each earthquake included.K: Strike 1; L: Dip 1; M: Rake 1; N: Strike 2; O: Dip 2; P: Rake 2: these columns represent the two nodal planes for the focal mechanism solution for each earthquake; each column contains a number for each mentioned individual parameter .Q: SOURCE: string variables indicating the source of the focal solutions.The third file in the repository is the focal mechanism of the 2019 Ambon aftershock main event and its biggest M 5.2 triggered event. The focal solutions of the main M 6.5 event were taken from Global CMT http://ds.iris.edu/ds/nodes/dmc) under the network codes II, IU, G, IC, dan RM. This file consists of two tables, i.e. represent each focal solution plane. Each table consists of four columns: X and Y location, seismic moments, and rake of each node. The header describes the reference point (X=0 km and Y=0 km) used in the inversion scheme.The fourth Microsoft Excel file is the slip model of the main 2019 Ambon earthquake derived using teleseismic data. The teleseismic dataset of the M 6.5 event was gathered from the Incorporated Research Institutions for Seismology (IRIS) Data Management Center (DMC) (2o and 128.60o and latitudes between \u22123.70o and \u22123.30o and occurred between October 18th to December 15th, 2019 were considered during the dataset compilation. During this monitoring period, 1009 and 1764 events were compiled from the BMKG 2019 Ambon aftershocks located in the spatial region spanning longitudes between 128.15Focal mechanism solutions of the 2019 Ambon main event and its largest M 5.2 triggered event were obtained from gCMT The related article has been submitted to the Tectonophysics under the title \u201cSource Mechanism and Triggered Large Aftershocks of the Mw 6.5 Ambon, Indonesia Earthquake\u201d.DPS, ADN, AM, AAR and SR: Conceptualization, Methodology, Software; ZZ, SW, NTP and AP: Writing-Original draft preparation; AL, DK, AA, YH and AWB: Visualization, Software and Validation; HAS: Software, Slip Model.The authors declare that they have no known competing financial interests or personal relationships which have or could be perceived to have influenced the work reported in this article."}
{"text": "Coleoptera: Cucujidae) is a small insect family with only about 70 species. Most of the species are distributed in Holarctic, Oriental and/or Australasian realms, while in South America, only six species have been recorded, including a single one known from Peru.The flat bark beetles  and Cusco and Jun\u00edn (P.nicaraguae) Regions of Peru, based, in part, on data collected through the iNaturalist citizen science database. Habitats of both species are presented in photographs for the first time. A country-level checklist to Cucujidae species currently known from South America is provided.Two cucujid beetle species,  Coleoptera: Cucujidae) form a small insect family which includes five genera and almost 70 species and is distributed worldwide, except for Africa, Antarctica, most of the oceanic islands and the greater part of the Arctic  fall within the tropical and subtropical climatic zones, with a mainly temperate climate in the southern regions. The western part of the continent is characteristically arid , while a cold, polar climate is present only in southern regions of Argentina and Chile . As a coPalaestesabruptus from Peru  in a photo published on the iNaturalist website . The iNaturalist site allows observers from around the world to post images of organisms on the website, while others provide identifications. Although the observer of the Palaestesabruptus photograph  was unable to send the material for study, he provided information that allowed RJ to contact Mr. Pavel Udovichenko, an insect dealer in Russia, who had additional material of this species. Subsequently, two male specimens were received from this seller. Moreover, Mr. Andrey Azarov sent us a pair of Palaestesnicaraguae adults for study. These specimens are currently deposited in the first author\u2019s collection (RJC). Three further specimens from Peru were examined by JM from loan material from the Florida State Collection of Arthropods, Gainesville, Florida, USA (FSCA), provided by the late Michael Thomas.This project was prompted from viewing a single male The specimens examined in this study were identified, based on the original species descriptions  and by cSharp, 189964FD53F4-FE8A-5EB8-8A94-53CE3A5B658EType status:Other material. Occurrence: sex: 2 males; lifeStage: adult; Taxon: higherClassification: Animalia; Arthropoda; Insecta; Coleoptera; Cucujidae' Palaestes; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Coleoptera; family: Cucujidae; genus: Palaestes; specificEpithet: abruptus; Location: higherGeography: South America; Peru; Pasco Region; Oxapampa Province; Pozuzo District; Pozuzo; continent: South America; country: Peru; countryCode: PE; stateProvince: Pasco Region; county: Oxapampa Province; municipality: Pozuzo District; locality: Pozuzo; verbatimElevation: 750-1430 m; Identification: identifiedBy: Radomir Jasku\u0142a; dateIdentified: 2020-12; identificationReferences: Sharp 1899; identificationRemarks: Pictures of type material were used to confirm identification; Event: eventDate: 2019-11; year: 2019; month: 11; habitat: mountain rain forest; eventRemarks: col. Alexander Sokolov; Record Level: collectionID: RJC ; ownerInstitutionCode: RJC/CUC-0008; RJC/CUC-0009; basisOfRecord: PreservedSpecimenSmall beetles with strongly flattened bodies; body length (measured from the top of clypeus to the end of elytra) of two studied Peruvian males: 14.7 mm ; ownerInstitutionCode: RJC/CUC-0010; RJC/CUC-0011; basisOfRecord: PreservedSpecimenType status:Other material. Occurrence: sex: male; lifeStage: adult; associatedOccurrences: NCBI BioSample ID: SAMN10963593; associatedSequences: MK614522GenBank: No. ; Taxon: kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Coleoptera; family: Cucujidae; genus: Palaestes; specificEpithet: nicaraguae; Location: higherGeography: South America; Peru; Cusco Region; Sancurtambo; Santa Isabel; Cosnipata [Kos\u00f1ipata] Valley Rain Forest Alt. 5525 ft.; continent: South America; country: Peru; countryCode: PE; stateProvince: Cusco Region; locality: Cosnipata [Kos\u00f1ipata] Valley Rain Forest Alt. 5525 ft.; Identification: identifiedBy: Mengjie Jin; dateIdentified: 2019; identificationReferences: Sharp 1899; identificationRemarks: Pictures of type material were used to confirm identification; Event: eventDate: 1951-12-14; year: 1951; month: 12; day: 14; eventRemarks: col. F Woytkowski; Record Level: collectionID: FSCA ; basisOfRecord: PreservedSpecimenType status:Other material. Occurrence: sex: male; lifeStage: adult; Taxon: higherClassification: Animalia; Arthropoda; Insecta; Coleoptera; Cucujidae' Palaestes; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Coleoptera; family: Cucujidae; genus: Palaestes; specificEpithet: nicaraguae; Location: higherGeography: South America; Peru; Cusco Region; Sancurtambo; Santa Isabel; Cosnipata [Kos\u00f1ipata] Valley Rain Forest Alt. 5525 ft.; continent: South America; country: Peru; countryCode: PE; stateProvince: Cusco Region; locality: Cosnipata [Kos\u00f1ipata] Valley Rain Forest Alt. 5525 ft.; Identification: identifiedBy: Mengjie Jin; dateIdentified: 2019; identificationReferences: Sharp 1899; identificationRemarks: Pictures of type material were used to confirm identification; Event: eventDate: 1951-12-14; year: 1951; month: 12; day: 14; eventRemarks: col. H. L. Dozier; Record Level: collectionID: FSCA ; basisOfRecord: PreservedSpecimeType status:Other material. Occurrence: sex: female [genitalia dissected]; lifeStage: adult; Taxon: higherClassification: Animalia; Arthropoda; Insecta; Coleoptera; Cucujidae' Palaestes; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Coleoptera; family: Cucujidae; genus: Palaestes; specificEpithet: nicaraguae; Location: higherGeography: South America; Peru; Cusco Region; Quiroz; Rio Paucartambo; continent: South America; country: Peru; countryCode: PE; stateProvince: Cusco Region; locality: Quiroz, Rio Paucartambo; Identification: identifiedBy: John W.M. Marris; dateIdentified: 2020-12; identificationReferences: Sharp 1899; identificationRemarks: Pictures of type material were used to confirm identification; Event: eventDate: 1933-11-23; year: 1933; month: 11; day: 23; Record Level: collectionID: FSCA ; basisOfRecord: PreservedSpecimenSmall beetles with strongly flattened bodies; body length (measured from the top of clypeus to the end of elytra) from 10.2 mm . The specimens from Peru share the following distinctive characteristics: head, mandibles and prothorax orange-brown, scutellum orange-brown, legs with femorae orange-brown and tibiae and tarsi black, tarsal claws brown-orange and elytra with black colouration extending apically from about the basal 1/3 to 2/5. The only notable difference is that, in the specimens from Peru, the antennomeres dark brown to black, except for the last two apical segmenta, which are red-brown. In contrast, the holotype has three apical segments that are red-brown.The Peruvian specimens match closely with the holotype of Previously, this species was known only from Nicaragua . The locP.abruptus, the larvae and adults of P.nicarague are presumed to live under the bark of dead trees, where they most probably prey on small insects and larvae. There are no published accounts of the ecology and biology specifically for P.nicaraguae.As noted for Coleoptera: Cucujidae) of South America has never been intensively studied and only a few papers have focused on the insect family in South America. For Palaestes Perty, 1830, original species descriptions were provided by P.freyreissi (described as Cucujus), by P.bicolor, by P.mandibularis and P.freyersi (both noted as Cucujus) and by P.dejeani (described as Cucujus) from Brazil  , one from Venezuela  and one from Ecuador (T.macclarini). Two species of Palaestes: P.nigriceps Waterhouse, 1880 and P.tenuicornis Waterhouse, 1880, were erroneously recorded from Peru by loci typici (and the only currently known locations) for these species are in Ecuador, from Chiguinda and Sarayacu [Sarayaku], respectively, as stated by Palaestes) and three species of Cucujidae in Peru, but later stated that only P.tenuicornis was present. P.nigriceps from Peru by P.tenuicornis. They also recorded P.freyreissi  and P.nigriceps from South America, but absent from Peru (P.freyreissi are published in the GBIF database (www.gbif.org).The flat bark beetle fauna ( [1827])  and by Wrom Peru . In addiP.abruptus and P.nicaraguae from South America, as well as the first confirmed data for the genus Palaestes from Peru. Discovery of one of these species was possible thanks to the data collected through the iNaturalist database, which confirms the high value of citizen science in studying biodiversity. Summarising all data mentioned above, we can conclude that the flat bark beetle fauna of South America comprises one subfamily (Platisinae), two genera  and at least eight species  has not been recorded from Brazil for almost one hundred years.This paper provides the first records of es Table , Fig. 5.Cucujidae in South America and for the genus Palaestes over its wider distributional range . Most of the published distribution information for Palaestes is from the original species descriptions, the most recent of which dates back to 1899. Since that time, the only publications discussing Palaestes were reliant on the same locality data as given in the descriptions . It is highly likely that further, targeted collecting in appropriate habitats will yield new taxa. This likelihood is emphasised by the recent discovery (the first specimen was collected in 1997) and description of the new genus, Thesaurus, with three new species from South America. It is remarkable that, despite more than 220 years of collecting on the continent, these relatively large and distinctive beetles had evaded discovery. Similarly, the state of taxonomy of Palaestes species is overdue for revision and there are no keys or modern identification aids available for the genus. The identifications of the two species recorded here are based solely on the original descriptions and photographs of the type material. Examination of existing collection material and detailed, critical analysis of the genus will likely show that new species are present. Both species, recorded here, have been identified as species otherwise known only from localities in Central America, separated by more than 2000 km in a straight line and crossing major geographical barriers. Hopefully, with more emphasis given to surveying for these beetles across Central and South America, more will be revealed about the ecology and biology of both the larvae and adults, as well as providing more information on the range of these distinctive and remarkable beetles.The two new species records, reported here, highlight the poor state of knowledge of ons viz. . Various"}
{"text": "The family Tortricidae includes approximately 11,500 species of small moths, many of which are economically important pests worldwide. A large number of tortricid species have been inadvertently introduced into North America from Eurasia, and many have the potential to inflict considerable negative economic and ecological impacts. Because native species behave differently than introduced species, it is critical to distinguish between the two. Unfortunately, this can be a difficult task. In the past, many tortricids discovered in North America were assumed to be the same as their Eurasian counterparts, i.e., Holarctic. Using DNA sequence data, morphological characters, food plants, and historical records, we analyzed the origin of 151 species of Tortricidae present in North America. The results indicate that the number of Holarctic species has been overestimated by at least 20%. We also determined that the number of introduced tortricids in North America is unexpectedly high compared other families, with tortricids accounting for approximately 23\u201330% of the total number of moth and butterfly species introduced to North America. This suggests that introduced tortricids have a greater potential of becoming economically important pests than moths in other families, and why distinguishing Holarctic from introduced species is critical to American agriculture.Acleris ferrumixtana , stat. rev.; Acleris viburnana , stat. rev.; Acleris pulverosana , stat. rev.; Acleris placidana , stat. rev.; Lobesia spiraeae , stat. rev.; and Epiblema arctica Miller, 1985, stat. rev. Cydia saltitans , stat. rev., is determined to be the valid name for the \u201cjumping bean moth,\u201d and Phiaris glaciana , comb. n., is placed in a new genus. We determine that the number of Holarctic species has been overestimated by at least 20% in the past, and that the overall number of introduced species in North America is unexpectedly high, with Tortricidae accounting for approximately 23\u201330% of the total number of Lepidoptera species introduced to North America.In support of a comprehensive update to the checklist of the moths of North America, we attempt to determine the status of 151 species of Tortricidae present in North America that may be Holarctic, introduced, or sibling species of their European counterparts. Discovering the natural distributions of these taxa is often difficult, if not impossible, but several criteria can be applied to determine if a species that is present in both Europe and North America is natively Holarctic, introduced, or represented by different but closely related species on each continent. We use DNA barcodes (when available), morphology, host plants, and historical records (literature and museum specimens) to make these assessments and propose several taxonomic changes, as well as future areas of research. The following taxa are raised from synonymy to species status:  Lymantria dispar , Erebidae) being among the most notorious. Examples of important lepidopteran pests that have been introduced recently to new regions around the globe include the fall armyworm, Spodoptera frugiperda (J. E. Smith) (Noctuidae), a native of the New World that has spread to much of Africa and Asia ), a native of Europe that was inadvertently introduced to the wine-growing regions of Argentina, Chile, and California )DNA barcode sequences were obtained from BOLD. All records for a particular taxon, usually at the genus level, were selected with the option \u201cinclude Public\u201d records. Records were filtered to exclude contaminants, records with stop codons, and records flagged as misidentifications or errors. Only sequences \u2265400 bp were used because of random alignment issues with shorter sequences. Sequences were aligned in BOLD using the BOLD amino acid-based HMM Aligner, and neighbor-joining trees were constructed in BOLD using the Kimura 2 Parameter (K2P) distance model.The \u201crevised status\u201d of each taxon was determined by examining how the specimens clustered in the distance tree, the identity and origin of the specimens, the specimens themselves , the relevant literature, and additional statistics in BOLD. In many cases, the average and maximum p-distance for each of BOLD\u2019s Barcode Index Numbers (BINs) and the p-distance between the nearest neighbors were examined; these are reported in the results when relevant. We did not use a specific percentage cut-off for species delimitation. We also did not rely exclusively on BOLD\u2019s BIN assignments, although in most cases, the placement of more than one taxon in a single BIN or the splitting of one taxon into multiple BINs did indicate there was an issue, either with the taxonomy or identifications. In some cases, the DNA data was completely ambiguous, either due to a lack of data, too many potential misidentifications, or the apparent sharing of DNA barcodes across multiple taxa.Each of the following species accounts includes five components: (1) the previously concluded status of the species with regards to its biogeographic origin (\u201cPrevious status\u201d), usually as listed in Pohl et al. ; (2) ourFamily TORTRICIDAESubfamily TORTRICINAEAcleris forsskaleana Previous status: Introduced from EuropeRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAA8796A. forsskaleana group into a single BIN (BOLD:AAA8796) with representatives from North America  and Europe . Many of the specimens from both continents share identical barcodes. Acleris forsskaleana was first recorded from North America by Klots  pattern or genitalia between the two. DNA barcodes indicate that C. cespitana is not present in North America. It is not known if North American C. cespitana and O. baccatana in BIN BOLD:AAA7669 are indeed the same species or if barcodes are not sufficient to separate taxa in this group. If they are synonyms, C. instrutana would be the senior name, with Sericoris poana Zeller, 1875 being an additional junior synonym.Heinrich  synonymiArgyroploce aquilonana Karvonen, 1932Previous status: HolarcticRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAB9941A. aquilonana, with specimens from Canada , Greenland, and Finland. Jalava and Miller [Olethreutes aquilonanus) from the Ogilvie Mountains in the Yukon, which was the first North American record. They also synonymized this taxon with Olethreutes kononenkoi, extending the distribution of A. aquilonana into Russia. Nedoshivina [There is a single BIN (BOLD:AAB9941) in BOLD representing d Miller  reportedoshivina  records Argyroploce externa Previous status: HolarcticRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAI3239A. externa are placed in a single BIN (BOLD:AAI3239) with representatives from Europe  and Canada . Jalava and Miller [Olethreutes dalecarlianus\u201d in North America, from the Ogilvie Mountains in the Yukon and Wellington, British Columbia. This name was synonymized under the Palearctic Argyroploce externa by Nedoshivina [Specimens of d Miller  reportedoshivina , making Hedya atropunctana Previous status: HolarcticRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:ABZ7645H. atropunctana are placed in a single BIN (BOLD:ABZ7645) that includes specimens from Europe  and a single specimen from Alaska. Jalava and Miller [Hedya atropunctana (which was previously placed in Metendothenia).In BOLD, sequences of d Miller  reportedd Miller  lists mad Miller  reviewedHedya ochroleucana Previous status: Holarctic Revised status:Hedya ochroleucana ; North American cryptic spp. (Nearctic)Supported by DNA in BOLD: YesBINs: BOLD:AAC0586 (Europe); BOLD:ACE9334 (British Columbia); BOLD:AAC0585 H. ochroleucana are placed in three BINs in BOLD: BOLD:AAC0586 contains specimens from Europe , and the other two BINs  contain specimens from North America. The North American BINs are separated by 3.10% (p-dist), and both are separated from the European BIN by 7.35% (p-dist).Specimens of Hedya ochroleucana was described from Germany. DNA barcode data indicate that it is Palearctic, and that specimens identified as this species from North America represent different taxa. Three closely related taxa, currently considered synonyms, are described from North America: nimbatana Clemens, 1860, from Massachusetts; contrariana Walker, 1863, from Nova Scotia; and consanguinana Walsingham, 1879, from California. It is uncertain whether these North American names are indeed all synonyms, or to which of the North American BINs the names should be applied.Hedya nubiferana Previous status: Introduced from EuropeRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAA4552A single BIN (BOLD:AAA4552) in BOLD contains nearly 100 specimens from the U.S., Canada, and Europe. The majority of specimens share a single identical barcode. This species was first reported from North America in 1913 from Nova Scotia and in 1914 from British Columbia . It is cHedya salicella Previous status: Introduced from EuropeRevised status: No changeSupported by DNA in BOLD: No (no specimens from North America in BOLD)BINs: BOLD:AAD6484H. salicella (BOLD:AAD6484), represented only by specimens from Europe . Sabourin et al. [BOLD contains a single BIN with sequences of n et al.  reportedAncylis comptana Previous status: HolarcticRevised status:Ancylis comptana ; North American cryptic sp. (Nearctic)Supported by DNA in BOLD: YesBINs: BOLD:AAB2712 (North America); BOLD:AAB2713 ; BOLD:ABX5131 ; BOLD:ADI5033 A. comptana are placed in four main BINs in BOLD; there are other single specimens placed in other BINs that are likely misidentified. BOLD:AAB2712 contains specimens from the U.S.  and Canada . The other three BINs contain specimens from Europe: BOLD:AAB2713 Austria, Finland, Italy, United Kingdom); BOLD:ABX5131 ; and BOLD:ADI5033 .Specimens of Ancylis comptana was described from Germany. Although the European representatives of this species in BOLD fall into three separate BINs, these form a single cluster separate from the North American BIN. Thus, it appears that A. comptana is restricted to the Palearctic, and there is a separate unrecognized species in North America. Numerous junior synonyms of A. comptana from North America are currently associated incorrectly with that species, and it is likely that one of these would apply to the Nearctic populations . However, more extensive research is needed to determine the taxonomic status of this group in North America and to examine the multiple BINs in Europe. Ancylis are notoriously difficult to identify, and there are many serious taxonomic issues to resolve in this genus.Ancylis unguicella Previous status: HolarcticRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAB3498Ancylis. They determined that A. unguicella is Holarctic, with a distribution that includes Western Europe east to Siberia and Japan in the Palearctic, and from Alaska and British Columbia east to Ontario and south to Colorado in the Nearctic [The BIN assignment listed here is from Gilligan et al. , who resNearctic .Ancylis uncella Previous status: Holarctic Revised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAA7191A. uncella is from Gilligan et al. [Ancylis uncella was previously thought to be a Palearctic taxon, but Gilligan et al. [A. carbonana, making it Holarctic. This species is distributed from Europe east to Siberia and Japan in the Palearctic and across southern Canada and the northeastern U.S. in the Nearctic [The BIN assignment for n et al. , who resn et al.  determinNearctic .Eucosmomorpha albersana Previous status: Palearctic Revised status: PalearcticSupported by DNA in BOLD: YesBINs: BOLD:AAF2360E. albersana in BOLD are placed in a single BIN (BOLD:AAF2360) representing Austria, Finland, Germany, The Netherlands, and Norway. This species was included by Pohl et al. [E. nearctica. We are unaware of any valid records of the European E. albersana from North America.Sequences of l et al.  as introl et al. ,128, Mill et al.  subsequeEnarmonia formosana Previous status: Introduced from EurasiaRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAC5227Enarmonia formosana sequences are placed in a single BIN in BOLD (BOLD:AAC5227), which contains specimens from the U.S., Canada, and Europe. Enarmonia formosana is widely distributed from Western Europe and northern Africa to Asia Minor, Russia, and Siberia [ Siberia . The fir Siberia ; it was  Siberia . The \u201cch Siberia .Rhyacionia buoliana Previous status: Introduced from EuropeRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAD1611 ; BOLD:ACE8290 (France and Spain)R. buoliana are placed in two BINs. BOLD:AAD1611 contains specimens from Europe , Canada (Ontario), and the U.S. (Maryland). BOLD:ACE8290 contains specimens from France and Spain. These BINs form a single cluster and are less than 1% (p-dist) different, indicating that they represent a single species.Specimens of Rhyacionia buoliana was first recorded in North America in 1913 in New York [New York . It was New York . The \u201cEuNew York .Spilonota ocellana Previous status: Introduced from EurasiaRevised status: No change; possible cryptic species in CanadaSupported by DNA in BOLD: YesBINs: BOLD:ABZ4399 ; BOLD:AAA6641 (Canada)S. ocellana in BOLD are placed in two BINs: BOLD:ABZ4399, with specimens from Europe and North America, and BOLD:AAA6641, with specimens from Canada . It is not known if this second BIN represents a possible cryptic species or genetic variation.Sequences of Spilonota ocellana was introduced to the Nearctic likely before 1840, with the first report from Massachusetts in 1841 [ in 1841 . It beca in 1841 . This is in 1841 .Spilonota laricana Previous status: Introduced from EuropeRevised status: No change; possible cryptic species in EuropeSupported by DNA in BOLD: YesBINs: BOLD:AAA7738 ; BOLD:AAA7739 (Finland)S. laricana are placed in two BINs in BOLD: BOLD:AAA7738 contains specimens from Europe  and Canada , while BOLD:AAA7739 contains specimens from Finland. These BINs are separated by 4.1% (p-dist).Sequences of S. ocellana [Historical records of this species in North America likely refer to ocellana ; thus itEucosma cana Previous status: Palearctic Revised status: Holarctic or Introduced?Supported by DNA in BOLD: YesBINs: BOLD:AAB4296E. cana in BOLD are placed in a single BIN (BOLD:AAB4296) with representatives from Europe  and Canada, which includes records from Cape Breton Highlands National Park in Nova Scotia, Sable Island National Park in Nova Scotia, Forillon National Park in Quebec, and Gros Morne National Park in Newfoundland. Records from Canada date back to as early as 2009. This is the first report of E. cana in North America.Specimens of Eucosma hohenwartiana Previous status: HolarcticRevised status: No changeSupported by DNA in BOLD: No (no specimens from North America in BOLD)BINs: BOLD:AAB4295E. hohenwartiana in BOLD are placed in a single BIN (BOLD:AAB4295), with all of the specimens from Europe. Ferris et al. [Sequences of s et al.  recordeds et al.  were unaPelochrista adamantana Previous status: HolarcticRevised status: NearcticSupported by DNA in BOLD: YesBINs: BOLD:AAF2211P. adamantana with sequence data in BOLD are from the U.S., and are placed in a single BIN (BOLD:AAF2211). This species has been listed as potentially Holarctic in some checklists because of the statement in the original description that it was described from \u201cex Lapponia (?),\u201d which could refer to Lapland in Finland. However, it has been excluded from European checklists since Rebel [The three specimens of ce Rebel  determince Rebel  appendedce Rebel  were unaPelochrista medullana Previous status: Introduced from EuropeRevised status: Not established in North AmericaSupported by DNA in BOLD: No (misidentifications and/or DNA barcodes do not separate species)BINs: BOLD:AAE7175P. medullana are placed in a single BIN (BOLD:AAE7175), along with specimens identified mostly as P. caecimaculana and a few other Pelochrista species from Europe. It is likely that the mixed species assignments to this BIN are the result of misidentifications. Pelochrista medullana was introduced into western North America for the biological control of Centaurea species (knapweed). This species was released in Idaho, Montana, Oregon, and British Columbia, but there is no evidence that it established in these locations [In BOLD, two specimens labeled as ocations ,136.Epiblema simploniana Previous status: HolarcticRevised status:Epiblema simploniana ; Epiblema arctica Miller, 1985, stat. rev. (Nearctic); other potential cryptic speciesSupported by DNA in BOLD: YesBINs: BOLD:ACO4599 ; BOLD:ACO4600 ; BOLD:AAF2136 ; BOLD:AAF2135 ; BOLD:ACJ7207 E. simploniana and its former junior synonym, E. arctica, are placed in five different BINs in BOLD: BOLD:ACO4599 contains specimens identified as E. arctica from the Ogilvie Mountains in the Yukon Territory, Canada; BOLD:ACO4600 contains specimens identified as E. arctica from the British Mountains in northwestern Yukon; BOLD:AAF2136 contains specimens identified as E. simploniana from Finland and Norway; BOLD:AAF2135 contains specimens labeled as E. simploniana from Finland; and BOLD:ACJ7207 contains specimens labeled as E. simploniana from Austria and Italy.Sequences of E. arctica from specimens collected in Alaska. He later [E. arctica was conspecific with E. simploniana, a Palearctic species recorded from the mountains of Central Europe, Scandinavia, western Russia, Siberia, and Mongolia [E. arctica in the Nearctic and E. simploniana in the Palearctic. In addition, we found what appear to be subtle but consistent morphological differences between E. arctica and E. simploniana that could be used to separate the two taxa (unpublished). Further research is necessary to determine why there are two separate BINs for E. arctica and three separate BINs for E. simploniana; this could indicate the possibility of one or more cryptic species in this group. Regardless, there is sufficient evidence to elevate E. arctica Miller, 1985, stat. rev., back to species status and restrict the distribution of E. simploniana to the Palearctic.Miller  describeHe later  determinMongolia . DNA barEpiblema sticticana Previous status: Palearctic Revised status: Holarctic or Introduced?Supported by DNA in BOLD: YesBINs: BOLD:AAC0719E. sticticana from Europe. It appears that this taxon is either Holarctic or newly introduced to North America.Specimens of this species are placed in a single BIN (BOLD:AAC0719) with representatives from Europe  and a single specimen from Canada. The specimen from Canada was collected in Gros Morne National Park in Newfoundland in 2009. It shares a 100% identical DNA barcode with 15+ specimens identified as Notocelia rosaecolana Previous status: Introduced from EuropeRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAC1134 N. rosaecolana in BOLD are placed in a single BIN (BOLD:AAC1134) with representatives from Europe , Canada , and the U.S. . There is little genetic variation in this BIN, and many specimens share nearly identical DNA barcodes. A single specimen from the United Kingdom is placed in a separate BIN by itself (BOLD:AAC1135), but the DNA sequence is short and likely accounts for placement of this specimen.Specimens of N. rosaecolana, N. trimaculana, or both species were introduced to North America. The earliest record is from Smith [Eucosma suffusana (a junior synonym of N. trimaculana) from New Jersey. Various other publications refer to N. trimaculana or N. rosaecolana as being the introduced taxon. Miller et al. [N. rosaecolana is the only species of the two present in North America, and that prior literature records referring to N. trimaculana were likely incorrect.There has been a long history of attempting to determine if the European om Smith , who repr et al.  resolvedNotocelia cynosbatella Previous status: Introduced from EuropeRevised status: No change; potential cryptic species and/or misidentificationsSupported by DNA in BOLD: YesBINs: BOLD:AAC3245 (Canada); BOLD:AAC9709 (Europe); BOLD:AAC3246 (Europe and Canada)N. cynosbatella are placed in three separate BINs in BOLD: BOLD:AAC3245 contains specimens from Canada ; BOLD:AAC9709 contains specimens from Europe ; and BOLD:AAC3246 contains specimens from Europe and Canada. The last BIN also contains some specimens labeled as N. illotana. BINs are separated by 2.4\u20133.4% (p-dist).Sequences of N. cynosbatella in North America from specimens collected near Vancouver, British Columbia in 1978. Pohl et al. [Notocelia cynosbatella is very similar to N. illotana, which is native to North America. Although Mutuura [N. illotana, or that DNA barcodes in BOLD are not sufficient to separate these two species. It is also possible that there are cryptic species in this group.Mutuura  documentl et al.  list the Mutuura  providesGypsonoma parryana Previous status: HolarcticRevised status: No changeSupported by DNA in BOLD: No (misidentifications and/or DNA barcodes do not separate species)BINs: BOLD:AAB1285Gypsonoma, including G. parryana, G. nitidulana, G. fasciolana, G. salicicolana, and G. nebulosana. The sequences cluster into several groups, but it is not clear if many of the specimens in this BIN are misidentified or if these DNA data are not sufficient to separate out species. Pohl et al. [The BIN BOLD:AAB1285 contains specimens identified as several different species of l et al.  list thil et al. .Gypsonoma nitidulana Previous status: HolarcticRevised status: PalearcticSupported by DNA in BOLD: No (misidentifications and/or DNA barcodes do not separate species)BINs: BOLD:AAB1285G. parryana, G. nitidulana, G. fasciolana, G. salicicolana, and G. nebulosana). It is not known if many of these are misidentifications or if DNA barcodes are not able to separate species in this group.Sequences of this species are placed in BIN BOLD:AAB1285, along with sequences of the previous taxon and several other species Previous status: Introduced from EuropeRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAB0379G. aceriana in BOLD are placed in a single BIN (BOLD:AAB0379) with specimens from Europe  and Canada. This species was first reported from North America in western Washington by Miller and LaGasa [G. aceriana that were collected in southwestern British Columbia as early as 1980. Subsequent collecting by LaGasa and Humble et al. [Sequences of d LaGasa . Severald LaGasa  reportede et al.  confirmeCrocidosema plebejana Zeller, 1847Previous status: HolarcticRevised status:Crocidosema plebejana ; potentially several other species, none with a Holarctic distributionSupported by DNA in BOLD: YesBINs: BOLD:AAA7083 ; BOLD:ABY9664 (Africa); BOLD:ACE9795 ; BOLD:AAA7084 C. plebejana in BOLD are separated geographically into several BINs. BOLD:AAA7083 contains specimens only from Australia; BOLD:ABY9664 contains specimens only from Africa; BOLD:ACE9795 contains specimens from Europe and Egypt; and BOLD:AAA7084 contains specimens from California, Texas, and Costa Rica. There is seemingly no regional overlap in the BOLD data, suggesting that each of these BINs might be a separate taxon. Distance between BINs varies from 1.4% (p-dist) between BOLD:AAA7083 and BOLD:ACE9795 to 4.3% (p-dist) between BOLD:AAA7084 and the other three BINs.Sequences of Crocidosema plebejana was originally described from Europe, and an additional 13 names, described from various parts of the world, are currently considered synonyms, including several from the New World. Some other species described from Hawaii and South America are closely related [C. plebejana is currently treated as a cosmopolitan species, it has been suggested that several of the synonyms are valid species [C. synneurota Meyrick  as a valid species and suggested other potential changes. The DNA data in BOLD suggest that at least populations on each continent might be separate taxa. Similarly, Lincango [C. plebejana, and the specimens of C. plebejana from Europe did not group with those from South America. Moreover, there is extreme variation in both male and female genitalia. A more comprehensive molecular analysis is necessary to clarify the identity of the species involved. For now, we believe C. plebejana should be restricted to the Palearctic, and that none of the taxa involved in this complex are Holarctic in distribution. related ,144. Alt species . Razowsk species  resurrecLincango  in a mulCrocidosema lantana Busck, 1910Previous status: Holarctic?Revised status: Neotropical; introduced elsewhere for biocontrolSupported by DNA in BOLD: Yes BINs: BOLD:AAH5763 C. lantana in BOLD are placed in a single BIN (BOLD:AAH5763), with specimens from Costa Rica, Jamaica, Australia, Madagascar, and Kenya.The sequences of Lantana [Crocidosema lantana has been introduced to Kenya [C. lantana is found in Florida.This species was introduced to Hawaii from Mexico in 1902 to control Lantana . It was Lantana . Crocidoto Kenya , and is Rhopobota naevana Previous status: HolarcticRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAA9812In BOLD, the nearly 700 sequences representing this species fall into a single BIN (BOLD:AAA9812), with representatives from Canada, Europe, Japan, Pakistan, and the U.S. There is no evidence of any cryptic taxa.This species is most likely Holarctic, being recorded from North America as early as 1863 and 1869 based on junior synonyms described from Hudson Bay, Canada and Massachusetts. Gillespie and Gillespie  state thEpinotia trigonella Previous status: HolarcticRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAB2504E. trigonella fall into a single BIN from Europe  and Canada . Sequences are clustered into three groups, with one consisting of mostly specimens identified as E. indecorana from Finland and Norway. Two specimens from Alaska identified as E. trigonella are placed in other BINs and most likely misidentified.Specimens identified as jasperana Brown, 1980 [E. trigonella. Aarvik [E. indecorana and E. trigonella as separate species, and Karsholt et al. [E. indecorana clustering separately from those of E. trigonella.DNA data support a Holarctic distribution for this species. Pohl et al.  include wn, 1980 , describ. Aarvik  treats Et et al.  follow tEpinotia solandriana Previous status: HolarcticRevised status: Holarctic?Supported by DNA in BOLD: No (sequence clustering is ambiguous)BINs: BOLD:AAA6716E. solandriana in BOLD are placed a single BIN (BOLD:AAA6716). However, sequences within this BIN are divided into two distinct clusters, with one representing North America  and the other representing Europe . This clustering of sequences could suggest that the European and North American populations represent different species, but more study is needed to determine the genetic variability of this species.Sequences of Epinotia solandriana is currently considered to be Holarctic [olarctic ,149. Marolarctic  suggesteEpinotia abbreviana Previous status: Introduced from EuropeRevised status: No changeSupported by DNA in BOLD: No (no specimens from North America in BOLD)BINs: BOLD:AAE1784Epinotia abbreviana is represented in BOLD with specimens from Europe placed in a single BIN (BOLD:AAE1784). This species was first recorded from North America by Dang [E. abbreviana reared from St. John\u2019s, Newfoundland in 1981 and 1988. by Dang , who docEpinotia nisella Previous status: Holarctic Revised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:ABZ1141 ; BOLD:AAA7530 ; BOLD:AAA7528 E. nisella is placed in three BINs: BOLD:ABZ1141 containing specimens from Austria and Germany; BOLD:AAA7530 containing specimens from Europe and Alaska; and BOLD:AAA7528 containing specimens rom Canada and Alaska. Mutanen et al. [In BOLD, n et al.  providesE. cinereana). Epinotia nisella has a long list of synonyms, owing to its variable forewing pattern. This species is currently distributed throughout Europe and Russia to China and Japan, and has even been recorded from Iceland [Mutanen et al.  resolved Iceland . In NortEpinotia cinereana Previous status: HolarcticRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAA7532 ; BOLD:AAA7529 ; BOLD:ABX4876 E. cinereana represented in BOLD are placed in three BINs: BOLD:AAA7532 containing specimens labeled as E. cinereana from Europe; BOLD:AAA7529 containing specimens labeled as E. criddleana from Canada; and BOLD:ABX4876 containing specimens labeled as E. cinereana from Europe and E. criddleana from Canada. Mutanen et al. [The specimens of n et al.  provide E. nisella. They determined (based on morphology) that the North American E. criddleana is a junior synonym of E. cinereana, resulting in a Holarctic distribution. Epinotia cinereana is widely distributed across Europe, with scattered records through Russia to Japan and China [Mutanen et al.  resolvednd China . In Nortnd China .Epinotia columbia Previous status: HolarcticRevised status: Nearctic; potential cryptic species in North AmericaSupported by DNA in BOLD: YesBINs: BOLD:AAF0407 ; BOLD:AAE1754 (Canada)Epinotia columbia is represented in BOLD with two BINs: BOLD:AAF0407 contains specimens from California and British Columbia, and BOLD:AAE1754 contains specimens from Canada . Both are separated from the BIN containing E. crenana (former senior synonym) from Europe (BOLD:AAE1756). It is not known which BIN represents E. columbia, although it was described from British Columbia, and the historic distribution has been limited to western North America. Thus, it is likely that BOLD:AAE1754 represents an undescribed cryptic species.columbia with E. crenana based on similarities in genitalia. In his unpublished Master\u2019s thesis, R. L. Brown [E. columbia back to species status; this change was formalized by J. Brown [E. columbia includes much of Canada west to British Columbia, Arizona, Nevada, Utah, and along the Pacific Coast to southern California [E. crenana.Heinrich  synonymiL. Brown  elevatedJ. Brown  in the tlifornia . There iEpinotia nanana Previous status: Introduced from EuropeRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAA8628 ; BOLD:ACF5528 (Europe)E. nanana fall into two BINs in BOLD. BOLD:AAA8628 contains specimens from Canada , the U.S. (Connecticut), and Europe . BOLD:ACF5528 contains specimens from other locations in Europe . Both BINs cluster together and are separated by only 1.09% (p-dist). As such, it is likely they represent a single taxon with some geographic structuring.Sequences of Epinotia nanana was originally described from Germany, and in the Palearctic, it is widely distributed across Europe, ranging into Siberia and Mongolia [E. nanana by Heinrich [Eucosma domonana  was described from Framingham, Massachusetts, and Epinotia piceafoliana  was described from Essex County Park, New Jersey. The first record of E. nanana in western North America is from a single specimen collected in British Columbia at some point prior to 1965 [E. nanana established in British Columbia.Mongolia . The firHeinrich . Eucosma to 1965 . This spEpinotia medioplagata Previous status: HolarcticRevised status: No changeSupported by DNA in BOLD: No (no specimens from outside North America in BOLD)BINs: BOLD:AAB6354BOLD contains sequences of specimens from the U.S. and Canada placed in a single BIN (BOLD:AAB6354). There are no specimens from the Palearctic represented in BOLD. However, this species is also recorded from Magadan Region in the Russian Far East , and wasEpinotia cruciana Previous status: HolarcticRevised status: No change; potential cryptic speciesSupported by DNA in BOLD: YesBINs: BOLD:ABX2894 (Canada); BOLD:ACE9994 ; BOLD:AAC2644 E. cruciana fall into three BINs: BOLD:ABX2894 contains specimens from Canada ; BOLD:ACE9994 contains specimens from Canada  and two specimens from Italy; and BOLD:AAC2644 contains specimens from Europe  and much of Canada. The first BIN containing specimens only from Canada is more distant (2.2% p-dist) from the other two BINs, which are only separated by 1.2% (p-dist). It is likely that one or both of the BINs containing specimens from Europe represent the true E. cruciana.Sequences of Epinotia cruciana ssp. alaskae was described from Alaska; cockleana was described from western Canada; direptana was described from Hudson Bay, Canada; E. cruciana ssp. lepida was described from New Hampshire; and vilisana was described from Hudson Bay, Canada. This species was described from Sweden and has at least 15 junior synonyms, several of which are from North America . EpinotiEpinotia seorsa Heinrich, 1924Previous status: Holarctic?Revised status: NearcticSupported by DNA in BOLD: No (this species not present in BOLD)BINs: N/AE. seorsa includes western Canada  and California [blanchardi [The known distribution of lifornia . There alifornia  includedanchardi  as a junEpinotia salicicolana Kuznetsov, 1968Previous status: Introduced?Revised status: Holarctic or Introduced?Supported by DNA in BOLD: No (no specimens from North America in BOLD)BINs: N/AEpinotia salicicolana was described from the Kuril Islands in the Russian Far East and has been also recorded from Korea, Japan, China, and Taiwan [www.efauna.bc.ca). Pohl et al. [d Taiwan ,155. It l et al.  listed tDichrorampha vancouverana McDunnough, 1935Previous status: HolarcticRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAC1223D. vancouverana are placed in a single BIN, BOLD:AAC1223, with specimens from Europe  and Canada . As the name suggests, D. vancouverana was described from Vancouver Island, British Columbia. Miller [D. vancouverana was the same species as the European D. gueneeana  and synonymized the two names.Sequences of . Miller  recognizTortrix politana from Austria (now a junior synonym of Lathronympha strigana). Guenee [Dichrorampha (now vancouverana) in Europe as politana; however, this was clearly a misidentification. Obraztsov [gueneeana as a replacement name for Guenee\u2019s misidentified politana. Because Guenee\u2019s reference to politana was simply a misidentification, it is likely that Obraztsov\u2019s gueneeana is invalid, because this was assigned as a replacement name and was not a new species description. Regardless, the species previously referred to as D. gueneeana in Europe can now be correctly referred to as the Holarctic D. vancouverana.The taxonomic history of this species is somewhat confusing. Denis and Schifferm\u00fcller  describe. Guenee  referredbraztsov  assignedDichrorampha sedatana Previous status: HolarcticRevised status: Holarctic?Supported by DNA in BOLD: No (misidentifications and/or DNA barcodes do not separate species)BINs: BOLD:AAA8637 ; BOLD:AAA8636 Dichrorampha sedatana can be problematic to separate from similar species such as D. aeratana, D. acuminatana, D. plumbana, and D. dana based only on wing pattern. A genitalic dissection is necessary to confirm identity in this group, and even then, identification is difficult due to variation. The majority of Dichrorampha in BOLD are not dissected, and thus, species identifications are sometimes questionable, especially when multiple species are assigned to the same BIN. Sequences of D. sedatana in BOLD are placed in two BINs. BOLD:AAA8636 contains specimens labeled as D. sedatana from Canada and specimens labeled as D. acuminatana from Europe. BOLD:AAA8637 contains specimens labeled as D. sedatana from Europe, specimens labeled as D. aeratana from Europe and Canada, and specimens labeled as D. tarmanni from Italy. Relatively low genetic diversity in both BINs suggests that multiple names in each BIN are a result of misidentifications, or that multiple species within this group share nearly identical DNA barcodes. It is not possible to determine the status of these taxa without extensive examination of the specimens from this group represented in BOLD.Dichrorampha sedatana is currently treated as Holarctic [D. sedatana specimens identified in Europe seem to be different from those identified in North America . However, the BOLD data are currently not sufficient to support this conclusion because of apparent issues with species identifications. Pohl et al. [D. plumbana  for North American populations is erroneous.olarctic . It has l et al.  noted thDichrorampha odorata Brown and Zachariades, 2007Previous status: Introduced?Revised status: Probably native to southern Florida/CaribbeanSupported by DNA in BOLD: No (this species not present in BOLD)BINs: N/AThis species was described from Jamaica in 2007, but was found in Florida in 2014 feeding on weeds. There is no evidence it is introduced, and thus, it is probably native to the region and simply not detected in Florida until recently. This species is not represented in BOLD.Dichrorampha petiverella Previous status: Introduced from EuropeRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAC9827D. petiverella in BOLD are placed in a single BIN (BOLD:AAC9827) representing Europe  and North America .Specimens of D. petiverella is also present in Ontario, Quebec, and Washington. Pohl et al. [Roberts  documentl et al.  recordedDichrorampha acuminatana Previous status: Introduced from EuropeRevised status: No changeSupported by DNA in BOLD: No (misidentifications and/or DNA barcodes do not separate species)BINs: BOLD:AAA8637 ; BOLD:AAA8636 D. sedatana for a discussion of the DNA data for this group of species. Dichrorampha acuminatana was first discovered in North America in 2001 in Washington County, Maine [See y, Maine . This spy, Maine , and they, Maine  recordedDichrorampha montanana Previous status: Introduced from EuropeRevised status: No change; cryptic species in EuropeSupported by DNA in BOLD: YesBINs: BOLD:AAE0714 ; BOLD:AAE0715 Dichrorampha montanana is represented in BOLD in two BINs: BOLD:AAE0715 contains specimens from Europe , and BOLD:AAE0714 contains specimens from Europe  and Canada (Newfoundland). It is assumed that BOLD:AAE0714 is the \u201ctrue\u201d D. montanana because it contains a specimen from Canada that was verified via dissection. Huemer [D. montanana for the first time from North America with specimens from Newfoundland that were confirmed via genitalic dissection.. Huemer  stated t. Huemer  recordedDichrorampha aeratana Previous status: Palearctic Revised status: Introduced from EuropeSupported by DNA in BOLD: No (misidentifications and/or DNA barcodes do not separate species)BINs: BOLD:AAA8637 ; BOLD:AAA8636 D. sedatana for a discussion of the DNA data for this group of species. Sabourin [D. aeratana from North America with specimens first collected in 1992 in Vermont. Sabourin [See Sabourin  reportedSabourin  also repGrapholita molesta Previous status: Introduced from AsiaRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAB0523G. molesta fall into a single BIN (BOLD:AAB0523) with a worldwide distribution. The earliest records of G. molesta in North America are from Washington, D.C., where it was apparently introduced in flowering cherry from Japan in 1912 or 1913 [In BOLD, specimens of  or 1913 . It has Grapholita delineana Walker, 1863Previous status: Introduced from AsiaRevised status: No changeSupported by DNA in BOLD: No (no specimens from North America in BOLD)BINs: BOLD:AAY2279 ; BOLD:ABW6517 (South Korea)G. delineana in BOLD are placed in two BINs: BOLD:AAY2279 contains specimens from Pakistan and Japan, and BOLD:ABW6517 contains a single specimen from South Korea. It is possible the South Korean specimen is misidentified.Specimens of Grapholita delineana is a native of East Asia that spread into Europe, Asia Minor, Transcausasia, and North America with the commercial production of hemp [G. delineana to be present in hemp fields in eastern Colorado in 2017\u20132018, and it is likely that this species will continue to spread with expanded industrial hemp production. of hemp ,165. The of hemp ,165. Cra of hemp  found G.Grapholita aureolana Previous status: HolarcticRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAE7252Grapholita aureolana fall into a single BIN in BOLD (BOLD:AAE7252), with specimens from Europe  and Canada. Pohl et al. [Sequences of l et al.  were theCydia coniferana Previous status: Introduced from EuropeRevised status: No change; potential cryptic species in western North AmericaSupported by DNA in BOLD: YesBINs: BOLD:AAC6167 (Europe and Canada); BOLD:AAC6168 (western U.S.)Cydia coniferana is represented in BOLD by sequences that fall into two BINs: BOLD:AAC6167 contains specimens from Europe  and Canada (Ontario), and BOLD:AAC6168 contains specimens from the western U.S. .This species was first reported from North America by Schaffner  for seveC. coniferana did establish in eastern North America, with one specimen collected in 2015 from Peterborough in Central Ontario represented in BOLD. It is likely that the populations in the Pacific Northwest and elsewhere in western North America (New Mexico) represent a cryptic species. There are also records of this species from the Russian Far East [C. coniferana. Based on the DNA sequence data, it seems that a population of Far East ; these aCydia nigricana Previous status: Introduced from EuropeRevised status: No change; potential cryptic species in North AmericaSupported by DNA in BOLD: YesBINs: BOLD:AAA7614 (Europe and Canada); BOLD:AAE7682 (North America)C. nigricana in BOLD are placed into two separate BINs: BOLD:AAA7614 contains specimens from Europe  and Canada , and this BIN likely represents the true C. nigricana, which was described from Great Britain; the second BIN (BOLD:AAE7682) contains specimens from only North America , and represents either a group of misidentified specimens or a potential cryptic species. There are two junior synonyms of C. nigricana that were described from the U.S. , and it is possible that one or both of these names could be applied to specimens in BOLD:AAE7682. Cydia nigricana was introduced from Europe, and first found in North America in eastern Canada in 1893 and in British Columbia in 1933 [Sequences of  in 1933 .Cydia pomonella Previous status: Introduced from EuropeRevised status: No changeSupported by DNA in BOLD: YesBINs: BOLD:AAA3532C. pomonella in BOLD are placed into a single BIN (BOLD:AAA3532) that consists of specimens collected throughout the world. There is no evidence of any cryptic species. The earliest record of C. pomonella in North America is a report of wormy apples and pears in the vicinity of Boston in 1819 [Sequences of  in 1819 . The \u201ccoCydia saltitans , stat. rev.Previous status: IntroducedRevised status: Neotropical; not present in the U.S.Supported by DNA in BOLD: YesBINs: BOLD:AAA0992Cydia deshaisiana Lucas, 1858 in most modern publications. Although this name was published by Lucas in November, 1858 [deshaisiana is a nomen nudum. The behavior of this insect (\u201cjumping seeds\u201d) had actually been described a year earlier by Westwood in 1857 [Carpocapsa saltitans [The name for the \u201cMexican jumping bean\u201d moth has traditionally been cited as er, 1858 , his acc in 1857 , althougaltitans ,172.C. saltitans, unless we simply use the June 7, 1858 date when the paper was first read and assume it was published in the next issue of the Proceedings in July. Regardless, the correct name for the \u201cMexican jumping bean\u201d moth is Cydia saltitans , stat. rev.Determining the exact date this description was published is difficult. The Proceedings of the Entomological Society of London were published on an irregular basis, most often quarterly. Wheeler  listed dC. saltitans appears to be restricted the northern states of Sinoloa and Sonora in Mexico.The only specimens in BOLD are from Costa Rica in (BOLD:AAA0992), and there is no evidence of this species occurring north of Mexico. \u201cMexican jumping beans\u201d are routinely imported into the U.S. and adult moths eventually emerge from the seeds. However, there are no records of this species being found in the wild in the U.S., and the distribution of Cydia cornucopiae Previous status: Holarctic?Revised status: No changeSupported by DNA in BOLD: No (no specimens from North America in BOLD)BINs: BOLD:AAF7704This species was first reported from North America in Alaska by Ferris et al. . It is oThaumatotibia leucotreta Previous status: IntroducedRevised status: Not established in North AmericaSupported by DNA in BOLD: YesBINs: BOLD:AAE7729This species is native to Africa. A single male specimen was found in a pheromone trap in Ventura County, California in July, 2008 . AlthougConiostola isabelae Razowski and Landry, 2008Previous status: Neotropical Revised status: No changeSupported by DNA in BOLD: No (this species not present in BOLD)BINs: N/AThis species was described from the Galapagos Islands. Razowski and Becker  reportedSubfamily CHLIDANOTINAEAuratonota dispersa Brown, 1990Previous status: Exotic, not established Revised status: No changeSupported by DNA in BOLD: No (insufficient records in BOLD)BINs: BOLD:AAJ9640This species is native to Central America, e.g., Guatemala to Panama . It has Determining whether a species is natively Holarctic or a relatively recent immigrant to North America from Eurasia is often difficult, even with the assistance of DNA data. Based on an established set of criteria, we evaluated 151 species of Tortricidae putatively documented from North America and hypothesize their origin. A summary of the data is presented in The overall number of tortricids introduced to North America is similar to those recently reported by other authors, e.g., Pohl et al. . A totalThe overall importance of introduced taxa cannot be overstated, and the environmental and economic costs from invasive species continue to increase. Hence, it is critically important to recognize these pests and distinguish them from species that are natively Holarctic. Based on the entire order Lepidoptera, the superfamily Tortricoidea has the third highest number of economically important species , trailing only Noctuoidea, with 1034 pests, and Pyraloidea, with 748 pests . Further"}
{"text": "There is an error in the Competing Interests statement. The correct Competing Interests statement is as follows: Co-author K. Nakayama is a co-founder and shareholder of Cyfuse Biomedical KK. and an inventor/ developer designated on the patent for the Bio-3D printer. Patent title: Method for Production of Three-Dimensional Structure of Cells; patent number: JP4517125. Patent title: Cell Structure Production Device; patent number: JP5896104. The other authors have declared that no competing interests exist. This does not alter the authors\u2019 adherence to PLOS ONE policies on sharing data and materials."}
{"text": "Bathytoshialata, Dasyatismarmorata, Dasyatispastinaca, Dasyatistortonesei, Himanturauarnak, Pteroplatytrygonviolacea and Taeniuragrabata. Papaconstantinou (2014) listed four species of Dasyatidae occurring in Greece . However, the marbled stingray (D.marmorata) was not amongst them. Here, the presence of D.marmorata was examined for the first time in Greece.Currently, seven dasyatid species have been described in the Mediterranean Sea: D.marmorata in the Eastern Mediterranean Sea. A juvenile male stingray was captured in February 2019, during an onshore survey in Maliakos Gulf, located in the central Aegean Sea, Greece. The ray was examined at the Fisheries laboratory of the Hellenic Centre for Marine Research (HCMR) in Athens and was identified as D.marmorata. Morphological characters were recorded and DNA barcoding was applied to confirm the species identification. The combination of the two methods verified the occurrence of the marbled ray in the Greek waters. This is the first record of D.marmorata from the Aegean Sea.The present study provides updated information on the geographical distribution of  Dasyatidae have been described in the Mediterranean Sea, which is the result of considerable updating of species occurrence in the region; for example, the roughtail stingray, valid as Dasyatiscentroura Mitchill, 1815, that was previously reported inhabiting the Mediterranean Sea, is now considered to be solely distributed along the Western coasts of the Atlantic Ocean, whereas its closely related species, the brown stingray Bathytoshialata Garman, 1880, occupies the Mediterranean and the eastern coasts of Africa  for males and females, respectively and the gestation period lasts around three to four months, with litter size of two to four embryos   Fig. . The occea) Fig. . The spe2 (1.5 mM), 200 \u03bcM of each deoxyribonucleotide triphosphate , 0.5 \u03bcl (300 \u03bcM) of each primer, 1 U GoTaq G2 Flexi polymerase (Promega) and 14.5 \u03bcl molecular grade water. Subsequently, the PCR product was sequenced commercially .Genomic DNA was extracted using the Chelex resin protocol . DNA barhttp://blast.ncbi.nlm.nih.gov/Blast.cgi) and the BOLD database .The sequence was compared with those available in GenBank using the standard nucleotide BLAST (blastn) against the nucleotide collection (nr/nt) database A39C719A-0311-5D12-B498-3FA2DAB02AE9Type status:Other material. Occurrence: occurrenceRemarks: collected dead in fishing nets; recordedBy: Stefanos Kavadas; individualCount: 1; sex: male; lifeStage: juvenile; reproductiveCondition: non-reproductive; preparations: whole animal, photographs, DNA extract; associatedSequences: MT044303GenBank: ; Taxon: kingdom: Animalia; phylum: Chordata; class: Chondrichthyes; order: Myliobatiformes; family: Dasyatidae; genus: Dasyatis; taxonRank: species; vernacularName: marbled stingray; Location: continent: Europe; waterBody: Aegean Sea; country: Greece; countryCode: GR; municipality: Central Greece; locality: Maliakos Gulf; verbatimLatitude: 38.882326; verbatimLongitude: 22.592301; verbatimCoordinateSystem: decimal degrees; Identification: identificationID: 371208; identificationReferences: Cyclostomata from the North-eastern Atlantic and the Mediterranean. Iglesias 2013\".\"Rays of the world. Last et al. 2016\". \"Chondrichthyans and ; identificationRemarks: blue blotches on pectoral fins, disc length vs. disc width; Event: samplingProtocol: trammel net; samplingEffort: 27 sampling hours; eventDate: 2019-02-09T09:00+0200; startDayOfYear: 39; endDayOfYear: 40; year: 2019; month: February; day: 9; habitat: muddy bottom; fieldNumber: 1902MLGT/T1H1/CM1; Record Level: type: By-catch entanglement; language: en; rightsHolder: Hellenic Centre for Marine Research; institutionCode: HCMR; basisOfRecord: Dead specimenThe collected specimen was a juvenile male measuring 330 mm in total length, 160 mm in disc length and 188 mm in disc width and weighing 171.8 g . Additionally, twenty six morphological characters were also recorded Table  and the D.marmorata (1.5 times) than that from D.pastinaca (1.8-2 times) (MT044303). The barcode search on GenBank produced clear top matches with 100% similarity to Dasyatismarmorata records reported in the database. Additionally, BOLD comparisons showed similar matching rates. The molecular results obtained verified the macroscopic identification of the species.Morphological measurements were expressed as percentage of DW as previously proposed for sting rays  and are 2 times) b. PrevioD.marmorata, collected in Greek waters, extending its distribution further into the Eastern Mediterranean Sea. Morphological measurements and molecular tools were combined to identify the species in the studied area. This is consistent with recent records of D.marmorata along the Turkish coast (Bilecenoglu in D.marmorata). Species records from the latest book of fish fauna in Greece do not include the marbled ray , in collaboration with the Fisheries Research Institute . Priority should be given to rare and vulnerable species occurring in the Eastern Mediterranean, to improve their conservation and restrict further biodiversity loss. Furthermore, this study highlights the utility of DNA barcoding in assisting species identification and its role to accurately determine the occurrence and distribution of species."}
{"text": "Comparison of different surgical approaches for pediatric cataracts: complications and rates of additional surgery during long-term follow-upIn the article Figure 1 for:Replace"}
{"text": "Colorectal carcinoma (CRC) is among the most common cancers with high morbidity and mortality among all malignancies, and the most common CRC is colon adenocarcinoma (CA).Overall, we obtained genome\u2010wide sequencing data from a cancer genome atlas of 319 patient cohorts . Lili Yan: Data curation . Yang Lu: Software . Dongfeng Liu: Methodology . Jia Niu: Writing\u2010original draft . Liyong Yin: Writing\u2010review & editing ."}
{"text": "The online version has been amended.In this paper by Harriet Forbes and colleagues (BMJ 2021;372:n628, doi:"}
{"text": "Plasmodium vivax, the most widespread Plasmodium species in the world. This species has been neglected and understudied for a long time, due to its lower mortality in comparison with Plasmodium falciparum. A renewed interest has emerged in the past decade with the discovery of antimalarial drug resistance and of severe and even fatal human cases. Nonetheless, today there are still significant gaps in our understanding of the population genetics and evolutionary history of P. vivax, particularly because of a lack of genetic data from Africa. To address these gaps, we genotyped 14 microsatellite loci in 834 samples obtained from 28 locations in 20 countries from around the world. We discuss the worldwide population genetic structure and diversity and the evolutionary origin of P. vivax in the world and its introduction into the Americas. This study demonstrates the importance of conducting genome-wide analyses of P. vivax in order to unravel its complex evolutionary history.More than 200 million malaria clinical cases are reported each year due to  Plasmodium species infecting humans, P. vivax is the most prevalent parasite outside Africa. To date, there has been less research on this species than for Plasmodium falciparum, a more lethal species, principally because of the lack of an in vitro culture system and also because P. vivax is considered relatively benign. Nevertheless, P. vivax is responsible for severe and incapacitating clinical symptoms with significant effects on human health. The emergence of new drug resistance and the discovery of severe and even fatal cases due to P. vivax question the benign status of P. vivax malaria. In recent years, there has been increased interest in characterizing the distribution of genetic variation in P. vivax. However, these studies either generated genetic information from a regional geographic scale or combine genetic datasets generated in different molecular platforms, which is known to generate biased results. In this study, we used a single genotyping platform to genotype 14 microsatellite markers in 834 samples of P. vivax obtained from 28 locations in 20 countries from around the world, including several populations from East and West Africa. We discuss the worldwide population genetic structure and the evolutionary origins of P. vivax, as well as its introduction into the Americas.Among the five  Plasmodium parasites are the agents responsible for malaria, one of the worst scourges of mankind, with almost 600,000 infant deaths and about 200 million clinical cases reported each year)ilibrium . In contilibrium . P. vivar others  Tables. observed , indicatulations , which cAt a worldwide scale, populations tend to group together according to their geographic locations but the relationships between populations of different geographic origins are far less obvious Figs  and 4. OP. vivax as well as the effect of more recent demographic events like population contraction, expansion or founding events.The variations of genetic diversity and genetic differentiation observed among populations at a worldwide scale are likely the consequence of the history of colonisation of the world by P. vivax and its spread throughout the world: the \u201cOut of Asia\u201d scenario and the \u201cOut of Africa\u201d scenario. Although these two hypotheses were based on different lines of evidence, the \u201cOut of Africa\u201d hypothesis has enjoyed renewed interest in recent years following the discovery of parasites closely related to P. vivax in African apes (named P. vivax-like) and the observation that human P. vivax diversity appears to be nested within that of the P. vivax-like parasites. This discovery has led some researchers to suggest that human strains of P. vivax originated following the transfer of parasites from African great apes to humans [P. vivax in sub-Saharan human populations, associated to the absence at the surface of their red blood cells of the Duffy antigen (i.e. Duffy negativity), suggesting that the Duffy-negative mutation was selected a long time ago in response to P. vivax infection [P. vivax was inferred from just a few nuclear genes and partial mitochondrial genomes and is consistent with several alternative scenarios. Indeed, such phylogenetic patterns can also be obtained because of incomplete lineage sorting or because of a lack of phylogenetic signal for the sequences used, two phenomena that are frequent when species have recently diverged (which is the case for P. vivax and P. vivax-like). We recently showed, comparing P. vivax-like genomes to those of P. vivax, that incongruent phylogenies may be obtained when one limits the analyses to a single or a couple of genes [P. vivax, with the high genetic diversity obtained in current Asian P. vivax parasite populations in comparison to the rest of worldwide P. vivax parasites? This pattern of genetic diversity is the opposite for P. falciparum, which has a well-established African origin [P. vivax [P. vivax among Plasmodium parasite species infecting mostly wild Asian monkeys (about fifteen monkey species\u2019) also calls into question the \u201cOut of Africa\u201d hypothesis.Two scenarios have been proposed to explain the origin of o humans ,33. The nfection . Howeverof genes . Second,n origin . Indeed,P. vivax . FinallyP. vivax at a worldwide scale, then our results based on microsatellite markers, would be more congruent with an Asian origin and a spread from Asia of the current populations of P. vivax found worldwide in humans. Genetic diversity and allelic richness are highest in South-East Asian P. vivax populations and decrease from South East Asia to East Africa  are clearly insufficient to disentangle the impact of recent and ancient demographic events on the distribution of P. vivax genetic variability. More extensive analyses of the population genetic structure of these parasites, using whole genome data and some tests of demographic scenarios, might be necessary to resolve the origin and evolution of these parasites.One may nevertheless advocate that some of these genetic patterns (e.g. the decrease of genetic diversity from Asia to Africa) could also be the consequence of the current differences in population size of the P. vivax populations from South America  and Central America (Mexico and Honduras)  appear to be more closely related to some African populations (the Mauritanian P. vivax population), thus suggesting a double origin of P. vivax in America (Asian and African). Moreover, we found that American P. vivax populations harbour low levels of genetic variation. These results are consistent with a scenario in which American P. vivax populations were introduced from multiple sources. This possibility of introduction from multiple locations has already been mentioned in several recent studies based on the analysis of different kinds of genetic markers [P. vivax populations contributed to the current diversity of P. vivax observed in South America [P. vivax dated between 1942 and 1944 that European isolates were closely related to the most common present-day American haplotype [P. vivax likely entered the American continent during the post Columbian contact [P. vivax parasites seem to be characterized by a recent history through multiple introductions and the next steps will be to identify the sources of introduction and to date such events.Within the Americas, a separation is observed between onduras) . When coonduras) , it seem markers ,38. Rodr America . Gelaberaplotype . This su contact . To concP. vivax populations. The highest genetic diversity is again observed in South East Asian P. vivax populations in comparison to the populations of the rest of the world, which argues again the suggested African origin of current human P. vivax. Concerning the colonization of the American continent, results obtained in our study seem to suggest a double origin from Africa (or Europe) and Asia, as already suggested by different studies [P. vivax are needed, including the study of ancient European P. vivax strains.This study confirmed the worldwide genetic structure of  studies ,37\u201339. IS1 FigFST computed using an island model. Red: area including the highest 5% neutral FST. Yellow: area including the lowest 5% neutral FST.The microsatellite markers suspected to be under positive selection (MS3 and MS6) are displayed. Grey: area including 95% of the neutral (PDF)Click here for additional data file.S2 FigRed and orange dots indicate the bootstrap values, ranging from 0.9 to 1, and from 0.6 to 0.89 respectively. The only difference detectable is that the AFR+MRT cluster is associated to the Central American populations when considering the full microsatellite markers set, whereas it is distinct when getting rid of the two markers detected under positive selection (MS3 and MS6). AFR: Central African Republic + Cameroon + Togo; ARM: Armenia; AZE: Azerbaijan; BAN: Bandarban; BAY: Bay Islands; CAM: Camopi; CAY: Cayenne; COX: Cox\u2019s Bazar; ETH: Ethiopia; HLF: New Halfa; HND: Honduras; IND: India; IRN: Iran; KGR: Khagrachari; KHA: Khartoum; MEX: Mexico; MRT: Mauritania; PAK: Pakistan; PER: Peru; STG: Saint Gorges de l\u2019Oyapock; THA: Thailand; TMY: Thailand/Myanmar; TUR: Turkey; VEN: Venezuela. In yellow are represented Asian countries, in purple Middle-east countries, in grey African countries and in green American countries.(PDF)Click here for additional data file.S3 FigIn yellow are represented Asian countries, in purple Middle-east countries, in grey African countries and in green American countries.(PDF)Click here for additional data file.S4 FigIn yellow are represented Asian countries, in purple Middle-east countries, in grey African countries and in green American countries.(PDF)Click here for additional data file.S5 FigST). A. Asian/Middle East continent and B. American continent. Mantel tests gave P-values < 0.05 for both continents tested.Pairwise geographic along landmasses plotted against pairwise genetic differentiation (F(PDF)Click here for additional data file.S1 TableAll isolates were genotyped by us for the 14 microsatellite loci. NA: non-available information.(DOCX)Click here for additional data file.S2 TableFor markers on the same chromosome, distances are enough to limit any physical linkage: MS2, MS5 and MS6 are at a minimum at 0.15Mb apart from each others; MS7 and MS8 are 1.14Mb appart; MS12 and MS15 are 1.04Mb appart.(DOCX)Click here for additional data file.S3 TableFor microsatellite genotypes, blank cases correspond to the absence of readable amplification/genotype.(DOCX)Click here for additional data file.S4 TableAFR: Central African Republic + Cameroon + Togo; ARM: Armenia; AZE: Azerbaijan; BAN: Bandarban; BAY: Bay Islands; CAM: Camopi; CAY: Cayenne; COX: Cox\u2019s Bazar; ETH: Ethiopia; HLF: New Halfa; HND: Honduras; IND: India; IRN: Iran; KGR: Khagrachari; KHA: Khartoum; MEX: Mexico; MRT: Mauritania; PAK: Pakistan; PER: Peru; STG: Saint Gorges de l\u2019Oyapock; THA: Thailand; TMY: Thailand/Myanmar; TUR: Turkey; VEN: Venezuela.(DOCX)Click here for additional data file.S5 TableARM: Armenia; AZE: Azerbaijan; BAN: Bandarban; BAY: Bay Islands; CAM: Camopi; CAY: Cayenne; COX: Cox\u2019s Bazar; ETH: Ethiopia; HLF: New Halfa; HND: Honduras; IND: India; IRN: Iran; KGR: Khagrachari; KHA: Khartoum; MEX: Mexico; MRT: Mauritania; PAK: Pakistan; PER: Peru; STG: Saint Gorges de l\u2019Oyapock; THA: Thailand; TMY: Thailand/Myanmar; TUR: Turkey; VEN: Venezuela.(DOCX)Click here for additional data file.S6 TableP-value < 0.008 (Bonferroni correction).*(DOCX)Click here for additional data file.S7 TableAll significant values are indicated in bold . AFR: Cantral African Republic + Cameroon + Togo; ARM: Armenia; AZE: Azerbaijan; BAN: Bandabar; BAY: Bay Islands; CAM: Camopi; CAY: Cayenne; COX: Cox\u2019s Bazar; ETH: Ethiopia; HLF: New Halfa; HND: Honduras; IND: India; IRN: Iran; KGR: Khagrachari; KHA: Khartoum; MEX: Mexico; MRT: Mauritania; PAK: Pakistan; PER: Peru; STG: Saint Georges de l\u2019Oyapock; THA: Thailand; TMY: Thailand/Myanmar; TUR: Turkey; VEN: Venezuela.(DOCX)Click here for additional data file."}
{"text": "In \u201cRecommendations From the Twitter Hashtag #DoctorsAreDickheads: Qualitative Analysis :e17595), the authors noted three errors.In the originally published manuscript, the fourth sentence of the second paragraph of the Introduction section read:The term originated from a professional YouTube video maker, who posted a video on Twitter explaining that she had been diagnosed with Ehlers-Danlos syndrome and postural orthostatic hypotension syndrome (POTS).This has been changed to:The term originated from a professional YouTube video maker, who posted a video on Twitter explaining that she had been diagnosed with Ehlers-Danlos syndrome and postural orthostatic tachycardia syndrome (POTS).a originally read:In Table 2, footnote POTS: postural orthostatic hypotension syndrome.This has been changed to:POTS: postural orthostatic tachycardia syndrome.The Abbreviations section originally included the following:POTS: postural orthostatic hypotension syndrome.This has been changed to:POTS: postural orthostatic tachycardia syndrome.These corrections will appear in the online version of the paper on the JMIR Publications website on November 9, 2020, together with the publication of this correction notice. Because this was made after submission to PubMed, PubMed Central, and other full-text repositories, the corrected article has also been resubmitted to those repositories."}
{"text": "Correction to:Movement Ecology (2023) 11:2010.1186/s40462-023-00378-1Following publication of the original article , the autThe statement in the \u2018Availability of data and materials\u2019 section originally read: We will make our data publicly available upon publication.The statement should read: The datasets generated for this study are available on request to the corresponding author.The original article  has been"}
{"text": "In the manuscript \u201cIsolated and combined association of excessive screen time and physical inactivity with negative self-rated health in adolescents\u201d, DOI: 10.1590/1984-0462/2023/41/2022077, published in the Rev Paul Pediatr. 2023;41:e2022077:On the top of the first page:Where it reads:Jean Carlos Parmigiani de MarcoIt should read:Jean Carlos Parmigiani De Marco"}
{"text": "Correction to: BMC Health Services Research (2023) 23:71110.1186/s12913-023-09725-9Following publication of the original article , the autThe incorrect author name is: Zahra Hadian ShiaziThe correct author name is: Zahra Hadian ShiraziThe author group has been updated above and the original article  has been"}
{"text": "There are errors in the Funding section. The correct Funding statement is: Specific grant number: GST03 Initials of authors who received award: AvS Specific grant number: EDU/0500057415 Initials of authors who received award: AvS, HYFull names of commercial companies that funded the study or authors: no commercial company funded the study or authors.Work preparatory to this meta-analysis was funded by the Organization for Economic Cooperation and Development (Contract Reference: EDU/0500057415).The systematic literature search and the coding for this meta-analysis was funded by the Global TIES for Children Research Center at New York University Abu Dhabi (GST03).https://nyuad.nyu.edu/en/research/faculty-labs-and-projects/global-ties-for-children.htmlURL to sponsor\u2019 website: The funders (other than the named authors) had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."}
{"text": "J Pediatr 2022;241:203; Open Forum Infect Dis 2022;9(2):ofac492.626) that residents trained in a structured communication strategy called AIMS  demonstrated specific behaviors of interest during live and virtual encounters with standardized patients (SPs) portraying vaccine-hesitant parents. The current study was conducted to determine if those behaviors were prioritized long after completion of training.We previously showed  or standard of care training ; blinding was maintained after training and until the time of the current study. Subjects were invited to complete an online survey wherein 10 possible communication behaviors were ranked from highest priority to lowest priority . Respondents were considered to have prioritized AIMS behaviors if they ranked each of the 3 AIMS items in the top 5; the ability of this measure to detect prioritization of AIMS behaviors was assessed by surveying unblinded residents who underwent AIMS training in the prior 2 weeks . Differences between groups were assessed using Chi-square tests for proportions. We hypothesized that a higher proportion of subjects in the AIMS Group would prioritize AIMS behaviors compared to subjects in the Control Group.p-value = 0.003). However, only 19% of the 32 residents in the AIMS Group met criteria for prioritization of AIMS behaviors .Characteristics of study participants are shown in Figure 3. Seventy-seven percent of the 31 residents in the Validation Group met criteria for prioritization of AIMS behaviors, compared with only 38% of the 32 subjects in the Control Group (AIMS communication behaviors are ranked highly shortly after training, but this prioritization is not retained over time. Future studies of the utility of structured vaccine hesitancy communication strategies should incorporate repetition and spaced retrieval to enhance retention and ensure deployment in practice.Shanna M. Barton, MD, M.Sc., Sanofi Pasteur: Grant/Research Support Gary S. Marshall, MD, GSK: Advisor/Consultant|GSK: Grant/Research Support|GSK: Honoraria|Merck: Advisor/Consultant|Merck: Grant/Research Support|Merck: Honoraria|Moderna: Advisor/Consultant|Moderna: Grant/Research Support|Moderna: Honoraria|Pfizer: Advisor/Consultant|Pfizer: Grant/Research Support|Pfizer: Honoraria|Sanofi: Advisor/Consultant|Sanofi: Grant/Research Support|Sanofi: Honoraria|Seqirus: Advisor/Consultant|Seqirus: Grant/Research Support|Seqirus: Honoraria"}
{"text": "Journal of Pharmaceutical Health Care and Sciences (2023) 9:1310.1186/s40780-023-00281-2The original publication of this article contained an incorrect title.The correct and incorrect title are listed below, the original article has been updated.Rhabdomyolysis caused by interaction between rosuvastatin and vadadustat: a case control studyRhabdomyolysis caused by interaction between rosuvastatin and vadadustat: a case report"}
{"text": "Correction: Journal of Orthopaedic Surgery and Research (2022) 17:544 10.1186/s13018-022-03434-5Following publication of the original article , the autThe incorrect author name is: Jingxing ZhaoThe correct author name is: Jingxin ZhaoThe author group has been updated above and the original article  has been"}
{"text": "Caption: Section of the digestive gland of a cockle infected with Marteilia cochillia.Credit: Dr. Antonio Villalba."}
{"text": "To the editor,We thank Dr. Sasaki, Dr. Suzaki, and Dr. Ueki for their interest and comments on the letter entitled \u201cPredictive significance of Charcot\u2010Leyden crystal structures for nasal polyp recurrence\u201d,However, we readily acknowledge that detection of CLCs by H&E staining has some issues as proposed by Ueki et\u00a0al. First, we believe that the most critical factor determining staining success is the optimal eosin pH value. Actually, many commercial eosin solutions could detect eosinophils perfectly but not CLCs. It should also be noted that CLCs identified by H&E staining may be interfered by other eosinophilic components, which can be improved by optimizing the eosin solution pH value. Second, CLCs count may vary depending on the different fields of view. In fact, CLCs are preferentially detected in the nasal mucosa tissue that is in close proximity to denuded epithelium and eosinophil degranulation.Yurong Bai: Data curation (lead); Formal analysis (lead); Methodology (lead); Writing \u2013 original draft (lead). Wenyi Chen: Data curation ; Methodology ; Validation . Weifeng Kong: Methodology (supporting); Software; . Xin Luo: Methodology (supporting); Software (supporting). Jingyuan Chen: Methodology (supporting); Software . Xinyue Wang: Methodology (supporting); Software . Qingwu Wu: Methodology (supporting); Software . Jianning Chen: Methodology (supporting); Resources . Qintai Yang: Funding acquisition (supporting); Investigation ; Project administration ; writing \u2013 review & editing . Yana Zhang: Conceptualization (lead); Funding acquisition (lead); Investigation ; Project administration (lead); Resources (lead); Supervision (lead); writing \u2013 original draft (supporting); writing \u2013 review and editing (lead).None.The National Natural Science Foundation of China (NSFC), Grant/Award Numbers: 8217114, U20A20399, 82271148; the Natural Science Foundation of Guangdong Province, Grant/Award Number: 2022A1515011787; the Science and Technology Program of Guangzhou, Grant/Award Number: 202201020402; the Key\u2010area Research and Development Program of Guangzhou Province, Grant/Award Number: 2020B0101130015; Fundamental Research Funds for the Central University, Sun Yat\u2010sen University, Grant/Award Number: 23qnpy141"}
{"text": "Penicillium roqueforti.Caption: A slice of a French Termignon blue cheese naturally colonized by Credit: Tatiana Giraud."}
{"text": "Correction: Journal of Medical Case Reports (2023) 17:434 10.1186/s13256-023-04160-0Following publication of the original article , an erroThe section currently reads:FundingNo fund received for this article.The section should read:FundingFunding Open Access funding provided by the Qatar National Library.The funding section has been updated above and the original article  has been"}
{"text": "Septic shock studies have identified that delay to the initial antimicrobial administration is the strongest predictor of survival. With every hour of delay mortality increases by 7.6%. The time from the written antibiotic order to intravenous administration or \u201chang-time\u201d can be several hours due to logistics within the hospital. As the optimization of the antibiotic administration involves the participation of a team in the ICU, Antimicrobial Stewardship Programs (ASP) play an important role in reducing this gap. The present study sought to determine the time between the prescription and the infusion of the antibiotic in 7 Latin American ICU that are implementing ASPs.Prevalence study between 2021-2022 in 7 hospitals . Hang-time was defined as the time elapsed from the written antibiotic order to actual IV administration. Hang-time compliant was defined as antibiotic administration within an elapsed time of 1 h from the written antibiotic order. Any patient with a suspected infection in the ICU , who had a first dose of the antibiotic was included. Patients with incomplete medical records or who died before the administration of the first dose were excluded. For the descriptive analysis, the average of the time difference between the formulation versus the administration of the treatment was determined, as well as the adherence to the administration of the antibiotic in the first hour after being formulated.1207 prescriptions were evaluated. The most common diagnose was sepsis and septic shock from urinary and pulmonary source. Hangtime adherence was 38.5% (22.5%-74.0%). The time range was 2 to 1080 minutes.HANGTIME RESULTS BY COUNTRYThe administration of antibiotics during the first hour in ICU patients was not an adherent practice despite being a risk factor for mortality. A stewardship process improvement protocol with physicians, pharmacists, and nursing collaboration has been developed to improve the hang-time of antibiotics in patients with sepsis. ASPs with limited resources should consider implementing hang-time protocols. Phase 2 will measure compliance of the hang-time protocol and mortality.Christian Pallares, MD, MSc, 3M: Advisor/Consultant|3M: Honoraria|MSD: Advisor/Consultant|MSD: Grant/Research Support|MSD: Honoraria|Pfizer: Advisor/Consultant|Pfizer: Grant/Research Support|Pfizer: Honoraria|Westqu\u00edmica: Advisor/Consultant|Westqu\u00edmica: Grant/Research Support|Westqu\u00edmica: Honoraria Jorge Chaverri, n/a, Pfizer: Advisor/Consultant|Pfizer: Honoraria Mar\u00eda Virginia Villegas, n/a, MSD: Advisor/Consultant|MSD: Grant/Research Support|MSD: Honoraria|Pfizer: Advisor/Consultant|Pfizer: Grant/Research Support|Pfizer: Honoraria|Westqu\u00edmica: Advisor/Consultant|Westqu\u00edmica: Grant/Research Support|Westqu\u00edmica: Honoraria"}
{"text": "Correction to: Current Hypertension Reports 10.1007/s11906-023-01264-2The article \u201cDoes Renal Denervation a Reasonable Treatment Option in Hemodialysis-Dependent Patient with Resistant Hypertension? A Narrative Review\u201d, was originally published electronically on the publisher\u2019s internet portal on 6 September 2023 with error on the tagging of the author names (first names and last names were interchanged) and affiliation of the third author.First Name: AlbertoLast Name: MazzaAuthor 1First Name: FabioLast Name: Dell'AvvocataAuthor 2First Name: GioiaLast Name: TorinAuthor 3First Name: FrancescaLast Name: BulighinAuthor 4First Name: YuriLast Name: BattagliaAuthor 5First Name: FulvioLast Name: FioriniAuthor 6The correct tagging of the author names are as follows:Gioia Torin (third author) should be affiliated to ESH Excellence Hpertension Centre and Dept. of Internal Medicine, Santa Maria della Misericordia General Hospital, AULSS 5 Polesana, Rovigo, Italy.The original article has been corrected."}
{"text": "Correction to: BMC Health Services Research (2023) 23:106910.1186/s12913-023-10066-wFollowing publication of the original article , the autThe incorrect author name is: Branden McCormack.The correct author name is: Brendan McCormack.The author group has been updated above and the original article  has been"}
{"text": "Details of correction: reverse order of first and second authors.Existing text: Federica Turati, Marta RossiCorrected text should read: Marta Rossi, Federica Turati"}
{"text": "Correction to: Acta Neuropathologica Communications (2023) 11:11110.1186/s40478-023-01609-7Following publication of the original article , the autThe incorrect author names are: Laura Kuhlman and Andrew Mackling.The correct author names are: Laura Kuhlmann and Andrew Macklin.The author group has been updated above and the original article  has been"}
{"text": "Caption: An infant of Macaca mulatta vestita is groveling on adult\u2010female monkey's back in Jiacha Gorge on the Yarlung Zangbo River, Tibet, China.Credit: Dayong Li."}
{"text": "Following publication of the original article , we haveOriginally published phrase:From top left: All-cause deaths; deaths from external causes; deaths from neoplasms; deaths from diseases of the nervous system and the sense organs. From bottom left: Deaths from circulatory diseases; deaths from mental and behavioural disorders; deaths from diseases of the respiratory system; deaths from other causes.Corrected caption phrase:Panel a: all-cause deaths; Panel b: deaths from external causes; Panel c: deaths from neoplasms; Panel d: deaths from diseases of the nervous system and the sense organs; Panel e: deaths from circulatory diseases; Panel f: deaths from mental and behavioural disorders; Panel g: deaths from diseases of the respiratory system; Panel h: Deaths from other causes.The original article has been corrected."}
{"text": "BJS Open 2023;7: https://doi.org/10.1093/bjsopen/zrad024This is a correction to: Bin Li and others, Surgical treatment of hilar cholangiocarcinoma: retrospective analysis. Fig. 2. This is the correct version:In the originally published version of this article, there were errors in the use of \u2018>\u2019 and \u2018<\u2019 symbols in the RLV/TLV presentation of the site area in instead of:The figure has been emended in the article."}
{"text": "There were multiple errors in the Author Contributions statement. The Author Contributions statement should read: \"Conceived and designed the experiments: SJD LAS DPB CJK. Performed the experiments: SJD LAS DPB CJK.Analyzed the data: SJD TP LAS DPB CJK. Wrote the paper: SJD MIT TP LAS DPB CJK.\""}
{"text": "HLA genes. In this study, we sought to use SNP genotyping in a large patient collection to identify sJIA susceptibility loci.Systemic juvenile idiopathic arthritis (sJIA) is a complex inflammatory disease whose etiology remains unknown. sJIA is distinguished from other forms of juvenile idiopathic arthritis (JIA) by its characteristic features including requisite quotidian fever and salmon-colored, evanescent skin rash, but also by an absence of autoantibodies. Based on its unique phenotype among JIA subtypes, it has been suggested that sJIA may be autoinflammatory rather than autoimmune in nature, and consistent with this, sJIA is distinct among JIA subtypes for its inconsistently detectable association with p below 0.001, producing a dataset of 690,672 SNPs in 576 cases and 426 controls. To address population stratification, we employed principal components (PC) analysis to identify and exclude samples with differing genetic backgrounds. We excluded 60 sJIA samples on this basis, reducing the size of the collection for final analysis to 516 cases and 426 controls. After correcting for the top 10 PCs, the genomic inflation factor reflected minimal population stratification (\u03bbGC = 1.01).We genotyped 576 children fulfilling ILAR criteria for systemic arthritis and 366 control subjects free of sJIA or autoimmune disease. The collection included 205 cases and 210 controls from Cincinnati Children\u2019s Hospital, 185 cases from the repository at University of Manchester, 56 cases and 60 controls from University of Genova, 54 cases from Hacettepe University, 42 cases from the University of Utah, 34 cases from Stanford University, and 96 controls from Istanbul University. SNP genotyping was performed using Illumina Omni1M Quad v1.0 beadchips and iScan platform. Omni1M beadchip data from 60 unrelated CEU HapMap individuals were obtained through Illumina\u2019s iControlDB. SNP associations were evaluated using SNP & Variation Suite 7, excluding SNPs with call rates below 95%, minor allele frequencies below 0.05, or Hardy-Weinberg Equilibrium HLA-DRB1 with PC-corrected associations that exceeded a stringent threshold for genome-wide significance (p < 5 x 10-8). These SNPs were part of a larger group of 45 SNPs with p < 5 x 10-5 in the MHC class II gene cluster. The effect size of the sJIA-associated SNPs ranged from odds ratios of 1.45 to 1.65. Notably, the effect size of this association is modest, relative to the effect of associated HLA genes in other JIA subtypes and other autoimmune diseases. Figure We identified 12 SNPs within MHC of sJIA patients, albeit with more modest effect sizes than those detected in other JIA subtypes. This suggests at least some contribution of autoimmunity to the pathogenesis of this complex disorder.A large collaborative effort to identify sJIA patients and a careful genetic matching strategy have allowed us to clearly detect an association signal within the class II region of the Michael Ombrello: None; Elaine F. Remmers: None; Alexei A. Grom: None; Wendy Thomson: None; Alberto Martini: None; Marco Gattorno: None; Seza Ozen: None; Ahmet Gul: None; John F. Bohnsack: None; Andrew S. Zeft: None; Elizabeth D. Mellins: None; Jane L. Park: None; Claudio Len: None; Colleen Satorius: None; Ricardo A.G. Russo: None; Terri H. Finkel: None; Rae S.M. Yeung: None; Rayfel Schneider: None; Sampath Prahalad: None; David N. Glass: None; Roger C. Allen: None; Nico Wulffraat: None; Pierre Quartier: None; Maria Odete E. Hilario: None; Kevin Murray: None; Sheila Oliveira: None; Jordi Anton: None; Anne Hinks: None; Eleftheria Zeggini: None; Carl Langefeld: None; Susan Thompson: None; Jeffrey Chaitow: None; Justine Ellis: None; Davinder Singh: None; Andre Cavalvanti: None; Blanca Bica: None; Flavio Sztajnbok: None; Hakon Hakonarson: None; Katherine A. Siminovitch: None; Kirsten Minden: None; Peter Haas: None; Tobias Schwarz: None; Daniel L. Kastner: None; Patricia Woo: None."}
{"text": "AbstractTettigettalnamariae Quartau & Boulard 1995 is recorded for the first time in Spain. Thought to be endemic to Portugal (occurring in the southern province of Algarve), the present paper adds its distribution to southern Spain, being an Iberian endemism. The acoustic signals of the new specimens collected were recorded in different localities of Huelva province, in Andalusia during August 2012. According to their present known distribution, specimens of Tettigettalnamariae tend to be sparsely distributed in small range populations in southern Iberian Peninsula, favouring wooded areas with Pinuspinea. Hemiptera: Cicadoidea) constitute a successful group of insects where males typically communicate during pair formation and courtship through acoustic distinctive signals  have been described and recorded so far in Portugal only . Identification was based on the collection of specimens and the recording of male acoustic signals typical of the species.As an outcome of intensive fieldwork in Portugal and Spain for species of the genus The field survey was conducted daily from 10:00 h to 19:00 h during sunny weather with temperatures ranging from 29\u00b0 to 32\u00b0 C. Searches were conducted by car while driving at a reduced speed, allowing the detection of the songs of calling males. Their acoustic signals were recorded at the collecting site using a Marantz PMD 661 Portable SD recorder (20 Hz \u2013 24 kHz) connected to a Telinga Pro 7 Dat-mic microphone (Twin Science) following the procedures given in Faculty of Sciences, University of Lisbon (FCUL). Collected specimens were stored dry and a front leg was preserved in 100% ethanol for DNA isolation.Geographical coordinates were determined with a GPS  for each site where male songs were heard and where specimens were collected. Species confirmation was accomplished with time and frequency analysis of sound recordings using the software Avisoft Sas-Lab Pro  as in prQuartau & Boulard, 1995Type status:Other material. Occurrence: recordedBy: Raquel Mendes; individualCount: 3; sex: male; Location: country: Espana; stateProvince: Andaluzia; verbatimLocality: Cartaya; verbatimLatitude: 37\u00b015'44.2\"N; verbatimLongitude: 7\u00b007'48.9\"W; Event: samplingProtocol: Acoustic recording; eventDate: 2012-08-15T17:00Z; Record Level: collectionID: 3372;3373;3374; institutionCode: FCUL; collectionCode: Entomology_PCSType status:Other material. Occurrence: recordedBy: Raquel Mendes; Vera Nunes; individualCount: 3; sex: male; Location: country: Espana; stateProvince: Andaluzia; verbatimLocality: Cartaya; verbatimLatitude: 37\u00b015'44.2\"N; verbatimLongitude: 7\u00b007'48.9\"W; Event: samplingProtocol: Acoustic recording; eventDate: 2012-08-15T18:00Z; Record Level: collectionID: 3375;3376;3377; institutionCode: FCUL; collectionCode: Entomology_PCSType status:Other material. Occurrence: recordedBy: Vera Nunes; individualCount: 1; sex: male; Location: country: Espana; stateProvince: Andaluzia; verbatimLocality: Cartaya; verbatimLatitude: 37\u00b015'44.2\"N; verbatimLongitude: 7\u00b007'48.9\"W; Event: samplingProtocol: Sweep net capture; eventDate: 2012-08-15T17:45Z; Record Level: collectionID: 3378; institutionCode: FCUL; collectionCode: Entomology_PCSType status:Other material. Occurrence: recordedBy: Raquel Mendes; Vera Nunes; individualCount: 1; sex: male; Location: country: Espana; stateProvince: Andaluzia; verbatimLocality: Moguer; verbatimLatitude: 37\u00b012'30.7\"N; verbatimLongitude: 6\u00b046'46.1\"W; Event: samplingProtocol: Acoustic recording; eventDate: 2012-08-16T11:50Z; Record Level: collectionID: 3379; institutionCode: FCUL; collectionCode: Entomology_PCSType status:Other material. Occurrence: recordedBy: Raquel Mendes; Vera Nunes; individualCount: 1; sex: male; Location: country: Espana; stateProvince: Andaluzia; verbatimLocality: Moguer; verbatimLatitude: 37\u00b012'30.7\"N; verbatimLongitude: 6\u00b046'46.1\"W; Event: samplingProtocol: Acoustic recording; eventDate: 2012-08-16T14:40Z; Record Level: collectionID: 3380; institutionCode: FCUL; collectionCode: Entomology_PCSType status:Other material. Occurrence: recordedBy: Vera Nunes; individualCount: 1; sex: male; Location: country: Espana; stateProvince: Andaluzia; verbatimLocality: Almonte; verbatimLatitude: 37\u00b013'43.0\"N; verbatimLongitude: 6\u00b033'51.1\"W; Event: samplingProtocol: Acoustic recording; eventDate: 2012-08-16T15:45Z; Record Level: collectionID: 3382; institutionCode: FCUL; collectionCode: Entomology_PCSTettigettalnamariae specimens in Spain.Our analysis of the morphological and acoustic data confirmed the presence of Tettigettalnamariae tending to favour wooded areas of Pinuspinea near the sea in the southern Iberian Peninsula (Figs Specimens were collected and recorded in different locations from Huelva province in Andalusia around the following localities: Cartaya, Aljaraque, Moguer, Mazag\u00f3n, Almonte and Hinojos Table . Recordsula Figs , 2.Tettigettalnamariae specimens have a broad spectrum near 6 - 16.5 kHz with maximum energy around 12 kHz. For time domain variables, our results indicated an echeme duration ranging from 0.02 to 0.10s, with an average value of 0.06s. For the echeme period we found a range of 0.16 to 0.54s and average of 0.32s.Acoustic analysis Table , Fig. 3 Tettigettalnamariae was a Portuguese endemic cicada, seeming to be confined to central Algarve, close to the sea (Tettigettalnamariae given the restricted habitat range of the known populations. The discovery of Tettigettalnamariae populations in Spain means that the species is not confined to the central wooded area of Algarve, close to the sea, having instead a wider distribution extending to Andalusia. The new populations of Tettigettalnamariae reported here constitute an important addition to the scarce knowledge of this rare species. However, Tettigettalnamariae distribution remains heavily fragmented and discontinuous. Consequently the species is still vulnerable to habitat loss caused by changes in land use or forest fires that often jeopardize Pinuspinea woods during the summer, when cicada adult males are active. These threats may cause the decline and eventual extinction of local populations of cicadas and are especially worrying for small range species such as Tettigettalnamariae (Previous studies suggested that  the sea  which isamariae .With the present data, obtained through our 2012 fieldwork, a new cicada species is listed for Spain and a new endemism for Iberia.Cicadetta (e.g.Moreover, the current species list available for the cicadas from Iberian Peninsula are likely to still be incomplete. As the male acoustic signals in cicadas are highly diagnostic for the separation of closely related species , it is qetta e.g.. All thi"}
{"text": "Several authors were omitted from the contributions to the \"Wrote the paper\" section. The correct Author Contributions are: Conceived and designed the experiments: CMC APM DAE EAW KEWJ. Performed the experiments: CMC PMW APM WKR AB. Analyzed the data: ERG CMC PMW RD WKR KEWJ. Contributed reagents/materials/analysis tools: APM WKR DAE KEWJ. Wrote the paper: ERG RAD EAW KEW."}
{"text": "The word \"arsenal\" was misspelled in the title of the article. The correct title is: \"Molecular Evolution of Vertebrate Neurotrophins: Co-Option of the Highly Conserved Nerve Growth Factor Gene into the Advanced Snake Venom Arsenal.\" The correct Citation is: Sunagar K, Fry BG, Jackson TNW, Casewell NR, Undheim EAB, et al. (2013) Molecular Evolution of Vertebrate Neurotrophins: Co-Option of the Highly Conserved Nerve Growth Factor Gene into the Advanced Snake Venom Arsenal. PLoS ONE 8(11): e81827. doi:10.1371/journal.pone.0081827."}
{"text": "There were errors in the name of the thirteenth author. The correct name is: Nhu Thi Quynh Nguyen.On two occasions in the Abstract, the letter \"M\" was dropped from words.Introduction: icroscopic Observation Drug Susceptibility (MODS)...\" should be \"Introduction: Microscopic Observation Drug Susceptibility (MODS)...\"\"Conclusion: ODS is a sensitive...\" should be corrected as \"Conclusion: MODS is a sensitive...\" \""}
{"text": "T. harzianum are well known for their biocontrol activity against many plant pathogens. However, there is a lack of studies concerning its use as a biological control agent against F. solani, a pathogen involved in several crop diseases. In this study, we have used subtractive library hybridization (SSH) and quantitative real-time PCR (RT-qPCR) techniques in order to explore changes in T. harzianum genes expression during growth on cell wall of F. solani (FSCW) or glucose. RT-qPCR was also used to examine the regulation of 18 genes, potentially involved in biocontrol, during confrontation between T. harzianum and F. solani.The species of T. harzianum growth on FSCW or glucose. We identified various genes of biotechnological value encoding to proteins which function such as transporters, hydrolytic activity, adherence, appressorium development and pathogenesis. Fifteen genes were up-regulated and sixteen were down-regulated at least at one-time point during growth of T. harzianum in FSCW. During the confrontation assay most of the genes were up-regulated, mainly after contact, when the interaction has been established.Data obtained from two subtractive libraries were compared after annotation using the Blast2GO suite. A total of 417 and 78 readable EST sequence were annotated in the FSCW and glucose libraries, respectively. Functional annotation of these genes identified diverse biological processes and molecular functions required during T. harzianum expressed different genes when grown on FSCW compared to glucose. It provides insights into the mechanisms of gene expression involved in mycoparasitism of T. harzianum against F. solani. The identification and evaluation of these genes may contribute to the development of an efficient biological control agent.This study demonstrates that  Trichoderma harzianum is a soil-borne filamentous fungus that protects crop plants from attack by a range of pathogenic fungi \u2009\u00d7\u2009100 [ng Phred . Only se program . The fil)]\u2009\u00d7\u2009100 .T. harzianum grown in FSCW, and T. harzianum grown in glucose medium. Both conditions were sampled at three different time points . Statistical tests  were performed when appropriate. Eighteen genes potentially involved in biocontrol were selected from the FSCW-library and 10 genes from Glc-library . Amplification efficiency was then calculated from the given slopes in the IQ5 Optical system Software v2.0 [The expression levels of 28 genes were estimated from the threshold cycle using the 2T method . In ordeare v2.0 . All calF. solani cell wall library; Glc-library: Glucose library.asm: acid sphingomielinase; aoc: amine oxidase; aqp: aquaporin; cfem: eight cysteine-containing domain; chk1: checkpoint-like protein; chit: chitinase 33; cpox: coproporphyrinogen oxidase; CWDE: Cell Wall Degrading Enzymes; Duf: duf895 domain membrane protein; Endo: Endochitinase 42; Eno: Enolase; Exo: Exo-rhamnogalacturonase; Gapd: Glyceraldehyde 3- phosphate dehydrogenase; Glyc: Glycosyl hydrolase; hsp98: heat shock protein; ht: hexose transporter-like protein; mbl2: mbl2-like secreted; norA: norsolorinic acid reductase; ptr2: peptide transporter; psd: phosphatidylserine decarboxylase family protein; pld: phospholipase d; pdc: pyruvate decarboxylase; qid: QID74 protein; sag: senescence-associated protein; ser: serine protease; sck1: serine threonine-protein kinase; c2h2: zinc finger domain protein; zt: zinc-regulated transporter; bgn: \u03b2-1,3-endoglucanase; FSCW-library: No competing financial interests exist.PMV, ASS and SJLS performed the construction of the cDNA gene libraries and sequenced the ESTs. PMV and ASGC designed the bioinformatics analysis. PMV and RNS performed the RT-PCR analyses and evaluation of the data. PMV drafted the manuscript. ASGC and CJU were responsible for the experimental design and revised the manuscript. All authors approved the final version of the paper.Relative expression profiles of genes identified in Trichoderma harzianum (FSCW and Glc libraries) at different times of exposure to Fusarium solani cell wall. The data is presented with log scale for better visualization.Click here for fileRelative expression profiles of genes identified T. harzianum during interaction with F. solani. The data is presented with log scale for better visualization.Click here for file"}
