diff --git "a/cluster/903.jsonl" "b/cluster/903.jsonl"
new file mode 100644--- /dev/null
+++ "b/cluster/903.jsonl"
@@ -0,0 +1,44 @@
+{"text": "Climate is a major driving force behind malaria transmission and climate data are often used to account for the spatial, seasonal and interannual variation in malaria transmission.This paper describes a mathematical-biological model of the parasite dynamics, comprising both the weather-dependent within-vector stages and the weather-independent within-host stages.Numerical evaluations of the model in both time and space show that it qualitatively reconstructs the prevalence of infection.A process-based modelling structure has been developed that may be suitable for the simulation of malaria forecasts based on seasonal weather forecasts. The importance of climate as a driving force of malaria transmission has been known since the earliest days of research on this devastating parasitic disease. However, it is only with the advent of effective weather forecasting techniques that this knowledge may be implemented numerically. Seasonal climate forecasting (with up to six months lead time) has developed rapidly in recent years with a number of atmospheric climate modelling groups showing evidence of skill and reliability in their systems. Because of the chaotic nature of the atmosphere, seasonal forecasts are necessarily probabilistic. These probabilistic predictions are derived from multiple integrations of deterministic climate models. These models successfully predicted the onset and demise of the 1997/1998 El Nino event and its impact on weather in Africa  and, con was aimed to advance the concept of seasonal climate forecasts based on multi-model ensembles. The DEMETER coupled models and the DEMETER retrospective forecast (hindcast) integrations are described elsewhere [ is being used to test the accuracy (\"skill\") of the hindcasts. Central to the DEMETER project is an evaluation of the potential of seasonal climate forecasts for end-user communities, such as those concerned with agricultural output and malaria epidemic control[The DEMETER project lsewhere . The Eurc control. ERA is The aim of the MALSAT group at the School of Tropical Medicine along with the Department of Geography of the University of Liverpool was the assessment of the methodological issues raised by driving a dynamic malaria model with seasonal climate forecasts. In this paper, the first phase is presented, namely the formulation of the model and the development of a dynamic mathematical model of malaria transmission, which can be driven by daily meteorological variables . Additional research assessed the future risk of malaria epidemics in probabilistic terms[Mathematical models of malaria span nearly a century and are well established. Macdonald reformulet al. [Anopheles maculipennis to transmit Plasmodium vivax malaria. Martens [et al. [Climate (as distinct from weather) models of malaria transmission have been developed in recent years to improve our understanding of the likely impact of climate change on malaria transmission. For example, Craig et al.  developeet al.  used a s Martens  used a r Martens  used a s [et al.  analysed [et al.  used a s [et al. .In order to be able to predict within-season and between-year variation in weather-related malaria risk, the model must be driven by varying weather. This paper describes in detail the development of a weather-driven dynamic mathematical malaria model, the final output of which is new infections in the human host. Preliminary results of its numerical evaluation in time and space are presented. The choice of a causal mathematical model rather than a statistical model is based on the knowledge that the former is better suited to extrapolations to novel situations (e.g. when interventions are introduced), and for investigating the non-linear impacts of short-lived changes in driving meteorological determinants. The present malaria model is designed to be used for two distinct but related functions (a) to determine the impact of weather variables on model output  for given interventions and (b) to determine the impact of specific control interventions on model outputs by modifying model parameters.For the former function, the model can be driven with meteorological variables, from ground-based observations, satellite or modelled weather data, seasonal climate forecasts  climate change scenarios. In the second function, the value of a malaria early warning system (MEWS) in terms of triggering earlier or scaling up intervention efforts  in epidemic years may be assessed. In both cases, the biological processes are included as a series of interlinked sub-models and thus represented as coupled delay differential equations. Each new item of knowledge  may be immediately used in the model. New developments such as, for example, the ominous spread of drug resistance may also be immediately incorporated into the model, as, in this example, a reduction in the parasite clearance rate. The implications of all such changes may then be assessed as a quantitative amendment to the prediction. This is done independently for each location and, therefore, the model can be fitted to local conditions, where relevant data are available, or to regional parameters when such data are lacking. Sensitivity analysis can also be used to establish the relative importance of obtaining more accurate data on each parameteret al. [Thus, central to the analysis is the development of a new weather-dependent mathematical dynamic model which no longer attempts to calculate a single constant epidemiological per-case multiplication rate, but follows the temporal progress of the prevalence of infection within a population through seasons and years, To simulate the stochastic elements of the model, delay differential equations based on probabilistic transition between groups rather than on Monte Carlo modelling, as has been undertaken by Gu et al. , have be. These three- to six-hourly data are stored on the ECMWF site and extracted by local software at the site by the user. Weather variables were extracted from the database as gridded data at one degree (~111 km.) and twelve-hour resolution for the African region. Ideally, daily averaged temperature, accumulated rainfall and humidity would have been the variables. However, reanalysis-based daily average temperature correlated poorly with station data , and daily minimum temperature proved even worse, and humidity too was poorly modelled. Thus, the analysis used surface (2 m above ground level) daily maximum temperature, offset by -5\u00b0C (to roughly represent mean temperature) and total rainfall estimates as input variables. As accumulated rainfall (puddles etc.) is more important than daily rainfall, Rd , the sum of the previous 10 days of rainfall., were used. There are four malaria parasites (Plasmodium spp.), which cause disease in humans. The focus here is on Plasmodium falciparum, as it is the principal life-threatening parasite species and is most common in Africa. The temporal resolution of the model was based on the nocturnal activity of the vector and the fact that empirical vector observations are usually made at no better than daily time-resolution. Therefore, the simulation time-step is a single day (24 hours).The ERA-40 weather reanalysis data set was chosen because it is the reference data for DEMETER and can provide daily estimates of a range of potentially significant weather variables for the whole globe. This data set was prepared by ECMWF and consists of weather reanalysis data for the whole globe for 40 years (1960\u20132000) and builds on previous reanalysis data ERA-15 which had been used in an earlier analysis of multi-model ensembles seasonal forecasts It was assumed that the dynamics at the grid-points used do not interact significantly and can be treated as independent, as the distance between grid-points is far greater than the normal mosquito flight distance of roughly 1 to 2 km -23. To sHuman malaria disease is caused in the individual by an infective mosquito biting a non or semi-immune human. After some two weeks the first gametocytes are produced, independent of ambient temperature. A second mosquito biting the infected human thereafter may ingest gametocytes, which after fertilization pass through the gut wall, develop and ultimately produce sporozoites which become infective when they migrate to the mosquito salivary glands. This process is ambient temperature-dependent. As transmission is less dependent on the number of parasites than on the infective status of the carriers, human and arthropod, only the infection and infectiousness status of the carrier populations are simulated (see Table Anopheles gambiae (s.l.) [Plasmodium hosts), and the mosquito's anthropophilic tendency is an important factor in establishing the intensity of transmission. While the anthropophily varies between regions, at this stage it is assumed constant. The male does not bite and, therefore, does not transmit the disease, and as there are always sufficient males to impregnate the mature females, there is no need to simulate the males' dynamics.The most common vector of falciparum malaria in Africa is e (s.l.) ,25. As tThe female life is divided into two major parts: the immature stages , and the mature stage, where onset of maturity is defined as the time of the first flight, which is shortly followed by the first bite. The importance of this division is twofold. First, the immature mosquitoes do not participate in the infection cycle and are, thus, basically in a waiting period, which limits rapid vector population growth. Second, the survivorship (defined as the probability to survive 24 hours) and development rate (part of stage completed in 24 hours) have a different dependence on weather conditions for mature and immature mosquitoes. A schematic representation of the mosquito life cycle is presented in Fig. Hitherto, the immature population dynamics have not been involved explicitly or clearly in malaria modelling. The immature forms are water-bound and are thus totally dependent on the existence of water bodies. High temperatures in breeding sites and evaporation  are generally lethal (see below). Unfortunately, reports giving quantified relationships of temperature and rainfall/humidity dependence of the mosquito dynamics are in short supply, although some data are available . Their fd filling the pool. Thus a mosquito's probability to oviposit, and for the larvae to survive, is proportional to the amount of water it finds. The inclusion of hydrology and soil typemay improve the understanding of the connection between rainfall and breeding-sites. This dependence on rainfall is valid for areas in which the surface water is dependent only on rainfall. However, in constant mosquito habitats such as stable pools or rice-fields, lack of rain may not limit growth of larvae, but natural predators may curb the growth of larval populations. As the movement between the human location  and the ovipostion site is dangerous and energy consuming, this distance is a major factor in determining the probability of oviposition. Future numeric data for this would be of great value.Eggs are posited by mosquitoes in pools. As a mosquito must find water to reproduce, the oviposition rate is roughly assumed to be proportionate to both the ovipositing mosquito number and to the dekadal (ten-daily) rainfall Ret al. [e, larvae L1 and pupae Lp) of An. gambiae s.l. in 11 different breeding habitats , in which the daytime water temperature was measured. Maturation rate, m, is defined as the fraction of the total immature stage covered in a single day, and is the inverse of the sum of the duration of the immature stages[There is a shortage of detailed information on the varied survivorship and stage-dependent developmental progress in natural habitats as functions of weather conditions. There are, however, certain limited sources for derivation of information,28. Jepsre stages,30e+L1 + Lp) \u00a0\u00a0\u00a0 (1).m = 1/ which would allow the introduction of this element.Thus the maturation rate is a function of temperature for these stages. Even though it is known that high temperatures are detrimental to larvae survival, there are no published numerical data . New eggs (box number 1) are laid as a fraction of the number of ovipositing adult females . Thus, at each time step, t, the immature population at stage s, I, has the dynamics:The immature population is, thus, simulated as a set of \u03bd virtual boxes with populations I(n) . At each simulated day the whole population of each box is multiplied by the I = \u03c3 I \u00a0\u00a0\u00a0 (2).Maturing pupae (reaching age n and above) are removed and enter the mature mosquito dynamics according to:i.e. all immature mosquitoes within one day of maturation (at stages above \u03bd(1-m)) will become mature mosquitoes the next day, if they survive(s).i.e. blood meals. Although sometimes more than one initial blood meal is required before egg maturation can occur, and fed mosquitoes that are unable to develop mature eggs are best described as pre-gravid[An. maculipennis  and hence also of the time for biting, which may be expressed asMature mosquitoes begin their adult life with their first, nuptial flight, during which fertilization occurs. In the model, a small constant trickle (trickle2) of young uninfected mosquitoes (representing a new imported population) is added to the population of maturing mosquitoes. Afterwards, the development of the fertilized eggs requires the intake of protein, re-gravid, this frre-gravid detectedC = 1+Dd/(T-Tc) \u00a0\u00a0\u00a0 (4);Gd is the number of degree-days required, Tc the threshold beneath which development halts and T is the daily average temperature. Both Dd and Tc are dependent on humidity. In highly humid conditions, Dd = 37 from Detinova's data. In the tropics GC is typically about three days depending on temperature. The temperature dependence of An. gambiae is assumed similar until further data become available.where DR = 1/GC is calculated. This assumes that the temperature dependence of the rate is constant throughout the gonotrophic cycle, which is implicit in the degree-day concept.As temperature is not assumed constant , a daily progress rate (part of gonotrophic cycle covered in one day): PPR values reaches 1. 37 \"boxes\" (corresponding to the 37 degree days) are constructed, between which the mosquitoes progress in steps of PR reduced by multiplication by the survival rate . At the end of a gonotrophic cycle , each mosquito oviposits and then begins a new cycle. The success of oviposition is dependent on the existence of water-bodies, and hence on dekadal rainfall, and we assume that each ovipositing female lays \u03b3Rd viable eggs, where \u03b3 is a constant. The following day these eggs begin the immature mosquito cycle (as above). It seems that the survivorship of mosquitoes is only weakly dependent on their age[per diem survival is thus calculated by P = \u03b1c1/G. As GC is weather-dependent, so is the daily survival. It was assumed that survivorship is independent of the infective state[The completion of a cycle may be established when the sum of daily their age,9,37-39,their age. The statheir age. Estimattheir age-43. The ive state,44, evenm) is the difference between the new mosquitoes maturing (and not dying in the period) and the fraction of the mature mosquitoes dying (the daily cycle completion rate 1/GC multiplied by the death rate 1-\u03b1):Combining these, it may be possible to write for \u03b4\u03c6, the daily change in the total number of mosquitoes (Ni) rather than non-infectious (Hn) bitten is the human infectious ratioAs mentioned, the parasite within-vector dynamics is superimposed on the mosquito dynamics. Mosquitoes are assumed to bite human hosts randomly (independent of their infective status) and thus the proportion of infectious humans (Hi/(Hi+Hn) \u00a0\u00a0\u00a0 (6).r = HNon-random biting by mosquito vectors is well described and thisAn. gambiae s.s. (even though the tendency varies between strains and regions) and generally much lower for zoophilic Anopheles arabiensis[The preference for human biting over cattle is described by the human blood index , which is high (0.6+) for anthropophilic rabiensis. Of courIP = \u03c7 B r \u00a0\u00a0\u00a0 (7)MC)  for P, falciparum lasts 111 degree-days above 18\u00b0C[R = 111/SC. The infectivity of a specific mosquito over its lifetime is dependent on the number of bites it makes after the completion of a sporogonic cycle following the first bite of an infective host.It is generally assumed that infected mosquitoes stay so for life. The sporogonic cycle , at stage s of the gonotrophic cycle and at stage Ss of the sporogonic cycle (in sporogonic-cycle degree days) at time t  progresses each day by gonotrophic rate PR and by the sporogonic rate SR:To combine the gonotrophic and sporogonic processes each of the 37 box-stages of the gonotrophic cycle are sub-divided into 112 sub-sections, numbered 0 to 111, representing progress in degree-days. The 0 subsection reflects an uninfected mosquito. The mosquito population is governed by the following dynamics. An infected mosquito sub-population, M = pM \u00a0\u00a0\u00a0 (8).M(s+PA finite fraction (1-p) of the mosquito population which dies and thus does not make the transition. Upon completion of the gonotrophic cycle, the process restarts. Upon the completion of the sporogonic cycle the mosquito remains at the infectious stage. If the mosquito is not infected at biting, it remains uninfected throughout the gonotrophic cycle:R,0,t+1) = pM (cycle without infection); \u00a0\u00a0\u00a0 (9a)M = pMMIP (new infection) \u00a0\u00a0\u00a0 (9b)M = pM(l-MIP). \u00a0\u00a0\u00a0 (9c)M by two processes, either just after maturation or else by completing an uninfected gonotrophic cycle:New eggs are laid by mosquitoes completing a gonotrophic cycle:R from the end of the gonotrophic cycle will oviposit. Their number must be summed over all infection states 0...111. As discussed above, the average brood size is dependent on rainfall by a multiplicative constant \u03b3. In the present report all the initial mosquitoes were non-infected.This means that all mosquitoes located less than PObviously, the focus is on the infected host population dynamics, which reflects the diseased population. The simulation of this population is based on the following assumptions:All hosts and mature mosquitoes are equivalent except for their infection status. Acquired immunity is not accounted for. Thus, the model reflected the prevalence of malaria infection in the population unless the population is largely non-immune in which case it reflects the prevalence of malaria disease. Immune individuals are assumed to be potential carriers, even though not at personal risk. This issue is contended within the modelling community, and future models will allow for both possibilities.The crude human death rate is taken as low enough to be unimportant over the time scale. Specifically, the malaria-induced death rate does not influence transmission patterns.Newly infected patients are not infectious for two weeks, during the intra-hepatic phase of the disease and the early erythrocytic stage, before gametocytaemia rises sufficiently for significant transmission:H = \u03b4H (13>h>l) \u00a0\u00a0\u00a0 (12)trickle = 0.01 into a population of 100 every four days). This has the technical benefit of not changing the total population considerably over the simulation period, but limiting the influence of initial conditions found when a large infected population is assumed, or the dying out of the disease after a short initial dry period. This reflects the constant pressure of low-scale transmission by migration (infected migrant workers or troops for instance). This would be quite similar to the case of static communities with low-level external contact [IR, of a human being bitten by an infectious mosquito each day. This rate depends on the abundance of infectious mosquitoes and of human hosts [Malaria clearance is a slow process. Patients may become uninfected at a constant rate (first order process). The rate selected  enables contact . A humanan hosts .There are three components of the human infectious population at time t+1, H: (i) Individuals remaining so from time t, (ii) those who complete the hepatic latent period and (iii) new imports:H = +H)(\u03b4) + trickle \u00a0\u00a0\u00a0 (13a). IR), or else (2) being an infected host )) and clearing his/her infection with probability (1-\u03b4):A host may be uninfected at time t+1, by either (1) remaining uninfected with probability (1-HIR)H+(1-\u03b4)S) \u00a0\u00a0\u00a0 (13b)H = . \u00a0\u00a0\u00a0 (13c)H = H) using Victoria Falls weather station (WMO ID 678430). Weather values for days with missing data  were filled by averaging data from adjacent days.The described modelling process was used to establish the fit of the model to a time series of clinical data from Hwange District, Matabeleland, Zimbabwe . Due to Using the steps described above, the model was run using the ERA-40 weather reanalysis for every grid point covering the African continent  over the time period 1987\u20132000. To allow a spin-up period for the model weather data for 1987 was run twice, while not storing the daily output for the first run, but allowing the first run's output of host, parasite and mosquito situation at the end of the year to be the initial conditions for the \"real\" run. This allows the simulation of more climatologically realistic starting conditions. Variations in the length of the spin-up period gave similar results. The average prevalence and incidence for the period is then established. Next, the variation of incidence during the period from interannual means was calculated, and hence the standard deviation of annual incidence. This value serves as an estimate of the extent of anomalous malaria, thus reflecting epidemics, beyond holoendemicity and seasonal variation.et al. [Fig. et al. . The x-am = 0.011 (\u00b1 0.001) T-0.2 (\u00b1 0.26) (1/day) \u00a0\u00a0\u00a0 (14)Note that the report is for water temperature in shallow pools, which may be significantly higher than the ambient temperature. A few points suggest themselves. To begin with, the intercept with the X-axis is around 18\u00b0C. Even though the variation for this value is large, it suggests a lower limit for larval development. Beyond this point, it seems that the assumption in the theoretical methodology of linearity of the development rate with temperature is justified. New data being collected may allow a more thorough validation.m), the per-cycle rain-dependent survivorship is simply Sm1/. The survivorship for the immature stage, by temperature for different values of S, is depicted in Fig. Using the proposed rain-dependent daily survivorship (S) and the length of cycle  for the range of climatic variables predicted by the hindcasts in the DEMETER multi-model system. In addition, this reanalysis-based dataset is used to derive the initial conditions of the hindcasts and verification dataset for DEMETER hindcasts. Thus an assessment of the value of the biological malaria model driven by ERA weather data represents the potential value of a \"perfect\" forecast of climatic conditions to the prediction of malaria epidemics. The assessment of this ability of the weather-driven model to describe interannual variability in malaria infection rates given a perfect forecast, is the basis for a realistic assessment of the benefit associated with the use of operational  seasonal climate forecasts in the context of a malaria early warning system.i.e. chaos. Chaotic behaviour may, however, be limited by the application of saturation limits to certain model parameters (such as a self-limiting proliferation rate). In addition, the knowledge of the equations themselves is often limited, being typically a linearization of behaviour of empirical data. Thus, there is considerable uncertainty in the result. The dynamic, deterministic method may, however, be used numerically, experimentally, by using small steps so as to validate the stability of the equations. For this reason, the improvement of the understanding of both the ability of weather forecasts to predict weather and of biological models to predict disease, presents a path to the understanding of probabilistic solutions to non-linear epidemic prediction problems.The dynamic approach claims that total knowledge of the initial state and of the equations, as well as of the external driving forces, allows total knowledge of all future states. However, in real situations, this precise knowledge is often lacking. In many cases, bifurcations of the motion in phase-space due to minute perturbations of initial conditions, may result in large differences in the result, The capability of seasonal climate forecasts to predict anomalous seasonal climate conditions has improved considerably over the last decade. In particular, the El Ni\u00f1o/La Ni\u00f1a cycle has been correlated with extreme weather conditions throughout the globe. This cyAn. gambiae s.l. In some regions, the existence of permanent waterbodies, such as slow-flowing rivers, lakes or swamps may provide suitable breeding sites, and thus make up for the shortage in rainfall, as far as the larvae are concerned. Even though the mature mosquito survival will be considerably reduced by the low humidity[This stage is, however, limited to reconstructions. The good fit in Fig.  humidity, malaria humidity. These efalciparum malaria, unless the temperature remains in the high 20s (\u00b0C) for considerable periods. For this reason falciparum malaria is associated heavily with tropical regions, while in pre-eradication malarious Europe P.. vivax was the dominant malaria parasite species.The requirement for high temperatures for malarial transmission is further illustrated by the plots in Figs. Further improvements should be added to the model. These may be achieved as new relevant numerical information becomes available on the biological processes, which were here handled somewhat heuristically. For example, the relationship between rainfall and larvae survivorship was simplified due to the lack of data. Laboratory and field, meteorological and entomological data may establish its true form.The relative importance of the various parameters, assessed by sensitivity analysis by variation of individual parameters is of great interest. This will allow field scientists to focus their efforts in establishing the values of the most critical parameters. In a parallel paper this has been presented. However, a full multivariate evaluation is still underway, using novel parallel computing methods.The model currently ignores both antiparasitic immunity (immunity to infection) and antitoxic immunity (immunity to disease) \u2013 the sharp distinction between which may not exist in reality,55. NeitHowever, where the model may be used to predict the impact of an intervention amongst a semi-immune or immune population then both forms of immunity may be significant factors in determining the transmission dynamics of malaria infection. Thus, iNumerical evaluations of the model in both time and space show that it has a good first order approximation to the prevalence of infection across the continent. It captures well both the seasonality and interannual variability of infection at the test site in Zimbabwe. Note that there is a large level of under-reporting of clinical cases  and also over-diagnosis of malaria, which often confound correlations  ,58.The model, when run with the following inputs Table , is ableStronger variation, both between seasons and interannual, may be expected. Thus malaria transmission will continue further north than suggested, but will also be less stable.2) means that the model can only represent the most marked changes in transmission potential over large geographic regions \u2013 appropriate to seasonal climate forecasts. This is expressed in the poor spatial resolution as regards Madagascar, in which the spatial variation of prevalence is not represented.There are other points to consider. The most obvious discrepancy between our results and those of previous workers is that of high prevalence rates being predicted for Somalia \u2013 an area where malaria transmission in normally low. The results are created from a relatively short time series and may be disproportionately influenced by the anomalously high rainfall recorded in 1997/1998 in this area, and in East Africa in general, which corresponded with unusually high rates of transmission. The malDespite the limitations, which may be overcome in specific regions by using daily weather data at a finer spatial resolution formed by downscaling , the model is capable of describing in general terms the spatial, seasonal and inter-annual variability of malaria transmission in Africa.max-5 as a surrogate for daily temperature was an ad hoc attempt to create a single value for a wide spectrum varying in time and place. The diurnal variation is, for example, usually far greater in dry regions than in humid conditions. Our attempt was to use a single value which bears relation to something measurable, namelyTmax. In fact, the two-metre model temperature value, was has been used may not have been the ideal, as larval development is closer to ground, but that would have required detailed soil data, which was beyond the scope of this research. The usage of reanalysis data is obviously inferior to high quality station data. Convective precipitation is highly local and is not well correlated to the averaging required by meteorological reanalysis. For example, the heavy rains in north-western Zimbabwe (end 1995) were under-expressed in ERA-40, partly due to the scale of the reanalysis data, and thus the local malaria incidence using that data is too low. The integration of the data in a reanalysis model in itself makes numerous physical assumptions. In some cases, the result is poor quality of even some large-scale processes, such as the El-Ni\u00f1o of 1997 in East Africa.The usage of T will allow development of coupled malaria and meteorological data sets, which will be more effective for future analysis. Development of seasonal climate forecasting tools over large geographic areas, however, will remain for some time partly dependent on verification by reanalysis. Thus, malaria epidemic seasonal early warning will also be linked to this imperfect data source, though perhaps improved by novel downscaling methods.High quality station data at the pan-African level is, however, not available. The stations are irregularly dispersed, and not all produce complete data sets, having many missing days. As the model requires daily values, interpolation over large areas with varying orographic characteristics is required with the inherent uncertainty this brings. In addition, the relation between mosquito habitat microclimate and station data too is unknown. High temporal and spatial resolution of weather data will improve the modelling attempts. Among other issues, the continuous measurement of weather data at malaria epidemiological and entomological research and surveillance sites now introduced This paper presents a first step in the preparation of a weather-driven dynamical model of malaria transmission, for use with both observed weather data and seasonal climate forecasts. The model incorporates the stages of the malaria vector and their dependence on temperature and rainfall, and part of the within-host parasite population dynamics. Some of these elements lack concrete theoretical and empirical development, requiring further input. Further work, under work at present, will enable the employment of such a model in the prediction of outbreaks based on skilful weather forecasts.MBH formulated the mathematical model, prepared the code and ran the program. APM lead the applications model work package in DEMETER.. Both authors read and approved the final manuscript."}
+{"text": "Timely and accurate information about the onset of malaria epidemics is essential for effective control activities in epidemic-prone regions. Early warning methods that provide earlier alerts  may permit control measures to interrupt transmission earlier in the epidemic, perhaps at the expense of some level of accuracy.th-degree polynomial distributed lag model. For each week, the numbers of malaria cases were predicted using coefficients obtained using all years except that for which the prediction was being made. The effectiveness of alerts generated by the prediction system was compared against that of alerts based on observed cases. The usefulness of the prediction system was evaluated in cold and hot districts.Expected case numbers were modeled using a Poisson regression with lagged weather factors in a 4The system predicts the overall pattern of cases well, yet underestimates the height of the largest peaks. Relative to alerts triggered by observed cases, the alerts triggered by the predicted number of cases performed slightly worse, within 5% of the detection system. The prediction-based alerts were able to prevent 10\u201325% more cases at a given sensitivity in cold districts than in hot ones.The prediction of malaria cases using lagged weather performed well in identifying periods of increased malaria cases. Weather-derived predictions identified epidemics with reasonable accuracy and better timeliness than early detection systems; therefore, the prediction of malarial epidemics using weather is a plausible alternative to early detection systems. Malaria epidemics are reported frequently and have caused high morbidity and mortality among all age groups in the African highlands -4. Earlyth percentile of cases from the same week in previous years [Early detection systems, which are used to detect epidemics once they have begun, can correctly identify periods that are defined by expert observers as \"epidemic,\" albeit with varying specificity. A number of such systems have been proposed or implemented. For example, WHO has advocated the use of alerts when weekly cases exceed the 75us years  and otheus years -12. Howeus years  and if tus years .While early detection systems appear to provide timely information about the onset of severe epidemics, they intrinsically trigger alerts only when unusual transmission is already underway. Another approach, known as \"early warning,\" attempts to predict epidemics before unusual transmission activity begins, usually by using weather variables that predict vector abundance and efficiency, and therefore, transmission potential ,15-18. THere, an attempt to combine these avenues of previous work is described, using modified versions of previously described models based on weather factors to provide predictions of Plasmodium falciparum cases in these 10 districts of Ethiopia, and evaluating thresholds that trigger warnings. The hypothesis tested here is that the use of predicted cases  would reduce the precision of the alert thresholds , as the price of obtaining the alerts with greater advance notice. In fact, the early warning system based on predicted cases performed slightly worse in most cases than the early detection system, but the performance was rarely much worse and occasionally slightly better. These comparisons are described and their implications for the choice of malaria prediction/detection systems in epidemic-prone areas of Africa are discussed.P. falciparum. The original data collected on the basis of Ethiopian weeks (where the number of days in each week varies between 5 and 9) were normalized to obtain mean daily cases for each Ethiopian week [Microscopically confirmed malaria cases were collected from a health facility in each of ten districts of Ethiopia over an average of 10 years; this data set has been previously described . Each ofian week .Daily meteorological data  recorded at the local weather stations nearest to the health facility were obtained from the National Meteorological Services Agency (NMSA) for the same period. These daily data were collapsed into weekly data to correspond with the weekly malaria cases. The weekly mean for minimum and maximum temperatures and the total weekly rainfall were calculated from the daily records.th-degree polynomial distributed lag (PDL) model [The expected case numbers for a given week were modeled using a Poisson regression with lagged weather factors, an autoregressive term, a time trend and indicator variables for week of the year. Biological considerations about the interrelationship between weather, mosquito and malaria parasite suggest that malaria cases should follow periods of increased temperature and increased rainfall, at defined intervals -28. ThusL) model  was fittE(stY) denotes expected value for the daily average number of malaria cases at site s on week t; , , t-iR, and st-i Yare the weekly minimum and maximum temperatures, rainfall and autoregressive term i weeks previously; s tand s Wdesignate time trend and week in a year at site s; s \u03b1represent the intercept, at site s.where For each week at each location in the data set, the number of cases was predicted using equation (1) and data available four weeks prior to the week for which the prediction is made. Coefficients of equation (1) were obtained using all years except that for which the prediction was being made, to avoid circularity. The prediction for week t was then made using this all-but-current-year model with weather and case data for the weeks up to week t-4. The predicted number of cases is thus estimated using the following model: represent the predicted cases for year j; , , , , ,  and  are parameter estimates  from all years except j; , , , jt,  and  are minimum and maximum temperatures, rainfall, time, week and autoregressive term respectively from year j.where In early detection algorithms, actual cases in a given time period are typically compared against some threshold level of cases to determine whether excess cases have been observed. Often, the threshold level represents an upper bound on \"normal\" case numbers from previous years. If this threshold level is crossed , an alert is generated . Such syIn this study of the usefulness of prediction systems for generating alerts, historically based thresholds were similarly used \u2013 weekly percentile (defined as a given percentile of the case numbers obtained in the same week) or weekly mean with standard deviation (defined as the weekly mean plus a defined number of standard deviations) algorithms as threshold levels  \u2013 but ge1. Weekly percentile, where sij T= psijQ, where psij Qrepresents the pth  percentile of observations from week i at facility s in years other than j.Threshold is exceeded when 2. Weekly mean with standard deviation., where sij T= sij \u03bc+ Ysij\u03b2\u03c3, where \u03b2 = 0.5, 1.0, 1.5, 2.0, 2.5 or 3.Threshold is exceeded when The effectiveness of alerts generated by our four-week-ahead prediction system was compared against that of alerts based on a detection system using actual cases. Since the prediction system generates predicted numbers of cases four weeks ahead of time, this permits implementation of control measures four weeks earlier than under a detection system. On the other hand, one would expect that the accuracy of prediction might be less than that of detection. The comparisons were designed to assess this trade-off between the ability to act earlier in possible epidemics and the possible loss of accuracy.A method previously described  was usedFor each value of each type of threshold (applied to either the predicted and observed number of cases) at each health facility, the number of PPC was transformed into a proportion (percentage), by adding the number of PPC for the alerts obtained and dividing this sum by the sum, over all weeks in the data set, of the number of potentially prevented cases. Proportion rather than actual cases were used because the numbers of malaria cases vary from district to district. To compare the performance of the predicted and observed cases on a single scale, a curve was plotted for each algorithm showing the mean percent of PPC (%PPC) over all districts versus the average number of alerts triggered per year, with each point representing a particular threshold value. Better methods of generating a warning were those that potentially prevent higher numbers of malaria cases using smaller numbers of alerts.The performance of the alerts provided by both the predicted and observed cases was compared with random and optimally timed alerts. PPC was estimated for alerts chosen on random weeks during the sampling period. To estimate the performance of optimally-timed alerts , the optimal timing of alerts were identified by retrospectively going through data if one had perfect predictive ability; the optimal week for one alert was chosen; then by going through the remaining weeks, the optimal week for a second alert was chosen, and so on. The optimal alert would serve as an upper bound curve for the best choice of alert times, given a defined alert frequency .The relative importance of weather factors in determining malaria transmission significantly depends on the climate of the area. It has recently been shown that although rainfall was significantly associated in cold and hot districts, minimum temperature contributed only in the cold districts of Ethiopia . FurtherThe prediction algorithm indicates the overall pattern of cases well, yet underestimates the height of the largest peaks. Comparisons of the predicted and observed malaria cases, for each week in six of the ten districts, are shown in Figure th percentile or mean + 1.50 standard deviations). The horizontal axis gives the number of alerts per year triggered by the particular threshold value, while the vertical axis shows the %PPC associated with that threshold value. Each point represents the mean across all 10 districts. Two different choices of the function for determining PPC  and the choice of window of effectiveness  were considered. The performance of the predicted number of malaria cases using the mean plus  standard deviation algorithm (for an eight-week window of low-effectiveness) reveals that it prevented 29%/0.9 alerts, 27.3%/0.6 alerts and 24.2%/0.43 alerts per year, which compares with 31.4%/0.85 alerts, 29.8%/0.65 alerts and 27.5%/0.52 alerts per year respectively when the observed cases are used to trigger alerts  indicate that for most  districts, the model performed well qualitatively, in the sense of predicting more cases than expected from the weekly mean when such excess cases occurred, and predicting fewer when in fact fewer cases than the weekly mean occurred. This finding focuses attention on the fact that a system can give timely and accurate alerts for epidemic control, even if it is unable to provide accurate predictions of case numbers Figure . The iniStudies have shown that temperature affects transmission in cold environments more than it does in hot environments ,32. ThusNon-climatic factors such as population immunity, migration and drug resistance are believed to influence malaria transmission and have been cited as causes of malaria epidemics -36. The The model chosen for the prediction of malaria cases was based loosely on a model previously evaluated for its ability to explain seasonal variation in malaria incidence in the same data set . The forP. falciparum cases using lagged weather and case incidence data performed well in identifying periods of increased malaria cases. Furthermore, the prediction system allowed recognition of epidemic periods at an early stage, thereby facilitating interventions making epidemics preventable with adequate lead time. However, this study indicated that early warning system using weather and other predictor variables are more reliable in relatively cold than hot districts. In conclusion, it has been demonstrated that weather derived predictions identified epidemics with reasonable accuracy and better timeliness compared to early detection systems. Therefore, warning systems based on predictions derived from lagged weather variables may be a useful alternative to early detection systems for targeting resources against incipient falciparum malaria epidemics.This study showed that short-term (four-week-ahead) predictions of HDT, ML and JS conceived the study. HT and ML undertook statistical analysis. HT drafted the manuscript, which was revised by ML. JS participated in designing of the study and statistical analysis. AT initiated the study and made data available in collaboration with WHO and Ministry of Health of Ethiopia. All authors contributed to the writing of the manuscript and approved the submitted version of the manuscript."}
+{"text": "Previous smallpox ring vaccination models based on contact tracing over a network suggest that ring vaccination would be effective, but have not explicitly included response logistics and limited numbers of vaccinators.We developed a continuous-time stochastic simulation of smallpox transmission, including network structure, post-exposure vaccination, vaccination of contacts of contacts, limited response capacity, heterogeneity in symptoms and infectiousness, vaccination prior to the discontinuation of routine vaccination, more rapid diagnosis due to public awareness, surveillance of asymptomatic contacts, and isolation of cases.We found that even in cases of very rapidly spreading smallpox, ring vaccination (when coupled with surveillance) is sufficient in most cases to eliminate smallpox quickly, assuming that 95% of household contacts are traced, 80% of workplace or social contacts are traced, and no casual contacts are traced, and that in most cases the ability to trace 1\u20135 individuals per day per index case is sufficient. If smallpox is assumed to be transmitted very quickly to contacts, it may at times escape containment by ring vaccination, but could be controlled in these circumstances by mass vaccination.Small introductions of smallpox are likely to be easily contained by ring vaccination, provided contact tracing is feasible. Uncertainties in the nature of bioterrorist smallpox  support continued planning for ring vaccination as well as mass vaccination. If initiated, ring vaccination should be conducted without delays in vaccination, should include contacts of contacts (whenever there is sufficient capacity) and should be accompanied by increased public awareness and surveillance. Concerns about intentional releases of smallpox have prompted extensive preparations to improve our ability to detect and respond to an outbreak of smallpox ,3,4,2. MThe Centers for Disease Control and Prevention (CDC) established ring vaccination , a straMathematical models can advance our understanding of how a smallpox outbreak might progress. Several mathematical and computer models address the question of smallpox transmission -13. The Because none of the available models includes both network structure (with explicit contact tracing) and response logistics limited by the number of available disease control investigators , we inclSmallpox was primarily a disease of close contact, especially household contacts . Such coSome evidence suggests that vaccination soon after exposure may lessen the severity of the resulting case of smallpox or possibly prevent disease entirely -20.Ring vaccination may involve not only vaccinating contacts of cases, but also contacts of contacts of cases ,22 \u2013 potLimited case-finding and vaccination capabilities lead to the possibility that it may be impossible to find newly exposed individuals and vaccinate them in time, resulting in a \"race to trace\" .Mild, ambulatory cases of smallpox may spread disease because such cases may be harder to recognize.Vaccination of individuals prior to the discontinuation of routine vaccination may provide some, possibly considerable, protection against infection ,23,24, aPublic awareness may lead to more rapid detection of cases.We use this model to determine what factors promote or hinder the success of ring vaccination during a smallpox outbreak, and whether ring vaccination is useful in the presence of a mass vaccination campaign. In particular, the goal of this paper is to examine the control of smallpox by contact tracing and ring vaccination using a network model which includes response logistics .focal rash, preceded in many cases by oropharyngeal lesions. In fatal cases of ordinary smallpox, death often occurred between the tenth and sixteenth day of symptoms; among survivors, most scabs had separated by day 22\u201327 of illness  and simulated the mean number of cases within 250 days in a population of 10000. We then computed the partial rank correlation coefficient  , as shown in Figure Because we assumed nonzero diagnosis probabilities during the prodromal period for all individuals in Figure In Figure Finally, in Figure In Figure Finally, in Figure Because our baseline hazard for infection of individuals may be larger than would be expected for naturally occurring smallpox, we examined the effect of more realistic values of this hazard. In particular, we chose different levels of ring vaccination capacity , and of the relative hazard for workplace/social contacts, and then chose values of the baseline hazard for infection varying from 0.5 per day (for a mean time to infection of 2 days) to 2 per day , and introduced 10 index cases into a population of 10000. We then repeated this 100 times, and reported the fraction of scenarios in which the number of infections ultimately exceeded 500 . These results, shown in Table Because of considerable uncertainty in the model parameters, we chose a collection of parameter values, and for each, estimated the containment probability . We estimated this containment probability by simulating the smallpox epidemic 100 times for the same parameter values, and computing the frequency out of these 100 realizations for which fewer than 500 index cases resulted within 250 days. .2), the monitored diagnosis rate \u03c6 , and the contact tracing/ring vaccination capacity per day (Kr). We then performed 100 realizations beginning with 10 index cases, and computed the containment fraction . Thus, for each of the two choices each of \u03c52 and \u03c6, and for each value of Kr we examined, we obtained 1000 values of the containment fraction. We use the resulting distributions in Figure One thousand scenarios chosen from a Latin Hypercube sample were analyzed, and as indicated before, we chose the hazard for close contact transmission and the hazard for random transmission to guarantee that between 2 and 5 secondary cases per case occur, and that no more than 5% of cases are attributable to random transmission . Having chosen this collection of 1000 parameter sets, we considered two levels of two different control parameters which were applied to each (so that each of the 1000 parameter sets were simulated under four different control conditions). The first of the two control parameters was the probability of workplace/social group contact finding; we chose values of 0.8 and 0.9 for this parameter . The second of the control parameters was the rate of diagnosis  from the community of cases developing among previously identified and traced contacts who were initially asymptomatic (we refer to this as the monitored diagnosis rate); we assumed first a low level corresponding to a mean diagnosis time of one day from the onset of symptoms, and a high level corresponding to a mean time of 3 hours from the onset of symptoms (high levels of the monitored diagnosis rate correspond effectively to isolation of contacts). Finally, we assumed a doubling of the diagnosis rate after the beginning of widespread community awareness of smallpox. We then computed the containment fraction at different levels of ring vaccination capacity (contact tracing capacity per day). Thus, for each of 1000 scenarios (parameter set choices), we assigned the workplace/social group contact tracing success probability (\u03c5-1 and 8 day-1). For low levels of ring vaccination (traceable contacts per day), the epidemic is almost never contained, but for ring vaccination levels near 50\u201360 per day (5\u20136 per index case per day), the average containment fraction became close to 1. However, this average conceals the fact that for some scenarios , control remains difficult or impossible even at high levels of ring vaccination. Therefore, in Figure In Figure fast scenario, 238 infections occurred on average and the (estimated) containment probability was 99%; for the slow scenario, on average 3587 infections occurred and the (estimated) containment probability was only 1%.Rapid contact tracing in ring vaccination may play an important role in suppressing the epidemic, since the longer it takes to trace a contact, the less likely the vaccine is to be efficacious, and the more opportunities the infected individual may have to transmit disease before they are finally located, isolated, and vaccinated if appropriate. We illustrate this possibility in Figure While Figure Public awareness of smallpox, leading to more rapid isolation and identification, may play an important role in eliminating the epidemic, as illustrated by the scenarios in Figure In many cases, however, more rapid diagnosis was not required for ring vaccination to be effective. As before, we simulated smallpox epidemics for each of 1000 calibrated scenarios, performing 100 realizations each beginning with 10 index cases, and computed the fraction of scenarios for which the epidemic was always contained (as defined earlier), assuming no change in diagnosis rates. We assumed 80 ring vaccinators per day, contact finding probabilities of 0.95 for households and 0.8 for workplace/social contacts , most individuals may already be infected when identified through contact tracing from an infective. Using the scenario we examined in Figure a = 1 hour, so that cases arising in previously contacted persons almost never transmit the infection further). We chose different levels of household and workplace/social contact finding probabilities and different levels of ring vaccination capacity, and performed 100 replications of each of the 1000 different scenarios. In Table Finally, we used the \"calibrated\" scenarios (parameter set choices) to explore the levels of contact finding probability needed to contain the epidemic  Table . In thesa relative infectivity during entire period is one , b the relative infectivity just prior to the rash is the same as during the first week of the rash, but during the prodromal period is 4% ; in case b (high infectivity just prior to onset of rash), loss of containment occurs 36% of the time ). Scenario a  showed loss of control in every realization. Increasing the ring vaccination capacity from 40 per day to 80 per day (results not shown) led to containment in all of the realizations with high infectivity just prior to the rash and low infectivity during the prodromal period (case b), but made no difference if the infectivity was as high during the prodromal period as during the rash (case a). While intuitively adding additional infectiousness must increase the number of secondary cases and make control more difficult, these results do illustrate that even a small amount of increased infectiousness prior to the rash (when diagnosis is more difficult) may substantially increase the difficulty of smallpox control.Transmission prior to the rash makes epidemic control more difficult. In Figure a in the figure). Specifically, we assume that severe smallpox (hemorrhagic and flat) on average takes four times longer to diagnose and isolate than ordinary smallpox (case b), that no one in the population has prior vaccination protection , that 10% more smallpox is too mild to diagnose  compared to baseline, and finally that the vaccine is completely ineffective (case e). Each of these scenarios will be discussed further below.Finally, in Figure b was motivated by the possibility that individuals with severe forms of smallpox may be more difficult to diagnose, and thus remain infectious in the community longer (despite the much greater degree of illness of such patients), or that such patients may be more infectious. In this particular case, quadrupling the mean diagnosis time led to one additional replication out of 100 in which containment was not achieved . However, we assumed that community awareness of smallpox leads to the same relative rate of increased diagnosis among severe cases as for ordinary cases, and that the most severe forms are relatively rare. In addition to the scenario shown in the figure, we also replicated the same 1000 \"calibrated\" simulations, assuming that in each case 40 contact tracings per day are possible and that the diagnosis time for severe cases was four times that of ordinary cases. Finally, we repeated each \"calibrated\" scenario 100 times assuming long diagnosis times for severe cases, and not making this assumption, and found that the difference in the decontainment fraction was not large (results not shown).Scenario c illustrates that vaccination prior to the discontinuation of routine vaccination does play a role in smallpox control by ring vaccination; there were more decontainment scenarios (5/100) when no prior protection exists in the population. The results suggest that prior vaccination aids in the control of smallpox, but that it is not strictly necessary for control . In Figure c of Figure Scenario d demonstrates that if 10% more smallpox infections . Here, with 40 contact tracings possible per day, 55% of the replications nevertheless exhibited containment even with a vaccine which offered no protection whatever. With 90 contact tracings possible per day, all replications exhibited containment even assuming no vaccine protection.Finally, scenario Although less efficient than ring vaccination in the sense that more vaccinations must be delivered to eliminate infection, comprehensive mass vaccination following the introduction of smallpox is sufficient to eliminate the infection. In Figure We constructed a simple network model of smallpox transmission, and addressed the question of what circumstances contribute to the success of a ring vaccination campaign designed to control smallpox. Our analysis focused on the use of contact tracing/ring vaccination to prevent a widespread epidemic following a deliberate release.We conducted a sensitivity analysis based on particular, but reasonable, ranges for the unknown parameters. Our results are consistent with prior vaccination models in identifying prior vaccination and ring vaccination capacity as significant factors in determining the spread of smallpox. Unsurprisingly, we also find that household size and ring vaccination speed are particularly important parameters; these results are intuitively plausible. The contact finding probability did not appear important in this analysis only because a narrow range of values was chosen.We illustrated smallpox control by presenting scenarios based on control of moderately severe smallpox epidemics. We find that swift, aggressive contact tracing and ring vaccination is is usually sufficient to bring the infection under control. Provided that there is sufficient capacity, vaccination of contacts of contacts is beneficial, and results in fewer infected individuals and more rapid elimination of infection; investigating contacts of contacts allows the chain of transmission to be outrun to some extent. When ring vaccination capacity is small, diversion of crucial resources away from contacts is harmful; contacts of contacts should only be traced and vaccinated provided that no resources are diverted away from contacts of cases. The increased surveillance (or isolation) of contacts, together with improved rates of diagnosis due to community awareness, play important roles in smallpox control; we note that in some cases, lowered diagnosis rates among severe cases contributed to a small extent to loss of epidemic control, and suggest that any public awareness campaign include information to help the public be more aware of the full spectrum of the clinical features of smallpox.One limitation of our analysis is that we chose not to explicitly incorporate the specific epidemiology of health care workers (or mortuary workers), who are likely to be exposed to infected individuals during any smallpox epidemic e.g. ,22), and, and22])While we analyzed the effect of contact tracing, case and contact isolation, and ring vaccination (together with mass vaccination), in a real smallpox epidemic, in practice, control efforts are unlikely to be limited strictly to vaccinating contacts  and isolating cases. Indeed, making vaccine available to individuals who believe they live near cases or to others on a voluntary basis occurred in smallpox control efforts in the past . VaccinaMore serious is the possibility that individuals who should be vaccinated or isolated would be missed; this could occur either because individuals or institutions did not cooperate with the disease control effort, or because the individuals simply could not be found. Our analysis suggests that ring vaccination need not be perfect to successfully contain the epidemic, and yet, under conditions where there is a high rate of infection among contacts, or a relatively high rate of casual transmission, high rates of contact finding (in excess of 90%), together with increased surveillance and contact isolation, are needed to contain the epidemic.Finally, the vaccination of individuals at low risk of contracting smallpox will cause harm due to adverse events of the vaccine; in our model, the assumed death rate due to vaccination was small compared to the probability of death from smallpox, and played essentially no role in the analysis. In practice, individuals suspected to be at high-risk for vaccine complications, but at relatively low risk for contracting smallpox, might simply be isolated or closely monitored even during an outbreak; while the presence of individuals in the population at higher risk for vaccine complications would increase the death rate during an outbreak, such individuals are unlikely to impair the containment of the epidemic .Our results support ring vaccination against epidemics of smallpox (even assuming high rates of transmission to close contacts), but do note that stochastically, for severe (rapidly transmissible) smallpox, scenarios of loss of control are seen, with resulting widespread epidemics. In scenarios in which the transmission potential of smallpox is smaller, such loss-of-control scenarios occur less frequently (results not shown). Mass vaccination campaigns, when conducted quickly and with very high coverage, do not result in loss of control in our model. Nevertheless, fewer deaths due to smallpox result when ring vaccination is conducted along with mass vaccination.Simulated smallpox epidemics with ring vaccination suggest that aggressive, fast ring vaccination can control epidemics of smallpox. To do so, however, smallpox must be identified quickly and contacts vaccinated promptly. We also identify public awareness of smallpox \u2013 leading to prompt identification of cases \u2013 as a major factor in smallpox control; in some simulations, it may play a role as significant as ring vaccination itself . Howeverwhich can facilitate more rapid identification and isolation of cases. We assumed that ring vaccination could be fast (little delay between identification of a case and vaccination of the contacts), effective , and available (there is sufficient capacity). To be effective, ring vaccination planning must yield a system capable of meeting these benchmarks; we should not only be able to assess the number of contact vaccinations that will be possible per day, but should have a plan in place to (1) identify contacts by working with individuals, employers, schools, community representatives, and authorities or businesses who may have access to information facilitating contact tracing, (2) rapidly investigate and vaccinate such individuals, perhaps using field teams managed by central dispatch. It is important to realize that for high-risk, transient, or unstably housed populations where reliable contact tracing is impossible, the conclusions of the model we present cannot be applied. It is important to note that while our model suggests that ring vaccination together with contact tracing and isolation is likely to be successful, we found that for some scenarios , epidemic containment required not only ring vaccination, but increased public awareness, the isolation of contacts, and tracing of contacts of contacts. For scenarios in which the smallpox was less transmissible, epidemic containment was possible at lower contact finding probabilities. Thus, while our simulations suggest that contact tracing/ring vaccination need not be perfect to succeed, because of uncertainties in our knowledge of the behavior of bioterrorist smallpox, it is impossible to know in advance how good it will have to be. Thus, that high contact finding rates, mass public awareness leading to early identification of cases, isolation of contacts, and investigation of contacts of contacts should all be conducted with maximum effectiveness to reduce the probability of a widespread epidemic.Because our model combines network structure with response logistics, our results support and complement the results of other investigators. Our results support the notion that prior vaccine protection may play an important role in slowing the epidemic , despiteWhile the possibility of smallpox uncontrollable by ring vaccination has made mass vaccination preparations wise, and while mass vaccination may be unavoidable in the event of a deliberate release of smallpox, we believe that ring vaccination is essential in any case. This is not only because individuals recently exposed to smallpox may be protected if they are vaccinated promptly, but because each contact identified potentially lies in the immediate future of the transmission chain. From the standpoint of epidemic control, it is far more valuable to vaccinate individuals next in the transmission chain than to vaccinate other persons. Our results support the idea that ring vaccination/case isolation may in many, if not most cases, eliminate smallpox even without mass vaccination, but also support planning for mass vaccination (so that the vastly more costly and difficult policy of mass vaccination will be available in the event of an explosive epidemic). When faced with the unknown, multiple redundant preparations are appropriate; case investigation/isolation may control smallpox even if the vaccine does not work at all, but mass vaccination is useful in the event of an explosive epidemic for which case tracking becomes impossible.None declared.TP, KH, SF, TA, RR, and DP performed the literature review , TP developed and implemented the model and simulation, TP performed the analysis of the simulation model and drafted the manuscript, DP performed analysis of contact tracing data, and KH conceived of the study. All authors contributed to, read and approved the final manuscript.The pre-publication history for this paper can be accessed here:For consistency, all references are included in the bibliography of the main text.Click here for fileFor consistency, all references are included in the bibliography of the main text.Click here for file"}
+{"text": "Plasmodium falciparum are reported frequently in the East African highlands with high case fatality rates. There have been formal attempts to predict epidemics by the use of climatic variables that are predictors of transmission potential. However, little consensus has emerged about the relative importance and predictive value of different factors. Understanding the reasons for variation is crucial to determining specific and important indicators for epidemic prediction. The impact of temperature on the duration of a mosquito's life cycle and the sporogonic phase of the parasite could explain the inconsistent findings.Malaria epidemics due to Daily average number of cases was modeled using a robust Poisson regression with rainfall, minimum temperature and maximum temperatures as explanatory variables in a polynomial distributed lag model in 10 districts of Ethiopia. To improve reliability and generalizability within similar climatic conditions, we grouped the districts into two climatic zones, hot and cold.In cold districts, rainfall was associated with a delayed increase in malaria cases, while the association in the hot districts occurred at relatively shorter lags. In cold districts, minimum temperature was associated with malaria cases with a delayed effect. In hot districts, the effect of minimum temperature was non-significant at most lags, and much of its contribution was relatively immediate.The interaction between climatic factors and their biological influence on mosquito and parasite life cycle is a key factor in the association between weather and malaria. These factors should be considered in the development of malaria early warning system. Plasmodium falciparum are reported frequently in the East African highlands [Malaria epidemics due to ighlands -6. Immunighlands . Since tighlands -9 to preighlands ,11. Therighlands -20. Howeighlands -27. Woubighlands  found a ighlands . Moreoveighlands  found vaighlands  showed tighlands ,22,24,29The inconsistency of findings from different studies may be due in part to the interaction of weather factors affecting vector abundance and survival, and parasite maturation, key determinants of malaria transmission. Deposition of mosquito eggs, and their maturation into larvae and then into adults, requires aquatic breeding sites, and is, therefore, dependent on rainfall ,31. The Once female adult mosquitoes emerge, they look for a blood meal, and in the process they ingest malaria parasites (gametocytes) with the blood. The feeding frequency of mosquitoes increases with temperature, resulting in increased proportions of infective mosquitoes . The durThese data on the timing of the mosquito life cycle suggest that malaria cases should follow, at defined intervals, periods of increased temperature and increased rainfall. Moreover, because temperature accelerates several steps in the process of mosquito and parasite development, the time lag between the appearance of suitable weather conditions and the appearance of new malaria cases should shorten as temperature rises. Although based largely on laboratory findings, these data suggest quantitative hypotheses about the precise time lag between increases in temperature and rainfall, and increases in malaria cases. At an average temperature of 20\u00b0C, the aquatic phase of the mosquito will be completed in about 28 days (five days for eggs to hatch and 23 days for the larva to develop into adult stage); and sporogony is completed in 28 days Table . At thisThe purpose of the investigations reported here is to test these hypotheses using weekly data on weather and malaria cases. Specifically, we used Polynomial Distributed Lag Models (PDL) to determine the effect of weather factors and their lag distribution on malaria in relatively hot and cold environments using a data set consisting of weekly parasitologically confirmed malaria cases collected from health facilities and locally collected meteorological factors in 10 districts of Ethiopia for the years 1990 to 2000.Plasmodium species; the analysis was restricted to P. falciparum. The original data collected on the basis of Ethiopian weeks were normalized to obtain mean daily cases for each Ethiopian week [Microscopically confirmed malaria cases were collected from a health facility in each of ten districts of Ethiopia over an average of 10 years. Each of these health facilities serve people living in the surrounding localities with few exceptions coming from other places. The data were extracted from records of outpatient consultations for the years 1990 through 2000. These data were compiled by residency  and ian week .Daily meteorological data  recorded at the local weather stations nearest to the health facility were obtained from the National Meteorological Services Agency (NMSA) for the same period. The assumption is that the meteorological data from the local weather stations represent the surrounding localities whose inhabitants are served by the respective health facilities. These daily data were collapsed into weekly data to correspond with the weekly malaria cases. The weekly mean for minimum and maximum temperature and the total weekly amount of rainfall were calculated from the daily records.The data set consists of records with missing values for some of the variables . Because of the multiple time lags considered in the analysis (see below), discarding estimates with a single missing value results in multiple records lost for each missing value. To avoid this substantial loss of data, missing values of the independent variables (weather variables) were interpolated by fitting a linear regression using the value from the previous week and a dummy variable for that week. A new variable was created with original values for non-missing data points and interpolated values for missing data points.The daily average number of cases  was modeled using a robust Poisson regression (implemented in Splus), using weekly rainfall, minimum and maximum temperature as explanatory variables in a distributed lag model. The model was:E(Yst) denotes the expected value for the daily average number of malaria cases at site s on week t; ,  and Rt - i are the weekly minimum and maximum temperature and the rainfall i weeks previously; \u03b1s and \u03b2s represent the intercept and coefficient for time trend (t), which are specific to the site under consideration.where \u03b2i.As described in the introduction, biological considerations suggest that the lag between rainfall and associated malaria cases will be different from that between temperature and associated cases. Therefore, lags of 4\u201312 weeks were considered for rainfall, and relatively shorter lags of 3\u201310 weeks for the minimum and maximum temperature. The assumption is that changes in temperature and rainfall at a particular time do not have an important influence after 10 and 12 weeks respectively. The overall effect of a unit increase in minimum temperature (for example) is the sum of the coefficients A large number of variables  were introduced for the three weather factors in this model. The efficiency of the coefficient estimates may be affected due to the large number of parameters to be estimated and the possibility of multicollinearity between the lagged weather factors. When lag terms are put in the same model, correlation between measurements of weather on weeks close together will cause a high degree of collinearity that may result in unstable estimates.\u03b2i,\u03b3i,\u03b8i, forcing each of them to take the form of a (separate) 4th-degree polynomial in i. This reduces the number of degrees of freedom for each weather factor from the number of lags considered to five and circumvents some of the difficulties associated with estimation of coefficients for multiple lags, including instability of estimates due to collinearity of the different lags of the same variable. With this model the coefficients for lagged minimum temperature, for example, are assumed to take the form:A polynomial distributed lag (PDL) model  imposes \u03c6k is the parameters of the d-th degree (here d = 4) polynomial distributed lag. To estimate the parameters describing the polynomial lag \u03c6k equation (2) was substituted into the unconstrained distributed lag model (1) to obtain a constrained polynomial distributed lag model:where The effects of weather factors on the number of malaria cases were distributed over multiple weeks and the separate analysis for each district (not shown) indicated heterogeneity in magnitude and direction of the effects of the weather factors. Districts with similar climatic characteristics were grouped, in order to reduce the effect of random error and to produce more reliable and precise estimates of weather effects. Moreover, this approach will produce more generalizable results within similar climatic conditions. Thus, the districts were grouped into hot  and cold on the basis of altitude and temperature. The hot districts included Diredawa, Nazareth, Wolayita and Zeway; and the cold districts included Alaba, Awasa, Bahirdar, Debrezeit, Hosana and Jimma. Two separate PDL models were fitted to estimate the effects of different weather factors.A basic issue in epidemiological analysis is controlling for the effect of confounding factors. Malaria transmission is affected by different factors and shows a systematic variation over time. To control for other factors that may affect the long-term trend, a time variable was included in the model, which would remove the long-term wavelength patterns, leaving the deviations representing short fluctuations. Since the long-term trend and the numbers of weekly cases vary between districts, an interaction term between the time variable and district (dummy variable) was introduced.Urban areas may have other sources of breeding sites for mosquito not driven by rainfall. To examine the influence of these and other unmeasured factors that vary between urban and rural environments, separate models were fitted for urban and rural cases.P. falciparum cases from a health facility in each of 10 districts over an average of 10 years and meteorological data from local stations in each of the districts. Table The data set consists of microscopically confirmed The effect of rainfall and temperature on daily average microscopically confirmed cases was estimated by lag in the 10 districts grouped into two climatic zones, hot and cold Table . Figure Similarly, rainfall is significantly associated with malaria cases in the hot districts. Compared to the cold districts, a significant and positive effect of rainfall in the hot districts manifests at relatively shorter lags  and remains positive afterwards but declines and becomes non-significant for the longer lags Figure . Much ofFigure In the hot districts, by contrast, the effect of minimum temperature on malaria cases is more complicated. At short lags, its effect is small and non-significantly positive Figure . A signiFigures To test the linearity of the association between the weather factors and malaria cases, a three dimensional relationship between weather factors, lag and the magnitude of effect at each lag was explored  and cold  environments in Ethiopia.The development of malaria early warning systems ,8 to preThe findings are largely consistent with hypotheses based on the relationship between weather factors and mosquito and parasite development. Rainfall is associated with malaria cases in both hot and cold districts with a lagged effect, and as expected, this lag is shorter in hot districts. The effect of rainfall on malaria is linear with saturating effects at higher rainfall levels  and a small increase in temperature substantially shortens the duration of these phases (to 37 days at 17\u00b0C). Similarly, the duration of the sporogony cycle will be short with increasing temperatures  correlation between weekly malaria cases and maximum temperature at shorter lags seen in hot districts may be due to its inhibitory and lethal effect on the survival of the parasites in the mosquitoes . The surAs with all observational studies of malaria incidence and weather, a limitation of this study is the likely presence of some confounding factors that may have influenced the number of malaria cases and may have been associated with weather. Existing interventions such as insecticide residual spraying and other methods are routinely applied and were not included in this analysis. The results would have been biased by such confounding factors if interventions were undertaken on the basis of weather, or if they were undertaken on the basis of incidence and their effect was differential depending on the weather. Another minor problem is with the assumption of a finite length for the delayed effect of the different weather factors. However, the lag length was chosen based on the inter-relationship between weather, mosquitoes and parasites Table  and it wWeather factors alone explain seasonal cycles but were not accurate in explaining the magnitude of unusually bad years Figure . This stThe findings are largely consistent with hypotheses, based on experimental data on mosquito and parasite development, about the interactions of climatic factors in determining the strength and lag structure of weather effects on falciparum malaria incidence. In the examined Ethiopian districts, weather-based predictors of malaria incidence are more useful in rural than in urban settings. These key points should be considered in the development of an early warning system for malaria.HDT and ML conceived the study, undertook statistical analysis and drafted the manuscript. AT initiated the study and made data available in collaboration with WHO and Ministry of Health of Ethiopia. JS made major contributions to the study design and statistical analysis. All authors contributed to the writing of the manuscript and approved the submitted version of the manuscript.Three dimensional relationships between weather, lags and magnitude of effect at each lagClick here for file"}