{"text": "This study describes the natural history of Barth syndrome (BTHS).The medical records of all patients with BTHS living in France were identified in multiple sources and reviewed.TAZ mutations were observed in 15 pedigrees. The estimated incidence of BTHS was 1.5 cases per million births (95%CI: 0.2\u20132.3). The median age at presentation was 3.1 weeks , and the median age at last follow-up was 4.75 years . Eleven patients died at a median age of 5.1 months; 9 deaths were related to cardiomyopathy and 2 to sepsis. The 5-year survival rate was 51%, and no deaths were observed in patients \u22653 years. Fourteen patients presented with cardiomyopathy, and cardiomyopathy was documented in 20 during follow-up. Left ventricular systolic function was very poor during the first year of life and tended to normalize over time. Nineteen patients had neutropenia. Metabolic investigations revealed inconstant moderate 3-methylglutaconic aciduria and plasma arginine levels that were reduced or in the low-normal range. Survival correlated with two prognostic factors: severe neutropenia at diagnosis (<0.5 \u00d7 109/L) and birth year. Specifically, the survival rate was 70% for patients born after 2000 and 20% for those born before 2000.We identified 16 BTHS pedigrees that included 22 patients. This survey found that BTHS outcome was affected by cardiac events and by a risk of infection that was related to neutropenia. Modern management of heart failure and prevention of infection in infancy may improve the survival of patients with BTHS without the need for heart transplantation. T studies ,14,22-27database . AllelicNotably, both in our cohort and in other BTHS patients , 3-methyFinally, the natural course of this disease illustrates the benefits of an interdisciplinary approach. In particular, a diagnosis of cardiomyopathy in a newborn or infant should lead to repeated tests to determine whether low ANC is present. The reverse is also true: It may be worth adding cardiac evaluation to the workup of the diagnosis of a chronic neutropenia suspected to be congenital. This diagnostic work-up should be performed in close cooperation with geneticists and metabolic disease specialists.TAZ gene; UPN: Unique patient number; WBC: White blood cell countACE-I: Angiotensin-converting enzyme inhibitor; ALC: Absolute lymphocyte count; AMC: Absolute monocyte count; ANC: Absolute neutrophil count; BSF: Barth Syndrome Foundation; BTHS: Barth syndrome; CBC: Complete blood count; CL: Cardiolipin; DCM: Dilated cardiomyopathy; GCSF: Granulocyte colony-stimulating factor; G6PC3: Glucose-6-phosphatase catalytic subunit 3 gene; Hb: Haemoglobin; HCM: Hypertrophic cardiomyopathy; IUGR: Intrauterine growth retardation; LV: Left ventricle; LVEDD: Left ventricle end diastolic diameter; LVEF: Left ventricle ejection fraction; LVNC: Left ventricular noncompaction; MLCL: Monolysocardiolipin; PCR: Polymerase chain reaction; QTc: Corrected QT interval; SD: Standard deviation; SF: Shortening fraction; TAZ: The authors declare no competing interests.A steering committee that included JD, DB, ASL, CO, AC and MR planned the study. ASL and RT carried out the molecular genetic studies, and CO and AC carried out the metabolic studies. DB analysed the data pertaining to the cardiac evaluations. CR collected the data and drafted the manuscript. JD was responsible for the statistical analysis and for the organization of the French SCN registry. All authors read and approved the final manuscript.Review of all published studies about Barth syndrome patients.Click here for fileFamily trees showing the 16 Barth syndrome pedigrees reported in this study.Click here for file"}
{"text": "There were errors in the Author Contributions section. The correct contributions are: Conceived and designed the experiments: WS JF. Performed the experiments: WS. Analyzed the data: WS. Interpreted the data: JF. Designed the simulations: CK WL. Performed and analyzed the simulations: CK. Wrote the paper: WS CK JF."}
{"text": "During early vertebrate development, various small non-coding RNAs (sRNAs) such as MicroRNAs (miRNAs) and Piwi-interacting RNAs (piRNAs) are dynamically expressed for orchestrating the maternal-to-zygotic transition (MZT). Systematic analysis of expression profiles of zebrafish small RNAome will be greatly helpful for understanding the sRNA regulation during embryonic development.We first determined the expression profiles of sRNAs during eight distinct stages of early zebrafish development by sRNA-seq technology. Integrative analyses with a new computational platform of CSZ  demonstrated an sRNA class transition from piRNAs to miRNAs as development proceeds. We observed that both the abundance and diversity of miRNAs are gradually increased, while the abundance is enhanced more dramatically than the diversity during development. However, although both the abundance and diversity of piRNAs are gradually decreased, the diversity was firstly increased then rapidly decreased. To evaluate the computational accuracy, the expression levels of four known miRNAs were experimentally validated. We also predicted 25 potentially novel miRNAs, whereas two candidates were verified by Northern blots.http://csz.biocuckoo.org.Taken together, our analyses revealed the piRNA to miRNA transition as a conserved mechanism in zebrafish, although two different types of sRNAs exhibit distinct expression dynamics in abundance and diversity, respectively. Our study not only generated a better understanding for sRNA regulations in early zebrafish development, but also provided a useful platform for analyzing sRNA-seq data. The CSZ was implemented in Perl and freely downloadable at:  Small non-coding RNAs (sRNAs) of about 20\u2009~\u200930 nucleotides (nt) play an essential role in a variety of animal developmental processes, such as embryonic, neuronal, muscle, and germline development -3. Microet al. quantitatively analyzed sRNA expression profiles in 256-cell (2.5 hpf), sphere (4 hpf), shield (6 hpf), and 1 dpf (days post fertilization) stages of early zebrafish development . The most widely used radial basis function (RBF) was chosen. The penalty parameter C and RBF kernel parameter \u03b3 were exhaustively searched as 8.0 and 0.03125, respectively.The LIBSVM package was used for training , while others are called false positives (FP). Among the predicted negative results obtained by ZmirP, real negatives are called true negatives (TN), while the others are called false negatives (FN). In a classification problem, the specificity (Sp), sensitivity (Sn), accuracy (Ac) and Mathew\u2019s correlation coefficient (MCC) are most widely used to evaluate the prediction system. They are defined as:Among the predicted positive results obtained by ZmirP, the real positives are called true positives  (AB type) were maintained under standard library conditions and the embryonic stages in this study were as described .k-nearest neighbors; ZmirP: Zebrafish miRNA prediction; CSZ: Characterization of small RNAome for zebrafish; RBF: Radial basis function; TP: True positive; FP: False positive; TN: True negative; Sp: Specificity; Sn: Sensitivity; Ac: Accuracy; MCC: Mathew\u2019s correlation coefficient; ROC: Receiver Operating Characteristic; qRT-PCR: quantitative real-time PCR; RPM: reads per million; Non-repeat-associated piRNAs: piRNAs that were not annotated as repeat sequences; Repeat-associated piRNAs: piRNAs that could be mapped to repetitive sequences.sRNAs: small non-coding RNAs; miRNAs: MicroRNAs; piRNAs: Piwi-interacting RNAs; pri-miRNAs: primary miRNA molecules; dsRNAs: double-stranded RNAs; RISC: RNA-induced silencing complex; hpf: hours post fertilization; MZT: Maternal-to-zygotic transition; NGS: Next-generation sequencing; dpf: days post fertilization; triplet elements: local structure-sequence features; SVMs: Support vector machines; RF: Random forest; MFE: Minimum of free energy; kNN: The authors declare that they have no competing interests.YX and HJ designed the project; YY, YX developed the algorithm and analyzed data; QY, LM and QJ performed experiments; WD, ZL, YZ and JR extensively shared and discussed data; YX, YY and QY wrote the manuscript. All authors read and approved the final manuscript.The detailed data statistics for different type of reads in eight libraries.Click here for fileThe 218 known zebrafish miRNAs identified from the sRNA-seq data, with corresponding mappable reads.Click here for fileThe 25 predicted miRNAs.Click here for fileThe secondary structures of 25 potentially novel miRNAs.Click here for fileThe piRNA clusters identified from the sRNA-seq data.Click here for fileThe distribution of different types of sRNAs in data from Wei\u2019s data . (A) TheClick here for file"}
{"text": "There were errors in the published Author Contributions. The correct Author Contributions are: Conceived and designed the experiments: WAB AV TLH DJG. Performed the experiments: WAB MS HZ. Analyzed the data: WAB AV TLH DAK DJG. Contributed reagents/materials/analysis tools: TLH DAK DJG. Wrote the paper: WAB."}
{"text": "AbstractCasuarinicolaaustralis Taylor, 2010 is reported for the first time, based on new material from Auckland. This is also the first record of the genus from New Zealand.The presence in New Zealand of the triozid  Casuarinicolaaustralis Taylor, 2010 was described from Australia, where it is the most common and widespread member of its genus, being widely distributed in New South Wales, Queensland, South Australia, Victoria and Western Australia. Like its congeners, it is restricted to host trees of the genus Casuarina. Casuarinicolaaustralis occurs on all Australian species of Casuarina, including Casuarinacunninghamiana and Casuarinaglauca. Both these species of Casuarina are exotic and present in the wild in New Zealand, according to the New Zealand Organisms Register (NZOR), as well as present in cultivation. Casuarinicola has not been reported (by name) previously from N.Z.Taylor, 2010Type status:Other material. Occurrence: recordedBy: Stephen Thorpe; sex: 1 male, 1 female; Location: country: New Zealand; verbatimLocality: Mechanics Bay, Auckland City; verbatimElevation: 0-5 m; verbatimLatitude: 36.8474938105S; verbatimLongitude: 174.7869624545E; Event: eventDate: 6 January 2013; Record Level: institutionCode: Auckland MuseumType status:Other material. Occurrence: recordedBy: Stephen Thorpe; individualCount: 1; sex: female; Location: country: New Zealand; verbatimLocality: Felton Mathew Avenue, Saint Johns, Auckland; verbatimLatitude: 36.8741794382S; verbatimLongitude: 174.8506522179E; Event: eventDate: 2013-02-20; Record Level: institutionCode: Auckland MuseumType status:Other material. Occurrence: recordedBy: Stephen Thorpe; individualCount: many; sex: males, females; Location: country: New Zealand; verbatimLocality: Thomas Bloodworth Park, Auckland; verbatimElevation: 0-5 m; verbatimLatitude: 36.8652411423S; verbatimLongitude: 174.7900235653E; Event: eventDate: 2013-02-26; Record Level: institutionCode: Auckland MuseumCasuarinaglauca trees growing in the vicinity of Ports of Auckland at Mechanics Bay. A few psylloids were observed, including a pair in copula, which I collected. The specimens will be vouchered in Auckland Museum. They are easily identified as Casuarinicolaaustralis Taylor in Casuarinicolaaustralis therein, except only that the second and third bands on the female fore wings of my specimen are narrowly joined. Such minor variation is entirely expected for insect colour patterns, and the pattern is still by far closest to that of typical Casuarinicolaaustralis than it is to any other species of Casuarinicola. I can find no other differences. I therefore recommend that Casuarinicolaaustralis be added to the New Zealand Organisms Register (NZOR) as present in the wild. Its \"origin\" is \"exotic\". Subsequently, on 20 Feb 2013, a further female specimen was found on a Casuarina tree in the Auckland suburb of Saint Johns. The second and third bands on the fore wings are separated, though narrowly (Fig. Casuarina trees at Thomas Bloodworth Park, Auckland. Several pairs were observed in copula. One female was collected. It has the second and third bands of one forewing joined, and of the other narrowly separated. On Casuarina in Auckland, there is also an apparently undescribed Australian species of Trioza, which is more common and widespread than Casuarinicolaaustralis.On 6 Jan 2013, I examined some"}
{"text": "AbstractMicrogasterdeductor Nixon (1968) are recorded from the Nearctic (Canada and the United States) and the Palaearctic (Sweden), expanding significantly the range of the species. Microgasterdeductor seems to be widely distributed in boreal areas of the Holarctic, and it is characterized by unique morphological  and molecular (COI) traits. Preliminary evidence, to be corroborated when more data is available, suggests that the species might have shifted northwards between 1950 and the present day.Four new localities for the species  Microgasterdeductor Nixon (1968) is a very distinctive microgastrine wasp , and can be easily separated from all Holarctic species of Microgaster based on its tarsal claws, which have a lobe (Microgasterdeductor could be more widely distributed in sub-Arctic or Arctic areas of the Holarctic (Europe and North America).e a lobe  Fig. 2)Microgaste a lobe . Howevere a lobe . That loMicrogasterdeductor is recorded from four additional localities, three in the Nearctic and one in the Palaearctic, which expand significantly the known range of the species. Morphological and molecular data that serve as diagnostic tools are presented, and the potential of a shift northwards of the species distribution is briefly discussed.Here http://www.boldsystems.org/).All the specimens studied for this paper are deposited in the Canadian National Collection of Insects (CNC), Ottawa, Canada. The only exception is one female deposited in the Biodiversity Institute of Ontario, which was not examined directly. Instead it was studied based on a single photo  and associated DNA barcode, both freely available as public data in the Barcode of Life Data Systems (BOLD)  were examined, although no specimen of Microgasterdeductor was found in those samples.Additionally, 40 specimens of The historical data on the distribution of the species was extracted from the original references  and compNixon, 1968Type status:Holotype. Occurrence: individualCount: 1; sex: female; Location: country: Finland; stateProvince: Lapland; verbatimLocality: Ivalo; Record Level: institutionCode: BMNHType status:Paratype. Occurrence: individualCount: 2; sex: 1 female, 1 male; Location: country: Finland; stateProvince: Lapland; verbatimLocality: Ivalo; Record Level: institutionCode: BMNHType status:Paratype. Occurrence: individualCount: 1; sex: female; Location: country: Sweden; stateProvince: Lapland; verbatimLocality: Tornetr\u00e4sk; Record Level: institutionCode: BMNHType status:Other material. Occurrence: recordedBy: Jose Fern\u00e1ndez-Triana; individualCount: 3; sex: 1 female, 2 males; Location: country: United States; stateProvince: Alaska; verbatimLocality: Unalakleet; verbatimLatitude: 63.878889; verbatimLongitude: -160.789722; Event: eventDate: 27 Jun 1961, 28 Jun 1961, 4 Jul 1961; Record Level: institutionCode: CNCType status:Other material. Occurrence: recordedBy: Jose Fern\u00e1ndez-Triana; individualCount: 4; sex: females; Location: country: Sweden; stateProvince: Lapland; verbatimLocality: Abisko; verbatimLatitude: 68.35; verbatimLongitude: 18.816667; Event: eventDate: 29 Jul 1951, 9 Aug 1951, 15 Aug 1951; Record Level: institutionCode: CNCType status:Other material. Occurrence: recordedBy: Jose Fern\u00e1ndez-Triana; individualCount: 1; sex: female; Location: country: Sweden; stateProvince: Lapland; verbatimLocality: Abisko; verbatimElevation: 400 m; verbatimLatitude: 68.35; verbatimLongitude: 18.816667; Event: eventDate: 31 Jul 1960; Record Level: institutionCode: CNCType status:Other material. Occurrence: recordedBy: Jose Fern\u00e1ndez-Triana; individualCount: 1; sex: female; Location: country: Canada; stateProvince: Northwest Territories; verbatimLocality: Tuktoyaktuk; verbatimLatitude: 66.4445; verbatimLongitude: -133.032; Event: samplingProtocol: Sweeping; eventDate: 14 Jul 2010; Record Level: institutionCode: CNCType status:Other material. Occurrence: recordedBy: Jose Fern\u00e1ndez-Triana; individualCount: 1; sex: female; Location: country: Canada; stateProvince: Yukon Territory; verbatimLocality: Herschel Island; verbatimLatitude: 69.571; verbatimLongitude: -138.902; Event: eventDate: 29 Jul 2008; Record Level: institutionCode: BIOType status:Other material. Occurrence: recordedBy: Jose Fern\u00e1ndez-Triana; individualCount: 35; Location: country: Canada; stateProvince: Manitoba; verbatimLocality: 23 km E of Churchill; verbatimLatitude: 58.734; verbatimLongitude: -93.82; Event: eventDate: 12 Jul 1952, 18 Jul 1952, 23 Jul 1952, 28 Jul 1952, 29 Jul 1952, 3 Aug 1952, 5 Aug 1952; Record Level: institutionCode: CNCType status:Other material. Occurrence: recordedBy: Jose Fern\u00e1ndez-Triana; individualCount: 6; Location: country: Canada; stateProvince: Manitoba; verbatimLocality: Warkworth Creek nr. Churchill; verbatimLatitude: 58.375; verbatimLongitude: -93.875; Event: eventDate: 29 Jun 1952, 7 Jul 1952, 3 Aug 1952; Record Level: institutionCode: CNCMicrogasterdeductor in the Nearcitc include three localities: Unalakleet, Alaska (United States), and Tuktoyaktuk, Northwest Territories and Herschel Island, Yukon Territory (Canada). They expand considerably the distribution of the species in the Holarctic, and the Alaskan record suggests the possibility that the species might also be in Siberia, Russia . The new record in the Palaearctic is from Abisko in Sweden, a locality very close to that of Tornetr\u00e4sk, where one of the paratypes, included by Nixon  but in others the pale spot is reduced  differed from Microgasterdeductor by 46 base pairs (7%). Full data of the sequences and specimens can be freely accessed in BOLD from the public projects with codes CNCAS, HARC and WOMIA. The nucleotide sequence of the full barcode of Microgasterdeductor, in FASTA format is:The two specimens recently collected (2008 and 2010) rendered full DNA barcodes \u2013 a section of 658 base pairs of the mitochondrial COI gene. Among the material collected in Churchill in 1952, one specimen rendered about half a barcode (320 base pairs), and for another 33 specimens short sequences of 129-144 base pairs were obtained. All sequences were identical, with the shorter ones perfectly matching the corresponding section of the full barcode obtained from the two recent specimens. The closest sequences in BOLD  species that this wasp parasitizes.Based on the studied molecular and morphological data, Microgasterdeductor, seems to suggest that its range might have shifted northwards recently. For example, the species was the most commonly collected Microgastrinae in Churchill during a period of intense study of insects in the area around the 1950's. However, it has never been found there again, in spite of even more intense collecting efforts carried out in the same locality between 2006\u20132011 , this project has not recovered the species either]. Conversely, the only two recent records of Microgasterdeductor correspond to Canadian localities at 69\u201370\u00b0N, which had similarly been sampled in the 1940\u20131960 without finding any record of the species. These two localities are 6\u201310\u00b0 north of the Canadian collections from the 1950\u20131960.The relatively scarce information about historical (1950\u20131960) and present (2008\u20132010) distribution of 006\u20132011 . Similardeductor ; also, bHowever, both historical and current day distribution patterns are likely to be biased by incomplete sampling efforts. The study of more specimens and more localities will be necessary before reaching any conclusions on this topic."}
{"text": "There was an error in the Author Contributions. The correct Author Contributions are: Designed the experiments: JRK RKK SB. Performed the experiments: SB. Analyzed the data: JRK RKK SB. Contributed reagents/materials/analysis tools: SB RKK JRK. Wrote the paper: JRK RKK SB. This research work is the part of PhD thesis (SB) under the supervision of JRK RKK."}
{"text": "There was an error in the Author Contributions Statement. The Author Contributions Statement should read: \"Conceived and designed the experiments: WG SD LP. Performed the experiments: WG HY SD. Analyzed the data: WG DW. Contributed reagents/materials/analysis tools: WG HY. Wrote the paper: WG HY.\""}
{"text": "Clostridium sticklandii belongs to a cluster of non-pathogenic proteolytic clostridia which utilize amino acids as carbon and energy sources. Isolated by T.C. Stadtman in 1954, it has been generally regarded as a \"gold mine\" for novel biochemical reactions and is used as a model organism for studying metabolic aspects such as the Stickland reaction, coenzyme-B12- and selenium-dependent reactions of amino acids. With the goal of revisiting its carbon, nitrogen, and energy metabolism, and comparing studies with other clostridia, its genome has been sequenced and analyzed.C. sticklandii is one of the best biochemically studied proteolytic clostridial species. Useful additional information has been obtained from the sequencing and annotation of its genome, which is presented in this paper. Besides, experimental procedures reveal that C. sticklandii degrades amino acids in a preferential and sequential way. The organism prefers threonine, arginine, serine, cysteine, proline, and glycine, whereas glutamate, aspartate and alanine are excreted. Energy conservation is primarily obtained by substrate-level phosphorylation in fermentative pathways. The reactions catalyzed by different ferredoxin oxidoreductases and the exergonic NADH-dependent reduction of crotonyl-CoA point to a possible chemiosmotic energy conservation via the Rnf complex. C. sticklandii possesses both the F-type and V-type ATPases. The discovery of an as yet unrecognized selenoprotein in the D-proline reductase operon suggests a more detailed mechanism for NADH-dependent D-proline reduction. A rather unusual metabolic feature is the presence of genes for all the enzymes involved in two different CO2-fixation pathways: C. sticklandii harbours both the glycine synthase/glycine reductase and the Wood-Ljungdahl pathways. This unusual pathway combination has retrospectively been observed in only four other sequenced microorganisms.C. sticklandii genome and additional experimental procedures have improved our understanding of anaerobic amino acid degradation. Several specific metabolic features have been detected, some of which are very unusual for anaerobic fermenting bacteria. Comparative genomics has provided the opportunity to study the lifestyle of pathogenic and non-pathogenic clostridial species as well as to elucidate the difference in metabolic features between clostridia and other anaerobes.Analysis of the  Clostridium consists of a large group of Gram-positive, anaerobic bacteria which belong to the Firmicute phylum . The genome annotation and features are available at http://www.genoscope.cns.fr/agc/microscope/Anaeroscope.The genome sequence reported in this article has been deposited in the EMBL database [EMBL:Rhodobacter capsulatus nitrogen fixation; Sec: selenocysteine; SLP: substrate-level phosphorylation; THF: tetrahydrofolate; WGS: whole genome shotgun.ATP: adenosine triphosphate; CoA or CoASH: coenzyme A; ETP: electron-transport phosphorylation; fd: ferredoxin; FMN: flavin mononucleotide; gcv-system: glycine cleavage system; LC-MS: Liquid Chromatography-Mass Spectrometry; MaGe: Magnifying Genomes; NADH: reduced nicotinamide adenine dinucleotide; NADPH: reduced nicotinamide adenine dinucleotide phosphate; Ppase: pyrophosphatase; Rnf: protein involved in AK, NF and GNC performed genome and comparative analysis and coordinated experimental procedures. SC carried out the growth experiments. ST analysed amino acid utilization by LC-MS. NP contributed to the experimental procedures. AL contributed to elaboration of the clostridial database Anaeroscope. MG constructed shotgun library for sequencing. VB carried out the assembly and finishing of the genome. EP performed bioinformatic analyses. ST, AL and VB participated in writing sections of the manuscript. MS, DL, and JW critically reviewed the manuscript. GNC and JRA contributed to writing of the manuscript. AK and NF wrote the manuscript. All authors read and approved the final manuscript.C. sticklandii compared with other clostridiaGenomic and metabolic features of . All data are extracted from the MaGe annotations except those of Clostridium sporogenes, which are from the NCBI database. C.stick: Clostridium sticklandii DSM 519; C.acet: Clostridium acetobutylicum ATCC 824; C.beij: Clostridium beijerinckii NCIMB 8052; C.botu: Clostridium botulinum A Hall; C.diff: Clostridium difficile 630; C.kluv: Clostridium kluyveri DSM 555; C.novy: Clostridium novyi NT; C.perf: Clostridium perfringens ATCC 13124; C.phyt: Clostridium phytofermentans ISDg; C.teta: Clostridium tetani E88; C.ther: C. thermocellum ATCC 27405; C.spor: C. sporogenes ATCC 1557; A.meta: Alkaliphilus metalliredigens QYMF; A.orem: Alkaliphilus oremlandii OhILAs; M.ther: Moorella thermoacetica ATCC 39073. *2-ketoacid ferredoxin oxidoreductases.Click here for fileC. sticklandii synteny conservation and Bidirectional Best Hit percentages with the most closely related clostrial species. Synteny conservation is given by the percentage of CDS in synteny between C. sticklandii and the complete sequenced genomes.Click here for fileC. sticklandii, their protein symbols and their corresponding labelsCharacteristic gene products of . This is a listing of all genes/proteins that are discussed in the text.Click here for fileComparative analysis of amino acid degradation pathways in several clostridial species. Blast searches (criteria: 30% identity over at least 80% of the length of the reference protein) were performed to determine the presence of the key enzymes in the microorganisms. All protein sequences were taken from C. sticklandii with two exceptions: the sequence of methylaspartate mutase was from Clostridium cochlearium, and that of 2-hydroxyglutaryl-CoA dehydratase from Acidaminococcus fermentans. C.stick: Clostridium sticklandii DSM 519; C.acet: Clostridium acetobutylicum ATCC 824; C.beij: Clostridium beijerinckii NCIMB 8052; C.botu: Clostridium botulinum A Hall; C.diff: Clostridium difficile 630; C.kluv: Clostridium kluyveri DSM 555; C.novy: Clostridium novyi NT; C.perf: Clostridium perfringens ATCC 13124; C.phyt: Clostridium phytofermentans ISDg; C.teta: Clostridium tetani E88; C.ther: C. thermocellum ATCC 27405; C.spor: C. sporogenes ATCC 15579; A.meta: Alkaliphilus metalliredigens QYMF; A.orem: Alkaliphilus oremlandii OhILAs; M.ther: Moorella thermoacetica ATCC 39073; C.coch: Clostridium cochlearium; A.ferm: Acidaminococcus fermentans DSM 20731. The genome of Clostridium cochlearium is not yet sequenced.Click here for fileLC-MS analyses of amino acid utilization during growth. For each amino acid, its presence in the medium was checked at different growth phases (colour graphs). The growth kinetic is represented by a yellow graph. Citrulline, ornithine, alanine and aspartate (indicated by a black frame) were not added to the medium. They appeared as intermediates or products of metabolism from other amino acids. Since the utilization of methionine was not discussed in the article, the graph for this amino acid is not shown.Click here for fileC. sticklandii in three types of media with different amino acid compositionCell growth of . Graph 1: medium containing amino acids that are catabolized in the exponential phase ; Graph 2: medium containing amino acids that are catabolized in the exponential and stationary phase ; Graph 3: the amino acid combination of this medium is equivalent to the second medium, complemented with amino acids apparently not metabolized . Tyrosine was added to each medium.Click here for fileComparison of the D-proline reductase gene cluster from different clostridial species. White arrows indicate hypothetical proteins or those presumed not to be involved in the D-proline reductase reaction. The letter \"U\" indicates the presence of selenocysteine. In Clostridium botulinum A Hall, a part of the cluster is duplicated.Click here for filePresence of characteristic enzymes of the glycine synthase (Gcv proteins)/glycine reductase (Grd proteins) and Wood-Ljungdahl (CODH proteins) pathway in microbial genomes. Complete and WGS microbial genomes  were scanned for some selected characteristic orthologous genes coding for carbon monoxide dehydrogenase/acetyl-CoA synthetase (Wood-Ljungdahl pathway), glycine reductase (Stickland reaction), and the glycine synthase (gcv-system) using a blastx search with stringent criteria (40% of positive residues over at least 80% of the length of the reference protein). For each target genome, the presence/absence of each protein was summarized in a 1/0 vector. Those WGS microbial genomes which do not contain all genes of both pathways are omitted.Click here for file"}
{"text": "Representing species-specific proteins and protein complexes in ontologies that are both human- and machine-readable facilitates the retrieval, analysis, and interpretation of genome-scale data sets. Although existing protin-centric informatics resources provide the biomedical research community with well-curated compendia of protein sequence and structure, these resources lack formal ontological representations of the relationships among the proteins themselves. The Protein Ontology (PRO) Consortium is filling this informatics resource gap by developing ontological representations and relationships among proteins and their variants and modified forms. Because proteins are often functional only as members of stable protein complexes, the PRO Consortium, in collaboration with existing protein and pathway databases, has launched a new initiative to implement logical and consistent representation of protein complexes.http://pir.georgetown.edu/pro/.We describe here how the PRO Consortium is meeting the challenge of representing species-specific protein complexes, how protein complex representation in PRO supports annotation of protein complexes and comparative biology, and how PRO is being integrated into existing community bioinformatics resources. The PRO resource is accessible at PRO is a unique database resource for species-specific protein complexes. PRO facilitates robust annotation of variations in composition and function contexts for protein complexes within and between species. Logical and semantic access to related protein forms is critical for advancing bioinformatics approaches to representing, modeling, and reasoning about complex biological systems at the genomic and cellular level . The Prointeractions in that they are continuant entities, i.e. they endure or continue to exist through time. Interactions, in contrast, are occurrent entities, i.e. they occur in time through successive temporal phases. The explicit representation of protein complexes in PRO--defining each member of the complex at the level of its isoform, variant, or modified form--provides the ability to represent complex biological knowledge as it is emerging in the experimental research community in structures that are both human readable and accessible to algorithmic approaches.The PRO has three components informally referred to as ProForm, ProEvo, and ProComp . ProFormspecific classes of protein complexes, while GO, in most instances, represents the species-independent classes of protein complexes; within PRO, the latter are referred to by using GO identifiers. The UniProt Knowledgebase (UniProtKB) comment: Category = organism-complex. Entities of this type are disposed to have the enzymatic activity described by EC:6.4.1.4.synonym: \"beta-methylcrotonyl-CoA carboxylase (mouse)\" EXACT synonym: \"MCC (mouse)\" EXACT is_a: GO:0002169! 3-methylcrotonyl-CoA carboxylase complex, mitochondrialhas_part PR:000025354 {cardinality = \"1\"} ! methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial (mouse)relationship: has_part PR:000025357 {cardinality = \"1\"} ! methylcrotonoyl-CoA carboxylase beta chain, mitochondrial (mouse)relationship: relationship: only_in_taxon taxon:10090 ! Mus musculusSerine palmitoyltransferase  catalyzes the key reaction in the biosynthesis of sphingolipids. In many eukaryotic species, this enzyme is a heterodimer consisting of two subunits, SPTLC1 and SPTLC2. Recently, it was shown that in human cells, SPTLC1 and SPTLC2 form a complex with a third subunit, SPTLC3, with a resulting molecular mass of 480 kDa . SPTLC1 A serine palmitoyltransferase complex is also found in gram-negative sphingolipid-containing bacteria. Unusually, the outer membranes of these bacteria contain glycosphingolipid (GSL) instead of lipopolysaccharide, and SPT catalyzes the first step of the GSL biosynthetic pathway in these organisms. But, as opposed to the human SPT complex, bacterial SPT complex is homodimeric -21. In shas_part relation to the corresponding classes of protein components. The functional human complex classes have an is_a relationship to the serine C-palmitoyltransferase complex class in GO (GO:0017059). The complex core has an is_a relationship to GO:0043234 (protein complex) as there is currently not a more specific complex class in GO.The representation of SPT complexes in PRO shown below and illustrated in Figure [Term]id: PR:000026144name: serine palmitoyltransferase complex core 1 (human)def: \"A serine palmitoyltransferase complex that is heterodimeric consisting of one subunit of serine palmitoyltransferase 1 and serine palmitoyltransferase 2. These components are encoded in the genome of human.\" [PRO:CNA]is_a: GO:0043234 ! protein complexrelationship: has_part PR:000026141 {cardinality = \"1\"} ! serine palmitoyltransferase 1 (human)relationship: has_part PR:000026142 {cardinality = \"1\"} ! serine palmitoyltransferase 2 (human)relationship: only_in_taxon taxon:9606 ! Homo sapiens[Term]id: PR:000026155name: serine palmitoyltransferase complex A (human)def: \"A serine palmitoyltransferase complex consisting of an unknown combination of the serinepalmitoyltransferase subunits 1-3. The stoichiometry is a tetramer composed of the serinepalmitoyltransferase core complexes 1 and/or 2.\" comment: Category = organism-complex. Entities of this type are disposed to have the enzymatic activity described by EC:2.3.1.50.is_a: GO:0017059 ! serine C-palmitoyltransferase complexrelationship: has_part PR:000026141 {cardinality = \"4\"}! serine palmitoyltransferase 1 (human)relationship: has_part PR:000026142 ! serine palmitoyltransferase 2 (human)relationship: has_part PR:000026143 ! serine palmitoyltransferase 3 (human)relationship: only_in_taxon taxon:9606 ! Homo sapiensThe protein complex stanza for the bacterial SPT complex PR:000026169) is shown below. The bacterial and human complexes differ in composition def: \"A homodimeric serine palmitoyltransferase complex that is composed of bacterial serine palmitoyltransferase encoded in the genome of Sphingobacterium multivorum.\" comment: Category = organism-complex. Entities of this type are disposed to have the enzymatic activity described by EC:2.3.1.50.is_a: GO:0002179 ! homodimeric serine palmitoyltransferase complexrelationship: has_part PR:000026168 {cardinality = \"2\"} ! bacterial serine palmitoyltransferase isoform 1 (Sphingobacterium multivorum)relationship: only_in_taxon taxon:28454 ! Sphingobacterium multivorum+ as a cofactor in the oxidative decarboxylation of isocitrate and one utilizes NAD+. The NAD+-dependent IDH is a mitochondrial protein complex in the citric acid cycle; it consists of three subunits , each of which is encoded by a single gene. The mouse alpha subunit gene encodes two different protein isoforms by alternative splicing. ProComp can distinguish between complexes that differ in the isoform of one of the constituents. As illustrated below (in bold), the protein complex stanzas from PRO describe two types of IDH complexes that differ only in the type of isoform of the alpha subunit. Both classes of isoform-specific protein complexes shown below (PR:000026072 and PR:000026073) are subclasses of the mouse-specific protein complex class (PR:000026071) which, in turn, is a subclass of the species-independent complex class defined in GO (GO:0005962).There are three types of isocitrate dehydrogenases (IDHs) in mammals; two IDHs utilize NADP[Term]id: PR:000026071name: mitochondrial isocitrate dehydrogenase complex (NAD+) (mouse)definition: A mitochondrial isocitrate dehydrogenase complex using NAD+ whose components are encoded in the genome of mouse [PRO:hjd]is_a:GO:0005962 ! mitochondrial isocitrate dehydrogenase complex (NAD+)relationship: has_part PR:000025358 ! isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial (mouse)relationship: has_part PR:000025359 ! isocitrate dehydrogenase [NAD] subunit beta, mitochondrial (mouse)relationship: has_part PR:000025360 ! isocitrate dehydrogenase [NAD] subunit gamma, mitochondrial (mouse)relationship: only_in_taxon taxon:10090! Mus musculus[Term]id: PR:000026072name: mitochondrial isocitrate dehydrogenase complex (NAD+) A (mouse)def: A mitochondrial isocitrate dehydrogenase complex using NAD+ whose components are encoded in the genome of mouse containing isoform 1 of subunit alpha\" [PRO:hjd]is_a:PR: 000026071! mitochondrial isocitrate dehydrogenase complex (NAD+) (mouse)relationship: has_part PR:000025355 ! isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial isoform 1 (mouse)relationship: has_part PR:000025359 ! isocitrate dehydrogenase [NAD] subunit beta, mitochondrial (mouse)relationship: has_part PR:000025360 ! isocitrate dehydrogenase [NAD] subunit gamma, mitochondrial (mouse)relationship: only_in_taxon taxon:10090 ! Mus musculus[Term]id: PR:000026073name:mitochondrial isocitrate dehydrogenase complex (NAD+) B (mouse)def: A mitochondrial isocitrate dehydrogenase complex using NAD+ whose components are encoded in the genome of mouse containing isoform 2 of subunit alpha\" [PRO:hjd]is_a:PR: 000026071! mitochondrial isocitrate dehydrogenase complex (NAD+) (mouse)relationship: has_part PR:000025356 ! isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial isoform 2 (mouse)relationship: has_part PR:000025359 ! isocitrate dehydrogenase [NAD] subunit beta, mitochondrial (mouse)relationship: has_part PR:000025360 ! isocitrate dehydrogenase [NAD] subunit gamma, mitochondrial (mouse)relationship: only_in_taxon taxon:10090! Mus musculushas_part statements that refer to \"either-or\" classes of proteins are used to represent uncertainty in a compact form with no loss of information. The union_of statement (highlighted by bold text in the stanza below) indicates which genes could code for a particular protein component. The union_of tag appears in the appropriate protein component stanzas, not in the protein complex stanza. These tags are shown below (as comments) for illustration purposes only.Cytochrome c oxidase, also known as Complex IV (EC 1.9.3.1), is a large transmembrane protein complex located in the inner mitochondrial membrane. Its function is sequestration of free radicals, coupled to the transport of protons across the inner mitochondrial membrane, which creates the proton gradient used by mitochondrial ATP synthase during ATP production. Although the function of Complex IV is well understood, the exact composition of the complex is not certain due to apparent genetic redundancy. Complex IV is composed of 13 polypeptides: three encoded in the mitochondrial genome, and ten encoded in the nuclear genome . The unc[Term]id: PR:000026295name: respiratory chain complex IV (mouse)def: A mitochondrial respiratory chain complex IV whose components are encoded in the genome of mouse. is_a: GO:0005751 ! mitochondrial respiratory chain complex IVrelationship: has_part PR:000025364 {cardinality = \"1\"} ! cytochrome oxidase subunit 1, mitochondrial (mouse)relationship: has_part PR:000025366 {cardinality = \"1\"} ! cytochrome oxidase subunit 2, mitochondrial (mouse)relationship: has_part PR:000025367 {cardinality = \"1\"} ! cytochrome oxidase subunit 3, mitochondrial (mouse)relationship: has_part PR:000026286 complex IV component 4 (mouse)! union_of: PR:000025368 ! Cox4i1! union_of: PR:000025369 ! Cox4i2relationship: has_part PR:000026294 {cardinality = \"1\"} ! cytochrome c oxidase subunit 5A, mitochondrial, transit peptide removed form (mouse)relationship: has_part PR:000025371 {cardinality = \"1\"} ! cytochrome c oxidase subunit 5B (mouse)relationship: has_part PR:000026287 {cardinality = \"1\"} ! complex IV component 6a (mouse)! union_of: PR:000025372 ! Cox6a1! union_of: PR:000025373 ! Cox6a2relationship: has_part PR:000026288 {cardinality = \"1\"} ! complex IV component 6b (mouse)! union_of: PR:000025374 ! Cox6b1! union_of: PR:000025375 ! Cox6b2relationship: has_part PR:000025376 {cardinality = \"1\"} ! cytochrome c oxidase subunit 6C (mouse)relationship: has_part PR:000026289 {cardinality = \"1\"} ! complex IV component 7A (mouse)! union_of: PR:000025377 ! Cox7a1! union_of: PR:000025378 ! Cox7a2! union_of: PR:000025379 ! Cox7a2lrelationship: has_part PR:000027496 {cardinality = \"1\"} ! complex IV component 7B (mouse)! union of PR:000027491 ! Cox7b! union of PR:000027489 ! Cox7b2relationship: has_part PR:000025383 {cardinality = \"1\"} ! cytochrome c oxidase subunit 7C, mitochondrial (mouse)relationship: has_part PR:000026290 {cardinality = \"1\"} ! complex IV component 8 (mouse)! union_of: PR:000025380 ! Cox8a! union_of: PR:000025381 ! Cox8b! union_of: PR:000025382 ! Cox8crelationship: only_in_taxon taxon:10090 ! Mus musculusWhile not illustrated in the use cases above, many PRO complexes have species-specific protein types of modified isoforms. A few examples are: (i) PR:000025933 smad2-smad4 protein complex 1 (human), which contains active phosphorylated form of smad2 (MAD homolog 2), (ii) PR:000026035 myc-max acetylated complex (human), where both myc (myelocytomatosis oncogene) and max (Max protein) are acetylated, and (iii) PR:000027084 IRF3-P:IRF7-P complex (human), which contains the active phosphorylated forms of IRF3 (interferon regulatory factor 3) and IRF7 (interferon regulatory factor 7).http://purl.obolibrary.org/obo/PR_000026144 is shown in Figure The web display of the ProComp stanza for the human SPT complex described above in Use Case 2 http://www.geneontology.org/GO.format.gaf-1_0.shtml. The PAF format consists of a standard header and 20 tab-delimited columns .The ProComp ontology provides species-specific, accessioned protein complex entities that support robust, context-specific annotation of protein biology . ComprehMCC; EC 6.4.1.4). Knowledge that mutations in human genes that encode the protein components of the MCC complex: MCCC1  and MCCC2 (subunit beta), cause methylcrotonylglycinuria type I (OMIM #210200) and methylcrotonylglycinuria type II (OMIM #210210), respectively, are represented in the PAF file  subunit is required for their proper functioning ,28. In mhttp://obi-ontology.org/) group on the development and application of an evidence code ontology to describe the evidence used to support protein complex assertions in ProComp, and with developers of the curation tools to enable capturing such evidence with appropriate granularity. Second, our current work records only protein monomer components of complexes facilitated by an interface that makes selection of the monomers and their identifiers manageable. However, as we note, protein complexes (such as Complex IV in Use Case 4) are known to have lipid, heme, and other co-factors as components. Extensions to our curation tools will be developed in order to select and include such components, identifiers for which are provided by, e.g., the Chemical Entities of Biological Interest (CheBI) ontology [has_agent and is_agent_in relations in our annotations to connect, provisionally, proteins with representation of sequence variation from the Sequence Ontology. However this does not agree with the formal definition in which these relations connect processes with their participants [has_part to relate a protein complex to its components and uses cardinality restriction to represent stoichiometry. However, because has_part is a transitive relation, the ontology falls outside OWL2-DL making it not possible to use standard reasoners. Thus, we are evaluating the possibility of replacing has_part with a new relation that is a non-transitive sub-property of the has_part relation. Finally, we will implement closure axioms that would more clearly define the number and kind of complex components. For example, our representation of Complex IV allows that there might be additional protein components because of the open world assumption. A closure axiom would assert that exactly 13 of the components of this complex are proteins, while still allowing that there might be other kinds of components.Improvements in the PRO ontology and annotation have come to light by our work on the use cases described in this manuscript. We outline a number of known issues that serve as the basis for future work. First, while the assertions in stanzas within PRO are intended to be backed by evidence, the distinction between experimental and inferential evidence (both legitimate) is not yet captured clearly. This is especially true in cases where the evidence for composition and stochiometry for protein complexes is derived from orthologous proteins and complexes in other organisms. Usefully recording such information, as we recognize is important, was hampered by deficits in our curation tools that made it impossible to record evidence for individual relations or, more specifically, cardinality. We are working with the Ontology for Biomedical Investigations  or text . Searches can be restricted to specific modified forms , database, or membership in a complex. PRO entries can also be accessed via hypertext links on gene detail pages in the Mouse Genome Informatics (MGI) database and from MouseCyc, Reactome, and EcoCyc. PRO (Release 20) contains 168 complexes drawn from Reactome (human), MouseCyc (mouse), EcoCyc (E. coli) and direct submissions from collaborating research groups. OBO Edit, an open source ontology editing tool http://oboedit.org/[The Protein Ontology resource can be accessed on-line edit.org/, can be http://purl.obolibrary.org/obo/pr.owl).Existing conversion tools allow for OBO-formatted ontologies to be converted into Web ontology language (OWL) ,33. The The authors declare that they have no competing interests.CJB, HD, AE, AR and PD researched and created protein complex stanzas for mouse and human. DN CA, and AR validated the ontology stanza formats and created the appropriate records in the PRO database. NR built software infrastructure to facilitate semi-automated acquisition of protein complex data from contributing databases. All authors contributed to the development of the formalisms to represent the classes of protein complexes illustrated in this manuscript. All authors participated in the writing of the manuscript. All authors read and approved the manuscript."}
{"text": "The 7th author's correct name is: Diane Wallace Taylor.The correct author contributions are: Conceived and designed the experiments: KLS ALC RGFL RJIL PG MEM DWT SJR KCK. Performed the experiments: KLS ALC. Analyzed the data: KLS ALC. Contributed reagents/materials/analysis tools: RGFL DWT MEM SJR KCK. Wrote the paper: KLS ALC KCK. Constructive review of manuscript: DWT MEM SJR."}
{"text": "The CIGS NCs of approximately 17 nm in diameter were homogeneously blended with P3HT layer to form an active layer of a photovoltaic device. The blend ratios of CIGS NCs to P3HT, solvent effects on thin film morphologies, interface between P3HT/CIGS NCs and post-production annealing of devices were investigated, and the best performance of photovoltaic devices was measured under AM 1.5 simulated solar illumination (100 mW/cm2).This work presents the systematic studies of bulk hybrid heterojunction solar cells based on CuSe Photovoltaic (PV) devices, converting photon into electricity as an elegant and clean renewable energy, have attracted tremendous attentions on research and developments. Among emerging PV technologies, organic photovoltaic devices (OPV) composed of polymer matrices can be considered as promising third-generation solar cell due to its exceptional mechanical flexibility for versatile applications ,2. Moreo2-Phenyl-C61 butyric acid methyl ester; PCE: Power-conversion efficiency; PEDOT/PSS: Poly-poly(styrenesulfonate); XRD: Powder X-ray diffraction; FTIR: Fourier transform infrared spectroscopy; HRTEM: High-resolution transmission electron microscopy; PL: Photoluminescence; FWHM: Full width at half maximum; Jsc: Short-circuit current; Voc: Opened circuit voltage; FF: Fill factor; OLA: Oleylamine; PYR: Pyridine.CIGS: CuSeThe authors declare that they have no competing interests.YKL carried out the device fabrication and drafted the manuscript; SHC synthesized the CIGS nanocrystals; HFH provided useful solutions to the experimental issues and helped to revise the draft; HYT participated in the design of the study; YTY participated in the sequence alignment and helped to draft the manuscript; YLC carried out the TEM analysis, conceived the study, and organized the final version of the paper. All authors read and approved the final manuscript."}
{"text": "The author contributions provided in the HTML and PDF versions of the article contain author initials from a different paper. The following are the correct author contributions for this article:Conceived and designed the experiments: BZ YYH QY. Performed the experiments: BZ YYH QY SWZ YW YXC DRX. Analyzed the data: YYH QY SWZ YW YXC DRX. Contributed reagents/materials/analysis tools: YYH QY SWZ YW YXC DRX. Wrote the paper: YYH QY."}
{"text": "There was an error in the author contributions section of the article. A correct version of the section is available below.Conceived and designed the experiments: AC JD LY. Performed the experiments: AC. Analyzed the data: AC. Wrote the manuscript: AC JD LY."}
{"text": "AbstractChilopoda) is proposed. Terms are selected from the alternatives used in the English literature, preferring those most frequently used or those that have been introduced explicitly. A total of 330 terms are defined and illustrated, and another ca. 500 alternatives are listed.A common terminology for the external morphological characters of centipedes ( Chilopoda).This contribution is intended to propose a common terminology for the external morphological characters of centipedes , because they have been documented only recently, by histology and scanning electron microscopy, so that a consistent terminology is available , 2008. OWe considered all publications in English dealing with centipedes since PageBreakTo maximize future applicability, alternative criteria of selection have been discussed with authors who are either currently the most active centipede systematists publishing descriptions in English and/or have already addressed issues of terminology standardization. In order to identify and recommend a single term for each character, we applied the following criteria: (i) we selected a term already used in the literature, except when all alternatives are either ambiguous or inconsistent with other selected terms; (ii) among alternatives, we selected either the term used most frequently (by most authors and/or in most publications) or the one explicitly introduced and defined by an influential author; (iii) we applied minor emendations to selected terms  when necessary for consistency and uniformity. We refrained from revising the terminology based on homology hypotheses with other arthropods , becauseMajor anatomical differences exist between the six centipede orders, five extant - Scutigeromorpha, Lithobiomorpha, Craterostigmomorpha, Scolopendromorpha, and Geophilomorpha - and one extinct, Devonobiomorpha. Morphological and taxonomical investigations by different authors have sometimes been and still are limited to single orders, leading to different terminological traditions. While we propose a consistent terminology for the entire class, we specify the order(s) to which each term is applicable to facilitate usage by students interested in single orders; when no orders are specified, it is meant that the term is applicable to all orders; when an order is specified, it is meant that the term is applicable to at least some taxa in the order.After reviewing the relevant literature as explained above, we retrieved roughly 830 terms that apply to 330 anatomical features. By applying the criteria described above, we obtained the recommended terminology presented herein.PageBreakby a slash; listed alphabetically, without an implicit ranking). An alphabetical index of all recommended and synonymous terms is provided in the additional file: Analytical index. Abbreviations for orders are: Cra (Craterostigmomorpha), Dev (Devonobiomorpha), Geo (Geophilomorpha), Lit (Lithobiomorpha), Sco (Scolopendromorpha), and Scu (Scutigeromorpha).Terms for surface depressions and projections are provided in cephalic capsule: integument of the head to the exclusion of its appendages. cephalic plate:  dorsal side of the cephalic capsule. median sulcus:  mid-longitudinal sulcus on the anterior part of the cephalic capsule.  transverse suture: transverse suture on the anterior part of the dorsal side of the cephalic capsule.  anterior projection/projections of the transverse suture: [Scu] one of the paramedian sutures projecting anteriorly from the cephalic transverse suture. Fig. 3antennocellar suture/sutures:  one of the paired sutures on the antero-lateral parts of the cephalic capsule. antennal branch/branches of antennocellar suture:  part of the antennocellar suture, anterior to the cephalic transverse suture. Syn.: anterior portion/portions of antennocellar sutureocellar branch/branches of antennocellar suture:  part of the antennocellar suture, posterior to the cephalic transverse suture. Syn.: posterior portion/portions of antennocellar suture, posterior limb/limbs of  transverse suturefrontal plate: anterior part of the dorsal side of the cephalic capsule, delimited posteriorly by the cephalic transverse suture. ocellar area/areas:  one of the paired antero-lateral parts of the cephalic capsule, bearing compound eyes or ocelli when present, and delimited mesally by the antennocellar suture. compound eye/eyes: [Scu] faceted vision organ, composed of similar units known as ommatidia. Fig. 3ocellus/ocelli:  simple vision organ, appearing as a single convex lens. Fig. 5posterior ocellus/ocelli: [Lit] the most posterior ocellus on each side of the head. seriate ocellus/ocelli: [Lit] one of the ocelli other than the posterior ocellus. ocellar series/series: [Lit] one of the sub-horizontal rows in which the seriate ocelli can be arranged. Syn.: ocellar row/rowsposterosuperior ocellus/ocelli: [Lit] the most posterior ocellus of the most dorsal row of seriate ocelli. Fig. 5PageBreakPageBreakT\u00f6m\u00f6sv\u00e1ry\u2019s organ/organs:  hygroreceptor sensory organ at the side of the head. paramedian suture/sutures: [Sco] one of the paired paramedian sutures on the cephalic plate. Fig. 6 paramedian sulcus/sulci:  one of the paired paramedian sulci on the posterior part of the cephalic plate.  marginal ridge:  narrow ridge along the lateral and posterior margins of the dorsal side of the cephalic capsule.  marginal sulcus/sulci:  sulcus between the marginal ridge and the remaining part of the dorsal side of the cephalic capsule. Fig. 1 lateral marginal interruption/interruptions : [Lit] notch on the lateral margins of the cephalic plate. basal plate/plates: [Sco] one of the paired sclerites at the posterior corners of the cephalic plate. Fig. 6 cephalic pleurite/pleurites:  one of the pleurites lateral to the clypeolabrum. transverse suture/sutures : [Geo] transverse suture on the cephalic pleurite. stilus/stili: [Geo] sclerotised ridge on the mesal margin of the cephalic pleurite. anterior incision/incisions (of stilus): [Geo] notch on the mesal side of the stilus. spiculum/spicula: [Geo] sclerotised, pointed projection on the anterior part of the cephalic pleurite. maxillary complex: whole of first and second maxillaeantenna/antennae: one of the paired most anterior appendages on the head. Fig. 1article/articles: one of the rigid sectors along the antenna.  scape/scapes: [Scu] set of the two most basal antennal articles. Fig. 10annulation/annulations: [Scu] short antennal article.  PageBreakPageBreakflagellum/flagella: [Scu] one of the sections along the antenna composed of annulations. node/nodes: [Scu] elongate antennal article between two flagella along the antenna. Fig. 11 first flagellum/flagella: [Scu] the most basal flagellum along the antenna. second flagellum/flagella: [Scu] the second flagellum along the antenna. third flagellum/flagella: [Scu] the third flagellum along the antenna. shaft organ/organs: [Scu] sensory organ on the first antennal articleclypeolabrum: antero-ventral part of the cephalic capsule, posterior to the antennae and between the cephalic pleurites. Fig. 7clypeus: sclerite on the antero-ventral part of the cephalic capsule, to the exclusion of the labrum. Fig. 12paraclypeal suture/sutures: one of the lateral margins of the clypeus. scute/scutes: area on the cuticle, corresponding to the external face of a single epithelial cell. areolate part: [Geo] anterior part of the clypeus that is evidently areolate.  plagula/plagulae: [Geo] one of the non-areolate areas on the posterior part of the clypeus. mid-longitudinal areolate strip: [Geo] mid-longitudinal areolate band separating two paired plagulae. clypeal insula/insulae: [Geo] non-areolate area inside the areolate part of the clypeus. Fig. 9clypeal area/areas: [Geo] small, subcircular, median area on the areolate part of the clypeus, with distinctly finer or indistinct areolation. clypeolabral suture: suture between clypeus and labrum. Fig. 12labrum: posterior part of the clypeolabrum, sometimes delimited from the clypeus by a suture. mid-piece: median sclerite of the labrum.  PageBreakintermediate part: [Geo] median part of the labrum, when not a sclerite distinct from the lateral parts.  mid-piece tooth: sclerotised tooth on the labral mid-piece. Fig. 13 side-piece/side-pieces: one of the paired lateral sclerites of the labrum.  lateral part/parts: [Geo] one of the paired lateral parts of the labrum, when not sclerites distinct from the intermediate part.  ala/alae: [Geo] one of the two sclerites composing the labral side-piece. Fig. 8 anterior ala/alae: [Geo] the anterior of the two sclerites composing the labral side-piece. Fig. 8 posterior ala/alae: [Geo] the posterior of the two sclerites composing the labral side-piece. Fig. 8 transverse thickened line/lines: [Geo] sclerotised ridge between the anterior and posterior ala of the labral side-piece. Fig. 8 median arc: [Geo] concave posterior margin of the labral intermediate part.  bristle/bristles: hair-like, sometimes branching, projection along the posterior margin of the labrum.  denticle/denticles: [Geo] subtriangular, flat projection along the posterior margin of the labrum.  tubercle/tubercles: [Geo] subconical, stout projection along the posterior margin of the labrum.  paralabial sclerite/sclerites:  one of the paired sclerites posterior to the clypeus and lateral to the labral side-pieces. tentorium/tentoria: Y-shaped sclerite whose three limbs are attached to the labral lateral parts, the cephalic pleurite, and the mandibular condyle, respectively. mandible/mandibles: one appendage of the first pair of the mouth-parts. Fig. 13mandibular condyle/condyles: condyle of the mandible serving the articulation with the tentorium. Fig. 15gnathal edge/edges: distal margin of the mandible. manubrium/manubria: slender projection of the mandible opposite to the gnathal edge with respect to the mandibular condyle. PageBreaktrunk/trunks: main part of the mandible, to the exclusion of the manubrium and the gnathal edge. (mandibular) cruciform suture/sutures: [Sco] pair of crossed sutures on the mandibular trunk. (mandibular) lamina/laminae manubrii: [Sco] part of the mandible between manubrium and cruciform suture. lamina/laminae triangularis/triangulares: [Sco] part of the mandible between the lamina manubrii and the lamina dentifera, opposite to the lamina condylifera with respect to the cruciform suture. lamina/laminae dentifera/dentiferae: [Sco] part of the mandible between apical ridge and cruciform suture. lamina/laminae condylifera/condyliferae: [Sco] part of the mandible between the lamina manubrii and the lamina dentifera, including the mandibular condyle and opposite to the lamina triangularis with respect to the cruciform suture. molar plate/plates: [Scu] sclerotised, flat area on the gnathal edgepulvillus/pulvilli: array of dense short scales on the dorsal end of the mandibular gnathal edge. acicula/aciculae: one of the slender long projections on the ventral end of the mandibular gnathal edge. (mandibular) pinnule/pinnules (of acicula): one of the branches of a mandibular aciculabranching bristle/bristles: [Lit] hair-like, branching projection fringing the mandibular teeth and aciculae(mandibular) accessory denticle/denticles:  one of the denticles arranged in rows on the mandibular teeth(mandibular) lamella/lamellae: one of the flat projections on the gnathal edge of the mandible. (mandibular) dentate lamella/lamellae: mandibular lamella bearing teeth. (mandibular) tooth/teeth: sclerotised, large, subconical, projection on a mandibular dentate lamella. Fig. 15(mandibular) tricuspid tooth/teeth: tooth with three tips on a dentate lamella. Fig. 16(mandibular) block/blocks: one of the sclerotised distinct parts of a dentate lamella, each bearing one or more teeth. Fig. 17(mandibular) pectinate lamella/lamellae:  mandibular lamella bearing poorly sclerotised, subcylindrical, slender projections. (mandibular) basal tooth/teeth: [Geo] subconical projection at the base of the first mandibular lamella(mandibular) PageBreakPageBreakfirst maxillae {plural only}: pair of appendages and associated basal sclerites between the mandibles and the second maxillae. sternite: most basal part of the coxosternite, associated with the first maxillae(first maxillary) coxa/coxae: part of the coxosternite corresponding to a coxa, of the first maxillae(first maxillary) coxosternite: entire sclerite corresponding to sternite and coxae of the first maxillae. (first maxillary) lateral incision: [Geo] notch on the lateral margin of the first maxillary coxosternite. (first maxillary) coxal projection/projections: one of the paired projections on the anterior margin of the first maxillary coxosternite, mesal to the telopodites. (first maxillary) telopodite/telopodites: one of the paired projections, usually articulated at the base, on the anterior margin of the first maxillary coxosternite, lateral to the coxal projections. (first maxillary) basal article/articles: the most basal article of the first maxillary telopodite. (first maxillary) distal article/articles: the most distal article of the first maxillary telopodite. (first maxillary) plumose bristle/bristles: [Lit] one of the feather-like projections on the distal article of the first maxillary telopodite. Fig. 21(first maxillary) pad/pads: [Sco] array of short, dense projections on the distal article of the first maxillary telopodite. Fig. 22(first maxillary) lappet/lappets: [Geo] projection on the lateral margin of the first maxillary coxosternite or telopodite. (first maxillary) coxosternal lappet/lappets: [Geo] lappet on the first maxillary coxosternite. (first maxillary) telopodital lappet/lappets: [Geo] lappet on the basal article of the first maxillary telopodite. (first maxillary) PageBreakPageBreaksecond maxillae {plural only}: pair of appendages and associated basal sclerite/s, posterior to the first maxillae. coxosternite: entire sclerite corresponding to sternite and coxae of the second maxillae. (second maxillary) isthmus: median part of the second maxillary coxosternite. Fig.\u00a024(second maxillary) setigerous insula/insulae: [Geo] one of the nonareolate areas, bearing setae, inside the areolate part of the second maxillary coxosternite. Fig. 20(second maxillary) metameric pore/pores: one of the paired pores of the maxillary glands on the second maxillary coxosternite. foraminal process/processes: [Geo] marginal projection of the second maxillary coxosternite surrounding the metameric pore. Fig. 20statumen/statuminia: [Geo] sclerotised elongated ridge mesal to the metameric pore. parastatuminial suture/sutures: [Geo] suture along the statumen. circumforaminal ring/rings: [Geo] sclerotised ring partially surrounding the metameric poreinner process/processes (of second maxillary coxosternite): [Geo] one of the paired projections on the anterior margin of the second maxillary coxosternite, mesal to the telopodites. postmaxillary sclerite/sclerites:  one of the paired sclerites adjacent to the posterior corners of the second maxillary coxosternite. telopodite/telopodites: part of the appendage of the second maxillae, distal to the most basal articulation. (second maxillary) trochanter/trochanters: [Scu] first article of the second maxillary telopodite. Fig. 25(second maxillary) prefemur/prefemora: [Scu] second article of the second maxillary telopodite. Fig. 25(second maxillary) femur/femora: [Scu] third article of the second maxillary telopodite. Fig. 25(second maxillary) tibia/tibiae: [Scu] fourth article of the second maxillary telopodite. Fig. 25(second maxillary) tarsus/tarsi: [Scu] fifth article of the second maxillary telopodite. Fig. 25(second maxillary) PageBreakarticle/articles 1:  first article of the second maxillary telopodite. (second maxillary) article/articles 2:  second article of the second maxillary telopodite. (second maxillary) article/articles 3:  third article of the second maxillary telopodite. (second maxillary) plumose seta/setae: [Lit] one of the setae with apical branches, on article 3 of the second maxillary telopodite. Fig. 26(second maxillary) dorsal brush/brushes:  longitudinal row of hairs on article 3 of the second maxillary telopodite. (second maxillary) pretarsus/pretarsi:  terminal element articulated to the most distal article of the second maxillary telopodite. (second maxillary) claw/claws:  second maxillary pretarsus in shape of a claw. (second maxillary) digit/digits (of second maxillary claw):  one of the short projections on the second maxillary claw. Fig. 26comb/combs (of second maxillary claw):  row of projections along the margin of the second maxillary claw. filament/filaments (of second maxillary claw):  one of the slender projections of the comb of the second maxillary claw. Fig. 18forcipular segment: segment bearing the forcipules. forcipular pretergite:  short sclerite anterior to the forcipular tergite. forcipular tergite: main tergite of the forcipular segment. forcipular pleurite/pleurites: lateral sclerite of the forcipular segment. scapula/scapulae: [Geo] dorsal ridge of the forcipular pleurite. Fig. 27(forcipular) scapular point/points: [Geo] projecting anterior tip of the forcipular scapula. (forcipular) PageBreakcollar: [Lit] ventral transversal bridge connecting the forcipular pleurites. (forcipular) coxa/coxae: [Scu] one of the paired sclerites basal to the forcipules, bearing spine-bristles on the anterior margin. (forcipular) coxosternite:  entire sclerite corresponding to sternite and coxae of the forcipular segment. (forcipular) coxopleural suture/sutures: suture between the forcipular pleurite and the forcipular coxae or coxosternite. (forcipular) coxosternal condyle/condyles: condyle of the forcipular coxa or coxosternite serving the articulation with the trochanteroprefemur. cerrus/cerri: [Geo] one of the paired groups of setae on the dorsal side of the forcipular coxosternite.  condylar process/processes: [Geo] one of the paired projections of the forcipular coxosternite, close to the dorsal coxosternal condyles shoulder/shoulders (of forcipular coxosternite): [Lit] one of the paired obtuse projections on the anterior margin of the forcipular coxosternite. median diastema:  median concavity on the anterior margin of the forcipular coxosternite.  tooth/teeth:  sclerotised, short, subconical projection on the anterior margin of the forcipular coxosternite.  tooth-plate/tooth-plates:  one of the paired sclerotised, flat, teeth-bearing projections on the anterior margin of the forcipular coxosternite.  denticle/denticles: [Geo] one of the paired small, subconical projections on the anterior margin of the forcipular coxosternite.  porodont/porodonts: [Lit] one of the paired large setae usually placed lateral to the forcipular coxosternal teeth. porodont node/nodes: [Lit] basal structure from which the porodont arisesmedian cleft: [Lit] mid-longitudinal suture on the ventral side of the forcipular coxosternite.  chitin-line/chitin-lines: [Geo] one of the paired paramedian sclerotised narrow stripes on the ventral side of the forcipular coxosternite. PageBreakSyn.: chitinous line/lines, pleurogram/pleurograms,  (subcondylic) sclerotic line/linesPageBreakmedian embayment:  median notch at the posterior margin of the forcipular coxosternite.  forcipule/forcipules: telopodite of the forcipular segment. trochanteroprefemur/trochanteroprefemora: first article of the forcipule. (forcipular) trochanteral suture/sutures: trace of suture on the forcipular trochanteroprefemur. Fig. 29(forcipular) intermediate article/articles: one of the second and third articles of the forcipule. Syn.: intercalary article/articles, intermediate joint/joints(forcipular) femur/femora: second article of the forcipule. (forcipular) tibia/tibiae: third article of the forcipule. (forcipular) tarsus/tarsi: [Scu] fourth article of the forcipule. (forcipular) ungulum/ungula: [Scu] terminal articulated element of the forcipule. tarsungulum/tarsungula:  ultimate article of the forcipule. (forcipular) process/processes of (forcipular) tronchanteroprefemur:  large projection on the mesal side of the forcipular trochanteroprefemur. denticle/denticles: [Geo] small subconical projection on the mesal side of the forcipule. (forcipular) proximal denticle/denticles (of trochanteroprefemur): [Geo] the most basal of two denticles along the mesal side of the forcipular trochanteroprefemur. distal denticle/denticles (of trochanteroprefemur): [Geo] the most distal of two denticles along the mesal side of the forcipular trochanteroprefemur. Fig. 27basal denticle/denticles (of tarsungulum): [Geo] denticle at the base of the forcipular tarsungulum. spine comb/combs: [Scu] row of spines on the forcipular tarsus(forcipular) PageBreakleg-bearing segment/segments: segment of the trunk bearing paired walking appendages. tergite/tergites (of leg-bearing segment): sclerite on the dorsal side of a leg-bearing segment. stomatotergite/stomatotergites: [Scu] tergite bearing a stoma. Fig. 35stoma/stomata: [Scu] elongate opening of the respiratory organs on the posteromedian part of a stomatotergite. stoma-saddle/stoma-saddles: [Scu] domed region of the stomatotergite surrounding the stoma. margination/marginations (of tergite):  marginal ridge on a tergite. posterior triangular projection/projections (of tergite): [Lit] angulated projection on each posterior corner of a tergite. pretergite/pretergites:  anterior sclerite of the two dorsal sclerites of a leg-bearing segment. metatergite/metatergites:  posterior sclerite of the two dorsal sclerites of a leg-bearing segment. paramedian sulcus/sulci or suture/sutures (of tergite):  one of the paired paramedian longitudinal sutures or sulci on a tergite. transverse sulcus/sulci or suture/sutures (of tergite): [Sco] transverse suture or sulcus on the first trunk tergite. (anterior) cruciform suture/sutures (of tergite): [Sco] pair of crossed sutures on the first trunk tergite. Fig. 33oblique suture/sutures (of tergite): [Sco] one of the paired oblique sutures on some anterior trunk tergites. lateral longitudinal suture/sutures (of tergite): [Sco] one of the paired longitudinal sutures close to the lateral margins of a tergite. lateral crescentic sulcus/sulci (of tergite): [Sco] one of the paired curved, sublongitudinal sulci on a tergite. eupleurium/eupleuria: the whole of pleurites on a side of a leg-bearing segment. pleural membrane/membranes: arthrodial membrane between pleuritesparatergite/paratergites: [Geo] pleurite contiguous or almost contiguous to a tergite. Fig. 36intercalary paratergite/paratergites: [Geo] paratergite lateral to a pretergite. primary intercalary paratergite/paratergites: [Geo] the most mesal of two intercalary paratergites. secondary intercalary paratergite/paratergites: [Geo] the most distal of two intercalary paratergites. principal paratergite/paratergites: [Geo] paratergite lateral to a metatergite. scutellum/scutella:  pleurite in antero-ventral position with respect to the stigmatopleurite. spiracle/spiracles:  one of the paired openings of the tracheae on the lateral sides of a leg-bearing segment. stigmatopleurite/stigmatopleurites:  pleurite bearing a spiracle. catapleurite/catapleurites: pleurite between the scutellum and the coxa. eucoxa/eucoxae superior/superiores: [Lit] pleurite dorsal to the coxaeucoxa/eucoxae inferior/inferiores: [Lit] pleurite ventral to the coxapleurocoxa/pleurocoxae: [Geo] pleurite between coxa and metacoxasubcoxa/subcoxae:  pleurite anterior or posterior to the coxa. Syn.: subcoxal pleurite/pleuritesprocoxa/procoxae:  subcoxa anterior to the coxa. metacoxa/metacoxae:  subcoxa posterior to the coxa. sternite/sternites (of leg-bearing segment): sclerite on the ventral side of a leg-bearing segment. presternite/presternites:  anterior region of the single sternite of a leg-bearing segment, or anterior sclerite of the two ventral sclerites of a leg-bearing segment. metasternite/metasternites:  posterior region of the single sternite of a leg-bearing segment, or posterior sclerite of the two ventral sclerites of a leg-bearing segment. transverse sulcus/sulci (of sternite): [Sco] transverse sulcus on a sternite. median longitudinal sulcus/sulci (of sternite): [Sco] mid-longitudinal sulcus on a sternite. cruciform suture/sutures (of sternite): [Sco] the pair of transverse and median longitudinal sulci on a sternite. trigonal suture/sutures (of sternite): [Sco] pair of crossed sutures on the posterior part of the sternite. endosternite/endosternites:  posterior projection of a sternite, covered by the sternite of the following segment. carpophagus peg/pegs: [Geo] median projection on the posterior margin of a sternite, in the carpophagus-structure. carpophagus pit/pits: [Geo] median socket on the anterior margin of a sternite, in the carpophagus-structure. carpophagus-structure/carpophagus-structures: [Geo] whole of a carpophagus peg and the associated carpophagus pit. Fig. 37ventral pore/pores: [Geo] glandular pore on the ventral side of a leg-bearing segment. pore-field/pore-fields: [Geo] an area of clustered pores on the ventral side of a leg-bearing segment.  sternobothrium/sternobothria: [Geo] median horseshoe-like pit on the metasternite. Fig. 40transverse fossa/fossae (of sternite): [Geo] transverse, ellipical depression on some trunk sternites. fungiform fovea/foveae: [Geo] median T-like pit on the metasternitevirguliform fossa/fossae: [Geo] comma-like pit at each of the anterior corners of a sternite. lateral gutter/gutters (of sternite): [Geo] longitudinal groove along the lateral margin of a sternite. leg/legs: one of the paired appendages of the trunk to the exclusion of the forcipules and the gonopods. cursiped/cursipeds: [Lit] a leg of the pairs 1\u201313. tenaciped/tenacipeds: [Lit] a leg of the pairs 14\u201315. PageBreakarticle/articles: one of the articulated elements of a leg. (leg) coxa/coxae: the most basal article of a leg. Fig. 38(leg) trochanter/trochanters: small, basalmost article of a telopodite. Fig. 38(leg) prefemur/prefemora: second article of a telopodite. (leg) femur/femora: third article of a telopodite. Fig. 43(leg) tibia/tibiae: fourth article of a telopodite. (leg) tarsus/tarsi: fifth article of a telopodite, when ultimate. Fig. 43(leg) tarsal article/articles: one of the articles of a biarticulated region of the leg corresponding to the tarsus. Syn.: tarsalium/tarsalia, tarsomere/tarsomerestarsus/tarsi 1: the basal article of two tarsal articles. tarsus/tarsi 2: the distal article of two tarsal articles. annulation/annulations:  each part of a tarsal article, between two contiguous constrictions.  carina/carinae: [Scu] longitudinal ridge on a leg article. tarsal papilla/papillae: [Scu] relatively short, stout projection with a rounded tip, on the ventral side of tarsus 2. resilient sole-hair/sole-hairs: [Scu] one of the paired hairs thickened at the base, on the ventral side of the leg, originating near the posteromedian margin of each tarsal papilla. spur/spurs:  spur on legs. (leg) distal spinose projection/projections (of tibia): [Lit] spinous process at the distal end of the tibia of a leg. pectinal seta/setae: [Lit] one of the decumbent setae arranged in rows along the tarsal articles of legs. pecten/pectines: [Lit] row of pectinal setae.  pretarsus/pretarsi: apical element articulated at the tip of a leg. claw/claws: pretarsus in shape of a claw. PageBreakfundus/fundi (of claw): basal, swollen part of a claw. unguis/ungues proper: distal, slender part of a claw. accessory spine/spines: slender, pointed projection at the base of the claw. anterior accessory spine/spines: the anterior accessory spine of two of a claw. posterior accessory spine/spines: the posterior accessory spine of two of a claw. posteroventral spine/spines: [Lit] the largest of a pair of spines emerging on the ventro-posterior side at the base of a claw, close to the posterior accessory spine.  subsidiary spine/spines: [Lit] the smallest of a pair of spines emerging on the ventro-posterior side at the base of a claw, close to the posterior accessory spine.  fibulunguis/fibulungues: [Geo] pretarsus with a large projection flanking the unguis proper. penultimate leg/legs: leg of the penultimate pair. ultimate leg-bearing segment: leg-bearing segment bearing the ultimate pair of legs. ultimate pretergite: [Geo] pretergite of the ultimate leg-bearing segment. Fig. 50intercalary pleurite/pleurites: [Geo] pleurite contiguous to the ultimate pretergite. pleuropretergite: [Geo] entire sclerite corresponding to the ultimate pretergite and the two intercalary pleurites. Fig. 49(ultimate) tergite (or metatergite) of the ultimate leg-bearing segment: main tergite of the ultimate leg-bearing segment. ultimate presternite: [Geo] presternite of the ultimate leg-bearing segment. Fig. 51sternite (or metasternite) of the ultimate leg-bearing segment: main sternite of the ultimate leg-bearing segment. PageBreakPageBreakultimate leg/legs: one of the legs of the ultimate pair. coxopleuron/coxopleura:  basal element of the ultimate leg, corresponding to coxa and pleurites. coxopleural process/processes: [Sco] posterior process of the coxopleuron. spine/spines: [Sco] spine on the coxopleuron.  side spine/spines: [Sco] spine on the posterior margin of the coxopleuron mesal to the coxopleural process.  coxal pore/pores:  one of the pores of the coxal organs on posterior legs. macropore/macropores: [Geo] coxal pore that is distinctly larger than the other pores. Fig. 51gutter-like depression/depressions: [Lit] depressed area on the coxopleuron containing the openings of the coxal organs. Fig. 53 pit/pits: [Geo] pit on the coxopleuron, containing the openings of the coxal organs.  fossa/fossae: [Geo] longitudinal pouch close to the mesal margin of the coxopleuron, containing the openings of the coxal organs. Syn.:  cavity/cavities,  fossula/fossulae pore-field/pore-fields:  part of the surface of the coxa or coxopleuron of the ultimate legs containing the coxal pores.  prefemoral spine/spines: [Sco] spine on the prefemur of ultimate and/or penultimate legs. prefemoral (spinous) process/processes: [Sco] process, usually bearing spines, on the prefemur of the ultimate legs. corner spine/spines: [Sco] spine on the distal end, on the mesal side, of the prefemur of ultimate legs. saw tooth/teeth: [Sco] one of the bluntly pointed projections arranged in rows on the tibia and tarsus 1 of ultimate legs. ultimate pretarsus/pretarsi: pretarsus of the ultimate leg. Fig. 56PageBreakPageBreakpostpedal segments {plural only}: part of the trunk posterior to the ultimate leg-bearing segment. intermediate tergite: [Lit] tergite posterior to the tergite of the ultimate leg-bearing segment, corresponding to the intermediate sternite. intermediate sternite: sternite between the sternite or metasternite of the ultimate leg-bearing segment and the first genital sternite. Fig. 54intermediate pleurite/pleurites: [Geo] one of the two pleurites flanking the intermediate sternite. Fig. 54first genital tergite: [Lit] tergite posterior to the intermediate tergite, corresponding to the first genital sternite. Fig. 57first genital sternite: sternite between the intermediate sternite and the second genital sternite, usually associated with gonopods. first genital pleurite/pleurites: one of the two pleurites flanking the first genital sternite. first genital pleurosternite: entire sclerite corresponding to the first genital sternite and the relevant pleurites. Fig. 58first genital coxite/coxites: [Scu] one of the paired sclerites lateral to the first genital sternite. Fig. 59second genital sternite: sternite posterior to the first genital sternite. gonopod/gonopods: one of the paired appendages usually associated with the first or the second genital sternite. style/styles: [Scu] styliform male gonopod. Fig. 60 proarthron: [Scu] basal part of the complex of the paired female gonopods, composed of the basal contiguous parts of the basal articles of the gonopods. Fig. 59depression/depressions of proarthron: [Scu] one of the paired depressions on the proarthron. Fig. 59mesarthron: [Scu] median part of the complex of the paired female gonopods, composed of the distal separated parts of the basal articles of the gonopods. Fig. 59sinus of mesarthron: [Scu] concave median posterior margin of the mesarthron. Fig. 59metarthron: [Scu] terminal part of the complex of the paired female gonopods. Fig.\u00a059syntelopodite: [Scu] coalescent pair of female gonopod telopodites. Fig. 59 first article/articles:  basal article of the gonopod.  telopodite/telopodites: [Lit] articles of the gonopod other than the first article. Fig. 61 third article/articles: [Lit] third article of the gonopod.  claw/claws: [Lit] apical claw of the female gonopod. Fig. 61 spur/spurs: [Lit] spur on the female gonopod.  plinth/plinths: [Lit] swollen projection bearing a gonopodal spur. Fig.\u00a061 papilla/papillae: [Lit] relatively short, stout projection with a rounded tip, on the gonopod supplementary spur/spurs: [Lit] spur on the female gonopod other than those invariantly present lateral denticle/denticles : [Lit] one of the denticles on one or both sides of a gonopodal claw. gonopodal lamina: [Geo] entire median projection, corresponding to the paired female gonopods. penis: median projection bearing the male genital pore. postpedal tergite: the most posterior tergite of the trunk. lamina adanalis: [Sco] median dorsal flat projection on the posterior tip of the female body. lamina subanalis: [Sco] median ventral flat projection on the posterior tip of the female body. Fig. 63subanal plate/plates: [Scu] one of the paired ventrolateral sclerites in the telson. Fig.\u00a059anogenital capsule: [Cra] terminal, capsule-like part of the trunk. anal pore/pores:  one of the pores of the anal organs, on the ventro-lateral sides of the telson. anal valve/valves: one of the paired rounded flat projections on the ventral side of the telson. Fig. 58Conventional abbreviations recommended for describing particular elements and patterns of elements are described below.Antennal articles in Geophilomorpha. Each article is indicated by a Roman number, from the most basal article (I) to the most distal one (XIV).PageBreakArrangement of ocelli in Lithobiomorpha. The number of ocelli in different rows are indicated from the most dorsal row to the most ventral row, separated by commas .Pattern of teeth on the anterior margin of the forcipular coxosternite in Lithobiomorpha and on the tooth-plates in Scolopendromorpha. The number of teeth is indicated for the right and the left side, separated by a plus [nright + nleft].Leg-bearing segments and pairs of legs. Each leg-bearing segment, or the corresponding pair of legs, is indicated by an Arabic number, from the most anterior one (1) to the most posterior one.Tergites and sternites of the leg-bearing segments. Each tergite and sternite is indicated by T and S respectively , followed by an Arabic number, from the most anterior ones (T1 and S1) to the most posterior ones.Arrangement of spurs on the legs in Lithobiomorpha  are indicated in parentheses. Spurs that could be present on one side only are marked by an asterisk. Additional spurs are indicated by the abbreviation of their position  typed as a superscript to the corresponding spur . Legs with the same plectrotaxy in both ventral and dorsal side can be indicated in distinct rows or in a single, common line. This convention was first proposed by Pattern of coxal pores on the legs in Lithobiomorpha. The number of coxal pores is indicated from anterior to posterior legs, without separation between the numbers [\u2026n13n14n15]."}
{"text": "Following the publication of our article, an erroThe GenBank accession number was incorrectly stated as:EX721840Forward primer: CCCTGTGGAAGTGGCTGAAGReverse primer: CATCCAAGGGTCCGTATCTCTTThe correct GenBank accession number should be:EX722124 Forward primer: CGGTATCCTCAAGCCCAACA Reverse primer: GTCAGAGACTCGTGGTGCATCTWe apologise for any inconvenience this may have caused."}
{"text": "The SLE Subcommittee of the Childhood Arthritis and Rheumatology Research Alliance (CARRA) is developing standardized treatment plans for proliferative lupus nephritis (LN) in childhood-onset SLE (cSLE) which will serve as the basis for future comparative effectiveness studies. The Initial Delphi survey revealed wide variability in the treatment of LN in cSLE. This abstract decribes the process of developing standardized evidence-based induction treatment plans for LN in cSLE by using consensus methods.A consensus conference attended by 12 trainees and 42 voting members of the CARRA SLE Subcommittee was conducted to discuss the components of the LN treatment plan for which there was wide variability and poor agreement. After the face-to-face conference, a second online survey focusing on management aspects of the induction therapy for LN was sent to the 42 voting members of the SLE Subcommittee of CARRA to resolve remaining issues. Consensus was defined at 70%.[see Figure A] Consensus was attained on: a) inclusion and exclusion criteria; b) primary and secondary outcome measures; and c) time-points for assessing patient response. No consensus was reached on the following points: a) age cut-off for the definition of childhood-onset SLE; b) need for SLE-specific quality of life measure; and c) measures of adherence to be utilized. These are being addressed through subsequent surveys.At the conference, two immunosuppressive treatment options for the 6-month induction phase, cyclophosphamide and mycophenolate mofetil, were selected. Three steroid regimens  with corresponding tapering schedules were developed to reduce variability in steroid exposure Several important consensus points were achieved in the development of induction treatment plans for proliferative lupus nephritis in childhood-onset SLE. Further refinement of these treatment plans and development of plans for maintenance therapy are needed to allow their use in future studies aimed at optimizing therapy for lupus nephritis.Rina Mina: NIH, 2; Hermine Brunner: NIAMS-NIH, 2; Barbara Anne Eberhard: None; Marilynn G. Punaro: None; Stacy P. Ardoin: None; Marisa S. Klein-Gitelman: None; Linda Wagner-Weiner: None; Lakshmi N. Moorthy: None; Joyce J. Hsu: None; Eyal Muscal: None; Suhas M. Radhakrishna: None; Laura E. Schanberg: Pfizer Inc, 2; Carol A. Wallace: None; Norman T. Ilowite: None; Emily Von Scheven: None."}
{"text": "Following the publication of our article  we becamDMAJNCHD: Date of above (days elapsed from randomisation)DSIDED: Date of above (days elapsed from randomisation)DRSISCD: Date of above (days elapsed from randomisation)DRSHD: Date of above (days elapsed from randomisation)DRSUNKD: Date of above (days elapsed from randomisation)DPED: Date of above (days elapsed from randomisation)DALIVED: Date of above (days elapsed from randomisation)DDEADD: Date of above (days elapsed from randomisation)FLASTD: Date of last contact (days elapsed from randomisation)FDEADD: Date of death (days elapsed from randomisation)FU1_RECD: Date discharge form received (days elapsed from randomisation)FU2_DONE: Date 6 month follow-up done (days elapsed from randomisation)FU1_COMP: Date discharge form completed (days elapsed from randomisation).http://datashare.is.ed.ac.uk/). Both this corrected and the erroneous version of the dataset are available to allow comparison with any previous analyses of the data. The corrected submission states clearly that it supersedes an earlier one.These errors, that were introduced in the process of anonymisation, have now been corrected in the final, double checked version of the dataset, which is also available at the University of Edinburgh repository (see"}
{"text": "The involvement of particulate matter (PM) in cardiorespiratory diseases is now established in developed countries whereas in developing areas such as Africa with a high level of specific pollution, PM pollution and its effects are poorly studied. Our objective was to characterize the biological reactivity of urban African aerosols on human bronchial epithelial cells in relation to PM physico-chemical properties to identify toxic sources.Size-speciated aerosol chemical composition was analyzed in Bamako  and Dakar  for Ultrafine UF, Fine F and Coarse C PM. PM reactivity was studied in human bronchial epithelial cells investigating six biomarkers (oxidative stress responsive genes and pro-inflammatory cytokines).PM mass concentrations were mainly distributed in coarse mode (60%) and were impressive in BK1 due to the desert dust event. BK2 and DK samples showed a high content of total carbon characteristic of urban areas. The DK sample had huge PAH quantities in bulk aerosol compared with BK that had more water soluble organic carbon and metals. Whatever the site, UF and F\u00a0PM triggered the mRNA expression of the different biomarkers whereas coarse PM had little or no effect. The GM-CSF biomarker was the most discriminating and showed the strongest pro-inflammatory effect of BK2 PM. The analysis of gene expression signature and of their correlation with main PM compounds revealed that PM-induced responses are mainly related to organic compounds. The toxicity of African aerosols is carried by the finest PM as with Parisian aerosols, but when considering PM mass concentrations, the African population is more highly exposed to toxic particulate pollution than French population. Regarding the prevailing sources in each site, aerosol biological impacts are higher for incomplete combustion sources resulting from two-wheel vehicles and domestic fires than from diesel vehicles (Dakar). Desert dust events seem to produce fewer biological impacts than anthropogenic sources.Our study shows that combustion sources contribute to the high toxicity of F and UF PM of African urban aerosols, and underlines the importance of emission mitigation and the imperative need to evaluate and to regulate particulate pollution in Africa. A number of epidemiological studies have now established associations between exposure to particulate pollution and increased morbidity and mortality for respiratory and cardiovascular diseases . Toxicol2, SO2 and particles) observed in African cities being at same levels as in Asian megacities pyrene) with 14%. 85% of total PAH were heavy PAH (5\u20136\u00a0cycles). This distribution profile and especially the relative abundance of BghiP were typical of diesel exhaust sources fluoranthene; BghiP: Benzo[ghi]perylene; BK: Bamako; C: Coarse; CHR: Chrysene; COPD: Chronic obstructive pulmonary disease; CYP1A1: Cytochrome P450 1A1; DK: Dakar; ELISA: Enzyme linked immunosorbent assay; F: Fine; FLUA: Fluoranthene; GM-CSF: Granulocyte macrophage-colony stimulating factor; HO-1: Heme oxygenase 1; IARC: International agency for research on cancer; IL-6: Interleukin 6; IncdP: Indenopyrene; UV: Ultraviolet; IR: Infrared; NHBE: Normal human bronchial epithelial; NQO-1: NADPH quinine oxydoreductase 1; OC: Organic carbon; PCR: Polymerase chain reaction; PHE: Phenanthrene; PM: Particulate matter; POLCA: Pollution des capitales africaines; POM: Particulate organic matter; PYR: Pyrene; UF: Ultrafine; RPL-19: Ribosomal protein L19; TC: Total carbon; WSOC: Water soluble organic carbon; XME: Xenobiotic responsive element.The authors declare no conflict of interest.SV performed the biological analyses, interpreted the results and contributed to write the paper. CL designed the research and with EHTD performed field experiments, analyzed the data and drafted the paper. CGL designed the research and performed field experiments with EG. HC contributed to the interpretation of the data. EHTD, HC, NM, EGand AS performed the chemical analysis. AB provided advices for statistical analysis. ABS directed the joint project and contributed to write the paper. All authors read and approved the manuscript.Correlation coefficients (Pearson) between biomarker responses induced by Parisian PM exposure. Correlations were calculated with results of Val et al. [l et al.  for UF aClick here for file"}
{"text": "There is an error in the author contributions. KMB should be listed in \"wrote the paper\" rather than DME. The correct author contributions are: Conceived and designed the experiments: KMB CLE DME. Performed the experiments: KMB JMT MDD. Analyzed the data: KMB. Contributed reagents/materials/analysis tools: KMB. Wrote the paper: KMB. Edited the manuscript: CLE DME."}
{"text": "In the Author Contributions statement, the last author (HRB) was incorrectly omitted from the list of those authors who wrote the paper. The Author Contributions statement should read: \"Conceived and designed the experiments: RLK HRB BS. Performed the experiments: RLK CS MR BS. Analyzed the data: RLK AG. Contributed reagents/materials/analysis tools: CS MR JS RF RKW. Wrote the paper: RLK RKW CJ EB NT SEH HRB.\""}
{"text": "Bacillus licheniformis, an important industrial enzyme producer. Thereby, valuable insights which help to understand the complex interactions during such processes are provided.Industrial fermentations can generally be described as dynamic biotransformation processes in which microorganisms convert energy rich substrates into a desired product. The knowledge of active physiological pathways, reflected by corresponding gene activities, allows the identification of beneficial or disadvantageous performances of the microbial host. Whole transcriptome RNA-Seq is a powerful tool to accomplish in-depth quantification of these gene activities, since the low background noise and the absence of an upper limit of quantification allow the detection of transcripts with high dynamic ranges. Such data enable the identification of potential bottlenecks and futile energetic cycles, which in turn can lead to targets for rational approaches to productivity improvement. Here we present an overview of the dynamics of gene activity during an industrial-oriented fermentation process with B. licheniformis DSM13. Since a significant amount of genes in Bacillus strains are regulated posttranscriptionally, the generated data have been confirmed by 2D gel-based proteomics. Regulatory events affecting the coordinated activity of hundreds of genes have been analyzed. The data enabled the identification of genes involved in the adaptations to changing environmental conditions during the fermentation process. A special focus of the analyses was on genes contributing to central carbon metabolism, amino acid transport and metabolism, starvation and stress responses and protein secretion. Genes contributing to lantibiotics production and Tat-dependent protein secretion have been pointed out as potential optimization targets.Whole transcriptome RNA-Seq has been performed to study the gene expression at five selected growth stages of an industrial-oriented protease production process employing a germination deficient derivative of B. licheniformis to changing conditions over the course of a typical fermentation process in such extensive depth.The presented data give unprecedented insights into the complex adaptations of bacterial production strains to the changing physiological demands during an industrial-oriented fermentation. These are, to our knowledge, the first publicly available data that document quantifiable transcriptional responses of the commonly employed production strain  Bacillus subtilis group -1-propanesulfonate; CoA: Coenzyme A; Da: Dalton; DHAP: Dihydroxyacetone phosphate; DTT: Dithiothreitol; F6P: Fructose 6-phosphate; FBP: Fructose 1,6-bisphosphate; FDR: False Discovery Rate; g: Gravitational constant; G6P: Glucose 6-phosphate; GADP: Glyceraldehyde 3-phosphate; GDH: Glutamate dehydrogenase; GO: Genome ontology; GOGAT: Glutamate synthase; GS: Glutamine synthetase; H: Hours; H2O2: Hydrogen peroxide; HCl: Hydrogen chloride; IEF: Isoelectric focusing; IPG: Immobilized pH gradient; kVh: Kilovolt hour; M: Molar; m/z: Mass-to-charge ratio; MALDI: Matrix-assisted laser desorption/ionization; min: Minute; mL: Milliliter; mM: Millimolar; mm: Millimeter; NPKM: Nucleotide activity per kilobase of exon model per million mapped reads; Oxo: Oxoglutarate; P: Phosphate; PEP: Phosphoenolpyruvate; Pyr: Pyruvate; RK motif: Twin-arginine motif; RNA-Seq: RNA sequencing; Rrpm: Revolutions per minute; RR motif: Arginine-lysine motif; s: Second; S/N: Signal-to-noise ratio; SDS: Sodium dodecyl sulfate; SRP: Signal recognition particle; Tat: twin-arginine translocation; TAXI: TRAP-associated extracytoplasmic immunity protein; TCA: Tricarboxylic acid; TOF: Time-of-flight mass spectrometer; TRAP: Tripartite ATP-independent periplasmic dicarboxylate transporter; V: Volt; v/v: Volume per Volume; Vh: Volt hour; W: Watt; w/v: Weight per volume.The authors declare that they have no competing interests.SW performed the experiments, analyzed data and wrote paper, BV supervised proteomics experiments and analyzed data, DA performed mass spectrometry analyses, JB and SE provided industrial fermentation facilities and organized fermentation and sampling, MH granted access to facilities for proteome analysis, RD wrote paper and provided research facilities, HL wrote paper, designed research and analyzed data. All authors read and approved the final version of the manuscript.Figure S1: Protease production and process parameters. Figure S2: Proteome of the amino acid metabolism \u2013 Part I. Figure S3: Proteome of the amino acid metabolism \u2013 Part II. Figure S4: Amino acid transport. Figure S5: Proteome of the central carbon metabolism. Figure S6: Carbohydrate transport. Figure S7: Acetoin utilization operon acuABC. Figure S8: Most abundant proteins. Figure S9: Lichenicidin gene cluster. Figure S10: Cell envelope stress response. Figure S11: Sporulation. Figure S12: Iron starvation. Figure S13: Heat shock response. Figure S14: Phosphate stress response. Figure S15: Putative Tat signal peptide of Subtilisin Carlsberg.Click here for fileTable S1: k-means clustering of expression profiles. Table S2: GO term enrichment analysis of k-means clusters. Table S3: Proteome data.Click here for file"}
{"text": "Please view Figure 2a in its original size here: The legend for Figure 4b refers to left and right panels rather than top and bottom panels. The correct legend for Figure 4b should read:The shapes of the binding pockets in the free and the antigen bound states: The top panel (apo form) and the bottom (METH complex) show identical cross sections. The entrance of the binding pocket is broader in apo structure, compared to the METH complex. Color code: Top panel: heavy chain -magenta and light chain -light pink. Bottom panel: heavy chain- blue light chain-light blue."}
{"text": "AbstractCheiloneurusflaccus  is reported from New Zealand for the first time. Cheiloneurusflaccus a distinctive species of encyrtid found widely in the New World, and also Australia Type status:Other material. Occurrence: recordedBy: Stephen Thorpe; individualCount: 2; sex: female; Location: country: New Zealand; verbatimLocality: Tamaki Campus of University of Auckland; verbatimLatitude: 36.88661S; verbatimLongitude: 174.85253E; Event: eventDate: 20 April 2013; Record Level: institutionCode: Auckland MuseumCheiloneurusflaccus, using the redescription by Cheiloneurusflaccus is a distinctive species, quite different to the two congeneric species already known from N.Z. The antenna, in particular, is distinctive, with the first segment of the funicle much longer than the pedicel  also occur on the campus. I recommend that Cheiloneurusflaccus be added to the New Zealand Organisms Register (NZOR) as exotic, present in the wild.On 20 April 2013, while looking for insects in swards of long grass on the Tamaki Campus of the University of Auckland, I noticed two specimens of an unusual looking encyrtid. I collected one of the two specimens (see Figs"}
{"text": "There were errors in the Author Contributions section. The correct version of this section is available below.Conceived and designed the experiments: VA UV EK LKV. Performed the experiments: FBF MS EK LKV, Analyzed and interpreted the data: VA UV SG JH EK LKV. Contributed reagents/materials/analysis tools: MS JH EK. Wrote the paper: VA UV LKV EK. Rose the funding: VA EK."}
{"text": "Assam is very rich in plant biodiversity as well as in ethnic diversity and has a great traditional knowledge base in plant resources. It is inhabited by the largest number of tribes and they lead an intricate life totally dependent on forest plants. The Mising is the major section and second largest tribal community of Assam and have a rich tradition of religion and culture. Their religious practices and beliefs are based on supernaturalism. A study of the plants related to magico religious beliefs in Dobur Uie of Mising is carried out. The results revealed the use of 30 plants belonging to 23 families. All plant species are used both in religious purpose as well as in the treatment of different ailments. Details of the uses of plants and conservational practices employed in Dobur Uie are provided. Our findings on the use of plants in Dobur Uie ritual reflect that some plants are facing problems for survival and they need urgent conservation before their elimination. Because this elimination may threat the rich tradition of Mising culture. Most of the plants that are domesticated for different rituals are almost same in all Mising populated areas. Plants are used in many ways including worshipping gods and goddesses for the protection and betterment of human life. In every human society worship is performed with traditional rituals for well-being. Many tribal communities preserve this tradition through folklore and worship their deities right from the occasion of birth to mourning death. They perform specific worship with pressie offerings.In India various gods and goddesses are worshipped in different religions throughout the country. Various plant parts like bark, twigs, leaves flowers, fruits and seeds are offered to gods. There are many plants grown near the different religious institutions are regarded as sacred plants by different ethnic groups of the country. They preserve the plants by all means which are used in different rituals. At a time when ecological degradation and deforestation have been taking place at an alarming rate throughout the globe, in India thousands of pockets of natural vegetation scattered throughout the country are preserved almost in pristine condition -5. AlmosTribal folklore is rich in magico-religious beliefs and taboos. They believe that some gods and deities reside on the trees in the forest. If they do not show mark respect to them their full clan will be destroyed. So they preserve the plants which they regard sacred for social, cultural and religious purposes. Their taboos, festivals, rituals and other cultural aspects are closely associated with the surrounding vegetation preserved on religious ground. The fear of getting attacked by the forest spirits or getting cursed by the deities eventually makes the local communities to resort to worship the spirits and making sacrifices and offerings to pacify them. Although the taboos, self imposed restricted and extra care exhibited by the community have significantly contributed in preserving the religious plants intact and in good shape thereby conserving a whole range of biodiversity that is housed in it. There is an inextricable link between indigenous and biological diversity. All over the world the indigenous people have protected the biodiversity with which they have symbiotic relationship . It has Assam is situated in the North eastern region of India lying between 24\u00b0- 28\u00b0 N and 90\u00b0- 96\u00b0 E Figure . The entThe Misings are one of the tribal communities of Assam. By faith they are the worshippers of 'Dony'(The Sun) and 'Polo' (The Moon) Figure . They clPhragmites karka), a kind of wild reed, its stems and bamboo to indicate prohibition against the entry of the outsiders into the village. After the completion of the prohibitory indicators at the entry points they come back to the village and they form a group consisting of 20 members approximately and start visiting the house holds of the village. Usually the visit starts from the eastern corner of the village. The members of the visiting group carry rods, sticks etc.in their hands and enter the courtyard of the houses. On entering they shout \"Ajenge! Ajenge!Bilangka\"  and at the same time they strike the platforms, walls etc of the house with rods and sticks. On hearing this the house wife comes out with food materials (Ajenge dues)  - a type of wild fern, a 'Tabong' (Imperata cylindrica) - a sharp grass and a split bamboo are placed on the altar facing the rising sun. Then the sacrifices of the animals like pigs and fowls are done. The heads, wings, legs of the poultries are mounted on specially designed sticks and erected them on the side of altar  for Dobur ritual considering all relevant aspects and convenience. In early morning of the 'Dobur day' some selected male folks proceed to the main entry points of the village. There they erect some structure specially designed braided leaves of 'Piro' plant  Figure  like ricr Figure . Rice, AAreas analyzed: Research was carried out in these eight districts - Sonitpur, Lakhimpur, Dhemaji, Dibrugarh, Tinsukia, Sibsagar, Jorhat and Golaghat. These areas of Assam rich with traditional knowledge and a good vegetation cover were selected based on mopping up surveys during 2009-2010. The potential Mising areas were selected based on whether they still practice own social customs, beliefs, religious rites, taboos, totems, food habits, medicinal and agricultural practices, as it was observed that the utilization and conservation practices of the Mising tribes are intertwined with these. Also this kind of life style has created a proper understanding between them and nature, which has resulted in enormous amount of knowledge available with them. Exploration trips were conducted periodically and data on religious and conservation practices revealing information about their informal innovation were recorded with details. Initially, the stay in Mising areas was shorter periods, as the initial trips were aimed at establishing rapport with the Mising people. They will not pass the information to others so easily unless a cordial and social relationship with them is established. After making several trips to these areas good rapport could be established with them. Frequent field surveys were made. Headmen and Mibus of the hamlet were consulted to have easy access to the people and also to get uninhibited flow of information. Mising healers both men and women were invited for interview. They demonstrated about the different use of the medicinal plants : English; (Ass): Assamese; (Mis): Mising; (Nep): Nepali; (San): Sanskrit; (Hin): Hindi; (Ben): Bengali.Acorus calamus L.(Acoraceae)Vernacular names: Sweet flag (Eng), Bos(Ass); Alokoni (Mis); Bojho (Nep.) Bach: (Ben)Vacha (San)DCH 5063Description: A marshy, rhizomatous perennial herb.Parts used: RhizomeReligious virtue: People believe that spirits, devils cannot enter due to its odour. They put the rhizome at the four corners of the altar or at he entrance of the ritual site.Medicinal use: It cures bronchitis, rheumatic pain, diarrhoea, flatulence, Pneumonia and cough.Local status: RareAgeratum conyzoides L. (Asteraceae)Vernacular names: Eng: Goat weed; San: Visamustih; Hin: Visadodi; Ben: Uchunti; Ass, Mis: Gendelabon; Nep: Ilame jhar; Man: Khonjainapi DCH 5001Description: A hairy annual weed, 5 m-1 m tall; leaves opposite, hairy on both sides; margin toothed; flowers pale in heads.Parts used: The flowers, leaves, rootsReligious virtue: Flowers are used in the preparation of ApongMedicinal use: Infusion of roots is used as appetizer and ophthalmic; leaves are used to stop bleedingLocal status: AvailableAlpinia allughas (Retz.) Rosc. (Zingiberaceae)Vernacular names: Ass, Mis: Tora DCH 5006Description: Rhizomes tuberous, perennial, Leafy stem 1-2 meter highParts used: Leaf and rhizomeReligious virtue: The leaves of the plant are used as food wrappers or dishes in every Mising religious festival. The people regard the plant as sacred one.Medicinal use : Rhizomes are used in gout and colicLocal status: RareAlpinia malaccensis Rosc. (Zingiberaceae)Vernacular names.: Ass: Kaupat, Mis: Lisin DCH 5010Description: Rhizomes tuberous, perennial, Stems 1.5-3 meter highParts used: Leaf and rhizomeReligious virtue: Same as in A.allughasMedicinal use :Rhizomes are used for treatment of sores.Local status: RareAnanas comosus (L.) Merr. (Bromeliaceae)Vernacular names: Eng: Pineapple; San: Anamnasam; Hin: Ananas; Ben: Anaras; Ass: Matikathal; Nep: Bhui Katahar; Man: Keehom; Kar: Parokjongphong; Ngl: Yeangkong Peyong. Mis: Anaras DCH 5311.Description: A herbaceous perennial plant; leaves many, spirally arranged, linear-lanceolate, toothed on margins; inflorescence small, reddish, terminal, ovoid.Parts used:Tender leafReligious virtue: Tender leaf base is used in Apong preparationMedicinal use: Leaf base is crushed and the extract is given one time daily for amoebic dysentery and intestinal wormsLocal status: AvailableArtocarpus heterophyllus Lamk. (Moraceae)Vernacular names : Eng : Jack fruit; San : Panasah; Hin : Kathal; Ass, Mis : Kathal; Ben : Kathal; Nep : Katahar; Man : Theibong. DCH 6331Description : An evergreen tree, 18-25 m in height; leaves simple, alternate, coriaceous, entire, shiny; male flowers crowded on cylindrical receptacles; female flowers crowded on globose receptacles; fruits fleshy, many, oblong or round, covered with tubercles.Parts used : Roots, seeds.Religious virtue: Matured leaves are used in Apong preparation. Leaves are also used as dish in religious festivals.Medicinal use: Roots are used for diarrheaLocal status: AvailableAsparagus racemosus Willd (Liliaceae)Vernacular names:Eng: Wild Asparagus; San: Shatavari: Hin: Satawari;Nep: Kurilo, Mis: Otmul;Ass: Satmul; Ben: Satamuli; Man: Nunggarei. DCH 6019Description: A climbing slender plant with curved spines; leaves reduced to scales, leaf like cladodes succulent and green, flowers white in simple recemes; fruits three lobed, mature fruits are red in colour.Parts used: Tuberous roots, whole plantReligious virtue: In Lakhimpur district many people use whole plant near the entry of Dobur Uie venue. They believe that this plant will guard the people from the bad spirits.In Dhemaji district the tuberous roots are used in the preparation of Apong.Medicinal use: Root decoction is used as health tonic, it is diuretic, ophthalmic, galactagogue, aphrodisiac and carminative.Local status: Very rareBambusa tulda Roxb. (Poaceae)Vernacular names Jati banh (Ass); Peka (Hin); Taru Bans (Nep); Jati dibang (Mis)DCH 5054Description: Tufted bamboo reaching 30-50 meters in height.Parts used: Root, stem. leavesReligious virtue: Bamboo sticks and leaves are used in the main entrance of the Dobur Uie and in the four corners of the altar. The head and the feathers of the sacrificed chickens are hung on the bamboo sticks near the altar.Medicinal use : The decoction of roots taken internally to promote flow of urine.Local status: AvailableCentella asiatica (L.) Urban (Apiaceae)Hydrocotyle asiatica L.)Vernacular Names: Eng: Indian cassia lignea; San: Tamala patra; Hin: Tezpat; Ben: Tezpat; Ass, Mis: Tezpat; Nep: Tezpat; Man: Tezpat; Kar: Tezpat; Miz: Hnahrimtui DCH 6103Description: A small evergreen tree 4.5 m in height; leaves simple, opposite, lanceolate, glabrous, entire; flowers pale yellowish, in axillary panicle.Parts used: Leaves.Religious virtue: Leaves are used in Apong preparation and are offered in Ajenge DuesMedicinal use: The leaves are useful in gonorrhoea, rheumatism, diarrhea, enlargement of spleen and diabetes.Local status: RareClerodendrum colebrookianum Walp. (Verbenaceae)Vernacular names. Pakkom (Mis); Nephaphu (Ass) DCH 5019Description: Shrub with foetid smell; 1.5-2 meters high, Leaves ovate, Flowers white.Parts used: LeavesReligious virtue: The leaves of the 'Pakkom'are included in the Ajenge DuesMedicinal use: The leaves are used to kill the intestinal worms. Tender leaves are boiled and the soup is used for reducing blood pressure.Local status: AvailableDillenia indica L. (Dillenniaceae)Vernacular names. Elephant apple (Eng), Outenga (Ass): Sompa: (Mis), Nep: Chalta, Bhavya: (San) DCH 5013Description: A big tree; leave 10-15 cm broad, Flowers large, white, the fruits are used as vegetablesParts used: Sepal of the fruit.Religious virtue: The fruits are included in 'Ajenge Dues'. The sepals are sometimes used as 'Diya'or oil lamp Medicinal use: Fleshy calyx is used for stomach disorder. The jelly like pulp of the fruit is applied to scalp for curing dandruff and falling hairs.Local status: AvailableFicus racemosa L. (Moraceae)Vernacular names.: Eng:Cluster fig; Mis: Tajjig; San: Udumbarah); Ass: Jagnya dimaru); Nep: Dumri, Hin: Gular; Ben:Dumur DCH 5057Description: A middle sized deciduous tree, fruits are in large cluster on short leafless branches, leaves elliptic, ovate or ovate lanceolate.Parts used: Leaves, latexReligious virtue: The tender leaves are given in 'Ajenge Dues'. In all religious festivals of Mising people the leaves are used as the primary curry item.Medicinal use: The latex is used for piles and diarrhoea; Powdered dry leaves are mixed with honey and given in bilious affections.Local status: AvailableGomphostemma parviflora Wall. (Lamiaceae)Vernacular names: Ass, Mis: Bhedaitita DCH 6434Description: A stout undershrub with quadrangular stem covered with glandular hairs; leaves simple, opposite, short petioled; flowers zygomorphic, in axillary, double row of cymes, the pairs forming false whorls and are in sessile clusters round the stem, flowers fade yellow.Parts used: Leaves.Religious virtue: The tender leaves are used in Apong preparationMedicinal use: Leaves are used in Malaria.Local status: Very rareImperata cylindrica (L.) Raeusch. (Poaceae)Vernacular names: Eng: Thatch grass, San: Darbha, Mis: Kase, Tabong: Ass: Ulu kher: Nep: Siru: Hin, Ben: Ulu DCH 6336Description: Erect perennial grass, 1-2 meter in height. Leaf blades are very sharpParts used: Leaf and rootReligious virtue: The leaves are tied with fronds of Thelypteris multilineata at the south corner of the altar made for Dobur Uie. It symbolizes that no any other spirits can come and disturb people of the village.Medicinal use : Root is used for wounds and piles. It is anthelmintic. Decoction of root is taken in diarrhea and dysentery.Local status: AvailableKaempferia rotunda L. (Zingiberaceae)Vernacular names : Eng: Indian crocus; San: Bhumi champaka; Hin: Bhuichampa; Ben: Bhui champa; Ass: Bhumi champa; Nep: Bhuichampa; Man: Yai-Thamna-manbi; Kar: Michove; Miz: Tuktinpar DCH 5999Description: A small, erect plant with perennial rootstock and very short stem; leaves simple, erect, oblong or ovate-lanecolate, acuminate, variegated green above, tinged with purple below; flowers in crowded spikes fragrant, white, lip purple.Parts used: TubersReligious virtue: Tuber of the plant is used in Apong preparation. The Mising of Lakhimpur district believes that growing the plant brings peace in the family.Medicinal use: The tubers are used for wounds, ulcers, tumours, swellings and gastroenteritis.Local status: Very rareLeucas plukenetii (Roth) Spreng. (Lamiaceae)Vernacular names: Eng: Thumbe; San: Dronapuspi; Hin: Chota halkusa; Ben: Sada halkusa; Ass, Mis: Boga Doron; Nep: Dronapuspa; Man: Mayanglambum. DCH 6312Description: Small hairy, square stemmed, annual herb found in open fields and waste lands. The leavesof the plants are ovate-lanceolate, lobed, thin and hairy with a tapering base; flowers white, small, in dense terminal clusters, sessile.Parts used: Leaves.Religious virtue: The leaves are used in Apong preparation. It is not used by all MisingMedicinal use: The leaves are used as vegetables. Leaf juice is used in sinusitisLocal status: AvailableMicrosorum punctatum (L.) Copel (Polypodiaceae)Vernacular names: Eng: Climbing bird's nest fern, Ass: Kapau dhekia; Mis: Ising Okang DCH 6216Description: Terrestrial or epiphytic, Fronds sre sessile, leaf blades simple, reticulate venation, sori are irregularly scattered on the abaxial surface.Parts used: LeavesReligious virtue: Leaves are used in Apong preparation in Dhemaji and Lakhimpur district.Medicinal use: Leaf juice used as purgative, diuretic and healing wounds.Local status: RareMusa paradisiaca L. (Musaceae)Vernacular names. Ass: Kach kol; Nep: Kera, Hin: Kela; San: Kadali; Mis: Kopak. DCH 5091Description: Stoloniferous plant; leaves with sheathed petiole up to 9 meter long, flowers in a terminal spike.Parts used: Leaves, fruitsReligious virtue: Leaves and leaf sheaths are used as plates or dishes in the ritual. The materials required for observing Dobur Uie are kept in the leaf or leaf sheath dishes.Medicinal use: Fruits are used for chronic dysentery.Local status: AvailableNaravelia zeylanica (L.) DC. (Ranunculaceae)Vernacular names: San: Dhanavalli; Ben: Chagalbati; Ass: Goropchoi, Nep: Ras gagri; Meg: Jyrmailasam, Behalisham (Garo) DCH 6636Description: A woody stout climber; leaves opposite, 2-foliate, terminal leaflet ending in tendril, leaflets ovate-lanceolate;flowers yellow, in axillary and terminal panicles.Parts used: Leaf.Religious virtue: Leaves are used in Apong preparation. The Mising of Dhemaji believe that if they grow this plant inside their compound the bad spirits can not disturb them.Medicinal use: The leaves are anthelmintic; they are useful for wounds and ulcers.Local status: Very rareOldenlandia corymbosa L. (Rubiaceae)Vernacular names: Eng: Diamond flower; San: parapatah; Hin: Daman Pappar;Ass: Bonjaluk DCH 6212Description: A much spreading, annual herb, erect or spreading; leaves simple, opposite, sessile, flowers white, pedicelled, solitary.Parts used: whole plantReligious virtue: It is commonly used in Apong preparation. In Sibsagar district it is given in Ajenge Dues.Medicinal use: The plant is diuretic, stomachic, carminative and used as liver tonic. It is also used in jaundice.Local status: AvailableOryza sativa L. (Poaceae)Vernacular names: Eng: Rice; Ass:Dhan; Mis: Aam. DCH 6001Description: Annual cereal, Stem erect, cylindrical, hollow except in nodes, leaf blade long, lanceolate, acuminate, inflorescence is partly covered by leaf sheath, Spikelets are borne either singly or in cluster, flowers bracteates.Parts used : Seed, StrawReligious virtue: Rice is indispensable item in Apong preparation. Straw is burnt and used in 'Chhai Mod' (Ash liquor). The colour of commonly used Apong is white but the colour of 'Chhai Mod' is smoky in colour. Chhai Mod is prepared only in the special occasion or any religious festivals. Important guests are entertained by offering 'Chhai Mod'. The straws are also used to filter the Apong.Medicinal use: Rice-wash water (water used to wash rice before cooking) is used in diarrhea and dysenteryLocal status: AvailablePhragmites karka (Retz.) Trin.ex Steud. (Poaceae)Vernacular names.: Eng: Wild reed; Mis:Piro; Ass: Nal Khagari; Nep:Narkat; Ben: Khagra DCH 5066Description: Perennial, stem cylindrical, 2-3 meter high, leaves alternate, lanceolate.Parts used: whole plant, rootReligious virtue: The plant is mostly used by the Mising community in religious festivals like Dobur Uie and Ali Ai Ligang. In Dobur Uie four 'Piro' plants are transplanted at the four corners of the Dobur Uie altar' Mising regard this plant as the most sacred plant.Medicinal use: Roots are cooling, diuretic and very useful in Diabetes.Local status: RarePsidium guajava L. (Myrtaceae)Vernacular names: Eng: Guava tree; San: perala, Perukah; Hin: Amrud; Ben:Peyara; Ass: Madhuriam; Nep: Ambak; Man:Pungdol. DCH 6010Description: A small tree; leaves simple, opposite, elliptic-oblong, glabrous above; flowers white, fragrant, in axillary cymes.Parts used: Tender leaves.Religious virtue: It is very commonly used by the Mising in Apong preparation.Medicinal use: Tender leaves are used in Amoebic dysenteryLocal status: AvailablePueraria tuberose (Roxb.ex Willd.)DC (Papilionaceae)Vernacular names: Eng: Indian Kudzu; San: Vidari, Bhumi Kusmandah; Ass: Bhuin Komora; DCH 6455Description: A large, herbaceous twiner with very large tuberous roots; leaves 3 foliolate, leaflets broadly ovate; flowers blue or purplish blue, in raceme; fruits membranous, flat, jointed clothed with long, silky, bristly brown hairs.Parts used: Tuberous roots.Religious virtue: Tuberous roots are used in Apong preparationMedicinal use: Tubers are used for fever.Local status: Very rareSarcochlamys pulcherrima (Roxb.) Gaud. (Urticaceae)Vernacular names. Eng. Duggal fibre tree; Mis :Ombe; Ass: Mesaki DCH 5101Description:A small evergreen branched tree or large shrub upto a height 5 meter, Stem brownish, rough and warty, leaves in dense clusters at the apex of the branches, 12-20 cm long, dorsal surface shining green and ventral surface white.Parts used: LeavesReligious virtue: Mising people consider the plant as sacred plant. They make special food item from the tender leaves of the plant in any religious festivals, given in 'Ajeng Dues'.Medicinal use: Leaves are useful for diarrhea and dysentery, they are carminative and digestive.Local status: RareScoparia dulcis L. (Scrophulariaceae)Vernacular names: Eng: Sweet broomweed; Ass : Seni bon; Man : Maipuipin.DCH 6135Description: A much branched, herbaceous plant of about 70 cm height; leaves opposite, lanceolate, dentate, flower four lobed, white with staminal hair, fruit a dentate margined small globular capsule with free central placentation.Parts used : Leaves.Religious virtue: Leaves are used in Apong preparationMedicinal use: Leaves are used for fever, cough and diabetes.Local status: AvailableSpilanthes paniculata Wall.ex DC (Asteraceae)Vernacular names. Eng: Brazil cress, Toothache plant; Mis: Marsang; Ass: Jati malkathi DCH 5045Description: Herb upto 40 cm. in heght; leaves opposite, dentate, petiolate, elliptic-lanceolate; flowers in capitulum, yellow.Parts used: Whole plant, flowerReligious virtue: The plant is very popular among the Mising community; special food item is prepared from this plant in religious festival. The poor people offered this plant along with the 'Ajeng Dues' in Dobur UieMedicinal use: The inflorescence relives toothache, bronchial trouble and ulcers inside the mouth, it has strong local anaesthetization and also used for dysentery.Local status: AvailableThelypteris angustifolia (Willd.)Proctor (Thelypteridaceae)Vernacular names: Mis: Ruktak; Nep: Koche DCH 5111Description:Terrestral fern, Fronds large, pinnate, sessile, found in marshy place.Parts used: Whole plant, rhizomeReligious virtue: The entire plant is placed ine corneer of the altar. The tip of the plant and tip of the leaves of 'Piro' are tied together near the altar of the Dobur UieMedicinal use: Juice of the rhizome about four teaspoons three times a day given for indigestion or any stomach problem.Local status: RareZanthoxylum nitidum (Roxb.) DC (Rutaceae)Vernacular names: Eng: Toothache tree; San:Tumburuh; Hin: Tezbal; Ass: Tezmooi DCH 6020Description: A large, scandent, ever green shrub with prickles, shrubs or woody climbers, leaves compound, flowers yellow, fruits reddish, subglobose.Parts used: Leaf, stem barkReligious virtue: Leaves are used in Apong preparationMedicinal use: Stem bark is used for toothache or any gum problem, it is carminative and stomachic.Local status: Very rarePueraria tuberose, Zanthoxylum nitidum, Naravelia zeylanica, Gomphostemma parviflora, Asparagus racemosus, Kaempferia rotunda are not found easily in those areas where the research work has been carried out. Previously these plants were said to be found abundant but now they are in 'very rare' condition. In this way they categorized the plants in different status. They can easily identify the plants which are locally threatened or abundant, rare or very rare depending on the availability of the plants and accordingly they take special care to conserve such threatened species in their garden. So there is an urgent need of conservation of their rich traditional knowledge before their extinction. The old village heads or elderly persons of the research areas were interviewed. They expressed about their constrains for leaking out the information about the medicinal plants at the beginning but later on we somehow could motivate them and collected few information. They strongly believe that if they leak the information the efficacy of the drugs will be lost. If this trend continues their rich traditional knowledge will be lost along with their death. So the need of conservation of their knowledge is very essential. The status which they mentioned may not be applicable in other places. It is strictly confined to their areas only and therefore the word 'Local status' is mentioned. They collected many important plants from the forest and transplanted in the gardens. The authors personally visited some of their gardens and found some important plants like Pueraria tuberose, Zanthoxylum nitidum, Naravelia zeylanica, Gomphostemma parviflora, Asparagus racemosus, Kaempferia rotunda etc.Mising people have a rich tradition of religion and medicinal practices. They collect the plants from wild state and conserve them around their residences. They have good knowledge about the status of the plants. This knowledge has been acquired by their long experiences. They have been using the plants for different purposes since time immemorial. So they have good knowledge about the use and availability of the plants. Here the 'availability' means the 'status'of the plants. Some plants like Zanthoxylum nitidum, Asparagus racemosus, Sarcochlamys pulcherrima, Pueraria tuberose, Phragmites karka, Naravelia zeylanica, Gomphostemma parviflora, Ficus racemosa, Dillenia indica, Clerodendrum colebrookianum, Cinnamomum tamala, Acorus calamus, Alpinia malaccensis, Alpinia allughas have been domesticated. They sometimes sell the vegetable parts in the local market for their livelihood. These benefits coming out from the market will typically go to improving living standards of their families. This makes a clear link between conservation and development. Communities can contribute to biodiversityby collecting and propagating indigenous seeds, planting and tending both indigenous and plantation trees in their forests and their private farms and policing against illegal harvesting of animals and tree products. These plants seem to be threatened to get eliminated in their natural habitats due to the over exploitation. Because other tribal communities also collect the plants from the same source. So the domestication of these plants is a need for conservation. Keeping this in view the plants used in Dobur Uie, Apong preparation or vegetables are locally categorized in three divisions rare, very rare and available. Eight rare plants and six very rare plants have been identified to be used in Dobur Uie celebration. Very rare plants like Zanthoxylum nitidum, Pueraria tuberose, Naravelia zeylanica, Gomphostemma parviflora, Asparagus racemosus, Kaempferia rotunda and need urgent conservation for their sustainable use. The plants locally found and used in Dobur Uie in rare status are Thelypteris angustifolia, Sarcochlamys pulcherrima, Phragmites karka, Microsorum punctatum, Cinnamomum tamala, Alpinia allughas, Alpinia malaccensis and Acorus calamus. For different ritual purposes these religious plants are frequently used by the Mising people so the Mising people are trying their best to protect the plants in situ or ex situ condition from elimination. The rest 16 plants though are found locally available but due to lack of awareness of the people for sustainable use of the plants many such plants like Spilanthes paniculata, Clerodendrum colebrookianum, Dillenia indica, Centella asiatica though are found in available status but due to unsustainable use and over exploitation the number of these plants is decreasing gradually and therefore they need an urgent protection. As the Mising culture and plants have inseparable linkage so to protect the rich Mising culture the plants need to be conserved.In the Dobur Uie day the Mising people will take wild vegetables with their meal. In the previous day of the ritual the Mising women go to the forest for collecting wild vegetables for the next day. 20-30 varieties of wild vegetables were collected in the earlier time but this number comes down to 10-15 at present. On the other hand the alarming decrease of Apong plants from 50 to 10-15 is becoming a serious concern. As stated by the informants many plants got eliminated from the locality may be due to wanton felling of the trees or may be indiscriminate collection of the plants. Moreover other tribal people except the Mising also use the same plants for Apong preparation resulting over exploitation of these plants. The informants stated that if this trend of decreasing the number of plants used in different ritual practices continues then the situation of cultural threat may arise one day or other. This situation is found in all Mising populated areas undertaken for this study. In this paper altogether 30 plants under 23 families were discussed. Plants used for wild vegetables, Apong preparation and for Dobur Uie celebration are found in wild state and many of them like The strong motive behind observing Dobur Uie is the sense of fear or reverence shown by the Mising people towards god or deities. Be it a patch, a single or cluster of sacred trees a lot of conservation concern has been imbibed into the Mising communities. Irrespective of the motivating force behind conferring the sacred or religious status to a plant, it may be said that this process saves the plants from wanton felling. Through this project an attempt has also been made to make them aware of the status and sustainable use of the plants.A number of folk medicinal claims used by Mising people in Dobur Uie are reported in this communication. Among these, some interesting and new claims relate to the treatment of different ailments of human beings such as diarrhea, dysentery, malaria, indigestion, gastroenteritis, high blood pressure, intestinal worms etc. About 34 diseases have been described for the treatment of different ailments. Diarrhoea, dysentery, indigestion, flatulence, stomach problems, liver problems are found very common among the diseases. Information on the effectiveness to cure the ailments by using these species is based on continuous use by succeeding generations of Mising people. However these claims need to be further tested using standard scientific methodologies. Local names are given in different regional languages for the easy identification of the species.Gomphostemma parviflora, Clerodendrum colebrookianum, Ficus racemosa, Sarcochlamys pulcherrima etc. in their gardens for consumption and sale. These plants can help overcome the deficiency of nutritional constituents, especially in rural areas. It is important to promote consciousness about the food habits and accept wild food plants like the cultivated ones. Thus they become conscious about conserving their surrounding plant resources. Though the use of plants in Dobur Uie varies from place to place but some plants like Alpinia allughas, Alpinia malaccensis, Imperata cylindrica, Thelypteris angustifolia, Phragmites karka are found common to all places. We suggest that the traditional knowledge of the Mising people could provide useful information in finding new drugs that contribute to human welfare. So the most urgent need is to rescue and record the traditional knowledge on plants in the form of digitized database before its extinction.In the present study 30 plants belonging to 23 families have been identified as medicinal plants used by the Mising people of Assam in Dobur Uie ritual. These plants are used in the treatment of some very common ailments like diarrhea, dysentery, indigestion, flatulence, stomach problems, liver problems etc. All these diseases are water born and this can be explained that the water taken from ponds or from other free sources in rural areas are not hygienic and so the children are easily infected by these diseases. The Mising people believe that all big trees are abodes of gods and deities and therefore they are sacred and should not be harmed, they try to save these plants by all means This perception of nature plays a positive role on the protection of the vegetation around their dwelling places. That is why many scholars advocate that people living in modern society learn from the minority people to respect the environment rather than depredating it ,14,20,21Permission was granted by the Mising people shown in figures The authors declare that they have no competing interests.US conducted field survey, interviews with the healers, village heads, head of the religious institutions, elderly men and women. Herbarium specimens were identified and finalized with SP. SP helped to take the photographs and to collect and analyze data. Both the authors examined the manuscripts minutely and approved as final manuscript"}
{"text": "There were errors in the Author Contributions. The correct contributions are: Conceived and designed the study: ST. Performed the study and contributed reagents/materials/analysis tools: ST MB GB. Analyzed the data: ST. Wrote the paper: ST GB."}
{"text": "The scope of our understanding of the evolutionary history between viruses and animals is limited. The fact that the recent availability of many complete insect virus genomes and vertebrate genomes as well as the ability to screen these sequences makes it possible to gain a new perspective insight into the evolutionary interaction between insect viruses and vertebrates. This study is to determine the possibility of existence of sequence identity between the genomes of insect viruses and vertebrates, attempt to explain this phenomenon in term of genetic mobile element, and try to investigate the evolutionary relationship between these short regions of identity among these species.Some of studied insect viruses contain variable numbers of short regions of sequence identity to the genomes of vertebrate with nucleotide sequence length from 28 bp to 124 bp. They are found to locate in multiple sites of the vertebrate genomes. The ontology of animal genes with identical regions involves in several processes including chromatin remodeling, regulation of apoptosis, signaling pathway, nerve system development and some enzyme-like catalysis. Phylogenetic analysis reveals that at least some short regions of sequence identity in the genomes of vertebrate are derived the ancestral of insect viruses.Short regions of sequence identity were found in the vertebrates and insect viruses. These sequences played an important role not only in the long-term evolution of vertebrates, but also in promotion of insect virus. This typical win-win strategy may come from natural selection. The interaction between viruses and animals is quite profound and complex. Precious studies have deeply increased the depth of our understanding of their long-term evolutionary history in terms of genome sequence. Viruses have a highly host-associated life circle. As a result, they infect and occasionally integrate into the germ line cells chromosome and are inherited vertically as host alleles ,2. A groHowever, most of these discoveries were merely addressed in an aspect of virus-host interaction and may narrow our prospective to probe the links between viruses and animals.Here in a broad sense, we aimed at to identify the possible regions identity between the genomes of vertebrates and non-retroviral families of insect viruses and the possible role(s) of the identical sequences in evolution of the corresponding animal(s). Moreover, we reported phylogenetic analysis of these identical sequences. In this paper, we showed that at least some of the sequences identity in vertebrates chromosomes identified here are likely to come from insect viruses and exapted during their long-term evolution.NW_002197778.1] with respective E-values 4e-23 and 1e-14.We screened several hundreds of insect viruses including DNA viruses and RNA viruses against 21 vertebrates. Of interest, dozens of short regions of sequence identity were found between animals and viruses including double stranded DNA viruses and double stranded RNA viruses  of the regions identity as described in Methods.Figure Table A screen of vertebrate genomes has unexpectedly exhumed short regions of sequence identity to insect viruses leading us to speculate about the evolutionary relationship among these sequences. And then phyogenetic comparisons of these sequences identity were performed as described in Methods.Significant blast hits to Adoxophyes orana NPV were sequences from species including mammalian, virus, fungi and bacteria Figure . SequencSequences matching Choristoneura occidentalis granulovirus were all identified in insects Figure . In phylWe identified high-level significant matches to Culex nigripalpus baculovirus in the genomes of plant, mammalian, insect Figure . PhylogeSignificant matches to Cydia pomonella granulovirus are short regions identified in a broad range of lineage genomes including chordate, fungi, insects, vertebrates, protozoa and plant Figure . CuriousMatches to Leucania separata were sequences from different species ranging from fungi, mammalians, bacteria and protozoa as well as insects Figure . InteresIn order to broaden the scope of people's understanding of the interaction between virus and animals, We searched genomes of 21 currently available vertebrates for sequences identity to that of insect viruses with expectation that possible sequences identity may exist, and unearthed lush short regions of sequence identity in diverse animals. The chance matches of the search were ruled out by performing reciprocal BLAST. With sequence length from 28 to 124 bp, most of them are non-functional, however, with exceptional occasions, some are within exon.The mechanism that nucleotide sequences flowed from ancestral insect viruses to vertebrates is still unclear. A possible explanation for the phenomenon is due to genetic mobile element such as virus and phage as well as plasmid. Earlier study shows that viruses move between different biomes and the total number of viruses largely exceeds the number of cells . In our The fate of most acquired nucleotide sequences in the chromosomes of animals has been to undergo deletion due to homologous recombination , howeverNo discussion of short regions of sequence identity would be complete without mention pseudo-genes. Pseudo-gene which is known for non-functional, gene-like sequences due to a high mutation rate is harbored by mammalian genomes . LackingWe have investigated the evolutionary radiation of some of the identified short regions of insect viruses and demonstrated a broad history of interaction between insect viruses and vertebrates. It is interesting to speculate that short regions of identity occurred across a brand species. According to our data, at least some short regions of identity identified in vertebrates are derived from insect viruses. And the initial gene flow from Cydia pomonella to the ancestor of the Mus musculus at least post dated the divergence of Mus musculus and Rattus norvegicus about 10 million years ago. However, due to the limited samples, it is hard for us to know whether some sequences identity of the insect viruses and that of vertebrates shared the same ancestral lineage or not. Since the evolution of some viral sequences is more rapid than that of animals, it may mask any two nucleotide sequences which actually derived from the same ancestor .Our study established that the genetic material derived from insect viruses can flow to vertebrates and play a significant evolutionary role for the development of vertebrates and the survival of the viruses. This win-win strategy may be the result of natural selection.The genomes of non-retroviral families of insect viruses were screened against chromosome assemblies and whole genome shotgun assemblies of 21 vertebrate species in silico approach using BLASTn with the resources of NCBI. Insect viruses sequences with a high-level identity  of matches to vertebrates nucleotide sequences were acquired. Then the acquired animal sequences were used as queries to screen the GenBank non-redundant (nr) database in a reciprocal BLASTn search. Significant matches to retroviruses and non-insect viruses were discarded, while the remaining matches were considered as regions of identity to non-retroviral families of insect viruses.Regions of identity were located in corresponding genome shotgun assemblies of vertebrates precisely. If pseudo-genes were found near regions of identity (i.e. 2000 kb within their 5' and/or 3' ends) distance was calculated between the nearby pseudo- genes and 5'site and/or 3's site of regions of identity.For understanding the distribution and possible origin of sequences identity, BLASTn was run with virus sequences as queries to screen the GenBank non-redundant (nr) database. Significant hits with over 95% identity and blast E-values of 10-7 or lower were identified as regions of sequence identity. And representative sequences were extracted. These nucleotide sequences were aligned using ClustalX program Mammals: Primates (= 5): Callithrix jacchus (white-tufted-ear marmoset); Homo sapiens (human); Macaca mulatta (rhesus macaque); Pan troglodytes (chimpanzee); Pongo abelii (Sumatran orangutan); Rodents (= 2): Mus musculus (laboratory mouse); Rattus norrvegicus (rat)Monotremes (= 1): Ornithorhynchus anatinus (duck-billed platypus) Marsupials (= 1):Monodelphis domestica (opossum) Other Mammals (= 8): Ailuropoda melanoleuca (giant panda); Bos taurus (cattle); Canis lupus familiaris (dog); Equus caballus (horse); Felis catus (cat); Oryctolagus cunniculus (rabbit); Ovis aries (sheep); Sus scrofa (pig) Other Vertebrates (= 4): Danio rerio (zebrafish); Gallus gallus (chicken); Taeniopygia guttata (zebra finch); Xenopus tropicalis (Silurana) (western clawed frog)NC_005137]; Agrotis segetum granulovirus [GenBank:NC_005839]; Helicoverpa armigera NPV G4 [GenBank:NC_002654]; Orgyia pseudotsugata MNPV [GenBank:NC_001875]; Mamestra configurata NPV-A [GenBank:NC_003529]; Cydia pomonella granulovirus [GenBank:NC_002816]; Spodoptera exigua MNPV [GenBank:NC_002169]; Bombyx mori NPV [GenBank:NC_001962]; Bombyx mandarina NPV [GenBank:NC_012672]; Spodoptera frugiperda MNPV virus [GenBank:NC_009011]; Lymantria xylina MNPV [GenBank:NC_013953]; Mamestra configurata NPV-B [GenBank:NC_004117]; Lymantria dispar MNPV[GenBank:NC_001973]; Epiphyas postvittana NPV[GenBank:NC_003083]; Xestia c-nigrum granulovirus [GenBank:NC_002331]; Autographa californica NPV [GenBank:NC_001623]; Helicoverpa armigera NPV NNg1[GenBank:NC_011354]; Pieris rapae granulovirus[GenBank:NC_013797]; Pseudaletia unipuncta granulovirus [GenBank:NC_013772]; Agrotis segetum NPV [GenBank:NC_007921]; Spodoptera litura granulovirus[GenBank:NC_009503]; Chrysodeixis chalcites NPV [GenBank:NC_007151]; Neodiprion abietis NPV [GenBank:NC_008252]; Neodiprion lecontii NPV[GenBank:NC_005906]; Cryptophlebia leucotreta granulovirus [GenBank:NC_005068]; Adoxophyes orana granulovirus[GenBank:NC_005038]; Helicoverpa armigera NPV [GenBank:NC_003094]; Rachiplusia ou MNPV[GenBank:NC_004323]; Phthorimaea operculella granulovirus [GenBank:NC_004062]; Spodoptera litura NPV [GenBank:NC_003102]; Culex nigripalpus NPV [GenBank:NC_003084]; Plutella xylostella granulovirus [GenBank:NC_002593]; Heliothis zea virus 1 [GenBank:NC_004156]; Clanis bilineata NPV [GenBank:NC_008293]; Neodiprion sertifer NPV [GenBank:NC_005905]; Trichoplusia ni SNPV [GenBank:NC_007383]; Choristoneura fumiferana MNPV [GenBank:NC_004778]; Helicoverpa zea SNPV [GenBank:NC_003349]; Euproctis pseudoconspersa NPV [GenBank:NC_012639]; Agrotis ipsilon multiple NPV [GenBank:NC_011345]; Orgyia leucostigma NPV [GenBank:NC_010276]; Helicoverpa armigera granulovirus [GenBank:NC_010240]; Ecotropis obliqua NPV [GenBank:NC_008586]; Anticarsia gemmatalis NPV [GenBank:NC_008520]; Choristoneura occidentalis granulovirus [GenBank:NC_008168]; Adoxophyes honmai NPV [GenBank:NC_004690]; Hyphantria cunea NPV [GenBank:NC_007767]; Antheraea pernyi NPV [GenBank:NC_008035]; Spodoptera litura nucleopolyhedrovirus II [GenBank:NC_011616]; Helicoverpa armigera multiple NPV [GenBank:NC_011615]; Adoxophyes orana NPV [GenBank:NC_011423]; Maruca vitrata MNPV [GenBank:NC_008725]; Plutella xylostella multiple NPV [GenBank:NC_008349]; Leucania separata nuclear polyhedrosis virus [GenBank:NC_008348]Baculoviridae: Choristoneura fumiferana DEF MNPV [GenBank:NC_002520]; Melanoplus sanguinipes entomopoxvirus [GenBank:NC_001993] Ascoviridae: Spodoptera frugiperda ascovirus 1a [GenBank:NC_008361]; Diadromus pulchellus ascovirus 4a [GenBank:NC_011335]; Heliothis virescens ascovirus 3e [GenBank:NC_009233]; Trichoplusia ni ascovirus 2c [GenBank:NC_008518] Polydnaviridae: Hyposoter fugitivus ichnovirus ; Microplitis demolitor bracovirus ; Cotesia congregata virus ; Cotesia congregata bracovirus ; Campoletis sonorensis ichnovirus [GenBank:NC_007985~ NC_008008]; Glypta fumiferanae ichnovirus ; Campoletis sonorensis ichnovirus  Reoviridae: Southern rice black-streaked dwarf virus [GenBank:NC_014708~ NC_014717]; Great Island virus [GenBank:NC_014522~ NC_014531]; Stretch Lagoon orbivirus ; Raspberry latent virus[GenBank: NC_014598~ NC_014607 ]; African horsesickness virus ; Epizootic hemorrhagic disease virus [GenBank:NC_013396~ NC_013405]; Kadipiro virus ; Fiji disease virus [GenBank:NC_007154~ NC_007163]; St Croix River virus [GenBank:NC_005997~ NC_005998]; Operophtera brumata reovirus segment 1 [GenBank:NC_007559]; Mal de Rio Cuarto virus[GenBank:NC_008728~ NC_008737]; Eyach virus [GenBank:NC_003696~ NC_003707]; Aedes pseudoscutellaris reovirus [GenBank:NC_007666~ NC_007674]; Heliothis armigera cypovirus [GenBank:NC_010661~ NC_010670]; Yunnan orbivirus [GenBank:NC_007656~ NC_007665]; Rice ragged stunt virus ; Nilaparvata lugens reovirus [GenBank:NC_003652~ NC_003661]; Trichoplusia ni cytoplasmic polyhedrosis virus ; Homalodisca vitripennis reovirus [GenBank:NC_012535~ NC_012546]; Rice gall dwarf virus [GenBank:NC_009241~ NC_009252]; Banna virus ; Rice dwarf virus ; Rice black streaked dwarf virus [GenBank:NC_003728~ NC_003737 ]; Lymantria dispar cypovirus1[GenBank:NC_003016~ NC_003025]; Cypovirus 14 [GenBank: NC_003006~ NC_003015] Birnaviridae: Drosophila x virus  Dicistroviridae: Black queen cell virus [GenBank:NC_003784]; Triatoma virus [GenBank:NC_003783]; Drosophila C virus [GenBank:NC_001834]; Kashmir bee virus [GenBank:NC_004807]; Aphid lethal paralysis virus [GenBank:NC_004365]; Cricket paralysis virus [GenBank:NC_003924]; Rhopalosiphum padi virus [GenBank:NC_001874]; Israel acute paralysis virus of bees [GenBank:NC_009025]; Himetobi P virus [GenBank:NC_003782]; Acute bee paralysis virus [GenBank:NC_002548]; Plautia stali intestine virus [GenBank:NC_003779]; Solenopsis invicta virus 1 [GenBank:NC_006559]; Homalodisca coagulata virus-1 [GenBank:NC_008029] Tetraviridae: Euprosterna elaeasa virus [GenBank:NC_003412]; Boolarra virus ; Pariacato virus chromosome [GenBank:NC_003691~ NC_003692]; Nodamura virus [GenBank:NC_002690~ NC_002691]; Black beetle ; Macrobrachium rosenbergii nodavirus RNA-2 [GenBank:NC_005095]; Flock house virus [GenBank: NC_004146~ NC_004144 ]Entomopoxvirinae: Amsacta moorei entomopoxvirus 'L' [GenBank:ChchNPV: Chrysodeixis chalcites NPV; SfMNPV: Spodoptera frugiperda MNPV; SeMNPV: Spodoptera exigua MNPV; MaviMNPV: Maruca vitrata MNPV; AdorGV: Adoxophyes orana NPV; GflV: Glypta fumiferanae ichnovirus; TnAV-2c: Trichoplusia ni ascovirus 2c; MdBV: Microplitis demolitor bracovirus; HfIV: Hyposoter fugitivus ichnovirus; CcBV: Cotesia congregata bracovirus; CuniNPV: Culex nigripalpus NPV; ChocGV: Choristoneura occidentalis granulovirus; CpGV: Cydia pomonella granulovirus; EcobNPV: Ecotropis obliqua NPV; LsNPV: Leucania separata NPV; PoGV: Phthorimaea operculella granulovirus; CsIV: Campoletis sonorensis ichnovirus; NLRV: Nilaparvata lugens reovirus; FDV: Fiji disease virus; RBSDV: Southern rice black-streaked dwarf virusThe authors declare that they have no competing interests.Conceived the experiment: JL, Designed the experiment: GF; Performed the experiment: GF; Analyzed the data: GF; Wrote the paper: GF; Revised the paper: JL; gave the final approval of the version to be published: JL. Both authors read and approved the final manuscript."}
{"text": "During cellulosic ethanol production, cellulose hydrolysis is achieved by synergistic action of cellulase enzyme complex consisting of multiple enzymes with different mode of actions. Enzymatic hydrolysis of cellulose is one of the bottlenecks in the commercialization of the process due to low hydrolysis rates and high cost of enzymes. A robust hydrolysis model that can predict hydrolysis profile under various scenarios can act as an important forecasting tool to improve the hydrolysis process. However, multiple factors affecting hydrolysis: cellulose structure and complex enzyme-substrate interactions during hydrolysis make it diffucult to develop mathematical kinetic models that can simulate hydrolysis in presence of multiple enzymes with high fidelity. In this study, a comprehensive hydrolysis model based on stochastic molecular modeling approch in which each hydrolysis event is translated into a discrete event is presented. The model captures the structural features of cellulose, enzyme properties , and most importantly dynamic morphological changes in the substrate that directly affect the enzyme-substrate interactions during hydrolysis.Cellulose was modeled as a group of microfibrils consisting of elementary fibrils bundles, where each elementary fibril was represented as a three dimensional matrix of glucose molecules. Hydrolysis of cellulose was simulated based on Monte Carlo simulation technique. Cellulose hydrolysis results predicted by model simulations agree well with the experimental data from literature. Coefficients of determination for model predictions and experimental values were in the range of 0.75 to 0.96 for Avicel hydrolysis by CBH I action. Model was able to simulate the synergistic action of multiple enzymes during hydrolysis. The model simulations captured the important experimental observations: effect of structural properties, enzyme inhibition and enzyme loadings on the hydrolysis and degree of synergism among enzymes.The model was effective in capturing the dynamic behavior of cellulose hydrolysis during action of individual as well as multiple cellulases. Simulations were in qualitative and quantitative agreement with experimental data. Several experimentally observed phenomena were simulated without the need for any additional assumptions or parameter changes and confirmed the validity of using the stochastic molecular modeling approach to quantitatively and qualitatively describe the cellulose hydrolysis. Lignocellulosic biomass is a complex matrix of three biopolymers: cellulose (20-50%), hemicellulose 15-35%) and lignin (5-30%) 5-35% and-6, folloHydrolysis of cellulose and hemicellulose into sugar monomers is a critical step in the biochemical conversion of cellulose into ethanol. Cellulose is the most abundant biopolymer on earth with about 100 billion tons produced by terrestrial plants every year . Trichoderma reesei (earlier known as T. viride), comprising endoglucanases EGI, two exoglucanases CBHI and CBHII and \u03b2-glucosidase. Cellulase system of T. reesei, a soft-rot fungi, has been extensively studied [T. reesei were assumed as 0.4, 0.8, and 1.6\u00a0IU/mg of EG I, CBH I and CBH II respectively [All model simulations were performed for four main classes of cellulase enzymes: Non-processive endoglucanases with CBM, processive CBH I with CBM and processive CBH II with CBM and \u03b2-glucosidase. These enzymes are similar to enzyme system of  studied ,3,18,20.ectively . Zhang aectively  calculatectively -68.Data from model simulations were compared with two sets of experimental results from literature to validate the model.T. reesei, provided by Novo Nordisk A/S, Denmark), at various enzyme: substrate loadings at 40\u00a0\u00b0C in 50\u00a0mM citrate buffer (pH\u00a04.8) for 47\u00a0h.Experimental details for the experimental data are detailed in Bezerra et al. -47. BrieT. reesei . For model simulations, activity of EG II enzymes used in experiments were assumed to be same as EG I enzyme (0.4\u00a0IU/mg protein).For model validation, cellulose conversion results were extracted from Figure\u00a0th\u2019 enzyme; BC: Bacterial cellulose; BG: \u03b2-glucosidase; C: Cellulose fraction of the solid; CBH: Cellobiohydrolases; CBM: Carbohydrate binding module; CBP: Consolidated bioprocessing; CD: Catalytic domain; CGlu: Concentration of glucose (g/L); CG2: Concentration of cellobiose (g/L); CG6+: Concentration of high DP molecules (g/L); CrI: Crystallinity index; DP: Degree of polymerization; DS: Degree of synergism; EF: Elementary fibril; EG: Endoglucanses; Ei: Amount of 'ith' enzyme used per unit of cellulose during hydrolysis (mg/g cellulose); fj: Fraction of hydrolysable bonds for 'jth' microfibril; Gactual: Number of glucose molecules in actual sample; Gsim: Number of glucose molecules simulated in the model; IU: International unit of enzyme activity; MF: Microfibrils; n: Number of microfibrils simulated; Nhij: Number of maximum bonds broken by ith enzyme on jth microfibril; Nhi_max: Maximum number bonds broken by an enzyme per minute; Ninhib: Increment in counter due to inhibition; Ninhib _G2: Increment in counter due to cellobiose encounter/inhibition; Ninhib _G: Increment in counter due to glucose encounter/inhibition; Nnb: Increment in counter when no binding occurs; Nnp: Increment in counter in case of non-productive binding; NNRj: Number of non-reducing end in jth microfibril; NRj: Number of reducing ends in jth microfibril; Nsj: Number of glucose molecules on the surface of elementary fibrils in jth microfibril; NSLj: Number of soluble oligomers produced from jth microfibril; ODE: Ordinary differential equations; R2: Square of the Pearson product\u2013moment correlation coefficient; S: Fraction of solids in the solution; Si: Stability of 'ith' enzyme under current hydrolysis conditions; SMM: Stochastic molecular modeling; T. reesei: Trichoderma reesei; Ui: Activity of 'ith' enzyme (IU/mg enzyme); Vactual: Volume of solution (mL); Wsample: Weight of total solution during hydrolysis (g)\u2206Cmixed: Cellulose conversion by action of mixture of \u2018n\u2019 enzymes; \u2206Ci: Cellulose conversion by individual action of \u2018iThe authors declare that they have no competing interests.DK developed the model, carried out the process simulations and wrote the paper. GM conceived and designed the study, helped in the development of the model, and reviewed the results and manuscript. All authors read and approved the final manuscript.1Graduate Student, Biological and Ecological Engineering, 116 Gilmore Hall, Oregon State University, Corvallis, OR-97331. 2Assistant Professor, Biological and Ecological Engineering, 116 Gilmore Hall, Oregon State University, Corvallis, OR-97331.This file includes seven sections (A1 \u2013 A7) as follow: Section A1: Parameters associated with glucose molecules in the model. This section illustrates the properties associated with glucose molecules in the model. Section A2: Binding and action of endoglucanase and cellobiohydrolase enzymes. This section explains the action pattern of cellulase enzymes on cellulose. Section A3: Values of parameters used for EG I, CBH I and CBH II action. This section provides the values of parameters (such as increment on productive or non-productive binding) used in model simulations. Section A4: Calculations of concentrations of soluble and insoluble sugars. Equations used to calculate concentration of soluble and insoluble sugars during hydrolysis are presented in this section. Section A5: Cellobiose production during hydrolysis of Avicel by CBH I action. This section presents the data from model simulation from hydrolysis of Avicel at various enzyme:substrate ratios. Simulations were performed three times at each condition and standard deviations are provided in the table. Section A6: Endoglucanases action on substrates with different crystallinity. This section illustrates effect of crystallinity on the hydrolysis profile of cellulose by endoglucanases action. Section A7: Effect of enzyme loading on the hydrolysis rate of cellulose. This section presents the data from model simulation from hydrolysis of Avicel at various enzyme loadings .Click here for file"}
{"text": "There were multiple errors in the Author Contributions statement. The Author Contributions statement should read: \"Conceived and designed the experiments: RKL. Performed the experiments: JMP AMT. Analyzed the data: JMP AMT HJHC ASU. Wrote the paper: RKL.\""}
{"text": "The terms \"PKA\" and \"EPAC\" are not appropriately capitalized in the article title. The correct title is: \"Opposing Roles of PKA and EPAC in the cAMP-Dependent Regulation of Schwann Cell Proliferation and Differentiation.\" The correct Citation is: Bacallao K, Monje PV (2013) Opposing Roles of pka and epac in the cAMP-Dependent Regulation of Schwann Cell Proliferation and Differentiation. PLoS ONE 8(12): e82354. doi:10.1371/journal.pone.0082354."}
{"text": "The fourth author was incorrectly omitted from the list of those authors who wrote the paper in the Contributions Statement. The Author Contributions section should read: \u201cConceived and designed the experiments: EG LHS WLG. Performed the experiments: LHS WLG. Analyzed the data: GCS. Contributed reagents/materials/analysis tools: EG. Wrote the paper: GCS EG.\""}
{"text": "There was an error in the name of the second author.The correct name of this author is: Michael G. FriskThe correct citation is: Karimi R, Frisk MG, Fisher NS (2013) Contrasting Food Web Factor and Body Size Relationships with Hg and Se Concentrations in Marine Biota. PLoS ONE 8(9): e74695. doi:10.1371/journal.pone.0074695The correct version of the Author Contributions section is: Conceived and designed the experiments: RK MGF NSF. Performed the experiments: RK. Analyzed the data: RK MGF. Contributed reagents/materials/analysis tools: MGF NSF. Wrote the paper: RK MGF NSF."}
{"text": "There was an error in the Author Contributions. The correct version of this section is available below.Conceived and designed the experiments: BSC MS AJ AG TJ PGK CW. Performed the experiments: BSC MS AJ CRB AG. Analyzed the data: BSC MS AJ AG TJ PGK CW. Wrote the paper: BSC CRB TJ MS PGK CW."}
{"text": "In Figure 1B, the figures for girls and boys in the primary analysis should be reversed. Please see the corrected version of Figure 1B here: There were multiple errors in the author contributions. The updated author contributions are as follows:Conceived and designed the experiments: AE PBo DE VM CF RL PBh.Performed the experiments: RL PBh. Analyzed the data: VM CF PBo AE DE. Contributed reagents/materials/analysis tools: RL AE PBh DE CF PBo VM. Wrote the paper: RL AE DE CF PBo VM PBh."}
{"text": "There was an error in the Author Contributions section. The second contributions category should read: \"Performed the experiments: GC MG MZ; GC and MG contributed equally to this work.\""}
{"text": "To the Editor: The recent publication by Habibzadeh and Shashok discussed the importance of direct verbatim textual plagiarism (agiarism . Indeed,agiarism . However"}
{"text": "CMLLite is a collection of definitions and processes which provide strong and flexible validation for a document in Chemical Markup Language (CML). It consists of an updated CML schema (schema3), conventions specifying rules in both human and machine-understandable forms and a validator available both online and offline to check conformance. This article explores the rationale behind the changes which have been made to the schema, explains how conventions interact and how they are designed, formulated, implemented and tested, and gives an overview of the validation service. There is an on-going need for formal, computable representations of scientific data and documents which are also accessible to humans -3. The cThe strengths and weaknesses of CML have been recently analysed by Dumontier  and we qChemical Markup Language, backed by a controlled vocabulary, has been rather successful in specifying most aspects of chemistry, from small molecules and their connectivity to polymers and crystal structures.Unfortunately, while most elements of this specification can be parsed out using one of the many XML libraries, certain elements do not render themselves to facile interpretation. Consider the sample CML specification of a water molecule [...]. In order to identify the member atoms in a given bond, it is necessary to carry out string processing as an intermediate step. Further, while many of the elements of CML are defined in a controlled vocabulary, the lack of explicit, consistent, and formal axiomatization of the involved concepts gives rise to difficulties in inferring connections between chemical concepts where no such connections are stated explicitly, something that is possible in formal ontology-backed RDF-based information specifications. Although CML specifications have been increasingly evolving to incorporate elements of the Semantic Web, the lack of widespread adoption of the format, and the limited availability of large-scale CML-based chemical knowledge repositories, have somewhat limited CML-assisted federation of the world of chemical data. Furthermore, the implementation of coverage of additional chemical concepts in most chemical representations requires a formal, rigorous representation specification, complicating the incorporation of data represented using domain-specific representation extensions. We believe that an ideal chemical representation would require no specialized wrapper or interpreter, would be generic such as to allow for facile and conflict-free extensions, would be based on a formal ontology, and would be encoded in a machine-understandable  manner and therefore facilitates automated reasoning and data integration.This article addresses these points and describes a system we have built for managing explicit and implicit semantics. It was initially developed during the Chem4Word (C4W) project   thenmolecule@formalCharge: = =sum  +sum ) is missing on a molecule, calculate it by recursively summing its descendants. This is more complex in practice as we have to apply semantics for atoms without formalCharge.)etc.). This article describes how their combination with unit tests and other validation procedures creates strong accessible semantics.CML has thousands of relationships like this, and they are relatively straightforward to implement through procedural code  , Open BaIt is commonly believed that the (perceived) ease of use of a new technology will affect its adoption by communities . A succe\u2022 Accessibility for humans\u2022 Proven infrastructure\u2022 Authoring tools\u2022 Reading tools\u2022 Editors\u2022 Domain libraries\u2022 Critical mass of content\u2022 Agreed concepts and vocabularies\u2022 Critical mass of users.Postel's Law  > 1)can be decomposed into a set of steps which define a set of elements to query over and the query itself:etc.).\u2022 ancestor::cml:molecule selects any molecule element of which the current atom is a descendent .\u2022 The count(...) > 1 expression forms the query and evaluates the number of atoms left in the set. If this is greater than 1 then multiple atoms in the same ancestor molecule have the same id.The conventions in CMLLite have built-in rules which are generally not explicitly stated in the specification of conventions:\u2022 A convention is applied through an element carrying the convention attribute. The convention applies to that element and all its descendants.\u2022 The value of the convention attribute MUST be a QName that expands to the URI identifying the convention to be applied.\u2022 A convention can require other conventions which must be explicitly specified on appropriate elements.\u2022 If no conventions are declared a warning is issued.We do not intend conventions to replace the CML schema and they are not a general schema language.mode-name\" > limits subsequent validation to templates with mode = \"mode-name\". An apply-templates call without a mode will only call those templates without a mode (i.e. not governed by a convention in the document).CMLValidator uses normal XSLT processing rules but makes special use of the mode attribute to allow validation of different conventions within the same document. < apply-templates mode = \"The current conventions contain many hundreds of validatorTest and to illustrate them we create a very simple sub-convention: simpleUnit. There is already a mature convention for units using the schema3 elements unitList and unit.  simpleUnit explores a small portion of this.http://www.xml-cml.org/convention/simpleUnit namespace.1 The simpleUnit convention is specified with the 2 The simpleUnit convention MUST be specified on a cml:unitList element using the convention attribute.3 A cml:unitList element MUST contain at least one cml:unit child element.4 A cml:unitList element MAY contain other child elements from the CML namespace or from foreign namespaces.There are no constraints on where in a document the unitList element may appear.We start by creating an exhaustive set of tests against which the validator will be developed. These tests (Appendix B) are independent of the actual implementation of the validator. We can be confident that any validator that passes all these tests is likely to be useful in determining whether any of a wide range of documents is valid or invalid against the simpleUnit convention.Figure We now address the purpose of each of the templates in the validator in detail.Template 1: creates the root report:result elementTemplate 2: match = \"*|@*|text\" matches any element, attribute or text node when not in simpleUnit mode. The match expressions for the three node types are the most general possible and will therefore be overridden by any more specific matches. This template takes no action but allows recursive traversal to find elements covered by the simpleUnit conventions arbitrarily deep in the input document.Template 3: carries out the same operations as template 2 but only when in simpleUnit mode. Non-CML elements may be interspersed with CML in the text document and will not cause the validator to emit warnings.Template 4: Only elements from the cml namespace will be matched; the element MUST have a convention attribute, with namespace http://www.xml-cml.org/convention/ and the local name simpleUnit. The schema enforces that the value of the convention attribute must be a namespaceRefType.If the element matched is cml:unitList this triggers mode = \"simpleUnit\" which remains in scope for all descendants.If the element matched is not cml:unitList the validator informs the users that it is an error to specify the simpleUnit convention and apply-templates is called but not in simpleUnit mode.Template 5: matches any cml:unitList element. If this does not have at least one cml:unit child element then an error is reported. Any child nodes are then processed in simpleUnit mode.Template 6: matches any cml:unit element in simpleUnit mode. XSLT rules dictate that it has higher priority than template 7.Template 7: matches any element from the CML namespace in simpleUnit mode. The match is more specific than template 3 but less specific than templates 4, 5 and 6. This will therefore catch any CML namespaced elements other than unitList and unit. The elements matched by this template are covered by rule 4-they are allowed but they are not really part of the convention, hence the output contains information to this effect.This template is primarily for information, not errors-it is therefore appropriate to warn when CML elements might be ignored. Note that the presence of report:info elements in the report document does not mean that the input document is invalid.i.e. they do not overlap .http://www.xml-cml.org/convention/compchem has been developed as part of the Quixote project. It requires that the initialization module contains exactly one molecule and that all the atoms in this molecule MUST have three dimensional coordinates. Rather than create a new convention for molecules it was decided that these requirements were compatible with the molecular convention but required a tightening of some constraints.The compchem convention Some of the rules from the compchem convention are shown below:http://xml-cml.org/dictionary/compchem/).\u2022 There MUST be an initialization module which is a module element with a specific value of its dictRef attribute .\u2022 molecules MUST declare that they conform to the molecular convention by declaring this in the convention attribute  and tests that an atomArray is present and that all the child atoms of this have 3D coordinates. Note that we do not need to check whether or not the molecule has child molecules or other atomArray children because this will be done by the molecular convention.Following the W3C validation tools   and produces a ValidationReport. If input is an InputStream the program checks that it is well-formed XML (this is not necessary for a xomDoc as it is necessarily well-formed). A xomDoc is built from the InputStream and further processing is identical regardless of input format.1. It is well-formed XML. The control class can takes as input either an 2. The xomDoc conforms to the CML schema3.3. Deprecated constructs are not used. The use of deprecated constructs will give a VALID_WITH_WARNINGS result.4. Any conventions specified in the document are obeyed.5. All the prefixes used in namespaceRefTypes (effectively QNames) have been bound to namespaces and are resolvable URLs.etc. publicly available. The workflow is shown in Figure The final check has been put in place as a reminder to users that sharing information is preferable and they can only \"code to the green bar\"  by makinhttp://validator.xml-cml.org/validate which returns a ValidationReport. This must then be queried by the user to determine whether the overall validation resulted in VALID, VALID_WITH_WARNINGS or INVALID. Informal feedback from users indicated that it was more useful to send the complete ValidationReport rather than just a ValidationResult as feedback as this would allow the calling tool to do more.The RESTful webservice implementation is accessed by POSTing the XML/CML document to The website is effectively an instance of a tool that uses the RESTful implementation to do the actual validation but then interprets the results and displays them in the most human-user friendly fashion. Figures conventions which can be as rigid or fluid as they wish. The conventions can be rigorously unit tested using CMLValidator.We have developed an approach to extensible semantics for Chemical Markup Language, where we assume that the current schema (schema3) is stable and expressive. There is enough software and data that this approach has been widely deployed and tested, even if it is not yet mainstream. Semantics are defined in the XSD schema, with additional natural language and validated using a unit test approach (Java and .NET). It works in the main fields of chemistry for which CML has been developed . The approach encourages sub-communities in chemistry to create The convention-based approach is intermediate between natural language and formal systems. It relies, in part, on the wider community agreeing the semantics in schema3 . Sub-communities are starting to build their extensions of which the compchem convention being developed by the Quixote project is a prime example.We believe the convention-based approach will help developers to create better software quicker. The tests/conventions define clear, testable APIs and these are essential for any distributed development.The system interoperates fully with RDF-based systems. Many elements  can be algorithmically translated to RDF. A few core elements  can be held in a more atomic form with bespoke semantics and software . By using this mixture of approaches we believe this is a cost-effective approach to interoperability within chemistry for those who wish to interoperate.http://bitbucket.org/cml/cmllite-validator-code and the web-based implementation is available at http://bitbucket.org/cml/cmllite-validator-ws both under an Apache 2.0 licence.The CMLValidator and associated tests are available at The authors declare that they have no competing interests.JAT developed the CMLLite approach, created the CMLValidator and the test corpus, and wrote the manuscript. PMR is the original author of CML, created the test corpus and wrote the manuscript.The attributes in CML are defined in attributeGroups which must have unique names allowing them to be disambiguated within the schema. The attributeGroup defines an attribute, its datatype/allowed values, and the name of the attribute in the document (these do not have to be unique).Element declarations in the schema specify which attributeGroups are allowed on them (which in this case caused polymorphism).Table etc.) of the convention, the validator is run against this test set to verify that its behaviour still conforms to expectations.The documents below are a subset of the documents used to test the behaviour of the simpleUnit convention validator. After every alteration <cml:unitList convention = \"conventions:simpleUnit\"><cml:unit/></cml:unitList>This produces the following ValidationReport:http://www.xml-cml.org/report/\"><report xmlns = \"<well-formed-test><valid >xml is well formed</valid></well-formed-test><schema-validation-test><valid>document conforms to the schema</valid></schema-validation-test><convention-validation-test><valid>document conforms to all the conventions specified</valid></convention-validation-test><uris-reachable-test><valid>All appropriate URIs were reachable</valid><valid>all dictRefs are resolvable </valid></uris-reachable-test></report>The subsequent inputs produce exactly the same report and we therefore choose to explain what the document is testing for rather than show the output.(ii)http://www.w3.org/1999/xhtml\"><x:p xmlns:x = \"<cml:unitList convention = \"conventions:simpleUnit\"><cml:unit/></cml:unitList></x:p>Tests that simpleUnit convention can be declared on a unitList that is not the root element of the document and is a child of a foreign namespaced element.(iii)<cml:module><cml:unitList convention = \"conventions:simpleUnit\"><cml:unit/></cml:unitList></cml:module>The simpleUnit convention can be declared on a unitList that is not the root element of the document and is a child of a CML element (module).(iv)<element-in-default-namespace><cml:unitList convention = \"conventions:simpleUnit\"><cml:unit/></cml:unitList></element-in-default-namespace>Tests that simpleUnit convention can be declared on a unitList that is not the root element of the document and is a child of an element from the default-namespace.(v)http://www.w3.org/1999/xhtml\"><x:p xmlns:x = \"the unitList need not be the root element<cml:unitList convention = \"conventions:simpleUnit\"><cml:unit/></cml:unitList></x:p>Test that although CML does not have a mixed content model the unitList can occur within non-CML mixed content.(vi)http://www.w3.org/1999/xhtml\"><x:p xmlns:x = \"there are multiple instances of the simpleUnitconvention in this document<cml:unitList convention = \"conventions:simpleUnit\"><cml:unit/></cml:unitList><cml:unitList convention = \"conventions:simpleUnit\"><cml:unit/></cml:unitList></x:p>Test that there can be multiple disjoint simpleUnit convention declarations in the same document.(vii)<cml:unitList convention = \"conventions:simpleUnit\"><cml:unit/>http://www.w3.org/1999/xhtml\"><x:p xmlns:x = \"non cml child-this is fine</x:p></cml:unitList>Tests that the unitList element can contain foreign namespaced elements without giving rise to info reports.(viii)<cml:unitList convention = \"conventions:simpleUnit\"><element-in-default-namespace/><cml:unit/></cml:unitList>Tests that the unitList element can contain elements from the default namespace without giving rise to info reports.(ix)<cml:unitList convention = \"conventions:simpleUnit\"><cml:unit>http://www.w3.org/1999/xhtml\"><x:p xmlns:x = \"non cml child-this is fine</x:p></cml:unit></cml:unitList>Tests that the unit element can contain foreign namespaced elements without giving rise to info reports.(x)<cml:unitList convention = \"conventions:simpleUnit\"><cml:unit><element-in-default-namespace/></cml:unit></cml:unitList>Tests that the unit element can contain elements from the default namespace without giving rise to info reports.(xi)<cml:unitList convention = \"conventions:simpleUnit\"><cml:unit/><cml:unit>http://www.w3.org/1999/xhtml\"><x:p xmlns:x = \"multiple cml:unit elements are allowed</x:p></cml:unit></cml:unitList>Tests that a unitList may contain more than one unit child.The input documents below should all result in a ValidationResult of VALID and the ValidationReport should contain a single info element and MUST NOT contain either error or warning elements. info elements are used to give information about rules in a convention involving the MAY clause. Note that the complete ValidationReport is given for the first example but subsequent examples only contain the error message for brevity.(i)<cml:unitList convention = \"conventions:simpleUnit\"><cml:unit/><cml:molecule/></cml:unitList>Produces:http://www.xml-cml.org/report/\"><report xmlns = \"<well-formed-test><valid > xml is well formed </valid></well-formed-test><schema-validation-test><valid > document conforms to the schema </valid></schema-validation-test><convention-validation-test>http://www.xml-cml.org/schema'] [http://www.xml-cml.org/schema'] [<info location = \"/*[local-name = 'unitList' and namespace-uri = 'schema'] /*[local-schema'] \">http://www.xml-cml.org/convention/simpleUnit convention and may be ignored by some processors.molecule is not a part of the </info><valid>document conforms to all the conventions specified</valid></convention-validation-test><uris-reachable-test><valid > All appropriate URIs were reachable </valid><valid > all dictRefs are resolvable </valid></uris-reachable-test></report>(ii)<cml:unitList convention = \"conventions:simpleUnit\"><cml:unit><cml:atom/></cml:unit></cml:unitList>http://www.xml-cml.org/convention/simpleUnit convention and may be ignored by some processors\"Produces: \"atom is not a part of the (iii)<cml:unitList convention = \"conventions:simpleUnit\"><cml:unit/><cml:unit><cml:bond/></cml:unit></cml:unitList>http://www.xml-cml.org/convention/simpleUnit convention and may be ignored by some processors\"Produces: \"bond is not a part of the e.g. order = '1') the test result would be VALID_WITH_WARNINGS because numeric bond orders are deprecated.Note that if the bond specified a numeric bond order ((iv)<cml:unitList convention = \"conventions:simpleUnit\"><cml:unit>http://www.w3.org/1999/xhtml\"><x:p xmlns:x = \"this is still going to be processed inunitList mode.<cml:bond/></x:p></cml:unit></cml:unitList>http://www.xml-cml.org/convention/simpleUnit convention and may be ignored by some processors\"Produces: \"bond is not a part of the (v)http://www.w3.org/1999/xhtml\"><x:p xmlns:x = \"the unitList need not be the root element<cml:unitList convention = \"conventions:simpleUnit\"><cml:molecule/><cml:unit/></cml:unitList></x:p>http://www.xml-cml.org/convention/simpleUnit convention and may be ignored by some processors\".Produces: \"molecule is not a part of the The documents below should all result in a ValidationResult of INVALID. The ValidationReport should contain a single error element and should not contain either info or warning elements.(i)<cml:molecule convention = \"conventions:simpleUnit\"><cml:unitList><cml:unit/></cml:unitList></cml:molecule>Produces the following ValidationReport:http://www.xml-cml.org/report/\"><report xmlns = \"<well-formed-test><valid > xml is well formed </valid></well-formed-test><schema-validation-test><valid > document conforms to the schema </valid></schema-validation-test><convention-validation-test>http://www.xml-cml.org/schema'] [<error location = \"/*[local-name = 'molecule' and namespace-uri = 'schema'] @*[local-the only valid cml element that can specify the simpleUnit convention is \"unitList\"</error></convention-validation-test><uris-reachable-test><valid > All appropriate URIs were reachable </valid><valid > all dictRefs are resolvable </valid></uris-reachable-test></report>(ii)http://www.w3.org/1999/xhtml\"><x:p xmlns:x = \"<cml:molecule convention = \"conventions:simpleUnit\"><cml:unitList><cml:unit/></cml:unitList></cml:molecule></x:p>Produces: \"the only valid cml element that can specify the simpleUnit convention is 'unitList'\". (Illustrating that the document is still being correctly traversed.)(iii)<cml:unitList convention = \"conventions:simpleUnit\"/>Produces: \"A unit list MUST contain child cml:unit elements\".(iv)<cml:unitList convention = \"conventions:simpleUnit\"><!-- not valid, a unitList must have at least one unit child --></cml:unitList>Produces: \"A unit list MUST contain child cml:unit elements\".(v)<cml:unitList convention = \"conventions:simpleUnit\">http://www.w3.org/1999/xhtml\"><x:p xmlns:x = \"no unit child of unitList</x:p></cml:unitList>Produces: \"A unit list MUST contain child cml:unit elements\".(vi)<cml:unitList convention = \"conventions:simpleUnit\">http://www.w3.org/1999/xhtml\"><x:p xmlns:x = \"<cml:unit/>This unit is not a direct child of unitListand therefore should cause an error.</x:p></cml:unitList>Produces: \"A unit list MUST contain child cml:unit elements\".(vii)<cml:unitList convention = \"conventions:simpleUnit\"><cml:unitList><cml:unit>http://www.w3.org/1999/xhtml\"><x:p xmlns:x = \"the outer unitList does not have at leastone unit child</x:p></cml:unit></cml:unitList></cml:unitList>Produces: \"A unit list MUST contain child cml:unit elements\"."}
{"text": "Simian immunodeficiency virus (SIV) infection of Indian-origin rhesus macaques (RM) has been widely used as a well-established nonhuman primate (NHP) model for HIV/AIDS research. However, there have been a growing number of studies using Chinese RM to evaluate immunopathogenesis of SIV infection. In this paper, we have for the first time reviewed and discussed the major publications related to SIV or SHIV infection of Chinese RM in the past decades. We have compared the differences in the pathogenesis of SIV infection between Chinese RM and Indian RM with regard to viral infection, immunological response, and host genetic background. Given AIDS is a disease that affects humans of diverse origins, it is of importance to study animals with different geographical background. Therefore, to examine and compare results obtained from RM models of Indian and Chinese origins should lead to further validation and improvement of these animal models for HIV/AIDS research. The antAlthough the published data have demonstrated that Chinese RM is a suitable macaque host for studies of HIV disease, more extensive investigations on testing of current HIV vaccine approaches in Chinese RM are needed in order to determine if efficacy of these approaches in humans can be predicted in Chinese RM. These future studies should provide further support for the use of Chinese RM for the investigation of HIV disease.AGM: African green monkey; AID50: 50% animal infectious doses; AIDS: Acquired immunodeficiency syndrome; CCL: Chemokine ligand; CCR5: C-C chemokine receptor 5; CD: Cluster of differentiation; Ch RM: Chinese rhesus macaques; CMV: Cytomegalovirus; CTL: Cytotoxic T Lymphocyte; DC: Dendritic cells; HIV: Human immunodeficiency virus; HLA: Human leukocyte antigen; HMBPP: (E)-4-Hydroxy-3-methyl-but-2-enyl pyrophosphate; IFN: Interferon; IL: Interleukin; LN: Lymph node; I.R: Intrarectally; I.V: Intravenously; IVAG: Intravaginally; MHC: Major histocompatibility complex; mtDNA: Mitochondrial DNA; NHP: Nonhuman primate; PMN: Polymorphonuclear neutrophils; SHIV: Simian-human immunodeficiency virus; SIV: Simian immunodeficiency virus; SNP: Specific single nucleotide polymorphisms; TCID50: 50% tissue culture infective dose; TDF: Tenofovir disoproxil fumarate.The authors declare that they have no competing interests.YZ wrote the manuscript. RB collected information for tables. NH, YP and WZH reviewed and edited the manuscript. All authors read and approved the final manuscript."}
{"text": "Scientific Reports6: Article number: 2721710.1038/srep27217; published online: 06022016; updated: 07042016The original version of this Article contained typographical errors in the spelling of the author Alexandra Christina Isabelle Depelsenaire which was incorrectly given as Alexandra Christina Isobel Depelsenaire. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 1521910.1038/srep15219; published online: 10152015; updated: 12142015The original version of this Article contained typographical errors in the spelling of the author Alice Mado Proverbio which was incorrectly given as C.A. Alice Mado Proverbio. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "AbstractGraminoids, including grasses, are frequently described in the botanical literature as being wind-pollinated. This paper offers visual evidence for insect pollination of a grass. Three of the bees involved were found to have 100% grass pollen in their pollen sacs. In reviewing the literature for this paper, it was evident that those working with bees are well aware that these insects often pollinate graminoids. It is not clear why this information has not been incorporated into the botanical literature. Eremochloaophiuroides)  Figs , 7 is a es) Figs . The popApismellifera, or honey bees, were introduced to North America by European settlers in the 1700's and are not native to the North American continent. They are now best described as being ubiquitous worldwide. Agricultural necessity has fostered this expansion as bees help to pollinate crops. Their evolutionary and phylogenetic origins appear to be multiple radiations out of Africa, with later expansions to Asia and Europe  (Fagaceae) (Sarcocornia)  , oaks (Fagaceae) , and eveocornia) .Supplementary material 1Climatological Data for Louisiana, June 2013Data type: PDFBrief description: Flat file for June 2013 precipitationFile: oo_6602.pdfNational Oceanic and Atmospheric AdministrationSupplementary material 2Climatological Data for Louisiana, July 2013Data type: PDFBrief description: Flat file for July 2013 precipitationFile: oo_6603.pdfNational Oceanic and Atmospheric AdministrationSupplementary material 3Climatological Data for Louisiana, August 2013Data type: PDFBrief description: Flat file for August 2013 precipitationFile: oo_6600.pdfNational Oceanic and Atmospheric AdministrationSupplementary material 4Climatological Data for Louisiana, September 2013Data type: PDFBrief description: Flat file for September 2013 precipitationFile: oo_6599.pdfNational Oceanic and Atmospheric AdministrationSupplementary material 5Climatological Data for Louisiana, October 2013Data type: PDFBrief description: Flat file for October 2013 precipitationFile: oo_6601.pdfNational Oceanic and Atmospheric AdministrationSupplementary material 6Derived wet summer data from NOAAData type: xlsBrief description: \"How-did\" converting inches to centimeters across three weather points in Baton Rouge, La., from manual NOAA PDF amalgamationFile: oo_6604.xlsxNOAA and Tim Jones"}
{"text": "Scientific Reports6: Article number: 2004810.1038/srep20048; published online: 01282016; updated: 05232016.In the original version of this Article, Affiliation 1 was omitted for Zhiming Ma. This error has now been corrected in the PDF and HTML versions of the Article."}
{"text": "The correct reference is: AntifilariasisCampaign (2013) Annual reports. Ministry of Health, Sri Lanka Available at"}
{"text": "Scientific Reports6: Article number: 1953710.1038/srep19537; published online: 01182016; updated: 04202016.The original version of this Article contained typographical errors in the spelling of the author Guodong Yuan, which was incorrectly given as Gongdong Yuan. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 1234910.1038/srep12349; published online: 08262015; updated: 02082016.The original version of this Article contained an error in the spelling of the author Kohei Fujikura, which was incorrectly given as K. Fujikura. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 21694;10.1038/srep21694 Published online: 02152016; Updated: 05092016The original version of this Article incorrectly listed \u2018College of Chemistry and Environment, Minnan Normal University, Zhangzhou, China, 363000\u2019 as a present address for Bang-Qin Huang rather than Shun-Xing Li.This error has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 18366;10.1038/srep18366 published online: 12172015; updated: 03302016The original version of this Article contained a typographical error in the spelling of the author Lee D. Roberts, which was incorrectly given as Lee D. Robert. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 20118; 10.1038/srep20118 published online: 01292016; updated: 03102016The original version of this Article contained typographical errors in the spelling of the author Terry G. Coursey, which was incorrectly given as Terry Coursy. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Asbestos exposure is related to various diseases including asbestosis and malignant mesothelioma (MM). Among the pathogenic mechanisms proposed by which asbestos can cause diseases involving epithelial and mesothelial cells, the most widely accepted one is the generation of reactive oxygen species and/or depletion of antioxidants like glutathione. It has also been demonstrated that asbestos can induce inflammation, perhaps due to activation of inflammasomes.The oxidation state of thioredoxin was analyzed by redox Western blot analysis and ROS generation was assessed spectrophotometrically as a read-out of solubilized formazan produced by the reduction of nitrotetrazolium blue (NTB) by superoxide. Quantitative real time PCR was used to assess changes in gene transcription.Here we demonstrate that crocidolite asbestos fibers oxidize the pool of the antioxidant, Thioredoxin-1 (Trx1), which results in release of Thioredoxin Interacting Protein (TXNIP) and subsequent activation of inflammasomes in human mesothelial cells. Exposure to crocidolite asbestos resulted in the depletion of reduced Trx1 in human peritoneal mesothelial (LP9/hTERT) cells. Pretreatment with the antioxidant dehydroascorbic acid (a reactive oxygen species (ROS) scavenger) reduced the level of crocidolite asbestos-induced Trx1 oxidation as well as the depletion of reduced Trx1. Increasing Trx1 expression levels using a Trx1 over-expression vector, reduced the extent of Trx1 oxidation and generation of ROS by crocidolite asbestos, and increased cell survival. In addition, knockdown of TXNIP expression by siRNA attenuated crocidolite asbestos-induced activation of the inflammasome.Our novel findings suggest that extensive Trx1 oxidation and TXNIP dissociation may be one of the mechanisms by which crocidolite asbestos activates the inflammasome and helps in development of MM. Malignant mesothelioma (MM) is a deadly cancer arising from the mesothelium and its etiology usually involves asbestos exposure. MM is aThioredoxin is a small ubiquitously expressed redox active protein that is important for maintaining the reducing milieu of the cell, in part by reducing protein disulfide bonds that occur in response to oxidative processes. During reduction of disulfide bonds Trx1 itself becomes oxidized and in turn reduced by thioredoxin reductase (TR) using electrons from reduced nicotinamide adenine dinucleotide phosphate (NADPH). Trx1 is2 and grown to 80\u201390% confluency as described previouslyethanesulfonic acid; ARE: Antioxidant response element; zYVAD-fmk: Carbobenzoxy-tyrosyl-valyl-alanyl-aspartyl-[O-methyl]- fluoromethylketone; Chry: Chrysotile asbestos; Croc: Crocidolite asbestos; DHA: Dehydroascorbic acid; DMSO: Dimethyl sulfoxide; DTT: Dithiotreitol; Dox: Doxorubicin; EV: Empty vector; EDTA: Ethylenediaminetetraacetic acid; ERK2: Extracellular signal regulated kinase 2; GB: Glass beads; HBSS: Hank\u2019s balanced salt solution; HMGB1: High mobility group box 1; LP9/hTERT (LP9): hTERT- immortalized human peritoneal cell line; HPRT: Hypoxanthine phosphoribosyl transferase; IAA: Iodoacetic acid; LDH: Lactate dehydrogenase; MM: Malignant mesothelioma; MnSOD: Manganese superoxide dismutase; NAC: N-acetylcysteine; NADPH: Nicotinamide adenine dinucleotide phosphate; NLRP3: NLR family pyrin domain containing 3; PBS: Phosphate-buffered saline; qRT-PCR/qPCR: Quantitative real time PCR; ROS: Reactive oxygen species; shERK2: Short hairpin RNA against ERK2; shCon: Short hairpin RNA non-targeting; SDS PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis; TBST: TBS-Tween; Trx1: Thioredoxin 1; TXNIP: Thioredoxin interacting protein; TR: Thioredoxin reductase; TBS: Tris-buffered saline.Authors declare no competing interests.JT, performed experiments and wrote the manuscript with the help of AS; CW, performed NAC and inflammasome related studies; MM, performed statistical analysis and made final figures for the publication. MM also provided technical assistance with many experiments; BM, conceived the initial idea and provided intellectual input; NH, provided all the plasmids used in the study and insightful discussion; PS, helped with redox Western blots; AS, conceived the idea, designed experiments, supervised the study, interpreted data, and helped JT in writing the manuscript. All authors have read and approved the manuscript."}
{"text": "There are errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: ALC CRM RP FG EFS. Performed the experiments: ALC AG. Analyzed the data: ALC CRM RP. Contributed reagents/materials/analysis tools: FC FG EFS. Wrote the paper: ALC CRM RP FG EFS FC."}
{"text": "Nature Communications7, Article number: 11317 10.1038/ncomms11317 (2016); Published: 04282016; Updated: 0526201615.13155/ncomms11317. This has now been corrected in both the PDF and HTML versions of the Article.The original version of this Article contained an error in the doi number, which was incorrectly given as"}
{"text": "Scientific Reports6: Article number: 2529710.1038/srep25297; published online: 04292016; updated: 05312016The original version of this Article contained a typographical error in the spelling of the author Genyue Fu, which was incorrectly given as Genyu Fu. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications 6: Article number: 788610.1038/ncomms8886 (2015); Published: 08072015; Updated: 10072015The original version of this Article contained an error in the phrase \u2018single electron spins' in the title. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Nature Communications 7: Article number: 1164110.1038/ncomms11641 (2016); Published: 05182016; Updated: 06242016.The original version of this Article contained an error in the spelling of the author Somenath Bakshi, which was incorrectly given as Somenath Bakhsi. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Nature Communications 6: Article number: 741410.1038/ncomms8414 (2015); Published: 06162015; Updated: 02182016.The authors inadvertently omitted Kimiora L. Ward, who managed and contributed data, from the author list. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 14570; 10.1038/srep14570published online: 09282015; updated: 10292015The original version of this Article contained a typographical error in the spelling of the author Hoe-Yune Jung which was incorrectly given as Hoe-Youn Jung.This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Citation: Inderjit. 2015. Introduction to the Special Issue: The role of soil microbial-driven belowground processes in mediating exotic plant invasions. AoB PLANTS7: plv052; doi:10.1093/aobpla/plv052One of the articles in the special issue  was not included in the previous version of the introduction. A revised version which includes the missing article has been published, and we apologize for the omission."}
{"text": "AbstractCales\u00a0has been extensively revised recently and divided into two species groups, the\u00a0noacki- and\u00a0spenceri-groups\u00a0The genus\u00a0Calesmotterni Polaszek, Shih & Ward sp. nov. is described from two females reared from the whitefly Bemisiapongamiae from Taiwan. The species belongs to the spenceri- group, and has a characteristic and unusual antennal clava. A key to the four\u00a0species currently known from the spenceri-group is provided. CalesCalesnoacki\u00a0Howard from eggs of Lepidoptera , C.orchamoplati Viggiani & Carver and C.berryi Mottern & Heraty .A series of surveys was undertaken from 2004 to 2014 for the collection of parasitoid host whiteflies, scale insects and aphids in Taiwan. Whiteflies were identified by C.C. Ko, National Taiwan University, where the holotype and paratype are deposited. Collection and rearing methods during this survey are detailed by Morphological terminology and the format for species descriptions follow NTU: National Taiwan UniversityPolaszek, Shih & Ward, 2015sp. n.urn:lsid:zoobank.org:act:81A93438-A9A8-45D3-9091-1EB842972CCAType status:Holotype. Occurrence: recordedBy: Y.T. Shih; individualCount: 1; sex: female; previousIdentifications: Bemisiapongamiaeex ; Location: country: TAIWAN; stateProvince: Xindian District; locality: Wulai; locationRemarks: Acer sp.on ; Event: eventDate: 10.xii.2010; Record Level: type: on slide; institutionID: NTUType status:Paratype. Occurrence: recordedBy: Y.T. Shih; individualCount: 1; sex: female; previousIdentifications: Bemisiapongamiaeex ; Location: country: TAIWAN; stateProvince: Xindian District; locality: Wulai; locationRemarks: Acer sp.on ; Event: eventDate: 10.xii.2010; Record Level: type: on slide; institutionID: NTUColour: pale brown; vertex of head and ante\u00adrior half of mesoscutum orange; posterior half of mesoscutum and scutellum brown; face and legs pale, almost white.Head with transverse sculpture, face ventral to antennae with scattered slender setae Fig. Unknown.Calesmotternisp.n. can be distinguished from other species in the genus by the following combination of characters: antennal clava with several multiporous plate sensilla attached throughout their lengths; each side lobe of mesoscutum with one seta; fore wing with setae rather evenly distributed; a single row of small campaniform sensilla on dorsal surface of basal cell, just posterior to submarginal vein.The species is named for Dr Jason Mottern, formerly of the University of California, Riverside, USA in recognition of his major contribution to our understanding of this unusual genus.TAIWAN: Xindian District, Wulai.Bemisiapongamiae (Hemiptera: Aleyrodidae). No parasitoids have been recorded to date from this host (A primary endoparasitoid of his host .Calesmotterni is an unusual species in several ways. Morphologically, the clava shows vestiges of having developed from a 2-segmented condition. This, plus the assumed plesiomorphic state of the wing setation, suggests it may be the most morphologically basal species known in the genus.The single female paratype is identical in all respects to the holotype. Calesmotternisp.n. is the only species of the genus currently known from Taiwan."}
{"text": "Scientific Reports6: Article number: 2928510.1038/srep29285; published online: 07082016; updated: 08192016.The original version of this Article contained a typographical error in the spelling of the author Baoqiang Du which was incorrectly given as Baoqing Du. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Correction to:Corrigendum: British Journal of Cancer (2015) 113, 1641\u20131641; doi:10.1038/bjc.2015.391; published online 1 December 2015British Journal of Cancer, the authors noted that author KM Matula had been placed in the incorrect position on the author listing. The publishers would like to apologise for this mistake. The full and correct author listing is reproduced above.Upon publication of the above corrigendum in the"}
{"text": "Scientific Reports5: Article number: 1424510.1038/srep14245; published online: 09182015; updated: 02082016.The original version of this Article contained typographical errors in the spelling of the authors Jaeyune Ryu, Hyoung-Juhn Kim and Jong Hyun Jang, which were incorrectly given as Jae Yoon Ryu, Hyung Juhn Kim and Jong Hyung Jang. These errors have now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 2584410.1038/srep25844; published online: 05162016; updated: 06102016.The original version of this Article contained an error in the spelling of the author Asfa Alli Shaik which was incorrectly given as Alli Shaik Asfa. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications6, Article number: 7879 10.1038/ncomms8879 (2015); Published: 07292015; Updated: 08282013.The original version of this Article contained a typographical error in the spelling of the author Matthew Gilliham, which was incorrectly given as Matthew Gillham. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 1399410.1038/srep13994; published online: 09142015; updated: 12162015The original version of this Article contained a typographical error in the spelling of the author Takahiro Masaki which was incorrectly given as Takahiro Masaski.This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "A reference is omitted from the figure caption for The reference is: Forsman J, Van den Bogaard M, Linder C, Fraser D (accepted for publication 2014). Considering student retention as a complex system: a possible way forward for enhancing student retention. European Journal of Engineering Education."}
{"text": "Nature Communications 6: Article number: 723110.1038/ncomms8231 (2015); Published: 06042015; Updated: 08272015.The original version of this Article incorrectly named the author Shuxin Han as Sean Han. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Three authors were omitted from the author contributions section in the \u201ccontributed to the writing of the manuscript\u201d sub-section. Please refer to the correct author contributions here:Conceived and designed the experiments: LC GB AB. Performed the experiments: LC GB GLP. Analyzed the data: LC GB FP GLP. Contributed reagents/materials/analysis tools: CD AB GLP. Contributed to the writing of the manuscript: LC FP GB.GLP CD AB"}
{"text": "Scientific Reports5: Article number: 1428810.1038/srep14288; published online: 09232015; updated: 12142015Review-only material was inadvertently published with the original version of this Article as Supplementary Movie 1. This has now been removed."}
{"text": "AbstractMyotisalbescens occurs from Mexico southward to Uruguay and Argentina. The species is known for all South American countries except French Guiana and Chile.Myotisalbescens occurs in the Guiana Shield with other four congeners, from which it can be distinguished by external and skull traits. As an aid to future identifications, we provide a key to this assemblage.Based on one specimen recently collected in French Guiana we fill part of the gap in the distribution of the species in South America.  Myotisalbescens was described by Etienne chauve-souris douzi\u00e8me (or chauve-souris brune-obscure) from Paraguay , on 31 July 2011 at an elevation of 42 m. The specimen was caught by hand, inside a hollow log. It is preserved in spirit, with skull prepared separately. The basicranium is broken, which prevented us from taking several measurements, but the rostrum and braincase\u2014structures useful in identifications\u2014are intact.The MHNG 1990.017 is an adult female  collected by M. Dewynter  at Rivi\u00e8re des Cascades, municipality of Montsinery, about 27 km SW of Cayenne, French Guiana  from Paraguar\u00ed, Paraguay. This set of specimens covers the entire distribution range of the species, and comprises most  of the morphological variation currently known for M.albescens.This specimen was directly or indirectly compared with more than 3,800 vouchers of New World Measurements are reported in millimetres (mm) and are from adults only. Dimensions were taken using digital callipers accurate to 0.02 mm, and craniodental measurements were taken under binocular microscopes with low magnification . Measurements include forearm length (FA), third metacarpal length (3MC), braincase breadth (BCB), interorbital breadth (IOB), postorbital breadth (POB), breadth across canines (BAC), breadth across molars (BAM), maxillary toothrow length (MTL), length of the upper molars (M1M3), and mandibular length (MAL). These measurements are defined in Type status:Other material. Occurrence: catalogNumber: MHNG 1990.017; occurrenceRemarks: caught by hand, inside a hollow log; sex: female; lifeStage: adult; preparations: Ethanol 70o GL; disposition: in collection; Taxon: scientificName: Myotisalbescens; kingdom: Animalia; phylum: Chordata; class: Mammalia; order: Chiroptera; family: Vespertilionidae; genus: Myotis; specificEpithet: albescens; taxonRank: species; scientificNameAuthorship: ; vernacularName: Silver-tipped myotis; nomenclaturalCode: ICZN; taxonomicStatus: accepted; Location: higherGeography: French Guiana; Montsinery; Rivi\u00e8re des Cascades; continent: South America; country: French Guiana; stateProvince: Cayenne; municipality: Montsinery; locality: Cayenne, 27 km SW; verbatimElevation: 42 m; verbatimCoordinates: 04\u00b045'01\"N 52\u00b029'08\"W; verbatimLatitude: 04\u00b045'01\"N; verbatimLongitude: 52\u00b029'08\"W; verbatimCoordinateSystem: degrees decimal minutes; Event: eventDate: 2011-07-31Presence of a fringe of hairs along the trailing edge of uropatagium, long and silky pelage with frosted appearance on the dorsum, ears 9\u201314 mm in length, broad interorbital and postorbital constrictions, and globular braincase.Southern Veracruz, Mexico, southward through Central America to Uruguay and Argentina.Myotis, there is no one single character distinguishing M.albescens from its congeners. However, the species can be easily identified based on the following set of traits: presence of a fringe of hairs along the trailing edge of uropatagium, long and silky pelage with frosted appearance on the dorsum, ears 9\u201314 mm in length, broad interorbital and postorbital constrictions, and globular braincase. Although this set of traits is not fully present in some specimens, the presence of a fringe of hairs along the trailing edge of the uropatagium has been recorded in 99.4% of the specimens examined (500 out of 503) throughout the entire distribution range of the species, and is useful to distinguish it from all Neotropical species but M.atacamensis  and M.levis . Myotisatacamensis occurs from western Peru to northern Chile  for French Guiana and for all South American countries except Chile, from which the species is possibly absent. Its southernmost record on the west side of the Andes is in the semideciduous forests of north-western Peru  field identification that are likely erroneous. This stresses the importance of vouchered and carefully identified specimens to appropriately record species occurrences in such difficult taxonomic groups as the Neotropical Myotis  of which occur in French Guiana (Although this record does not add any biological information for the species, it is useful to more accurately describe the spectacular biodiversity of French Guiana, and emphasizes its rich biota, which is taxonomically and ecologically highly diversified for bats. Paracou in French Guiana concentrates one of the highest species diversity in the world, with ca. 78 species see . About 1h Guiana ."}
{"text": "Scientific Reports6: Article number: 2930910.1038/srep29309; published online: 07072016; updated: 08242016The original version of this Article contained a typographical error in the spelling of the author Amitava Banerjee, which was incorrectly given as Amitava Banarjee. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 15578; 10.1038/srep15578 published online: 10232015; updated: 01202016.The original version of this Article contained a typographical error in the spelling of the author Gal Richter-Levin, which was incorrectly given as Gal Richter-Levine. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "AbstractTelotheta Warren found in Ecuador and Bolivia are described. The paper focuses on the morphological description and illustration of the wing pattern and genitalia structures of the typus generis Telothetamuscipunctata Dognin and the newly identified species Telothetaunoi and Telothetafresei. The distinguishing characters of the genera Telotheta and Paromphacodes are also briefly discussed.Two new species of the lophochoristine genus  Geometramuscipunctata.\u00a0Telothetachlorostigma), discussing the similarity of the species he discovered and Dognin's Geometramuscipunctata, highlighting the differences observed in the colour of the frons, and of the venation of the forewing.A delicate, bluish green moth from Southern Ecuador was described by\u00a0Telotheta for the first time, presented a comparative morphological characterization and synonymized the two species.\u00a0Telotheta\u00a0 with the tribe Lophochoristini. She characterized the male and female genital structures of the monotypical genus Telotheta. The genus-level characteristics of Telotheta include: hind tibia with one pair of  spurs, the absence of the frenulum in females, the absence of usual transverse lines on wings, the absence of fields of modified scales on the male abdominal sternite A3. Pitkin described the female antennae as being filiform or dentate and mentioned the similarity of the genera Oospila Warren, 1897 and Telotheta, while the latter differs from the former by lacking the characteristical lophochoristine abdominal crests, which are composed of specialized, long, erect and curled scales.Telotheta are described below.Two further species of the genus The present study was initiated by attempts to identify moths found in the collections of the Estonian Museum of Natural History  and in the IZBE insect collection which is deposited at the Estonian University of Life Sciences (Tartu). The material is collected by Aare Lindt.Telothetamuscipunctata (see the description of Telothetafresei\u00a0 below). Moths were mostly photographed prior to investigation of the genital structures using a Canon 300D digital camera, while genital slides were photographed with an Olympus SZ60 microscope and Leica M165C digital camera. The obtained photographs were augmented using Adobe Photoshop Elements v7 in order to improve their resolution.The mounting of emerald green moths is a complicated process and the method that was used required injecting some water into the thorax, followed by keeping the moth in a container with a high air moisture environment for about 2 hours, and finally desiccating the mounted sample at around 60\u00b0C for about 12 hours. Palpi, antennae, legs and details of wing venation were measured using an ocular micrometer and binocular microscopes, using 40\u00d7 magnification. The genital slides of males and females were treated using established procedures , inspectLindt & Viidaleppsp. n.urn:lsid:zoobank.org:act:DA996931-3FEE-4EF9-8DEE-E4D6FAE4AE0DType status:Holotype. Occurrence: sex: male; Location: country: Ecuador; stateProvince: Napo; verbatimLocality: Carlos Julio; verbatimElevation: 950 m; verbatimLatitude: 01\u00b015'33\"S; verbatimLongitude: 77\u00b049'27\"W; decimalLatitude: -1.259167; decimalLongitude: -77.824167; Event: samplingProtocol: UV light sampling; eventDate: 2008-02-10; Record Level: institutionCode: EMNHType status:Paratype. Occurrence: sex: 4 males; Location: country: Ecuador; stateProvince: Napo; verbatimLocality: Carlos Julio; verbatimElevation: 950 m; verbatimLatitude: 01\u00b015'33\"S; verbatimLongitude: 77\u00b049'27\"W; decimalLatitude: -1.259167; decimalLongitude: -77.824167; Event: samplingProtocol: UV light sampling; eventDate: 2008-02-10; Record Level: institutionCode: EMNH; collectionCode: IZBEHead, thorax and abdomen. Male: The wing span of males is 15\u201317 mm . The costal edge of the forewing is lined light brown (slightly rosy in Telothetamuscipunctata). The hindwing distal margins are evenly rounded, not slightly angulated at the middle.Male genitalia Type status:Other material. Occurrence: recordedBy: Aare Lindt; individualCount: 1; sex: male; Location: country: Ecuador; stateProvince: Pichincha; verbatimLocality: El Transito; verbatimElevation: 1080; verbatimLatitude: 00\u00b018'59\"S; verbatimLongitude: 78\u00b054'54\"W; Event: samplingProtocol: UV light sampling; eventDate: 2008-02-03; Record Level: institutionCode: ENHMBoth original descriptions by P. Dognin and W. Warren (see Introduction) refer to the pale bluish green moths with large green discal blotches on both wings. The colour of the frons was described as yellowish ochreous by Dognin, and as brick red by Warren.Telothetamuscipunctata has a row of about 20 stout curved setae to the distal margin of valva, and the thorn-like projections of the sternite A8 appear slightly diverging . The forewing costal edge is lined light brown (slightly rosy in Telothetamuscipunctata).ngs Fig.  are densMale genitalia . The aedeagus is about 1.3 mm long. The distal process of the uncus is reduced, the gnathos arms are short hooked. In Telothetafresei the juxta and the transtilla together constitute a long anellar complex. The juxta is broader than in the two other species. The valva is apically bilobed, the apical lobe as in Telothetamuscipunctata (more slender in Telothetaunoi). The dorsal margin of the apical lobe bears about 8-10 scattered, stout, curved setae,\u00a0and about 20 such setae in a row in Telothetamuscipunctata. The ventral margin of the subapical lobe of the valva is straight. Sternite A8 distal projections are flat and triangularly rounded, completely different from the slender, rigid projections in Telothetamuscipunctata and Telothetaunoi.lia Fig. c. The maTelothetamuscipunctata  and therefore treated as conspecific.\u00a0Telothetamuscipunctata males by the presence of two rod-like processes to the posterior edge of the last abdominal sternite and females by having a large roundish sclerotization in\u00a0 the sterigmal area, a membranous bursa copulatrix, provided with a \"small signum with two tapered prongs\" (Telothetamuscipunctata and Telothetafresei are clear. prongs\" : 408. ThTelothetafresei from Ecuador and from Bolivia differ slightly in the shape of the eighth sternite of male abdomen. The sternite has triangular projections to its posterior edge in the populations of Ecuador, and more rounded projections in the\u00a0 populations from Bolivia. This phenomenon requires further investigation: the differences are slight and, possibly, clinal.The series of This new species is named in honour of the former lutherian pastor in L\u00e4\u00e4ne-Nigula, West Estionia, Theodor Alexander Benedict Frese. His insect collection, consisting of several thousands of mounted and labelled local butterflies, moths and other hexapods, was donated in 1864 to the Eestimaa Provintsiaalmuuseum, the precedor of the Estonian Museum of Natural History. The 150th anniversary of the Museum will be celebrated 2014. The gender is masculine.Telothetafresei is described from Eastern Ecuador and Bolivia.Telothetafresei is collected in tropical forests between about 500 m and 2000 m elevation.Telotheta species are to be separated as follows:The three Telothetamuscipunctata\u00a0 moths have a slender frons, pale green, semidiaphanous wings and a bicornute sternite A8 in male;Telothetafresei moths have frons broad, both wings similarly pale green, the male sternite A8 flat with two broad projections distally;Telothetaunoi\u00a0 has frons broad, forewings dark green and dense scaled, and the male sternite A8 bicornute like in Telothetamuscipunctata."}