+{"text": "Malaria still remains a public health problem in some districts of Bhutan despite marked reduction of cases in last few years. To strengthen the country's prevention and control measures, this study was carried out to develop forecasting and prediction models of malaria incidence in the endemic districts of Bhutan using time series and ARIMAX.This study was carried out retrospectively using the monthly reported malaria cases from the health centres to Vector-borne Disease Control Programme (VDCP) and the meteorological data from Meteorological Unit, Department of Energy, Ministry of Economic Affairs. Time series analysis was performed on monthly malaria cases, from 1994 to 2008, in seven malaria endemic districts. The time series models derived from a multiplicative seasonal autoregressive integrated moving average (ARIMA) was deployed to identify the best model using data from 1994 to 2006. The best-fit model was selected for each individual district and for the overall endemic area was developed and the monthly cases from January to December 2009 and 2010 were forecasted. In developing the prediction model, the monthly reported malaria cases and the meteorological factors from 1996 to 2008 of the seven districts were analysed. The method of ARIMAX modelling was employed to determine predictors of malaria of the subsequent month.s model  for the overall endemic districts was 12; the modelling data from each district revealed two most common ARIMA models including 12 and 12. The forecasted monthly malaria cases from January to December 2009 and 2010 varied from 15 to 82 cases in 2009 and 67 to 149 cases in 2010, where population in 2009 was 285,375 and the expected population of 2010 to be 289,085. The ARIMAX model of monthly cases and climatic factors showed considerable variations among the different districts. In general, the mean maximum temperature lagged at one month was a strong positive predictor of an increased malaria cases for four districts. The monthly number of cases of the previous month was also a significant predictor in one district, whereas no variable could predict malaria cases for two districts.It was found that the ARIMA  The ARIMA models of time-series analysis were useful in forecasting the number of cases in the endemic areas of Bhutan. There was no consistency in the predictors of malaria cases when using ARIMAX model with selected lag times and climatic predictors. The ARIMA forecasting models could be employed for planning and managing malaria prevention and control programme in Bhutan. There are an estimated 300-500 million clinical cases of malaria reported each year -4. One fHistorically, the first malaria survey in Bhutan was conducted in 1962 . There wAnopheles minimus is still sensitive to DDT [Plasmodium falciparum transmission areas with API >10% [Plasmodium falciparum is the combination of artemether and lumefantrine (Coartem\u00ae) administered over three days (except for pregnant woman). Plasmodium vivax is treated with chloroquine (25 mg/kg) for three days and primaquine (0.25 mg/kg) administered over 14-days [Malaria transmission is clearly associated with the rainy season -13. Preve to DDT . InsectiAPI >10% . With thAPI >10% , from 20 14-days ,17.Although there has been a marked reduction of malaria cases due to the implementation of these integrated control measures by the VDCP for the whole country, the malaria problem is still a major threat to the country and requires a well developed strategic plan and resource preparation for prevention and control, and eventual elimination. Forecasting malaria enables suitable allocation of resources and forestalls outbreaks and epidemics. There has been no such modelling of malaria in Bhutan before. This study aimed to propose a forecasting model based on the time series analysis. In addition, this study also aimed at proposing a prediction model incorporating climatic factors such as temperature, humidity and rainfall; which are important in the development of malaria parasites and vector bionomics -21.Seven malaria endemic districts of total 20 districts in Bhutan were selected for this study as they have been identified since malaria transmission occur throughout the year; these districts are Chukha, Dagana, Pemagatshel, Samdrup Jongkhar, Samtse, Sarpang and Zhemgang districts Figure . These dThe monthly incidence of malaria cases were obtained from Vector-borne Disease Control Programme (VDCP), Department of Public Health, Ministry of Health, Royal Government of Bhutan. Malaria cases from various levels of health centres are reported to the programme every month. These health centres provide free malaria diagnosis either by microscopy or by using rapid diagnostic test (RDT). All malaria cases are treated with the national standard regimen.Malaria distribution varies greatly between the districts and sub districts. Figure A climatic record from 1996 to 2008 was obtained from the Meteorological Unit, Department of Energy, Ministry of Economic Affairs, Royal Government of Bhutan. Daily reported climatic variables include mean minimum and maximum temperature, humidity and rainfall; these variables are collected and recorded at the weather stations in each districts. The meteorological Unit maintains the records of all the district climatic variables at the central level. Overall, the maximum temperature of the whole region varies between 20\u00b0C and 30\u00b0C; mean minimum temperature ranges between 10\u00b0C and 20\u00b0C. Monthly relative humidity ranges between 60% and 90%. Amount of rainfall greatly varies from month to month, ranging from zero to 1000 mm per month Figure .s model where:The forecasting model proposed in this study was the multiplicative seasonal Auto-regressive Integrated Moving Average (ARIMA). A seasonal ARIMA   p and P- the auto regressive and seasonal autoregressive, respectively;\u25aa d and D- the non-seasonal differences and seasonal differencing, respectively;\u25aa q and Q- the moving average parameters and seasonal moving average parameters, respectively.\u25aa s representing the length of the seasonal period.\u25aa A stationary time series is a time series whose statistics do not change over time. Such statistics are typically the mean and the variance. There are three types of non-stationarity; series that have a non-stationary mean; series that have a non-stationary variance; and series with a periodic or seasonal component .In this research, the data series was non-stationary Figure -Top but From the autocorrelation functions (ACF) and partial autocorrelation functions (PACF), plausible models were identified. The forecasting models were developed for each selected district as well as the overall endemic districts. Time series data from 1994 to 2006 were used as a training set while data from 2007 to 2008 were used as a testing set  12 with error percentages of 2.43%, -7.72%, 0.70% and 5.90%, respectively. Samtse had ARIMA  12 as the best-fit model with an error percentage of 24.80%. The best-fit model for the overall districts was ARIMA  12. This had an error percentage of -8.12%  of malaria for the subsequent month. The best model for Chhukha district was the model II with a BIC of 1107.768. The significant predictors was mean minimum temperature (p = 0.002) when the malaria cases of the previous month, mean minimum temperature and humidity lagged at one month were fitted. Previous month's malaria cases were a significant predictor of subsequent month's malaria cases for Dagana districts in all the five models. However, model III was the best model with the lowest BIC of 748.5172. The different predictors that were fitted in the model III were malaria cases, maximum temperature and rainfall. Model III with previous month's malaria cases, maximum temperature and rainfall was the best model for Samdrup Jongkhar district. But two of the covariates, maximum temperature (p < 0.001) and rainfall (p < 0.001) were significant predictors for Samdrup Jongkhar in the Model IV. Samtse, Sarpang and all endemic districts in the model I consisting of previous month's malaria cases, and mean minimum temperature was the best model. However, only significant predictor was mean minimum temperature (Table This study provides an example of applying a simple ARIMA model to forecast malaria cases in a low malaria-transmission area, where targeted interventions are highly recommended for most effective malaria control. This model was developed according to the trend of the malaria cases over the years and presuming pattern stability of all other conditions such as climatic factors, control and preventive measures, treatment seeking behaviour and migration of people. The developed models were validated and appeared to fit well at both each district level and the overall districts, providing tolerable error levels in forecasting.Different ARIMA models were found for different districts, which is consistent with the findings of the study by Briet et al . This suIn exploring different prediction models by fitting covariates to the time series data, no single best model was found; some covariates were found significant in one model but not in another model. These covariates included number of cases in previous month, mean maximum and minimum temperature, rainfall and humidity. These climatic covariates were lagged at one month to allow for sufficient time to complete life cycle of vector which takes around two weeks and subsequently complete the generation of parasites in the new host for two weeks. The number of malaria cases observed in the previous month reflect the level of human reservoir within the area, while other meteorological factors such as temperature, humidity and rainfall are an important extrinsic factors that are directly associated with the development of vectors. The temperature is also an important factor that determines the rate of development of parasites in the mosquitoes.Two districts did not have any significant covariates as predictors of malaria cases. This can be explained by the fact that the malaria cases in these districts were rather low with no malaria cases in certain months, therefore the malaria cases of the preceding month was not a significant predictor, or at worst could lead to inaccurate prediction, similar to a study in Sri Lanka . SimilarTemperature was found as an important predictor for three districts and overall districts. Temperature affects - the mosquito bionomics through the time required for development of the ookinete, the egg of the parasite, in the midgut of the anopheline mosquito, which decreases as temperature increases from 21\u00b0C to 27\u00b0C . IncreasWhen more climatic variables were added, rainfall was found as one of the significant predictors for only two districts. Rainfall provides aquatic medium for the growth and development of mosquitoes. But excessive rainfall might have a negative effect by washing off the breeding sites . In all,These forecasting models developed in the study provide the VDCP with expected malaria cases in advance, which would be a useful guidance for timely prevention and control measures to be effectively planned. The knowledge of the spatial distribution of the malaria at the sub districts would also greatly aid in the targeting the control measures, even though the forecasting is feasible at the district level data due to the small number of cases at the sub district level. Thus, VDCP can use the forecasting model to estimate the number of malaria cases at the district while targeting the control measures at the sub district using the spatial distribution of malaria cases of the previous years.The prediction model based on the time series and climatic factors were developed and showed different predictors for different districts. Some districts did not have any covariates as predictor of malaria. Model based on time series would provide forecasting for longer period unlike the models fitted with other covariates like climatic factors, which is best suited for forecasting in shorter period.The main limitation of models based on time series is that they provide forecasting for longer period. In contrast, the models that are fitted with other covariates such as climatic factors may be best suited for forecasting within a shorter period. The time series model proposed in the study can be applied to other diseases such as dengue. However, further research is recommended to evaluate the effectiveness of integrating the forecasting model into the existing malaria control programme in terms of its impact in reducing the disease occurrence and also the cost of control interventions.The authors declare that they have no competing interests.KW and JK conceived the study. KW undertook the statistical analysis, interpretation of results and drafted the manuscript. JW assisted in statistical analysis, interpretation of results and was involved in the critical revision of the manuscript. PS, TS, and SL assisted in statistical analysis, interpretation and revision of the manuscripts. NJW assisted in the interpretation of results and revision of the manuscripts. All authors read and approved the final manuscript."}
+{"text": "Malaria in Sri Lanka is unstable and fluctuates in intensity both spatially and temporally. Although the case counts are dwindling at present, given the past history of resurgence of outbreaks despite effective control measures, the control programmes have to stay prepared. The availability of long time series of monitored/diagnosed malaria cases allows for the study of forecasting models, with an aim to developing a forecasting system which could assist in the efficient allocation of resources for malaria control.Exponentially weighted moving average models, autoregressive integrated moving average (ARIMA) models with seasonal components, and seasonal multiplicative autoregressive integrated moving average (SARIMA) models were compared on monthly time series of district malaria cases for their ability to predict the number of malaria cases one to four months ahead. The addition of covariates such as the number of malaria cases in neighbouring districts or rainfall were assessed for their ability to improve prediction of selected  ARIMA models.The best model for forecasting and the forecasting error varied strongly among the districts. The addition of rainfall as a covariate improved prediction of selected  ARIMA models modestly in some districts but worsened prediction in other districts. Improvement by adding rainfall was more frequent at larger forecasting horizons.Heterogeneity of patterns of malaria in Sri Lanka requires regionally specific prediction models. Prediction error was large at a minimum of 22% (for one of the districts) for one month ahead predictions. The modest improvement made in short term prediction by adding rainfall as a covariate to these prediction models may not be sufficient to merit investing in a forecasting system for which rainfall data are routinely processed. Malaria has been a major public health problem in Sri Lanka  until reWhile many factors play a role in the spatial and temporal distribution of malaria, climate variability  has been shown to be important in explaining its occurrence -8 and isAt present, there are no practical tools for temporal prediction of the occurrence of malaria based on observed rainfall or weather forecasts in Asia, although these are in development . For AfrMalaria case numbers are influenced by factors intrinsic to malaria such as infectivity, immunity and susceptibility of vectors and humans, and extrinsic, environmental factors such as rainfall. The number of possible models for malaria prediction is infinite. In biological process models, typically consisting of sets of equations, prediction can be done with details of all pathways, parameters and variables believed to be important for the dynamics of the disease . In statThis section describes the data used for the analyses, methods for pre-processing of the data, types of models tested and the criteria for model selection.The count of blood films examined for malaria as well as those positive for malaria per month reported by government health facilities and aggregated by medical officer of health (MOH) area  were provided by the Anti Malaria Campaign of Sri Lanka for the period 1972 \u2013 2003. In addition, data aggregated by district were available for the years 2004 \u2013 2005. For some of the records, the number of blood films examined was marked as \"not received\" (and therefore classified as missing). For 14.90% of the MOH area level records, the value was zero, or left blank. For the latter records, there was ambiguity as to whether the data value could be missing due to problems in data recording, or genuinely zero if no patients presented themselves for examination in that particular area in that particular month. As such, in a data cleaning procedure , 1.4% of the records was declared as not available (NA) if the number of blood films examined was marked as \"not received\" (0.95%), or if the number of blood films could be classified as a lower additive outlier (0.44%). The data from districts in the north and east, where data gathering and reporting was affected by the armed conflict, had the largest percentage of data labelled not available: Jaffna (5.4%), Mannar (26.1%), Vavuniya (8.9%), Kilinochchi (2%), Trincomalee (2%) and Ampara (5.4%). After imputation, MOH area level data for positive cases were aggregated to district resolution and combined with the district level data (for the period 2004 \u2013 005).Records of precipitation  collected by 342 stations across the island were purchased from the Meteorological Department of Sri Lanka . The models tested included exponentially smoothing and auto-regressive integrated moving average (ARIMA) models [The monthly count of malaria positive blood slides in each district ) models . As some) models . In ARIM) models , was tess) at time t+h is given by the following equation:The additive Holt-Winters prediction function mod s where (h - 1) mod s is the remainder of h-1 after division by s (e.g. 14mod12 = 2). Thuswhere at, rt and St are calculated by the following recursive functions:where \u03b3 fixed to 0) models were tested using the function \"HoltWinters\" in the package \"stats\" of the statistical software package \"R\".Both seasonal and non-seasonal , with mean \u03bct and variance \u03c32. Further, it was assumed thatIt was assumed that f and g model the temporal correlation aswhere whereut is Gaussian white noise;St models the seasonal process;mt models the mean of ztB is a backshift operator with Bd(zt) = zt-d.The seasonality in the ARIMA models of equation 2 was modelled by fixed effects. In particular it was assumed:St = 0 ,\u2022 \u2022 mt does not contain an intercept to avoid over parameterisation), of harmonic i.a second order harmonic component where s, obtained by modifying equation 2 intoAlso, a multiplicative seasonal ARIMA* model (henceforth SARIMA) was considered with period wherep(B), \u0398q(B), ut, mt and B as explained above.and \u03a6p, d, q) with p, q \u2208 {0,1,2} and with d = 1, without explanatory variables, and all (Gaussian) SARIMA models possible with combinations of parameters  with p, q \u2208 {0,1,2} and d = 1 and P, D, Q \u2208 {0,1}, also without explanatory variables. An intercept was not included in the mean as it drops out of the equation due to differencing (d = 1). The differencing also removes effects of trends such as potentially caused by population growth.The function \"arima\" in the package \"stats\" of the statistical software \"R\" was used to calculate the prediction criterion. Tested models included all (Gaussian) ARIMA models possible with combinations of parameters  zj,t-1 is the transformed malaria count at month t - 1 in neighbour j; 2) mt = \u03b2\u03c7t-l where \u03c7t is the rainfall parameter in month t-l with l = lag. Rainfall was considered at lags of one to four months preceding malaria and in the following forms: untransformed monthly rainfall, logarithmically transformed monthly rainfall, rainy day index (for those districts appropriate), monthly rainfall factored into quintiles (in case of non-linear relationships), and rainfall with a separate coefficient for each of the twelve months, i.e. a coefficient for January rainfall, one for February, etc., in order to allow for seasonally varying effects. For each district, covariates were tested by including them into the (S)ARIMA model that performed best for the respective district and lag.Covariates were included in the term p = 0, d = 1, q = 1, P = 0, D = 1, and Q = 1. Observations were marked as additive outlier if the likelihood ratio test statistic (for an additive outlier) for the observation was below a threshold of -6 [In a data cleaning procedure, the time series of blood film counts in MOH areas were logarithmically transformed to normality . Under the null hypothesis, each observation was assumed to be part of a seasonal autoregressive integrated moving average (SARIMA) process with parameters ld of -6 . For thold of -6 . FinallyAbeku and colleagues  tested aFor each district, model parameters were estimated on approximately the first half of the malaria case time series (January 1972 \u2013 December 1987), and one to four step ahead (out of sample) predictions were made on the second half (January 1988 \u2013 December 2005) with the parameters fixed.mare) of back transformed out of sample predictions:For selection of the best predictive models, all models tested were evaluated on the prediction criterion which was defined as the mean absolute relative error  was used rather than mean square error, as the malaria count time series show widely differing variances across the series [where e series . The besmare was relatively high for the districts Galle and Kalutara in the south west, and Nuwara Eliya in the central hill country, which have low malaria endemicity. The mare was also (very) high for the districts affected by the armed conflict in the north and east. Within a model class, the most complicated model tested was not necessarily the best model, and often the prediction improvement obtained by fitting an extra (S)ARIMA parameter as compared to more parsimonious models was marginal.The best model (without extrinsic explanatory variables) varied by district and forecasting horizon Table . For insmare, with 6.8% and 4.6%, respectively. For many other districts, inclusion of malaria in neighbouring districts raised the mare.In the analysis of covariates for the mean term, only the (S)ARIMA models shown in Table mare with 2.5% or more for eight districts at one or more horizons (Table mare for Gampaha District (at horizons of three and four months), Mannar District (at a horizon of one month) and Vavuniya District (at a horizon of four months). Logarithmically transformed rainfall with a separate coefficient for each calendar month lowered the mare for Ratnapura District (at horizons of three and four months), and Trincomalee District (at horizons of two and three months). Rainfall factored into quintiles  lowered the mare for Moneragala District (at a horizon of two months) and Mullaitivu District (at a horizon of one month). The rainy day index lowered the mare for Moneragala District (at a horizon of three months), and the rainy day index with a separate coefficient for each calendar month lowered the mare for Badulla District at a horizon of four months.Inclusion of a rainfall variable lowered the ns Table . Logarite.g. through access to health facilities for sampling) are of less importance than those pertaining to temporal aspects, such as the deployment of mobile clinics during specific periods. Despite the sometimes large prediction errors, especially for larger forecasting horizons, prediction intervals yielded by these models  could aid the AMC in assessing the risk of malaria in the near future, and adjust resources for preparedness accordingly. Although the best model selected varied among districts and over forecasting horizons, the difference between models was often small. Instead of specifying a different model for each situation, for practical implementation, it may be worth selecting for each district (or even group of districts) one model that performs well on average over a range of forecasting horizons (and districts within the group), provided that the prediction quality does not deteriorate more than a set percentage. A pilot forecasting system using district specific SARIMA models is currently being tested by the AMC in Sri Lanka (the system currently uses models without explanatory variables because a system to incorporate newly observed data is not yet in place). As the spatial resolution of the forecasting models presented is at district level, predictions will not help spatially targeted control at sub district level. For this, regional malaria control officers will have to rely on their experience of where within the district cases tend to occur if they occur, possibly aided by existing malaria maps at sub district level [The mean absolute relative prediction error calculated by the best model (without extrinsic explanatory variables) tested was quite large for many districts. However, as the models were fitted to only half of the length of the time-series available for the purpose of model testing (out of sample predictions are required), it is expected that for application in a forecasting system where the full series are used for fitting, the error will be reduced. For some districts in the north, the forecasting error was particularly large. For these districts, a relatively large proportion of the data had been imputed, and the quality of the existing data is likely compromised by the armed conflict in this region. General issues related to data quality are discussed elsewhere . In thisct level .It should be kept in mind that the malaria count data are not a direct proxy of new malaria infections or even infective bites. Recrudescent and relapsing cases (mostly due to ineffective drugs) occur multiple times in the malaria dataset, and immunity may play a role during periods of higher endemicity, thus weakening explanatory power of a variable such as rainfall, which would probably be better at explaining infectious bites .Rainfall improved the prediction for eight districts, at one or more of the tested forecasting horizons, but it also worsened the prediction for other districts at various horizons. For some districts, the rainfall preceding malaria by two months improved performance at forecasting horizons of three and four months (not shown), but this is of little use in a forecasting system, unless rainfall can be predicted with high confidence (one to two months ahead). Although only tested for four districts, the rainy day index was promising as it improved results for two out of these.The results of the analysis incorporating rainfall was remarkably different from what would be expected based on results of cross correlation analysis of malaria and rainfall. Although both (pre-whitened) cross correlations  and the Varying seasonal effects of rainfall on malaria in seasonal inter-annual analysis  suggestee.g. through civil war), rainfall may gain in relative importance as a predictor of the true number of cases, although this would be difficult to validate. It should be noted that high cross correlations between  malaria time series and extrinsic covariates  such as rainfall and temperature may exist [For most districts , presumably due to strong short term temporal auto correlation, the observed number of malaria cases is a good predictor at a one month forecasting horizon Figure . Interesay exist , and theThe contribution of rainfall to reducing the prediction error was modest, and it is arguable whether or not the achieved reduction in the prediction error  merits investing in a system where at the end of each month, monitored rainfall data are collected and processed to obtain average values for the district surface for entering into the prediction model. However, as such data become increasingly available with the development of monthly rainfall data monitoring systems at district and sub district scale , the redThe modest improvement found by including rainfall compares well to a study in Ethiopia . This stAnopheles culicificacies, primarily breeds in pooling rivers . In general, rainfall and river flow show strong cross correlations, and therefore rainfall can serve as a proxy for river flow. However, under dryer conditions -important for vector breeding- direct runoff will be decreased and river flow will be increasingly influenced by other hydrological processes such as percolation and evapo-transpiration. As river flow and soil moisture are difficult to measure over large surfaces , they can be estimated through modelling, although rainfall will remain an important variable in such models [Other rainfall related variables such as soil moisture content and river flow might give better results than observed rainfall, as these are more directly related to malaria vector breeding conditions. The main malaria vector in Sri Lanka, h models . Vegetath models , but witTemperature was not considered as part of the present analysis, based on the assumption that it was of less importance than rainfall, showing little temporal variability (because Sri Lanka is situated close to the equator), and a large part of its temporal variability being governed by rainfall. Except for the hill country , the temperature is generally conducive to malaria transmission throughout the year. However, for parts of the districts Kandy and Badulla, temperature could be limiting during part of (but not the whole of) the year and its role in these districts merits further investigation. In a study on the relationship between malaria and rainfall and temperature in Ethiopia, rainfall was found to be important in hot districts which were situated below 1650 m, but not in cold districts above 1650 m, where minimum temperature was significant . Other eOJTB conceptualized and conceived of the analysis, performed the data treatment and analysis, and drafted the manuscript. PV participated in the conceptualization, edited the manuscript and critically revised the statistical methodology. DMG participated in the conceptualization of the study and edited the manuscript. GNLG provided the data and helped define the scope of the paper. PHA participated in defining the approach to analysis, edited and critically reviewed the paper for intellectual content. All authors read and approved of the manuscript."}
+{"text": "Plasmodium falciparum malaria for the past two decades. We formulate a dynamical model of malaria transmission that explicitly incorporates rainfall, and we rely on recent advances on parameter estimation for nonlinear and stochastic dynamical systems based on sequential Monte Carlo methods. Results show a significant effect of rainfall in the inter-annual variability of epidemic malaria that involves a threshold in the disease response. The model exhibits high prediction skill for yearly cases in the malaria transmission season following the monsoonal rains. Consideration of a more complex model with clinical immunity demonstrates the robustness of the findings and suggests a role of infected individuals that lack clinical symptoms as a reservoir for transmission. Our results indicate that the nonlinear dynamics of the disease itself play a role at the seasonal, but not the interannual, time scales. They illustrate the feasibility of forecasting malaria epidemics in desert and semi-arid regions of India based on climate variability. This approach should be applicable to malaria in other locations, to other infectious diseases, and to other nonlinear systems under forcing.Malaria epidemics in regions with seasonal windows of transmission can vary greatly in size from year to year. A central question has been whether these interannual cycles are driven by climate, are instead generated by the intrinsic dynamics of the disease, or result from the resonance of these two mechanisms. This corresponds to the more general inverse problem of identifying the respective roles of external forcings vs. internal feedbacks from time series for nonlinear and noisy systems. We propose here a quantitative approach to formally compare rival hypotheses on climate vs. disease dynamics, or external forcings vs. internal feedbacks, that combines dynamical models with recently developed, computational inference methods. The interannual patterns of epidemic malaria are investigated here for desert regions of northwest India, with extensive epidemiological records for  Malaria epidemics can exhibit pronounced variation from year to year that can be driven by external forcings, such as climate, or can be generated instead by dynamic feedbacks within the disease system itself. For example, levels of immunity in the population (or control efforts) can rise and fall as the result of past levels of infection. This type of feedback is found in the dynamics of all (nonlinear) biological systems. Feedbacks can interact in complex ways with external drivers, for example by creating refractory periods. It remains a challenge to identify internal feedbacks vs. external forcings from available temporal records of aggregated reported cases and forcing variables. We propose a quantitative approach that can statistically compare the hypotheses of feedbacks vs. forcings  based on dynamical and mechanistic models. Our approach is computational, based on a large number of computer simulations of the different models. We illustrate and apply the approach to the analysis of extensive monthly records for malaria incidence in desert regions of India that span two decades. Our analyses confirm the strong role of rainfall, and quantify this effect with transmission model(s) for malaria that include rainfall and are shown to exhibit a remarkable prediction skill. Epidemic or \u2018unstable\u2019 malaria occurs in areas of marginal environmental conditions for the development of the parasite and the population dynamics of the mosquito vector, at the edge of the distribution of the disease. Millions of people live in the highlands and desert fringes around the tropics in Africa, Asia and South America. It is in these regions, where temperature or rainfall limit transmission, that climate variability and climate change have the potential to most strongly impact the population dynamics of the disease. Determining the role of climate variability is fundamental to evaluate both the feasibility of early-warning systems for infectious diseases based on climate, as well as the consequences of longer-term trends in climate. The intermittent nature of epidemics in unstable malaria regions results in populations that cannot sustain high levels of acquired immunity and are therefore susceptible to high morbidity and mortality; it also poses a different challenge for control efforts than the more stable, high-transmission intensity, endemic regions Studies of the role of climate variability, not just in malaria but also in other infectious diseases, have been limited by the scarcity of long temporal records of disease incidence, and by the difficulties of addressing the role of climate forcing in the context of the nonlinear dynamics of infectious diseases. These systems are well-known to behave as seasonally-forced nonlinear oscillators, capable of generating substantive variation from year to year on their own, in the complete absence of any year-to-year variation in an external driver such as climate Plasmodium falciparum, while also taking into account disease dynamics. The periodically recurring epidemics in the (semi) arid parts of India, particularly the Punjab, were amongst the most devastating described in the history of malaria Extensive epidemiological records for the past two decades in desert and semi-arid districts of India provide an opportunity to examine the role of rainfall on malaria epidemics of Our analysis shows a strong and significant effect of rainfall in the inter-annual variability of epidemic malaria that involves a threshold in the disease response. Simulations of the transmission model for twenty years capture remarkably well the observed epidemic patterns when rainfall is prescribed. We demonstrate the high prediction skill of the model for yearly cases in the transmission season following the monsoonal rains. We compare this skill to that of statistical models, in particular a mixture model that incorporates a threshold, to examine the feasibility of forecasting epidemics in these regions with simpler, more phenomenological, models of malaria's response to rainfall. We end by showing the robustness of the results to a more complex transmission model that includes clinical immunity, and the value of the dynamical models for predicting the time course of epidemics.A maximum correlation between monthly cases and rainfall was found when rainfall was accumulated for the five to six previous months . A nonliP. falciparum malaria were developed to capture some key aspects of the human, parasite and vector dynamics while remaining sufficiently parsimonious for parameters to be estimated directly from the available time series data. The structures of the two models are shown in Our models for The VSEIRS model that includes rainfall in the force of infection performs better than the model without rainfall, based on log-likelihoods  . This is\u22121329.0) . Figure \u22121329.0)  have a p\u22121329.0) . This ep\u22121329.0) .One difference between the parameters of the two VSEIRS models is the duration of \u2018effective\u2019 immunity at the population level  in . ImmunitTo further explore the possibility of an interaction between the longer immunity and rainfall forcing, we considered an intermediate model, with the epidemiological parameters fixed at the values of the best VSEIRS model without rainfall see . Only thAnother parameter of interest is the delay between the latent and current force of infection. This was estimated to be approximately 10 days in the model without rainfall  in  and arouThe performance of our best VSEIRS model suggests the feasibility of forecasting malaria cases as a function of previous rainfall. Moreover, the short duration of immunity, which here involves full protection to both disease and infection, further suggests that the depletion and replenishment of susceptibles, that is at the heart of intrinsic interannual cycles in infectious disease dynamics, does not play an important role here, despite the low reporting rate. This is confirmed by simulations with a fixed and large value of rainfall   . By cont 12 days . The wavFinally, to further compare the temporal patterns generated by this model to the data in a way that accounts for the uncertainty in the parameters, we considered the correlation value between total rainfall, accumulated during the monsoon season, and the cases, accumulated during the epidemic season. This value is influenced by both the timing and the interannual variability of the peaks in cases. We simulated repeatedly from the fitted model by resampling the We have proposed a computational approach to formally compare hypotheses on the respective roles of extrinsic forcings vs. intrinsic feedbacks in dynamical systems for which time series data are available but provide only a partial measurement of the relevant variables. This extends previous efforts on this inverse problem by incorporating climate covariates explicitly in dynamical models that also include both measurement uncertainty and dynamic noise. Our approach complements time series methods based on phenomenological, autoregressive models, developed to address the role of covariates and density-dependence in ecology and epidemiology e.g. . ConcernWe have applied the proposed approach to demonstrate the impact of rainfall on the interannual cycles of epidemic malaria in desert regions of India, by incorporating a climate variable into a stochastic dynamical model of disease transmission. Our approach directly confronted different hypotheses on the population dynamics of the disease based on time series data. The findings on the predominant role of rainfall are robust to consideration of more complex epidemiological models of malaria transmission with a different representation of immunity Our results with the simpler model suggest that immunity, in the sense of complete protection to both infection and disease, is of short duration and negligible at the population level in these semi-arid regions. These regions are expected to lie at one extreme of continuum in the gradient from stable to unstable, or endemic vs. epidemic. In this case, climate variability and not epidemiological dynamics are expected to be the main driver, as proposed for desert fringes in Africa Our second model follows naturally from the result that immunity as included in a typical SEIRS framework, meaning protection against disease and infection, appears negligible. The better performance of the model with clinical immunity indicates that a more complex representation of the epidemiological dynamics is warranted, and further suggests the importance of the contribution of asymptomatic infections to transmission, especially as a reservoir during the low season. In particular, the incorporation of two pathways, associated with more than one time scale of the recovery to disease susceptibility, appears warranted. This better performance is consistent with more detailed models of malaria transmission in the literature that consider the different effects or underlying mechanisms of immunity in malaria e.g. . These aHowever, we are here at the limit of model complexity that retrospective data on a single epidemiological variable (the number of cases) can support, as shown by the poor identifiability of specific parameters, especially those associated with the duration of clinical immunity. This is not surprising given the obvious trade-offs between epidemiological parameters that become possible in this more complex model: for example, individuals may remain for shorter times in the infectious but clinically immune class if we increase their contribution to the force of infection. Despite this limitation, it is interesting that even for an epidemic region, where transmission is intermittent and at its limit for disease persistence, we can clearly improve the fit of the data by including asymptomatic infections. The low estimate of the reporting rate also suggests the possibility of a considerable number of asymptomatics and a larger disease burden than reflected by the detected cases. Microscopy has been shown to underestimate the diagnosis of malaria compared to PCR (polymerase chain reaction) in similarly low prevalence settings P. falciparum in these regions of low transmission intensity. In its current formulation, this kind of long-lasting protection is obtained by making In our model, the reservoir provided by infectious individuals that lack severe symptoms plays a dynamical role primarily at seasonal scales in the decay and trough of epidemics Alternatives to our likelihood-based approach for inference on nonlinear dynamic systems include spectral matching Finally, our results indicate the feasibility of forecasting malaria epidemics in these desert and semi-arid regions of India based on climate variability. Our epidemiological models including rainfall exhibited high prediction skill for seasonal cases as a function of monsoonal rainfall. This skill is comparable to, and even higher than, that of a purely statistical model that incorporates a threshold and increasing uncertainty with rainfall. Thus, these aspects of the nonlinear response to climate variability, and not the nonlinear dynamics of the disease itself, appear key to variation and prediction of total epidemic size in these regions. However, disease dynamics appear useful to predict the time course of the epidemic curve, that is, the rise and fall of the individual outbreaks following the monsoons. Future investigations should consider other districts to encompass a larger geographic area, as well as the effects of control efforts, socio-economic conditions, and related land-use patterns including irrigation, to tackle the remaining unpredictability in the size of large epidemics. Other aspects of rainfall variability, in particular those pertaining to the monsoon season, should be examined to consider not just short-term prediction but possible implications of changes in the intensity and frequency of extremes with climate change in India Plasmodium falciparum from 1987 to 2007 in Kutch and from 1985 to 2005 in Barmer, two large semi-arid and desert districts of North-West India in the states of Gujarat and Rajasthan respectively , and random environmental noise (multiplicative Gamma noise) ; et al. (1974) on malaria models that recognize different levels and roles of immunity. We incorporate here two classes of infected individuals, corresponding to two levels of infection, for clinical and asymptomatic cases, respectively. The latter retain the ability to transmit to mosquitoes but at a reduced rate. Two classes of susceptibles allow us to differentiate individuals lacking protection to clinical disease from those protected from disease but retaining susceptibility to (asymptomatic) infection. Thus this model incorporates clinical immunity Click here for additional data file.Figure S2Seasonality of rainfall and reported cases for Kutch, 1987\u20132007. (A) Superimposed monthly rainfall; (B) Superimposed monthly cases. Some extreme years are highlighted: 1988 in black, 1989 in red, 1992 in green, 1994 in orange, and 2003 in blue.(0.72 MB TIF)Click here for additional data file.Figure S3P. falciparum malaria reported cases (red) and monthly rainfall from local stations (black) for Barmer. (B) The same rainfall data is shown here with the monthly malaria cases in a logarithmic scale, which emphasizes the patterns of the outbreaks other than the extreme event of 1994\u20131995. (C) Correlation between accumulated rainfall in the previous months to the months of the cases. A maximum is observed when rainfall is accumulated for 4 to 6 months (D) Correlation between accumulated cases in the previous five months to the month of the cases. A threshold non-linear response of cases to accumulated rainfall can be noticed, with a threshold of around 200mm.Malaria cases and rainfall for Barmer (c.f. (1.08 MB TIF)Click here for additional data file.Figure S4Prediction likelihood density for the year 2006 and the VSEIRS model with rainfall. The histogram is produced from one thousand simulations. Red line shows a kernel density estimate using a bandwith of 0.45 and a gaussian kernel. Given a value of observed cases (on x axis), we can use this curve to determine its likelihood when predicting with a given model (on the y axis).(1.47 MB TIF)Click here for additional data file.Figure S5Reported monthly malaria cases (red) and simulations for Barmer (1985\u20132005) in a logarithmic scale. Black lines show the median of ten thousand simulations; the shadowed regions correspond to the range between the 10% and 90% percentiles of the simulations. (A) VSEIRS model with rainfall; (B) VSEIRS model without rainfall.(1.08 MB TIF)Click here for additional data file.Figure S6RS. The upper panel corresponds to Kutch; the lower one, to Barmer. Red and blue represent the models with and without rainfall respectively. The dashed vertical lines construct approximate 95% confidence intervals. (A) For Kutch, the duration of immunity is estimated to fall in the interval  or  years for the VSEIRS model with rainfall, and  years for the VSEIRS model without rainfall. (B) For Barmer, the duration of immunity is estimated to lie in the interval  years for the VSEIRS model with rainfall and is not estimable for the VSEIRS model without rainfall .Profile likelihood plot of the duration of immunity 1/\u03bc(1.08 MB TIF)Click here for additional data file.Figure S7Profile likelihood plot of reporting rate (\u03c1) for Kutch (upper panel) and Barmer (lower panel), for the VSEIRS model with rainfall. The dashed vertical lines construct approximate 95% confidence interval. (A) The estimated reporting rate is between 0.3 and 1.9 percent of new infections for Kutch. (B) The estimated reporting rate is between 0.7 and 4.5 percent of new infections for Barmer.(1.08 MB TIF)Click here for additional data file.Figure S8Profile likelihood plot for the mean duration of the delay between the latent and the current force of infection, for Kutch (upper panel) and Barmer (lower panel), for the VSEIRS model with rainfall. The dashed vertical lines construct approximate 95% confidence interval. (A) The estimated delay \u03c4 is between 4 and 30 days for for Kutch. (B) The estimated delay \u03c4 is between 16 and 39 days for Barmer.(1.08 MB TIF)Click here for additional data file.Figure S9Intermediate model: Reported monthly malaria cases (red) and simulations. Black lines show the median of ten thousand simulations; the shadowed regions correspond to the range between the 10% and 90% percentiles of the simulations. (A) Kutch; (B) Barmer.(1.08 MB TIF)Click here for additional data file.Figure S102EI2 model with rainfall. The dashed vertical lines construct approximate 95% confidence interval. The estimated delay, \u03c4, is between 6.2 and 28.4 days.Profile likelihood plot for the mean duration of the delay between the latent and the current force of infection, for Kutch for the VS(1.47 MB TIF)Click here for additional data file.Figure S112EI2 model from (1) the end of August (solid dots in blue) and (2) the end of December (solid dots in green). Shadowed regions in respective colors correspond to the standard deviation from a set of 5000 predicted values. (A) VS2EI2 model with rainfall; (B) VS2EI2 model without rainfall. Click here for additional data file.Figure S122EI2 model with rainfall. B) P. falciparum malaria cases. C) Rainfall.Wavelet power spectra for simulations, malaria cases and rainfall in Kutch. On the left panels, the y-axis corresponds to the period in years and the x axis, to time. The colors code for the value of the power for a given time and period, from low values in dark blue, to high values, in dark red. The black continuous line gives the boundary within which these values are not influenced by edge effects and are therefore considered reliable, i.e. the cone of influence. The respective right panel represents the global power spectrum (obtained by averaging the wavelet spectrum over time), and is therefore, comparable to a Fourier spectrum. The white lines track the local maxima of the power in the wavelet spectrum. The discontinuous black line corresponds to the 5% significance level : the areas within this line indicate significant variability at the corresponding periods and times. A) Simulation from the MLE of the VS(1.23 MB TIF)Click here for additional data file.Figure S13Wavelet power spectra for simulations from VSEIRS models. See caption of (1.10 MB TIF)Click here for additional data file.Table S1l and AIC of the fitted models for Kutch and Barmer. In the table \u201cp\u201d denotes the number of parameters for each model. AIC is computed by the formula AIC\u200a=\u200a\u22122 l + 2p. The SARIMA model was fitted to the data on the log scale .Table of log-likelihood (0.03 MB PDF)Click here for additional data file.Table S2\u22121, n\u03bb\u200a=\u200a1, \u0394\u200a=\u200a1 day and 1/\u03b4\u200a=\u200a50 yr.List of symbols for the malaria model. Fixed parameters are \u03b2\u200a=\u200a1 yr(0.03 MB PDF)Click here for additional data file.Table S32EI2 correspond to maximum likelihood point estimates for each type of model, with and without including rainfall. The last two columns give the lower and upper bounds for approximate 95% confidence intervals for the VS2EI2 model with rainfall, derived from profile likelihood computations as shown in Estimated model parameters for Kutch. Corresponding units and parameter descriptions are given in (0.05 MB PDF)Click here for additional data file.Table S4Point estimates for estimated parameters of the VSEIRS model with and without rainfall for Barmer district. Corresponding description and units are given in (0.03 MB PDF)Click here for additional data file.Text S1Supporting Information online.(0.12 MB PDF)Click here for additional data file."}
+{"text": "In the last paragraph of the Materials and Methods subsection \"Testing for recent range expansion,\" the formula for the estimated mutation rate at locus i appears incorrectly. View the correct formula and related text here: i was estimated as First, the mutation rate at locus"}
+{"text": "Reports on agmatine are controversial showing that it may improve memory, it can deteriorate memory and some did not notice any interference with learning and memory. In the present study, the effect of directly intra-CA1 agmatine microinjection on water maze learning and memory has been assessed.The cannuls were implanted in hippocampal CA1 regions of rats in a sterotaxic frame after general anesthesia. After one week recovery period, the animals were assessed in the reference memory version of water maze. Agmatine  or saline were infused 20 minutes before or immediately after training.Agmatine-treated rats did not show any significant difference neither in water maze acquisition nor in consolidation task in comparison with control and sham groups.Agmatine does not affect water maze learning and memory. Agmatine (4-aminobutyl guanidine) is one of the metabolites of L-arginine. It is synthesized by arginine decarboxylase (ADC) and hydrolyzed by agmatinase. AlthoughThere are some evidences that agmatine modulate learning and memory. For example, agmatine (ip) has been reported to impair contextual fear conditioning and learning, but did not have any effect on water maze performance.8] Arten Arten8] Knowing the important role of CA1 region in hippocampal function, existence of agmatine in this area and the inconsistency of previous experiments regarding agmatine effect on hippocampal function, we aimed to target CA1 region to assess if agmatine can affect its function considering that intra-CA1 agmatine administration allows us to assess agmatine's direct effect on CA1 area with the least contribution of the other brain regions.Male Sprague-Dawely rats (200\u2013250 g at the time of surgery) were obtained from Laboratory Animal Center of Shiraz University of Medical Sciences. The animals were housed four per cage before surgery and two per cage after surgery in a constant temperature (24\u00b11\u00b0C) and humidity controlled room, under a 12-12h light/dark cycle. Food and water were provided ad libitum except for the periods of experimental studies in water maze. The behavioral experiments were done during the light phase. All experiments were carried out in accordance with recommendations from the Declaration of Helsinki and the internationally accepted principles for the use of experimental animals. Agmatine was purchased from Sigma  and was diluted in sterile isotonic saline.Animals were anesthetized with a combination of ketamine  and xylazine  and placed in a stereotaxic apparatus . Stainless steel guide cannulae (22-gauge) were bilaterally implanted in the CA1 region with the following coordinates according to the rat brain atlas of Paxinos and Watson: AP\u22123.84 Saline or drug were administered into CA1 region bilaterally, through guide cannula (22-gauge) using injection needles (27-gauge) connected by a piece of polyethylene tube to a 10 \u00b5l Hamilton syringe. The tip of the injection needle was protruded 0.5 mm beyond the guide cannula tip and in each microinjection 0.5 \u03bcl saline or drug was infused within 2 minutes. After completion of the infusion, the needle was left in place for another 60 seconds to allow diffusion of the drugs from the needle.The water maze has been described previously. Briefly Experiment 1: The aim of experiment 1 was to determine the effect of bilateral pre-training injection of agmatine into CA1 region on water maze place learning. The rats were divided into 7 groups (n=7); four groups received bilateral injections of agmatine into CA1 area, 20 minutes before training in doses 1, 10, 100 and 200 \u00b5g/0.5 \u00b5l, the sham group received saline as vehicle  and the control group received nothing. In order to assess our water maze sensitivity, a positive control group receiving scopolamine in dose 1 mg/kg/ip- which previous studies had showed its memory impairing effect, was considered in the experiment. The time interval of 20 minutes was selected according to previous reports.One week after surgery and 20 minutes after saline or drug administration, the rats were trained in the water maze. Animals received four session training during four daily sessions; each sesExperiment 2: The aim of experiment 2 was to determine the effect of bilateral post-training administration of agmatine into CA1 region on water maze memory consolidation. The rats were randomly divided into 7 groups (n=7); four groups received bilateral injections of agmatine into CA1 area, immediately after training in doses 1, 10, 100 and 200 \u00b5g/0.5 \u00b5l, the sham group received saline as vehicle  and the control group which received nothing. In order to assess our water maze sensitivity, a positive control group receiving scopolamine in dose 1 mg/kg/ip was put in the experiment.One week after surgery, the rats were trained in the water maze. The single training session consisted of eight trials with four different starting positions that were equally distributed around the perimeter of maze. The taskAt the completion of the memory test, animals were anesthetized with ether, decapitated and their brains were removed and stored in 10% formalin. After 2 days, the brain sections were prepared, mounted on slides, and cannulae placements were examined for verification of needle tip locations. Animals were included for data analysis only if both needle placements were located within the CA1 region.Data were expressed as the mean\u00b1SEM. An analysis of variance (ANOVA) followed by Student, Newman-Keuls multiple comparison tests was used for statistical comparison. In all cases, a p value of less than 0.05 was considered statistically significant.The effect of pre- or post-training infusion of saline or agmatine into CA1 area of the hippocampus on the swimming speed of animals (data were averaged to obtain a mean performance of the groups) is depicted in Our findings in the present study indicate that i) Pretraining intra-CA1 administration of 1, 10, 100 and 200 \u03bcg agmatine had no effect on water maze place learning, ii) Post-training intra-CA1 administration of agmatine in doses 1, 10, 100 and 200 \u03bcg could not affect water maze memory consolidation, iii) Intra- CA1 agmatine administration did not affect animal's swimming speed and iv) Intra- CA1 agmatine administration did not affect the escape latency to the visible platform in non-spatial visual discrimination task.Agmatine did not affect animal's swimming speed or its motivation toward visible platform, showing that it does not affect animal's sensorimotor coordinance. Pre- or post-training administration of scopolamine (1 mg/kg/ip) could impair water maze learning and memory, which confirms our water maze system sensitivity. Agmatine was administered 20 minutes before each training episode, the time interval which previous studies reported some impairing effects after its intraperitoneal injection. Pre-traiCompatible with our results, McKay et al. showed tThere are also some other experiments demonstrating the impairing effect of agmatine on learning and memory. For example it was shown that contextual fear conditioning and learning were impaired by agmatine (ip).8] Altho Altho8] Arteni et al. found thIn conclusion, our findings are the first report indicating that intra-CA1 agmatine administration in a broad range of doses has no effect on water maze learning and memory. It will be valuable in the future to know more about the effect of agmatine on the hippocampal function and mechanisms in physiologic and pathologic states as there are increasing evidences that agmatine is protective against some neurodegenerative disorders."}
+{"text": "Populus euphratica is a dominant tree in riparian ecosystems in arid areas of northwest China, but it fails to regenerate in these systems. This study evaluates causes for the failure of sexual and asexual regeneration of this species in the wild. P. euphratica disperses as many as 85743 seeds/m2 during summer, and the seeds germinate to 92.0% in distilled water and to 60.8% on silt. However, very few seeds (3.6%) can germinate on unflooded soil. The seed-rain season is prolonged by temporal variability in seed dispersal among individuals, which ensures that seedling emergence can occur during favorable conditions . As a result of water shortage and river channeling due to water usage and altered river flows, there are no safe sites on river banks for seed germination, which has led to the failure of P. euphratica to regenerate from seed. Root suckers of P. euphratica were present in 86% of the forest gaps investigated. However, extensive grazing has destroyed many of them and thus has reduced this form of regeneration. This research suggests that human activities are resulting in the failure of P. euphratica to regenerate. Changes in land management such as reduced use of concrete canals in Populus forests and/or reduced sheep grazing in these areas may promote their regeneration. Populus spp.) are severely affected by human disturbances to riparian ecosystems in many parts of the world Plant adaptation and reproductive strategies occur over a long evolutionary time, while present human disturbances alter the environment rapidly. Such maladjustment leads to severe endangerment and even local extinction of some species Populus euphratica is a dominant tree species of the riparian forests in arid areas of Central Asia P. euphratica forests have been in rapid decline due to water shortage and water pollution P. euphratica populations P. euphraticaP. euphratica forests P. euphratica has the ability to regenerate by both seed/seedlings and root suckers P. euphratica, attention should be paid to both seedling establishment and sucker establishment. In field investigations, we observed two distinct kinds of forest gaps in which P. euphratica produces root suckers. In some forest gaps with >50% canopy covering, there were very high densities of root suckers and mortality was very low, while in other gaps, there were many fewer root suckers, and mortality was high. We also found that adult individuals in a stand were usually of similar ages. The purpose of the present study was to (1) examine regeneration strategies of P. euphratica by seed/seedlings and root suckers, (2) test if P. euphratica has some problems in its reproduction and (3) to clarify any constraints found on its reproduction and define how they function. Thus, we investigated seed dispersal and germination of P. euphratica and its adaptations to flooding regimes. We also investigated establishment of root suckers in the field and the effect of sheep grazing on sucker establishment. On the basis of these experiments and investigations, we discussed the effects of human activities on regeneration of P. euphratica forests.P. euphratica disperses large numbers of seeds during seed rain seasons. The cumulative seed rain density (hereafter SRD) reached 44204\u00b13406  and 85743\u00b13617 seeds per m2 in 2006 and 2007, respectively  on filter paper, to 60.8\u00b13.5% on river silt, and to only 3.6\u00b10.4% on forest soil . Height of root suckers was positively associated with mean distance to nearest adult trees (p<0.05) and negatively associated with sheep grazing (p<0.01). In addition, there was a positive association between basal diameter of root suckers and number of adult P. euphratica individuals  showed that the 20 forest gaps clustered into two groups . Group Asprouted . Root suP. euphratica individuals in a stand were 0.3 to 3.7 yr , no seedlings survive if the change from wet to dry conditions lasts for more than one week P. euphratica that long durations of wet substrate help ensure seedling survival.Most P. euphratica fails to regenerate by seeds in the field, and root suckers are the main source of recruitment. Root suckers occur in most forest gaps. However, there is very low survivorship of root suckers, which leads to the failure of regeneration in many forest gaps. Although grazed root suckers may not initially die, sheep grazing has significant detrimental effects on their growth. Thus, sheep grazing delays the time taken for root suckers to develop into adult trees. The possibility of death for root suckers increases as the developing process increases in harsh environments.Currently, P. euphratica has much potential for both sexual and asexual reproduction. There are several possible actions that may help to preserve and restore P. euphratica. Concrete canals in P. euphratica forests may limit opportunities for seedling establishment along banks. Additional work is needed to determine the effect of removing concrete canals on P. euphratica establishment. Altered stream flows may also help to produce wet conditions favoring seed germination and establishment. Coordinated efforts with those in charge of regulating stream flow may help to encourage establishment if sufficient water is released during peak seed rain.In conclusion, Populus euphratica in Ejina County, Inner Mongolia, China. The Ejina National Natural Reserve of Populus euphratica issued the permission for all our field studies. Populus euphratica is a protected species in China. In field studies we tried our best not to damage seedlings or individuals. The soil was replaced after investigation of root suckers. When we investigated ages of individuals, the relation between age and diameter at breast height (DBH) was adopted rather than potentially harmful techniques such as stem cutting or increment coring.All necessary permits were obtained for the described field studies, which were carried out in the National Natural Reserve of P. euhpratica, in Ejina, Inner Mongolia Autonomous Region, China .The Heihe River, the second largest inland river in China, is the main contributor to the oasis, and groundwater in this region is mostly fed by the Heihe River P. euphratica forests in the National Natural Reserve of P. euphratica in Ejina in 2006. Density, height and diameter at breast height (hereafter DBH) of seed-dispersing P. euphratica trees were examined . There was an interval of 10 m between two adjacent bowls and between two adjacent transects. According to kind of microhabitat the seed traps were divided into three groups: on turf (n\u200a=\u200a11), on bare ground (n\u200a=\u200a7) and under shrub (n\u200a=\u200a8). Populus euphratica seeds in all seed traps were collected and counted daily during the seed-rain season (early July to late August). In addition, starting date and duration of seed dispersal of each female adult P. euphratica individual were recorded in all three sampling plots (50 m\u00d750 m) in 2008. Fruits of P. euphratica are capsules grouped in catkins. The capsules dehisce at maturity, and large amounts of cotton-containing seeds are released. Binoculars were used to observe seed dispersal of individuals. The earliest date open capsules were observed in any part(s) of the canopy was recorded as the starting date of seed dispersal of the individual. The date all capsules had opened and some of them had begun to fall was recorded as the ending date. Observations were carried out daily in all three plots for 59 d from 1 July to 28 August, 2008.Three plots were established in homogeneous examined . Seed raP. euphratica forest at Erdaoqiao in July 2008. The seeds were mixed after harvest and incubated in 5-cm-diameter Petri dishes at alternating temperatures of 30 (day) and 20\u00b0C (night) which simulates conditions in the P. euphratica forest in July, in cool white fluorescent light  for 12 h and in darkness for 12 h each day. Three kinds of substrates were used: filter paper, soil collected from the P. euphratica forest and silt on local river banks, each with five replications. Soil and silt were used to represent different habitats of nonflooded forests and flooded river banks, and filter paper was used to test potential germinability of P. euphratica seeds. Fifty seeds were spread evenly in each Petri dish after the substrate was moistened with distilled water, and then the dishes were wrapped with clear plastic film to slow evaporation. Germination (emergence of radicle) was monitored every 12h. When no additional seeds had germinated for 5d, experiments were terminated, and final germination percentages were determined.Freshly-matured seeds were obtained from different parts of canopies in 40 trees of different ages in the P. euphratica in the field. The first observation was aimed at gaining a general understanding of the establishment of root suckers of P. euphratica in the forests. Five line transects, each 5 km long, were established in the nature reserve of P. euphratica in 2008, and 10 forest gaps on each transect were investigated. In total, 50 forest gaps were surveyed. The number of living and dead root suckers of P. euphratica and the area of the forest gaps were recorded.Four separate observations were conducted to analyze asexual regeneration of P. euphratica root suckers. Growth characteristics of P. euphratica root suckers including density, height and basal diameter of root suckers were recorded in 60 forest gaps. In addition, environmental conditions were also investigated, including species composition and coverage of ground cover flora, human disturbance (sheep grazing or not), number of P. euphratica adults around the forest gaps, distance from these adult trees to root suckers, and moisture and compactness of soil. If there were sheep excreta and evidence of sheep browsing on root suckers in a forest gap, it was recorded as sheep grazed. Intensity of sheep grazing was divided into four levels: 0, no sheep excreta or browsing; 1, <20% of root suckers browsed; 2, 20%\u223c50% root suckers browsed; and 3, >50% root suckers browsed. About 30 g of soil were collected around roots of root suckers, and the oven drying method was used to determine moisture content. Five replications were made in forest gaps with more than five root suckers. Soil samples were collected around all the root suckers if there were less than five root suckers in a forest gap. Degree of compactness of soil was obtained by using a portable soil compaction tester .A second observation was conducted to determine factors influencing occurrence and growth of In the third observation, living and dead root suckers were counted in 20 forest gaps. Height and basal diameter of each living root sucker, depth and diameter of roots on which root suckers sprouted, and area of forest gaps were recorded. Density and mortality of root suckers were calculated as:Density \u200a=\u200aNumber of living root suckers/Area of a forest gapMortality (%) \u200a=\u200a (Number of dead suckers/Number of dead and living suckers) \u00d7100.P. euphratica on them where this species had successfully regenerated in recent decades were investigated; ages of 50 P. euphratica individuals were recorded on each site. Ages were calculated by employing the relationship between age and diameter at breast height (DBH). Xu P. euphratica aged 5 to 137 y. On the basis of his study, a regression equation was obtained:In the fourth observation, areas of 20 sites and density of a\u200a=\u200a 4.086+0.395 \u00d7 d+0.028 \u00d7 d2 , where a is age, and d is DBH.P. euphratica were excavated from 0\u201320 cm soil depth in the forest at Erdaoqiao, and each was cut into 5 sections 10 cm in length. Each root section was buried at a depth of 20 cm in a plastic pot (30 cm \u00d730 cm \u00d730 cm) filled with sandy soil collected from 0\u201320 cm soil depth in the habitat. Before use, the soil was mixed and dried at 105\u00b0C in an oven for 48h. Weights of pots (Wp), soil in each pot (Ws) and root sections (Wr) were measured before burial of root sections. Weight of water (Ww) was determined when the pots were first watered after burial of root sections. Soil moisture (SM) was calculated as:Due to rapid changes in environmental conditions in deserts, it is difficult to explore a relationship between occurrence of root suckers and environmental conditions in field investigations. An experiment was conducted in July 2010 to determine if there was any linkage between occurrence of root suckers and soil moisture. Five roots (d\u200a=\u200a0.9\u00b10.05 cm) of p+Ws+Wr+Ww). The root sections were retrieved after 20 d and washed in running water. Number of buds of root suckers was counted.Five levels of soil moisture were used: 0 (CK), 5, 10, 15 and 20%. The experiment consisted of a completely randomized block design of five treatments, each with five replications. Each of the five sections from a root was haphazardly selected for incubation under one of the five soil moisture levels in pots in a greenhouse for 20 d. The pots were weighed daily, and water was added to make weights of the pots the same as they were first watered  of root suckers and influencing factors  were analyzed using Bivariate Correlations procedure of SPSS. In the third observation, density, mortality, height and basal diameter of root suckers, depth and diameter of roots on which root suckers sprouted in the 20 forest gaps investigated were analyzed by using hierarchical cluster analysis (HCA). The cluster analysis was conducted using XLSTAT 2006 . The dendrogram was created using the Euclidean distance for dissimilarity scale for the Ward's method. The forest gaps were clustered into two groups by HCA, and differences in all the indices between the two groups of forest gaps described above were tested using Independent-Samples T Test procedure of SPSS. In the fourth observation, standard deviation (SD) and coefficient of variation (CV) were used to test variation in ages of individuals in a given site.All data were analyzed using SPSS 13.0 (SPSS Inc. 2004). One-way ANOVA was used to estimate differences in seed rain density in different microhabitats, germination percentage among seeds incubated on different substrates, and number of buds on roots present in soil at different moisture contents. Multiple Comparisons procedure of least significant difference (LSD) was conducted when significant differences were found. In the second observation, ground cover plants were mainly"}
+{"text": "Software tool, CDMS , clinical trials, eCRF, open source community edition.OpenClinica is an electronic Case Report Form (eCRF) tool designed to capture clinical trial data. The tool is web-based and thus can be accessed from most locations in the world to support multi-center studies. It is a \u2018do-it-yourself\u2019 tool: users can operate all the modules and functions that are described below and system administrators are not required to perform study specific actions .OpenClinica is an open source tool and has two editions: Community and Enterprise edition. The OpenClinica Community edition is freely available, while the Enterprise edition has additional capabilities, is commercially supported and is therefore subject to a license fee. The CTMM-TraIT  project aims to establish a long-lasting IT infrastructure for translational biomedical research in the Netherlands and hosts the OpenClinica Community edition. The CTMM-TraIT OpenClinica server is currently used for data capture in 120 clinical studies involving 600 users from 146 different centers.OpenClinica has a modular design with separate modules for study setup, data submission, data monitoring and data extraction. The study setup module allows building CRFs Figure , creatinOpenClinica Community Version: 3.4 (October 2014).A large international user community exists https://community.openclinica.com] and OpenClinica user documentation [https://docs.openclinica.com]["}
+{"text": "Diversity of clinical presentation of inborn errors of metabolism (IEM) gives a diagnostic challenge to the practicing physicians. In recent years there have been dramatic advances in the diagnosis and treatment of these fatal diseases, which shows improved prognosis of many of these conditions. The need for screening for IEM arises out of the fact that most cases take to irreversible effects as time progresses. Here, the main challenge is to recognize the early signs and symptoms that are also common to sick infants with other diseases. We describe a 32-day-old female infant who was finally diagnosed as a case of IEM (organic acidemia).The baby had a history of multiple neonatal intensive care unit admission. She died during her last hospital admission. The purpose of our case presentation is to provide clues to the true nature of the disease and to make physicians aware about the possibility of IEM.Mosleh T, Dey SK, Mannan MA. A Case of Organic Acidemia: Are Physicians Aware Enough? Euroasian J Hepato-Gastroenterol 2016;6(1):89-90. Probably, since it is considered rare, many physicians do not consider IEM until most frequent conditions have been ruled out. Here we report a rare case of organic acidemia with its clinical course.Inborn error of metabolism (IEM) is an inherited enzyme deficiency leading to the disruption of normal body metabolism that causes accumulation of a toxic substrate  or impaired formation of a product normally produced by the deficient enzyme.A 32-day-old female infant, 2nd issue of its nonconsan-guineous parents, was referred from a private hospital to the neonatal intensive care unit (NICU) of Bangabandhu Sheikh Mujib Medical University (BSMMU), Dhaka, Bangladesh, due to respiratory distress and less activity for 1 day. She also had feeding intolerance characterized by emesis 5 to 10 times a day, mostly following feeding since 11 days of age.The baby was delivered by a lower uterine cesarean section (LUCS). Her mother is 34 years old, G5 P2 Ab2 magnetic resonance imaging (MR1), blood group O+ ve, on regular antenatal check-up, had a history of diabetes mellitus, but no fever, rash, or any other chronic illness. In the last trimester she developed hypertension, for which LUCS was done at 36 weeks of pregnancy in a private hospital.3.She gave birth to a female child weighing 1750 gm who cried immediately after birth with APGAR score of 7 at 1 minute and 9 at 5 minutes. As the baby was preterm with low birth weight, she was transferred and admitted up to 9th postnatal day in the NICU of the same hospital. After discharge, she had no complaint for 2 days at home and was nursed without difficulty. At 11th postnatal age she developed vomiting containing milk, after almost every feed. The baby was again admitted to a private hospital. During the hospital stay of 14 days, she developed hypoglycemia, convulsion, and features of sepsis and was treated with IVF, IV antibiotics, IV phenobarbitone, IV fosphenytoin, and IV NaHCO2: 90% at room temperature; vitals: heart rate 134/minute, RR 58/minute, temperature 36.0\u00b0C, CRT < 3 seconds, CBG 3.2 mmol/L; anthropometry: OFC 30 cm, wt 1550 gm, length 35 cm. Her head, ears, eyes, nose, and oropharyngeal structures were without obvious abnormalities. Her lungs were clear, but notable intermittent grunting was present. Her heart was normal with no murmurs. Her abdomen was flat and soft, but liver palpitation of 2 cm was observed. Extremities were normal, with 1+ pulses. Genitalia had a normal female pattern. Her reflex activity was poor. Other findings were unremarkable.On arrival at the NICU of BSMMU on day 32, the baby was lethargic and emaciated. The following were noted: SPOEmpiric antibiotics were started considering sepsis in mind after sending sepsis workup. Her ABG showed severe metabolic acidosis with an increased anion gap of 18. Bicarbonate infusion was initiated to treat the acidosis.3, DC-neutrophil 15%, lympho 74%, platelet count 1 lac, CRP positive, blood C/S no growth.The CBC report showed the following: Hb 13.5 gm/dL, total WBC 5730/mmDuring her hospital stay we failed to continue feeding the baby due to repeated vomiting. On day 36 the baby again developed generalized seizure. Surgical causes were excluded. The baby most likely had a defect in metabolism. A metabolic defect workup was done. Serum ammonia and lactate level was elevated. Urine for ketone body was suggested, but parents refused to do the test. IMD (inborn metabolic disease) panel revealed acyl carnitines. Echocardiogram report showed dilated cardiomyopathy.Treatment was started with Biotin and Levocarnitine. She later developed bradycardia, sepsis with DIC-like features. Her condition was worsening despite all efforts, and required mechanical ventilation. As her condition was not improving, a decision was made by her parents not to do any further invasive procedure as her condition was believed to be terminal; she died at the age of 55 days.12 The frequency of occurrence of organic aciduria is 1 in 15,000 according to Seymour CA et al.5 The term \u201corganic acidemia\u201d or \u201corganic aciduria\u201d (OA) applies to a group of disorders characterized by the excretion of non-amino organic acids in the urine.6Inborn error of metabolism causes a group of hereditary metabolic diseases resulting from a lack of activity of 1 or more specific enzymes or defects in the transportation of proteins resulting in a block of metabolic pathway.7 After an initial period of well-being, affected children develop a life-threatening episode of metabolic acidosis characterized by an increased anion gap. This presenting episode may be mistaken for sepsis and, if unrecognized, is associated with significant mortality.1268 In our case as well we faced the same difficulties. The usual clinical presentation includes vomiting, poor feeding, neurologic symptoms such as seizures and abnormal tone, and lethargy progressing to coma.29 Appropriate laboratory testing for metabolic disorders should be performed in any infant who exhibits these findings.8Most organic acidemias become clinically apparent during the newborn period or early infancy.The exact diagnosis depends on specialized enzyme assays and/or the identification of molecular defect. These methods are not very widely available, especially in our country. Such tests are, however, suitable only when there is a strong and more specific suspicion of IEM diagnosis. In our context we mainly depend on the high index of suspicion.An IEM could be a diagnosis of inclusion rather than exclusion. It is frequently underestimated by the doctors in neonatal and intensive care units of national health clinics or in private clinic. An increase in the rate of identification of these disorders is directly related to clinical judgment and a lifesaving difference can be made by appropriate and timely care for the small number of babies with 1 of these disorders."}
+{"text": "Acute lung injury (ALI) is a progressive clinical disease with a high mortality rate, and characterized by an excessive uncontrolled inflammatory response. MicroRNAs (miRNAs) play a critical role in various human inflammatory diseases, and have been recognized as important regulators of inflammation. However, the regulatory mechanisms mediated by miRNAs involved in Lipopolysaccharide (LPS)-induced inflammation in ALI remain hazy. In this study, we found that miR-181a expression in the lung tissues of ALI mice and LPS-stimulated RAW 264.7 macrophages is dramatically reduced. We also show that over-expression of miR-181a significantly decreased the production of inflammatory cytokines, such as IL-1\u03b2, IL-6, and TNF-\u03b1, whereas inhibition of miR-181a reversed this decrease. Moreover, miR-181a inhibits NF-\u03baB activation and accumulation of reactive oxygen species (ROS) by targeting TLR4 expression. We further verify that miR-181a suppresses TLR4 expression by binding directly to the 3\u2032-UTR of TLR4. Therefore, we provide the first evidence for the negative regulation of miR-181a in LPS-induced inflammation via the suppression of ROS generation and TLR4-NF-\u03baB pathway. Acute lung injury (ALI) is an excessive uncontrolled inflammatory response in lung tissues caused by various clinical disorders, including pneumonia, major trauma, and sepsis . ALI is It is well established that inflammatory stimuli from microbial pathogens, such as endotoxin, are widely considered to be one of the causes of severe pneumonia . Lipopolin vivo and in vitro. Here, we found that LPS treatment highly decreased the expression of miR-181a in lung tissues and macrophages. We also showed that transfection with miR-181a mimics or inhibitors resulted in a down-regulation or up-regulation in pro-inflammatory cytokines, such as IL-1\u03b2, IL-6, and TNF-\u03b1. Further experiments demonstrated that miR-181a decreased TLR4 expression by binding directly to the 3\u2032-UTR of TLR4. This study revealed that miR-181a could be an important negative regulator of inflammation and shed new light on therapeutic approaches toward some inflammatory diseases including ALI.MicroRNAs (miRNAs) are a class of evolutionarily conserved, single strand and small non-coding RNA molecules, approximately 20\u201325 nucleotides (nts), which mainly regulate gene expression in a post-transcriptional level . Once inEscherichia coli 055:B5) was purchased from Sigma-Aldrich . Mouse TNF-\u03b1, IL-1\u03b2, and IL-6 enzyme-linked immunosorbent assay (ELISA) kits were purchased from ImmunoWay Biotechnology . The myeloperoxidase (MPO) determination kits were obtained from Nanjing Jiancheng Bioengineering Institute . Phospho-NF-\u03baB p65 (Ser536) (93H1) Rabbit mAb, NF-\u03baB p65 (D14E12) XP Rabbit mAb, Phospho-I\u03baB\u03b1 (Ser32) (14D4) Rabbit mAb, I\u03baB\u03b1 (L35A5) Mouse mAb, Phospho-IKK\u03b2 (Ser176/180) (16A6) Rabbit mAb, IKK\u03b2 (D30C6) Rabbit mAb and TLR4, \u03b2-actin were provided by Cell Signaling Technology . MyD88 (A0980) Rabbit pAb and TRAF6 (A0973) Rabbit pAb were purchased from ABclonal Biotechnology Co., Ltd. .Lipopolysaccharide . Mice were randomly divided into two groups (n = 12): control group and LPS group. The method for creating the LPS-induced ALI model was described previously (BALB/c mice (25\u201330 g) were purchased from Experimental Animal Center of Huazhong Agricultural University . All animals were maintained in animal rooms at 22\u00b0C in a 12-h light/dark cycle and received food and water eviously . BrieflyFor histological analysis, lung tissues were excised and fixed with 4% paraformaldehyde for 24 h. Sections (4 \u03bcm) of the lungs were embedded in paraffin, sliced, and then stained with hematoxylin and eosin (H&E).w/v, 1/9). The MPO activity was determined using an MPO determination kit according to the manufacturer\u2019s protocols.The severity of pulmonary oedema was measured by calculating the W/D ratio of lung tissues. The lungs were excised, rinsed briefly in PBS, and then weighed to obtain the \u201cwet\u201d weight. Subsequently, the lung tissues were dried at 80\u00b0C for 24 h to obtain the \u201cdry\u201d weight. The lung W/D ratio was measured by dividing the wet weight by the dry weight. To detect the MPO activity, tissue samples were homogenized with reaction buffer . RAW264.7 macrophages were cultured in DMEM  supplemented with 10% fetal bovine serum , streptomycin (50 \u03bcg/mL), and penicillin (50 U/mL) at 37\u00b0C in a 5% CO4 cells/well in 96-well plates for 1 h, and then the cells were treated with or without LPS for 0, 6, or 12 h. After treatment, 10 \u03bcL of CCK8 solution was added to each well and continued incubate for another 3 h. Finally, the optical density (OD) was measured at 450 nm on a microplate reader .The viability of macrophages after treatment with LPS (2 \u03bcg/mL) was assessed using a Cell Counting Kit-8 (CCK-8) assay kit purchased from Beyotime . In brief, macrophages were plated at a density of 4 \u00d7 105 cells/well in 6-well plates  for 12 h before transfection. The cells were transfected with miR-181a mimics, miR-181a inhibitors, siRNA or the negative controls using Lipofectamine 2000  according to the manufacturer\u2019s instructions. The mimics, inhibitors, siRNA and corresponding negative controls were all synthesized by GenePharma . These sequences are shown in Table 1. The transfection efficiency was evaluated by qPCR assay.Cultured cells were seeded at 5 \u00d7 1024 h after transfection with miR-181a mimics or inhibitors or the respective controls, the cells were then stimulated with 2 \u03bcg/mL LPS for 12 h. The levels of TNF-\u03b1, IL-1\u03b2, and IL-6 in the cell culture supernatants were measured with ELISA kits according to the manufacturer\u2019s protocols.-\u0394\u0394Ct method.Total RNA was isolated using the TRIzol reagent  in accordance with the manufacturer\u2019s instructions. The concentration and purity of isolated RNA were evaluated by OD values at 260 and 280 nm using Q5000 . The ratios of OD260 to OD280 for the samples were between 1.9 and 2.0. Typically, the ratio of OD260 to OD280 should range between 1.9 and 2.0 for good-quality RNA. Then all RNA samples were treated with RNase-free DNase to remove contaminating genomic DNA. For miRNA analysis, cDNA was synthesized by M-MLV reverse transcriptase with a special reverse transcription primer for miRNAs. PCR was performed using a miRNAs real-time PCR kit  according to the instructions of the manufacturer. The primers for miR-181a and U6 snRNA were purchased from GenePharma. For mRNA analysis, cDNA was synthesized using a PrimeScript RT reagent kit  according to the manufacturer\u2019s instructions. PCR was carried out using SYBR Green plus reagent kit  according to the instructions of the manufacturer. The sequences of the primers for PCR are as follows: TLR4, sense-TTCAGAGCCGTTGGTGTATC, antisense-CTCCCATTCCAGGTAGGTGT; IL-1\u03b2, sense-CCTGGGCTGTCCTGATGAGAG, antisense-TCCACGGGAAAGACACAGGTA; IL-6, sense-GGCGGATCGGATGTTGTGAT, antisense-GGACCCCAGACAATCGGTTG; TNF-\u03b1, sense-CTTCTCATTCCTGCTTGTG, anti-sense-ACTTGGTGGTTTGCTACG; GAPDH, sense-CAATGTGTCCGTCGTGGATCT; antisense-GTCCTCAGTGTAGCCCAAGATG. The relative expression levels of miR-181a and mRNAs were normalized to the endogenous references U6 snRNA and GAPDH following the 2Total protein was extracted with RIPA reagent  according to the manufacturer\u2019s recommended protocol. The total protein concentrations were determined using the Pierce BCA Protein Assay Kit . Protein samples (40 \u03bcg) were separated by 10% SDS\u2013polyacrylamide gel electrophoresis (SDS\u2013PAGE), transferred onto polyvinylidene difluoride (PVDF) membranes, and probed with primary antibodies against the indicated proteins (1:1000) overnight. Membranes were then washed and exposed to horseradish peroxidase-conjugated secondary antibodies (1:4000), and visualized using enhanced chemiluminescence.To study the effect of miR-181a on the LPS-induced activation of NF-\u03baB, a NF-\u03baB luciferase reporter gene assay was carried out as described previously . Briefly1 and miRanda2. To determine whether TLR4 is a direct target of miR-181a, we cloned 3\u2032-UTR of TLR4 into a psiCHECKTM-2 vector  to generate a wild- or mutant-type TLR4 3\u2032-UTR luciferase reporter vector. For the luciferase assay, HEK293T cells were co-transfected with the luciferase reporter vectors and miR-181a mimics or controls, respectively. After 24 h of transfection, the luciferase activities were measured.The possible sites of binding between TLR4 and miR-181a were predicted using TargetScanIntracellular ROS levels were detected using the fluorescent probe DCFH-DA . At the end of the treatment, cells were incubated with 10 \u03bcM DCFH-DA at 37\u00b0C for 30 min in the dark. The fluorescence intensity were then determined using an inverted fluorescence microscope  or a flow cytometry . For the fluorescence images, the integrated optical density (IOD) and area of cells were measured by Image-Pro Plus (IPP) 6.0 software , and the ROS fluorescence intensity was expressed as IOD/area. For the flow cytometry, the intracellular mean fluorescence intensity was analyzed for more than 10000 cells of each sample by FlowJo software .5 cells/mL) were seeded onto a 12-well plates. After the cells were treated as indicated, immunofluorescence staining was performed. Sections of tissues or cells were incubated with special primary antibodies (1:100) overnight at 4\u00b0C and then incubated with FITC-labeled secondary antibodies (1:200) in the dark for 1 h at 25\u00b0C. Nuclei were stained using DAPI for 10 min, and fluorescent images were captured with an inverted fluorescence microscope. The IOD and area of cells were measured by IPP 6.0 software, and the fluorescence intensity was expressed as IOD/area.Lung tissues were fixed in 4% paraformaldehyde for 24 h and then embedded in paraffin. Tissue samples were permeabilized with PBS containing 0.3% Triton X-100 and 10% BSA. RAW264.7 macrophages . Some miRNAs play a pivotal role in regulation of inflammation response triggered by LPS .We induced ALI in mice with LPS and then performed H&E staining. As shown in d by LPS . In ordeFigure 2A, miR-181a expression was significantly decreased upon LPS stimulation and the down-regulation of miR-181a expression was dose-dependent. Besides, we also tested miR-181a expression at different time points of LPS treatment. Results showed that LPS decreased miR-181a expression in a time-dependent manner and reached a nadir at 12 h . In addition, CCK-8 assay demonstrated that the cell viabilities were not affected by LPS at the concentration (2 \u03bcg/mL) used . These results further confirm that miR-181a is involved in LPS-mediated immune response.To investigate the effect of miR-181a in LPS-induced inflammation in ALI, the expression of miR-181a in LPS-stimulated RAW 264.7 macrophages was also detected. As displayed in Figures 3A,B). Subsequently, the cells were stimulated with 2 \u03bcg/mL LPS for another 12 h and the levels of inflammatory cytokines were detected by qPCR and ELISA. As shown in Figures F, over-expression or inhibition of miR-181a significantly decreased or increased the LPS-induced secretion of pro-inflammatory cytokines. These results indicate that miR-181a play an anti-inflammatory role in the LPS-induced inflammatory response.It is well-known that LPS could activate NF-\u03baB pathway and subsequently lead to the secretion of inflammatory cytokines such as IL-1\u03b2, IL-6, and TNF-\u03b1, which all promote the development of ALI . To unraFigures 4A,B, the phosphorylated p65 and I\u03baB\u03b1 proteins were significantly increased in the LPS group. In contrast, their levels were dramatically reduced while over-expression of miR-181a. We also studied the effect of miR-181a in NF-\u03baB activation by dual-luciferase assay, and the results showed that miR-181a inhibited NF-\u03baB activation . Similarly, immunofluorescence results confirmed that miR-181a mimics induced a decrease in the nuclear translocation of NF-\u03baB p65 after 12 h of LPS stimulation when compared to the control mimics . To find out the possible target of miR-181a, we next detected the expression of upstream molecules of NF-\u03baB pathway. Western blot results showed that LPS-induced TLR4, MyD88, TRAF6 and phosphorylated IKK\u03b1/\u03b2 levels were markedly inhibited. However, the TLR4 expression was also decreased by miR-181a mimics in the absence of LPS compared with the control mimics . These data suggests that miR-181a could suppress LPS-induced activation of NF-\u03baB pathway, likely through decreasing TLR4 expression.It has been generally accepted that the expression levels of inflammatory cytokines are regulated by multiple signaling pathways, such as NF-\u03baB pathway. NF-\u03baB, a crucial nuclear transcription factor, plays an important role in LPS-induced ALI . To furtFigures E, transfection with miR-181a mimics restrained the protein level of TLR4 but not the mRNA level, indicating that miR-181a may function at the translational level. In addition, bioinformatic softwares (TargetScan and miRanda) showed that there are two putative binding sites between miR-181a and the 3\u2032-UTR of TLR4 . To further confirm that miR-181a is able to directly bind to TLR4 mRNA, a luciferase reporter assay was performed. Briefly, the wild- or mutant-type TLR4 3\u2032-UTR luciferase reporter vectors were transfected into HEK293T cells, and then treated with miR-181a mimics or control mimics. We found that miR-181a mimics markedly decreased the luciferase activity for the wild-type 3-UTR of TLR4 but showed no inhibition effect for the mutated 3\u2032-UTR of TLR4 . These results imply that miR-181a inhibits TLR4 expression by directly binding the 3\u2032-UTR of TLR4 mRNA.We transfected macrophages with miR-181a mimics or negative controls and then examined the expression of TLR4. As displayed in Figures C). Moreover, the production of the pro-inflammatory cytokines including IL-1\u03b2, IL-6, and TNF-\u03b1 was also repressed . Knockdown of TLR4 also significantly inhibited the phosphorylation of NF-\u03baB p65 and I\u03baB\u03b1, consistent with the above results . Taken together, these findings strongly demonstrate miR-181a is implicated in the negative regulation of LPS-induced inflammation through inhibiting TLR4-NF-\u03baB pathway.TLR4 has been shown to play an essential role in LPS-mediated NF-\u03baB activation . To furtFigures D). These results reveal that miR-181a could also alleviate the inflammatory response mediated by inhibition of the ROS production .Reactive oxygen species were involved in LPS-mediated immune response, and contributes to the exacerbation of inflammation . We obseAcute lung injury is a type of severe inflammatory disease, which is hard to treat and poor prognosis . Althougin vivo ALI model as well as an in vitro inflammation model using RAW 264.7 macrophages to explore the possible role of miR-181a in inflammatory response induced by LPS.In the current study, we found that exposure to LPS led to severe pathological lesions, including alveolar damage and inflammatory cell infiltration. Subsequently, we demonstrated that miR-181a is down-regulated in the lung tissues of LPS-challenged mice, consistent with a previous study  through pattern recognition receptors (PRRs), and is the main contributor to inflammation caused by pathogenic microbial infection . TLR4 isIn order to explore the programmed feedback mechanism of miR-181a regulating inflammation, it is essential to study its target genes. TLR4 plays an essential role for the LPS triggered-NF-\u03baB activation . Knock-oIt is well-known that inflammation induced by endotoxin such as LPS was closely associated with ROS generation . ROS, whThe results of our study not only demonstrates that miR-181a targets TLR4 directly to regulate the activation of NF-\u03baB and subsequent secretion of inflammatory cytokines in response to LPS stimulation, but also reveal further that this miRNA represses the intracellular ROS accumulation. All these findings indicates, that miR-181a may be a negative regulator of LPS-stimulated inflammation via the suppression of ROS generation and TLR4-NF-\u03baB pathway.KJ and GZ conceived and designed the experiments. TZ and YY carried out the experiments. SG, HW, and AS analyzed the data. KJ and GD wrote the manuscript. All authors agreed to be responsible for the content of the work.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Tamiasciurus hudsonicus) population. Red squirrels are territorial, solitary, and live in a highly seasonal environment and therefore represent a very attractive system to study factors that drive the temporal and spatial dynamics of gut microbiota.Our understanding of gut microbiota has been limited primarily to findings from human and laboratory animals, but what shapes the gut microbiota in nature remains largely unknown. To fill this gap, we conducted a comprehensive study of gut microbiota of a well-studied North American red squirrel  contains supplementary material, which is available to authorized users. Mammalian guts harbor trillions of microbes, which play important roles in diverse aspects of host biology, including nutrition, immune system development, and behavior. Changes in gut microbial composition have been linked to host health and disease \u20134. PreviDiet is believed to be a key selective factor in shaping gut microbiota in wild animals. For example, large differences in gut microbial communities have been found among carnivorous, herbivorous, and omnivorous mammals , 14. WilHost genetics can also play a role in controlling gut microbial community structure. Accumulating evidence has linked specific host genetic loci to gut microbial variation in humans and mice \u201324. AlthWhile most studies focused on important deterministic factors, little attention has been paid to the role of stochastic processes such as dispersal on structuring gut microbiota. Two recent studies have shown that dispersal limitation could play an important role in shaping gut micriobial communities , 26. WitRecent studies in baboons and chimpanzees have suggested that microbes can disperse within the host population through host social interactions , 31, 32.Tamiasciurus hudsonicus). As part of the Kluane Red Squirrel Project, every red squirrel in the population has been continuously monitored in each year since 1987, and multiple environmental and host factors were recorded, including age, sex, territory membership, dietary composition, and genetic relatedness [To determine the relative contribution of seasonal dietary shift, host genetics, maternal effects, and dispersal limitation to the diversity of gut microbiota, we performed a large-scale study on a well-characterized population of wild North American red squirrels\u00a0 are listed in Table\u00a0By 16S rRNA gene sequencing, we analyzed the gut microbial communities of North American red squirrels using 905 fecal samples collected from 363 red squirrels. Of these, 622 samples were collected from 230 females and 283 samples were collected from 133 males. Samples varied in both time (collected from February to August between 2008 and 2010) and space  and were from hosts of both sexes, different ages, and relatedness. The metadata associated with individuals in the main study grid Kloo , Blautia , Oscillospira , Clostridium , Ruminococcus , Prevotella , Dorea , Anaerostipes , Bacteroides , and Faecalibacterium  , late spring , and summer  , including all highly discriminatory genera identified in the random forest analysis except unclassified Coriobacteriaceae. Many of the 15 genera were also core genera. Among them, Coprococcus and Oscillospira exhibited the largest periodic fluctuation in relative abundance (amplitude). As shown in Fig.\u00a0Oscillospira and Coprococcus, which peaked in late spring and summer, respectively.Using JTK_cycle , a non-pn\u2009=\u20091279 observations between 2008 and 2010; Additional\u00a0file\u00a0Picea glauca) cones and hypogeous fungi . In late spring, red squirrels also consumed a significant amount of fresh white spruce buds and needles. In summer, red squirrels began to consume seeds from newly available spruce cones produced in the current year [r\u2009=\u20090.44, P\u2009=\u20090.003). To further explore what specific components of the diet correlated with the changes in gut microbial community structure, we analyzed the association of food items with the seasonal rhythmic genera. The elevated level of Oscillospira correlated with increased intake of spruce buds in the late spring . In contrast, the relative abundance of Coprococcus was higher at times of year when new spruce cones were consumed (P\u2009=\u20090.0002), but was negatively associated with spruce buds . The percentage of false truffle mushroom consumption best predicted the levels of Clostridium in red squirrel gut microbiota  where lower levels of Clostridium were associated with greater false truffle consumption.The seasonal changes in gut microbiota occurred in parallel with the shift in red squirrel\u2019s dietary composition as measured by opportunistic feeding observations of individually marked squirrels . Within each year, species richness reached minima in the late spring and maxima in the summer  also displayed a distinct cyclical pattern (JTK_cycle: adjusted R2\u2009>\u20090.6). Despite the overall similarity in network structure  was the most dominant hub in the network. In late spring, it faded out of the network and an Oscillospira species (OTU 54301) became the most dominant hub. Nevertheless, there was still notable continuity in network structures. For example, early spring and late spring both had OTU 47644 (unclassified Ruminococcaceae) as a prominent hub. Late spring and summer had more hubs in common: OTU 67162 (Dorea), OTU 100783 (Clostridium), and OTU 32425 (unclassified Ruminococcaceae). Summer and early spring both had OTU 21475 as their most dominant hub. Interestingly but not surprisingly, most of the hub species belonged to the core genera.To investigate how species interactions and the structure of red squirrel gut microbial community changed over time, we reconstructed OTU co-occurrence network in each season. Analyses of OTU network revealed scale-free network structures in all three seasons . Food supplemented squirrels also had significantly lower alpha diversity (Chao1) than unsupplemented control squirrels .In three out of the six study grids, peanut butter was supplied from October to May in a large-scale food supplementation experiment . In our n\u2009=\u2009225) described above . To control for potential confounding effects of food supplementation and host relatedness . Only one sample from each red squirrel was included.To investigate whether red squirrel gut microbiota had any spatial structure, we carried out analyses on the same set of samples (erritory ), we onlP\u2009<\u20090.0001, Wilcoxon rank sum test).PERMANOVA analysis performed on grids within the same food group confirmed that grid was a significant predictor of microbiota beta diversity (data not shown). Consistently, between-grid distances were significantly higher than within-grid distances  and 0.2% increase between the grids (P\u2009<\u20090.001).Next, we investigated the effect of geographic distance on microbial diversity. Linear regression analysis revealed significant similarity-distance decays for both within and across grids Fig.\u00a0. Every 1r\u2009=\u20091) sampled at different times (average 19.8\u00a0days apart), 59 mother\u2013offspring pairs (r\u2009=\u20090.5), 35 father-offspring pairs (r\u2009=\u20090.5), 13 full sibling pairs (r\u2009=\u20090.5), 77 pairs of half-siblings  and 1293 pairs of unrelated individuals (r~0).Previous studies have shown that family members tend to have more similar gut microbiota than unrelated individuals and increased levels of host relatedness are associated with greater similarity in gut microbial communities , 27, 28.n\u2009=\u200921) collected over a time span ranging from 83\u00a0days to 828\u00a0days. Samples collected from the same individual at different time points were more similar to each other than to other individuals .We found evidence of individual gut microbiota signatures. We analyzed multiple samples  from the same squirrels   were not significantly different from unrelated pairs  Fig.\u00a0.We next performed PERMANOVA on Bray-Curtis beta diversity to assess the relative contribution of environmental factors (year and season) and host factors (sex and age). Our results revealed that overall the environmental factors explained ~\u200911 times more variation in gut microbial community structure than the host factors Table\u00a0. As expeApodemus sylvaticus), which are dominated by the genus Lactobacillus [Coprococcus (12.3%) and Oscillospira (6.2%), but very low levels of Lactobacillus (0.88%). Notably, red squirrels have remarkably low variation in gut bacterial phyla and shared a core set of genera across time , space (study grid), and host family  fed to cattle or in soil [The fact that  in soil . Our resBiogeographic patterns have been observed in human and wild mice populations , 29, 30.Island biogeography theory  can be uIn summary, we performed a comprehensive survey of gut microbiota of a well-studied wild red squirrel population. Red squirrels harbor a typical rodent gut microbiota with a stable set of core genera. However, these core genera exhibited a remarkably strong seasonal rhythm in their relative abundance mainly associated with seasonal dietary changes that was consistent across 3\u00a0years of study. We also found significant biogeographic pattern in gut microbial structure at a fine local scale (meters to kilometers) indicative of limited gut microbial dispersal. Despite the dominant effect of environmental factors, we found clear signatures of individuality and maternal effects in red squirrel gut microbial communities. However, host genetics does not seem to be a significant driver. Taken together, the results of this study emphasize the importance of external ecological factors rather than host attributes in driving temporal and spatial patterns of gut microbiota in natural environment.Study subjects were from a natural population of North American red squirrels in the southwest Yukon 61\u00b0N, 138\u00b0W) near Kluane National Park. Red squirrels in this area have been continuously monitored by the Kluane Red Squirrel Project since 1987 using a combination of live-trapping and behavioral observations. All squirrels were permanently marked with small metal ear tags and regularly monitored from March to September of each year. Several types of data including identity, sex, body mass, reproductive status, territory ownership, and dietary information were collected , 38. In \u00b0W near KStudy grids. The study area consists of six ~\u200940\u00a0ha grids that are 0.2~7.3\u00a0km apart from each other . Samples collected from the other four grids were used to study the biogeographic structure of microbiota between grids . On grids AG, LL, and JO, peanut butter was provided as a food supplement from October to May in each year to experimentally increase population density [ density . The thrPicea glauca) are the major food resource for red squirrels [The seeds of white spruce cones . Red squirrels mostly feed on the seeds of white spruce cones. White spruce trees produce fresh cones that are available to be consumed by red squirrels from July to September of each year. These fresh spruce cones are hoarded for subsequent consumption in a larder hoard at the center of the squirrel\u2019s territory (midden). Squirrels consume these cached cones from their midden throughout the winter and at least into the next spring. Squirrels also feed on mushrooms, spruce buds, false truffles, berries, and a variety of items depending on their seasonal availability [Chrysomyxa arctostaphyli, animal material, snow, and unidentifiable items)  containing cached white spruce cones for over winter survival . JuvenilThe average adult lifespan of wild red squirrels in this population is 3.5\u00a0years  . JuvenilRed squirrels are sexually monomorphic in adult body mass, and there is no sex-bias in natal dispersal . During For the fecal samples that we collected between 2008 and 2010, the multigenerational pedigree  for the Fecal samples collected from underneath live traps were placed into 1.5\u00a0mL vials individually using forceps. Fecal samples collected in the colder months (January\u2013April) were generally frozen upon collection. In the warmer months (May\u2013September), the vials were kept on ice and then transferred to a \u2212\u200920\u00a0\u00b0C freezer within 5\u00a0h of collection .We extracted DNA from fecal samples in a 96-well format using the ZR-96 Fecal DNA Kits  following the manufacturer\u2019s protocol. The V1\u2013V3 hypervariable regions of the 16S rRNA gene were amplified using two universal primers 27F (5\u2019-AGRGTTTGATCMTGGCTCAG-3\u2032) and 534R (5\u2019-TTACCGCGGCTGCTGGCAC-3\u2032). We added a unique 8\u00a0bp barcode to each primer to tag the samples and used a 50-uL reaction for each PCR amplification by QIAGEN Taq polymerase . PCR conditions consisted of 94\u00a0\u00b0C for 3\u00a0min, followed by 25\u00a0cycles of 94\u00a0\u00b0C for 30\u00a0s, 57\u00a0\u00b0C for 30\u00a0s, and 72\u00a0\u00b0C for 60\u00a0s, with a final extension of 5\u00a0min at 72\u00a0\u00b0C. 16S rRNA amplicons from different samples were pooled in equal molar ratios, then gel purified and sequenced on an Illumina MiSeq platform using the 300\u00a0bp paired-end (PE) protocol. All liquid transfer steps were performed on a Biomek NXp liquid handling station .We filtered sequence reads by base quality using TRIMMOMATIC 0.32 with settings of LEADING\u2009=\u20093, SLIDINGWINDOW\u2009=\u200910:20, and MINLEN\u2009=\u200950 . Paired-We measured alpha diversity by Chao1 index. To compare beta diversity among samples, we first excluded any OTUs with less than five sequence reads. We then constructed beta diversity matrices from OTU table using four distance metrics: Jaccard, Bray-Curtis, unweighted UniFrac and weighted UniFrac distance .R2, and the significance  of each factor was obtained by 999 permutation tests.To test the predictors of gut microbial composition, we first performed exploratory PCoA using all beta diversity matrices in QIIME. To assess the relative contribution of environmental and host factors to the variation of microbial community, we performed PERMANOVA on Bray-Curtis distance matrices of 549 samples in the KL grid using the \u201cadonis\u201d function of the vegan package implemented in R . FactorsWe used supervised random forest model implemented in QIIME (supervised_learning.py) to identify signature genera in each of the three seasons: early spring, late spring, and summer. Random forest model classified each fecal sample into one of three seasons using models built on the relative abundance of each genus. Model accuracy was calculated using the 10-fold cross validation error estimate, which was an approximation of how frequently a sample was misclassified. The discriminatory power of each genus was assessed by comparing the classification accuracy with and without including the genus in the model. Genera that led to more loss of classification accuracy were considered to be more discriminatory.To test whether bacterial genera identified above had seasonal rhythms, we used a non-parametric test JTK_CYCLE . JTK_CYCr was assessed with 999 permutations.To test possible associations between dietary items and rhythmic genera identified above, we constructed general linear models on each genus. We began with the full model including all dietary items as the explanatory variables and genus relative abundance as the response variable. Non-significant predictor variables were excluded stepwise from the saturated model using the \u2018step\u2019 command, and the best model with the lowest AIC score was selected. We checked model assumptions by examining the distribution of residuals and plotting fitted values against residuals. We also performed Mantel tests to evaluate the correlation between the distance matrices built based on dietary item variation and bacterial beta diversity distances. The significance of Mantel\u2019s r\u2009=\u20091, n\u2009=\u2009121), mother-offspring , father-offspring , full siblings , half siblings , and unrelated . Jaccard distances of each group were compared with non-parametric Kruskal-Wallis tests with post hoc comparisons and corrected using Benjamini-Hochberg false discovery rate (FDR). To control for temporal variation, we restricted all the above analyses to only comparing samples collected within the same year and season.To assess the effects of genetic relatedness, we calculated pairwise relatedness from the extensive pedigree data available for red squirrels in the KL grid  using thMicrobial network of significant co-occurrence and co-exclusion interactions was built using the CoNet 1.1.0 plugin  in Cytos"}
+{"text": "This short reply contests two assumptions made by the authors of Mayrhuber et al\u2019s. \u201cWith fever it\u2019s the real flu I would say.\u201d The first is that there is influenza can be reliably defined by a medical case definition. The second is that this small qualitative study can be generalisable. However, it does underline the important point that technical diagnostic terms may be used on different registers by a variety of actors in the medical setting. Elisabeth Anne-Sophie Mayrhuber and her colleagues have delved into the fascinating matter of influenza . Indeed,But their article takes for granted two important assumptions that it should not have. The first is that the lay person\u2019s version should be measured against the biomedical concepts. Our work on self-diagnosis of influenza revealed that people  whose reported symptoms aligned with the case definition of influenza were no more likely have had influenza than those who did not . And thiAnd, the authors should not forget that \u201cflu\u201d is rarely confirmed as influenza in general practice. It is explained as \u201cflu,\u201d and charted as \u201cinfluenza like illness,\u201d but the presence of the virus is not used to diagnose. The benign and self-limiting influenza infection may or may not conform to the symptom profiles that we attribute to it. Influenza infection is widely variable in its acuity and in its presentation , and notThe second assumption is that if lay people understand influenza better, we can improve vaccination coverage. Influenza and vaccination are different subjects and need to be differently explored. Concluding that by understanding a disease, a subject will necessarily want a vaccination is a leap of faith.Qualitative research provides a deeply textured understanding of the problems faced by groups and individuals, and is indeed, useful to understanding cultural practices and beliefs. However, the information revealed by three sets of 30 individuals in different countries cannot be generalised or used, as these authors claim, as a way of increasing uptake of vaccination. On the other hand, using the material gleaned from this qualitative study, the authors could certainly devise and implement further research to determine how generalisable these views may be to the broader populations they wish to enlist in vaccination campaigns.However, what this paper, and many like it underline, is that in any technical setting  lay people and technicians may use the same words, but in different registers , 7. Doct We thank Jutel A. for her interest in our work and the addition of interesting aspects and literature to our publication . We agreThe objective of our study was to gain a deeper understanding of individuals in Austria, Belgium and Croatia regarding their reasoning and concept in terms of common cold, influenza and its differences as well as possible cross-country differences. This is what we have elaborated and described throughout the publication.\u201c[\u2026] Influenza is mainly recognized as starting with onset of a sudden high fever, whereas a common cold more commonly begins with coryza or a sore throat \u201d However, besides this challenge it is important to gain a better understanding of laypersons\u2019 reasoning and concepts of diseases to be able to pick up the individuals from their own starting points to increase communication and health literacy.We are in line with the comment that influenza cannot be reliably defined by a medical case definition , 4, whice throat , 10. Altinvolved , 11, 12,inicians , 11, 13.Surely, it is not enough to raise the lay person knowledge regarding influenza to improve health literacy or preventive measures like vaccination. Therefore, we discussed in addition a variety of measures like awareness activities, involvement of GPs, rapid tests as well as the use of timely epidemiological data . AdditioWe welcome further research efforts to elaborate the topic further including a broader population."}
+{"text": "This study also aimed to investigate the modulation of the transient receptor potential vanilloid 1 (TRPV1) receptor activity by tesaglitazar which could provide a potential mechanism that underlie tesaglitazar antinociceptive effects. Von Frey filaments were used to determine the paw withdrawal threshold (PWT) in adult male Sprague Dawley rats (180-250g) following i.p. injection of streptozotocin (STZ) or cisplatin, which were used as models of neuropathic pain. Antinociceptive effects of tesaglitazar were determined 6 hours after drug administration. Cobalt influx assays in cultured dorsal root ganglia (DRG) neurons were used to study the effects of tesaglitazar preincubation on capsaicin-evoked cobalt influx. Both cisplatin and STZ produced a significant decrease in PWT. The higher dose of tesaglitazar (20\u03bcg/kg) significantly restored PWT in both neuropathic pain models (P<0.05). 10\u03bcM capsaicin produced a robust cobalt response in DRG neurons. Preincubation of DRG neurones with tesaglitazar 6 hours prior to stimulation with capsaicin significantly reduce capsaicin-evoked cobalt responses in a PPAR\u03b1 and PPAR\u03b3 dependent fashion (P<0.05). In conclusion, tesaglitazar produced significant analgesic effects in STZ and cisplatin-induced neuropathy, possibly by modulating TRPV1 receptor activity. This may be of potential benefit in clinical practice dealing with peripheral neuropathy.Neuropathic pain is a growing healthcare problem causing a global burden. Currently used analgesics such as opioids are associated with adverse effects; urging the need for safer alternatives. Here we aimed to investigate the potential analgesic effects of tesaglitazar; dual peroxisome proliferator-activated receptors  Peripheral neuropathic pain is a significant pharmaceutical and medical problem. It is usually an undertreated secondary symptom of many diseases including diabetes mellitus and an adverse effect of many chemotherapeutic agents such as cisplatin . PeripheAnimal models of peripheral neuropathic pain have been utilized in preclinical studies to characterize complex mechanisms that underlie and maintain the peripheral neuropathic pain. Of those currently used models are diabetes-induced peripheral neuropathy and chemotherapeutics (in particular Cisplatin)-induced peripheral neuropathy. Those two models could be used to investigate different mechanisms of peripheral neuropathy after an injury to develop novel drugs to alleviate or treat the peripheral neuropathy. Diabetic peripheral neuropathy has been suggested to be a putative consequence of chronic hyperglycemia, dyslipidemia, inflammation, and oxidative stress . Cisplat\u03b1, PPAR\u03b2/\u03b4 (most commonly identified as PPAR\u03b4), and PPAR\u03b3, which have various tissue expression distributions including pain neuroaxis and distinct physiological roles including inflammation [\u03b3 [\u03b1 [\u03b1 and PPAR\u03b3 agonists to alleviate peripheral neuropathic pain. However, a limited number of studies investigated the usefulness of PPAR\u03b1/PPAR\u03b3 dual agonists for ameliorating the peripheral neuropathic pain. In this context, PPAR\u03b1/PPAR\u03b3 receptors are attractive targets as they are expressed throughout the pain neuroaxis [\u03b1 and PPAR\u03b3 isoforms could improve the efficacy and provide a superior drug for peripheral neuropathic pain treatment. Tesaglitazar is a dual PPAR\u03b1/\u03b3 agonist [\u03b1 agonist [\u03b3 receptors in mediating PEA antinociceptive effect was also reported [Studies in the last decade suggest that activating the Peroxisome proliferator-activated receptors (PPARs) can alleviate peripheral neuropathic pain, perhaps by their anti-inflammatory effects . PPARs aammation . The comation [\u03b3  and the on [\u03b3 [\u03b1 . Severalon [\u03b3 [\u03b1 , 12. Thoeuroaxis . Targeti agonist , previou agonist , 16. Add agonist . However agonist . Modulat agonist \u201321. The reported . These sAdult male Sprague Dawley rats  were used for behavioral experiments. Rats were group housed in the Animal House Unit (The University of Jordan), and free accessibility of food and water was insured throughout all experiments. All procedures were done during the animals' light cycle. Experiments were carried out in accordance with the Animal (Scientific Procedures) Act 1986, International Association for the Study of Pain guidelines and the Scientific Research Committee at the University of Jordan.In order to induce diabetes, animals received intraperitoneal (i.p.) injections of STZ  or vehicle (0.1M citrate buffer pH 4.6) under general anesthesia with isoflurane inhalation. Body weight, blood glucose levels, and mechanical allodynia were measured before the injections and weekly after that. Diabetes was confirmed by assaying the glucose levels in blood obtained from the tail vein using Accu-Check Performa . Rats with glucose levels greater than 200 mg/dl 3 days after STZ injection were considered diabetic.Rats were treated with daily intraperitoneal (i.p.) injection of 2.3 mg/kg cisplatin (Sigma-Aldrich) or vehicle  for 5 days, followed by 5 days of rest, for two cycles. Total cumulative doses of 23 mg/kg cisplatin over a total of ten injections were used. Mechanical allodynia was measured before the injections and at the end of each treatment cycles at days 11 and 21.The von Frey filament test was used to measure sensitivity to a punctuate pressure stimulus. Rats were placed in a plastic cage with a wire mesh bottom which allowed full access to the paws. Behavioral accommodation was allowed for at least 25min until cage exploration, and major grooming activities ceased. Subsequently, von Frey filaments  were applied to the mid-plantar aspect of the left hind paw using the \u201cup-down\u201d method to determine the withdrawal threshold; the von Frey hair was presented perpendicular to the plantar surface and held for approximately 6-8sec , 24. Dat\u03bcg/kg, Tocris Bioscience, UK) or vehicle  was injected i.p. at week 4 after STZ injection, when mechanical allodynia was fully developed. The nociceptive test was performed at 6 hours after tesaglitazar administration. On the other hand, to evaluate the effects of tesaglitazar on the development of chemotherapy-induced neuropathic pain, tesaglitazar (20\u03bcg/kg) or vehicle  was injected i.p. at the end of the cisplatin treatment cycles. In all behavioral experiments, the observer was blinded to the treatments.To assess the effects of tesaglitazar on the development of STZ-induced changes in mechanical hind paw withdrawal thresholds. Tesaglitazar  were decapitated to extract all the DRGs . The neurons were incubated in Dulbecco's Modified Eagle Medium-F12 (DMEM-F12) containing 0.25% collagenase/30 min/37\u00b0C followed by 7 min incubation with 0.25% trypsin in DMEM-F12 media containing 1% HEPES buffer and penicillin/streptomycin (1:200). The neurons were triturated 50 times with normal Pasteur pipettes then 50 times with thin-flame polished pipettes. The neurons were then centrifuged at 400 g for 20 min followed by resuspension of the pellet in media containing 10% heat inactivated fetal bovine serum (FBS). After that, the neurons were triturated again with the thin-flame polished pipettes (50 times), filtered with a cell strainer, and cultured in 96 well-plates for 24 hr at 37\u00b0C, 5% CO2.\u03bcM or 10 \u03bcM) in 5 mM cobalt chloride for 2 min to choose the concentration of capsaicin for the subsequent experiments. In the control group, only cobalt chloride was added. The cells were then lysed with lysis buffer  without chelating agents. After that, 2-mercaptoethanol (5%) was added to each well, mixed and incubated for few minutes. The color complex was detected by spectrophotometer at 475 nm absorbance. Other wells received capsazepine (10 \u03bcM) for 4 minutes prior to 10 \u03bcM capsaicin (the chosen concentration in the experiment) to confirm that capsaicin-evoked cobalt influx is TRPV1 mediated. 2 \u03bcM tesaglitazar plus 10 \u03bcM GW 6471, a selective PPAR\u03b1 antagonist, or 2 \u03bcM tesaglitazar plus 10 \u03bcM GW 9662, a selective PPAR\u03b3 antagonist, was applied 6 hours before capsaicin (10 \u03bcM) application to assess the effects of tesaglitazar on capsaicin-evoked cobalt influx in DRGs and evaluate the role of PPAR\u03b1 and \u03b3 (respectively) in mediating theses effects.After 24 hours, the neurons were treated with different concentrations of capsaicin .Mechanical allodynia data are presented as means \u00b1 SEM of PWT in grams. Blood glucose levels are presented as means \u00b1 SEM in mg/dL units. Body weight data are presented as means \u00b1 SEM in grams. Two-way ANOVA analysis of variance used with time and treatment are the main factors. Significant ANOVA (p\u22640.05) was followed by Holm-Sidak post hoc test. Also, Student'sAfter STZ treatment, blood glucose levels were significantly elevated by the first week and remained elevated for the course of the study compared to vehicle-injected rats . As the \u03bcg/kg) was injected i.p. and antinociceptive properties of tesaglitazar were evaluated 6 hours after drug administration. The higher two doses of tesaglitazar (10 and 20\u03bcg/kg) significantly restored PWT . Tesaglitazar significantly reversed mechanical PWT 6 hours afterdrug administration . After the first treatment cycle, cisplatin-treated rats had no significant reduction in the PWT compared to vehicle-treated controls. However, after the second treatment cycle, cisplatin-treated rats had a significant reduction in the PWT compared to the vehicle-treated group  produced a significant effect (\u03bcM capsaicin is used for the subsequent experiments. Capsazepine (10 \u03bcM) significantly blocks capsaicin-evoked cobalt uptake in DRG neurons  significantly inhibits capsaicin-evoked cobalt influx in DRG neurons  to relieve pain in STZ-induced neuropathy.In agreement with previous studies, stable hyperglycemia was observed 3 days after STZ administration in rats. As expected, this diabetogenic action of STZ was accompanied by the development of hyperalgesia in response to mechanical stimulus. This study highlighted the ability of tesaglitazar  and late resolution/remission of allodynia (6-7 weeks). This latency may be attributed to many factors including, firstly, the chronic effect of STZ such as gradual accumulation of glucose and activation of microglia , secondlMechanisms underlying neuropathic pain are still poorly understood. Indeed, the supposed mechanisms depend on the type of model used to induce the neuropathic pain. There are many proposed mechanisms in STZ model that are likely to contribute to the development of neuropathic pain, increase in the activity of neurons, and the central sensitization , the ner\u03b1 and PPAR\u03b3 receptors. In contrary to previous reports [The higher two doses of tesaglitazar (10 and 20ug/kg) were needed to significantly relieve the STZ-induced mechanical allodynia in rats after 4 weeks of the induction. This effect of tesaglitazar probably involves the activation of both PPAR reports , 45, tes\u03b1) signaling pathways [\u03ba\u03b2 phosphorylation significantly through PI3/Akt signaling cascade in ovarian cancer cells [Since the high glucose level has been reported to contribute to the development of diabetic neuropathy, tesaglitazar-induced relief of diabetic neuropathy can be due to an action upon blood glucose level. However, our findings showed that tesaglitazar did not decrease blood glucose level 6 hours after drug administration. This finding is suggesting that tesaglitazar's antinociceptive effects are independent of the slower and longer-term cellular and molecular changes that are brought into play by reducing blood glucose levels. The exact molecular mechanism underlying such effects is still unknown and deserves further investigations. To further investigate this possibility, we evaluated the antinociceptive effects of tesaglitazar on a different model of neuropathic pain. In agreement with previous studies, we have expectedly shown that cisplatin treatment evokes significant tactile allodynia compared to the vehicle-treated controls, suggesting the development of apparent pain behavior. The higher dose tesaglitazar significantly attenuates the cisplatin-induced tactile allodynia. The mechanisms of cisplatin-induced neuropathy are not fully understood; however, studies demonstrate that it is related to axonal damage of peripheral nerves, causing dysfunctional effects in primary afferent fibers that lead to abnormal impulse transmission, nerve hyperexcitability, and pain , 47. Morpathways . Ohta eter cells .\u03b1 and PPAR\u03b3 dependent fashion as revealed by the cobalt influx assays could explain the antinociceptive of tesaglitazar observed in vivo. PPAR\u03b1 ligands such as fenofibrate reduced the expression of cyclooxygenase-2 gene and the production of prostaglandins [\u03b1 have been attributed to the inhibition of the proinflammatory signaling pathways mediated by the transcription-dependent nuclear factor \u03ba\u03b2 (NF-\u03ba\u03b2) and activated protein-1 (AP-1). This signaling pathway is essential to the development of neuropathic pain as described earlier. Furthermore, tesaglitazar can activate PPAR\u03b1 receptors which in turn inhibit the large and the intermediate conductance Kca channels  [\u03b3 and TRPV1 receptors mediated the antinociceptive effects of PEA in rat model of neuropathic pain [The ability of tesaglitazar to inhibit TRPV1 responses in DRG neurons in a PPARglandins , which ictively) . In agrehic pain .\u03b1/PPAR\u03b3 dual activation.This study suggests a new pharmaceutical application of tesaglitazar which exhibits a beneficial property on painful neuropathy characterized by mechanical allodynia and reasoned that tesaglitazar is a potential pharmaceutical agent for treating painful diabetic neuropathy. In the light of the current clinical need for neuropathic pain treatment, this study also provides novel evidence for additional therapeutic potential of PPAR"}
+{"text": "Severe intoxication with carbon monoxide (CO) is extremely lethal and causes numerous deaths due to cardiac or respiratory failure. Conventional intensive treatment may not be sufficient. The aim of this study was to investigate the treatment effect of extracorporeal veno-arterial extracorporeal membrane oxygenation (ECMO) following severe CO poisoning in an experimental porcine model.2 of 100% or ECMO). In the case of cardiac arrest, advanced resuscitation using standard guidelines was performed for at least 10\u2009min. ECMO was also initiated in the ventilation group if the return of spontaneous circulation did not occur within 10\u2009min. Lung tissue biopsies were obtained before and after CO intoxication.A total of twelve pigs were anaesthetized, routinely monitored and intoxicated by inhalation of CO until the beginning of cardiac failure and randomized to a treatment (ventilator using an FiOAll animals in the ECMO group survived; however, one had to be resuscitated due to cardiac arrest. A single animal survived in the ventilator group, but five animals suffered from cardiac arrest at an average of 11.8\u2009min after initiation of treatment. Conventional resuscitation failed in these animals, but four animals were successfully resuscitated after the establishment of ECMO.2 with increasing HbCO, but there was no increase in pulmonary vascular resistance. No differences in H&E-stained lung tissue biopsies were observed.A significant decrease was noticed in POThe use of ECMO following severe CO poisoning greatly improved survival compared with conventional resuscitation in an experimental porcine model. This study forms the basis for further research among patients. Carbon monoxide (CO) is extremely treacherous; invisible and without smell or taste, this lethal gas overtakes people without warning. Negligible CO concentrations occur in the atmosphere, but large amounts of CO form during the insufficient combustion of organic material, and a primary risk of exposure is the inhalation of smoke from fires . Other sApproximately 50,000 annual contacts with emergency departments in the US are due to CO poisoning, resulting in approximately 2700 deaths , 7. Surv2 instead of HbCO, and to increase the oxygen content in the blood [The rationale behind all currently established treatments for CO poisoning is to elevate the partial pressure of oxygen in the blood, favouring the formation of HbOhe blood , 12. In he blood . HBO canhe blood .CO poisoning may have a profound effect on both respiratory and cardiac function, but although HBO increases blood oxygen tension and decreases HbCO half-life, the benefits of HBO remain highly debated \u201317. ConvThis study was carried out in accordance with Danish and European legislation regarding the use of animals for research purposes. The experiments were approved by the Danish Animal Experiments Inspectorate (J.nr. 2016-15-0201-01064). At all times, a veterinarian was present, and all participants had training in laboratory animal science prior to experimentation.2 levels (14\u201317/min) and reduced whenever ECMO was running. FIO2 was set at the lowest level possible while still achieving blood PO2 levels within a normal range. To avoid atelectasis, positive end-expiratory pressure (PEEP) was fixed at five cm H2O and recruitment was performed regularly by increasing PEEP to 10\u201315\u2009cm H2O. A small venous catheter was placed in one ear vein to facilitate the infusion of fentanyl and propofol as primary anaesthesia during the remainder of the experiment. Throughout the experiment, fluid was administered according to existing guidelines for porcine anaesthesia [All experiments were carried out at the Biomedical Research Laboratory at Aalborg University Hospital, Denmark. The research animals were 12 female pigs (Danish Landrace) with an average weight of 48\u2009kg (range 45\u201351\u2009kg) and approximately 90\u2009days old. The animals were housed in nearby boxes at the laboratory for acclimatization up to 7\u2009days prior to the experiment. During this period, the animals had access to food/water and were attended to by laboratory staff several times each day. Premedication with Zoletil, an anaesthetic combination drug containing equal concentrations of Tiletamine and Zolazepam, was used. Anaesthesia, which was similar in both study groups, was maintained with continuous intravenous infusion of fentanyl and propofol based on weight, with minor adjustments to ensure that anaesthesia was sufficient. The animals were intubated using a 6.5-mm cuffed endotracheal tube and connected to a ventilator . Tidal volume was calculated using 8\u2009mL/kg and the respiratory rate (RR) was adjusted according to blood COesthesia , 20. A bAfter a full sternotomy, arterial catheters were inserted into the pulmonary artery and the left atrium to measure pressure differences over the pulmonary vascular system. The catheters were also used for drawing blood for analysis. Using an articulating dissection instrument -modified for multiple use as a guide, a division of the fibrous tissue connecting the aorta and the pulmonary artery was made, allowing for the placement of a sonography probe  around the main pulmonary artery. The probe was connected to a flow monitor , enabling real-time measurements of the cardiac output.The flow through the main pulmonary artery was used as cardiac output and for calculating the pulmonary vascular resistance (PVR). PVR was calculated using the following formula: PVR\u2009=\u2009)/Pulmonary Blood Flow. The right femoral artery and vein were exposed after surgical incision, and after heparin injection , a 15 French cannula  was inserted into the artery for infusion of blood from the extracorporeal system. Drainage to the system was achieved using a 21 French cannula  inserted over a guide wire into the right jugular vein.For extracorporeal circulation, we used a prototype centrifugal pump to drive the extracorporeal circulation through an oxygenator . Oxygen flow to the oxygenator was set at a constant level of 2\u2009L/min with 100% oxygen. Extracorporeal blood flow was measured using an ultrasonic flowmeter . The pump was initially set to 3000 rounds per minute (RPM), resulting in a mean flow of 2.4\u2009L/min. By using two additional Y-connectors, a shunt in the external circulation was created, allowing us to initiate/stop external circulation quickly without tampering with pump settings.CO was delivered from a pressure cylinder with an attached pressure reduction valve. Through \u201cair\u201d tubes, CO gas was connected to 1) a CO monitor  and 2) the research animal via the ventilator, forming a closed system to avoid leakage of CO into the operating theatre. When administering CO, the valve was opened briefly with intervals to avoid overdosing and to keep the inhalation concentration at a level of approximately 1\u20132%. CO administration was stopped permanently at the time of randomization. Conventional arterial blood gas analyses were made regularly using a blood gas analyser , allowing us to track changes and to keep track of HbCO during the experiment. Constant CO monitoring with an alarm was used to secure the safety of laboratory personnel in the room.Animals were randomly assigned to the study groups following simple randomization procedures (computerized random numbers) by a third party. Allocation concealment was kept blinded for the study personnel who were going to implement assignments at the time that cardiac failure was evident (defined as cardiac output decreased to 50%), which was taken as a surrogate measure of severe CO intoxication. At this point, a sequential numbered, sealed, opaque envelope was opened. Blinding to the allocated arm was not possible due to the nature of the experiment. The primary outcome in the model was survival. The histological effect on lung tissue and changes in PVR were used as secondary outcomes.Cardiac arrest, defined as systolic blood pressure below 25\u2009mmHg, was treated using advanced resuscitation according to the 2015 guidelines of the European Resuscitation Council , 22. How3 were taken from the lungs close to the pleura at different sites prior to CO poisoning. Similar samples were taken after intoxication at the time of randomization. These samples were preserved using formalin and analysed microscopically at the Department of Forensic Medicine, Aarhus University, after slicing and staining with haematoxylin and eosin (H&E).Tissue samples of approximately eight cmWe used the \u201cresource equation\u201d method for sample size calculation in the present study, as it was not possible to assume anything about the effect size or to determine standard deviations from previous studies . Accordi2 at baseline and mean pO2 at the point of randomization. A simple linear regression was constructed to predict pO2 based on HbCO. Similarly, we constructed a linear regression to predict pulmonary vascular resistance (PVR) based on HbCO and PVR based on pO2. An exponential regression was performed to describe the correlation between lactate and HbCO.For statistical analysis, we used the open source freeware program R, version 3.4.3/R-studio and IBM SPSS, version 25. Group comparisons at baseline and at the point of randomization were made using an unpaired t-test. Tests for normality were performed by visual inspection of qq-plots of all variables and Levene\u2019s test for equality of variances. A paired-samples t-test was conducted to compare mean pOp\u00a0=\u20090.97.There were no significant differences between the study groups at baseline Table  and at tp\u00a0=\u20090.96. The mean time for HbCO to fall below 0.1 after intoxication was 123.7\u2009min (SD\u2009=\u200920.0) for the ECMO group and 163.7\u2009min (SD\u2009=\u200915.2) for the ventilator group, p\u00a0=\u20090.56.All animals survived in the ECMO group for at least 10\u2009min after weaning from ECMO once HbCO was below 10%, although one had to be resuscitated due to a cardiac arrest that occurred immediately after the initiation of external circulation (ROSC after 17\u2009min). The mean time from the identification of heart failure to the initiation of ECMO treatment was 4.3\u2009min. Only one animal survived in the ventilator group, and five suffered from cardiac arrest at an average of 11.8\u2009min after the initiation of treatment. It was not possible to resuscitate any of these animals by conventional means within 10\u2009min of cardiac arrest. However, after initial resuscitation attempts were abandoned, we established ECMO treatment and successfully managed to resuscitate four of these animals  . The predicted pO2 was equal to 109.2\u2009mmHg minus 10.4\u2009mmHg for every 0.1% increase in HbCO  at baseline vs. mean 26.3\u2009mmHg (95% CI: 20.3\u201326.3) at randomization, p\u00a0<\u20090.001. We did not find a significant linear regression equation, p\u00a0=\u20090.54 (R2\u00a0=\u20090.008) when exploring the association between PVR and HbCO  compared to the baseline mean PVR of 319\u2009dyn\u00b7s/cm5 (95% CI: 261\u2013378)   versus the highest pO2 on a ventilator at 99.8\u2009mmHg (95% CI: 0\u2013283.5)  at the time of randomization to a mean of 209.3\u2009mmHg (95% CI: 102.8\u2013315.0), p\u00a0=\u20090.003.Lactate concentrations in the blood increased exponentially as HbCO increased, <\u20090.001 R of 0.562There were no microscopic differences in H&E-stained lung tissue biopsies obtained prior to CO intoxication versus after Fig. . No intrIn this study, we showed that ECMO treatment in severe cases of CO poisoning greatly improved survival compared with conventional resuscitation in an experimental porcine model. Thus, ECMO may serve as a treatment option in addition to conventional treatment following severe CO poisoning. The use of HBO is only possible in a limited number of hospitals within each country, and treatment can only be offered to a fraction of the population without the need for interhospital transportation. In contrast, ECMO treatment is available in mobile systems and can be transferred to the patients . In DenmThe increased probability of survival, even following cardiac arrest and resuscitation, underlines ECMO treatment\u2019s ability to stabilize respiratory and cardiac function while proper restitution occurs. For practical reasons, we weaned the animals from ECMO as soon as HbCO was below 0.1%. In real clinical settings, more time would probably be advisable to allow for more complete restitution. We chose 10\u2009min post-weaning as marker for survival because in our experience, subsequent circulatory failure would probably reoccur during this timeframe.A large proportion of CO-poisoned patients may suffer from lung injuries from other components in smoke  and thermal injuries from the inhalation of hot gases. In these cases, the benefits of ECMO would potentially be even greater, as current treatment with a ventilator and/or HBO rely on the lung diffusion capacity to ensure sufficient oxygen tension in the blood.In a study of 18 patients who suffered from cardiac arrest due to CO poisoning, none of the patients who were subjected to HBO treatment after resuscitation survived hospitalization . The autThe benefits of ECMO may be explained by the release of strain on the heart, lowering oxygen consumption and allowing sufficient restitution following ischaemia. Another favourable effect of using ECMO is its non-dependence on the condition of the lungs and airways. ECMO has the potential to increase blood oxygen tension, diminishing ischaemia and favouring increased formation of oxyhaemoglobin and elimination of CO.Prior to the experiments, we expected that PVR would increase during CO poisoning, contributing to cardiac insufficiency through a backward failure mechanism. However, this was not the case as the trend was towards a lower PVR during CO poisoning. It is possible that this can be explained by hypoxia induction of the relaxation of smooth muscle cells in resistance vessels in the pulmonary system, but separate experiments must be undertaken to clarify this. To the best of our knowledge, no previous studies regarding changes in PVR due to CO poisoning have been published.2. Our initial presumption was that this might be due to a negative impact on the lung tissue, especially the diffusion barrier, making O2 absorption progressively harder. This was not supported by the histological findings on the lung biopsies obtained prior to CO poisoning and compared individually with biopsies obtained after CO poisoning; no consistent differences were detected. The answer may be found on a molecular level, undetectable by the analysis of this experiment. Another hypothesis may be that CO causes shunting in the lungs, which is supported by our finding of decreased PVR.We found a negative linear correlation between HbCO and O3 instead of O2 as oxygen supply to the oxygenator in the external circulation to decrease HbCO\u2019s half-life [Promising experiments have been made using light to decrease HbCO\u2019s half-life, and it would be simple to expose the oxygenator in the ECMO system to a strong source of light . Other ealf-life . Some paalf-life . A speciA limitation of this study is that all animals were sacrificed at the end of the experiment due to ethical reasons. Thus, we had no ability to evaluate any neurological outcomes. Additionally, long-term mortality and morbidity could not be evaluated. In two case reports regarding successful ECMO support of patients suffering from severe CO poisoning with insufficient response to traditional ventilator therapy, no neurological deficits were detected during follow-up , 30. ThePrecautions must be taken when inferring results from animal studies to human clinical settings; nevertheless, since this study involved large animals, we speculate that similar results may be obtained when humans are treated. Furthermore, the benefits of using ECMO must be weighed against the risk of potential complications.The use of VA-ECMO following severe cases of CO poisoning with cardiogenic shock greatly improved short-term survival compared with conventional resuscitation in an experimental porcine model. This study forms the basis for further research among patients."}
+{"text": "Alcohol withdrawal syndrome (AWS) is commonly treated in medical ICUs and typically requires high resource utilization. Dexmedetomidine for AWS has not been extensively investigated, and guidelines regarding its use are lacking. We evaluated the association between dexmedetomidine use in AWS and ICU length of stay (LOS).We performed a multi-institutional retrospective cohort study of patients in the ICU with the primary diagnosis of AWS. ICU LOS of those treated with benzodiazepines alone vs. benzodiazepines plus dexmedetomidine was compared. Negative binomial regression was performed to test whether dexmedetomidine use was associated with increased ICU LOS after adjustment for age, gender, body mass index, and the time between hospital and ICU admission.p\u2009<\u20090.0001). After covariate adjustment, dexmedetomidine remained associated with longer ICU LOS .Four hundred thirty-eight patients from eight institutions were included. Patients treated with benzodiazepines plus dexmedetomidine had higher Clinical Institute Withdrawal Assessment for Alcohol scores at ICU admission, spent longer on the medical wards prior to ICU admission, and had longer unadjusted ICU LOS (Compared to benzodiazepines alone, dexmedetomidine for the treatment of AWS was associated with increased ICU LOS. These results provide evidence that dexmedetomidine may increase resource utilization. Alcohol withdrawal syndrome (AWS) accounts for 9% of intensive care unit (ICU) admissions in the USA and 13% of overall ICU costs  (Table\u00a0p\u2009<\u20090.0001]. The DEXBZD group had a longer pre-ICU LOS [mean (SD) 23.4 (32.4) h] than the BZD group . ICU discharge CIWA did not differ significantly between the two groups. The mean APACHE IVa scores between the DEXBZD [40.2 (13.0)] and BZD [39.7 (15.2)] were not significantly different (p\u2009=\u20090.7) overall as well as within the CIWA severity strata (p\u2009=\u20090.5)  while the lowest utilizer administered dexmedetomidine in 14% of cases. No patients included in the analysis received phenobarbital or clonidine for the treatment of their alcohol withdrawal. Additionally, no patients were discharged from the ICU while receiving a dexmedetomidine or benzodiazepine infusion.There was institutional variability in the adjunctive utilization of dexmedetomidine among the eight different hospitals with the highest utilizer administering dexmedetomidine in 57% of cases (p\u2009<\u20090.0001] (Table\u00a0p\u2009<\u20090.0001)  Table\u00a0, correspIn the adjusted analyses stratified by admission CIWA , the ICU LOS remained higher in the DEXBZD group within each stratum Table\u00a0.Table 3Our study found that in a cohort of patients admitted to the medical ICU with alcohol withdrawal, initial treatment with dexmedetomidine in addition to benzodiazepines was associated with more than a twofold increase in ICU length of stay compared to benzodiazepine use alone.The justification for dexmedetomidine use is based on its effect on alpha-2 receptors which reduces the hyper-adrenergic state in AWS thus suppressing tachycardia and anxiety while promoting arousable sedation , 7. In cThe finding of significantly longer length of stay for those treated with dexmedetomidine in our study corresponds to prior literature which showed that combination therapy with benzodiazepine and dexmedetomidine lengthened ICU LOS from 2.9\u2009days compared to 1.4\u2009days for benzodiazepine use alone . This stOur study can be distinguished from previous reports through the larger number of patients included, the stratification of subjects according to admission CIWA, and the inclusion of subjects who were only treated initially with dexmedetomidine  as opposed to categorizing patients in the dexmedetomidine group if there had been any exposure during an ICU stay. We did not focus upon or report the total doses of dexmedetomidine and/or benzodiazepines provided during ICU admissions which is potentially a limitation of the study. While medication doses may serve as a surrogate for alcohol withdrawal severity and outcome, we instead considered ICU admission and discharge CIWA scores and ICU length of stay to be more clinically meaningful measures of withdrawal outcomes. Integrating medication doses with additional clinical metrics is an important consideration for future studies.Dexmedetomidine is typically considered an adjunctive therapy for the management of AWS used when primary medications are thought to be insufficient for symptom control. With an increase in the familiarity of dexmedetomidine in this clinical setting, its use appears to have risen. Multiple studies of patients with severe AWS who receive early, aggressive, intermittent, symptom-triggered doses of benzodiazepines have shown that an escalation of symptoms can be avoided when AWS is managed early and effectively , 11. IncWe speculate that there are at least two explanations to account for the association between dexmedetomidine use in AWS and prolonged ICU lengths of stay. Dexmedetomidine potentially suppresses AWS signs and symptoms without treating the underlying withdrawal physiology as it has no GABA modulation effects. This may alter the kinetics of withdrawal in a manner that potentially prolongs its duration. Additionally, as noted above, the infusion of dexmedetomidine requires ICU level of care because of its potential to cause cardiovascular complications. Those patients who received prolonged infusions of dexmedetomidine may have remained in the ICU simply because of the monitoring requirements of the medication.The study findings must be viewed within the context of the study design. This is a retrospective cohort study, and thus, there is potential for unmeasured confounding and residual confounding within the adjusted variables. We accounted for confounding within our model by including only patients that were started on dexmedetomidine no later than 1\u2009h following admission to the ICU and by stratifying patients by their CIWA scores. This was to attempt to control for treatment bias in patients in whom benzodiazepine therapy was deemed inadequate to control symptoms and also to group patients according to the stage or severity of their alcohol withdrawal process . FurtherThe use of dexmedetomidine for the initial treatment of AWS in the ICU is associated with increased ICU LOS compared to the use of benzodiazepines alone. These findings were consistent across all strata of alcohol withdrawal severity. These results provide evidence that dexmedetomidine use is associated with increased resource utilization, and further studies are warranted to determine how best to incorporate dexmedetomidine into AWS treatment protocols."}