{"text": "In the Funding section, one grant number from the funder Papes VI/FIOCRUZ/Brazilian National Council for Scientific and Technological Development (CNPQ) is missing. The grant number is: 407582/2012\u20136."}
{"text": "Nature Communications 6: Article number: 805610.1038/ncomms9056 (2015); Published: 08202015; Updated: 09232015.In Fig. 5d of this Article, a shaded box was inadvertently placed over the lower part of the panel during the final stages of production. The correct version of the figure appears below.Figure 5"}
{"text": "Nature Communications7: Article number: 11826 10.1038/ncomms11826 (2016); Published: 06072016; Updated: 08162016The original version of this Article contained an error in the spelling of the author Frances Eun-Hyung Lee that was incorrectly given as Francis Eun-Hyung Lee. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 1122810.1038/srep11228; published online: 06102015; updated: 09022015.In the Supplementary Information file originally published with this Article, the primer sequences for cloning the constructs were omitted. This error has now been corrected in the Supplementary Information that now accompanies the Article."}
{"text": "Nature Communications 6: Article number: 786610.1038/ncomms8866 (2015); Published: 07222015; Updated: 02102016.The original version of this Article contained an error in the spelling of the author Edda Kloppmann, which was incorrectly given as Edda Kloppman. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 2577810.1038/srep25778; published online: 05122016; updated: 07202016The original version of this Article contained a typographical error in the spelling of the author Qingjian Wu, which was incorrectly given as Qingjiang Wu. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 13532; 10.1038/srep13532 published online: 09012015; updated: 05202016.The original version of this Article contained a typographical error in the spelling of the author Karen Vanhoorelbeke, which was incorrectly given as Karen Vanhoorelbeeke. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "BMC Medical Genomics [Following the publication of the article in Genomics , it was Given names: Herman M.J.Surname: SontropGiven names: Marcel J.T.Surname: ReindersGiven names: Perry D.Surname: MoerlandWe apologize for the inconvenience this may have caused."}
{"text": "Nature Communications6: Article number: 8745 10.1038/ncomms9745 (2015); Published: 10262015; Updated: 11272015The original version of this Article contained an error in the spelling of the author Gilbert Di Paolo, which was incorrectly given as Gilbert D. Paolo. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Nature Communications 6: Article number: 868710.1038/ncomms9687 (2015); Published: 10222015; Updated: 01112016.The original version of this Article contained an error in the spelling of the author Tomislav Ilicic, which was incorrectly given as Tomislav Illicic. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 2132310.1038/srep21323; published online: 02182016; updated: 04132016Supplementary Datasets 2\u20135 were inadvertently published with the original version of this Article. These have now been removed."}
{"text": "Nature Communications6: Article number: 888410.1038/ncomms9884 (2015); Published: 12022015; Updated: 01212016.The original HTML version of this Article contained an error in the spelling of the author R. Elizabeth Sockett, which was incorrectly given as Elizabeth R. Sockett. This has now been corrected in the HTML. The PDF version of the Article was correct from the time of publication."}
{"text": "Nature Communications6: Article number:681910.1038/ncomms7819 (2015); Published 04142016; Updated 06142016The original version of this Article contained an error in the spelling of the author Hugh P. Possingham, which was incorrectly given as Hugh P. Posssingham. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 21817; 10.1038/srep21817 published online: 02242016; updated: 05202016.In Figure 2 of this Article, the upper left graph is a duplication of the upper right graph. The correct Figure 2 appears below as"}
{"text": "Scientific Reports6: Article number: 1931910.1038/srep19319; published online: 01132016; updated: 04132016In the original version of this Article, the symbol \u201cIn addition, the HTML version of the Article incorrectly listed Venkata Jayasurya Yallapragada, and not Venu Gopal Achanta, as corresponding author.These errors have now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 23499; 10.1038/srep23499 published online: 03232016; updated: 04292016.In the Supplementary Information file originally published with this Article, references 31 and 32 were incorrectly given as references 44 and 45 respectively. These errors have been corrected in the Supplementary Information that now accompanies the Article."}
{"text": "AbstractMilichiidae are often myrmecophilic. We document the first record of a fly from this family interacting with an ant of the genus Polyrhachis. In lowland riparian rainforest in Sabah, Malaysia, we observed a female of the genus Milichia following an ant of the species of\u00a0P.illaudata, and repeatedly attempting to make close contact. Our observation suggests that the dipteran may have been attempting to feed kleptoparasitically from the Polyrhachis\u00a0worker, since members of this ant genus often feed on liquid carbohydrate-rich food resources. This is the first time an interaction has been observed between a fly of this family and an ant of this widespread old world tropical genus.Flies in the family  Milichid flies often interact with ants, with either adults feeding kleptoparasitically from foraging ant workers, or larvae feeding on detritus in the nest . Howeverth 2014, in an area of regularly inundated riparian forest 100m from the river  close to the field centre, we observed an ant of the genus Polyrhachis traversing the top of a plastic sheet c. 50 cm in height, which was being used as a vertical barrier to trap amphibians on the forest floor during the field course. The single Polyrhachis worker was being followed closely (c. 3 cm above and behind) by a hovering dipteran, which frequently attempted to make closer contact with the ant, in particular when the ant stopped moving. The ant was not behaving normally, but appeared to be attempting evasion of the dipteran. We observed this for approximately thirty seconds before collecting both ant and dipteran into a plastic container. The dipteran was initially not disturbed by its collection, and continued for some time with attempts to make close contact with the ant. We were unable to directly observe the outcome of these attempts (either kleptoparasitism or oviposition). Both insects were then preserved in 95% ethanol and point mounted for identification. To identify the ant we first used a key to the ant genera of Borneo . To identify the fly we used the key to genera at http://milichiidae.info/content/key-genera-milichiidae, based on that of Field observation and collection was conducted during a field course organised by the Naturalis Biodiversity Center at Danau Girang Field Centre on the lower Kinabatangan river, Sabah, Malaysia. On March 4f Borneo . We thenf Borneo \u00a0and finaMeigen, 1830Type status:Other material. Occurrence: individualCount: 1; sex: female; lifeStage: adult; behavior: following an ant; preparations: whole animal point\u00a0mounted; disposition: In collection; otherCatalogNumbers: DIP 00713; Taxon: scientificName: Milichia; parentNameUsage: Milichiinae; originalNameUsage: Milichia\u00a0Meigen 1830; Location: higherGeography: Asia; Malaysia; Sabah; Kinabatangan River Floodplain; continent: Asia; country: Malaysia; stateProvince: Sabah; locality: Kinabatangan River Floodplain; verbatimLocality: Kinabatangan River Floodplain ~10km downstream from Lahad Datu - Sandakan road crossing; verbatimElevation: 30 m; verbatimCoordinates: 5.4115, 118.0395; verbatimLatitude: 5.4115; verbatimLongitude: 118.0395; verbatimCoordinateSystem: decimal degrees; decimalLatitude: 5.4115; decimalLongitude: 118.0395; Identification: identifiedBy: Irina Brake; dateIdentified: 13-09-2014; identificationReferences: Brake (2000); identificationRemarks: Milichia females to species.Not possible to assign ; Event: samplingProtocol: Manual collection into plastic pot.; samplingEffort: Single collection event.; eventDate: 2014-03-04; habitat: Riparian lowland rain forest.Walker, 1859Type status:Other material. Occurrence: individualCount: 1; sex: female; lifeStage: adult; behavior: foraging; preparations: whole animal point mounted; disposition: in collection; otherCatalogNumbers: HYM\u00a00003736; Taxon: scientificName: Polyrhachis (Myrma) illaudata\u00a0Walker 1859; parentNameUsage: Formicinae; Location: higherGeography: Asia; Malaysia; Sabah;\u00a0Kinabatangan River Floodplain; continent: Asia; country: Malaysia; stateProvince: Sabah; locality: Kinabatangan River Floodplain; verbatimLocality: Kinabatangan River Floodplain ~10km downstream from Lahad Datu - Sandakan road crossing; verbatimElevation: 30 m; verbatimCoordinates: 5.4115, 118.0395; verbatimLatitude: 5.4115; verbatimLongitude: 118.0395; verbatimCoordinateSystem: decimal degrees; decimalLatitude: 5.4115; decimalLongitude: 118.0395; Identification: identifiedBy: Tom M. Fayle; dateIdentified: 2014-06-20; identificationReferences: www.antbase.net; The BORNEENSIS collection at the Institute for Tropical Biology, Universiti Malaysia Sabah; Dorow 1995.; Event: samplingProtocol: Manual collection into plastic pot.; samplingEffort: Single sampling occasion.; eventDate: 2014-03-04Milichia . The ant was identified as belonging to the species Polyrhachisillaudata\u00a0, and P.beccarii, which is morphologically similar, but much larger than P.illaudata.The dipteran was identified as a female of the genus hia Fig. , in the ata\u00a0Fig.  in the sMilichiidae being associated with an ant in the genus Polyrhachis. The only other record of an ant in the tribe Camponotini being associated with this family of flies is that of Camponotusacvapimensis, with a fly of the species Milichiasavannaticola being found with the ant, although it was not clear whether the two species were interacting (Formicinae including Lasius (Formica (Milichia female was attempting to feed kleptoparasitically from the P.illaudata\u00a0ant, since many other species of diptera in this family are known to conduct such attacks, either feeding on regurgitated liquid food or through licking anal secretions (Polyrhachis ants, and indeed other genera in the Camponotini, are known to feed extensively on liquid carbohydrate-rich food sources at extrafloral and floral nectaries, and also to attend homopterans (To our knowledge, this is the first record of a fly in the family eracting . Howeverg Lasius \u00a0and Form(Formica . Althougcretions . Polyrhaopterans , and henopterans . Howeveropterans , and so"}
{"text": "Scientific Reports6: Article number: 2089810.1038/srep20898; published online: 02162016; updated: 04132016The original version of this Article contained a typographical error in the spelling of the author Josef Andreas Weber, which was incorrectly given as Josef Andreass Weber. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "AbstractNeossos Malloch contains three Nearctic and one western European species. Most known specimens have been collected from bird nests. Two specimens of an undescribed species of Neossos were collected by sweeping in subarctic tundra and a mesic meadow in the Yukon Territory, Canada. This represents a significant northward extension of the known Nearctic range of the genus.The rarely collected genus Neossostombstonensissp. n. is described from the Yukon Territory. This represents the fourth described Nearctic species of Neossos. Although the type specimens were collected by sweeping, the species is predicted to be associated with bird nests, based on habits of other members of the genus. A revised key to the Nearctic species of Neossos is provided. Neossos Malloch, 1927 is a rarely collected genus of acalyptrate Diptera primarily associated with bird nests, where the larvae are apparently saprophagous in nest material. Neossos and recognized three species in the region: Neossosmarylandicus Malloch, 1927 (associated with cavity-nesting passerine birds in eastern North America); N.californicus Melander, 1952 (associated with raptors in western United States and southern British Columbia); and N.atlanticus Gilbert & Wheeler, 2007 . In the course of a large-scale study of arthropod diversity and ecology in northern Canada, we collected two specimens of Neossos from the Yukon Territory, far north of the documented geographic range of Nearctic Neossos species. Those specimens are described here as Neossostombstonensissp. n.Field-collected specimens were preserved in 95% ethanol and subsequently chemically dried using Hexamethyldisilazane. Type specimens are deposited in the Lyman Entomological Museum, McGill University, Ste-Anne-de-Bellevue, QC, Canada (LEMQ) and have been assigned unique specimen identifiers in the format LEM0000000. Genitalic dissection of the male holotype was made by detaching the posterior part of the abdomen, and heating it in 85% lactic acid on a heating plate for 10 minutes. Cleared genitalia were transferred to glycerin for examination and drawing, then stored in glycerin in a plastic microvial pinned with the specimen.Solecki & Wheeler, 2015sp. n.urn:lsid:zoobank.org:act:A7C54472-8048-461F-8C58-5DE8413622E4Type status:Holotype. Occurrence: recordedBy: NBP Field Party; sex: male; Taxon: class: Insecta; order: Diptera; family: Heleomyzidae; genus: Neossos; specificEpithet: tombstonensis; scientificNameAuthorship: Solecki & Wheeler, 2015; Location: continent: North America; country: Canada; stateProvince: Yukon Territory; verbatimLocality: Dempster Hwy nr North Fork Pass; verbatimElevation: 1200 m; decimalLatitude: 64.57942; decimalLongitude: -138.28212; geodeticDatum: WGS84; Event: samplingProtocol: sweeping; year: 2011; month: 6; day: 24; habitat: wet tundra; fieldNumber: wet replicate 3; Record Level: datasetID: LEM0110624; institutionCode: LEMQType status:Paratype. Occurrence: recordedBy: TA Wheeler; sex: female; Taxon: class: Insecta; order: Diptera; family: Heleomyzidae; genus: Neossos; specificEpithet: tombstonensis; scientificNameAuthorship: Solecki & Wheeler, 2015; Location: continent: North America; country: Canada; stateProvince: Yukon Territory; verbatimLocality: S Klondike Hwy, 18.2 km S Alaska Hwy, Robinson Road House; decimalLatitude: 60.44839; decimalLongitude: -134.84961; geodeticDatum: WGS84; Event: samplingProtocol: sweeping; year: 2012; month: 7; day: 9; habitat: mesic meadow; Record Level: datasetID: LEM0110625; institutionCode: LEMQGeneric characters as described by Epandrium brown, rounded, wider than high; hypandrium pale brown, ventral hypandrial process with 9 setae; surstylus with outer lobe roughly triangular, narrowing distinctly in basal half; postgonite large; distiphallus with fine setulae for most of length except distally; epiphallus clavate Figs , 3.The species is named for the Tombstone Mountains and Tombstone Territorial Park, where the holotype specimen was collected.Known only from the southern and central Yukon Territory, Canada.Neossos are rarely collected. Of approximately 130 specimens studied by Neossos, N.nidicola , known from Great Britain and Finland (N.tombstonensis by sweeping was surprising, the rarity of specimens was not. Multiple years of intensive sampling at the two localities from which types were collected, as well as other similar sites in the Yukon, have not produced another specimen.Because they are apparently obligate associates of bird nests, specimens of  Finland  is closeN.tombstonensis were collected in two distinct habitats. The North Fork Pass site is a wet tundra meadow north of treeline in the Ogilvie Mountain ranges. Dominant vegetation includes sphagnum mosses, grasses, sedges and ericaceous shrubs over a substrate with extensive permafrost. In contrast, the Robinson Road House site is a mesic meadow with a diverse assemblage of herbaceous plants dominated by Asteraceae, Fabaceae, and Poaceae, on a sand substrate in a clearing surrounded by spruce-pine-aspen forest.The types of Neossos, it is likely that N.tombstonensis is also a nest associate. Each of the other three Nearctic species exploits a different microhabitat and host group: Neossosmarylandicus in association with cavity-nesting passerines; N.californicus in raptor nests; and N.atlanticus in nests of cliff-nesting seabirds (N.tombstonensis was collected, so it is impossible to speculate on the identity or nesting habits of the hosts.Based on the known habits of the other described species of seabirds . Several"}
{"text": "Scientific Reports6: Article number: 21282;10.1038/srep21282 Published online: 02172016; Updated: 06022016The original version of this Article contained errors in the spelling of the authors Anis Allagui, Mohammad Ali Abdelkareem, Hussain Alawadhi and Ahmed S. Elwakil which were incorrectly given as Allagui Anis, Ali Abdelkareem Mohammad, Alawadhi Hussain and S. Elwakil Ahmed respectively.These errors have now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 24628; 10.1038/srep24628 published online: 04192016; updated: 06272016.An incorrect Supplementary Information file was inadvertently published with this Article. In addition, Supplementary Movies 1\u20135 were omitted. The correct Supplementary Information and Supplementary Movies now accompany the Article."}
{"text": "Scientific Reports6: Article number: 2009010.1038/srep20090; published online: 01292016; updated: 04132016The original version of this Article contained an error in the spelling of the author Yan Huang, which was incorrectly given as Yanhuang. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 1731910.1038/srep17319; published online: 11302015; updated: 03292016The original version of this Article contained a typographical error in the spelling of the author Mikhail A. Livshits, which was incorrectly given as Mikhail A. Livshts. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "There are errors in the Funding section. The correct funding information is as follows: This work was supported by Chang Gung Medical Research Program CMRPG 3C1441: HSC; CMRPG 391201\u20133: HSC; CMRPD 1A0302: WJS; CMRPD 190173: WJS. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."}
{"text": "Scientific Reports5: Article number: 17094; 10.1038/srep17094 published online: 11252015; updated: 01192016.The original version of this Article contained a typographical error in the spelling of the author Ben Murrell which was incorrectly given as Ben Murrel. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 17568;10.1038/srep17568 published online: 12032015; updated: 04282016The original version of this Article contained a typographical error in the spelling of the author Marc B. Bissonnette, which was incorrectly given as Marc B. Bissonette. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "There are errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: GS SA AM LF. Analyzed the data: GS. Wrote the paper: GS. Revised paper: SA AKW FM AM LF"}
{"text": "Nature Communications7 Article number:1147910.1038/ncomms11479 (2016); Published: 05102016; Updated: 06062016.The original version of this Article contained an error in the spelling of \u2018refine' in the title of the paper. This has now been corrected in both the PDF and HTML."}
{"text": "AbstractCoccidohystrixinsolita (Green) (Hemiptera: Pseudococcidae), is recorded from the island of Guam in the Mariana Islands for the first time. Factors indicating that this introduced mealybug has the potential to become a pest of economic importance for agriculture and horticulture on Guam are discussed.The eggplant mealybug,  Coccidohystrixinsolita (Green) is broadly distributed in the tropics and subtropics and well known as a agricultural and horticultural pest  for diagnosis. A total of seven adult female specimens were selected and prepared on three microscope slides using the method given by Type status:Other material. Occurrence: catalogNumber: AM20131204.002; occurrenceRemarks: on eggplant leaves; recordedBy: Jesse Bamba; sex: 7 slide-mounted adult females were examined; Location: islandGroup: Mariana Islands; island: Guam; municipality: Dededo; locality: near Swamp Road; decimalLatitude: 13.539981; decimalLongitude: 144.83435; Identification: identifiedBy: Gillian W. Watson; dateIdentified: 2013-12-13; Event: samplingProtocol: eggplant leaf samples; eventDate: 2013-12-04; Record Level: collectionID: ESUG; institutionCode: UGUAM; basisOfRecord: LivingSpecimen; source: http://guaminsects.myspecies.info/node/26239-segmented; posterior ostioles present, anterior ostioles absent; cerarii on margins numbering 17 pairs, numerous dorsal cerarii present also, each cerarius consisting of 1\u201315 large conical setae situated on a sclerotized prominence, without any associated trilocular pores; legs well developed, each claw with a denticle present on plantar surface; circulus absent; anal lobes well developed, each with a sclerotized ventral bar; quinquelocular pores numerous on venter; multilocular disc pores numerous on venter of abdominal segments III-IX, a few also present on the venter of segments I and II and on the dorsum of segment VII; ventral oral collar ducts present on submargins of abdominal segments V-VIII; oral rim ducts absent entirely.Coccidohystrixinsolita.Diagnosis was based Coccidohystrixinsolita has been recorded in the literature from the following regions and countries:Afrotropical: Kenya, Madagascar, Rodriques Island (Mauritius), South Africa, Tanzania, Zanzibar; Australasian: Western Samoa; Oriental: Bangladesh, Burma (=Myanmar), India, Laos, Pakistan, Philippines, Sri Lanka, Thailand, Vietnam; Palaearctic: China, Saudi Arabia (i Arabia .Coccidohystrixinsolita on Alternanthera (Amaranthaceae) imported from Singapore ; Hyperaspismaindronia; Nephusregularis; Lepidoptera:Lycaenidae: Spalgisepeus . Experience has shown that invasive species which originate from outside of the U.S., such as this one, are harder to deal with than those accidentally imported from the U.S. mainland or Hawaii. For invasive insect species already present in the U.S., control resources are usually readily available. Often research has been done, control methods have been developed, biological control agents have been identified, an exploratory entomologist has been sent out to collect candidate species, and these have been imported, cultured and tested, and are available for use on Guam. However, resources are scant when it comes to responding to invasive species of non-U.S. origin.Rapid Response Capacity. There is currently a critical lack of capacity to deal with entomological problems on Guam and in the rest of Micronesia. The number of Ph.D. level entomologists practicing on Guam and in the rest of Micronesia has decreased from nine during the mid-1990s to only three at present.Biological Control Agent Import Permits. Guam is required to comply with U.S. Department of Agriculture regulations for importing biological control agents. These requirements are far more stringent for organisms originating outside of the U.S. than for those imported from within the U.S. Delays in the permitting process and a lack of capacity to comply with permit conditions sometimes impede rapid progress towards establishment of biological control in time to prevent major economic and environmental damage. Often, there is a pest population explosion prior to implementation of biological control. During this initial outbreak, risk of accidental export to trading partners is high."}
{"text": "There are currently no agreed recommendations on how to investigate children for gastrointestinal (GI) involvement in Juvenile Systemic Sclerosis (JSSc). The aim of screening is to detect disease early to facilitate early aggressive therapy and improve outcomes. GI involvement at diagnosis incurs a worse outcome [1]. Most deaths occur early in the disease course .To develop recommendations for investigation of GI involvement in JSSc, based on paediatric evidence and where this was lacking, consensus expert agreement.Members of the PRES Scleroderma Working Group were invited to participate; additionally a paediatric gastroenterologist was invited. A nominal group technique was used. 75% consensus was defined as agreement.Table N-terminal pro-brain natriuretic peptide; GORD: gastro-oesophageal reflux disease.BP: blood pressure; ECG: electrocardiogram; ECHO: echocardiogram; MRI: magnetic resonance imaging; HRCT: high resolution computerised tomography; PFT: DLCO pulmonary function tests with diffusion capacity of lung for carbon monoxide; 6MWT: 6 minute walk test; NT BNP: JSSc has a significant mortality particularly early on in the disease course. The objective of an aggressive screening program is to identify GI involvement at a stage which may be amenable to treatment. The recommendations developed by this group aim to standardise care and improve outcomes in this rare disease.None declared."}
{"text": "Scientific Reports5: Article number: 1243910.1038/srep12439; published online: 07272015; updated: 09212015The original version of this Article contained an error in the spelling of the author Paul R. Bessell, which was incorrectly given as Paul B. Bessell. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "AbstractTipula (Vestiplex) hugueniniana Alexander, 1971 is proposed as junior synonym of Tipula (V.) wahlgrenana Alexander, 1968. The new synonymy is based on similarity of male genitalia.Based on examination of type specimens a crane fly species  Tipula (Vestiplex) Bezzi, 1924, are characterized by an ovipositor with the cerci powerfully constructed, heavily sclerotized with outer margins serrate, smooth in several Asiatic species; hypovalvae small to rudimentary  includes 170 valid species and subspecies level taxa, which are distributed throughout the Nearctic, Palaearctic and Oriental Regions .TMMP, program Immage-Pro Express 6.0. (Media Cybernetics).Specimens were studied with an Olympus SZ51 microscope. Pictures were taken with an Olympus SZX10, camera EvolutionTerminology of morphological features generally follows that of Alexander, 1968Tipula (Vestiplex) wahlgrenanaTipula (Vestiplex) wahlgrenanaTipula (Vestiplex) hugueninianasyn. n.Type status:Holotype. Occurrence: recordedBy: Schmid; sex: male; preparations: antennae, leg, wing and genitalia on slide mounted; Taxon: genus: Tipula; subgenus: Vestiplex; specificEpithet: wahlgrenana; scientificNameAuthorship: Alexander, 1968; Location: country: India; stateProvince: Kumaon; verbatimLocality: Khumyara, Pauri Garhwal; verbatimElevation: 4300-5000 feet [1311-1524 m]; Event: eventDate: 28 May 1958; Record Level: institutionCode: USNMType status:Holotype. Occurrence: recordedBy: Schmid; sex: male; preparations: antenna, legs, wing and genitalia on slide mounted; Taxon: genus: Tipula; subgenus: Vestiplex; specificEpithet: hugueniniana; scientificNameAuthorship: Alexander, 1971; Location: country: India; stateProvince: Sikkim; verbatimLocality: Nanga; verbatimElevation: 5000 feet [1524 m]; Event: eventDate: 11 May 1959; Record Level: institutionCode: USNMType status:Paratype. Occurrence: recordedBy: Schmid; sex: male; preparations: antenna, leg, wing and genitalia on slide mounted; Taxon: genus: Tipula; subgenus: Vestiplex; specificEpithet: hugueniniana; scientificNameAuthorship: Alexander, 1971; Location: country: India; stateProvince: Kumaon; verbatimLocality: Duldhar, Pauri Garhwal; verbatimElevation: 4500 feet [1372 m]; Event: eventDate: 2 June 1958; Record Level: institutionCode: USNMTipula (Vestiplex) recorded in India. Three species were described by Edwards  .Tipula (V.) wahlgrenana Alexander, 1968  hugueniniana Alexander, 1971  wahlgrenana, the other male was collected somewhat east of the previous locality, but two weeks earlier in the following year. These two males are also the only known specimens for the described species  hugueniniana, Tipula (V.) gandharva Alexander, 1951 and Tipula (V.) tuta Alexander, 1936, without mentioning its similarity to Tipula (V.) wahlgrenana. After detailed analysis of the two holotype and one paratype specimens of Tipula (V.) wahlgrenana and Tipula (V.) hugueniniana, we found that they cannot be distinguished from each other positively; differences concern only quantitative characters, without qualitative differences. The original description of the morphological details of Tipula (V.) hugueniniana in essence repeats the morphological characters of Tipula (V.) wahlgrenana. The only difference, according to Alexander\u2019s descriptions, is the general coloration of the mesonotal prescutum, which is obscure yellow in Tipula (V.) hugueniniana and light grey in Tipula (V.) wahlgrenana. Based on our observation, the coloration of the prescutum varies depending on the angle at which light strikes its surface.The types of both species were examined. It was found that all the specimens are very similar. In the original description of The new synonymy is based on the structure of the male genitalia. All the three examined specimens have the hypopygium as in Fig. Female unknown."}
{"text": "Nature Communications 6: Article number: 7390 (2015); 10.1038/ncomms8390 Published: 06162015; Updated 08212015.The original version of this Article contained a typographical error in the spelling of the author Jae-Ho Cheong, which was incorrectly given as Jae-Ho Jeong. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 850210.1038/srep08502; published online: 02172015; updated: 09182015This Article contains an error in Fig. 5e, where the p-Akt immunoblots depicted for the Cerebellum are a duplication of the p-Akt immunoblots depicted for the Hippocampus. The correct Fig. 5e appears below as"}
{"text": "Scientific Reports6: Article number: 21838;10.1038/srep21838 Published online: 02242016; updated: 05092016The original version of this Article contained a typographical error in the spelling of the author Xianzhen Yin, which was incorrectly given as Xianzheng Yin. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications4: Article number: 186710.1038/ncomms2886 (2013); Published: 05212013; Updated: 04202016The financial support for this Article was not fully acknowledged. The Acknowledgements should have included the following:Huang-Ge Zhang is supported by a Research Career Scientist (RCS) Award."}
{"text": "The following information is missing from the Funding section: Grant name: Using Fossil Proteomics for Resolving Phylogenetics of Extinct Mammalian Orders in Ancient Biodiversity Hotspots Principal. Investigator: Dr M Buckley, The University of Manchester, Life Sciences. Grant held at: The University of Manchester, Life Sciences. NERC Reference: NE/K000799/1"}
{"text": "Some of the author contributions for Melissa S. Anderson were omitted. The following are the correct author contributions for this paper:Conceived and designed the experiments: ENW DHK. Performed the experiments: ENW MSA MSL. Analyzed the data: ENW MSA DHK. Contributed reagents/materials/analysis tools: MSA. Wrote the paper: ENW DHK"}
{"text": "There are errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: IG. Performed the experiments: IG. Analyzed the data: IG OS. Wrote the paper: IG OS."}
{"text": "It should be corrected as follows:incorrect: November 26, 2013correct: December 13, 2013This correction has been completed on the electronic file of the present paper available at J-STAGE.The editorial board expresses sincere apology for the misprinting.Microbes and Environments editorial board"}
{"text": "The sixth author's name is spelled incorrectly. The correct name is: Bidhan Chandra Chakraborty.The seventh author's name is spelled incorrectly. The correct name is: Sukanta Ray.The second sentence of the \u201cCell culture and Transfection\u201d section of the Materials and Methods incorrectly references Xtremegene. It should read X-tremeGENE HP.In the Acknowledgements, Bidhan Chandra Chakraborty should also be listed as having a registered PhD with the West Bengal University and health sciences.There are errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: KD GKD AC SB. Performed the experiments: Somenath Datta S. Roychoudhury Alip Ghosh DD Amit Ghosh BCC AKS. Analyzed the data: Somenath Datta SB. Contributed reagents/materials/analysis tools: S. Ray SG Simanti Datta. Contributed to the writing of the manuscript: SB."}
{"text": "There are errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: TFK MP. Performed the experiments: MP. Analyzed the data: KAM. Contributed reagents/materials/analysis tools: KAM MP TFK. Wrote the paper: KAM TFK."}
{"text": "Scientific Reports5: Article number: 1514510.1038/srep15145; published online: 10192015; updated: 01212016The original version of this Article contained a typographical error in the spelling of the author Jakob Goldmann which was incorrectly given as Jakob Goldman. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 2660310.1038/srep26603; published online: 05252016; updated: 06202016The original version of this Article contained errors in the spelling of the author Hemanta K. Majumder which was incorrectly given as H. K. Mazumdar. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Prevention plays a fundamental role: if these disorders are diagnosed and treated precociously, the risk of infertility is considerably reduced.Andrological disorders in paediatric age are important: they may cause serious repercussions on normal fecundity  and someThe authors suggest a new prevention model based on an Andrological Form to be included in the periodical medical examination by the family paediatrician. If the paediatrician detects an andrological disorder during periodical checks, he/she should refer the patient to the paediatric andrologist or paediatric surgeon. The Andrological Form consists of 11 sections to be filled by the family paediatrician . The first section consists of the patient's records, weight and height included. Second: patient's pubertal development. Third: testicular volume according to Prader. Forth: testicular position. Fifth section: the presence of varicocele. Sixth: penis disorders . Seventh: gynecomastia . Eight: occurrence of other associated genito-urinary disorders. Ninth: previous andrological surgery interventions. Tenth: previous medical therapies. Eleventh: sport practicing. The Andrological form should be filled at the following ages: 1) 6 months ; 2) 1 year old ; 3) 5 years old ; 4) 10 years old ; 5) at 11, 12, 13 and 14 years old .The periodic compilation of the Andrological Form , therefo"}
{"text": "AbstractEuphydryas (Hypodryas) maturna (L.) is included in the Habitats Directive's Annexes II and IV(a). Therefore, it is crucially important to be able to define the habitat and breeding places of E.maturna in a correct and unbiased way.The scarce fritillary Melampyrumsylvaticum L.), of Euphydryasmaturna in Finland is presented.Data on a previously unknown pre-diapause main host plant, the small cow-wheat ( Euphydryas (Hypodryas) maturna  is a high-profile species within the European Union, as it has been included in the Habitats Directive's  Annexes II and IV(a). Based on the Annex II, special conservation areas (i.e. Natura 2000 areas) need to be designated for E.maturna. The Annex IV lists species in need of strict protection, and those species and their breeding and resting places are protected by national legislation, which also applies to Finland. Therefore, the ability to define the habitat and breeding places of E.maturna in a correct and unbiased way is crucially important for both protecting the species effectively and not making uninformed administrative decisions which may be economically very costly. Euphydryasmaturna is a wide-spread species in SW Finland, and it has been assessed as Least Concern by the IUCN criteria in Finland  has been recorded as the main host plant (Melampyrumsylvaticum L.), of Euphydryasmaturna in Finland.The species of the tribe iridoids . Iridoidiridoids . Larval se Table  and/or psee e.g. . In Finlst plant . Here, IE.maturna were systematically searched from an area of ca. 3.5 km2 within the municipalities of Sipoo and Pornainen in southern Finland . All larval groups were georeferenced with GPS and photographed, and a sample of each host plant was collected for identification. Plant samples were identified by Henry V\u00e4re . Fieldwork was made by MN and Kari Nupponen between August 27 and September 11 in 2014.Larval groups of Type status:Other material. Occurrence: occurrenceRemarks: number of larval groups counted (with unknown number of larvae per group); recordedBy: Marko Nieminen; individualCount: 120; lifeStage: larva; Taxon: scientificName: Euphydryas maturna; order: Lepidoptera; family: Nymphalidae; genus: Euphydryas; specificEpithet: maturna; taxonRank: species; Location: country: Finland; stateProvince: Uusimaa; municipality: Sipoo; locality: Brusas; verbatimElevation: 60 m; verbatimCoordinates: 60\u00b026.73'N 25\u00b017.95'E; verbatimLatitude: 60\u00b026.73'N; verbatimLongitude: 25\u00b017.95'E; decimalLatitude: 60.4455; decimalLongitude: 25.2992; Identification: identifiedBy: Marko Nieminen; dateIdentified: 2014; Event: samplingProtocol: visual search; eventDate: 2014-08-27/09-11; Record Level: language: en; basisOfRecord: Photographed; source: marko.nieminen@faunatica.fiType status:Other material. Occurrence: occurrenceRemarks: number of larval groups counted (with unknown number of larvae per group); recordedBy: Marko Nieminen; individualCount: 23; lifeStage: larva; Taxon: scientificName: Euphydryas maturna; order: Lepidoptera; family: Nymphalidae; genus: Euphydryas; specificEpithet: maturna; taxonRank: species; Location: country: Finland; stateProvince: Uusimaa; municipality: Pornainen; locality: M\u00e4kel\u00e4; verbatimElevation: 60 m; verbatimCoordinates: 60\u00b027.32'N 25\u00b017.94'E; verbatimLatitude: 60\u00b027.32'N; verbatimLongitude: 25\u00b017.94'E; decimalLatitude: 60.4554; decimalLongitude: 25.2991; Identification: identifiedBy: Marko Nieminen; dateIdentified: 2014; Event: samplingProtocol: visual search; eventDate: 2014-08-27/09-11; Record Level: language: en; basisOfRecord: Photographed; source: marko.nieminen@faunatica.fiType status:Other material. Occurrence: occurrenceRemarks: number of larval groups counted (with unknown number of larvae per group); recordedBy: Kari Nupponen; individualCount: 24; lifeStage: larva; Taxon: scientificName: Euphydryas maturna; order: Lepidoptera; family: Nymphalidae; genus: Euphydryas; specificEpithet: maturna; taxonRank: species; Location: country: Finland; stateProvince: Uusimaa; municipality: Pornainen; locality: Honkasenkalliot; verbatimElevation: 60 m; verbatimCoordinates: 60\u00b026.51'N 25\u00b019.27'E; verbatimLatitude: 60\u00b026.51'N; verbatimLongitude: 25\u00b019.27'E; decimalLatitude: 60.4419; decimalLongitude: 25.3211; Identification: identifiedBy: Kari Nupponen; dateIdentified: 2014; Event: samplingProtocol: visual search; eventDate: 2014-09-10/11; Record Level: language: en; basisOfRecord: Photographed; source: marko.nieminen@faunatica.fiMelampyrum spp.  M.sylvaticum. In addition, three larval groups have been found in the same area in the autumn of 2013, all on M.sylvaticum .Due to the dry conditions in July and August, many or even all host plants had withered especially in open rocky areas. Therefore, reliable identifications based on plant morphology were possible for 121 samples. Of the identified samples, 30 plants (25%) were E.maturna is highly variable throughout its range (Table Fraxinus is the most regularly used oviposition-plant genus in the Central Europe (e.g. Veronicalongifolia are often used in the eastern areas (e.g. Plantagolanceolata is frequently used after diapause in Austria (M.sylvaticum in a study performed about 200 km to the northeast of this study area (M.pratense and M.sylvaticum still remain uncertain throughout Finland.The regional host plant use of ge Table , but is ope e.g. , whereaseas e.g. . Howevereas e.g. , for exa Austria . There mudy area . MoreoveM.sylvaticum as a host plant (Fig. E.maturna and the amount of resources available for it. In the study area, the increase in both of these variables must be manyfold, but remains to be quantified. Melampyrumpratense is much more vulnerable to desiccation and withering because it grows in drier sites than M.sylvaticum. The ability to use both of these Melampyrum species is extremely important in dry summers such as 2014, when more than 90% of host plants had withered in several sites. That high rate of dry host plants has likely increased mortality of groups of small larvae and may also decrease overwintering success due to starvation of larvae, which are common phenomena in another larval group-forming species Melitaeacinxia in Finland (e.g. The use of ant Fig.  considerand e.g. .Vacciniummyrtillus had been eaten within some larval webs. Even though I could not confirm that E.maturna larvae had eaten them, it is, however, likely because other herbivorous larvae were not observed and Melampyrum individuals were almost completely dry in and around these larval nests. Therefore, larvae may have used V.myrtillus to rescue themselves from starvation. The same explanation may apply to the odd observations of larvae feeding on e.g. Fagus, Populus and Salix regularly referred to in the literature (e.g. Some leaves of ure e.g. . A furth"}
{"text": "Scientific Reports5: Article number: 1043410.1038/srep10434; published online: 05222015; updated: 10052015The original version of this Article contained a typographical error in the spelling of the author Kaori Ishikawa, which was incorrectly given as Kaori Iashikawa. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 1737810.1038/srep17378; published online: 11272015; updated: 02082016.This Article contains a typographical error in Affiliation 2. The correct affiliation is listed below:Department of Radiation Oncology, The Fifth Affiliated Hospital of Sun Yat-sen University, People\u2019s Republic of China"}
{"text": "Nature Communications6: Article number: 8510 10.1038/ncomms9510 (2015); Published: 10142015; Updated: 03042016The original version of this Article contained a typographical error in the spelling of the author Zhenyi Liu, which was incorrectly given as Zenhy Liu. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 2402710.1038/srep24027; published online: 04132016; updated: 05312016The original version of this Article contained an error in the spelling of the author Esaki Muthu Shankar, which was incorrectly given as Shankar Esaki Muthu. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "There is an error in the corresponding author designations. Christoph Buettner should be listed as a co-corresponding author. The correct corresponding authors are:mlamerrill@ucdavis.eduMichele La Merrill christoph.buettner@mssm.eduChristoph Buettner There are errors in the Author Contributions. Christoph Buettner should be listed as one of the persons who conceived and designed the experiments, analyzed the data, contributed reagents/materials/analysis tools and contributed to the writing of the manuscript. The correct contributions are:Conceived and designed the experiments: MLM and CB. Performed the experiments: MLM EK CL MLF. Analyzed the data: MLM EK EM CL MLF JN and CB. Contributed reagents/materials/analysis tools: MLM JN CB. Contributed to the writing of the manuscript: MLM EK EM CL MLF JN CB."}
{"text": "Although molecular tools are increasingly employed to decipher invertebrate systematics, earthworm (Annelida: Clitellata: \u2018Oligochaeta\u2019) taxonomy is still largely based on conventional dissection, resulting in data that are mostly unsuitable for dissemination through online databases. In order to evaluate if micro-computed tomography (\u03bcCT) in combination with soft tissue staining techniques could be used to expand the existing set of tools available for studying internal and external structures of earthworms, \u03bcCT scans of freshly fixed and museum specimens were gathered.GigaDB and are publicly available for download.Scout images revealed full penetration of tissues by the staining agent. The attained isotropic voxel resolutions permit identification of internal and external structures conventionally used in earthworm taxonomy. The \u03bcCT projection and reconstruction images have been deposited in the online data repository The dataset presented here shows that earthworms constitute suitable candidates for \u03bcCT scanning in combination with soft tissue staining. Not only are the data comparable to results derived from traditional dissection techniques, but due to their digital nature the data also permit computer-based interactive exploration of earthworm morphology and anatomy. The approach pursued here can be applied to freshly fixed as well as museum specimens, which is of particular importance when considering the use of rare or valuable material. Finally, a number of aspects related to the deposition of digital morphological data are briefly discussed. The present dataset constitutes the first attempt at comparative micro-computed tomography (\u03bcCT) scanning of earthworm (Annelida: Clitellata: \u2018Oligochaeta\u2019) specimens. When used in combination with staining techniques that permit enhancing soft tissue contrast , \u03bcCT couThe aim of the present report is to provide the earthworm research community with a reference dataset for future analyses of soft-bodied organisms based on non-destructive imaging techniques. In addition, uninhibited data access and enforced data deposition, as practiced here, are briefly discussed.i.e. Aporrectodea caliginosa  and Aporrectodea trapezoides . All four specimens were stained using an ethanol-based phosphotungstic acid (PTA) solution, which was adapted from protocols described previously . This would result in large morphological taxon sampling, one of the prerequisites for broad taxonomic and systematic studies. Furthermore, non-invasive imaging techniques such as \u03bcCT leave specimens intact and generate digital data suitable for online dissemination, an important condition for effective data mining.GigaDB and has a citable digital object identifier (DOI) [The dataset is available at er (DOI) . Each ofDataset name: MicroCT scans of freshly fixed and museum earthworm specimensOperating system: Platform-independentLicense: Creative Commons 0 (CC0) public domain dedication (https://creativecommons.org/publicdomain/zero/1.0/)http://imagej.nih.gov/ij/). In addition, numerous other 2D and 3D visualization tools are available for free [Following download, the reconstructed images can, for example, be rapidly visualized using the \u2018File:Import:Image Sequence\u2019 command chain in the Java-based imaging software ImageJ (for free . Given tGigaDB[The dataset presented here permits full open access both to \u03bcCT-derived raw data (here: the projection images) as well as derivative data (here: the reconstructed image stacks). The availability of \u03bcCT raw data files has been deemed important, primarily due to the rapid increase in the performance of reconstruction algorithms, which in the future could lead to improved data reconstruction . FurtherGigaDB. DespiteGigaDB, and metGigaDB.GigaScience Database online repository [The dataset supporting the results of this article is available in the pository .2D: Two-dimensional; 3D: Three-dimensional; BMP: Bitmap image file; CC0: Creative Commons 0 1.0 public domain dedication; DOI: Digital object identifier; FTP: File Transfer Protocol; GigaDB: GigaScience Database; GNU: GNU\u2019s not unix; gzip: GNU zip; MCZ IZ: Museum of Comparative Zoology Invertebrate Zoology; \u03bcCT: Micro-computed tomography; PTA: Phosphotungstic acid; RAM: Random access memory; ROI: region of interest; TIFF: Tagged image file format; VOI: Volume of interest.The authors declare that they have no competing interests.Conceived and designed the experiments: JL SK RF AZ. Performed the experiments: JL SK RF. Analyzed the data: JL SK RF AZ. Contributed reagents/materials/analysis tools: JL SK RF GG AZ. Wrote the paper: JL SK RF GG AZ. All authors read and approved the final manuscript."}
{"text": "There is an error in reference 71. The correct reference is: Abele, AE. The dynamics of masculine-agentic and feminine-communal traits: Findings from a prospective study. Journal of Personality and Social Psychology. 2003; 85: 768\u2013776."}
{"text": "AbstractCamponotusparabarbatus sp. n. Presence of dense, short setae on gena and ventral surface of head resembles it most to Camponotusbarbatus Roger, 1863 distributed in Southeast Asia. A regional identification key of Camponotus species is provided from the Shivalik hills of Indian Himalaya.A new species of carpenter ant, collected in the Shivalik range of Himalaya is described and illustrated based on the worker and gyne castes under the name  Camponotus are known worldwide  software. These images were processed with Adobe Photoshop CS5. Holotype and paratypes have been deposited in PUPAC, Punjabi University Patiala Ant Collection, Patiala. One paratype will be deposited at BMNH, Natural History Museum, London, UK and one at California Academy of Sciences, San Francisco, USA. Morphological definitions for measurements (accurate to 0.01 mm) include:  \u2013 HL+ML+PL+GLTL; (Head Length) \u2013 length of head, excluding mandibles, measured in a straight line from anteriormost point of median clypeal margin to midpoint of occipital margin in full-face viewHL; (Head Width) \u2013 maximum width of head, measured in full-face viewHW; (Eye Length) \u2013 maximum length of eye as measured in oblique view of the head to show full surface of eyeEL; (Scape Length) \u2013 straight-line length of antennal scape excluding condylar bulbSL; (Mesosoma Length) \u2013 diagonal length of mesosoma in lateral view from the point at which pronotum meets cervical shield to posteroventral corner of mesosomaML; (Pronotum Width) \u2013 maximum width of pronotum in dorsal viewPW; (Petiole Length) \u2013 In profile, the maximum length of the petiole node, measured in a straight horizontal line from immediately above the dorsal base of the anterior petiolar tubercle to the posterior marginPL; (midtibia Length) \u2013 maximum length of midtibia in lateral view, with tibial base and apex in the same plane of focus, and with tibia at right angle to femurmTbL; (hindtibia Length) \u2013 maximum length of hindtibia in lateral view, with tibial base and apex in same plane of focus, and with tibia at right angle to femurhTbL; \u2013 length of the gaster in lateral view from the anteriormost point of first gastral segment to the posteriormost point of the last segmentGL.Bharti & Wachkoo, 2014sp. n.urn:lsid:zoobank.org:act:2A5E348D-3C27-4194-B147-9CACF67854CFType status:Holotype. Occurrence: recordedBy: Aijaz A. Wachkoo; individualCount: 1; sex: worker; Location: country: India; stateProvince: Himachal Pradesh; locality: Rewalsar; verbatimElevation: 1360 m; verbatimLatitude: 31.6345\u00b0N; verbatimLongitude: 76.8343\u00b0EType status:Paratype. Occurrence: recordedBy: Aijaz A. Wachkoo; individualCount: 5; sex: 2 workers, 3 gynes; Location: continent: Asia; country: India; stateProvince: Himachal Pradesh; locality: Rewalsar; verbatimElevation: 1360 m; verbatimLatitude: 31.6345\u00b0N; verbatimLongitude: 76.8343\u00b0EType status:Paratype. Occurrence: recordedBy: Aijaz A. Wachkoo; individualCount: 6; sex: workers; Location: continent: Asia; country: India; stateProvince: Uttarakhand; verbatimElevation: 640 m; verbatimLatitude: 30.3416\u00b0N; verbatimLongitude: 77.9903\u00b0E; Record Level: institutionCode: Forest Research InstituteType status:Paratype. Occurrence: recordedBy: Aijaz A. Wachkoo; individualCount: 8; sex: workers; Location: continent: Asia; country: India; stateProvince: Uttarakhand; locality: Rajaji Forest Area; verbatimElevation: 660 m; verbatimLatitude: 30.2483\u00b0N; verbatimLongitude: 77.9878\u00b0EDescription of worker .Head: Head subtriangular, longer than wide in major worker , with arched margins laterally, posterior margin shallowly concave .As in major worker, with modifications expected for caste and the following differences: head more elongate, sides relatively straight, occipital margin convex; mandible, clypeus and gena brownish. Head narrower than in conspecific major workers; mandible 7 toothed; scape barely reaches the posterior margin of head. Reticulate sculpture more pronounced on head; scutum with scattered wide, shallow punctures. Propodeum dorsum forms right angle with declivity.parabarbatus is a compound word meaning \u201csimilar to barbatus\u201d.The species epithet This species seems to be rare in the Shivalik range of Northwest Himalaya although collected from both forested and non-forested areas of the region. Most workers were collected from vegetation while gynes and some workers were found under a large stone.Camponotusparabarbatus resembles to the Camponotusbarbatus distributed in Southeast Asia (Camponotusparabarbatus is subtriangular with a shallowly concave posterior margin, the eyes well within the lateral cephalic margins, and the scape barely touches the posterior margin of head, while in Camponotusbarbatus majors the head is subrectangular with gently convex posterior margin, eyes almost touching the lateral cephalic margins, scape surpasses the posterior margin of head by about 0.25 of its length. In Camponotusparabarbatus minor workers, the scape surpasses the posterior margin of head by about 0.33 of its length, whilst in Camponotusbarbatus the scape does so by half its length. Additionally, Camponotusparabarbatus is uniformly jet-black whereas Camponotusbarbatus is red brown in color.ast Asia  but can"}
{"text": "There are errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: ANJ. Performed the experiments: ANJ. Analyzed the data: ANJ CPU. Contributed reagents/materials/analysis tools: ESG. Wrote the manuscript: ANJ."}
{"text": "Scientific Reports5: Article number: 1601910.1038/srep16019; published online: 11022015; updated: 01072016.The original version of this Article contained a typographical error in the spelling of the author Mengtao Sun, which was incorrectly given as Mentao Sun. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications 6: Article number: 894810.1038/ncomms9948 (2015); Published: 11132015; Updated: 06062015.Imin using a simple parabolic \u03ba(E) WKB approximation, one would extract a much smaller bandgap since Imin is severely underestimated.'This Article contains an error in the penultimate sentence of the penultimate paragraph. This sentence should read: \u2018In other words, if one would analyse the minimum current level"}
{"text": "Scientific Reports5: Article number: 1121710.1038/srep11217; published online: 06162015; updated: 09212015The original version of this Article contained a typographical error in the spelling of the author Huanyang Chen, which was incorrectly given as Huangyang Chen. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Nature Communications6: Article number: 8963 10.1038/ncomms9963 (2015); Published: 11252015; Updated: 02012016The original version of this Article contained a typographical error in the spelling of the author Chang-Hsiao Chen, which was incorrectly given as Chiang-Hsiao Chen. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "AbstractLaonastesaenigmamus Jenkins, Kilpatrick, Robinson & Timmins, 2005 was originally discovered in Lao People's Democratic Republic in 2005. This species has been recognized as the sole surviving member of the otherwise extinct rodent family Diatomyidae. Laonastesaenigmamus was initially reported only in limestone forests of Khammouane Province, Central Lao. A second population was recently discovered in Phong Nha Ke Bang National Park (PNKB NP), Quang Binh Province, Central Vietnam in 2011. The confirmed distribution range of L.aenigmamus in Vietnam is very small, approximately 150 km2, covering low karst mountains in five communes of Minh Hoa District, Quang Binh Province, at elevations between 250 and 400 m asl. The Laotian Rock Rat inhabits the lower part of steep karst towers with many rock boulders and crevices under tall limestone evergreen forest. They use small rock crevices for their dens. The natural habitat of this species in PNKB NP has been affected by selected timber harvesting, however, a complex 3-4 layer forest structure is retained. The Laotian Rock Rat is omnivorous, feeding on parts  of 18 plant species and also some insects . The population of this species in PNKB NP is seriously threatened with extinction due to its very restricted distribution, high hunting pressure, and habitat disturbance. Laonastesaenigmamus is listed in the IUCN Red List as endangered and in the Wildlife and Aquatic Red List of Lao, however, this species has not been listed in the Red Data Book or any conservation legislative documents of Vietnam.The Laotian Rock Rat  Laonastesaenigmamus, was first discovered in 2005 in Lao People's Democratic Republic  of Minh Hoa District, Quang Binh Province. These communes were selected because only these communes contain primary or little affected limestone forest as preferable habitat of the Laotian Rock Rat and are situated close to locality where the first Vietnamese specimens of Laotian Rock Rat were collected in 2011. During the village interview survey, all previously trapped animals of Laotian Rock Rat or their remains were collected for further laboratory studies.Based on the results of our village interview survey, 12 areas where local villagers have previously trapped the Laotian Rock Rat were selected for targeted field surveys using cage traps and box traps. After taking morphological characters, all live-trapped animals were released back into the wild at the place where they were trapped. Study of Laotian Rock Rat habitat was carried out in the same 12 areas using transect survey and plot survey techniques. Plots of 10 x 10 m were used for inventory of all trees with height more than 3m, plots of 4 x 4 m for inventory of bush trees of height from 0.5 m to 3 m, and plots of 1 x 1 m for inventory of herbs and tree seedlings less than 0.5 m high.Food items of the Laotian Rock Rat were identified by examining the stomach contents of 10 preserved specimens, food remnants found in the species dens, and observation of live specimens in semi-wild conditions in natural habitat. Food identification was conducted by taxonomic experts based on morphological characters of food item remains. Threats to population and habitat of Laotian Rock Rat were evaluated based on interviews of local villagers and direct observation of threat signs  in the species distribution area.Jenkins, Kilpatrick, Robinson & Timmins, 2005Type status:Other material. Occurrence: recordedBy: Nghia Xuan Nguyen; individualCount: 1; sex: male; Location: country: Vietnam; stateProvince: Quang Binh; verbatimLocality: Thuong Hoa Commune, Minh Hoa District; verbatimElevation: 200-350m; verbatimLatitude: 17\u00b040\u201939\u2019'N; verbatimLongitude: 105\u00b057\u201922\u2019\u2019E; Event: samplingProtocol: trapping; eventDate: 6 Sept 2011; habitat: Karst forest; Record Level: collectionID: PNKB-NXN21; institutionCode: IEBR; collectionCode: RodentiaDVZ-Type status:Other material. Occurrence: recordedBy: Nghia Xuan Nguyen; individualCount: 1; sex: unkown; Location: country: Vietnam; stateProvince: Quang Binh; verbatimLocality: Thuong Hoa Commune, Minh Hoa District; verbatimElevation: 200-350m; verbatimLatitude: 17\u00b040\u201905\u2019'N; verbatimLongitude: 105\u00b056\u201927\u2019\u2019E; Event: samplingProtocol: trapping; eventDate: 3 Sept 2011; habitat: Karst forest; Record Level: collectionID: PNKB-NXN232; institutionCode: IEBR; collectionCode: RodentiaDVZ-Type status:Other material. Occurrence: recordedBy: Nghia Xuan Nguyen; individualCount: 1; sex: unkown; Location: country: Vietnam; stateProvince: Quang Binh; verbatimLocality: Thuong Hoa Commune, Minh Hoa District; verbatimElevation: 200-350m; verbatimLatitude: 17\u00b040\u201955\u2019'N; verbatimLongitude: 105\u00b054\u201940\u2019\u2019E; Event: samplingProtocol: trapping; eventDate: 7 April 2012; habitat: Karst forest; Record Level: collectionID: PNKB-NXN231; institutionCode: IEBR; collectionCode: RodentiaDVZ-Type status:Other material. Occurrence: recordedBy: Nghia Xuan Nguyen; individualCount: 1; sex: unkown; Location: country: Vietnam; stateProvince: Quang Binh; verbatimLocality: Thuong Hoa Commune, Minh Hoa District; verbatimElevation: 200-350m; verbatimLatitude: 17\u00b040\u201932\u2019'N; verbatimLongitude: 105\u00b057\u201952\u2019\u2019E; Event: samplingProtocol: trapping; eventDate: 22 December 2013; habitat: Karst forest; Record Level: collectionID: PNKB-NXN181; institutionCode: IEBR; collectionCode: RodentiaDVZ-Type status:Other material. Occurrence: recordedBy: Nghia Xuan Nguyen; individualCount: 1; sex: Male; Location: country: Vietnam; stateProvince: Quang Binh; verbatimLocality: Thuong Hoa Commune, Minh Hoa District; verbatimElevation: 200-350m; verbatimLatitude: 17\u00b040\u201907\u2019'N; verbatimLongitude: 105\u00b056\u201906\u2019\u2019E; Event: samplingProtocol: trapping; eventDate: 12 April 2014; habitat: Karst forest; Record Level: collectionID: PNKB-NXN219; institutionCode: IEBR; collectionCode: RodentiaDVZ-Type status:Other material. Occurrence: recordedBy: Nghia Xuan Nguyen; individualCount: 1; sex: Female; Location: country: Vietnam; stateProvince: Quang Binh; verbatimLocality: Thuong Hoa Commune, Minh Hoa District; verbatimElevation: 200-350m; verbatimLatitude: 17\u00b040\u201927\u2019'N; verbatimLongitude: 105\u00b055\u201905\u2019\u2019E; Event: samplingProtocol: trapping; eventDate: 15 April 2014; habitat: Karst forest; Record Level: collectionID: Released to the wildType status:Other material. Occurrence: recordedBy: Nghia Xuan Nguyen; individualCount: 1; sex: Female; Location: country: Vietnam; stateProvince: Quang Binh; verbatimLocality: Thuong Hoa Commune, Minh Hoa District; verbatimElevation: 200-350m; verbatimLatitude: 17\u00b040\u201903\u2019'N; verbatimLongitude: 105\u00b056\u201927\u2019\u2019E; Event: samplingProtocol: trapping; eventDate: 15 April 2014; habitat: Karst forest; Record Level: collectionID: PNKB-NXN223; institutionCode: IEBR; collectionCode: RodentiaDVZ-Type status:Other material. Occurrence: recordedBy: Nghia Xuan Nguyen; individualCount: 1; sex: Female; Location: country: Vietnam; stateProvince: Quang Binh; verbatimLocality: Thuong Hoa Commune, Minh Hoa District; verbatimElevation: 200-350m; verbatimLatitude: 17\u00b040\u201903\u2019'N; verbatimLongitude: 105\u00b056\u201927\u2019\u2019E; Event: samplingProtocol: trapping; eventDate: 18 April 2014; habitat: Karst forest; Record Level: collectionID: PNKB-NXN224; institutionCode: IEBR; collectionCode: RodentiaDVZ-Type status:Other material. Occurrence: recordedBy: Nghia Xuan Nguyen; individualCount: 1; sex: Female; Location: country: Vietnam; stateProvince: Quang Binh; verbatimLocality: Thuong Hoa Commune, Minh Hoa District; verbatimElevation: 200-350m; verbatimLatitude: 17\u00b040\u201939\u2019'N; verbatimLongitude: 105\u00b057\u201934\u2019\u2019E; Event: samplingProtocol: trapping; eventDate: 5 May 2014; habitat: Karst forest; Record Level: collectionID: PNKB-NXN225; institutionCode: IEBR; collectionCode: RodentiaDVZ-Type status:Other material. Occurrence: recordedBy: Nghia Xuan Nguyen; individualCount: 1; sex: Male; Location: country: Vietnam; stateProvince: Quang Binh; verbatimLocality: Thuong Hoa Commune, Minh Hoa District; verbatimElevation: 200-350m; verbatimLatitude: 17\u00b041\u201913\u2019'N; verbatimLongitude: 105\u00b053\u201951\u2019\u2019E; Event: samplingProtocol: trapping; eventDate: 27 June 2014; habitat: Karst forest; Record Level: collectionID: PNKB-NXN230; institutionCode: IEBR; collectionCode: RodentiaDVZ-Fig. 1Fig. 217\u00b040'28\u201dN; 105\u00b055'05\"E). This low trapping success can be explained by very low density of the Laotian Rock Rat in the survey area and because of dry season weather. As reported by local villagers, small mammal trapping success is always very low in dry season (from January to June). The live animal was released into the wild after taking its body measurements and monitoring it for a few days in semi-wild conditions. In total, during the period from the first reports of the Laotian Rock Rat in PNKB NP in September 2011 to October 2014, we collected 12 specimens of the species  and checked coordinates of all these localities for the species distribution mapping. The distribution map of the Laotian Rock Rat was established based on data from the village interview surveys comprising 35 localities reported by villagers and 12 localities confirmed by our field surveys. The map showed that the distributional range of the Laotian Rock Rat in PNKB NP area covered about 150 km2 of limestone evergreen forests belonging to five communes  of Minh Hoa District, Quang Binh Province , Hoa Son commune  and Dan Hoa commune  , Dracontomelonduperreanum (Anacardiaceae), Toonasurenii (Meliaceae), Paviesiaanamensis (Sapindaceae), Pterospermumgrewiaefolium (Sterculiaceae), Mahuca sp., Hopea sp., Streblusasper (Moraceae), Litsea sp. (Lauraceae), Sumbaviopsismacrophylla (Euphorbiaceae), Actinodaphne sp. (Lauraceae), Pometiachinensis (Sapindaceae), Choerospondiasaxillaris (Anacardiaceae), Alangiumridleyi (Alangiaceae), Knema sp. (Myristicaceae); etc.The canopy tree layer consists of trees 20-25 m high with stem diameter 0.5-0.8 m. The most common trees species are: Knemacorticosa (Myristicaceae); Streblustonkinensis, Streblusasper (Moraceae), Xylopiavielana (Annonaceae), Diospyros sp. (Ebenaceae), Caryotamitis (Arecaceae), Arengapinnata (Arecaceae), Camelia sp. (Theaceae), Actinodaphne sp. (Lauraceae), Pterospermum sp. (Sterculiaceae), Litsea sp.(Lauraceae), Ormosialaoensis (Fabaceae), Nepheliumlappaceum (Sapindaceae), Sumbaviopsismacrophylla (Euphorbiaceae), Paranepheliumspirei (Sapindaceae), Alangiumridleyi (Alangiaceae), Baccaurea sp. (Euphorbiaceae), Aglaia sp. (Meliaceae), etc.The middle tree layer consists of trees 10-15 m high with stem diameter of 0.3-0.5 m. The most common species are Euphorbiaceae, Theaceae, Myrtaceae and Verbenaceae. Some dominant species are Antidesma sp. (Euphorbiaceae), Trevesiapanmalta , Litseavaliabilis (Lauraceae), Arengapinnata (Arecaceae), Excoecariacochinchinensis (Euphorbiaceae), as well as seedlings of trees from higher layers.The scrub layer consists of trees 3-7 m high, mostly with twisted stems, many branches, and several stems rising from one base. The most common species are from the families Araceae, the genera Calamus and Caryota (family Arecaceae), and many herb species from various families . Some of the most common species are Homalomenaocculta (Araceae), Aglaonemasimplex (Araceae), Aglaonemasiamensis (Araceae), Taccachantrieri (Taccaceae), Aspidistratypica , Piper sp. (Piperaceae), Corymborkisveratrifolia (Orchidaeceae), etc.The herb and fern layer is about 0.5-3 m high, with trees of 0.2-3 m high from family Local villagers reported that the Laotian Rock Rat feeds exclusively on plant parts  of various plant species. Stomach content analysis, examination of food remains dropped in dens, and observation of a live Laotian Rock Rat in semi-wild conditions showed that the species feeds mostly on plant parts, but also some insects, as follows:Aglaonemasimplex (Araceae), Streblusasper (Moraceae), Dracontomelonduperreamum (Anacardiaceae), Pometiachinensis (Sapindaceae), Ficus sp. (Moraceae), Acanthopanaxtrifoliatus , Perillafrutescens (Lamiaceae), Psidiumguajava (Myrtaceae), Zeamays (Poaceae), Prunuspersica (Rosaceae)Young leaves and buds of Streblusasper (Moraceae), Ficus sp. (Moraceae), Dracontomelonduperreamum (Anacardiaceae), Alangiumridleyi (Alangiaceae), Lythocarpusfenestratus (Fagaceae), Musaparadisiaca, Musauranoscapos (Musaceae)Ripe fruits of Zeamays (Poaceae)Seeds of Manihotesculenta (Euphorbiaceae) and Aglaonemasimplex (Araceae)Roots of Cicadidae), Mantis (Mantidae), Grasshopper (Acrididae)Insects: Cicada (2) and located close to the villages of ethnic minorities . These minority groups are very poor and their livelihood depends on wildlife and forest products. Wildlife hunting is a long tradition of the local people, and a practice that remains extensive currently. Most men 15 to 60 years in age in these villages are engaged in wildlife hunting. Their hunting season lasts about eight months per year (from July to February). The most widely used means for trapping the Laotian Rock Rat and other small animals is a metal spring snare, which has a high trapping success and can trap animals of various body size, such as rats, civets, large birds, and snakes. Snap traps are also used because they are easily made in the forest from bamboo and small trees. Each hunter usually keeps 30-100 active snares in forests; some hunters keep up to 300-500 active snares. It is estimated that 30-35 specimens of the Laotian Rock Rat are trapped by local villagers each year in the survey area. Other threats to the natural habitat of the Laotian Rock Rat include forest clearance for agricultural fields, removal of timber trees, collecting firewood and other forest products that lead to degradation of forest quality, and habitat modification. At present, no specific conservation measures are being undertaken aside from awareness education for local villagers.The distribution range of the Laotian Rock Rat in PNKB NP is very small  of Lao. It is expected that this area harbors the Laotian Rock Rat, but no surveys on rodents in this area were carried out.The confirmed distribution of the Laotian Rock Rat population in PNKB NP comprises roughly 150 km2. The species was most abundant in Phou Hin Boun NBCA, while in two nearby limestone areas (Nam Kading NBCA to the north and Hin Namno NBCA to the east) there are no reports of the species. The distribution of the Laotian Rock Rat in PNKB NP, Vietnam is small and far away from Phou Hin Boun NBCA as well as the species distribution range in Khammuoane province. This implies that the population of the Laotian Rock Rat in PNKB NP may be genetically isolated from other populations in Lao and conservation measures for the Vietnamese population should be of high priority and urgency.In Lao, HabitatPNKB NP is located along the eastern slope of the Great Annamite Range which has a wetter climate. The forest habitat of PNKB NP is characterized by dense moist evergreen forest with different types such as evergreen forest on limestone above 700 m asl, montane evergreen forest on hills above 700 m asl, evergreen forest on limestone under 700 m asl, evergreen forest on hills under 700 m asl, degraded evergreen forest on hills, tree and scrub savanna on limestone, tree and scrub savanna on hills, agricultural land, and plantations and other land uses . HoweverThreats and conservationDiatomyidae that was formerly believed to have been extinct for more than 11 million years (Conservation of the Laotian Rock Rat is a high priority not only because the species is the only surviving member of the otherwise extinct family on years  but alsoon years  and in ton years  for cons"}
{"text": "Scientific Reports5: Article number: 9847; 10.1038/srep09847 published online: 06032015; updated: 12182015.The original version of this Article contained a typographical error in the spelling of the author Yeon-Gil Kim which was incorrectly given as Yeun Gil Kim.This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5 Article number: 10179; 10.1038/srep10179 published online: 07102015; updated: 12182015.The original version of this Article contained an error in the spelling of the author Wen-cai Ye, which was incorrectly given as Ye Wencai.This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 17487; 10.1038/srep17487 published online: 12032015; updated: 02172016.The original version of this Article contained a typographical error in the spelling of the author Corrado Corradi-Dell\u2019Acqua which was incorrectly given as Corrado Corradi-Dell\u2019 Acqua. This error has been corrected in both the PDF and HTML versions of the paper."}
{"text": "Scientific Reports6: Article number: 25763; 10.1038/srep25763published online: 05102016; updated: 08252016In the original version of this Article, Affiliation 1 was incomplete. The correct affiliation is listed below:State Key Laboratory of Microbial Metabolism and School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, China.This error has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports1: Article number: 18510.1038/srep00185; published online: 12072011; updated: 09182015The original version of this Article contained a typographical error in the spelling of the author Lesego Busang which was incorrectly given as Lesogo Busang. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 1291410.1038/srep12914; published online: 09032015; updated: 09302015The original version of this Article contained a typographical error in the spelling of the author Xavier Rocquefelte, which was incorrectly given as Xavier Rocquelfelte. In addition, Affiliation 2 was omitted for this author. These errors have now been corrected in both the PDF and HTML versions of the Article."}
{"text": "The following information is missing from the Funding section: The study also used resources from the Department of Pathology/Comparative Medicine, Wake Forest University Health Science which were supported by NIH grant RR019963/OD010965 (PI: Jay R. Kaplan)."}
{"text": "Scientific Reports6: Article number: 18970; 10.1038/srep18970published online: 01062016; updated: 03042016The original version of this Article contained a typographical error in the spelling of the author Bharati Tudu, which was incorrectly given as Bahrati Tudu. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications7: Article number: 11521 10.1038/ncomms11521 (2016); Published: 0592016; Updated: 06072016The HTML version of this Correspondence was previously published with an incomplete title. This has now been corrected in the HTML; the PDF version of the paper was correct from the time of publication."}
{"text": "There are errors in the Author Contributions. The correct contributions are: Conceived and designed the device: DMassai GC GI DG UM. Conceived and performed the computational multiphysics modeling: GI DMassai UM DG. Conceived and performed the biological tests: DMadeddu AF CF FQ DMassai GC. Analyzed the computational multiphysics modeling data: GI DMassai UM DG MAD. Analyzed the biological data: DMadeddu CF AF FQ. Contributed reagents/materials/analysis tools: FQ AA GFDL UM. Conceived and wrote the manuscript: DMassai GI UM DMadeddu FQ. The publisher apologizes for the errors."}
{"text": "Scientific Reports6: Article number: 21413;10.1038/srep21413 Published online 02252016; Updated: 05092016A marked-up version of the Supplementary Information was inadvertently published with the original version of this Article. In addition, Supplementary Software 1 was omitted. These errors have now been corrected."}
{"text": "In November 2013, CEGMR continued its leading role in genomics and organized its 2nd IGMC. The conference was well received and attended by 505 international and national participants. Among the international participants was Professor Erwin Neher, a Nobel laureate with Bert Sakmann in 1991 in Physiology or Medicine, who gave the keynote talk on the first day of the conference on his discovery of \u201cThe function of single ion channels in cells\u201d with notes on their function and role in disease. His presence and talk was an excellent opportunity for junior and senior national researchers in Saudi Arabia to meet and learn from a scientific pioneer.Centre of Excellence in Genomic Medicine Research  , is a lend IGMC scientific committee led by Dr Muhammad Abu-Elmagd worked tirelessly hard and managed, for the first time ever for the conference, to publish 98 IGMC abstracts and more than 24 peer-reviewed full articles in two separate special supplements in a high impact factor (IF) journal in the field, the BMC Genomics (IF: 4.04) [The 2nd IGMC program, Table . Abstracts of all oral presentations are now published in BMC Genomics special supplement [Oral presentation sessions started with a talk given by Dr Abdulaziz Al-Swailem from KCAST who elaborated on Saudi national science, technology and innovation plans towards knowledge based economy. After Dr Al-Swailem\u2019s presentation, the conference participants enjoyed attending a series of 17 two days excellent talks presented by Thomson Reuters\u2019s ranked highly distinguished scientists who came from various institutions around the globe to deliver presentations in different topics. The latter mainly covered five genomics and genomic-related areas including oncogenomics, genomics and environment interactions, systems biology and computational genomics, immunogenomics, and omics of cell signalling and reproductive biology , where we not only enjoyed tasty and spicy Saudi food, but also had a chance to inspect his remarkable facility for keeping desert wildlife.''APC: Adenomatous Polyposis Coli; BMC: BioMed Central; CEGMR: Center of Excellence in Genomic Medicine Research; ChIP-Seq: Chromatin Immuno-precipitation Sequencing; CIPM: Centre of Innovation in Personalized Medicine; CMV: Cytomegalovirus; CRC: Colorectal Cancer; ENCODE: Encyclopedia of DNA Elements; IF: Impact Factor; IGB: Integrated Gulf Biosystem; IGMC: International Genomic Medicine Conference; KAU: King Abdulaziz University; KACST: King Abdulaziz City for Science and Technology; KIFs: Kinesin superfamily proteins; Kras: Kirsten rat sarcoma viral oncogene homolog; KSA: Kingdom of Saudi Arabia; MOH: Ministry Of Higher Education; MTNR1B: Melatonin Receptor 1B; STSs: Sequence-Tagged SitesThe authors disclose no competing interests."}
{"text": "Scientific Reports5: Article number: 1420010.1038/srep14200; published online: 09232015; updated: 02042016In this Article, an additional affiliation for Qian Liu and Xinyi Zhu was omitted. The correct affiliation is listed below:University of Chinese Academy of Sciences, Beijing 100101, China"}
{"text": "The correct listing for corresponding author contact information in the PDF should be: *Email: licy_60@163.com (CYL); liuqiyong@icdc.cn (QYL).The email address for one of the corresponding authors, Cheng-Yi Li, is listed incorrectly. The correct email address should be"}
{"text": "The correct name is: Bertrand Raynal. The correct citation is: Alexandre T, Raynal B, Munier-Lehmann H (2015) Two Classes of Bacterial IMPDHs according to Their Quaternary Structures and Catalytic Properties. PLoS ONE 10(2): e0116578. doi: There is an error in the Author Contributions. The correct contributions are: Conceived and designed the experiments: HML. Performed the experiments: TA BR HML. Analyzed the data: TA BR HML. Contributed reagents/materials/analysis tools: BR HML. Wrote the paper: BR HML."}
{"text": "Nature Communications7: Article number: 1146310.1038/ncomms11463 (2016); Published: 05102016; Updated: 08042016.The source of reagents for this Article was not fully acknowledged. The Acknowledgements should have included the following:https://www.cellhub.org) for patient fibroblasts.'\u2018We thank Professors Robin Goland and Dieter Egli ("}
{"text": "Scientific Reports5: Article number: 984610.1038/srep09846; published online: 04202015; updated: 10052015This Article contains an error in the affiliation of Daesung Yoon. The correct affiliation is listed below:Department of Bio-convergence Engineering, Korea University, Seoul, Korea"}
{"text": "Nature Communications 7: Article numbber:1069910.1038/ncomms10699 (2015); Published: 03072016; Updated: 07192016.Technical support for this Article was not fully acknowledged. The Acknowledgements should have included the following: We are also grateful to Dr Alexei Barinov for his kind help during our beamtime at the spectramicroscopy beamline of the Elettra synchrotron."}
{"text": "In a Belgian pilot study honey bee wax combs from ten hives were analyzed on the presence of almost 300 organochlorine and organophosphorous compounds by LC\u2013MS/MS and GC\u2013MS/MS. Traces of 18 pesticides were found and not a single sample was free of residues. The number of residues found per sample ranged from 3 to 13, and the pesticides found could be categorized as (1) pesticides for solely apicultural (veterinary) application, (2) pesticides for solely agricultural (crop protection) application, (3) pesticides for mixed agricultural and apicultural (veterinary) application. The frequencies and quantities of some environmental pollutants bear us high concerns. Most alarming was the detection of lindane (gamma-HCH) and dichlorodiphenyltrichloroethane (including its breakdown product dichlorodiphenyldichloroethylene), two insecticides that are banned in Europe. The present comprehensive residue analysis, however, also reveals residues of pesticides never found in beeswax before, i.e. DEET, propargite and bromophos. Varroa destructor with synthetic chemicals, like pyrethroid and organophosphate acaricides, naturally occurring organic acids and essential oils  [Regulation (EC) No 396/2005]. Although the contamination of honey is widely documented in the scientific literature . It should allow us to narrow the scope of future nationwide surveys.During hive control in spring 2012, wax combs were sampled from ten honey bee hives at apiaries located in Flanders at Heist-op-den-Berg (six samples), Leuven (three samples) and Ghent (one sample). As at least 100\u00a0g beeswax was required for the multiresidue analysis, we took two empty wax combs from each hive. The sampled bee colonies seemed healthy, with no clinical signs of infectious diseases or acute intoxication.The beeswax was analyzed on the presence of 293 organochlorine and organophosphorous compounds at Intertek Food Services GmbH  according to the European EN 15662 method CEN . The pesThe LC\u2013MS/MS procedure enables to determine the following agents: Abamectin; Acetamiprid; Aldicarb; Aldicarb sulfone; Aldicarb sulfoxide; Amitraz; Azoxystrobin; Benalaxyl; Bitertanol; Boscalid; Bromacil; Bromuconazole; Bupirimate; Buprofezin; Cadusafos; Carbaryl; Carbendazim; Carbofuran; Carbofuran (3-Hydroxy-); Chloroxuron; Clofentezine; Clomazone; Clothianidin; Cymiazole; Cyproconazole; Cyprodinil; Demeton-S-methyl; Demeton-S-methyl; Diethofencarb; Diethyltoluamid (DEET); Difenoconazole; Diflubenzuron; Dimethoate; Dimethomorph; Dimoxystrobin; Diniconazole; Diphenylamine; Disulfoton; Disulfoton-PS-sulfone; Disulfoton-PS-sulfoxide; Ditalimfos; Diuron; Dodine; EPN; Epoxiconazole; Ethiofencarb; Ethoprophos; Ethoxyquin; Famoxadone; Fenamiphos; Fenarimol; Fenazaquin; Fenbuconazole; Fenhexamid; Fenoxycarb; Fenpropimorph; Fenpyroximate; Fenthion; Fenthion-oxon; Fenthion-PO-sulfone; Fenthion-PS-sulfone; Fenthion-sulfoxide; Fluazifop-P-butyl; Fluazinam; Fludioxonil; Flufenoxuron; Fluquinconazole; Flusilazole; Fonofos; Hexaconazole; Hexythiazox; Imazalil; Imidacloprid; Indoxacarb; Iprovalicarb; Isofenphos; Isofenphos-methyl; Isoproturon; Kresoxim-methyl; Linuron; Lufenuron; Malaoxon; Malathion; Mecarbam; Mepanipyrim; Mepronil; Metalaxyl; Metamitron; Metazachlor; Methiocarb; Methiocarb; Methiocarb; Methomyl; Methoxyfenozide; Metobromuron; Metolcarb; Metribuzin; Monolinuron; Myclobutanil; Nitenpyram; Nuarimol; Omethoate; Oxadixyl; Oxamyl; Oxydemeton-methyl; Penconazole; Pencycuron; Pirimicarb; Pirimicarb (Desmethyl-); Prochloraz; Propamocarb; Propargite; Propiconazole; Propoxur; Propyzamide; Pymetrozine; Pyraclostrobin; Pyridaben; Pyridaphenthion; Pyrifenox; Pyrimethanil; Pyriproxyfen; Quinoxyfen; Rotenone; Spinosad; Spirodiclofen; Spiromesifen; Spiroxamine; Tebuconazole; Tebufenozide; Tebufenpyrad; Teflubenzuron; Terbutylazine; Tetraconazole; Thiabendazole; Thiacloprid; Thiametoxam; Thiodicarb; Thiophanate-methyl; Triadimefon; Triadimenol; Trichlorfon; Trifloxystrobin; Triflumizole; Triforine.The GC\u2013MS/MS procedure enables to determine the following agents: Aclonifen; Acrinathin; Alachlor; Aldrin; Benfluralin; Bifenthrin; Binapacryl; Bromophos (-methyl); Bromophos-ethyl; Bromopropylate; Captan; Carbophenothion; Chlordane ; Chlordane (Oxy); Chlordane ; Chlorfenapyr; Chlorfenson; Chlormephos; Chlorobenzilate; Chloroneb; Chloropropylate; Chlorothalonil; Chlorpropham; Chlorpyrifos (-ethyl); Chlorpyrifos-methyl; Chlorthal-dimethyl; Chlorthion; Chlorthiophos; Chlozolinate; Coumaphos; Cyanofenphos; Cyanophos; Cyfluthrin; Cyhalothrin (lambda-); Cypermethrin; DDD ; DDD ; DDE ; DDE ; DDT ; DDT ; Deltamethrin; Diazinon; Dichlobenil; Dichlofenthion; Dichlofluanid; Dicloran; Dicofol; Dieldrin; Endosulfan ; Endosulfan (beta-); Endosulfan-sulfat; Endrin; Esfenvalerate; Ethion; Etofenprox; Etridiazole; Etrimfos; Famphur; Fenchlorphos; Fenitrothion; Fenpropathrin; Fenson; Fensulfothion; Fenvalerate; Fluchloralin; Flucythrinate; Fluvalinate,; Folpet; Formothion; Halfenprox; HCH ; HCH (beta-); HCH (delta-); Heptachlor; Heptachlor epoxide ; Heptachlor epoxide ; Heptenophos; Hexachlorobenzene (HCB); Hexaflumuron; Iodofenphos; Iprobenfos; Iprodione; Isazofos; Isocarbofos; Isodrin; Isoxathion; Leptophos; Lindane (gamma-HCH); Methacrifos; Methidathion; Methoxychlor; Mevinphos; Mirex; Monocrotophos; Nitrapyrin; Nitrofen; o-Phenylphenol; Paraoxon-ethyl; Paraoxon-methyl; Parathion-ethyl; Parathion-methyl; Pendimethalin; Pentachloroaniline; Pentachloroanisole; Permethrin; Phenthoate; Phorate; Phorate-sulfone; Phosalone; Phosmet; Phosphamidon; Piperonyl butoxide; Pirimiphos-ethyl; Pirimiphos-methyl; Procymidone; Profenofos; Profluralin; Propetamphos; Prothiophos; Pyrazophos; Quinalphos; Quintozene; S 421 (octachlorodipropyl ether); Sulfotep; Sulprofos; Tecnazene; Tefluthrin; Terbufos; Tetrachlorvinphos; Tetramethrin; Tetradifon; Tetrasul; Thionazin; Tolclofos-methyl; Tolylfluanid; Triallate; Triazophos; Trichloronat; Trifluralin; Vinclozolin.Both procedures enables to determine the following agents: Acephate; Azinphos-ethyl; Azinphos-methyl; Chlorfenvinphos; Dichlorvos; Fipronil; Methamidophos.Traces of 18 pesticide residues were found in the beeswax samples and not a single sample was free from pesticide residues   and Perizin . However, illegal sales of prescription drugs or the use of home-made preparations based on the agrochemical formulations cannot be excluded.Amitraz was found in two out of ten samples and could originate from both apicultural and agricultural applications in the past. Both applications are presently no longer allowed in Belgium. Since this acaricide was proven to be unstable in beeswax and honey  with no MRL required in food from these animals [Commission Regulation (EU) No 37/2010]. In theory piperonyl butoxide could be allowed to be used in beekeeping upon prescription of a veterinarian under \u2018cascade\u2019. The use of this pesticide in beekeeping cannot be excluded: it is sometimes used in insect and bee repellents which are on the market for use in beekeeping and some authors claim that piperonyl butoxide is enhancing the toxicity of fluvalinate to control All other found pesticides originate from a pollution of outside the beehive and their frequencies and quantities bear us high concerns. We have found several fungicides and crop protection agents that are highly toxic for honey bees Table\u00a0. All of Just like two other Belgian studies we failed to find traces of neonicotinoids in beeswax (Nguyen et al. Worker bees of all ages are susceptible to the effects of pesticide exposure (Rortais et al. Given the contamination of beeswax one may consider to take actions in the field, aimed at lowering the pesticide contamination of beeswax in Belgian apiaries, as stated also before in other countries (Pettis et al."}
{"text": "Nature Communications7, Article number: 11290 10.1038/ncomms11290 (2016); Published: 04122016; Updated: 05062016The original version of this Article contained an error in the spelling of the author Mark Hatherill, which was incorrectly given as Mark Hatheril. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 9813; 10.1038/srep09813 published online: 05112015; updated: 03042016.The Acknowledgements section was omitted from the Article. It should read:AcknowledgementsThis work was supported by the Center for Nanoscale Science, an NSF Materials Research Science and Engineering Center, under the award DMR-1420620."}
{"text": "There are errors in the Author Contributions. The correct contributions are:Conceived and designed the experiments: RKF MAG LAD-M RK AMVCS. Performed the experiments: RKF TFB DRR HAB. Analyzed the data: RKF MAG RK. Contributed reagents/materials/analysis tools: RK AMVCS. Wrote the paper: RKF AMVCS RK. Software used in analysis: MAG."}
{"text": "It should be corrected as follows:incorrect: November 26, 2013correct: December 13, 2013This correction has been completed on the electronic file of the present paper available at J-STAGE.The editorial board expresses sincere apology for the misprinting.Microbes and Environments editorial board"}
{"text": "Nature Communications7: Article number: 11106 10.1038/ncomms11106 (2016); Published: 04262016; Updated: 06032016The original version of this Article contained an error in the spelling of the author Milka Koupenova, which was incorrectly given as Milka Koupenova-Zamor. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "The authors would like to correct an error in the Author Contribution section. Jeffery L. Dangl (JLD) should be listed as one of the persons who wrote the paper.The correct author contributions are:Conceived and designed the experiments: GFW JJ JLD GJ PJBK. Performed the experiments: GFW JJ FEK. Analyzed the data: GFW JJ FEK GJ PJBK. Contributed reagents/materials/analysis tools: GFW PJBK. Wrote the paper: GFW FEK JLD PJBK."}
{"text": "Scientific Reports5: Article number: 14557; 10.1038/srep14557published online 09282015; updated: 10292015The original HTML version of this Article incorrectly listed Ameeta Kelekar as being affiliated with \u2018College of Biological Sciences, University of Minnesota, Minneapolis, MN 55455\u2019. The correct affiliation is listed below:Department of Laboratory Medicine and Pathology and Masonic Cancer Center, University of Minnesota, Minneapolis, MN 55455.This has now been corrected."}
{"text": "BMC Medicine 2015, 13:111 indicating the correct name for one of the authors.This is an Erratum to http://www.biomedcentral.com/1741-7015/13/111Please see related article:  Authors\u2019 corrected note:Jan NM IJzermans last name was incorrectly spelled in the author list and was indicated as Jan NM IJermans in our published article . The errCorrected text:Jan NM IJzermans"}
{"text": "Scientific Reports6: Article number: 22867 10.1038/srep22867; published online: 03112016; updated: 04222016The original version of this Article contained a typographical error in the spelling of the author Yves De Repentigny, which was incorrectly given as Yves De Repentingy. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 22020; 10.1038/srep22020 Published online: 02252016; Updated: 04072016The original version of this Article contained a typographical error in the spelling of the author Ariane Kaeppeli, which was incorrectly given as Ariane Kaeppli. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 1346510.1038/srep13465; published online: 08272015; updated: 10162015In the Supplementary Information file originally published with this Article, Table S15 was truncated. This error has been corrected in the Supplementary Information that now accompanies the Article."}
{"text": "There are errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: RT TCB. Performed the experiments: GPM TCB. Contributed reagents/materials/analysis tools: JRD TCB. Wrote the manuscript: TCB GPM.The publisher apologizes for the error."}
{"text": "Scientific Reports5: Article number: 937810.1038/srep09378; published online: 03232015; updated: 03312016This Article contains an error in Figure 3, where the numbers of genes are incorrectly indicated in the 24-hour and 48-hour sections. The correct Figure 3 appears below as"}
{"text": "Scientific Reports5: Article number: 16953; 10.1038/srep16953 published online: 11202015; updated: 04152016.In this Article, an additional affiliation for Keith L. March was omitted. The correct affiliation is listed below:Krannert Institute of Cardiology and the Indianapolis VA Center for regenerative medicine"}
{"text": "Scientific Reports6: Article number: 2898710.1038/srep28987; published online: 07072016; updated: 08242016The original version of this Article contained a typographical error in the spelling of the author Gerald Fontenay, which was incorrectly given as Gerald Fonteney. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications6: Article number: 866710.1038/ncomms9667 (2015); Published: 10202015; Updated: 11172015.The original version of this Article contained an error in the spelling of isomerism in the title of the paper. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "AbstractMacrotrachelianigronitens  (Heteroptera: Anthocoridae) is permanently present in the wild in Auckland (AK), New Zealand. It should therefore be added to the New Zealand Organisms Register (NZOR). It is a specialised predator of thrips inside leaf-roll galls. It has been present in New Zealand since at least the 1980s. Aspects of its biology, distribution, biosecurity status and history in New Zealand are discussed. The first detailed specimen records from New Zealand are provided, and a biological association is noted for the first time with Teuchothripsdisjunctus on Callistemon, probably its main association in New Zealand, where only two species of thrips cause leaf-roll galls. It has not been found associated with other thrips in New Zealand. Macrotrachelianigronitens is not known to be present in Australia, but the poorly known Anthocorisaustropiceus Gross, 1954 has been reported, in an easily overlooked publication, to be associated with Teuchothripsdisjunctus on Callistemon in Canberra. This led to an early tentative identification, by the author, of New Zealand material of Macrotrachelianigronitens as Anthocorisaustropiceus, in collections. This likely misidentification can now be discounted, but further research in Australia is required to determine the true identity of both Anthocorisaustropiceus, and whatever species of anthocorid was found in Canberra. Macrotrachelianigronitens   has recently been submitted by Bioforce Limited to the Environmental Protection Authority (EPA) to have Macrotrachelianigronitens declared as \"not new\", so that it can be legally propagated and/or distributed for the purposes of biological control of pest thrips. In fact, it shall be argued herein that Macrotrachelianigronitens ought never to have been classified as a \"new organism\" (under the Hazardous Substances and New Organisms (HSNO) Act = not present in New Zealand before 29 July 1998) in the first place, had its biosecurity status been properly assessed. An AMNZ record from 1997 is presented, and an even earlier record from the 1980s is indicated to be held in NZAC. Notes are provided on the biology, distribution and history in New Zealand of Macrotrachelianigronitens.ns St\u00e5l, 860 https://species.wikimedia.org/wiki/Macrotrachelia_nigronitensAnthocorisnigronitens St\u00e5l, 1860: 43 [Original description]Type status:Other material. Occurrence: recordedBy: Keith A. J. Wise; individualCount: 1; sex: female; Taxon: scientificName: Macrotrachelianigronitens ; Location: country: New Zealand; stateProvince: Auckland (AK); verbatimLocality: 15 Kingdale Road, Henderson, New Zealand, AK; verbatimElevation: 10 m; decimalLatitude: -36.86036; decimalLongitude: 174.62549; coordinateUncertaintyInMeters: 32; Identification: identifiedBy: Stephen E. Thorpe; Event: samplingProtocol: Swept; eventDate: 1997-05-09; habitat: Garden; fieldNumber: L5751; Record Level: institutionCode: Auckland Museum; collectionCode: AMNZ 59842Type status:Other material. Occurrence: recordedBy: G. Robertson; individualCount: 3; sex: females; Taxon: scientificName: Macrotrachelianigronitens ; Location: country: New Zealand; stateProvince: Auckland (AK); verbatimLocality: Auckland Regional Botanic Gardens, Manurewa, New Zealand, AK; verbatimElevation: 40m; decimalLatitude: -37.00879; decimalLongitude: 174.90646; coordinateUncertaintyInMeters: 570; Identification: identifiedBy: Stephen E. Thorpe; Event: eventDate: 2005-08; habitat: Callistemon sp. infested with Teuchothripsdisjunctus (Hood)In leaf-roll galls on ; fieldNumber: L14594; Record Level: institutionCode: Auckland Museum; collectionCode: AMNZ 73644, 73645, 73646Type status:Other material. Occurrence: recordedBy: John W. Early; individualCount: 5; sex: 3 females, 2 immatures; Taxon: scientificName: Macrotrachelianigronitens ; Location: country: New Zealand; stateProvince: Auckland (AK); verbatimLocality: Auckland Airport, Mangere, New Zealand, AK; decimalLatitude: -37.00019; decimalLongitude: 174.79505; coordinateUncertaintyInMeters: 400; Identification: identifiedBy: Stephen E. Thorpe; Event: eventDate: 2011-04-17; habitat: Gynaikothripsficorum in rolled leaves of FicusmicrocarpaWith ; fieldNumber: L19131; Record Level: institutionCode: Auckland Museum; collectionCode: AMNZ 85334 (immature), 85335 (immature), 85336 , 85337 , 85338 Type status:Other material. Occurrence: recordedBy: Stephen E. Thorpe; individualCount: 1; sex: male; Taxon: scientificName: Macrotrachelianigronitens ; Location: country: New Zealand; stateProvince: Auckland (AK); verbatimLocality: 25 Felton Mathew Ave, suburb of Saint Johns, New Zealand, AK; verbatimLatitude: -36.87246; verbatimLongitude: 174.84731; coordinateUncertaintyInMeters: 5; Identification: identifiedBy: Stephen E. Thorpe; Event: eventDate: 2014-03-01; habitat: Callistemon sp. In leaf-roll galls of TeuchothripsdisjunctusOn ; fieldNumber: L17240; Record Level: institutionCode: Auckland Museum; collectionCode: AMNZ 87996Type status:Other material. Occurrence: recordedBy: Stephen E. Thorpe; individualCount: 1; sex: male; Taxon: scientificName: Macrotrachelianigronitens ; Location: country: New Zealand; stateProvince: Auckland (AK); verbatimLocality: 2 Farringdon Street, suburb of Glen Innes, New Zealand, AK; verbatimLatitude: -36.87164; verbatimLongitude: 174.85883; coordinateUncertaintyInMeters: 0; Identification: identifiedBy: Stephen E. Thorpe; Event: eventDate: 2014-03-02; habitat: Callistemon sp., growing over fence into Paddington Reserve. In leaf-roll gall of TeuchothripsdisjunctusOn ; fieldNumber: EN17241; Record Level: institutionCode: Auckland Museum; collectionCode: AMNZ 87997Macrotrachelianigronitens is present in at least the vicinity of Auckland City and suburbs (AK). The genus Macrotrachelia consists of 6 currently recognised Central American species, with only Macrotrachelianigronitens extending  into South America , and possibly also adventive in California  are responsible for such galls in New Zealand, both of them adventive. One is Gynaikothripsficorum on Ficusmicrocarpa (Moraceae). The other is Teuchothripsdisjunctus on Callistemon (Myrtaceae). Ficusmicrocarpa is rare in New Zealand, present only in cultivation as an ornamental. Callistemon is far more common, and probably represents the main habitat of Macrotrachelianigronitens in New Zealand. Note that Gynaikothripsficorum in New Zealand appears to occur only on Ficusmicrocarpa, and not any of the other, more common species of Ficus. Note also that Macrotrachelianigronitens has not been found feeding on any other thrips, at least not in New Zealand.Macrotrachelianigronitens is present in New Zealand as a permanent wild population in suburban gardens and parks. It should therefore be added to the New Zealand Organisms Register (NZOR), as exotic and present in the wild.The data presented herein strongly indicates that Macrotrachelianigronitens into New Zealand is unknown. It may have arrived here directly from the Americas, associated with Gynaikothripsficorum, and then shifted host to the much more locally abundant Teuchothripsdisjunctus on Callistemon. It is not known to be present in Australia, where both Teuchothripsdisjunctus and Callistemon are native.The pathway of entry of Teuchothripsdisjunctus) in leaf-roll galls on Callistemon sp. The species was subsequently found by the author in the same habitat in Auckland Domain. In the then absence of a clue to the identity of the species, the author noticed a published reference by Anthocorisaustropiceus Gross, 1954. It had been found in leaf-rolls of Teuchothripsdisjunctus on Callistemon, in Canberra, Australia (see p. 83.) The author tentatively identified the New Zealand species as Anthocorisaustropiceus, based purely on the biological association. The identity of Anthocorisaustropiceus remains somewhat unclear from the original description in Anthocorisaustropiceus (AMSA K.67861) is apparently mounted on a microscope slide , and has not been examined by the author. Macrotrachelianigronitens has not been reported from Australia. Therefore, Australian entomologists are encouraged to double check the true identities of both Anthocorisaustropiceus Gross, 1954, and whatever species of anthocorid was collected in Canberra , as it is not impossible that one or other of them could turn out to be Macrotrachelianigronitens. Note that Anthocorisaustropiceus is the only known native Australian member of the tribe Anthocorini (see http://www.environment.gov.au/biodiversity/abrs/online-resources/fauna/afd/taxa/ANTHOCORINI/checklist), the tribe to which Macrotrachelia is also assigned , which was collected in the Auckland suburb of Henderson in 1997. Subsequently, Dr. Jocelyn Berry (then hymenopterist at NZAC) gave the author some material collected from Auckland Regional Botanic Gardens in August 2005, and given to her privately by the collector. This material was associated with thrips (assigned . It therhttps://commons.wikimedia.org/wiki/File:Anthocoris_austropiceus.jpg), as Anthocorisaustropiceus, an image of a specimen from Teuchothripsdisjunctus leaf-rolls on a Callistemon tree in Auckland Domain. On 31 March 2011, an email was received from David Horton (USDA research entomologist) suggesting that the imaged specimen was in fact a species of Macrotrachelia, which he suggested was probably Macrotrachelianigronitens, but with some reservations as the genus has not been taxonomically revised in recent times. Meanwhile, the author noted a specimen in NZAC collected in the 1980s (1986?), by entomologist Dr. Beverley A. Holloway, on a clothes line in her garden at Lynfield, Auckland. The specimen had an identification label on it reading \"near Maoricorisbenefactor\", det. M.-C. Larivi\u00e8re. The specimen was with the other material of Maoricoris (an unrelated endemic monotypic genus). Full details are currently unavailable to the author, but it is important for this specimen to be tracked down and confirmed as the likely first New Zealand record of Macrotrachelianigronitens. The issue is therefore highlighted herein for others to follow up. Until September 2007, the author deposited several other specimens into NZAC, tentatively identified as Anthocorisaustropiceus. In 2008 the species was independently discovered in New Zealand , associated with Gynaikothripsficorum leaf-rolls on Ficusmicrocarpa . Macrotrachelianigronitens in California and elsewhere. The Ministry for Primary Industries  treated this as a new incursion, which resulted in the current biosecurity status of Macrotrachelianigronitens as a new organism in New Zealand. Regrettably, none of the people involved or officially consulted by MPI during the incursion investigation took into account the all of the relevant material in AMNZ and NZAC, material which clearly demonstrates that Macrotrachelianigronitens has been present in N.Z. since at least 1997 and almost certainly at least since the 1980s.On 27 March 2010, the author collected and uploaded to Wikimedia Commons  Note that the present author had already sent New Zealand material to Horton, who carefully examined it, including dissections of both male and female genitalia, and he determined it as Macrotrachelianigronitens, based on the published literature. Larivi\u00e8re and Larochelle 2014 formally published the identification after 'comparison between specimens from NZAC and MACN', but without giving details how the comparison was made, or upon what the identification of the MACN material is based. Nevertheless, the present author accepts the determination as being certain enough to run with, in lieu of future taxonomic and/or molecular studies.David Horton initially intended to publish the New Zealand record of"}
{"text": "Nature Communications7: Article number: 11146 10.1038/ncomms11146 (2016); Published: 03312015; Updated: 04262015In Fig. 3 of this Article, data in panel \u2018a' were inadvertently partially obscured during the production process. The correct version of Fig. 3 now appears in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 869710.1038/srep08697; published online: 03032015; updated: 12182015This Article contains a typographical error in the Introduction section.16,17.although the existence of a such a transition below the upper critical dimension is still under debateshould read:16,17.although the existence of such a transition below the upper critical dimension is still under debateIn addition, there are errors in the following equations.In Equation (14)should read:In Equation (15)should read:In Equation (16)should read:"}
{"text": "It came to our attention after our manuscript was published that the caption of Table 1 was incomplete. We provide below the missing information, which is essential to the correct interpretation of the referred table.a Species names and authors are as specified in the original text.b Setation formulae of the first (P1), second (P2) and fourth (P4) swimming legs are summarized as follows: Re /Ri , where Re: exopod, Ri: endopod. F: adult female; M: adult male; TL: total length (mm); Ur1 to Ur5: urosome segments; Fu: furca; CR: caudal rami. nd: no data.PageBreak* Character not explicitly stated in the original but taken from accompanying drawings for comparison purposes.\u00a7 Most likely Crisafi (1959) described a late juvenile C5 as an adult male. In addition to the non-geniculated antennule, the urosome is 4-segmented with the last two segments fused ."}