+{"text": "He), observed heterozygosity (Ho), and admixture. Signatures of selection were studied using extended haplotype homozygosity (EHH) (iHS and Rsb) and inter-population Wright\u2019s Fst. The results of PCA and admixture analysis, including European taurine, Asian indicine, African indicine, and taurine indicate that the two breeds are crossbreed zebu \u00d7 taurine, with more zebu background in Jenoubi cattle compared with Rustaqi. The Rustaqi has the greatest mean heterozygosity (He = 0.37) among all breeds. iHS and Rsb signatures of selection analyses identify 68 candidate genes under positive selection in the two Iraqi breeds, while Fst analysis identifies 220 candidate genes including genes related to the innate and acquired immunity responses, different environmental selection pressures , and genes of commercial interest .The Near East cattle are adapted to different agro-ecological zones including desert areas, mountains habitats, and humid regions along the Tigris and Euphrates rivers system. The region was one of the earliest and most significant areas of cattle husbandry. Currently, four main breeds of Iraqi cattle are recognized. Among these, the Jenoubi is found in the southern more humid part of Iraq, while the Rustaqi is found in the middle and drier region of the country. Despite their importance, Iraqi cattle have up to now been poorly characterized at the genome level. Here, we report at a genome-wide level the diversity and signature of positive selection in these two breeds. Thirty-five unrelated Jenoubi cattle, sampled in the Maysan and Basra regions, and 60 Rustaqi cattle, from around Baghdad and Babylon, were genotyped using the Illumina Bovine HD BeadChip (700K). Genetic population structure and diversity level were studied using principal component analysis (PCA), expected heterozygosity ( Bos taurus (humpless taurine) and Bos indicus (humped zebu), dispersed across the world, with taurine cattle reaching Africa, Europe, and East Asia and indicine cattle migrating to Africa, South Asia, and South-East Asia  e.g.,  or full Today, four cattle breeds are officially recognized in Iraq  Supplem with cro\u00ae) from two indigenous Iraqi breeds, Rustaqi and Jenoubi (n = 9) (560 km South of Baghdad) and in Maysan (n = 26) (400 km South of Baghdad). The middle region of Iraq (Baghdad and Babylon) is characterized by a hot and arid climate, while the climate in the southern part of Iraq (Basra and Maysan regions) close to the marshes is hot and more humid . Samples were shipped to a private company  for genotyping using the Illumina Bovine HD Genotyping BeadChip (700K) (http://www.illumina.com). The geographic location and global positioning system (GPS) coordinates of the Iraqi cattle samples can be found at Supplementary Table S2A, B. Aerial distances in kilometers between sampling sites were calculated using the geographic information system (GIS) ArcGIS\u00ae software Esri (www.esri.com).We collected blood samples spotted on FTA paper  were genotyped with the Illumina Bovine HD Genotyping BeadChip (http://www.illumina.com) including 777,962 SNPs mapped to the UMD 3.1; please see section of Data Accessibility for more details . High-density SNP data for references cattle breeds, Holstein-Friesian , Jersey , Nellore , Gir , Sahiwal , EASZ , Sheko , Ankole , Adamawa Gudali , Muturu , Red Bororo , and N\u2019Dama Guinea  were obtained from Ninety-five samples of Iraqi breeds  and PLINK 1.9  and observed heterozygosity (Ho) were computed using PLINK 1.9 (Bos taurus) and Nellore (Bos indicus)  . Furtherver loci .https://github.com/shaze/genesis).The PLINK 1.9 software was used for principal component analysis (PCA) . The authttp://www.bioinf.wits.ac.za/software/genesis/).In order to estimate the ancestry and the genetic structure of the Iraqi cattle population, we used Admixture version 1.3.0  using thTo construct haplotype files for signature selection analysis, haplotype data of Iraqi breeds (Rustaqi and Jenoubi) and other cattle references were reconstructed by phasing the genotyped SNPs using the SHAPEIT software (v2.8 37) .iHS test was applied to Rustaqi and Jenoubi. Rsb test was conducted between i) Jenoubi and Rustaqi and ii) between each Iraqi cattle (Jenoubi and Rustaqi) with three reference breeds . The standardized Rsb and iHS values were normally distributed, so a Z-test was applied to identify statistically significant SNPs under selection. One-sided upper-tail P-values were derived as 1 \u2212 \u03a6 (Rsb) from the Gaussian cumulative density function \u03a6. For Iraqi breeds, we set a threshold of \u2212log10P-value = 4 and \u22124 for the iHS test and a threshold of \u2212log10P-value = 5 and \u22125 for the Rsb test for the candidate regions. All annotated genes within the region were considered as candidate changes. Then, we examined commonly detected iHS and Rsb genes for the Iraqi cattle (Jenoubi and Rustaqi) as well as the Rsb results of Iraqi cattle and the three reference breeds. A Venn diagram online tool (http://bioinfogp.cnb.csic.es/tools/venny/index.html) was used to check the overlap of candidate genes (Identification of signature selection was based on the extended haplotype homozygosity (EHH) tools, using the Rehh package in R. Two analyses were performed (i) based on within-population statistics using Integrated Haplotype Score (iHS) ; and (ii) relative integrated EHH of a site between populations (Rsb) . The iHSte genes .Fst analyses were conducted between the two Iraqi cattle breeds. Fst summarizes the genetic differentiation among populations, through estimation of the allele frequency between populations relative to the total variance of these populations  using the BioMart tool (http://www.ensembl.org/biomart). PANTHER 11.0 (http://www.pantherdb.org/) and the Enrichr (http://amp.pharm.mssm.edu/Enrichr/) tools were used to explore protein families, molecular functions, biological processes, cellular components, and pathways  and most recent literature, integrating Google Scholar (https://scholar.google.com). To determine over-represented ontology terms for candidate genes following Fst analysis, we used DAVID version 6.7 (https://david.ncifcrf.gov/), which detects enriched functional terms  in Jenoubi. Our findings indicate that Iraqi breeds possess significant diversity compared to Asian , African , and European breeds  . As shown in K = 3, we do observe in Rustaqi and Jenoubi an European taurine and an African taurine shared ancestry as well as an Asian indicine one, for the latter higher in Jenoubi than in Rustaqi. At K = 4, shared ancestry with Holstein-Friesian is observed in Rustaqi but much less so in Jenoubi. Shared ancestries with the Nellore and African cattle are present in both Iraqi breeds, but these are low. At K = 5 and K = 6, both Rustaqi and Jenoubi show admixed background, however, less so for the former than the latter. For the second analysis, the optimal number of clusters was defined as K = 7  and then including also Jersey, Sahiwal, Gir, East African Shorthorn zebu (EASZ), Ankole, Adamawa Gudali, and Red Bororo. In the first analysis, the selected breeds are representative of the main lineages of cattle . The optimal number of clusters was here defined as iHS and Rsb statistics, based on extended haplotype homozygosity (EHH). Results are presented in iHS score of \u22125.40 and on BTA26 with iHS score of \u22125.0. Several genes are present within these regions, on BTA1 NCAM2, TMPRSS15, and CHODL and on BTA26 PRKG1. In Rustaqi, we observe the strongest evidence of selection on BTA1 with iHS score of \u22125.60 and on BTA18 with iHS score of \u22125.03. Genes present within these significant regions include on BTA1 PPM1L and IGSF5 and on BTA18 PLCG2, CDH13, NOVEL, OSGIN1, TLDC1, CRISPLD2, IRF8, JPH3, KLHDC4, SLC7A5, CA5A, BANP, GALNS, CBFA2T3, ABCC12, ZNF423, and LPCAT2. The Jenoubi breed has 13 candidate-selected regions derived and six ancestral, compared with 11 and 16, respectively, for Rustaqi (Footprints of selection for Iraqi breeds (Jenoubi and Rustaqi) were analyzed using Rsb results between Rustaqi and Jenoubi show a total of 209 SNPs in Jenoubi and 236 in Rustaqi above the significant threshold. The Rsb plots show strong signals of positive selection on BTA1, BTA6, BTA7, BTA8, BTA10, BTA17, BTA22, and BTA26 in Jenoubi, and on BTA1, BTA5, BTA13, BTA18, and BTA26 in Rustaqi , while candidate regions under positive selection in Rustaqi include 45 annotated genes ; see Candidate regions under positive selection in Jenoubi include 24 annotated genes  and ABCC2  linked to the acquired immune response to protozoan and bacterial infections , associated with anti-apoptotic activity especially during fertility stage , linked to the autophagy process  is related to fertility traits  is linked to fat, protein, and milk yield  of the most significant SNPs within the different significant regions in both breeds. In Jenoubi, the most significant SNPs  are within the PCDH15 gene region involved in the maintenance of the integrity of the intestinal membrane. Then, NCAM2  and TMPRSS15  are linked to fat, protein, and milk yield.The remaining genes are related to other environmental adaptation or production characteristics. For instance, y traits , and NCAlk yield . Supplemn = 25 SNPs, maximum SNP log P-value = 8.01; BTA18) are within the DNMBP gene region. This gene has been shown to contribute the milk-fat composition .In Rustaqi, the most significant SNPs , 7.8 on BTA5 (Jenoubi versus Nellore), and 7.6 on BTA1 (Jenoubi versus N\u2019Dama).For the comparisons of the Jenoubi with Holstein-Friesian, Nellore, and N\u2019Dama, we used a threshold for the Rsb regions. Among these, four candidate genes overlap with previous Iraqi cattle analysis (iHS and Rsb). These candidate genes are ATG7 (autophagy control), PRKG1 (tick resistance), PCDH15 (maintenance of intestine membrane), and TMEM132B (control of brain physiology). The remaining 34 genes were considered to be new genes not identified in our previous analysis of Iraqi breeds. Thirteen genes are included in the Jenoubi\u2013N\u2019Dama Guinea comparison, including eight genes overlapping with the Iraqi breeds analysis (iHS and Rsb) . Only one gene PCDH15 is present for Rsb Jenoubi versus Nellore analysis. . Rsb analysis of Rustaqi against Nellore uncovered five genes, again with no shared genes with our previous Iraqi analysis (iHS and Rsb). Rsb Rustaqi versus N\u2019Dama Guinea found 26 genes, with one gene (CD96) previously identified in Iraqi breeds  reveals the following significant categories: biological regulation, molecular function, cellular components, protein class, and pathways  identifies the same categories   (5 genes), biological adhesion (GO:0022610) (3 genes), cellular process (GO:0009987) (12 genes), localization (GO:0051179) (6 genes), metabolic process (GO:000 8152) (5 genes), cellular component organization or biogenesis (GO:0071840) (2 genes), multicellular organismal process (GO:0032501) (1 gene), and response to stimulus (GO:0050896) (1 gene). On the other hand, molecular function shows binding (GO:0005488) (6 genes), catalytic activity (GO:00 03824) (3 genes), and transporter activity (GO:0005215) (3 genes). The Enrichr tool reveals the following biological processes: vitamin D metabolic process and growth factor activity. These ontologies and others  are further shown at For the Rsb analysis) indicates the following two biological process supported with two genes, cellular process (GO:0009987) and metabolic process (GO:0008152), and the biological process binding (GO:0005488) with one gene. The Enrichr analysis identifies three enriched terms: small GTPase-mediated signal transduction (GO:0007264), cell\u2013matrix adhesion (GO:0007160), and positive regulation of hydrolase activity (GO:0051345). On the other hand, the molecular function analysis recognizes one enriched term, Rho guanyl-nucleotide exchange factor activity (GO:0005089).The PANTHER analysis for Rustaqi  representing 51 genes has an enrichment score of 4.89, largely above the threshold of 1.3 (P = 0.05), with the next cluster, enrichment score 1.29 , just below the significant threshold level considered.The overall genome differentiation of In this study, we report at a genome-wide level for the first time the genetic structure, diversity, and candidate signatures of positive selection in two Iraqi cattle breeds, Jenoubi and Rustaqi. At the crossroad of the zebu and taurine centers of domestication, Iraqi cattle may be expected to show high diversity of both taurine and zebu origin. This is confirmed in our study with the presence of both indicine and taurine ancestry in the two breeds, although in different proportions for each of them. Jenoubi cattle are classified as zebu following their humped cattle phenotypes. Our principle component and admixture analyses support such classification, but they also reveal a small proportion of taurine ancestry in their genetic backgrounds. Two factors may have contributed in the shaping of the genetic make-up of Jenoubi. The taurine background within this breed may be corresponding to ancient admixture events from the putative Near East cattle taurine domestication centers, and/or it is the consequence of recent exotic taurine introgression. At K = 3, the Jenoubi taurine background is shared with N\u2019Dama and European taurine. However, at K = 4, the optimal K, the ancestry with European taurine largely disappears. The native habitat of the Jenoubi breed (South-Eastern of Iraq) is away from areas where exotic breeds  have been introduced in Iraq in the recent past , supportIn contrast, with a significant proportion of European ancestry, as revealed in our admixture analysis, recent gene flow from exotic cattle origin likely occurred in Rustaqi. The geographic origin of this breed is central Iraq. It is close to the capital Baghdad, and crossbreeding with exotic taurine might have been driven by the pressures to increase milk production in response to the consumer demands from the city. Admixture analysis indicates also some low zebu background in Rustaqi. Likewise, with the taurine introgression in Jenoubi breed, it may be of ancient origin and the consequence of past trading networks not only between central Iraq and southern Iraq but also further north and south, linking the ancient civilization of the Fertile Crescent and the Indus Valley .He is higher compared with all the Iranian cattle population examined by Interestingly, genetic studies in Anatolian cattle  have also revealed taurine \u00d7 zebu admixture . Also, KiHS and Rsb analyses.Our signature of selection results in both Iraqi breeds, are suggesting that environmental challenges including diseases pressures have shaped the genomes of Rustaqi and Jenoubi breeds, but not in an identical way, with important differences between the two breeds according to our findings from the iHS results in Rustaqi indicate more candidate-selected regions with genes involved in innate and acquired immunities, compared with the results obtained in Jenoubi. Interestingly, among the 14 immune response-related genes unique to Rustaqi, we do find that OSGIN1 and CBFA2T3 previously showed to be part to the cattle immune response to mammary gland inflammation  and protozoan infections  indicate that the most enriched cluster among the biological process category is the gene ontology term apoptotic process. Programmed cell death (apoptosis) is part of the immune adaptive response of an organism. In particular, positive regulation of the apoptotic process has been shown to play a role in the immune response of blood cells to trypanosome infection in cattle  indicated biological process related to gene upregulation  (Enrichr results for Rustaqi (lopment) , as welllopment) .Rsb results reveals several clusters linked to biological process. For instance, cluster genes of metabolic process are associated with milk production, metabolism of water-soluble vitamins, and regulation of actin cytoskeleton , DAVID tool identifies the significance cluster metal-thiolate function important for metabolism detoxification activities   . It suppIn conclusion, we have reported here for the first time at a genome-wide level the genetic structure, diversity, and candidate signatures of positive selection in two Iraqi cattle breeds. Our results support the phenotypic classification of Jenoubi cattle as zebu, and Rustaqi cattle as taurine but with introgression from the other cattle subspecies in each of them. In addition, the results show a significant level of genetic diversity in indigenous Iraqi cattle in line with their history. Genome-wide analysis unravels the genes that play an important role in immunity and other environmental adaptive traits, including in relation to parasitic, bacterial disease challenges, and heat tolerance. This study illustrates the uniqueness of these two indigenous breeds, while the information obtained is expected to help the control of diseases, conservation, management, and utilization of the indigenous Iraqi cattle genetic resources.The animals used in this study are owned by farmers. Prior to sampling, the objectives of the study were explained to them in their local languages so that they could make an informed decision regarding giving consent to sample their animals. Government veterinary, animal welfare, and health regulations were observed during sampling of the populations analyzed here. The procedures involving animal sample collection also followed the recommendation of directive 2010/63/EU. Collection of blood samples was permitted by the Iraqi Ministry of Agriculture.AA and OH conceived and designed the experiment. AA and OH performed the experiment. AA, AE, and SA-B collected samples. AA analyzed the data. AA and OH wrote the manuscript. All authors have agreed on the contents of the manuscript.We would like to extend our sincere gratitude to the Iraqi Ministry of Higher Education and Scientific Research , Iraqi cultural attach\u00e9, for sponsoring this workThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "KMT2A gene represent a unique subtype of leukaemia, with biphenotypic clinical manifestations, a rapid and aggressive onset, and a generally poor prognosis. Chromosomal translocations involving KMT2A often cause the formation of oncogenic fusion genes, such as the most common translocation t producing the KMT2A\u2010AFF1 chimera.Haematological malignancies harbouring rearrangements of the KMT2A\u2010rearranged RS4;11 cell line and put those in context with other reports of cell lines also harbouring a t rearrangement.The aim of this study was to confirm and review the cytogenetic and molecular features of the MYC. A homozygous deletion of 9p21 containing the tumour\u2010suppressor genes CDKN2A and CDKN2B was also revealed by FISH. The production of the fusion transcript KMT2A\u2010AFF1 arising from the der(11)t was confirmed by RT\u2010PCR, but sequencing of the amplified fragment revealed the presence of multiple isoforms. Two transcript variants, resulting from alternative splicing, were identified differing in one glutamine residue in the translated protein.The main chromosomal rearrangements t and i(7q), described when the cell line was first established, were confirmed by fluorescence in situ hybridisation (FISH) and 24\u2010colour karyotyping by M\u2010FISH. Additional cytogenetic abnormalities were investigated by further FISH experiments, including the presence of trisomy 18 as a clonal abnormality and the discovery of one chromosome 8 being an i(8q), which indicates a duplication of the oncogene KMT2A\u2010leukaemia.As karyotype evolution is a common issue in cell lines, we highlight the need to monitor cell lines in order to re\u2010confirm their characteristics over time. We also reviewed the literature to provide a comparison of key features of several cell lines harbouring a t. This would guide scientists in selecting the most suitable research model for this particular type of  KMT2A rearrangements can give rise to different cellular phenotypes, with affected cells showing an interesting lineage heterogeneity, hence the designation of \u201cmixed\u2010lineage\u201d. Rearrangements involving KMT2A are often found in de novo and DNA topoisomerase II inhibitor therapy\u2010related myeloid and lymphoblastic acute leukaemias, with varying incidence according to type and age.KMT2A rearrangements account for 10% of all acute leukaemiasLeukaemia harbouring rearrangements of the KMT2A\u2010leukaemia,KMT2A to fuse in\u2010frame with the C\u2010terminus of a partner gene.KMT2A covers approximately 8 kbp between exons 7 and 11.KMT2A have been identified, forming the so\u2010called \u201cMLL recombinome.\u201d The most common translocation partners are AFF1 (previously known as AF4) on 4q21, MLLT3 (AF9) on 9q22, ELL on 19p13.1, MLLT1 (ENL) on 19p13.3, MLLT10 (AF10) on 10p12, and MLLT4 (AF6) on 6q27, giving rise to t, t, t, t, t, and t, respectively.KMT2A and a partner gene produces chimeric proteins with oncogenic activity, which largely depends on the retained domains of KMT2A and the characteristics of the fusion partner.Chromosomal translocations are common rearrangements in MLL recombinome is the t, which produces the KMT2A\u2010AFF1 chimeric protein.The most common translocation in the s the t4;1KMT2A rearrangements is thought to occur via an improper expression and regulation of Hox genes.Drosophila melanogasterLeukaemia initiation by KMT2A gene have been documented in utero.KMT2A\u2010leukaemia is the extraordinarily short latency and the limited number of secondary somatic mutations,FLT3, KRAS, and NRAS have been proposed as \u201csecond hits\u201d drivers for leukaemogenesis of KMT2A\u2010leukaemias.It is a topic of debate whether KMT2A fusions alone are sufficiently powerful to cause the disease, contradicting the \u201cmulti\u2010hit model\u201d that applies to most leukaemias.KMT2A\u2010leukaemia. Although at least 16 cell lines with the t have been described, only four have been appropriately authenticated.A reliable in vivo model faithfully mimicking the disease is still lacking  (Gibco), and incubated at 37\u00b0C in 5% CO2. Cells were passaged every 48\u00a0hours.The cell lines RS4;11 (ATCC CRL\u20101873\u2122) and Farage (ATCC CRL\u20102630\u2122) were grown in RPMI 1640  supplemented with 10% foetal bovine serum (FBS) (Gibco) and 1% penicillin/streptomycin  to cell cultures 1\u00a0hour before harvesting according to well\u2010established methods.2.3KMT2A\u2010AFF1 fusion PCR fragment was amplified according to the protocol of van Dongen et alKMT2A and exon 7 on AFF1, respectively. PCR products were analysed by 2% agarose gel electrophoresis, purified using GeneJET PCR Purification Kit and cloned into pJET2.1 vector . A number of clones containing the insert were selected by colony PCR and then sequenced by GENEWIZ UK Ltd.Total RNA was extracted from cell cultures using TRIzol Reagent and converted into cDNA using random hexamers and SuperScript III reverse transcriptase, according to manufacturer's instructions . The 33.1All of the metaphases showed the presence of a derivative chromosome 11, carrying chromosome 4 material. In addition, the majority of the cells (76%) also had a derivative chromosome 4 , and derivatives chromosomes 7 and 8  and der(4), respectively q21;q23) was confirmed by M\u2010FISH  was detected by FISH using arm\u2010specific chromosome paints for 7q (red) and 7p (green), and single locus probes for bands 7q22 (red) and 7q36 (green). Arm\u2010specific probes showed the complete coverage of one chromosome 7 in red, corresponding to the long arm  in RS4;11, which has not been previously described. The formation of the i(8q) results in a duplication of the proto\u2010oncogene CDKN2A and CDKN2B, coding for the tumour suppressors p16(INK4A)/p14(ARF) and p15(INK4B), respectively. This was previously shown by Southern blottingKMT2A\u2010rearranged cell lines. Clinically, homozygous del(9p21) is predominantly found in T\u2010ALL patients and particularly in paediatric cases, in which the deletion confers poor prognosis.KMT2A translocations are seen but at a lower frequency than in other cytogenetic subgroups such as t and t/BCR\u2010ABL, indicating that the inactivation of CDKN2A/2B is not indispensable for the malignant phenotype.We confirmed the homozygous deletion at 9p21, a locus containing KMT2A span the region between exon 7 and exon 11, and in AFF1 the breakpoint locates between exon 8 and exon 4.KMT2A breakpoint has been shown to occur between exon 8 and 9 and between exon 5 and exon 4 in AFF1.KMT2A\u2010AFF1 transcript. Two distinct isoforms of the fusion are produced differing in a glutamine (Q) residue proximal to the breakpoint. Interestingly, up to eight different transcript variants are known to occur in patients with t, although their significance has not been elucidated.AFF1 gene, is estimated to be present in 30% of human genes, and it was suggested that it may play a functional role in about 5% of the genes.KMT2A\u2010AFF1 transcripts is unsurprising.At the molecular level, known breakpoints on AFF1\u2010KMT2A from the der(4) was not investigated in our study, but its production has been reported in RS4;11.AFF1\u2010KMT2A protein in leukaemogenesis is still debated, as AFF1\u2010KMT2A transcripts are only occasionally found in patients due to the fusion not consistently occurring in\u2010frame.AFF1\u2010KMT2A is required to achieve full malignant transformation,The generation of the reciprocal fusion transcript KMT2A\u2010AFF1 and the reciprocal AFF1\u2010KMT2A fusions,KMT2A\u2010AFF1 from the der(11).Although at least 16 cell lines with the t have been described, only few have been appropriately authenticated  in the B\u20101 cell line, which is however present in MV\u20104\u201011, RS4;11, AN4;11, and SEM, suggests that it is the der(11) to detain a pivotal role in the promotion and maintenance of the malignancy.TP53 and FLT3, can prove useful in investigating the role of point mutations in leukaemogenesisThe MV\u20104\u201011, SEM, AN4;11, and B\u20101 cell lines are particularly suitable for the study of childhood KMT2A\u2010AFF1 transcript is useful for proteomic and pharmacological studies, and might help to shed some light on the significance of transcript variants and alternative splicing. As with other cell lines, the karyotype is subjected to evolution over extended culturing, by the accumulation of secondary mutations and rearrangements. Monitoring cell lines over time would provide further information on clonal evolution and proliferative advantage of certain subclones, such as the proportion of different clones within the population, how they vary over time, and which abnormalities provide the strongest growth advantage. While these changes may represent an obstacle in reproducibility and reliability of experiments, investigating these changes could be used to understand tumour evolution in patients.We conclude that the RS4;11 cell line is a suitable in vitro model for the study of leukaemia harbouring t, owing to the presence and retention of its original cytogenetic abnormalities. At the molecular level, the production of the The authors have no conflict of interest.Conceptualisation, S.T.; Methodology, S.T., E.M.M.; Investigation, D.R., O.B., D.M., E.M.M., Formal analysis, D.R., O.B., D.M., E.M.M., S.T., Resources, S.T., E.M.M., C.M.G.; Writing\u2014original draft, D.R., S.T., E.M.M., D.M.; Writing\u2014Review and Editing, D.R., S.T., E.M.M., D.M.; Visualisation, D.R., S.T., E.M.M., D.M.; Supervision S.T., E.M.M., C.M.G.; Project Administration, S.T.All authors had full access to the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis."}
+{"text": "N = 66, 265 transcripts) and McArthur-Bates CDI database , the language production of 18- to 24-month-old Spanish- and English-speaking children was analyzed to determine the age and order of acquisition, and frequency of demonstratives. Results indicate that demonstratives do not typically appear before the 50th word and only become frequent from the two-word utterance stage. Corpus data show few differences between Spanish and English, whereas parental report data suggest much later acquisition for demonstratives in English. These findings expand our knowledge of the foundations of deictic communication, and of the methodological challenges of assessing early production of function words.The present work re-evaluates the long-standing claim that demonstratives are among infants\u2019 earliest and most common words. Although demonstratives are deictic words important for joint attention, deictic gestures and non-word vocalizations could serve this function in early language development; the role of demonstratives may have been overestimated. Using extensive data from the CHILDES corpora (Study 1,  This happens by 12 months, before children have learnt their first words, with the onset of pointing  are deictic terms. They function to establish joint attention, and often appear in conjunction with pointing  and because both languages have a large amount of data available as open source for study. Data are obtained from two large repositories of child language acquisition: the CHILDES corpus, comprising transcripts of child spontaneous speech, and the MacArthur-Bates CDI Wordbank, comprising data from parental surveys. A secondary aim is to describe the use of demonstratives in English and Spanish in infant speech and parent-directed speech.this and that  and the locative adverbs here and there. This and that can function as pronouns  or determiners . Most authors include locative adverbs in the category of demonstratives  and high frequency would indicate an essential role of this word class for language acquisition and communication. Contrarily, a later acquisition or marked differences between-languages would support the hypothesis that demonstratives are just one of the possible forms of deixis, and not essential to language acquisition. Specifically, the acquisition of the first demonstrative words will be examined in relation to chronological age, mean length of utterance  and estimated vocabulary size (CDI data). Study 1 will examine the data from spontaneous speech and Study 2 from parent report.Additionally, we compare the use of determiners/pronouns with that of locatives. Subtle differences between the two types of term may affect their developmental trajectory. We also compare parent and child use of demonstratives in the same conversation to examine whether parents tend to adopt the demonstratives used by the child regardless of their own perspective.To preview the results, we find that demonstrative words do not typically appear among the first 50 words, and are more frequent in child\u2019s speech toward the age of two years and in two- and multi-word utterances than in the earliest stages of language acquisition. We find cross-linguistic differences, namely late acquisition of demonstratives in English with respect to Spanish. However, these differences are evident only in parental report data. The discussion will cover the implications for deictic communication and methodological considerations regarding the study of function words in child speech.Study 1 investigates the acquisition and use of demonstrative words using data from spontaneous speech.M = 240, SD = 156); t-tests confirmed that there are no significant differences between languages in the number of child utterances by transcript for each of the age groups 18\u201320 months, 21\u201322 months, and 23\u201324 months .Data come from monolingual children aged 18 to 24 months from the European Spanish and British English corpora in CHILDES . All traParent data were obtained in most cases from maternal transcripts, because they were much more frequent than paternal transcripts and generally had more utterances. Paternal transcripts were used when maternal transcripts were not available. In the case of one child of the Spanish corpus (12 transcripts), the father was selected for all instances, because the mother had few utterances and was absent in three of them.childesr . In English, demonstratives also have non-deictic uses, such as there is/are to indicate existence or in fixed expressions such as there you go, and the conjunction that (as in the lady that we met today). This is not the case for Spanish. We were concerned about the possibility of children using these words non-deictically prior to the acquisition of proper demonstrative use in English. Thus, we checked manually the transcripts of the 10 children from the English corpus who produced only that or there, which could indicate this non-deictic usage . In all cases we found they apparently functioned as demonstrative words3.Data were extracted and processed in R  in Decemchildesr . The num2) were used for dichotomous variables and Mann-Whitney U Tests for continuous variables with Bonferroni adjusted alpha levels for multiple comparisons. The correlational analysis was performed with bootstrap.All statistical analyses were performed on the raw frequencies. Due to differences in sample size between languages and the violation of the normality and homoscedasticity assumptions, non-parametric tests were used: Chi-squared tests  = 0.32, p = 0.6; locatives, \u03c72 (1) = 1.7, p = 0.2; or any demonstrative, \u03c72 (1) = 0.59, p = 0.4. Locatives featured more often in children\u2019s vocabulary than determiners/pronouns: in Spanish, \u03c72 (1) = 3.96, p = 0.047; and English, \u03c72 (1) = 42.76, p < 0.001. In Spanish, this difference was only significant for the youngest age group, 18 to 20 months  and at none of the MLU bins. In English it was significant in the two youngest groups , and the two lower MLU bins , Bonferroni adjusted alpha levels of 0.017.There were no between-languages differences in the percentage of children who produced at least one demonstrative word: determiners/pronouns, \u03c7este/aqu\u00ed, this/here, \u03c72 (1) = 9.5, p = 0.002]. Contrarily, English distal terms that and there appeared in more transcripts than Spanish medial terms ese and ah\u00ed . Spanish distal terms aquel and all\u00ed were rare:1% of Spanish transcripts featured the demonstrative aquel and 28% the locative all\u00ed.After finding that demonstratives featured in a similar proportion of Spanish and English transcripts, we tested which demonstrative words occurred in each language, irrespective of how frequently they were used. The percentages of children who used each demonstrative term at least once are displayed in tidytext R package  and 65 from Spanish children (mean Age = 21 months).Corpora transcripts were processed with the  package  to extraeste (this), aqu\u00ed (here) and ah\u00ed (there) were among the 20 most frequent words, in 11th, 13th, and 17th position, respectively. In English, there, that, and this were among the 20 most frequent words. There was the single most frequent word in the corpus, and that and this occupied 4th and 16th positions, respectively.Word frequencies were computed for all words in all scripts for each language. U Test, Z = 1.0, p = 0.32). However, locatives were much more frequent in English than in Spanish in child speech . In parent speech, both determiners/pronouns and locatives were slightly more frequent in English than in Spanish .The number of demonstratives per thousand words was computed for determiners/pronouns and locatives in both languages and is displayed in 4. There were positive correlations between MLU and determiner/pronoun frequency in Spanish  and English : determiners/pronouns were more frequent in children with longer MLU. Locative adverbs did not significantly correlate with MLU in Spanish  or English . Age correlated with MLU in English, r = 0.40, p < 0.001, but not in Spanish, r = 0.14, p = 0.2. Correlations between demonstrative frequency and age did not approach significance .Next, we examined demonstrative frequency across the age and MLU range using correlational analysisr = \u22120.17, p = 0.031, and Spanish, r = \u22120.22, p = 0.037. Nevertheless, parents\u2019 and children\u2019s demonstrative frequency correlated positively in English, r = 0.41, p < 0.001, and Spanish, r = 0.277, p = 0.008. Changes in frequency of demonstrative words by MLU for children and parents are displayed in We also examined possible differences in child-directed speech across development. Parent demonstrative frequency correlated negatively with child MLU: parents used more demonstratives at the early stages of language acquisition and parent usage decreased with child language development: in English, This analysis examined the relationship between the demonstrative words used by each parent-child dyad, particularly whether they tend to use the same demonstrative words during an interaction. A correlational analysis was performed on the frequency of each demonstrative word per thousand words between speakers (parent and child) within transcripts. Results are displayed in Analysis of the spontaneous speech of 18 to 24 month old English and Spanish speaking children revealed that demonstratives are used by more than half of children from age 18 months, and at the single-word utterance stage. However, it is not until children are starting to produce two-word utterances that we see demonstratives in nearly all children. There were no significant between-language differences. What CHILDES data do not reveal is the order of acquisition of demonstratives, nor whether they appear among the first 50 words. That will be examined using parental report (CDI) data in Study 2. Findings from the descriptive analysis of CHILDES data on demonstrative use and parental input will be discussed in the General Discussion.Study 2 investigates the acquisition of demonstrative words in English and Spanish using data from parental report. Specifically, we look at when the majority of children use demonstratives with respect to their vocabulary size and age in both languages.Data come from 277 monolingual speakers of European Spanish and 673 of British English, between the age of 18 and 24 months. Sample distribution by age is displayed in The instruments used were the Oxford CDI for British English and the Words and Sentences for European Spanish . These qthis, that and there, but not here, nor the plural forms these and those. The Spanish questionnaire features all demonstrative words, including gender and number variations  was binned in groups of 50 words . Chi-squared tests on the raw data were used throughout. Two separate analyses were made, one for determiners/pronouns only, and one for all demonstratives including locatives.Data were extracted and processed using the  package  on 25/11este, ese and/or aquel). Including locatives, 68% of Spanish children produced at least one demonstrative word from 18 months, and approached 100% at 22 months. In contrast, only 9% of British children produced at least one determiner/pronoun word by 18 months, 17% when including locatives. At 24 months, less than 50% of English speakers produced determiner/pronouns, and 55% when including locatives. At any age point, a greater number of Spanish children compared to British children produced at least one demonstrative, whether or not locatives were included in the analysis .2s (1) > 10, p\u2019s < 0.001, Bonferroni adjusted alpha level of 0.006]. There were no significant between-language differences thereafter .Data from parental report reveal important crosslinguistic differences. The majority of Spanish speakers use at least one demonstrative from 18 months and among their first 50 words if locatives are included, whereas English speakers do not use demonstratives up until age two and a vocabulary size of 200 words, and even later if considering determiners/pronouns only. It was expected that fewer children would use demonstratives in CDI data compared to CHILDES data. However, the striking crosslinguistic differences solely in CDI data suggest possible sampling differences.n = 222) and low education level parents  in the Spanish sample . The mean age of children of both groups did not differ significantly , nor the total CDI score . More parents with higher education reported that their children used demonstratives, 88% vs 77%, \u03c72(1) = 4.56, p = 0.03. This supports the hypothesis that parental education might play a role in their accuracy in reporting demonstrative production. However, only 34% of British parents from our data reported demonstrative use, thus sampling issues cannot fully account for the cross-linguistic differences in Study 2.In the Spanish CDI sample, high education families were over-represented, with 77% of parents having college and graduate education. Maternal education is not reported in the British data, although it is presumably lower, since authors state that their sample SES was representative of the British population , word frequency and parent input. In Study 2, we looked at data from parental report, that feature a measure of vocabulary size and a large sample size. Results will help understand the role of demonstrative words in deictic communication and language acquisition in infancy. They are also interesting from a methodological point of view, contributing to assessing the suitability and validity of parental report and corpus analysis in the study of function words.First, we asked whether demonstratives appear among children\u2019s first 50 words and at the earliest stages of language development (18 months). Results on age of acquisition differ between measures: according to the CDI results (Study 2), only around half of the English speakers use demonstratives by 24 months, whereas nearly all Spanish speakers used at least one demonstrative by the age of 22 months. In contrast, corpus data (Study 1) indicated that the majority of children of both languages produced at least one demonstrative word from 18 months and all of them did at 24 months. Data from CHILDES indicates that the majority of children from both languages use demonstratives from MLU 1 to 1.5, and reach ceiling with an MLU of 1.5 to 2. Data from the CDI showed at what point in vocabulary acquisition demonstratives appear. The majority of Spanish speakers have a demonstrative among their first 50 words (after the 50th word if considering determiners/pronouns only), reaching ceiling after the 150th word. In contrast, the majority of English speakers do not use demonstratives before their 200th word, reaching ceiling only after their 350th word. This reflects a great discrepancy between CDI and CHILDES data, and it is unclear which one of these sources reflects a more accurate estimation. Nevertheless, we can confidently say that demonstratives do not typically appear before the 50th word, and they are more frequent in two-word utterances. We cannot make any firm statement about possible cross-linguistic differences because the results we obtained were very different between the two sources. We will discuss the possible methodological and sampling sources of discrepancies.there and that were often hard to distinguish from babbling, whereas the Spanish words esto or aqu\u00ed were easier to recognize, perhaps because they are disyllabic words.It was expected that the CDI data would underestimate demonstrative production with respect to corpus data ; howeverAs argued in the introduction, neither checklist nor observational methods alone are ideal for estimating the proportion of particular word types in children\u2019s early vocabulary . HoweverThe second aim of this work was to describe the use of demonstratives in child spontaneous speech (Study 1). The analysis of CHILDES data revealed no significant differences between languages in the acquisition of demonstratives with respect to age and MLU. However, it did show that proximal demonstratives appear more often in Spanish and distal demonstratives in English, both in terms of frequency of use and of percentage of children using them at least once. Thus, whereas the use of demonstratives by infants is not a language-specific communicative tool, the preferred demonstrative term varies across languages.there/ah\u00ed. In English, it was the most frequent word in children\u2019s lexicons, and its frequency was particularly high in the youngest children. In contrast, the Spanish equivalent ah\u00ed  was no more frequent than the determiner/pronouns. Our hypothesis is that there in English (unlike locative adverbs in Spanish) functions as a fixed expression instead of a deictic term, or as a verbalization linked to a particular action. This was the case for the children studied by there among the first 10 words, but they used it in a very specific context: for example, one participant would only use it with the action of handing a toy. This use might be a precursor of the acquisition of deictic words . However, the analysis of transcripts provides limited context, particularly those of infants in the single-word stage, and thus makes it difficult to assess when children use demonstratives in a ritualistic way or as a deictic communication tool. Future research in the development of deictic communication might take this into consideration, and perhaps analyze separately determiners/pronouns and locatives.One striking finding is that locatives and determiners/pronouns do not seem to have the same function in language development. Locatives appear earlier and are more frequent, particularly in English and in earlier stages. They are less complex than determiners/pronouns, which are more frequent in children with higher MLU. The most salient difference between languages in children transcripts is in the locative there and that, were among the five most frequent words of child\u2019s lexicon, whereas in Spanish the most frequent demonstratives, the proximal terms este and aqu\u00ed, are the 11th and 13th most frequent words. Demonstrative words were also very common in parent speech, although parents used fewer demonstratives than children per thousand words, presumably due to their larger vocabulary.Another interesting difference between the two languages is in the frequency of demonstratives: in English, two demonstratives, The analysis of spontaneous speech also allowed description of parent use of demonstratives. Data revealed that parents use more demonstratives in children\u2019s earlier stages of language development, as indicated by a negative correlation between parents\u2019 frequency of demonstratives and children\u2019s MLU. This might indicate that parents move on to use words that are more complex than demonstratives at the moment in their child\u2019s language development when they are acquiring new words at a fast rate.this for an object closer to them, whereas the conversational partner refers to the same object with that). Our hypothesis is that parents repeat the demonstrative that the child uses in order to reinforce their word learning, while the spatial content of demonstratives (close or far) is not relevant at this stage. Interestingly, the frequency of use of each demonstrative term correlated between parent and child. This has potentially interesting implications for later development of spatial demonstratives to convey distance and semantic information. That parent and child are using the same demonstrative word in a given speech suggests that children are not switching the demonstrative term, as happens in adult speech: frequently in an interaction with objects, the speakers view them from opposite sides and therefore use opposed demonstratives :In this example, the child uses the proximal demonstrative, then the mother repeats it, but her next sentence features the distal demonstrative for the same referent. The child, mother, and the referent (the baby doll) do not apparently change location during the exchange, so the mother\u2019s appropriate demonstrative would have been Child and mother are playing on the floor. Child turns around and refers to a game that is located slightly further, indicating that he would like to play with it some more. The child uses the proximal demonstrative and the mother uses it too.This.Child: \u00e9te [: \u00e9ste]. - More.Child: m\u00e1 [: m\u00e1s]. - Very well. More?Mother: muy bien (.) \u00bfm\u00e1s? - MoreChild: m\u00e1 [: m\u00e1s]. - This one?Mother: \u00bf\u00e9ste? - Do we do this one again?Mother: \u00bfhacemos \u00e9ste otra vez? - Child: t\u00edto [/] [?].This one again?Mother: \u00bf\u00e9ste otra vez? - This hypothesis, however, should be taken with caution, since there are frequent examples where it does not occur. There are also numerous events in which it cannot be assessed because only parent or child use demonstratives. Parents\u2019 use of demonstratives according to the child\u2019s perspective might be limited to a specific developmental stage. Further research could investigate parent-child synchrony of demonstratives in video-recorded interactions, to see at what stage in development parents take their children\u2019s perspective with demonstrative words and how it influences their subsequent acquisition of the spatial contrast.Results from the CHILDES corpora are to be interpreted with caution because of the small sample size in Spanish (seven children). Individual differences and preferences might have been overrepresented in our results. The CHILDES database would benefit from more contributions of early speech in languages other than English. Particularly, parent-child interactions in video format would be a valuable addition to the study of deictic communication in infancy.We studied the acquisition and frequency of demonstrative words in English and Spanish using transcripts of spontaneous speech and parental report data. Results indicate that demonstratives do not typically appear before the 50th word and are more frequent at the two-word-utterance stage than at the onset of productive language. This work challenges previous claims about the acquisition of demonstratives . In lineFrom a methodological point of view, comparing parental report and spontaneous speech data in the study of function words has highlighted the potential limitations of both measures. Further research needs to examine the suitability, limitations, or improvement of both methods for the study of function words in child speech.The datasets generated for this study are available on request to the corresponding author.PG-P contributed with the conceptualization, methodology, investigation, data analysis, visualizations, theoretical framework, results interpretation, and writing. PG-F contributed with the conceptualization, supervision, theoretical framework, results interpretation, review, and editing. MD contributed with the theoretical framework, results interpretation, review, and editing. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The outbreak of Corona Virus Disease 2019 (COVID-19) in Wuhan has significantly impacted the economy and society globally. Countries are in a strict state of prevention and control of this pandemic. In this study, the development trend analysis of the cumulative confirmed cases, cumulative deaths, and cumulative cured cases was conducted based on data from Wuhan, Hubei Province, China from January 23, 2020 to April 6, 2020 using an Elman neural network, long short-term memory (LSTM), and support vector machine (SVM). A SVM with fuzzy granulation was used to predict the growth range of confirmed new cases, new deaths, and new cured cases. The experimental results showed that the Elman neural network and SVM used in this study can predict the development trend of cumulative confirmed cases, deaths, and cured cases, whereas LSTM is more suitable for the prediction of the cumulative confirmed cases. The SVM with fuzzy granulation can successfully predict the growth range of confirmed new cases and new cured cases, although the average predicted values are slightly large. Currently, the United States is the epicenter of the COVID-19 pandemic. We also used data modeling from the United States to further verify the validity of the proposed models. Infectious diseases are caused by various pathogens that can be transmitted from person to person, animal to animal, or person to animal. They can be transmitted in various ways, and the speed of transmission is fast. Early diagnosis of infectious diseases is crucial, and prevention and control are paramount.In December 2019, an unexplained viral pneumonia was reported in Wuhan, China. The virus, named the 2019 Novel Coronavirus (2019-nCoV) by the World Health Organization (WHO) on January 12, 2020, causes Corona Virus Disease 2019 (COVID-19), and is currently the seventh known species of coronavirus that can infect human beings. The remaining six species are human coronavirus (HCoV)-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, severe acute respiratory syndrome (SARS)-CoV, and Middle East respiratory syndrome (MERS)-CoV. COVID-19 and severe acute respiratory syndrome (SARS), which broke out in 2003, are both caused by coronaviruses. Their clinical symptoms are similar but not identical. People infected with the 2019-nCoV will experience varying symptoms, including fever, mild cough, or pneumonia, occasionally leading to death. The mortality rate of COVID-19 is approximately 2% to 4%, although this is an extremely early percentage and may change as more information becomes available. Meanwhile, this does not mean that the virus is not serious, it simply means that not everyone infected with it will face the worst outcome. We are currently in a tense state of prevention and control, and are concerned about a global pandemic.2019-nCoV is an intractable and unexpected virus with the following characteristics. First, it has a strong ability to camouflage itself. The virus can be present asymptomatically, making an infected person appear healthy, or can manifest with various other symptoms in which an infected person seems to be suffering from a common respiratory disease. It also has a long latency period. According to a report from Lancet, the median latency time of the new coronavirus is approximately 20 days, reaching up to 37 days for some patients. In addition, it is transmitted in various ways. The transmission method of the 2019-nCoV is similar to that of various other infectious diseases. In addition to a traditional droplet transmission, it also includes contact, air, fecal\u2013oral, and blood transmissions. A high relapse rate has also been seen. Since the initial outbreak of COVID-19, there have been many cases of recovered patients testing positive again after a reexamination, even leading to death after a relapse. The virus has also shown variability. As a foreboding aspect of the future development of novel coronaviruses, their rapid genetic recombination results in a mutation into new strains. Each recombination can increase the toxicity and infectivity, invalidating original treatment methods and drugs. Forty variants of novel coronaviruses have been discovered by scientists in Iceland. Finally, it is highly infectious. Scientific data have shown that the affinity between the S-protein of 2019-nCoV and angiotensin converting enzyme 2 (ACE2) is 10 to 20 times that of SARS, which means that the infectivity of COVID-19 is significantly higher than that of SARS.There are currently no specific treatments for COVID-19. However, many symptoms can be treated, and treatment must be given according to the clinical status of the patient. In addition, supplementary care for those infected may be effective. Self-protection includes maintaining basic hand and respiratory hygiene, adhering to safe eating habits, and avoiding close contact with anyone who shows symptoms of a respiratory disease (such as coughing or sneezing). At present, owing to the widespread nature of COVID-19, factories are being shut down, schools are being suspended, and people are isolating in their own homes, significantly disrupting daily life. It is therefore extremely important to reasonably predict and analyze the development trend of this pandemic.In previous studies, the prediction methods for the occurrence, spread, and change in infectious diseases mainly included regression prediction models , 2, MarkFor example, Ray  used ensMany scholars have published reports on COVID-19. For example, in \u201320, its To date, few studies related to the use of quantitative prediction methods to predict the development trend and growth range of COVID-19 have been conducted. In the present study, three methods, namely, an Elman neural network, LSTM, and SVM are applied to predict and analyze COVID-19 data from January 23, 2020 to April 6, 2020 in Wuhan, Hubei Province, China, including cumulative confirmed cases, confirmed new cases, cumulative deaths, new deaths, and cumulative cured cases and new cured cases. First, the Elman neural network, LSTM, and SVM were used to predict the development trend of cumulative confirmed cases, cumulative deaths, and cumulative cured cases. Next, the SVM with fuzzy granulation was used to predict the growth range of confirmed new cases, new deaths, and new cured cases. Experimental results showed that the Elman neural network and SVM adopted in this study can accurately predict the development trend of COVID-19, whereas LSTM is more suitable for the prediction of cumulative confirmed cases. The SVM with fuzzy granulation is effective for the growth range prediction of confirmed new cases, new deaths, and new cured cases, despite the larger averages. The same models were also used on data in the United States to verify the robustness of the models.The rest of this paper is organized as follows. Section 2 introduces the methods applied. Section 3 describes the experiments and analysis results. Finally, some concluding remarks and areas of future research are provided in Section 4.There are two main research topics in this paper. The first is the development trend prediction and analysis of the cumulative confirmed cases, deaths, and cured cases. The second is the growth range prediction of the confirmed new cases, new deaths, and new cured cases. Because the present state of cumulative confirmed cases, deaths, and cured cases is related to the state of the previous day, and shows a non-linear growth, recurrent neural networks (RNNs) are applicable. In this study, we mainly apply the Elman neural network and LSTM. In addition, the SVM has a better prediction effect on non-linear data, therefore, the SVM model is also introduced for development trend prediction. Because there are many factors affecting the growth of new cases, the growth trend fluctuates significantly. Here, only the growth range of the new cases is predicted. To predict the change space of the three datasets more accurately, this paper introduces a SVM model with fuzzy granulation.The Elman neural network is generally divided into four layers: input, hidden, receiving, and output layers. The receiving layer is also called the context layer or state layer, and is used to memorize the output value of the hidden layer unit at the previous moment and return it to the network input. It can be considered a one-step delay operator. As the characteristic of the Elman neural network, the output of the hidden layer is self-connected to the input of the hidden layer through the delay and storage of the receiving layer. This self-connected method makes it sensitive to historical data. The addition of an internal feedback network enhances the ability of the network to process dynamic information, thereby achieving the purpose of dynamic modeling. The network structure of the Elman neural network is shown in The connections of the input layer, hidden layer, and output layer are similar to those of a feedforward network. Unlike a feedforward network, the Elman neural network contains a receiving layer, which takes the hidden layer state of the previous moment together with the network input of the current moment as the input of the hidden layer.xc(k) = x(k \u2212 1) indicates that the feedback state vector is equal to the hidden layer state at the previous moment. The hidden layer state is expressed as follows:Here, u is the input vector, xc is the feedback state vector, w1 is the weight of the receiving layer to the hidden layer, w2 is the weight of the input layer to the hidden layer, w3 is the weight of the hidden layer to the output layer, f(*) is the activation function of the hidden layer, and g(*) is the activation function of the output layer.The output layer state is expressed asLSTM networks are variants of RNNs. General RNNs only have short-term memory owing to a disappearance of the gradients. LSTM networks combine short-term and long-term memory through a subtle gate control and solve the problem of disappearing gradients to a certain extent. LSTM was proposed by Hochreiter and Schmidhuber  in 1997.ht\u22121 and the current input data xt, and then outputs a vector between zero and 1. The value between zero and 1 in this vector indicates how much information is retained or discarded in the cell state ct. A value of zero means all information is discarded, and 1 means all information is retained.The diagram shows the details of the forget gate, input gate, and output gate. The first step is to decide what information to discard from the cell state, which is done through a layer called the forget gate. The forget gate reads the hidden state of the previous moment ht\u22121 and xt to decide which information to update through an input gate operation. We then use ht\u22121 and xt to obtain a new candidate cell state z through a tanh layer.The next step is to decide how much new information is added to the cell state. Two steps are needed to achieve this. First, we use Next, the cell state is updated as follows:ht\u22121 and xt. Here, we need to pass the input through a sigmoid layer called the output gate to obtain the judgment conditions. We then need to pass the cell state through the tanh layer to obtain a vector between -1 and 1, which is multiplied by the judgment conditions obtained by the output gate to obtain the output.zi, zf, and zo are the gate control state of the forget gate, input gate, and output gate, respectively. In addition, z is the input through a tanh layer, which is a so-called candidate cell state. Finally, \u2299 represents a multiply operation of the corresponding elements of the matrix.Finally, we need to determine the output value. After updating the cell state, we need to determine which part of the cell state will be output according to the input SVM is a classic model that can be used not only for classification but also for regression. We do not delve into its theoretical derivation here, however. Unlike with a classification problem, the output of the regression problem is no longer a discrete value, but a continuous value. In reality, it is often impossible to accurately predict the value of the COVID-19, and to this end, it is particularly important to predict the development trend and change space for the important parameters of this disease.Without considering other factors, time is clearly an important independent variable affecting COVID-19. To more accurately predict the change space of each group of data on this disease, in this paper, a fuzzy granulation model is introduced. First, we divide the original data into multiple granulation windows and then apply fuzziness to each window.X as a window and then apply fuzziness to it. Fuzzification is a task used to establish a fuzzy particle P on X, that is, a fuzzy concept G that can reasonably describe X. Fuzzy particles can reasonably represent the original data and have certain specialties. A fuzzy particle P can be described simply as P = A(x), where A is a membership function of the fuzzy concept G. Commonly used fuzzy particles include triangular, ladder, Gaussian, and parabolic particles. In this study, we choose triangular fuzzy particles, the membership function of which is as follows:The so-called fuzzy granulation means that the information granulation adopted is based on the model of fuzzy set theory. The key to fuzzy granulation is fuzzification, here, we use the Pedrycz\u2019s granulation method . For a gm is the kernel of triangular fuzzy particles, and a and b are the lower and upper bounds of the support, respectively.Here, http://wjw.wh.gov.cn/) [We studied COVID-19 data from January 23, 2020 to April 6, 2020, which were published by the Wuhan Municipal Health Commission (gov.cn/) . We usedgov.cn/) . The datIn this section, the Elman neural network, LSTM, and SVM were used to predict and analyze the development trends of the cumulative confirmed cases, deaths, and cured cases. In the Elman neural network and LSTM, the experimental datas are in the form of the first three days to the fourth . Thus, the original 75 groups of data are converted into 72 groups, and the last group of data are used as the test sample. According to the data, both the Elman neural network and the LSTM in this paper contain only one hidden layer.Because the initial weights of the Elman neural network and LSTM were randomly initialized, the average of 20 experimental results is given here as the final outcome. In addition, the number of hidden layer neurons is an important factor. We chose 7, 11, 14, and 18 hidden layer neurons according to experience. As can be seen from In the SVM experiment, we used a one-day-to-the-next approach, that is, we used the data from the previous day to predict data for the next day. In this study, data of 61 days from January 23 to March 23 were used as training samples, and data from March 24 to April 6 were used as test samples. The radial basis function was used in the experiments. The prediction mean square error and square correlation coefficient of the cumulative confirmed cases, deaths, and cured cases are shown in It can be seen from the results that the SVM can predict the three sets of data well, and the square correlation coefficients of the cumulative deaths and cumulative cured cases between the predicted output and the actual output are all above 99%. Although the mean square error of the cumulative confirmed cases is relatively large and the square correlation coefficient is relatively small, it can be seen from Similar to the aforedescribed experiments, herein we predict and analyze the development trend of cumulative confirmed cases and deaths from the data in the United States. Here, 12 hidden layer neurons of the Elman neural network and LSTM are applied. In the SVM experiment, data of 61 days from March 23 to May 22 were used as training samples, and data from May 23 to June 5 were used as test samples. The prediction results of the cumulative confirmed cases and deaths are shown in Comparing the experimental results of Wuhan and the United States, the Elman neural network and SVM can well predict the development trend of Wuhan and the United States, whereas the prediction result of LSTM for the United States is clearly worse than that of Wuhan. This occurs because the data from the United States used in this study are national data, not data from a certain city, and the data growth is more irregular and without any periodicity.In addition to predicting the development trend of COVID-19, we also used a SVM with fuzzy granulation to predict the growth range of the confirmed new cases, new deaths, and new cured cases. Taking 5 days as a granulation window, the data from January 23, 2020 to April 1, 2020 were used as the training samples, and the growth range of the next 5 days was predicted, that is, the growth range of the confirmed new cases, new deaths, and new cured cases from April 2 to April 6. To reduce the impact of the peak value on the experimental results, we first smoothed the data of confirmed new cases and new cured cases. The data from March 23, 2020 to May 31, 2020 were used as the training samples, and the growth range of the confirmed new cases and new deaths from June 1 to June 5 were predicted. The predicted growth range of confirmed new cases and new deaths is smaller than the actual growth. The predicted average for confirmed new cases is larger than the actual average of 19,648.6, whereas the predicted average for new deaths is smaller than the actual average of 879. The negative value in the public data has a significant influence on the prediction results . There is no obvious downward trend in confirmed new cases and new deaths, and strict control is still required. Individuals should therefore strengthen their awareness of prevention and control and be responsible for themselves and others.The emergence of COVID-19 has been a heavy burden. During the past 2 months, however, significant progress has been made in the diagnosis and treatment of this disease. In this study, machine learning was used to predict and analyze the development trend and growth range of COVID-19. The results using data from Wuhan showed that the Elman neural network and SVM can better predict the development trend of cumulative deaths and cumulative cured cases, whereas the prediction error of cumulative confirmed cases is relatively large. In comparison, the LSTM model has a worse predictive effect on cumulative confirmed cases, deaths, and cured cases owing to the aperiodic data. Moreover, the prediction results of the two recurrent neural network models used in this study are unstable because neural networks tend to fall into a local optimum for data with irregular growth. This is a major drawback of neural networks, and needs to be improved in the future. For the prediction of the growth range of confirmed new cases, new deaths, and new cured cases, the SVM with fuzzy granulation introduced in this paper was shown to be effective. However, the predicted average values are larger than the actual average values, which indicates that the model is less robust to data with large fluctuations and still needs to be improved. The experimental results on data from the United States verified the robustness of the models, although the prediction result of LSTM was worse than that of Wuhan. In future research, we will improve the models based on the aforementioned problems and continue to improve the generalizability of the models.S1 Data(XLSX)Click here for additional data file.S2 Data(XLSX)Click here for additional data file.S1 File(DOCX)Click here for additional data file.S2 File(DOCX)Click here for additional data file."}
+{"text": "Oral squamous cell carcinoma (OSCC) is the most common malignant epithelial neoplasm of the head and neck, with poorer prognosis. There is lack of specific targets for diagnosis and treatment of OSCC at present. Annexin A2 (ANXA2) is involved in cell angiogenesis, invasion, proliferation and metastasis. In this study, the significance and effect of ANXA2 on OSCC and OSCC cells were explored from the clinical and basic study. First, ANXA2 expression in OSCC tissues and adjacent non-cancer tissues of 124 patients were detected, and the correlation between ANXA2 expression and clinical parameters were analyzed. The results found that ANXA2 was highly expressed in OSCC tissues, and was associated with the TNM stage, tumor differentiation, lymph node metastasis and poor survival of OSCC patients. The expression of ANXA2 in OSCC cells were higher than the normal oral cells. And knockdown of ANXA2 by transfecting ANXA2-siRNA could suppress the proliferation, migration, and invasion abilities of OSCC cells. Overall, ANXA2 expression is correlated with poor survival of OSCC patients, and silencing of ANXA2 suppress the proliferation, migration and invasion of OSCC cells. In recent years, the incidence of OSCC has been on the rise and the onset age has been getting younger2. Though the diagnosis and treatment technology of OSCC have improved over the last three decades, the prognosis is still poor and there is still a lack of specific targets for diagnosis and treatment of OSCC at present3. Thus, the identification of biological markers related to the biological behaviors of OSCC cells, is crucial for the diagnosis, treatment and prognosis of OSCC.Oral squamous cell carcinoma (OSCC) is the world\u2019s eighth malignancy and the most common malignant epithelial neoplasm of the head and neck6. Abnormal expression of ANXA2 has been verified to be associated with multiple malignancies, such as gastric carcinoma7, pancreatic cancer8, colorectal cancer9, breast cancer10, prostate cancer11 and esophagus cancer12. Furthermore, it is reported that ANXA2 plays an important role in biological behaviors involving cytoskeleton, cell phenotype and other changes in cell malignant transformation, tumor growth, tumor cell adhesion and metastasis13. However, the physiological functions of ANXA2 in OSCC is still unclear. In the present study, the correlation among ANXA2 expression, clinicopathological characteristics, and prognosis of OSCC patients were analyzed. The siRNA interference experiments were used to analyze the function of ANXA2 in modulating cell migration, invasion, and proliferation, to evaluate whether ANXA2 could be considered as a potential target of OSCC.Annexin A2 (ANXA2), a 36\u00a0kDa membrane protein on cell surface, is a member of calcium-dependent phospholipid-binding protein family, which is widely expressed in various eukaryotic cells. Previous researches have identified that ANXA2 is involved in cell angiogenesis, invasion, proliferation and metastasisP\u2009<\u20090.05).IHC analysis was used to detect the expression of ANXA2 in OSCC tissues Fig.\u00a0 and the P\u2009<\u20090.001). Moreover, TNM stage, lymph node metastasis and invasion depth were also correlated with the overall survival of OSCC patients (P\u2009<\u20090.001). Multivariate Cox regression analysis was conducted to analyze the further correlation of ANXA2 and OSCC, and the results showed that ANXA2 positive expression was an independent risk markers for poor prognosis of OSCC .As shown in Fig.\u00a0P\u2009<\u20090.05).Wound healing assay was used to identify the effect of ANAX2-siRNA on migration ability of HSC-3 and SCC-4 cells. As shown in Fig.\u00a0The invasion abilities of HSC-3 and SCC-4 cells were analyzed by Transwell assay. As shown in Fig.\u00a014. Zhong et al.15 discovered that the expression of ANXA2 protein in OSCC tumor tissues was higher than that in adjacent non-malignant epithelial tissues which detected by immunohistochemistry. However, in Rodrigo\u2019s research, the expression of ANXA2 in OSCC tissue was lower, compared with normal oral epithelial tissues16. In the present research, the expression of ANXA2 in OSCC tissues and adjacent carcinoma tissues were detected and verified that the positive expression rate of ANXA2 in OSCC tissues was higher than that in adjacent normal oral epithelium tissues, which was consistent with Zhong\u2019s research15. Furthermore, the relationship of ANXA2 with OSCC patients\u2019 clinical features were analyzed and the results indicated that the expression of ANXA2 was correlated with the TNM stage, tumor differentiation and lymph node metastasis (P\u2009<\u20090.05). In addition, Kaplan\u2013Meier survival analysis found that patients with ANXA2 negative expression had a significantly longer overall survival than those with ANXA2 positive expression. And Cox multivariate analysis showed that ANXA2 positive expression was an independent risk factors for the survival of OSCC patients, which was in accordance with the results of Zhang et al.17. However, it still need to do more in-depth statistical analysis with large samples to verify the relationship of ANXA2 and prognosis and survival of OSCC patients.OSCC is a malignant tumor with poor prognosis, and there is no ideal curative method currently. Understanding of the molecular mechanism of proliferation, invasion and metastasis of OSCC cells could provide useful effective therapeutic targets or prognostic indicators for this disease. ANXA2 has been reported to be associated with a variety of malignancies: A meta-analysis showed that ANXA2 over-expression was associated with tumor invasion, lymph node metastasis, overall survival, and poor prognosis13. In this research, the results showed that the expression of ANXA2 in OSCC cell lines HSC-3, SCC-4, CAL27 were higher than normal oral cell line NOK, which was consistent with the results in OSCC patients. The following experiments showed that knockdown of ANXA2 in OSCC cells inhibited the abilities of cell proliferation, migration, and invasion, suggesting that ANXA2 had positive effect on malignant biological properties of OSCC cell. The same results were observed in other cancers: The down-regulation of ANXA2 in lung cancer cell line A54918 or breast cancer cell line MDA-MB-23119 significantly reduced the proliferation capacity of tumor cells. Studies also found that silencing of ANXA2 inhibited cell proliferation by arresting cell cycle20. Wang et al.18 verified that the deletion of ANXA2 inhibited cell proliferation during cell cycle arrest by inducing p53. Ma et al.21 suggested that ANXA2 may regulate the invasion ability of cells through c-myc. And the further research demonstrated that ANXA2 activated the FIF1A-VEGF axis through increasing the protein abundance of myc, to promote cell migration and invasion23. Yuan et al.24 demonstrated that ANXA2 was correlated with the proliferation and invasion of breast cancer cells, and the mechanism was phosphorylation of ANXA2 enhanced STAT3 activation, increasing the expression of cyclin D1 and MMP2/9, which were the key target genes of STAT3 playing vital roles in cell proliferation and invasion. And Wu et al.25 indicated that ANXA2 increased the expression of c-myc and cyclin D1 by activating the Erk1/2 signaling pathway, thereby affecting the proliferation, migration, and invasion of MCF-7 cells. In mouse adenocarcinoma models, knockdown of ANXA2 significantly inhibited cell metastasis26. Andey et al.27 also found that silencing of ANXA2 gene could significantly reduce the metastasis ability of lung cancer cells. From the above studies, it can be concluded that ANXA2 might trigger different signaling pathways, promoting the proliferation, invasion and metastasis ability of tumor cells, and accelerating the development of tumor. The results in the present study show that ANXA2 is significant for the development and survival of OSCC and plays a pivotal role in tumor proliferation, migration, and invasion of OSCC cells, which should be concerned by clinical and considered as a potential target of OSCC therapy. However, specific mechanism and possible involved signal pathways have not been studied. Therefore, it is necessary to further explore the mechanism of ANXA2 in OSCC.In the process of tumor development, the changes of cytoskeleton, the decreased adhesion from cell to cell and cell to matrix increase the cell motility and invasion ability and promote tumor invasion and metastasis. In recent years, most studies have shown that ANXA2 played an important role in tumor cell growth, adhesion and metastasisThe present study showed that ANXA2 positively expressed in most OSCC tissues, and was correlated with the TNM stage, tumor differentiation and lymph node metastasis in OSCC. Knockdown of ANXA2 expression inhibited the proliferation, migration and invasion of OSCC cells. These results indicated that ANXA2 may play a pivotal role in OSCC progression and may be a potential target for therapeutic intervention of OSCC.OSCC and adjacent specimens were collected from 124 OSCC patients who visited Henan Provincial Stomatological Hospital from Oct, 2014 to Oct, 2017. All patients were primary OSCC with complete medical records, and the pathological specimens were obtained by resection operation and well preserved in liquid nitrogen. None of the patients had a history of chemoradiotherapy or immunotherapy, without any autoimmune diseases or oral mucosal diseases. Patients were followed up 24\u201360\u00a0months, until death or Oct, 2019. Overall survival time referred to the beginning of treatment to death or the last follow-up. 124 patients included 56 males and 68 females with an age of (55.5\u2009\u00b1\u20091.65) years old (range: 30\u2009~\u200976\u00a0years). All patients had signed the informed consent for participating in the research and the research has been approved by the Ethics committee of the First Affiliated Hospital of Zhengzhou University.2 at 37\u00a0\u00b0C. The medium was replaced once in 2\u00a0days.Normal Oral corneum cell line NOK and Human oral squamous cell carcinoma cell lines HSC-3, SCC-4 and CAL27 were given by School of Stomatology, Zhengzhou University. NOK, HSC-3 and CAL27 cells were cultured in MEM , and SCC-4 cells were cultured in DMEM/ Nutrient Mixture F-12  medium , all of them containing 10% FBS , penicillin (100 U/L) and streptomycin (100\u00a0mg/L) . The cells were cultured in an incubator of 5% CO2O2 for 30\u00a0min to block endogenous peroxidase. To reduce non-specific binding, FBS treatment was used for 30\u00a0min. Then a rabbit polyclonal ANXA2 antibody  was incubated for 2\u00a0h at 36\u00a0\u00b0C. After washed with PBS, the sections were incubated with a goat anti rabbit IgG antibody  for 30\u00a0min. At last, the sections were washed with PBS and color reacted with DAB  as a chromogen. The sections were counterstained by hematoxylin solution, dehydrated. And the sections were photographed under light microscope . The expression of ANXA2 was defined according to the staining intensity, which was scored as \u20180\u2019 (0\u2009~\u200925%), \u20181\u2019 (26%\u2009~\u200950%), \u20182\u2019 (51%\u2009~\u200975%), \u20183\u2019 (76%\u2009~\u2009100%). 5 fields of view were selected to measure the staining intensity for each section, and the average score from 3 sections was represented as the score of ANXA2 expression. The final score of 0\u2009~\u20091 defined as negative and 2\u2009~\u20093 was defined as positive.Tissues removed during surgery were fixed with 10% neutral formalin solution, dehydrated and embedded in paraffin and cut into 4\u00a0\u03bcm sections. Then the sections were deparaffinized, rehydrated, and subjected to microwave antigen retrieval in citrate buffer for 20\u00a0min. Then treated with 3% HRNA was extracted according to the Trizol-spin-column kit  protocols and reversed transcribed using the HiScriptII QRT SuperMix for qPCR kit . The expression level of ANAX2 was determined by using ChamQ SYBR Color qPCR Master Mix kit . PCR amplification was performed on a CFX Connect Real-Time System . Primer sequences were as follows: ANXA2-F: AAATGTCTACTGTTCACGAAATC; ANXA2-R: GTGTCGGGCTTCAGTCATC; \u03b2-actin-F: ACTCTTCCAGCCTTCCTTCC; \u03b2-actin-R: CATACTCCTGCTTGCTGATCC. 6 multiple holes were set in each experiments and the experiment was repeated three times. The two of three cancer cell lines whose ANXA2 expression level were higher were selected to do the following experiments.6 were collected at 4\u00a0\u00b0C, 1200\u00a0rpm centrifugetion, and washed by ice-cold PBS twice. And 500\u00a0\u00b5l RIPA buffer (containing PMSF) was added into the cells and centrifuged at 4\u00a0\u00b0C, 13,000\u00a0rpm for 10\u00a0min to extract the total protein. The protein concentration was detected by BCA method. SDS loading buffer was added in protein specimen and degenerated at 100\u00a0\u00b0C for 5\u00a0min. 40\u00a0\u00b5g protein was separated by 12% SDS-PAGE, and transferred to PVDF membrane by wet type galvanometer . The membrane was blocked by 5% skim milk for 1\u00a0h at room temperature, and cut according to precision plus protein dual color standards value  to incubate the antibodies. Then the primary antibodies : Anti-ANXA2 , \u03b2-actin  were incubated at 4\u00a0\u00b0C overnight. The secondary antibody  were incubated for 1\u00a0h. ECL detection reagent was added to the membranes to observe the protein bands, and the band densities were analyzed by Image J software  with \u03b2-actin as internal reference. The experiment was repeated three times.The cells about 1\u2009\u00d7\u200910Human OSCC cell lines HSC-3 and SCC-4 were transfected with scrambled siRNA (Negative Control) and human ANXA2-specific siRNA (ANXA2-siRNA) respectively, which were designed and purchased from GenePharma . The transfection of siRNAs was performed using RFect siRNA transfection Reagent  according to the manufacture\u2019s protocol. After transfected for 24\u00a0h, qRT-PCR analysis was used to detect the expression of ANXA2 mRNA. And after transfected for 48\u00a0h, western blot analysis was used to detect the expression of ANXA2 protein to verify the transfection efficiency.4 cells/well with 3 replicate wells per group. After cultured for 12, 24, 36, and 48\u00a0h, 10\u00a0\u03bcl CCK-8 solution was added to each well and incubated for 2\u00a0h. The absorbance OD was measured at 450\u00a0nm by the microplate reader . The experiment was repeated three times.Cell proliferation was measured using a CCK-8 Cell Counting Kit . After transfected for 24\u00a0h, cells were seed into 96-well plates at 1\u2009\u00d7\u2009106 cells/well. When cells were at 80% confluency, a two-hundred-microliter-pipette was used to create a wound, and the cells were cultured in fresh serum-free medium. The healing of the scratch area was observed and photographed under an inverted microscope at 0, 24, and 48\u00a0h respectively. The healing area was calculated by Image J software.The migration ability was evaluated by healing area (%): /Initial scratch width\u2009\u00d7\u2009100%. The experiment was repeated three times.After transfected for 24\u00a0h, cells were grown in 6-well plates at 1\u2009\u00d7\u2009106 cells/ml. And 200\u00a0\u03bcl cells were added into the upper chamber. The MEM medium with 10% FBS were added into lower chamber. After 24\u00a0h, the cells passed through the Matrigel-coated membrane (8.0\u00a0\u03bcm pore size) were fixed, stained with 0.1% crystal violet for 15\u00a0min. Then cells were counted using a microscope . Five visual fields were randomly selected to calculate the numbers of invaded cells.The Transwell upper chamber  were coated by Matrigel . The transfected cells were digested with 0.25% trypsin and collected at 1500\u00a0rpm centrifugation for 5\u00a0min. Cells were resuspended with MEM medium containing 2% FBS to adjust the cell density at 1\u2009\u00d7\u200910t-test; For enumeration data, comparison between two groups was analyzed by chi-square test, P\u2009<\u20090.05 was considered statistically significant. Survival analysis was performed by Kaplan\u2013Meier analysis, univariate and multivariate Cox regression analysis.All the data were analyzed by SPSS 20.0. The measurement data was showed as mean\u2009\u00b1\u2009standard deviation and the comparison between two groups was analyzed by independent sample The present study was conducted with the informed consent of all participates, all experiments were performed in accordance with relevant guidelines and regulations of Declaration of Helsinki and has been approved by the ethics committee of the first affiliated hospital of Zhengzhou University.Supplementary Information"}
+{"text": "Phyllobius or Polydrusus, from the Pleistocene (16\u201310 ka) of Switzerland. The scales display vibrant blue, green and yellow hues that resemble those of extant Phyllobius/Polydrusus. Scanning electron microscopy and small-angle X-ray scattering analyses reveal that the subfossil scales possess a single-diamond photonic crystal nanostructure. In extant Phyllobius/Polydrusus, the near-angle-independent blue and green hues function primarily in crypsis. The preservation of far-field, angle-independent structural colours in the Swiss subfossil weevils and their likely function in substrate matching confirm the importance of investigating fossil and subfossil photonic nanostructures to understand the evolutionary origins and diversification of colours and associated behaviours (e.g. crypsis) in insects.Extant weevils exhibit a remarkable colour palette that ranges from muted monochromatic tones to rainbow-like iridescence, with the most vibrant colours produced by three-dimensional photonic nanostructures housed within cuticular scales. Although the optical properties of these nanostructures are well understood, their evolutionary history is not fully resolved, in part due to a poor knowledge of their fossil record. Here, we report three-dimensional photonic nanostructures preserved in brightly coloured scales of two weevils, belonging to the genus  BioloHypera diversipunctata) from the Pleistocene of Canada that possesses a single-diamond (Fd-3m) photonic crystal (PC) structure within its scales [Phyllobius or Polydrusus (Curculionidae: Entiminae) from Lobsigensee . Using scanning electron microscopy (SEM) and small-angle X-ray scattering (SAXS), we show that the bright colours of these scales are produced by a single-diamond three-dimensional PC structure and have optical properties consistent with substrate matching. The fossil nanostructures, therefore, represent intermediate stages in models for the evolution of three-dimensional photonic nanostructures and confirm the importance of the Pleistocene fossil insect record as a key source of data on the evolution of three-dimensional photonic nanostructures.Despite extensive research into the development, function and optical properties of three-dimensional photonic nanostructures in extant insects, and notwithstanding insights from modern phylogenetic analyses , the evos scales . Here, w2.ca 10 000\u201313 000 BP [Phyllobius or Polydrusus , which are closely related [Specimens L150D-L and L150D-N were recovered from site L150D  at the locality of Lobsigensee , a small3 000 BP . A preci related .2) cuticle samples were mounted on an aluminium stub with carbon tape and sputter coated with Au/Pd. Samples were analysed using a FEI Inspect F50FE-SEM at 5 kV.Optical micrographs of the specimens were taken using a Leica S8APO stereomicroscope fitted with a Leica DFC260 digital camera. For SEM, small  data in transmission geometry were collected at beamline 8-ID-I at the advanced photon source (APS), Argonne National Laboratory as described elsewhere ,25. For 3.Phyllobius/Polydrusus exhibiting sparse bright blue to yellow-green scales that each show 8\u201310 parallel ridges oriented along the scale axis . Similar colours and axial ridges are evident in the scales of extant Phyllobius .Each subfossil specimen comprises a partial elytron of ale axis a,b,e,f. c,d,g,h) reveal that the scales of both subfossil specimens have an elongate spatulate shape  with rounded apical margins. Some scale margins, notably for specimen L150D-L, show the evidence of physical damage, while many scale pedicles are severed . The paucity of preserved scales (relative to extant Phyllobius) thus likely reflects fracturing and loss of scales.SEM images c,d,g,h rd,g,h; see electronic supplementary material, figure S2). This nanostructure was characterized for specimen L150D-L using SAXS (a) confirms the polycrystalline nature of the nanostructure, displaying a concentric series of discrete Bragg scattering peaks from variously oriented crystallite domains. The SAXS scattering profile (b) features discrete Bragg peaks with scattering wave vector positional ratios (pkq/q): \u221a3, \u221a8, \u221a11 and \u221a19 (where pkq = 0.025 nm\u22121 with a width (FWHM) of 0.0041 nm\u22121; N = 1). These peaks correspond to reflections from the (111), (220), (311) and (331) planes, which are consistent with the single-diamond (Fd-3m) space group symmetry [S) against the moduli of the assigned Miller indices (c) confirms the cubic aspect of the nanostructure and highlights the absence of scattering peaks at wave vector positional ratios \u221a4 and \u221a20 that distinguish the subfossil nanostructure from one with a face-centred cubic (Fm-3m) space group symmetry. In addition, it estimates the lattice constant for specimen L150D-L to be 435 nm. This result is consistent with SAXS structural measurements from extant Phyllobius and Polydrusus , 0, (311) Phyllobius . We performed finite-difference time-domain (FDTD) simulations optimized to match the mean measured reflectance peak for specimen L150D-L, which indicate that its nanostructure has a mean refractive index (avgn) of 1.11, corresponding to a chitin (n = 1.56) volume fraction of 0.20  and 515 \u00b1 4 nm (L150D-N), consistent with extant erial of ). SAXS r4.Phyllobius/Polydrusus; this, plus the abundant fractured scales and/or scale pedicles, strongly indicates that additional scales were originally present but disarticulated from the elytra during decay and/or transport. This process is likely a major control on the fidelity of the fossil record of three-dimensional photonic structures. Despite the resistance of such structures to microbial decay and maturation at elevated temperatures and pressures [The low density of cuticular scales on the Lobsigensee specimens is not representative of extant ressures , transpoPhyllobius/Polydrusus confirm that fossil three-dimensional PCs can produce vivid structural colours with minimal iridescence. Such nanostructures usually produce less angle-dependent colours than one-dimensional thin-film or multilayer reflectors due to the three-dimensional nature of the Brillouin zones of the underlying PCs [The subfossil ying PCs . In addiying PCs . Althougying PCs ,27,44.Hypera from the Pleistocene of Canada) also comprises a single-diamond PC structure [Phyllobius/Polydrusus, the preserved Hypera scales exhibit an unremarkable reddish-brown macroscopic hue due to the larger lattice constant (ca 500 nm (Hypera); 435 nm (specimen L150D-L)) of the single-diamond structure, pointillistic mixing of colours from small (ca 2 \u00b5m wide) lattice domains and a higher chitin volume fraction (0.44 (Hypera); 0.20 (specimen L150D-L)) [The only other known example of fossil three-dimensional PCs (in the weevil tructure . In cont150D-L)) ,45.Phyllobius/Polydrusus specimens is consistent with published SAXS data for extant Phyllobius and Polydrusus [The diagnosis of a single-diamond PC structure in the subfossil lydrusus . Single-lydrusus . This islydrusus ,46, withlydrusus  positionlydrusus .n = 60) entimine weevils studied in [Phyllobius/Polydrusus specimens performed a similar function to the matte brown of H. diversipunctata by facilitating cryptic substrate matching, in this case with vegetation.Entiminae are the most speciose weevil subfamily. Adults eat young shoots and leaves and typically deposit their eggs on plants, surface litter and/or soil. As a result, entimine weevils have evolved various strategies to facilitate crypsis, including substrate matching. Most , crypsis minimizes the signal/noise ratio between body and background ,47. Disrn leaves . Similarn leaves ,51.Phyllobius/Polydrusus photonic nanostructure, i.e. a single-diamond PC tuned to scatter greenish hues, are a synapomorphy or shared-derived trait of a clade of broad-nosed weevils (predominantly Entiminae) as proposed by Seago et al. [The key features of the o et al. . Such sto et al. . This hyo et al. ,52,53. F"}
+{"text": "The author has not responded to multiple attempts to secure the missing table, therefore it is being retracted from the article.In the article, \u201cTranexamic acid reduces blood cost in long-segment spinal fusion surgery: A randomized controlled study protocol\u201d,"}
+{"text": "This article was initially published with an incomplete table provided by the authors, and an erratum published in anticipation of the corrected version. The authors have not responded to multiple requests, and as a result, the article has been fully retracted.The article, \u201cTranexamic acid reduces blood cost in long-segment spinal fusion surgery: A randomized controlled study protocol\u201d,"}
+{"text": "Malignant melanoma of the female genital tract is relatively uncommon and accounts for 3\u20137% of all melanoma localizations. This study aimed to identify driver genes in melanoma of the female genital tract with the purpose of enhancing understanding of disease pathogenesis and identifying potential new therapeutic targets to develop effective therapies.BRAF, NRAS, KRAS, NF1, KIT, PDGFRA and SF3B1 on 19 melanomas of the female genital tract, paired with 25 cutaneous melanomas, 18 acral melanomas and 11 melanomas of nasal cavity.KIT (CD117) and BRAF expression were detected immunohistochemically. Polymerase Chain Reaction (PCR) and Sanger sequencing techniques were performed to identify the mutational status of KRAS  as the most commonly mutated gene, followed by KIT , SF3B1  and NRAS . None of the cases were found to harbor BRAF, NF1 and PDGFRA mutations in melanomas of the female genital tract. However, none of the cases were found to harbor SF3B1 and KIT mutations in cutaneous melanomas, acral melanomas and melanomas of nasal cavity. Recurrent KIT mutations, as well as mutations in the less frequently mutated genes NRAS and SF3B1, were exclusively detected in vulvovaginal melanomas, but not in tumors arising in the cervix. However, recurrent KRAS mutations were detected in similar frequencies in tumors of the vulva, vagina, and cervix. Additionally, recurrent KRAS and KIT mutations occurred predominantly in polygonal and epithelioid cell types of melanoma in the female genital tract. Immunohistochemistry revealed moderate or strong cytoplasmic CD117 expression in 6 of the 19 cases (31.6%).Somatic variant analysis identified KIT, BRAF, SF3B1, KRAS, and NRAS genes. Our findings support the notion that gynecologic melanoma is a distinct entity from non-gynecologic melanoma, and these findings offer insights into future therapeutic options for these patients.We observed that gynecologic melanoma harbored distinct mutation rates in the The online version contains supplementary material available at 10.1186/s12885-021-08427-x. Primary malignant melanomas arise from melanocytes which present in the genital mucosal epithelium of the female genital tract are extremely rare, accounting for 3\u20137% of all melanoma localizations , 2. The BRAF V600E [SF3B1. Newell and colleageues [NRAS, BRAF, NF1, KIT, SF3B1, TP53, SPRED1, ATRX, HLA-A and CHD8 genes. These studies have provided the foundation for understanding the molecular profiles of mucosal melanoma and expanded our knowledge of this rare disease. The distinct mutation profiles of cutaneous and mucosal melanoma are striking and support a model of different developmental pathways.Mucosal melanomas are not related to sun exposure or other known environmental factors; therefore, mucosal melanomas have been shown to have distinct molecular profiles compared with cutaneous melanoma arising on sun-exposed sites , 8. SomeAF V600E , have leAF V600E \u201319. To bAF V600E , 20\u201323. AF V600E  found thleageues  also fouTo better understand the mutational profile and provide important new clues into the molecular changes that occur in melanomas of the female genital tract, our study analyzed the molecular drivers of 19 melanomas of the female genital tract , paired with 25 cutaneous melanomas, 18 acral melanomas and 11 melanomas of nasal cavity. Our findings expand this knowledge by contributing the large cohort of mucosal melanoma of the female genital tract known to date with validated mutations and may lead to a better understanding of the molecular drivers, and hence improved therapeutics for these rare forms of melanoma.Nineteen melanomas of the female genital tract, 25 cutaneous melanomas, 18 acral melanomas and 11 melanomas of nasal cavity were obtained from the case files of the Department of Pathology of Fujian Cancer Hospital, China, from October 2010 to September 2019. The biopsy material was fixed in 10% formalin and embedded in paraffin after routine histological tissue processing. Formalin-fixed paraffin-embedded tissue (FFPE) sections (3\u20134\u2009\u03bcm thick) were stained with hematoxylin-eosin for microscopic examination. All cases were carefully reviewed independently by two melanoma pathologists to confirm the histological diagnosis according to the criteria of the 2014 WHO Classification of Tumors Female Reproductive Organ, and extensive review of medical records was performed. This study was carried out in accordance with the Declaration of Helsinki and written informed consent was obtained from the patients or their legal guardians. The study protocol was approved by the institutional review boards of Fujian Cancer Hospital.Immunohistochemistry assays were performed on diagnosed patient tissues available in the form of FFPE tissue blocks using Bond-III Autostainer  in the Department of Pathology\u2019s clinical immunohistochemistry laboratory. Immunostaining on paraffin sections was done for CK, EMA, S-100, HMB45, Melan-A, SOX-10, Ki67, KIT (CD117) and BRAF . Conditions for individual immunohistochemistry assays including antigen retrieval and antibody dilutions varied according to the antibody used and were determined by standard optimization and validation procedures. Positive and negative staining controls were included as appropriate.Five pieces (5-\u03bcm-thick sections) were cut from FFPE tumor tissues. The sections were deparaffinized and manually microdissected according to standard procedures. Genomic DNA was isolated using the QIAamp FFPE DNA Tissue Kit  according to the manufacturer\u2019s instructions. Samples were quantified using the Qubit DNA high sensitivity assay .BRAF exon 15; NRAS exons 2, 3 and 4; KRAS exons 2, 3 and 4; KIT exons 9, 11, 13, 17 and 18; PDGFRA exons 12 and 18; NF1 exon 22; and SF3B1 exon 14 on 19 melanomas of the female genital tract, as previously described [BRAF, NRAS, KRAS, PDGFRA, KIT, NF1 and SF3B1 were designed using Primer Premier 5. The PCR products were routinely purified and sequenced in both directions using the BigDye Terminator version 3.1\u2009Cycle Sequencing Kit . At least two independent PCR and sequencing experiments were conducted to confirm mutations.Nested PCR was performed to amplify escribed \u201326. PCR BRAF, NRAS, KRAS, NF1, KIT, PDGFRA and SF3B1 [The panel of targeted genes was designed on the basis of large-scale mutation-profiling studies on melanomas covering nd SF3B1 , 22. TheThis study included 19 patients with primary melanomas of the female genital tract, with a median patient age of 53.0\u2009years and an average age of 55.4\u2009years at diagnosis (range from 34 to 84\u2009years). The primary melanomas of the female genital tract included five vulvar (26.3%), eight vaginal (42.1%) and six cervical melanomas (31.6%). Six (31.6%) patients had T4 disease, two (10.5%) had T3 disease, three (15.8%) patients had T1 disease and the remaining eight (42.1%) patients had T2 disease. The clinicopathological features of the patients are summarized in Table\u00a0Microscopic examination revealed that the tumor cells were distributed in solid islets, nests or band-like formations. Tumor cells were polygonal, epithelioid or spindle in shape and rarely of small cell type, with oval, pleomorphic, hyperchromic nuclei Fig.\u00a0A\u2013C. In mImmunohistochemistry revealed moderate or strong cytoplasmic CD117 expression in 6 of the 19 cases (31.6%)  and one cases with NRAS mutation (p.Q61*) . The SF3B1 p.R625H hotspot mutation was detected in 16% (3/19) of the mucosal melanomas of the female genital tract  were found in 21% (4/19) of the melanomas of the female genital tract; one sample was found to harbor both p.S476N and p.G498V mutations . None of the cases were found to harbor NF1 and PDGFRA mutations (data not shown).We examined gene mutations in the 19 melanomas of the female genital tract  as the most commonly mutated gene, followed by NRAS , and KRAS  in cutaneous melanomas. While, BRAF V600E mutation was less frequent in acral melanomas . In total, 28% (3/18) of acral melanomas showed either a KRAS or NRAS mutation . Interestingly, the BRAF V600E hotspot mutation was not detected in the melanomas of nasal cavity. We identified five cases with NRAS mutations  and two cases with KRAS mutations  in the melanomas of nasal cavity. Notably, none of the cases were found to harbor SF3B1, NF1, KIT and PDGFRA mutations in cutaneous melanomas, acral melanomas and melanomas of nasal cavity. In a word, compared with gynecologic melanoma, non-gynecologic melanoma harbored distinct mutation rates in KIT, BRAF, SF3B1, KRAS and NRAS genes.We next examined gene mutations in 25 cutaneous melanomas, 18 acral melanomas and 11 melanomas of nasal cavity (listed in Supplementary Table\u00a01). We identified Primary malignant melanomas of the female genital tract are extremely rare. The clinical behavior and molecular characteristics of these melanomas have not been well explored. Although melanoma of the female genital tract is an aggressive disease with histological resemblance to melanomas of other sites, recent studies found the heterogeneity of molecular biology of melanoma of different sites. Up to date, relatively little information is known about the molecular alterations that drive melanoma of the female genital tract \u201318. To bBRAF V600E, which were commonly identified in 44% cutaneous melanoma, were not detected in the melanomas of female genital tract. Our finding is similar to most published data on vulvovaginal melanomas [BRAF mutation. In contrast, Hou and colleagues [Activating V600E or V600K mutations in BRAF kinase have been observed in up to 62% of melanomas arising in sun-exposed skin. However, in melanomas arising on mucosal surfaces or non-sun-exposed skin, BRAF mutations are infrequently reported . Previouelanomas \u201318. The lleagues  used a clleagues \u201329. A lilleagues . Our resKRAS mutations are common in pancreas, colon and lung cancers [NRAS mutations are common in myeloid leukemias and cutaneous melanomas [KRAS mutations and one NRAS mutation in 19 melanomas of the female genital tract. In total, 37% of tumors showed either a KRAS or NRAS mutation . As reported previously, the mutations were found to be mutually exclusive. In our study, the prevalence of KRAS mutation in melanomas of the female genital tract was notably higher than melanomas of other sites, whereas the prevalence of NRAS mutation in melanomas of the female genital tract was notably lower compared with the prevalence in melanomas arising in nasal cavity, where mutation rates of up to 45%. Our finding is similar to the published data on esophageal melanomas, which harbored NRAS mutations in 30% of cases [KRAS or NRAS mutation contribute to poor prognosis [According to the literatures,  cancers , whereaselanomas \u201332. Howeof cases . Recurrerognosis .KIT mutations have been observed in varying frequencies in melanomas arising at different primary sites [KIT gene mutations but has been insufficient to predict response to KIT-targeted therapy with imatinib [KIT mutations were observed in 21% (4/19) of the mucosal melanomas of female genital tract. All four tumors with KIT mutations showed strong KIT immunostaining. This finding shows that KIT protein expression correlated with KIT mutation. The frequency of KIT mutation in our series was much higher than rates reported in studies on non-gynecologic melanoma [KIT mutations were associated with histological subtype and tumor site. Notably, recurrent KIT mutations were exclusively detected in vulvovaginal melanomas, but not in tumors arising in the cervix, and KIT mutation varied immensely between vulvar and vaginal sites, with 20% (1/5) of vulvar samples harboring the mutation compared with only 37.5% (3/8) of vaginal samples. This further highlights our conclusion that mucosal melanomas of the female genital tract have a genetic profile that is distinct from that of mucosal melanomas from different anatomical sites. In addition, we found that KIT mutations occurred predominantly in polygonal and epithelioid cell subtypes, but rarely in spindle cells. However, our findings are different from those of Hou and colleagues [KIT mutation rate than vaginal melanoma. The differences between our findings and published studies on KIT mutations in vulvar and vaginal melanomas could be due to the small numbers of samples in our series, different methodology or ethnic difference. It is also possible that vulvar tumors were regarded as melanomas of non-sun-exposed areas. In addition, co-mutations of KIT and NF1 have been reported in mucosal melanoma, although they are rare [NF1 and PDGFRA mutations in melanomas of the female genital tract, as well as in cutaneous melanomas, acral melanomas and melanomas of nasal cavity. I think the small number of samples in our series could account for this discrepancy.ry sites , 20. KITimatinib , 18. In melanoma . Intereslleagues  that shoare rare . HoweverSF3B1 mutations have been identified in subsets of solid tumors, as well as in myelodysplastic syndrome and chronic lymphocytic leukemia [SF3B1 was identified as a significantly mutated gene in mucosal melanoma, especially in uveal, female genital and anorectal melanomas [SF3B1 R625 hotspot mutation occurred in 16% of the mucosal melanomas of the female genital tract and not detected in cutaneous melanomas, acral melanomas and melanomas of nasal cavity. SF3B1 mutations have different prognostic associations in different types of cancers. In uveal melanoma, SF3B1 mutations are associated with a better prognosis, whereas in other mucosal melanomas [SF3B1 mutations are correlated with a worse prognosis [leukemia \u201338. Receelanomas \u201323. Our elanomas , SF3B1 mc-KIT, BRAF, SF3B1, KRAS and NRAS genes compared with non-gynecologic melanoma. Our findings support the notion that gynecologic melanoma is a distinct entity from non-gynecologic melanoma, especially cutaneous melanomas. Although our results are preliminary, they highlight the unique molecular landscape of gynecologic melanoma within the spectrum of melanoma malignancies, and these findings offer insights into future therapeutic options for these patients.We observed that gynecologic melanoma harbored distinct mutation rates in Additional file 1."}
+{"text": "This article studies the evolution of nutritional inequality, measured through the male adult height, in one of the poorest regions of Spain, in southwestern Europe: Extremadura. With a wide sample of statures of recruits born between 1855 and 1979, conscripted between 1876 and 2000, the research delves into the urban-rural height gap using coefficients of variation, tests of equality of means and proxy variables of a socioeconomic nature. The results of the analysis reveal that the strong anthropometric growth that Extremadura experienced since the last decades of the 19th century was accompanied by a less internal inequality. The lower heterogeneity did not eliminate, however, the urban-rural height gap during the period under study. In this sense, despite the absence of environmental differences between urban and rural areas in Extremadura, there was a clear rural height penalty in the region from the mid-19th century to the late 20th century. Rural punishment was fundamentally related to the greater presence of agrarian workers and the lower presence of wealthy families in villages and small towns. On the contrary, educational differences or differences in terms of nutritional health were not as decisive in the rural height penalization, at least when such differences are measured with the sources of military recruitment. The ability of adult height to capture the influence of different factors during childhood and adolescence, in addition to the genetic factor, has made this measure a proxy variable for the biological well-being ,2,3. TheIn the same way, and since adult height synthesizes the socioeconomic conditions in which physical development occurs from birth ,6, statuWithin the distinct determinants of stature inequality, the place of residence and, more specifically, the height gap between urban and rural areas has been one of the facts that has received most attention. This difference has been accompanied by a hypothesis that is not without controversy, the existence of an \u201curban height penalty\u201d because of the industrialization process. The hypothesis of such punishment seems to be particularly true when applied to the first countries in which industrialization took place, the so-called \u201cfirst comers\u201d. For these territories, there is an extensive bibliography showing that in the early stages of the contemporary economic modernization the combination of industrialization and rapid population growth resulted in an urban height penalty and, by contrast, in a \u201crural height premium\u201d ,16,17.Several reasons can explain why the stature of urban dwellers decreased relative to rural statures in the early phases of industrialization . The groIn them, the urban height penalty declined over time and finally the rural premium reversed into a penalization . The impThis general account of an urban height penalization during the 19th century becoming in a rural height penalty in the 20th century is, nevertheless, far from universal . HistoriIn such circumstances, the only thing that seems clear is that, since the Industrial Revolution, there has not been a unique and irreversible evolutionary line in the urban-rural height gap. Nor is there currently a single explanation for the differences that anthropometric historiography has observed in this regard between territories. From the different peculiarities that urban and rural areas acquire in each country or in each region, to the various institutional conditions under which these areas develop, there are many variables that can explain anthropometric gap between the countryside and the city during the last centuries.It is just here, in the geographical diversity that height inequality shows throughout contemporary history, where the present research fits. In it we analyze the case of Extremadura, an extensive Spanish region, located in the southwest of the country, bordering with Portugal . Unlike crisis agraria finisecular (end-of-the-century agrarian crisis) was overcome, the biological living standard in Extremadura, measured through adult stature, began a process of sustained growth that was only slightly interrupted during the 1920s. Such a \u201cleap forward\u201d was accompanied in the region by a progressive reduction in inequality that, however, did not eliminate the anthropometric gap between countryside and city. In this sense, despite the limited environmental differences between urban and rural areas in Extremadura, it was \u201crural height penalty\u201d that dominated the region throughout the period under study. Indeed, it was precisely the rural world that suffered most intensely the crises that the evolution of stature in the region showed from the mid-19th century to the end of the 20th century. The reasons for this punishment are not easy to weigh with the available sources. However, from the tests carried out here, two factors emerge as the most important determinants of the urban-rural height gap in Extremadura: the economic  difference and the social ones. Other variables of an educational or nutritional health nature are analyzed in our study, but none of them is conclusive when it comes to explaining rural height penalization.These results reveal that, once the so-called Actas de Clasificaci\u00f3n y Declaraci\u00f3n de Soldados (henceforth ACDSs) and are the result of the Military Recruitment Law of 1856. With some exception, corrected in 1912, this law established compulsory male military service in Spain and obligation to collect in each town hall of the country the medical and anthropometric information of all recruits called up at each conscription. Since then, until 2001, every year, around the same dates, in each Spanish municipality all young men of legal enlistment age were called for the official recognition. From these annual calls the ACDSs were born. In them, not only the stature is recorded, but also the thoracic perimeter and, since 1955, the weight of each recruit. In addition, they include the filiation, the place of birth and of residence, the level of literacy, and, though not always, the occupation and the economic situation of the conscript\u2019s family. All this qualitative information is very useful to carry out disaggregated analyzes, such as the one proposed here.The height data used in this research come from the so-called The sample used to this article, which we have called Extremadura\u201935, comes from the men conscripted between 1876 and 2000, born between 1855 and 1979, in thirty-five Extremadura\u2019s localities. Some of these municipalities fit perfectly into what demographers call \u201cagro-cities\u201d : absolutIn quantitative terms, the magnitude of the sample drawn from the ACDSs gives statistical robustness to our analysis. Of the 138,231 records gathered for the conscripts born between 1855 and 1979, almost 87%  contains accurate information on the height of each recruit. The remaining 13% is composed mainly of individuals who were declared \u201cfugitives\u201d or \u201calleged fugitives\u201d; those who, residing in municipalities other than that of recognition, were classified as \u201cpending\u201d due to lack of data; the sick youth who were hospitalized or were \u201cin bed\u201d; and those other young men who, while fit for military service, did not attend the act of recognition because they were serving as \u201cvolunteers\u201d in the army.In summary, the sources used for this study collect the results of a universal male conscription that only leaves out of each generation the previous cases of exclusion. It is to say, the average annual height of the conscripts recruited in the thirty-five localities of the sample is also, except for error or omission, the same as that of all the men who, having been born in such entities, reached the legal age of military enrolment. This facet of the ACDSs is statistically important. In some countries, stature data often stem from institutions that imposed a height requirement, minimum and maximum, as a precondition of entrance . ObviousIn Spain, such age was mostly 21 years, just when experts consider that the stage of physical growth in the male population has concluded. However, this age was modified several times throughout the period under study. Extremadura conscripts, for example, were measured at 18 years old in 1996\u20132000, at 19 in 1885\u20131899 and 1991\u20131995, and at age 20 in 1878\u20131884, 1901\u20131905 and 1986\u20131990. Given that in contexts exposed to nutritional stress physical development could exceed the 20-year-old threshold, the sample Extremadura\u201935, like those from the rest of the country, must be corrected standardizing at 21 years the mean height of the recruits conscripted to the 18\u201320 years.50) for the conscripts between the ages of 18 and 21 and, afterwards, add the resulting differences between ones and the others to height of the recruits conscripted before age 21. Previously, however, given that throughout the period under study the average stature of the young men conscripted in Extremadura increased significantly, we have calculated the height differences for two distinct generations: the generation born between 1855 and 1890, conscripted between 1876 and 1911, and the generation born between 1954 and 1982, conscripted between 1975 and 2000 . Based on them, the first series offers the number of valid cases that each cohort comprises, and the mean stature of all recruits born between 1855 and 1979, distinguishing between standardized and non-standardized heights.In the second series, we have segmented our sample by place of residence, making the distinction between urban and rural areas. The criterion used to distinguish one area from other has been the size registered in the Population Census of Spain of 1920 , an inteOur third series of statures attempts identify the determinants of the urban-rural height gap, disaggregating the sample Extremadura\u201935 by professional occupation. To not complicate the analysis, we have distinguished only between agrarian workers and non-agrarian workers. The hypothesis behind this simple classification is that, in poor areas with low nutrient consumption, like Extremadura, the physical effort required by the agricultural and livestock tasks, at least until the mechanization that brought with in the so-called \u201cgreen revolution\u201d since the mid-1950s, may have generated shorter statures in agrarian workers than in non-agrarian ones.The following series of heights uses the professional information provided by the ACDSs to distinguish between recruits who declare to be students and the rest of recruits who claim to exercise a particular occupation. When we speak of students, we are referring specifically to young people who at the time of enlistment are pursuing university studies or, at the very least, secondary education. From this perspective, the social component of the new variable is evident. Not in vain studying a university career in Spain until well into the 20th century has been a difficult luxury to assume for most Spanish families. This fact makes it possible to identify students among the social groups with the highest income and, therefore, with a best access to nutrition, hygiene, and health. It is not by chance that all research carried out so far in Spain coincide in pointing to the students as the tallest of all the conscripts recruited in the course of the 19th and 20th centuries .We complement our four anthropometric series with four more time series constructed from the number of records contained in the sample Extremadura\u201935. The first one shows for each area, urban and rural, the percentage of the recruits who declare working in agrarian sector over the total number of recruits who report on their profession, except those who claim to be students. The objective in this case is to evaluate the extent to which rural areas in Extremadura concentrate a higher proportion of agrarian workers than urban areas. If the difference in proportions between one area and other is maintained over time and if the difference in statures between agrarian and non-agrarian workers is also maintained throughout the period under study, it seems clear that professional activity may be one of the explanatory keys to the urban-rural height gap.The same is true of our second series, disaggregated by place of residence: the proportion of recruits who report being students over the total number of conscripts who declare to exercise a profession. The objective in this case is to try to know to what extent the anthropometric superiority that the specialized literature attributes to the students with respect to the rest of the conscripted population allows us to explain the urban-rural height gap in Extremadura.In the third time series, we distinguish between those recruits who claim to know how to read and write and those who confess not knowing to do it. This educational information does not allow us to know the actual level of literacy achieved at 21 years of age. In fact, some studies cast doubt on the veracity of the opinion of the conscripts and conclude that the functional literacy of the Spanish recruits was generally lower than that indicated in the sources of military recruitment . We thinOur fourth and final series attempts to approximate us, if only superficially, to the differences in nutritional health between urban and rural areas. To do this, we have calculated the proportion of recruits who were excluded from compulsory military service for not reaching the required minimum stature or for suffering from insufficient organic development, that is, physical weakness. This indicator, expressed as a percentage over the total recruits presented for conscription, can be useful to better understand the evolution of adult height, as it captures some of the most obvious consequences of nutritional deficiencies during childhood and youth ,52,53. I50), both well known, we have used the test of equality of means and the coefficient of variation.Regarding the statistical methods used in our analysis, in addition to the average or mean and the 50th percentile (PH0) is that the difference between the compared means is not statistically significant. To interpret the results obtained by SPSS, we must use the criterion \u201cobserved significance level\u201d (sig.). If this value  is less than the significance level at which the test is performed , we must reject the null hypothesis. On the contrary, if said value is greater than the significance level (\u03b1 = 0.05), there are not enough elements in the sample to reject the null hypothesis.The test of equality of means or T-test for independent samples is a procedure that allows to know if the difference between the means of the different groups that contains a variable is statistically significant or is the result of chance. That is, it allows us to know, for example, if the difference between the average stature of recruits living in urban areas and the average stature of those residing in rural areas is statistically significant or random. The test, carried out in our case through the SPSS program, implies a hypothesis test where the null hypothesis (\u03c3) as a percentage of the arithmetic mean (\u03bc):For its part, the coefficient of variation is the most used procedure to measure anthropometric inequality . Its forThe result is easy to interpret: the higher the value of the coefficient, the greater the heterogeneity within the variable, and vice versa.Both for this coefficient and for the rest of the statistics calculated here, we graphically represent the results by birth cohorts and by recruitment cohorts. Given that at age 21 the effects of the environment  on the height are clearly in decline, the specialized literature tends to use the date of birth as a reference for the interpretation of anthropometric series. In the graphic representation of our sample, we follow the same criterion, but adding a secondary horizontal axis with the recruitment cohorts. The objective of this axis is to try to capture the circumstances that may have influenced adult height throughout adolescence .Once standardized, the series of statures built for Extremadura is easy to interpret . After fFor the moment, we stop in height inequality. From this perspective, the evolution of the variation coefficients  reveals This image of relative equality contrasts with the one shown by the comparison between the height of men from urban areas and that of those living in rural ones . From thThe test of equality of means carried out for our sample of statures as a whole reinforces the strength of the urban-rural height gap . With anThe result of our analysis cannot surprise us. We must not forget that we are talking about one of the poorest areas in Europe and, without a doubt, the least industrialized region of Spain. It is true that, according to the occupation data offered by the ACDSs for Extremadura\u2019s recruits, there are visible differences between rural and urban areas in terms of economic structure . Thus, eTo try to answer this question, we resort to the complementary variables extracted from the sample Extremadura\u201935, starting with the one that distinguishes the stature of agrarian workers from that of non-agrarian workers. The hypothesis to be tested is twofold. On the one hand, we intuit that, given the energy expenditure required by countryside tasks, agrarian workers may have generally been shorter than non-agrarian workers, especially in poor areas with low levels of food consumption. On the other hand, we suspect that agrarian workers, that is, the shortest men according to the previous conjecture, are more concentrated in villages and small towns than in cities and large towns. The results of our tests fully confirm such hypothesis. Occupation is not the only variable that could have marked the anthropometric difference between urban and rural areas. For Spain, some studies suggest that while the highest-income social groups are concentrated in urban nuclei, the lowest income groups predominate in rural localities . In ExtrLess conclusive turns out to be the proportion of recruits who claim to be illiterate. In this case, we talk about a variable that not only makes it possible to identify training problems among the recruited population, but also differences in income and access to education among the recruits\u2019 families. In fact, illiteracy continues to be one of the main determinants of malnutrition and poverty in developing countries today . In ExtrNor does the proportion of conscripts excluded from military service for being short or suffering insufficient organic development seems to be of much importance in understanding the urban-rural height gap. Conceived as a proxy for nutritional health, the evolution of this variable over time does not allow the identification of significant differences between urban and rural areas . Since 1In this article, we have studied trends in biological living standard in one of the poorest regions of Spain (Extremadura), delving into the height gap that anthropometric historiography has observed between urban and rural areas. To this purpose, we have worked on a large sample of male statures (Extremadura\u201935) extracted from the sources of military recruitment (ACDSs) conserved in thirty-five Extremadura\u2019s municipalities. The sample comprises the period between 1855 (year of birth of the first recruits in the study) and 2000 (year in which the last recruits of the sample were conscripted). Given that the Spanish military legislation modified the legal age of enlistment several times and given that, according to the experts, the end of the physical growth of the male population can be delayed until after the age of 20, we have standardized our sample of statures at 21 years. To explore the inequality that it contains, we have calculated coefficients of variation, we have made tests of equality of means, and we have built several complementary time series of economic or professional, social, educational, or nutritional health nature.Regarding long-term trends, the results of the analysis leave no room for doubt. Once the end-of-the-century agrarian crisis had been overcome, the male population of Extremadura began a cycle of physical growth that, except during the 1920s, remained practically constant until the last decades of the 20th century. For Extremadura, therefore, as for other regions of Spain, the last decades of the 19th century marked the beginning of what some specialists call \u201cthe great leap forward\u201d .It is difficult to know the specific reasons for this prolonged stretching. Given the wide margin of physical growth of the Extremadura\u2019s young men born in the last third of the 19th century  and in tIn line with other studies, our work also reveals two critical moments for long-term physical growth in Extremadura: the period between 1855 and 1884 and the environmental context related to the First World War, the Spanish Civil War, and the post-war period, which fundamentally affected recruits born in the 1920s. In both cases, the evolution of the mean height of the recruits conscripted in the region shows a clear trend towards stagnation, with annual growth rates of \u22120.01 and 0.01, respectively.For the first nutritional bump, the most convincing explanation is related to the end-of-the-century agrarian crisis, caused by the massive arrival in Europe of primary products from overseas . The criIn the explanation of the second nutritional crisis, less visible in Extremadura than in other areas of Spain, two adverse circumstances converge: the inflation inherited from the First World War and the scarcity derived from the Spanish Civil War and the postwar period. In the first case, the sharp rise in the general price level, especially that of basic foods such as bread, was linked to the rapid expansion of demand by the countries that, unlike Spain, participated in the conflict. The consequent possibility of exporting food at a very good price brought with it in some areas, such as Extremadura, an unusual situation of shortage that raised inflation rates and reduced the purchasing power of the region\u2019s population until well into the 1920s .estraperlo, a market parallel to the official one in which the regulated products reached exorbitant prices [Young people born in these circumstances not only suffered from nutritional problems during childhood, but also reached puberty amid the severe deprivation resulting from the Spanish Civil War and, especially, from the autarchic policies of the 1940s, the so called \u201cyears of hunger\u201d . The reit prices . Hence tt prices .It goes without saying that this combination of perverse circumstances led to a worsening of the nutritional levels of the Extremadura\u2019s society, also, of course, of the recruits who lived the adolescent growth during the decades of 1930 and 1940 ,67. The In terms of inequality, measured through the coefficient of variation, neither the Spanish Civil War nor the postwar period seem to have left too deep a mark on the region. In fact, not even during the end-of-the-century agrarian crisis, a stage in which the statistical dispersion soared, did height inequality reach significant levels in Extremadura. It is more, once the agrarian crisis was ended, the internal heterogeneity of our height sample tended to stagnate and, later, to decline. From this perspective, it should be noted that, unlike some areas of Spain  but in cNor did the urban-rural height gap lose intensity throughout the period under study. In this regard, our analysis reveals, on the one hand, that the conscripts recruited in urban areas were always taller than those measured in rural ones, and, on the other side, that the anthropometric differences between them were always statistically significant. It is clear, therefore, that the urban penalty hypothesis does not work in our height sample. In fact, unlike some other regions in which the urban penalty was replaced by an urban premium since the last decades of the 19th century, the rural punishment in stature was always the predominant trend in Extremadura. Let us see briefly what reasons are behind this regional difference.Regardless of the changes in perspective that the rapid advance of anthropometric research has generated in Spain , today iIn these circumstances, the case of Extremadura is easy to explain. On the one hand, it should be remembered that the Industrial Revolution passed almost on tiptoe through Extremadura . Only sidehesa, a model of agrosilvopastoral exploitation dominated by extensive cattle ranching and rainfed agriculture [If on the industrial side it was difficult to suffer urban height penalty in Extremadura, on the agriculture side it was also practically impossible to enjoy a rural premium. With almost more intensity than in the rest of Spain, the predominance of large estates in the region and the concentration of land ownership in very few hands have historically been the main characteristics of Extremadura\u2019s agriculture . These ticulture . SingulaIt should be pointed out on this regard that in Extremadura, as in the rest of deindustrialized Spain, the green revolution rapidly raised the productivity of labor in the farms in the region. The consequent departure of surplus labor abroad  or to other areas of the country  originated a process of \u201cartificial biological selection\u201d that left in the rural world to the weakest part, anthropometrically speaking, of the male rural population . The migOther factors, in addition to the agrarian and industrial backwardness, can explain the forceful of this rural height penalization. As in many other areas of Spain, Extremadura cities were not only less industrialized and less populated than those of other European regions, but they were mostly residential and administrative areas. In them lived the social elites, the emerging middle classes and the bulk of industrial workers, artisans, merchants, and service sector personnel. Definitely, a whole range of social and professional groups that normally had family income that maximized the quality of nutrition . In mostOn the contrary, in rural areas there were high levels of poverty and malnutrition. It is true that the rural population enjoyed some advantages in terms of biological well-being by living in a more favorable environment and having easier access to sources of nutrients. However, a large part of the people who lived in the countryside remained oblivious to the provision of basic infrastructures, such as health or education, until well into the 20th century. In fact, the Spanish rural population was not covered by health public services until the 1960s . On the In our study we have delved only into those factors for which the ACDSs offer reliable information: economic, social, educational, and health factors. From an economic perspective, we have used the data offered by this source on the occupation of the recruits. Starting from the idea that the greater physical effort traditionally required by the agricultural and livestock tasks makes agrarian workers shorter than non-agrarian workers, we have compared the average stature of these two groups of professionals. The results of the comparison are quite conclusive. The anthropometric difference between ones and the others is maintained throughout the entire period under study and is also statistically significant. Therefore, and given that the countryside hosts a higher proportion of agrarian workers than the city during the period under study, it can be concluded that an important part of the rural height penalty that persists in Extremadura since the mid-19th century is due to the anthropometric penalization suffered agrarian workers with respect to non-agrarian ones.From a social perspective, the hypothesis to be tested is that the higher-income groups and, therefore, those with greater access to nutrition, education, and health preferably live-in urban areas. Among the little information that the ACDS offers in this regard is that which distinguishes the students from the rest of the recruits who declare to exercise a profession. It should be remembered that when we speak of students, we are speaking mainly about university students. For their families, this situation historically implied a high social am economic level. Not only because, while a young man was studying, he did not contribute income to the family, but because until the extension of public grants during the last decades of the 20th century the expenses of a student could be truly considerable. Let is think not so much in terms of study material, but above all in terms of accommodation costs. It should be considered that high schools were preferably located in urban areas and that until 1973 there was no university in Extremadura, so young people who wanted and could study a university degree had to do so outside the region, generally in Madrid, Salamanca, or Seville.Therefore, if we understand the student population as a proxy variable of social status, we must conclude that the hypothesis that links the rural height penalty with a lower presence in rural areas of social elites seems to be true in Extremadura. Not by chance, our analysis confirms that the students were by far the tallest of all the young men recruited in the region since the mid-19th century. The research also reveals that the proportion of students living in urban areas was not only higher than that of students living in rural ones, but that this difference increased after the Spanish Civil War. From this perspective, the importance of social inequality as a determining factor of the urban-rural height gap in Extremadura acquires a dimension that other proxy variables such as the illiteracy rate prevent us from perceiving. When looking for the causes that explain why men living in rural Extremadura were always shorter than urban dwellers, we must focus mainly on profession and on social status.Different is conclusion raised by the information that the ACDSs offer on alphabetization, information that, very cautiously, can be also considered as a proxy variable of socioeconomic status. It should be noted in this sense that literacy can be understood as the ability to access knowledge , a definAnd what about nutritional health? Is it not a decisive factor for physical growth and, therefore, to understand the differences in stature observed between urban and rural areas? The specialized literature maintains that it is, but our data do not allow us to confirm it. Such data, prepared from the information offered by the ACDSs on the recruits who were excluded from compulsory military service for being short in stature or for suffering from insufficient organic development, confirm the nutritional deficiencies of the last decades of the 19th century in Extremadura, but they do not mark significant differences between urban and rural areas. We must remember in any case that these data cannot be considered indicators of malnutrition in the strict sense. Therefore, it is advisable to be careful when trying to weigh the incidence of nutritional health over the urban-rural height gap with proxy variables that may be debatable.From this perspective, one last methodological consideration must be made. With the sources of military recruitment in hand, it is more than tempting to try to build other more powerful health indicators. It should be noted in this regard that the ACDSs also provide individualized information on illnesses or physical problems that recruits claim to suffer in order to be excluded from compulsory military service. These diseases range from mental disorders to bone problems, through pathologies related to sight, ears, stomach, intestines, and a long etcetera. So, what is the problem? The problem is that very few times, diseases that are related to nutrition or that have clear effects on physical growth are indicated in the ACDSs. Once again, therefore, prudence must be imposed while waiting for specific epidemiological studies to allow us to know whether rural height penalty obey a state of health inferior to that of the urban world.Starting from the idea that adult stature is a good indicator of the biological standard of living, this article delves into nutritional inequality, more specifically in the open debate within anthropometric historiography on the urban-rural height gap. For this, the present study uses a wide sample of statures extracted from the sources of military recruitment conserved in thirty-five municipalities of Extremadura, one of the poorest regions in Europe and the least industrialized of all Spain. The height sample, called Extremadura\u201935, comprises the period between 1855 (year of birth of the first recruits of the sample) and 2000 (year of conscription of the last recruits that our sample of statures includes). It is thus situated in the middle of the broad spectrum of improvements that have accompanied to contemporary social and economic modernization, among them, of course, the epidemiological and nutritional transition.The combination of these processes of change, together with the slow but important socioeconomic improvements experienced by Extremadura since the last decades of the 19th century, explains the powerful physical growth registered by the male population conscripted in the region during the period under study. Only two critical moments seem to have slowed down this spectacular increase in adult stature: the period between 1855 and 1884 and the period between 1920 and 1929. The first of them is defined in Extremadura by the scarcity generated by the last subsistence crises of the 19th century, especially those caused by the so-called end-of-the-century agrarian crisis. In the second period, less dramatic in anthropometric terms than in other regions of Spain, the nutritional deficiencies inherited from the First World War converge with the deprivations suffered by those who go through the adolescent growth during the Spanish Civil War and the postwar period.Only for the first of the two indicated moments, our study reveals a substantial increase in height inequality, at least as measured by the variation coefficients and considering the small margin of heterogeneity shown by such coefficients for Extremadura. From this perspective, the conclusion derived from the present research is that in the long term there is an inverse relationship between physical growth and anthropometric inequality. In other words, the greater the growth in stature, the less height inequality. This general conclusion contrasts with those extracted from other studies carried out in Spain, but in no case does it deny the existence of an anthropometric gap between urban areas (cities and large towns) and rural ones .From this other way of analyzing nutritional inequality, our study clearly demonstrates that it was the rural height penalty and not the urban penalization that predominated in Extremadura from the mid-19th century to the late 20th century. It is more, the analysis carried out here confirms that it was the population living in villages and small towns in the region that suffered most intensely the severe consequences of the end-of-the-century agrarian crisis and, to a lesser extent, the effects of the First World War, the Spanish Civil War, and the postwar period.There are many factors that can explain this rural punishment, both in Extremadura and in most of Spain. On the urban side, it is worth highlighting: the lower overcrowding and pollution of Spanish cities compared to the more industrialized countries, the greater presence in such areas of the higher-income social and professional groups, the better access to educational and health services and, even, the existence of more efficient systems of conservation and distribution of food. On the rural side, no one denies some advantages, such as greater environmental health and easier and faster access to sources of nutrients. More important, however, are the disadvantages with respect to the urban world, especially the difficulty of access to basic health, education, or welfare infrastructures, as well as the preponderance of the agrarian population, generally of lower income and forced to develop a greater physical effort than that of the non-agrarian population.In the case of Extremadura, there are also specific historical conditions that reinforce the rural penalization in terms of the biological well-being. Not in vain do we speak of a never industrialized region that not only did not generate massive exoduses from the countryside to the city within the region, but additionally fueled strong migratory movements to other territories since the mid-1950s. Until then, in addition, the agrarian sector was characterized in Extremadura by limited technical improvement and very low productivity. This lack of innovation, together with a highly concentrated distribution of land ownership, has historically favored the proletarianization of the peasant family and the persistence of low per capita income. We are therefore faced with an economic, technical, and institutional structure incapable of substantially raising the nutrition levels of most of the rural population.With this background, our research delves into the determinants of the rural height penalty that the sources of military recruitment show for Extremadura. These same sources seem to contain two of the explanatory keys for such penalization: the professional structure and the social composition of the villages and small towns in the region. Regarding the professional structure, our study confirms the hypothesis that, in areas with a low nutritional level, like Extremadura, the physical effort required by the tasks of the agriculture and livestock keeps the average statures of the agrarian population below the mean of the non-agrarian population. In the same way, this research reveals that, despite the importance that the agrarian population acquires in the so-called agro-cities, in Extremadura it is in rural areas where a greater proportion of agrarian workers are concentrated. Despite the progressive loss of importance suffered by farming activity in the region since the beginning of the 20th century, this proportional difference is maintained throughout the period under study. Everything therefore seems to indicate that one of the reasons that explain the persistence of the urban-rural height gap in Extremadura since the mid-19th century is the prevalence in rural areas of a labor (economic) structure that generates shorter statures than those of urban areas.Concerning the social composition of villages and small towns, we only have indirect information from the sources of military recruitment. The best data on this regard are the ones that makes it possible to distinguish students, generally university ones, from among recruits who declare exercising a certain profession. Studying a university career in Spain has historically been a luxury available to very few families. In fact, all the investigations carried out so far in the country coincide in pointing out the students as the tallest among the conscripted population. This is an evident proof that students have traditionally belonged to the families with the highest incomes and, consequently, with better access to nutrition, hygiene, and health. In the specific case of Extremadura, our research reveals that students were the highest of all recruits conscripted in the region since the last decades of the 19th century. The article additionally reveals that the proportion of students residing in rural areas was also always lower than that in urban areas. The conclusion, therefore, seems clear: the lower presence of the more affluent families of society in villages and small towns is another reason that explains the persistence of the rural height penalty in Extremadura since the mid-19th century.The social factor does not exhaust the list of factors that can explain the existing nutritional gap in Extremadura between the countryside and the city. The problem is that the sources of military recruitment do not allow us to go much further. It is true that these sources do contain enough information to test, for example, the incidence of education, more specifically literacy, in this urban-rural height gap. In fact, previous research has shown that literate recruits have always been taller than non-literate ones. In the present article we have tried to go a little further by measuring the proportion of illiterates in urban and rural areas. The results, however, are not conclusive. According to them, there are only significant differences between one area and other until the beginning of the 20th century. From the mid-1880s, however, the proportion of illiterates residing in both urban and rural areas has not stopped falling. Given that in the meantime the urban-rural height gap has remained active, it is difficult to argue that the educational factor is a determining factor in the persistence of such a gap.The same is true of the variable used here as an alternative measure of nutritional health: the proportion of recruits who were excluded from military service for being short or suffering physical weakness. Expressed as a percentage of the total number of recruits presented in each recognition act and disaggregated down by place of residence, this proxy variable draws a trajectory that is hardly compatible with the rural height penalty experienced by Extremadura since the mid-19th century. First, because it does not allow to identify significant differences between cities and large towns on the one hand and villages and small towns on the other. And, secondly, because since the mid-1890s this proxy variable begins a sustained decline in both areas that ends up dissolving over time despite the persistence of the rural height punishment.In short, our study confirms the relevance of economic and social factors for the analysis of rural penalization. It also reveals that the sources of military recruitment do not allow to ratify the importance of education or nutritional health in the study of such penalization. In no case does our research attempt to deny the, on the other hand, demonstrated incidence of both variables in the evolution of the biological standard of living. What it denies is the possibility of considering them as determining factors of the urban-rural height gap that Extremadura, like so many other regions of Spain, has suffered since at least the middle of the 19th century."}
+{"text": "FH gene can develop into aggressive renal cell carcinoma (RCC). We report the case of a 27-year-old man who died of RCC. Genetic testing revealed a novel pathogenic variant of FH, NM_000143.3:c.1013_1014del (p.Ile338Serfs*3), that was also identified in healthy siblings. Identification of genetic causes in the proband helped us to provide relatives with precise genetic counseling and appropriate surveillance programs.Hereditary leiomyomatosis and renal cell carcinoma caused by loss-of-function germline variants of the  More than 300 families with HLRCC have been reported to date, although the condition may be underdiagnosed3. Loss-of-function germline variants of the FH gene, which is located on chromosome 1q43 and encodes fumarate hydratase, cause HLRCC4. The incidence of RCC in FH pathogenic variant carriers is estimated to be approximately 15\u201320% with a median age of onset of 35\u201344 years6; however, a substantial number of FH pathogenic variant carriers can develop RCC at a very young age. Actually, a case of a seven-year-old boy with HLRCC-associated RCC was recently reported7. Histologically, these renal tumors are characterized by a unique type 2 papillary architecture but can also have a variety of patterns, such as cystic, tubular, solid, or mixed patterns8. HLRCC-associated RCC is typically aggressive and metastatic, and most patients with this type of RCC are at an advanced stage at the time of diagnosis. Thus, surveillance and early detection are of great importance9. Herein, we report a familial case of HLRCC caused by a novel pathogenic variant of FH.Hereditary leiomyomatosis and renal cell carcinoma (HLRCC) is a newly emerging hereditary tumor syndrome with an autosomal dominant inheritance pattern characterized by cutaneous leiomyoma, uterine leiomyoma, and renal cell carcinoma (RCC)A 26-year-old Japanese man was admitted to our hospital with right inguinodynia and motor dysfunction of the right lower limb. His medical history was unremarkable. Notably, his mother died of cancer of unknown primary origin at the age of 41 years, nine years before his admission. She had pelvic tumors with multiple metastatic lesions in the lungs, skin, left kidney, and vertebra. Malignant transformation of uterine leiomyomas was suspected, but an accurate assessment of the primary origin was not provided. The patient\u2019s maternal grandfather died of pulmonary adenocarcinoma at the age of 74 years, and none of the other family members had HLRCC-associated episodes Fig. .Fig. 1PeOn admission, the patient\u2019s laboratory tests were normal, except for mildly elevated levels of C-reactive protein (0.69\u2009mg/dL) and lactate dehydrogenase (617\u2009U/L). He did not develop any cutaneous manifestations. Enhanced computed tomography scanning revealed a solid mass measuring approximately 60\u2009mm in the left kidney and an adjacent paravertebral tumor Fig. , coupledFH gene in the patient, thereby confirming the diagnosis of HLRCC-associated RCC. A multiplex ligation-dependent probe amplification (MLPA) assay revealed no copy number changes in FH (data not shown).Given the early onset of cancer with an aggressive phenotype in the patient as well as his mother, we proceeded to conduct genetic investigations as described in the Supplementary Methods after providing genetic counseling and obtaining written consent. Germline multigene panel testing identified a novel heterozygous frameshift variant NM_000143.3:c.1013_1014del (p.Ile338Serfs*3) in the 10. Immunohistochemistry for FH revealed minimal staining  has hitherto not been reported. The variant is predicted to cause a frameshift in exon 7 of the FH gene, which can result in truncation of downstream amino acids. Of note, analysis of the somatic mutations of the tumor did not reveal any other pathogenic variants in the FH gene but revealed an LOH pattern. Specifically, the wild-type allele was lost, and the germline variant was retained. The occurrence of such an LOH event in the FH gene, which is frequently observed in HLRCC-associated RCC11, would be of substantial importance, thereby confirming that Knudson\u2019s two-hit theory for tumor suppressor genes can be applied to FH. Of note, the minor existence of the wild-type allele in the tumor (Fig. The identified germline mor Fig.  was thouFH in a family with HLRCC. Identification of an underlying genetic cause in the patient helped us to provide family members with precise genetic counseling based on proper assessment of the genetic risk and appropriate surveillance programs in the future. Considering the documented childhood onset and aggressive phenotype of HLRCC-associated RCC, genetic testing and early intervention are crucial for at-risk family members of HLRCC.In summary, we report a novel pathogenic variant of The relevant data from this Data Report are hosted at the Human Genome Variation Database at 10.6084/m9.figshare.hgv.3116.Supplementary Information"}
+{"text": "The molecular profiling of glioblastoma (GBM) based on transcriptomic analysis could provide precise treatment and prognosis. However, current subtyping  is time-consuming and cost-intensive hindering its clinical application. A simple and efficient method for classification was imperative.In this study, to simplify GBM subtyping more efficiently, we applied a random forest algorithm to conduct 26 genes as a cluster featured with hub genes, OLIG2 and CD276. Functional enrichment analysis and Protein\u2013protein interaction were performed using the genes in this gene cluster. The classification efficiency of the gene cluster was validated by WGCNA and LASSO algorithms, and tested in GSE84010 and Gravandeel\u2019s GBM datasets.p\u2009=\u20090.0051 for training cohort, p\u2009=\u20090.065 for test cohort).The gene cluster (n\u2009=\u200926) could distinguish mesenchymal and proneural excellently (AUC\u2009=\u20090.92), which could be validated by multiple algorithms  and datasets (GSE84010 and Gravandeel\u2019s GBM dataset). The gene cluster could be functionally enriched in DNA elements and T cell associated pathways. Additionally, five genes in the signature could predict the prognosis well (Our study proved the accuracy and efficiency of random forest classifier for GBM subtyping, which could provide a convenient and efficient method for subtyping Proneural and Mesenchymal GBM.The online version contains supplementary material available at 10.1186/s12967-021-03083-y. Glioblastoma (GBM) is the most common malignant primary brain tumor. The past decades have witnessed considerable advances in neurosurgery and radio-chemotherapy but limited survival benefits . Many efMany genomic and epigenetic biomarkers for gliomas have been found in situ or blood \u20137. SpeciTo this end, we employed random forest, a machine-learning algorithm developed by Breiman . Random-The current study aims to establish a gene cluster that could distinguish different molecular subtypes suitable for clinical application. Gene cluster featured with hub genes of OLIG2 and CD276 from our analysis will be conducted to distinguish molecular profiles.http://gliovis.bioinfo.cnio.es/). Clinical information and RNA-seq data of GSE84010 were downloaded from Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE84010). All data were normalized for following analysis. Samples whose molecular classification are not available were excluded.Clinical information and array expression data of TCGA-GBM and Gravendeel were downloaded from Gliovis . A random number table generated by R 3.6.3 randomly assigned 70% of the patients to the training cohort (n\u2009=\u2009342) and 30% to the validation cohort (n\u2009=\u2009147).http://bioinfo.life.hust.edu.cn/ImmuCellAI#!/). ImmuCellAI can predict the abundance of 24 immune cell types in samples through a gene set signature-based method. The difference of immune cell infiltration in diverse groups was analyzed with the Immune cell abundance in groups [The immune infiltration analysis was conducted by ImmuCellAI, a website tool  was set as 3000, and the max features (mtry) were set as 3. After every training, the input genes were ordered according to their importance, reflected by mean decreased accuracy and Gini. Genes whose mean decreased accuracy and Gini lower than OLIG2 and CD276 are excluded from the candidate genes until all genes were not lower than OLIG2 and CD276 in the form of mean decreased accuracy and Gini.https://github.com/vqv/ggbiplot), and every gene is displayed in the coordinates with arrows from the origin.Principal component analysis (PCA) based on the transcription matrix was performed using the R package \u201cggbiplot\u201d .The protein\u2013protein interaction (PPI) data were downloaded from String (protein\u2013protein interaction). Furthermore, the web plot was performed by the R package \u201cigraph\u201d .In order to find the predictive value of the individual genes, the proportional hazards (Cox) model was conducted. The results were summarized in forest plots and 2-dimension plots to show the risk factor for both PFS and OS. Calculations and graphing were conducted with the \u201csurvminer\u201d and \u201cggforest\u201d packages in R (https://cran.r-project.org/web/packages/glmnet/). LASSO calculated the risk score based on the gene expression level and regression coefficients.To explore the prognosis predictive significance of the gene cluster, we conducted the most minor absolute shrinkage and selection operator (LASSO) with the \u201cglmnet\u201d package in R . In comparing OLIG2hi/CD276lo and OLIG2lo/CD276hi, immune infiltration score differs, especially in CD4 na\u00efve cells, cytotoxic cells, Th1 cells, central memory cells, macrophage cells, neutrophil cells, Gamma delta cells, and infiltration score , both of which favored expression in proneural and mesenchymal expression subtypes. Therefore, we suppose that the two biomarkers, OLIG2 and CD276, represent two tendencies or subtypes of GBM, resulting in different expression profiles and prognosis status. Thus, through the identification of the two biomarkers, we can predict prognosis. Since these genes are potential biomarkers for some unique subtypes, target drugs can be administrated accordingly.In the process of WGCNA analysis, we found some contradiction with the results of PCA analysis. In detail, OLIG2 belonged to Proneural-module and MEturquoise, which is in high expression in mesenchymal but in low expression in proneural. The bias of the model is not elusive to explain this mismatch. The mesenchymal-proneural transition might result in this phenomenon, based on the evidence that increased OLIG2 expression is considered a biomarker of mesenchymal-to-proneural transition (PMT). We also hypothesize that OLIG2 represented the expression subtype and might be a driver gene of the biological transition process. Loss of OLIG2 function in GSCs resulted in mesenchymal transformation, which indicates OLIG2 plays a vital role in PMT . It is kAlso, there are some limitations in this study. The sample size of the training cohort is small. As a result, our random forest algorithm-generated fewer decision trees to avoid overfitting, which might miss some essential genes. Another drawback is that, we did not take inter-tumor and intra-tumor heterogeneity into consideration when applying the random forest algorithm. Moreover, in order to obtain a simplified gene panel, a small number of genes were obtained. The weak association of a small number of genes leads to the low significance of the functional enrichment analysis, which might miss critical pathways. Furthermore, we found it is difficult to distinguish the neural subtype from the classical one, which is confirmed in other validation studies. The previous study based on a similar random forest method also found it challenging to distinguish neural subtypes . The pheIn conclusion, the random forest algorithm is proved efficient in the multi-classification of GBM expression subtypes, which would pave the way for precision medicine. With the development of sequencing, the combination of machine learning and next generation sequencing is likely to play an essential role in the diagnosing and predicting of GBM.Additional file 1: Fig. S1. The immune infiltration score in CD276hi/OLIG2lo and CD276lo/OLIG2hi groups. .Additional file 2: Fig. S2. The survival curve of TCGA, GSE84010, and Gravandeel\u2019s dataset according to the three-subtype classifications ."}