{"text": "Scientific Reports5: Article number: 1589510.1038/srep15895; published online: 10282015; updated: 12142015In the original HTML version of this Article, Li Yue-Chun was incorrectly listed as being affiliated with \u2018Department of Pediatrics, Second Affiliated Hospital of Wenzhou Medical University, Wenzhou 325000, China\u2019. The correct affiliation is listed below:Department of Cardiology, Second Affiliated Hospital of Wenzhou Medical University, Wenzhou 325000, ChinaThis has now been corrected."}
{"text": "There are errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: MR AO MW MJ. Performed the experiments: MR MJ CS MG MM. Analyzed the data: MR AO MJ MM. Wrote the paper: MR AO MW."}
{"text": "There are errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: SW EC. Analyzed the data: SW EC. Contributed reagents/materials/analysis tools: SW EC. Wrote the paper: SW EC."}
{"text": "Scientific Reports5: Article number: 1215610.1038/srep12156; published online: 07172015; updated: 09222015The original version of this Article contained a typographical error in the spelling of the author Seulki Roh, which was incorrectly given as Seulki Rho. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "The correct contributions are: Conceived and designed the experiments: SNF MZ. Performed the experiments: JB SC. Analyzed the data: SC MZ JB. Contributed reagents/materials/analysis tools: SNF JB SC. Wrote the paper: SC MZ JB SNF. Designed the computational analysis: MZ SC.There is an error in the penultimate sentence of the second paragraph of the \u201cThe least-dependent components are statistically nearly independent\u201d subsection of the Results. The correct sentence is: The distribution of this null estimate calculated from 100 flight segments (12000 pairs of LDCs) is shown in Fig. 7B (red dashed line)."}
{"text": "Scientific Reports6: Article number: 2421010.1038/srep24210; published online: 04132016; updated: 06202016In the original version of this Article, an additional affiliation for Taek Dong Chung was omitted. The correct affiliation is listed below:Advanced Institutes of Convergence Technology, Suwon-Si, Gyeonggi-do 16229, Korea.This error has now been corrected in the PDF and HTML versions of the Article."}
{"text": "AbstractHomotrysismacleayi  in New Zealand. Evaluation of this evidence clearly indicates that the species is fully established in the wild in New Zealand. It is therefore recommended that the species be added to the New Zealand Organisms Register (NZOR), as exotic and present in the wild. Some general comments are offered on the importance of data and evidence in faunistics.The first detailed specimen records are presented for the Australian beetle  Homotrysismacleayi . Although I immediately recognised it as a species of alleculine tenebrionid unknown in New Zealand, it was not identified until I found others in 2012. These were identified as Homotrysismacleayi by Australian tenebrionid expert Dr. Eric Matthews . The species was validated new to N.Z., based on this material identified by Matthews, by Homotrysismacleayi (tenebrionid beetle), Acacia sp. (wattle), Auckland, General Surveillance). Nothing more has been published regarding the presence of this beetle in New Zealand. There is currently no record of it on the New Zealand Organisms Register (NZOR). It is therefore somewhat unclear what the status is of the species in New Zealand. Is it a permanently established member of the New Zealand fauna? Faunistics is the study of the presence/absence of species in a given area, such as New Zealand. Since we are scientists, and not stamp collectors, the presence of a given species in a given area should be stated with specification of the associated evidence for its presence. Presence/absence can change over time. Presence could be based on a single, possibly mislabelled and/or misidentified specimen, or by many independent specimen records taken over a long period of time. It is important to specify, but it is not often done. Similarly, presence could be based on a specimen or specimens representing only post border interceptions, without a breeding resident population. Only the systematic accumulation of data can establish the facts.In 2004, I collected what is probably the first New Zealand specimen of the Australian beetle https://species.wikimedia.org/wiki/Homotrysis_macleayiAlleculamacleayi Borchmann, 1909 Alleculaflavicornis Macleay, 1887 (objective synonym)Type status:Other material. Occurrence: recordedBy: S.E. Thorpe; individualCount: 1; Taxon: scientificName: Homotrysismacleayi ; Location: country: New Zealand; stateProvince: Auckland; verbatimLocality: Auckland Domain; verbatimLatitude: 36.86385S; verbatimLongitude: 174.77501E; Identification: identifiedBy: Stephen E. Thorpe; Event: samplingProtocol: On trunk of Eucalyptus tree at night; eventDate: 2004-04-28; Record Level: institutionCode: Auckland Museum; collectionCode: AMNZ57969Type status:Other material. Occurrence: recordedBy: S.E. Thorpe; individualCount: 3; Taxon: scientificName: Homotrysismacleayi ; Location: country: New Zealand; stateProvince: Auckland; verbatimLocality: Tamaki Campus (East), suburb of Saint Johns, Auckland; verbatimLatitude: 36.88615S; verbatimLongitude: 174.85258E; Identification: identifiedBy: Eric G. Matthews; Event: samplingProtocol: Under loose bark of chopped up wattle tree (possibly Paraserianthes lophantha); eventDate: 2012-03-08; Record Level: institutionCode: Auckland Museum; collectionCode: AMNZ86134 (1 specimen)Type status:Other material. Occurrence: recordedBy: S.E. Thorpe; individualCount: 1; Taxon: scientificName: Homotrysismacleayi ; Location: country: New Zealand; stateProvince: Auckland; verbatimLocality: Tamaki Campus (East), suburb of Saint Johns, Auckland; verbatimLatitude: 36.88216S; verbatimLongitude: 174.85331E; Identification: identifiedBy: Stephen E. Thorpe; Event: samplingProtocol: Under bark of Pittosporum eugenioides stump, at edge of carpark.; eventDate: 2013-05-05; Record Level: institutionCode: Auckland Museum; collectionCode: AMNZ87636Type status:Other material. Occurrence: recordedBy: S.E. Thorpe; individualCount: 1; Taxon: scientificName: Homotrysismacleayi ; Location: country: New Zealand; stateProvince: Auckland; verbatimLocality: Tamaki Campus (East), suburb of Saint Johns, Auckland; verbatimLatitude: 36.88100S; verbatimLongitude: 174.85310E; Identification: identifiedBy: Stephen E. Thorpe; Event: samplingProtocol: On dead tree fern frond, on ground, by pond; eventDate: 2014-01-09; Record Level: institutionCode: Auckland Museum; collectionCode: AMNZ87720Homotrysismacleayi is easily recognised as an alleculine tenebrionid. Fig. Homotrysismacleayi on four separate occasions, spread over a number of years , at two sites in the vicinity of metropolitan Auckland . Figs I have now collected Homotrysismacleayi. I have collected it on a trunk of a Eucalyptus tree at night, under the bark of a chopped up wattle tree , under the bark of a stump of the native tree Pittosporumeugenioides at the edge of a carpark, and on the ground on a dead tree fern frond. I have only collected the species from anthropogenic habitats in metropolitan Auckland.Little or nothing is known of the ecology of Homotrysismacleayi was proposed as a new replacement name by Alleculamacleayi) for Alleculaflavicornis Macleay, 1887 , which is a junior homonym of Alleculaflavicornis Kolbe, 1883 (West Africa). It therefore makes no sense that Homotrysisflavicornis (Macleay 1887) and Homotrysismacleayi , with different associated data!There is some published confusion regarding this species in Australia. Homotrysismacleayi is present in the wild in metropolitan Auckland, and has been present there for some 10 years. The identification has been validated by Ministry for Primary Industries (MPI). I therefore recommend that Homotrysismacleayi  be added to the New Zealand Organisms Register (NZOR), as exotic and present in the wild.The available data clearly indicates that a breeding population of"}
{"text": "Critical Care, Oshiro and colleagues describe the profile of acute coagulopathy of trauma-shock (ACOTS) using viscoelastic techniques [In an interesting and original article in a recent issue of chniques . The autchniques \u20134]. How. HowCritchniques . In thischniques . RegardlSatoshi GandoWe appreciate the interest of Egea-Guerrero and colleagues in our article regarding DIC in trauma . We agreACOTS: Acute coagulopathy of trauma-shock; APC: Activated protein C; DIC: Disseminated intravascular coagulation; PAI-1: Plasminogen activator inhibitor-1.The authors declare that they have no competing interests."}
{"text": "Scientific Reports6: Article number: 1951710.1038/srep19517; published online: 01222016; updated: 02252016.in vivo: A Biomarker for LDH Activity\u201d was incorrectly given as \u201cLactate Chemical Exchange Saturation Transfer (LATEST) Imaging in vivo A Biomarker for LDH Activity\u201d. This has now been corrected in the PDF and HTML versions of the Article.The original version of this Article contained an error in the title of the paper, where \u201cLactate Chemical Exchange Saturation Transfer (LATEST) Imaging"}
{"text": "There is an error in the funding statement. Please refer to the correct funding statement below.The authors received funding for this study from the following sources.http://www.sdcz.gov.cn/; Funding institution: Shandong Province Finance Bureau; Authors that received the funding: HZ;Grant number:Lu Cai Jiao Zhi (2013) 171;URL:\u00a0http://www.nsfc.gov.cn/; Funding institution: National Natural Science Foundation of China; Authors that received the funding: WG;Grant number:81400573; URL:\u00a0http://www.nsfc.gov.cn/; Funding institution: National Natural Science Foundation of China; Authors that received the funding: WG.Grant number:61471384; URL:"}
{"text": "Computer Aided Diagnosis (CAD), which can automate the detection process for ocular diseases, has attracted extensive attention from clinicians and researchers alike. It not only alleviates the burden on the clinicians by providing objective opinion with valuable insights, but also offers early detection and easy access for patients.We review ocular CAD methodologies for various data types. For each data type, we investigate the databases and the algorithms to detect different ocular diseases. Their advantages and shortcomings are analyzed and discussed.We have studied three types of data  that have been commonly used in existing methods for CAD. The recent developments in methods used in CAD of ocular diseases  are investigated and summarized comprehensively.While CAD for ocular diseases has shown considerable progress over the past years, the clinical importance of fully automatic CAD systems which are able to embed clinical knowledge and integrate heterogeneous data sources still show great potential for future breakthrough. Patients with ocular diseases are often unaware of the asymptomatic progression of the said disease  until atOwing to the fast pace of technological advancements in both hardware and software, many CAD systems have been developed for the diagnosis of ocular diseases over the past years, though most of them are still undergoing evaluation or clinical validation. For example, Fujita et al.  discusseThough such fully automated systems are not yet on the market, semi-automated and manual computer systems incorporating these CAD systems are relatively widely used, with several clinical publications already reporting on their usage. Examples of the development of such systems include IVAN  from UniThis survey covers three types of data for CAD systems: clinical data, image based data and genetic data. Clinical data refers to a patient\u2019s demographic information  and data acquired from clinical laboratory tests or exams, e.g. intra-ocular pressure (IOP), but excludes data acquired from digital imaging or genomic tests . Image based data refers to images captured using an imaging device for observing the pathology in the affected part of the eye . Genetic information refers to any data obtained from an individual\u2019s DNA, genes or proteins (Section \u201cResult: predicting ocular diseases based on genetic information\u201d). These definitions are specific to this paper and may vary depending on context. Of the three data types, CAD systems using clinical data has already been widely studied in the clinical field -10. As fThere have been surveys on retinal imaging in the area of ocular research ,13. HoweIn this work, we review research and development on automatic ocular disease diagnosis in the light of three data types, viz. clinical, image and genetic. For each data type, we investigate the algorithms and available databases developed for different ocular diseases. The associated publications were retrieved from two literature databases, PubMed and IEEEXplore. Considering the works which use images as data, to understand the major image modalities used for CAD applications and the trends of research areas, we summarize the statistics of image-based studies conducted on various ocular diseases. We examine the biomedical databases to extract the known genetic information regarding ocular diseases.The results of the review are presented in three sections: Sections \u201cResult: CAD of ocular diseases based on clinical data\u201d and \u201cResult: CAD of ocular diseases based on imaging\u201d describe the CAD of ocular diseases based on clinical data and ocular imaging respectively. Section \u201cResult: predicting ocular diseases based on genetic information\u201d concerns studies relating genomic informatics to disease prediction. Furthermore, in Section \u201cDiscussion\u201d we discuss the observed trends in the field and the possibility of CAD systems based on integrated data sources.One of the pioneer research works on Clinical Decision Support Systems (CDSS), CASNET   or through a cultural sample of bacteria from the eye tested in a laboratory 31], a meResearch on CAD of PM has mainly relied on DFP but recently there have been efforts to explore the use of SS-OCT for PM analysis.An observable sign for PM detection is PPA, an atrophy of pre-existing retina tissue. The APAMEA system proposed by Liu et al.  was the Different features have been extracted from DFP for PM detection. APAMEA extracted a texture feature obtained through entropy analysis. In  BIF was \u03bcm range, which has improved their ability to penetrate deeper into tissues than the conventional SD-OCT instruments [SS-OCT uses a frequency swept laser as a light source  and, in truments . Though truments  reportedA brief review of cataract grading and CAD for corneal opacity is given below.Cataract is characterized by a cloudiness (opacity) in the eye lens which obstructs vision and can even lead to blindness. Cataract can be categorized into three types based on the location of opacity within the lens structure: nuclear, cortical and Posterior Sub-Capsular (PSC) . NuclearFigure\u00a0Typical features used for grading CC and PSC include enhanced texture features , intensiCorneal haze describes the condition when the cornea becomes cloudy or opaque. The cornea is normally clear, so corneal haze can greatly impair vision. Although the haze can occur in any part of the cornea, it is most often found within the thicker, middle layer of the cornea, called the stroma. Corneal haze is most often caused by inflammatory cells and other debris that are activated during trauma, infection or surgery. Corneal haze sometimes occurs during laser vision correction procedures.Slit lamp imaging has been used to clinically estimate corneal haze manually by physicians but not automatically. For example, it was used to observe the cornea haze after excimer laser ablation of cornea ,287. SliThe above imaging modalities have been used in clinic with manual detection but till now, as far as we know, there is no automatic method based on these modalities. Currently, the existing automatic method is based on the most straightforward way: examining frontal photograph of eye ,291. In AMD: Age-related macular degeneration; AM-FM: Amplitude modulation-frequency modulation; BM: Bruch\u2019s membrane; BMO: Bruch\u2019s membrane opening; CAD: Computer aided detection; CASNET: Causal association network; CC: Cortical cataract; CCT: Central corneal thickness; CDR: Cup-to-disc ratio; CDSS: Clinical decision support systems; CME: Cystoid macular edema; CNV: Choroidal neovascularization; CSLO: Confocal scanning laser ophthalmoscopy; DH: Disc haemorrhage; DR: Diabetic retinopathy; FBIF: Focal biologically inspired feature; GRI: Glaucoma risk index; GWAS: Genome-wide association studies; HALT: Histogram based adaptive local thresholding; HE: Hard exudates; HRT: Heidelberg retina tomography; ICA: Independent component analysis; IOP: Intra-ocular pressure; LASSO: Least absolute shrinkage selector operation; LDA: Linear discriminant analysis; MGG: Mixture of generalized Gaussian; MLP: Multilayer perceptron; MOG: Mixture of Gaussian; MRA: Moorfields regression analysis; MRI: Magnetic resonance imaging; MTA: Major temporal arcade; NC: Nuclear cataract; NCO: Neural canal opening; NRR: Neuro-retinal rim; OCT: Optical coherence tomography; OMIM: Online Mendelian inheritance in man; PCA: Principal component analysis; PM: Pathological myopia; PPA: Parapapillary atrophy; PSC: Posterior sub-capsular; QDA: Quadratic discriminant analysis; RNFL: Retina nerve fibre layer; RNFLT: Retina nerve fibre layer thickness; ROI: Region of interest; RPE: Retinal pigment epithelium; SAP: Standard automated perimetry; SD-OCT: Spectral domain-optical coherence tomography; SEAD: Symptomatic exudate-associated derangements; SIFT: Scale-invariant feature transform; SLIC: Simple linear iterative clustering; SLP: Scanning laser polarimetry; SNP: Single-nucleotide polymorphism; SNR: Signal to noise ratio; SS-OCT: Swept source-optical coherence tomography; SVDD: Support vector data description; SVM: Support vector machines; TCA: Topographic change analysis; VCD: Vertical cup diameter; VDD: Vertical disc diameter.The authors declare that they have no competing interests.ZZ conceived topic of this survey, did the review for ocular genomic data, and image related PM research and wrote the concerned parts of the manuscript. RS surveyed and wrote on Cataract and DR and consolidated the final manuscript. HL surveyed and wrote on the topics of AMD detection and corneal opacity detection. XC surveyed and wrote about Glaucoma screening and also enriched the section on CAD of ocular diseases based on clinical data. LD clarified the motivation of this survey and wrote the conclusion. JL, CKK and DWKW conceived of the survey and participated in designing it. TYW provided clinical advice. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6947/14/80/prepub"}
{"text": "Scientific Reports5: Article number: 1042210.1038/srep10422; published online: 05282015; updated: 10282015.The original version of this Article contained a typographical error in the spelling of the author Martin Nors Pedersen, which was incorrectly given as Martin Nors Perdersen.This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 16577; 10.1038/srep16577published online 11122015; updated: 01272016The original version of this Article contained a typographical error in the spelling of the author Chae-Myeong Ha which was incorrectly given as Chae-Myung Ha. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications 6: Article number: 784110.1038/ncomms8841 (2015); Published: 07312015; Updated: 10222015.The original version of the Supplementary Information attached to this Article did not contain Supplementary Tables 1\u20137. The HTML has now been updated to include a corrected version of the Supplementary Information."}
{"text": "Scientific Reports6: Article number: 24396; 10.1038/srep24396published online: 04182016; updated: 08252016The original version of this Article contained a typographical error in the spelling of the author Paola Bolognesi, which was incorrectly given as Paolo Bolognesi. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 17665; 10.1038/srep17665 published online: 12072015; updated: 01202016.The original version of this Article contained a typographical error in the spelling of the author Konstantinos Karakostis, which was incorrectly given as Kostantinos Karakostis. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 23213; 10.1038/srep23213 published online: 03182016; updated: 04292016.The original version of this Article contained a typographical error in the spelling of the author Ana C. Glembotsky, which was incorrectly given as Ana C. Glembostky. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications7: Article number: 10268 10.1038/ncomms10268 (2016); Published: 01082016; Updated: 03032016The financial support for this article was not fully acknowledged. The Acknowledgements should have included the following:This work was supported by the intramural research program of the NIMH (ZIA-MH-002498-24)."}
{"text": "Nature Communications6, Article number: 7131 10.1038/ncomms8131 (2015); Published 05192015; Updated: 08262015.The original version of this Article contained an error in the spelling of circulation in the title of the paper, and in"}
{"text": "The seventh and eighth authors\u2019 names are spelled incorrectly. The correct names are: Flavia de Lima Alves and Juri Rappsilber.The authors contributions with the corrected initials are provide here:Conceived and designed the experiments: JG FT SCL BH JR. Performed the experiments: SCL BH PP FdLA SMG JG SY HT EdL. Analyzed the data: FdLA KS GVJ JG FT. Wrote the paper: JG FT EJF BH SCLThe 7th author\u2019s current address is missing. Flavia de Lima Alves\u2019 current address is: Centre for Microbial Chemical Biology, Department of Biochemistry, McMaster University, Ontario, CanadaThe affiliation for the 8th author is incomplete. Juri Rappsilber is affiliated with: Department of Bioanalytics, Institute of Biotechnology, Technische Universit\u00e4t Berlin, Berlin, Germany in addition to the listed affiliation: 3. Wellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh, United KingdomThe following information is missing from the Funding section: The Wellcome Trust generously funded this work through a Senior Research Fellowship to JR (103139), a Centre core grant (092076) and an instrument grant (108504)."}
{"text": "Scientific Reports6: Article number: 22440;10.1038/srep22440 Published online: 03012016; Updated: 06022016The following statement has been omitted from the \u2018Additional Information\u2019 section of the HTML version of this Article:\u201cData Availability: The images and spectra on which this paper is based may be publicly accessed and are stored at 10.17639/nott.35\u201d.The PDF version of this Article was correct at the time of publication."}
{"text": "Nature Communications6: Article number: 10063 10.1038/ncomms10063 (2015); Published: 12212015; Updated: 04202016Staphylococcus aureus accession codes is incorrect, as follows:In Supplementary Data 3 of this Article, one of the SRR2101499 should be ERR1197981."}
{"text": "Scientific Reports6: Article number: 2907310.1038/srep29073; published online: 07012016; updated: 08192016.The original version of this Article contained a typographical error in the spelling of the author Daniela Fernandois, which was incorrectly given as Daniela Fernadois. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications 6: Article number: 6756 (2015); 10.1038/ncomms7756 Published: 04092015; Updated: 08212015.The affiliation details for Lin Xu and Xintian Hu are incorrect in this article. The correct affiliation for these authors is given below. Kunming Institute of Zoology, CAS Center for Excellence in Brain Science, Chinese Academy of Sciences, Kunming 650223, China."}
{"text": "There are errors in the Author Contributions section. The correct contributions are: Conceived and designed the experiments: HM MK. Performed the experiments: HM. Analyzed the data: HM JT MK. Contributed reagents/materials/analysis tools: MK. Wrote the paper: HM MK JT."}
{"text": "Scientific Reports5: Article number: 11699;10.1038/srep11699 Published online: 07012015; Updated: 05092016This Article contains an error in Figure 2: the arrow depicting the electric field should point right to left. The correct Figure 2 appears below as"}
{"text": "Scientific Reports6: Article number: 22027; 10.1038/srep22027 published online: 02232016; updated: 06102016In the original version of this Article, an additional affiliation for Lin Chen and YiMing Zhu was omitted. The correct affiliation is listed below:Cooperative Innovation Center of Terahertz Science, Chengdu 611731, China.This error has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Description: Due to errors introduced in the production process, the Supporting Informationfiles were excluded. They can be found here:Table S1:  [^]"}
{"text": "Scientific Reports6: Article number: 2186410.1038/srep21864; published online: 02232016; updated: 05042016In this Article, Figure 4 is incorrect. The Figure legend is correct. The correct Figure 4 appears below as"}
{"text": "Nature Communications6: Article Number: 744610.1038/ncomms8446 (2015); Published 07012015; Updated 12142015The financial support for this Article was not fully acknowledged. The Acknowledgements should have included the following:ST acknowledges financial support from Grant-in-Aid Research S No. 26220710."}
{"text": "There are errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: PLA JS JM. Collected data: ELV JLR KG JS. Interpreted images: ELV JLR. Analyzed the data: ALGB ELV OJA. Wrote the paper: ALGB ELV BM."}
{"text": "Scientific Reports5: Article number: 950210.1038/srep09502; published online: 03302015; updated: 09212015et al. (reference 31), but in that paper the relevant data are not shown.The results presented in Fig. 1B were produced by Wei Wang, Kun-Liang Guan and Michael Karin. The authors neglected to indicate that the same results were also reported by Parmigiani"}
{"text": "Scientific Reports5: Article number: 1591510.1038/srep15915; published online: 11032015; updated: 02052016In the Supplementary Information file originally published with this Article, the details of the beta testers in Supplementary Table S11 were incorrect. These errors have been corrected in the Supplementary Information that now accompanies the Article."}
{"text": "There are errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: GL LX TF YC GJ HZ JW XC CW. Performed the experiments: GL LX TF JW. Analyzed the data: GL LX TF. Contributed reagents/materials/analysis tools: GL. Wrote the paper: GL.Additionally, there is an error in the legends for Further, there is an error in the footnotes for"}
{"text": "Scientific Reports5: Article number: 1741310.1038/srep17413; published online: 11272015; updated: 01292016The Acknowledgements section in this Article is incomplete.\u201cThis study was supported by National Natural Science Foundation of China .\u201dshould read:\u201cWe thank Min Zhao , Zhu Ba , Zhaoxia Zhang , and Xinbo Song  for helpful sample collection.This study was supported by National Natural Science Foundation of China .\u201d"}
{"text": "Scientific Reports6: Article number: 2012710.1038/srep20127; published online: 02162016; updated: 04202016.The original version of this Article contained an error in the spelling of the author Maha Al-Asmakh, which was incorrectly given as Al-Asmakh Maha. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "The affiliation for the seventh author is incorrect. Ajit Varki is not affiliated with #4 but with #3 University of California, San Diego, CA, USA.The following information is missing from the Funding section: This work was also supported by NIH grants R01GM32373 and U01 CA199792 (to AV).There are errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: GFG YS HS JQ. Performed the experiments: HS JQ SD. Analyzed the data: HS JQ YS ZK. Contributed reagents/materials/analysis tools: HS JQ YS HY XC. Wrote the paper: HS AV YS GFG. Collected the X-ray data and solved the structures: JQ. Array analysis and interpretation: ZK SD AV. Synthesis of glycans for array: HY XC."}
{"text": "There are errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: LFT EMF. Performed the experiments: LFT WAdG EAJC. Analyzed the data: NAW. Contributed reagents/materials/analysis tools: CNW SG PD LJSH EMF. Wrote the paper: NAW LFT PMA WAdG EAJC CNW SG PD LJSH EMF"}
{"text": "Scientific Reports6: Article number: 2266110.1038/srep22661; published online: 03032016; updated: 05042016In the Supplementary Information file originally published with this Article, references 32, 33 and 37 were incorrectly given as references 25, 26 and 35 respectively. These errors have been corrected in the Supplementary Information that now accompanies the Article."}
{"text": "Following publication of the original article , the autSuperficial venous thrombosisas a possible consequence of ChAdOx1 nCoV-19 vaccine: two case reports.The incorrect title is:Superficial venous thrombosis as a possible consequence of ChAdOx1 nCoV-19 vaccine: two case reports.The correct title is:The title has been updated above and the original article  has been"}
{"text": "Donacaulaniloticus  is known from south-eastern Europe, Middle East and Turkey to Central Asia, northern India and China and widely distributed in North Africa .Donacaulaniloticus (Zeller 1867) is recorded for the first time from the Iberian Peninsula and the first DNA barcode sequence is published and compared with other European and North American Donacaula species. Crambidae  currently includes 10,343 species in 15 subfamilies worldwide of which 239 species in 29 genera belong to the subfamily Schoenobiinae , S.xanthopygataSchoenobiusgigantellus  collected from the saltmarshes of Adventus in Trebujena . The specimens collected have some consistent morphological features which differ from the other Donacaula species. In addition, mtDNA sequence(COI) were used to assess genetic divergence between the Donacaula species from Europe and North America.In this article, we provide the first record and DNA barcoding of During the sampling, one female specimen with a white discocellular spot and unpointed apex traits was collected Fig. a. AdditiThe specimen was pinned, wings spread and dried. Their external characters were examined in order to evaluate possible differences in colouration and wing shape. Furthermore, it was dissected using standard procedures  with minMZ920225).For DNA extraction, two legs were removed from the specimen in order to sequence the 658 base-pair long barcode segment of the mitochondrial COI gene . The tissue samples were submitted to the Canadian Centre for DNA Barcoding  to obtain DNA barcodes using the high-throughput protocol described in Donacaulaniloticus and the Donacaulaother  species from Europe and from North America, we included all sites with the pairwise deletion option. The public sequences of Donacaulaforficella , D.mucronella  from Europe and D.longirostrallus , D.maximellus , D.melinellus , D.sordidellus  and D.unipunctellus  from North America were obtained from the public database in BOLD. We selected Scirpophagapraelata , which is systematically related into subfamily Schoenobiinae as outgroup to root the trees.Voucher data, images, sequences and trace files are publicly available on the Barcode of Life Data System (BOLD) . Sequencstrallus  BA57C87D-617C-568C-BEB0-08E4550B3C75Schoenobiusniloticus Type status:Other material. Occurrence: recordedBy: J.J. Guerrero; individualCount: 1; sex: female; lifeStage: adult; disposition: in collection; Taxon: scientificName: Donacaulaniloticus ; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Lepidoptera; family: Crambidae; genus: Donacaula; specificEpithet: niloticus; taxonRank: species; verbatimTaxonRank: sp.; scientificNameAuthorship: ; taxonomicStatus: accepted; Location: country: Spain; stateProvince: Andalusia; county: Cadiz; locality: Trebujena, Saltmarshes of Adventus, Seno de la Esparraguera; verbatimCoordinates: 36\u00b053'31.20\"N 6\u00b015'36.00\"W; verbatimLatitude: 36\u00b053'31.20\"N; verbatimLongitude: 6\u00b015'36.00\"W; Identification: identifiedBy: J.J. Guerrero; dateIdentified: 2020; Event: samplingProtocol: light trap; eventDate: 08/09/2020; year: 2020; month: 9; day: 8; Record Level: institutionCode: ZAF-UMU; collectionCode: RCBA; basisOfRecord: PreservedSpecimenDonacaulaniloticus according to the diagnosis in Donacaula, are for the male: forewing with dark brownish line from the costal margin to approximately the centre of the wing, parallel to the outer margin; and for the female: forewing with white discocellular spot and apex non-pointed. Integrating the evidence from COI mitochondrial DNA sequences and adult morphology, we conclude that the D.niloticus specimen collected in the saltmarshes of Adventus (C\u00e1diz) is genetically different to other species included in the genus Donacaula from Europe and North America.The Iberian specimen showed morphological traits Figs , 2 typicDonacaulaniloticus and seven Donacaula species from Europe and North America, including Scirpophagapraelata as additional Schoenobiinae species, are presented in Table The COI divergences between All trees presented the same topology and were practically identical; therefore, only the ML tree is presented here with the branch tips collapsed since each of the groups of sequences correspond to a single BIN Fig. . The comDonacaulaniloticus in the riparian vegetation near to the mouth of the Guadalquivir River into the saltmarshes of Adventus  is confirmed by integrating the evidence from COI mitochondrial DNA sequences and adult morphology and is genetically different to the other two European and six North American Donacaula species. Molecular data indicate significant divergence with large mean distances amongst Donacaula species (13.0%) with maximum distance between D.sordidellus and D.longirostrallus and minimum distance between D.melinellus and D.mucronella (7.6%). In the case of D.niloticus, the distance to the European Donacaula species was 13% to D.forficella and 11.8% to D.mucronella, while the genetic divergence amongst D.forficella and D.mucronella was 13%. .The presence of  species 3.0% with%. Table . AlthougDonacaula is associated with various semi-aquatic and marsh plants where their larval stages live in stems or roots or on exposed and non-submerged leaves of Phragmitesaustralis, Glyceria spp. and Carex spp. These lepidopterans have developed various strategies and adaptations that have allowed them to stay in close proximity to water  which forms estuaries, salt marshes and marshes with a mixture of salty and fresh waters which is represented by the communities Cistancho-Arthrocnemetum macrostachyi, Polygono-Limoniastretum monopetaliSpartinetum maritimae, Puccinellio-Sarcocornietum perennis, Halimiono-Sarcocornietum alpini,  and, on the edge of the estuaries, the halonitrophilic community, Cistancho-Suaedetumverae. Sometimes, a plantation of Polygono-Tamaricetumafricanae may appear. The land use bordering the habitat are mainly agricultural fields  of the Data typeMaximum Likelihood tree (ML)Brief descriptionDonacaula species rooted with Scirpophagapraelata. Branch supports are represented by SH-aLRT/aBayes/UFBoot.Maximum Likelihood tree (ML)  including 99 sequences of selected File: oo_607849.pdfhttps://binary.pensoft.net/file/607849Antonio S. Ortiz"}
{"text": "Many flies have specially evolved feeding mechanisms to imbibe liquids of specific viscosities. Observations of feeding on atypical liquids are notable because of their rarity.Philolicherondani.We report the first record of intrusive fluid feeding on vertebrate carrion by  Diptera constitute one of the five taxonomically megadiverse insect orders 19FAFF98-8D86-5F61-BD1E-029FBC8D2480Type status:Other material. Occurrence: individualCount: 1; sex: female; lifeStage: adult; behavior: feeding; occurrenceStatus: present; preparations: photograph; Taxon: scientificName: Philolicherondani; acceptedNameUsage: Philolicherondani; parentNameUsage: Tabanidae; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Diptera; family: Tabanidae; genus: Philoliche; specificEpithet: rondani; taxonRank: species; scientificNameAuthorship: ; nomenclaturalCode: ICZN; taxonomicStatus: accepted; Location: higherGeographyID: 7017573; higherGeography: Africa: South Africa: Limpopo: Mookgophong: ASDIA Wild Game Farm; continent: Africa; country: South Africa; countryCode: ZA; stateProvince: Limpopo; locality: ASDIA Wild Game Farm; verbatimLocality: ASDIA Wild Game Farm, Mookgophong region; locationAccordingTo: Getty Thesaurus of Geographic Names; verbatimCoordinates: 24\u00b026'S 28\u00b025'E; verbatimLatitude: 24\u00b026'S; verbatimLongitude: 28\u00b025'E; verbatimCoordinateSystem: degrees minutes; decimalLatitude: -24.43333; decimalLongitude: 28.41666; Identification: identifiedBy: John Chainey; Event: eventDate: 2014-12; startDayOfYear: 334; endDayOfYear: 365; year: 2014; month: 12; verbatimEventDate: December 2014; habitat: savanna; eventRemarks: about 18 hours post mortem; Record Level: type: StillImage; modified: 2014-12; rights: Content licensed under Creative Commons Attribution 4.0 International; rightsHolder: R Boon; basisOfRecord: HumanObservation24\u00b026'S, 28\u00b025'E) in the Mookgophong area of Limpopo, South Africa, a female of Philoliche (Philoliche) rondani  was photographed visiting the carcass of a blue wildebeest ) cow that had died during calving  rondani specimens was taken from the KwaZulu-Natal Museum entomology collection (n = 15) and the average ratio of proboscis length  to head height  was measured using vernier calipers.A random selection of Tabanidae.Measurements of preserved specimens found the ratio of proboscis to head height to be 1.59:1 (n = 15). The minimum observed ratio was 1.15:1. In Fig. P. (P.) rondani is needed to establish the ability of these secretions to reverse the coagulation of blood. The reversal of coagulation is a likely explanation for this feeding observation, given the morphological specialisation in Philoliche.The average night time temperature in Mookgopong in December is 17.4\u00b0C, which is not low enough to delay decomposition or blood coagulation. Given the depth that the proboscis has penetrated and the time since death, intrusive feeding on coagulated blood is the most likely explanation for this observation. Further investigation into the oral secretions of Tabanidae at carcasses, but these observations have largely been dismissed as incidental (Tabaninae (three), Pangoniinae (one) and Scepsidinae (one). The variety in distribution and diversity of these observations indicates that more attention needs to be given to potential carcass feeding in Tabanidae and the potential range of viscosity in their food.Several authors have noted cidental . This maTabanidae provide evidence for their presence on a corpse and could show that a corpse has been moved after death (This behaviour is relevant to the field of forensic entomology and further investigation into the frequency of this behaviour is warranted. In future, known post-mortem bite marks should be documented, as the physiological response is likely to be different from that in pre-mortem bites. Post-mortem bite marks indicating feeding by er death ."}
{"text": "Following publication of the original article , the autIncorrect: Kullbeck.Correct: Kullback.The original article has been corrected."}
{"text": "RSC Advances article due to a significant amount of unattributed text overlap with The Royal Society of Chemistry hereby wholly retracts this Somayeh Sohrabi, Nour kassir and Mostafa Keshavarz Moraveji have not agreed to the retraction.RSC Advances Executive Editor.Signed: Laura Fisher, th November 2022.Date: 25"}
{"text": "Following publication of the original article , the autGivenName: MshunqaneFamilyName: NombekoThe incorrect author\u2019s name is:GivenName: NombekoFamilyName: MshunqaneThe correct author\u2019s name is:The author group has been updated above and the original article  has been"}
{"text": "Consent was added to this article: The patient provided consent (by signing on a consent document) at the time of tumor tissue and blood sample collection stating willingness to: Provide the required sample for tumor molecular profiling.Research use of deidentified data including publication of (deidentified) findings.4358-4363. https://doi.org/10.18632/oncotarget.27809Original article: Oncotarget. 2020; 11:4358\u20134363."}
{"text": "Due to a publishing error the article: \u201cThe effect of cooling procedures on monomer elution from heat-cured polymethyl methacrylate denture base materials\u201d, published at Journal of Applied Oral Science 2022;30:e20220161 was printed with the following error:Where it reads:It should read:Where it reads:It should read:"}
{"text": "The seventh author\u2019s name is spelled incorrectly. The correct name is: Shira Gur-Arieh. There is also an error in affiliation 6 for author Shira Gur-Arieh. The correct affiliation 6 is: The Leon Recanati Institute for Maritime Studies, University of Haifa, Haifa, Israel."}
{"text": "The original version of the above article contains errors that need to be corrected. Incorrect ALP staining images for Fig.\u00a0Additional file 1: Fig. S3. The original gel images of BSP and ALP results in fig.3c. a The original gel image of BSP. b The original gel image of BSP with labels and marks. c The original gel image of ALP. d The original gel image of ALP with labels and marks. PDLSCS: periodontal ligament stem cell sheet; JBMMSCS: jaw bone marrow-derived mesenchymal stem cell sheet; CSCS: composite stem cell sheet; Yellow arrows: the blots displayed in fig.3c (BSP and ALP)."}
{"text": "The correct name is: Simon Traub. The correct citation is: Traub S, Pianykh OS (2022) An alternative to the black box: Strategy learning. PLoS ONE 17(3): e0264485."}
{"text": "Following publication of the original article , the autThe incorrect heading is: Transmittance electron microscopyThe correct heading is: Transmission electron microscopyThe incorrect name of the electron microscope is: Zeiss EM900The correct name of the electron microscope is: EM-10, Zeiss, GermanyThe original article  has been"}
{"text": "Analysis of broad-spectrum antibiotic use in pneumonia revealed that 60% of patients were overtreated, highlighting the need for effective antibiotic stewardship practices.Systems such as the Drug Resistance in Pneumonia (DRIP) score select patients who are more likely to need broad spectrum antibiotics but still leads to overtreatment as it does not target specific pathogens. Rapid diagnostics such as the Unyvero Lower Respiratory Tract Panel (LRTP) can identify specific pathogens to narrow antibiotic use even further when combined with the DRIP score.max and DRIPmin were calculated assuming all missing elements were positive or negative respectively. The sensitivity and specificity of the DRIP score vs culture and LRTP were determined. An algorithm for antibiotic selection based on the results of the DRIP score combined with the LRTP was applied to each patient  .Using an existing patient pool from a clinical trial of the LRTP (NCT01922024) a DRIP score was determined for each patient. When data elements of the DRIP score were unavailable a DRIPStenotrophomonas maltophilia Applying the algorithm to each patient based on the DRIP score and the LRTP improved antibiotic choices by reducing broad spectrum antibiotic and by more selectively targeting the identified pathogens earlier and eliminating use of multiple empiric antibiotics.The sensitivity of the DRIP score vs culture in this population was 91.2% and the specificity was 65.1%. DRIP score vs culture + LRTP combined had a sensitivity of 86.6% and a specificity of 66.3%., the lower sensitivity was mainly due to Using an antibiotic stewardship algorithm combining DRIP score with LRTP rapid diagnostic data, which results in 5 hours, can lead to improved prediction of the presence of drug resistant pathogens and aid in narrowing antibiotics. The LRTP compensates for the DRIP score only predicting presence of antibiotic resistant pathogens, not specific pathogens. The DRIP score can compensate for the LRTP only having limited antibiotic resistance markers on panel and not supplying phenotypic antibiotic resistance testing. Further study using a prospectively collected cohort with antibiotic adjustment in real time is needed for validation of our results.Matthew Sims, MD PhD, Astra Zeneca: Grant/Research Support|ContraFect: Grant/Research Support|Crestone: Grant/Research Support|Diasorin Molecular LLC: Grant/Research Support|Epigenomics Inc: Grant/Research Support|EUROIMMUN US: Grant/Research Support|Finch Theraputics: Grant/Research Support|Genentech USA Inc: Grant/Research Support|Janssen Research and Development LLC: Grant/Research Support|Kinevant Sciences GmBH: Grant/Research Support|Leonard-Meron Biosciences: Grant/Research Support|Lysovant: Grant/Research Support|Merck: Grant/Research Support|OpGen: Grant/Research Support|Prenosis: Advisor/Consultant|Prenosis: Grant/Research Support|Qiagen: Grant/Research Support|Regeneron Pharmaceuticals: Grant/Research Support|Seres Therapeutics Inc: Grant/Research Support|Shire: Grant/Research Support|Summit Therapeutics: Grant/Research Support."}
{"text": "Following publication of the original article , the autsection.The corrected Author contributions should read:The idea and design of project: MA; designed the experiments: HST, FF, PM; performed the experiments: HST; Analyzed data: HST, FF, PM; Wrote the paper: HST; Comprehensive reading and editing of the manuscript: MA, FF, PM.The authors affiliation has been updated above and the original article  has been"}
{"text": "This series lists a pictorial quiz pertaining to identification of normal and abnormal anatomical structures and landmarks at a given level on computed tomography (CT). Readers are expected to identify and appreciate the changes from normal anatomy and variations of a given pathology. It is anticipated that this series will enhance the understanding of sectional anatomy of the brain to aid in brain CT interpretation. AnswersA: Frontal (anterior) horn of left lateral ventricleB Septum pellucidumC: Right lentiform nucleusD: Head of left caudate nucleusE: Right thalamusF: Posterior limb of the left internal capsule G: Occipital (posterior) horn of the left lateral ventricleH: Splenium of corpus callosum  The image is at the level of level of the basal ganglia which is group of paired deep grey matter nuclei including caudate and lentiform nucleus. Thin linear high density seen in the occipital horns of the lateral ventricles is due to calcification of the choroid plexus. Acute subdural hematoma characteristically appears as a crescent shaped high density area.Sub-acute subdural hematoma can be isodense to the normal brain parenchyma makings its detection difficult on CT. Chronic subdural hematoma is lower in density compared to the brain parenchyma.rd Ed. New York: Elsevier Health Sciences; 2011.1. Ryan S, McNicholas M, Eustace SJ. Anatomy for diagnostic imaging e-book. 32. Currie S, Kennish S, Flood K. Essential Radiological Anatomy for the MRCS. Cambridge University Press. 2009.3. Moeller T, Reif E. Pocket atlas of sectional anatomy. Computed tomography and magnetic resonance imaging. Vol. 1 Head and neck. Stuttgart: Thieme; 2013."}
{"text": "Due to a publishing error the article: \u201cPreemptive analgesia with ibuprofen increases anesthetic efficacy in children with severe molar: a triple blind randomized clinical trial\u201d, published at Journal of Applied Oral Science 2022;30:e20210538 was printed with the following error:Where it reads:Title: Preemptive analgesia with ibuprofen increases anesthetic efficacy in children with severe molar: a triple blind randomized clinical trialThe sentence should read:Title: Preemptive analgesia with ibuprofen increases anesthetic efficacy in children with severe molar hypomineralization: a triple-blind randomized clinical trial"}
{"text": "The Sharr Mountains are one of the most important hotspots of terrestrial and freshwater biodiversity in the Balkan Peninsula, with many endemic and rare species. The caddisfly studies in this area increased during the past years, although insufficiently investigated areas still remain.Potamophylaxhumoinsapiens sp. n. from the Sharr Mountains in the Republic of Kosovo, which is morphologically closest to Potamophylaxidliri Ibrahimi, Bilalli & Ku\u010dini\u0107, 2022 and Potamophylaxjuliani Kumanski, 1999. The males of the new species differ from all known species of the Potamophylaxwinneguthi Species Group by their uniquely-shaped parameres, which are long, bulbous in their basal half and thin in the remaining length, with a bunch of very thin and long, hair-like spines, grouped uniformly at the apex. The new species further differs from its most similar congeners by its very wide distance between the dorsal and ventral edges of the apical part of inferior appendages in lateral view. The new species was found at three localities from 1416 to 1505 m a.s.l.In this paper, we describe a new species, Potamophylaxwinneguthi Species Group, which have very narrow distribution areas, we posit that Potamophylaxhumoinsapiens sp. n. is a microendemic of the Sharr Mountains. The new species is the second known caddisfly species occurring only in the Kosovan part of the Sharr Mountains.Similar to the other species of the  The knowledge about the caddisflies of Kosovo has increased significantly over the past decade. Only few species were known before 2011 e.g.  and the The Sharr Mountains are one of the most important hotspots of freshwater and terrestrial biodiversity in the Balkan Peninsula, with many endemic and rare plant and animal species e.g. . This moPotamophylaxwinneguthi Species Group from the Sharr Mountains in Kosovo and also discuss morphological, molecular and ecological features of the Potamophylaxwinneguthi Species Cluster.In this paper, we describe a new species of the Fieldwork, identification and taxonomic work. We collected adults of the new species with ultraviolet light traps. Nocturnal light trapping followed Potamophylaxhumoinsapiens sp. n., we used specimens of Potamophylaxjuliani Kumanski, 1999, Potamophylaxwinneguthi Malicky, 1999  and Morphological characteristics of male terminalia of the new species were examined in specimens cleared in 10% potassium hydroxide (KOH). Nomenclature of male terminalia follows Potamophylaxhumoinsapiens sp. n. were analysed from 12 male specimens by using the Olympus SZX16 stereomicroscope. Illustrations were prepared in Adobe Illustrator (version Creative Cloud 2018) by digitising pencil templates drawn in the pictures taken with Olympus SC50 camera.Morphological features of genitalia of Specimens of the new species were collected at three localities in the Sharr Mountains, belonging to the Sht\u00ebrpce and Prizren Municipalities Fig. Ibrahimi & Bilallisp. n.721160E4-BE2A-5F10-A8A4-8B4BA1A0840895A49795-937A-419F-BA72-A85AD2C1C98EType status:Holotype. Occurrence: recordedBy: Halil Ibrahimi, Astrit Bilalli; individualCount: 1; sex: male; lifeStage: adult; occurrenceID: 6E91A186-F8FF-5E67-A55C-F4BF514BD704; Taxon: class: Insecta; order: Trichoptera; family: Limnephilidae; genus: Potamophylax; nomenclaturalCode: ICZN; Location: continent: Europe; waterBody: Aegean Sea Basin; country: Kosovo; countryCode: XKS; municipality: Sht\u00ebrpce; locality: main road towards Prevall\u00eb; verbatimLocality: sidestream of the Lepenc River; verbatimElevation: 1416; decimalLatitude: 42.172804; decimalLongitude: 20.969464; Event: samplingProtocol: UV light trap; year: 2021; month: 11; day: 12Type status:Paratype. Occurrence: recordedBy: Halil Ibrahimi, Astrit Bilalli; individualCount: 12; sex: males; lifeStage: adults; occurrenceID: 89E22BF4-8039-5F0B-A92B-6620CF80DFB8; Taxon: class: Insecta; order: Trichoptera; family: Limnephilidae; genus: Potamophylax; nomenclaturalCode: ICZN; Location: continent: Europe; waterBody: Aegean Sea Basin; country: Kosovo; countryCode: XKS; municipality: Sht\u00ebrpce; locality: main road towards Prevall\u00eb; verbatimLocality: sidestream of the Lepenc River; verbatimElevation: 1416; decimalLatitude: 42.172804; decimalLongitude: 20.969464; Event: samplingProtocol: UV light trap; year: 2021; month: 11; day: 12Type status:Paratype. Occurrence: recordedBy: Halil Ibrahimi, Astrit Bilalli; individualCount: 20; sex: males; lifeStage: adults; occurrenceID: 97FDA7E5-5061-50AA-9C21-CE0ADE296551; Taxon: class: Insecta; order: Trichoptera; family: Limnephilidae; genus: Potamophylax; nomenclaturalCode: ICZN; Location: continent: Europe; waterBody: Aegean Sea Basin; country: Kosovo; countryCode: XKS; municipality: Sht\u00ebrpce; locality: 2 km away from the main road Sht\u00ebrpce - Prevall\u00eb; verbatimLocality: Lepenc River; verbatimElevation: 1505; decimalLatitude: 42.176299; decimalLongitude: 20.984170; Event: samplingProtocol: UV light trap; year: 2021; month: 11; day: 20Type status:Paratype. Occurrence: recordedBy: Halil Ibrahimi, Astrit Bilalli; individualCount: 7; sex: males; lifeStage: adults; occurrenceID: 68CC6836-CFAE-5D3A-8226-FA10865B105E; Taxon: class: Insecta; order: Trichoptera; family: Limnephilidae; genus: Potamophylax; nomenclaturalCode: ICZN; Location: continent: Europe; waterBody: Aegean Sea Basin; country: Kosovo; countryCode: XKS; municipality: Sht\u00ebrpce; locality: few kilometers before Brezovica ski center; verbatimLocality: tributary of the Lepenc River; verbatimElevation: 1457; decimalLatitude: 42.185053; decimalLongitude: 21.006089; Event: samplingProtocol: UV light trap; year: 2021; month: 11; day: 12Male. General appearance  in lateral view very long paramere shaft, bulbous in basal half, thin in the remaining length; (2) median ventral incision on paramere shaft in lateral view; (3) parallel set-up of the basal 2/3rd of parameres on ventral view, with distal thirds diverging greatly from each other; (4) 30-40 very thin and long apical hair-like spines on parameres, grouped uniformly, curved and directed mesad in lateral view, almost reaching apex of the aedeagus in ventral view; (5) very wide distance between the dorsal and ventral corners of the apical part of inferior appendages, 2.1 times wider than in P.coronavirus, 1.4 times wider than in P.idliri and 1.2 times wider than in P.juliani; and (6) longer ventral edge of inferior appendages. The P.idliri male has long shaft of parameres, very narrow mesally, wide apically on lateral view; ventral incision on paramere shaft is located right after the basal third on lateral view; parallel set-up of the basal 1/3rd of parameres, with the remaining length gradually diverging from each other on ventral view; 10-15 medium long and very thick apical spines of different sizes on parameres, grouped irregularly, directed mesad; longer ventral edge of inferior appendages on lateral view. The P.juliani male has a short shaft of parameres with wider basal half on lateral view without any incision; parallel set-up of parameres, only with apices diverging from each other on ventral view; medium long 5-10 medium thick apical spines on parameres; ventral and dorsal corners of inferior appendages parallel to each other, directed mesad on lateral view. The P.coronavirus male has a short shaft of parameres, slightly wider on basal half on lateral view; ventral margin of paramere shaft straight, without any incision on lateral view; parallel set-up of parameres, only with apices diverging from each other, on ventral view; short, thick 5-10 apical spines on parameres; ventral and dorsal corners of inferior appendages parallel to each other, directed mesad on lateral view.Males of the new species are most similar to those of ies Figs , 8. The The species epithet is a combination of two Latin words, \u2018humo\u2019, which in English means \u2018to cover with soil, to bury\u2019 and \u2018insapiens\u2019 meaning \u2018unwise\u2019 and refers to the unwise and careless treatment of habitats of the new species, degraded greatly during the past years by hydropower plants and other activities. In some segments, the whole parts of the Lepenc River are \u2018buried\u2019 in large pipes.Potamophylaxhumoinsapiens sp. n. was found at three localities during 2021 in the Sharr Mountains, in the tributaries of the Lepenc River. All sampling sites are located inside a forested area. The substrates of streams close to the sampling sites were dominated by meso- to macrolithal substrate, surrounded by dense riparian vegetation. The species was captured only by ultraviolet light traps. The species was collected during October and November, implying it has an autumn flying period. All sampling sites are located in upstream sections of streams and rivers.Potamophylaxhumoinsapiens sp. n. have been found during 2009 in tributaries of the Lepenc and Lumbardhi i Prizrenit Rivers. The genetic distinction, calculated based on sequencing of the barcode region of the cytochrome c oxidase subunit I gene (COI) between Potamophylaxhumoinsapiens sp. n. and other species of the Potamophylaxwinneguthi Species Group, was found to be on par with those of the other morphologically recognised species in the group and especially the other five species of the P.winneguthi Species Cluster (Potamophylaxhumoinsapiens sp. n. is Potamophylaxidliri from the Jastrebac Mountains in Serbia, with the p-distance of 4%. However, due to the low number of specimens, we refrained from describing it as a new species at that time. During 2021, we collected a large number of male specimens and, based on a large scale analysis of more than 40 male specimens, we realised that the differences in paramere shape, spine pattern, inferior appendages and other characters are stable and easily distinguishable from all other species of this Species Group.Two male specimens of  Cluster . These mPotamophylaxwinneguthi Species Cluster contains six species, all of them confined to certain mountains of the Balkan Peninsula. Species of this cluster have diversified in several characters of the male terminalia, the most visible being paramere shaft shape and size, paramere spine pattern and length and inferior appendages shape. Paramere shaft varies in length, width of basal and apical parts, as well as the curvature. Paramere spine pattern is especially diverse in this species complex. Spines vary from being very thick in P.winneguthi, medium thick in P.juliani, P.idliri and P.coronavirus and very thin and hair-like in P.humoinsapiens sp. n. Length of paramere spines varies from very short as 1/5th of the total paramere shaft lengh in P.juliani and P.coronavirus, as 1/3rd of paramere shaft in P.idliri, as half of paramere shaft in P.humoinsapiens sp. n. and as long as paramere shaft in P.winneguthi. In P.haidukorum Malicky, 1999 spines are lacking completely and paramere shaft is long and slender. The level of divergence in the female terminalia remains to be studied, as currently only females of P.juliani, P.winneguthi and P.haidukorum are described (Currently the escribed .Potamophylaxwinneguthi Species Group are all found at isolated habitats at different mountain ranges of the Balkan Peninsula, usually at upstream segments of streams and rivers. These habitats have deteriorated heavily during the past decades by illegal logging, pollution and water extraction. Considering the fact that all species of this cluster up to now are known to be microscale endemics of certain mountain ranges, we posit that other new species will be found in the Balkans in future.Species of the Potamophylaxhumoinsapiens sp. n. is the second known endemic caddisfly species occurring only in the Kosovan part of the Sharr Mountains, the first one being Drusussharrensis Ibrahimi, Ku\u010dini\u0107 & Vitecek, 2015. This part of the Sharr Mountains represents the spring and upstream area of two rivers, namely Lepenc and Lumbardhi i Prizrenit. During the past decade, both rivers have deteriorated heavily, primarily by construction of dams and hydropower plants, illegal logging and pollution. Some of these activities occur in the very vicinity of the freshwater ecosystems where the new species is found. During the sampling of 2021, the new species was not found at one of the localities where it was sampled during 2009. Although large areas of upstream segments of both rivers are within the borders of the protected area, more law enforcement activities in the field are needed in order to protect unique freshwater diversity of this part of the Sharr Mountains, including the newly-described species Potamophylaxhumoinsapiens sp. n."}
{"text": "Abstract: ; Results: 9678 participants .There were some errors in the original publication in the Abstract and Results sections . AbstracAbstract, line 6: ; Results, Paragraph 1, line 1: 9775 participants .A correction has been made to The authors state that the scientific conclusions are unaffected. This correction was approved by the Academic Editor. The original publication has also been updated."}
{"text": "The Department of Acute Kidney Injury (IRA) of the Brazilian Society of Nephrology prepared this document for the purpose of standardizing AKI terminology and dialysis modalities in the Portuguese language for Brazil. Several terms with similar meanings have been used in AKI and its dialysis modalities, causing confusion and disparities among patients, nephrologists, health institutions, private care companies, insurance companies and government entities. These disparities can impact medical care, hospital organization and care, as well as the funding and reimbursement of AKI-related procedures. Thus, consensual nomenclature and definitions were developed, including the definitions of AKI, acute kidney disease (AKD) and chronic kidney disease (CKD). Additionally, we addressed all dialysis modalities and extracorporeal procedures related to AKI, currently approved and available in the country. The Brazilian Society of Nephrology hopes that this Consensus can standardize the terminology and provide technical support to all involved in AKI care in Brazil. Acute kidney injury (AKI) is a frequent complication in hospitalized patients, especially in ICUs, still causing high rates of morbidity and mortality. AKI can also occur in outpatients and in the community, often related to socioeconomic and cultural conditions. Several terms with similar meanings have been used in AKI and its dialysis modalities, causing confusion and disparities among patients, nephrologists, healthcare institutions, private care companies, insurance companies and government entities. These disparities can impact medical care, hospital organization and care, as well as the funding and reimbursement of AKI-related procedures. Thus, we worked on the terminology and consensual definitions, including the definitions of AKI, acute kidney disease (AKD) and chronic kidney disease (CKD). Additionally, all dialysis modalities and extracorporeal procedures related to AKI, currently approved and available in the country, were addressed in this document by the AKI Department of the Brazilian Society of Nephrology.. An additional advantage of using the term \u201cinjury\u201d is that it encompasses initial cases with cellular and tissue functional alterations to cases of established anatomical lesions. Therefore, it is suggested to avoid the term acute kidney lesion (AKL), which would be restricted to cases of anatomic kidney lesion.Preferably, use the term Acute Kidney Injury, in order to maintain the acronym AKI, which is well established and widespread in our country. In addition, the term was also approved in the Ibero-American Consensus on the Uniformity of Nomenclatures, observing the deliberations proposed by the Kidney Disease: Improving Global Outcomes (KDIGO) panelWe must also avoid the term \u201cfailure\u201d, as it denotes a more advanced stage of renal failure.2 or when dialysis is required .- Single-pass albumin dialysis. Single-pass albumin dialysis (SPAD).- Hemoperfusion to remove bilirubin and bile salts (uses the same system as hemoperfusion to remove medium molecules).Note: Therapeutic plasma exchange may be considered as artificial liver support.2). Extracorporeal CO2 removal (ECCO2R).- Extracorporeal removal of carbon dioxide  and high partition (high cutoff).- Dialysis solution: polyelectrolytic concentrate for hemodialysis.- Anticoagulation: heparin (unfractionated or low molecular weight), citrate or without anticoagulation.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis or in intensive and semi-intensive care units.- Duration: up to 6 hours.- Technique: hemofiltration.- Removal mechanism: convection.- Equipment: hemodialysis machine and machines capable of performing ultrafiltration alone.- Device: membrane filters with biocompatible polymer.- Filter type: low flow, high flow, medium partition (medium cutoff) and high partition (high cutoff).- Dialysis solution: not applicable.- Anticoagulation: heparin (unfractionated or low molecular weight), citrate or without anticoagulation.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis or in intensive and semi-intensive care units.- Duration: up to 6 hours.- Technique: hemodialysis and hemofiltration.- Removal mechanism: diffusion and convection.- Equipment: hemodialysis machine with module for hemodiafiltration.- Device: membrane filters with biocompatible polymer.- Filter type: high flow.- Dialysis and replacement solution: polyelectrolytic concentrate for hemodialysis.- Anticoagulation: heparin (unfractionated or low molecular weight), citrate or without anticoagulation.- Place of treatment: preferably in individualized rooms, hemodialysis rooms or in intensive and semi-intensive care units, with ultrapure water criteria.- Duration: 6 to 12 hours.- Technique: hemodialysis.- Removal mechanism: diffusion.- Equipment: hemodialysis machine.- Device: membrane filters with biocompatible polymer.- Filter type: low flow, high flow, medium partition (medium cutoff) and high partition (high cutoff).- Dialysis solution: polyelectrolytic concentrate for hemodialysis.- Anticoagulation: heparin (unfractionated or low molecular weight), citrate or without anticoagulation.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis or in intensive and semi-intensive care units.- Duration: 6 to 12 hours.- Technique: hemofiltration.- Removal mechanism: convection.- Equipment: hemodialysis machine and machines capable of performing ultrafiltration alone.- Device: membrane filters with biocompatible polymer.- Filter type: low flow, high flow, medium partition (medium cutoff) and high partition (high cutoff).- Dialysis solution: not applicable.- Anticoagulation: heparin (unfractionated or low molecular weight), citrate or without anticoagulation.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis or in intensive and semi-intensive care units.- Duration: 6 to 12 hours.- Technique: hemodialysis and hemofiltration.- Removal mechanism: diffusion and convection.- Equipment: hemodialysis machine with module for hemodiafiltration.- Device: membrane filters with biocompatible polymer.- Filter type: high flow.- Dialysis and replacement solution: polyelectrolytic concentrate for hemodialysis.- Anticoagulation: heparin (unfractionated or low molecular weight), citrate or without anticoagulation.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis or in an intensive and semi-intensive care unit, with ultrapure water.- Duration: > 12 hours.- Technique: hemodialysis, hemofiltration or hemodiafiltration.- Removal mechanism: diffusion, convection and adsorption.- Equipment: continuous hemodiafiltration machine with autonomy for uninterrupted operation for more than 24 hours.- Device: membrane filters with biocompatible polymer.- Filter type: high flow and high partition (high cutoff).- Dialysis and replacement solution: specific electrolyte solutions for continuous hemodiafiltration.- Anticoagulation: heparin (unfractionated or low molecular weight), citrate or without anticoagulation.- Place of treatment: intensive and semi-intensive care units and surgical center.- Duration: > 12 hours.- Technique: hemofiltration.- Removal mechanism: convection.- Equipment: continuous hemodialysis machines and specific equipment for isolated ultrafiltration, with autonomy for uninterrupted operation of more than 24 hours.- Device: membrane filters with biocompatible polymer.- Filter type: low or high flow.- Dialysis and replacement solution: not applicable.- Anticoagulation: heparin (unfractionated or low molecular weight), or without anticoagulation.- Place of treatment: intensive and semi-intensive care units and surgical center.- Duration: up to 12 hours.- Volume: up to 12 L.- Technique: peritoneal dialysis.- Removal mechanism: diffusion.- Equipment: not applicable.- Solutions: hypertonic glucose or icodextrin.- Anticoagulation: not applicable.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis or in intensive and semi-intensive care units.- Duration: > 12 hours.- Standard volume: up to 12 L.- Technique: peritoneal dialysis.- Removal mechanism: diffusion.- Equipment: not applicable.- Anticoagulation: not applicable.- Solutions: hypertonic glucose, icodextrin.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis or in intensive and semi-intensive care units.- Duration: up to 12 hours.- Standard volume: up to 12 L.- Technique: peritoneal dialysis.- Removal mechanism: diffusion.- Equipment: cycling machine.- Solutions: hypertonic glucose or icodextrin.- Anticoagulation: not applicable.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis or in intensive and semi-intensive care units.Note: the term \u201cautomated\u201d implies the need for a specific machine for this therapy.- Duration: > 12 hours.- Standard volume: up to 12 L.- Technique: peritoneal dialysis.- Removal mechanism: diffusion.- Equipment: cycling machine.- Solutions: hypertonic glucose.- Anticoagulation: not applicable.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis or in intensive and semi-intensive care units.- Duration: > 12 hours.- Standard volume: > 12 L up to 42 L.- Technique: peritoneal dialysis.- Removal mechanism: diffusion.- Equipment: cycling machine.- Solutions: hypertonic glucose.- Anticoagulation: not applicable.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis or in intensive and semi-intensive care units.- Duration: 2-6 hours.- Technique: hemofiltration.- Removal mechanism: convection limited by the size of the molecule.- Equipment: hemodialysis or continuous hemodiafiltration machine with plasmapheresis module.- Device: membrane filters with biocompatible polymer.- Filter type: plasma filter.- Replacement solution: solution with human albumin, fresh frozen plasma or cryoprecipitate.- Anticoagulation: heparin (unfractionated or low molecular weight), citrate or without anticoagulation.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis or in intensive and semi-intensive care units.- Duration: 2-6 hours.- Technique: centrifugation.- Removal mechanism: sedimentation by specific gravity.- Equipment: centrifuge machine.- Device: not applicable.- Filter type: not applicable.- Replacement solution: solution with human albumin, fresh frozen plasma or cryoprecipitate.- Anticoagulation: heparin (unfractionated or low molecular weight), citrate or without anticoagulation.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis or in intensive and semi-intensive care units.- Duration: 2-24 hours.- Technique: hemoperfusion.- Removal mechanism: adsorption.- Equipment: hemodialysis machines, continuous procedure machines or specific machines for hemoperfusion, or cartridges connected to the extracorporeal circulation circuit or to the extracorporeal membrane oxygenation (ECMO) circuit, in these situations without the need for specific equipment.- Device: cartridges with resins or microspheres.- Filter type: not applicable.- Dialysis and replacement solution:- In case of use of a specific machine for hemoperfusion: not applicable.- If using a hemodialysis or hemofiltration machine: specific electrolyte solutions.- In case of use of continuous hemodiafiltration machine: specific electrolyte solutions for continuous hemodiafiltration.- Anticoagulation: heparin (unfractionated or low molecular weight), citrate or without anticoagulation.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis, intensive care unit, semi-intensive care unit and surgical center.- Duration: 2-4 hours.- Technique: hemoperfusion.- Removal mechanism: adsorption.- Equipment: specific machine for hemoperfusion, hemodialysis machine or continuous hemodiafiltration connected in series with the pre- or post-filter extracorporeal circuit.- Device: cartridge with synthetic resins with specific adsorptive capacity.- Filter type: not applicable.- Dialysis and replacement solution:- In case of use of a specific machine for hemoperfusion: not applicable.- If using a hemodialysis or hemofiltration machine: specific electrolyte solutions.- In case of use of continuous hemodiafiltration machine: specific electrolyte solutions for continuous hemodiafiltration.- Anticoagulation: heparin (unfractionated or low molecular weight), citrate or without anticoagulation.- Place of treatment: intensive and semi-intensive care unit.- Duration: 6-8 hours.- Technique: hemodialysis and perfusion for regeneration of the albumin solution.- Removal mechanism: diffusion and adsorption by albumin.- Equipment: specific machine coupled to a continuous hemodiafiltration or hemodialysis machine.- Device: membrane filters with biocompatible polymer, with parallel circuit of activated carbon cartridge and ion exchanger cartridge, for recirculation of solution with albumin.- Type of filter: low flow  and high flow .- Dialysis and replacement solution: specific electrolyte solutions for continuous hemodiafiltration. Human albumin solution for the parallel circuit.- Anticoagulation: heparin (unfractionated or low molecular weight), citrate or without anticoagulation.- Place of treatment: intensive and semi-intensive care unit.- Duration: 6-8 hours.- Technique: hemodialysis.- Removal mechanism: diffusion.- Equipment: continuous hemodiafiltration machine with autonomy for uninterrupted operation for more than 24 hours.- Device: membrane filters with biocompatible polymer.- Filter type: high flow and high partition (high cutoff).- Dialysis solution: specific electrolyte solutions for continuous hemodiafiltration with the addition of human albumin.- Anticoagulation: heparin (unfractionated or low molecular weight), citrate or without anticoagulation.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis or in intensive and semi-intensive care units.- Duration: 2-24 hours.- Technique: hemoperfusion.- Removal mechanism: adsorption.- Equipment: hemodialysis machines, continuous procedure machines or specific machines for hemoperfusion, or cartridges connected to the extracorporeal circulation circuit or to the extracorporeal blood oxygenation (ECMO) circuit, in these situations without the need for specific equipment.- Device: cartridges with resins or microspheres.- Filter type: not applicable.- Dialysis and replacement solution:- In case of use of a specific machine for hemoperfusion: not applicable.- If using a hemodialysis or hemofiltration machine: specific electrolyte solutions.- In case of continuous hemodiafiltration machine use: specific electrolyte solutions for continuous hemodiafiltration.- Anticoagulation: heparin (unfractionated or low molecular weight), citrate or without anticoagulation.- Place of treatment: preferably in individualized rooms, rooms for hemodialysis, intensive care unit, semi-intensive care unit and surgical center.- Duration: >48 h.- Technique: hemodialysis.- Removal mechanism: diffusion of gases.- Equipment: specific machine for hemoperfusion, continuous hemodiafiltration machine coupled to the oxygenating membrane.- Device: oxygenating membrane.- Filter type: not applicable.- Sweep gas: oxygen.- Dialysis and replacement solution:- In case of use of a specific machine for hemoperfusion: not applicable.- In case of use of continuous hemodiafiltration machine: specific electrolyte solutions for continuous hemodiafiltration.- Anticoagulation: heparin (unfractionated or low molecular weight) or without anticoagulation.- Place of treatment: intensive care unit.The AKI Department of the Brazilian Society of Nephrology prepared this document in order to standardize the terminology and definitions related to AKI.Terminology and consensual definitions were addressed, including definitions of AKI, acute kidney disease (AKI) and chronic kidney disease (CKD). All dialysis modalities and extracorporeal procedures related to AKI, currently approved and available in the country, were described. The Brazilian Society of Nephrology hopes that this Consensus can standardize the terminology and provide technical support to all sectors involved in AKI assistance in Brazil."}
{"text": "Glycinemax) is a major source of edible oil and protein. A novel species of the genus Pythium, Pythiumhuanghuaiense, isolated from soybean seedlings in China, is described and illustrated on the basis of morphological characters and molecular evidence.Soybean (Pythiumhuanghuaiense sp. nov. is closely related to species of the genus Pythium in clade F, as evidenced by the presence of hyphal swellings and its relatively rapid morphological growth. However, it differs by having relatively small sporangia and plerotic or nearly plerotic and thin-walled oospores. A pathogenicity test confirmed the newly-identified species as a pathogen of soybean. Pythium Pringsheim are diverse, occupying a variety of habitats , wheat (Triticum spp.) and corn (Zeamays)  . Some Pyic fungi . To datein China .Pythium in the Huang-Huai Valley, a novel species of clade F was identified, based on morphological characters and molecular phylogenetic analyses of internal transcribed spacer (ITS) and cytochrome c oxidase subunit I (Cox1) sequence data. The novel species is described and illustrated in this work. Moreover, comparisons of the novel species with morphologically and phylogenetically related species are also provided.Huang-Huai Valley is one of the main areas of soybean farming in China, covering an enormous area in Shandong, Anhui, Jiangsu and Henan Provinces between the Yellow River and the Haihe River. During the studies on the diversity of During April and August 2016, 60 plants of soybean cultivar 'Hefeng 47' exhibiting seedling blight, damping off and root rot were collected from three fields in the Huang-Huai region of China. 'Hefeng 47' is commonly grown in the Huang-Huai Valley. The fields were located in Jining of Shandong Province, Suzhou of Anhui Province and Nanjing of Jiangsu Province, which are representative geographic locations in the Huang-Huai region. Soybean plants were sampled from fields at approximately 10 m intervals along a 150 m transect laid out in a \u201cW\u201d pattern.Soybean plants were washed three times with sterile water and six sections of 0.5\u20131 cm length were cut from the roots of each plants using a sterile scalpel. One section was taken from the root tip, one from the interface between the hypocotyl and soil and the others at either the middle of the root or a symptomatic area along the length of the root. The sections were blotted dry and embedded in selective V8 juice agar (V8A) containing rifampicin (50 mg/l), ampicillin (50 mg/l) and pentachloronitrobenzene (50 mg/l) and incubated for 2\u20133 days in the dark at 25\u00b0C. When mycelial growth was observed, cultures were purified by transferring a small piece of medium with mycelium at the edge of a colony to fresh medium or by transferring a single hyphal tip on to water agar three times.The cultures studied were deposited in the Herbaria of the Institute of Microbiology, Beijing Forestry University (BJFC), Beijing, China; the College of Plant Protection, Nanjing Agricultural University (NJAU), Nanjing, China; and the College of Landscape Architecture, Jiangsu Vocational College of Agriculture and Forestry (JAFLA), Zhenjiang, China. Purified isolates were examined after incubation for 2\u20133 days at 25\u00b0C on V8A in the dark. Colony patterns of the representative isolate of the novel species were examined after incubation for 3 days at 25\u00b0C on corn meal agar (CMA), potato carrot agar (PCA) and V8A media . IsolateDNA extraction, amplification, sequencing and sequence alignmentA cetyl trimethylammonium bromide (CTAB) rapid plant genome extraction kit  was used to extract total genomic DNA from purified isolates and the polymerase chain reaction (PCR) was performed according to the manufacturer\u2019s instructions . PCR amphttp://purl.org/phylo/treebase; submission ID S24209).Sequences, generated in this study, were aligned with additional sequences downloaded from GenBank Table  using ClPhylogenetic analysesSaprolegniaparasitica Coker were used as outgroups ; language: enType status:Paratype. Occurrence: recordedBy: Jiajia Chen; Taxon: scientificName: Pythiumhuanghuaiense; class: Oomycetes; order: Pythiales; family: Pythiaceae; genus: Pythium; Location: country: China; stateProvince: Jiangsu; locality: Nanjing, Jiangning District, Pengfu Village; Identification: identifiedBy: Jiajia Chen & Xiaobo Zheng; Event: year: 2016; month: 4; day: 1; habitat: Glycinemaxon seedlings of ; Record Level: type: Chen 95  & Chen 96 ; language: enType status:Paratype. Occurrence: recordedBy: Jiajia Chen; Taxon: scientificName: Pythiumhuanghuaiense; class: Oomycetes; order: Pythiales; family: Pythiaceae; genus: Pythium; Location: country: China; stateProvince: Anhui; locality: Suzhou; Identification: identifiedBy: Jiajia Chen & Xiaobo Zheng; Event: year: 2016; month: 7; habitat: Glycinemaxon seedlings of ; Record Level: type: Chen 99 ; language: enType status:Paratype. Occurrence: recordedBy: Jiajia Chen; Taxon: scientificName: Pythiumhuanghuaiense; class: Oomycetes; order: Pythiales; family: Pythiaceae; genus: Pythium; Location: country: China; stateProvince: Shandong; locality: Jining; Identification: identifiedBy: Jiajia Chen & Xiaobo Zheng; Event: year: 2016; month: 8; habitat: Glycinemaxon seedlings of ; Record Level: type: Chen 100 ; language: enType status:Other material. Occurrence: recordedBy: Jiajia Chen; Taxon: scientificName: Pythiumhuanghuaiense; class: Oomycetes; order: Pythiales; family: Pythiaceae; genus: Pythium; Location: country: China; stateProvince: Jiangsu; locality: Nanjing, Jiangning District, Pengfu Village; Identification: identifiedBy: Jiajia Chen & Xiaobo Zheng; Event: year: 2016; month: 4; day: 29; habitat: Glycinemaxon seedlings of ; Record Level: type: JAFLA 94, NJAU-JN11 ; language: enPathogenic on soybean. Colonies submerged, with a cottony pattern on CMA, a rosette pattern on PCA and a cottony pattern on 10% V8A Fig. . CardinaWith reference to the distribution of the species in the Huang-Huai area of China.Pythiumhuanghuaiense can be distinguished morphologically from its closest relatives, including P.mamillatum Meurs, P.paroecandrum Drechsler, P.spiculum B. Paul and P.wuhanense Y.Y. Long, J.G. Wei & L.D. Guo, by its narrower hyphae and relatively higher maximum growth rate. Additional differences between the novel species and other related species are listed in Table Pythium , representing an unknown species of Pythium, were obtained from soybean plant samples collected from three fields in three cities during April and August 2016.Five cultures of Pythiumhuanghuaiense, showed the best phylogenetic matches with species of clade F in Pythium , indicating that they are phylogenetically distinct from other species of clade F in Pythium  significantly stunted and reduced the growth of soybean seedlings compared with uninoculated controls ; mostly monoclinous, sometimes hypogynous antheridia; sub-globose, club-shaped or fist-shaped antheridial cells; and plerotic or nearly plerotic and thin-walled oospores (0.5\u20131.5 \u00b5m).Pythium can be split into 11 clades (A-K), of which clade F is composed of species with either globose, non-proliferating sporangia or globose hyphal swellings (only P.irregulare Buisman develops both) and a fast growth rate  was highly pathogenic on soybean and wheat (Pythium spp. associated with soybean in China, the novel species, P.huanghuaiense, was identified and described in this study on the basis of morphological characteristics and ITS and Cox1 sequence data. Additional pathogenicity tests and studies on the economic impact of P.huanghuaiense on soybean and other crop plants will be conducted in the future.Soybean is a major source of edible oil and protein and plays an important role in the human diet. Many species of  such as . Howevernd wheat . As part"}
{"text": "Publisher Correction to: BMC Biol 9, 44 (2021)https://doi.org/10.1186/s12915-021-00980-yFollowing publication of the original article , the autThe correct tagging of the author name is:Given name: Hye InFamily name: KaThis results in the correct citation information for this author on Pubmed as: Ka HI.The metadata of the original article  has been"}
{"text": "Diptera: Cecidomyiidae) inducing leaf bud galls on MagnoliakobusDC.var.borealis Sarg. (Magnoliaceae) was found in Hokkaido and northern Honshu, Japan.A gall midge species . The species is herein described as Pseudasphondyliasaohimea Matsuda, Elsayed and Tokuda sp. n. The new species is easily distinguishable from its congeners by the number of adult palpal segments and the shape of the male terminalia and larval spatula.Based on its morphology, the species is regarded as an undescribed species of the genus  Pseudasphondylia (Diptera: Cecidomyiidae: Asphondyliini) includes 11 species associated with various plant families (P.elaeocarpi Tokuda and Yukawa on Elaeocarpuszollingeri K.Koch (= E.sylvestrisvar.ellipticus Hara) (Elaeocarpaceae), P.kiritanii Tokuda & Yukawa on Cornuscontroversa Hemsl. ex Prain (Cornaceae), P.matatabi (Yuasa & Kumazawa) on Actinidiapolygama (Siebold et Zucc.) Planch. ex Maxim. (Actinidiaceae), P.neolitseae Yukawa on Neolitseasericea (Blume) Koidz. (Lauraceae), P.rokuharensis Monzen on Viburnumdilatatum Thunb. (Caprifoliaceae) and P.tominagai Elsayed & Tokuda on Eleutherococcusspinosus (L.f.) S.Y.Hu   . They haliaceae) . In addiliaceae)  and otheliaceae) .MagnoliakobusDC.var.borealis Sarg. (Magnoliaceae) in Tomakomai, Hokkaido and Aomori Prefecture, Honshu, Japan. Based on morphological comparison, we concluded that the gall midge is a member of Pseudasphondylia. We describe the species as new to science and discuss the phylogenetic relationships amongst Japanese congeners on the basis of molecular analysis. We also compare its life history strategy with those of the Japanese congeners.In recent years, we found an undescribed species of asphondyliine gall midge that induces leaf bud galls on M.kobusvar.borealis . A 472 bp fragment of the mitochondrial gene cytochrome oxidase subunit I (COI) of the species from leaf galls of M.kobusvar.borealis and P.tominagai was sequenced and aligned following P.elaeocarpi was sequenced using the primer set: COIS (5\u2019\u2013GGA TCA CCT GAT ATA GCA TTC CCA TAT TGG\u20133\u2019) and COIA (5'\u2013CCC GGT AAA ATT AAA ATA TAA ACT TC\u20133\u2019)  . The seqT TC\u20133\u2019)  and depoPseudasphondylia and four species of Asphondylia were downloaded from the GenBank and used as ingroup taxa: P.rokuharensis (LC538357), P.kiritanii (LC538356), P.matatabi (AB085873) (P.neolitseae (AB334237) (Asphondyliatojoi Elsayed and Tokuda (LC373200) (A.aucubae Yukawa & Ohsaki (AB238595) (A.yushimai Yukawa and Uechi (AB194473) (A.sphaera Monzen (AB197945) (Ampelomyiaconicocoricis Elsayed and Tokuda (LC422091) (Gephyrauluszewaili Elsayed and Tokuda (LC270942)  , P.neolB334237) , AsphondC373200) , A.aucuB238595) , A.yushB194473)  and A.sB197945) . GenBankC422091)  and GephC270942) . These sC270942) .Matsuda, Elsayed & Tokudasp. n.34B09DDF-9268-5078-8309-13576CB34083C7679EFB-7E8C-4157-A5AE-C618D2D82B28Type status:Holotype. Occurrence: sex: male; lifeStage: adult; Taxon: order: Diptera; family: Cecidomyiidae; genus: Pseudasphondylia; specificEpithet: saohimea; taxonRank: species; nomenclaturalCode: ICZN; Location: country: Japan; stateProvince: Aomori; locality: Ashizaki, Mutsu City; Event: samplingProtocol: Magnoliakobusvar.borealis (Magnoliaceae) collected on 10.v.2015 by S. Yamauchireared from a leaf bud gall on Type status:Paratype. Occurrence: individualCount: 7; sex: males; lifeStage: adult; Taxon: order: Diptera; family: Cecidomyiidae; genus: Pseudasphondylia; specificEpithet: saohimea; taxonRank: species; nomenclaturalCode: ICZN; Location: country: Japan; stateProvince: Aomori; locality: Ashizaki, Mutsu City; Event: samplingProtocol: Magnoliakobusvar.borealis (Magnoliaceae) collected on 10.v.2015 by S. Yamauchireared from leaf bud galls on Type status:Paratype. Occurrence: individualCount: 8; sex: females; lifeStage: adult; Taxon: order: Diptera; family: Cecidomyiidae; genus: Pseudasphondylia; specificEpithet: saohimea; taxonRank: species; nomenclaturalCode: ICZN; Location: country: Japan; stateProvince: Aomori; locality: Ashizaki, Mutsu City; Event: samplingProtocol: Magnoliakobusvar.borealis (Magnoliaceae) collected on 10.v.2015 by S. Yamauchireared from leaf bud galls on Type status:Paratype. Occurrence: individualCount: 3; lifeStage: mature larvae; Taxon: order: Diptera; family: Cecidomyiidae; genus: Pseudasphondylia; specificEpithet: saohimea; taxonRank: species; nomenclaturalCode: ICZN; Location: country: Japan; stateProvince: Aomori; locality: Ashizaki, Mutsu City; Event: samplingProtocol: collected on 19.v.2019 by S. Yamauchi at the type localityType status:Paratype. Occurrence: individualCount: 4; lifeStage: pupal exuviae; Taxon: order: Diptera; family: Cecidomyiidae; genus: Pseudasphondylia; specificEpithet: saohimea; nomenclaturalCode: ICZN; Location: country: Japan; stateProvince: Aomori; locality: Ashizaki, Mutsu City; Event: samplingProtocol: Magnoliakobusvar.borealis (Magnoliaceae) collected on 10.v.2015 by S. Yamauchireared from a leaf gall on Type status:Paratype. Occurrence: individualCount: 3; sex: females; lifeStage: adult; Taxon: order: Diptera; family: Cecidomyiidae; genus: Pseudasphondylia; specificEpithet: saohimea; taxonRank: species; nomenclaturalCode: ICZN; Location: country: Japan; stateProvince: Hokkaido; locality: Takaoka , Tomakomai City; Event: samplingProtocol: collected on 31.v.2015 by M. LibraType status:Paratype. Occurrence: individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Diptera; family: Cecidomyiidae; genus: Pseudasphondylia; specificEpithet: saohimea; taxonRank: species; nomenclaturalCode: ICZN; Location: country: Japan; stateProvince: Hokkaido; locality: Takaoka , Tomakomai City; Event: samplingProtocol: collected on 31.v.2015 by M. LibraHead .Pseudasphondyliasaohimea is univoltine. Third instars and pupae were found in the galls in mid-May and adults emerged directly from the galls in mid- to late May. All mature galls collected in July were empty, indicating that no individuals had entered long-term diapause. In rearing conditions, adults emerged in the morning and mated around 11:00 h, suggesting that the gall midge is a diurnal species. The adults are supposed to oviposit into host buds. First instars were found in undeveloped bud galls in late September. They possibly overwinter in the undeveloped bud galls and develop to the second and third instars in the following spring.MagnoliakobusDC.var.borealis Sarg. (Magnoliaceae), \u201cKita-kobushi\u201d in Japanese.Pseudasphondyliasaohimea induces hairy leaf bud galls on Magnoliakobusvar.borealis (Magnoliaceae). The galled buds remain closed and indistinguishable in appearance from ungalled buds until the following spring and rapidly grow with bud burst. Mature galls are 2.7\u20136.0 mm in diameter and 5.1\u201313.7 mm in length (n = 45). Galls are multi-chambered and each chamber contains a single gall midge larva.Pseudocatolaccus sp.  from Hokkaido and Aomori, Torymus sp. (Torymidae) from Hokkaido and Eurytoma sp. (Eurytomidae) from Aomori.The following three species of hymenopteran parasitoids were reared from the mature galls: P.neolitseae and four in P.rokuharensis, P.kiritanii and P.tominagai. Although P.matatabi and P.elaeocarpi have three-segmented palpi, they are easily distinguished from the new species by their cerci which are shorter than the hypoproct. The larval spatula of the new species has four lobes of which the outer two are longer than the inner two. However, the larval spatula of P.neolitseae has only two lobes anteriorly and the other species have four lobes of which the inner two are longer than the outer two. In the pupa, five pairs of long abdominal spiracles are present in the new species, while only three pairs are present in P.rokuharensis, P.kiritanii, P.elaeocarpi and P.tominagai and four pairs in P.matatabi. The pupa of P.neolitseae, which has five pairs of abdominal spiracles, is otherwise similar to the new species, but it can be distinguished by dorsal abdominal spines that are markedly shorter than in P.saohimea.The new species is distinguishable from most of its other congeners in Japan by the number of palpal segments: three in the new species, but two in Pseudasphondylia species in P.saohimea will run to couplet 5 that separates P.matatabi and P.elaeocarpi. In order to update the key and include P.saohimea, couplet 5 is amended and a sub-couplet is added as in Table In the key to the males of world Pseudasphondylia species constructed a monophyletic clade relatively supported by 65% bootstrap value. Although P.saohimea constructed a clade with P.rokuharensis, their bootstrap support was lower than 50%. Genetic divergence of P.saohimea and the other Japanese Pseudasphondylia species was high and ranging between 15% to 21% .In the ML tree Fig. , PseudasP.saohimea is distinct from its congeners in Japan, although phylogenetic relationships amongst Pseudasphondylia species were not revealed in the analyses, except for the sister group relationship of P.kiritanii and P.tominagai. Pseudasphondylia was hypothesised to be an ancient clade within the subtribe Asphondyliina  oviposit into axillary overwintering buds of Styraxjaponica Siebold and Zucc. (Styracaceae) and its larvae spend summer, autumn and winter as the first instar in the host buds; then, galls and larvae rapidly grow, coinciding with host bud burst , overwinters as the first instar in inconspicuous overwintering buds, although this species is multivoltine and repeatedly uses axillary buds throughout the year , Procontarinia on Mangifera (Anacardiaceae), Rabdophaga on Salix  and Semudobia on Betula (Betulaceae)  . Pseudases level ."}
{"text": "Specifically, the order of the bar graphs was incorrect: Sigmoidal input; No input; Linear; Quadratic. Instead, the correct order is: No input; Sigmoidal input; Linear; Quadratic. The corrected version of this figure now appears in the paper."}
{"text": "N/A C.iwatai was collected from Yunnan: Baoshan, instead of Yunnan: Menglian Dai; C.kaihuanus was collected from Yunnan: Jinghong, instead of Yunnan: Guangnan county; and C.filippovi was collected from Sichuan: Mount Emei, instead of Sichuan: Emeishan city.It has come to our attention that in the work referenced above, Figure"}
{"text": "Following the publication of the original article , the autThe incorrect author name is: Julia Klensney-Tait.The correct author names is: Julia Klesney-Tait.The original article  has been"}
{"text": "After publication of the original article , the autThe incorrect authors\u2019 names are:Danielle da Costa: given name.da Palacio: family name.Camila Monteiro: given name.Nascimento: family name.The correct authors\u2019 names are:Danielle: given name.da Costa Palacio: family name.Camila: given name.Nascimento Monteiro: family name.The author group has been updated above and the original article  has been"}
{"text": "Following publication of the original article , the autThe incorrect and correct Figure 9 are published in this Correction article. The original article has been updated.Figure 9 before correction: :Corrected Fig."}
{"text": "The correct name is: Agata Sielska. The correct citation is: Sielska A (2021) Determinants of hospital inefficiency. The case of Polish county hospitals. PLoS ONE 16(8): e0256267."}
{"text": "There is an error in the second author\u2019s affiliation. The correct affiliation is: European Commission, Joint Research Centre (JRC), 21027 Ispra (VA), Italy."}
{"text": "The online version has been amended.In this paper by Jasper Tromp and colleagues (BMJ 2021;372:n461, doi:"}
{"text": "Corrigendum to: Drivers of stunting reduction in Peru: a country case study. Am J Clin Nutr 2020;112:816S\u2013829S.In the originally published version of this article, there was an error in the author, Aviva I Rappaport's full name. This has now been corrected online."}
{"text": "The authors wish to correct the Funding statement of their article  to:Wellcome Trust; BBSRC. Funding for open access charge: Institutional award from Wellcome (103857/Z/14/Z) and RCUK (BB/R002851/1).This change does not affect the results, discussion and conclusions presented in the article. The published article has been updated."}
{"text": "In the original article, Mueller et al.  and Muel(A) zebrafish (B) mouse and (C) human brains. Am: amygdala; Ce: cerebellum; Ctx: cortex; Dp: dorsal pallium; Hip: hippocampus; Lp: lateral pallium; Mp: medial pallium; Th: thalmus; Vp: ventral pallium. Zebrafish image in (A) adapted from Mueller et al. (Figure 1. Comparison of homologous regions of the r et al.  and Muelr et al. .The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
{"text": "Micronecta (Micronecta) griseola Horvath, 1899 is a representative of water bugs of the family Corixidae. It is expanding its range eastwards according to our observations in Russia. In the last decade, the species has become more common in Western Siberia.M.griseola from the territory of the Middle Urals (Russia). The distribution of the species and the features of its biology are considered.The article presents the first records of  Corixidae family and two species of the Gerridae family in the Polar Urals is given by A.N. Corixidae are mentioned. In a later work by A.N. Corixidae family for the Orenburg Region and adjacent areas of the middle reaches of the Ural River. In the generalising work of A.N. Corixidae are given for the Urals. However, information on the species of the subfamily Micronectinae Jaczewski, 1924 in all these works is absent. This article presents the first records of Micronecta (Micronecta) griseola Horvath, 1899 from the Middle Urals (Sverdlovsk region).Water bugs of the Urals and Cis-Urals have not been sufficiently studied to date. Information on the finding of two species of the Sirotinina, who worked at the Volga biostation near Saratov. All specimens of Micronecta were determined by her as M.minutissima , according to the European literature existing at that time. These data were repeated in our country by many faunists before the publication of the key to the European part of the USSR , despite the fact that the real M.minutissima was reliably recorded from Russia only in Karelia and the Leningrad Region.In connection with the development of the national economy of the country in the 1920s , the employees of biological stations carried out an intensive study of water bodies and their inhabitants - the fodder base of fish. Extensive material on water bugs from the Volga, Oka, Kama and other water bodies, collected by A.L. Benning  and othethe USSR . The keyountries . A subseountries  showed tM.minutissima from the Southern Urals from the Orenburg Region , with the preparation of male parameres and comparison with the collection.The collection of material in the Middle Urals was done in the eastern part of the Sverdlovsk Region in the spring-summer period of 2020. Small rivers of the Pyshma and Tura River Basins (Ob-Irtysh Basin) were investigated. The material was collected with a hydrobiological net, by catching water near the coast and mowing aquatic vegetation. The determination was made at the Horvath, 189984D76BB6-21E2-56C9-B86F-153896819731Type status:Other material. Occurrence: recordedBy: Vitaly Stolbov; lifeStage: 1 larva of the last instar; Taxon: kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Hemiptera; family: Corixidae; genus: Micronecta; subgenus: Micronecta; specificEpithet: griseola; scientificNameAuthorship: Horvath, 1899; Location: country: Russia; stateProvince: Sverdlovsk region; county: Slobodo-Turinsky district; locality: vicinity of the village Bobrovskoe; verbatimLocality: Bobrovka River, backwater, slow current, silty ground, depth 1 meter; verbatimElevation: 60 m a.s.l.; decimalLatitude: 57.498944; decimalLongitude: 64.148056; Identification: identifiedBy: Elena Kanyukova; Event: eventDate: 28.05.2020; Record Level: basisOfRecord: PreservedSpecimenType status:Other material. Occurrence: recordedBy: Vitaly Stolbov; lifeStage: 2 males, 9 larvae of the last instar; Taxon: kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Hemiptera; family: Corixidae; genus: Micronecta; subgenus: Micronecta; specificEpithet: griseola; scientificNameAuthorship: Horvath, 1899; Location: country: Russia; stateProvince: Sverdlovsk region; county: Irbitsky district; locality: vicinity of the village Chernovskoe; verbatimLocality: Kirga River, depth more than a meter, fast current, sandy-silty soil, stones; verbatimElevation: 60 m a.s.l.; decimalLatitude: 57.609778; decimalLongitude: 63.382833; Identification: identifiedBy: Elena Kanyukova; Event: eventDate: 28.05.2020; Record Level: basisOfRecord: PreservedSpecimenType status:Other material. Occurrence: recordedBy: Vitaly Stolbov; lifeStage: 1 larva of the last instar; Taxon: kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Hemiptera; family: Corixidae; genus: Micronecta; subgenus: Micronecta; specificEpithet: griseola; scientificNameAuthorship: Horvath, 1899; Location: country: Russia; stateProvince: Sverdlovsk region; county: Artyomovsky district; locality: vicinity of the village Antonovo; verbatimLocality: Sparganium sp.Borovaya River, depth 50 cm, fast current, muddy soil with separate stones, thread algae, ; verbatimElevation: 95 m a.s.l.; decimalLatitude: 57.544000; decimalLongitude: 62.361556; Identification: identifiedBy: Elena Kanyukova; Event: eventDate: 28.05.2020; Record Level: basisOfRecord: PreservedSpecimenType status:Other material. Occurrence: recordedBy: Vitaly Stolbov; lifeStage: 1 male, 252 1-2 instar larvae, 2 last instar larvae; Taxon: kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Hemiptera; family: Corixidae; genus: Micronecta; subgenus: Micronecta; specificEpithet: griseola; scientificNameAuthorship: Horvath, 1899; Location: country: Russia; stateProvince: Sverdlovsk region; county: Talitsky district; locality: Pripyshminskie Bory National Park; verbatimLocality: bypass channel of the Urga River, depth 30 cm, clay-sandy soil, fast current; verbatimElevation: 86 m a.s.l.; decimalLatitude: 56.976389; decimalLongitude: 63.681250; Identification: identifiedBy: Elena Kanyukova; Event: eventDate: 30.07.2020; Record Level: basisOfRecord: PreservedSpecimenM.griseola for the first time in the Sverdlovsk Region. Species of the genus Micronecta are the smallest representatives of the Corixidae family, the body length of the species ranges from 1.5 to 2.4 mm . In cold countries, one generation was recorded each summer (According to Wroblewski (1958), h summer . The larh summer .In a previous work , we discM.griseola. The date of collection of imagos and young larvae in the rivers of the Middle Urals on 30 July 2020, makes it possible to think that these adults belong to the second (summer) generation, which, after laying eggs, gives rise to wintering larvae. Although, like many insect species, Micronecta's breeding times are extended during the summer and may overlap.Finds of older larvae and some imagos in the last ten days of May in the Middle Urals make it possible to attribute them to overwintered individuals and to consider this time as the date of the appearance of the first generation of adults of ConclusionM.griseola was recorded in the Novosibirsk Region in 2010. All records from the southwest of Western Siberia in the Tyumen Region were made by authors within several years after 2017. Findings of M.griseola in large numbers in four rivers of the Sverdlovsk Region in 2020 suggest that this species has been actively spreading in recent years over the territory of the West Siberian Plain (Ob-Irtysh Basin).For the first time beyond the Urals, in Western Siberia, M.griseola in different countries have also been published (In Europe, in recent decades, data on new finds of ublished , which iM.griseola is also evidence of the ecological plasticity of the species. Often, the expansion of the ranges of aquatic organisms is associated with human economic activities - unintentional introduction and transformation of water bodies (M.griseola range requires additional research.The expansion of the ranges of a number of species in recent years has been noted in many regions, including Siberia. Often, in the case of terrestrial animal and plant species, this phenomenon is associated with global climate change . The sitr bodies . Identif"}
{"text": "We regret the unprofessional behavior of the authors involved.hongruiyan001@163.com> (new email)Correspondence: Ruihong Yan: <"}