+{"text": "Autism Spectrum Disorder (ASD) is a set of neurodevelopmental disorders characterised by behavioural impairment and deficiencies in social interaction and communication. A recent study estimated that 1 in 89 children have developed some form of ASD in European countries. Moreover, there is no specific treatment and since ASD is not a single clinical entity, the identification of molecular biomarkers for diagnosis remains challenging. Besides behavioural deficiencies, individuals with ASD often develop comorbid medical conditions including intestinal problems, which may reflect aberrations in the bidirectional communication between the brain and the gut. The impact of faecal microbial composition in brain development and behavioural functions has been repeatedly linked to ASD, as well as changes in the metabolic profile of individuals affected by ASD. Since metabolism is one of the major drivers of microbiome\u2013host interactions, this review aims to report emerging literature showing shifts in gut microbiota metabolic function in ASD. Additionally, we discuss how these changes may be involved in and/or perpetuate ASD pathology. These valuable insights can help us to better comprehend ASD pathogenesis and may provide relevant biomarkers for improving diagnosis and identifying new therapeutic targets.  A vast number of microbes including bacteria, fungi, archaea and viruses coexist in the human body. These microorganisms mostly colonise the intestinal tract and are known as the gut microbiota . Among iAutism Spectrum Disorders are a set of neurodevelopmental disorders diagnosed early in childhood. However, they are often misdiagnosed or undiagnosed due to the subjectivity of the diagnostic methodologies, the heterogeneity of symptoms, and the lack of specific biomarkers . The diaIndividuals affected by ASD are a heterogeneous group with differences in symptoms and prevalence of developing comorbid medical conditions. However, intestinal problems are often present in these patients, which may reflect aberrations in the bidirectional communication between the brain and the gut ,15. FurtThe identification of potentially relevant articles for this review was conducted using three electronic databases . Our search strategy included a combination of keywords and MESH terms together with \u201cAND\u201d or \u201cOR\u201d. Several key terms that were employed include Autism Spectrum Disorder, ASD, metabolism, metabolites, microbial metabolites, gut bacteria, microbiota, microbiota composition, human study, animal study, among others. Over a hundred articles, published over the years, were reviewed. The final selection includes articles published between 2002 and 2020 that are presented in The interaction between brain and intestine, often referred to as the \u201cgut-brain axis\u201d, is highly complex and potentially involves multiple  communication pathways, including roles for the immune and entero-endocrine system, but also metabolic and neuronal communication via the enteric nervous system (ENS) . MoreoveRecent studies have shown the impact of the gut microbiota in brain development, behavioural function as well as blood\u2013brain barrier (BBB) integrity ,24,25,26In previous years, the main pathways that describe the relationship between microbiota, gut and the nervous system were thoroughly reviewed ,30,31,32In a healthy state, a balanced relationship exists between bacterial communities that colonise the gut and other organs of the host . DysbiotHighly diverse gut microbiota is thought to promote the host\u2019s health . ConversBacteroidetes and Firmicutes are two phyla that compose around 90% of the total bacterial species present in the human gut . PerturbBifidobacterium , Prevotella  and Akkermansia  were reported to be associated with ASD. On the other hand, the presence of specific Clostridia species  was also reported to be linked to ASD [At the genus level, multiple bacterial abundances have shown discrepancies when comparing individuals diagnosed with ASD to healthy children . Lower pd to ASD ,55,56,57Gut microbes have a vast genome, thus metabolic functions, which makes them key modulators of health and disease . It is cThe interaction between human gut microbiota and host metabolic function has been extensively investigated, however, the exact mechanisms are not fully understood. A major limitation of this field of study is to differentiate between host and bacterial metabolism. Currently, in silico techniques that build metabolic networks to study the gut environment are becoming popular . The metHost metabolic changes influenced by gut bacteria in ASD have been linked to oxidative stress, mitochondrial dysfunction, genetic expression changes, immune dysfunction and neural abnormalities such as BBB permeability, microglia activation, altered neurotransmitter production and synaptic dysfunction . InvestiSCFAs, mainly acetate, propionate and butyrate, are by far the most investigated bacterial-produced metabolites involved in health and disease. These bioactive compounds influence the host in several ways; some of their biological activities are: (i) the source of energy for intestinal cells, (ii) the production of hormones that regulate hunger/satiety homeostasis, (iii) the modulation of the immune system, (iv) the stimulation of gut motility and epithelial barrier integrity, and (v) the impact on brain development and social behaviour ,91,92,93In ASD, SCFA analyses from urine, faecal and caecal samples have provided controversial results, thus their exact relation in the disease\u2019s pathophysiology remains to be elucidated. Two studies showed lower quantities of acetate, propionate and butyrate measured in faeces from autistic children when compared to healthy controls ,41. On tPrevotella, Bifidobacterium and Ruminococcus genera [Lachnospiraceae and Ruminococcaceae families [Bacteroides and Prevotella) and from Firmicutes phylum , among others [Acetate is the most abundant SCFA circulating in the colon and bloodstream and is produced by a vast number of anaerobic bacteria including some species from s genera . Althougs genera . In addis genera . Lower ls genera ,41,44. Os genera ,66,70. Sfamilies . Besidesfamilies . Epigenefamilies . SCFA anfamilies ,58,70, afamilies ,41. Propfamilies , althougfamilies . It is ifamilies . Propiong others . Propiong others ,103. Theg others ,70 or deg others ,41 compaAltogether, excessive amounts of SCFAs like propionate affect a multitude of molecular processes including signalling processes, epigenetic changes, barrier integrity, immune function and neurotransmitter synthesis and release ,105. AnoAlthough the research on the role of SCFAs in host health has been thoroughly investigated and there are relevant data, there is little consensus on the role of SCFAs in neurological diseases such as ASD. Besides the production of SCFAs in the colon, which contains the largest microbial population within the gut, other important bioactive metabolites such as succinate, pyruvate or lactate are produced from carbohydrate metabolism . For exaIn the distal colon, numerous bacteria have the ability to ferment proteins and amino acids derived from diet and protein turnover which are essential for their growth . Bacteripara-cresol  levels are higher in both urinary and faecal samples from children with ASD [Clostridia class [Multiple compounds from tyrosine and phenylalanine-derived bacterial metabolism were shown to be at abnormal concentrations in individuals affected by ASD compared to healthy controls. In particular, tyrosine-derived with ASD ,67,73,80ia class . It is tia class . p-Cresoia class . Interesia class . One of ia class . Anotheria class ,121. TheDopamine, norepinephrine and epinephrine are derived products from the metabolism of phenylalanine . In a reClostridia species (main producers of phenylpropionic acid) [Several metabolites produced in multiple steps, including bacterial and host metabolites of phenylalanine, were found to be increased in the urine of autistic children. Some of these metabolites were phenylpropionic acid and its derivative, 3-(3 hydroxyphenyl)-3 hydroxypropionic acid (HPHPA) ,68,77. Iic acid) . It is kic acid) ,130. \u03b2-eic acid) . Accordiic acid) ,132. Tph1 gene in the intestine [Tph1 expression [Tryptophan can enter the three following metabolic pathways: (i) serotonin pathway, (ii) kynurenine pathway, and (iii) gut bacterial metabolism , see Figntestine . Additiopression . Some stpression ,142. Gut microbiota plays an important role in regulating the availability of circulating tryptophan . In partBdnf expression in the brain [In ASD, increased BBB permeability, which has been related to gut dysbiosis, possibly allows the pass of kynurenine-derived metabolites such as kynurenic acid and quinolinic acid. These two compounds are an antagonist and an agonist of the N-methyl-D-aspartate receptor (NMDAR), respectively . The NMDhe brain . BDNF anhe brain ,150. Aryhe brain . Furtherhe brain . Balancehe brain , includihe brain .Escherichia and Clostridium species, is converted into 3-indoxylsulfate in the liver to be further excreted in urine [Besides the serotonin and kynurenine pathways, tryptophan can be converted into multiple indolic compounds by intestinal bacteria . Indole in urine . The metin urine . In chroin urine ,163. Olein urine . In addiin urine . HoweverAbnormal glutamate metabolism leads to neural dysfunction and seems to play an important role in ASD pathogenesis. Glutamate is tightly involved in neurotransmission and redox processes. \u03b3-Amino butyric acid  and glutamate are responsible for inhibitory/excitatory signalling leading to brain dysfunction . RegardiMoreover, glutamate is a precursor of glutathione (GSH) whose main function is to regulate redox metabolism acting as an antioxidant compound in the host. GSH is converted into glutathione disulfide (GSSG) that in turn can be reduced to GSH. In the brain, its pivotal role counteracts the excess of reactive oxygen species (ROS) and therefore avoids the alteration of other host processes such as neuronal damage and loss . GSH insBile acid metabolism is involved in health and disease considering that it is essential for immune function homeostasis and lipid metabolism . Primaryacc1 and fas, is mediated by gut microbiota [Gut bacteria also alter the metabolism of fatty acids, phospholipids and vitamins mediated by the production of secondary bile acids. Opposed to T helper cells  that obtain energy from glucose metabolism, T regulatory cells rely on fatty acid oxidation . Abnormacrobiota . Moreovecrobiota . Alteredcrobiota . Specificrobiota ,178. It crobiota . OverallTo date, there is no specific treatment designed for ASD and the pathophysiology is still unclear. Current evidence indicates that the gut microbiome can trigger and/or exacerbate the disease through bacterial metabolite production. Therefore, a better understanding of the microbiome-related metabolites and their role in the gut\u2013brain axis might bring new insights into ASD pathology progression, as well as lead to new therapeutic approaches. More specifically, promoting a \u201chealthy\u201d gut microbiota might be a promising avenue for improving ASD symptomatology. Recent studies using faecal microbiota transplantation or dietary interventions for ASD treatment showed promising results . Kang etThe first step towards this goal is understanding the mechanisms that drive microbiome composition and function, including the interactions of species with the environment (the diet) and with each other, which are still poorly understood. Recent experiments are showing the critical role that metabolic traits play in the assembly of microbial communities and the maintenance of their diversity ,186,187.In particular, new metabolic modelling platforms such as COMETS  allow the simulation of microbial communities with thousands of species in ecologically realistic settings, e.g., mimicking natural environments such as the gut . This paMany gut bacteria-derived metabolites are altered in ASD; however, more in-depth studies are essential to demonstrate the (causative) role of these metabolites in ASD. Besides the research centred on the gut microbiome and its function, a second, important line of research will require us to understand precisely how microbiome-derived metabolites interact with the host. More specifically, we need to understand how it compromises the maintenance of intestinal homeostasis, and how it contributes to neurodevelopmental disorder susceptibility. Overall, achieving the goals of understanding the composition and function of the gut microbiome and its interaction with our own body holds great promise for a successful design of treatment for ASD and might allow us to identify specific biomarkers for improving diagnosis and identifying new therapeutic targets."}
+{"text": "Large mammalian herbivores use a diverse array of strategies to survive predator encounters including flight, grouping, vigilance, warning signals, and fitness indicators. While anti-predator strategies appear to be driven by specific predator traits, no prior studies have rigorously evaluated whether predator hunting characteristics predict reactive anti-predator responses. We experimentally investigated behavioral decisions made by free-ranging impala, wildebeest, and zebra during encounters with model predators with different functional traits. We hypothesized that the choice of response would be driven by a predator\u2019s hunting style  while the intensity at which the behavior was performed would correlate with predator traits that contribute to the prey\u2019s relative risk . We found that the choice and intensity of anti-predator behaviors were both shaped by hunting style and relative risk factors. All prey species directed longer periods of vigilance towards predators with higher capture success. The decision to flee was the only behavior choice driven by predator characteristics (capture success and hunting style) while intensity of vigilance, frequency of alarm-calling, and flight latency were modulated based on predator hunting strategy and relative risk level. Impala regulated only the intensity of their behaviors, while zebra and wildebeest changed both type and intensity of response based on predator traits. Zebra and impala reacted to multiple components of predation threat, while wildebeest responded solely to capture success. Overall, our findings suggest that certain behaviors potentially facilitate survival under specific contexts and that prey responses may reflect the perceived level of predation risk, suggesting that adaptive functions to reactive anti-predator behaviors may reflect potential trade-offs to their use. The strong influence of prey species identity and social and environmental context suggest that these factors may interact with predator traits to determine the optimal response to immediate predation threat. When encountering a predator, prey can perform a number of different behaviors to survive or mitigate a possible attack , 2. ThesEudorcas thomsonii), which employ stotting and other honest signals of fitness when facing coursing predators but react to ambush predators using alarm cues and predator inspection ) . When co 9.377])  whereas  9.377]) . Impala  9.377]) . Wildebe 9.377])  and were 9.377]) . Zebra,  9.377])  and rema 9.377]) .Social and environmental context modulated the intensity of anti-predator responses across all species . Alarm-cSystematic evaluation of reactive anti-predator responses to predator functional diversity allows us to refine our frameworks for understanding how predators shape prey behavior. We had predicted that choice of anti-predator response would be driven by predator hunting style whereas the perceived level of predation risk would influence the intensity at which the response was performed. Instead, we found that predator hunting style, success rate, and prey preference all played a role in determining overall risk-mitigation strategies of impala, wildebeest and zebra. Capture success was the only trait that elicited a universal response (increased vigilance) across species. Otherwise, prey reacted to aspects of predation threat in distinct ways. Impala performed the same suite of behaviors in response to all four predators but modulated the intensity of their responses according to particular predator traits. Both wildebeest and zebra altered the type and intensity of their response, but while wildebeest behavior was driven only by capture success, zebra tactics were shaped by multiple predator traits. Response intensity was further modified by social and environmental context, highlighting how multiple factors interact with predator traits to shape overall anti-predator strategies \u201359.Prey altered aspects of flight, alarm-calling, and vigilance behavior in response to predator hunting style. Alerting and vigilance behaviors were primarily directed towards ambush predators and evasion used in response to coursing predators, lending support to hypothesized functions of these behaviors . Sev. Sev70])The physical and social environments may also shape anti-predator decision-making , 68, 70.Direct encounters between predators and prey are only rarely observed in the wild, and much research on reactive anti-predator responses has assumed that predators and prey located within a certain radius have knowledge of each other\u2019s presence e.g., , 70, 79), 7970, 7By complementing recent work characterizing how prey may proactively avoid encountering predators, we have related reactive risk mitigation tactics, within and across prey species, to elements of predator functional diversity , 59, 70.S1 FigPhotorealistic predator models were mounted on all-terrain trolleys which were used to move predators through the bush towards prey individuals, simulating a predator encounter. Control models of impala and Thomson\u2019s gazelle not pictured.(DOCX)Click here for additional data file.S1 TableSites were never sampled for more than three consecutive weeks in order to avoid habituating focal animals (note: the third sampling period for the Phinda/Thanda complex was greater than three weeks but split between two separate reserves).(DOCX)Click here for additional data file.S2 TableNote that prey individuals were only tested with models of predators present in their reserve .(DOCX)Click here for additional data file.S3 TableSummary of social and environmental context under which experiments took place for each species. Reported are focal individual counts (group-level counts). Not all of the measured variables made it into top-ranking models. Range of model presentation distances is 2\u2013142 m . Range of impala herd sizes is 1\u201343 individuals . Range of wildebeest herd sizes is 1\u201332 . Range of zebra herd sizes is 1\u201319 .(DOCX)Click here for additional data file.S4 TableGLMM results for presence of prey anti-predator response  during encounters with predator models. Note that the interaction effect tests the difference between simple slopes (continuous) or effects , not whether each simple slope/effect is different from 0. Post hoc tests see  Tables a(DOCX)Click here for additional data file.S5 TablePost-hoc interaction analysis of GLMM results from (DOCX)Click here for additional data file.S6 TablePost-hoc interaction analysis of GLMM results from (DOCX)Click here for additional data file.S7 TableGLMM results for intensity of prey anti-predator response  during encounters with predator models. Note that the interaction effect tests the difference between simple slopes (continuous) or effects , not whether each simple slope/effect is different from 0. Post hoc tests see  Tables a(DOCX)Click here for additional data file.S8 TablePost-hoc interaction analysis of GLMM results from (DOCX)Click here for additional data file.S9 TablePost-hoc interaction analysis of GLMM results from (DOCX)Click here for additional data file."}
+{"text": "Visual search is a ubiquitous activity in real-world environments. Yet, traditionally, visual search is investigated in tightly controlled paradigms, where head-restricted participants locate a minimalistic target in a cluttered array that is presented on a computer screen. Do traditional visual search tasks predict performance in naturalistic settings, where participants actively explore complex, real-world scenes? Here, we leverage advances in virtual reality technology to test the degree to which classic and naturalistic search are limited by a common factor, set size, and the degree to which individual differences in classic search behavior predict naturalistic search behavior in a large sample of individuals (N\u2009=\u200975). In a naturalistic search task, participants looked for an object within their environment via a combination of head-turns and eye-movements using a head-mounted display. Then, in a classic search task, participants searched for a target within a simple array of colored letters using only eye-movements. In each task, we found that participants\u2019 search performance was impacted by increases in set size\u2014the number of items in the visual display. Critically, we observed that participants\u2019 efficiency in classic search tasks\u2014the degree to which set size slowed performance\u2014indeed predicted efficiency in real-world scenes. These results demonstrate that classic, computer-based visual search tasks are excellent models of active, real-world search behavior. Yet, little is known about whether the principles of visual search revealed by these studies extend to active, self-directed exploration in real-world environments, and whether individual performance in both traditional and naturalistic contexts is limited by common factors.Locating an object in a cluttered environment is a ubiquitous visual behavior. The mechanisms by which humans accomplish visual search have been comprehensively studied in traditional computer-based settings using both artificial arrays3. For example, search is limited by the similarity between the visual features of a target  and the array of distractors in which it is embedded4. A key component of these studies is the use of minimalistic, simplified stimulus arrays, which allow experimenters to systematically manipulate one factor of interest , while controlling for others , and to measure the impact of this isolated factor on performance. This approach has provided insights into the mechanisms underlying visual search and inspired multiple formal and conceptual models of the behavior6. Further, these models underpin frameworks for understanding diverse cognitive processes including attention9, reward11, and decision-making12.Classic, computer-based studies have identified numerous factors that govern visual search performance15. First, artificial stimuli lack the complex visual statistics and structural cues present within real-world scenes14. Recent computer-based studies investigating search in complex scene images demonstrate that the structure of the visual environment supplements attentional guidance beyond basic factors probed in paradigms with minimalistic stimuli17 by engaging episodic and semantic memory19 and guiding eye-movements to visual targets21. Second, computer-based approaches engage working memory differently from active, immersive contexts22. During active exploration, working memory operates across multiple spatial reference frames to guide attention23. Thus, naturalistic paradigms present a valuable opportunity to validate models of human behavior derived in traditional laboratory settings and extend these models to the conditions and demands of everyday life25.However, the computer-based approach contains two key drawbacks that limit generalization to real-world search behavior31. In particular, researchers have characterized visual search performance in multiple professional contexts including radiology34, airport security36, and driving30. These studies have revealed numerous features of computer-based visual search that translate to everyday settings. For example, these studies have shown that experienced radiologists are both faster and more accurate at detecting abnormalities in medical images than na\u00efve observers39. In the context of airport security, individual differences in search speed and accuracy measured on a computer-based app have been shown to predict target detection at TSA checkpoints40. Interestingly, not all aspects of the laboratory are paralleled in real-world environments. For example, because radiologists and airport security officers encounter targets at lower rates in occupational settings, as compared with laboratory paradigms, error rates (misses) are relatively higher and false alarm rates lower in these occupational settings, regardless of expertise38. Together, these studies show important parallels of visual search performance across computer-based and real-world contexts.Indeed, decades of research have established many connections between visual search in laboratory settings and in real-world environments41. However, in contrast to real-world settings, VR enables researchers to present diverse sets of stimuli with ease, manipulate specific environmental features of these stimuli, and explore the contributions of these factors to visual search performance. Recent studies have investigated active visual search behavior using head-mounted VR44. These studies again highlight the importance of environmental structure  in shaping active visual search strategies48. However, these studies have largely employed minimalistic, computer-rendered virtual environments as stimuli, where the experimenter can manipulate scene content and structure to identify regularities that facilitate attentional guidance in active settings. Because such rendered stimuli do not contain real-world visual content, these studies are subject to the first limitation of the classic paradigms described above: they cannot address the degree to which the statistical regularities of real-world scenes impact search in active, naturalistic settings.Virtual reality (VR) offers complementary opportunities to investigate visual behavior in naturalistic contexts. Similar to real-world settings, head-mounted VR displays allow researchers to study search in active conditions, where working memory can guide search across spatiotopic reference frames50 and images of complex scenes52. However, it remains unclear whether set size effects analogously limit behavioral performance during active exploration of real-world environments, where environmental structure and memory are available to aid attentional guidance54. Further, to our knowledge, whether individual differences in search efficiency in artificial displays predict naturalistic search performance in real-world environments has never been explored.Here, we leverage advances in VR technology to study the common factors limiting visual search in classic, computer-based paradigms and immersive scenes with real-world visual content. We specifically focused on one key factor that limits search performance in classic studies, set size: the number of items within a visual array. Increasing set size impairs search performance in both artificial arrays55. In both tasks, we characterized the impact of set size on visual search performance. We also tested whether participants\u2019 search efficiency was related across the two paradigms .Thus, our study aimed to answer two questions: (1) does set size limit both classic and naturalistic search, and (2) is search efficiency on classic, computer-based search tasks predictive of active search performance in real-world scenes? Participants (N\u2009=\u200975) completed two tasks: (1) a classic, computer-based conjunctive search paradigm with arrays varying in set size and (2) a naturalistic, VR-based search paradigm with immersive, real-world environments varying in levels of visual clutter47, and no participants were excluded from the analysis. Written consent was obtained in accordance with the Declaration of Helsinki via a protocol approved by the Dartmouth College Ethics Committee for the Protection of Human Subjects (CPHS).75 adults participated in two experiments . Participants were recruited based on (1) having normal or corrected-to-normal vision and no colorblindness, (2) having no neurological or psychiatric conditions, and (3) having no history of epilepsy. We selected our sample size based on comparable studieswww.oculus.com, single fast-switch LCD, 1832\u2009\u00d7\u20091920px per eye;\u2009~\u200990\u00b0 field of view; 72\u00a0Hz refresh rate) preconfigured with the ManageXR (www.managexr.com) device management software. Experiments were built in Unity version 2018.4.12f1 (www.unity.com) with custom scripts written in C#. Experimental data was collected through a custom data transfer pipeline written in C# and PHP to transmit data from the HMD to lab servers.Participants received a standalone head-mounted display . We curated 54 photospheres with four criteria to minimize the complications of defining set size in real scenes52. First, we selected photospheres of indoor scenes, as outdoor scenes contain few segmented regions which may not be representative of the true set size. Second, we ensured the photospheres did not contain humans to avoid the possibility that humans are a unique object category. Third, we confirmed that each photosphere contained a \u201csingleton\u201d target object: an object that appeared only once inside a given photosphere. Fourth, given the importance of depth to scene processing in early visual areas on the brain56, we ensured that all photospheres had comparable depth. To this end, we estimated the depth of each photosphere using the big-to-small (BTS) algorithm57. In the naturalistic search experiment, stimuli consisted of 360\u00b0 \u201cphotospheres\u201d of real-world scenes, sourced from an online photo sharing website  based on the estimated clutter measurements  and ensured that the average clutter of each bin significantly differed from the others  to the left of the participant, (2) in front of the participant, or (3) to the right of the participant. This resulted in an equal distribution of target object locations relative to the participant across the three possible quadrants (6 photospheres per quadrant), and across the clutter bins (18 photospheres per quadrant). On each trial of the naturalistic visual search experiment , participants were presented with a photosphere via the head-mounted display (HMD) for a maximum of 30\u00a0s, or until the controller trigger was pressed indicating detection of the target object Fig.\u00a0. In all Before each trial, participants were presented with a pre-trial fixation target at screen-center to ensure participants entered each photosphere facing the same direction. Participants were required to align their head-center with the target for 3\u00a0s. Subsequently, participants were presented with a conjunctive word cue  describing the target object in the following photosphere. Participants were instructed to \u201cfind the target as quickly as possible\u201d. To report the target, participants centered their head on the target  and pressed the controller trigger. A response was considered correct if the participant\u2019s head coordinate was within a 7.5\u00b0 visual angle radius from target center when the trigger was pressed, and reaction time was calculated as the time of the trigger press relative to trial start. After pressing the trigger, participants were given feedback on the accuracy of their response. The gray, head-locked circle would turn green if the participant selected the correct object and would turn red if the participant selected an incorrect object. After each trial, participants were returned to a virtual home environment where they were informed of their reaction time and instructed to take a break. A mandatory break occurred after each quarter of the experiment  to allow participants to rest their eyes.At the start of the study, participants were shown a set of instructions orienting them to the task. Following the instructions, participants completed two practice trials to ensure familiarity with the task. Participants were highly accurate during practice trials (mean accuracy: 84%), indicating comprehension of the task. In the classic visual search experiment, stimuli consisted of letter arrays, which were presented on a gray background around a central fixation point Fig.\u00a0B. The le On each trial of the classic conjunctive search task , participants were instructed to report the presence/absence of a target letter (a red T) using a keypad. Note, the target letter shared a feature dimension with each type of distractor (black Ts and red Ls). There were two trial types, target present or target absent, which each occurred 50% of the time. On trials without a conjunction target, an additional distractor was added at random.Each trial lasted for a maximum of 10\u00a0s or until a keypress. Before each trial, participants were shown a black fixation cross and required to press a button to start the trial. Participants were instructed to fixate on the cross until trial start, after which point they were free to move their eyes. Participants were instructed to \u201cfind the target as quickly as possible\u201d and to \u201cpress 4 if the target is present or 6 if the target is absent\u201d. Participant reaction time was calculated as the time of the button press relative to trial start. Following each trial, participants were given feedback on the accuracy of their response (a green check for correct responses and a red X for incorrect responses). A mandatory break occurred every 45 trials to allow participants to rest their eyes.At the start of the study, participants were shown a set of instructions orienting them to the task. Following the instructions, participants completed a set of practice trials  to ensure familiarity with the task. Participants were highly accurate during practice trials (mean accuracy: 91%), indicating comprehension of the task.p\u2009<\u20090.05 was used to assess significance, tests were two-tailed, and we applied Bonferroni correction for multiple-comparisons where appropriate. All analyses were conducted in the R statistical programming environment59. Effect sizes were calculated using the effectsize package60. For each task , we built a linear mixed-effects model to evaluate the predictivity of condition  on reaction time (RT) using the lme4 package61. In each model, we included a fixed effect of condition. Additionally, we included a within-subject random effect of condition to account for individual variation in a) baseline reaction times (random intercepts) and b) individual efficiency (random slopes). Thus, we were able to separately estimate group-level and subject-level effects of the impact of condition on RT.For all statistical tests, alpha level of To investigate whether classic findings of visual search extend to naturalistic settings, we developed a novel paradigm in which participants searched for real-world objects inside of 360\u00b0 real-world scenes. For each visual search task , we evaluated the extent to which condition  predicts reaction times (RT) using a linear mixed-effects model. We hypothesized that greater set sizes would result in slower RTs in each task, and that individual estimates of this effect of set size on RT (search efficiency) would correlate across tasks .rs\u2009=\u20090.595, p\u2009<\u20090.001). This correlation was significant in all three sections of the environment: left, front, and right\u00a0of the participant . Importantly, a one-way ANOVA on the fixed\u00a0effect of clutter revealed a significant main effect on reaction times across participants \u2009=\u2009187.42, p\u2009<\u20090.001, \u03b7p2\u2009=\u20090.5). An additional one-way ANOVA demonstrated a main effect of condition on individual participant false alarm rate \u2009=\u200963.1, p\u2009<\u20090.001, \u03b7p2\u2009=\u20090.36). Overall, these results suggest that visual clutter modulates visual search performance inside real-world scenes.We first examined the relationship between visual clutter levels and search performance inside immersive, real-world scenes. As predicted, we found that participants were faster and more accurate to locate the target in less-cluttered as compared with more-cluttered scenes. Combining data across our participants, we found a significant correlation between clutter-level and reaction times to correctly detect a target \u2009=\u2009463.04, p\u2009<\u20090.001, \u03b7p2\u2009=\u20090.89) and target absent trials \u2009=\u2009309.66, p\u2009<\u20090.001, \u03b7p2\u2009=\u20090.85). A separate one-way ANOVA demonstrated a main effect of set size on individual participant false alarm rates \u2009=\u20096.40, p\u2009=\u20090.002, \u03b72\u2009=\u20090.05). In sum, these results dovetail with previous findings of classic visual search paradigms\u00a0that demonstrate the impact of set size on visual search performance4.We next evaluated the relationship between set size and search performance in a classic visual search paradigm. For target present and target absent trials, we used separate linear mixed-effects models to evaluate the fixed effect of set size on RT while accounting for the random effect of subject. A one-way ANOVA conducted on the fixed effect of set size revealed a significant main effect of set size on RT across participants for both target present  as the Pearson\u2019s correlation between search efficiency of one half and the other, corrected with the Spearman-Brown prediction formula to estimate the full-length task reliability. We find low reliability for naturalistic search efficiency (\u03c1*\u2009=\u20090.293) and high reliability for classic search efficiency on both target present (\u03c1*\u2009=\u20090.947) and target absent trials (\u03c1*\u2009=\u20090.947).Having established the reliability of search efficiency within each task, we next investigated the relationship of search performance between the two tasks. For each task, we used a linear-mixed effects model to derive search efficiency: the random slope of condition fit to each participant\u2019s RT. Importantly, we accounted for variability of RT within each task by modelling random intercepts for each participant.rs\u2009=\u20090.36, p\u2009=\u20090.002). However, the relationship between naturalistic and classic visual search was attenuated on target absent trials . We next compared individual efficiency in each quadrant  of the naturalistic visual search task with each trial type of the classic visual search task. Interestingly, efficiency in the front quadrant of the naturalistic visual search task was significantly related to efficiency on both target present and target absent trials . While we also observed a significant relationship between efficiency in the right quadrant and target present trials , this relationship did not hold when considering target absent trials . Furthermore, we found no relationship between efficiency in the left quadrant and either classic search trial type . Together, these results suggest that efficiency on a classic visual search task, indexed by a set size manipulation, predicts efficiency in naturalistic visual search, indexed by a clutter manipulation in complex, visual scenes.We found a significant relationship between search efficiency on the naturalistic search task and on target present trials of the classic visual search task 68. For instance, previous research has shown a relationship between airport security officers\u2019 search performance on a computer-based app and their detection of violations at an airport checkpoint, where people with faster and more accurate search within the app were better at detecting prohibited items at TSA checkpoints40. While studies within professional settings begin to establish connections between computer-based paradigms and naturalistic experience, both the examined populations  and sampled contexts  limit the generalizability of these results to diverse, real-world environments.Relating individual performance between computer-based and naturalistic settings is central to identifying the cognitive factors and task strategies that facilitate visual search44. First, VR enables researchers to exact similar rigor as in computer-based studies  without placing physical limitations  on the complex repertoire of participants\u2019 naturalistic behavior. Second, researchers can leverage VR to efficiently investigate behavior across a wide range of diverse settings , likely increasing the real-world generalizability of findings. Taken together, the use of VR empowers researchers to construct more representative models of naturalistic experience. Accordingly, an increasing number of studies employ VR headsets to investigate visual functions, providing essential connections between computer-based findings and naturalistic behavior. Yet, few studies have sought to relate models of visual functions, such as visual search, that are derived from behavior measured in traditional, computer-based paradigms to analogous behavior measured in real-world settings.Advances in virtual reality (VR) technology present a promising avenue to investigate visual behavior within naturalistic stimuli and contexts while simultaneously maintaining experimental control69, a benefit not seen for explicit memorization70. For example, one study demonstrates that spatial memory aids search by restricting attention to relevant areas of the scene47: when the location of a target object was changed from a learned location, participants continued to initially fixate on the learned location. Further, interaction with objects in virtual environments bolsters memory of target object locations: participants are faster to locate objects they arranged within a room compared with objects arranged by others45. By utilizing VR to investigate visual search, these studies reveal the contributions of action in and interaction with virtual environments on search performance. Our results extend prior research on active search by generalizing the well-known set size effect to a diverse set of real-world scenes, and by demonstrating a predictive relationship between an individual\u2019s search efficiency in artificial and naturalistic contexts.Recent studies investigating visual search using head-mounted displays highlight, in particular, that active behavior recruits memory to aid search performance in naturalistic settings. Active exploration of virtual environments prior to search has been shown to improve search performance by engaging spatial memory71 and the presence of set size effects within both paradigms, we do not believe a different measurement would drastically alter our results. Second, while the classic search paradigm demonstrated high split-half reliability, the naturalistic search paradigm exhibited relatively low split-half reliability. Despite this low reliability, our results show a relationship of an individual\u2019s search efficiency between the two visual search tasks. We hypothesize that, the magnitude of the task relationship would increase with more naturalistic search trials. Future studies are needed to test this hypothesis, as well as to understand behavioral changes across a continuum of stimulus naturalism moving from well-controlled psychophysical displays to naturalistic settings.Certainly, our experimental paradigm has shortcomings. First, in contrast to many studies of visual search in which eye-tracking measures are employed, we were only able to use a combination of head-tracking data and keypress reaction times. This method is undoubtably noisier than measuring eye-tracking reaction times in each task. However, given the close coupling of head and eye movementsIn sum, we find that set size analogously limits visual search performance in both classic, computer-based visual search and immersive, real-world scenes. Further, individual search efficiency on a classic search task predicts search efficiency in a naturalistic search task. These findings suggest that individual search performance is limited by common properties in artificial and naturalistic contexts and have important implications for relating models of vision to real-world behavior.Supplementary Information."}
+{"text": "A large number of workers and heavy equipment are used in most industrial sizes, and the prevention of safety accidents is one of the most important issues. Therefore, although a number of systems have been proposed to prevent accidents, existing studies assume that workers are gathered in some areas. These assumptions are not suitable for large-scale industrial sites in which workers form as a group and work in a large area. In other words, in a large-scale industrial site, existing schemes are unsuitable for the timely notifying of warnings of threats, and excessive energy is consumed. Therefore, we propose a k-means clustering-based safety system for a large-scale industrial site. In the proposed scheme, workers deployed over a large area are divided into an appropriate number of groups, and threat notification is delivered by a multicasting tree toward each cluster. The notification to workers is delivered through local flooding in each cluster. The simulation results show that the system is able to deliver the notification within a valid time, and it is energy efficient compared to the existing scheme. Industrial wireless sensor networks (IWSNs) have been exploited to improve productivity and financial profits in various industrial fields, such as manufacturing, construction, agriculture, quarrying, timber harvesting, and so on ,2,3. In Therefore, we design a k-means clustering-based safety system to notify warnings in a timely manner. We assume the following environment for the proposed scheme. First, the sensor nodes for detecting threats are evenly distributed in the industrial site. Second, workers perform their roles by grouping, and there might be some positional changes during the task. In addition, when the task is completed, they move to another location for another task. In this case, the workers report their new position. Third, it is assumed that the workers have a receiver capable of receiving notifications transmitted from the sensor.1The workers periodically report their current location through the sensors around them to the sink node, and report separately if there is a change in location when the task is completed. The location reporting period might vary depending on the using equipment in the site.(1)If a collision between the mobile equipments and workers is expected, a notification of the threat is immediately send to the relevant workers;(2)In the generic case, the sink divides the workers into the appropriate number of clusters based on the locations of the reported workers by exploiting k-means clustering. The information of each worker group is expressed as a center point and a radius;2The sink node propagates the clustering information to the whole network to deliver the position of workers to each sensor;3The source node that sensed threats such as gas leaks and wildfires constructs a real-time multicasting tree using the received cluster information;4When the notification arrives at any node inside the cluster along the multicasting tree, the node performs that local flooding via branch points to deliver the notification to workers located inside the cluster.To achieve real-time notification delivery, the designed system consists of the following four steps:1We propose a safety system in large-scale industrial site using k-means clustering;2The proposed system consists of three phases: clustering, multicasting, and local flooding;3The system can deliver notifications about threats to the worker within a valid time and is more energy-efficient than the existing method;4We provide simulation results on the proposed scheme and compare them with ,14 usingThrough these steps, threats are delivered to workers within a valid time, and could significantly reduce energy consumption compared to existing schemes. The main contributions of our work in this paper could be summarized as follows:The remainder of this paper is organized as follows. In In this section, we briefly summarize the existing schemes based on the local flooding, multicasting, and virtual storage for notifications.The local flooding scheme is a proposed scheme that aims to reduce the energy waste of flooding, delivering data to the whole network, and is a technique that performs flooding only within any range specified by the user or application. The notification scheme exploiting local flooding consists of two steps: member information collection and notification to members. In the process of information collection, a cluster representing members is created and the center point and radius of the cluster are reported. After the information collection process, Mobile Geocasting (M-Geocasting)  transmitThe virtual tube scheme is a scheme that delivers data to a user based on the prediction of a movement of the user. The sensor that detects the events receives the movement information of the user from the sink and places the data at the sensors around the location, through which, the user passes in consideration of the movement direction and speed of the user. The work in  puts theMulticasting is a method in which a source that detects an event constructs a multicast tree for delivering data to each destination and exploits the tree to deliver data. This scheme usually designs a tree in the directions where the sum of the costs of transmitting data to each destination is the lowest. Multicasting ,10,13 alIn this section, we describe the k-means clustering-based safety system for preventing accidents in industrial sites. Since the k-means clustering is an algorithm based on the distance between each point (worker), it is suitable for classification according to the location of the workers. To prevent the accident, the notification about various threats should be delivered to the workers within a valid time. Our main idea is to divide the scattered workers into the appropriate number of clusters. By dividing workers into clusters, real-time notifications exploiting multicasting trees are possible and the energy consumption can be reduced.This section is divided into four parts. In Through this section, we show the overall operation process of the proposed system. First, we assume that all sensor nodes are aware of their own location by GPS  or otherAs shown in After performing notifications for potential threats, the sink node divides workers into the appropriate number of groups based on the k-means clustering scheme. In the clustering process, the sink node can calculate the center point and radius of the cluster with the least average standard error based on the location of the workers. The sink node periodically notifies the information of calculated clusters to the whole network. To increase the lifetime of the network, a cluster head node representing each cluster is selected, such as in . Through1The sink node confirms the possibility of conflict between workers and mobile equipment during the network initialization phase;(1)If a possibility of collision is detected, the sink node immediately delivers a notification to the relevant workers;(2)After the notification is delivered or if there is no possibility of collision, the clustering is performed;2The location information of the workers is propagated throughout the network;3If a location report of workers is received, the life cycle is repeated again from 1.1The sensor node is always detecting events;(1)Therefore, if no event is found, monitoring is continuously performed;(2)If the event is found, these steps are followed;2A multicasting tree is constructed based on destination information that is received from the sink. In this case, the tree is constructed in consideration of the time limitation required by the application or user;3The notification is delivered along the tree, and when the notification enters the cluster, local flooding is performed to notify the threats to workers located inside the cluster;4The sensor that has completed the notification performs event detection again. If the sensor detects an event, the life cycle resumes at 1.In the case of the sensor node, the following life cycle is followed:In our proposed system, after performing threat notifications about conflicts between workers, the sink node performs clustering for real-time multicasting. Thus, we describe how to divide workers and equipment into the appropriate number of clusters by the k-means clustering scheme in this section.R, respectively, when the number of clustering is three. R are no longer changed. In As inferred from the above clustering process, the number of clusters is one of the important factors in the clustering process. If there were two or four clusters, the results would not have been as shown in Through the above-mentioned process, the sink node could find the appropriate number of clusters to construct a multicasting tree based on the locations of reported workers. However, in a variety of industrial environments, workers could shift their positions according to their roles, in which case, they report their movement information to the sink. If a worker\u2019s movement information is reported to the sink, the sink node identifies the threat to the movement and notifies the threat if it exists. In addition, the sink node performs re-clustering and re-propagates the clustering information to the whole network.In this section, we describe a multicasting scheme to deliver data within a valid time to all workers in the cluster. The method of multicasting is largely divided into three stages: (1) calculation of the longest distance, (2) multicasting tree construction, and (3) local flooding via branch points inside the cluster. First, the source node calculates the distance to the farthest cluster to find the reference delivery speed for real-time transmission. Subsequently, the source node constructs a multicasting tree oriented toward the center of each cluster. This multicasting tree focuses on reducing the number of hops, with the shortest distances from the source to the center of each cluster. Finally, when the packet arrives in the cluster, the sensor node that received it performs local flooding via branch points inside the cluster, allowing all workers to receive the packet.We calculate the reference delivery speed based on a spatiotemporal approach . The refTo satisfy the real-time requirement of the application, the reference delivery speed should be satisfied at all nodes. That is, when transmitting the packet to the next node, all next nodes should select a node capable of relaying the packet faster than the reference delivery speed in order to meet the requirement. In the process, the temporal requirement is determined according to the application, whereas the spatial requirement is defined as the Euclidean distance between the source and the destination. To calculate the Euclidean distance, we assume that each node knows its location by GPS or any localization algorithms. However, the end-to-end distance between a source node and workers cannot be defined, as the data delivery towards each worker is based on local flooding within the area.\u03b8: . The distance to each point is presented as follows:Therefore, a source node defines the distance and calculates the reference delivery speed after obtaining the location information of the furthest cluster ,8,12. InThrough the differential equation, from Equation , we can In this section, we describe how to construct a multicasting tree based on the longest distance calculated in x-axis  , which iIn-time Packet Transmission Success Ratio is defined as the number of messages arriving at the workers in a timely manner divided by the number of messages sent by the source node;Energy Consumption is defined as the average energy consumption exploited to transmit and receive packets of sensor nodes participating in data transmission;The Number of Workers is defined as the number of workers simultaneously moving in the network;Radio Range can be influenced by various industrial environments. Thus, simulations are conducted on various radio ranges of sensor nodes.Although various industries are upgrading today, various safety accidents are occurring for workers. Despite paying a lot of attention to this problem, such as through safety codes and standard legislation, ironically, workers have become more vulnerable to threats. Therefore, appropriate notification of threats to prevent safety accidents is required, and various studies have been proposed. However, since they did not consider the characteristics of workers who are working in an industrial environment, they failed to deliver the notification packet within a valid time and consumed excessive energy.To deal with these problems, in this paper, we proposed a k-means cluster-based safety system considering the characteristics of clustered workers in an industrial environment. The proposed system consists of the following three steps: (1) dividing the workers into the appropriate number of clusters, (2) constructing a multicasting tree toward each cluster, and (3) local flooding via branch points in the cluster. Through the three steps, the proposed scheme aims to consume less energy than existing schemes, while simultaneously delivering notification packets within a valid time.We analyzed the performance of the proposed safety system from the aspect of energy consumption and the in-time packet transmission success ratio with computer simulation. The results show that the proposed safety system has a maximum 10% and 14% increase in the in-time packet transmission success ratio after varying the number of workers and radio range, respectively, compared to existing schemes. In addition, the energy consumption of the proposed safety system decreases by 36% and 30% or more, after varying the number of workers and radio ranges, respectively, than the existing method.The proposed system has a high performance for situations in which workers move intermittently, such as quarrying and timber harvesting. However, for workers who continue to move locations, such as in agriculture, frequent location updates are required, leading to excessively wasting energy. Therefore, further research in terms of worker mobility is required to ensure the safety of workers in various industries."}
+{"text": "With industrialization, urbanization, and modernization, mass sports have entered people's daily lives to maintain their health status. However, less attention has been paid to the heterogeneity and inequality of access to mass sports, especially in developing countries. This study aims to analyze the factors that affect mass sports participation in developing countries represented by China, and explain the changing trends and inequality in the class differentiation and mobility of public sports participation.The study selected the Chinese General Social Survey (CGSS) data in 2010 and 2018 as the research samples, and used an ordered Probit model and sub-sample regression to analyze the factors and trends of Chinese residents' mass sports participation and the influencing factors. By stratified three-stage probability sampling, the study obtained 4,940 valid responses, including 1,014 in CGSS 2010 and 3926 in CGSS 2018.First, in terms of social factors, urban residents have a higher frequency of sports participation than rural residents. Second, regarding family factors, residents with higher social classes are more likely to participate in sports than those with lower social classes. Third, in terms of self-induced factors, the elderly are more motivated to exercise than the young. Residents with public-sector jobs, high incomes, and higher education levels are keener to participate in sports. Fourth, residents' mass sports participation rate has generally shown an upward trend over time. Fifth, with time changes, the sports participation rate varies between urban and rural areas, between ethnic minorities and Han ethnic, between old and young age groups, and between higher and lower education levels will continue to shrink, but differences between social classes will further increase over time.Our analysis demonstrated that hidden inequality existed in accessing mass sports participation in developing countries, and the self-induced characteristics were significantly correlated with the quality of sports participation. Future public sports policies should address the inequity to ensure equal access to affordable qualified personal mass sports. With the improvement of social and economic levels, human values gradually surpass the pursuit of a single economic dimension, and pay more attention to multi-dimensional experiences such as social, psychological and physical health . When heFrom the perspective of sports sociology, sports access or mass sports participation can be regarded as one of the most common social phenomena in modern society and one of the crucial ways for ordinary members of society to achieve socialization . EarlierUp to now, sports participation has been gradually decoupled from the political class. Economic or willingness analyzes of new technologies are beginning to be applied to sports participation , 19. TheBased on the above classification, this article chooses to focus on sports participation in mass sports. Compared with competitive and school sports, mass sports are more closely related to each of us. Meanwhile, due to economic improvement, residents are paying more and more attention to healthy lifestyles, and mass sports can include as many samples as possible. Research on mass sports participation can better reflect the changes in mass exercise methods and the development of health policies.Hence, the research will start with the specific factors that affect mass sports participation and answer two progressive questions:(1) Does the inequality of mass sports participation in developing countries (China) exist? If it exists, what are the specific influencing factors; if it does not, clarifies the presentation form of mass sports participation.(2) With the changes of the times, what kind of changing trend does mass sports participation in developing countries show? Has inequality improved amid this trend?By sorting out residents' sports participation tendencies, we find that social structures, such as class, status, prestige, power, etc., affect the socialization of sports participation to a certain extent \u201331. In fIn sociology, scholars have also linked public sports participation with social structure and individual agency along the perspective of social stratification theory , 37\u201339. Scholars' research in recent years has also found that the family has a non-negligible influence on the behavior and habits of adults, and the way family upbringing will affect the individual's lifestyle in adulthood , 41, 42.Specifically, in this study, the author attempts to classify the factors that affect mass sports participation into social factors, family factors and self-induced factors, and accordingly put forward the following hypotheses:H1: Inequality in mass sports participation exists in developing countries (China).H1a: Social factors have a significant impact on mass sports participation.H1b: Family factors have a significant impact on mass sports participation.H1c: Self-induced factors have a significant impact on mass sports participation.H2: As times change, inequality in mass sports participation in developing countries will improve.The data in this paper comes from the Chinese General Social Survey (CGSS). CGSS is the earliest national, comprehensive and continuous academic survey project in China, implemented by the China Survey and Data Center of Renmin University of China. Since 2003, the project has basically guaranteed to conduct continuous cross-sectional surveys on more than 10,000 households in various provincial units in mainland China once a year. 2003\u20132008 is the first phase of the CGSS project. A total of 5 annual surveys were completed (exclude 2007), and 5 sets of high-quality annual data were produced. 2010-2019 is the second phase of the CGSS project. As of the article writing, 7 annual survey data  have been released, the latest year of data available is 2018.This article explores Chinese residents' sports participation and its influencing factors. Considering that with the evolution of the times, Chinese citizens' attitudes toward physical participation have changed, this article will also attempt to deeply explore the changing trends of the effects of various influencing factors. The authors selected the CGSS data in 2010 and 2018 as the research samples. CGSS 2010 and 2018 contain several parts, including core modules (basic information), class consciousness, social stratification, income and consumption, religion, environment, and health. After removing missing values and outliers, the study obtained 4940 valid observation samples, including 1014 in CGSS 2010 and 3926 in CGSS 2018.The CGSS is a national large-scale survey project which targets all urban and rural households in 31 provinces, autonomous regions, and municipalities directly under the Central Government . CGSS 2010 and 2018 adopt stratified three-stage probability sampling. As shown in For the mandatory layer, choosing streets as the primary sampling unit can refine the sampling frame and make the sample points relatively scattered, which is conducive to collecting general information and avoids sample bias due to too thick a sampling frame. For the selection layer, considering that there are many districts, county-level cities, and counties in the whole country, it is more appropriate to use them as the primary sampling unit.Based on past survey experience, the target sample size for the survey is set at 12,000 households, of which 2,000 are compulsory and 10,000 are selected. The sample size allocations covered in the subsequent sections are all based on the target sample size.For the mandatory layer, the total sample size is 2,000 households. Specifically, 40 primary sampling units (streets) are selected, and two secondary sampling units (neighborhood committees) are chosen from each primary sampling unit (PSU). The third stage of sampling contains 25 households, which were selected from SSU.For the selection layer, the total sample size is 10,000 households. Specifically, 100 PSUs  are selected, and 4 SSUs  are chosen from each PSU. Each neighborhood committee (village committee) selects 25 households.Hence, a total number of 140 PSUs and 480 SSUs were drawn in this survey.Considering that the answer rate in the survey is difficult to reach 100%, this plan adopts the method of expanding the sample size by using the expansion coefficient to enlarge the sample size of the third stage. According to the survey experience in previous years, due to various reasons, the answer rate of residents in the municipal districts of developed cities is 50%. That is, the expansion coefficient is around 2, so 50 households are selected from each second-level unit in the mandatory layer, and the contact sample size of this layer is expanded to 4,000.The response rate of the residents in the selected layer is higher than that of the mandatory layer. In general, based on the experience in the previous year, the response rate of urban residents is around 65%, and the response rate of rural residents is higher than that of urban residents, roughly about 85%. Therefore, for the selection layer, 38 households were selected for each neighborhood committee, and 30 households were selected for each village committee.This survey's final contact sample size is 17,664, of which 4,000 are mandatory, and 13,664 are selection. In the mandatory layer, when the number of primary and secondary units remains unchanged, the number of contact samples in each secondary unit increases to 50 households. In the selection layer, the number of primary units is 100, and the number of secondary units in each primary unit is 4. The contact sample size in each sampling neighborhood committee was expanded to 38 households, while in each sampling village committee was expanded to 30 households. Therefore, the contact sample size of the selection layer was 13,664, of which 7,904 were urban residents and 5,760 were rural residents.The dependent variable in this paper is residents' sports participation. Unlike the previous studies, which defined sports participation as a dummy variable\u2014whether or not to participate in physical exercise; this study believes that the previous method limits the study to qualitative analysis. In fact, there are also significant differences in the frequency of participation among groups that participate in physical activity. Therefore, this article will focus on the number of participants. For example, taking the 2010 questionnaire as an example, this research selects the following questions:B4: How many times a week do you do physical exercise for at least 20 minutes or more? Here refer to those exercises that make sweat or breathe faster.\u201d\u201cAccording to the answer, define the dependent variable sports participation and set the five frequencies of \u201cI do not exercise\u201d, \u201cseveral times a year or even less\u201d, \u201cseveral times a month\u201d, \u201cseveral times a week\u201d and \u201cexercise every day\u201d as 1, 2, 3, 4, 5. Similarly, in the 2018 questionnaire, the number of specific exercises was classified as the above five frequencies for assignment.Considering the diversification of factors influencing sports participation, whether or not to participate in physical exercise and the frequency of participation are often the result of the combined action of multiple factors. The past literature introduces a series of factors that may affect the dependent variable as independent variables from three aspects: social factors, family factors, and self-induced factors. (1) Social factors include household registration, gender, and ethnicity; (2) Family factors include family income and social class of the households at the age of 14; (3) Self-induced factors include age, occupation, individual income, education level, marital status, and religious beliefs. In addition, considering that the changes in the times may impact on sports participation, the study also introduces time virtual variables; the specific variable selection and assignment are shown in The descriptive statistics of the main variables in this paper are shown in The independent variables of this study consist of three dimensions:(1) Social factors dimension includes household registration, gender, and ethnicity. In 2010, the average household registration was 0.603; that is, 60.3% of the households were registered as urban residents. In 2018, this figure rose to 65.5%, which is generally consistent with China's urbanization process. In 2010, the gender average was 0.509; that is, 50.9% of the respondents were female. In 2018, this figure was 54.8%, and the proportion of female respondents increased slightly. In 2010, the average ethnicity value was 0.081, showing that about 8.1% of the respondents were ethnic minorities, and this figure dropped to 5.8% in 2018.(2) Family factors dimension includes family income and the social class of the respondents when they were 14 years old. Among them, the average value of social class in 2010 was 3.037; that is, the majority of interviewees believed that their native families belonged to the middle and lower classes. In 2018, this number rose to 3.517, indicating that most interviewees had jumped in class. In 2010, the average value of household income after logarithm removal was 10.45; in 2018, it rose to 10.93, and the standard deviations were relatively large, indicating that the family income of different resident groups varies considerably.work in the system in China. In 2010, the average occupation value was 0.163; that is, about 16.3% of the respondents were working in the system. In 2018, this figure rose to 20.2%. For individual income in 2010 and 2018, the mean value after taking the logarithm is 8.647, and the standard deviation is slight different, indicating that the income difference of resident groups has changed little. The average education level in 2010 was 8.547, and it rose to 9.145 in 2018, with a median of 9, which means that the intermediate education level of the interviewed households is about junior high school. The average value of marital status in 2010 was 0.829, indicating that 82.9% of the interviewed households were married; this figure dropped to 74.9% in 2018, which also explained the decline in the marriage registration rate. It should be noted that in statistics, remarriage with spouse is considered as a type of marital change, so this indicator is not included in the statistics of married. Meanwhile, considering that the sample size of remarried with spouse is small (n = 200), its impact on the statistical results can be ignored. The average value of religious belief in 2010 was 0.122, indicating that religious believers accounted for 12.2% of the total sample, and this figure dropped to 11.6% in 2018.(3) Self-induced factors dimension includes factors related to individuals, such as age, occupation, individual income, education level, marital status, and religious belief. In 2010, the average age was 53.24, and in 2018 it rose to 59.08, reflecting the acceleration of the aging process in China. In terms of occupation, based on social experience and previous research, influenced by the socialist system with Chinese characteristics, people generally believe that occupations that work for the state (or are paid by the state) are more stable. This type of occupation is habitually called The empirical goal of this paper is to explore the influencing factors of Chinese residents' sports participation. Since the dependent variable in this paper is an ordered discrete variable, when the explained variable is a multivariate ordered discrete variable, the ordered Probit model can better meet the needs of empirical regression. Compared with the traditional ordered Logit model, the ordered Probit model relaxes the assumption of the independence of irrelevant alternatives of the sample data and has broader applicability. Therefore, this paper establishes the ordered Probit model. The equations are as follows:* is the frequency of resident sports participation in the dependent variable, which is divided into five grades: \u201c I do not exercise\u201d, \u201cseveral times a year or even less\u201d, \u201cseveral times a month\u201d, \u201cseveral times a week\u201d, and \u201cexercise every day\u201d. \u03b1i is a constant term, there are five categories of dependent variable values, and five constant terms will be generated under the ordered multiple regression. \u03b2i is the regression coefficient of the corresponding i-th influencing factor, and \u03b5iis the residual term. Set the threshold \u03bb1 < \u03bb2 < \u03bb3 < < \u03bb4 < \u03bb5, there is the formula:Among them, YY looks like this:The probability of \u03d5 is the standard normal cumulative distribution function.In the above formula, \u03b2i of the independent variable. If it is positive and significant, it means that the factor will promote the increase of the frequency of residents' sports participation; if it is negative and significant, the factor will reduce the frequency of residents' sports participation; if it is insignificant, it means that the factor has no significant relationship with the frequency of residents' sports participation. According to empirical needs, the study will also conduct sub-sample regression on the two-year cross-sectional data in 2010 and 2018 to explore the different changes in the influencing factors in each era.The study concentrates on the direction and significance of the coefficient According to the sample data, combined with the empirical model established above, an ordered Probit regression is carried out, and robust standard errors are used to overcome the heteroscedasticity problem. The regression results are as follows see .As shown in Regarding family factors, the coefficient of social class is significantly positive while the coefficient of family income is not, which means that residents of higher social classes are more motivated to participate in sports than residents of lower social classes; and the family income has little effect.For self-induced factors, age, individual income, education level and the occupation coefficient are all significantly positive, while religious belief and marital status are not; that is, the elderly are more active in physical exercise than the young, which may be because the elderly have sufficient leisure time. It also indicates that residents who work in the system (those who work for the state), residents with high income, and residents with higher education levels are keener to participate in sports.The era (whether it is 2018) is significantly positive, indicating that the resident' sports participation in 2018 is more active than that in 2010, and it also shows that the residents' sports participation has changed significantly in the 9-year period; ascension is the main feature.The authors also conduct a sub-sample regression to verify whether the influence of various influencing factors on sports participation has changed from 2010 to 2018, the results can be found in For social factors, the results show that from 2010 to 2018, the coefficient of household registration is still significant, but the size of the coefficient gradually decreases, indicating that despite the current enthusiasm of urban residents to participate in sports is more potent than that of rural areas, but the gap with the latter has been narrowing. Meanwhile, it can be seen that gender was insignificant in 2010 but significantly positive in 2018, indicating that in 2010, the frequency of male and female participation in sports had no significant difference, while after 9 years, female's fitness enthusiasm has improved and been significantly higher than that of male. Also, the ethnicity coefficient changed from significant to negative insignificant; in 2010, compared with the Han group, the overall fitness enthusiasm of ethnic minorities was not strong, and after 9 years, the two were nearly indistinguishable.For family factors, the coefficient of social class was insignificant in 2010, while it was significantly positive in 2018, which also means that with the evolution of the times, people with higher social status have an increasing awareness of physical fitness, and the frequency of participation has also increased.For self-introduced factors, the age coefficient was significantly positive in 2010 and 2018, but the coefficient was reduced in 2018, showing that young people's enthusiasm for physical exercise increased with time. The occupation coefficient never increased, which shows that practitioners in the system (those who work for the state) have more enthusiasm for fitness. The individual income coefficient is from insignificant to significantly positive, indicating that groups with high income have a greater increase in fitness enthusiasm. When it turns to education level, its coefficient in 2010 and 2018 were both significantly positive in the middle of the year, but the coefficient shrank significantly in 2018, which means that the frequency of fitness among groups with lower education levels is also increasing.To verify the validity of the empirical conclusion of the study, that is, whether the empirical conclusion can reveal the correct social phenomenon, or it is only a particular result under the accidental regression, and cannot be generalized as a general conclusion, this paper attempts to conduct a robustness test to check.Previously, the source of the dependent variable in this paper was the item:B4: How many times a week do you do physical exercise for at least 20 minutes or more? Here refer to those exercises that make sweat or breathe faster.\u201d\u201cConsidering that some sports participants prefer low-intensity exercise without sweating, the author re-selects an item from the questionnaire to replace current dependent variable:A30i. In the past year, did you often engage in the following activities in your spare time-physical exercise?\u201d\u201cThe five grades of \u201cI do not exercise\u201d, \u201cseveral times a year or even less\u201d, \u201cseveral times a month \u201c, \u201cseveral times a week\u201d, and \u201cexercise every day\u201d are, respectively, assigned to 1\u20135. The intensity is specified, reflecting the degree of participation more comprehensively. Taking this variable as the new dependent variable, the ordered Probit regression is performed again, and the results are shown in Comparing the two-year data between 2010 and 2018, the influence of most social and self-induced factors shows a certain rigidity. However, the coefficient estimates of the main variables have changed to a certain extent. To test whether the influence of various factors on residents' sports participation has been strengthened or weakened with the evolution of time and social transformation, the authors introduce the multiplication term of each influencing factor and the dummy variable of the era, and conduct an ordered Probit regression analysis again; the results are shown in Opinions on Further Promoting the Reform of the Household Registration System promulgated in 2014, Chinese household registration no longer distinguishes between rural and urban household registration. Compared with rural residents, although urban residents have long-term advantages in sports participation, with the evolution of the times, especially the continuous improvement of rural sports facilities and the awakening of rural fitness awareness, the difference will continue to shrink. On the other hand, the regression results also show that the coefficients of gender and era are not significant, but the interaction term is significantly positive, indicating that although there is no significant difference in the frequency of sports participation between men and women, as time progresses, women's fitness levels are higher than men's. The frequency will be increased to a greater extent. Finally, the regression results show that the ethnicity coefficient is significantly negative, while its interaction term with the era is significantly positive, indicating that compared with the Han, ethnic minorities have a lower frequency of sports participation, but with the evolution of the times, ethnic minorities catch up effect is more pronounced.For social factors, both household registration and era are significantly positive, but the interaction term between those two is significantly negative, which shows that with the development of the times, the impact of household registration on resident' sports participation is weakening. This result may be related to the reform of the household registration system implemented in China in 2014 and the improvement of rural sports facilities in recent years. According to the For family factors, the regression results show that the coefficient of the interaction term between social class and era is significantly positive, which means that under the blessing of time, groups with a higher social class will be more active in sports. On the other hand, family income, era and their interaction items are insignificant, indicating that family income is not a critical indicator affecting sports participation, and the impact of family income on sports participation will not change with the evolution of the times.working in the system is more active in participating in physical exercise than the group working outside the system. The difference tends to shrink, but the trend is not apparent, indicating that the differences in sport participation in and outside the system will persist for a considerable time. Moreover, the education level and era coefficients are both significantly positive, but the interaction term is significantly negative, indicating that the group with a higher education level has a higher frequency of sports participation than the group with a lower education level. However, with the evolution of the times, the latter will pay more and more attention to their health and spend more time participating in physical exercise, and the inter-generational gap in the education level of sports participation will continue to narrow. On the other hand, individual income, religious belief, and marital status do not affect the frequency of sports participation. Its interaction items are also insignificant, indicating that these characteristics are not the decisive factors affecting sports participation, and the evolution of the times will not significantly impact the change's effectiveness.As for self-induced factors, although times are changing, these are still the most crucial aspect affecting residents' sports participation. According to the regression results, the coefficients of age and era are both significantly positive, while the interaction term is significantly negative, indicating that the elderly have a higher frequency of sports participation than the young. Still, as the times evolve, young people will also invest more time in physical exercise, and the inter-generational age gap in sports participation will continue to narrow. At the same time, the occupation and era coefficients are both significantly positive, but the interaction term between the two is insignificant, indicating that the group The specific issue under investigation here is whether mass sports participation behavior appears to be characterized by inequities in terms of social, family, and self-induced factors. Using the two-year sample data of CGSS 2010 and 2018, the authors screened 4940 valid observation samples and conducted an ordered Probit regression in Stata 17 software. The empirical results are studied and the following five conclusions are found.First, in terms of social factors, urban residents have a higher frequency of sports participation than rural residents.Second, in terms of family factors, residents with higher social classes are more likely to participate in sports than those with lower social classes.Third, in terms of self-induced factors, the elderly are more motivated to exercise than the young; residents who work in the system (those who work for the state), residents with high incomes, and residents with higher education levels are keener to participate in sports.Fourth, Chinese residents' mass sports participation rate has generally shown an upward trend over time.Last but not least, after the robustness test of the results to verify its validity, the study finds that with time changes, the sports participation rate varies between urban and rural areas, between ethnic minorities and Han ethnic, between old and young age groups, between higher and lower education levels will continue to shrink, but differences between social classes will further increase over time.Since the study used ordered Probit regression to discuss the influencing factors and changing trends of Chinese residents' sports participation, the author's interpretation of the economic significance of the variable coefficient is mainly based on the current situation and previous research results. It cannot conduct a further in-depth discussion on the impact mechanism.As shown above, the study also used sub-sample regression to illustrate the changing trends and effects of time. Sub-sample test is a classic method in social science and has been used for a long time, which may not be fashionable enough. Since we have already added interaction terms to our variables in Probit analysis, it is meaningless to multiply variables by interaction terms again, so we still chose sub-sample regression. Nevertheless, to ensure the results' robustness, we also replaced the dependent variable as a supplement in the robustness check section; the results are meaningful and robust. Therefore, we hope future researchers could dig out better and more fashionable methods to replace the sub-sample regression.Moreover, considering that the study focused on the influencing factors of sports participation rather than discussing a specific independent variable's influence on the dependent variable, the authors carefully selected the sample and adopted a method of replacing the dependent variables to reduce the effect of endogeneity. However, the study cannot deny that there exist more influencing factors in real society other than the variables covered by design, and the endogeneity could not essentially avoid. We can only guarantee the mentioned factors have been thoroughly explained and proven to have a non-negligible impact.Hence, based on the limitations, the authors hope that future research could design models that include a more comprehensive range of indicators so that discussions on mass sport participation can get further deepened.This paper explores the influencing factors of residents' sports participation, analyzes the role of social, family, and self-induced factors in residents' mass sports participation, and studies the temporal trend of the above factors.It can be concluded that inequality existed in the access to mass sports on social, family, and self-induced factors. Suppose China and other developing countries would like to reduce the inequality of sports participation caused by social and family factors such as the urban-rural gap and social class disparity, they need to increase investment in rural public sports facilities and fundamentally change residents' awareness of healthy lifestyles.Meanwhile, considering that self-induced factors are the most critical factors affecting the inequality of mass sports participation, improving the educational level and individual income can also reduce the gap. On the educational aspect, China has implemented a 9-year compulsory education policy since 1986; as of 2018, the average length of educated duration in China is maintained at about nine years, which is very low. Over the past 30 years, given that residents' income levels and educational concepts have changed tremendously, policymakers may consider extending compulsory education to 12 years as most developed countries do. On the individual income aspect, it should distinguish individual income and family income first. Individual income measures the individual's economic level, while family income reflects the family's survival. Although China's economy has developed rapidly in recent years, the fact that the agricultural population accounts for the majority has not changed fundamentally. Measurements based on family statistics need to consider the number of hidden unemployed or non-labor force households in Chinese society. Based on this situation, the relative advantage of the individual income will disappear, because the individual has the obligation and responsibility to help other family members financially. That is to say, the higher overall income of individuals does not mean that the family's total income is also higher. This situation should be more common in developing countries. Therefore, while paying attention to improving personal income, policymakers need to consider the ultimate impact of policies on personal benefits separately.Inequality of social class will bring socio-political and economic instability. Although mass sports participation is only one indicator of a healthy lifestyle, if the country continues to ignore equal access to mass sports participation, it will eventually affect the stability of the social structure.As a developing country, China has already reached the upper middle-income status by World Bank definitions. Most developing countries are growing much slower than China and remain relegated to low-income or lower-middle-income status. Based on this consideration, inequality in mass sports participation in China can be seen as an inevitable process that other developing countries will experience in the future, and the discussion of the study using China as a case can provide prior experience to a certain extent. However, China's political system and economic development process differ greatly from most developing countries. Developing countries should fully understand and analyze their national conditions when learning from China's experience.http://www.cnsda.org/index.php?r=projects/index.Publicly available datasets were analyzed in this study. This data can be found here: Ethical review and approval was not required for the study on human participants in accordance with the local legislation and institutional requirements. The patients/participants provided their written informed consent to participate in this study.YW conceived the study, collected and analyzed the data, and prepared the manuscript draft. HD provided comprehensive editing, interpretation of the data, and manuscript refinement. WL sorted out the literature. JD put forward suggestions for revision. All authors read and approved the final manuscript."}