{"text": "Museums and other institutions curating natural history collections (NHCs) are fundamental entities to many scientific disciplines, as they house data and reference material for varied research projects. As such, biological specimens preserved in NHCs represent accessible physical records of the living world's history. They provide useful information regarding the presence and distribution of different taxonomic groups through space and time. Despite the importance of biological museum specimens, their potential to answer scientific questions, pertinent to the necessities of our current historical context, is often under-explored.The currently-known wild bee fauna of Luxembourg comprises 341 registered species distributed amongst 38 different genera. However, specimens stored in the archives of local NHCs represent an untapped resource to update taxonomic lists, including potentially overlooked findings relevant to the development of national conservation strategies.Andrenalagopus , Nomadafurva , Hoplitispapaveris  and Sphecodesmajalis . Additionally, the presence of Nomadasexfasciata , which inexplicably had been omitted by the most current species list, can be re-confirmed. Altogether, our findings increase the number of recorded wild bee species in Luxembourg to 346. Moreover, the results highlight the crucial role of NHCs as repositories of our knowledge of the natural world.We re-investigated the wild bee collection of the Zoology Department of the National Museum of Natural History Luxembourg by using morphotaxonomy and DNA barcoding. The collection revision led to the discovery of four species so far not described for the country:  Natural history museums are important research and educational institutions, with a crucial role in the production and communication of scientific knowledge. Their associated natural history collections (NHCs) document what is known about the world\u2019s bio- and geodiversity, provide resources and reference material for scientific research and outreach and contribute to the very basis of formal educational programmes . ArchiveIn this study, we followed this approach and performed a revision of the wild bee collection material curated at the Zoology Department of the National Museum of Natural History Luxembourg  to produce an updated species checklist of the wild bee fauna of Luxembourg. Additionally, specimens collected in 2019 during the pilot phase of the ongoing \"Atlas of the wild bee fauna of Luxembourg\u201d project were integrated in the analysis to evaluate the presence of potential new findings.Relevant entries of 5,908 wild bee voucher specimens stored in the database of the MNHNL  were downloaded as spreadsheets to evaluate the presence and distribution of Luxembourgish and non-Luxembourgish species in the collection . SpecimeSpreadsheets were manipulated using R version 3.6.2  to identFrom the pilot phase of the wild bee atlas project, 16 specimens were selected for molecular identification via DNA barcoding. The BF2/BR2 primer pair  was usedPotential new species discoveries originating from either the revised museum collection entries or the fieldwork material were inspected with a Keyence VHX-S660E digital microscope, using various morphological keys to evaluate diagnostic traits Table .11409551-665C-5A11-98D1-1B559156557BNomadafurva Common names: Nomade funeste (French), Schw\u00e4rzliche Wespenbiene (German)Type status:Other material. Occurrence: catalogNumber: MNHNL39915; recordedBy: Fernand Feitz; sex: male; lifeStage: adult; Taxon: scientificName: Nomadafurva ; order: Hymenoptera; family: Apidae; genus: Nomada; specificEpithet: furva; taxonRank: species; scientificNameAuthorship: ; vernacularName: Nomade funeste (French), Schw\u00e4rzliche Wespenbiene (German); Location: country: Luxembourg; locality: Remerschen; decimalLatitude: 49.4837; decimalLongitude: 6.3475; Identification: identifiedBy: Andrea Jakubzik; Event: samplingProtocol: Net; eventDate: 16-07-2004; Record Level: institutionCode: MNHNL; basisOfRecord: Preserved SpecimenNomada presenting yellow maculations in the margin of labrum, malar area, apex of clypeus and in front of the eyes  dark coloured yes Fig. a and b. yes Fig. c. The dayes Fig. d. The layes Fig. e and theyes Fig. f.Voucher specimen (MNHNL39915): Adult male. Body length of 4.7 mm.Lasioglossum, with a flight season that extends from the end of April until mid-September \u201d, meaning that there is a lack of scientific information to assess extinction risk 67382451-6A9B-5F81-8BA9-F874E30E9C0FHoplitispapaveris Common names: Osmie du Coquelicot (French), Mohn-Mauerbiene (German).Type status:Other material. Occurrence: catalogNumber: MNHNL21866; recordedBy: Svenja Christian; sex: male; lifeStage: adult; Taxon: scientificName: Hoplitispapaveris ; order: Hymenoptera; family: Megachilidae; genus: Hoplitis; specificEpithet: papaveris; taxonRank: species; scientificNameAuthorship: ; vernacularName: Osmie du Coquelicot (French), Mohn-Mauerbiene (German); Location: country: Luxembourg; locality: Mertert; decimalLatitude: 49.70359; decimalLongitude: 6.48171; Event: samplingProtocol: Caught by hand; eventDate: 04-06-2015; Record Level: institutionCode: MNHNL; basisOfRecord: Preserved SpecimenMale: A medium sized (9-11 mm) mason bee with a black body covered in yellow-brown hair and short antennae Fig. a. TergitVoucher specimen (MNHNL21866): Adult male. Body length of 8.8 mm.Papaverrhoeas) to line the brood cells \u201d (rn (LC)\u201d , but it rn (LC)\u201d .61DAE441-E835-587B-8939-D61C404ED6DCNomadasexfasciata Common names: Nomade six-bandes (French), Langkopf-Wespenbiene (German), Six-banded Nomad Bee (English).Type status:Other material. Occurrence: catalogNumber: MNHNL25076; recordedBy: Fernand Feitz; sex: female; lifeStage: adult; Taxon: scientificName: Nomadasexfasciata ; order: Hymenoptera; family: Apidae; genus: Nomada; specificEpithet: sexfasciata; taxonRank: species; scientificNameAuthorship: ; vernacularName: Nomade six-bandes (French), Langkopf-Wespenbiene (German), Six-banded Nomad Bee (English); Location: country: Luxembourg; locality: Remich; decimalLatitude: 49.5479; decimalLongitude: 6.36037; Identification: identifiedBy: Andrea Jakubzik; Event: samplingProtocol: Net; eventDate: 05-05-2000; Record Level: institutionCode: MNHNL; basisOfRecord: Preserved SpecimenNomada species. Yellow maculations are present in the pronotal lobes, tegula, as two small spots on the scutellum and as large yellow spots on the sides of tergites 1-3, that become bands in tergites 4-5  black and yellow  mm blackVoucher specimen (MNHNL25076): Adult female. Body length of 12 mm.Eucera nests, with a flight season spanning from late April until late July on the European continent (An univoltine species that parasites ontinent .Nomadasexfasciata is classified under the IUCN category \u201cLeast Concern (LC)\u201d (rn (LC)\u201d , but it rn (LC)\u201d .F86547C4-1DF0-5E0D-BFBD-11E2FF45A4DBAndrenalagopus Common names: Andr\u00e8ne deux-cellules (French), Zweizellige Sandbiene (German).Type status:Other material. Occurrence: catalogNumber: MNHNL100056; sex: female; lifeStage: adult; associatedSequences: BOLD: MNHNL162-21; Taxon: scientificName: Andrenalagopus ; order: Hymenoptera; family: Andrenidae; genus: Andrena; specificEpithet: lagopus; taxonRank: species; scientificNameAuthorship: ; vernacularName: Andr\u00e8ne deux-cellules (French), Zweizellige Sandbiene (German); Location: country: Luxembourg; locality: Kehlen; decimalLatitude: 49.671931; decimalLongitude: 6.046718; Identification: identifiedBy: Fernanda Herrera-Mes\u00edas; Event: samplingProtocol: pan trap (passive sampling); eventDate: 20-05-2019; Record Level: institutionCode: MNHNL; basisOfRecord: Preserved SpecimenAndrena : Adult female. Body length of 9.23 mm.Andrenalagopus from France , collected in Alsace and Indre et Loire.The taxonomic annotation is supported by DNA barcoding data. The best percentages of sequence identity were achieved with two specimens of Brassicaceae) for pollen collection \u201d (rn (LC)\u201d  as it isrn (LC)\u201d .A68A4ADA-245F-5A6A-8572-B7C6269E7294Sphecodesmajalis Common names: Sph\u00e9code de mai (French), Kortsnuitbloedbij (Dutch), Mai-Blutbiene (German).Type status:Other material. Occurrence: catalogNumber: MNHNL100057; sex: male; lifeStage: adult; associatedSequences: BOLD: MNHNL163-21; Taxon: scientificName: Sphecodesmajalis ; order: Hymenoptera; family: Halictidae; genus: Sphecodes; specificEpithet: majalis; taxonRank: species; scientificNameAuthorship: ; vernacularName: Sph\u00e9code de mai (French), Kortsnuitbloedbij (Dutch), Mai-Blutbiene (German); Location: country: Luxembourg; locality: Manternach; decimalLatitude: 49.710039; decimalLongitude: 6.430916; Identification: identifiedBy: Fernanda Herrera-Mes\u00edas; Event: samplingProtocol: pan trap (passive sampling); eventDate: 28-04-2019; Record Level: institutionCode: MNHNL; basisOfRecord: Preserved SpecimenSphecodes species (6-8 mm)  Fig. a and b. mm) Fig. c. The himm) Fig. d. The pumm) Fig. e. The gomm) Fig. f.Voucher specimen : Adult male. Body length of 7.19 mm.Sphecodesmajalis from France , collected in Loir et Cher.The taxonomic annotation is supported by DNA barcoding data. A perfect match of genetic sequence similarity was achieved with a specimen of Lasioglossumpallens , its only known host in Europe \u201d (ed (NT)\u201d . Recordsed (NT)\u201d .Andrenidae, Apidae, Colletidae, Halictidae, Megachilidae and Melittidae). Exact sampling sites and detailed information for each museum specimen are available at the Species Observation Database Service of the museum. From the 218 wild bee species listed in the database, 194 were present in previous species checklists, confirming that at least some individuals have been found in Luxembourgish territory. The remaining 24 species did not figure as present in the country in the literature sources consulted. These species were represented in the collection exclusively by individuals collected in other countries, except for five species, whose annotations linked them to at least one voucher specimen from a gathering site placed in modern Luxembourgish territory: Colletesfodiens , Hylaeusstyriacus , Nomadafurva , Nomadasexfasciata  and Hoplitispapaveris . In three of these cases, previous taxonomic annotations of the analysed voucher specimens and our morphological re-examinations were in agreement .The 5,908 wild bee specimens registered in the MNHNL collection were distributed amongst 33 genera from six families  in the collection. The results of the morphological re-evaluation of both specimens were inconclusive. The female specimen (MNHNL41840), which was collected in 1999, lacked the conspicuous white-haired face and those hairs across the dorsal surface of the first tergite that characterise C.fodiens , which was collected in 2013, had the hairs of the sternites glued together and partially covered by sand grains. The genitalia were contracted inside the abdomen, obscuring visualisation of the crucial characters described in the taxonomic keys. As a more conservative approach, we thus do not recognise C.fodiens as a potential new finding for Luxembourg.However, in the remaining two cases, the taxonomic annotations showed conflicting results. In the case of ns sensu . Some au females . HoweverH.styriacus, there were eleven female specimens in the collection. In all cases, the shape of the facial fovea matched the one of Hylaeus from the subgenusParaprosopis  presented the tridentate mandible and pronotum with pointed edges that characterise Hylaeusclypearis . In the rest of the cases evaluated, the characteristics of the specimens matched the description of Hylaeuspictipes : facial lateral yellow spots, punctures on tergites/mesopleura and the overall shape of the head. For the aforementioned reasons, the original annotation and the presence of H.styriacus in Luxembourg remains to be confirmed.In the case of is sensu  to whichAndrenalagopus  and Sphecodesmajalis , respectively. Both species have no previous records in the country, rendering those two entries the first documented findings.Finally, the DNA barcodes of two of the specimens from the pilot phase of the wild bee atlas project had a 100% genetic similarity in BOLD with sequences annotated as Therefore, the morphological and molecular evidence indicates the presence of five wild bee species that are missing in the most current checklists . The fifth species, Nomadasexfasciata, is missing in N.sexfasciata for Luxembourg as well. Moreover, two specimens  were collected in the country in 1997 . It is worth mentioning that the most important morphological traits used to separate species within the subgenusParaprosopis, according to the key of Hylaeus bees (~ 4 mm), distinguishing similar species without such a level of magnification and optical performance might not be straightforward, as it may be hard to observe the most subtle details in the head and face. The importance of this factor as a potential error source in the morphological identification of Hylaeus bees and other wild bees of similar size remains to be determined.In the case of the potential of 2.17% , DNA barAndrenalagopus and Sphecodesmajalis require a special ecological discussion. Both were collected in 2019 during the pilot phase of a wild bee atlas project. In particular, the discovery of the ground nesting bee, A.lagopus, is locally relevant. This species is described as an oligolectic, warm-habitat-loving bee with an Atlanto-Mediterranean distribution , Sinapsisarvensis, Barbareavulgaris and Cardaminepratensis  in Turkey  might be a consequence of the particular relationship this cuckoo bee has with its host. Unlike most other blood bees, which visit different nests and kill or expel their occupants, it has been observed that S.majalis females do not drive away its host, showing no aggressive or defensive behaviour towards L.pallens females  were added to the national checklist of Luxembourg. Additionally, we found evidence that supports the current presence in the country of a fifth species (N.sexfasciata), which was omitted during past inventories. With the addition of these findings, the number of wild bee species registered in Luxembourg has increased to 346. The wild bee collection curated at the National Museum of Natural History Luxembourg is preserved under suitable conditions, which will allow future generations of researchers to use, re-examine and debate it in order to answer scientific questions pertinent to their own historical time. As such, our results represent just a small fraction of the exceptional value that NHCs have as repositories for the documentation of the bio- and geodiversity of the world. Despite this great potential, the current decrease in the available funds to keep and curate NCHs threatens the future of several collections, especially the smaller ones, affecting our possibilities to continue profiting from them in the years to come. Therefore, support from the scientific community and funding bodies is imperative, so biological collections can keep growing, documenting and ultimately, fulfilling their role in society.Our results highlight the importance of NHCs as sources for discoveries and critical re-interpretations of scientific knowledge. In combination with recent fieldwork material, four new wild bee species Data typeSpecies listFile: oo_530987.xlsxhttps://binary.pensoft.net/file/530987Fernanda Herrera-Mes\u00edas, Alexander Weigand71958FD8-B10A-5BD2-A63F-E05C3E4550B210.3897/BDJ.9.e64027.suppl2Supplementary material 2Additional species suggested by the westpalbees database for Luxembourg.Data typetaxonomicFile: oo_532963.xlsxhttps://binary.pensoft.net/file/532963Alexander Weigand, Fernanda Herrera-Mes\u00edas"}
{"text": "We regret the unprofessional behavior of the authors involved.fuyan0059@sina.com>Correspondence: Yan Fu: <"}
{"text": "Arctiini is a species-rich tribe of the subfamily Arctiinae of the family Erebidae. The genus Olepa Watson, 1980 is distributed in the Oriental and Palearctic Regions and the diversity reaches its peak in south Asia.The tribe Olepa from China and re-describe Oleparicini , together with illustrations of its adult and male genitalia. Furthermore, based on an analysis of 658-bp COI barcoding sequences, together with morphological studies, we consider that Olepaschleini Witt et al., 2005 syn. n. is a new synonym of O.ricini.We herein describe the first record of the genus  Olepa was originally established by Alope Walker, 1855  with Alopeocellifera Walker, 1855 as the type species. Oleparicini Fabricius, 1775 species group, restored the specific status of O.ocellifera Walker and O.clavatus Swinhoe and described four new species from southern India and Sri Lanka. Subsequently, Olepa into two species groups, based on differences in male genitalia. Subsequent studies revealed three additional species from western Asia, India and Indochina . Two species, namely O.neumuthi and O.toulgoeti, were treated as the synonyms of O.ricini and O.clavatus, respectively. Recently, Kalawate et al.  solution for examination of male genitalia, photographs of which were taken under a Keyence VHX-5000 digital microscope. Terminology of adult and genitalia follows Olepa as the ingroup and, for the outgroup, we used Trischalisaureoplagiata and Cyclosiellaspiralis (two species of the tribe Lithosiini of the subfamily Arctiinae). We sequenced four specimens from China and the remaining sequences were obtained from GenBank and Bold Systems. DNA was extracted from two or three legs of dried adult specimens using a TIANamp Genomic DNA Kit  following the manufacturer\u2019s instructions. We amplified a single mitochondrial gene (a 658-bp fragment of COI) using the general primers 1490-2198 7F131776-AEE6-57B1-A7C1-524B2EEEE8C9BombyxriciniAlopericini Moore, 1882: 70Pericalliaricini Hampson, 1901, 350Oleparicini Watson, 1980:133Olepa (Ricinia) ricini ; Singh & Singh, 2013:276Olepaneumuthi Orhant, 2012:61, synonymised by Singh & Singh, 2013Olepaschleinisyn. nov. Witt et al., 2005:102 , Type status:Other material. Occurrence: recordedBy: S.Y. Huang; sex: 1 male; lifeStage: adult; occurrenceID: SCAU:Ole02; Taxon: scientificName: Oleparicini ; order: Lepidoptera; family: Erebidae; genus: Olepa; taxonRank: species; taxonomicStatus: accepted; Location: country: China; stateProvince: Guangdong; county: Guangzhou; locality: campus of South China Agricultural University; Event: eventDate: 14-Sep-2021Type status:Other material. Occurrence: recordedBy: S.Y. Huang; sex: 1 male; lifeStage: adult; occurrenceID: SCAU:Ole01; Taxon: scientificName: Oleparicini ; order: Lepidoptera; family: Erebidae; genus: Olepa; taxonRank: species; taxonomicStatus: accepted; Location: country: China; stateProvince: Guangdong; county: Guangzhou; locality: campus of South China Agricultural University; Event: eventDate: 24-Sep-2020Type status:Other material. Occurrence: recordedBy: Y.X Hou; sex: 1 males; lifeStage: adult; occurrenceID: SCAU:Ole03; Taxon: scientificName: Oleparicini ; order: Lepidoptera; family: Erebidae; genus: Olepa; taxonRank: species; taxonomicStatus: accepted; Location: country: China; stateProvince: Guangdong; county: Guangzhou; locality: campus of South China Agricultural University; Event: eventDate: 1-Oct-2021Type status:Other material. Occurrence: recordedBy: L.P. Zhou; sex: 1 males; lifeStage: adult; occurrenceID: SCAU:Ole04; Taxon: scientificName: Oleparicini ; order: Lepidoptera; family: Erebidae; genus: Olepa; taxonRank: species; taxonomicStatus: accepted; Location: country: China; stateProvince: Hainan; locality: Yinggeling Natural Reserve; Event: eventDate: 13-Jul-2020Type status:Other material. Occurrence: recordedBy: P. Qin; sex: 1 male; lifeStage: adult; occurrenceID: SCAU:Ole05; Taxon: scientificName: Oleparicini ; order: Lepidoptera; family: Erebidae; genus: Olepa; taxonRank: species; taxonomicStatus: accepted; Location: country: China; stateProvince: Guangdong; county: Guangzhou; locality: campus of South China Agricultural University; Event: eventDate: 14-Oct-20212; marginal line serrate, extending from apex to vein CuA1. Venation , Thailand, India, Israel.Olepa is morphologically similar to O.schleini and O.ricini. These two species were supposed to be distinguished from each other mainly by the differences in the tip of the valva, i.e. tip rounded in the former and more acute in the latter, together with a great genetic difference in COI sequences (O.ricini (GenBank accession numbers AM050280-AM050284) used by Witt et al. (2005) in GenBank, we found that these sequences are actually closer to those of certain species in the family Geometridae rather than other members of Arctiinae of the family Erebidae. It is very likely that these COI sequences of O.ricini are wrong and are not the true ones of this species. This result can also explain why the genetic difference between O.ricini and O.toulgoeti was also as large as 18.2% to 18.5%, but the difference between O.schleini and O.toulgoeti was only 1.6% to 1.8%, despite the fact that O.schleini and O.ricini are morphologically closer. Based on our analysis, the genetic difference between Chinese Olepa sp. and Israeli O.schleini is 0%, the difference between two true Indian O.ricini (GenBank accession numbers KX371816 and KY559102) and Israeli O.schleini varies from 0.3% to 0.9% and the difference between Chinese Olepa sp. and Indian O.ricini also varies from 0.3% to 0.9%. Considering the fact that the genetic difference between the morphologically dissimilar O.ricini and O.toulgoeti is only 1.6% to 1.8% and the difference found between Indian O.ricini and Israeli O.schleini is smaller than 1%, we believe that all the three populations of O.ricini and O.schleini mentioned above should be regarded as conspecific. As for the difference in wing pattern, according to Orhant (1986), the lectotype of O.ricini housed in the Natural History Museum of Denmark is a female without abdomen  and the holotype of O.schleini is a male deposited in Museum Witt Munich, but the adult of this specimen was not specified in the plates in Witt et al. (2005). By comparing the female lectotype of O.ricini and illustrations of males of this species from various publications with males and females of O.schleini figured in Witt et al. (2005), we found no significant difference between these individuals and, interestingly, the pale rings are mostly reduced in the lectotype of O.ricini, similar to the situation in O.schleini. Hence, we concluded that this character is most probably due to individual variation. Thus, we herein present the following synonym: Olepaschleini Witt et al., 2005 syn. n. = Oleparicini  and the Chinese Olepa sp. should be also identified as O.ricini.The Chinese population of equences . In addi"}
{"text": "In \u201cA Patient Journey Map to Improve the Home Isolation Experience of Persons With Mild COVID-19: Design Research for Service Touchpoints of Artificial Intelligence in eHealth\u201d :e23238) the authors noted one error.In the originally published manuscript, Multimedia Appendix captions incorrectly appeared as follows:Multimedia Appendix 1: Patient journey map of persons with mild COVID-19 during home isolation.Multimedia Appendix 2: Visual summary.Multimedia Appendix 3: Video purpose and comments coding trees.Multimedia Appendix 4: Personal video story coverage and experienced symptoms during home isolation.In the corrected version of the manuscript, Multimedia Appendix captions have been corrected to:Multimedia Appendix 1: Personal video story coverage and experienced symptoms during home isolation.Multimedia Appendix 2: Patient journey map of persons with mild COVID-19 during home isolation.Multimedia Appendix 3: Video purpose and comments coding trees.Multimedia Appendix 4: Visual summary of design research.The correction will appear in the online version of the paper on the JMIR Publications website on May 4, 2021, together with the publication of this correction notice. Because this was made after submission to PubMed, PubMed Central, and other full-text repositories, the corrected article has also been resubmitted to those repositories."}
{"text": "Lycaenidae is the second-largest group of butterflies which contains about one third of the known species of Papilionoidea. The genera Tajuria Moore, [1881] and Drupadia Moore, 1884 are both mainly found in the Oriental and Australian realms. In a very recent expedition to south-west China in Xishuangbanna (Yunnan Province), specimens of T.sekii Saito, 2005 and D.scaeva  were collected for the first time, a new subspecies of the former: T.sekiisisyphus ssp. nov., is described and illustrated and the latter species comprises the first record of the genus Drupadia in China.The family T.sekii Saito, 2005, T.sekiisisyphus ssp. nov., is described and illustrated. The species T.sekii Saito, 2005 and D.scaeva  are first recorded in China and the latter comprises the first record of the genus Drupadia in China. Relevant details are presented for the species.A new subspecies of  Lycaenidae is the second largest family of butterflies, which includes over 6,000 species  were first collected in Yunnan Province and a new subspecies, T.sekiisisyphus ssp. nov., is described and illustrated.In this contribution, specimens of Photographs of the adults were taken by an Olympus E-M1 digital camera with a M. ZUIKO DIGITAL ED 60 mm F2.8 Macro lens. To examine the male genitalia, the abdomen was removed and soaked in 10% potassium hydroxide solution at room temperature for about 24 hours and was dissected under a Nikon SMZ18 stereoscope, following D9D8C9F4-C372-5584-9389-C7C2C4618AC3Type status:Other material. Occurrence: recordedBy: Si-Xun Ge; Zhuo-Heng Jiang; individualCount: 3; sex: 3 males; lifeStage: adult; Taxon: scientificName: Drupadiascaeva ; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Lepidoptera; family: Lycaenidae; genus: Drupadia; specificEpithet: scaeva; taxonRank: species; scientificNameAuthorship: ; Location: country: China; stateProvince: Yunnan Province; county: Mengla Country; locality: Menglun township; maximumElevationInMeters: 800 m a.s.l.; verbatimCoordinates: 21\u00b09629\u2032 N, 101\u00b02073\u2032 E; Identification: identifiedBy: Shao-Ji Hu; dateIdentified: 2021; Event: samplingProtocol: sweep net; year: 2021; month: 4; day: 24; habitat: Rain Forest; Record Level: basisOfRecord: PreservedSpecimenMale cooperi, with the bluish scales in the centre of fore-wings absent and a relatively limited violet area on hind-wings.We tentatively identified specimens collected in this study as ssp. Ge & Jiangn.566CA7A0-CD39-5557-A79A-2406410BBD0669624BFA-969D-44FC-9ED6-CFC6BEB9E2B5Type status:Holotype. Occurrence: recordedBy: Si-Xun Ge; individualCount: 1; sex: male; lifeStage: adult; disposition: in collection; Location: country: China; countryCode: CN; stateProvince: Yunnan; county: Mengla Country; locality: Menglun township; verbatimElevation: 800 m; verbatimCoordinates: 21\u00b09629\u2032 N, 101\u00b02073\u2032 E; Identification: identifiedBy: Si-Xun Ge; dateIdentified: 2021; Event: samplingProtocol: sweep net; year: 2021; month: 4; day: 24; habitat: Rain Forest; Record Level: basisOfRecord: PreservedSpecimenType status:Paratype. Occurrence: recordedBy: Si-Xun Ge; Zhuo-Heng Jiang; individualCount: 4; sex: 4 females; lifeStage: adult; disposition: in collection; Location: country: China; countryCode: CN; stateProvince: Yunnan; county: Mengla Country; locality: Menglun township; verbatimElevation: 800 m; verbatimCoordinates: 21\u00b09629\u2032 N, 101\u00b02073\u2032 E; Identification: identifiedBy: Si-Xun Ge; dateIdentified: 2021; Event: samplingProtocol: sweep net; year: 2021; month: 4; day: 24; habitat: Rain Forest; Record Level: basisOfRecord: PreservedSpecimenMale Fig. : Fore-wiMale genitalia Fig. : Highly Female Fig. : Fore-wiTajuriasekiisisyphus ssp. nov. can be distinguished from the nominotypical subspecies by the combination of the following characteristics: 1) Blue areas of both sexes are more reduced, especially in female, 2) Hindwing with tornal black spot in space 2 on the upperside of females, while absent in nominotypical subspecies and 3) Compared to the nominotypical subspecies, females of the new subspecies with both wings broader and more rounded.The Myth of Sisyphus. The process of scientific research is just like the act of rolling the boulder up the hill. However, the description of each new taxon is exciting enough. \"Each atom of that stone, each mineral flake of that night-filled mountain, in itself forms a world. The struggle itself toward the heights is enough to fill a man's heart. One must imagine Sisyphus happy.\" The subspecies name is treated as a noun in apposition.The subspecies name is derived from the name of a man in Greek mythology, who also appears in sisyphus is only known from China.The nominotypical subspecies can be found in Thailand, Vietnam and Laos, while ssp. China is a country with mega-biodiversity of butterflies, especially the southwest mountainous part . Yunnan D.scaeva had already been taken by nature lovers in Xishuangbanna Prefecture, while there has been no official publication of this species in China. In this expedition, specimens of D.scaeva were collected and it was confirmed that the species is, indeed, present in China.Before this contribution, photos of Tajuria has a high diversity in Oriental and Australian Realms. However, systematic studies on this genus are still very limited, even in recent years; therefore, the definition of some species is still unresolved. We speculate that there should be more species of Tajuria to be found in China.The genus"}
{"text": "We regret the unprofessional behavior of the authors involved.joethomas5725@gmail.com>Correspondence: Wenhao Zhang: <"}
{"text": "Quasipaa is a genus of frogs that belongs to a relatively poorly known group. Most of the species distribution has been recorded in China; however, a few incidences of identification have occurred in the eastern part of Indochina. To date, only one species (Quasipaafasciculispina) of Quasipaa has been recorded from Chanthaburi and Trat Provinces in south-eastern Thailand.Spiny Frog Quasipaaverrucospinosa from Doi Phu Kha National Park, Nan Province at an altitude of 900\u20131000 m a.s.l. Our study has demonstrated that populations of this species are paraphyletic and has revealed deep genetic differences. Therefore, it is recommended that a comprehensive study be undertaken to clarify the taxonomic and geographic distribution of this species for its suitable protection and conservation.Based on recent fieldwork conducted in northern Thailand, we report a new record of  Dicroglossidae is a diverse group of amphibians in Thailand. As a direct result of the increasing amounts of attention and effort being devoted to herpetological research studies, the species diversity of this family in Thailand has remarkably increased from 31 species in the year 2011, to 38 species at present . To date, official records are comprised of 12 recognised species of this genus, of which only one species, namely Q.fasciculispina, was reported from south-eastern Thailand (Frost 2021). The Granular Spiny Frog Quasipaaverrucospinosa (considered to be at the \u2018Near Threatened\u2019 level on the IUCN Red List) was first described by Ren\u00e9 Bourret in 1937 and was collected from Chapa and Fansipan (now Sa Pa) in Lao Cai Province and Tam Dao National Park in Vinh Phuc Province, northern Vietnam. Currently, the distribution of this species ranges from northern and central Vietnam; southern China; and northwest Laos  and Fejervaryalimnocharis (Gravenhorst) which were used as the outgroup  and Maximum Likelihood (ML). JMODELTEST v.2.1.7  was used65BF7EC1-909C-58BE-AE2D-9A7B3157EDF3Type status:Other material. Occurrence: catalogNumber: AUP-00392; individualCount: 1; sex: female; lifeStage: adult; Taxon: scientificName: Quasipaaverrucospinosa; class: Amphibia; order: Anura; family: Dicroglossidae; genus: Quasipaa; specificEpithet: verrucospinosa; Location: country: Thailand; countryCode: TL; stateProvince: Nan; locality: Doi Phu Kha; verbatimElevation: 900\u20131000; verbatimLatitude: 21\u00b019.66'N; verbatimLongitude: 103\u00b036.26'E; verbatimCoordinateSystem: WGS84; Event: eventRemarks: collected by C. Suwannapoom, P. Pawangkhanant; Record Level: basisOfRecord: preserved specimeType status:Other material. Occurrence: catalogNumber: AUP-00393; individualCount: 1; sex: female; lifeStage: adult; Taxon: scientificName: Quasipaaverrucospinosa; Record Level: basisOfRecord: preserved specimen; dynamicProperties: collection date, collector and location as the AUP-00392Type status:Other material. Occurrence: catalogNumber: AUP-00530; individualCount: 1; sex: female; lifeStage: adult; Taxon: scientificName: Quasipaaverrucospinosa; Record Level: basisOfRecord: preserved specimen; dynamicProperties: collection date, collector and location as the AUP-00392Type status:Other material. Occurrence: catalogNumber: AUP-00531; individualCount: 1; sex: male; lifeStage: adult; Taxon: scientificName: Quasipaaverrucospinosa; Record Level: basisOfRecord: preserved specimen; dynamicProperties: collection date, collector and location as the AUP-00392Type status:Other material. Occurrence: catalogNumber: AUP-00532; individualCount: 1; sex: male; lifeStage: adult; Taxon: scientificName: Quasipaaverrucospinosa; Record Level: basisOfRecord: preserved specimen; dynamicProperties: collection date, collector and location as the AUP-00392Type status:Other material. Occurrence: catalogNumber: AUP-00533; individualCount: 1; sex: male; lifeStage: adult; Taxon: scientificName: Quasipaaverrucospinosa; Record Level: basisOfRecord: preserved specimen; dynamicProperties: collection date, collector and location as the AUP-00392Type status:Other material. Occurrence: catalogNumber: AUP-00534; individualCount: 1; sex: male; lifeStage: adult; Taxon: scientificName: Quasipaaverrucospinosa; Record Level: basisOfRecord: preserved specimen; dynamicProperties: collection date, collector and location as the AUP-00392Type status:Other material. Occurrence: catalogNumber: AUP-01609; individualCount: 1; sex: female; lifeStage: adult; Taxon: scientificName: Quasipaaverrucospinosa; Record Level: basisOfRecord: preserved specimen; dynamicProperties: collection date, collector and location as the AUP-00392Morphological characteristics of the specimens (n = 10) obtained from Nan Province agreed with the descriptions of Skin. Dorsal surface with very rough back covered by short, thick, ridges and round tubercles. Sides covered by oval tubercles with dark spines; ventral surface smooth. During the breeding season (May to October), males have black spikes on finger I, chin, chest and underarms. Colouration of dorsum is grey-brown with dark brown spots; ventral surface cream-coloured, except for the chin with dark markings; iris dark green Figs , 3.This species is known to be from northern and central Vietnam, southern China and northwest Laos . This isLimnonectestaylori Matsui, Panha, Khonsue & Kuraishi and L.bannaensis Ye, Fei, Xie & Jiang. Advertisement calls of the males can be heard within or beside rocky streams from May to October  to 7.1% (with Q.shini) , was 0.2%. Furthermore, both ML and BI analyses placed the Nan population in one clade along with topotypic Q.verrucospinosa in conjunction with strong node support  of 16S rRNA data for Quasipaa are distinguished from each other mainly by the pattern and number of genital spikes in the areas of the first finger, chest, chin and underarms of males during their breeding season. Therefore, it can be considerably difficult for herpetologists to identify this species. Consequently, the taxonomic status of the species in this group is both controversial and unclear. Additionally, there has been a notable lack of interest in and integrated research  conducted on this species. However, this species has been determined to be especially widespread ; Paaboulengeri ; Paaspinosa  and Paa spp.  and Tam Dao NP. (Vinh Phuc Province). These two locations are situated on opposite sides of the Red River. Q.verrucospinosa sensu stricto. Specimens previously placed in other groups should be assigned to groups Q.cf.verrucospinosa in order to more accurately correspond with specimens in groups B, C and D .Sequences and voucher specimens of Data typeTable of sequences and voucher specimens of Quasipaa and outgroup taxa used in molecular analysesFile: oo_592305.docxhttps://binary.pensoft.net/file/592305Suwannapoom et al.FECF5CBD-031A-5187-912F-4A426C20EA2210.3897/BDJ.9.e70473.suppl2Supplementary material 2Quasipaa.The pairwise uncorrected p-distance (%) of 16S rRNA gene between species of Data typep-distanceFile: oo_554712.docxhttps://binary.pensoft.net/file/554712Suwannapoom et al.4B07CD53-2032-5B61-904D-4E72DA05A73C10.3897/BDJ.9.e70473.suppl3Supplementary material 3Quasipaaverrucospinosa in Thailand. .Measurement (in mm) and proportions of the series of Data typeMeasurement of Quasipaa verrucospinosa in ThailandFile: oo_554755.docxhttps://binary.pensoft.net/file/554755Suwannapoom et al."}
{"text": "Facilitators include: tension for change for low-cost, accessible IDs; relative advantage over existing tools; development of partnerships; and identification of implementation champions. Barriers include: need for educational strategies to encourage clinical provider acceptability; lack of evidence of the optimal beneficiary. DISCUSSION/SIGNIFICANCE OF IMPACT: Tools for therapeutic OF self-management could be integrated into comprehensive OF programming. Employing the CFIR as an overarching typology allows for comparison across contexts and settings where OF care occurs and may be useful for clinicians, researchers, and policy-makers interested in implementing IDs for OF self-management in LMICs. CONFLICT OF INTEREST DESCRIPTION: I am working with colleagues at the non-profit Restore Health on developing an insertable cup for therapeutic self-management of obstetric fistula in LMICsOBJECTIVES/GOALS: Insertable devices (IDs) for obstetric fistula (OF) management are feasible, acceptable, but not accessible; implementation determinants in low and middle-income countries (LMICs) are unknown. Thus, the purpose of this study was to understand pre-adoption facilitators and barriers among global stakeholders for a therapeutic ID for OF in LMICs. METHODS/STUDY POPULATION: Stakeholders, including researchers (n = 11), clinicians (n = 4), government officials (n = 2), and administrators (n = 4), were purposefully identified from various sectors involved in understanding and addressing the needs of women with OF: clinical care, academia, international health, civil society, and government. Twenty-one individuals were interviewed about their perceptions of IDs for OF self-management and their implementation. Interviews were audio-recorded and transcribed. The Consolidated Framework for Implementation Research (CFIR) guided data collection and analysis. Thematic analyses were carried out within Nvivo v.12. RESULTS/ANTICIPATED RESULTS: Determinants of implementation of an ID for OF self-management (by CFIR domain) include: (1) intervention characteristics\u2014"}
{"text": "Anoplura), some of their common, Eurasian or even cosmopolitan species still lack complete taxonomic descriptions, especially those for their nymphal stages. This applies especially to the most common rodent parasites: the lice of the genus Hoplopleura. In Europe, only two of the five most common Hoplopleura species have full taxonomic characteristics with a description of the nymphal stages. This study enriches the current state of knowledge for another species, Hoplopleuralongula and presents the first description of its nymphal stages.Despite the widespread belief that an extensive body of knowledge exists for the sucking lice  of H.acanthopus, H.affinis, H.captiosa, H.edentula and H.longula) have been given full taxonomic descriptions, including immature stages. This paper presents a description of the nymphal stages of H.longula (described for the first time).Only two of the five species found in Eurasia ( Psocodea: Anoplura) are obligatory, permanent ectoparasites of mammals. Lice complete their entire lifecycle on their host and it includes: egg, three nymphal stages  and an adult stage (imago). Some past research on this group has focused on their relationship with humans (e.g. Sucking lice (ans e.g.  or livesans e.g.  and theians e.g. . In compAnoplura are associated with rodents (Rodentia), the most abundant group of mammals in terms of species (Hoplopleuridae (Psocodea: Anoplura) is the most speciose group parasitising the Rodentia. Amongst the family, most representatives are in the genus Hoplopleura, which contains 154 species distributed around the world. The following five are most widespread in Europe - four of them being common in Eurasia: H.acanthopus , H.affinis , H.edentula and H.longula Neumann, 1909 and one is probably cosmopolitan: H.captiosa Johnson, 1960 , obtained from the Scientific Collection of the Mammal Research Institute Polish Academy of Sciences in Bialowieza . These were isolated from four  Eurasian harvest mice  Pallas, 771, obtaza Table .Lice were collected from dead rodent specimens by combing the fur with tweezers and the specimens were fixed and preserved in 70% ethyl alcohol. The specimens, intended for analysis of morphological traits, were immersed in polyvinyl-lactophenol to develop total preparations for light microscope examination .Topographic preferences were observed. The entire body surface area of the test hosts was analysed and all locations were marked; this allowed for a complete (intensive) analysis of the topography.The names and abbreviations of individual setae or body parts are provided following Abbreviations of head and thorax:ADHS accessory dorsal head setae;AHS apical head setae;AS antennal setae;CS clypeal setae;DAHS dorsal anterior head setae;DMsS dorsal mesothoracic setae;DMtS dorsal metathoracic setae;DPTS dorsal principal thoracic setae;DPtS dorsal prothoracic setae;ISHS inner sutural head setae;MHS marginal head setae;AMHS anterior marginal head setae;MMHS middle marginal head setae;PMHS posterior marginal head setae;OS oral setae;OSHS outer sutural head setae;PAS preantennal setae;PCHS posterior central head setae;PDHS posterior dorsal head setae;VMHS ventral marginal head setae;VPHS ventral principal head setae.Abbreviations of abdomen:AnS anal setae;MAS major abdominal setae.Neumann, 1909D8E3045B-4432-5473-9A0D-8B006A12B951Type host: Micromysminutus Other hosts: Micromysglareolus Schreber, 1780 in MicrotusarvalisSorexaraneus Linnaeus, 1758 in Wegner (1966b) Pallas, 1778 and Type status:Other material. Occurrence: lifeStage: 1 nymph first instar; Taxon: scientificName: Hoplopleuralongula Neumann, 1909; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Psocodea; family: Hoplopleuridae; genus: Hoplopleura; Location: continent: Europe; country: Poland; locality: area of the Bialowieza National Park; verbatimCoordinates: 52\u00b045'23.3\"N 23\u00b052'23.6\"E; georeferenceProtocol: GPS; Identification: identifiedBy: Kozina P.; Event: samplingProtocol: Micromysminutushost ; eventDate: 20-09-1949; Record Level: institutionCode: UGDIZPMMmHHl1N1Type status:Other material. Occurrence: lifeStage: 1 nymph first instar and 1 nymph second instar; Taxon: scientificName: Hoplopleuralongula Neumann, 1909; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Psocodea; family: Hoplopleuridae; genus: Hoplopleura; Location: continent: Europe; country: Poland; locality: area of the Bialowieza National Park; verbatimCoordinates: 52\u00b045'23.3\"N 23\u00b052'23.6\"E; georeferenceProtocol: GPS; Identification: identifiedBy: Kozina P.; Event: samplingProtocol: Micromysminutushost ; eventDate: 08-12-1949; Record Level: institutionCode: UGDIZPMMmHHl2N1, UGDIZPMMmHHl1N2Type status:Other material. Occurrence: lifeStage: 2 nymph third instar; Taxon: scientificName: Hoplopleuralongula Neumann, 1909; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Psocodea; family: Hoplopleuridae; genus: Hoplopleura; Location: continent: Europe; country: Poland; locality: area of the Bialowieza National Park; verbatimCoordinates: 52\u00b045'23.3\"N 23\u00b052'23.6\"E; georeferenceProtocol: GPS; Identification: identifiedBy: Kozina P.; Event: samplingProtocol: Micromysminutushost ; eventDate: 07-10-1949; Record Level: institutionCode: UGDIZPMMmHHl1N3, UGDIZPMMmHHl2N3Nymph I . MAS four in number; AnS present, two in number.h I Figs , 3 . Legh I Figs . Head. ANymph II . Ventral side: large, concave scales around the mouth; head margins covered imbricately with scales (U-shaped); VMHS, OS and AHS present; VPHS constituting 50% of the head length. Dorsal side: AHS, DAHS and PAS present; ISHS and OSHS closely arranged; PCHS visible; ADHS and PDHS (reaching second segment of the abdomen) present; MHS minute. Thorax. Dorsal side: DPTS reaching beginning of the abdomen; pronounced border between the thorax, head and abdomen. Abdomen. Disproportionately large relative to the rest of the body, barrel-shaped, densely covered with U-shaped scales; traces of segmentation visible; MAS eight in number. After x-ray, structure of nymph III visible. II Figs , 5 . Bod II Figs . Head. WNymph III .III Figs , 7 . BodIII Figs . Head. WThe lice demonstrated topographic preferences - a tendency for congregating along the sides of the host\u2019s body and on both sides of the head (between the ears and on the neck) Fig. Table 1)1).H.longula was found amongst the lice. Despite the fact that there are also other species parasitising M.minutus, for example, of the genus Polyplax given in literature (In the present study, only terature , they weM.minutus is considered to be the main host of H.longula; it has not been recorded in any other hosts to date (The harvest mouse  to date .H.longula are easily identifiable. Nymph I possessed four major abdominal setae and an elongated, ovoid abdomen. Nymph II possessed eight MAS and a barrel-shaped abdomen. Like nymph II, nymph III possessed eight MAS; however, its abdomen is elongated and ovoid. In addition, like nymph I, the body of the adult individual can be seen inside the nymph.Individual nymphs of H.longula-M.minutus relationship. Despite this, similarities can be found with the distribution of H.acanthopus on Microtusarvalis (H.longula appeared to have a wider distribution on the sides and the dorsum on its rodent hosts. Similarly to H.affinis in Apodemusagrarius (H.longula was also found on the dorsal portion of the head and on the nape of the animal. In both of the previous studies, Dubinin did not observe lice on the ventral portion of the head; this was also confirmed in the present study.Regarding the location of the lice on the host, no comparative data are available in previous studies regarding the arvalis : in bothagrarius , H.longH.longula is a rare species associated with only one, also rare host, M.minutus. This is the first description of all three nymphal stages of H.longula. This characteristic will support other researchers working on lice to make positive identifications which will benefit future research examining host-parasite associations.Current research indicates that"}
{"text": "The prognosis of breast cancer has radically changed in recent years and continues to improve due to the broad application of effective therapies. New targeting strategies including targeted delivery of cytotoxic drugs via receptor-targeting agents have been developed. We summarize recent publications and developments of novel antibody-drug conjugates (ADCs) used to control breast cancer. Cancer is the second main cause of mortality worldwide . Breast ADCs are a new class of protein-based therapeutic agents which bring together the targeting capabilities, high selectivity, and stability of mAbs with the cancer-killing potential of highly potent payloads to increase precise drug delivery in cancer cells, while sparing healthy tissues and/or cells from chemotherapeutic damage. This ability of discrimination between normal and cancerous cells would not have been achieved without decades of development of mAbs , 14\u201318.In order to achieve the desired results, each ADC must contain three parts  19]::19]:Monoclonal antibody: it binds the ADC to a specific tumor cell surface protein . The antLinker: it is a chemical spacer between the cytotoxic drug and the monoclonal body. It is usually stable in the circulation, but most of the linkers are easily displaced inside the cells. However, if the linker stays stable inside the cell, it requires degradation to release the drug. The linker must allow the release of the drug in its active form within or close enough to the target cells, because early release of drugs in the circulation can result in systemic toxicity and a lower therapeutic index , 25. TheCytotoxic drug: cytotoxic compounds are divided into two main categories: microtubule inhibitors and DNA-damaging agents. There are also other small molecules under investigation , 28. AllThere are three generations of ADCs: first, second, and third. The monoclonal anti-HER2 binds to the HER2 expressed on the cells of the tumor and gets internalized by endocytosis. The proteases in the lysosomes cleavage the linker, releasing the payload and starting the cytotoxic effects.This effect happens when the ADC is designed that the antibody releases the payload before internalization so that the surrounding cells get affected by its cytotoxic effects even if they do not express the receptor.Monoclonal antibody: a human epidermal growth factor receptor 2  targeting monoclonal antibody.Payload: an undisclosed cytotoxic agent with potential antineoplastic activity.Development status: first in human phase I/II.Monoclonal antibody: an engineered version of the humanized monoclonal antihuman epidermal growth factor receptor 2 (HER2) immunoglobulin G1 (IgG1) trastuzumab.Linker: cathepsin B-cleavable valine-alanine linker.Payload: DNA cross-linking pyrrolobenzodiazepine (PBD) dimer-based drug tesirine.Development status : phase IMonoclonal antibody: trastuzumab biobetter HM2.Payload: monomethyl auristatin E (MMAE).Development status : phase IMonoclonal antibody: a human epidermal growth factor receptor 2 (HER2) site-specifically targeting monoclonal antibody.Linker: cleavable valine-citrulline- linker.Payload: an analog of dolastatin 10, auristatin-0101.Monoclonal antibody: a human epidermal growth factor receptor 2  site-specifically targeting monoclonal antibody.Linker: para-acetyl-phenylalanine .Development status : preclinMonoclonal antibody: a human epidermal growth factor receptor 2  targeting monoclonal antibody.Payload: undisclosed maytansine derivative.Development status : BAT8001Monoclonal antibody: a monoclonal antibody targeting human epidermal growth factor receptor 2 .Payload: a DNA minor groove cross-linking agent pyrrolobenzodiazepine monoamide (PBD-MA).Development status : first-iMonoclonal antibody: a monoclonal antibody targeting human epidermal growth factor receptor 2 .Linker: a cleavable maleimidocaproyl-valyl-citrullinyl-p-aminobenzyloxycarbonyl  type linker.Payload: monomethyl auristatin E (MMAE).Development status: phase I and phase II .Monoclonal antibody: a monoclonal antibody against human epidermal growth factor receptor 2 (HER2) site-specifically.Payload: monomethyl auristatin F (MMAF).Development status: LegoChemistry\u2122 and ADC platform technology ConjuAll\u2122.Monoclonal antibody: hertuzumab.Payload: monomethyl auristatin E (MMAE).Development status: phase I and phase II.Monoclonal antibody: a bispecific antibody against the extracellular domain of human epidermal growth factor receptor 2  comprised of the single-chain variable fragment (scFv) of the anti-HER2 monoclonal antibody trastuzumab, fused to the heavy chains of the anti-HER2 monoclonal antibody 39S.Payload: tubulysinDevelopment status : phase IMonoclonal antibody: trastuzumab.Linker : it has Payload: PM050489.Development status : preclinMonoclonal antibody: a monoclonal antibody against the human epidermal growth factor receptor 2 (HER2).Payload: the antineoplastic anthracycline antibiotic doxorubicin encapsulated within liposomes.Development status : phase IMonoclonal antibody: a monoclonal antibody targeting human epidermal growth factor receptor 2 .Linker: a tetrapeptide linker, Gly-Phe-Leu-Gly (GFLG).Payload: deruxtecan, a derivative of the camptothecin analog exatecan ; a DNA topoisomerase 1  inhibitor, with antineoplastic activity.Development status : FDA appMonoclonal antibody: trastuzumab, a monoclonal antibody targeting epidermal growth factor receptor 2 (HER2).Linker : a cleavPayload: the duocarmycin prodrug.Development status : phase IMonoclonal antibody: trastuzumab.Linker : noncleaPayload: the microtubule-inhibitory agent DM1.Development status : approveMonoclonal antibody: HT-19, a monoclonal antibody directed against the human epidermal growth factor receptor 2  that binds to domain IV of HER2 to an epitope that is distinct from the trastuzumab-binding sitePayload: proprietary auristatin-derived payload molecules.Development status : in JanuMonoclonal antibody: sactizumab, an anti-Trop-2 humanized antibody.Payload: the topoisomerase-I inhibitor SN-38.Development status : phase IMonoclonal antibody: the zinc transporter LIV-1 targeting humanized antibody.Payload: monomethyl auristatin E (MMAE).Development status: phase I.Monoclonal antibody: anti-EGFR antibody.Payload: DM1 (derivative of maytansine).Development status: phase I.Monoclonal antibody: an anti-HER3 antibody.Payload: a topoisomerase I inhibitor exatecan derivative (DXd).Development Status: phase I/II.Monoclonal antibody: receptor tyrosine kinase-like orphan receptor 2 (ROR2) targeting antibody.Payload: an undisclosed payload.Development status: phase I/II.Monoclonal antibody: a humanized DS6 antibody directed against tumor-associated sialoglycotope CA6.Payload: the maytansinoid DM4.Development status: phase I.Breast cancer has become the most common cancer in the world; a lot of treatment methods and technologies were used in order to control it, but all of them did not achieve the required goal, until the invention of the antibody-drug conjugates. The concept of targeted delivery of anticancer drugs helped the oncologists to improve the tumor selectivity of anticancer drugs and to lower their systemic toxicity. Meaning that these drugs could be administered at higher doses, providing better therapeutic benefit to their patients. The tumor selectivity of antibodies offered a chance to achieve this goal by using them as guide for the drug towards the tumor. This seemingly simple concept had great attention from researchers at academic institutions and in the pharmaceutical industry. The current breed of ADCs uses antibodies that are humanized, not immunogenic, and linkers that are designed to be stable in circulation, but are cleaved upon delivery into a cell. The recent FDA approvals of new ADCs have generated tremendous excitement. There are a lot of ADCs currently in clinical evaluation and almost every major pharmaceutical company has embraced this technology. There is active research by medicinal chemists to develop new linkers and discover new potent effector molecules suitable for use in ADCs, while biologists have focused on identifying cell-surface targets suitable for antibody development."}
{"text": "We regret the unprofessional behavior of the authors involved.li06yh@126.com>Correspondence: Yinghao Li: <"}
{"text": "Moderate or severe burns are potentially devastating injuries that can even cause death, and many of them occur every year. Infection prevention, anti-inflammation, pain management and administration of growth factors play key roles in the treatment of burn wounds. Novel therapeutic strategies under development, such as nanotherapeutics, are promising prospects for burn wound treatment. Nanotherapeutics, including metallic and polymeric nanoformulations, have been extensively developed to manage various types of burns. Both human and animal studies have demonstrated that nanotherapeutics are biocompatible and effective in this application. Herein, we provide comprehensive knowledge of and an update on the progress of various nanoformulations for the treatment of burn wounds. HighlightsThe recent progress of various nanotherapeutics for the management of burn wounds and their therapeutic mechanisms are systematically reviewed.Assessment of burn wounds treated with nanotherapeutics is briefly summarized.Skin is the most active immune system organ and the largest organ of the body, as well as the main barrier between the environment and the internal organs . Acute sToday, we have a deep understanding of the pathogenesis of burn wounds. The main factors determining burn wound progression include bacterial infection, excessive inflammatory reaction and low expression levels of various growth factors (GFs). Of these, bacterial infection is the most serious complicating factor . In acco to treat burn wounds . I. IOther feration . By conteceptors . The res lesions . Importae models ,119.in vitro and in vivo models have been extensively employed to evaluate the therapeutic efficacies of nanotherapeutics. Anti-bacterial, anti-inflammatory and cell proliferation experiments have been mainly used to assess in vitro therapeutic efficacies of nanotherapeutics. However, many studies have focused on the animal models to evaluate the in vivo therapeutic efficacies of nanotherapeutics. Animals such as mice [et\u00a0al. have synthetically reviewed the establishment of various types of burn wounds  in animals [Both  as mice , rats [1 as mice , rabbits as mice ,112, dog as mice , and pig as mice  bearing  animals . The cli animals . AntibacA wide range of NPs have been explored for management of burn wounds. Using nanotherapeutics to treat these wounds has some advantages, such as increasing antibacterial effect, overcoming bacterial drug resistance, facilitating cell proliferation and decreasing drug administration frequency. The therapeutic efficacy of nanotherapeutics has been evaluated in various animal models on different types and degrees of burns. Some nanotherapeutics exhibit satisfactory therapeutic effects in patients with burn injuries, making them promising candidates for further studies of their role in the management of these wounds. Although gratifying therapeutic effects have been achieved, the toxicity of nanotherapeutics due to their particular physicochemical properties cannot be ignored. How to prepare multifunctional nanotherapeutics with good biocompatibility and efficacy for the treatment of burns needs further investigation. In particular, the systemic toxicity of nanotherapeutics should be investigated in various animal models before proceeding to patient applications. How to prepare nanotherapeutics for clinical practice on a large scale must also be considered. Although some problems must be overcome before this can happen, we believe that more burn patients can profit from nanotherapeutics in the future.sn-glycero-phosphatidylcholine; DNA: Deoxyribonucleic acid; DOTAP: 1,2-Dioleoyl-3-trimethylamonium propane chloride; EC: Endothelial cell; ECM: Extracellular matrix; EGF: Epidermal growth factor; EGF CDLs: EGF cationic deformable liposomes; FBS: Fetal bovine serun; FDA: Food and Drug Administration; FGF: Fibroblast growth factor; FN: Fibronectin; GFs: Growth factors; GM-CSF: Granulocyte macrophage colony stimulating factor; HA: Hyaluronic acid; HaCaT: Human immortal keratinocyte cell line; HB-EGF: Heparin binding epidermal growth factor; hFBs: Normal human fibroblast; HM-PA: Heparin-mimetic peptide; HUVECs: Human umbilical vein endothelial cells; ICAM-1: Intercellular adhesion molecule-1; IGF: Insulin-like growth factor; IGF-BP: Insulin like growth factor binding protein; IL: Interleukin; KGF: Keratinocyte formation growth factor; MMP: Matrix metalloproteinase; MRSA, Methicillin-resistant Staphylococcus aureus; MSC: Mesenchymal stem cell; NGF: Nerve growth factor; NPs: Nanoparticles; PBS: Phosphate buffer saline; PC: Phosphatidyl choline; PCL: Poly(caprolactone); PDA: Polydopamine; PEG: Polyethylene glycol; PEO: Polyethylene oxide; PDGF: Platelet-derived growth factor; PSIS: Porcine-derived small intestinal submucosa; PLA: Poly(lactic acid); PLGA: Poly(lactic-co-glycolic acid); PVA: Poly; ROS: Reactive oxygen species; SG: Silver nanoparticle gel; SF: Nanosilver foam; siRNA: Short interfering ribonucleic acid; TGF-\u03b2: Transforming growth factor beta; TIMP-1: Tissue inhibitor of metalloproteinase-1; TNF-\u03b1: Tumor necrosis factor alpha; TRA: All-trans retinoic acid; TRA DLs: All-trans retinoic acid loaded deformable liposomes; TSP: Thrombin-sensitive protein; VEGF, Vascular endothelial growth factor.AgSD: Silver sulfadiazine; \u03b1-SMA: Alpha-smooth muscle actin; BAC: Benzalkonium chloride; bFGF: Basic fibroblast growth factor; C: Collagen; CINC: Cytokine-induced neutrophil chemoattractant; Col1a1: Collagen type 1 alpha 1; CPC: Cetylpyridinium chloride; CXCL-1: Chemokine (C-X-C motif) ligand 1 protein; CRP: C-reactive protein; CTAB: Cetyltrimethyl ammonium bromide; CTGF: Connective-tissue growth factor; DMPC: Dimyristoyl-This work supported by the Open Project Program of the State Key Laboratory of Trauma, Burn and Combined Injury, Third Military Medical University .R.H. drafted the manuscript. J. H. and D. Z. designed this project and revised the manuscript. W. Q. prepared the revised manuscript. L. C. prepared some figures and tables. All authors read and approved the final manuscript.The authors declared that they have no conflicts of interest to this work."}
{"text": "Correction to:Mol Syst Biol (2021) 17: e10179. DOI: 10.15252/msb.202010179 | Published online 30 March 2021et\u2009al  LacI variants include the following: a study of temperature\u2010sensitive variants (Sadler & Novick, Besides the sentence quoted above, this mistake does not impact the findings of the study. The authors apologize for this error."}
{"text": "Following publication of the original article , the autThe incorrect author name is: Brandon P. Luke-WoldThe correct author name is: Brandon P. Lucke-WoldThe author group has been updated above and the original article  has been"}
{"text": "Nature Communications8: Article number: 15732; DOI: 10.1038/ncomms15732 (2017); Published: 06092017; Updated: 03122018In the original version of this Article, the affiliation details for Yan Fang were incorrectly given as \u201cZJU-UoE Institute, Zhejiang University School of Medicine, Hangzhou 310058, China\u201d. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Nature Communications8: Article number: 14969; DOI: 10.1038/ncomms14969 (2017); Published: 04252017; Updated: 06202017In the original version of this Article, which was received on 04 November 2016, the received date was incorrectly given as 04 November 2017. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Nature Communications6: Article number: 7143; DOI: 10.1038/ncomms8143 (2015); Published: 05152015; Updated: 03262018The original HTML version of this Article had an incorrect article number of 8143; it should have been 7143. This has now been corrected in the HTML; the PDF version of the Article was correct from the time of publication."}
{"text": "Nature Communications8: Article number: 14715; DOI: 10.1038/ncomms14715 (2017); Published: 03092017; Updated: 04242017In Fig. 2 of this Article, the inset image in the bottom panel was inadvertently omitted during the production process. The correct version of the Fig. 2 is shown below as"}
{"text": "Scientific Reports6: Article number: 3960910.1038/srep39609; published online: 12202016; updated: 01232017This Article contains a typographical error in the Affiliation of the author Tingyong Feng. The correct affiliation is listed below:School of Psychology, Southwest University, Chongqing, China."}
{"text": "Scientific Reports5: Article number: 991810.1038/srep09918; published online: 04212015; updated: 03192018Correction to: The original version of this Article contained a typographical error in the volume number \u20185\u2019 was incorrectly given as \u20184\u2019. This error has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 2552310.1038/srep25523; published online: 05102016; updated: 05172018The original version of this Article contained an error in the indexing of the author Anang A. Shelat. This error has now been corrected."}
{"text": "Nature Communications8: Article number: 13708 ; DOI: 10.1038/ncomms13708 (2016); Published: December162016; Updated: march042017The financial support for this Article was not fully acknowledged. The acknowledgements should have included the following:The European Community FP7 grant no. 602239 (ATECT)."}
{"text": "Nature Communications7: Article number: 13903; DOI: 10.1038/ncomms13903 (2016); Published 12132016; Updated 01202017The original version of this Article contained a typographical error in the spelling of the author Stephen F. Price, which was incorrectly given as Stephen A. Price. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 3316810.1038/srep33168; published online: 09092016; updated: 01232017The original version of this Article contained an error in the order of author names, which were incorrectly given as \u2018Naeime Karamipour, Mohammad Mehrabadi & Yaghoub Fathipour\u2019.These errors have now been corrected in the HTML and PDF versions of this Article."}
{"text": "Nature Communications8: Article number: 13804; DOI: 10.1038/ncomms13804 (2017); Published: 01052017; Updated: 05032017In Fig. 7b of this Article, traces depicting the average MUA response evoked by the target (red) and distractor (blue) were inadvertently omitted during the production process. The correct version of Fig. 7 appears below as"}
{"text": "Scientific Reports6: Article number: 35429; 10.1038/srep35429 published online: 10202016 updated: 01112017.The Supplementary Information file originally published with this Article contained incorrect Figures for the \u2018NMR spectra of all new compounds\u2019. This error has now been corrected in the Supplementary Information file that accompanies the Article."}
{"text": "Nature Communications8: Article number:15137 ; DOI: 10.1038/ncomms15317 (2017); Published: 06052017; Updated 06302017In the original HTML version of this Article, which was published on 5 June 2017, the publication date was incorrectly given as 5 July 2017. This has now been corrected in the HTML; the PDF version of the paper was correct from the time of publication."}
{"text": "Scientific Reports6: Article number: 2842210.1038/srep28422; published online: 06222016; updated: 01122017A supplementary dataset containing 3411 genes and their expression profiles from 303 microarrays available in the public domain, Gene Expression Omnibus (GEO) was omitted from the original version of this Article. This has been corrected in the HTML version of the Article; the PDF version was correct at time of publication."}
{"text": "Scientific Reports6: Article number: 37810; 10.1038/srep37810 published online: 11252016; updated: 04062018.The original version of this Article contained an error in the indexing of the author Shaymaa Mohamed Mohamed Badawy. This error has now been corrected."}
{"text": "Scientific Reports6: Article number: 37908; 10.1038/srep37908 published online: 11292016; updated: 02102017.The original version of this Article contained an error in the spelling of the author Pankaj Ror which was incorrectly given as Pankaj Kumar. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications7: Article number: 13611; DOI: 10.1038/ncomms13611 (2016); Published 12052016; Updated 12172017The original version of this Article contained a typographical error in the spelling of the author S.A. Cannas, which was incorrectly given as S. Cannas. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 44794; 10.1038/srep44794 published online: 03202017; updated: 12222017.The original version of this Article contained a typographical error in the spelling of the author Jack van Horssen, which was incorrectly given as Jack Van Horsen. This has now been corrected in the PDF and HTML versions of the Article, and in the accompanying Supplementary Dataset File."}
{"text": "Nature Communications7: Article number: 12951; DOI: 10.1038/ncomms12951 (2016); Published 11252015; Updated 12172017The authors inadvertently omitted Richard Bianco, who provided consultation for the experimental surgical services, from the author list. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 3616810.1038/srep36168; published online: 11032016; updated: 11302016The original version of this Article contained errors in the name of the author Deepika, which was incorrectly given as Deepika Goyal.These errors have now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 45919; 10.1038/srep45919 published online: 04042017; updated: 05162017.The original version of this Article contained an error in the spelling of the author Cagla Ozgit-Akgun, which was incorrectly given as \u00c7agla Ozgit-Akgun. This error has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 3713710.1038/srep37137; published online: 11162016; updated: 03132017This Article contains errors in Figure 6c. The Pearson correlation values for the automated and manually prepared samples were inadvertently switched. The correct Figure 6c appears below as"}
{"text": "Scientific Reports6: Article number: 3578810.1038/srep35788; published online: 10202016; updated: 02242017The original version of this Article contained a typographical error in the spelling of the author Wenguang Xu, which was incorrectly given as Wengguang Xu. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications8: Article number: 14944; DOI: 10.1038/ncomms14944 (2017); Published: 04212017; Updated: 06062017The HTML version of this Article previously published had an incorrect publication date of 20 April 2017; it should have been 21 April 2017. This has now been corrected in the HTML; the PDF version of the paper was correct from the time of publication."}
{"text": "After the publication of this article  it was nAquatic Biosystems 2012, 12:33, which should be: Hayman et al. BMC Geriatrics, 2012, 12:33.An incorrect heading at the top of each page: Hayman et al. 2.The citation at the end of the article which was:This affected:Hayman et al.: Life and Living in Advanced Age: A Cohort Study in New Zealand -Te Pu\u0101waitanga o Nga Tapuwae Kia Ora Tonu, LiLACS NZ: Study protocol. Aquatic Biosystems 2012 12:33.This was incorrect and should be:Hayman et al.: Life and Living in Advanced Age: A Cohort Study in New Zealand -Te Pu\u0101waitanga o Nga Tapuwae Kia Ora Tonu, LiLACS NZ: Study protocol. BMC Geriatrics 2012 12:33."}
{"text": "Scientific Reports7: Article number: 44894; 10.1038/srep44894 published online: 03202017; updated: 08292017.This article was published twice in error during a change in production systems. The publisher apologizes to the authors and readers for the error. When citing this work, please refer to the original version.1"}
{"text": "Scientific Reports6: Article number: 25462; 10.1038/srep25462 published online: 05052016; updated: 10102016.In this Article, the values given in the column labeled \u2018compound\u2019 of Table 1 are incorrect. The correct"}
{"text": "Scientific Reports7: Article number: 4300010.1038/srep43000; published online: 02232017; updated: 05122017This Article contains an error in Figure 8: the oxygen percentage for the black columns is incorrectly labeled as 21% instead of the correct value of 5%. The correct Figure 8 appears below as"}
{"text": "Nature Communications8: Article number: 15845 ; DOI: 10.1038/ncomms15845 (2017); Published: 06202017; Updated: 07112017An incorrect version of the Supplementary Information was inadvertently published with this Article which included incorrect figure references in Supplementary Table 4. The Article has now been updated to include the correct version of the Supplementary Information."}
{"text": "Scientific Reports7: Article number: 40259; 10.1038/srep40259 published online: 01112017; updated: 08242017.In the Supplementary Information file originally published with this Article, References 1\u20135 were omitted. This error has been corrected in the Supplementary Information that now accompanies the Article."}
{"text": "Nature Communications7: Article number:13707 ; DOI: 10.1038/ncomms13707 (2016); Published: 12192016; Updated: 06302017The original version of this Article contained an error in the gene ID for TimRhom I, cited in the Methods, which specified an unrelated gene. The correct gene ID for TimRhom I is Tb927.9.8260. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Nature Communications7 Article number: 10144 ; DOI: 10.1038/ncomms10144 (2016) Published: 01112016; Updated: 08042017The original version of this Article contained an error in the spelling of the author Giorgos Gouridis which was incorrectly given as Giorgos Guoridis. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 1026310.1038/srep10263; published online: 06232016; updated: 09072016In the Supplementary Information file originally published with this Article, Figures S1 and S2 were omitted. These errors have been corrected in the Supplementary Information that now accompanies the Article."}
{"text": "Scientific Reports6: Article number: 3580510.1038/srep35805; published online: 10262016; updated: 03132017A glitch in the authors\u2019 reference-management software led to extensive errors in the reference list and in-text citations. These errors have been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 4100910.1038/srep41009; published online: 01202017; updated: 04062017In the original version of this Article, the link to the Supplementary Information file was omitted. This has now been corrected in the PDF and HTML versions of the paper."}
{"text": "Scientific Reports6: Article number: 39511; 10.1038/srep39511 published online: 12222016; updated: 10202017.A Supplementary Information data file and Supplementary Mathematica notebook file were omitted from the original version of this Article. This has been corrected in the PDF and HTML version of the Article."}
{"text": "Nature Communications7: Article number: 10427 ; DOI: 10.1038/ncomms10427 (2016); Published: 01292016; Updated: 03092016The original version of this article contained an error in the spelling of the author C. Martijn de Sterke, which was incorrectly given as de Sterke C. Martijn. This has now been corrected in both the PDF and HTML versions of the article."}
{"text": "Scientific Reports7: Article number: 44888; 10.1038/srep44888 published online: 03202017; updated: 08292017.This article was published twice in error during a change in production systems. The publisher apologizes to the authors and readers for the error. When citing this work, please refer to the original version.1"}
{"text": "Nature Communications8: Article number: 14112; DOI: 10.1038/ncomms14112 (2017); Published: 07152015; Updated: 02162017The original version of this Article contained a typographical error in the spelling of the Author Preetam Janakirama, which was incorrectly given as Preetam Jankirama. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "There are errors in the Author Contributions. The correct contributions are: Conceptualization: MG EB. Data curation: MG ET EB. Formal analysis: MG ET EB. Methodology: MG EB. Supervision: MG CM EB. Writing-original draft: MG CM ET EB.There are errors in the Funding section. The correct funding information is as follows: This study was conducted when Massimo Grassi was supported by the grant CPDA123458 (\"Progetto di ricerca di Ateneo\"), and Chiara Meneghetti by the grant CPDA140302 (\"Progetto di ricerca di Ateneo\") awarded by the University of Padova. The Department of General Psychology financially supported Erika Borella for this study."}
{"text": "Scientific Reports5: Article number: 1651110.1038/srep16511; published online: 11102015; updated: 01082018The original version of this Article contained a typographical error in the spelling of the author Maisoon Al-Jawad, which was incorrectly given as Maisoon AI-Jawad. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 3817110.1038/srep38171; published online: 11022016; updated: 03162017The original version of this Article contained errors in the spelling of the authors Chung-Yuh Tzeng and Hsueh-Yao Chu, which were incorrectly given as Chung-Yuh Tseng and Shueh-Yao Chu respectively. These errors have now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nucleic Acids Res (2017). doi: 10.1093/nar/gkx695The name of Hediye Erdjument-Bromage was misspelled in the original version of this paper. This has now been corrected online and in print."}
{"text": "Scientific Reports6: Article number: 3811310.1038/srep38113; published online: 11292016; updated: 05262017The original version of this Article incorrectly included Haibing Chen as a corresponding author. This error has now been corrected in the PDF and HTML versions of this Article."}
{"text": "Nature Communications8: Article number:15745 ; DOI: 10.1038/ncomms15745 (2017) Published: 06072017; Updated: 06302017The financial support for this Article was not fully acknowledged. The Acknowledgements should have included the following:The publication charges for this article have been funded by a grant from the publication fund of UiT The Arctic University of Norway."}
{"text": "There are errors in Table 4. The correct version of Table 4 can be seen here:Part 1: Part 2: In the supplemental PDF download of this article, the Table 4 is correct, but missing the footnotes. The missing footnote information is: RSA values for proteins marked with * were determined from homology models (SWISS MODEL repository) and the PDB code given is that of the template (T) used for the model. Buried residues (RSA < 20 %) are in bold. Secondary structure information for residue determined by DSSP: Alpha helix (H), extended strand participating in beta ladder (E), 310-helix (G), hydrogen bonded turn (T), bend (S), loop/irregular (-)."}
{"text": "Scientific name: Pimoa delphinicaSpecies authority: Mammola, Hormiga & Isaia, 2016Kingdom: AnimaliaPhylum: ArthropodaClass: ArachnidaOrder: AraneaeFamily: PimoidaeTaxonomic notes: Pimoa delphinica is a medium-sized spider , with slender legs and a brown-reddish coloration . The species\u2014previously misidentified with P. rupicola \u2014was described in 2016. It is readily distinguishable from the other species of European pimoids by morphological characters in male and female genitalia .Region for assessment: GlobalBiogeographic realm: PalearcticCountries: ItalyMap of records (image): Fig. 2Map of records (Google Earth): Suppl. material 1Basis of EOO and AOO: Known habitat extentBasis (narrative): During relatively intense speleological research studies in the Western Alps, we collected Pimoa delphinica in a few caves and military bunkers in the municipalities of Casteldelfino, Sampeyre and Sant'Anna di Bellino . Specifically, the species occurred in four small wild caves and a few subterranean military bunkers in Casteldelfino and Sant'Anna di Bellino and an abandoned house in the hamlet of Becetto (Sampeyre). Two additional localities reported in Isaia et al. (2011) and Mammola et al. (2016b)\u2014Buco del Nebin 1 [Speleological Cadastre: Pi 1158] and Buco del Nebin 2 [Pi 1159] caves\u2014are in need of verification, since only juvenile specimens were collected. However, even if confirmed, these additional localitites would fall within the known extent of occurrence of the species . Despite our extensive study of Pimoa specimens from Italy and France\u2014including material stored in Museums or private collections and original records\u2014we have not been able to find additional records of Pimoa delphinica outside this small area .We used the verified occurrence records of the species to calculate the extent of occurrence (EOO) as the minimum convex hull and the area of occupancy (AOO) through a 2x2 km2 grid, as implemented in the red R package (Cardoso 2016).Min Elevation/Depth (m): 1230Max Elevation/Depth (m): 2242Range description: Pimoa delphinica is a stenoendemic species with a restricted Western Alpine distribution. The species is recorded in seven nearby localities, in the high Varaita valley. Its distribution range represents a small enclave (ca. 20 km2) within the range of distribution of the sister species P. graphitica Mammola, Hormiga & Isaia, 2016.Type status:Other material. Occurrence: recordedBy: Stefano Mammola, Alessandro Girodo; individualCount: 2; sex: female; lifeStage: adult, juvenile; Taxon: scientificName: Pimoadelphinica; kingdom: Animalia; phylum: Arthropoda; class: Arachnida; order: Araneae; family: Pimoidae; genus: Pimoa; specificEpithet: delphinica; scientificNameAuthorship: Mammola, Hormiga, Isaia, 2016; Location: country: Italy; stateProvince: Piedmont; county: CN; municipality: Casteldelfino; locality: Military bunker 1 near the road to Casteldelfino; verbatimElevation: 1280 m; minimumElevationInMeters: 1280; maximumElevationInMeters: 1280; locationRemarks: Abandoned military bunker (II World War); verbatimCoordinates: 44\u00b035'07.21\"N, 7\u00b004'40.02\"E; georeferenceProtocol: GPS; Identification: identifiedBy: Stefano Mammola, Marco Isaia; dateIdentified: 2016; Event: samplingProtocol: hand collected; eventDate: 12 Dec 2016; Record Level: basisOfRecord: PreservedSpecimenType status:Other material. Occurrence: recordedBy: Stefano Mammola, Alessandro Girodo; individualCount: 3; sex: female; lifeStage: adult, juvenile; Taxon: scientificName: Pimoadelphinica; kingdom: Animalia; phylum: Arthropoda; class: Arachnida; order: Araneae; family: Pimoidae; genus: Pimoa; specificEpithet: delphinica; scientificNameAuthorship: Mammola, Hormiga, Isaia, 2016; Location: country: Italy; stateProvince: Piedmont; county: CN; municipality: Casteldelfino; locality: Military bunker 2 near the road to Casteldelfino; verbatimElevation: 1288 m; minimumElevationInMeters: 1288; maximumElevationInMeters: 1288; locationRemarks: Abandoned military bunker (II World War); verbatimCoordinates: 44\u00b035'07.70\"N, 7\u00b004'40.15\"E; georeferenceProtocol: GPS; Identification: identifiedBy: Stefano Mammola, Marco Isaia; dateIdentified: 2016; Event: samplingProtocol: hand collected; eventDate: 12 Dec 2016; Record Level: basisOfRecord: PreservedSpecimenType status:Other material. Occurrence: recordedBy: Alessandro Girodo, Paolo Bertacco; individualCount: 2; sex: females; lifeStage: adults; Taxon: scientificName: Pimoadelphinica; kingdom: Animalia; phylum: Arthropoda; class: Arachnida; order: Araneae; family: Pimoidae; genus: Pimoa; specificEpithet: delphinica; scientificNameAuthorship: Mammola, Hormiga, Isaia, 2016; Location: country: Italy; stateProvince: Piedmont; county: CN; municipality: Casteldelfino; locality: Miniera di Casteldelfino, galleria Auriol (Borgata Ciampanesio); verbatimElevation: ca. 970 m; locationRemarks: Mineshaft; verbatimCoordinates: 44\u00b035'10.3\"N, 7\u00b007'06.6\"E; verbatimCoordinateSystem: WGS84; decimalLatitude: 44.5862; decimalLongitude: 7.1185; georeferenceProtocol: GPS; Identification: identifiedBy: Stefano Mammola, Marco Isaia; dateIdentified: 2016; Event: samplingProtocol: hand collected; eventDate: 16 Dec 2016; habitat: Subterranean; Record Level: basisOfRecord: PreservedSpecimenEOO (km2): 26Trend: UnknownJustification for trend: The species is troglophile (sensu Sket 2008), showing a preference for dark and moisty habitats. Yet, the species exhibits a moderate plasticity in its ecological requirements, being able to colonize both cave and extra-cave environments, such as forests in high altitude habitats. The distribution range of Pimoa delphinica is enclosed within the range of the more widespread P. graphitica, which is apparently competing with the former thus limiting its expansion . The subterranean habitats colonized by P. delphinica are as yet not threatened by direct human activities. However, biogeographic studies and genetic data suggested that past climate change determined strong contraction in the distribution ranges of the species of alpine Pimoa . It is thus plausible that anthropogenic climate change may determine reduction or habitat shift for this species. In order to confirm this hypothesis statistically, a deeper study of the detailed occurrence of this species in its distribution range is required.Causes ceased?: UnknownCauses understood?: UnknownCauses reversible?: UnknownExtreme fluctuations?: NoTrend: UnknownJustification for trend: See paragraph \"Extent of Occurrence\".Causes ceased?: UnknownCauses understood?: UnknownCauses reversible?: UnknownExtreme fluctuations?: NoAOO (km2): 12Number of locations: Trend: StableExtreme fluctuations?: NoNumber of individuals: Unknown.Trend: UnknownJustification for trend: No information about population size are currently available.Causes ceased?: UnknownCauses understood?: UnknownCauses reversible?: UnknownExtreme fluctuations?: NoPopulation Information (Narrative): A census of the population has never been attempted. According to our observations, populations are locally abundant. In two caves in which Pimoa delphinica was found in syntopy with the congeneric P. graphitica, mixed nuclear alleles between the two species have been found, indicating the existence of unidirectional introgression of males of P. graphitica into females of P. delphinica .Number of subpopulations: 2Trend: StableJustification for trend: Examining the known range of distribution and taking into account habitat connectivity, it is possible to identify two subpopulations within the range. The first subpopulation includes the localitites from Casteldelfino and the Bellino valley, which are more connected through alpine scree and larch woods, acting as potential route of dispersal. The other subpopulation is found on the other slope of the Varaita valley, in the nearby of the hamlet of Becetto . The subpopulation are as yet not threatened.Extreme fluctuations?: NoSevere fragmentation?: NoJustification for fragmentation: System: TerrestrialHabitat specialist: YesHabitat (narrative): The species primarily lives in the twilight zone of wild caves and other similar sheltered habitats, in high alpine environments . Healthy populations were also observed in artificial subterranean habitat (military bunkers and mines), offering suitable cool climatic conditions . Further individuals of P. delphinica were collected in pitfall traps placed within the rocky debris on the floor of the cellar of an abandoned cottage . During summertime, we observed juveniles\u2014tentatively classified as P. delphinica\u2014in an epigean environment, near the locus typicus , in a larch (Larix decidua) wood. Accordingly, it is possible that juveniles of P. delphinica may be able to disperse trough epigean habitats under suitable climatic condition. Extra-cave dispersal was also documented for the congeneric alpine species P. graphitica and P. rupicola, as justified by occasional catches of juveniles and males in pitfall traps placed in the leaf litter of broad-leaved woods at mid-altitudes .Trend in extent, area or quality?: StableHabitat importance: Major ImportanceHabitats: 7. Caves and Subterranean Habitats (non-aquatic)Habitat importance: MarginalHabitats: 1. ForestSize: Total length (leg excluded) = Male: 7 mm, Female: 10.5 mmGeneration length (yr): 1Dependency of single sp?: NoEcology and traits (narrative): Little is known about the ecology of Pimoa delphinica. We report the result of our sporadic observations, which are not supported by specific studies or statistical inference. Like other Pimoa species , P. delphinica exhibits a moderate ecological plasticity. In caves, it is found preferentially in the twilight zone. We observed adult males and females during the summertime. Adults display thanatotic behaviour when disturbed, possibly as a protection against predators . Depositions of cocoons occurs in July and cocoons are guarded by females. Females affix substrate particles to their cocoons .Justification for threats: See \"Extent of occurrence\".Threat type: FutureThreats: 11.1. Climate change & severe weather - Habitat shifting & alterationJustification for conservation actions: A portion of the distribution range of Pimoa delphinica falls within the border of the Natural Park \"Parco del Monviso\".The installation of information panels educating the visitors about this peculiar endemic species would positively increase the awareness of the caves as a natural heritage deserving protection.Conservation action type: In PlaceConservation actions: 2.1. Land/water management - Site/area managementConservation action type: NeededConservation actions: 4. Education & awarenessResearch needed: 1. ResearchJustification for research needed: Supplementary material 1PimoadelphinicaExtent of Occurrence of Data type: Geographic rangeFile: oo_102120.kmlMammola S., Hormiga G., Isaia M."}
{"text": "Scientific Reports6: Article number: 3578910.1038/srep35789; published online: 10212016; updated: 12232016The original version of this Article contained a typographical error in the name of the author Dan Zheng, which was incorrectly given as Zheng Dan. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Nature Communications8 Article number: 15909 ; DOI: 10.1038/ncomms15909 (2017); Published 06262017; Updated 07272017.An incorrect version of the Supplementary Information was inadvertently published with this Article where the wrong file was included. The Article has been updated to include the correct version of the Supplementary Information."}
{"text": "Scientific Reports7: Article number: 3997810.1038/srep39978; published online: 01052017; updated: 03092017This Article contains an error in the order of the Figures."}
{"text": "Scientific Reports6: Article number: 20077; 10.1038/srep20077 published online: 01292016; updated: 06302017.The original HTML version of this Article listed an incorrect volume number. This has now been corrected in the HTML version; the PDF version was correct at the time of publication."}
{"text": "Nature Communications8: Article number: 14014; DOI: 10.1038/ncomms14014 (2017); Published 01102017; Updated 05192017cains@hotmail.co.uk. The error has been corrected in the HTML and PDF versions of the Article.The original version of this Article contained an error in the email address of the corresponding author Sarah Cains. The correct email is"}
{"text": "Scientific Reports7: Article number: 4333810.1038/srep43338; published online: 02232017; updated: 04062017The original HTML version of this Article contained formatting errors in the \u201cGravimetric water (ice) content (%)\u201d row. The correct This error has been corrected in the HTML version of the Article; the PDF version was correct at the time of publication."}
{"text": "Scientific Reports6: Article number: 3337010.1038/srep33370; published online: 09262016; updated: 11242016This Article contains an incorrect version of Figure 4. The correct version of Figure 4 appears below as"}
{"text": "Nature Communications5: Article number: 3562; DOI: 10.1038/ncomms4562 (2014); Published online: 04152014; Updated: 04102018The original HTML version of this Article had an incorrect article number of 4562; it should have been 3562. This has now been corrected in the HTML; the PDF version of the Article was correct from the time of publication."}
{"text": "Nature Communications8: Article number: 15987; DOI: 10.1038/ncomms15987 (2017); Published: 07112017; Updated: 03132018In the original version of this Article, financial support was not fully acknowledged. The PDF and HTML versions of the Article have now been corrected to include the following:\u2018This work was supported by grant I10-0095 from the STARR foundation.\u2019"}
{"text": "In the original publication  one authWrong: Miro, ZupcicCorrect: Zupcic, Miro"}
{"text": "Scientific Reports6: Article number: 32096; 10.1038/srep32096 published online: 08242016; updated: 01192017.The original version of this Article contained a typographical error in the spelling of the author Kathleen Cheng, which was incorrectly given as Katherine Cheng. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications8: Article number: 14530; DOI: 10.1038/ncomms14530 (2017); Published 02212017; Updated 03212017The financial support for this Article was not fully acknowledged. The Acknowledgements should have included the following:The research was funded by a grant from the Medical Research Council (MR/N004299/1) and the German Research Foundation (DFG) through the priority programme 1608."}
{"text": "AbstractMantispidae are a distinctive group of Neuroptera known for the adults\u2019 possession of raptorial forelegs. There are four recognised, extant subfamilies of Mantispidae: the Mantispinae, Symphrasinae, Calomantispinae and Drepanicinae. The life history and larval behaviour of the subfamily Mantispinae is best known: the immatures are spider egg predators. Among the three remaining subfamilies, larval Symphrasinae and Calomantispinae most likely predate on other small arthropods, while the immature life history of Drepanicinae, until now, remained completely unknown.The Ditaxisbiseriata (Westwood), within a well-established Macadamia orchard in northern New South Wales, Australia. A female deposited fertile eggs, allowing this first report of egg batch and first instar morphology. The mass emergence of mobile pharate adults from the ground was observed in the same month in two consecutive years. The pharates climbed tree-trunks for a distance before undergoing eclosion. The newly-hatched first instar larvae are campodeiform and prognathous; a typical morphology among Mantispidae. After hatching, they drop to the ground and burrow into soil. They are unpigmented and appear to lack stemmata. Together, the observations infer that the immature component of the life cycle takes place underground in forested habitats. If this feature is common among the Drepanicinae, it might explain why so little is known of the biology of the immature stages.Here we provide observations of annual, near-synchronised, mass emergences of adults of the drepanicine,  Neuroptera is one of the most ancient orders of insects that show complete metamorphosis. Larvae are typically predaceous with elongate, slender mouthparts that are adapted for piercing and sucking , based on the raptorial forelimbs and elongated prothorax  have been reared in the laboratory on immature Lepidoptera, Hymenoptera and Coleoptera  between 11th and 16th September 2015. This appeared to have no effect on subsequent emergences of pharate adults.The study site was a th to 22nd September 2015 and from 17th to 24th September 2016. Mature adults and pharate adults were collected on and after 5th September 2015.Observations of adult eclosion were made between 5Some adults were kept in captivity (in petri dishes or insect containers) while others were killed and pinned. Pharate adults were preserved in ethanol.Both field and studio photographs were taken, with studio images being of both live and preserved specimens. To record larval morphology, ethanol-preserved first instars were washed in water and cleared in KOH before slide-mounting and photomicroscopy.For the timelapse observations of adult eclosion, a Canon EOS 60D dSLR camera with 100 mm macro lens was mounted on a tripod and focused on a pharate adult and 759 images were taken over a period of 43 minutes. The camera was controlled by an external remote control and a canon speedlite 580EX II was used to light the specimen. A video was produced comprising of all 759 images played at 25 frames per second.Type status:Other material. Occurrence: catalogNumber: JD1DB; recordedBy: James B Dorey; individualCount: 1; lifeStage: adult; associatedMedia: http://www.jamesdoreyphotography.com.au/Nonpublic-galleries/Mantispids/n-s3NpJH/; Taxon: taxonID: urn:lsid:biosci.ohio-state.edu:osuc_names:275502; scientificName: Ditaxisbiseriata; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Neuroptera; family: Mantispidae; genus: Ditaxis; Location: country: Australia; stateProvince: New South Wales; locality: Newrybar; verbatimElevation: 11 m; locationRemarks: label transliteration: \"Newrybar, NSW, 28\u02da43'52.0\"S 153\u02da33'18.8\"E, J.B.Dorey, 05/09/2015, JD1DB\"; verbatimCoordinates: 28\u02da43'52.0\"S 153\u02da33'18.8\"E; decimalLatitude: -28.731111; decimalLongitude: 153.555222; georeferenceProtocol: label; Identification: identifiedBy: Kevin Lambkin; dateIdentified: 2017; Event: samplingProtocol: sweeping; Record Level: language: en; collectionID: JD1DB; collectionCode: Insects; basisOfRecord: PreservedSpecimenType status:Other material. Occurrence: catalogNumber: JD2DB; recordedBy: James B Dorey; individualCount: 1; lifeStage: adult; associatedMedia: http://www.jamesdoreyphotography.com.au/Nonpublic-galleries/Mantispids/n-s3NpJH/; Taxon: taxonID: urn:lsid:biosci.ohio-state.edu:osuc_names:275502; scientificName: Ditaxisbiseriata; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Neuroptera; family: Mantispidae; genus: Ditaxis; Location: country: Australia; stateProvince: New South Wales; locality: Newrybar; verbatimElevation: 11 m; locationRemarks: label transliteration: \"Newrybar, NSW, 28\u02da43'52.0\"S 153\u02da33'18.8\"E, J.B.Dorey, 05/09/2015, JD2DB\"; verbatimCoordinates: 28\u02da43'52.0\"S 153\u02da33'18.8\"E; decimalLatitude: -28.731111; decimalLongitude: 153.555222; georeferenceProtocol: label; Identification: identifiedBy: Kevin Lambkin; dateIdentified: 2017; Event: samplingProtocol: sweeping; Record Level: language: en; collectionID: JD2DB; collectionCode: Insects; basisOfRecord: PreservedSpecimenType status:Other material. Occurrence: catalogNumber: JD3DB; recordedBy: James B Dorey; individualCount: 1; lifeStage: adult; associatedMedia: http://www.jamesdoreyphotography.com.au/Nonpublic-galleries/Mantispids/n-s3NpJH/; Taxon: taxonID: urn:lsid:biosci.ohio-state.edu:osuc_names:275502; scientificName: Ditaxisbiseriata; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Neuroptera; family: Mantispidae; genus: Ditaxis; Location: country: Australia; stateProvince: New South Wales; locality: Newrybar; verbatimElevation: 11 m; locationRemarks: label transliteration: \"Newrybar, NSW, 28\u02da43'52.0\"S 153\u02da33'18.8\"E, J.B.Dorey, 05/09/2015, JD3DB\"; decimalLatitude: -28.731111; decimalLongitude: 153.555222; georeferenceProtocol: label; Identification: identifiedBy: Kevin Lambkin; dateIdentified: 2017; Event: samplingProtocol: As pharat adult; Record Level: language: en; collectionID: JD3DB; collectionCode: Insects; basisOfRecord: PreservedSpecimenDitaxisbiseriata, is provided by A description of the subject of this study, Ditaxisbiseriata was distinguished from its sister species, Ditaxismeridiei, by characters of the adult vertex and colouration of the sclerites  and emergence was observed simultaneously in nearby regenerated rainforest, suggesting that emergence is highly seasonal over the local area, perhaps through detection of photoperiod or some attribute of their yet-unknown food source, and that the life cycle covers a single year. Further, the presence in rainforest as well as in a location within the orchard with high soil moisture, dense canopy cover and numerous epiphytes hints at a rainforest association. The much higher prevalence of emergence in the Macadamia orchard compared to nearby regenerating rainforest could be due to more favourable conditions in the Macadamia orchard. It is possible that the coordinated emergence of D.biseriata facilitates mating because at least one of the females collected at the site produced fertile eggs. The species might not just be associated with rainforest; reports suggest that it is also common at the same time of year in open eucalyptus forest.As far as the authors are aware, mass, near-synchronous emergence of mantispids is a previously unreported phenomenon. It is uncertain if the emergence in such large numbers is a natural occurrence or an artefact of monoculture farming. Adults and exuviae were observed in other local Mantispidae, pupation generally takes place within a silken cocoon in a concealed location and the pharate adults leave the cocoon and walk some distance away before eclosing  . Larval morphology was not detailed but it was noted that they lacked stemmata  . In one stemmata , an obsetispidae  and the rothidae . Comparitispinae , the ovetispinae . Distincrothidae , whose lrothidae . The antrothidae .D.biseriata are subterranean. If this life history was common to all or most Drepanicinae, it could explain the lack of historical knowledge about the immature stages of the subfamily. The larval diet remains unknown; they could be subterranean arthropod predators like the subfamilies Symphrasinae and Calomantispinae or spider-egg predators like their sister sub-family, Mantispinae. A clue, at least in this species, might lie in the apparent preference for moist soil and the rainforest association. Future studies could focus on taking soil samples in the orchard to determine what potential prey or host species are present and possibly to detect larvae or pupae in situ.Together, the behaviour and morphology of larvae, including their lack of stemmata, their tendency to drop from the egg and burrow into soil, and the subterranean origin of the pharate adults, support the premise that the larval and pupal stages of"}
{"text": "Scientific Reports7: Article number: 46474; 10.1038/srep46474 published online: 04122017; updated: 12222017.This Article contains errors in Figure 3 where the authors calculated the probability of survival instead of the probability of mortality. The correct"}
{"text": "Nature Communications5: Article number: 5446 ; DOI: 10.1038/ncomms6446 (2014); Published: 11172014; Updated: 08212017Because two of its three major findings have been invalidated, the authors wish to retract this Article3The symmetry error"}
{"text": "Scientific Reports6: Article number: 3701610.1038/srep37016; published online: 11212016; updated: 02152017The original version of this Article contained referencing errors, where multiple instances of reference 5 were incorrectly given as reference 1. The publishers regret introducing these errors during final typesetting.This has now been corrected in the HTML and PDF versions of this Article."}
{"text": "Nature Communications8 Article number:14632 ; DOI: 10.1038/ncomms14632 (2017); Published: 03082017; Updated: 03312017The original version of this Article contained an error in the spelling of post-transcriptional in the title of the paper. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 4112510.1038/srep41125; published online: 11242017; updated: 03162017The original version of this Article contained a typographical error in the spelling of the author Armand Bensussan which was incorrectly given as Armand Benssusan. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 2724810.1038/srep27248; published online: 06062016; updated: 09212016While this paper was under review, a correction was published to reference 17, which indicated that the reported dosage rate was incorrect. Therefore, points 2\u20134 in the Supplementary Information of this paper cannot explain the reported discrepancy in metabolic rates. The authors apologize for this oversight."}
{"text": "Scientific Reports7: Article number: 4081510.1038/srep40815; published online: 01192017; updated: 03232017The original version of this Article contained an error in the spelling of the author Xuan Qin, which was incorrectly given as Xun Qin. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 3134710.1038/srep31347; published online: 08112016; updated: 05112018In the original version of this Article, the Supplementary Information files containing the supplementary figure and datasets were omitted. This error has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 4504010.1038/srep45040; published online: 04282017; updated: 05262017The original version of this Article contained a typographical error in the spelling of the author Martin H. de Borst, which was incorrectly given as Martin de Borst. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 22834; 10.1038/srep22834 published online: 03092016; updated: 04262017.The Supplementary Information file originally published with this Article omitted Reference 1, and a number of equations contained errors. Therefore,now reads:now reads:now reads:These errors have been corrected in the Supplementary Information that now accompanies the Article."}
{"text": "Scientific Reports6: Article number: 36161; 10.1038/srep36161 published online: 11022016; updated: 01192017.The original version of this Article contained an error in the spelling of Fatemeh Seyednasrollah, which was incorrectly given as Fatemeh Seyednasrollah sadat.This has now been corrected in the HTML and PDF versions of this Article."}
{"text": "Nature Communications7 Article number:13702 ; DOI: 10.1038/ncomms13702 (2016); Published 12022016; Updated 02272017The financial support for this Article was not fully acknowledged. The acknowledgements should have included the following: The authors acknowledge Nano-Tera.ch for financial support."}
{"text": "Scientific Reports6: Article number: 1996810.1038/srep19968; published online: 01292016; updated: 04052017The original HTML version of this Article listed an incorrect volume number. This has now been corrected in the HTML version; the PDF version was correct at the time of publication."}
{"text": "Scientific Reports6: Article number: 29905; 10.1038/srep29905 published online: 10232016; updated: 10102016.In the Supplementary Information file originally published with this Article, Reference 1 was omitted. This error has now been corrected in the Supplementary Information that now accompanies the Article."}
{"text": "Scientific Reports6: Article number: 2330510.1038/srep23305; published online: 03162016; updated: 01122017In this Article there is a plotting error in Figure 1b and c, due to the data sorting technique. The correct figure appears below as"}
{"text": "Nature Communications8: Article number:15238; DOI: 10.1038/ncomms15238 (2017); Published: 05032017; Updated: 06272017An incorrect version of the Supplementary Information was inadvertently published with this Article. The HTML has now been updated to include the correct version of the Supplementary Information."}
{"text": "Scientific Reports7: Article number: 4015710.1038/srep40157; published online: 01142017; updated: 05312018In the Corrigendum published 28 April 2017, the author Schalk van der Merwe was incorrectly indexed. This error has now been corrected."}
{"text": "Nature Communications8: Article number:15559 ; DOI: 10.1038/ncomms15559 (2017); Published 05302017; Updated 07042017The original version of this Article contained an error in the email address of the corresponding author Daniel I. Simon. The correct email is Daniel.Simon@UHHospitals.org. The error has been corrected in the HTML and PDF versions of the article."}
{"text": "Scientific Reports7: Article number: 4334010.1038/srep43340; published online: 02272017; updated: 03282017The original version of this Article contained an error in the spelling of author Tian Jian Lu, which was given as Tian Jain Lu.This has now been corrected in the HTML and PDF versions of this Article."}
{"text": "Scientific Reports6: Article number: 39026; 10.1038/srep39026 published online: 12152016; updated: 01312017.The original version of this Article contained an error in the spelling of Sin-Hyeog Im, which was incorrectly given as Sin-Hyeog Lm. This has now been corrected in the PDF and HTML versions of this Article."}
{"text": "Scientific Reports7: Article number: 4364710.1038/srep43647; published online 03132017; updated on 04242017This Article contains an error in the legend of"}
{"text": "Scientific Reports7: Article number: 4552210.1038/srep45522; published online: 04032017; updated: 03192018Correction to: In the original version of this Article, the authors Maximilian P. J. de Courten and Barbora de Courten were incorrectly indexed. These errors have now been corrected."}
{"text": "Scientific Reports6: Article number: 3388010.1038/srep33880; published online: 09272016; updated: 12092016The original version of this Article contained a typographical error in the spelling of Jianfang Chen, which was incorrectly given as Jian Feng Chen.This has now been corrected in the HTML and PDF versions of the Article"}
{"text": "Scientific Reports6: Article number: 3386010.1038/srep33860; published online: 09202016; updated: 02172017The original version of this Article contained a typographical error in the spelling of the author Geoffrey R. Oxnard, which was incorrectly given as Geoffrey G. Oxnard.Additionally, the original version of this Article contained an error in Figure 4A, where an asterisk was omitted in error. The correct Figure 4 appears below as These errors have now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications7: Article number: 12554; DOI: 10.1038/ncomms12554 (2016); Published: 09132016; Updated: 11232017.x and y axis labels of the scatter graph were inadvertently inverted. This error has been corrected in both the PDF and HTML versions of the Article.The previously published version of this Article contained an error in Figure 1. In panel b the"}
{"text": "Nature Communications7: Article number: 12597; DOI: 10.1038/ncomms12597 (2016); Published: 08312016; Updated: 05032017The authors inadvertently omitted Christine H\u00e4ger, who was involved in the initial characterization of Notch mutant mice presented in this Article, from the author list and Author contributions statement. These errors have now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 2672010.1038/srep26720; published online: 06072016; updated: 10192016In this Article, there is an error in Figure 6. The arrows in the right-hand portion of the image are misplaced. The correct Figure 6 appears below as"}
{"text": "Scientific Reports6: Article number: 3953510.1038/srep39535; published online 12232016; updated on 04242017The original HTML version of this Article listed an incorrect volume number. This has now been corrected in the HTML version; the PDF version was correct at the time of publication."}
{"text": "Nature Communications7: Article number: 13660; DOI: 10.1038/ncomms13660 (2016); Published: 12162016; Updated: 04102018The original HTML version of this Article had an incorrect volume number of 8; it should have been 7. This has now been corrected in the HTML; the PDF version of the Article was correct from the time of publication."}
{"text": "Nature Communications8: Article number:14385 ; DOI: 10.1038/ncomms14385 (2017); Published: 02092017; Updated: 06012017In the original version of Supplementary Data 1 associated with this Article, the list of predicted enhancer-associated insertions was inadvertently truncated. The HTML has now been updated to include the correct version of the Supplementary Data 1."}
{"text": "Scientific Reports7: Article number: 41279; 10.1038/srep41279 published online: 02012017; updated: 08042017.In the original version of this Article, Supplementary Dataset 1 was omitted. This has been corrected in the HTML version of the Article; the PDF version was correct at the time of publication."}
{"text": "Scientific Reports7: Article number: 4517010.1038/srep45170; published online: 03242017; updated: 05222018This Article contains an error in Figure 7, where the arrows indicating the helical directions are inconsistent with Figure 2. The correct Figure 7 appears below as"}
{"text": "Nature Communications8: Article number: 14356; DOI: 10.1038/ncomms14356 (2017); Published: 02162017; Updated: 04182017The original version of this Article contained an error in the spelling of the author Carlos S. Moreno, which was incorrectly given as Carlos Moreno. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 3670210.1038/srep36702; published online: 11102016; updated: 01042017The original version of this Article contained errors. The publication date of the Article, 10th November 2016, was incorrectly listed as 10th October 2016.In addition, an incorrect version of There were typographical errors in formulas (1) and (2):now read:These errors have now been fixed in the HTML and PDF versions of this Article."}
{"text": "Scientific Reports7: Article number: 3989010.1038/srep39890; published online: 01042017; updated: 03302017This Article contains a typographical error in the Results and Discussion section. In should read:"}
{"text": "Nature Communications8: Article number: 15451 ; DOI: 10.1038/ncomms15451 (2017); Published 05162017; Updated 08232017The original version of this Article contained an error in the spelling of the author Leon Di Stefano, which was incorrectly given as Leon di Stephano. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Nature Communications8: Article number: 15519; DOI: 10.1038/ncomms15519 (2017); Published: 05302017; Updated: 02212018In the originally published version of this Article, reference 23 did not refer to the correct paper. This error has now been corrected in both the HTML and PDF versions of the Article."}
{"text": "Giant condyloma acuminata are associated with malignant transformation in up to 50% of cases, high recurrence rate, and poor prognosis. Treatment strategies have included wide local excision, abdominopelvic resection, and addition of radiotherapy and adjuvant and/or neoadjuvant systemic chemotherapy. Question\u2010Quiz: What is this condition and how should it be treated?Answer: A 53\u2010year\u2010old woman visited our gynecology emergency room complaining about a perianal mass, bleeding, and odor. Clinical examination revealed a giant mass originating from anorectum. Biopsy samples of the tumor were retrieved and sent for pathological examination. Results indicated a well\u2010differentiated squamous cell carcinoma on the ground of a giant  condyloma acuminata (Fig.\u00a0IKP: Obstetrician and Gynaecologist, Author: involved in primary handling of the patient in the emergency room; KM: Obstetrician and Gynaecologist, Co\u2010author: involved in primary handling of the patient in the emergency room. GI: Oncology Radiologist, Member of the multidisciplinary oncological team: was responsible for radiation therapy received by the patient; DX: Oncology Radiologist: was responsible for radiation therapy received by the patient; VK: Surgeon, Member of the multidisciplinary oncological team: reviewed the manuscript; TMS: Surgeon, Director of the Surgical Department. ET: Obstetrician and Gynaecologist, Director of the Gynaecology Oncological Department. TMS and ET: were members of the multidisciplinary oncological team.None declared."}
{"text": "Scientific Reports5: Article number: 1338610.1038/srep13386; published online: 08252015; updated: 08112018In the original version of this Article, the Supplementary Information file containing the derivation for individual payoffs was omitted. This error has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 42845; 10.1038/srep42845 published online: 02202017; updated: 12222017.The original version of this Article contained an error in the spelling of the author Yuuki Imai, which was incorrectly given as Yu-ki Imai.This error has now been corrected in the PDF and HTML versions of the Article, and in the accompanying Supplementary Information."}
{"text": "Scientific Reports5: Article number: 992110.1038/srep09921; published online: 04212015; updated: 03192018Correction to: The original version of this Article contained a typographical error in the volume number \u20185\u2019 was incorrectly given as \u20184\u2019. This error has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 16922; 10.1038/srep16922 published online: 11202015; updated: 02212017.www.qzbiotech.com.The export of human derived tissues and related materials from China is currently subject to regulatory restrictions. Consequently, we are unable to share the human cell line described in this paper with researchers outside of China at the present time. However, scientists within China who wish to use this cell line for research only may obtain them from the following company: Cellular Biotech. Inc."}
{"text": "The database includes the results from a geochemical and behavioral analysis of obsidian artifacts and debitage in the article entitled \u201cObsidian Procurement and Distribution in the Northwestern Maya Lowlands during the Maya Classic, a Regional Perspective\u201d   Specifications TableValue of the data\u2022The data summarizes the statistical results from the behavioral analysis of all the artifacts analyzed.\u2022The data illustrates the raw results from the EDXRF study of each artifact, which can be compared and used for similar studies.\u2022The data complements similar comparative studies with analogous methodologies and techniques.1The 2Every artifact was analyzed using a behavioral analysis of the formal attributes and physical characteristics Ti: TitaniumMn: ManganeseFe: IronZn: ZincRb: RubidiumSr: StrontiumY: YttriumZr: ZirconiumNb: NiobiumPb: LeadTh: ThoriumB1S1: nomenclature given to each artifact: B (Bag number) and S (Sample number).RGM1: Rhyolite, Glass Mountain Sample 1."}
{"text": "Scientific Reports5: Article number: 1247010.1038/srep12470; published online: 07272015; updated: 01082018In this Article, figure 1 contains errors. Errors were made during the preparation of figure 1: the same HylD blot was accidentally used in figures 1 and 2. The correct"}
{"text": "Scientific Reports7: Article number: 4384610.1038/srep43846; published online: 03072017; updated: 04272017In the Supplementary Information file originally published with this Article, Supplementary Tables 1 and 2 were omitted. This error has been corrected in the Supplementary Information that now accompanies the Article."}
{"text": "Scientific Reports6: Article number: 28680; 10.1038/srep28680 published online: 07062017; updated: 09062017.In the original version of this Article, the Supplementary Software files were omitted. This has been corrected in the HTML version of the Article; the PDF version was correct at the time of publication."}
{"text": "Scientific Reports6: Article number: 34879; 10.1038/srep34879 published online: 10172016; updated: 01192017.The original version of this Article contained an error in the spelling of the author Peter Guttmann, which was incorrectly given as Peter Guttermann.This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 19007; 10.1038/srep19007 published online: 01082016; updated: 02212017.The original version of this Article contained an incorrect version of Supplementary Table S7. This error has now been corrected in the HTML version of this Article; the PDF version was correct at the time of publication."}
{"text": "The new and evolving technologies of laser spectroscopy, laser cooling and trapping of atoms as well as squeezed states will have a dramatic impact on this area of metrology. While these topics have received a great deal of attention in their own right, there has not been a forum in which their impact on the field of fundamental measurements has been specifically addressed. For this reason, the National Bureau of Standards hosted a workshop on \u201cFundamental Measurements on Optically Prepared Atoms\u201d on September 29\u201330, 1986.Measurements of our fundamental scaling parameters . The second session dealt mainly with the kinetic state or velocity of atoms. Demonstration of highly efficient new laser-cooling techniques based on stimulated processes as well as spontaneous emission and speculation on what may be possible with ultra-cold atoms made for a very lively and exciting session. The idea that an atom placed in a box and cooled to a temperature so low that the deBroglie wavelength is long compared to atomic dimensions might lead to confinement with almost no perturbation from encounters with the walls. If verified experimentally, this idea could have profound consequences for precision measurements.The third session dealt with the limits to measurement accuracy as we understand them today and how those limits come into play with the new spectroscopic and cooling techniques. The last session dealt with an important applied field: the use of optically prepared atoms in frequency standards. Since frequency standards have many orders of magnitude more precision and accuracy than any other standard, they represent a great testing ground for the concepts discussed during the workshop.The workshop was attended by 45 people. Seven countries were represented with 40% of the attendees from outside the United States. Twenty-seven papers were presented in the four half-day sessions, which had to be augmented with an evening session to accommodate the lively discussion that followed most of the papers. The format of informal talks with no subsequent publication of papers was designed to encourage speculation and judging from the discussion during and following many of the talks, we were quite successful.A list of the workshops and talks follow:H. J. Kimble:Non-Classical Dynamics With Intra-Cavity AtomsP. Toschek:Absorption by the Numbers: Recent Spectroscopy of Trapped IonsD. McIntyre:Two-Photon Optical Ramsey Spectroscopy of Freely Falling AtomsL. Hunter:Search for an Electric Dipole Moment of the ElectronT. Bergeman:Proposed Application of Decelerated Atomic Beams to Observe Long-Lived (Interference Stabilized) Stark ResonancesS. A. Lee:Fast Beam Laser Spectroscopy: Present and FutureW. Fairbank:2 Reference Lines Near Hydrogen and Positronium Transitions at 4880\u00c5Precision Wavelength Measurement of TeS. Chu:Laser Cooling and Trapping of Atoms: Where are the Limits?C. Salomon:Cooling Atoms With Stimulated EmissionJ. Hall:Some Ideas About Experiments With Freely Falling AtomsW. Ertmer:Preparation of Cold Atoms for Precision MeasurementsW. Phillips:New and Future Experiments on Cooling and Trapping of Neutral AtomsF. Plumelle:+ IonsExperiments on Laser Cooled MgB. Jaduszliwer:Electron-Cesium Collisions With Optical State Preparation and AnalysisJ. Bahns:On Containerless Condensation of \u201cMirror\u201d MatterD. Wineland:Fundamental Limits to Spectroscopic AccuracyJ. S. Boulanger:Requirements for Evaluatable EnvironmentsJ. Shirley:Majorana Effects in Atomic BeamsA. DeMarchi:Does Spin Exchange Limit the Density of Neutral Vapors for Accurate Measurements?G. Hanes:Candidate Ions for Extended Observation PeriodsR. Douglas:Multiphoton Ionization for Atom-State Detection or State PreparationG. Theobald:Detailed Studies of Cesium Beam Optical Pumping; Applications to an Atomic ClockJ.-L. Picqu\u00e9:Laser Cooling and Optically Pumped Cesium Beam Frequency StandardsA. Clairon:The LPTF Optically Pumped Cesium Frequency StandardR. Drullinger:Design of the NBS Optically Pumped Frequency StandardM. Ohtsu:87Rb Atomic ClocksUltrahigh Sensitive Frequency Discrimination in Diode Laser Pumped H. Robinson:The Temperature Dependence of the Wall Shift in Some Evacuated Rb Cells"}
{"text": "Nature Communications8: Article number: 14864; DOI: 10.1038/ncomms14864 (2017)); Published: 03282017; Updated: 04252017The original version of this Article contained a typographical error in the spelling of the author Beifang Niu, which was incorrectly given as Beifung Niu. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 27452; 10.1038/srep27452 published online: 06102016; updated: 09012016.The original version of this Article contained a typographical error in the spelling of the author Muhammad Sahimi, which was incorrectly given as Muhammad Sahim. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications7: Article number: 13176; DOI: 10.1038/ncomms13176 (2017); Published 10192016; Updated 02222017y axis in In this article, there are errors in the labelling of the"}
{"text": "There is an error in the first sentence of the fourth paragraph of the results section. The correct sentence is as follows: The relationships between experiential avoidance, coping functions and demographic/ contextual factors were explored (see Table 3).The last paragraph of the Limitations section is incorrect. The correct paragraph is as follows: Notwithstanding these limitations, the study offers novel insight into the relationship between self-harm, experiential avoidance and coping function, expanding on the existing literature to consider the recency and frequency of self-harm engagement.There are errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: EN KS ET. Performed the experiments: EN. Analyzed the data: EN KS ET. Wrote the paper: EN KS ET."}
{"text": "Scientific Reports6: Article number: 20029; 10.1038/srep20029 published online: 01292016; updated: 06302017.The original HTML version of this Article listed an incorrect volume number. This has now been corrected in the HTML version; the PDF version was correct at the time of publication."}
{"text": "Nature Communications7: Article number: 12185; DOI: 10.1038/ncomms12185 (2016); Published: 07152015; Updated: 11222016The GEO accession number provided in this article is incorrect; the correct number is GSE74893."}
{"text": "Scientific Reports6: Article number: 3949310.1038/srep39493; published online: 12222016; updated: 04052017This Article contains an error in the order of the Figures, where Figures 2 and 3 were inverted. The correct"}
{"text": "Nature Communications7: Article number: 1253710.1038/ncomms12537 (2016); Published: 07272016; Updated: 09022016In Fig. 6 of this article, the division between the zincblende and wurtzite phases is misplaced in the low temperature range. The correct version of Fig. 6 appears below as"}
{"text": "Nature Communications8: Article number: 15933; DOI: 10.1038/ncomms15933 (2017); Published 06212017; Updated 07172017The original version of this Article contained an error in the spelling of the author Denis Gebauer, which was incorrectly given as Denis Gebaue. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 42262; 10.1038/srep42262 published online: 02102017; updated: 08292017.This article was published twice in error during a change in production systems. The publisher apologizes to the authors and readers for the error. When citing this work, please refer to the original version.1"}
{"text": "Scientific Reports6: Article number: 39104; 10.1038/srep39104 published online: 12202016; updated: 03072017.The original version of this Article contained an error in the spelling of the author Karina Dolgilevica, which was incorrectly given as Karina Dolgevica.This error has now been corrected in the HTML and PDF versions of this Article."}
{"text": "Scientific Reports6: Article number: 3223310.1038/srep32233; published online: 08302016; updated: 06042018A Supplementary Information file containing Appendices A and B was omitted from the original version of this Article. This has been corrected in the HTML version of the Article; the PDF version was correct at time of publication."}
{"text": "Nature Communications8: Article number: 15875 ; DOI: 10.1038/ncomms15875 (2017); Published 06202017; Updated 12222017In Fig. 2 of the original Article, information indicating the extent of the lagged correlations between low-passed and detrended time series was inadvertently omitted during the production process. The correct version of this figure appears below as"}
{"text": "Scientific Reports7: Article number: 3870610.1038/srep38706; published online: 01312017; updated: 03142017The Acknowledgements section in this Article was omitted. The Acknowledgements should read: \u201cThis work was supported by the National 863 Hi-tech Project (2015AA033703), National Natural Science Foundation of China  and Specialized Research Fund for the Doctoral Program of Higher Education (NO. 20120071110067)\u201d."}
{"text": "Nature Communications7: Article number: 13542; DOI: 10.1038/ncomms13542 (2016); Published: 12062016; Updated: 01052017The original version of this Article contained an error in the spelling of the author Tommaso Poggioli, which was incorrectly given as Tommaso Pogglioli. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 46314; 10.1038/srep46314 published online: 04102017; updated: 08242017.The original version of this Article contained an error in the spelling of the author Minseop Byun, which was incorrectly given as Minsueop Byun.This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 2899510.1038/srep28995; published online: 07142016; updated: 09022016The original version of this Article contained a typographical error in the spelling of the author Sophie Petropoulos, which was incorrectly given as Sophie Petropoulous. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 3632310.1038/srep36323; published online: 11032016; updated: 04052017The original version of this Article contained errors in the spelling of the author Sharon Baumel-Alterzon, which was incorrectly given as Sharon Alterzon-Baumel. These errors have now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 2393410.1038/srep23934; published online: 03312016; updated: 12072016; updated: 11102017; updated: 03202018et al. PLoS Comp. Biol. [2014]) of this Article introduced a feature set called gapped k-mer for regulatory sequence prediction; this Article applied these gapped k-mer features to recombination spot identification, and a computational predictor was constructed for recombination spot identification.This Article reports an application of methodology originally reported in Reference 33 to recombination spot identification. Reference 33 (Ghandi, M. The original and corrected versions of the Article include ambiguous sentences and textual overlap without adequate attribution, which failed to give due credit to the authors of Reference 33. The original and corrected versions of the Article are therefore being retracted by the Editors. The authors do not agree with the retraction."}
{"text": "Scientific Reports6: Article number: 31703; 10.1038/srep31703 published online: 08172016; updated: 11082016.The original version of this Article contained a typographical error in the spelling of the author Xiaochun Wan, which was incorrectly given as Xiachun Wan. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 3786910.1038/srep37869; published online: 11292016; updated: 03162017This Article contains an error in the x-axis labelling of Figure 5. The correct Figure 5 appears below as"}
{"text": "Scientific Reports6: Article number: 2899410.1038/srep28994; published online: 07262016; updated: 09142016The original version of this Article contained a typographical error in the spelling of the author Liang Zhao, which was incorrectly given as Liang Zhaog. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 20010; 10.1038/srep20010 published online: 01292016; updated: 06302017.The original HTML version of this Article listed an incorrect volume number. This has now been corrected in the HTML version; the PDF version was correct at the time of publication."}
{"text": "Nature Communications7: Article number: 12752 ; DOI: 10.1038/ncomms12752 (2016); Published 09152016; Updated 11142016The financial support for this Article was not fully acknowledged. The acknowledgements should have included the following:Yorgo Modis, PhD was supported by a senior research fellowship from the Wellcome Trust, grant no. 101908/Z/13/Z."}
{"text": "Scientific Reports6: Article number: 30410; 10.1038/srep30410 published online: 07262016; updated: 12222014.In the Supplementary Information file originally published with this Article, Figures S8 and S12 were omitted.These errors have been corrected in the Supplementary Information file that now accompanies the Article."}
{"text": "Scientific Reports6: Article number: 20136; 10.1038/srep20136 published online: 01292016; updated: 06302017.The original HTML version of this Article listed an incorrect volume number. This has now been corrected in the HTML version; the PDF version was correct at the time of publication."}
{"text": "Nature Communications8: Article number: 15039; DOI: 10.1038/ncomms15039 (2017); Published: 04062017; Updated: 07062017The original version of the Supplementary Information attached to this Article did not contain Supplementary Figures 11\u201316 and Supplementary References. The HTML has now been updated to include a corrected version of the Supplementary Information file.Supplementary Figures and Supplementary References"}
{"text": "Nature Communications7: Article number: 13637 ; DOI: 10.1038/ncomms13637 (2016): Published 11242016; Updated 10092017.The original version of this Article contained an error in the email address of the corresponding author George Church. The correct email is gchurch@genetics.med.harvard.edu. The error has been corrected in the HTML and PDF versions of the Article."}
{"text": "Scientific Reports6: Article number: 2848310.1038/srep28483; published online: 06242016; updated: 09022016The original version of this Article contained an error in the spelling of the author Shuangchun Wen, which was incorrectly given as Shangchun Wen. This error has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 2345810.1038/srep23458; published online: 03212016; updated: 01082018The original version of this Article contained a typographical error in the spelling of the author Ghaith Aljayyoussi, which was incorrectly given as Ghaith Al Jayoussi. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 4634010.1038/srep46340; published online: 04192017; updated: 05262017The original version of this Article contained a typographical error in the spelling of the author Yeong Man Yu, which was incorrectly given as Yu Yeong Man. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 3530810.1038/srep35308; published online: 10182016; updated: 04102017This Article contains an error in Figure 4F of this Article. The immunoblot for GAPDH is incorrect. The correct Figure 4F appears below as"}
{"text": "Scientific Reports6: Article number: 26756; 10.1038/srep26756 published online: 06072016; updated: 12222017.Due to a technical error during the publication of the original version of this Article, the Supplementary Tables S2 and S3 were published in incomplete forms. These errors have been corrected in the Supplementary Information that now accompanies the Article."}
{"text": "Scientific Reports6: Article number: 3214810.1038/srep32148; published online: 08252016; updated: 03302017The original version of this Article contained a typographical error in the spelling of the author Shuijin Hu, which was incorrectly given as Shuijing Hu. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 45235; 10.1038/srep45235 published online: 03222017; updated: 12222017.The original version of this Article contained an incorrect link to the Breast Cancer Integrative Platform in the Abstract.http://omics.bmi.ac.cn/bcancer/).\u201d\u201cTo facilitate the identification of potential regulatory or driver genes, we present the Breast Cancer Integrative Platform .\u201d\u201cTo facilitate the identification of potential regulatory or driver genes, we present the Breast Cancer Integrative Platform (BCIP, This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "The following funding information is missing from the Funding section: Emerson Franchini was supported by FAPESP grant number: 2015/22315-9."}
{"text": "Scientific Reports7: Article number: 44248; 10.1038/srep44248 published online: 03162017; updated: 04062018.The original version of this Article contained an error in the indexing of the author Shaymaa Mohamed Mohamed Badawy. This error has now been corrected."}
{"text": "Scientific Reports6: Article number: 3475210.1038/srep34752; published online: 10132016; updated: 12232016In the PDF version of this Article, affiliations 2 and 3 are reversed; the HTML version of the Article was correct at the time of publication."}
{"text": "Scientific Reports6: Article number: 2565510.1038/srep25655; published online: 05192016; updated: 11022016This Article contains an error in Figure 3(B), where the Fermi distributions of the pumping path are incorrectly shaded black. The correct Figure 3 appears below as"}
{"text": "Scientific Data 4:170194 doi: 10.1038/sdata.2017.194 (2017); Published: 19 December 2017; Updated: 6 March 2018In the original version of the Data Descriptor the tables were presented in the incorrect order. This has now been corrected in the HTML and PDF versions."}
{"text": "AbstractInsecta, Lepidoptera), some of them under severe long term threats due to small sized habitats or climatic changes. In this contribution, we present the IUCN Red List profiles of 34 endemic moths to the Azorean archipelago, including species belonging to two diverse families: Noctuidae (11 species) and Crambidae (eight species). The objective of this paper is to assess all endemic Azorean moth species and advise on possible future research and conservation actions critical for the long-trem survival of the most endangered species.The few remnants of Azorean native forests harbour a unique set of endemic moths (Eupitheciaogilviata). Therefore, we suggest as future conservation actions: (1) a long-term species monitoring plan and (2) control of invasive species.Most species have a large distribution (i.e. 58% occur in at least four islands), very large extent of occurrence (EOO) and a relatively large area of occupancy (AOO). Only nine species are single-island endemics, three of them from Flores, three from S\u00e3o Miguel and one from Pico, S\u00e3o Jorge and Faial. Most of the species also experience continuing decline in habitat quality, number of locations and subpopulations caused by the ongoing threat from pasture intensification, forestry, invasive plant species and future climatic changes. The lack of new records may indicate that one of the species previously named is extinct ( Lepidoptera from the Azorean archipelago is still scarce and skewed towards the diurnal species of Rhopalocera , eight grass moths (Crambidae), three geometer moths (Geometridae), three Stathmopodidae, three ermine moths (Yponomeutidae), two snout moths or pyralid moths , one twirler moth or gelechiid moth (Gelechiidae), one leaf-miner moth (Gracillaridae), one plume moth (Pterophoridae) and one fungus moth or tineid moth (Tineidae), which represent the majority of families present in the Azores  provide updated information on the distribution, abundance and ecology for the 34 Azorean endemic moths; 2) identification of the major threats involving these species; 3) the evaluation of the species conservation profiles for all known Azorean endemic moth species.Azorean Biodiversity Portal and downloaded CSV files with the distribution of each species; iv) species images were obtained from specimens deposited in Coll. ZMUC (Credit: Anders Illum) and also from the repository available at the Azorean Biodiversity Portal, the most important source of information on Azorean biodiversity. Species distributions in the Azores were obtained from the list of Azorean biota  and using an approximation to the standard IUCN 2 km \u00d7 2 km cells (4 km2). Final maps with species distributions were produced using the IUCN standards with Google Earth (.kmz files).Prior to the calculation of area of occupancy (AOO) and extent of occurrence (EOO), the 500 m \u00d7 500 m cells obtained from Critical information on species threats and conservation were mostly obtained from Crambidae, which are important pollinators of the Azorean native forest  and Neomarianiaoecophorella  for presenting a low value of AOO. Five more species have an AOO and EOO decline, which present a low range between 1,950-8,900 km2 for EOO and 16-48 km2 for AOO. In addition to this, nine of these species have a very restricted distribution, occupying a unique island  and, therefore, they have a very small EOO and AOO. Amongst the analysed taxa, it should be noted that, for five species, only one individual is known , leaving one of the two sexes totally unknown. These species have low areas of occupation and are frequently restricted to a single patch of native forest. The lack of new records may indicate that one of the species previously named is extinct (Eupitheciaogilviata). In addition, many other species are in a critical conservation situation and actions should be taken with some urgency, namely the implementation of area-based management plans for those species distribution historical sites.We evaluated that 15 endemic species have an extent of occurrence (EOO) and area of occupancy (AOO) that is stable with a range of between 6,200-62,00 kmHadenaazorica Meyer & Fibiger, 2002; Phlogophorakruegeri Saldaitis & Ivinskis, 2006; Apameasphagnicola Wagner, 2014; Apamearamonae Wagner, 2015) challenges the notion that Lepidoptera are one of the most well studied taxonomic groups of insects in the Azores  and invasive species . Consequently, formal education and awareness is needed to allow future investments in habitat restoration of areas invaded by invasive plants or impacted by forestry and dairy-cow management, located mostly at mid elevations. The use of greatly magnified images (extreme macro photography) of Lepidoptera may be a successful strategy to inform the public about the ecological an aesthetical value of Azorean endemic moths (e.g. see Climate change is one of the prevailing threats across the world affecting numerous species and studies on some Azorean taxa show its negative effects, such as on Macaronesian bryophytes  and Azored areas  and theie.g. see  (Fig. 13Concerning the most threathened Azorean moth species, a community monitoring plan is also crucial to generate data for the development of species recovery plans. Monitoring every ten years using the BALA protocol will inform about habitat quality e.g. see .DiscussionSupplementary material 1Eudoniainterlinealis mapData type: Map Google EarthEudoniainterlinealis in the Azores islands.Brief description: Distribution of File: oo_174738.kmzAnja DanielczakSupplementary material 2Eudonialuteusalis mapData type: Map Google EarthEudonialuteosalis in the Azores islands.Brief description: Distribution of File: oo_174739.kmzAnja DanielczakSupplementary material 3Eudoniamelanographa mapData type: Map Google EarthEudoniamelanographa in the Azores islands.Brief description: Distribution of File: oo_174740.kmzAnja DanielczakSupplementary material 4Scopariaaequipennalis mapData type: Map Google EarthScopariaaequipennalis in Azores islands.Brief description: Distribution of File: oo_174741.kmzAnja DanielczakSupplementary material 5Scopariacarvalhoi mapData type: Map Google EarthScopariacarvalhoi in Azores islands.Brief description: Distribution of File: oo_174742.kmzAnja DanielczakSupplementary material 6Scopariacoecimaculalis mapData type: Map Google EarthScopariacoecimaculalis in Azores islands.Brief description: Distribution of File: oo_174743.kmzAnja DanielczakSupplementary material 7Scopariasemiamplalis mapData type: Map Google EarthScopariasemiamplalis in Azores islands.Brief description: Distribution of File: oo_174744.kmzAnja DanielczakSupplementary material 8Udeaazorensis mapData type: Map Google EarthUdeaazorensis in the Azores islands.Brief description: Distribution of File: oo_174745.kmzAnja DanielczakSupplementary material 9Brachmiainfuscatella mapData type: Map Google EarthBrachmiainfuscatella in Azores islands.Brief description: Distribution File: oo_174746.kmzAnja DanielczakSupplementary material 10Cyclophoraazorensis mapData type: Map Google EarthCyclophoraazorensis in the Azores islands.Brief description: Distribution of File: oo_174747.kmzAnja DanielczakSupplementary material 11Eupitheciaogilviata mapData type: Map Google EarthEupitheciaogilviata in Faial island.Brief description: Distribution of File: oo_174748.kmzAnja DanielczakSupplementary material 12Xanthorhoeinaequata mapData type: Map Google EarthXanthorhoeinaequata in the Azores islands.Brief description: Distribution of File: oo_174749.kmzAnja DanielczakSupplementary material 13Micrurapteryxbistrigella mapData type: Map Google EarthMicrurapteryxbistrigella in Azores islands.Brief description: Distribution of File: oo_174750.kmzAnja DanielczakSupplementary material 14Apamearamonae mapData type: Map Google EarthApamearamonae in Flores island.Brief description: Distribution of File: oo_174751.kmzAnja DanielczakSupplementary material 15Apameasphagnicola mapData type: Map Google EarthApameasphagnicola in Azores islands.Brief description: Distribution of File: oo_174752.kmzAnja DanielczakSupplementary material 16Hadenaazorica mapData type: Map Google EarthHadenaazorica in S\u00e3o Jorge island.Brief description: Distribution of File: oo_174754.kmzAnja DanielczakSupplementary material 17Melanchragranti mapData type: Map Google EarthMelanchragranti in Azores islands.Brief description: Distribution of File: oo_174773.kmzAnja DanielczakSupplementary material 18Mesapameastorai mapData type: Map Google EarthMesapameastorai in Azores islands.Brief description: Distribution of File: oo_174755.kmzAnja DanielczakSupplementary material 19Noctuaatlantica mapData type: Map Google EarthNoctuaatlantica in Azores islands.Brief description: Distribution of File: oo_174756.kmzAnja DanielczakSupplementary material 20Noctuacarvalhoi mapData type: Map Google EarthNoctuacarvalhoi in Azores islands.Brief description: Distribution of File: oo_174757.kmzAnja DanielczakSupplementary material 21Phlogophoracabrali mapData type: Map Google EarthPhlogophoracabrali in Azores islands.Brief description: Distribution of File: oo_174758.kmzAnja DanielczakSupplementary material 22Phlogophorafurnasi mapData type: Map Google EarthPhlogophorafurnasi in Azores islands.Brief description: Distribution of File: oo_174759.kmzAnja DanielczakSupplementary material 23Phlogophorainterrupta mapData type: Map Google EarthPhlogophorainterrupta in Azores islands.Brief description: Distribution of File: oo_174760.kmzAnja DanielczakSupplementary material 24Phlogophorakruegeri mapData type: Map Google EarthPhlogophorakruegeri in Flores island.Brief description: Distribution of File: oo_174761.kmzAnja DanielczakSupplementary material 25Stenoptiliameyeri mapData type: Map Google EarthStenoptiliameyeri in S\u00e3o Miguel island.Brief description: Distribution of File: oo_174762.kmzAnja DanielczakSupplementary material 26Homoeosomamiguelensis mapData type: Map Google EarthHomoeosomamiguelensis in S\u00e3o Miguel island.Brief description: Distribution of File: oo_174763.kmzAnja DanielczakSupplementary material 27Homoeosomapicoensis mapData type: Map Google EarthHomoeosomapicoensis in Pico island.Brief description: Distribution of File: oo_174764.kmzAnja DanielczakSupplementary material 28Neomarianiaincertella mapData type: Map Google EarthNeomarianiaincertella in Flores island.Brief description: Distribution of File: oo_174765.kmzAnja DanielczakSupplementary material 29Neomarianiaoecophorella mapData type: Map Google EarthNeomarianiaoecophorella in Azores islands.Brief description: Distribution of File: oo_174766.kmzAnja DanielczakSupplementary material 30Neomarianiascriptella mapData type: Map Google EarthNeomarianiascriptella in Azores islands.Brief description: Distribution of File: oo_174767.kmzAnja DanielczakSupplementary material 31Eudarciaatlantica mapData type: Map Google EarthEudarciaatlantica in Azores islands.Brief description: Distribution of File: oo_174768.kmzAnja DanielczakSupplementary material 32Argyresthiaatlanticella mapData type: Map Google EarthArgyresthiaatlanticella in Azores islands.Brief description: Distribution of File: oo_174771.kmzAnja DanielczakSupplementary material 33Argyresthiaminusculella mapData type: Map Google EarthArgyresthiaminusculella in Azores islands.Brief description: Distribution of File: oo_174772.kmzAnja DanielczakSupplementary material 34Argyresthiapoecilella mapData type: Map Google EarthArgyresthiapoecilella in S\u00e3o Miguel island.Brief description: Distribution of File: oo_174769.kmzAnja Danielczak"}
{"text": "Nature Communications7: Article number: 12992; DOI: 10.1038/ncomms12992 (2016); Published: 10052016; Updated: 11082016The original version of this Article contained an error in the spelling of the author Tin-Lap Lee, which was incorrectly given as T.P. Lee. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Nature Communications7: Article number: 1219510.1038/ncomms12195 (2016); Published: 07202016; Updated: 08312016The original version of this Article contained an error in which the first affiliation was incorrectly given as \u2018CNRS, ICMCB, UPR 9048, Pessac 33600, France'. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 3642210.1038/srep36422; published online: 11102016; updated: 12092016The original version of this Article contained a typographic error in the spelling of Pranati Nayak, which was incorrectly given as Pranati Nayuk.This error has now been fixed in the HTML and PDF versions of this Article."}
{"text": "Scientific Reports7: Article number: 42627; 10.1038/srep42627 published online: 02152017; updated: 04062018.The original PDF version of this Article contained an error in the order of corresponding authors. This has now been corrected in the PDF version of this Article; the HTML version was correct from the time of publication."}
{"text": "Nature Communications7: Article number: 13526; DOI: 10.1038/ncomms13526 (2016); Published: 11242016; Updated: 01182017In Fig. 4c of this Article, the colour bars were inadvertently changed from graded to solid during the production process. The correct version of Fig. 4c appears below as"}
{"text": "Scientific Reports6: Article number: 2592910.1038/srep25929; published online: 05162016; updated: 12232016In Supplementary Information published with this Article, the authors omitted Table S10, which contains information pertaining to the primers used in qRT-PCR. The correct"}
{"text": "Nature Communications8: Article number: 14095; DOI: 10.1038/ncomms14095 (2017); Published: 01242017; Updated: 08302017.The authors inadvertently omitted Eltyeb Abdelwahid, who contributed to the generation of animal models and their initial evaluation, from the author list. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Nature Communications8: Article number:15308; DOI: 10.1038/ncomms15308 (2017); Published: 05182017; Updated: 06162017The original version of this Article contained an error in the spelling of the author Zemin Zhang, which was incorrectly given as Zeming Zhang. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Nature Communications7: Article number: 13867; DOI: 10.1038/ncomms13867 (2016); Published 12222016; Updated 02072017The original version of this Article contained an error in the spelling of the author Yih-Leong Chang, which was incorrectly given as Yi-Liang Chang. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 3156710.1038/srep31567; published online: 08162016; updated: 03162017In this Article, the Gene Expression Omnibus (GEO) accession number for the RNA sequencing data was incorrectly given as GSE77446. The correct accession number is GSE77466."}
{"text": "Scientific Reports6: Article number: 3573210.1038/srep35732; published online: 10212016; updated: 11292016The original version of this Article contained typographical errors in the spelling of the author Yong Ryoul Yang which was incorrectly given as Yong Ryul Yang.These errors have now been corrected in the PDF and HTML versions of this Article."}
{"text": "Scientific Reports6: Article number: 2092710.1038/srep20927; published online: 02182016; updated: 09232016The original version of this Article contained a typographical error in the spelling of the author E. Gazquez, which was incorrectly given as E. Gazguez. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 3981010.1038/srep39810; published online: 01052017; updated: 06072017This Article contains an error in Figure 3B where the y-axis label of the scale bar is missing. The correct Figure 3 appears below as"}
{"text": "Scientific Reports7: Article number: 44797; 10.1038/srep44797 published online: 03202017; updated: 06162017.In the HTML version of this Article, Figure 6 was incorrect. The correct Figure 6 appears below as This error has been corrected in the HTML version of the Article; the PDF version was correct at the time of publication."}
{"text": "Nature Communications7: Article number: 12494; DOI: 10.1038/ncomms12494 (2016); Published 08122016; Updated 12062016In Fig. 7a of this article, the structure of the intermediate compound was inadvertently misdrawn during the production process. The correct version of Fig. 7 appears below as"}
{"text": "Scientific Reports5: Article number: 1285910.1038/srep12859; published online: 08052015; updated: 03092017This Article contains an error in the order of the"}
{"text": "Scientific Reports7: Article number: 3976410.1038/srep39764; published online: 01042017; updated: 02172017In the Supplementary Information file originally published with this Article, Supplementary Table 1 was omitted. This error has now been corrected in the Supplementary Information that now accompanies the Article."}
{"text": "Nature Communications7: Article number: 1267210.1038/ncomms12672 (2016); Published: 08312016; Updated: 1005201621.'In the originally published version of the Article, an incorrect reference number was cited. The final sentence of the first paragraph of the Introduction section should read: \u2018The likely reasons are technical difficulties in generating atomic size electron vortex beams, together with fine control of their resulting orbital angular momentum in the case of electron vortex beams, and a low EMCD signal fraction in the case of astigmatic beams"}
{"text": "Scientific Reports6: Article number: 2298510.1038/srep22985; published online: 03092016; updated: 01122017This Article contains a typographical error in the name of fluorescence dye for the mutant LNA probe in"}
{"text": "Nature Communications8 Article number: 16017 ; DOI: 10.1038/ncomms16017 (2017); Published: 07062017; Updated: 08072017.The financial support for this Article was not fully acknowledged. The Acknowledgements should have included the following:This work was supported by a Nanken-Kyoten grant from Tokyo Medical and Dental University (TMDU)."}
{"text": "Nature Communications7: Article number: 10144; DOI: 10.1038/ncomms10144 (2016); Published: 01112016; Updated: 11162017This Article contains an error in Fig. 4. Figure 4b shows the structure of the rhodamine dye Alexa488, not the Alexa555 used in this work. The structure of Alexa555 is not known."}
{"text": "Scientific Reports7: Article number: 4657810.1038/srep46578; published online: 04132017; updated: 05262017The original version of this Article incorrectly included the following text in the Methods section:\u201cStatistical analyses on volunteers and ELISAs, BAM files and reference genomes for genome assemblies, genome fragments too short for inclusion in GenBank, BEAST inputs and outputs, TempEst inputs and outputs and pipeline Perl scripts, are available from: doi://10.17635/lancaster/researchdata/111\u201d.This now appears in a Data Availability section in the PDF and HTML versions of the Article."}
{"text": "Nature Communications8: Article number: 14482; DOI: 10.1038/ncomms14482; published: 02172017; Updated: 03222017The original version of this Article contained a typographical error in the spelling of the author Omid Kavehei, which was incorrectly given as Omid Kevehei. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 4266610.1038/srep42666; published online: 02202017; updated: 03232017The original version of this Article contained a typographical error in the spelling of the author H. B. Zhuo, which was incorrectly given as H. B. Zhou. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 20069; 10.1038/srep20069 published online: 01292016; updated: 06302017.The original HTML version of this Article listed an incorrect volume number. This has now been corrected in the HTML version; the PDF version was correct at the time of publication."}
{"text": "Scientific Reports5: Article number: 994210.1038/srep09942; published online: 04232015; updated: 03012018The Acknowledgements section in this Article was omitted. The Acknowledgements section should read:\u201cKhashayar Khoshmanesh acknowledges the Australian Research Council for funding under the Discovery Early Career Researcher Award (DECRA) scheme (Project No. DE120101402).\u201d"}
{"text": "Nature Communications8: Article number: 14778; DOI: 10.1038/ncomms14778 (2017); Published: 03162017; Updated: 05242017In Fig. 5 of this Article, the image in the centre column for [111] incorrectly replicates the image above. The correct version of Fig. 5 appears below as"}
{"text": "Scientific Reports6: Article number: 2982510.1038/srep29825; published online: 07192016; updated: 09302016The original version of this Article contained a typographical error in the spelling of the author Masayasu Nagoshi, which was incorrectly given as Masayasu Yagoshi. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 33784; 10.1038/srep33784 published online: 09282016; updated: 11212016.The original version of this Article contained errors in the spelling of the author Joydeep Das, which was incorrectly given as Das Joydeep.These errors have now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 4507910.1038/srep45079; published online: 03242017; updated: 05042017The original version of this Article contained a typographical error in the spelling of the author Jin-Beom Kwon, which was incorrectly given as Jin-Beon Kwon. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports5: Article number: 1669710.1038/srep16697; published online: 11162015; updated: 09142016The original Supplementary Information file published with this Article was incorrect. This version included errors in the \u2018Calculation of Phonon Coherent Length (CL) in Si/Ge SNW and H-SNW\u2019 section and a number of typographical errors. The correct Supplementary Information file now accompanies the Article."}
{"text": "Scientific Reports7: Article number: 3964710.1038/srep39647; published online: 01032017; updated: 03162017The SBML models provided in the original Supplementary Information files published with this Article contained formatting errors. These errors have been corrected in the Supplementary Information files that now accompany the Article."}
{"text": "Nature Communications7: Article number: 10525; DOI: 10.1038/ncomms10525 (2016); Published: 01222016; Updated: 11172016The authors wish to add \u2018Mads H. Ribergaard' and \u2018John Mortensen' to the author list of this Article for the provision of oceanographic data. This has now been updated in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 4127510.1038/srep41275; published online: 01302017; updated: 04052017In the original version of this Article, Affiliation 1 was incomplete. The correct affiliation is listed below.Institute of Geographic Sciences and Natural Resources Research, Chinese Academy of Sciences, Beijing 100101, China.These errors have been corrected in both the HTML and PDF versions of the Article."}
{"text": "Scientific Reports6: Article number: 2650810.1038/srep26508; published online: 05242016; updated: 09212016This Article contains discrepancies between the HTML and PDF versions of Figures 14 and 15. The correct Figures 14 and 15, with their accompanying legends appear below as"}
{"text": "Scientific Reports6: Article number: 3277710.1038/srep32777; published online: 09082016; updated: 11102016.The original version of this Article contained a typographical error in the spelling of the author Sebastien Magnifico, which was incorrectly given as Sebastien Magifico. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 3684110.1038/srep36841; published online: 11142016; updated: 01032017The original version of this Article contained an error in the name of the first author Mark Zeller which was incorrectly given as Jelle Matthijnssens. This error has now been corrected in the PDF and HTML versions of this Article."}
{"text": "In the Funding section, the grant number from the funder Medical Research Council (MRC) is listed incorrectly. The correct grant number is: MC_UU_12014/5."}
{"text": "Nature Communications8: Article number:15533 ; DOI: 10.1038/ncomms15533 (2017); Published 06052017; Updated 07042017The original version of this Article contained an error in the formatting of the author name Yang Shu, which was incorrectly given as Shu Yang. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 3186610.1038/srep31866; published online: 08182016; updated: 09212016The original version of this Article contained a typographical error in the spelling of the author Gholamreza Asadikaram, which was incorrectly given as Golamreza Asadikaram. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Nature Communications7: Article number: 11928 10.1038/ncomms11928 (2016); Published: 060162016; Updated: 09022016An incorrect version of the Supplementary Information was inadvertently published with this Article that contained errors in Supplementary Equations 18 and 19. The HTML has now been updated to include the correct version of the Supplementary Information."}
{"text": "Scientific Reports7: Article number: 4287410.1038/srep42874; published online: 02232017; updated: 04052017The original version of this Article contained a typographical error in the spelling of the author Tony D. James, which was incorrectly given as Tony James. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 37686; 10.1038/srep37686 published online: 11252016; updated: 05032017.In the Supplementary Information file originally published with this Article, Figure S3 was elongated and of poor quality. This error has been corrected in the Supplementary Information that now accompanies the Article."}
{"text": "Nature Communications7: Article number: 13660; DOI: 10.1038/ncomms13660 (2016); Published: 12162016; Updated: 02092017This Article was originally published with an incorrect publication date. The paper was due to be published on 3 Jan 2017, but due to an error was published earlier on the 16 Dec 2016. The publication date in both the PDF and HTML versions of the paper has been updated to reflect this."}
{"text": "Grants: R01AR045992 (MSM), R01AR062189 (MSM), R01AR052771 (MSM).The following information is missing from the Funding section: This study was funded through grants obtained from: National Institutes of Arthritis, Musculoskeletal and Skin Diseases (The publisher apologizes for the error."}
{"text": "The grand challenge currently facing metabolomics is the expansion of the coverage of the metabolome from a minor percentage of the metabolic complement of the cell toward the level of coverage afforded by other post-genomic technologies such as transcriptomics and proteomics. In plants, this problem is exacerbated by the sheer diversity of chemicals that constitute the metabolome, with the number of metabolites in the plant kingdom generally considered to be in excess of 200 000. In this review, we focus on web resources that can be exploited in order to improve analyte and ultimately metabolite identification and quantification. There is a wide range of available software that not only aids in this but also in the related area of peak alignment; however, for the uninitiated, choosing which program to use is a daunting task. For this reason, we provide an overview of the pros and cons of the software as well as comments regarding the level of programing skills required to effectively exploit their basic functions. In addition, the torrent of available genome and transcriptome sequences that followed the advent of next-generation sequencing has opened up further valuable resources for metabolite identification. All things considered, we posit that only via a continued communal sharing of information such as that deposited in the databases described within the article are we likely to be able to make significant headway toward improving our coverage of the plant metabolome. Arabidopsis thaliana  forVisualization tools provide a simple means of representing and mapping metabolic changes in tools like PATHOS , PathWhiFew tools try to actually use mass spectra features to build the networks, which can also improve annotation of unknown compounds. MetaNetter  uses rawIt must be clear from previous sections that mass spectrometry\u2013based metabolomics, particularly metabolite annotation and data interpretation, relies heavily upon data from characterized mass spectra, molecular properties of analytes, and metabolic pathways. While all the different techniques offer a lot of flexibility, metabolomics struggles with standardization, and a great volume of metadata when compared with other omics techniques and still lags behind most of them in terms of public repositories of published data. Nonetheless, there is a wealth of databases with useful information for mass spectrometry\u2013based plant metabolomics, and we try to summarize some of the most relevant and the structure and functionalities of the resources available.Chemspider , PubChemThere are a few plant-specific databases with curated information on chemical composition and distribution across different plant species as well, namely KNApSAcK , with inDatabases that provide mass spectra of pure compounds under controlled conditions developed to allow searching for common spectra features for the identification of unknown compounds are an essential resource for MS-based identification of metabolites. As previously mentioned, the great stability and reproducibility of GC-MS generates reliable fragmentation patterns and relative retention indexes that are very efficient for metabolite annotation by spectra matching. NIST is a very popular commercial library for GC-MS annotation that also provide free access to some data through NIST Chem WebBook , contain++. Metabolite Link (METLIN) [in silico MS/MS data. Additionally, over 14 000 metabolites were analyzed, and mass spectra at multiple collision energies in positive and negative ionization mode obtained. METLIN also integrates isoMETLIN [in silico libraries from different sources. The search is limited to name, compound class, molecular formula, or exact mass of the metabolite. It can be filtered by type of spectra, and the results are presented as a single list of individual interactive spectra next to the metadata, making it easy to navigate through different spectra. The great diversity of phytochemicals observed in plants represents an important portion of all these numbers, and a few plant-specific databases are available, such as Spektraris [One of the greatest efforts in the field of metabolomics has been directed to the development of databases of mass spectra obtained from LC-MS analysis. The higher flexibility of this technique compared to GC-MS in terms of the chemical space that it can analyze comes with the drawback of a high sensitivity to multiple factors that can influence mass spectra quality and reproducibility. LC-MS databases are usually characterized by the greatest volume of metadata that accompany the analytical data and a more complex structure for search based on spectra features when compared to GC-MS databases. Some large general LC-MS databases include MassBank , a publi(METLIN)  currentlsoMETLIN , which asoMETLIN  is a datsoMETLIN . FinallysoMETLIN  is intenektraris , an LC-Mektraris  is a verektraris  is a colektraris , a metabA very common issue encountered in data from mass spectrometry is the presence of a variety of contaminants from sample preparation and analysis that can be challenging for data interpretation. Mass Spectrometry Contaminant Database (MaConDa)  providesSolanum lycopersicum with information on annotated metabolites where the user can search for specific masses or a range of masses. The database is based on accurate mass, and the user therefore does not have access to raw data and chromatograms. Nicotiana attenuata Data Hub (NaDH) [Nicotiana attenuata including LC-MS data on 14 different tissues, allows searching for spectra based on name and m/z and provides some interesting tools for data interpretation that are easily accessible directly from the metabolite entry, including metabolite-metabolite and metabolite-gene coexpression analysis and visualization of metabolite expression across different tissues in a bar chart or eFP browser interface. Optimas-DW software [Compound spectra databases are essential for identification of metabolites by mass spectrometry, but a significant effort has also been directed toward the development of repositories of experimental data on specific samples to facilitate dereplication studies and data analysis. These databases are often restricted to specific species, as is the case for AtMetExpress , an LC-Mb (NaDH) , a platfsoftware  is a datsoftware , a metabsoftware , currentsoftware  is an MSsoftware  is a datsoftware  and currsoftware , a repossoftware  is a larsoftware  is a repsoftware  is a crosoftware  is a datsoftware , a plantReactome.org and 44 metabolic models in a standardized description of metabolites and reactions where all metabolites have matched synonyms, resolved protonation states, and are linked to unique structures, and all reactions are balanced.As previously mentioned, many resources that are particularly useful for data interpretation organize the data in pathways based on literature data, and often also provide tools for data visualization and interpretation. Many of these databases contain either generic pathways or combine different organisms. One example is KEGG , which iin silico databases that are extremely useful for de novo metabolite identification, such as Metabolic In Silico Network Expansion Databases (MINE) [In Silico MS/MS Database (ISDB) [in silico database of natural products generated using CFM-ID [Together with the development of many prediction tools previously mentioned, we watched in the last years the development of some interesting s (MINE) , a databs (MINE) , a databe (ISDB) , an in sg CFM-ID  with inpThe complexity of metabolomics data experiments, particularly in terms of sample number and metadata, pushed the development of many tools for experiment and metadata management, and while many of these functions are integrated in some of the databases previously discussed, there are a few specialized tools such as QTREDS  and MASTThe enormous amount of data available for metabolomics raises many questions regarding how to easily access and unify all this data, taking into account the vast chemical space explored in these experiments. Many tools have been developed with the purpose of facilitating access to chemical data spread in the literature, from the development of identifiers to reduce duplication of information such as Spectral Hash , designeDifferent vendors usually export their data in proprietary formats, which complicates data transfer across different platforms. Most proprietary software packages are able to convert files to .cdf format, but some tools, the most popular being msConverter from Proteowizard , can han++ [All equipment for mass spectrometry comes with its own software for data visualization and some basic analysis, but those are usually not designed to deal with the complexities of metabolomics datasets. There are some interesting open source alternatives such as BatMass  and Mass++  for data++ , which p++ , capableMass spectrometry imaging is a relatively young technique that has being growing fast in importance, providing high-resolution special distribution of small molecules in molecular histology . Few tooin silico generated lipids databases LipidHome [Lipidomics data require a very specialized pipeline, and therefore many tools were developed exclusively for this kind of analysis; however, we will only briefly summarize these here. Analysis of Lipid Experiments (ALEX) , MultiplipidHome , SwissLiipidHome  ,and ARAipidHome .Many of the resources presented here were fruit of the efforts of setting the theoretical background for each step in the data processing and analysis workflow. However, more recent efforts are moving toward the development of integrated tools, which are often developed by the integration of already well-established tools into a single pipeline in an attempt to accelerate the process and in a few cases providing an easier interface. XCMS online, for example, is a web platform providing most of the function from XCMS with additional capabilities for interactive exploratory data visualization and analysis in a much easier interface than the original software . HayStacIt is clear from this review the infinity of choices for performing a variety of functions and the fast pace by which they change and get outdated; hence it is an arduous task to keep updated on all of them. Some research groups, engaged in the development of metabolomics tools, have their own repositories like KOMICS , MetaOpeAdditional file 1.xls: summary of resources for mass spectrometry\u2013based metabolomics.In Silico MS/MS Database; KaPPA\u2013view: Kazusa Plant Pathway Viewer; KEGG: Kyoto Encyclopedia of Genes and Genomes; KMMDA: Kernel Machine Approach for Differential Expression Analysis of Mass Spectrometry\u2013Based Metabolomics Data; Komic Market: Kazusa Omics Data Market; kpath: Khaos Metabolic Pathways; LC: liquid chromatography; LDA: latent Dirichlet\u00a0allocation; LDA: lipid data analyzer; LIMS: Laboratory Information Management System; LIMSA: Lipid Mass Spectrum Analysis; LOBSTAHS: Lipid and Oxylipin Biomarker Screening Through Adduct Hierarchy Sequences; m/z: mass-to-charge ratio; MaConDa: Mass Spectrometry Contaminant Database; MAGMa: MS Annotation Based on In Silico Generated Metabolites; MAIT: Metabolite Automatic Identification Toolkit; MarVis-Suite: Marker Visualization Suite; MathDAMP: Mathematica Package for Differential Analysis of Metabolite Profiles; MAVEN: Metabolomic Analysis and Visualization Engine; MeKO: Metabolite Profiling Database for Knock-Out Mutants in Arabidopsis; MetCCS: Metabolite Collision Cross-Section Predictor; MET-COFEA: Metabolite Compound Feature Extraction and Annotation; MET-COFEI: Metabolite Compound Feature Extraction and Identification; MET-IDEA: Metabolomics Ion-Based Data Extraction Algorithm; METLIN: Metabolite Link; MetNetDB: Metabolic Network Exchange Database; MFSearcher: Molecular Formula Searcher; MIA: Mass Isotopolome Analyzer; MID: mass isotopomer distributions; MINE: Metabolic In Silico Network Expansion Databases; MI-Pack: Metabolite Identification Package; MMCD: Madison Metabolomics Consortium Database; MMSAT: Metabolite Mass Spectrometry Analysis Tool; MoNA: MassBank of North America; MPA-RF: Model Population Analysis\u2013Random Forests; MPEA: Metabolite Pathway Enrichment Analysis; MPMR: Medicinal Plant Metabolomic Resources; MRM: multiple reaction monitoring; MRM-DIFF: Multiple Reaction Monitoring\u2013Based Differential Analysis; MRMPROBS: Multiple Reaction Monitoring\u2013Based Probabilistic System; MS: mass spectrometry; MS/MS: tandem mass spectrometry; MS2T: MS/MS spectral tag; MS-DIAL: Mass Spectrometry\u2013Data Independent Analysis; MSFACT: Metabolomics Spectral Formatting, Alignment, and Conversion Tool; MUSCLE: Multi-Platform Unbiased Optimization of Spectrometry via Closed-Loop Experimentation; NaDH: Nicotiana attenuata Data Hub; NIST: National Institute of Standards and Technology; OpenMSI: Open Mass Spectrometry Imaging; PCA: principal component analysis; PlantMAT: Plant Metabolite Annotation Toolbox; PLS-DA: partial least squares discriminant analysis; PMR: Plant/Eukaryotic and Microbial Systems Resource; PRIMe: Platform for RIKEN Metabolomics; RAMSY: Ratio Analysis of Mass Spectrometry; ReSpect: RIKEN MSn Spectral Database for Phytochemicals; SDBS: Spectral Database for Organic Compounds; SIRIUS: Sum Formula Identification by Ranking Isotope Patterns Using Mass Spectrometry; SMART: Statistical Metabolomics Analysis\u2013An R Tool; SoyMetDB: Soybean Metabolome Database; SPICA: Selective Paired Ion Contrast; SPLASH: Spectral Hash; T3DB: Toxin and Toxin Target Database; UNPD: Universal Natural Product Database; VaLID: Visualization and Phospholipid Identification; VANTED: Visualization and Analysis of Networks Containing Experimental Data; yamss: Yet Another Mass Spectrometry Software.ADAP: Automated Data Analysis Pipeline for Untargeted Metabolomics; AIST: National Institute of Advanced Industrial Science and Technology; ALEX: Analysis of Lipid Experiments; AMDIS: Automated Mass Spectral Deconvolution And Identification System; ANOVA: analysis of variance; apLCMS: Adaptive Processing of High-Resolution LC-MS data; ARALIP: Arabidopsis acyl-lipid metabolism; ASCII: American Standard Code for Information Interchange; BKM-react: BRENDA-KEGG-MetaCyc reactions; BNICE: Biochemical Network Integrated Computational Explorer; CAMERA: Collection of Algorithms for Metabolite Profile Annotation; CDF: common data format; CFM-ID: Competitive Fragmentation Modeling for Metabolite Identification; ChEBI: Chemical Entities of Biological Interest; CID: collision-induced dissociation; cosmiq: combining single masses into quantities; COVAIN: Covariance Inverse; CRAN: Comprehensive R Archive Network; CSI: FingerID: compound structure identification: FingerID; CTS: Chemical Translation Service; DIA: data-independent acquisition; EIC: extracted ion chromatogram; EssOilDB: Essential Oil Database; EXIMS: Exploring Imaging Mass Spectrometry Data; FT: Fourier transform; FunRich: Functional Enrichment Analysis Tool; GC: gas chromatography; GNPS: Global Natural Products Social Molecular Networking; GUI: graphical user interface; HCS: hierarchical cluster analysis; HMDB: Human Metabolome Database; HRMS: high-resolution mass spectrometry; ICT: Isotope Correction Toolbox; IIS: Integrated Interactome System; iMet-Q: Intelligent Metabolomic Quantitation; IMPaLA: Integrated Molecular Pathway Level Analysis; InCroMAP: Integrated Analysis of Cross-Platform Microarray and Pathway Data; IOKR: Input Output Kernel Regression; iPATH: Interactive Pathways Explorer; IPO: Isotopologue Parameter Optimization; ISDB: GIGA-D-17-00039_Original_Submission.pdfClick here for additional data file.GIGA-D-17-00039_Revision-1.pdfClick here for additional data file.GIGA-D-17-00039_Revision-2.pdfClick here for additional data file.Response_to_Reviewer_Comments_Original-Submission.pdfClick here for additional data file.Reviewer_1_Report_.pdfClick here for additional data file.Reviewer_1_Report_(Revision-1).pdfClick here for additional data file.Reviewer_2_Report_.pdfClick here for additional data file.Additional FileClick here for additional data file."}
{"text": "Scientific Reports6: Article number: 20054; 10.1038/srep20054 published online: 01292016; updated: 06302017.The original HTML version of this Article listed an incorrect volume number. This has now been corrected in the HTML version; the PDF version was correct at the time of publication."}
{"text": "Nature Communications8: Article number: 14290; DOI: 10.1038/ncomms14290 (2017); Published: 01302017; Updated: 02202017The original version of this Article contained an error in the spelling of the author Rossella Marullo, which was incorrectly given as Rosella Marullo. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Nature Communications8: Article number: 14350; DOI: 10.1038/ncomms14350 (2017); Published: 02082017; Updated: 05252017The original version of this Article contained a typographical error in the first sentence of the abstract in which \u2018Shockley-Queisser' was incorrectly given as \u2018Schottky-Queisser'. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Scientific Reports7: Article number: 44277; 10.1038/srep44277 published online: 03102017; updated: 04062017.The Acknowledgements section in this Article is incomplete.The investigation of novel molecular mechanisms of antidepressants at cellular level\u201d.\u201cNeuroNova gGmbH, Munich provided financial support between 2011 and 2016 aiming at should read:The investigation of novel molecular mechanisms of antidepressants at cellular level. C.B. and L.M. thank the excellence clusters Nanosystems Initiative Munich (NIM) and the Center for Integrated Protein Science Munich (CIPSM) as well as the Center for Nanoscience Munich (CeNS)\u201d.\u201cNeuroNova gGmbH, Munich provided financial support between 2011 and 2016 aiming at"}
{"text": "Scientific Reports5: Article number: 1701410.1038/srep17014; published online: 11232015; updated: 12192016Supplementary Dataset S1 was omitted from the original version of this Article. This error has now been corrected."}
{"text": "Scientific Reports6: Article number: 20067; 10.1038/srep20067 published online: 01292016; updated: 06302017.The original HTML version of this Article listed an incorrect volume number. This has now been corrected in the HTML version; the PDF version was correct at the time of publication."}
{"text": "Scientific Reports6: Article number: 3247310.1038/srep32473; published online: 08312016; updated: 09262016.The original version of this Article contained a typographical error in the spelling of the author Mafalda Lopes da Silva which was incorrectly given as Silva Mafalda Lopes da. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 33706; 10.1038/srep33706 published online 09202016; updated: 10102016.The original version of this Article contained a typographical error in the spelling of the author Huafang Wan, which was incorrectly given as Huafan Wan. This has now been corrected in the PDF and HTML versions of the Article."}
{"text": "The following information is missing from the funding section: This study was supported by CNPq, Brazil, grant # 308216/2014-8 to CLVL."}
{"text": "There are errors in the Funding section. The correct funding information is as follows: This study was partially supported by a Grant-in-Aid from the Ministry of Education, Science, Sports, Culture and Technology, Japan, and partially supported by the National Natural Science Foundation of China (81460118-Dr. Shuohua Zhang). Dr. Al Shaimaa Hasan is supported by the joint supervision mission scholarship from the Ministry of Higher Education, Egypt. The funders played no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.There is a sentence missing after the fourth sentence of the third paragraph of the Introduction. The sentence should read: Furthermore, it has been recently demonstrated that CDCs limit acute injury by polarizing an effector macrophage population within the heart.A reference is omitted from the fourth sentence of the third paragraph of the Introduction, the second sentence of the fourth paragraph of the Introduction, and the second sentence of the third paragraph of the Discussion.10.1172/JCI81321.The reference is: de Couto G, Liu W, Tseliou E, Sun B, Makkar N, Kanazawa H, Arditi M, Marb\u00e1n E. Macrophages mediate cardioprotective cellular postconditioning in acute myocardial infarction. J Clin Invest. 2015;125:3147\u201362. doi: The fourth sentence of the third paragraph of the Introduction should read: Furthermore, it has been recently demonstrated that CDCs limit acute injury by polarizing an effector macrophage population within the heart .The second sentence of the fourth paragraph of the Introduction should read: Similar to previous study , results showed that CDCs-conditioned medium significantly promotes the macrophages to shift into a regulatory (M2) phenotype.The second sentence of the third paragraph of the Discussion should read: The immunomodulation property of MSCs has been demonstrated by previous studies, and a recent study has already demonstrated the potential role of CDCs for polarizing macrophages [18\u201321] .There are errors in the Author Contributions. The correct contributions are: Conceptualization: AH MAR SZ TL. Data curation: AH TL. Formal analysis: AH LL CY TZ YU SG MAR SMSZ TL. Funding acquisition: SZ TL. Investigation: AH LL CY TZ YU SG MAR SMSZ TL. Methodology: AH MAR SZ TL. Project administration: TL. Resources: AH LL CY TZ YU SG SZ TL. Software: LL CY YU SG. Supervision: TL. Validation: MAR SZ TL. Visualization: AH LL CY TZ YU SG MAR SMSZ TL. Writing\u2013original draft: AH TL. Writing\u2013review& editing: AH TL."}
{"text": "Scientific Reports6: Article number: 1790810.1038/srep17908; published online: 01192016; updated: 11112016The Supplementary Information file originally published with this Article omitted the PDB codes in Table S1. This error has now been corrected in the Supplementary Information file that accompanies the Article."}
{"text": "Nature Communications7: Article number: 13330 ; DOI: 10.1038/ncomms13330 (2016); Published 11022016; Updated 10092017.The original version of this Article contained an error in the email address of thecorresponding author George Church. The correct email isgchurch@genetics.med.harvard.edu. The error has been corrected in the HTML andPDF versions of the Article."}
{"text": "Scientific Reports6: Article number: 3249810.1038/srep32498; published online: 09012016; updated: 10242015The original version of this Article contained a typographical error in the spelling of the author Maryam Alaayedi, which was incorrectly given as Maryam Alayedi. This error has now been corrected in the PDF and HTML versions of the Article."}
{"text": "Scientific Reports6: Article number: 3082810.1038/srep30828; published online: 08262016; updated: 05022017In the original version of this Article, the author list for the \u201cTEDDY Study Group\u201d was incomplete.This has now been corrected in the PDF and HTML versions of this Article."}
{"text": "Scientific Reports6: Article number: 24105; 10.1038/srep24105 published online: 04072016; updated: 04052018.This article contains an error in Figure 2, where the same image was inadvertently shown in both panel (a) and (b). The correct"}
{"text": "Nature Communications8: Article number: 14024; DOI: 10.1038/ncomms14024 (2017); Published: 01192017; Updated: 03012017The present address for U. Sassi is incorrect in this Article. This author does not have a present address. The correct full affiliation details for this author are given below:Cambridge Graphene Centre, University of Cambridge, Cambridge CB3 0FA, UK."}
{"text": "Scientific Reports6: Article number: 35990; 10.1038/srep35990 published online: 10262016; updated: 12062016.The original version of this Article contained errors in the spelling of the author Md Sainur Samad, which was incorrectly given as M.d. Sainur Samad.These errors have now been corrected in the PDF and HTML versions of the Article."}
{"text": "Poorly understood but highly diverse microbial communities exist within anoxic and oxygen-depleted marine sediments. These communities often harbour single-celled eukaryotes that form symbiotic associations with different prokaryotes. During low tides in South-western British Columbia, Canada, vast areas of marine sand become exposed, forming tidal pools. Oxygen-depleted sediments within these pools are distinctively black at only 2-3 cm depth; these layers contain a rich variety of microorganisms, many of which are undescribed. We discovered and characterized a novel (uncultivated) lineage of heterotrophic euglenozoan within these environments using light microscopy, scanning and transmission electron microscopy, serial sectioning and ultrastructural reconstruction, and molecular phylogenetic analyses of small subunit rDNA sequences.Bihospites bacati n. gen. et sp. is a biflagellated microbial eukaryote that lives within low-oxygen intertidal sands and dies within a few hours of exposure to atmospheric oxygen. The cells are enveloped by two different prokaryotic episymbionts: (1) rod-shaped bacteria and (2) longitudinal strings of spherical bacteria, capable of ejecting an internal, tightly wound thread. Ultrastructural data showed that B. bacati possesses all of the euglenozoan synapomorphies. Moreover, phylogenetic analyses of SSU rDNA sequences demonstrated that B. bacati groups strongly with the Symbiontida: a newly established subclade within the Euglenozoa that includes Calkinsia aureus and other unidentified organisms living in low-oxygen sediments. B. bacati also possessed novel features, such as a compact C-shaped rod apparatus encircling the nucleus, a cytostomal funnel and a distinctive cell surface organization reminiscent of the pellicle strips in phagotrophic euglenids.B. bacati n. gen. et sp. Molecular phylogenetic analyses demonstrated that this species belongs to the Euglenozoa and currently branches as the earliest diverging member of the Symbiontida. This is concordant with ultrastructural features of B. bacati that are intermediate between C. aureus and phagotrophic euglenids, indicating that the most recent ancestor of the Symbiontida descended from phagotrophic euglenids. Additionally, the extrusive episymbionts in B. bacati are strikingly similar to so-called \"epixenosomes\", prokaryotes previously described in a ciliate species and identified as members of the Verrucomicrobia. These parallel symbioses increase the comparative context for understanding the origin(s) of extrusive organelles in eukaryotes and underscores how little we know about the symbiotic communities of marine benthic environments.We characterized the ultrastructure and molecular phylogenetic position of  Euglena and Phacus), but the majority of the species are heterotrophic (osmotrophs or phagotrophs). Photosynthetic euglenids evolved from phagotrophic ancestors with a complex feeding apparatus and a large number of pellicle strips that facilitate a characteristic peristaltic cell movement called \"euglenoid movement\". This combination of characters allows phagotrophic euglenids to engulf large prey cells, such as eukaryotic algae, which eventually led to the acquisition of chloroplasts via secondary endosymbiosis .Both resin-embedded cells used for TEM and cells on gold sputter-coated SEM stubs have been deposited in the Beaty Biodiversity Research Centre (Marine Invertebrate Collection) at the University of British Columbia, Vancouver, Canada.Figs Tidal sand-flat at Centennial Beach, Vancouver, British Columbia, Canada .Marine sand, black layer 2-3 cm deep.bacati, ornamented with pearls. The etymology for the specific epithet reflects the presence of distinct longitudinal rows of spherical-shaped episymbionts, reminiscent of pearl necklaces.Specific epithet, Latin LSID for article: urn:lsid:zoobank.org:pub:40211D82-B95C-494A-B8D0-7E061E80DD18Bihospites: urn:lsid:zoobank.org:act:794D6C7B-BFB1-45C7-8DDA-32D44F3B0E50LSID for the genus B. bacati: urn:lsid:zoobank.org:act:E1549565-5434-4F85-B936-7D0C485596B8LSID for the species ar: accessory rod; CGS: congregated globule structure; Cyt: cytostome; Db: dorsal basal body; Db': dorsal pro-basal body; Df: dorsal flagellum; DL: dorsal lamina; DMt: dorsal microtubules; DR: dorsal root; E: extrusome; epi: epixenosome; ER: endoplasmic reticulum; FP: flagellar pocket; IR: intermediate root; LM: light microscope; MtD: mitochondrion-derived organelle; N: nucleus; Nu: nucleolus; PR: paraxial rod; r: rod; S: strips; SF: striated fibre; SEM: scanning electron microscope; TEM: transmission electron microscope; tz: transition zone; Vb: ventral basal body; Vb': ventral pro-basal-body; Vf: ventral flagellum; VL: ventral lamina; VR: ventral root; vt: vestibulum.SAB collected the sediment samples from Boundary Bay; generated the LM, SEM, and SSU rDNA sequence data; and wrote the first draft of the paper. NY generated the TEM data and helped with the phylogenetic analyses and interpretation of the TEM data. MH carried out the sampling, identification and LM work of the German material and helped with the identification of the Canadian material. BSL funded and supervised the collection and interpretation of the ultrastructural and molecular phylogenetic data and contributed to writing the paper. All authors have read, edited and approved the final manuscript."}
{"text": "Dr. Luis D. Giavedoni was not included in the author byline. He should be listed as the sixth author and affiliated with Department of Virology and Immunology and Southwest National Primate Research Center, Southwest Foundation for Biomedical Research, San Antonio, Texas, United States of America.The author contributions should also be amended to the following: Conceived and designed the experiments: TRK JBB RDH JP PD. Performed the Experiments: RDH JC JP AC CT AC TRK LDG. Analyzed the data: RDH JC TRK AC LDG CT AC JBB PD. Contributed reagents/materials/ analysis tools: AC TRK JBB. Wrote the paper: JC JBB PD."}
{"text": "Escherichia coli (E. coli). To gain an insight into the genes and pathways involved in hepatic APR of dairy cows we performed a global gene expression analysis of liver tissue sampled at different time points before and after intra-mammary (IM) exposure to E. coli lipopolysaccharide (LPS) treatment.Liver plays a profound role in the acute phase response (APR) observed in the early phase of acute bovine mastitis caused by Approximately 20% target transcripts were differentially expressed and eight co-expression clusters were identified. Each cluster had a unique time-dependent expression profile and consisted of genes involved in different biological processes. Our findings suggest that APR in the liver is triggered by the activation of signaling pathways that are involved with common and hepatic-specific transcription factors and pro-inflammatory cytokines. These mediators in turn stimulated or repressed the expression of genes encoding acute phase proteins (APP), collectins, complement components, chemokines, cell adhesion molecules and key metabolic enzymes during the APR. Hormones, anti-inflammatory and other hypothalamus-pituitary-adrenal axis (HPAA) linked mediators also seemed to participate in APR.E. coli mastitis, and that the bovine hepatic APR follows the same pattern as other mammals when they are challenged with LPS. Our work presents the first insight into the dynamic changes in gene expression in the liver that influences the induction, kinetics and clinical outcome of the APR in dairy cows.Performing global gene expression analysis on liver tissue from IM LPS treated cows verified that the liver plays a major role in the APR of  Escherichia coli (E. coli) is a common disease in lactating dairy cows. During infection, lipopolysaccharide (LPS) released from the cell wall of E. coli rapidly induces a sophisticated inflammatory response. Locally it is characterized by recruiting leukocytes especially neutrophils to the injured mammary tissue, as well as activation of macrophages in the mammary gland to produce pro-inflammatory cytokines  (the probe set is Bt.21216.1.S1_at), were significant.Differential expression of individual genes was assessed using linear modeling and empirical Bayes methods  as impleTo identify co-expression clusters, the 4610 DE transcripts were ordered by the hierarchical clustering. Centered Pearson correlation method was used as the distance measure. The optimum cluster number was determined using the ratio of the sums of squares between and within cluster  see Fig.There are 1789 UniGenes possessing Gene Ontology (GO) among all DE transcripts in contrast to 6843 UniGenes from the whole array. Within each co-expression cluster, overrepresentation of gene sets defined by the Biological Process (BP) of GO was tested using Fisher's exact test.E. coli: Escherichia coli; EGF: epidermal growth factor; GCRMA: GeneChip robust multi-array analysis; GH: growth factor; GO: gene ontology; HPAA: hypothalamus-pituitary-adrenal axis; IM: intra-mammary; i.p.: intraperitoneal; IU: international units; i.v.: intravenous; LIMMA: linear models for microarray analysis; LPS: lipopolysaccharide; MAS: microarray suite; MCP: monocyte chemotactic protein; MIP: macrophage inflammatory protein; NAP: neutrophil-activating protein; PG: prostaglandin; PRL: prolactin; PRLR: prolactin receptor; Q-PCR: quantitative polymerase chain reaction; RMA: robust multi-array analysis; SCC: somatic cell countAMPK: adenosine monophosphate-activated protein kinase; APP: acute phase proteins; APR: acute phase response; ATP: adenosine 5'-triphosphate; BP: biological process; CAM: cell-adhesion molecules; CC: complement components; cRNA: complementary ribonucleic acid; DE: differentially expressed; LJ and PS analyzed the microarray data and drafted the manuscript. CR carried out the animal challenge, KLI performed the liver biopsy and LV performed the Q-PCR. PS, CR and KLI designed the experimental plan. LJ, PS, CR and KLI contributed to the interpretation of results and iterative refinement of the manuscript. LJ is responsible for depositing microarray data in NCBI GEO.  LJ and PS contributed equally to this work."}
{"text": "The Author Contributions are incorrect. They should read as follows: Conceived and designed the experiments: GA. Performed the experiments: AAM GA. Analyzed the data: AAM GA. Wrote the paper: GA GB."}
{"text": "The Author Corrections are incomplete. The full Author Contributions are: Conceived of the study: CL BD. Performed the numerics: CL. Wrote the paper: CL BD."}
{"text": "However, in order to fully utilize the scale-independent properties of CGR, it should be accessible through scale-independent user interface instead of static images. Here we describe a web server and Perl library for generating zoomable CGR images utilizing Google Maps API, which is also easily searchable for specific motifs. The web server is freely accessible at  Moreover, other web-pages or web-database sites can utilize our service to add CGR and  website .CGR: Chaos Game Representation; FCGR: Frequency matrices extracted from CGR; G-language GAE: G-language Genome Analysis Environment; IFS: Iterated Function System; REST: Representational State Transfer; ZUI: Zoomable User Interface.The authors declare that they have no competing interests.KA designed and developed the software, and drafted the manuscript. KO participated in the implementation of the software. MT supervised the project. All authors have read and approved the final manuscript."}
{"text": "There were errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: GH DRS. Performed the experiments: GH SY NS KJD TS. Analyzed the data: GH DRS. Wrote the paper: GH DRS. Made the figures: GH KJD."}
{"text": "Correction to: British Journal of Cancer (2006) 94, 1351. doi:10.1038/sj.bjc.6603068Owing to an author error, the title of the above letter was incorrect. The title should be:\u2018Mobile phone use and risk of acoustic neuroma: results of the Interphone case\u2013control study in five North European countries\u2019."}
{"text": "Daphnia magna (Crustacea:Cladocera) to isolate variable number of tandem repeat (VNTR) markers for linkage mapping, Quantitative Trait Loci (QTL), and functional studies.Expressed sequence tag (EST) databases provide a valuable source of genetic data in organisms whose genome sequence information is not yet compiled. We used a published EST database for the waterflea Seventy-four polymorphic markers were isolated and characterised. Analyses of repeat structure, putative gene function and polymorphism indicated that intragenic tandem repeats are not distributed randomly in the mRNA sequences; instead, dinucleotides are more frequent in non-coding regions, whereas trinucleotides (and longer motifs involving multiple-of-three nucleotide repeats) are preferentially situated in coding regions. We also observed differential distribution of repeat motifs across putative genetic functions. This indicates differential selective constraints and possible functional significance of VNTR polymorphism in at least some genes.Databases of VNTR markers situated in genes whose putative function can be inferred from homology searches will be a valuable resource for the genetic study of functional variation and selection. Daphnia (Crustacea:Cladocera) are small planktonic crustaceans found in standing freshwater bodies around the world. They have a long history as model organisms for evolutionary, ecological and ecotoxicological research. Recently, the genus has been the focus of a major sequencing effort, and the full genome sequence of Daphnia pulex is now available : Concentration of MgCl2 used in the PCR buffer. An asterisk following MgCl2 concentration indicates hot start PCR.Click here for fileDescription of the 74 polymorphic VNTR loci. EST locus: locus containing the VNTR; Size: size of the repeated motif; Sequence: repeat consensus sequence. N: number of repeats, ; A: number of alleles. *: total number of alleles in loci with more than one repeated motif. He: Gene diversity.Click here for fileResults of homology searches and putative functions of EST loci. TM: transmembrane regions. Function categories: DEF: defense; MET: metabolism; OTH: other; SIG: signaling and gene expression regulation; SUR: surface and integumental proteins; UNK: unknown function. No hit: no significant homolog found .Click here for fileDistribution of allele sizes of polymorphic loci in each sampled location.Click here for file"}
{"text": "The author contributions are incorrect. The correct contributions are: Performed the experiments: ZA RC LC ADB EAAF ON CT CU HK HPS"}
{"text": "Hemophagocytic syndrome is a rare clinicopathological condition characterized by the activation of the mononuclear phagocyte system, resulting in hemophagocytosis in the reticuloendothelial systems. The pathogenesis of HPS remains unclear.We report the case of a 20-year-old soldier suffering from HPS. Because of long history fever and no reasons being found, his left groin lymph node and left neck lymph node biopsy were done with two weeks interval. We found a marked increase in plasma cells in left neck lymph node during the course of the disease.Our result provides a new thought for the researchers to understand the mechanisms responsible for the phagocytosis in HPS. Hemophagocytic syndrome (HPS) is a rare entity characterized by the dysfunction of cytotoxic T cells (CTL) and natural killer (NK) cells, and the activation of the mononuclear phagocyte system ,2. Its c9/L, red blood cell 3.42 \u00d7 1012/L, hemoglobin 107 g/L, platelet count 156 \u00d7 109/L, fibrinogen 0.67 g/L, triglyceride 13.9 mmol/L (Table A 20-year-old enlisted man presented with a 1-month history of discontinuous fever, panic, and hypodynamia, and was admitted to People's Liberation Army 152 hospital in May 2008. He had no other complaints. The patient had previously been healthy, with no history of infectious diseases or allergies to food or drugs. Physical examination showed a temperature of 37.3\u00b0C and no other remarkable signs. Laboratory measurements and examinations revealed no abnormalities. On admission, the patient was administered broad spectrum antibiotics and antiviral drugs. However, his fever failed to resolve and his temperature rose to between 38.5\u00b0C and 40.9\u00b0C. More than 2 weeks later, lymphadenopathy of the left neck, armpit, and left groin was detected by ultrasound. Left groin lymph node and bone marrow puncture biopsies were performed. Histopathological examination of the groin lymph node showed reactive hyperplasia and revealed one histiocyte engulfing few blood cells Figure. . The bonLeft neck lymph node biopsy and bone marrow puncture smear were performed. The results were characteristic of HPS Figure. . The gerHPS is a life-threatening condition characterized by the activation of the MPS. It can be divided into genetic HPS and secondary HPS . GeneticAlthough progress has been made in understanding the pathophysiology of HPS, the exact mechanisms responsible for the phagocytosis are unknown in HPS. Researchers found out that there have the RBC antibodies in the EBV-HPS and anti-RBC antibodies were involved in the phagocytosis of RBCs by macrophages . Also seThis case report showed plasma cells increased markedly in the left neck node during the progression of HPS. The result maybe provide one way to study the pathophysiology of the HPS.HPS: hemophagocytic syndrome; CTL: cytotoxic T cells; MPS: mononuclear phagocyte system; HAV: hepatitis A virus; HBV: hepatitis B virus; HCV: hepatitis C virus; HIV: human immunodeficiency virus; CP: chlamydia pneumoniae; MP: mycoplasma; RSV: respiratory syncytial virus; Adv: adenovirus; WBC: white blood cell count; RBC: red blood cell; HGB: hemoglobin; PLT: platelet count; PT: prothrombin time; NR: international normalized ratio; TT: thrombin time; APTT: activated partial thromboplastin time; FIG: fibrinogen; TP: total protein; ALB: albumin; GLOB: globulin; DB: direct bilirubin; IB: indirect bilirubin; \u03b3-GT: \u03b3-glutamyl transpeptidase; CK: creatine kinase; CK-MB: creatine kinase-MB; HBDH: hydroxybutyrate dehydrogenase; LDH: lactate dehydrogenase; TG: triglyceride; \u03b22-MG: \u03b22-microglolulin; CRP: C-reactive protein; ALP: alkaline phosphatase.Written informed consent was obtained from the patient' older brother for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this Journal.The authors declare that they have no competing interests.L CY and M YY interpreted the data, operated on the patient and wrote the manuscript. L CG performed the histological examination. H XX reviewed the paper. All authors read and approved the final manuscript."}
{"text": "Axiothella rubrocincta. Employing immunocytochemistry in combination with confocal laserscanning microscopy, we broaden the database on capitellid organogenesis, thereby incorporating classical histological data in our analysis. Besides assessing possible shared features with the echiurans, we also discuss the variability of neural and muscular characters within the Capitellida.Numerous phylogenetic analyses on polychaete annelids suggest a taxon Capitellida that comprises the three families Maldanidae, Arenicolidae and Capitellidae. Recent molecular studies support the position of the Echiura, traditionally ranked as a separate phylum, within the capitellids. In order to test the robustness of this molecular-based hypothesis we take a different approach using comparative analyses of nervous and muscle system development in the maldanid Axiothella, consists of cerebral commissures that give rise to simple circumesophageal connectives with fused ventral and dorsal roots and a single ventral neurite bundle. From the latter arise segmental neurites that innervate the peripheral bodywall. Since there is no observable regular pattern, and individual neurites are lost during ontogeny, their exact arrangement remains elusive. The pharynx is encircled by a prominent stomatogastric nerve ring, with a pair of anterior and lateral proboscis neurites directly connecting it to the central nervous system. One pair of ventral and one pair of dorsal longitudinal muscles form the earliest rudiments of the bodywall musculature in late larval stages, while a continuous layer of circular muscles is lacking throughout ontogeny.The scaffold of the adult central nervous system, which is already established in early developmental stages of Comparative neurodevelopmental analysis of capitellid and echiuran species reveals several common characters, including simple circumesophageal connectives, a single fused ventral nerve strand, and a stomatogastric ring nerve, that support a close relationship of both taxa, thus corroborating recent molecular phylogenetic analyses. The data on myogenesis show that four longitudinal muscle bands most likely represent an ancestral character not only for the Capitellida, but for the Annelida in general. Whether or not circular muscles are part of the annelid groundpattern remains uncertain. Axiothella rubrocincta not only offers an opportunity to assess the ingroup variability of neural characters within the Capitellida but also allows to compare neurogenesis and nervous system organization with those data that recently have become available for echiurans. This serves as an independent test of the molecular data which propose the placement of the echiurans within the Capitellida.The Maldanidae, also referred to as 'bamboo worms', comprise a group of deposit-feeding polychaete annelids that live in tubes composed of bottom material. They are usually considered related to the Arenicolidae and Capitellidae, and these three families are grouped together in the taxon Capitellida . Recent Axiothella may also aid in casting light on the ancestral state of muscular systems in annelids and lophotrochozoans as a whole. The musculature of the Capitellida comprises a closed outer layer of circular fibers similar to that of clitellate oligochaetes . The primary antibodies, polyclonal rabbit anti-serotonin , polyclonal rabbit anti-FMRFamide , and monoclonal mouse anti-acetylated \u03b1-tubulin , all in block-PTA, were either applied separately or in a mixed cocktail for 24 h. Subsequently, the specimens were rinsed in block-PTA with three changes over 6 h and incubated in a mixture of 4'6-diamidino-2-phenyl-indole [DAPI ], secondary fluorochrome-conjugated antibodies  and, for F-actin visualization, Alexa Fluor 488 phalloidin  in block-PTA overnight. Finally, the specimens were washed three times in PB without NaN3 and were directly mounted in Fluoromount G  on glass slides. A minimum of 10 immunolabeled specimens per developmental stage was analyzed for each antibody. Approximately 65 image stacks of optical sections were recorded as Z-wide-projections with 0.1-0.5 \u03bcm step size using a Leica DM IRE2 fluorescence microscope equipped with a Leica TCS SP 2 confocal laserscanning unit . Setae are visible in the tubulin scans due to autofluorescence. Images were processed with Adobe Photoshop CS3 to adjust contrast and brightness and were arranged into figure plates using Adobe Illustrator CS3 . The three-dimensional computer reconstructions were generated with the imaging software Imaris v. 5.5.3  using surface rendering algorhithms.The following steps were all performed at 4\u00b0C. Antibody staining was preceded by tissue permeabilization for 1 h in 0.1 M PB with 0.1% NaN1s-7s: setigers; a: anus; ac: apical cilia; apn: anterior proboscis neurite; as: anal sphincter; a-str: accessory stomatogastric nerve ring; bun: nerves of the buccal epithelium; cc: circumesophageal connective; cg: cerebral ganglion; cm-rs: circular muscle of the retractor sheath; dl-cg: dorsal lobe of the cerebral ganglion; dlm: dorsal longitudinal muscle bundle; d-sp: dorsal serotonergic perikarya; d-vlm: diagonal ventral longitudinal muscle; e: esophagus; ge: glandular epidermis; h: head; i: intestine; lm: longitudinal muscle fiber; lm-rs: longitudinal muscle of the retractor sheath; lpn: lateral proboscis neurite; ma: main strand; me: median strand; nn: nuchal neurite; nt: neurotroch; pc: posterior cilia; per: peristomium; ph: pharynx; pn: protonephridium; pnn: peripheral network of neurites; prn: prostomial nerves; pro: prostomium; pt: prototroch; py: pygidium; s: setae; sm: setal muscles; stp: neuronal stomatogastric projection; str: stomatogastric nerve ring; s-vlm: straight ventral longitudinal muscle; tt: telotroch; vl-cg: ventral lobe of the cerebral ganglion; vlm: ventral longitudinal muscle bundle; vnb: ventral neurite bundle; v-sp: ventral serotonergic perikarya.NB performed research, analyzed data and drafted the manuscript. AW designed and coordinated research and contributed to writing of the manuscript. Both authors conceived the study, read, and approved the final version of the manuscript."}
{"text": "Due to the addition of author Dao-Fu Dai, the author contributions should now read: Conceived and designed the experiments: WL. Performed the experiments: LCE JFM PRT. Analyzed the data: LCE PRT MJE DFD WL. Contributed reagents/materials/analysis tools: NSW GSM PSR WL. Wrote the paper: LCE."}
{"text": "Because the author Aruna Panda was added to the author byline after publication, the Author Contributions section does not correctly reflect the new authorship. The new Author Contributions should read:Conceived and designed the experiments: GN WK ZY DP SR CW DS. Performed the experiments: WK ZY DP LD SR CW ES HS HW GR AP. Analyzed the data: GN WK ZY DP MN SR CW DS. Wrote the paper: GN WK ZY DP SR CW DS AP."}
{"text": "Objective: To investigate clinical experience with the apparent malignant transformation of benign liver cell adenomas.Design: Retrospective review of personal experience and literature.Setting: University hospital and affiliated community hospitals.Patients: All patients diagnosed with liver cell adenomas over a 30-year period.Interventions: Liver resection and/or tumor biopsy.Main Outcome Measures: Gender, age, drug associations, alpha-fetoprotein levels, response to treatment, and survival.Results: Thirteen patients from personal experience and 26 patients from the reports of others had liver cell adenomas that were not resected. Five of these patients subsequently developed hepatocellular carcinoma.Conclusions: Malignant transformation of a liver cell adenoma is a rare phenomenon, but it does occur. Alphafetoprotein levels may be more helpful in diagnosis than expected from previous reports. Solitary benign adenomas should be resected whenever possible. Patients with diffuse multiple tumors should be observed closely over a long period."}
{"text": "There were errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: TK KH ZPF PR. Performed the experiments: TK KH WK NR GS. Analyzed the data: TK KH ZPF PR. Wrote the paper: TK KH ZPF PR."}
{"text": "With the advent of functional magnetic resonance imaging (fMRI) in awake animals it is possible to resolve patterns of neuronal activity across the entire brain with high spatial and temporal resolution. Synchronized changes in neuronal activity across multiple brain areas can be viewed as functional neuroanatomical circuits coordinating the thoughts, memories and emotions for particular behaviors. To this end, fMRI in conscious rats combined with 3D computational analysis was used to identifying the putative distributed neural circuit involved in aggressive motivation and how this circuit is affected by drugs that block aggressive behavior.1a receptor antagonist SRX251 or the selective serotonin reuptake inhibitor fluoxetine, drugs that block aggressive behavior, both caused a general suppression of the distributed neural circuit involved in aggressive motivation. However, the effect of SRX251, but not fluoxetine, was specific to aggression as brain activation in response to a novel sexually receptive female was unaffected.To trigger aggressive motivation, male rats were presented with their female cage mate plus a novel male intruder in the bore of the magnet during image acquisition. As expected, brain areas previously identified as critical in the organization and expression of aggressive behavior were activated, e.g., lateral hypothalamus, medial basal amygdala. Unexpected was the intense activation of the forebrain cortex and anterior thalamic nuclei. Oral administration of a selective vasopressin VThe putative neural circuit of aggressive motivation identified with fMRI includes neural substrates contributing to emotional expression , emotional experience  and the anterior thalamic nuclei that bridge the motor and cognitive components of aggressive responding. Drugs that block vasopressin neurotransmission or enhance serotonin activity suppress activity in this putative neural circuit of aggressive motivation, particularly the anterior thalamic nuclei. Aggression is a normal component of mammalian behavior . For ani1a and 5HT1b receptor agonists  arginine vasopressin, blocks aggressive behavior -1for each subject (i) was also calculated.Anatomy images for each subject were obtained at a resolution of 2562 with a depth of 1200 \u03bcm, many small brain areas  cannot be resolved; or, if they could be resolved they would be represented by one or two voxels only . Consequently, small detailed regions are not included in the analysis or are grouped into larger \"minor volumes\" of similar anatomical classification. For example, in these studies we have the basal nucleus of the amygdala listed as a minor volume. This area is a composition of the basomedial anterior part, basomedial posterior part, basolateral anterior part and basolateral posterior part with a composite voxel size of 54. In this study, 12 brain slices were collected extending from the tip of the forebrain to the end of the cerebrum stopping at the midbrain just rostral to the cerebellum. Within these rostral/caudal boundaries we delineated 83 minor volumes. In addition, we grouped brain areas into \"major volumes\" . The volume of activation (number of significant voxels) can be visualized in these 3D major and minor anatomical groupings  is 486 \u03bcmt tests were performed on each voxel  of each subject within their original coordinate system. The baseline threshold was set at 2%. The t test statistics used a 95% confidence level, two-tailed distributions, and heteroscedastic variance assumptions. As a result of the multiple t test analyses performed, a false-positive detection controlling mechanism was introduced -1, mapped it within a voxel of subject (i). A tri-linear interpolation of the subject's voxel values (percentage change) determined the statistical contribution of subject (i) to the composite  location. The use of [Ti]-1 ensured that the full volume set of the composite was populated with subject contributions. The average value from all subjects within the group determined the composite value. The BOLD response maps of the composite were somewhat broader in their spatial coverage than in an individual subject; so only average number of activated pixels that has highest composite percent change values in particular ROI was displayed in composite map. Activated composite pixels are calculated as follows:A statistical composite was created for each group of subjects. The individual analyses were summed within groups. The composite statistics were built using the inverse transformation matrices. Each composite pixel location , premultiplied by [The composite percent change for the time history graphs for each region was based on the weighted average of each subject, as follows:N is number of subjects.where The percent change in BOLD signal for time history graphs see Figs , 7, 8 weACA: anterior cingulated; ACB: accumbens; AH: anterior hypothalamus; AL: agranular insular cortex; ALP: anterior lobe pituitary; AM: anteromedial nucleus thalamus; AON: anterior olfactory nucleus; AUD: auditory cortex; AV: anteroventral nucleus thalamus; BNST: bed nucleus stria terminalis; CA1: hippocampus; CA3: hippocampus; COA: cortical nucleus amygdale; DG: dentate gyrus; DS: dorsal striatum; ENT: entorhinal cortex; IC: inferior colliculi; ILA: infralimbic cortex; IPN: interpeduncular nucleus; LHA: lateral hypothalamus; LP: lateral posterior nucleus thalamus; LS: lateral septum; MEA: medial amygdale; MM: mammillary nuclei; MO: motor cortex; MRN: mesencephalic reticular nucleus; ORB: orbital cortex; OT: olfactory tubercle; PAG: periaqueductal gray; PIR: piriform cortex; PL: prelimbic cortex; PTL: parietal cortex; PVN: paraventricular nucleus hypothalamus; PVT: paraventricular nucleus thalamus; RE nucleus reunions thalamus; RSP: retrosplenial cortex; RPH: raphe; SC: superior colliculi; SN: substantia nigra; SSP: primary somatosensory cortex; VMH: ventromedial hypothalamus; VP: ventral posterior nucleus thalamus; VTA: ventral tegmental areaCraig Ferris and Mathew Brevard have a financial interest in Insight MRI the bioengineering company that manufactures the animal imaging equipment used in these studies. Craig Ferris and Neal Simon have a financial interest in Azevan Pharmaceuticals the company developing SRX251 an orally active V1a receptor antagonist used in these studies.Each author has made a significant contribution to these studies either in the acquisition of data , software development, data analysis , or study design and manuscript preparation . All authors read and approved the final manuscript."}