+{"text": "Four treatments containing a 0.5 g of substrate were supplemented with 1 mg/mL sodium nitrate (SN), 100 ppm cysteamine hydrochloride (CS), and a combination of SN 1 mg/mL and CS 100 ppm (CS+SN), and a control (no additive) were applied in a completely randomized design. Each treatment group had five replicates. Two experimental runs using in vitro batch culture technique were performed for two consecutive weeks. Total gas and CH4 production were measured in each fermentation bottle at 3, 6, 9, 12, 24, 48, and 72 h of incubation. The results showed that SN and CS+SN reduced the production of total gas and CH4, increased the rumen pH, acetate, acetate to propionate ratio (A/P), and microbial protein (MCP) contents (p < 0.05), but decreased other volatile fatty acids (VFA) and total VFA (p = 0.001). The CS had no effect on CH4 production and rumen fermentation parameters except for increasing A/P. The CSN increased the populations of total bacteria, fungi, and methanogens but decreased the diversity and richness of rumen microorganisms. In conclusion, CS+SN exhibited a positive effect on rumen fermentation by increasing the number of fiber degrading and hydrogen-utilizing bacteria, with a desirable impact on rumen fermentation while reducing total gas and CH4 production.Nitrate is used as a methane inhibitor while cysteamine is considered as a growth promoter in ruminants. The present study evaluated the effect of sodium nitrate and cysteamine on methane (CH One of the major strategies to reduce methanogenesis is the use of hydrogen-consuming compounds [4 emissions per kg of body weight gain and a 35.4% reduction in CH4 emissions per kg of dry matter intake [2 availability for methane synthesis and also directly posing toxic effects on the rumen microorganisms.Rumen fermentation in ruminants leads to the production of methane (CHG) loads . Reducinompounds . Nitrateompounds . Studies4 emissions. This in vitro experiment evaluated the effect of adding sodium nitrate, cysteamine, and their mixtures in a low protein diet  on the cumulative gas and CH4 production, rumen fermentation parameters, amino acid metabolism, and rumen microbial populations.In recent years, nutritionists consider amino acid contents instead of crude protein to optimize the requirements of ammonia and amino acids for efficient rumen fermentation to maximize the synthesis of microbial protein (MCP) . Total dThe substrate was a low protein diet, which was composed of 90% elephant grass and 10% concentrate on a dry matter (DM) basis. Details of the chemical composition of the substrate are given in Four treatments containing a 0.5 g of the substrate (90% roughage and 10% concentrate mixture) were supplemented with 1 mg/mL SN , 100 ppm CS  and a combination of 1 mg/mL SN and 100 ppm CS and a control (no additive) were applied in a completely randomized design. The control group was used to correct for sensitivity variations induced by the inocula. In addition, a blank control group was set without substrate, SN, and CS. The blank group was used to address the variations of rumen fluid used for the in vitro fermentation and to obtain the net gas production. Samples with variations above 10% were rejected. Each treatment group had five incubation bottles as replicates per run.ad libitum, which was used as a substrate for in vitro culture. Before morning feeding, the fistula cover was opened to collect the rumen contents. After collection, the rumen contents of three buffalo were mixed at a ratio of 1:1:1, blended for 10 s, squeezed, and filtered twice through two layers of gauze in the collection bottle preheated (at 39 \u00b0C) under a continuous flow of CO2 [2 to maintain an anaerobic environment, mixed evenly, then placed in a preheated constant temperature water bath, and incubated at 39 \u00b0C for 72 h with continuous oscillation. Two experimental runs were performed for two consecutive weeks using the same experimental conditions.Three female buffaloes with permanent rumen fistula were selected as rumen fluid donors. These buffaloes were fed on the same ration consisting of elephant grass and concentrate 4 production were measured in each in vitro culture bottle at 3, 6, 9, 12, 24, 48, and 72 h of incubation. The gas production was measured with 100 mL lubricated glass syringes with a soft short tube as described previously [Gas and CH4 production was measured through gas chromatography  as described previously [4 production in 72 h was the sum of the actual CH4 production of the incubation bottle at each time point.At the same time of gas measurement, the CHeviously . A 10 \u03bcL4 production. Products such as lactate, formate, and succinate are not considered in this equation:4; iV = isovalerate; and V = valerate (net molar production).The hydrogen balance was calculated by using the equation developed by Demeyer  consider3-N) was determined by phenol sodium hypochlorite colorimetry through an ultraviolet-visible spectrophotometer at 560 nm wavelength as described previously [g (4 \u00b0C) for 10 min. After centrifugation, 920 \u00b5L of supernatant was added to 80 \u00b5L internal standard crotonic acid (1 mol/L). Different VFA fractions  were measured using the GC system as described previously [At the end of 72 h of incubation, the incubation bottles were taken out and immediately, and cooled for 15 min by putting them into the ice water mixture to terminate the fermentation. The pH of the culture medium was measured with a pH meter . About 8 mL of culture medium was used for the determination of microbial protein (MCP) content through colorimetry by using an ultraviolet-visible spectrophotometer . Similarly, ammonia nitrogen  in a constant temperature oven at 110 \u00b0C for 22 h. Then, concentrations of individual amino acids were determined through liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis using a SCIEX Triple Quad 5500 LC-MS/MS System (AB SCIEX (Pvt.) Ltd., Framingham, MA, USA) as reported previously . The catThe total microbial DNA in rumen fluid was extracted by the cetyltrimethylammonium bromide (CTAB) method as described previously . The pur2 value of >0.999 in the standard curve of all primers, indicated the optimum efficiency of primers. The concentration and purity of PCR products were determined by a Nanodrop spectrophotometer . The copy number of each standard was calculated by using the length of the PCR product and its respective DNA concentration. The copy number of each unknown sample was calculated through the association of threshold cycle (CT) values to standard curves. The results were then transformed to log10 copies/mL of the sample for further statistical analysis.Quantitative real-time PCR (qRT-PCR) was used to quantify the microbial populations in the rumen fluid by using methods as described in our previous study . The prihttp://login.majorbio.com/, accessed on 6 November 2020) provided by Shanghai Meiji Biotechnology Co., Ltd.  to determine the relative abundance, microbial diversity matrices, and other parameters.High throughput (Illumina MiSeq PE300) sequencing of the 16S rRNA gene was carried out using barcoded primers for the V3\u2013V4 region. Based on the original data obtained by the illuminamiseqtm sequencing platform, the paired reads were spliced into a sequence according to the overlapping relationship between PE Reads, and then the samples were identified and distinguished according to the barcode tag sequence and primer sequence at the beginning and end of the sequence to obtain each sample data, Finally, the quality of each sample data and the effect of merge were filtered by quality control to obtain the effective sequence of each sample. The non-repetitive sequences were clustered at a 97% similarity level to obtain operational taxonomic units (OTU). Each species was compared with the OTU database using the search representative software, and then the OTU was used to classify each species. After classification, OTU abundance was obtained according to the number of sequences in each OTU. Rumen bacterial composition of samples was determined by species annotation and abundance analysis, and further alpha diversity analysis was conducted to determine the differences among samples. Binformatic analysis of the OTU data was conducted through the Meiji biological cloud platform  multi-dimensional scaling (NDMS) of the Bray-Curtis dissimilarity matrix. Samples were grouped by treatment. PERMANOVA amongst all groups was performed (using 999 permutations). The linear discriminant analysis (LDA) effect size (LEfSe) was used to identify predominant bacterial taxa in each treatment group that can be considered biomarker taxa. In the present study, bacterial taxa having LDA scores (log10) > 2.5 were considered significantly different. PICRUSt was used to predict the function of 16S rDNA sequences. Spearman\u2019s rank correlation (r) analyses were performed with the vegan R package (version 3.2) to analyze the relationship between the relative abundance of bacterial genera with rumen fermentation and amino acid parameters. Correlation heatmaps were constructed using the complot R package. In the two-dimensional heat map, the change in defined color and its depth indicates the nature and strength of the correlation, respectively. Asterisk sign was used when the r value was greater than 0.1 and the p values were less than 0.05 .For each experimental run, the average of five fermentation bottles was taken that served as the experimental unit for statistical analysis. Data were analyzed by the analysis of variance (ANOVA) using a general linear model in SPSS software . Statistical significance was declared at 4 production, H2 produced, H2 utilized and H2 recovery in the treatment groups except CS were significantly lower than the control group (p < 0.05)  . The res < 0.05) a. Howevehin 72 h b. Howevep < 0.05). The MCP concentration of the CSN was the highest (5.65). The concentrations of propionate, butyrate, isobutyrate, valerate, isovalerate, and TVFA in SN and CSN were lower than those in the control group and CS (p = 0.001). Treatment increased (p = 0.001) the A/P ratio as the highest (2.31) A/P ratio was observed for CSN followed by SN (2.20) and CS (1.86) as compared to the control. However, the treatment showed no effect on NH3-N and DMD (p > 0.05).Cysteamine didn\u2019t affect all fermentation parameters except acetate/propionate ratio (A/P ratio) which increased than the control group . The SN p < 0.05). Treatment increased the valine as compared to the control revealing the highest value in CSN followed by SN and CS (p < 0.05). The concentration of lysine was lower in CS and CSN as compared to the control group (p < 0.05). Compared with the control group, the concentration of total non-essential amino acids in SN and CS increased, while decreased (p < 0.05) in CSN. The concentrations of alanine, glycine, glutamate, and asparagine were higher in SN and CS as compared to CSN and the control group (p < 0.05). Treatment significantly reduced the concentrations of histidine, arginine, glutamine, proline, and aspartic acid compared with the control group (p < 0.05).Treatment affected all ruminal amino acids except tyrosine and cysteine which did not exhibit any change . The conp = 0.001). The total fungi population of CSN was significantly higher than those of control and CS (p = 0.009), and the methanogens in CSN was significantly higher than those of other groups (p = 0.001). However, there was no significant difference in the population of protozoa among the treatment groups (p = 0.168).The effect of treatment on rumen microbes is presented in Based on the sequence similarity (>97%), 2420 OTUs were obtained, belonging to 20 phyla, 38 classes, 79 orders, 139 families, 280 genera, and 554 species. The highest number of OTUs was found in the control followed by CS, SN, and CSN, respectively . The majp = 0.001). Compared with the control group, Ace, and Chao indexes were not affected in SN and CS but decreased significantly in CSN (p < 0.05).The Coverage index for sequencing analysis was greater than 0.98, , indicatp = 0.001) of treatment (Beta diversity was determined through (non-metric) multi-dimensional scaling (NDMS) of the Bray-Curtis dissimilarity matrix using PERMANOVA with 9999 permutations which showed a significant effect (reatment . The resp = 0.001) compared with other groups (p = 0.379). Treatment decreased (p = 0.001) the relative abundance of Verrucomicrobiota as compared to the control and CSN groups. Compared with the CS and control group, the relative abundances of Campilobacterota and Proteobacteria were increased in SN and CSN, but the relative abundance of Spirochaetota was decreased in SN and CSN (p = 0.001). The relative abundance of Patescibacteria was lower in SN and CSN as compared to the control group (p = 0.031).The relative abundance of microorganisms in the rumen contents of buffalo at phylum and genus levels is shown in r groups . HoweverPrevotella, norank_f__UCG-011, and Succiniclasticum, etc. Compared with the CS and control group, the relative abundances of Rikenellaceae_RC9_gut_group, norank_f__UCG-010 and norank_f__Eubacterium_coprostanoligenes_group were decreased in SN and CSN, but the relative abundances of Christensenellaceae_R-7_group, Campylobacter, and Butyrivibrio were increased (p = 0.001) in SN and CSN (p < 0.05) the relative abundances of norank_f__Muribaculaceae and Prevotella as compared to the control, however, decreased the relative abundances of Succiniclasticum and norank_f__norank_o__WCHB1-41 (p < 0.05). The relative abundances of NK4A214_group and UCG-005 of CSN were higher than those of other groups (p < 0.05). The relative abundance of norank_f__F082 was lower in CSN as compared to the control group (p = 0.001). The Lachnospiraceae_NK3A20_group was lower in CSN as compared to CS (p = 0.030).The relative abundance of major bacterial genera was shown in  and CSN . TreatmeBlautia and XBB1006. Three genera, namely norank_f__vadinBE97, norank_f__Victivallaceae and unclassified_o__Oscillospirales were highly affected in control group. Metagenomic functional prediction revealed 50 enriched KEGG pathways as shown in We identified bacterial taxa that were predominantly abundant as biomarkers among the treatment groups through LEfSe. A total of 15 significant taxonomic clades (LDA score > 2.5) were identified with 7 genera biomarkers . Two bioPrevotella and Campylobacter) showed negative correlation  with gas, CH4, ruminal hydrogen balance , total and individual VFA including propionate, butyrate, isobutyrate, isovalerate, and valerate, but three bacterial genera  showed positive correlation  with these parameters . Christensenellaceae_R-7_group showed a positive correlation with acetate and A/P ratio but negatively correlated with gas, CH4, ruminal hydrogen balance , propionate, and butyrate . The NK4A214_group showed negative correlation with propionate content . The Prevotella showed a positive correlation with the A/P ratio . Norank_f__UCG-010 was negatively correlated with acetate and A/P ratio but positively correlated with gas, CH4, ruminal hydrogen balance , propionate, butyrate, valerate, and TVFA . The UCG-005 showed a negatively correlated with isobutyrate and isovalerate but a positively correlated with MCP . Norank_f__norank_o__WCHB1-41 showed negatively correlated with A/P ratio but positively correlated with H2 recovery . Butyrivibrio was positively correlated with acetate and A/P ratio but negatively correlated with gas, CH4, ruminal hydrogen balance , and VFAs including propionate, butyrate, isobutyrate, isovalerate, and valerate . Norank_f__norank_o__Clostridia_UCG-014 showed negative correlation with isobutyrate and isovalerate . Family_XIII_AD3011_group positively correlated with gas, CH4, ruminal hydrogen balance (except H2 produced), butyrate, and valerate . Eubacterium_oxidoreducens_group was negatively correlated with the A/P ratio but positively correlated with gas, CH4, ruminal hydrogen balance (except H2 produced), propionate, and butyrate . Ruminococcus showed a positive correlation with acetate content . Lachnospiraceae_UCG-008 was positively correlated with acetate and A/P ratio . Sphaerochaeta was negatively correlated with acetate and A/P ratio but positively correlated with gas, CH4, ruminal hydrogen balance (except H2 produced), propionate, and butyrate . Prevotella ceae_NK3B31_group showed a negative correlation with gas, CH4, and H2 recovery . Papillibacter showed positive correlation with valerate .Our findings revealed three bacterial genera . Norank_f__Muribaculaceae was positively correlated with valine but negatively correlated with proline, glutamine, and cysteine . The Norank_f__F082 showed positively correlation with Histidine . The UCG-005 showed a negative correlation with serine, threonine, glycine, phenylalanine, glutamate, non-essential amino acids, and total amino acids . Norank_f__Bacteroidales_BS11_gut_group was positively correlated with lysine, histidine, glutamine, and serine . Ruminococcus showed a negative correlation with proline but positively correlated with alanine, methionine, essential amino acids, and glutamate .Spearman\u2019s correlation between the relative abundance of bacterial genera and ruminal amino acid contents is shown in 4 production, H2 produced, H2 utilized, and H2 recovery. Cysteamine alone did not affect these indicators. It showed that SN was the main factor affecting CH4 formation and hydrogen balance. Our findings are consistent with earlier studies that reported the negative effects of nitrates on CH4 production in vitro [4 emissions of grazing steers [2 away from CH4 production, but also reduce the relative abundance of H2-producing Firmicutes [2, and also reduced the relative abundance of Firmicutes.The results of the present study showed that the addition of SN alone and the mixture of SN and CS significantly reduced the total gas volume, CHin vitro ,22,23,24g steers . Studiesrmicutes . The res4 and propionate, leading to the reduction in CH4 and propionate production. Acetate in the rumen mainly comes from the fermentation of cellulose and hemicellulose by microorganisms, and this process is accompanied by the production of hydrogen. The reduction process of nitrate consumes oxygen, alleviates the inhibition of hydrogen on fiber degradation, and promotes the production of acetate, which is also one of the reasons why nitrate can change the mode of rumen fermentation and increases the A/P ratio [Rumen VFA is an important energy source for ruminants. In the present study, the addition of SN alone and the mixture of SN and CS significantly increased the ruminal pH, but it was within the normal range of rumen pH value (6.0~7.5). The rumen pH value is affected by the balance between ammonia, VFA production, and lactate. The addition of SN in the present study reduced the concentrations of butyrate, isobutyrate, valerate, isovalerate, and TVFA. These findings are consistent with previous studies reporting supplementation of sodium nitrate under in vitro cultures ,28,29,30/P ratio .2. Therefore, when nitrate is present in the rumen, hydrogen preferentially combines with nitrate to produce ammonia nitrogen and reduces the production of CH4 [4 production, but also provides raw materials for the synthesis of microbial proteins. It has been reported that [3-N and MCP, which is inconsistent with the previous results of in vitro studies [3-N. At the same time, the relative balance of energy and nitrogen in the rumen is also an important factor to improve the synthesis of MCP. Nitrate supplementation has shown different effects on NH3 concentration under in vitro conditions [Many studies ,38,39,40n of CH4 . This prted that  cysteami studies  revealednditions ,29,32, wnditions .Studies have shown that adding nitrate to ruminant diets already adapted to nitrate can promote nutrient DMD . It is r4 [The amino acids in rumen fluid come from the degradation of dietary protein and endogenous amino acids. In the present study, the results revealed that the addition of sodium nitrate and cysteamine alone had a positive effect on the content of total amino acids, while the addition of their mixture exhibited a negative effect on the content of total non-essential amino acids. Previous in vitro studies  have sho4 . Cysteam4 ,48. Howe4 production while increasing the number of total bacteria and methanogens [4 production [4 production. In the present study, the addition of 1 mg/mL nitrate alone increased the total number of bacteria but did not affect the number of methanogens, fungi, and protozoa, but reduced CH4 production. These findings might be attributed to the type of substrate and dose of sodium nitrate because higher concentrations of nitrate are toxic to rumen microorganisms, hence an appropriate dose of sodium nitrate can be used as a non-protein nitrogen source to provide nitrogen for rumen microorganisms [Studies have shown that nitrate inhibits CHhanogens . Howeveroduction . Thereforganisms . Moreoverganisms ,30, esperganisms .2 circulation in the rumen and the microecological environment [3-N in response to cysteamine supplementation is consistent with the decrease of rumen protozoa [Studies have shown that cysteamine can affect the characteristics of biofilm, and change the process of Hironment . The decprotozoa . In vitrprotozoa . Furtherprotozoa , but theprotozoa . The supprotozoa . HoweverThe alpha diversity analysis of buffalo rumen flora in this experiment showed that the coverage of each group was higher than 98%, indicating that the sequencing results truly reflected the species and structural diversity of the buffalo rumen bacterial community. Sodium nitrate reduced the diversity of rumen bacteriome (Shannon index and Simpson index) in the present study which is in agreement with earlier studies . In the The Firmicutes and Bacteroidota were major bacterial phyla observed in buffalo rumen in the present study, which is consistent with previous studies ,58. In tPrevotella belong to Bacteroidota, which participate in the metabolism of a variety of microorganisms and can degrade hemicellulose with high activity [Prevotella is one of the main H2 utilization bacteria, and its abundance increases under the condition of CH4 inhibition [Prevotella. The combination of sodium nitrate and cysteamine inhibits CH4 production, indicating the decomposition and utilization of non-cellulosic material in buffalo rumen, and nitrate can stimulate H2 to inhibit CH4 production by using bacterial growth. Succiniclasticum can metabolize succinic acid produced by rumen microorganisms after decomposing carbohydrates into propionate, and then produce propionate [Succiniclasticum in rumen fluid decreased significantly after treatment, which may be one of the reasons for the significant reduction of propionate concentration. Campylobacter is a gram-negative non-fermenting bacterium containing nitrate reductase genes [Butyrivibrio is a bacterium that decomposes and utilizes cellulose in the rumen [Campylobacter and Butyrivibrio while inhibiting methanogenesis at the same time. It indicates that sodium nitrate can have a positive effect on nitrate-reducing bacteria and hydrogen-utilization bacteria, which facilitates to reduce the nitrite accumulation in the rumen during nitrate reduction, and avoids nitrite toxicity.The relative abundance of Rikenellaceae is positively correlated with the feed utilization rate of the host and the metabolism of VFAs and short-chain fatty acids ,64. Our activity . On the hibition . Our stuopionate . In the se genes . Butyrivhe rumen , and it he rumen . Our stuThe Peptococcaeae and Eubacterium hallii were identified as biomarkers of the cysteamine group in the rumen in the present study. Peptococcaeae can use peptones or amino acids as energy sources to produce VFAs . EubacteBlautia and XBB1006. Studies have shown that Blautia can promote the biosynthesis of rumen lysine and branched-chain amino acids, and promote the breaking of carbohydrate ester bonds leading to better degradation and utilization of polysaccharides [Blautia is positively correlated with the content of short-chain fatty acids , which is desirable for the decomposition of non-digestible carbohydrates [Our findings revealed that the dominant bacterial genera in the CSN group were charides . Moreovehydrates . Our stuMetagenomic functional prediction revealed 50 enriched KEGG pathways including biosynthesis of amino acids, carbon metabolism, and ribosome with the highest abundance. No substantial change in the top three pathways in different treatment groups reveals the functional redundancy of the microbial ecosystem as these pathways did not significantly differ despite substantial changes observed in the relative abundance of rumen bacteria.4, ruminal hydrogen balance , and VFAs , and VFAs , which agrees with earlier studies [Prevotella is mainly responsible for the utilization of H2 [2-producing bacteria [2-consuming Prevotella spp. [Our results showed that fibrolytic bacteria positively correlated with gas, CH studies . Studiesnd fungi . In addi studies . Prevoteon of H2 . Methanebacteria . A corollla spp. .Ruminococcus was positively correlated with alanine, methionine, Essential Amino acids, and glutamate. Christensenellaceae is a cellulose-decomposing bacterium. Bacteroidales can use cellulose, xylan, arabinogalactan, and pectin, as well as plant starch to obtain energy [Ruminococcus can degrade cellulose, hemicellulose, and lignin in roughage in the rumen to produce acetate [Our findings revealed that Christensenellaceae_R-7_group showed a positive correlation with valine, Norank_f__Bacteroidales_BS11_gut_group showed a positive correlation with lysine, histidine, glutamine, and serine, while n energy . Ruminoc acetate . These b acetate . This is4 production and rumen fermentation parameters except the A/P ratio, but nitrate significantly reduced the cumulative gas and CH4 production. Cysteamine combined with nitrate significantly increased the proportion of microbial protein, A/P ratio, and the number of total bacteria, fungi, and methanogens, while reducing the cumulative gas and CH4 production. Nitrate and cysteamine alone significantly increased the contents of total non-essential and essential amino acids. Biomarker taxa for Cysteamine included Peptococcaeae and Eubacterium hallii, while Blautia and XBB1006 were the most dominant genera in the nitrate and cysteamine mixture group. Our findings concluded that the combination of Cysteamine and nitrate was favorable for the synthesis of microbial protein, and rumen microorganisms, but same it also reduced the CH4 and total gas production which is nutritionally beneficial.Our study revealed that cysteamine had no effect on CH"}
+{"text": "Cannabis sativa (C. Sativa) in the management of MS outcomes such as spasticity, pain, tremors, ataxia, bladder functions, sleep, quality of life, and adverse effects were assessed in this review. Most clinical studies showed the positive effects of cannabinoids with their different routes of administration, such as oromucosal spray and oral form, in reducing most MS symptoms. The oromucosal spray Nabiximols demonstrated an improvement in reducing MS spasticity, pain, and quality of life with a tolerated adverse effect. Oral cannabinoids are significantly effective for treating MS pain and spasticity, while the other symptoms indicate slight improvement and the evidence is quite inconsistent. Oromucosal spray and oral cannabis are mainly used for treating patients with MS and have positive effects on treating the most common symptoms of MS, such as pain and spasticity, whereas the other MS symptoms indicated slight improvement, for which further studies are needed.Multiple sclerosis (MS) is known as an autoimmune disease that damages the neurons in the central nervous system. MS is characterized by its most common symptoms of spasticity, muscle spasms, neuropathic pain, tremors, bladder dysfunction, dysarthria, and some intellectual problems, including memory disturbances. Several clinical studies have been conducted to investigate the effects of cannabis on the relief of these symptoms in MS patients. The efficacy of  MS is a neurological disease with an autoimmune origin that affects and damages the central nervous system and affects 2.3 million people worldwide ,2. This Cannabis indica and Cannabis sativa (C. Sativa) [C. Sativa has a higher ratio of CBD to THC and the reverse is seen for C.indica [Cannabis sativa [In the 21st century, the Sativa plant has become the most widely used illicit drug . It isal Sativa) ,8. Both  Sativa) ,10. Prev Sativa) . C. Satis sativa , the moss sativa ,13.Cannabis has been used for over 5000 years, with the discovery of the endogenous cannabinoid system occurring more than a decade ago. CB1 and CB2 are cannabinoid receptors that are linked to adenylyl cyclase negatively and mitogen-activated protein kinase positively through the Gi/o protein ,15. CB1 Phytocannabinoids, endocannabinoids, and synthetic cannabinoids are the three types of cannabinoids. The major chemical components of cannabis are phytocannabinoids, which include a variety of non-cannabinoid C21 terpenes phenolic compounds, or C22 for the carboxylate group, which is largely synthesized in cannabis ,19. HeatCannabis isconsidered a promising anti-inflammatory and immunosuppressive agent due to its central and peripheral actions on CB1 and CB2 receptors that mediate different intracellular pathways when activated . In addiC. Sativa plant, 9-THC, was discovered in the late 1980s and was shown to have activity on a specific cannabinoid receptor in the brain (the cannabinoid CB1 receptor), which had a huge impact on the development of cannabinoid therapeutic drugs and their potential to relieve MS spasticity symptoms [The main psychoactive constituent of the symptoms . Preclinsymptoms ,26.C. Sativa that accounts for up to 40% of the cannabis plant\u2019s extract and binds to a wide range of physiological targets of the endocannabinoid system in the human body. CBD has shown potential in the treatment of MS symptoms. CBD, in particular, has been shown in numerous trials to reduce stiffness, discomfort, inflammation, exhaustion, and depression in MS patients, resulting in increased mobility [CBD is a key non-psychotropic cannabinoid present in mobility ,28. CBD mobility .Several attempts have been made to determine the primary genetic factor contributing to MS progression and severity ,30,31. AThe efficacy of oromucosal spray nabixiomol, oral dronabinol, and oral nabilone forms of cannabis on MS-related spasticity, pain, tremor, urine function, sleep disturbances, quality of life, disability, and disability progression is assessed in this review. The sections below go through the signs and symptoms of MS, as well as the treatment options.Spasticity is a common symptom of MS, affecting 60\u201384% of patients, particularly throughout the disease\u2019s progression . SpasticMS spasticity is a complicated condition characterized by the most prevalent symptom, muscle rigidity, which is induced by the stretch reflex\u2019s hyperexcitability. Fatigue, discomfort, and bladder dysfunction are among the more prevalent and troubling symptoms . CombiniMS spasticity therapy is used to improve functional ability, assist rehabilitation, avoid contractures, and relieve discomfort in people with MS. The only use of cannabinoids in neurological disorders and the only complementary medicine intervention with high-level evidence for efficacy in MS is pharmaceutical cannabinoids for spasticity, according to most recent studies ,41.The most prevalent and available treatment for MS spasticity is multimodal , which cMS is frequently linked to pain . Pain haMS affects the cerebellum and its efferent and afferent pathways, causing tremors, ataxia, and dysarthria in both acute and chronic symptoms . More thIn MS patients, lower urinary tract dysfunction is a prevalent symptom. It usually appears in the later stages of the disease. In total, 50\u201390% of MS patients develop this symptom after 6 years of disease ,59,60, wOne of the most prevalent symptoms among MS patients is sleep disturbances . The mosHRQoL  is a multidimensional perception that encompasses physical, emotional, mental, and social functioning . MS patiProgression MS is a disability-causing disease that is characterized by relapsing-remitting neurological episodes . Progres\u00ae, an oromucosal spray containing a 1:1 molecular ratio of THC and CBD (Nabiximols (c), Nabiximols is the generic name for SativexWade and colleagues reported an open-label extension trial in 2006 that included 137 patients diagnosed with MS after 6-week placebo-controlled research, in which the efficacy and tolerability of Sativex for the management of spasticity and other symptoms were assessed for about 15 weeks . The prip = 0.048 [Collin et al. conducted a 6-week, double-blind, placebo-controlled research on 189 patients in 2007, comparing the effects of Sativex between the groups . There w = 0.048 . As a se = 0.048 .Novotna and colleagues conducted a large multicenter phase III trial in 2011 that included two phases of study design: phase A began with a four-week single-blind treatment phase to identify early responders to oromucosal spray Nabixomols, followed by phase B, which was a 12-week randomized, double-blind study phase . The recBased on a series of randomized controlled clinical trials vs. placebo, Nabiximols were given and licensed for their therapeutic efficacy and relief of spasticity-related symptoms ,79,83. TNabiximols are approved and advised as an add-on treatment for adult patients with moderate to severe resistant MS spasticity in several Western countries ,87.Nabiximols : randomized, placebo-controlled research in which 66 patients were randomly assigned to Nabiximols or placebo found that Nabiximols was effective in alleviating both central pain associated with MS and pain-related sleep disruption . In a diOnly 13 of the individuals in a Class I trial using the Nabiximols to see if cannabis extracts had an effect on symptoms in MS had a tremor as their predominant symptom. The Visual Analogue Scale did not change when (THC/CBD) oral spray was used at a dose of 2.5/120 daily in divided doses. Due to the small number of participants, no conclusion or difference was reached . A more THC: CBD oromucosal spray (Nabiximols) reduced urine frequency of nocturia and improved incontinence-related quality of life measures in Class 1 research . Nabiximp = 0.056) [p = 0.00. Sativex appears to have some effect on improving bladder dysfunction in MS patients; however, the primary endpoint did not reach statistical significance [p = 0.001), and an oromucosal spray administration was found to be beneficial in treating overactive bladder symptoms. THC/CBD oromucosal spray can improve overactive bladder in people with MS-resistant symptoms, according to a study [The impact of a cannabis-based medicinal extract on MS symptoms was studied in 160 MS patients in a double-blind, randomized, placebo-controlled class 1 study. Sativex\u2019s effect on the symptoms of MS bladder dysfunction was investigated . These g= 0.056) . Sativexificance . Giorgiaificance . Overact a study .p-value 0.0001) in MS sleep problems, which were considered a secondary endpoint in the study [Russo et al. conducted a review of utilizing Sativex to examine sleep disorders and found that there was a sleep improvement with no medication tolerance . Wade ethe study .The effects of Nabiximols on MS-specific HRQoL were studied for 3 to 4 months in the MOVE 2 research . AlthougIn terms of disability and progression, evaluations found no significant changes in various indexes, such as the Barthel index of daily living activity and walking time of MS disability ,63,95. TThe primary THC isomer present in the cannabis plant, (\u2212)-trans-9-THC(Dronabinol(d), p = 0.003) after 12 months of follow-up, which was not detected in the canned or placebo groups [Zajick et al. conducted a multicenter, randomized, placebo-controlled research on 630 patients aged 18 to 64 in 2003 . The effo groups .Schimrigk et al. published a study that found Dronabinol to be superior to placebo in the treatment of neuropathic pain . They dip = 0.052) or self-report (p = 0.398) [A total of 391 individuals in the CAMS study were given THC (Dronabinol), THC/CBD, or placebo orally; however, there was no statistically significant difference in the reaction to tremor as measured by a physician assessment (= 0.398) .The CAMS trial  used oraThe CAMS trial looked at the effects of marijuana on 630 MS patients with spasticity. For 15 weeks, MS patients were divided into four groups: oral Cannador, Dronabinol, Candor placebo, or Dronabinol placebo . When coA three-week crossover study comparing the effect of Dronabinol on HRQoL in 24 MS patients found no significant differences in HRQoL in the treated patients compared to the placebo group .Dronabinol\u2019s effect on progression in progressive MS was studied in a randomized, double-blind, parallel, and placebo-controlled experiment . For 36 Nabilone e is the Martyan et al. studied the effects of Nabilone on MS-related spasticity for four weeks . Their fA meta-analysis of randomized clinical trials found sufficient evidence to support the improved impact of Nabilone on MS-related pain . In 2015Oral Nabilone was shown to have no meaningful effect on tremors in a class III trial . In a syMartyn et al. observed significant relief of MS bladder dysfunction symptoms with oral Nabilone for two periods of four weeks in a double-blind crossover, placebo-controlled research .There was no clinical investigation that demonstrated the efficacy of Nabilone on the symptoms of MS sleep problems .In 2015, a randomized controlled trial looked at the efficacy of combining Nabilone and gabapentin for the treatment of MS-related neuropathic pain . This coThere was no clinical investigation that indicated how Nabilone affected MS-related disability and progression .Several studies that employed cannabis in MS patients reported the side effects of the drugs ,112,113.In a class I research, 268 (46.9%) of 572 patients treated with Nabiximols reported at least one side effect, the most prevalent of which were dizziness and weariness . The tolThe majority of the side effects were mild to moderate and dose-dependent, according to a review report that covered multiple clinical trials of CBD/THC in MS patients . They stWhile some studies have found that combining oral THC and CBD causes significantly more negative effects ,97, otheThis study looks at the impact of various cannabis administration routes on MS patients with varying symptoms. It found indications that cannabis will support the efficacy of cannabinoids, namely throughan oromucosal spray and orally, in the treatment of pain and spasticity, which are the most common symptoms in MS patients. In general, adverse effects were modest to moderate, although special attention should be exercised in patients with multiple sclerosis."}
+{"text": "The experience of passage of time is assumed to be a constitutive component of our subjective phenomenal experience and our everyday life that is detached from the estimation of time durations. However, our understanding of the factors contributing to passage of time experience has been mostly restricted to associated emotional and cognitive experiences in temporally extended situations. Here, we tested the influence of low-level visual stimuli on the experience of passage and duration of time in 10\u201330\u00a0s intervals. We introduce a new paradigm in a starfield environment that allows to study the effects of basic visual aspects of a scene (velocity and density of stars in the starfield) and the duration of the situation, both embedded in a color tracking task. Results from two experiments show that velocity and density of stars in the starfield affect passage of time experience independent from duration estimation and the color tracking task: the experienced passage of time is accelerated with higher rates of moment-to-moment changes in the starfield while duration estimations are comparably unaffected. The results strongly suggest differential psychological processes underlying the experience of time passing by and the ability to estimate time durations. Potential mechanisms behind these results and the prospects of experimental approaches towards passage of time experience in psychological and neuroscientific research are discussed. This is also reflected in changes of the experience of passage of time as described by patients with depressive syndromes6 and mild cognitive impairments7, even when their ability to judge durations is preserved. However, what defines and constitutes the subjective experience of the passage of time as a unique category of time experience remains poorly understood10.Time measurements, e.g. as performed by physical clocks, structure our everyday life and enable us to coordinate our actions with others over long distances and long periods, based on the fundamental assumptions that physical time passes by with the same velocity and that it can be reliably measured with clocks. However, everyday experience suggests that this is not how we subjectively experience the passage of time: We refer to time passing by \u201cslowly\u201d when feeling bored or to time \u201cflying\u201d when being engaged in a pleasant activity. In fact, we are aware of this difference and seem to have accepted this decoupling of the experienced subjective passage of time from the ongoing physical time as measured by clocks11 and attentional demands14, the emotional state and the level of anxiety or fear17, as well as expectations19, the recall of experiences20 and salient contextual factors8 regarding a specific interval, and assumptions about time . Nevertheless, the role of low-level stimulus features in modulating the passage of time remains unresolved. To study these features is even more pressing as such features exert a considerable influence on judgements of the duration of a time interval as has been already examined in time perception studies26.Prior studies of subjective passage of time experience have focused on the effects of high level emotional or cognitive aspects of activities and situations. Passage of time experience has been associated with the current activity, its hedonic value29. Accelerating stimuli on the other hand were judged as being shorter in time compared to static stimuli whereas static stimuli were judged as being shorter compared to decelerating stimuli31. Furthermore, durations were estimated longer for stimuli with larger size, numbers, luminance, and even digit values32.Numerous studies have demonstrated that duration judgments are influenced by the stimuli presented during that interval. For example, for visual stimuli, duration estimations increased with the velocity of moving visual stimuli35. Importantly, however, duration estimations do not require any judgment about the passage of time (which is the focus here). Previous studies suggest that judgments about the passage of time are qualitatively distinct from judgments about the duration of a time interval both for healthy persons37 and for patients with cognitive disorders7. However, the extensively documented effects of low-level stimulus features on duration judgments raises the question whether these features might also be capable of modulating the subjective passage of time. Furthermore, unlike the sub-second intervals typically investigated for duration judgments, studies of passage of time have typically investigated scenarios involving intervals of several minutes21. Therefore, in the current study , we investigated whether and how the properties of a simple visual stimulus (a field of moving dots) during a supra-second time interval (of 10\u201330\u00a0s) can influence prospective time experience38, namely, the subjective experience of the passage of time and its relationship to accompanying effects on judgments about the interval\u2019s duration.Duration estimations have been used to make indirect inferences about the \u201cspeeding up/slowing down\u201d of time-related psychological processes and their neural mechanismsIn both experiments, the stimulus on each trial was a \u201cstarfield\u201d Fig.\u00a0a\u2014a rando8. This potential linkage between visual change and time experience suggests that stimulus velocity and density might exert an influence on the experienced passage of time, irrespective of the physical duration of stimuli. By contrast, the actual duration of the interval might be expected to be the dominant factor that influences duration judgments, which might additionally be modulated by velocity and/or density.For the starfield stimulus, the velocity and density are critical determinants of the intensity of visual change. Since the perceived visual change between consecutive frames might be larger for higher velocity and higher density, we reasoned that the moment-to-moment differences between the immediate present and the immediate past might also be perceived as being more salient for starfields of higher velocity and higher densityTo test these predictions employing the starfield color tracking paradigm, we systematically varied the velocity and density of the stars in the starfield and the\u00a0trial duration and analyzed their effects on passage of time judgments (PoTJs) and duration of time judgments (DoTJs). We hypothesized that velocity, density, and duration could have dissociable consequences of for DoTJs and PoTJs.20 participants  were recruited for the experiment and received monetary compensation (10\u20ac per hour). Inclusion criteria were an age between 18 and 55, exclusion criteria were any record of psychiatric or neurological illnesses, any current psychoactive medication or color blindness. All participants gave their written informed consent before participation in the study. The study was approved by the ethics committee of the Medical Faculty of the University of Cologne, Germany, and adhered to the Declaration of Helsinki. All experiments were conducted in accordance with relevant guidelines and regulations. Note, since neither effect sizes nor intra- or interindividual variance of prospective PoTJs in short time intervals could be estimated from previous studies, the sample size was not based on a-priori power calculation. Instead, we used this study to generate hypotheses in an abductive manner and conducted a second experiment (see below) to test the replicability of central results.The stimuli in our study were characterized by a black background and colored dots (referred to as \u201cstars\u201d) that appear in the center of the screen before moving steadily to the periphery of the screen in a radial fashion and on a straight trajectory. This elicited the impression of moving through a starfield in outer space or a movement in relation to space.https://www.python.org/) using the PsychoPy39 and PyGame40 packages, and presented on a 27 inch screen .These stimuli were generated using python 3.7.3  random location within a source rectangle , and was assigned one of three colors  based on a color ratio specified for the entire stimulus (see below). Thus, depending on the specified color ratio, the color composition of the entire starfield was predominated by one of the colors.Each star then moved on a straight line along the Z-axis until the rectangle Z\u2009=\u2009\u2009+\u2009128 was reached. When a star reached this target rectangle, it was removed from the display and replaced with a new star at a randomly chosen location within the source rectangle and with a randomly chosen color based on the specified color ratio for the entire stimulus. On each trial, all stars moved in a radial fashion with the same speed. The impression of a dynamic color change was reached through changes in the specified color ratio of the entire stimulus. Subsequently, the whole stimulus would then gradually change the color composition with each star disappearing in the \u2018front\u2019 (periphery) and reappearing in the \u2018back\u2019 (center) with a new color, chosen based on the new color ratio.The 3-dimensional motion of the stars were viewed after a perspective projection to a 2D plane at Z\u2009=\u2009128 parallel to the source rectangle, with a viewing direction towards the source rectangle. Following this projection, the source rectangle for all the stars had the dimensions  at the center of the screen. The prospective projection was also applied to the size of the stars and the brightness.With the perspective projection, each star was small , dimly light, and barely visible when they appeared, and then moved radially along a straight line to the periphery of the screen. On their way, the stars increased in size  and brightness. This approach was chosen to support the participants immersion in a three-dimensional environment and thus to strengthen the effects of the visual stimulation.Building on this general framework, different variations of the starfield stimuli could be created and displayed. Each particular trial was defined by four parameters: DURATION on three levels ; VELOCITY on two levels , DENSITY on two levels , and DIFFICULTY on two levels based on color ratio  relative to the two other colors (denominator).23.Each trial commenced with the display of the starfield stimulus see Fig.\u00a0a. The en(\u2018DoTJ\u2019): \u201cHow long was the waiting period?\u201d ; : \u201cHow fast did the time pass?\u201d : \u201cHow many stars did you see?\u201d ; : \u201cHow fast did the stars move?\u201d .  was presented twice in randomized order, once with DoTJ, once with PoTJ. In addition, each block contained 4 manipulation check trials, with all 8 possible combinations of the 2 velocity levels, 2 density levels and 2 manipulation check questions randomly distributed over the whole experiment . In total, each block contained 52 trials .Before the start of the experiment, participants were informed in verbal and written format about the study details and gave their written consent.After the participant information but before participants had received any more detailed information or instructions about the experiment and the task, a short pre-experimental interview was conducted. In this interview . Between the two blocks of the experiment, participants were given the opportunity to take a short break. After the experiment a short post experimental inquiry and questionnaires followed ). This ensured comparability of DoTJs between different stimulus durations by taking into account the scalar properties of duration estimations39. Proportional duration estimates\u2009>\u20090 can be interpreted as overestimations of interval durations while values\u2009<\u20090 mean an underestimation of interval durations. Correspondingly, positive signed coefficients of individual factors would mean that duration estimations are increased while negative coefficients indicate a decrease in duration estimations. Since no equivalent monotonous relationship was expected between the experience of passage of time and the elapsed duration37, PoTJs were not transformed. Subject-wise visual inspection of DoTJs, PoTJs, and ratings in the color detection task suggested that all participants had followed the instructions. No subjects or individual trials had to be excluded from analysis.DoTJ raw values were transformed into proportional duration estimates for the analysis by taking the logarithm of the estimated durations divided by the true duration of stimuli  as the ratio of participant wise influences (random intercepts) in the overall variance.Data were statistically analyzed with RAs a manipulation and validity check, we analyzed the effects of star velocity (VELOCITY) on velocity ratings and starfield density (DENSITY) on density ratings. Furthermore, we tested the effect of task difficulty (DIFFICULTY), as well as the additional influences of DURATION, VELOCITY, and DENSITY on the probability for correct color ratings.46). Lastly, we combined all factors for which our first analysis had suggested significant individual effects into full models in order to assess potential interactions between the individual factors. Test statistics for individual coefficients  were obtained via the lmerTest package47, using the Satterthwaite\u2019s degree of freedom approximation.We analyzed the influence of interval duration (DURATION), star velocity (VELOCITY), starfield density (DENSITY) and task difficulty (DIFFICULTY) on DoTJs and PoTJs. In order to assess the influence of each of these factors individually, we added them to mixed effects models which we separately compared to null models not including any fixed effects. We then tested for DoTJs and PoTJs whether the stimulus duration or the low-level visual features velocity and density would explain more variance in the participants responses. This was achieved by comparing the fits of the respective models based on which one resulted in a lower (i.e. better fit) AIC \u2009=\u200959.05, p\u2009<\u20090.001), with a probability for a correct rating of 0.61 for easy and 0.44 for difficult color compositions according to the model. Adding DURATION (X2(1)\u2009=\u200916.60, p\u2009<\u20090.001) or VELOCITY (X2(1)\u2009=\u200914.61, p\u2009<\u20090.001) but not DENSITY (X2(1)\u2009=\u20092.24, p\u2009=\u20090.134) further increased the fit significantly. Accordingly, the probability for correct color ratings increased with faster stars  but decreased for each second of stimulus duration  whereas density did not change the correctness of color ratings.DIFFICULTY had a significant effect on the probability of correct color ratings \u2009=\u2009261.30, p\u2009<\u20090.001). The corresponding coefficient for DURATION  implies that underestimation increased with the duration of the intervals .A model that included the stimulus DURATION Fig.\u00a0a improve2(1)\u2009=\u20096.28, p\u2009=\u20090.012), with the corresponding coefficient  suggesting an increase of the estimated duration by a factor of 1.05 for faster stars.VELOCITY Fig.\u00a0b also im2(1)\u2009=\u200912.23, p\u2009<\u20090.001), with the coefficient for DENSITY  suggesting increased duration estimations by a factor of 1.07 for more dense starfields.Similarly, DENSITY Fig.\u00a0c improve2(1)\u2009=\u20092.80, p\u2009=\u20090.094).Conversely, DIFFICULTY Fig.\u00a0d did notWe then assessed whether the stimulus duration or the combination of the stars velocity and density would have a stronger effect on duration estimations. Here AICs and BICs suggested that the DURATION model (AIC\u2009=\u2009166.42) fitted the data better than the VELOCITY\u2009+\u2009DENSITY model (AIC\u2009=\u2009411.13).Lastly, we assessed potential interactions between the factors for which significant individual effects on duration estimations had been found, i.e. DURATION, VELOCITY, and DENSITY (see above). For this purpose, we fitted a full model Table , includiFor PoTJs Fig.\u00a0, the ICC2(1)\u2009=\u2009148.45, p\u2009<\u20090.001). The coefficients  suggest that the probability for a higher PoTJ level decreased on average by a factor of 0.91 for each second of stimulus duration.Here, too, the inclusion of DURATION Fig.\u00a0a increas2(1)\u2009=\u2009143.97, p\u2009<\u20090.001), with the corresponding coefficient  implying an increase in the probability for a higher PoTJ level by a factor of 4.28 for higher velocities.VELOCITY Fig.\u00a0b, too, i2(1)\u2009=\u200916.83, p\u2009<\u20090.001), with higher density increasing the probability for a higher PoTJ level by a factor of 1.61, according to the coefficient .Similarly, including DENSITY Fig.\u00a0c improve2(1)\u2009=\u20091.13, p\u2009=\u20090.287).As for DoTJs, DIFFICULTY Fig.\u00a0d did notWhen comparing the influence of stimulus duration to the combined influence of velocity and density, AICs suggested that the VELOCITY\u2009+\u2009DENSITY model (AIC\u2009=\u20092980.56) fitted the data better than the DURATION model (AIC\u2009=\u20092997.55).To assess potential interactions between the different factors we again fitted a full model including terms for DURATION, VELOCITY, DENSITY, and their interactions Table . Here, hConsistent with the experimental manipulation, duration judgments (DOTJs) were influenced by the corresponding objective stimulus durations but with the longer intervals being more underestimated than the shorter intervals Fig.\u00a0a. SimilaBased on their explanatory power, stimulus duration and the low-level visual features  differed in their relative influence on DOTJs and POTJs. Stimulus duration had a more decisive influence on duration estimations than the low-level visual features. This was reversed for POTJs, which were more strongly influenced by the visual features as compared to stimulus duration. Together these findings suggest that the low-level stimulus features that are known to effect duration judgments can also have a substantial influence on judgments of the passage of time.faster. This stands in contrast to the explicit passage of time judgments where longer intervals were judged to have a slower passage of time. This relationship would suggest that DOTJs and POTJs were not mere derivatives of each other. Note, however that in this experiment participants performed prospective time judgments, which are presumably based on different cognitive processes compared to everyday life situations where the passage is usually judged retrospectively48. Furthermore, since participants were not informed before a trial whether they had to provide either a DoTJ or PoTJ, both types of judgments could have potentially interfered with each other.Furthermore, the differences in the relative explanatory power of duration vs. low-level visual features in DoTJs and PoTJs suggest that duration estimation and passage experience might be based on different mechanisms. The effect of stimulus duration on DOTJs and POTJs points towards another phenomenological distinction between the two types of time experience. It is noteworthy that when estimating duration, longer intervals  were underestimated to a greater extent than a short interval . This underestimation pattern would seem to suggest that the longer intervals were implicitly experienced as running relatively To further corroborate the notion of the qualitative distinction between DoTJs and PoTJs and also to confirm the effects of visual stimulus features especially on PoTJs, we conducted a second experiment with some adjustments to the general approach. Data from Exp. 1 did not give any reason to suspect a significant influence of task difficulty on either DoTJs or PoTJs. However, significant differences in color detection accuracy between trials of different durations and different velocities could suggest a confounding of task difficulty and interval duration and star velocity. This may point to a potential limitation of Exp. 1, namely the fact that we did not systematically control the time points of color changes in the starfield. Since the starfield changed its color composition gradually with every star that reached the front and reappeared with a new color in the back, the speed of the whole process depended on the velocity of the stars. Thus, color composition changes were more abrupt for faster stars and especially color changes immediately before the end of a trial would be easier to detect in case of faster moving stars.We decided to drop the different intervals and difficulty levels, instead focusing on the effects of velocity and density on DoTJs and PoTJs. In addition, we now controlled closely the number and time points of color changes in each trial, ensuring a balance between the conditions and preventing the occurrence of color changes in the last 1.5\u00a0s of a trial. Most importantly, every participant was either asked to respond to DoTJs or to PoTJs (but not both during the experiment) in order to separate both tasks between subjects and prevent potential confusions of the two. We also decided to investigate the effects of velocity and density within and between subjects. These changes in design required a higher number of participants compared to Exp. 1, because of which Exp. 2 was conducted online. Furthermore, the design changes meant that effect sizes were not readily transferable between experiments and thus the minimum sample size for each comparison was set to 40 participants .179 participants  were included for the analysis of this study. Due to data-quality considerations, an additional 85 participants had to be excluded due to different reasons  containing different numbers of changes: 1 video containing 3 changes, 3 videos containing 2 changes, 6 videos containing 1 change. These changes were evenly spread over the duration of the trial.In total, four groups of stimuli were created, one for each combination of velocity (slow vs. fast) and density (low vs. high).The design of the experiment itself was very similar to Exp. 1, only that now conditions were varied in a mixed within- and between-subject design (instead of the pure within-subject design of Exp. 1). To this end, participants were split into 8 groups Table . Each ofTask and instructions were highly similar to the procedure in Exp. 1 with the key difference that each participant only received instructions according to their respective judgment condition.To each participant 20 (10 low\u2009+\u200910 high velocity or 10 low\u2009+\u200910 high density) trials were presented in randomized order but with uniform structure. Each trial started with the presentation of a starfield video, embedded in a page with black background and without any visible border. Unbeknownst to the participants, each video lasted exactly 20\u00a0s. After the video, participants were first asked to report the last predominant color before they were then asked either for a DoTJ or PoTJ, according to their assigned judgment condition. DoTJs were entered as a number of seconds in a text box while PoTJs were reported via a slider on a scale ranging from \u201cvery slow\u201d to \u201cvery fast\u201d (in 100 steps). Afterwards, the next trial started automatically after a short pause caused by loading the stimuli (the duration depended on the participants device and internet connection).For procedures specific to the online format of this study please refer to the supplementary material Data analysis was conducted in accordance with the procedure from the analysis for Exp. 1. The effects of stimulus velocity and density were again tested in likelihood ratio tests of differently saturated models. However, PoTJs were now recorded on a scale (100 steps) that can be considered continuous for the purpose of this analysis and therefore it was also modeled as a linear model. This experiment did not entail a manipulation of stimulus durations and task difficulty. Instead, the split into different experimental groups see \u201c allowed 49.As a first step and in parallel to the analysis of Exp. 1, we tested the effects of variations of VELOCITY and DENSITY on DoTJs and PoTJs within subjects. Since in each group of participants only one factor (VELOCITY or DENSITY) was manipulated and each group was only asked to provide either DoTJs or PoTJs . In each of the four power calculations, it was then tested for each of the 10,000 data sets, whether including the respective factor (e.g. velocity) would improve the model fit significantly either as a main effect or via an interaction with the other factor (e.g. density). The power was then approximated as the ratio of significant results in the total number of repetitions . This procedure is based on and explained in more detail in DeBruine and Barr2(1)\u2009=\u200929.72, p\u2009<\u20090.001), but not DENSITY (X2(1)\u2009=\u20091.60, p\u2009=\u20090.206) significantly affected the probability for correct color ratings with 0.951 for slow and 0.981 for fast stars .Exp. 2 did not contain checks of the effect of speed or density manipulations. The overall accuracy in the color detection task was 0.966. As in Exp.1 we tested the effect of star VELOCITY and DENSITY on the probability for correct color ratings by comparing the model fit of generalized mixed effects models including a random intercept for participants in likelihood ratio tests. VELOCITY \u2009=\u20090.14, p\u2009=\u20090.707) nor the interaction VELOCITY*DENSITY (X2(1)\u2009=\u20090.57, p\u2009=\u20090.450) improved model fits significantly. Accordingly, post-hoc pairwise comparisons did not reveal any significant effects of VELOCITY, neither in the low density \u2009=\u20090.27, p\u2009=\u20090.993) nor the high density group \u2009=\u2009\u2212\u00a00.80, p\u2009=\u20090.855).In the comparison of trials of different VELOCITY \u2009=\u20090.01, p\u2009=\u20090.915) nor the interaction DENSITY*VELOCITY (X2(1)\u2009=\u20090.34, p\u2009=\u20090.560) led to a significant improvement of model fits. Again, post-hoc pairwise comparisons did not reveal significant effects of density in the low velocity \u2009=\u20090.34, p\u2009=\u20090.987) or the high velocity group \u2009=\u2009\u2212\u00a00.48, p\u2009=\u20090.962).Similarly, in the comparison of trials of different DENSITY , model fits were not significantly improved by including the effects of VELOCITY \u2009=\u20090.60, p\u2009=\u20090.441).The same was true for the effect of DENSITY \u2009=\u20090.02, p\u2009=\u20090.892), which also did not improve the fit in the comparison between the groups of different DENSITY levels (group 1 vs. 2).In PoTJs, ICCs suggest that in groups 5 & 6, experiencing changes in velocity, 14.6% \u2009=\u2009425.17, p\u2009<\u20090.001) as well as the term for the interaction VELOCITY*DENSITY (X2(1)\u2009=\u200910.21, p\u2009=\u20090.001) improved model fits significantly. The coefficients in the resulting model suggested that PoTJs were decreased for slower compared to faster trials , with the effect decreasing in interaction with low density .In the comparison between trials of different VELOCITY , lower velocity showed significant effects in both the low density group \u2009=\u2009\u2212\u00a016.06, p\u2009<\u20090.001) and the high density group \u2009=\u2009\u2212\u00a016.99, p\u2009<\u20090.001).2(1)\u2009=\u200934.22, p\u2009<\u20090.001) but not the interaction DENSITY*VELOCITY (X2(1)\u2009=\u20091.91, p\u2009=\u20090.167) improved model fits significantly. Accordingly, PoTJs were decreased for low density compared to high density trials .In the comparison between trials of different DENSITY , lower density showed significant effects in both the low velocity \u2009=\u2009\u2212\u00a05.25, p\u2009<\u20090.001) and the high velocity group \u2009=\u2009\u2212\u00a03.05, p\u2009=\u20090.013).In the comparison of PoTJs between groups of different VELOCITY levels (group 7 vs 8), including VELOCITY did not significantly improve the model fit \u2009=\u20092.41, p\u2009=\u20090.128).Similarly, when comparing PoTJs between groups of different DENSITY levels (group 5 vs. 6), the inclusion of DENSITY did not significantly improve the model fit \u2009=\u20092.83, p\u2009=\u20090.098).In contrast to Exp. 1, in Exp. 2 only velocity and density of the starfield were manipulated while interval duration and task difficulty were kept constant. Each participant only provided DoTJs or PoTJs and experienced changes in only one modality, either velocity or density. The groups of participants experiencing changes in velocity were further split into one low and one high density group and vice versa. This allowed the analysis of effects between as well as within subjects. Contrary to the results from Exp. 1, in Exp. 2 DoTJs did not show any significant influence of either velocity or density, neither between- nor within subjects. However, the effect of increased PoTJs for higher velocity and higher density could be confirmed in the within subject analysis. Furthermore, the PoTJ increasing effect of velocity was further increased in the high density group. The between subject analysis of PoTJs did not reveal significant differences. However, note that the analysis of velocity effects on DoTJs was underpowered see\u00a0\"\" section52. Since we had no prior hypothesis regarding ICCs we will refrain from speculating about the potential differences between DoTJs and PoTJs suggested by the results for Exp. 1.In principle, the paradigm also allows to assess the influence of participant specific effects in DoTJs and PoTJs by comparing the ICCsThe paradigm does require thoroughly controlling all aspects related to the color tracking task as apparent from the low accuracy rates in color ratings in Exp. 1. In Exp. 2, especially the number and time point of color changes were controlled more closely, resulting in higher overall accuracy scores. This was necessary to exclude potential confounds between experimental conditions, prevent frustration in participants and to generally ensure a closer control over the participants experience while doing the task. It has to be noted that in Exp. 2 we again observed a significant difference in accuracy depending on the speed of stars. However, the resulting difference in the accuracy was small (0.95 vs 0.98) and most likely not noticeable for participants.In this study, we investigated the experience of how fast time passes in time intervals in the range of decades of seconds and whether it would be susceptible to manipulations by low-level stimulus features and/or task characteristics. This study shows for the first time that passage of time experience can be manipulated in the sub-minute range through low-level visual stimuli. Furthermore, using the starfield color tracking paradigm, the experience of passage of time and estimation of the duration of an interval can be experimentally differentiated under laboratory conditions.8 or the relationship between the unfolding of events in the external world (e.g. starfield) and internal (e.g. bodily) processes53. Accordingly, trials with high velocity or high density and thus higher rates of moment-to-moment change felt faster in relation to less salient changes or the unchanged speed of internal processes.Passage of time experience was increased for faster stars and more dense starfields, but was not as much affected by the actual duration of the interval or the task difficulty. This shows that the salience of moment-to-moment differences between individual frames is more directly associated with the experience of passage of time than is the actual duration of the interval. This is in line with the notion that the phenomenal experience of passage of time depends on the most salient internal or external contextual changes54\u2014that DoTJs were found to be influenced by the stimulus durations with more pronounced underestimations of longer intervals. Previous studies have also found duration estimations to be susceptible to manipulation by low level visual stimuli32. However, in our study duration estimations were only affected if participants were trying to assess both types of time experience in parallel in Exp. 1. When participants were instructed to explicitly focus on either passage experience or duration estimation in Exp. 2, duration estimations were not influenced by low level features any more. This suggests that participants might have not been able to give entirely independent reports of the two aspects of time experience when not being informed before the trial which judgment would be required in Exp. 1. This raises the question to which extent earlier results about the effects of visual stimuli on duration estimations32 might be attributable to similar effects. As pointed out, humans are aware of the discrepancy between the passage and duration of time in everyday life on a conceptual level2. However, the question remains to which extent this insight is reflected when actually reporting on time experience.Analyzing the effects of the experimental manipulations on DoTJs, we found\u2014as predicted by \u201cVierodts\u2019 Law\u201d35. The qualitative distinction between these experiences has repeatedly been emphasized37. However, empirical investigations of this relationship so far have proven to be complicated. For many existing studies about the relationship of DoTJs and PoTJs it is difficult to assess the validity of the results, as in these studies the two judgments in fact relate to two different situations55. Passage of time was reported for a situation which participants experienced up until a cue  while durations were estimated for an interval presented afterwards. Surprisingly few studies about time perception entailed assessments of duration estimations and passage judgments for the same situations14. Some additional older studies and/or focusing on topics other than time perception per se are summarized in Th\u00f6nes et al.21. With exception of one14, these studies seem to have found concurrent effects in duration estimations and time passage experience. Other studies demonstrated that under certain circumstances, the estimation of durations and experience of passage of time can indeed influence each other. In two studies18 passage of time reports were altered by manipulating either the prediction of a duration or information about its actual duration. Similarly, presenting participants with unbeknownst manipulated (accelerated or decelerated) physical clocks could affect their experience of passage of time (for a review see21).Judgments about the \u201cpassage of time\u201d are indicators of a category of subjective experience unlike the conceptual notions of \u201cpassage of time\u201d, for example, when duration judgments and neuroimaging data are used to draw inferences about the \u201cspeeding up/slowing down\u201d of time related psychological or neural processesWith regard to the origin and mechanism behind the effects of velocity and density on the experience of passage of time, two potential explanations can be discussed, either (1) direct influences on an internal passage of time state (\u201cbottom-up\u201d) or (2) influences by metacognitive concepts of passage of time experience (\u201ctop-down\u201d).14 or their hedonic value11. The experience of \u201cflow\u201d is often described as mechanism behind these effects on the experience of passage of time56.The notion that passage of time experience is directly affected by situational factors (1) assumes that participants have access to and report directly on internal bodily states that constitute their experience of passage of time. Passage of time would thus be experienced similar to sensations or emotions. In the past, different situational factors have been identified to determine the experience of passage of time in longer time ranges than studied here. So far, passage of time experience has been linked mainly to attentional demands of activities17. The most convincing argument for the internal state hypothesis would certainly be finding some kind of signal  that reliably predicts PoTJs across different contexts.However, we did not find any evidence that task difficulty as a potentially attention mediating factor in the starfield color tracking paradigm had a substantial effect on passage of time experience. Manipulations of the starfield\u2019s velocity and density on the other hand were irrelevant for the attentional demands of the task. Likewise, it seems implausible that the effect of manipulations of visual features on passage of time experience was mediated by an influence on the current emotional state of the participants\u2014another factor that has been reported to affect passage of time experience in the past9. Thus, instead of reports reflecting experiences during the specific situation, they could be inferred based on mental concepts of time experience58. According to this view, the experience of passage of time would not emerge in the situation itself but it would be constructed only afterwards when participants were asked to report on it. It could well be that participants\u2014knowingly or unknowingly\u2014associated movement and density in their imagination with more interesting activities and in turn with faster passing of time and this metacognition superimposed their PoTJs. However, our everyday understanding of time as passing slowly when being bored and fast when being engaged in interesting activities usually refers to situations which are usually in the range of minutes or even hours, these judgments are usually made retrospectively. This is different from and not fully comparable to the laboratory situation in this study where participants were asked to make time judgments for durations\u2009\u2264\u200930\u00a0s prospectively. Consequently, PoTJs in this task should not be very prone to superimpositions by cognitive concepts of passage of time.Another possible explanation for the effects of velocity and density requires the assumption of metacognitive judgments or reconstructions of primary passage of time experience (2). As pointed out by several authors, currently the basis for participants reports of their experience of passage of time is unclearfast did time pass?\u201d. The design of this study does not allow to control for the specific effect of the speed metaphor on the judgment. However, the contextual cues entailed in the prompt would not explain the other effect of low-level visual stimuli properties, i.e. density. Nonetheless, it seems worth examining the impact of the wording of PoTJ prompts in future investigations of the effect of low-level visual stimuli on the experience of passage of time.Especially the association between the velocity of stars and the speed with which time passes could have been further emphasized by the wording of the PoTJ question \u201cHow Since PoTJs as requested in our study in itself already involve higher cognitive processes, ruling out any kind of metacognitive influences on the decision does not seem possible. Therefore, the probability of the metacognitive hypothesis being true can only be assessed by systematically ruling out other mechanisms like e.g. suggested by the internal state hypothesis. Additional experiments, specifically designed to compare and test alternative mechanisms will be necessary to decide which concept of passage of time experience is more adequate.6. One question that should be addressed is whether the background of effects in passage of time rely on internal states and/or on metacognitive judgments. This admittedly ambitious endeavor promises to further elucidate the nature of the experience of time passing by.In conclusion, in this study we were able to show that low-level visual stimuli can affect passage of time experience in short time intervals. Furthermore, with the starfield color tracking task we have introduced a paradigm which allows to experimentally manipulate passage of time experience under controlled laboratory settings and compare it to other aspects of time processing such as duration estimation. Especially the ability to systematically modify the experience of passage of time in a laboratory setting might entail the opportunity for a more thorough search for the (neuro)physiological correlates of the experience of passage of time. This potentially enables investigations into the neural correlates of time experience and their variances in psychiatric conditions with prospects of an incorporating time experience in clinical diagnostics and treatmentSupplementary Information."}
+{"text": "VHL gene. Pathogenic germline variants in the succinate dehydrogenase A (SDHA) gene are associated with paraganglioma and pheochromocytoma. Here we report co-occurrence of germline pathogenic variants in both VHL and SDHA genes in a patient who presented with pancreatic neuroendocrine tumor. As these genes converge on the pseudo-hypoxia signaling pathway, further studies are warranted to determine the significance of co-occurrence of these variants in relation to tumor penetrance, disease severity, treatment response and clinical outcomes in this selected group of patients.Von Hippel Lindau(VHL)syndrome presents with cerebellar and spinal hemangioblastomas, renal cell cancer, neuroendocrine pancreatic tumor, and pheochromocytoma and it is caused by germline mutations in the  VHL, is an autosomal dominant cancer predisposition syndrome (SDHA) gene are associated with familial paraganglioma and pheochromocytoma syndrome inherited in an autosomal dominant manner  (VHL and SDHA) in a patient who presented with pancreatic neuroendocrine tumor. We describe the known molecular pathways involving VHL and SDHA and postulate that the disease prognosis may be dependent on the presence of co-occurring pathogenic variants in these genes through the involvement of HIF-\u03b1 in the final common pathway. To our knowledge, this is the first case report of both VHL and SDHA pathogenic variants.Von Hippel Lindau (VHL) syndrome caused by germline loss-of-function variants in the gene syndrome . Clinicat manner . At the  (HIF-\u03b1) . Here weVHL and SDHA genes. She presented with recurrent episodes of abdominal pain, vomiting, and anorexia at 21-years of age. Initial radiological and endoscopic evaluations were unremarkable. Her symptoms continued to persist, and a review of her prior abdominal computed tomography     genes  is an autosomal dominant hereditary tumor predisposition syndrome caused due to a germline pathogenic variant in the VHL gene . VHL synVHL gene , 5. OtheVHL gene . PatientVHL gene . AlthougVHL gene , they apVHL gene , and lesVHL gene . Present are classified under the cluster I genes which results in dysfunction of succinate dehydrogenase (SDH) leading to competitive inhibition of the enzyme, prolyl hydroxylase, involved in the degradation of hypoxia-inducible factor 1- \u03b1 (HIF1- \u03b1) . A recent study identified only 10 patients harboring a pathogenic germline SDHA variant in 4,974 pediatric and adult patients with a variety of solid tumors  syndromes are rare neuroendocrine tumors with an estimated incidence of approximately 2-8 cases per million per year . ApproxiHIF1- \u03b1) , 14. SDHHIF1- \u03b1) . PatientHIF1- \u03b1)  with symd tumors . Out of SDHB which is a highly penetrant tumor predisposition gene, SDHA confers a much lower penetrance and severity, estimates of which are largely unknown  is a relatively new entity that was initially reported in  cancers . With inant CSGs .VHL and SDHA encode for proteins that target the protein HIF-\u03b1 for degradation (via the electron transport chain. Therefore, pathogenic variants in the genes involved in the SDH complex could result in accumulation of the \u2018oncometabolite\u2019 succinate, leading to disruption of the succinate to fumarate ratio that would inhibit the enzymatic degradation of HIF-\u03b1. Accumulation of succinate may also destabilize the redox state and cause mitochondrial dysfunction by increasing reactive oxygen species production and utilizing glutamine as an energy source (VHL and SDHA genes could have an impact on the long-term prognosis. Although our hypothesis is limited by the lack of functional studies and a single case report, further studies looking at this genotype-phenotype correlation in similar cases will be helpful. Co-occurrence of two germline variants in VHL and SDHA in our patient also creates an opportunity for the use of novel therapeutics based on the convergence of these two genes within the pseudo-hypoxia signaling pathway. Recently approved selective HIF inhibitors could be one of the therapeutic considerations in our patient as it has been shown to be effective in patients with renal cell carcinoma due to an underlying germline VHL pathogenic variant (Interestingly, on a molecular level, both radation . Absenceradation . The SDHy source . Epigeney source  and may  variant . HIF-2\u03b1  variant . Preclin variant , 26. Sub variant  and VHL- variant . Belzuti variant . The U.SVHL and SDHA pathogenic variants implicated in PNET is described in this case report. It opens the way for additional exploratory studies to determine the significance of co-occurrence of these variants in terms of tumor penetrance, severity, and outcomes, as well as for the development of novel therapeutic approaches targeting the shared cellular pathway involved in VHL and SDHA-related etiopathogenesis.The co-occurrence of The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.Ethical review and approval was not required for the study on human participants in accordance with the local legislation and institutional requirements. The patients/participants provided their written informed consent to participate in this study.MT and BC drafted the original manuscript and created the figure, KD obtained consent and performed counseling for the testing coordinated in the patient. MG provided the pathology images and drafted the pathology description. TS provided radiology images and drafted the imaging description. AS provided patient information and performed manuscript revisions. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "P\u2009>\u20090.05). However, there were inter-task differences in the accuracy and stability of the accommodative responses across refractive groups (P\u2009<\u20090.05). The relationship between accommodation and vergence was not significant in both tasks (P\u2009>\u20090.05). However, increased accommodative and vergence instabilities were associated with total accommodative response (P\u2009<\u20090.05). Despite having greater accommodative demand, uncorrected hyperopes accommodate comparably to emmetropic controls. However, uncorrected hyperopes have increased instabilities in their accommodative and vergence responses, which may adversely impact their visual experience.This study investigated the accuracy and stability of accommodative and vergence functions in children with and without hyperopia while engaged in two sustained near tasks. The sustained accommodative and vergence characteristics of participants without refractive correction  with and without hyperopia (defined as cycloplegic retinoscopy\u2009\u2265\u2009\u2009+\u20091.00D and less than\u2009+\u20095.00D) were measured using eccentric infrared photorefraction . Binocular measures of accommodation and eye position were recorded while participants engaged in 2 tasks at 25\u00a0cm for 15\u00a0min each: (1) reading small print on an Amazon Kindle and (2) watching an animated movie on liquid crystal display screen. Comprehensive visual assessment, including measurement of presenting visual acuity, amplitude of accommodation, and stereoacuity was conducted. The magnitude of accommodative and vergence responses was not related to refractive error ( Efficient near vision is increasingly more important for the social and educational well-being of children in general, and the hyperope in particular, as most tasks are performed at close/near working distances3. Compared to myopia, there are few studies which have investigated the accuracy and stability of the accommodative response in hyperopia. However, of the few studies reporting on hyperopes the consistent finding is that children with uncorrected hyperopia tend to demonstrate significant accommodative lags5. Furthermore, these studies report that children with higher magnitudes of hyperopia tend to demonstrate larger and more variable lags of accommodation4, and may be at risk for abnormal visual development including strabismus and amblyopia6. There is limited literature on the accommodative characteristics of the hyperopic child in relation to the sustained accommodative response, which reflects what happens naturally when, for example, the hyperopic child engages in near work at school for a prolonged period of time. Moreover, beyond conventional school tasks, children employ electronic devices such as smartphones and tablets for educational and recreational purposes for prolonged periods, suggesting that the accommodation and vergence systems will often be engaged for sustained periods. A single previous study by Roberts et al.7 explored the question of sustained accommodative accuracy and stability in children with uncorrected hyperopia, aged 3\u201310\u00a0years while engaged in two near activities. However, their study did not address the question of sustained vergence response in children with uncorrected hyperopia. A previous study which investigated the dynamic relationship between vergence and accommodation at a single time point, found that hyperopes simultaneously demonstrated accurate vergence responses alongside significant accommodative lag1. No previously published study has concurrently investigated the characteristics of young uncorrected hyperopes\u2019 accommodation and vergence responses, in terms of accuracy and stability, and the interaction between the two systems during sustained near vision tasks. The purpose of this study was to investigate differences between the accuracy and stability of the accommodative and vergence responses in uncorrected hyperopes and emmetropic children while participants were engaged in two sustained typical daily near tasks with different visual demands; reading and watching a movie. Our hypothesis was that uncorrected hyperopes would have poorer accommodative and vergence responses than emmetropes and that there would be a difference in performance across tasks, with the movie task being less visually demanding8. We also hypothesized that hyperopes would fatigue more in their accommodative and vergences responses while performing these two sustained tasks.Hyperopia, a common refractive error in young children, presents a challenge to the clarity of near vision because of the additional accommodative burden exerted on the vision system which must compensate for the distance refractive error in addition to overcoming the dioptric demand of near targets9. The study adhered to the tenets of the Declaration of Helsinki and commenced after approval by the Ulster University Research Ethics Committee. For each participant, informed consent was obtained from their parents, and a short medical and ocular history obtained via a parental-administered questionnaire9. For the hyperopic group, inclusion criteria were participants with uncorrected hyperopia  whose spherical equivalent refraction in the least plus eye after cycloplegic retinoscopy was\u2009\u2265\u2009\u2009+\u20091.00D and less than\u2009+\u20095.00D, and with anisometropia less than 1.00D, and astigmatism less than 2.00DC9. Inclusion criteria for control group was emmetropia (n\u2009=\u200934) defined as a spherical equivalent refraction of \u2212\u20090.25D to less than\u2009+\u20091.00D. For both groups, refractive error was defined by a cycloplegic retinoscopy result obtained using 1% drop Cyclopentolate hydrochloride. The refractive assessment was carried out after baseline visual assessments and the two sustained near tasks had been performed on a different day 1\u20132\u00a0weeks later. Comprehensive visual assessment including measures of presenting binocular distance and near visual acuity (Sonksen crowded LogMAR letter test at 3\u00a0m and 40\u00a0cm for distance and near respectively), stereoacuity (Frisby stereotest), ocular posture (prism cover test), near point of convergence (measured with the RAF rule10), accommodation amplitude  and accommodative response (modified Nott dynamic retinoscopy) were obtained from all participants9. As all participants were non-spectacle wearers, all visual measures were taken without correction. Amplitude of accommodation was calculated from the accommodation amplitude determined by the push-up test plus the underlying spherical equivalent refractive error from the least plus eye. Exclusion criteria were: habitual spectacle wearers, presence of strabismus, a history of patching/penalisation amblyopia therapy and/or hospital eye service attendance, distance visual acuity worse than 0.2 LogMAR14 and those with refractive errors beyond the parameters described above.Study participants included children aged 5\u201310\u00a0years (n\u2009=\u200992) who were recruited from a local Primary school, a community optometric practice and the Ulster University Optometry clinic, in Coleraine, UK9. Briefly, participants undertook two tasks, both of which were performed for a period of 15\u00a0min each including reading text and watching a movie on screens placed in downgaze at 25\u00a0cm. The choice of the reading and movie tasks enabled investigation of the characteristics of the accommodative and vergence responses under two different visual task demands, with the reading task constituting an \u201cactive/high\u201d demand task, and the movie task a \u201cpassive/low\u201d demand task8. In the reading (active) task designed to simulate a typical visually demanding activity undertaken at school, participants read aloud selected age-appropriate text  on an Amazon Kindle9. The task was designed to be visually demanding to stimulate accommodation rather than as a test of reading ability . Participants read from an Amazon Kindle presented at a near distance of 25\u00a0cm while simultaneous measurement of accommodation, gaze position (vergence), and pupil sizes were recorded by the PowerRef 3\u2122 photorefraction system9. The Kindle, with a viewing window of 14\u00b0 by 10.20\u00b0 at 25\u00a0cm was housed in a wooden box with a forehead rest. Two Velcro straps around the head of the participant helped to minimise head movements during the task9. Prior to testing, participants were evaluated to determine their reading ability in relation to the choice of age-appropriate reading text, and to confirm that all participants could read the font size on the Kindle or customised reading material. For the youngest children  who could not fluently read the simplest reading text on the Kindle, custom-made reading material was designed and presented on an LCD monitor of similar dimension to the Kindle9. The background illumination for the Kindle and monitor was 40\u00a0cd/m2 and 50\u00a0cd/m2 respectively , consistent with conventional usage of these devices9. This illumination setting provided sufficient contrast for the Kindle and monitor while allowing pupil sizes to be maintained within the operational range of the PowerRef 3\u212215.Details of the two tasks, including testing time, distance and order of introducing tasks have been described in detail by the authors elsewhere9. The task was modelled after a recreational activity frequently undertaken by children. The target for the movie task was a popular, commercially available stop-motion animated movie containing broadband spatial frequency content17, chosen to engage and sustain interest and attention of participants. The movie target and the reading task were housed in the same set-up. Background illumination for the movie target ranged from range: 10\u201350\u00a0cd/m2 (mean 30\u00a0cd/m2)9.In the movie (passive) task, participants watched an animated movie while simultaneous measurement of accommodation, vergence and pupillary response were recorded by the PowerRef 3\u2122 at 25\u00a0cm19 and a thorough description of the set-up for the measurement of sustained accommodation and vergence in this study has been described by the authors elsewhere9. Briefly, the set-up consisted of the PowerRef 3\u2122 camera, mounted on a custom-designed bench at 1\u00a0m\u2009\u00b1\u20090.05\u00a0m. Two Periscopic mirrors were used to reflect infrared light from the instrument\u2019s camera aperture into the eye17. The entire table was tilted by 16.7 degrees to enable participants to view in downgaze, thus adopting a more natural reading/viewing position. A lens calibration factor was obtained using a range of lenses , and incorporated into individual refraction estimates to increase precision of results20. For the few participants in whom individual calibration was unsuccessful, the group average calibration factor was applied17. Prior to participants undertaking the sustained tasks at 25\u00a0cm, a baseline measure of refractive state, eye position and pupil size was obtained at 1\u00a0m while participants viewed a Maltese cross target. The accommodative response during the two sustained tasks was computed as the difference in refraction at baseline  and the 25\u00a0cm target demand as recorded by the PowerRef 3\u21229. The accuracy of this accommodative response was computed as the difference between the known dioptric demand of 4 D for the 25\u00a0cm target and the individual accommodative response measured with photorefraction22. For example, an emmetropic participant would yield a value of 0.00D refraction at baseline, and then, if they exhibited a typical accommodative response to the 4D target demand, they would measure a \u2212\u20093.00D refraction for viewing distance of 25\u00a0cm, indicating that they produced a 3.00D response. The total accommodative response was calculated as the sum of the mean accommodative response to the target at 25\u00a0cm, and the accommodation needed to correct the subject\u2019s underlying refractive error . The vergence response was computed as the difference in gaze position between the right and left eyes (as recorded by the PowerRef 3\u2122). The magnitude of vergence response to the target at 25\u00a0cm was calculated in metre angles as the difference in vergence at baseline (1\u00a0m) and the 25\u00a0cm target demand.Measurement of sustained accommodation, gaze position (vergence), and pupil size were made with the PowerRef 3\u2122  at a sampling frequency of 50\u00a0Hz. The photorefraction principle, from which the PowerRef 3 operates, has been utilised in many studies and described in detail previously9. For participants who read on the Kindle, data below the 5th percentile and above the 95th percentile in the vertical range were excluded to eliminate data arising from when the participants were reading the top and bottom of the page of text, as this up- and down-gaze could contaminate measurements. These outliers were therefore removed using the winsorization technique23. The outliers which were seen while participants read on the Kindle were non-existent in the movie task  of the response was obtained using the Fast Fourier Transform (FFT) in MATLAB27. The stability of the vergence response was investigated using the standard deviation of the mean vergence response across the 15-min time period. While vergence was calculated using eye position data from the two eyes, data from the eye with the least plus spherical equivalent refraction were used for accommodative analyses.The stability of the accommodative response was analysed in the time domain using the root mean square deviation of accommodative microfluctuations (RMS) P\u2009<\u20090.05.A two-factor repeated measure ANOVA was used to assess inter-task difference in the accuracy and stability of the accommodative and vergences responses. Pearson\u2019s correlation (Bonferroni correction applied in multiple comparisons) was used to assess relationships between the accommodative and vergence responses and the magnitude of refractive error. Multivariate regression analysis was used to assess the relationship between the stability of the accommodative response and total accommodative response after adjusting for other variables. Statistical significance was set atThe mean age of participants was 7.92\u2009\u00b1\u20091.54\u00a0years. All participants engaged in the two sustained near tasks. Other descriptive statistics of refractive error, accommodation, pupil sizes and baseline measures are presented in Table \u2009=\u200933.28, P\u2009<\u20090.0001; 2\u2009\u00d7\u20092 mixed ANOVA analysis, dependent variable being mean accommodative lag, and factors being task type (reading/movie) and refractive group (emmetropes/hyperopes)). There was no group difference in results \u2009=\u20090.52, P\u2009=\u20090.71), and no significant interactions observed between the two factors \u2009=\u20090.39, P\u2009=\u20090.54).The accuracy of the mean accommodative response differed by task, with significant accommodative lag observed in the movie task (1.75\u2009\u00b1\u20090.76D) compared to the reading task (1.04\u2009\u00b1\u20090.78D),  and refractive error  across the two tasks was not statistically significant in the two groups \u2009=\u20094.45, P\u2009=\u20090.04; 2\u2009\u00d7\u20092 mixed ANOVA analysis, dependent variable being root mean squared error of accommodation, and factors being task type (reading/movie) and refractive group (emmetropes/hyperopes)). There were no refractive group differences \u2009=\u20091.09, P\u2009=\u20090.30), and no significant interactions observed between the two factors: F \u2009=\u20090.33, P\u2009=\u20090.57. Similarly, in the frequency domain analysis (LFC), the accommodative response was more unstable in the movie task (1.2E\u22123\u2009\u00b1\u20097.71E\u22124) than reading task (7.65E\u22124\u2009\u00b1\u20097.42E\u22124), \u2009=\u200914.12, P\u2009=\u20090.0002; 2\u2009\u00d7\u20092 mixed ANOVA analysis,) with no refractive group effect (P\u2009>\u20090.0.5 in both domains).In the time domain analysis (RMS), there was more instability in the accommodative response in the movie task (0.15\u2009\u00b1\u20090.05D) compared to the reading task (0.13\u2009+\u20090.06D), (FP\u2009>\u20090.05 in both domains). However, the RMS of the accommodative microfluctuations increased with the total accommodative response in the reading task  but not the movie task , Fig.\u00a0P\u2009<\u20090.0001, and r\u2009=\u20090.75, P\u2009<\u20090.0001 for reading and movie tasks respectively). A multiple regression model was used to assess the relationship between the stability of the accommodative response (RMS) and the total accommodative response, after adjusting for pupil size, age across the two tasks (Table P\u2009<\u20090.001) after controlling for pupil size and age.Across the two tasks, the stability of the accommodative response was not related to the magnitude of the refractive error, in both time domain (RMS) and frequency domain (LFC) (P\u2009>\u20090.05 for both tasks).No significant associations were observed between the LFC of accommodative microfluctuations and the magnitude of refractive error for the reading and movie tasks \u2009=\u20095.51, P\u2009=\u20090.02; 2\u2009\u00d7\u20092 mixed ANOVA analysis, dependent variable being vergence response, and factors being task type (reading/movie) and refractive group (emmetropes/hyperopes), with no group effect (P\u2009>\u20090.05)).Overall, the vergence response was higher in the reading task (2.91\u2009\u00b1\u20090.49 MA) compared to the movie task (2.67\u2009\u00b1\u20090.72 MA), and the observed difference was statistically significant , Fig.\u00a0The relationship between the mean vergence response and the mean accommodative response was not significant in both tasks \u2009=\u2009423.53, P\u2009<\u20090.0001; 2\u2009\u00d7\u20092 mixed ANOVA analysis, dependent variable being vergence response, and factors being task type (reading/movie) and refractive group (emmetropes/hyperopes).The stability of the vergence response was considered using the standard deviation of the mean vergence response over the 15-min duration. There was more instability in the vergence response in the reading task (1.91\u2009\u00b1\u20090.19 MA) compared to the movie task (1.34\u2009\u00b1\u20090.17 MA), (FP\u2009>\u20090.05 in both tasks). Stability in the vergence response across the two tasks was not related to the stability of the accommodative response in both time and frequency domains (P\u2009>\u20090.05 in both domains). However, participants with greater total accommodation tended to have more unstable responses in their vergence response particularly in the movie task .An investigation to determine whether the vergence instability increased with the mean vergence response in both tasks revealed no significant relationships  task, to investigate the two systems.7, which examined accommodative performance in response to a 3D target demand across a range of uncorrected refractive errors (\u2212\u20090.37 to\u2009+\u20094.58D) during a 10-min viewing period in children aged three to less than 10\u00a0years. Our study provides further evidence that uncorrected hyperopes exhibit sufficient average accommodation to achieve similar level of focusing to children with lower refractive errors. Moreover, in the present study, when the total accommodative response produced at 25\u00a0cm is considered, it becomes evident that the hyperope produces relatively more accommodation compared to their emmetropic counterparts. In the absence of amblyopia and strabismus, some hyperopes may be able to accommodate as accurately as other children1, but the stability of this response, and whether such prolonged accommodative demand is associated with oculomotor stress, including symptomatic presentation by patients, needs further investigation. There are a number of studies which have reported conflicting results on the accommodative response in uncorrected hyperopia, noting that significant accommodative lags are demonstrated by uncorrected hyperopes5. A number of factors may explain this conflict; the accommodative response in earlier reports was assessed for few seconds whereas in the present study and that of Roberts et al.7, a sustained accommodative response was studied. Moreover, in the work by Horwood and Ridell1, although a photorefraction technique was employed, five testing distances  were explored and the target used was a large, high contrast, looming cartoon target. Candy et al.2 used Nott retinoscopy to measure accommodation responses in typically developing children whilst they viewed a high contrast cartoon picture positioned at 50\u00a0cm for a few seconds. In contrast, the present study employed two targets positioned at a 25\u00a0cm test distance both designed to simulate near activities typically engaged by children for both educational and recreational activities.The results of our study indicate that the average accuracy of the accommodative response over a 15-min time period to a 4D target demand was not related to the magnitude of uncorrected refractive error present. Children with uncorrected hyperopia demonstrated comparable accommodation to their emmetropic controls, although the magnitude of the response demonstrated in the reading and movie tasks by both groups was lower than expected for the 4D target demand. This finding is consistent with a previous study2. In the present study, the accommodative responses of naturally uncorrected young hyperopes did not differ significantly from those of emmetropic controls, which consequently leads to the question of the relationship between vergence response and refractive error. The present study revealed that vergence responses were also independent of refractive error in either the movie or reading tasks. Participants with uncorrected hyperopia demonstrated vergence responses similar to emmetropic controls in both tasks\u2014a finding in line with the comparable accuracy of their accommodative results. An association between the accommodative and vergence responses in both tasks was weak and of borderline significance. Nonetheless, a previous study in hyperopes found vergence responses to be accurate even when significant lag in accommodation was observed1. Our understanding of the dynamic relationship between the accommodation and vergence responses is based on the Schor\u2019s model where cross-link interactions between the two motor systems occur mainly in the phasic  stage of the response, and dissipate during the sustained, tonic component of the response28. Our study which investigated sustained accommodative and vergence responses likely tested the slow, sustained, tonic component of Schor\u2019s model by which time no cross-link interactions were at play, with the consequent lack of significant relationships between the two motor systems.The characteristics of the vergence response, and the interaction between the vergence and accommodative motor systems in childhood hyperopia have not been extensively discussed in the literature. However, this topic is important given that the relationship between the two motor systems may help to understand which hyperopic cohorts are at risk of abnormal visual development such as strabismus29 report a preference to maintain gaze near the centre of the screen while watching a video, while the nature of the reading task meant that the individual conducted small saccadic eye movements and fixations from left to right while reading text. It is possible that the increased saccadic eye movements during reading helped drive more accurate vergence eye movements. However, the different visual demands between the two tasks could also yield a notable potential difference in vergence and accommodative performance.While the parameters of this study did not examine eye tracking, it is likely that saccadic eye movements were somewhat different between the two tasks. Dorr et al.8. The reading task demanded more active participation as participants were required to read text aloud on a kindle/LCD monitor compared to the movie task. The increased task demand could be associated with the increased accommodative response observed, which also tended to be more stable, consistent with the outcomes described by Roberts et al.7 Although uncorrected hyperopes in the present study demonstrated more accommodative instability than the emmetropic controls across the two tasks, this finding did not reach statistical significance. However, given that uncorrected hyperopes tended to have greater total accommodative response, which was associated with higher RMS of accommodative microfluctuations, our finding still confirms the reported association between unstable accommodative response and uncorrected hyperopia30. Our study used low to moderate uncorrected hyperopes, and a repetition of this experiment in those with higher levels of uncorrected hyperopia may reveal that at higher magnitudes, those with hyperopia may not be able to maintain sufficient accuracy and stability for clear and comfortable reading. Definitive functional roles of accommodative microfluctuations are yet to be fully elucidated, however, it has been suggested that they may be a mechanism to provide feedback error to maintain appropriate response during steady-state accommodation31. It has also been reported that where there is increased accommodative effort, such as may occur in higher magnitude of hyperopia, there is a decreased zonular tension which causes the lens to move freely resulting in increased microfluctuations34. Although microfluctuations may have functional roles, they also represent temporal instability in the retinal image quality35, and have the potential to cause visual discomfort37, which may present in some hyperopes as asthenopia. Such asthenopic symptoms could negatively impact the ability of uncorrected hyperopes to undertake sustained and effective engagement with near tasks commonly associated with schoolwork and become detrimental to their academic performance38. Previous studies suggest that small pupil sizes, and young age are factors which affect accommodative microfluctuations39. However, in the present study of similarly aged children, only pupil size was consistently related to accommodative microfluctuations across the two tasks.Results of the present study reveal increased accommodative instability in the passive task (movie) compared to the active task (reading) in both time and frequency domain analyses, in both refractive groups. Attentional differences between the active task (reading) and passive task (movie viewing) could partly explain the observed differences between the two tasksThere was inter-task difference in the stability of the vergence response, with increased vergence instabilities in the reading task compared to the movie task. Again, the reading task being the more visually demanding, perhaps, elicited more unstable responses. There is a paucity of data describing the relationship between the stability of the vergence response and refractive error, and the clinical relevance of such data. Across the two tasks, instability in the vergence response was higher in uncorrected hyperopes than emmetropes Table . Althoug28. Further studies are required to advance our understanding of the cross-link interactions between accommodation and vergence in hyperopia. Other limitations include that our maximum level of hyperopia was\u2009+\u20094.38D mean spherical equivalent, and it would be valuable to include more moderate to high levels of hyperopia in future. In common with other studies of accommodation using photorefraction, it is not possible to determine true underlying defocus, but the use of relative measures (i.e. a change in defocus), individual calibration, and scrutiny of group level patterns, overcomes the impact of potential inaccuracies for individual participants. Strengths of this study include a large sample size, and a long time frame (15\u00a0min) to evaluate accommodative and vergence responses in both reading and movie tasks.Our study provides insights into sustained vergence characteristics of uncorrected hyperopes under two visual demands to complement our understanding of the two oculomotor systems under closed-loop conditions. The present study was designed to elicit accommodation and vergence during the slower, tonic response, rather than to address the magnitude of cross-link interactions between accommodation and vergence which occur during the fast, phasic responseThis study revealed that the average magnitude of accommodative and vergence responses demonstrated during sustained near vision tasks are comparable between natural uncorrected hyperopes and emmetropes. Furthermore, accommodative and vergence instabilities increased in uncorrected hyperopes who demonstrated greater accommodative responses, which may have implications for the visual experience of the uncorrected hyperope during sustained near vision activity."}
+{"text": "Total hip arthroplasty (THA) is most likely one of the most successful surgical procedures in medicine. It is estimated that three in four patients live beyond the first post-operative year, so appropriate surgery is needed to alleviate an otherwise long-standing suboptimal functional level. However, research has shown that during a complete THA procedure, a solid hip implant inserted in the femur can damage the main arterial supply of the cortex and damage the medullary space, leading to cortical bone resorption. Therefore, this study aimed to design a porous hip implant with a focus on providing more space for better osteointegration, improving the medullary revascularisation and blood circulation of patients. Based on a review of the literature, a lightweight implant design was developed by applying topology optimisation and changing the materials of the implant. Gyroid and Voronoi lattice structures and a solid hip implant (as a control) were designed. In total, three designs of hip implants were constructed by using SolidWorks and nTopology software version 2.31. Point loads were applied at the x, y and z-axis to imitate the stance phase condition. The forces represented were x = 320 N, y = \u2212170 N, and z = \u22122850 N. The materials that were used in this study were titanium alloys. All of the designs were then simulated by using Marc Mentat software version 2020  via a finite element method. Analysis of the study on topology optimisation demonstrated that the Voronoi lattice structure yielded the lowest von Mises stress and displacement values, at 313.96 MPa and 1.50 mm, respectively, with titanium alloys as the materials. The results also indicate that porous hip implants have the potential to be implemented for hip implant replacement, whereby the mechanical integrity is still preserved. This result will not only help orthopaedic surgeons to justify the design choices, but could also provide new insights for future studies in biomechanics. According to the Food and Drug Administration (FDA), hip implants are classified as one of the medical devices which help to restore mobility and contribute to reducing pain in patients who are commonly associated with arthritis, hip diseases and injuries . Each deIn order to fulfil the patient\u2019s requirements and market needs, a survey was conducted and new proposed solutions were suggested in a previous paper. The opinions from the survey were considered, and the suggestions were to develop hip implants by using materials that guarantee adequate biocompatibility, strength and lightweight . MoreoveMoulton et al.  conducteBased on all of the problems that arise, the necessity of porous and lightweight hip implants is important in order to provide the best possible treatment to patients. By implementing porous and lightweight hip implants during THA operation, it can resolve most of the issues by providing more space for better osteointegration, improve medullary revascularization and improve the blood circulation of the patients . A lightA computed tomography (CT) dataset of a 27-year-old male weighing 75 kg and standing at 169 cm tall was used to create a three-dimensional (3D) model of the femur bone. The segmentation process was performed in Mimics software version 21.0  ,19. In gA convergence analysis was conducted to guarantee the quality of the femur model so that the findings would not be impacted by varying mesh sizes. The 4-node tetrahedral element was used for the bone model, since it has been shown to be more precise than its corresponding node element . FurtherA porous hip implant was constructed by using Computer Aided Design (CAD), SolidWorks version 2020  and nTopology software. The geometry of hip implant was constructed and referred from CORAIL Hip System (Depuy Synthes) . The parIn this investigation, a finite element model was presumed to be isotropic, homogeneous and linear for the femur  and hip To imitate the stance phase condition, point loads were applied at the x, y and z axis with forces of Fx = 320 N, Fy = \u2212170 N, and Fz = \u22122850 N, as demonstrated by a previous study ,32. To lTM 3D Scanner  to assure a similar position of the bone and jig. In addition, the bone was assumed to be isotropic, homogeneous, and linearly elastic, with Young\u2019s modulus values and Poisson\u2019s ratio set at 735 MPa and 0.3, respectively, based on the researchers\u2019 previous experiments [The finite element (FE) model of the femur was experimentally validated to strengthen the reliability of the analyses. In the context of finite element analysis (FEA), validation is the process of comparing the model predictions to experimental data in order to identify the modelling error ,36. The eriments . Based oeriments . NeverthThe mass of each design was weighed in nTopology software, and the mass is tabulated in The findings are presented through contour plots in The lightest hip implant, which is the Voronoi design, was also tested with different implant materials other than titanium alloys, such as magnesium alloy, stainless steel and cobalt-chromium. Voronoi implants yielded 314.67 MPa, 315.15 MPa and 314.29 MPa for magnesium alloy, stainless steel and cobalt-chromium, respectively, as shown in Contact stress is a critical factor in determining the load-bearing capacity of machine components and structures. The results of our analysis revealed that the contact stress distribution was highly dependent on the surface geometry, load distribution, and material properties. The highest contact stresses were observed at the neck region of the implant and bone where the load was concentrated. The implant contact stress magnitudes from our results were 9.13 MPa, 9.75 MPa, and 9.99 MPa for the solid, Gyroid, and Voronoi designs, respectively . For theThe displacement of the implants can be seen in The displacement of the lightest hip implant design (Voronoi) with different materials such that magnesium alloy, stainless steel and cobalt-chromium is also represented in The main aim of this study was to design a lightweight hip implant and carry out an investigation of the effect of introducing a lattice structure at the stem of the prosthesis. It also focused on improving the long-term success of hip implants by integrating a porous structure into the stem. This design facilitates bone ingrowth, enhancing the implant\u2019s stability over time . To furtIn addition, according to another study, topology optimisation can help in the mass distribution that led to a lighter hip implant. In comparison with a previous study by Delikanli and Kayacan , they foHigh stress can lead to femoral stem fractures, whereas past research has mentioned that the failure of hip implants is caused by several circumstances, including increasing stress in the stem as a result of patients getting heavier, intense activity, or an undersized hip implant ,42,43. AAdditionally, materials for hip implants also play an important role in the proper application of prostheses. As noted, all three of these different implants underwent the same simulation and, as expected, the solid implant yielded the least stress and smaller displacements, similarly to in a previous study. However, between the two lattice structures, Voronoi showed promising results as a lightweight hip implant. Based on the findings, magnesium alloy produced the lowest von Mises stress amongst the four materials. Magnesium alloys are known to have a small Young\u2019s modulus of 45 GPa, which is close to the natural bone Young\u2019s modulus of 3 GPa\u201320 GPa . As a reAs shown in Meanwhile, for the femur bone , the maxUnfortunately, dislocation of the hip implant can occur after THA, which sometimes leads to a long-term disabling difficulty, especially if there is no proper treatment. Based on the FEA results, the displacements  seemed tAs mentioned previously, bone remodelling might occur if local displacements of the implant and bone surpass the allowable deformation of the tissues, which then will lead to the loosening of the hip implant . FurtherThe model did not consider the porosity of cancellous bone, as the primary objective of the study was not to examine the bone\u2013implant interface at the microscopic level. Nonetheless, the results were found to be almost identical to the experimental validation of cadavers described in previous papers ,56. TherWhile this study focused on testing the design and materials of the implants through compression tests in MacNeal-Schwendler Corporation (MSC) Marc Mentat version 2020 , additional experiments, such as motion, thermal, and fatigue tests, should be conducted to enhance the accuracy and variability of the results. It would also be beneficial to fabricate the design model for carrying out dynamic and fatigue tests to ensure the durability and long-term performance of the hip implants. The results of von Mises stress and displacement presented in this study are therefore valuable for guiding future research and providing insights into the development of lighter hip implants. Both parameters are favourable options to be analysed and have been used by many researchers to check the strength and stability of the implant structure ,58,59.A lightweight hip implant was constructed, whereby the analysis results indicate that a lightweight hip implant had the potential to be implemented as a hip implant for THA. Titanium alloy was used as the material due to its good mechanical strength and natural ability to have low strain rates for ideal specific strength and stiffness. The use of a Voronoi lattice structure in hip implant design has been proven to result in implants which were 35% lighter and experience less stress as compared to other designs. This was due to topology optimisation. Consequently, incorporating a Voronoi structure in hip implant design could enhance their long-term stability and minimise the risk of complications. However, there will always be room for improvement in further study in order to validate all of the results and data."}
+{"text": "Nature Metabolism 10.1038/s42255-022-00558-0. Published 18 April 2022.Correction to: In the version of the article originally published, the cell line HT-29 was wrongly referred to as T18. This was identified as a result of quality control verification of the RNA sequencing datasets, where the analysis revealed the cells used were HT-29 instead of the reported T18 cells. This has now been corrected throughout the Results, Methods, Fig. 2d\u2013f, and Extended Data figures in the HTML and PDF versions of the article. The authors confirm that this change does not alter the central findings of the manuscript."}
+{"text": "Evidence shows that negative symptoms of schizophrenia and underlying dysfunctional cognition are related to persistently low functioning and quality of life. However, despite the abundance of existing recovery programs for people with schizophrenia, few have examined whether and how the widely-adopted hope-motivation recovery pathway and the deficit-oriented cognitive pathway might converge to influence functioning and quality of life.n\u2009=\u2009124). Self-reported measurements included personal recovery , social functioning , hope , quality of life , defeatist beliefs , and asocial beliefs . Correlation analysis and structural equation modelling was applied to investigate how the two pathways intertwined to predict social functioning and quality of life.A cross-sectional, quantative survey recruited a convenient sample of adult outpatients with DSM-5 schizophrenia spectrum disorders and low social functioning . Meanwhile, defeatist beliefs, social functioning, and personal recovery further predicted quality of life.This is one of the very few studies that provides empirical evidence of a deficit-strength linkage in the recovery from schizophrenia. Remediation of dysfunctional beliefs and the injection of hope and successful experiences should be undertaken concurrently in recovery as they are associated with differential effects on enhancing social functioning and personal recovery, which then converge and contribute to a better quality of life. According to the World Health Organization  schizophtaking even a small risk is foolish because the loss is likely to be a disaster\u201d) ([(p. 67)), and asocial beliefs concern aversive social attitudes and self-isolating beliefs  ([(p. 70)). These beliefs can interact and impede motivation, hamper activity engagement, and limit people\u2019s opportunity to generate positive experiences [Existing literature reports two major lines of enquiry concerning the occurrence and maintenance of negative symptoms and social functioning of people with schizophrenia. One involves a defeatist-asocial beliefs pathway derived from the work of Beck et al. . Essentiaster\u201d) (p. 67)),),taking eriences . Indeed,eriences . Some steriences . Howevereriences . Meanwhieriences .This line of analysis has generated the application of recovery-oriented cognitive therapy (CT-R) to neutralize negative beliefs and attitudes while activating the people\u2019s underlying positive attitudes and interests to promote adaptive living . In esseHowever, some studies have reported mixed or not-better-than-control effects on dysfunctional beliefs and social withdrawal at post-intervention or follow-up . Another\u201c(a) moratorium: a time of withdrawal characterized by a profound sense of loss and hopelessness; (b) awareness: realization that all is not lost and that a fulfilling life is possible; (c) preparation: taking stock of strengths and weaknesses regarding recovery and starting to work on developing recovery skills; (d) rebuilding: actively working toward a positive identity, setting meaningful goals, and taking control of one\u2019s life; and (e) growth: living a meaningful life characterized by self-management of illness, resilience, and a positive sense of self\u201d ([(p. 976)).f self\u201d ((p. 976))The second line of enquiry regarding the occurrence and maintenance of negative symptoms and social functioning of people with severe mental illness involves a hope-motivation-strength pathway that is derived from a strength-based recovery approach to mental illness. According to Slade et al. , recoverOthers describe recovery from mental illness as a journey from a passive, disengaging, withdrawing, and disparaging self to one characterized by a sense of hope, optimism, and meaning and purpose in life . The jouAlthough many scholars have suggested the importance of hope and strength in facilitating the recovery of people with severe mental illness , 25, theThe current study aimed to examine how the above two pathways are meaningfully and empirically connected. First, it examined the relationship between hope, personal recovery, social functioning, and quality of life. Second, it further investigated how defeatist beliefs and asocial beliefs were associated with hope, personal recovery, social functioning, and quality of life. Third, It examined the pathways from defeatist beliefs and asocial beliefs to quality of life, mediated by hope, personal recovery, and social functioning.First, we made hypotheses regarding correlations. H1: hope, personal recovery, social functioning, and quality of life would be positively intercorrelated. H2: defeatist beliefs and asocial beliefs would negatively correlate with the four constructs in H1. We further hypothesized the four pathways illustrated in Fig.\u00a0A cross-sectional study was conducted by recruiting a convenience sample of 126 informants at six government-sponsored community mental health centers in Hong Kong from July 2020 to June 2021. Inclusion criteria were (a) a diagnosis of DSM-5 schizophrenia spectrum disorders  at the tA printed questionnaire containing the following scales was administrated to the informant after written consent was obtained. All data collected were self-reported. Each informant received HKD50 (~\u2009USD6.4) upon questionnaire completion.Cronbach\u2019s \u03b1\u2009=\u20090.95, with subscale \u03b1 ranging between 0.68 and 0.90.The 30-item Mental Health Recovery Measure  assessesCronbach\u2019s \u03b1\u2009=\u20090.55.The 8-item Social Functioning Questionnaire  is a selCronbach\u2019s \u03b1\u2009=\u20090.90.The 12-item Hope Scale developed by Snyder et al.  was admiCronbach\u2019s \u03b1physical\u2009=\u20090.75, \u03b1psychological\u2009=\u20090.81, \u03b1social\u2009=\u20090.60, \u03b1environmental\u2009=\u20090.82.The 28-item World Health Organization Quality of Life Scale-Abbreviated Version-Hong Kong  has beenCronbach\u2019s \u03b1\u2009=\u20090.88.Following the method of Grant and Beck  and GranCronbach\u2019s \u03b1\u2009=\u20090.69.Following the method of Grant and Beck  and Grann\u2009=\u2009124). Multiple imputations were applied to missing data which was missing completely at random \u2009=\u20092417.765, p\u2009=\u20090.94). Then, descriptive analyses were conducted on demographic and measured variables, followed by correlation analyses to identify associations (Pearson's r) between variables.Descriptive and correlation analyses were performed using IBM SPSS Statistics\u00a0version 26. Two informants who had omitted responses to more than 5% of the questionnaire were excluded from the analysis , comparative fit index (CFI), Tucker Lewis Index (TLI), standardized root mean square residual (SRMR), and root mean square error of approximation (RMSEA). Third, bootstrapping analysis with 5,000 resamples were performed to determine the bias-corrected 95% confidence intervals [Structural equation modeling analysis was conducted with R 4.2.2  with pacntervals  of each ntervals .th grade, 34.7% graduated from the 9th grade, 37.1% graduated from high school, and 25.0% graduated from tertiary education. Regarding medication, 96.0% had regular medication prescribed by a doctor, 0.8% had no medication, and 3.2% had unstable medication. Meanwhile, 93.5% received periodic case management follow-up, and 6.5% received irregular follow-up. In the previous six months, informants had been hospitalized for a mean (SD) of 2.09 (8.72) days and 0.12 (0.39) times.Of the 124 informants, 58.9% were female. Their age ranged between 19 and 81\u00a0years, with a mean (SD) of 42.70 (13.10). Regarding education, 3.2% of informants graduated from the 6Means, standard deviations (SD) and correlations are shown in Table p\u2009<\u20090.05). Besides, having higher defeatist beliefs was associated with poorer social functioning , lower hope , poorer quality of life , and higher asocial beliefs . However, defeatist beliefs were not correlated with personal recovery. Meanwhile, higher asocial beliefs were associated with poorer social functioning , poorer personal recovery , poorer quality of life , although asocial beliefs were not correlated with hope.Higher hope, better personal recovery, better functional recovery, and better quality of life in four domains were all associated .The confirmatory factor analysis (CFA) of quality of life showed an excellent fit , and the whole model explained 75.7% of the variance of the latent factor \u201cquality of life\u201d. Mediation pathways 1a  and pathway 1b  were significant, whereas pathway 2a  and pathway 2b  were marginally significant. Although some confidence intervals included zero when rounded, none of the lower boundaries fell into negative values, and the test of joint significance [Figure\u00a0ificance  supporteThis study examined the interwining pathways to recovery among people with severe mental illness. While the results confirm some current understanding, they also uncover some interesting pathways that have not been expirically explored in the literature. Indeed, some of the newly found pathways bridge the cognitive-behavioral model  and the We hypothesized that defeatist beliefs, via asocial beliefs, influence the social functioning and sense of recovery of a person recovering from severe mental illness. The results of path analysis indicated that fewer defeatist beliefs were associated with fewer asocial beliefs, and in turn, predicted higher social functioning (pathway 1a). Interestingly, fewer defeatist beliefs and asocial beliefs were also found to be associated with a greater sense of personal recovery (pathway 1b). These two pathways ultimiately converged into better quality of life for the person. Both findings are consistent with existing literature , 14 and (p. S621)), motivating people to make the change (Pathway 2b). In the hope-personal recovery pathway (Pathway 2a), however, a person does not only embrace a general positive outlook in life, but they also take action to identify and utilize internal and external resources  to work towards achieving life goals that enhance their meaning in life. Indeed, the current recovery movement engineered by scholars such as Slade et al. [Supporting our hypotheses, this study also confirms the hope, motivation and strength pathway towards better social functioning and quality of life for people with severe mental illness (Pathway 2a and 2b). Research has repeatedly found hope an indispensable factor underpinning the process of personal recovery . In essee et al.  and Rappe et al.  has adopOur results in pathways 1a and 1b revealed that fewer asocial beliefs predicted higher social functioning and higher personal recovery. To the best of our knowledge, this is one of very few studies that has established two relationships stemming from asocial beliefs to social functioning and personal recovery respectively, particularly among an Asian population. Previous research had hypothesized but had not fully, empirically substantiated such possible relationships. One of the thorny issues facing by people with severe mental illness is social withdrawal, which has a strong link to deterioration in social functioning and poor mental health . Our curAs shown by the results, hope mediated the effect of defeatist beliefs on personal recovery and social functioning. The pathway from defeatist beliefs to hope is another new and interesting result in our study. Indeed, this is one of the few studies providing empirical support for the linkage between defeatist beliefs and hope, thus bridging the two dominant lines of enquiry on recovery for people with severe mental illness. This linkage is not difficult to understand given that people with severe mental illness, such as schizophrenia, have neurocognitive deficits in memory and attention. These deficits contribute to possible unsuccessful goal attainment in life, which over time, can give rise to dysfunctional, defeatist attitudes about oneself and one\u2019s performance. These dysfunctional attitudes, in turn, may lead to dissatisfaction and a sense of despair and hopelessness. On the other hand, a reduction in defeatist beliefs can increase the sense of hope among people with severe mental illness and then develop into different hope pathways identifed by our model.This is one of the first few studies that have attempted to examine the connection between a cognitive deficit and hope-strength connection in the recovery of people with schizhophrenia. The conventional hope pathway in mental health recovery programs would suggest that an increase in hope, say, through building successful experiences, can build a strength-oriented momentum, mitigate negative presumptions and enhance a person\u2019s motivation to make further positive changes . But ourThe current study had several limitations. First, the data were collected through a cross-sectional survey. Although path analysis can test our theoretically constructed model against the data, our result could not ascertain the temporal, causal relationship between variables. Further studies with longitudinal design and clinical trials are required to further establish the causality among variables. Second, all the measurements were based on self-reported scales, which could be affected by subjective factors. Some studies have reported that self-reported quality of life and functioning could be affected by insight . FurtherThis study provides empirical support of an integrated multiple pathway model to full recovery for people with severe mental illness. It answered the research objectives that, first, hope, personal recovery, social functioning, and quality of life were positively correlated. Second, higher defeatist beliefs was associated with poorer social functioning, lower hope, poorer quality of life, and higher asocial beliefs; whereas higher asocial beliefs were associated with poorer social functioning, poorer personal recovery, and poorer quality of life. Third, it also empirically illustrates that the defeatist-asocial cognition pathway and the hope-motivation-strength pathway stem from defeatist beliefs, intertwine and converge into quality of life. On the one hand, defeatist beliefs predicted asocial beliefs, which predicted quality of life as mediated by personal recovery and social functioning; on the other hand, defeatist beliefs also predicted hope, which further predicted quality of life, mediated by personal recovery and social functioning.The findings emphasize the importance of attending to both strengths and deficits when assessing and working with people with severe mental illness. While it is important to continue to uphold the hope-motivation-strength pathway to recovery, it is also important to pay attention to the defeatist-asocial pathway as these can demoralize people in the recovery process. Indeed, when designing intervention programs for people with severe mental illness, both aspects should be considered to provide a more balanced recovery approach to them."}
+{"text": "Introduction: Accumulating evidence reveals that endocrine disrupting chemicals (EDCs) can disrupt aspects of metabolic programming, suggesting that skeletal development may be at risk, a possibility that is rarely examined. The commercial flame retardant (FR) mixture, Firemaster 550 (FM 550), has repeatedly been shown to negatively influence metabolic programming, raising concerns that skeletal integrity may consequently be impaired. We have previously shown that gestational and lactational exposure to 1,000\u00a0\u00b5g FM 550 negatively affected sex-specific skeletal traits in male, but not female, rats assessed at 6\u00a0months of age. Whether this outcome is primarily driven by the brominated (BFR) or organophosphate ester (OPFR) portions of the mixture or the effects persist to older ages is unknown.Materials and methods: To address this, in the present study, dams were orally exposed throughout gestation and lactation to either 1,000\u00a0\u03bcg BFR, 1,000\u00a0\u00b5g OPFR, or 2,000\u00a0\u00b5g FM 550. Offspring (n = 8/sex/exposure) were weaned at PND 21 and assessed for femoral cortical and trabecular bone parameters at 8\u00a0months of age by high-resolution X-ray micro-computed tomography (micro-CT). Serum levels of serotonin, osteocalcin, alkaline phosphatase, and calcium were quantified.Results: FM 550 affected both sexes, but the females were more appreciably impacted by the OPFRs, while the males were more vulnerable to the BFRs.Conclusion: Although sex specificity was expected due to the sexual dimorphic nature of skeletal physiology, the mechanisms accounting for the male- and female-specific phenotypes remain to be determined. Future work aims to clarify these unresolved issues. These dem cells . We haveem cells . Here, wFRs are used in a myriad of household products such as carpets, baby and children\u2019s products, electronics, building materials, and polyurethane foam used in gyms, furniture, and mattresses. As such, exposure is widespread and higher in children than in adults . The useIn vitro, FM 550 has been shown to interact with PPAR\u03b3 to promote adipogenesis in mesenchymal stem cells at the expense of osteogenesis, even when cultured under pro-osteogenic conditions. Upon differentiating 3T3-L1 cells in the presence of triphenyl phosphate (TPHP), an OFPR found in the FM 550 mixture, lipid size and volume were increased and the expression of multiple pro-adipogenic genes was upregulated (egulated . This sucrh) and thyroid-stimulating hormone (tsh) transcription in the brain and downregulation of thyroglobulin and deiodinase 2 in the thyroid and liver, while females displayed downregulated crh and tsh  Wistar rats that were gestationally and lactationally exposed to a single dose of FM 550  . FM 550-lrp5 decreases bone mass in mice  and osteocalcin (OCN) levels. Our group has previously shown that developmental FM 550 exposure alters serotonergic (5-HTergic) innervation of the rat fetal forebrain, disrupts placental tryptophan metabolism, and promotes anxiety in female rodents . Althoug in mice . 5-HT al in mice . The ATF in mice . Similar in mice . The maiin vitro and in zebrafish assays.Because, in its own internal studies, the chemical manufacturer found adverse skeletal effects in rats exposed to only the BFR components, albeit at doses at much higher exposures, we hypothesized that the BFRs could be most consequential . At doseIn Vivo Experiments (ARRIVE) Guidelines Essential 10 Checklist for Reporting Animal Research to ensure the highest standard of reporting for animal-based research . Control, OPFR, and BFR solutions were dispensed in 20\u00a0\u00b5L volumes, and FM 550 solution was dispensed in a 40\u00a0\u00b5L volume on approximately 1/8 of a wafer cookie, which the dams readily consumed. The chemical composition of OPFR, BFR, and FM 550 dosing solutions is presented in Either the left or right leg of the animal was surgically removed at the hip joint, gently cleaned of skin and auxiliary soft tissue, and submerged in 10% neutral-buffered formalin (NBF). Specimens were randomly assigned a unique ID to blind the user responsible for scanning and analyzing the specimens. The specimens were imaged in 10% NBF in 50-mL conical vials gently immobilized to prevent movement of the specimen during the scan. CT imaging of either the left or right femur was performed using a high-resolution Xradia 510 Versa X-ray microscope . The imaging conditions were designed in agreement with the guidelines for CT imaging of biological specimens . ScanninThe scans were analyzed using Dragonfly Pro software . All scans and analyses were conducted by a blinded user. The femur and a subregion in the distal femur were selected as regions of interest. The femur was digitally isolated to avoid the tibia, fibula, and patella which were included in the complete scan of the leg but not the analysis. In concordance with our previous study, which focused on the distal femur, a z-stack of 100 images immediately below the growth plate was used to digitally create a subregion of interest in the distal femur. Cortical, trabecular, and total bone measurements were then conducted in the distal and total femur. The cortical parameters included average cortical area, average cortical fraction, average cortical thickness, endocortical perimeter, and endocortical surface. The trabecular parameters included average trabecular separation, average trabecular thickness, and average trabecular number. The total bone measurements included bone volume, volume fraction, mineral density, average marrow area, total volume, and average total area. These skeletal parameters are described briefly in NBP2-68153) were quantified using enzyme-linked immunosorbent assays (ELISAs) according to the manufacturer\u2019s instructions. The serotonin assay used the serum diluted at 1:20, and the osteocalcin assay used the undiluted serum. The plate layout was randomized to minimize inter-assay variation. Additionally, our parent 2020 study conducted a comprehensive analysis of multiple serum markers, including alkaline phosphatase and serum calcium  was performed for all endpoints where possible, and outliers were removed on a case-by-case basis if they were found to disrupt normal distribution. To preserve transparency of data reporting, the outliers were kept in the dataset if they did not affect significance or normal distribution. One male and one female from the OPFR exposure group were entirely excluded due to the total body weight exceeding two standard deviations from the mean, which reduced the final animal numbers to 7 M and 7 F within the OPFR exposure group.The data are presented as the mean \u00b1 standard error of the mean (SEM). Statistical analysis was performed using GraphPad Prism, version 9.3.1 . Male and female datasets were analyzed independently. A Shapiro\u2013Wilk test was conducted to determine a normal distribution of data. Grubbs\u2019 outlier test , medium, (0.5), or large (0.8).For each measurement, the controls were compared using Student\u2019s p = 2.34, p = 0.09); females:  = 1.358, p = 0.27), As expected and consistent with our previous results , the cont-test. The representative CT images of this subset are included in p \u2264 0.02), decreased average cortical area , decreased trabecular thickness , and decreased average total area  in the total femur  in the full femur, along with the distal femur, and 2) using newer CT technology . The fulal femur . While nFor the assessment of the total femur, one BFR male was removed from the measurements of bone volume, endocortical surface, periosteal surface, and total volume, and one control male was removed from average trabecular separation measurement. One OPFR-exposed female was removed from measurements of average cortical thickness, periosteal surface, and total volume. One control female and one BFR-exposed female were removed from the measurement of BMD for being statistical outliers and influencing normal distribution.p = 0.01, d = 1.57) and FM 550-exposed  animals had a statistically significant increased bone volume fraction (BV/TV) . No significant effects were found for females. A full list of the outcomes in the distal femur is provided in In the distal femur, only BFR-exposed males had decreased bone volume fraction  or females  or females [F = 1.31, p = 0.28, ALP could not be measured for one control female due to a technical error. As reported previously and restated here, serum ALP levels were higher in control males than those in females . Females had 12.23\u00a0mg/dL, while males had 11.86\u00a0mg/dL. However, no effect of exposure was found for serum calcium in females [F = 0.22, p = 0.87,  = 2.54, p \u2264 0.05, d = 1.242, Calcium could not be measured for one control female due to a technical error. As reported previously, we restate here that an expected sex difference was found within controls, with females having higher serum calcium than males  commonly occur with EDCs via multiple mechanisms . In someWhy a phenotype emerged in the older females when we did not detect one previously in younger adults is unknown. Estrogen is largely protective of bone health; thus, one hypothesis is that gonadal estrogens may mask exposure-related effects in younger females that recede with age as estradiol (E2) levels naturally decline . In maleOther EDC studies report evidence of improvement with age. In a similar study with gestational and lactational bisphenol-A (BPA) exposure, skeletal insults recorded in males at 5\u00a0weeks of age were resolved by 52\u00a0weeks, suggesting that the phenotype may be reversible or resolved through remodeling as the animal ages . SimilarThe effects of FR exposure on serum biomarkers were minimal, but the identification of expected sex differences confirms that the study was sufficiently powered to detect biologically meaningful effects. Expected sex differences in serum calcium and ALP levels were found, with males having higher ALP and lower serum calcium levels than females. FM 550-exposed females had higher concentrations of osteocalcin than controls, and BFR-exposed males had increased serum calcium compared to controls. Osteocalcin is produced exclusively from osteoblasts and primarily deposited in the bone matrix. Increased osteocalcin levels in the FM 550 females could suggest increased bone turnover activity but would need to be confirmed . BecauseThe sex-specific effects of developmental FR exposure found are consistent with known sex differences in skeletal physiology and many other EDCs. In mice exposed to either 200\u00a0\u03bcg/kg body weight BPA or bisphenol-S (BPS) orally via the dam throughout gestation and lactation, only the BPA-exposed males had an impaired skeletal structure . The effTo the best of our knowledge, skeletal outcomes of FM 550 exposure have not been assessed in human studies, although a limited but growing number of studies include bone structure assessment in populations exposed to broader categories of EDCs. Globally, BFR and OPFR chemicals are routinely detected in biological tissues such as nail clippings, urine and feces in adults and toddlers, and breastmilk in women . The avegli1 and runx3  showed deficits in adult femur organization including significantly decreased marrow area, increased bone volume fraction in FR-exposed males, and decreased bone mineral density in FR-exposed females. The presence of skeletal effects in late adulthood suggests the disruption of pathways involved in early skeletal organization, but this needs to be examined in younger animals, as well as the potential mechanisms by which these adverse effects occur. The FRs examined have been shown to disrupt estrogen and thyroid hormone signaling, and this is a relevant point to consider since both estrogen and thyroid hormones are critically involved in skeletal development and maintenance. Further examination of other long bone components, especially the vasculature, is also needed to better elucidate the complete phenotype in each sex across the lifespan."}