{"text": "Escherichia coli, allowing for the estimation of energy generation and cell synthesis, based on intracellular fluxes and that may be used to characterize phenotypic growth.It is quite important to simulate the metabolic changes of a cell in response to the change in culture environment and/or specific gene knockouts particularly for the purpose of application in industry. If this could be done, the cell design can be made without conducting exhaustive experiments, and one can screen out the promising candidates, proceeded by experimental verification of a select few of particular interest. Although several models have so far been proposed, most of them focus on the specific metabolic pathways. It is preferred to model the whole of the main metabolic pathways in E. coli. Once intracellular fluxes were computed by this model, the specific ATP production rate, the specific CO2 production rate, and the specific NADPH production rate could be estimated. The specific ATP production rate thus computed was used for the estimation of the specific growth rate. The CO2 production rate could be used to estimate cell yield, and the specific NADPH production rate could be used to determine the flux of the oxidative PP pathway. The batch and continuous cultivations were simulated where the changing patterns of extracellular and intra-cellular metabolite concentrations were compared with experimental data. Moreover, the effects of the knockout of such pathways as Ppc, Pck and Pyk on the metabolism were simulated. It was shown to be difficult for the cell to grow in Ppc mutant due to low concentration of OAA, while Pck mutant does not necessarily show this phenomenon. The slower growth rate of the Ppc mutant was properly estimated by taking into account the lower specific ATP production rate. In the case of Pyk mutant, the enzyme level regulation was made clear such that Pyk knockout caused PEP concentration to be up-regulated and activated Ppc, which caused the increase in MAL concentration and backed up reduced PYR through Mez, resulting in the phenotypic growth characteristics similar to the wild type.In the present study, we considered the simulation of the main metabolic pathways such as glycolysis, TCA cycle, pentose phosphate (PP) pathway, and the anapleorotic pathways using enzymatic reaction models of E. coli for understanding metabolic changes inside the cell in response to specific pathway gene knockouts, considering the whole main metabolic pathways. The comparison of the simulation result with the experimental data indicates that the present model could simulate the effect of the specific gene knockouts to the changes in the metabolisms to some extent.It was shown to be useful to simulate the main metabolism of  One of the most challenging goals of metabolic engineering is to design the cell metabolism based on the analysis of metabolic regulation. For this, it is strongly desired to develop a mathematical model which can describe the dynamic behaviour of the cell in response to the changes in the culture environment and/or specific genetic modifications. Although an attempt has been made to develop a platform for the whole cell model , the totSaccharomyces cerevisiae  glucose, 0.4 g of [1-13C] glucose, and 3.2 g of naturally labeled glucose per liter. Biomass samples for GC-MS analysis were taken after one residence time. Sample preparation, analytical procedures for GC-MS analysis, and flux computation are given elsewhere  denotes the concentration, and the abbreviations for the metabolites are explained in Nomenclature. ll grows . As showThe estimation for the cell growth rate is by far important. In particular, it is critical for the prediction of the specific gene knockout mutant. The most typical equation for the cell growth rate is the Monod equation:S is the substrate concentration and S \u2261 [ex Glc] in the present case. The drawback of this equation is that the cell will keep growing at \u03bcm as far as S \u226b Ks where Ks is usually quite small in the case of the utilization of glucose as the substrate. This does not reflect the fermentation characteristics in practice. Therefore, we introduced another term such aswhere X is the cell concentration and Xm is the final value of X in the batch culture, and n is the model parameter. Xm may be set as S(0)YS/X where S (0) is the initial substrate concentration, and YS/X is the yield coefficient. Although this equation can be used to simulate the dynamic behavior in batch culture, Eq. (2b) may not be able express the cell growth rate for the mutants. We, therefore, introduce another idea by taking into account the effect of ATP generation on the cell growth rate based on experimental observation.where 2 can contribute in generating ATP via oxidative phosphorylation. The pathways involved in electron transfer and oxidative phosphorylation have variable stoichiometry due to the use of different dehydrogenases and cytochromes. Namely, the NADH dehydrogenase NDH-I encoded by nuo gene transports 2 H+/e-, while NDH-II encoded by ndh gene transports 0 H+/e- /[NAD] ratio increases as given by Eq.10) of Table 0 of Tablm = 8 mM) and Icl  compete for ICIT. This branch point is under both gene level regulation by aceBAK operon and the enzyme level regulation by the phosphorylation/dephosphorylation of ICDH. Here, we considered the rate equation for ICDH as given by Eq.(15) of Table For citrate synthase reaction, Eq.14) in Table 4 in TablAs for the glyoxylate pathway, Eq. 16) of Table 6 of TablFor G6PDH and 6PGDH reactions in the PP pathway, Eqs.(23) and (24) of Table 2 production rate Once the fluxes were determined, the specific CO2 production rate was computed by the product of net production of CO2 and biomass concentration, i.e. and the total COvNADPH may also be estimated byMoreover, the specific NADPH production rate \u03bc and vNADPH computed based on the flux estimates obtained from 13C-labeling experiments [It should be noted that the flux determination in the PP pathway is not easy for the enzyme-based kinetic equations. In particular, it is not easy to accurately predict the flux of G6PDH at the branch point of G6P. Figure eriments ,15, indikNADPH value from Figure kNADPH after \u03bc was computed. Then, the flux of G6PDH may be estimated.Once we identified As stated in introduction, it is not easy, even if it is not impossible, to express gene-level regulation by mathematical equations. Here, we alternatively introduced several rules for the simulation based on the experimental observations and the roles of global regulators such as given in Additional file Metabolites2KG: 2-Keto-D-gluconate; 6PG: 6-Phosphogluconolactone; ACE: Acetate; AcP: Acetyl phosphate; AcCoA: Acetyl-CoA; ASP: Aspartate; ADP: Adenosine diphosphate; ATP: Adenosine-5'-triphosphate; AMP: Adenosine monophosphate; DHAP: Dihydroxyacetone phosphate; E4P: Erythrose 4-phosphate; F6P: Fructose 6-phosphate; FDP: Fructose 1,6-bisphosphate; FUM: Fumarate; G6P: Glucose-6-phosphate; GAP: Glyceraldehyde 3-phosphate; ICIT: Isocitrate; NAD/NADH: Nicotinamide adenine dinucleotide; NADP/NADPH: Nicotinamide adenine dinucleotide phosphate; MAL: Malate; OAA: Oxaloacetate; P: Phosphate; PEP: Phosphoenolpyruvate; PYR: Pyruvate; R5P: Ribulose 5-phosphate; Ru5P: Ribose 5-phosphate; S7P: Sedoheptulose 7-phosphate; SUC: Succinate; X5P: Xylulose 5-phosphateProtien (enzyme)Glc,/EIICBGlc: Enzyme for glucose; Eno: Enolase; Fum: Fumarase; G6PDH: Glucose-6-phosphate dehydrogenase; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; ICDH: Isocitrate dehydrogenase; HPr: Histidine containing protien; Icl: Isocitrate lyase; MDH: Malate dehydrogenase; Mez: Malic enzyme; Ms: Malate synthase; Pck: Phosphoenolpyruvate carboxykinase; PDH: Pyruvate dehydrogenase; Pfk/Pfk-1: Phosphofructokinase-1; Pgi: Phosphoglucose isomerase/Glucosephosphate isomerase; Pgk: Phosphoglycerate kinase; Pgm: Phosphoglycerate mutase; Ppc: PEP carboxylase; Pps: Phosphoenolpyruvate synthase; Pta: Phosphotransacetylase; PTS: Phosphotransferase system; Pyk: Pyruvate kinase; Rpe: Ribulose phosphate 3-epimerase; Rpi: Ribulose 5-phosphate 3-isomerase; SDH: Succinate dehydrogenase; Tal: Transaldolase; TktA: TransketolaseI; TktB: TransketolaseII2KGDH: 2-Keto-D-gluconate Dehydrogenase; Ack: Acetate kinase; Acs: Acetyl coenzyme A synthetase; AcP: Acetyl phosphate; Aldo: Aldolase; CS: Citrate synthase; EI: Cytoplasmatic protein (enzyme1); EII, EIIB, EIIC,: Carbohydrate specific (enzyme II); EIIAGeneaceBAK: operon which encodes the metabolic and regulatory enzymes of the glyoxylate bypass; cra: Catabolite repressor/activator; crr: Catabolite repressor; fadR: Fatty acid metabolism regulator; icdA: Isocitrate dehydrogenase A; iclR: Transcriptional repressor IclR; pckA: Phosphoenolpyruvate carboxykinase gene; pfkA, pfkB: Phosphofructokinase gene; ppsA: Phosphoenolpyruvate synthase gene; ptsG, ptsHI: Pts gene; pykA, pykF: Pyruvate kinase geneThe authors declare that they have no competing interests.TAAK made modeling, experiment and computer simulation, AAM made some TCA cycle modeling and simulation, AMK supervised computer simulation, JM made formulation, KS made modeling and manuscripts preparation. All authors read and approved the final manuscripts.Effects of initial metabolite concentrations on the fermentation characteristics.Click here for fileSimulation result of wild type and Ppc mutant in batch culture.Click here for fileTable S1 - Ruled used for the simulation.Click here for fileSimulation result of wild type and Ppc mutant in continuous culture.Click here for fileSimulation result of wild type and Pck mutant in continuous culture.Click here for fileSimulation result of wild type and Pyk mutant in batch culture.Click here for fileSimulation result of wild type and Pyk mutant in continuous culture.Click here for fileComputational procedure for the simulation of fitting experimental data.Click here for file"}
{"text": "There were errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: ACC KHAC LHW. Performed the experiments: ACC ELN LHW. Analyzed the data: ACC ELN KHBM KHAC LHW. Contributed reagents/materials/analysis tools: KHAC LHW. Wrote the paper: ACC KHAC LHW. Technical advice and discussion: ACC ELN KHBM KHAC LHW."}
{"text": "The EQ-5D has been extensively used to assess patient utility in trials of new treatments within the cardiovascular field. The aims of this study were to review evidence of the validity and reliability of the EQ-5D, and to summarise utility scores based on the use of the EQ-5D in clinical trials and in studies of patients with cardiovascular disease.A structured literature search was conducted using keywords related to cardiovascular disease and EQ-5D. Original research studies of patients with cardiovascular disease that reported EQ-5D results and its measurement properties were included.Of 147 identified papers, 66 met the selection criteria, with 10 studies reporting evidence on validity or reliability and 60 reporting EQ-5D responses (VAS or self-classification). Mean EQ-5D index-based scores ranged from 0.24 (SD 0.39) to 0.90 (SD 0.16), while VAS scores ranged from 37 (SD 21) to 89 (no SD reported). Stratification of EQ-5D index scores by disease severity revealed that scores decreased from a mean of 0.78 (SD 0.18) to 0.51 (SD 0.21) for mild to severe disease in heart failure patients and from 0.80 (SD 0.05) to 0.45 (SD 0.22) for mild to severe disease in angina patients.The published evidence generally supports the validity and reliability of the EQ-5D as an outcome measure within the cardiovascular area. This review provides utility estimates across a range of cardiovascular subgroups and treatments that may be useful for future modelling of utilities and QALYs in economic evaluations within the cardiovascular area. Cardiovascular disease (CVD) imposes a great burden on societies around the world, with an estimated 16.7 million - or 29.2% of total global deaths - resulting from various forms of CVD.Increasingly over time, clinical trials within the cardiovascular field have included HRQoL measures. Such measures, alongside clinical measures of functionality, can help evaluate the physical, mental and emotional implications of CVD as well as the effects of surgical and medical treatments. Commonly used functional classification systems within the cardiovascular field are the New York Heart Association (NYHA) functional classification system for heart failure patients and the Canadian Cardiovascular Society (CCS) grading scale for angina pectoris,5. HRQoLAmong the available generic measures, the EQ-5D has gained widespread use due to its simplicity to administer, score and interpret. It also imposes minimal burden on the respondent as it is a brief, simple measure for patients to understand and to complete. The index-based score is generated by applying societal preference weights to the health state classification completed by the patient that consists of five dimensions , each with three levels of response or severity . The ability to convert self classification responses into a single index score makes the EQ-5D practical for clinical and economic evaluation. The indThe principle aims of this paper were: to synthesise the evidence on the validity and reliability of the EQ-5D in studies within the cardiovascular field; to summarise the EQ-5D based scores reported in studies within the CVD field; and to attempt to stratify mean utility scores according to level of disease severity.http://www.euroqol.org was also used to identify unique references, including working papers and conference proceedings that may not have been captured in the initial literature search. Only full-text published papers were included for analysis.A computerised search of the current published literature was performed using MEDLINE and EMBASE for the period January 1988 to October 2008. The search strategy combined exploded or medical subject headings relating to the CVD field and the EQ-5D as follows: ('cardiovascular'/exp OR 'cardiovascular') OR ('cardiac'/exp OR 'cardiac') OR ('cardiology'/exp OR 'cardiology') AND 'euroqol' OR 'EQ 5D' OR 'EQ5D'. The EuroQol website The inclusion criteria required that the paper was original research, and that it reported EQ-5D scores specific to cardiovascular disease or reported psychometric properties of the EQ-5D in a population with cardiovascular disease. Studies that only reported EQ-5D index or VAS scores graphically in terms of change over time were excluded from the analysis. When multiple studies used the same dataset, EQ-5D scores were only reported from one article to avoid double counting. No language restrictions were imposed. Study abstracts that potentially met the inclusion criteria were identified, and full-text articles were retrieved for further review. A standard data abstraction form was developed to facilitate the structured review, which included study design, patient characteristics, intervention information, published source of index-based preference weights and EQ-5D scores as well as details of any other clinical measures; disease-specific quality of life and generic HRQoL instruments. A summary of the results of the literature search is provided in figure I2 statistic [I2 statistic uses the sum of the squared differences of each study from the pooled estimate and the degrees of freedom of the test to provide a measure of the percent of total variation across studies due to heterogeneity between studies. A meta-analysis yielding a value of I2 above 75% suggests a high level of heterogeneity between the studies. Psychometric properties were summarised according to the type of property assessed , the comparison performed, and the statistical test result.Initially, studies that reported EQ-5D index-based scores and/or VAS scores were sorted into cardiovascular subgroups  that were informed by the latest WHO International Classification of Diseases (ICD-10: I00-I99 - diseases of the circulatory system)  explored construct validity (convergent and discriminative), typically in terms of correlations with other disease-specific HRQoL measures as well as reliability and responsiveness . Both the CCS and NYHA scales range from class I (mild symptoms) to class IV (severe symptoms) and CCS can also be graded as 0 for no symptoms  rely on generic measures such as the EQ-5D for the calculation of QALYs. Increased use of the EQ-5D may also support the view that patient reported outcomes and quality of life are becoming more widely accepted as routine measures in clinical studies, with the EQ-5D being an internationally recognised generic measure of HRQoL. This summary of EQ-5D index and VAS scores in the cardiovascular field complements other published reports describing the use of the EQ-5D in the cancer and asthma/COPD literature and of utility scores associated with various conditions -50.The review found that the majority of studies that included the EQ-5D were within IHD I20 - I25) and cerebrovascular disease (I60 - I69), subgroups, reflecting the relative prevalence of these diseases worldwide. Stratification by disease severity  was possible for IHD patients and heart failure patients and illustrated a positive relationship with the EQ-5D when moving from severe to mild disease severity  as well as non-disease-related factors such as other co-morbidities and demographic characteristics. Furthermore, no Overall, this study illustrated the difficulty in attempting to adequately deal with statistical heterogeneity based on aggregated data from published studies . This woHRQoL measures such as the EQ-5D can be useful tools to clinicians in terms of evaluating the impact of cardiovascular disease on patients and can help to inform decision making and resource allocation. The use of the EQ-5D in CVD studies has increased in recent years and published studies provide evidence of its validity and reliability. The variation in EQ-5D index and VAS scores reported here largely reflect systematic differences in terms of disease stage, treatment and patient characteristics. In the future, as more studies of CVD present EQ-5D scores according to disease severity, it may be possible to calculate pooled mean estimates that can be useful in modelling of CVD-related health outcomes in economic evaluations.AAA: Abdominal aortic aneurysm; ACS: Acute coronary syndromes; ACT: Anticoagulation therapy; AF: Atrial fibrillation; AH-Drug: Anti-hypertensive drug therapy; AHF: Advanced heart failure; AMI: Acute myocardial infarction; Amp.: Amputation; Angio: Coronary Angiography; ASA: American Society of Anaesthesiologists; ASCOT-AHD: Anglo-Scandinavian cardiac outcomes trial - anti-hypertensive drug treatment; Asym./Sym.: Asymptomatic/Symptomatic; AUT: Austria; AVR: Aortic valve replacement; BI: Barthel Index; BOTH-CABG/PCI/MM: Patients who are suitable for both CABG and PCI and receive CABG/PCI/MM; CABG: Coronary artery bypass graft; CABG-80: Coronary artery bypass surgery in octogenarians; CABG-CABG/PCI/MM: Patients who are suitable for CABG and receive CABG/PCI/MM; CABG-CPB: CABG using heart lung machine; CAD: Coronary artery disease; C-Arrest: Cardiac arrest; CCR: Comprehensive cardiac rehabilitation; CCS: Canadian Cardiovascular Society; CCU: Coronary care unit; CES-D: Centre for Epidemiological Studies - Depression Scale; CHD: Coronary heart disease; CHD-PHARM/Control: Community pharmacy-led medicines management programme/control treatment for patients with CHD; CML: Case method learning supported lipid-lowering strategy; COMM - CVD/NOCVD: Community dwelling-based elderly patients with/without CVD; CR: Cardiac resynchronisation; CR-Home/Hosp: Home/Hospital-based cardiac rehabilitation; C-REHAB: Cardiac rehabilitation; CS: Conservative strategy; CVA: Cerebrovascular Accident; CVD: Cardiovascular disease; Duplex US: Duplex ultrasonography; Echo: Echocardiography; EHS-CR: Euro Heart Survey on coronary revascularisation; Endo: Endovascular AAA surgery; ES: Effect size; Exercise-Qol: Long-term effects of exercise training on quality of life; F-u: Follow-up; GRS: Guyatt's responsiveness statistic; HeartMed: Lifestyle advice intervention by community pharmacists for heart failure patients; HF: Heart failure; HOSP - CVD: Hospital-based elderly patients with CVD; HRQoL: Health-related quality of life; HUI2/3: Health Utilities Index mark 2/3; IC: Intermittent claudication; ICC: Intra-class correlation; ICD: Implantable cardioverter defibrillator; ICP: Integrated care pathway; IHD: Ischaemic heart disease; IQR: Inter-quartile range; IS: Interventional strategy; IV: Intravenous; KCCQ: Kansas City Cardiomyopathy Questionnaire; LV: Left ventricular; MacNew: MacNew Heart Disease Quality of Life Questionnaire; MCS: Mental component summary; MDT: Multi-disciplinary team; MEDMAN: Community pharmacy-led medicines management services; MEPS: Medical expenditure panel survey; MI: Myocardial infarction; MI - Self-help: Home-based self-help rehabilitation package for MI patients; MIDCAB: Minimally invasive direct CABG; MM: Medical management; MR Angio: Magnetic resonance angiography; MRI: Magnetic resonance imaging; MT: Medical therapy; MVPS: Mitral valve prolapse syndrome; NYHA: New York Heart Association; OP-CABG: Off-pump CABG; Open: Open AAA surgery; PAOD: Peripheral arterial occlusive disease; PCI: Percutaneous coronary intervention; PCI-BMS: PCI with bare-metal stents; PCI-CABG/MM/PCI: Patients who are suitable for PCI and receive CABG/PCI/MM; PCI-DES: PCI with drug-eluting stents; PCS: Physical component summary; PER: Peripheral endovascular revascularisation; Pre-op: Pre-operation; Proxy: HRQol questionnaire completed by spouse/family member; PSM: Patient self-management; P-PTCA: Primary PTCA; P-Stent: Primary stent placement; PTCA: Percutaneous transluminal coronary angioplasty; QLMI: Quality of Life after MI questionnaire; QoL: Quality of life; RCT: Randomised controlled trial; REV/NO REV: Eligible/Ineligible for Revascularisation; SAH: Subarachnoid haemorrhage; SCOPE-Drug/Control: Study on cognition and prognosis in the elderly - Drug/Control treatment; SD: Standard deviation; SES: Socioeconomic status; SF-36: Short-form 36-item health survey questionnaire; SF-6D: Short-form 6D; SF-12: Short-form 12-item health survey questionnaire; SPECT: Single photon emission computed tomography; SRM: Standardised response means; Stroke-4Y: Four years post-stroke; TIA: Trans-ischaemic attack; Trans.: Heart Transplantation; Tx: Treatment; UC: Usual care; VAD: Ventricular assist device; VAS: Visual analogue scale; VascuQol: Vascular Quality of Life Questionnaire; -ve/+ve: Deterioration/Improvement in condition; WHO-ICD: World Health Organisation - International Classification of Diseases; W-list: Waiting-list.The authors declare that they have no competing interests.MD participated in the design of the study, carried out the systematic literature review, conducted any data analysis and drafted the manuscript. KG provided support in the statistical analysis and helped to draft the manuscript. LS participated in the design of the study, provided support in the statistical analysis and helped to draft the manuscript. MB conceived of the study, participated in the design of the study and helped to draft the manuscript. All authors read and approved the final manuscript.Tables. Table 1: Description of studies that have used the EQ-5D as an outcome measure in clinical and observational studies of patients with cardiovascular disease. Table 2: Summary of studies examining validity and reliability of EQ-5D in cardiovascular disease (n = 10). Table 3: Summary of EQ-5D utility scores reported in cardiovascular studies. Table 4: Canadian Cardiovascular Society (CCS) and New York Heart Association (NYHA) classification systems [ systems -95.Click here for file"}
{"text": "The initials for author A. David Redish appear incorrectly in the Author Contributions. The correct initials are ADR. The Author Contributions should read: \"Conceived and designed the experiments: ZKN DDR. Performed the experiments: ZKN ADR. Analyzed the data: ZKN ADR. Wrote the paper: ZKN ADR.\""}
{"text": "Although homeobox genes have been the subject of many studies, little is known about the main amino acid changes that occurred early in the evolution of genes belonging to different classes.In this study, we report a method for the fast and efficient retrieval of sequences belonging to the ANTP (HOXL and NKL) and PRD classes. Furthermore, we look for diagnostic amino acid residues that can be used to distinguish HOXL, NKL and PRD genes.The reported protein features will facilitate the robust classification of homeobox genes from newly sequenced bilaterian genomes. Nevertheless, in non-bilaterian genomes our findings must be cautiously applied. In principle, as long as a good manually curated data set is available the approach here described can be applied to non-bilaterian organisms as well. Our results help focus experimental studies onto investigating the biochemical functions of key homeodomain residues in different gene classes. Genes that belong to the homeobox family are characterized by the ability to code for a protein that contains a recognizable, although very variable, 'homeodomain', usually 60 amino acids in length ,2. Many Here, we report amino acid patterns typical of bilaterian HOXL, NKL, and PRD genes that can be used to quickly and efficiently retrieve amino acid sequences belonging to these classes and subclasses, among hundreds of other homeodomain sequences. Retrieving a given class or subclass of sequences from many animal genomes may be thus an easier task than previously thought. However, we show that these typical amino acid patterns should be cautiously used when sequences come from non-bilaterian animals.Since phylogenetic analysis was one of the primary sources of evidence used to establish the different classes and sub-classes, it is likely that most of homeobox gene classes and subclasses represent monophyletic lineages. Hence, it is conceivable that amino acid changes important for protein function in a given lineage may be revealed as fixed differences between classes and subclasses. Previous attempts have been made to classify genes within HOX families -9 but noWe have used the hand-curated data set of Holland et al. , the PROIn order to find amino acid patterns that distinguish genes from the ANTP subclasses, as well as genes from the PRD class, from genes belonging to other classes, a fast word discovery program  encode this amino acid pattern. None of the human NKL genes encode this amino acid pattern.The pattern LE [AGKNR]E  was buiDrosophila melanogaster AbdB, Drosophila melanogaster btn, Strigamia maritima Hox3b, Gallus gallus HMD2 (PROSITE annotation), Danio rerio HXABA (PROSITE annotation), and Salmo salar HXB2 (PROSITE annotation). These sequences do not form a closely related subgroup of sequences. For instance, the Drosophila melanogaster Abd-B and btn genes belong to two different HOXL gene families. Moreover, other genes belonging to these families do show the HOXL 1 amino acid pattern. The Fugu rubripes HXDBB (PROSITE annotation) and the Gallus gallus HXB8 (PROSITE annotation) sequences are incomplete, and thus it is not possible to determine whether they show this amino acid pattern. In addition to the 194 known HOXL genes showing the HOXL 1 pattern, 178/288 'unclassified' sequences also had this pattern .The HOXL 2 pattern is not as specific as the HOXL 1 pattern, since it is observed in about 46% of the genes belonging to the POU class and in a few NKL (0.5%) and PRD (8%) genes. All 16 PRD genes showing the HOXL 2 pattern belong to the Pax4/6 gene family, thus it is likely that this is a case of convergent evolution. The human POU homeodomains showing HOXL 2 pattern are POU1F1, POU3F1, POU3F2, POU3F3, and POU3F4. The latter four genes are closely related, although the POU1F1 gene is distantly related to those genes  [^DGHMPTVWY] [^CDGKMNPQR] [FL] [^CFILPTWY] [AEFHKQRV] [ADEGKNSTW] [CHKMPQR] [FHY]P (positions 16\u201326) PRD pattern, use a negatively charged amino acid at position 27 (DE) and a less polar or non-polar amino acid (^RKDENQ) at position 30. About 80% of all animal bilaterian PRD genes follow this description.ANTP  genes show the [HQ] [IV] [AKLT] (positions 44\u201346) ANTP 1 pattern. In contrast to PRD genes, ANTP genes do not use a negatively charged amino acid at position 27 (DE). Furthermore, at position 30, 99.8% of all bilaterian ANTP genes use a polar amino acid (RKDENQ). 97% of all ANTP bilaterian genes follow this description (data not shown).HOXL genes are characterized by the presence of the HOXL 1 pattern. 96% of all bilaterian HOXL genes show the [KT] [IV]WFQNRR [AMV]K [DEHKLMQWY] [KR] [KR] (positions 46\u201358) HOXL 1 pattern.NKL genes show the NKL pattern (positions 41\u201345) or a NKL derived pattern. About 98% of the bilaterian NKL genes follow this pattern. If the NKL pattern is generalized to include the derived NKL patterns then many hits are observed in other homeodomain classes (data not shown). This is why several NKL-related patterns are reported.The above definitions suggest that the region in between amino acid positions 16\u201330 and 44\u201358 are the most important for function specificity of genes belonging to different classes and sub-classes. The former region corresponds to the end of Helix 1, the inter Helix 1\u20132 region and to the first positions of Helix 2 . The regThe situation observed for NKL genes suggest that specific amino acid patterns may exist for groups of genes within major classes, as previously suggested . It alsoIt is tempting to use these features to classify homeobox containing genes. Nevertheless, given the very old age of the gene families considered, the possibility of convergent evolution must be considered when analyzing a given amino acid sequence. Therefore, for the purpose of gene classification, the features here described should not be decisive but rather used as additional evidence. It should be noted, that the reconstruction of gene genealogies is a hard problem, namely when proteins belonging to the same family share some of the same protein interaction partners, thus facing a similar selective environment . Any additional piece of evidence that may shed light on the correct classification of genes should therefore be used.In this work we report a method for the fast retrieval of bilaterian ANTP and PRD sequences. Given the availability of a sufficiently large curated data set this method can be applied to any group of proteins. Furthermore, we report some of the main amino acid changes that occurred early in the HOXL, NKL and PRD lineages. These features can be used for the classification of gene sequences, although, as shown, convergent evolution must be considered as an explanation for the presence of a given pattern in a sequence. The possibility that the region of the protein that allows distinguishing the different classes, also allows the distinction of different families within classes, has important practical and evolutionary consequences and must be explored in more detail.NAF, JV and CPV conceived the design of the study. NAF developed the software needed for the large-scale analyses, while JV and CPV collected, aligned the sequence data, and performed the phylogenetic analyses. JV drafted the manuscript. All authors participated in the results discussion and helped writing the final version of the manuscript. All authors read and approved the final manuscript.Gi numbers of the 251 non-bilaterian non-redundant sequences used for the analysis presented in Table Nematostella vectensis: 32263856; 32263873; 74039490; 74039492; 82621559; 82621587; 82621611; 82621663; 83356315; 156363224; 156363226; 156387518; 156397205Ephydatia fluviatilis: 438584Acropora millepora: 117581722; 117581724; 117581726; 117581728; Anemonia erythraea: 158936936; Ephydatia fluviatilis: 438585; 510584; Halichondria bowerbanki: 33641771; Nematostella vectensis: 32816231; 78190373; 82621509; 82621525; 82621533; 82621555; 82621557; 82621585; 82621591; 82621609; 82621625; 82621657; 82621665; 82621667; 110339021; 110339029; 110339121; 156353243; 156363798; 156367335; 156372762; 156397943; 168693291;Suberites domuncula: 34786940; 49659003; Sycon raphanus: 11066243Anthopleura japonica: 144369330; 144369363; Hydra vulgaris: 2331219; 7635735; Nematostella vectensis: 82570553; 82621543; 82621677; 110339077; 110339133; 156376845; 156402818; 156406963; 156407174Nematostella vectensis: 82621563; 82621631; 82621655; 156366927; 156402173Nematostella vectensis: 82621579; 82621647; 82621651; 110339063; 156388033; 156400908; 156407394Nematostella vectensis: 110339027Baikalospongia interm\u00e9dia: 62238212; Ephydatia fluviatilis: 1438870; Ephydatia muelleri: 3184520; Hydra vulgaris: 7635740; Nematostella vectensis: 82621517; 82621615; 82621619; 82621623; 82621635; 82621653; 156375827; 156375891; 156376334; 156401296; 156402692; Podocoryne carnea: 28188799; Potamolepis sp.: 62238208; Suberites domuncula: 49659001Anthopleura jap\u00f3nica: 144369334; Cladonema californicum: 9652040; Hydra vulgaris: 3021450; 3021452; 6503072; Nematostella vectensis: 38569883; 78190377; 82395396; 82395402; 82395404; 82395406; 82395408; 82395412; 82395414; 82570541; 82570557; 82570559; 82570563; 110339183; 110339213; 110339215; 110339225; 113120207; 156377162; 156615306;Tripedalia cystophora: 33391193Acropora formosa: 228960; Acropora millepora: 7335704; 7595811; 7595813; 13506878; 117581730; 117581732;Anthopleura jap\u00f3nica: 144369323; 144369326; 144369366; Aurelia aurita: 50841484; Cassiopea xamachana: 4894653; 4894655; 4894659; Cladonema radiatum: 47155918; 47155920; 47155922; Eleutheria dichotoma: 1147626; 91982983; 91982989; Hydra littoralis: 2102728; Hydra magnipapillata: 630481; 630482; 89242120; 144369369; 144369375; Hydra viridis: 7120; 7124; 7130; 83763566; Hydra vulgaris: 4433647; 4838455; 7635731; 7635733; 7635737; 7635742; 9945022; Hydractinia symbiolongicarpus: 2980868; 83272159; Nematostella vectensis: 5081328; 32816237; 74039494; 78190375; 82395398; 82395410; 82570519; 82570521; 82570527; 82570529; 82570537; 82570539; 82570545; 82570549; 82570555; 82570561; 82621507; 82621511; 82621513; 82621515; 82621519; 82621523; 82621527; 82621531; 82621535; 82621539; 82621541; 82621547; 82621549; 82621551; 82621565; 82621567; 82621571; 82621573; 82621575; 82621589; 82621595; 82621601; 82621603; 82621605; 82621613; 82621621; 82621627; 82621629; 82621633; 82621637; 82621643; 82621645; 82621671; 82621675; 83356317; 99030986; 110338989; 110339023; 110339061; 110339099; 110339101; 110339115; 110339171; 110339191; 110339211; 110339247; 113120203; 156356964; 156358580; 156361301; 156361303; 156364678; 156368221; 156371265; 156371439; 156372678; 156374167; 156377158; 156377160; 156377164; 156389076; 156390886; 156393340; 156395806; 156396978; 156398319; 156407912; Podocoryne carnea: 976094; 6118056; 6465862; 7649930; 9964019; 47155914; 62002543; Sarsia sp.: 9988771; Scolionema suvaense: 158936914; Suberites domuncula: 49659005; Trichoplax adhaerens: 38565482"}
{"text": "The Open Rheumatology Journal,\u00a02018, 12: 1-10The type of Article has been revised as follows:Review ArticleThe type of article originally provided was:Research ArticleThe revised headings of declarations are mentioned below:CONSENT FOR PUBLICATION:Not applicable.The original headings of declarations provided were:ETHICS APPROVAL AND CONSENT TO PARTICIPATENot applicable.HUMAN AND ANIMAL RIGHTSNo Animals/Humans were used for studies that are base of this research."}
{"text": "Correction to: Trials (2017) 18:22https://doi.org/10.1186/s13063-017-1906-7In the original publication  Figures There were some minor typographical errors on pages 2 and 4 and in the backmatter.Page 2 should have read: \u2018There is a clear knowledge gap with regard to effective strategies aimed at recruiters\u2019 ([The backmatter: Trial status: The first recruitment review took place in September 2015, and the last review in August 2016. The first 6-month follow-up took place in March 2016, with the last one in February 2017.\u2019Incorrect name tagging:Last Name: SalmanFirst Name: Rustam Al-ShahiCorrect author name tagging:Last Name: Al-Shahi SalmanFirst Name: RustamFollowing publication of the first correction article , we have"}
{"text": "Nature Communications8: Article number: 14475; DOI: 10.1038/ncomms14475 (2017); Published: 02152017, Updated: 06252018The original HTML version of this Article omitted the article number; it should have been \u201814475\u2019. This has now been corrected in the HTML version of the Article. The PDF version was correct from the time of publication."}
{"text": "Retirement preparation program: evaluation of resultsPsychology: Research and ReviewIncorrect version:Retirement preparation program: evaluation of resultsIt should read:The original publication (Psicologia: Reflex\u00e3o e Cr\u00edticaPsychology: Research and Review,"}
{"text": "This article has been corrected: The correct Grant Support information is given below:GRANT SUPPORTThis work was funded by National Natural Science Foundation of China grant 81472606, Chinese Ministry of Science and Technology grant (973 grant) 2011CB812401, and the Beijing Municipal Government.https://doi.org/10.18632/oncotarget.6461Original article: Oncotarget. 2016; 7:3884-3896."}
{"text": "This article has been corrected: The correct Acknowledgments information is given below:ACKNOWLEDGMENTSThe authors thank Tamar Ziv and Arie Admon  for the proteomic analysis. The authors also thank Antonella Di Pizio and Masha Y. Niv  for performing the structural analysis on predicted NF1 cleavage sites. The authors also thank The De Botton Protein Profiling institute of the Nancy and Stephen Grand Israel National Center for Personalized Medicine, Weizmann Institute of Science for identifying the proteolytic product of NF1. The work was supported by Minerva Foundation Grant.https://doi.org/10.18632/oncotarget.25805Original article: Oncotarget. 2018; 9:31264-31277."}
{"text": "Nature Communications8: Article number: 14907; DOI: 10.1038/ncomms14907 (2017); Published: 04072017; Updated: 05252018The original version of this Article contained an error in the spelling of the author Aysegul Gezer, which was incorrectly given as Aysegul Geyser. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "AbstractHierodulapatellifera  occurs several Mediterranean countries, such as Italy. These arrivals could come from many factors: new pets or commercial human transport.Originally from Asia, Hierodulapatellifera  is here reported for the first time in France. A well settled and probably widespread population of this species is here discussed as its adaptability to the Mediterranean climate. Some considerations on the potential impacts on the local ecosystems and its future spreading in Europe as an invasive species are given.The presence of  Hierodulatenuidentata Saussure, 1869 in Italy, in the Po valley . Amongst these groups, insects are widely represented. In parallel, entomologists use, since 1999, the forum hosted on insecte.org to discuss their sigthings and upload them into a gallery of photographs where they are validated by the community. A third widely-used website for Citizen-Science is inaturalist.org. This website, which is also available as a mobile application, has been used to collect collateral information and monitor the presence of o valley .Mantodea male, located in Marseille, was put online with the app INPN Esp\u00e8ces and its identity discussed within the community. Sightings of alien Mantodea were then also highlighted on the forum insecte.org. The results of this research are presented here, highlighting the presence of a new Asian mantid species for France since at least 2013: Hierodulapatellifera .On 1 September 2019, a photo of a In addition, several species of mantids seem to invade Europe from Caucasus  and AsiaRecently, Citizen Science in France relies heavily on the application INPN Esp\u00e8ces. The sightings of insects are based on the website insecte.org and the World\u2019s fauna and flora observations are organised on the online database inaturalist.org.These three methods of publishing sightings in France are presented here:INPN Esp\u00e8cesA genuine tool for raising awareness and knowledge, building on the French biodiversity, INPN Esp\u00e8ces allows everyone to discover, from their mobile phone, the diversity of the species around us and to participate in the biodiversity inventory in France. It is the only app in France that allows us to investigate all the French Fauna and Flora species (mainland and overseas) through their characteristics, distribution or conservation status. Thanks to a data entry eased by images and geolocalisation from one\u2019s mobile, anyone can, with one click, improve the knowledge on the surrounding wildlife.To take part in the country\u2019s species surveying by transmitting our records to experts, only a few clicks are needed to share the sightings. The first identification by the observer is then checked by experts of each group involved in the project.insecte.org (\u2018Le Monde des insectes\u2019)This website is a gathering places for all insect lovers, whatever their level of knowledge, their approaches and their objectives. A discussion forum is organised according to the different orders of insects. When images in a post are validated collectively, the photos are placed in a gallery that serves as a reference library. Once a year, data are sent to the French national species inventory (INPN).inaturalist.orgOne of the world\u2019s most popular online wildlife databases, iNaturalist helps everyone identify the plants and animals around us. It allows connection to a community of over 750,000 scientists and naturalists who can help us learn more about nature. Moreover, by recording and sharing our sightings, people will create research quality data for scientists who are working to better understand and protect nature. iNaturalist is a joint initiative by the California Academy of Sciences and the National Geographic Society.Mantodea used here follow the latest update  was published, from the 9th district of Marseille  , one with a juvenile at Arles  and, finally, one with a female travelling on a boat in the Black Sea.In parallel, research was initiated on the forum of the website insecte.org, as well as on inaturalist.org. Alien Specimens from Mouri\u00e8s:Mantodea was observed in an olive grove. It was compared with a female Irisoratoria  on a photo published on insecte.org. During the many exchanges between naturalists, its identity was discussed between Sphodromantisviridis  and Hierodulatranscaucasica Brunner von Wattenwyl, 1878. On 28 September 2015, a new Mantodea female was discovered in the same locality. It seemed to be the same species. It was kept and put in breeding to observe an ootheca and to photograph it. It had been stated that the specimens observed were Hierodulatranscaucasica. The different people involved in the discussion were contacted. Detailed photographs were taken of the second captured female. The exact location of the captures was also noted. Oothecae and an old female were observed on olive trees in early November 2019 . It turns out that it was a female. Its identity was not fixed at the end of the discussions.On 27 July 2019, a nymph Specimen on the Black Sea:M.religiosa. Discussions then orientated for the identification towards H.transcaucasica. A synonymy with Hierodulatenuidentata Saussure, 1869, is suggested on the basis of recent references.On 22 September 2011, an adult female was photographed on a boat on the Black Sea. It was first mistakenly identified as Specimen from Marseille:H.patellifera. It was compared with a male of H.tenuidentata from the Greek island of Skopelos. Some morphological criteria, such as yellowish callous spots of the anterior coxae, are characteristic and can be observed on the photographed specimens. After examining the photographs of females from Mouri\u00e8s and the nymph (then adult) from Arles, it is possible to identify them as H.patellifera.The male from Marseille was studied morphologically. It is H.tenuidentata.On the other hand, the morphological criteria of the female on the boat on the Black Sea and its geographical location indicate that it is Serville, 18394A66F50F-FA2C-5B96-BDB4-D5106A1E3CF2Type status:Other material. Occurrence: recordedBy: Mattias Perez; individualCount: 1; sex: female; lifeStage: adult; Location: continent: Europe; country: France; stateProvince: Bouches-du-Rhone; county: Mouries; verbatimElevation: 30 m; verbatimLatitude: 43.69858; verbatimLongitude: 4.85217; verbatimCoordinateSystem: decimal degrees; Identification: identifiedBy: Nicolas Moulin; Event: samplingProtocol: hand catching; eventDate: 2013-11-03; eventRemarks: on oliveType status:Other material. Occurrence: recordedBy: Mattias Perez; individualCount: 1; sex: female; lifeStage: adult; Location: continent: Europe; country: France; stateProvince: Bouches-du-Rhone; county: Mouries; verbatimElevation: 30 m; verbatimLatitude: 43.69858; verbatimLongitude: 4.85217; verbatimCoordinateSystem: decimal degrees; Identification: identifiedBy: Nicolas Moulin; Event: samplingProtocol: hand catching; eventDate: 2015-09-28; eventRemarks: on oliveType status:Other material. Occurrence: recordedBy: Gauillaume Paulus; individualCount: 1; sex: female; lifeStage: nymph; Location: continent: Europe; country: France; stateProvince: Bouches-du-Rhone; county: Arles; verbatimElevation: 5 m; verbatimLatitude: 43.673112; verbatimLongitude: 4.633544; verbatimCoordinateSystem: decimal degrees; Identification: identifiedBy: Nicolas Moulin; Event: samplingProtocol: hand catching; eventDate: 2019-07-26; eventRemarks: in a gardenType status:Other material. Occurrence: recordedBy: Didier Aurelle; individualCount: 1; sex: male; lifeStage: adult; Location: continent: Europe; country: France; stateProvince: Bouches-du-Rhone; county: Marseille; verbatimElevation: 45 m; verbatimLatitude: 43.2565769; verbatimLongitude: 5.4097269; verbatimCoordinateSystem: decimal degrees; Identification: identifiedBy: Nicolas Moulin; Event: samplingProtocol: hand catching; eventDate: 2019-09-01; eventRemarks: on a balcony, 6th floorHierodulapatellifera, described from Java  will be updated with all these observations.Hierodulapatellifera occurs in a French department, Bouches-du-Rh\u00f4ne, on the basis of these records. The arrival would be prior to 2013. Several generations and a nymph have been observed. The first individuals could have arrived by Cargo from Asia or could have been voluntarily released, because it is a commonly reared pet. This would not be a continuation of colonisation with the known populations of H.tenuidentata in Northern Italy, in the Po Valley . The hypothesis of displacement by boat is valid because, a few years ago, a female specimen of H.tenuidentata was observed aboard a ship on the Black Sea. Its place of arrival in the boat could not really be located between Ukraine, Turkey, Romania, Bulgaria, Albania and the Danube Estuary. It is, however, well known that this species occurs in these countries  and is represented by one species: Sphodromantisviridis (Finally, the species of viridis .Mantodea must be in charge to identify them.Today, thanks to citizen science, it is important and possible to monitor such invasive alien species. However, the problem of the specific attribution of these specimens through photos is important. Then, some specialists of Vespavelutina (These invasive species could destabilise existing ecological niches by creating competition and ecological pressure, like the Asian Hornet, velutina . At the"}
{"text": "Correction to: BMC Genomics (2019) 20:389DOI: 10.1186/s12864-019-5782-2Following the publication of this article , the autIn this Correction article the incorrect and correct author name are shown. The original publication of this article has been corrected.Rona DoyleOriginally the author name was published as:Ronan DoyleThe correct author name is:The publisher apologizes to the authors and readers for any inconvenience caused by this error."}
{"text": "Objectives: To analyze how older adults conceptualize these intergenerational relationships. Methods: In this qualitative study, in-depth interviews were carried out with 316 older adults, aged 65-102, from three different nationalities who lived at home. Verbatim transcripts were examined. Results: Data analysis generated six themes representing intergenerational relationships: affection and reward; interest and integration; grandparent-grandchild interaction quality; privacy and boundaries definition; provision of support; and obligation of providing childcare, on two dimensions of ambivalence concerning their intergenerational relationships . Conclusions: The empirical findings from this research indicate how ambivalence in intergenerational relationships is experienced by older adults and stress the contradictory expectations of older adults with grandchildren. Keywords: Ambivalence; conflict; intergenerational relationships; older adults; support."}
{"text": "AbstractClavicornaltica is a genus of very small flea beetles living in the leaf litter layer of Asian forests, easily sampled with Winkler extraction. The genus is presumably very rich in species, but their taxonomy is hampered by their small size and morphological uniformity.Clavicornalticabelalongensis n. sp., was discovered and taxonomically treated by the course participants. We also present the first DNA barcodes for the genus.On a \u2018taxon expedition\u2019-style field course at Kuala Belalong Field Studies Centre in Brunei Darussalam (Borneo), a new species,  We expect this concept may (i) improve the public appreciation for taxonomy and (ii) yield valid taxonomic output , discovered during the same field course, will appear elsewhere .In this paper, we provide partial results from a taxon expedition to the Ulu Temburong rainforest in Brunei, namely the taxonomic treatment of a new species of the leaf litter chrysomelid Callophylum sp., Dacroydes sp., and Horsfieldia sp., 70-80% canopy coverage, few vines, several decaying logs, and a distinct Dicuspiditermes termite presence.We worked in the vicinity of the Kuala Belalong Field Studies Centre (KBFSC) in the Ulu Temburong National Park in the Temburong district of Brunei. We collected specimens at the start of the \u2018Ashton Trail\u2019 just west of KBFSC, adjacent to the \u2018Earthwatch Plot\u2019 . The areClavicornaltica specimens removed. Our Winkler sampling yielded 12 specimens of Clavicornaltica which we provisionally assigned to four morphospecies, of which one was represented by sufficient individuals to warrant taxonomic description.On 27.09.2018 and 1.10.2018, we carried out the following field workshop. Field course participants collected leaf litter from two microhabitats, sampled separately (~75 l each): (i) open forest floor and (ii) the area between buttress roots. Leaf litter was then passed through a 1-cm mesh-width beetle sieve and subsequently extracted in a Winkler apparatus, the yield of which was preserved in 96% ethanol. This was then sorted under a dissection microscope and all Morphological examinations were carried out in the field lab with a Nikon SMZ445 dissection microscope with 10\u00d7 eye pieces (magnification up to 35\u00d7), a Leica ICC50 HD compound microscope and basic dissection materials. Photographs were made either with a smartphone through the eyepiece of a microscope or on a translucent white acrylic sheet with a Nikon D800e fitted with a Laowa 25 mm ultra-macro lens . Images were processed in Adobe Lightroom and subsequently stacked in Adobe Photoshop CS6. Genitalia and other dissected parts were embedded in polyvinylpyrrolidone . Lengthswww.boldsystems.com).One individual (TxExBr0004w-1) was analysed genetically as follows. DNA was isolated from a sample of abdominal soft tissue using the DNeasy Blood & Tissue Kit (Qiagen) and the extracted DNA was then purified with AMPureXP beads (Beckman Coulter). Around 10 ng of DNA were used in a PCR to generate amplicons for the COI barcoding region, using general primers ; institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimenType status:Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0004w-2; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0004w; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; verbatimLatitude: 4.5472; verbatimLongitude: 115.1571; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-09-27; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01172); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimenType status:Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0014w-3; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0014w-3; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; decimalLatitude: 4.5472; decimalLongitude: 115.1571; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-09-27; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01173); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimenType status:Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0004w-4; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0004w; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; decimalLatitude: 4.5472; decimalLongitude: 115.1571; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-09-27; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01174); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimenType status:Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0004w-5; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0004w; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; decimalLatitude: 4.5472; decimalLongitude: 115.157; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-09-27; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01176); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimenType status:Paratype. Occurrence: recordedBy: Taxon Expeditions field course participants; individualID: TxExBr0004w-8; individualCount: 1; sex: female; lifeStage: adult; preparations: card-mounted; disposition: in collection; Taxon: scientificName: Clavicornalticabelalongensis; kingdom: Animalia; phylum: Arthropoda; class: Hexapoda; order: Coleoptera; family: Chrysomelidae; genus: Clavicornaltica; specificEpithet: belalongensis; taxonRank: species; scientificNameAuthorship: Schilthuizen et al., 2019; nomenclaturalCode: ICZN; Location: locationID: TxExBr0004w; continent: Asia; island: Borneo; country: Brunei Darussalam; stateProvince: Temburong; locality: Kuala Belalong Field Studies Centre; verbatimLocality: Kuala Belalong Field Studies Centre, along Ashton trail; verbatimElevation: 120 m; decimalLatitude: 4.5472; decimalLongitude: 115.1571; Event: samplingProtocol: Winkler sampling; samplingEffort: 150 l of forest leaf litter; eventDate: 2018-10-01; habitat: Lowland dipterocarp forest; Record Level: type: PhysicalObject; bibliographicCitation: Clavicornalticabelalongensis (UBDM.3.01175); institutionID: UBD; institutionCode: IBER-UBD; collectionCode: Zoology; basisOfRecord: PreservedSpecimenBody orange-red, small, nearly hemispherical, 1.15-1.30 mm long and 0.9-1.1 mm wide (i.e. ca. 1.25 times as long as wide) , densely beset with confluent double punctuation; tubercles and midfrontal sulcus poorly developed and inconspicuous. Eyes convex, each eye consisting of 26-30 ommatidia, ca. 1/5 the width of the head measured across the eyes in dorsal view. Antennae: clava long and moderately robust.Pronotum: Very weakly shagreened and punctuated; punctures sparse and minute, of similar strength to the subordinate punctuation on the elytra; pronotal surface therefore shiny. Lateral margin with a callosity that stretches from the anterior to the posterior corner. Lateral setiferous pore at 2/3 of the length of the margin, seta as long as the clava of the antenna, pore removed from the margin by a distance similar to the width of antennomere II. Posterior setiferous pore placed directly at the margin, the seta length similar to antennomeres IX+X.Hind wings: Absent.Elytra: Shiny, punctate in 9 longitudinal rows, scutellar row \u00bc the length of the other rows, consisting of ca. 6 punctures. Punctures in all rows deeply impressed along their entire length (puncture width is similar to their interspaces). In between, the major punctures are irregularly scattered and there are much smaller subordinate punctures. A rudiment of a 10th row exists in the final 1/3 flanking the elytral margin. A fine groove runs along the entire margin continuing to the apex; apex itself slightly drawn out. The internal edge of epipleura carries a short row of punctures, alongside the 4th and 5th visible sternite.Legs: Tibia and tarsus orange, femur dark orange and robust. Metafemur robust, oval, covered in reticulate microsculpture. External edge of metatibia bearing two parallel rows of 8-10 minute stiff setae placed along the terminal one-fifth and flanking the basis of metatarsomere I. Internal side of metatibia bearing ca. 10 thin setae that are placed along the terminal half of the tibia and increase to about 2.5\u00d7 the length of the external setae, then decrease in length towards the apex. The metatibia carries a long terminal spine of about the same length as metatarsomere I. No serrations or microteeth are visible on the spine.Mesosternum: Processus rounded, with a distinct margin, central area somewhat convex.Abdomen: Carina on the first visible abdominal sternite sharp and narrow, not broadened anteriorly or posteriorly, running along the length of the sternite. In reduced form, this carina is carried on to the four posterior sternites, which therefore, in lateral view, offer a slightly serrated aspect. The surface of the sternites carries a rough microsculpture of confluent punctures. Tergum IX (last visible tergite) with three longitudinal median ridges, the central one of which is much weaker than the two outermost. Subapically, tergum IX has a horizontal row of 8 serrations.Female genitalia: Spermatheca consisting of a pear-shaped receptacle, ca. 90 \u00b5m in length, with crosswise annulations Clavicornalticabelalongensis sp. n. differs from all other known Clavicornaltica are (i) the pear-shaped spermathecal receptacle that is distinctly separated from the pump and (ii) the medially keeled abdominal sternites. Furthermore, the new species can be separated from other oriental Clavicornaltica in the following respects: C.fortepunctata Scherer, 1974 (Vietnam) is more elongate  is black, the pronotum is impunctate and it is also much larger (1.9 mm)  have impunctate elytra  is larger (>1.5 mm)  is reddish-black and the elytral punctuation is reduced  has a widened first protarsomere and an anteriorly widened carina on the 1st abdominal segment  has a wide plate on the underside of the 1st abdominal sternite; Clavicornalticatrautneri Medvedev, 1993 is much larger (2.1 mm)  has a posteriorly narrowed pronotum  has an anteriorly widened carina on the 1st abdominal segment  has the spermathecal pump fused with the receptacle and a widened carina on the first abdominal segment  has the spermathecal pump fused with the receptacle  has the mesosternal processus flat, not convex  has the spermathecal pump wider than the receptacle  has vaginal palpi very short and the spermathecal pump wider than the receptacle  is 1.6 times as long as wide and has the carina on the 1st abdominal sternite widened posteriorly  is larger and more elongate; its head is not shagreened  has a spherical spermathecal receptacle, the carina on the 1st abdominal sternite is widened anteriorly and is flanked by rows of strong punctures, the metafemur is more elongated and the vaginal palpi are diverging, not parallel  has a much more elongate habitus  has impunctate elytra and a black body  ; Clavicoe elytra ; Clavico>1.5 mm) ; Clavico reduced ; Clavico segment ; Clavico(2.1 mm) ; Clavicopronotum ; Clavico segment ; Clavico segment ; Clavicoceptacle ; Clavicot convex ; Clavicoceptacle ; Clavicoceptacle ; Clavicoteriorly ; Clavicoagreened ; Clavicoparallel ; Clavico habitus ; finallyack body .Clavicornalticabelalongensis Schilthuizen et al., 2019, provided the full citation of this publication appears in the bibliography or elsewhere in the referring work.The species is named after the Belalong river; the new species was recorded in the close vicinity of the river\u2019s left bank. Following Article 51C of the Code , the speKnown only from a location near the confluence of the Belalong and Temburong rivers, at 120 m elevation . However, as pointed out by Clavicornaltica, which currently stands at 26 species, has barely scratched the surface of the true diversity. Given the morphological inaccessibility of this diversity, we expect DNA barcoding to be of some use. We hope the sequence we present here for C.belalongensis will be a starting point for further building up a database of DNA barcodes for this genus.These and previous results (ors e.g. , the speors e.g.  suggesteDespite the present single-species description based on limited material from a single locality, we believe that taxonomic work is best carried out in the context of larger revisions. However, we think that concise treatments of single species such as we present here, have value . As reso"}
{"text": "Nature Communications8:15223 doi: ; DOI: 10.1038/ncomms15223 (2017); Published 05122017; Updated 05252018The originally published version of this Article contained an error in Fig. 1. In panel d, the uppermost western blot was inadvertently inverted during typesetting of the figure. This has now been corrected in both the PDF and HTML versions of the Article."}
{"text": "Reproducibility, or a lack thereof, is an increasingly important topic across many research fields. A key aspect of reproducibility is accurate reporting of both experiments and the resulting data. Herein, we propose a reporting guideline for mass spectrometry imaging (MSI). Previous standards have laid out guidelines sufficient to guarantee a certain quality of reporting; however, they set a high bar and as a consequence can be exhaustive and broad, thus limiting uptake.To help address this lack of uptake, we propose a reporting supplement\u2014Minimum Information About a Mass Spectrometry Imaging Experiment (MIAMSIE)\u2014and its abbreviated reporting standard version, MSIcheck. MIAMSIE is intended to improve author-driven reporting. It is intentionally not exhaustive, but is rather designed for extensibility and could therefore eventually become analogous to existing standards that aim to guarantee reporting quality. Conversely, its abbreviated form MSIcheck is intended as a diagnostic tool focused on key aspects in MSI reporting.We discuss how existing standards influenced MIAMSIE/MSIcheck and how these new approaches could positively impact reporting quality, followed by test implementation of both standards to demonstrate their use. For MIAMSIE, we report on author reviews of four articles and a dataset. For MSIcheck, we show a snapshot review of a one-month subset of the MSI literature that indicated issues with data provision and the reporting of both data analysis steps and calibration settings for MS systems. Although our contribution is MSI specific, we believe the underlying approach could be considered as a general strategy for improving scientific reporting. N-glycans  : \u201c2017/6/1\u201d[Date\u2014Publication])) AND maldi AND imaging\u201d on the 3rd of July 2017Additional File S8. R script required for plotting of MSIcheck review resultsDCI: data citation index; DOI: digital object identifier; EMBL: European Molecular Biology Laboratory; FTMS: Fourier Transform Mass Spectrometry; GUI: graphical user interface; LDI: laser desorption/ionization; MALDI: matrix-assisted laser desorption/ionization; MIAMSIE: Minimum Information About a Mass Spectrometry Imaging Experiment; MIAPE: Minimum Information About a Proteomics Experiment; MIRAGE: Minimum Information Required for a Glycomics Experiment; MS: mass spectrometry; MSI: mass spectrometry imaging; MSIS: Mass Spectrometry Imaging Society; SIMS: secondary ion mass spectrometry.The authors declare that they have no competing interests.O.J.R.G.'s position was funded by the Australian Research Council (ARC) Centre of Excellence for Convergent Bio-Nano Science & Technology . L.J.W.'s position was funded through Bioplatforms Australia . E.A.B.U. was funded by the ARC (DE160101142).Supplemental FileClick here for additional data file."}
{"text": "Nature Communications8: Article number: 14479; DOI: 10.1038/ncomms14479 (2017); Published: 02152017; Updated: 06252018The original HTML version of this Article omitted the article number; it should have been \u201814479\u2019. This has now been corrected in the HTML version of the Article. The PDF version was correct from the time of publication."}
{"text": "This article has been corrected: The correct Acknowledgment information is given below:ACKNOWLEDGMENTThis work was funded by National Natural Science Foundation of China grant 81472606, Chinese Ministry of Science and Technology grant (973 grant) 2011CB812401, and the Beijing Municipal Government.https://doi.org/10.18632/oncotarget.6491Original article: Oncotarget. 2016; 7:3367-3378."}
{"text": "AbstractPolycentropusierapetraslovenica has been considered a narrow range endemic of Slovenia and surrounding areas. Rhyacophilaaurata, a species known from many parts of Europe, according to the current knowledge, is absent from a large part of the Balkan Peninsula.The knowledge about distribution, ecology and species composition of caddisflies of the Balkan Peninsula is still not complete. The ongoing investigations of the last years highlight this area as an important hotspot of caddisfly diversity. Trichoptera from the Republic of Kosovo with exact distribution data, based on sampling carried out randomly during 2014 and 2017. Polycentropusierapetraslovenica was found in several streams in Bjeshk\u00ebt e Nemuna Mountains and Karadak Mountains. Rhyacophilaaurata was found during this investigation at a single locality in Bjeshk\u00ebt e Nemuna Mountains.In this paper, we present records of these two rare taxa of The unexpected finding of these two taxa in Kosovo greatly enlarges their known distribution area and makes a contribution towards the better knowledge of distributional patterns of these rare taxa of caddisflies in this part of Europe. The knowledge about distribution, ecology and species composition of caddisflies in the Balkan Peninsula is still not complete. The recent and ongoing investigations in this area e.g.  make posUntil recently, there were only few registered records of caddisfly species in Kosovo, but the list has significantly increased during the past decade, with several new species being described e.g. . HoweverThe main goal of this study was to contribute to the list of caddisfly taxa in the Republic of Kosovo and improve the knowledge about geographic distribution of rare taxa of caddisflies in the Balkan Peninsula, to assist in proper conservation of freshwater ecosystems.Sampling was carried out occasionally during 2014 and 2017 at six sampling stations, three of them being located in Bjeshk\u00ebt e Nemuna and the other three in Karadak Mountains in the Republic of Kosovo Table  were plaMalicky, 1998F78BD300-7078-52F6-A6D0-77ECB1B42750https://www.gbif.org/species/6262227Type status:Other material. Occurrence: recordedBy: Halil Ibrahimi, Ruzhdi Ku\u00e7i, Astrit Bilalli, Milaim Musliu; individualCount: 5; sex: males; Location: higherGeography: Europe; waterBody: tributary of Lepenc River, Aegean Sea Basi; country: Kosovo; municipality: Hani i Elezit; locality: D\u00ebrmjak; verbatimLocality: streamlet above the village, towards the border with the Republic of North Macedonia; decimalLatitude: 42.17264; decimalLongitude: 21.31582; Event: samplingProtocol: UV light trap; samplingEffort: overnight; year: 2017; month: 6; day: 12; fieldNotes: collected with ultraviolet light over the white pan operating from dusk until the next morning; Record Level: institutionCode: University of Prishtina \"Hasan Prishtina\", Faculty of Mathematics and Natural Sciences, Department of Biology; collectionCode: caddisflies of KaradakType status:Other material. Occurrence: recordedBy: Halil Ibrahimi, Ruzhdi Ku\u00e7i, Astrit Bilalli, Milaim Musliu; individualCount: 5; sex: males; Location: higherGeography: Europe; waterBody: tributary of Morava e Bin\u00e7\u00ebs River, Black Sea basin; country: Kosovo; municipality: Gjilan; locality: Zheg\u00ebr village; verbatimLocality: streamlet above the village; decimalLatitude: 42.31572; decimalLongitude: 21.53148; Event: samplingProtocol: UV light trap; samplingEffort: overnight; year: 2017; month: 7; day: 14; fieldNotes: collected with ultraviolet light over the white pan operating from dusk until the next morning; Record Level: institutionCode: University of Prishtina \"Hasan Prishtina\", Faculty of Mathematics and Natural Sciences, Department of Biology; collectionCode: caddisflies of KaradakType status:Other material. Occurrence: recordedBy: Halil Ibrahimi, Ruzhdi Ku\u00e7i, Astrit Bilalli, Milaim Musliu; individualCount: 5; sex: males; Location: higherGeography: Europe; waterBody: tributary of Morava e Bin\u00e7\u00ebs River, Black Sea Basin; country: Kosovo; municipality: Viti; locality: Letinic\u00eb; verbatimLocality: stream above the village; decimalLatitude: 42.28727; decimalLongitude: 21.45736; Event: samplingProtocol: UV light trap; samplingEffort: overnight; year: 2017; month: 7; day: 20; fieldNotes: collected with ultraviolet light over the white pan operating from dusk until the next morning; Record Level: institutionCode: University of Prishtina \"Hasan Prishtina\", Faculty of Mathematics and Natural Sciences, Department of Biology; collectionCode: caddisflies of KaradakType status:Other material. Occurrence: recordedBy: Halil Ibrahimi, Arben Gashi, Besnik Em\u00ebrllahu, Naman Sinani; individualCount: 4; sex: males; lifeStage: adult; Location: higherGeography: Europe; waterBody: tributary of Lumbardhi i Pej\u00ebs River, Adriatic Sea basin; country: Kosovo; municipality: Pej\u00eb; locality: Drelaj; verbatimLocality: stream above the village; decimalLatitude: 42.706667; decimalLongitude: 21.18056; Event: samplingProtocol: UV light trap; samplingEffort: overnight; year: 2014; month: 7; day: 14; fieldNotes: collected with ultraviolet light over the white pan operating from dusk until the next morning; Record Level: institutionCode: University of Prishtina \"Hasan Prishtina\", Faculty of Mathematics and Natural Sciences, Department of Biology; collectionCode: caddisflies of Bjeshk\u00ebt e NemunaType status:Other material. Occurrence: recordedBy: Halil Ibrahimi, Arben Gashi, Besnik Em\u00ebrllahu, Naman Sinani; individualCount: 3; sex: males; lifeStage: adult; Location: higherGeography: Europe; waterBody: tributary of Lumbardhi i Pej\u00ebs River, Adriatic Sea basin; country: Kosovo; municipality: Pej\u00eb; locality: Pepaj; verbatimLocality: stream above the village; decimalLatitude: 42.700278; decimalLongitude: 20.143889; Event: samplingProtocol: UV light trap; samplingEffort: overnight; year: 2014; month: 9; day: 17; fieldNotes: collected with ultraviolet light over the white pan operating from dusk until the next morning; Record Level: institutionCode: University of Prishtina \"Hasan Prishtina\", Faculty of Mathematics and Natural Sciences, Department of Biology; collectionCode: caddisflies of Bjeshk\u00ebt e NemunaSlovenia, Italy, Bosnia and Herzegovina and Kosovo .We found that the flight period of this subspecies is from May to September. The subspecies is present at different altitudes, from 620 m up to 1307 m.slovenica subspecies  clearly point to the bspecies .Polycentropusierapetraslovenica in D\u00ebrmjak on 12.06.2017 are: Rhyacophilafasciata Hagen, 1859 , Rhyacophilaloxias Schmid, 1970 , Rhyacophilapolonica McLachlan, 1879 , , Rhyacophilatristis Pictet, 1834 , , Glossosomaconformis Neboiss, 1963 , Synagapetusiridipennis McLachlan, 1879 ; Philopotamusmontanus  , Plectrocnemiaconspersa  , Polycentropusexcicus Klap\u00e1lek 1894 , Polycentropusflavomaculatus  , Psychomyiaklapaleki Malicky, 1995 , Psychomyiapusilla  , Lypereducta  , Tinodesrostocki McLachlan, 1878 , Tinodesunicolor  , Potamophylaxluctuosus  , Silograellsii Pictet, 1865  and Oecismusmonedula  .Other species associated with Polycentropusierapetraslovenica in Zheg\u00ebr on 14.07.2017 are: Rhyacophilafasciata Hagen, 1859 , Rhyacophilatristis Pictet, 1834 , Philopotamusmontanus  , Hydropsychefulvipes Curtis, 1834 ; Hydropsychesaxonica McLachlan, 1884  and Oecismusmonedula  .Other species associated with Polycentropusierapetraslovenica in Letnic\u00eb on 20.07.2017 are: Rhyacophilafasciata Hagen, 1859 , Philopotamusmontanus   and Hydropsycheinstabilis   .Other species associated with Polycentropusierapetraslovenica in Drelaj on 14.07.2014 are: Plectrocnemiamojkovacensis Malicky, 1982 , Limnephilussparsus Curtis, 1834  and Micropternasequax McLachlan, 1875 .Other species associated with Polycentropusierapetraslovenica in Pepa on 17.09.2014 are: Rhyacophilaarmeniaca Guerin-Meneville, 1843 , Rhyacophilapalmeni McLachlan 1879  and Ecclisopteryxkeroveci Previ\u0161i\u0107, Graf & Vitecek .Other species associated with Brauer, 18573377AAF6-494F-57FA-B5C3-6E2762B7B25Fhttps://www.gbif.org/species/1433826Type status:Other material. Occurrence: recordedBy: Halil Ibrahimi, Naman Sinani, Arben Gashi; individualID: 1; sex: male; lifeStage: adult; Location: continent: Europe; waterBody: tributary of Lumbardhi i Pej\u00ebs River, Adriatic Sea basin; country: Kosovo; municipality: Pej\u00eb; locality: Stankaj; verbatimLocality: streamlet below the village; decimalLatitude: 42.700278; decimalLongitude: 20.143889; Event: samplingProtocol: UV light trap; year: 2014; month: 07; day: 20; fieldNotes: collected with entomological net; Record Level: institutionCode: University of Prishtina \"Hasan Prishtina\", Faculty of Mathematics and Natural Sciences, Department of Biology; collectionCode: caddisflies Bjeshk\u00ebt e NemunaAustria, Bosnia and Herzegovina, Czech Republic, Croatia, France, Germany, Italy, Liechtenstein, Poland, Slovakia, Slovenia, Switzerland .Rhyacophilaaurata in Stankaj on 20.07.2014 are: Rhyacophilaloxias Schmid, 970 , Rhyacophilapolonica McLachlan, 1879 , Rhyacophilapalmeni McLachlan, 1879 , Rhyacophilatristis Pictet, 1834 , Rhyacophilamocsaryi Klapalek, 1898 , Philopotamusmontanus   and Micrasemasericeum Klapalek, 1902 .Other species associated with Rhyacophilidae family is reported for the first time and one subspecies of Polycentropodidae is documented for the first time with the exact data from the Republic of Kosovo: Rhyacophilaaurata and Polycentropusierapetraslovenica.One species of the Polycentropusierapetra is endemic to South-eastern Europe and Turkey, with several known subspecies which are narrow endemics of certain areas  and Greece . In Bulgaria, only one subspecies  is known. The only subspecies with wider distribution is Polycentropusierapetraslovenica, which was described from Slovenia but was later found in Italy and Bosnia and Herzegovina as well  greatly enlarges their known distribution area. Previously, they have been reported from only few localities in the Balkans. It is only the second time that Psychomyiaklapaleki and the third time that Plectrocnemiamojkovacensis have been reported from Kosovo. This investigation shows that both mountainous areas where this investigation was conducted harbour a collection of rare caddisfly taxa, many of which are known only from a limited number of localities in the area, based on current knowledge. Further investigations of this area will most certainly increase the number of known species in Kosovo and improve the knowledge about this order of insects in the Balkans.Finding of several other rare species during this investigation (such as:"}
{"text": "The Funding section is incorrect. The correct Funding section is: The authors would like to acknowledge the financial support of: FINEP (Financiadora de Estudos e Projetos\u2014Project 01.12.0476.01), CNPq  and PRPq-UFMG (Pro-Reitoria de Pesquisa da UFMG). The publisher apologizes for the error."}
{"text": "This article has been corrected: The correct Due to erroneous figure processing and oversight, unintended mistakes occurred during the assembly of The authors apologize for the oversight. The authors declare that this correction does not affect the description, interpretation, or the original conclusions of the manuscript.https://doi.org/10.18632/oncotarget.4754Original article: Oncotarget. 2015; 6:26841-26860."}
{"text": "AbstractAvrainvillea was recently discovered off the island of O\u2018ahu in the Main Hawaiian Islands. Specimens were collected from Honolulu Harbor, including its entrance channel, and near Ke\u2018ehi Harbor. These locations are both in M\u0101lama Bay on O\u2018ahu\u2019s south shore in or adjacent to urbanized estuaries, respectively. In situ observations, morphological and molecular assessments were conducted to examine the alga\u2019s habit and distribution, as well as to assess its putative species identification.A second species in the siphonous green algal genus Halophiladecipiens) and algal meadows composed of the green alga Halimedakanaloana and an unidentified Udotea species at the Ke\u2018ehi Harbor site. All analyses supported both populations as representative of the same taxa, reported until further investigation in the broad Pacific as Avrainvilleacf.erecta based on morphological and molecular analyses. This record of a second Avrainvillea species in Hawai'i is of particular concern considering that an alga recognized as A.amadelpha, first observed in 1981 from two locales on O\u2018ahu\u2019s south shore, has become invasive in Hawai\u2018i\u2019s intertidal to mesophotic environments.The alga occurred in sand as single individuals or in clusters of several individuals at both sites, and near or within seagrass beds ( Bryopsidales includes over 500 extant species  C. Agardh in the Mediterranean (Codiumfragilessp.tomentosoides(van Goor) P. C. Silva (=ssp.fragile (Suringar) Hariot) across the globe  A. Gepp & E. S. Gepp. However, A.amadelpha is most likely incorrect  were used to compare the newly recorded Avrainvillea sp. and the previously recorded \u201cA.amadelpha\u201d.Two specimens collected in 2014 BISH768338-9) and six collected in 2017 (BISH768278-83) that included what appeared to be mature and juvenile forms or possibly ecotypes were selected for morphological and molecular characterization  were borrowed from the Natural History Museum of London and included in our molecular assessment . DNA extraction was completed using the OMEGA E.Z.N.A\u00ae Plant DNA Kit . For the two type specimens, the protocol developed by rbcL  and tufA . These gene regions were selected as informative and reliably sequenced regions for siphonous green algae  and reverse (rbcLR) primers developed by 6 generations with chain sampling every 1,000 generations and a burnin value of 25% until congruence was met (standard deviation of split frequencies <0.05). Both RAxML and MrBayes were accessed on the CIPRES Science Gateway  A. Gepp & E.S. Gepp; Location: country: USA; municipality: Honolulu; locality: M\u0101lama Bay, seaward of Ke\u2018ehi Lagoon; minimumDepthInMeters: 25; maximumDepthInMeters: 40; decimalLatitude: 21.29; decimalLongitude: 157.9205; georeferenceProtocol: GPS; Identification: identifiedBy: Rachael M. Wade; dateIdentified: May-2017; identificationReferences: Olsen-Stojkovich 1985; Event: eventDate: Apr-22-2017; Record Level: language: en; basisOfRecord: PreservedSpecimenType status:Other material. Occurrence: catalogNumber: BISH768338-9; recordedBy: Kimberly Peyton, Kevin Foster, Paul Murakawa; individualCount: 2; otherCatalogNumbers: ARS09436-7; associatedSequences: MF969093-6; Taxon: scientificName: Avrainvillea cf. erecta; kingdom: Plantae; phylum: Chlorophyta; class: Ulvophyceae; order: Bryopsidales; family: Dichotomosiphonaceae; genus: Avrainvillea; specificEpithet: erecta; scientificNameAuthorship: (Berkeley) A. Gepp & E.S. Gepp; Location: country: USA; municipality: Honolulu; locality: M\u0101lama Bay, Honolulu Harbor; minimumDepthInMeters: 12; maximumDepthInMeters: 15; decimalLatitude: 21.30; decimalLongitude: 157.8689; georeferenceProtocol: GPS; Identification: identifiedBy: Rachael M. Wade; dateIdentified: Aug-2017; identificationReferences: Olsen-Stojkovich 1985; Event: eventDate: Oct-15-2015; Record Level: language: en; basisOfRecord: PreservedSpecimenType status:Other material. Occurrence: associatedSequences: MH938452; Taxon: scientificName: Avrainvilleaerecta; acceptedNameUsage: Avrainvilleaerecta Gepp & Gepp 1911; originalNameUsage: ChloroplegmapapuanumZanaradini 1878; kingdom: Plantae; phylum: Chlorophyta; class: Ulvophyceae; order: Bryopsidales; family: Dichotomosiphonaceae; genus: Avrainvillea; specificEpithet: erecta; taxonomicStatus: heterotypic synonym; Location: waterBody: Pacific Ocean; country: Indonesia; stateProvince: Papua; Identification: identifiedBy: Zanardini; dateIdentified: 1878; Event: year: 1872; month: May; fieldNotes: Collected by Odoardo Beccari; Record Level: institutionID: BM000561613; basisOfRecord: PreservedSpecimenAvrainvillea sp. was observed at six of 16 survey sites in the Honolulu Harbor entrance channel from 12-15m depths  in areas with deep sand , giving some thalli a U-shaped appearance. The holdfasts of larger, more mature individuals protruded from the sediment by approximately 1-5 cm, creating a conical mound at the base of the alga. Individuals were generally clean and not heavily epiphytized. The two morphologies at this location experienced very little water motion due to attenuation of wave motion with depth, and therefore were most likely the result of differences in age. The individuals with spherical assemblages of loose siphons were consistently much smaller in thallus size than the well-formed blade morphology.In 2017, the newly recorded Avrainvilleaerecta (Berkeley) A. Gepp & E.S. Gepp and their further morphological characterization by The specimens were olive-green upon collection and dried to a darker green with fulvous, or tawny, coloration Fig. c, d. Spe2rbcL and tufA, however, molecular characterization of historical material was only successful for rbcL for one of the heterotypic synonym type specimens - Chloroplegmapapuanum BM000561613. The concatenated alignment of the two gene regions yielded a dataset of 1,360 bp. Both the Maximum Likelihood and Bayesian inference phylogenetic reconstructions strongly supported that the newly recorded Avrainvillea species, A.cf.erecta, was clearly distinct from Hawai\u2018i specimens identified as \u201cA.amadelpha\u201d (obscura\u201d group while \u201cA.amadelpha\u201d clusters within the \u201clongicaulis\u201d group (A.cf.erecta (Berkeley) A. Gepp & E. S. Gepp from Japan and Micronesia. Although they exhibited two different morphs (loose siphons or blade), all specimens from the two Hawai\u2018i populations had identical DNA sequences.The majority of examined specimens were sequenced for both adelpha\u201d ; these ns\u201d group  Fig. 3)rbcL and Avrainvillea species showed most affinities to the description of A.erecta based on stipe length, blade habit, siphon width and morphology (constriction at dichotomy); however considering that we could not obtain material from type locality or the basionym type specimen (Dichonemaerectum Berkeley 1842), we temporarily consider the newly recorded species as A.cf.erecta until further research can be conducted  J.Agardh, in part due to the description of the species\u2019 ecomorphs that resemble both morphologies described here . However, during the past two years, H.kanaloana has begun to appear, and in many places, is now one of the dominant species. Similarly, Udotea sp. was only observed for the first time in the area earlier in 2017. Based on these observations, this habitat may be undergoing significant shifts in species composition, in which A.cf.erecta is playing a part .The site examined near Ke\u2018ehi Lagoon has historically been dominated by A.erecta  encompasses the East coast of Africa and the Red Sea to as far as the western Pacific in the waters of New Zealand and several Pacific Islands . Bolded character text represent character congruence with the newly discovered species from Hawai\u2018i.File: oo_233632.xlsxWade R"}
{"text": "This article has been corrected: The correct Acknowledgment information is given below:ACKNOWLEDGMENTSThis work was funded by National Natural Science Foundation of China grant 81472606, Chinese Ministry of Science and Technology grant (973 grant) 2011CB812401, and the Beijing Municipal Government.https://doi.org/10.18632/oncotarget.5221Original article: Oncotarget. 2015; 6:31628-31639."}
{"text": "Following publication of the original article , the autIncorrect tagging:Bart Staal JCorrect tagging:Staal JB"}
{"text": "Nature Communications8: Article number: 15405; DOI: 10.1038/ncomms15405 (2017); Published online 05222017; Updated 05252018The originally published version of this Article contained errors in Figure 4. In panels c and d, the labeling of the light and dark blue lines was inverted. These errors have now been corrected in both the PDF and HTML versions of the Article."}
{"text": "OBJECTIVES/SPECIFIC AIMS: Objectives: To determine genes that are shared between human and obese Zucker rat hypertrophic hearts, in order to identify potential early biomarkers and drug target for heart failure. METHODS/STUDY POPULATION: Four age-paired lean and obese Zucker rats were used. The human data are derived from doi:10.1152/physiolgenomics.00122.2016. RESULTS/ANTICIPATED RESULTS: We expect to find genes that are upregulated and downregulated in Zucker rats and humans that present cardiac hypertrophy. DISCUSSION/SIGNIFICANCE OF IMPACT: The genes and proteins determined from this study will provide future directions in order to determine whether obese Zucker rats are a valid model organism for the development of cardiac hypertrophy."}
{"text": "Nature Communications8: Article number: 14389; DOI: 10.1038/ncomms14389; Published: 02242017; Updated: 07132018The original HTML version of this Article had an incorrect article number of \u20180\u2019; it should have been \u201814389\u2019. This has now been corrected in the HTML version of the Article. The PDF version was correct from the time of publication."}
{"text": "Nature Communications7: Article number: 11414; DOI: 10.1038/ncomms11414 (2016), Published 04252016; Updated 11232018In the original version of this Article, the accession codes section within the Methods was inadvertently omitted. This section has now been added in both the PDF and HTML versions of the Article."}
{"text": "Correction to: BMC Public Healthhttp://dx.doi.org/10.1186/s12889-019-7144-zIt was highlighted that the original article  containeThe Publisher apologizes to the authors and readers for the inconvenience caused by the typesetting mistake.Incorrect title:Formative research for the design of a scalable mobile health program water, sanitation, and hygiene: CHoBI7 mobile health program.Correct title:Formative research for the design of a scalable water, sanitation, and hygiene mobile health program: CHoBI7 mobile health program.Incorrect Table Correct Table"}
{"text": "Nature Communications8: Article number: 16081; DOI: 10.1038/ncomms16081 (2017); Published: 07172017, Updated: 07132018The original version of this Article omitted the following from the Acknowledgements:A. baumannii targets, based on whole genome sequencing and annotation of BM4454 strain; and Stephanie Van Horn, Allan Kwan, Elizabeth Valoret for A. baumannii genome sequencing and annotation.\u2019\u2018We thank Robert Kirkpatrick for implementing the high throughput protein design strategy that enabled screening and triage of essential Also, the original version omitted an acknowledgement to Prof. Lydia Tabernero as one of our collaborators for supplying the purified proteins used in the Tuberculosis screen.This has been corrected in both the PDF and HTML versions of the Article."}
{"text": "J Clin Exp Dent2018;3:252-263 1 Mar), there is an error in the authors of the manuscript. The correct author list is: Ioannis Kioleoglou, Argirios Pissiotis, Konstantinos Michalakis.In this article by Kioleoglou and colleagues ("}
{"text": "Nature Communications8: Article number: 15544; DOI: 10.1038/ncomms15544 (2017); Published: 05182017, Updated: 07132018In the originally published version of this Article, financial support was not fully acknowledged. The PDF and HTML versions of the Article have now been corrected to include support from the National Natural Science Foundation of China grant number 81573325."}
{"text": "The first sentence of the second paragraph of the Introduction should read: Australia has had seven highly pathogenic avian influenza (HPAI) outbreaks on chicken farms during the last 42 years (1976\u20132018), two of which have occurred in the last 10 years.Reference 20 should read: Office of Chief Veterinary Officer (AU). National Avian Influenza Surveillance Dossier. Canberra: Australian Government Department of Agriculture, Fisheries and Forestry; 2010. 165 p. [The last sentence of the fifth paragraph of the Introduction should read: Six of the seven outbreaks occurred in poultry low density regions (as outlined in farm density maps [26]) and the potential for spread of HPAI between farms in higher density regions is also not known [26].A reference is omitted from the last sentence of the second paragraph of the Discussion section, included to account for the 2012 and 2013 outbreaks.The sentence should read: In the seven HPAI out-breaks reported in poultry in Australia, introduction of LPAI viruses from wild birds and subsequent mutation has been hypothesized as the most likely origin of these outbreaks .The reference is: Brown I, Abolnik C, Garcia-Garcia J, McCullough S, Swayne DE, Cattoli G. High\u2010pathogenicity avian influenza outbreaks since 2008, excluding multi\u2010continental panzootic of H5 Goose/Guangdong\u2010lineage viruses. In: Swayne DE, editor. Animal Influenza 2nd ed. New York City: USA: Wiley; 2016. pp. 248\u2013270."}
{"text": "Nature Communications8: Article number: 14278; DOI: 10.1038/ncomms14278 (2017); Published 02152017, Updated 07182018The original HTML version of this Article omitted the article number; it should have been \u201814278\u2019. This has now been corrected in the HTML version of the Article. The PDF version was correct from the time of publication."}
{"text": "Nature Communications8: Article number: 14485; DOI: 10.1038/ncomms14485 (2017); Published: 02152017; Updated: 06252018The original HTML version of this Article omitted the article number; it should have been \u201814485\u2019. This has now been corrected in the HTML version of the Article. The PDF version was correct from the time of publication."}
{"text": "AbstractVanhorniaeucnemidarum Crawford is the only species of Vanhorniidae that occurs in North America. This species is rarely collected and thus the distribution is not well documented. Intending to uncover a more accurate range of this species, we assembled collection records from museums, personal collections and citizen science projects. Many of these records were non-digitised and had to be personally requested.V.eucnemidarum to include nine new provinces and states: Manitoba, Connecticut, Oregon, Mississippi, Missouri, New Hampshire, New Jersey, Texas and Wisconsin. Although Quebec has been listed as a previous locality, the recorded province was mislabelled, so Quebec is now also officially a provincial record.Here we expand the known distribution of  In spite of the fact that many species on our planet remain undescribed , our in-Vanhorniidae . They can be distinguished from other proctotrupoids using a combination of characters: exodont mandibles  and V.leileri Hedquist, 1976  found in dead maple  between the dates of 7-14 August 2015 in a stand of trees that included maple. Additional collection records were gathered from personal communications with museums (Table Two specimens of ms Table . The majAll locality records have been entered in Darwin Core archive format (Suppl. material All photos in this study were taken using a Canon 7D Mark II with either a Canon MP-E 65 mm F/2.8 Macro photo lens or a Mitutoyo M Plan Apo 10\u00d7 objective mounted on to the Canon EF Telephoto 70-200 mm zoom lens. Multiple images were taken across numerous focal planes and combined using Zerene Stacker 1.04. Images were edited using Adobe Photoshop CC and plates were prepared using Adobe Illustrator CC.Crawford 1909c0ba557b-ca86-5da2-b771-3b049a0609a0http://www.catalogueoflife.org/col/details/species/id/84c6010b1c8cef32c9a7ee8e730446b8Type status:Other material. Occurrence: catalogNumber: JBWM0378038; recordedBy: Amber Bass; sex: female; lifeStage: adult; occurrenceID: UCFC:Veuc:00000265; Taxon: scientificName: Vanhorniaeucnemidarum Crawford 1909; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Vanhorniidae; genus: Vanhornia; taxonRank: species; scientificNameAuthorship: Crawford 1909; Location: continent: North America; country: Canada; countryCode: CA; stateProvince: Manitoba; verbatimLocality: Howden; geodeticDatum: WGS84; Event: samplingProtocol: Malaise Trap; eventDate: 2015-07-14; year: 2015; month: 07; day: 14; Record Level: institutionCode: WRME; basisOfRecord: PreservedSpecimenType status:Other material. Occurrence: catalogNumber: UCFC0528248; recordedBy: Amber Bass; sex: female; lifeStage: adult; occurrenceID: UCFC:Veuc:00000196; Taxon: scientificName: Vanhorniaeucnemidarum Crawford 1909; kingdom: Animalia; phylum: Arthropoda; class: Insecta; order: Hymenoptera; family: Vanhorniidae; genus: Vanhornia; taxonRank: species; scientificNameAuthorship: Crawford 1909; Location: continent: North America; country: Canada; countryCode: CA; stateProvince: Manitoba; verbatimLocality: Howden; geodeticDatum: WGS84; Event: samplingProtocol: Malaise Trap; eventDate: 2015-07-14; year: 2015; month: 07; day: 14; Record Level: institutionCode: UCFC; basisOfRecord: PreservedSpecimenVanhorniaeucnemidarum can be distinguished from other species of Vanhornia by the following combination of characters: Antennal sockets inserted immediately above dorsal margin of clypeus; tegulae black to dark brown but never yellow; and rugulose metasomal striations restricted to the basal third.V.eucnemidarum in the states of Connecticut, Mississippi, Missouri, New Hampshire, New Jersey, Oregon, Texas and Wisconsin in USA and the Canadian province of Manitoba (Fig. V.eucnemidarum (Fig. V.eucnemidarum north to Manitoba, west to Oregon and south to Texas. This vast increase in the known range of V.eucnemidarum may be due to rarity of collection (Our search discovered 278 specimen records and three BugGuide photos. These data represent new records for rum Fig. , illustrrum Fig. D. The nellection , lack ofV.eucnemidarum, presented here, do not include host associations, they do allow for some speculation regarding the only known host, I.ruficornis. Several records of V.eucnemidarum were found to be in a state or province in which the known host I.ruficornis has not yet been recorded (I.ruficornis may be present in these areas but has not yet been collected or V.eucnemidarum may have a wider host breadth than previously thought. If the latter is true, we suspect the host range may include other Isorhipis species.Though the new records of recorded . These iV.eucnemidarum are with maple and beech (Isorhipisruficornis is a generalist on dead and rotting wood and, in addition to maple and beech, this species has been known to associate with eastern hemlock (V.eucnemidarum across a range of possible hosts will provide more information about the host breadth of V.eucnemidarum and may help predict its full range and possible biological control potential.The only known host plant associations of nd beech . Isorhip hemlock  and elm  hemlock . TargeteBiodiversity studies, such as this one, assist in building more complete ranges for species, which are vital for ecological, evolutionary and applied biological research. Researchers often have limited access to these data, with an estimated 10% of specimen data stored in a digital form and even less made available online . Only 22Citizen science records provided another important source of locality data used in this study. Photos, uploaded through citizen science projects and social media websites such as BugGuide, Flickr and iNaturalist, are becoming frequent sources of legitimate taxonomic records . This fuV.eucnemidarum, using a combination of museum, citizen science and digitised records. Given the large increase in range discovered through this study, it is possible that this species is present throughout North America. We hope this paper will aid in recognition of V.eucnemidarum by curators and naturalists, which will further our understanding of this enigmatic family of parasitoid wasps.This study has updated the distribution records of 681c9921-66bc-5f3f-9b21-a6f5ab2021b110.3897/BDJ.7.e37569.suppl1Supplementary material 1Vanhorniaeucnemidarum NA RecordsData type: OccurrencesBrief description: This datasheet provides an accessible way to search collection records gathered during this study.File: oo_312013.xlsxhttps://binary.pensoft.net/file/312013Joshua Hogan"}
{"text": "Previous computational modeling suggests it is much easier to segment words from child-directed speech (CDS) than adult-directed speech (ADS). However, this conclusion is based on data collected in the laboratory, with CDS from play sessions and ADS between a parent and an experimenter, which may not be representative of ecologically collected CDS and ADS. Fully naturalistic ADS and CDS collected with a nonintrusive recording device as the child went about her day were analyzed with a diverse set of algorithms. The difference between registers was small compared to differences between algorithms; it reduced when corpora were matched, and it even reversed under some conditions. These results highlight the interest of studying learnability using naturalistic corpora and diverse algorithmic definitions. Although children are exposed to both child-directed speech (CDS) and adult-directed speech (ADS), children appear to extract more information from the former than the latter , were independently transcribed by two undergraduate assistants, who resolved any disagreements by discussion. Transcription was done at the lexical level adapting the CHILDES minCHAT guidelines for transcription .We derived several versions of the ADS and CDS subcorpora crossing two factors see , we had Scripts used for corpus preprocessing, phonologization, and segmentation are available Cristia, . During Each algorithm  was run using the WordSeg package ), which is multiplied by 100 and reported as percentages here. Results for all other possible alternative metrics, and further discussion on these methods, are provided in the Supplemental Materials  and recall is .3 (one out of three gold words is correct). The overall F-score ranges from 0 to 1, as it is the harmonic mean of precision Cristia, .phonotactic-gold) sets the diphone probability threshold based on gold word boundaries. The unsupervised version (phonotactic-unsupervised) sets the threshold using utterance boundaries only. The phonotactics were computed on the concatenation of CDS and ADS versions of the corpus. The second algorithm, labeled TP, posits boundaries using transition probabilities between syllables, as proposed in Saffran, Aslin, and Newport (TP-relative). That is, given the syllable sequence WXYZ, a boundary is posited between X and Y if the transition probability between the X-Y is lower than between W-X and Y-Z. The second version uses average transitions over all pairs of syllables in the corpus as the threshold . The other variant, which we call lexical-multigram, is based on a more complicated rule set with hierarchically defined levels that are both smaller and larger than words . The other posits word boundaries at syllable edges (henceforth base-syll). The latter is likely to be effective for English CDS, which has a very high proportion of monosyllabic words  and whether CDS and ADS were matched in length . Positive difference scores, indicative of better CDS than ADS performance, were found in most matching conditions, regardless of whether automatic or human-utterance boundaries were used . HoweverIn short, we observe smaller CDS advantages than those found in previous work. To check whether this was due to algorithms or corpora, we applied our extensive suite of algorithms onto the Bernstein Ratner corpus ; ED from European Research Council (ERC-2011-AdG-295810 BOOTPHON), the Fondation de France, the Ecole de Neurosciences de Paris, the Region Ile de France (DIM cerveau et pens\u00e9e); MS from SSHRC . AC and ED acknowledge the institutional support of Agence Nationale de la Recherche (ANR-17-EURE-0017).AC: Conceptualization: Lead; Data curation: Lead; Formal analysis: Lead; Funding acquisition: Lead; Methodology: Lead; Project administration: Lead; Resources: Lead; Software: Lead; Validation: Lead; Visualization: Lead; Writing \u2013 original draft: Lead; Writing \u2013 review & editing: Lead. ED: Conceptualization: Supporting; Formal analysis: Supporting; Methodology: Supporting; Software: Supporting; Visualization: Supporting; Writing \u2013 review & editing: Supporting. NBR: Conceptualization: Supporting; Resources: Supporting; Writing \u2013 review & editing: Supporting. MS: Conceptualization: Supporting; Methodology: Supporting; Resources: Lead; Validation: Supporting; Visualization: Supporting; Writing \u2013 review & editing: Supporting.1\u2003The LENA Foundation built a hardware and software system to record and automatically analyze day-long child-centered recordings. For more information, see Soderstrom and Wittebolle .2\u2003https://osf.io/rvdbq/.The transcription manual is available from"}
{"text": "Following publication of the original article , the autIncorrect Title:Associations between post-operative rehabilitation of hip fracture and outcomes: national database analysis (90 characters)Correct Title:Associations between post-operative rehabilitation of hip fracture and outcomes: national database analysis"}
{"text": "Following publication of the original article , the autOriginally the author name was published as:Naima M. MoustaidThe correct author name is:Naima Moustaid-Moussa"}
{"text": "Nature Communications8: Article number: 14375; DOI: 10.1038/ncomms14375 (2017); Published online: 02152017, Updated: 06252018The original HTML version of this Article omitted the article number; it should have been \u201814375\u2019. This has now been corrected in the HTML version of the Article. The PDF version was correct from the time of publication."}
{"text": "Following publication of the original article , the autOn page 10:Equation but should read as:On page 12:The equation reads as:but should read as:The original article has been updated."}
{"text": "Personality Traits in Fibromyalgia (FM): Does FM Personality Exists? A Systematic Review2018, 14: 223-232Clinical Practice & Epidemiology in Mental Health, CorrectionThe corrections are provided and replaced online which is mentioned as under:Original: The name of coauthor was Ciacchini RebeccaCorrected:The name of coauthor has been revised as Rebecca Ciacchini"}
{"text": "This article has been corrected: An institutional investigation was conducted at the request of the Oncotarget editorial staff by the Academia Sinica Ethics Committee . The Committee concluded the following: \u201cThe partial duplication of Figure https://doi.org/10.18632/oncotarget.9660Original article: Oncotarget. 2016; 7:43629-43653."}
{"text": "Scientific Reports6: Article number: 2876710.1038/srep28767; published online: 06302016; updated: 07182018The Corrigendum published 25 April 2017 did not explain that the issue of entanglement swapping had been raised previously by Pathak and Thapliyal"}
{"text": "Nature Communications8: Article number: 14602; DOI: 10.1038/ncomms14602 (2017); Published: 02272017, Updated: 06252018The original HTML version of this Article had an incorrect article number of \u20180\u2019; it should have been \u201814602\u2019. This has now been corrected in the HTML version of the Article. The PDF version was correct from the time of publication."}
{"text": "Nature Communications8: Article number: 15587; DOI: 10.1038/ncomms15587 (2017); Published: 05262017, Updated: 07132018In the originally published version of this Article, financial support was not fully acknowledged. The PDF and HTML versions of the Article have now been corrected to include support from the European Union\u2019s Horizon 2020 Framework Programme for Research and Innovation\u2014Grant Agreement No. 720824."}
{"text": "AbstractPselaphodes Westwood, P.fansipanensis Bekchiev & Yin sp. n., is described from northern Vietnam. The unique modification of the antennomeres 9\u201310 of the male readily separates the new species from all known congeners.A new species of the genus Pselaphodes species from VietnamNew  Pselaphinae (Coleoptera: Staphylinidae) fauna of Vietnam is poorly studied. Until now, 112 species (Pselaphodes (Tyrini) have been described, all from the Oriental region - China, Nepal, India, Sri Lanka, Thailand, the Philippines and East Malaysia  and the National Museum of Natural History (Sofia), giving the opportunity to collect rich zoological material. One of the visited localities was Fansipan Mountain and, especially, the Fansipan Summit. It is the highest  mountain in the Indochinese Peninsula , hence its nickname \"the Roof of Indochina\u201d.Pselaphodes species, which is described below.Included in the material was a new The material was collected in an open habitat with shrubs and grasses Fig.  by soil Specimens were examined by Zeiss Stemi 2000C stereo-microscopes. Male genitalia and other dissected parts were studied using a Zeiss transmitted-light microscope at magnifications up to 500x. Genital segments were dissected and treated with potassium hydroxide (KOH). The dissected parts were mounted in Euparal and pinned with the relevant specimen.The following acronyms are used in the text: BL\u2014length of the body (= HL + PL + EL + AL); HL\u2014length of the head from the anterior clypeal margin to the occipital constriction; HW\u2014width of the head across eyes; PL\u2014 length of the pronotum along the midline; PW\u2014maximum width of the pronotum; EL\u2014length of the elytra along the suture; EW\u2014maximum width of the elytra; AL\u2014length of dorsally visible part of the abdomen along the midline; AW\u2014maximum width of the abdomen; NMNHS \u2013 National Museum of Natural History, Sofia, BulgariaPselaphodesfansipanensis sp. n.\u201d, \u201cR. Bekchiev & Zi-Wei Yin, 2019 \u201c .The type specimen is provided with a red printed label: \u201dHOLOTYPUS\u201d, \u201cBekchiev & Yinsp. n.D09F6ED4-1593-5404-953B-D5FB98029570urn:lsid:zoobank.org:act:EB4A1A24-6782-4926-97E6-08CCFF8B1B79Type status:Holotype. Occurrence: recordedBy: R. Bekchiev, N. Simov, I. Dedov, P. Beron; individualCount: 1; sex: male; lifeStage: adult; Taxon: scientificNameID: Pselaphodesfansipanensis; higherClassification: Coleoptera; Staphylinidae; Pselaphinae; class: Insecta; order: Coleoptera; family: Staphylinidae; genus: Pselaphodes; specificEpithet: fansipanensis; taxonRank: species; Location: locationID: Fansipan peak; higherGeographyID: Lao Cai Province; higherGeography: Vietnam; continent: Asia; verbatimElevation: 2992 m; verbatimLatitude: 22.30560; verbatimLongitude: 103.77625; decimalLatitude: 22.30560; decimalLongitude: 103.77625; Identification: identifiedBy: Rostislav Bekchiev, Zi-Wei Yin; dateIdentified: 2019; Record Level: institutionID: National Museum of Natural History-Sofia; institutionCode: NMNHSMale Fig. . Body reAntennomeres Fig. a 9\u201311 foLength of aedeagus 0.77 mm, median lobe broad and asymmetrical, parameres elongate, endophallus with one elongate sclerite Fig. d, e; theFemale. Unknown.The new species is named after Fansipan Summit, the type locality of the new species.North Vietnam: Lao Cai Province.The new species can be readily separated from all other members of the genus by the unique modification of the antennomeres 9\u201310 and the short, triangular metaventral processes of the male, as well as the shape of the aedeagus."}
{"text": "Nature Communications6: Article number: 6262; DOI: 10.1038/ncomms7262 (2015); Published: 02092015, Updated: 06252018John S. Church, who provided access to the FLIR E60 infrared camera and provided guidance in its use, was inadvertently omitted from the author list in the originally published version of this Article. This has now been corrected in both the PDF and HTML versions of the Article."}